African Journal of Biotechnology - 26 April, 2012 Issue by Academic Journals

African Journal of

Biotechnology Volume 11 Number 34 ISSN 1684-5315

26 April, 2012

ABOUT AJB The African Journal of Biotechnology (AJB) is published bi-weekly (one volume per year) by Academic Journals. African Journal of Biotechnology (AJB) a new broad-based journal, is an open access journal that was founded on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed.

Submission of Manuscript Submit manuscripts as e-mail attachment to the Editorial Office at: ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com. A manuscript number will be mailed to the corresponding author shortly after submission. For all other correspondence that cannot be sent by e-mail, please contact the editorial office (at ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com). The African Journal of Biotechnology will only accept manuscripts submitted as e-mail attachments. Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given the last name of the first author.

Editors George Nkem Ude, Ph.D Plant Breeder & Molecular Biologist Department of Natural Sciences Crawford Building, Rm 003A Bowie State University 14000 Jericho Park Road Bowie, MD 20715, USA N. John Tonukari, Ph.D Department of Biochemistry Delta State University PMB 1 Abraka, Nigeria Prof. Dr. AE Aboulata Plant Path. Res. Inst., ARC, POBox 12619, Giza, Egypt 30 D, El-Karama St., Alf Maskan, P.O. Box 1567, Ain Shams, Cairo, Egypt Dr. S.K Das Department of Applied Chemistry and Biotechnology, University of Fukui, Japan Prof. Okoh, A. I Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and Microbiology, University of Fort Hare. P/Bag X1314 Alice 5700, South Africa Dr. Ismail TURKOGLU Department of Biology Education, Education Faculty, Fırat University, Elazığ, Turkey Prof T.K.Raja, PhD FRSC (UK) Department of Biotechnology PSG COLLEGE OF TECHNOLOGY (Autonomous) (Affiliated to Anna University) Coimbatore-641004, Tamilnadu, INDIA. Dr. George Edward Mamati Horticulture Department, Jomo Kenyatta University of Agriculture and Technology, P. O. Box 62000-00200, Nairobi, Kenya.

Dr Helal Ragab Moussa Bahnay, Al-bagour, Menoufia, Egypt. Dr VIPUL GOHEL Flat No. 403, Alankar Apartment, Sector 56, Gurgaon122 002, India. Dr. Sang-Han Lee Department of Food Science & Biotechnology, Kyungpook National University Daegu 702-701, Korea. Dr. Bhaskar Dutta DoD Biotechnology High Performance Computing Software Applications Institute (BHSAI) U.S. Army Medical Research and Materiel Command 2405 Whittier Drive Frederick, MD 21702 Dr. Muhammad Akram Faculty of Eastern Medicine and Surgery, Hamdard Al-Majeed College of Eastern Medicine, Hamdard University, Karachi. Dr. M.MURUGANANDAM Departtment of Biotechnology St. Michael College of Engineering & Technology, Kalayarkoil, India. Dr. Gökhan Aydin Suleyman Demirel University, Atabey Vocational School, Isparta-Türkiye, Dr. Rajib Roychowdhury Centre for Biotechnology (CBT), Visva Bharati, West-Bengal, India. Dr.YU JUNG KIM Department of Chemistry and Biochemistry California State University, San Bernardino 5500 University Parkway San Bernardino, CA 92407

Editorial Board Dr. Takuji Ohyama Faculty of Agriculture, Niigata University

Dr. Mehdi Vasfi Marandi University of Tehran

Dr. FÜgen DURLU-ÖZKAYA Gazi Üniversity, Tourism Faculty, Dept. of Gastronomy and Culinary Art

Dr. Reza Yari Islamic Azad University, Boroujerd Branch

Dr. Zahra Tahmasebi Fard Roudehen branche, Islamic Azad University

Dr. Tarnawski Sonia University of Neuchâtel – Laboratory of Microbiology

Dr. Albert Magrí Giro Technological Centre

Dr. Ping ZHENG Zhejiang University, Hangzhou, China. Prof. Pilar Morata University of Malaga

Dr. Greg Spear Rush University Medical Center

Dr. Mousavi Khaneghah College of Applied Science and Technology-Applied Food Science, Tehran, Iran.

Prof. Pavel KALAC University of South Bohemia, Czech Republic.

Dr. Kürsat KORKMAZ Ordu University, Faculty of Agriculture, Department of Soil Science and Plant nutrition

Dr. Tugay AYAŞAN Çukurova Agricultural Research Institute, PK:01321, ADANA-TURKEY.

Dr. Shuyang Yu Asistant research scientist, Department of Microbiology, University of Iowa Address: 51 newton road, 3-730B BSB bldg.Tel：+319-3357982, Iowa City, IA, 52246, USA.

Dr. Binxing Li E-mail: Binxing.Li@hsc.utah.edu

Dr Hsiu-Chi Cheng National Cheng Kung University and Hospital.

Dr. Kgomotso P. Sibeko University of Pretoria, South Africa.

Dr. Jian Wu Harbin medical university , China.

Instructions for Author Electronic submission of manuscripts is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Arial font). The cover letter should include the corresponding author's full address and telephone/fax numbers and should be in an e-mail message sent to the Editor, with the file, whose name should begin with the first author's surname, as an attachment. Article Types Three types of manuscripts may be submitted: Regular articles: These should describe new and carefully confirmed findings, and experimental procedures should be given in sufficient detail for others to verify the work. The length of a full paper should be the minimum required to describe and interpret the work clearly. Short Communications: A Short Communication is suitable for recording the results of complete small investigations or giving details of new models or hypotheses, innovative methods, techniques or apparatus. The style of main sections need not conform to that of full-length papers. Short communications are 2 to 4 printed pages (about 6 to 12 manuscript pages) in length. Minireview: Submissions of mini-reviews and perspectives covering topics of current interest are welcome and encouraged. Mini-reviews should be concise and no longer than 4-6 printed pages (about 12 to 18 manuscript pages). Mini-reviews are also peer-reviewed.

Regular articles All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title page. The Title should be a brief phrase describing the contents of the paper. The Title Page should include the authors' full names and affiliations, the name of the corresponding author along with phone, fax and E-mail information. Present addresses of authors should appear as a footnote. The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. The Abstract should be 100 to 200 words in length.. Complete sentences, active verbs, and the third person should be used, and the abstract should be written in the past tense. Standard nomenclature should be used and abbreviations should be avoided. No literature should be cited. Following the abstract, about 3 to 10 key words that will provide indexing references should be listed. A list of non-standard Abbreviations should be added. In general, non-standard abbreviations should be used only when the full term is very long and used often. Each abbreviation should be spelled out and introduced in parentheses the first time it is used in the text. Only recommended SI units should be used. Authors should use the solidus presentation (mg/ml). Standard abbreviations (such as ATP and DNA) need not be defined.

Review Process All manuscripts are reviewed by an editor and members of the Editorial Board or qualified outside reviewers. Authors cannot nominate reviewers. Only reviewers randomly selected from our database with specialization in the subject area will be contacted to evaluate the manuscripts. The process will be blind review. Decisions will be made as rapidly as possible, and the journal strives to return reviewersâ&#x20AC;&#x2122; comments to authors as fast as possible. The editorial board will re-review manuscripts that are accepted pending revision. It is the goal of the AJB to publish manuscripts within weeks after submission.

The Introduction should provide a clear statement of the problem, the relevant literature on the subject, and the proposed approach or solution. It should be understandable to colleagues from a broad range of scientific disciplines.

Materials and methods should be complete enough to allow experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. Capitalize trade names and include the manufacturer's name and address. Subheadings should be used. Methods in general use need not be described in detail.

Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the authors' experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. Discussion, speculation and detailed interpretation of data should not be included in the Results but should be put into the Discussion section. The Discussion should interpret the findings in view of the results obtained in this and in past studies on this topic. State the conclusions in a few sentences at the end of the paper. The Results and Discussion sections can include subheadings, and when appropriate, both sections can be combined. The Acknowledgments of people, grants, funds, etc should be brief. Tables should be kept to a minimum and be designed to be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes. Each table should be on a separate page, numbered consecutively in Arabic numerals and supplied with a heading and a legend. Tables should be self-explanatory without reference to the text. The details of the methods used in the experiments should preferably be described in the legend instead of in the text. The same data should not be presented in both table and graph form or repeated in the text. Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, TIFF, JPEG or Powerpoint before pasting in the Microsoft Word manuscript file. Tables should be prepared in Microsoft Word. Use Arabic numerals to designate figures and upper case letters for their parts (Figure 1). Begin each legend with a title and include sufficient description so that the figure is understandable without reading the text of the manuscript. Information given in legends should not be repeated in the text. References: In the text, a reference identified by means of an author‘s name should be followed by the date of the reference in parentheses. When there are more than two authors, only the first author‘s name should be mentioned, followed by ’et al‘. In the event that an author cited has had two or more works published during the same year, the reference, both in the text and in the reference list, should be identified by a lower case letter like ’a‘ and ’b‘ after the date to distinguish the works. Examples: Smith (2000), Blake et al. (2003), (Kelebeni, 1983), (Chandra and Singh,1992),(Chege, 1998; Steddy, 1987a,b;

Gold, 1993,1995), (Kumasi et al., 2001) References should be listed at the end of the paper in alphabetical order. Articles in preparation or articles submitted for publication, unpublished observations, personal communications, etc. should not be included in the reference list but should only be mentioned in the article text (e.g., A. Kingori, University of Nairobi, Kenya, personal communication). Journal names are abbreviated according to Chemical Abstracts. Authors are fully responsible for the accuracy of the references. Examples: Diaz E, Prieto MA (2000). Bacterial promoters triggering biodegradation of aromatic pollutants. Curr. Opin. Biotech. 11: 467-475. Dorn E, Knackmuss HJ (1978). Chemical structure and biodegradability of halogenated aromatic compounds. Two catechol 1, 2 dioxygenases from a 3chlorobenzoate-grown Pseudomonad. Biochem. J. 174: 73-84. Pitter P, Chudoba J (1990). Biodegradability of Organic Substances in the Aquatic Environment. CRC press, Boca Raton, Florida, USA. Alexander M (1965). Biodegradation: Problems of Molecular Recalcitrance and Microbial Fallibility. Adv. Appl. Microbiol. 7: 35-80. Boder ET, Wittrup KD (1997). Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotechnol. 15: 537-553.

Short Communications Short Communications are limited to a maximum of two figures and one table. They should present a complete study that is more limited in scope than is found in full-length papers. The items of manuscript preparation listed above apply to Short Communications with the following differences: (1) Abstracts are limited to 100 words; (2) instead of a separate Materials and Methods section, experimental procedures may be incorporated into Figure Legends and Table footnotes; (3) Results and Discussion should be combined into a single section. Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF file. Page proofs are considered to be the final version of the manuscript. With the exception of typographical or minor clerical errors, no changes will be made in the manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that the editorial office waive some of the handling fee under special circumstances. Copyright: ÂŠ 2012, Academic Journals. All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary bibliographic citation, including author attribution, date and article title. Submission of a manuscript implies: that the work described has not been published before (except in the form of an abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the publisher. Disclaimer of Warranties In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or not advised of the possibility of damage, and on any theory of liability. This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or information in this publication or of any other publication to which it may be linked.

African Journal of Biotechnology Table of Contents: 11 Number 34 26 April, 2012, International JournalVolume of Medicine and Medical Sciences

ences

ARTICLES Review BioMatriX: Sequence analysis, structure visualization, phylogenetics and linkage analysis workbench Shagufta Kanwal, Usman Ali, Muhammad Irfan Khan, Zainab noor, Farhat-ul-ain Mirza

8414

Research Articles GENETICS AND MOLECULAR BIOLOGY Identification of SNPs in chemerin gene and association with carcass and meat quality traits of Qinchuan Cattle Fubiao Song, Hongcheng Wang, Hong Wangďź&#x152;Hongbao Wang, Yaping Xin and Linsen Zan

Genetic diversity of Stipa bungeana populations in the Loess Plateau of China using inter-simple sequence repeat (ISSR) markers Yu Jing, Jing Zhao-Bin and Cheng Ji-Min

8417

8425

PLANT AND AGRICULTURAL TECHNOLOGY The role of rhizospheric Aspergillus flavus in standing maize crop contamination in different ecological zones of Khyber Pakthunkhwa, Pakistan Saleem Ullah, Hamid Ullah Shah, Anwar Ali Shad and Sahib Alam

Calcium enhances cadmium tolerance and decreases cadmium accumulation in lettuce (Lactuca sativa) Walid Zorrig, Zaigham Shahzad, Chedly Abdelly and Pierre Berthomieu

8433

8441

Table of Contents:

Volume 11

ences

Number 34 26 April, 2012

ARTICLES

Impact of different moisture regimes and nitrogen rates on yield and yield attributes of maize (Zea mays L.) Muhammad Maqsood, Muhammad Asif Shehzad, Muhammad Aqeel Sarwar, Hafiz Tassawar Abbas and Salman Mushtaq

Physico-chemical properties of indigenous micro organism-composts and humic acid prepared from selected agro-industrial residues A. Norida Hanim, A. M. Nik Muhamad, O. H. Ahmed, K. Susilawati and A. Khairulmazmi

Biological control of Fusarium foot rot of wheat using fengycin-producing Bacillus subtilis isolated from salty soil REBIB Hanene, HEDI Abdeljabbar, ROUSSET Marc, BOUDABOUS Abdellatif, LIMAM Ferid and SADFI-ZOUAOUI Najla

8449

8456

8464

Degrading capability and activity of extracellular xylanase secreted by a composite microbial system XDC-2 WANG Hui, GUO Peng, WANG Xiaofen, WANG Xiaojuan and CUI Zongjun

8476

Improving planting pattern for intercropping in the whole production span of rubber tree Zeng Xianhai, Cai Mingdao and Lin Weifu

8484

ENVIRONMENTAL BIOTECHNOLOGY Biocontrol properties of indigenous Trichoderma isolates from North-east India against Fusarium oxysporum and Rhizoctonia solani Th. Kamala and S. Indira Devi

Enhanced accumulation of root hydrogen peroxide is associated with reduced antioxidant enzymes under isoosmotic NaCl and Na2SO4 salinities Mahmoudi Hela, Baatour Olfa, Ben Salah Imen, Nasri Nawel, Wissal Abidi, Huang Jun, Zargouni Hanen, Hannoufa Abdelali, Lachaal Mokhtar and Ouerghi Zeineb

8491

8500

Table of Contents:

Volume 11

Number 34 26 April, 2012

ences ARTICLES Crystal phases of calcium carbonate within otoliths of Cyprinus carpio. L. from Miyun Reservoir and Baiyangdian Lake, China Liang-Feng Yang, Sheng-Rong Li, Guo-Wu Li and Jun-Yan Luo

8510

INDUSTRIAL MICROBIOLOGY Synthesis of ZnO nanoparticles and their antibacterial effects Mohammad Reza Arefi, Saeed Rezaei-Zarchi and Saber Imani

8520

APPLIED BIOCHEMISTRY Characterization of polygalacturonases from fruit spoilage Fusarium oxysporum and Aspergillus tubingensis Ahmed R. Al-Najada, Rashad R. Al-Hindi and Saleh A. Mohamed

Changes in photosynthesis and activities of enzymes involved in carbon metabolism during exposure to low light in cucumber (Cucumis sativus) seedlings Guoquan Mi, Liying Liu, Zhenxian Zhang and Huazhong Ren

Optimization of lactic acid production with immobilized Rhizopus oryzae Muhammet Şaban Tanyıldızı, Şule Bulut, Veyis Selen and Dursun Özer

8527

8537

8546

Table of Contents:

Volume 11

Number 34

26 April, 2012

ences ARTICLES MEDICAL AND PHARMACEUTICAL BIOTECHNOLOGY Biofilm production and antibiotic susceptibility profile of Escherichia coli isolates from HIV and AIDS patients in the Limpopo Province Samie, A. and Nkgau, T. F

8560

ENTOMOLOGY Entomophaga maimaiga – New entomopathogenic fungus in the Republic of Serbia Mara Tabaković-Tošić,Georgi Georgiev, Plamen Mirchev, Dragutin Tošić and Vesna Golubović-Ćurguz

8571

FISHERY SCIENCE Toxicity bioassay and effects of sub-lethal exposure of malathion on biochemical composition and haematological parameters of Clarias gariepinus Zubair Ahmad

8578

BIOTECHNIQUES Influence of technological treatments on bacterial communities in tilapia (Oreochromis niloticus) as determined by 16S rDNA fingerprinting using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) Maïwore J, Tatsadjieu Ngoune L, Goli T, Montet D and Mbofung C. M. F

Development of rapid PCR-RFLP technique for identification of sheep, cattle and goat’s species and fraud detection in Iranian commercial meat products Hamideh Amjadi, Mohammad Javad Varidi, Seyed Hassan Marashi, Ali Javadmanesh and Shahrokh Ghovvati

8586

8594

Table of Contents:

Volume 11

Number 34

26 April, 2012

ences ARTICLES A new screening method for discovering antibacterial agents from filamentous fungi Guohua Chen, Yehui Tan, Kaizhi Li, Fangqing Chen, Ruiping Li, Chaoyin Yue and Wei Shao

8600

ANIMAL SCIENCE Influence of turmeric rhizome and black pepper on blood constituents and performance of broiler chickens Abdollah Akbarian, Abolghasem Golian, Hassan Kermanshahi, Ali Gilani and Sajad Moradi

Gastro-protective activity of aqueous Carica papaya seed extract on ethanol induced gastric ulcer in male rats OKEWUMI Tolunigba Abisola and OYEYEMI Adekunle Wahab

8606

8612

African Journal of Biotechnology Vol. 11(34), pp. 8414-8416, 26 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.427 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Review

BioMatriX: Sequence analysis, structure visualization, phylogenetics and linkage analysis workbench Shagufta Kanwal1*, Usman Ali2, Muhammad Irfan Khan1, Zainab noor1, Farhat-ul-ain Mirza1 1

International Islamic University, H-10, Islamabad, Pakistan. Lahore University of Management Sciences, DHA, Lahore Cantt, Pakistan.

Accepted 14 March, 2012

The BioMatriX (Build Mine Xplore) is a bioinformatics work bench (http://www.bmxbiomatrix.blogspot.com) developed for biological science community to augment scientific research regarding genomics, proteomics, phylogenetics and linkage analysis in one platform. BioMatriX offers multi-functional services to perform specific tasks like DNA/RNA/Protein sequence analysis with graphical representations, sequence editing, sequence alignment, restriction enzyme mapping, protein structure visualization, mutation and structure superimposition programs along with phylogenetics tree construction supporting dendrograms, neighbor joining and unweighted pair group method with arithmetic mean (UPGMA) programs. Genomic studies like linkage programs are also implemented. Special emphasis has been paid to integrate all the resources in one software so that the researcher does not have to install numerous pieces of software to analyze his data. Key words: Bioinformatics, linkage, visualizer, alignment, superimposition, phylogenetics.

INTRODUCTION BioMatriX is developed in Biojava language and major help and support is taken from Biojava Cook book (http://www.biojava.org/wiki/BioJava: CookBook3.0). BioMatriX is an interactive, multi-functional and user friendly bioinformatics tool kit. It represents similarities with most of the famous scientific research work benches like ExPAsy Proteomics Server (http://expasy.org/) and CLC Bio (http://www.clcbio.com/). BioMatriX is a desktop application just like CLC Bio and composite of various modules and functionalities implemented with graphical outputs in order to facilitate research analysis from various aspects. Although it has adopted many features of ExPAsy and CLC Bio (http://www.clcbio.com/ index.php?id=30), an effort has been made to represent sequences with proper scaling and color scheme. The module of genetic linkage is a distinguishing feature of BioMatriX which is not found integrated in any workbench yet. There are many standalone protein visualizers Like RASMOL (http://www.umass.edu/microbio/rasmol/)

*Corresponding author. E-mail: shagufta.kanwal@iiu.edu.pk.

(Rodger and James, 1995) that are freely available, but BioMatriX itself has a visualizer and other structural manipulation functions implemented in it. It is freely available for download for academic use for the scientific community (http://www.bmx-biomatrix.blogspot.com). An overview of the software main interface is shown in Figure 1. SOFTWARE PROGRAMS BioMatriX supports multiple file format reader, format converter and other file writing manipulation functions. This extensive tool kit comprises the following various modules implementing several programs. DNA sequence analysis This module is especially designed for DNA/RNA sequence analysis, which include basic functions like calculating nucleotide composition, DNA complement, DNA reverse complement, DNA transcription, RNA com-

Kanwal et al.

8415

plement, RNA reverse complement, protein translation, open reading frames (ORF) finding and alternate protein translation. This module also supports graphical representations like nucleotide concentration plot and molecular weight plot and nucleotide composition plot as shown in Figure 2. Another useful feature of this module is sequence editing, which provides various sequence manipulation functions like sequence search by selecting sequence location and range, sequence insertion at the any selected location, sequence deletion by selecting location and number of nucleotides to be deleted like frameshift, point mutation, missense/non-synonymous and nonsense mutations. Sequence alignment provides pair-wise alignment by two methods: the local alignment by implementing Smith-Waterman Algorithm (Smith and Waterman, 1981), and the global alignment by Needleman-Wunsch Algorithm (Zhihua and Lin, 2004). Multiple sequence alignment integrates ClustalW program (Thompson et al., 1994) which is a well known frequently used alignment tool with reliable results. Dot plot has been implemented for quick comparative visualization of two sequences with possible optimal matches in diagonal direction.

unweighted pair group method with arithmetic mean (UPGMA) trees.

Protein sequence analysis

Genetic linkage analysis

This module is designed for protein sequence analysis such as amino acid composition, amino acid to nucleotide conversion, molecular weight, charge density (PI) and protein nature (acidic/basic) along with graphical representations. The protein polarity plot, molecular weight plot, protein flexibility plot, accessibility plot, antigenic plot, exposed plot, turn plot, hydrophilicity plot and hydrophobicity plotting on several scales like EnglemanSteitz, Hopp-Woods, Kyte-Doolittle, Janin, Chothia & Eisenberg-Weiss, as evaluated by Kallol et al. (2003) are also implemented in this module (http://www.clcbio.com/ sciencearticles/BE-hydrophobicity.pdf). This module also supports sequence editing functions like sequence search, insertion, deletion and mutation. Likewise, sequence alignment is also implemented as earlier mentioned in the DNA sequence analysis.

This module is subdivided into calculating linkage at single point locus and multipoint locus calculation. Single point locus helps in creating the pedigree file which is used as an input to the linkage program in order to find recombinants and non recombinants of family data of any genetic disorder and LOD score calculation on it. This module also displays graphical representations of LOD score plot and recombinant/non-recombinant ratio plot. An example of pedigree data and LOD score calculation are shown in Figure 5. Second is multipoint locus calculation which includes preparation of PRE, PED and DAT files required by MLINK (http://hg.wustl.edu/info/ linkage/mlink.html) which is a free ware linkage program (Goldgar and Oniki, 1992) and integrated in it. This module is integrated with a database of genetic markers in order to facilitate a research scientist or geneticist to keep the records of the genetic markers and corresponding reports. This database helps in adding new records, updating the old ones, deleting records and searching for genetic markers via markers identifier number (ID). Apart from analysis modules, various other miscellaneous programs have been implemented like restriction enzyme cutter and file format converter.

Phylogenetic analysis This module constructs phylogenetic trees. Outputs of multiple sequence alignment are taken as input to this program to display dendrograms. One of the examples of alignment tree is mentioned in Figure 3. Apart from displaying dendrograms, two important methods of constructing phylogenetics trees are implemented: the neighbor joining (Saitou and Nei, 1987) and UPGMA (Backeljau et al., 1996). These programs take distance matrix as input to display neighbor joining and the

Structure analysis This module provides protein structure analysis- extracts PDB information like structure ID, chains, length and residues information. Another program, Mutate a residue, is also implemented in order to mutate an amino acid and to show the change in protein structure. As an example, one of proteins, 1TNF has been displayed in Figure 4 with its original structure in one window and its structure after mutation is displayed in another window for comparative structural analysis. One of the useful features of this module is structure visualizer which is named as BIOMOL by integrating Jmol (http://www.jmol.org). This tool acquires all basic structure manipulations and visualization functions as that of JMOL. Another important feature of this module is structure superimposition. This program displays two different protein structures in two separate windows and superimposed structure in the third window along with alignment in the output tab.

CONCLUSION BioMatriX offers services with multiple functions on the researcherâ&#x20AC;&#x2122;s desk and freely available for the scientific

8416

Afr. J. Biotechnol.

community. It is designed in an easy to use and environment friendly manner with production of precise results in minimum time. The use of this application will prove to be helpful in major analysis like sequence and structure of biomolecules (DNA/RNA/Protein), comparative, evolutionary and genetic studies. Therefore, it will play an important role to build, mine and explore the scientific knowledge and can be a vital entity of every researcher at his desktop. REFERENCES Backeljau T, Bruyn LD, Jordaens LDWK, Dongen SV, Winnepenninckx TB (1996). Multiple UPGMA and Neighbor-joining Trees and the Performance of Some Computer Packages. Mol. Biol. Evol. 13(2): 309-313. Goldgar DE, Oniki RS (1992). Comparison of a multipoint identity-bydescent method with parametric multipoint linkage analysis for mapping quantitative traits. Am. J. Hum. Gene. 50(3): 598-606. Kallol MB, Daniel RD, John GD (2003). Evaluation of methods for measuring amino acid hydrophobicities and interactions. J. Chromatogr. A. 1000: 637-655

Rodger S, James EM (1995). RasMol: Biomolecular graphics for all, Trends in Biochem. Sci. (TIBS). 20: p. 374. Saitou N, Nei M (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4(4): 406-425. Smith TF, Waterman MS (1981). Identification of Common Molecular Subsequences. J. Mol. Biol. 47: 195-197. Zhihua DU, Lin F (2004). Improvement of the Needleman-Wunsch Algorithm. SpringerLink, 3066: 792-797. Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22(22): 4673-4680.

Full Length Research Paper

Identification of SNPs in chemerin gene and association with carcass and meat quality traits of Qinchuan Cattle Fubiao Song1, Hongcheng Wang1, Hong Wang1，Hongbao Wang1,2, Yaping Xin1,2 and Linsen Zan1,2* 1

College of Animal Science and Technology, Northwest A and F University, Yangling, Shaanxi, 712100, P. R. China. 2 National Beef Cattle Improvement Centre, Yangling, Shaanxi, 712100, P. R. China. Accepted 11 April, 2011

Chemerin is a novel adipokine that regulates adipogenesis and adipocyte metabolism via its own receptor. In this study, two novel SNPs (868A>G in exon 2 and 2692C>T in exon 5) of chemerin gene were identified by PCR-SSCP and DNA sequencing technology. The allele frequencies of the novel SNPs were determined in the genetically diverse bovine breeds including six Chinese indigenous cattle breeds (Caoyuan red, Jiaxian red, Luxi, Nanyang, Qinchuan and Xia’nan cattle). We evaluated the potential association of the SNPs with traits measured by ultrasound measurement in 214 Qinchuan individuals. Furthermore, meat quality traits data gotten from carcass measurement in another 69 Qinchuan individuals were analyzed by the comparison between the genotypes and their phenotypic data. Results showed that SNP 868A>G had a significant association with the ultrasound loin-muscle area (P < 0.05), loin-eye area and water holding capability (P < 0.05). And also revealed significant effects of genotype on the ultrasound backfat thickness (P < 0.05), backfat thickness and water holding capability (P < 0.05) of SNP 2692C>T. It was shown that associations do exist between chemerin gene and carcass and meat quality traits. As a result of the small sample size of this study, it is proposed that further effort is required to validate these findings in larger populations. It could be concluded that ultrasound measurements are similar in accuracy to carcass measurements for predicting carcass and meat quality traits in cattle, and could be a useful predictor of retail yield in live animals. Key words: Bos bovine, chemerin gene, PCR-SSCP, SNP, meat quality traits. INTRODUCTION Chemerin is a new adipokine associated with obesity and the metabolic syndrome in human (Bozaoglu et al., 2007) and mouse (Ernst et al., 2010). Chemerin gene is also known as retinoic acid receptor responder 2 (RARRES2) and tazarotene-induced gene 2 (TIG2) (Nagpal et al., 1997), has been isolated as a novel chemoattractive agonistic protein binding to the G-protein-coupled receptor ChemR23 (Gantz et al., 1996; Meder et al., 2003), also known as chemokine-like receptor-1 (CMKLR1) (Wittamer et al., 2003; Zabel et al., 2005). The chemerin gene of Bos bovine is located on chromosome 4 (GenBank: NC_007302) and consists of six exons, with exon 2, 3, 4 and exon 5 coding a protein with 162 amino

*Corresponding author. E-mail: zanls@yahoo.com.cn Tel: + 86-29-87091247. Fax: +86-29-87092614

acid (Song et al., 2010). Through its binding to chemerinR, chemerin is involved in regulating adipogenesis and adipocyte metabolism (Goralski et al., 2007), innate and adaptive immunity (Meder et al., 2003; Wittamer et al., 2005; Zabel et al., 2005), bone development (Methner et al., 1997) and immunodeficiency virus infections (Martensson et al., 2006). It potentiates insulin-stimulated glucose uptake and insulin signaling in 3T3-L1 adipocytes, which identifies chemerin as a novel adipokine (Takahashi et al., 2008). It was reported that chemerin gene was expressed in many tissues, such as liver, lung, pituitary glands, ovaries, kidney and so on (Bozaoglu et al., 2007; Roh et al., 2007), but white adipose tissue was the only histiocyte that express high level chemerin and ChemerinR (Goralski et al., 2007; Meder et al., 2003). Recently, Song et al. (2010) cloned chemerin gene and acquired its receptor gene from the adipose tissues of

8418

Afr. J. Biotechnol.

Japanese Black cattle, and found that their DNA sequences and amino acid sequence were highly homologous to those of humans, mice and pigs, and the bovine chemerin mRNA was highly expressed in the adipose and liver tissues than the other histiocyte. In addition, they found that the transcripts of chemerin and expression of its receptor were up-regulated during adipocyte differentiation. So, chemerin primarily acts on adipogenesis and adipocyte metabolism through its own receptor. To our knowledge, few polymorphisms of bovine chemerin gene have been reported. Based on the important roles in organisms, it could be a potential gene for carcass and meat quality traits in bovine. Therefore, the objective of this study was to detect SNPs of chemerin gene in bovine and explore their possible association with carcass and meat quality traits in Qinchuan cattle breed. MATERIALS AND METHODS Sample collection and DNA extraction Individuals were randomly selected from six cattle breeds of 627 adult animals as follows: Qinchuan (QC, no = 214, Shaanxi province of China), Caoyuan red (CYR, no = 112, Jilin province of China), Jiaxian red (JR, no = 71, Henan province of China), Luxi (LX, no = 69, Shandong province of China), Nan yang (NY, no = 81, Henan province of China) and Xia’nan cattle (XN, no = 76, Henan province of China). Ultrasound measurements were available for 214 Qinchuan cattle (Brethour et al., 1994; Hamlin et al., 1995) including ultrasound backfat thickness (UBF), ultrasound loin-muscle area (ULMA) and ultrasound marbling score (UMAR). As we know, ultrasound technology has been used extensively used in beef cattle and swine enterprises over the past decade, and its use is continuing to gain popularity (Wall et al., 2004). Apart from that 69 individual Qinchuan heifers 2.5 to 3.0 years old were selected randomly and slaughtered in Shaanxi Kingbull Livestock Development Co., Ltd, and data with seven meat quality traits were collected, including live weight (LW), carcass weight (CW), backfat thickness (BFT), loin-eye area (LEA), marble score (MAR), water holding capacity (WHC) and tenderness (TD).

94°C for 30 s, 58.3°C (or 64.5°C) annealing for 30 s, 72°C for 35 s, with a final extension at 72°C for 1 0 min. PCR products were electrophoresis on 1.5% agarose gels. Then the products for sequencing were purified with Axygen kits (MBI Fermentas, Canada) and sequenced in both directions in an ABI PRIZM 377 DNA sequencer (Perkin-Elmer, USA). The sequences were analyzed with the SeqMan software.

SSCP polymorphism and sequencing Aliquots of 6 μl of the PCR products were mixed with 10 μl denaturing solution (95% formamide, 25 mM EDTA, 0.025% xylene-cyanole and 0.025% bromophenol blue), heated for 10 min at 98°C and chilled on ice immediately after heated. Then 16 μl of this mixture was applied to a 12% polyacrylamide gel (29:1 acrylamide:bis), 14% (V/V) glycerol and 10 × TBE buffer, Electrophoresis was carried out with 1×TBE buffer at 250 V for 30 min and 115 V for 14 h at room temperature. The gel was stained with 0.1% silver nitrate (Lan et al., 2007) and visualized with 2% NaOH solution (containing 0.1% formaldehyde) according to Zhang et al. (2007). After the polymorphism was detected, the PCR products of different electrophoresis patterns were sequenced in both directions in an ABI PRIZM 377 DNA sequencer. The sequences were analyzed by DNASTAR 5.0 package.

Statistical analysis Based on the genotype number in analyzed breeds, genotypic frequencies and allelic frequencies of chemerin locus were calculated directly; Hardy-Weinberg equilibriums and differences in genotypic frequencies were analyzed using χ2 test, which were performed by SPSS software (version 17.0). Population genetic indexes: He (gene heterozygosity), Ne (effective allele numbers) and PIC (polymorphism information content) were calculated according to Nei and Roychoudhury (1974) and Nei and Li (1979), respectively. The software SPSS (version 17.0) was used to analyze the relationship between the genotypes and records of traits (UBF, ULMA and UMAR) on 214 Qinchuan individuals, which were measured by ultrasound, according to the following statistical linear model: Yijkl = μ+ Ai+Gj +Sk + BFl +εijkl (1)

DNA preparation The animal’s blood samples were obtained and treated with 2% heparin and stored at -80°C. And the genomic DNA was extracted from blood leucocytes by a standard phenol-chloroform protocol method (Mullenbach et al., 1989).

Meat quality traits (BFT, EMA, MAR, WHC, MC and TD) were also evaluated by the comparison between the genotypes of 69 Qinchuan individuals and their phenotypic data by the least-squares method according to the following statistical linear model: Yijkl = μ+ Ai+Gj +Sk +εijkl (2)

PCR conditions In order to amplify DNA region, primer A (F: 5'-CAGGAGACGGAGGTGAAGC-3', R:5'-CACCGTGTCTGCCGCATT-3';) and primer B (F:5'-GTGGTAGGCGCTGGCAGGAA-3'; R:5'-CGTGAGGGAGGCGGTCTTT-3') were designed to amplify 196 and 288 bp fragments from exon 2 and exon 5 of the bovine chemerin gene (GenBank: NC_007302) by Primer 5.0 software, respectively. Each PCR was performed in a 20-μl reaction volume containing 50 ng genomic DNA, 10 mM of each primer, 2.5 mM Mgcl2, 0.20 mM dNTP and 0.5U Taq DNA polymerase (TaKaLa, Dalian, China). The cycling protocol was 5 min at 95°C, 32 cycles of

Where, Yijkl is the observation for the traits; μ is the overall population mean; Ai is the fixed effect of the ith age; Gj is the fixed effect of jth genotype (AA, AG and GG genotype); Sk is the fixed effect of sex; BFl is the fixed effects of breed and farm and Eijk is the random error.

RESULTS Genetic polymorphism of Bos bovine chemerin gene The 196 and 288 bp fragments of bovine chemerin gene

Song et al.

8419

Figure 3

AA Figure 1. The electrophoresis patterns of PCR-SSCP exon 2 of bovine chemerin gene.

Figure 2. The electrophoresis patterns of PCR-SSCP exon 5 of bovine chemerin gene.

Figure 3. The sequencing maps of the novel SNP for locus The sequencing maps of the novel SNP for locus 868A>G 868A>G of the chemerin gene. Sample chromatograms of of exon 2 and exon 5 were amplified by PCR. Then, by heterozygous (AG) and homozygous (AA and AG) sequencing, two SNPs were revealed. They were genotypes are shown. The arrow denotes the location of the synonymous mutation of leucine and aspartic acid, polymorphism. respectively. An adenine (A)-to-guanine (G) transition and an adenine (A) cytosine (C)-to-thymine (T) transition (868A>G and 2692C>T) were shown in two SNPs. The expect for CYR and NY breeds. And three genotypes genetic polymorphisms of the six bovine breeds were (named AA, AG and GG) were detected in all genetic detected by SSCP in the locus of 868A>G (Figure 1) and groups; with respect to the 2692C>T polymorphism, both 2692C>T (Figure 2). The polymorphism of 868A>G locus alleles were detected in the sample of animals studied. was induced by A-G SNP at nucleotide 868 bp (Figure 3), Allele A had signiﬁcant lower frequent in the CYR group and the polymorphism of 2692C>T locus was induced by as compared to the other detected groups. C-T SNP at nucleotide 2962 bp of chemerin gene (Figure The χ2-test showed that the genotype distributions in 4). the detected breeds were in agreement with Hardy-Weinberg equilibrium (PHW value > 0.05) of locus 868A>G, except CYR breed, while XN breed was not at Genotypic, allelic frequencies and genetic characters locus 2692C>T (PHW value < 0.05). The χ2-test showed in the six bovine breeds that the genotype distributions in the detected breeds were in agreement with Hardy-Weinberg equilibrium (P > The allele and genotype frequencies of the 868A>G and 0.05), except CYR (P < 0.01) and XN (P < 0.05). This 2692C>T polymorphisms obtained for the different observation may be as a result of the occurrence of strict genetic groups are shown in Tables 1 and 2, respectively. choice made by the people for forming the CYR and XN The two alleles of the 868A>G polymorphism were breed. According to the classification of PIC, all Bos observed in all genetic groups analyzed. Frequency of taurus population belongs to the median polymorphism allele G was the predominant allele of locus 868A>G,

8420

Afr. J. Biotechnol.

re 4

sequencing maps of the novel Figure SNP 4. The sequencing maps of the novel SNP for locus 2692C>T of the chemerin gene. This figure was the reverse sequencing map of the locus 2692C>T; Sample chromatograms of heterozygous (AB) and homozygous (AA and BB) genotypes are shown. The arrow denotes the location of the polymorphism.

level and there was no significant difference of PIC value in the six breeds (Table 3). Effect of the polymorphism locus on carcass traits Association studies between each SNP genotypes and studied traits in Qinchuan cattle were given in Tables 4 and 5. In polymorphism locus 868A>G, animals with the

genotype AA have higher mean values of UBF and ULMA than those with genotype AG (P < 0.05). While the association between genotypes and carcass and meat quality traits were analyzed, from which we can see significant differences on the LEA (P < 0.05) and WHC (P < 0.05) among different genotypes. Animals of AA genotype have greater mean values for BFT, LEA and WHC than those with AG genotypes. For locus 2692C>T SNP genotypes, the cattle with the AA genotype showed

Song et al.

8421

Table 1. Genotype frequencies (%) of the locus 868A>G of chemerin gene in Bos bovine populations.

Breed QC CYR JR LX NY XN

Observed genotype(number) AA AG GG 0.2150(46) 0.5047(108) 0.2804(60) 0.4911(55) 0.2679(30) 0.2411(27) 0.1690(12) 0.4507(32) 0.3803(27) 0.0870(6) 0.5942(41) 0.3188(22) 0.3333(27) 0.4321(35) 0.2346 (19) 0.1579(12) 0.5000(38) 0.3421(26)

Allelic frequency A G 0.4673 0.5327 0.6250 0.3750 0.3944 0.6056 0.3841 0.6159 0.5494 0.4506 0.4079 0.5921

Total 214 112 71 69 81 76

χ (HW)

PHW value

0.0401 20.5714** 0.2265 4.5198 1.3124 0.0938

0.9801 < 0.01 0.8927 0.1044 0.5188 0.9542

HW, Hardy-Weinberg equilibrium; QC, Qinchuan cattle breed; CYR, Caoyuan red cattle breed; JR, Jiaxian red cattle breed; LX, Luxi cattle breed; NY, Nan yang cattle breed; XN, Xia’nan cattle breed. Generally, PHW value is classified into the following three types: in Hardy-Weinberg equilibrium (PHW value > 0.05), not in Hardy-Weinberg equilibrium (0.01 < PHW value < 0.05) and highly not in Hardy-Weinberg equilibrium (PHW value < 0.01).

Table 2. Genotype frequencies (%) of the locus 2692C>T of chemerin gene.

Breed QC CYR JR LX NY XN

Observed genotype (number) AA AG GG 0.4626(99) 0.3972(85) 0.1402(30) 0.2679(30) 0.4018(45) 0.3304(37) 0.4507(32) 0.4085(29) 0.1408(10) 0.3913(27) 0.4348(30) 0.1739(12) 0.3457(28) 0.3951(32) 0.2593 (21) 0.3158(24) 0.3553(27) 0.3289(25)

Total 214 112 71 69 81 76

Allelic frequency A G 0.6612 0.3388 0.4688 0.5313 0.6549 0.3451 0.6087 0.3913 0.5432 0.4568 0.4934 0.5066

χ2(HW)

PHW value

2.7539 4.1839 0.6589 0.5259 3.3686 6.3630*

0.2523 0.1234 0.7193 0.7687 0.1855 0.0415

HW, Hardy-Weinberg equilibrium; QC, Qinchuan cattle breed; CYR, Caoyuan red cattle breed; JR, Jiaxian red cattle breed; LX, Luxi cattle breed; NY, Nan yang cattle breed; XN, Xia’nan cattle breed. Generally, PHW value is classified into the following three types: In Hardy-Weinberg equilibrium (PHW value > 0.05), not in Hardy-Weinberg equilibrium (0.01 < PHW value < 0.05) and highly not in Hardy-Weinberg equilibrium (PHW value < 0.01).

Table 3. Allele and genotype frequencies of the locus 868A>G and 2692C>T polymorphism of chemerin gene in the different genetic groups.

Locus

868A>G

2692C>T

Breed QC CYR JR LX NY XN QC CYR JR LX NY XN

Gene heterozygosity 0.4979 0.4688 0.4777 0.4731 0.4951 0.4830

Effective allele number 1.9915 1.8824 1.9145 1.8979 1.9807 1.9344

PIC 0.3739 0.3589 0.3636 0.3612 0.3725 0.3664

0.4480 0.4980 0.4520 0.4764 0.4963 0.4999

1.8117 1.9922 1.8248 1.9097 1.9852 1.9997

0.3477 0.3740 0.3498 0.3629 0.3731 0.3750

PIC, Polymorphism information content; QC, Qinchuan cattle breed; CYR, Caoyuan red cattle breed; JR, Jiaxian red cattle breed; LX, Luxi cattle breed; NY, Nan yang cattle breed; XN, Xia’nan cattle breed. Generally, PIC is classified into the following three types: Low polymorphism (PIC value < 0.25), median polymophism (0.25 < PIC value < 0.5) and high polymorphism (PIC value > 0.5).

greater UBF, BFT and WHC in comparison with the cattle

with the AB and BB genotypes (P < 0.05).

8422

Afr. J. Biotechnol.

Table 4. Association between locus 868A>G and 2692C>T genotypes of chemerin gene and UBF, ULMA and UMAR traits in Qinchuan cattle.

Polymorphism

868A>G

2692C>T

Genotype AA AG GG P value

UBF (mm) a 0.980±0.3 b 0.900±0.22 ab 0.925±0.2 0.104

AA AB BB P value

0.982±0.023a 0.898±0.025b 0.895±0.042ab 0.031

Trait (Mean ± SE) 2 ULMA (cm ) a 74.741±1.483 b 70.516±1.068 ab 73.460±1.170 0.042 73.044±1.240 74.250±1.337 72.999±2.242 0.779

UMAR 2.718±0.055 2.585±0.040 2.646±0.043 0.145 2.653±0.042 2.550±0.046 2.695±0.076 0.144

Means with different superscripts are significantly different (P < 0.05).

Moreover, the A>G synonymous mutation of leucine results in the increase of the part of the phenotypic variation, especially on the BFT and LEA phenotypes in animals studied, and the C>T synonymous mutation of aspartic acid results in the higher BFT phenotypes. DISCUSSION Although, initially chemerin was reported to play an important role in the innate and adaptive immunity (Parolini et al., 2007), recent researches gave a new point that chemerin play a crucial role in adipocyte metabolism, differentiation, obesity and diabetes in human and mice (Sell et al., 2009) and is related to the pathogenesis of metabolic syndrome (Michiko et al., 2008). Chemerin and its receptor ChemR23 are abundantly expressed in mouse and human adipose tissue (Thamer et al., 2008). Furthermore, chemerin is a well-known target gene of the retinoic acid receptor α (Müssig-K et al., 2009), and a growing body of evidence supports a link between retinoic acid signalling and adipocyte differentiation (Safonova et al., 1994). A recent study showed that the human chemerin gene have three SNPs, in which rs10278590 is associated with increased visceral fat mass in non-obese subjects of human, and in generalized obesity, this genetic effect may be masked by the close association between whole-body obesity and visceral fat mass (Müssig et al., 2009). The cloning and expression analysis of chemerin and chemerin receptor in Japanese Black cattle showed that bovine chemerin mRNA was highly expressed in the adipose and liver tissues, and is the TNF-α-up-regulated gene with a role in adipogenesis (Song et al., 2010). Above all, the available association studies on bovine and other livestock have never been reported. Therefore, we detected the SNPs of this gene in cattle, and found two SNPs (868A>G and 2692C>T) in exon 2 and exon 5, respectively. Statistical analysis revealed that the chemerin gene

polymorphisms of 868A>G had a significant effect on BFT and LEA in the Qinchuan cattle population studied, and the additive genetic effects were significant for WHC as well. Similarly, the polymorphisms of 2692C>T were significant on BFT and WHC. Therefore, we assumed that the mutation for 868A>G and 2692C>T might influence the carcass and meat quality traits; it could be a candidate molecular marker for the quality improvement of Qinchuan cattle. The meat quality traits of bovine are affected by many factors, such as genotype, breed, herd, location, sex and other random environmental factors. We got a new statistical model in which the three factors (breed, herd and location) were involved and then, we employed the least-squares method in GLM procedure of SPSS software to do the related analysis and we did not find any significant difference (P > 0.05) (data not shown). Ultrasound technology has been popularly used in recent years, for example, Trejo et al. (2010) used the ultrasound technology to measure the backfat and marbling deposition in feedlot cattle to evaluate the different effect on the ultrasound backfat and marbling deposition. Previously, Hamlin et al. (1995) indicated that ultrasonic predictors showed about 10% less variation in retail product percentage than did carcass measurements. Greiner et al. (2003) found that the ultrasound measurements were useful predictors of retail yield in live animal, such as 12th-rib fat thickness and longissimus muscle area. Our result showed that the relevance in this study was the same as the traits measured by ultrasound with the carcass traits (Jiao et al., 2010). Implications Our data showed that the chemerin gene might have potential influence on carcass and meat quality traits in Qinchuan cattle. And the impact of SNPs on these traits variability represents a vast area for further research. It is also significant to investigate whether the chemerin gene

Song et al.

8423

Table 5. Association between locus 868A>G and 2692C>T genotypes of chemerin gene and carcass and meat quality traits in Qinchuan cat tle.

Trait (Mean ± SE)

Polymorphism

Genotype

Water holding capability (WHC)/%

2.647±0.127 2.333±0.095 2.500±0.107 0.138

Meat tenderness (MT)/kg 2.154±0.136 2.062±0.102 2.230±0.115 0.548

2.552±0.100 2.375±0.110 2.556±0.179 0.452

2.013±0.105 2.293±0.115 2.289±0.188 0.160

78.348±1.260a 74.288±1.385b 73.433±2.261ab 0.050

Live weight (LW)/kg

Carcass weight (CW)/kg

Backfat thickness (BFT) (cm)

Loin eye area (LEA)/cm2

Marbling score (MS)/1-5

868A>G

AA AG GG P

400.765±9.511 388.333±7.160 397.500±8.005 0.521

198.035±8.956 185.587±6.741 189.733±7.537 0.542

1.214±0.086a 1.013±0.065b 1.087±0.072ab 0.064

81.251±4.344a 69.004±3.270b 78.555±3.656ab 0.048

2692C>T

AA AB BB P

392.103±6.892 396.208±7.576 389.444±12.371 0.872

193.738±6.239 185.967±6.859 183.044±11.20 0.593

1.215±0.058a 1.027±0.064b 1.014±0.104ab 0.061

73.896±3.452 77.404±3.795 74.175±6.197 0.777

79.788±1.539a 74.523±1.159b 75.083±1.295b 0.021

Means with different superscripts are significantly different (P < 0.05).

plays a role in the development of these traits and whether it involves linkage disequilibrium with other causative mutations. In conclusion, ultrasound technology could be a useful method in animal production, especially in breeding, and people can manage their farm easily. ACKNOWLEDGMENTS Research supported by the China National GMO new varieties major project (2011ZX08007-002), Beef cattle and Yak Industrial Technology System project (CARS-38), National Twelfth ‘‘Five Year’’ Science and Technology Support Project(2011BAD28B04-03) and Changjiang Scholars and Innovative Team Development Project from Ministry of Education of the People's Republic of China (IRT0940) . REFERENCES Akridge JT, Brorsen BW, Whipker LD, Forrest JC, Kuei CH,

Schinckel AP (1992). Evaluation of alternative techniques to determine pork carcass value. J. Anim. Sci., 70:18-28. Bozaoglu K, Bolton K, McMillan J, Zimmet P, Jowett J, Collier G, Walder K, Segal D (2007). Chemerin is a novel adipokine associated with obesity and metabolic syndrome. Endocrinology, 148(10): 4687-4694. Ernst MC, Issa M, Goralski KB, Sinal CJ (2010). Chemerin Exacerbates Glucose Intolerance in Mouse Models of Obesity and Diabetes. Endocrinology, 151(5): 1998-2007. Goralski KB, McCarthy TC, Hanniman EA, Zabel BA, Butcher EC, Parlee SD, Muruganandan S, Sinal CJ (2007). Chemerin, a novel adipokine that regulates adipogenesis and adipocyte metabolism. J. Biol. Chem., 282(38): 28175-28188. Greiner SP, Rouse GH, Wilson DE, Cundiff LV, Wheeler TL (2003). Prediction of retail product weight and percentage using ultrasound and carcass measurements in beef cattle. J. Anim. Sci., 81(7): 1736-1742. Gantz I, Konda Y, Yang YK, Miller DE, Dierick HA, Yamada T (1996). Molecular cloning of a novel receptor (CMKLR1) with homology to the chemotactic factor receptor. Cytogenet. Cell. Genet., 74(4): 286-290. Hamlin KE, Green RD, Cundiff LV, Wheeler TL, Dikemad ME (1995). Real-time ultrasonic measurement of fat thickness and longissimus muscle area: II. Relationship between real-time ultrasound measures and carcass retail yield. J. Anim. Sci., 73: 1725-1734. Jiao Y, Zan LS, Liu YF, Wang HB, Guo BL (2010). A novel polymorphism of the MYPN gene and its association with

meat quality traits in Bos Taurus. Genet. Mol. Res., 9(3): 1751-1758. Lan XY, Pan CY, Chen H, Zhang CL, Li JY, Zhao M, Lei CZ, Zhang AL, Zhang L (2007). An AluI PCR-RFLP detecting a silent allele at the goat POU1F1 locus and its association with production traits. Small. Ruminant. Res., 73: 8-12. Martensson UEA, Fenyö EM, Olde B, Owman C (2006). Characterization of the human chemerin receptor--ChemR23/CMKLR1--as co-receptor for human and simian immunodeficiency virus infection, and identification of virus-binding receptor domains. Virology. 355(1): 6-17. Methner A, Hermey G, Schinke B, Hermans-Borgmeyer I (1997). A novel G protein-coupled receptor with homology to neuropeptide and chemoattractant receptors expressed during bone development. Biochem. Biophys. Res., 233(2): 336-342. Mullenbach R, Lagoda PJ, Welter C (1989). An efficient salt-chloroform extraction of DNA from blood and tissues. Trends Genet., 5(12): 391. Müssig K, Staiger H, Machicao F, Thamer C, Machann J, Schick F, Claussen CD, Stefan N, Fritsche A ,Häring HU (2009). RARRES2, encoding the novel adipokine chemerin, is a genetic determinant of disproportionate regional body fat distribution: a comparative magnetic resonance imaging study. Metabolism, 58(4): 519-524. Meder W, Wendland M, Busmann A, Kutzleb C, Spodsberg N, John H, Richter R, Schleuder D, Meyer M, Forssmann WG (2003). Characterization of human circulating TIG2 as a

8424

Afr. J. Biotechnol.

ligand for the orphan receptor ChemR23. FEBS Lett., 555(3): 495-499. Nei M, Li WH (1979). Mathematic model for studying genetic variation in terms of restriction endonucleaes. Proc. Natl. Acad. Sci. U S A., 76(10): 5269-5273. Nei M, Roychoudhury AK (1974). Sampling variance of heterozygosity and genetic distance. Genetics, 76: 379-390. Nagpal S, Patel S, Jacobe H, DiSepio D, Ghosn C, Malhotra M, Teng M, Duvic M, Chandraratna RA (1997). Tazarotene-induced gene 2 (TIG2), a novel retinoid- responsive gene in skin. J. Invest. Dermatol., 109(1): 91-95. Parolini S, Santoro A, Marcenaro E, Luini W, Massardi L, Facchetti F, Communi D, Parmentier M, Majorana A, Sironi M, Tabellini G, Moretta A, Sozzani S (2007) The role of chemerin in the colocalization of NK and dendritic cell subsets into inflamed tissues. Blood, 109: 3625-3632. Roh SG, Song SH, Choi KC, Katoh K, Wittamer V, Parmentier M, Sasaki Si (2007). Chemerin-a new adipokine that modulates adipogenesis via its own receptor. Biochem. Biophys. Res., 362(4): 1013-1018. Safonova I, Darimont C, Amri EZ, Grimaldi P, Ailhaud G, Reichert U, Shroot B (1994). Retinoids are positive effectors of adipose cell differentiation. Mol. Cell. Endocrinol., 104: 201-211. Sell H, Eckel J (2009). Chemotactic cytokines, obesity and type 2 diabetes: in vivo and in vitro evidence for a possible causal correlation. Proc. Nutr. Soc., 68(4): 378-384. Song SH, Fukui K, Nakajima K, Kozakai T, Sasaki S, Roh SG, Katoh K (2010). Cloning, expression analysis, and regulatory mechanisms of bovine chemerin and chemerin receptor. Domest. Anim. Endocrin., 39(2): 97-105. Takahashi M, Takahashi Y, Takahashi K, Zolotaryov FN, Hong KS, Kitazawa R, Iida K, Okimura Y, Kaji H, Kitazawa S, Kasuga M, Chihara K (2008). Chemerin enhances insulin signaling and potentiates insulin-stimulated glucose uptake in 3T3-L1 adipocytes. FEBS. Lett., 582: 573-578. Thamer C, Machann J, Stefan N, Schäfer SA., Machicao F, Staiger H, Laakso M, Böttcher M, Claussen C, Schick F, Fritsche A, Haring HU (2008). Variations in PPARD determine the change in body composition during lifestyle intervention: a wholebody magnetic resonance study. J. Clin. Endocrinol. Metab., 93: 1497-1500.

Trejo CO, Faulkner DB, Shreck A, Homm JW, Nash TG, Rodriguez-Zas SL, Berger LL (2010). Effects of Co-Products and Breed of Sire on the Performance, Carcass Characteristics, and Rates of Ultrasound Backfat and Marbling Deposition in Feedlot Cattle. Profession. Anim. Sci., 26(6): 620 - 630. Wall PB, Rouse GH, Wilson DE, Tait RG, Jr., Busby WD(2004). Use of ultrasound to predict body composition changes in steers at 100 and 65 days before slaughter. J. Anim. Sci., 82: 1621-1629. Wittamer V, Bondue B, Guillabert A, Vassart G, Parmentier M, Communi D (2005). Neutrophil-mediated maturation of chemerin: a link between innate and adaptive immunity. J. Immunol., 175: 487-493. Wittamer V, Franssen JD, Vulcano M, Mirjolet JF, Le Poul E, Migeotte I, Brézillon S, Tyldesley R, Blanpain C, Detheux M, Mantovani A, Sozzani S, Vassart G, Parmentier M, Communi D (2003). Specific recruitment of antigen-presenting cells by chemerin, a novel processed ligand from human inflammatory fluids. J. Exp. Med., 198(7): 977-985. Zabel BA, Allen SJ, Kulig P, Allen JA, Cichy J, Handel TM, Butcher EC (2005). Chemerin activation by serine proteases of the coagulation, fibrinolytic, and inflammatory cascades. J. Biol. Chem., 280(41): 34661-34666. Zhang C, Wang Y, Chen H, Lan X, Lei C (2007). Enhance the efficiency of single-strand conformation polymorphism analysis by short polyacrylamide gel and modified silver staining. Anal. Biochem., 365(2): 286-287.

African Journal of Biotechnology Vol. 11(34), pp. 8425-8432, 26 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4176 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Genetic diversity of Stipa bungeana populations in the Loess Plateau of China using inter-simple sequence repeat (ISSR) markers Yu Jing1, Jing Zhao-Bin2 and Cheng Ji-Min1, 2, 3* 1

College of Resources and Environment, Northwest A and F University, Yangling 712100, Shaanxi, P. R. China. College of Animal Science and Technology, Northwest A and F University, Yangling 712100, Shaanxi, P. R. China. 3 Institute of Soil and Water Conservation, Chinese Academy of Sciences and Ministry of Water Resources, Yangling 712100, Shaanxi, P. R. China. 2

Accepted 22 March, 2012

Inter-simple sequence repeat (ISSR) markers were used to determine the genetic diversity and genetic differentiation for eight natural populations of Stipa bungeana in the Loess Plateau of China. 15 primers produced stable and reproducible amplification bands which were selected from the screened 96 primers. Among a total of 390 amplified bands, 335 (85.90%) were polymorphic loci. At species level, Nei's gene diversity index and Shannon's information index were 0.1633 and 0.2703, respectively. Based on the cluster analysis, the eight populations were divided into three groups. Analysis of molecular variance (AMOVA) demonstrated that the genetic variation was found mainly among populations, which accounted for 68.71% of the total variation, but the within-population accounted for 31.29%. Mantel test revealed no significant correlation between genetic distance and geographic distance (r= -0.1345, P= 0.71). In this study, the lower genetic diversity of S. bungeana may be related with human activities and habit destroyed. The conservation strategies further were proposed for this plant. Key words: Stipa bungeana, inter simple sequence repeats, genetic diversity, the Loess Plateau. INTRODUCTION Understanding the genetic diversity of a species and a population with the relation to ecological factors is a prerequisite for effective conservation and management of a species and a population. The genetic diversity and genetic differentiation of a species was considered important for species diversity and protection (Zhao et al., 2006). Genetic diversity within populations was considered highly important for possible adaptation to environmental changes for long-term survival of plant species (Bauert et al., 1998). To preserve the genetic diversity of population was considered important to stabilize population and ecosystem dynamics (Hughes et al., 2008). The genetic structure of population were affected by various environment and human activity

*Corresponding author. E-mail: gyzcjm@ms.iswc.ac.cn. Tel: 8629-87012272. Fax: 86-29-87012210.

factors, including life history, mecological traits, reproductive mode, over grazing and mowing and fire disturbance (Nybom, 2004; Mohamed et al., 2010) . The Loess Plateau of China is located in the upper and middle of Yellow River. The total area is about 52 million hectares. At present, the Loess Plateau is a typical region of ecological fragile that is suffering from water and soil erosion and drought for a long time. The amount of annual soil erosion is estimated to be over 2200 million tons (Zhang et al., 2010). Under this weak condition, Stipa bungeana is the dominant and constructive species of the typical steppe in the Loess Plateau (Cheng et al., 2011). Its distribution covers some major provinces in China including Tibet, Gansu, Ningxia, Xinjiang, Qinghai, Shaanxi, Shanxi, and Inner Mongolia. In addition, S. bungeana is one of the major grassland types in the temperate zone of Asia. S. bungeana is a perennial grass which clonally grows by tiller. It mainly depends on vegetative propagation by repeatedly producing tiller

8426

Afr. J. Biotechnol.

Figure 1. Geographic distribution of the eight sampled populations of S. bungeana in the Loess Plateau.

ramets from shoot base. It have large root systems and big crown width to promote few seed survival depending on the water and nutrients offered by parents. S. bungeana contains high level of nutrients and palatable for livestock. It tolerates drought and grazing and can be grazed by sheep in different growth stages. Therefore, it is important for ecological restoration in the Loess Plateau. Gustafson et al. (1999) showed that the genetic variation of dominant (constructive) species could provide the information for the utilization and protection of these species and the evaluation of the ecosystemâ&#x20AC;&#x2122;s genetic health. At present, the genetic diversity of a few Stipa genus plants have been reported including Stipa grandis, Stipa purpurea and Stipa tenacissima (Zhao et al., 2006, 2008; Wu et al., 2010; Mohamed et al., 2010; Liu et al., 2009). A number of studies have reported on S. bungeana ecology (Cheng et al., 2011; Huang et al., 2001a, 2001b). However, up till now, there is no report on the genetic diversity and the genetic structure of the S. bungeana populations from the Loess Plateau of China. Inter-simple sequence repeat (ISSR) is now established as a powerful approach for detecting species and population genetic diversity and differen-tiation

(Zietkiewicz et al., 1994; Zhao et al., 2008). In this study, ISSR molecular markers were used to analyze the genetic diversity and genetic differentiation of S. bungeana populations in the Loess Plateau of China. The objectives of this study were to (1) investigate the level of genetic diversity of S. bungeana natural populations; (2) reveal the level of genetic variations within and among populations; (3) analyze the relationship between and among genetic diversity and environmental factors; (4) provide scientific conservation strategies for S. bungeana. MATERIALS AND METHODS Sample collection A total of 160 individuals of S. bungeana were collected from eight populations in Loess Plateau in September 2010 (Figure 1). Habitat conditions of the populations are shown in Table 1. 20 individuals from each population were sampled randomly, and the distance between individual plants were kept at least 10 cm within the same population. Young and fresh leaves were collected from each sampled individuals and immediately stored in zip lock bags with silica gel and taken back to the laboratory and stored at -80Â°C in ultra-freezer for DNA extracted.

Jing et al.

8427

Table 1. Locations and the habitat characters.

Location

Chengchuan, Inner-Mongolia Machangjie, Inner-Mongolia Huining, Gansu Jingchuan, Gansu Pucheng, Shaanxi Binxian,Shaanxi Nanshan, Yunwu Mountain,Ningxia Deteriorated grassland, Yunwu Mountain, Ningxia

A1 A2 A3 A4 A5 A6 A7 A8

DNA extraction Genomic deoxyribonucleic acid (DNA) was extracted using the modified cetyltrimethyl ammonium bromide (CTAB) method (Zhao et al., 2006). DNA concentration and purity were determined with ultraviolet-visible spectroscopy (UV– VIS) spectrophotometer and the DNA quantity was detected by using 0.8% (w/v) agarose gels. The solution was diluted to 20 ng μL-1 and then stored at -20°C for polymerase chain reaction (PCR) analysis.

Inter-simple amplification

sequence

repeat

(ISSR)

-PCR

According to the primer sequence published by University of British Columbia (UBC), a total of 96 inter-simple sequence repeat (ISSR) primer sequence were synthesized by Beijing Aoke Biological Technology Co., Ltd. Four individual plants from different populations were used for the primer screening. Finally, 15 primers (Table 2) were selected for the study based on clarity and reproducibility, and high polymorphism of amplified product bands. PCR amplification reaction system with had total volume of 20 μl, containing 20 ng of template DNA, 10 × PCR buffer (100 Mm Tris-HC, pH 8.3; 500 mM KCl), 0.18 mM of each dNTPs, 0.75 mM of each primer, 1.87 mM of MgCl2, and 1 units of Taq DNA polymerase (TaKaRa Biotechnology Dalian Co., Ltd., China). PCR amplification was carried out on Eppendorf PCR instrument and the PCR reaction programs as follows: initial 5 min at 94°C, followed by 35 cycles of 45 s at 94°C , 45 s annealing at 50°C

Altitude (m) 1364 1354 1726 1305 430 1161 2049 2047

Longitude (E) 107°23′ 107°43′ 105°01′ 107°31′ 109°45′ 108°50′ 106°37′ 106°37′

Latitude (N) 38°06′ 38°02′ 35°58′ 35°19′ 34°53′ 35°15′ 36°25′ 36°27′

Annual mean precipitation (mm) 294.1 294.1 340.0 555.0 533.2 602.3 445.0 423.5

(varies according to different primers), and 90 s extension at 72°C, ending with a final extension of 5 min at 72°C. PCR products were separated on 6% denatured polyacrylamide gel and detected by silver staining. Then, clear and reproducible bands were recorded and used in the analysis.

Data analysis Clear and reproducible bands were selected for statistical analysis. Amplified bands were scored for each individual as presence (1) or absence (0). DCFA1.1 program was used to build the original document of data analysis (Zhang et al., 2002). Assuming Hardy-Weinberg equilibrium, POPGENE1.32 (Yeh et al., 1997) was used to calculate the following genetic diversity parameters: the percentage of polymorphic bands (PPB), Shannon’s information index (I), Nei’s gene diversity (H), the effective number of alleles (ne), observed number of alleles (na), gene differentiation (Gst) and Nei’s genetic distance (Nei, 1973). The average level of gene flow (Nm) among populations was indirectly calculated using the formula: Nm = 0.5 (1-Gst)/Gst. (McDermott and McDonald, 1993). An unweighted pairgroup method using arithmetic mean (UPGMA) dendrogram was constructed based on the matrix of Nei’s genetic distance using NTSYS-pc 2.1e program (Rohlf, 2000). In addition, analysis of molecular variance (AMOVA) procedure was used to estimate the coefficient of genetic variation among and within populations (Excofier et al., 1992). The variance components were tested statistically

Annual mean temperature (°C) 7.4 7.4 6.4 10.0 13.3 9.2 5.8 6.1

Habitat Desert steppe Desert steppe Typical steppe Forest steppe Forest steppe Forest steppe Typical steppe Typical steppe

by nonparametric randomization tests using 1000 permutations. Meanwhile, Pearson correlation analysis was used to detect the correlation between genetic diversity parameters and environment factors, including altitude, longitude, latitude, annual mean temperature and annual mean precipitation. All these data analyses were calculated by SPSS11.0 (SPSS, 2001). Finally, the relationship between genetic distance and corresponding geographical distance among all populations was tested by Mantel’s Test (Mantel, 1967).

RESULTS Genetic diversity of S. bungeana A total of 390 bands were generated using 15 primers for 160 individuals of eight populations, corresponding to an average of 26 bands per primer. Of these bands, 335 bands were polymorphic, and the percentage of polymorphic bands was 85.90% (Table 3). Amplified bands ranged in size from 100 ~ 2000 bp. Assuming Hardy-Weinberg equilibrium, Nei’s gene diversity (H) was 0.1663, and Shannon’s information index (I) was 0.2703 at the species level. Among the eight populations, the highest genetic diversity occurred in population A8 (PPB = 34.36%, H = 0.0981,I = 0.1517) and the lowest was in

8428

Afr. J. Biotechnol.

Table 2. Primer sequences used in inter-simple sequence repeat (ISSR) analyses of S. bungeana.

Primer UBC806 UBC813 UBC814 UBC820 UBC822 UBC823 UBC827 UBC834 UBC840 UBC864 UBC868 UBC880 UBC886 UBC887 UBC891

Sequence (5’-3’) (TA)8G (CT)8T (CT)8A (GT)8C (TC)8A (TC)8C (AC)8G (AG)8YT (GA)8YT ( ATG)5 (GAA)5 (GGAGA)3 VDV(CT)7 VDV(TC)7 HVH(TG)7

Tm (°C) 41.5 48.4 50.0 57.7 55.7 57.7 56.4 56.0 54.1 46.7 42.6 51.0 57.7 54.5 47.1

Y = (C,G); D = (A,G,T); V = (A,C,G) ; H = (A,C,T).

population A1 (PPB =10.51%, H = 0.0306, I = 0.0541) (Table 3).

dendrogram (Figure 2) of eight populations was constructed based on Nei’s unbiased genetic distance matrix. The dendrogram indicated that the eight populations were divided into two groups. One group consisted of the individuals from populations A7 and A8, and the other six populations were clustered in another group that can be further divided into two sub-clusters. A1 population was clustered into one separate sub-group, and the other five populations (A2, A3, A4, A5 and A6) constituted the other sub-group. The relationship between genetic distance and corresponding geographical distance among populations was tested by Mantel’s Test, and the result shows that there was no significant correlation (r= -0.1345, p = 0.71) (Figure 3). This result showed that geographical distance was not the main reason for genetic differentiation of S. bungeana populations.

Correlation of genetic diversity and environment factors Pearson’s correlation analysis showed that there were no significant correlation among the genetic diversity parameters (PPB, H and I) and environment factors (latitude, longitude, altitude, average temperature and annual rainfall) (Table 6).

Genetic differentiation of S. bungeana Analysis of molecular variance (AMOVA) demonstrated that the genetic variation of S. bungeana existed mainly among populations, which accounted for 68.71% of the total variation, but the within-population accounted for 31.29%. The coefficient of genetic differentiation (ΦST) was highly significant (P <0.001) based on the 1000 permutations (Table 4). Genetic differentiation coefficient cannot only evaluate the degree of differentiation provenance but also indicate the relationship between provenances. In addition, genetic identity (I) and genetic distance (D) could be used to illustrate the degree of genetic differentiation further (Wang et al., 2011). POPGENE was used to calculate the genetic identity and genetic distance among populations (Table 5). Among the eight populations of S. bungeana, the genetic identity between A5 and A7 populations was the lowest (I = 0.7930), thus the genetic distance was the greatest (D = 0.2320). The genetic identity between A5 and A6 populations was the greatest (I=0.9806), but the genetic distance was the least (D = 0.0196). Moreover, the level of gene flow (Nm) was measured to be 0.1139 individual per generation among populations. Genetic relationship Genetic relationship among the populations was examined by UPGMA cluster analysis. The UPGMA

DISCUSSION Genetic diversity in S. bungeana Genetic diversity refer to the level of genetic difference within species, and reflect the ability of species to adapt to the environment and the potential to be used and transformed (Wang et al., 2011). Until now, this is the first time that inter-simple sequence repeat (ISSR) markers were used on the population of S. bungeana from the Loess Plateau of China. It is generally acknowledged that the genetic diversity of the plant is abundant when the percentage of polymorphic bands reach about 50% at the population level (Ma et al., 2000; Liu and Jia, 2003; Sun et al., 2004). In this study, the percentage of polymorphic bands ranged from 10.51 ~ 34.36% at the population level; it was lower than at the species level. This result may be caused by some loci which only could be detected in the individual population; the other reason was that the uneven distribution of the loci in each population may lead to high polymorphism rate (Li et al., 2004). From the percentage of polymorphic bands, S. bungeana had a lower genetic diversity at the population level. However, the percentage of polymorphic bands could be affected by sample size and band quantity. So, the evaluation of genetic diversity only was a rough estimated value by the percentage of polymorphic bands. Therefore, Nei’s gene diversity based

Jing et al.

8429

Table 3. Genetic diversity indexes of eight populations of Stipa bungeana.

Population A1 A2 A3 A4 A5 A6 A7 A8 Mean Species level

Polymorphic loci 41 84 93 73 48 93 109 134 84.4 335

PPB 10.51 21.54 23.85 18.72 12.31 23.85 27.95 34.36 21.64 85.90

na 1.1051 1.2154 1.2385 1.1872 1.1231 1.2385 1.2795 1.3436 1.2164 1.8590

ne 1.0604 1.1007 1.1352 1.0967 1.0757 1.1328 1.1298 1.1613 1.1116 1.2601

H 0.0360 0.0608 0.0787 0.0583 0.0434 0.0751 0.0794 0.0981 0.0662 0.1663

I 0.0541 0.0933 0.1184 0.0885 0.0642 0.1124 0.1231 0.1517 0.1007 0.2703

PPB = percentage of polymorphic bands; na = observed number of alleles; ne = effective number of alleles; H = Neiâ&#x20AC;&#x2122;s gene diversity; I = Shannonâ&#x20AC;&#x2122;s information index.

Table 4. Analysis of molecular variance (AMOVA) for eight populations of S. bungeana.

Source of variation Among groups Within groups Total

d.f.

Sum of squares

Variance component

Percentage of variation (%)

P value

7 152 159

579.587 12.901 592.488

28.3343 12.9013 41.2356

68.71 31.29 100.00

<0.001

P-values were estimated by a permutation procedure based on 1000 replicate.

Table 5. Genetic similarity coefficient (above diagonal) and genetic distance (below diagonal) of S. bungeana.

Population A1 A2 A3 A4 A5 A6 A7 A8

A1 0 0.1566 0.1081 0.1504 0.1887 0.1292 0.2086 0.2009

A2 0.8551 0 0.0561 0.0364 0.0470 0.0409 0.2056 0.2006

A3 0.8975 0.9455 0 0.0596 0.0774 0.0452 0.1874 0.1841

A4 0.8604 0.9642 0.9421 0 0.0268 0.0246 0.2081 0.2050

on Hardy-Weinberg supposition and Shannonâ&#x20AC;&#x2122;s information index based on band phenotype frequency can be used to evaluate the genetic diversity of population more accurately (Qian and Ge, 2001). Nybom (2004) concluded that the average value of Nei's genetic diversity was 0.190 for monocotyledonous. In comparison to this result, our estimate for S. bungeana (0.0360~0.0981) was significantly lower than the average value, this result shows that the genetic diversity of S. bungeana was relative lower at the population level. During the process of field survey and sampling, we found that the populations with higher genetic diversity (A2, A3, A6, A7 and A8 populations) were always located

A5 0.8280 0.9540 0.9256 0.9736 0 0.0196 0.2320 0.2317

A6 0.8788 0.9599 0.9557 0.9757 0.9806 0 0.1817 0.1785

A7 0.8117 0.8142 0.8291 0.8121 0.7930 0.8338 0 0.0949

A8 0.8180 0.8183 0.8319 0.8147 0.7932 0.8365 0.9095 0

in the untraversed places, the habitat protection was relatively intact and the populations were larger. In contrast to these, the populations with lower genetic diversity (A1, A4, A5) were located near the residence of farmers and herdsmen or around the traffic arteries; in these places, human and livestock destroyed the ecological environment seriously, which caused the numbers and scope of S. bungeana population to became smaller, and further caused the level of the genetic diversity to be relatively lower. Sun (1996) has shown that the scope of population was significant relevance with its genetic diversity. In this study, the lower genetic diversity of S. bungeana may be related

8430

Afr. J. Biotechnol.

Figure 2. Dendrogram generated by UPGMA based on Nei’s unbiased genetic distances for populations of S. bungeana.

Figure 3. The correlation between genetic distance and geographic distance for populations of S. bungeana.

Table 6. Pearson correlation analyses for the relationships between genetic diversity index and ecological factors.

Diversity index PPB H I

Altitude (m)

Longitude

Latitude

0.768 0.730 0.749

-0.583 -0.596 -0.605

-0.066 -0.187 -0.159

Annual mean temperature (°C) 0.059 0.110 0.091

Annual mean precipitation (mm) -0.629 -0.588 -0.606

PPB =percentage of polymorphic bands; H = Nei’s gene diversity; I = Shannon’s information index. All data significant level P > 0.05.

Jing et al.

with human activities and habit destroyed. Genetic differentiation among populations Population genetic structure was defined as the nonrandom distribution pattern of genetic variation of one species or population in the spatial and temporal pattern. To a large extent, it represents the evolutionary potential of a species or population (Sun, 1996). The genetic differentiation is an important parameter to evaluate the population genetic structure (Hamrick and loveless, 1989). In the present study, genetic differentiation coefficient (ΦST) among eight populations was 0.687 by the AMOVA. Population differentiation of S. bungeana was higher than that of long-lived perennial species (ΦST = 0.25, n = 60), out-crossing species (ΦST = 0.25, n = 73), mixed breeding species (ΦST = 0.40, n = 18) and the widespread species (ΦST = 0.34, n = 32) (Nybom, 2004). Wright (1951) pointed that the genetic differentiation was strong when coefficient was greater than 0.25. Therefore, S. bungeana population appeared the greater genetic differentiation. Hamrick and Godt (1990) considered that the mean value of genetic differentiation coefficient is 0.20 for cross-pollination plant, and for the selfing species is 0.51. Compared to cross-pollination plant, the selfing plant has higher genetic variation among populations and lower genetic variation within population. S. bungeana is a selfing species, thus the genetic variation mainly existed among the populations and the genetic variation within populations was relatively lower. First, the significant population differentiation in S. bungeana can be explained by the geographic environment factors. In this study, the habitat of field survey and sampling are in the Loess Plateau. There is strong wind in autumn in this area, but the terrain is complicated, and the isolation of High Mountain leads to the big geographic distances among populations, this further hinder the long-distance spread of seed and pollen and affecting the genetic information exchange among different populations in different historical periods. Second, S. bungeana is an excellent grass that is favored by the cattle, sheep or goats. Under the great pressure of animals graze, it is difficult to form a strong seed bank among populations. In addition, it is hard to achieve long-distance spread depend on wind or animal carrying. Meanwhile, human over-grazing and excessive deforestation also lead to the living environment of S. bungeana continue to shrank and deteriorate, which result in the discontinuous distribution of populations. Third, our field survey also found that the germination rate of S. bungeana was low. It grow mainly by clonal reproduction to expand population, this special reproduction increased the mating opportunity among similar individuals and lacked effective gene flow for among different populations. Therefore, we assumed that selfing breeding system, lower gene flow, seed and pollen close range spread and the limited population size

8431

may result in the greater genetic differentiation among populations of S. bungeana. Hamrick and Godt (1990) concluded that plant breeding system, gene flow and seed dispersal mechanisms, reproduction mode, natural selection and other factors had a significant impact on the genetic structure of plants. Gene flow was considered as one of the main factors for homogenization of population genetic structure. The species with limited gene flow had a greater genetic differentiation than the species with wide gene flow (Hamrick and Loveless, 1989). In this study, the gene flow (Nm = 0.1139) was far less than 1, which indicated that the gene flow of S. bungeana populations was very limited. Wright (1951) pointed that if the estimated value of gene flow (Nm) was greater than 1, there would be certain gene flow among populations; when Nm is smaller than 1, the genetic drift was an important factor to lead to significant genetic differentiation among populations.

Implications for conservation of S. bungeana The environmental degradation caused by natural and

human factors exceeds the maximum limit, and then it must result in the loss of genetic diversity for a species or population (Yan et al., 2010). S. bungeana is widely distributed on the Loess Plateau, but with the development and utilization of grassland, the water loss and soil erosion becoming increasingly serious, which is causing the continuously destroy of natural growing environment for S. bungeana and further leads to the genetic diversity decreased. Therefore, it is necessary to take effective protection strategies and methods to protect the S. bungeana in the Loess Plateau. From this study, we known the lower genetic diversity of S. bungeana were related to the fragmented distribution range and the number of population continued reduction. Therefore, we should enhance in situ conservation of S. bungeana to ensure its normal growth and reproduction, and to restrain the decline trend of genetic diversity by prevent overgrazing and excessive deforestation. In addition, it is important to carry out in-depth research for seed reproduction characteristics of S. bungeana to improve its self-reproductive capacity by seeds in natural habitat.

ACKNOWLEDGEMENTS We are grateful to Wang Xi-Ping and Yang Yong for the laboratory work and guide. This work was financially supported by "Strategic Priority Research ProgramClimate Change: Carbon Budget and Related Issues" of the Chinese Academy of Sciences (XDA05050202), and the earmarked fund for Modern Agro-industry Technology Research System (CARS-35-40).

8432

Afr. J. Biotechnol.

REFERENCES Bauert MR, Ka LM, Baltisberger M, Edwards PJ (1998). No genetic variation within isolated relict populations of Saxifraga cernua in the Alps using RAPD markers. Mol. Ecol. 7: 1519-1527. Cheng J, Wu GL, Zhao LP, Li Y, Li W, Cheng JM (2011). Cumulative effects of 20-year exclusion of livestock grazing on above- and belowground biomass of typical steppe communities in arid areas of the Loess Plateau, China. Plant Soil Environ. 57: 40-44. Excofier L, Smouse PE, Quattro JM (1992). Analysis of molecular variance inferred from metric distances among DNA haplotypes: applications to human mitochondrial DNA restriction data. Genetics, 131: 479-491. Gustafson DJ, Gibson DJ, Nickrent DL (1999). Random amplified polymorphic DNA variation among remnant big bluestem (Andropogon gerardii vitman) populations from Arkansas’ Grand Prairie. Mol. Ecol. 8: 1693-1701. Hamrick JL, Loveless MD (1989). Associations between the breeding system and the genetic structure of tropical tree populations. Westview Press, Boulder, pp. 129-146. Hamrick JL, Godt MJW (1990) Allozyme diversity in plant species. In: Plant Population Genetics, Breeding and Ge-netic Resources (eds Brown AHD, Clegg MT, Kahler AL,Weir BS), Sinauer, Sunderland, MA. pp. 43-63. Huang FX, Fu DS, Liu ZD (2001a). Study on the relationship between aboveground biomass of the Artemisia phaerocephala-Stipa bungeana community and climate variables at sandy grassland ErdosPlateau. Acta Agrestia Sin. 9: 148-153. Huang FX, Gao Q, Fu DS, Liu ZD (2001b). Relation between climate variables and the aboveground biomass of Thymus mongolicus-Stipa bungeana community in steppe of Ordos Plateau, Inner Mongolia. Acta Ecol. Sin. 21: 1339-1346. Hughes AR, Inouye BD, Johnson MTJ, Underwood N, Vellend M (2008). Ecological consequences of genetic diversity. Ecol. Lett. 11: 609-623. Li JM, Jin ZX, Zhong ZC (2004). RAPD analysis of genetic diversity of Sargentodoxa cuneataat different altitude and the influence of environmental factors. Acta Ecol. Sin. 24: 567-573. Liu GH, Jia BL (2003). The study of genetic diversity of Ulmus pumila var. sabulosa. J. Arid Land Resour. Environ. 17: 123-128. Liu WS, Dong M, Song ZP, Wei W (2009). Genetic diversity pattern of Stipa purpurea populations in the hinterland of Qinghai–Tibet Plateau. Ann. Appl. Biol. 154: 57-65 Ma XJ, Wang XQ, Xu ZX (2000). RAPD Vriation within and among populations of Ginseng cultivars . Acta Bot. Sin. 42: 587-590. Mantel NA (1967). The detection of disease clustering and a generalized regression approach. Cancer Res. 27: 209-220. McDermott JM, McDonald BA (1993). Gene flow in plant pathosystems. Annu. Rev. Phyto-pathol. 31: 353-373. Mohamed B, Cesar B, Meriem KH, Tomas N, Mohamed Z (2010). Genetic Variation in Natural Populations of Stipa tenacissima from Algeria. Biochem. Genet. 48: m857-872. Nybom H (2004). Comparison of different nuclear DNA markers for estimating intra-specific genetic diversity in plants. Mol. Ecol. 13: 1143–1155.

Qian W, Ge S (2001). Analysis of population genetic structure by using dominant markers. Acta Gene. Sin. 28: 244-255. Rohlf FJ (2000). NTSYS-pc: Numerical Taxonomy and Multivariate Analysis System, version 2.1. Exeter Software, Setauket, New York, USA. SPSS Inc. (2001). SPSS Base 11.0 User’s Guide. SPSS Inc., Chicago. Sun M (1996). Effects of population size,mating system,and evolutionary origin on genetic diversity in Spiranthes sinensis and S.hongkongensis. Conserv. Biol. 10: 785-795. Sun K, Chen W, Ma RJ (2004). A study on the genetic diversity of subpopulations of Aippophae rhamnoides ssp. Sinensis at Ziwuling. GanSu. J. Lanzhou Univ. 40: 72-75. Wang DN, Mu CC, Gao Z, Feng FJ (2011). Inter-simple sequence repeat (ISSR) analysis of genetic diversity of Juglans mandshurica Maxim populations. Nonwood Forest Res. 29: 22-29. Wu JB, Gao YB, Bao XY (2010). Genetic diversity of Stipa grandis P.Smirn populations across the species’ range in the Inner Mongolia Plateau of China, Biochem. Syst. Ecol. pp. 1-7. Wright S (1951). The genetical structure of populations. Ann. Eugen. 15: 323-354. Yan JJ, Bai SQ, Zhang XQ, Chang D,You MH, Zhang CB (2010). Genetic diversity of native Elymus sibiricus populations in the Southeastern Margin of Qinghai-Tibetan Plateau as detected by SRAP and SSR marker. Acta Pratacul. Sin. 19: 122-134. Yeh FC, Boyle TJB (1997). Population genetic analysis of codominant and dominant markers and quantitative traits. Belg. J. Bot. 129: p. 157. Zhao NX, Gao YB, Wang JL, Ren AZ, Xu H (2006). RAPD diversity of Stipa grandis populations and its relationship with some ecological factors. Acta Ecol. Sin. 26: 1312-1319. Zhao NX, Gao YB, Wang JL, Ren AZ (2008). Population structure and genetic diversity of Stipa grandis P. Smirn, a dominant species in the typical steppe of northern China. Biochem. Syst. Ecol. 36: 1-10. Zhang JT, Dong YR (2010). Factors affecting species diversity of plant communities and the restoration process in the Loess area of China. Ecol. Eng. 36: 345-350. Zhang FM, Ge S (2002). Data analysis in population genetics. I. analysis of RAPD data with AMOVA. Biodiver Sci. 10: 438-444. Zietkiewicz E, Rafalski A, Labuda D (1994). Genome fingerprinting by simple sequence repeats (SSR) – an hored polymerase chain reaction amplification. Genomis, 20: 176-183.

Full Length Research Paper

The role of rhizospheric Aspergillus flavus in standing maize crop contamination in different ecological zones of Khyber Pakhtunkhwa, Pakistan Saleem Ullah, Hamid Ullah Shah, Anwar Ali Shad* and Sahib Alam Department of Agriculture, Chemistry, FNS, Khyber Pakhtunkhwa Agriculture, University, Peshawar-25120, Pakistan. Accepted 23 February, 2012

Soil and un-husked maize samples were collected from 29 different locations belonging to three distinct ecological zones (Swat, Hazara and Peshawar) of Khyber Pakhtunkhwa, Pakistan. The samples were evaluated for the incidence of aflatoxigenic strains of Aspergillus flavus. The soil samples collected from Peshawar (100%) and Hazara (66%), and grain samples collected from Swat (64%) and Peshawar (55%) were severely infected with aflatoxigenic strains of A. flavus. The strains isolated from maize kernels of Manyar, Jalala (Swat zone), Palosi and Takkar (Peshawar zone) produced the highest amount of aflatoxin B1 (324 to 514 µg g-1) and B2 (23 to 486 µg g-1). Similarly, the strains isolated from soils of Bannu (Peshawar) and Huripur (Hazara) were prominent in B1 (662 to 1323 µg g-1) and B2 (145 to 826 µg -1 g ). Microbial analysis of the surface sterilized grains showed that the strains isolated from Jalala (Swat) and Palosi (Peshawar) samples were high in B1 (62 to 79 µg g-1) and B2 (21 to 36 µg g-1). It was concluded, therefore, that A. flavus from soil might contaminate maize crop, but not directly from the same field. The most probable contamination occurred through air borne spores. It is thus recommended that protection from air borne spore should be devised. Key words: Aspergillus flavus, aflatoxin, ecology, maize crop, field, soil toxicology. INTRODUCTION Aspergillus flavus is a well documented fungus prevalent in humid and warm regions (80 to 90% and 25 to 30°C, respectively) of the world (Gupta et al., 1993; Gibson et al., 1994; Adhikari et al., 2004). Due to its infective nature, the fungus is predominantly found in soil where it mostly contaminates agriculture and related vegetation (Scheidegger and Payne, 2003; Masayuki and Katsuya, 2010; Shah et al., 2010). A plethora of research confirmed that consumption of infected victuals cause weight loss, liver damage, hepatitis, cancer and interfere protein and other nutrients metabolism. A. flavus can be identified as green or yellowish colonies, round or oblong shape conidia in soil and grains of various crops that can be easily isolated by various techniques (Sutton et al., 1998; Hell et al., 2000; Cardwell and Cotty, 2002). Various studied have reported that A. flavus infection occurs during yielding or maturity, harvest and storage

stage in agricultural crops (Silva et al., 2000; Magan et al., 2004; Alam et al., 2009). Likewise, recent studies confirmed increased amount of toxins during storage (Marin et al., 2004; Waliyar et al., 2009). However, due to the presence of the fungus in the rhizosphere, there must be some chance of infection of the standing crops (Jeffrey et al., 2010). Whatsoever the mechanism, green Aspergillus mycelium can be seen on freshly uncovered cobs of maize. This and other observations relate the standing crops infection especially of maize crop with soil A. flavus. Considering the importance of maize crop for the populace of Khyber Pakhtunkhwa, Pakistan, a project was design to assess the soil as a possible inoculum of standing maize crop and weigh up its potential role of aflatoxins contaminations during storage. MATERIALS AND METHODS Study area and Sampling

*Corresponding author. E-mail: anwaralishad@aup.edu.pk.

Khyber Pakhtunkhwa Province of Pakistan varies from dry rocky

8434

Afr. J. Biotechnol.

areas in the south to forests and green plains in the north. Its climate immensely varies from intensely hot summers to freezing cold winters. It is a wide arable land with irrigation facilities. The area is well known for maize production. In the present study, the subject area is divided into three different ecological zones on the basis of temperature, humidity and rainfall. Soils (1 kg each) and un-husked maize cobs samples (3 kg each) were obtained after harvest from 29 different sites of the three distinct ecological zones comprising Swat, Hazara and Peshawar of Khyber Pakhtunkhwa province of Pakistan. There was only one composite sample each of soil and maize cobs per region and each was collected from five different places per region. Each representative sample of maize cobs was threshed and systematically mixed in a composite sample (200 g each). They were air dried in shade for at least 42 h under protected conditions to avoid any foreign contaminations. Whereas the air-dried soil materials (100 g each) were pulverized and were sieved from 80 mm mesh sieve. Both maize and soil samples were packed in sealed plastic bags and stored at 4°C for subsequent fungal enumeration analysis. All the research work pertaining to this project was carried out in the Toxicology Laboratory of the Department of Agricultural Chemistry, Khyber Pakhtunkhwa Agricultural University, Peshawar, Pakistan and the Laboratory of Applied Mycology Group, Cranfield Health, Cranfield University, Bedford, U.K.

Media preparation and malt extract agar (MEA) plates About 45 g of malt extract agar media (MEA, Oxoid, Basingstoke, Hampshire, U.K.) was prepared in 900 ml of double distilled water in 1000 ml capacity bottle. The media was sterilized in autoclave at 121°C for 25 min. The MEA was then spread in disposable Petri dishes and were placed in 4°C temperature for fungal culturing (Ali et al., 2009).

Serial dilution of soil samples Soil sample (about 1 g each) was dissolved in 10 ml of Tween-20 mixed sterile water in a 25 ml capacity bottle, and then a dilution range of 10-2 to 10-5 g ml-1 was obtained by transferring 1 ml to 9 ml of sterile water in five serially placed bottles for each sample. Afterward, 10-3 and 10-4 were platted (0.4 µL) in duplicate on already prepared MEA plates. The plates were incubated at 25°C room for about seven days (Sharma, 2010). The A. flavus was then identified from the color of mycelium, shape of the colony and structure of spore head etc (Pitt and Hocking, 2009) and to type strains of A. flavus (SRKC-G1907; USDA,USA) and Aspergillus parasiticus (SSWT 2999, USA). Subsequently, they were subcultured by taking a patch of the mycelium from the mixed culture and transferring under sterile condition to a clean Petri dish of MEA. The plates were incubated at 25°C for seven days. Consequently, clean A. flavus strains were obtained.

Isolation of A. flavus from maize grains Five grains were randomly selected from 100 grains of each maize composite sample and were incubated on MEA plates at 25°C under sterile condition. Grains were also sterilized with 70% isopropanol for 3 min, rinsed thoroughly with double distilled water, dried with ballot paper and then placed on MEA Petri dishes for internal A. flavus infection. The A. flavus colonies were identified and counted. The data was converted to percentage of grain infection.

Aspergillus flavus toxicity and aflatoxin content Various strains of A. flavus isolated from soil and grain samples were grown on coconut agar media (Dyer and McCammon, 1994). The plates were inoculated with 2 or 3 pinches of each isolated A. flavus strain and kept at 25°C for six days. Plates on reverse sides were examined for blue or green fluorescence.

Quantification of aflatoxin The isolated strains were cultured on yeast extract agar media (YEA, Fisher, Loughborough, Leicestershire, U.K.) for their aflatoxin production. About 4 µL of the suspended spores in 20 ml of Tween20 water of each isolated strain were spread on YEA plates and kept for 10 days at 25°C. Five patches, each about 4mm in diameter, was taken from YEA with a circular cutter (Farid et al., 2009) and smashed in 1 ml of chloroform in a plastic vial. The clear liquid was pipetted out and dried at ambient temperature in a hood. Furthermore, the dried extract was redissolved in 200 µL of hexane and 50 µL trifluoroacetic acid (TFA) agitated mechanically for 30 s. After waiting for 5 min, 950 µL of water-acetonitrile mixture with a ratio of 9:1 was added and vortexed again for 30 s and kept for 10 min. The hexane layer was decanted and the rest was transferred in 1 ml amber vial for high performance liquid chromatography (HPLC) analysis (AOAC, 2000).

HPLC conditions The HPLC system used for aflatoxins determination was an Agilent 1200 series system (Agilent, Berks., Germany) with a fluorescence detector (FLD G1321A), an auto sampler ALS G1329A, FC/ALS therm G1330B, Degasser G1379B, Bin Bump G1312A and a C18 (Phenomonex, Luna 5 micron, 150 × 4.6 mm) column joined to a pre-column (security guard, 4 × 3 mm cartridge, Phenomenex Luna). The mobile phase was methanol : water : acetonitrile (30:60:10, v/v/v) using an isocratic flow rate of 1 ml min-1 at 360 nm excitation and 440 nm emission wavelengths and a 25 min run time for aflatoxin determination (Figure 1). The aflatoxin content of the strains was calculated using the following formula (AOAC, 2000).

RESULTS A. flavus was isolated from 17 samples of soil (Figure 2) and 16 samples of maize kernels (Figure 3), while four samples of sterilized maize grains (Figure 4) were found infected with Aspergillus strains. The zonal distribution of A. flavus strains showed that 100% of soil samples of Peshawar zone were found infected, followed by Hazara Zone (66%), whereas minimum infection (28%) was found in Swat. The highest colonies strength was found in Mardan (29.30 × 103 CFUs g-1) and Palosi (1.00 × 103 CFUs g-1) regions of Peshawar zone, Abattabad (30.70 × 103 CFUs g-1) and Shenkiari (11.7 × 103 CFUs g-1) regions of Hazara zone and in Ghalagay (7.00 × 103 CFUs g-1) of Swat zone. In case of maize kernels, the zonal distribution of A. flavus strains were different than that of soil samples; the highest isolation was done from Swat Zone (64%), followed by Peshawar zone (55%) and

Ullah et al.

8435

Figure 1. Chromatogram of aflatoxin standards (60 ng B1, G1 and 200 ng B2, G2/ml, runtime 20 min).

Figure 2. A. flavus infection CFUs (103) g-1 of soil samples belonging to three different ecological zones of Khyber Pakhtunkhwa. The bars represent the standard errors of means.

Hazara zone by 33% of different regions (Figure 3). The fungal density denoted as %grain infection was highest (16 and 11.67%) in Natmaira and Jalala regions of Swat zone, Palosi region (12.33%) of Peshawar zone and Dodial region (14.67%) of Hazara zone. The strains of A. flavus of sterilized grain showing internal infection of maize kernels, was found in one sample of Jalala region of Swat zone (14.67%), and in one sample of Palosi region (2.67%) of Peshawar zone, while also Dodial

region sample (10.33%) of Hazara zone was found to be infected. The aflatoxin production rates of the various strains are presented in Figures 5 to 8. Almost all the strains produced aflatoxin B1 and B2, which indicated that all the strains were A. flavus because one of its subspecies, A. parasiticus, produced four type of toxin (B1, B2, G1 and G2) such as in the case of strains isolated from soil sample of Haripure region and from grain sample of

8436

Afr. J. Biotechnol.

Figure 3. A. flavus infection of maize kernels (%) samples belonging to three different ecological zones of Khyber Pakhtunkhwa. The bars represent the standard errors of means.

Figure 4. A. flavus infection of sterilized maize kernels (%) belonging to three different ecological zones of Khyber Pakhtunkhwa. The bars represent the standard errors of means.

Palosi Peshawar regions. In soils samples (Figure 6), maximum quantities of aflatoxin B1 and B2 (1323 and 828 µg g-1) were produced by strain isolated from the soil of Haripure region of Hazara zone, followed by 668 and 416 µg g-1 of Banu region of Peshawar zone. In Swat zone, maximum production was observed for strain obtained from Qumber region, which was B1 215µg g-1 -1 and B2 13 µg g . On the other hand, in grain samples (Figure 7), the highest amounts of B1 (504.17 and 451.87 µg g-1) and B2 (478.09 and 76.03 µg g-1) were produced by sample from Palosi and Takkar regions of Peshawar

zone, followed by Jalala and Manyar regions of Swat -1 which produced 335.77 and 319.09 µg g of B1 and -1 29.39 and 22.81 µg g of B2, respectively. Of the Hazara regions, no appreciable amount of aflatoxin was produced by the isolated strains. In sterilized maize grain samples, maximum amounts of B1 and B2 (78.11 and 36.09 µg g-1) were produced by strain isolated from Jalala region of Swat Zone, whereas minimum levels (26.11 and -1 18.66 µg g , respectively) were found in samples from Dodial of Hazara region. Figure 8 shows the comparative production rate of

Ullah et al.

8437

Figure 5. Aflatoxin production (Âľg g-1) of A. flavus strains isolated from soil samples belonging to three different ecological zones of Khyber Pakhtunkhwa. The bars represent the standard errors of means.

Figure 6. Aflatoxin production (Âľg g-1) of A. flavus strains isolated from maize kernels belonging to three different ecological zones of Khyber Pakhtunkhwa.

aflatoxin by various isolated strains. Although almost all the species were able to produce both B1 and B2, however, the amount was quite different for soil stains versus maize kernels strains isolated from the same regions. DISCUSSION A. flavus produces aflatoxin when it attacks crops,

especially in the final agricultural products. In this context, maize is the most susceptible crop for this fungus as historical out-breaks are connected to the consumption of the moldy corn. This fungus is present in the soil and might infect the crops when cultivated, and if this assumption is true, then it will be a great risk to cultivate crops in infected soils or where there is a prevalence of A. flavus. From various research studies, it is evaluated that the A. flavus from soil may be the possible cause of

8438

Afr. J. Biotechnol.

Figure 7. Aflatoxin production (Âľg g-1) of A. flavus strains isolated from sterilized maize kernels belonging to three different ecological zones of Khyber Pakhtunkhwa. The bars represent the standard errors of means.

Figure 8. Comparative aflatoxin production (Âľg g-1) of A. flavus strains isolated form soil and maize kernels belonging to three different ecological regions. The bars represent the standard error of means. G, Grain; S, soil samples.

infection of standing maize crops or the field laying crop immediately after harvest (Abbas et al., 2008; Miguel et al., 2007). This view could also be clarified by the work of Nesci and Etcheverry (2002) who pointed out that maize crop could possibly be contaminated by the A. flavus in

the rhizosphere. Lillehoj et al. (1980), Angle et al. (1982) and Horn et al. (1994) also suggested the soil as the main source of inoculation of maize and peanut crops, especially when drought conditions prevail. For this purpose, A. flavus from the soil and from the standing

Ullah et al.

maize crops of the same field was isolated and checked for their aflatoxin production. The similarity in aflatoxin quantity could possibly be an indication that the rhizospheric A. flavus contaminate the standing or the field laying crops In the present study, the data obtained shows that 17 samples of soil, 16 samples of maize grains and four samples of sterilized maize grains were found infected with A. flavus strains. This constituted 64% infection of maize samples from Swat region, 55% of Peshawar and 33% of Hazara region. The soil samples infection was 100% from Peshawar zone, 66% from Hazara zone and 28% of Swat zone. The data also indicates that A. flavus is prevalent in the study area both in the soil and maize grains samples. This means that the grain infection may be from the A. flavus present in the soil of the same field. However, aflatoxins B1 and B2 produced by the A. flavus stains isolated from soil and maize grains samples of the same fields were different, indicating that strains present on grains might not come from the same soil because the variation in aflatoxin is related to difference in the strains. This could be explained by the work of Miguel et al. (2007), Leema et al. (2010) and Niles et al. (1985), Faraj et al., (1991), Miguel et al., (2007), Giorni et al., (2009), Leema et al., (2010), and who reported that A. flavus strains were different in their aflatoxin production due to their genetic variation. The difference in the infected A. flavus strains found in the present study could possibly illustrate that the A. flavus may not come from the soil of the same field because the spores of the A. flavus from old crops debris in the soil blow in the air and this could contaminate crops anywhere in the nearby area, and so crops standing in one field might get contaminated with spores from the other field. This view is supported by Abbas et al. (2004), who reported that difference in strains might be due to the difference in sources. Conclusions and recommendation The present study confirmed the prevalence of A. flavus in the three ecological regions of Swat, Hazara and Peshawar. Majority of the strains were found to be toxigenic in nature. However, the soil and grain samples collected from same fields showed that the A. flavus present in the same field was not the absolute contaminant of the standing crop. The crop might get contaminant from any other source, which might be from the airborne spore. It was also concluded that the aflatoxin production rate were strain-related and they produced unequal amount of aflatoxin. In the light of above study, we therefore recommended that fields must be cleared from any contaminant present in the form of fungus or any other dangerous microorganisms. However care should be taken to control airborne spores’ contamination, which might cause greater damage as compared to the microbes present in

8439

the same field of crops. ACKNOWLEDGEMENTS We sincerely thank the Higher Education Commission, Islamabad Pakistan for financial support and the Laboratory of Applied Mycology Group, Cranfield Health, Cranfield University, Bedford, UK, for providing necessary space and facilities for some analytical work. REFERENCES Abbas HK, Zablotowicz RM, Locke MA (2004). Spatial variability of Aspergillus flavus soil populations under different crops and corn grain colonization and aflatoxins. Can. J. Bot. 82: 1768-1775. Abbas HK, Zablotowicz RM, Bruns HA, Abel CA (2008). Development of non-toxigenic strains of aspergillus flavus for control of aflatoxin in corn. J. Food Addit. Contamin. 7:181-192. Adhikari A, Sen MM, Gupta-Bhattacharya S, Chanda S (2004). Airborne viable, non-viable, and allergenic fungi in a rural agricultural area of India: a 2-year study at five outdoor sampling stations. Sci. Total Environ. 326: 123-141. Alam S, Shah HU, Magan N (2009). Water availability affects extracellular hydrolytic production by Aspergillus flavus and Aspergillus parasiticus. World Mycotoxin J. 2: 313-322. Ali E, Saleem U, Anjum F, Barkat AK, Zubair A (2009). Aflatoxin contamination and mineral profile of almond seeds. Mycopath. 7(1): 39-44. Angle JS, Dunn KA, Wagner GH (1982). Effect of cultural practices on the soil population of Aspergillus flavus and Aspergillus parasiticus. Soil Sci. Soc. Am. J. 46: 301-304. AOAC (2000). Association of Official Analytical Chemist, Official methods of analysis. Natural toxins, 17th Edn., Chapter 49, Washington, D.C. Cardwell KF, Cotty PJ (2002). Distribution of Aspergillus section Flavi among field soils from the four agro-ecological zones of the Republic of Bénin, West Africa. Plant Dis. 86: 434-439. Dyer SK, McCammon S (1994). Detection of aflatoxigenic isolates of Aspergillus flavus and related species on coconut cream agar. J. Appl. Bacteriol. 76: 75-78. Faraj MK, Smith JE, Harran G (1991). Interaction of water activity and temperature on aflatoxin production by Aspergillus flavus and A. parasiticus in irradiated maize seeds. Food Addit. Contam. 8: 731-6. Farid W, Reddy SV, Lava-Kumar P (2009). Review of immunological methods for the quantification of aflatoxins in peanut and other foods . Peanut Sci. 36: 54-59. Gibson AM, Baranyi J, Pitt MJ, Eyles MJ, Roberts TA (1994). Predicting fungal growth: the effect of water activity on Aspergillus flavus and related species. Int. J. Food Microbiol. 23: 419-431. Giorni P, Pietri A, Magan N, Battilani P (2009). Control of the development of Aspergillus flavus in maize during post-harvest. Tecnica Molitoria, 60: 261-267. Gupta SK, Pereira BM, Singh AB (1993). Survey of airborne culturalable and non-culturable fungi at different sites in Delhi metropolis. Asian Pac. J. Allergy Immunol. 11: 19-28. Hell K, Cardwell KF, Sétamou M, Poehling HM (2000). Maize storage practices and their influence on aflatoxin contamination in stored grains in four agroecological zones in Bénin, West-Africa, J. Stored Prod. Res. 36: 365-382. Horn BW, Dorner JW, Greene RL, Blankenship PD, Cole RJ (1994). Effect of Aspergillus parasiticus soil inoculum on invasion of peanut seeds. Mycopathology, 125: 179-191. Jeffrey D, Palumbo, Teresa L, O'Keeffe, Ali K, Hamed KA, Bobbie JJ (2010). Inhibition of Aspergillus flavus in Soil by Antagonistic Pseudomonas Strains Reduces the Potential for Airborne Spore Dispersal. Phytophath. 100: 532-538.

8440

Afr. J. Biotechnol.

Lillehoj EB, McMillian WW, Guthrie WD, Barry D (1980). Aflatoxinproducing fungi in preharvest corn: inoculum source in insects and soils. J. Environ. Qual. 9: 691-694. Leema G, Jayaraman K, Pitchairaj G, Philip AT (2010). Keratitis due to Aspergillus flavus: Clinical profile, molecular identification of fungal strains and detection of aflatoxin production. Mol. Vis. 16: 843-854. Magan N, Sanchis V, and Aldred D (2004). Fungal biotechnology in agricultural, food and environmental applications. Role of spoilage fungi agricultural, food and environmental applications. Role of spoilage fungi in seeds deterioration. New York: New York: Marcel Dekker Inc. Chapter 28, p. 311â&#x20AC;&#x201C;323. Marin S, Magan N, Ramos AJ, Sanchis V (2004). Fumonisin producing strains of Fusarium: a review of their ecophysiol. J. Food Prot. 61: 1792-1805. Miguel A. Moreno R, Guillermo SF (1007). Aflatoxin-producing potential of Aspergillus flavus strains isolated from Spanish poult. feeds. Mycopathology, 95: 129-132. Nesci A, Etcheverry M (2002). Aspergillus section Flavi populations from field maize in Argentina. Let. Appl. Microbiol. 34: 343-348. Niles EV, Joanna NA, Pimbley D (1985). Growth and aflatoxin production of Aspergillus flavus in wheat and barley. Trans. Br. Mycol. Soc. 84: 259-266. Pitt JI, Hocking AD (2009). Fungi and Food Spoilage (3rd ed), Spinger Verlag, Germany, p. 540. Scheidegger KA, Payne GA (2003). Unlocking the secrets behind secondary metabolism: a review of Aspergillus flavus from pathogenicity to functional genomics. J. Toxicol. 22: 423-459. Shah, HU, Simpson TJ, Alam S, Khattak KF, Perveen S (2010). Mould incidence and mycotoxin contamination in maize kernels from Swat Valley, North West Frontier Province of Pakistan. Food Chem. Toxicol. 48: 1111-1116. Sharma, K (2010). Isolation of soil Mycoflora of Katao near Gangtok, India. J. Phytol. 2(5): 30-32.

Silva CF, Schwan RF, Dias ES, Wheals AE (2000). Microbial diversity during maturation and natural processing of coffee cherries of Coffea arabica in Brazil. Int. J. Food Microbiol. 60, 251-260. Sutton DA, Fothergill AW, Rinaldi MG (1998). Guide to Clinically Significant Fungi. 1st edn. Baltimore, M.D., Williams & Wilkins. Waliyar F, Reddy SV, Lava-Kumar P (2009). Review of Immunological Methods for the Quantification of Aflatoxins in Peanut and Other Foods. Peanut Sci. 36: 54-59.

Full Length Research Paper

Calcium enhances cadmium tolerance and decreases cadmium accumulation in lettuce (Lactuca sativa) Walid Zorrig1,2*, Zaigham Shahzad1,3, Chedly Abdelly2 and Pierre Berthomieu1 1

Biochimie and Physiologie Moléculaire des Plantes, Unité Mixte de Recherche CNRS-INRA-Université Montpellier IIMontpellier supagro, Place Viala, 34060 Montpellier Cédex 2, France. 2 Laboratoire des Plantes Extrêmophiles, Centre de Biotechnologie, BP 901, Hammam-Lif 2050, Tunisie. 3 Department of Plant Breeding and Genetics, University of Agriculture, Faisalabad, Pakistan. Accepted 4 November, 2011

We aimed at characterizing mechanisms controlling cadmium accumulation in lettuce, which is a food crop showing one of the highest capacities to accumulate this toxic compound. In this study, plants from three lettuce varieties were grown for eight days on media supplemented or not with cadmium (15 µM CdCl2) and containing different concentrations of calcium (0.5, 1, 2.5, 5 and 10 mM Ca(NO3)2). Our results show that exposure to cadmium resulted in biomass reduction. The biomass reduction was particularly high at 0.5 mM calcium but supplementation of the medium with increasing calcium concentrations alleviated the toxic effect of cadmium on the growth and water status of lettuce plants. The three lettuce varieties displayed different abilities to accumulate cadmium. Interestingly, increasing the calcium concentration in the medium resulted in a strong decrease in cadmium contents. These results suggest that cadmium uptake in lettuce plants is negatively associated with the presence of calcium in the culture medium, maybe due to a competition between these two cations for binding and absorption sites in roots. In conclusion, the results suggest that fertilization with Ca2+ appears to be a promising strategy for decreasing risk associated with ingesting food crops grown on cadmium polluted soils. Key words: Lettuce, food security, growth, cadmium accumulation, cadmium translocation, calcium. INTRODUCTION Since the industrial revolution, impact of industrial and agricultural activities on the environment has not stopped growing. While many organic molecules can be degraded, heavy metals remain in the environment, thus their concentrations are continuously increasing, particularly in upper horizons of the soils and in water resources. Cadmium (Cd) is an extremely toxic heavy metal that is often referred as the metal of the 20th Century. It is widely used in industry, principally in galvanizing and electroplating, in batteries, in electrical conductors, in the manufacture of alloys, pigments, plastics, and in the stabilization of phosphate fertilizers (Byrne et al., 2009). Cadmium is listed by the US Environmental Protection Agency as one of the 126 priority contaminants and as a

*Corresponding author. E-mail: zorrigwalid@yahoo.fr. Tel : 00216 22 177 081. Fax: 00216 79 412 948.

human carcinogen by the International Agency for Research on Cancer (IARC, 1993). Cadmium has wellestablished renal, bone, and pulmonary effects, with less conclusive evidence for neurotoxic, teratogenic, and endocrine-disrupting effects (Godt et al., 2006; Nordberg et al., 2007). Plants growing in contaminated soils can absorb and accumulate cadmium in edible tissues, thereby introducing the metal into the food chain by trophic transfer, including the human diet. As a non-essential element for plants, cadmium has been assumed to be taken up by plants thanks to the lack of ion specificity of transporters involved in the uptake of essential elements (Clemens, 2006). For instance, cadmium, which is an analogue of calcium (Jacobson and Turner, 1980), was shown to be transported into or between plant cells through calcium transport systems (Hirschi et al., 1996; Perfus-Barbeoch et al., 2002; Antosiewicz and Hennig, 2004). Thus, it has been demonstrated that putative

8442

Afr. J. Biotechnol.

tonoplast Ca /H antiporters encoded by calcium exchanger 1 (CAX1) and calcium exchanger 2 (CAX2) from Arabidopsis are involved in the transport of cadmium from the cytoplasm to the vacuole (Pittman et al., 2004; Pittman et al., 2005; Manohar et al., 2011). Another non-selective trans-membrane transporter of Ca2+, the low affinity cation transporter (LCT1) expressed 2+ in wheat, also appears to mediate Cd transport into the cell (Clemens et al., 1998). Antosiewicz and Hennig (2004) showed that overexpression of LCT1 in tobacco enhances the protective action of calcium against cadmium toxicity and decreases cadmium accumulation in roots. Indeed, these results are the first to demonstrate the involvement of LCT1 in calcium acquisition and in diminishing Cd-toxicity by calcium. Exposure of mankind to cadmium mainly results from eating cadmiumcontaminated food. Indeed, over 80% of the dietary cadmium intake has been estimated to come from cereals (especially rice and wheat), vegetables (especially leafy greens), and root vegetables (especially potatoes and carrots) (Järup and Åkesson, 2009). Among cultivated plant species, lettuce (Lactuca sativa) is known for displaying comparatively high cadmium contents in leaves (Mensch and Baize, 2004; Kim et al., 1988). Hence, it has been proposed as an indicator crop for testing the potential human dietary risk associated with ingesting food crop grown on cadmium polluted soils (Brown et al., 1996). In this context, lettuce is a good model both to study the mechanisms responsible for cadmium accumulation in tissues and to develop breeding strategies aiming at decreasing cadmium accumulation in crop plants. Up to now, researches are mainly focused on the effects of cadmium on growth of lettuce plants, as well as on the mechanisms of cadmium absorption by roots and cadmium distribution within different organs (Thys et al., 1991; Costa and Morel, 1994; Ramos et al., 2002). Moreover, interactions between cadmium and other elements such as manganese, calcium, zinc and iron, have been reported in lettuce (Ramos et al., 2002; Monteiro et al., 2009; Zorrig et al., 2010). This study aimed at analysing the impact of calcium on the accumulation of cadmium in three lettuce varieties exhibiting contrasting features for the characters of cadmium accumulation and cadmium translocation from roots to shoots. MATERIALS AND METHODS Plant material and growth conditions Seeds of three lettuce varieties analysed in this study (Paris Island Cos, Fenja and Red Salad Bowl) were kindly provided by Dr. B. Maisonneuve (INRA Avignon, France). All accessions were pure lines. Seeds were germinated on sterile Whatmann paper humidified first with distilled water for five days and then with a nutrient solution for five additional days. The nutrient solution contained 2.5 mM KNO3, 0.5 mM NaH2PO4, 0.5 mM MgSO4, 0.1 FeIIINaEDTA, 0.05 mM H3 BO3, 0.05 mM MnSO4, 15 µM ZnSO4, 3 µM Na2MoO4, 2.5 µM KI, 0.05 µM CuSO4 and 0.044 µM CoCl2.

Different calcium treatments were applied (0.5, 1, 2.5, 5 and 10 mM Ca (NO3)2). Ten-day-old plantlets were transferred onto a floating support and grown in hydroponic condition. For every set of 24 plantlets, 8 L of aerated nutrient solution was used. Four days later, CdCl2 was added to the culture medium at the final concentration of 15 µM and maintained for eight additional days. A control assay without cadmium addition was in parallel but only for the 0.5, 2.5, and 10 mM Ca (NO3)2 treatments. Nutrient solution was changed every four days over the course of the entire experiment. Growth conditions were adjusted to 20°C, 70% relative humidity and 16:8 h light-dark cycle with light intensity being 150 µmol.m-2.s-1. For each calciumXcadmiumXvariety condition, seven plants were considered and distributed following a randomized complete block design. At the end of the experiment, roots were dipped for a dozen of seconds in three separate ice-cold 0.5 mM CaCl2 solutions to remove the cadmium adsorbed on the root surface. Then roots were gently dried between two layers of filter paper. Analyses were performed on individual plants, roots and shoots being analysed separately. There were thus seven repeats for each calcium x cadmium x variety condition. Cadmium assays After the fresh weight measurements, plant samples were dried at 80°C for 48 h. Samples were incubated in 1 N H2SO4 at 80°C for 30 min to extract cadmium (Zorrig et al., 2010). Concentration of cadmium in the extracts was determined by atomic absorption spectrophotometry (SpectrAA 220, Varian and Australia) using the deuterium background correction. Following preliminary assays, extracting cadmium from lettuce tissues using this procedure was proven to be as efficient as recovering cadmium following a complete acidic digestion (data not shown). A series of standard solutions was prepared (0, 0.3, 0.5, 0.7, 1, 2, 3, 4; and 5 mg/l of Cd2+). The absorbances of the standard solutions were measured (228.8 nm) and used to prepare a calibration curve, which is a graph showing how the experimental observable (the absorbance in this case) varies with the cadmium concentration. The points on the calibration curve should yield a straight line (Beer's Law). The slope and intercept of that line provide a relationship between absorbance and cadmium concentration. The data obtained with the Varian SpectrAA 220 was manipulated by the SpectrAA software. The precision of the value of the cadmium concentration is given by the SpectrAA software. The “bad” samples were passed after the adaptation of dilution. Cadmium concentration (expressed in µg/g of dry weight) was calculated on entering the parameters; final volume after dilution, dilution factor and mass of the digested sample. Statistical analyses One-way ANOVA was used for parametric or nonparametric comparison of means. Significant differences were further analysed using Turkey’s parametric or nonparametric tests to identify differences between accessions. All these tests used an alpha of 0.05 and were done with XLSTAT software v. 2011 (www.xlstat.com). A principal component analysis (PCA) was done using XLSTAT, considering variables centred on their means and normalized with a standard deviation of 1.

RESULTS Effect of cadmium on lettuce growth according to calcium concentration in the medium In order to analyse the effects of cadmium on lettuce growth according to calcium concentration in the medium,

Zorrig et al.

plants from the Paris island Cos, Fenja and Red Salad Bowl varieties were exposed to different calcium treatments (0.5, 1, 2.5, 5 and 10 mM Ca (NO3)2) with or without cadmium at the final concentration of 15 µM. Exposure to increasing calcium concentrations resulted in both shoot and root biomass stimulation, especially for the Paris Island Cos variety (Figure 1). This stimulation was observed in whatever cadmium in the culture medium. The three varieties displayed similar overall responses regarding cadmium toxicity symptoms. Indeed, exposure to cadmium resulted in both shoot and root biomass reduction. However, the cadmium-induced biomass reduction was particularly high at 0.5 mM calcium (Figure 1); the cadmium-treated plants exhibiting exceptionally severe symptoms of dehydration, chlorosis and necrosis (data not shown). Our results clearly show that lettuce plants are more challenged by cadmium at low calcium concentrations in the culture medium than at higher ones: increasing calcium concentration in the medium protected plants against cadmium toxicity (Figure 1).

8443

the cadmium treatment: water and cadmium contents, cadmium translocation from the roots to the shoot, as well as of calcium concentration in the medium. These analyses confirmed the previously observed negative correlation linking calcium concentration in the culture medium and root and shoot cadmium contents, which were themselves highly correlated to each other (Figure 3 and Table 1). These analyses also confirmed the lack of effect of the calcium concentration in the culture medium on the translocation of cadmium from the roots to the shoot. The new information is the positive correlation linking calcium concentration in the medium and the shoot water content. Differences between the three lettuce varieties clearly appeared. Paris Island Cos displayed rather average performances even if it was characterised by an ability to limit cadmium accumulation in roots. In contrast, Red Salad Bowl and Fenja displayed more contrasted phenotypes. Red Salad Bowl was for instance characterized by a high translocation of cadmium from roots to shoot, in contrast to Fenja. DISCUSSION

Cadmium accumulation and translocation Cadmium contents were measured in roots and shoots for the three lettuce varieties. Root and shoot cadmium contents decreased in response to increasing concentrations of calcium in the growth medium (Figure 2A, B). However, the three varieties displayed a differential ability to accumulate cadmium in their roots as well as in their shoots: Paris Island Cos displayed the lowest cadmium contents in roots and shoots in nearly all conditions while Fenja displayed the highest ones. The greatest betweenvariety differences were observed for plants grown in the presence of 0.5 mM calcium. We then checked whether the inter-varietal differences in root and shoot cadmium contents could be related to different strategies with respect to cadmium translocation from roots to shoot. Cadmium translocation from roots to shoots was very stable in Fenja and Red Salad Bowl across all calcium treatments: ~ 57% of the cadmium present in Fenja plants was in the shoot, while this proportion was ~ 72% for Red Salad Bowl plants. In contrast, Paris Island Cos plants show cadmium translocation from roots to shoots slightly decreased from 70 to 62% in response to increases in external calcium concentration (Figure 2C). This might reveal different strategies developed by the three lettuce varieties to cope with cadmium. Combined analyses of the different cadmium-related traits The trait by trait analyses were completed by a (PCA) as well as by a correlation analysis, which took into account all the analysed traits characterising plants submitted to

This study aimed at characterising the impact of the calcium concentration of the culture medium on the cadmium response of lettuce plants. Three varieties were comparatively analysed; Paris Island Cos, Red Salad Bowl and Fenja. The three varieties displayed similar overall responses to cadmium that is shoot and root biomass reduction, chlorosis, necrosis and decreases in relative water content. This was in agreement with previous reports showing that cadmium displays a large panel of toxic effects: restriction of photosynthesis, decrease in chlorophyll contents, induction of oxidative stress, or alteration of plant water status (Mobin and Khan, 2007; López-Millán et al., 2009; Razinger et al., 2008; Szőllősi et al., 2009; Perfus-Barbeoch et al., 2002; Zorrig et al., 2010). Our results reveal that calcium counteracted the toxic effect of cadmium on growth as well as on the water status in lettuce. A similar result had already been obtained in beet or in Trifolium repens (Greger and Bertell, 1992; Wang and Song, 2009). Given the known broad spectrum of calcium contribution to the regulation of metabolic processes (Bush, 1995), it is not known whether the observed calcium-induced reduced cadmium toxicity might result from less cadmium uptake or from more efficient detoxification. In our study, the presence of calcium in the culture medium leads to a decrease in the cadmium content in tissues. Numerous authors have described that calcium may decrease the uptake, translocation and accumulation of cadmium in plants (Jarvis et al., 1976; Kawasaki and Moritsugu, 1987; Wallace et al., 1980; Tyler and McBride, 1982; Österås and Greger 2003; Österås and Greger, 2006). Some of these results were shown on soil (Österås and Greger, 2003; Österås and Greger, 2006).

8444

Afr. J. Biotechnol.

Calcium concentration in hydroponic solution (mM)

Figure 1. calciumium protection of growth of lettuce plants from cadmium. Absolute root and shoot dry weight (A-F) and relative root and shoot dry weight (G,H) were measured in Fenja (A,B,G,H), Paris Island Cos (C,D,G,H) and Red Salad Bowl (E-H) lettuce plants grown in media supplemented or not with CdCl2 at the final concentration of 15 ÂľM and harbouring increasing calcium concentrations. In G and H, relative dry weights correspond to the ratio between dry weight of plants grown in the presence of cadmium and dry weight of control plants. Measurements were performed on individual plants (Mean Âą S.E) n=7. Bars marked with same letter are not significantly different at p = 0.05.

Zorrig et al.

8445

-1

to shoots (g.g %)

Cadmium translocation from roots

Calcium concentration hydroponicsolution solution (mM) Cadmium concentration inin hydroponic solution (mM) Calcium concentration in hydroponic (mM)

Calciumconcentration concentration inin hydroponic solution (mM) Cadmium concentration hydroponicsolution solution(mM) (mM) Calcium in hydroponic Figure 2. calcium prevention of cadmium accumulation in lettuce plants. The effect of increasing the calcium concentration in the culture medium on the cadmium content of roots (A) and shoots (B) as well as on the cadmium translocation from roots to shoots (C) is reported for Fenja, Paris Island Cos and Red Salad Bowl lettuce plants. Cadmium translocation from roots to shoots is expressed as the amount of cadmium in the shoot relative to the total amount of cadmium accumulated in the plant; it is expressed in percentage. Measurements were performed on individual plants (meanÂą S.E.; n=7). Bars marked with same letter are not significantly different at p = 0.05.

In fact, because Ca2+ and Cd2+ ions compete for binding sites, their concentration in the uptake solution are decisive for the resulting transport across a membrane (Kim et al., 2002; Lu et al., 2008; Lu et al., 2010). Cd2+ (and other non-essential metal ions) is supposed to enter into plant cells through systems devoted to the uptake of essential cations. Cadmium and calcium are chemically very similar (Jacobson and Turner, 1980). Raising the Ca2+ concentration was shown to block both Cd2+ transport into rice roots as a result of the competition of Cd2+ with Ca2+ for calcium transporters (Clemens et al., 1998; Clemens, 2006). Ca2+ channels have for long been shown to be involved in Cd2+ uptake into mammalian cells (Hinkle et al., 1992). Furthermore, Perfus-Barbeoch 2+ et al. (2002) showed that guard cell Ca channels are

permeable to Cd2+. More recently, it has been demonstrated that putative tonoplast Ca2+/H+ antiporters encoded by calcium exchanger 1 (CAX1) and calcium exchanger 2 (CAX2) from Arabidopsis are involved in the transport of cadmium from the cytoplasm to the vacuole (Pittman et al., 2004; Pittman et al., 2005; Manohar et al., 2011). Alternatively, calcium may protect cells against cadmium through other mechanisms. Choi et al. (2001) described the contribution of calcium in immobilizing cadmium as co-precipitates with calcium and phosphorous. Recently, Tian et al. (2011) demonstrated that calcium protects Sedum alfredii plants against cadmium-induced oxidative stress. Paris Island Cos and Fenja plants exhibited a significant difference with respect to cadmium

Afr. J. Biotechnol.

F2 (20.91%)

8446

F1 (52.15%) Figure 3. Principal component analysis of water content, cadmium content and cadmium translocation from the roots to the shoot for the three L. sativa varieties as well as of calcium concentration in the medium. The six variables (arrows) as well as the three different varieties are projected onto the F1-F2 principal factorial plane that explains 73% of the variation.

accumulation as well as to tolerance to cadmium. This variability might be explained by different abilities to limit cadmium net uptake at the root level, as already suggested in lettuce (Zorrig et al., 2010). However, since increasing the calcium concentration in the culture medium resulted in a similar effect on the cadmium content in the tissues for the two varieties, it seems that these varieties do not differ with respect to the mechanism by which calcium interacts with cadmium. The lettuce varieties also differed in their translocation of cadmium from the roots to the shoot. Changing the calcium concentration in the culture medium had however almost no impact on this trait. In Arabidopsis, cadmium tran-slocation from roots to shoots is known to depend mainly on the activity of the HMA2 and HMA4 heavy metal P1B-type ATPase, which control cadmium loading into, and unloading from the xylem sap (Verret et al., 2004; Wong et al., 2009). No report describes any role of calcium in influencing the transport properties of these ATPases. If the lettuce

orthologues of AtHMA2 and AtHMA4 also play a critical role in the root to shoot transport of cadmium and display the same characteristics as AtHMA2 and AtHMA4, it is probably not surprising that calcium had no impact on the translocation of cadmium from the roots to the shoot. Conclusion The results show that calcium enhances cadmium tolerance and decreases cadmium accumulation in lettuce. Fertilization with Ca2+ could thus be a promising strategy for decreasing risk associated with ingesting food crops grown on cadmium polluted soils. ACKNOWLEDGEMENTS W. Zorrig was supported by a scholarship from the Tunisian Ministry of Higher Education, Scientific

Zorrig et al.

8447

Table 1. Pearson’s correlation matrix analysing the water content, the cadmium content, and the cadmium translocation from the roots to shoot in three L. sativa varieties and the calcium concentration in the medium. a

Variable

Shoot water content Root water content Shoot cd content Root Cd content Cd translocation Calcium concentration a

Water content Shoot Root 1b 0.228 b 1

Cadmium content Shoot Root -0.663b -0.682b -0.164 -0.125 0.896b 1b

Cd translocation

Calcium concentration

-0.306b 0.026 0.212 0.009 b 1

0.461b 0.261 -0.702b -0.652b -0.230 b 1

Fenja 0,171 -0.027 0.036 0.255 b -0.769 0.005

Lettuce variety Paris Island Cos Red Salad Bowl -0.061 -0.107 b b -0.348 0.362 -0.241 0.198 b -0.276 0.020 b 0.098 0.646 0.072 -0.074

Variables were centred around their means and normalized with a standard deviation of 1; Figures in bold represent significant correlations at 0.05 level.

Research and Technology (LR10CBBC02), and then by a scholarship from the “Agence Universitaire de la Francophonie” (AUF). Z. Shahzad was supported by a scholar-ship from the Higher Education Commission, Pakistan. We thank T. Ghnaya, A. Adiveze, H. Afonso, C. Baracco, H. Baudot, F. Bourgeois, C.Dasen, X. Dumont, C. Fizames, J. Garcia, S. Gélin, F. Lecocq, V. Papy, V. Rafin, G. Ruiz and C. Zicler, for the scientific, technical and administrative supports. REFERENCES Antosiewicz DM, Hennig J (2004). Overexpression of LCT1 in tobacco enhances the protective action of calcium against cadmium toxicity. Environ. Pollut. 129: 237-245. Brown SL, Chaney RL, Lloyd CA, Angle JS, Ryan JA (1996). Relative uptake of cadmium by garden vegetables and fruits grown on long-term biosolid-amended soils. Environ. Sci. Technol. 30: 3508-3511. Bush DS (1995). Calcium regulation in plant cells and its role in signalling. Annu. Rev. Plant. Physiol. Plant. Mol. Biol. 46: 95-122. Byrne C, Divekar SD, Storchan GB, Parodi DA, Martin MB (2009). Cadmium - a metallohormone - ?. Toxicol. Appl. Pharmacol. 238: 266-271. Choi YE, Harada E, Wada M, Tsuboi H, Morite Y, Kusano T, Sano H (2001). Detoxification of cadmium in tobacco plants: formation and active excretion of crystals containing

cadmium and calcium through trichomes. Plant, 213: 45-50. Clemens S (2006). Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants. Biochimie, 88: 1707-1719. Clemens S, Antosiewicz DM, Ward JM, Schachtman DP, Schroeder JI (1998). The plant cDNA LCT1 mediates the uptake of calcium and cadmium in yeast. Proc. Natl. Acad. Sci. USA. 95: 12043-12048. + Costa G, Morel JL (1994). Efficiency of H -ATPase activity on cadmium uptake by four cultivars of lettuce. J. Plant Nutr. 17: 627-637. Godt J, Scheidig F, Grosse-Siestrup C, Esche V, Brandenburg P, Reich A, Groneberg D (2006). The toxicity of cadmium and resulting hazards for human health. J. Occup. Med. Toxicol. 1: 22-27. 2+ 2+ Greger M, Bertell G (1992). Effects of Ca and Cd on the carbohydrate metabolism in sugar beet (Beta vulgaris). J. Exp. Bot. 43: 167-173. Hinkle PM, Shanshala ED, 2nd, Nelson EJ (1992). Measurement of intracellular cadmium with fluorescent dyes. Further evidence for the role of calcium channels in cadmium uptake. J. Biol. Chem. 267: 25553-25559. Hirschi KD, Zhen RG, Cunningham KW, Rea PA, Fink GR + 2+ (1996). CAX1, an H /Ca antiporter from Arabidopsis. Proc. Natl. Acad. Sci. USA. 93: 8782-8786. IARC (1993). IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, Vol. 58, Beryllium, Cadmium, Mercury, and Exposures in the Glass Manufacturing Industry, Lyon, 58: 239-345. Jacobson KB, Turner JE (1980). The interaction of cadmium and certain other metal ions with proteins and nucleic acids. Toxicology, 16: 1-37. Järup L, Åkesson A (2009). Current status of cadmium as an environmental health problem. Toxicol. Appl. Pharmacol.

238: 201-208. Jarvis SC, Jones LHP, Hopper MJ (1976). Cadmium uptake from solution by plants and its transport from roots to shoots. Plant Soil, 44: 179-191. Kawasaki T, Moritsugu M (1987). Effects of calcium on the absorption and translocation of heavy metals in excised barley roots: Multi-compartment transport box experiment. Plant Soil, 100: 21-34. Kim SJ, Chang AC, Page AL, Warneke JE (1988). Relative concentrations of cadmium and zinc in tissue of selected food plants grown on sludge-treated soils. J. Environ. Qual. 17: 568-753. Kim YY, Yang YY, Lee Y (2002). Pb and Cd uptake in rice roots. Physiol. Plant. 116: 368-372. López-Millán AF, Sagardoy R, Solanas M, Abadia A, Abadia J (2009). Cadmium toxicity in tomato (Lycopersicon esculentum) plants grown in hydroponics. Environ. Exp. Bot. 65: 376-385. Lu LL, Tian SK, Yang XE, Wang XC, Brown P, Li TQ, He ZL (2008). Enhanced root-to-shoot translocation of cadmium in the hyperaccumulating ecotype of Sedum alfredii. J. Exp. Bot. 59: 3203-3213. Lu LL, Tian SK, Zhang M, Zhang J, Yang XE, Jiang H (2010). The role of Ca pathway in Cd uptake and translocation by the hyperaccumulator Sedum alfredii. J. Hazard. Mater. 183: 22-28. + Manohar M, Shigaki T, Hirschi KD (2011). Plant cation/H exchangers (CAXs): Biological functions and genetic manipulations. Plant. Biol. 13: 561-569. Mensch M, Baize D (2004). Contamination des sols et de nos aliments d'origine végétale par les éléments en trace, mesures pour réduire l'exposition. Courrier de l’Environnement de l’INRA, 52: 31-54. Mobin M, Khan NA (2007). Photosynthetic activity, pigment

8448

Afr. J. Biotechnol.

composition and antioxidative response of two mustard (Brassica juncea) cultivars differing in photosynthetic capacity subjected to cadmium stress. J. Plant. Physiol. 164: 601-610. Monteiro MS, Santos C, Soares AM, Mann RM (2009). Assessment of biomarkers of cadmium stress in lettuce. Ecotoxicol. Environ. Saf. 72: 811-818. Nordberg GF, Fowler BA, Nordberg M, Friberg L (2007). Handbook on the Toxicology of Metals, Third edition, Salt Lake City, UT: Acad. Press. Österås AH, Greger M (2003). Accumulation of, and interactions between, calcium and heavy metals in wood and bark of Picea abies. J. Plant Nutr. Soil Sci. 166: 246-253. Österås AH, Greger M (2006). Interactions between calcium and copper or cadmium in Norway spruce. Biol. Planta, 50: 647-652. Perfus-Barbeoch L, Leonhardt N, Vavasseur A, Forestier C (2002). Heavy metal toxicity: cadmium permeates through calcium channels and disturbs the plant water status. Plant. J. 32: 539-548. Pittman JK, Shigaki T, Marshall JL, Morris JL, Cheng NH, Hirschi KD (2004). Functional and regulatory analysis of the A. thaliana CAX2 cation transporter. Plant Mol. Biol. 56: 959-971. Pittman JK, Shigaki T, Hirschi KD (2005). Evidence of differential pH 2+ + regulation of the Arabidopsis vacuolar Ca /H antiporters CAX1 and CAX2. FEBS Lett. 579: 2648-2656. Ramos I, Esteban E, Lucena JJ, Garate A (2002). Cadmium uptake and subcellular distribution in plants of Lactuca sp Cd-Mn interaction. Plant. Sci. 162: 761-767. Razinger J, Dermastia M, Koce JD, Zrimec A (2008). Oxidative stress in duckweed (Lemna minor L.) caused by short-term cadmium exposure. Environ. Pollut. 153: 687-694. Szőllősi R, Varga IS, Erdei L, Mihalik E (2009). Cadmium-induced oxidative stress and antioxidative mechanisms in germinating Indian mustard (Brassica juncea L.) seeds. Ecotoxicol. Environ. Saf. 72: 1337-1342. Thys C, Vanthomme P, Schrevens E, De Proft M (1991) Interactions of Cd with Zn, Cu, Mn and Fe for lettuce (Lactuca sativa L.) in hydroponic culture. Plant Cell. Environ. 14: 713-717.

Tian S, Lu L, Zhang J, Wang K, Brown P, He Z, Liang J, Yang X (2011). Calcium protects roots of Sedum alfredii H. against cadmium-induced oxidative stress. Chemosphere, 84: 63-69. Tyler LD, McBride MB (1982). Influence of Ca, pH and humic acid on Cd uptake. Plant Soil. 64: 259-262. Verret F, Gravot A, Auroy P, Leonhardt N, David P, Nussaume L, Vavasseur A, Richaud P (2004). Overexpression of AtHMA4 enhances root-to-shoot translocation of zinc and cadmium and plant metal tolerance. FEBS Lett. 576: 306-312. Wallace A, Romney EM, Mueller RT, Alexander GV (1980). Calciumtrace metal interactions in soybean plants. J. Plant Nutr. 2: 79-86. Wang C, Song H (2009). Calcium protects Trifolium repens L. seedlings against cadmium stress. Plant. Cell. Rep. 28: 1341-1349. Wong CK, Jarvis RS, Sherson SM, Cobbett CS (2009). Functional analysis of the heavy metal binding domains of the Zn/Cdtransporting ATPase, HMA2, in Arabidopsis thaliana. New Phytol. 181: 79-88. Zorrig W, Rouached A, Shahzad Z, Abdelly C, Davidian JC, Berthomieu P (2010). Identification of three relationships linking cadmium accumulation to cadmium tolerance and zinc and citrate accumulation in lettuce. J. Plant. Physiol. 167: 1239-1247.

Full Length Research Paper

Impact of different moisture regimes and nitrogen rates on yield and yield attributes of maize (Zea mays L.) Muhammad Maqsood1, Muhammad Asif Shehzad1*, Muhammad Aqeel Sarwar1, Hafiz Tassawar Abbas2 and Salman Mushtaq3 1

Department of Agronomy, University of Agriculture, Faisalabad-38040, Pakistan. Department of Plant Pathology, University of Agriculture, Faisalabad-38040, Pakistan. 3 Institute of Horticultural Sciences, University of Agriculture, Faisalabad-38040, Pakistan. 2

Accepted 30 March, 2012

Nitrogen and irrigation, both are essential to determine the yield and quality of maize (Zea mays L.). A field study was accomplished to determine the upshots of different levels of irrigation and varying nitrogen rates on yield, yield contributing attributes and radiation use efficiency (RUE) of maize hybrid on sandy clay loam soil. Different nitrogen rates and moisture regime treatments comprised of N0 = 0, N1 = 100 and N2 = 200kg N ha-1, I1 (25 mm water deficit), I2 (50 mm water deficit), I3 (three irrigations during vegetative development + one irrigation at tasseling stage) and I4 (three irrigations during vegetative development + one irrigation at tasseling stage + one irrigation at silking stage + one irrigation at grain -1 filling stage), respectively. Results showed that maximum grain yield (7.04 t ha ) was recorded when six irrigations were applied (three irrigations during vegetative development + one irrigation at tasseling stage + one irrigation at silking stage + one irrigation at grain filling stage) coupled with 200 kg N ha-1 (N2 × I4). The lowest grain yield (2.08 t ha-1) was obtained in response to 25 mm water deficits. Overall, N2 × I2 also gave a positive response in terms of yield attributes but highest plant height (160.80 cm), cob length (29.00 cm), number of grains per cob (308.33), 1000-grain weight (294.33 g) and biological yield (25.67 t ha-1) with maximum coefficient of correlation (R2) values (0.9399; 0.8851; 0.9161; 0.8743 and 0.9126), respectively, was attained with N2 × I4 treatment combinations. The superior (RUE) radiation use efficiency (5.33 g MJ-1) with higher R2 value (0.8821) was significantly affected by nitrogen rates and irrigation levels as obtained from N2 × I4 treatment. However, in all treatment combinations, N2 × I4 was superior by producing the highest maize grain yield. Key words: Moisture regimes, nitrogen rates, deficit irrigation, Zea mays L., radiation use efficiency, maize yield. INTRODUCTION Maize (Zea mays L.), an important cereal crop belonging to family poaceae thrives best in tropical regions with mild summers. Its importance arises both because of its higher biological efficiency and because it can be grown over an extremely wide environmental range. It is very important as food for human beings, animals and also provides raw material for many agro-based industries (Ahmad et al., 2007). In Pakistan, maize was grown on an area of 939 thousands hectares with annual

*Corresponding author E-mail: asifbukhari01@gmail.com. Tel: (+92) 3346059373.

production of 3341 thousands tones of grain and average -1 yield about 3264 kg ha (Govt. of Pakistan, 2011). Yield per unit area in Pakistan is alarmingly low when compared to the biological potential of the existing maize varieties. The yield potential of Pakistani varieties is fairly high but it is not being completely exploited from farmers due to some management constraints as well as many agronomic, edaphic and environmental factors. The climatic condi-tions and existing varieties in Pakistan are highly favorable for increasing maize production, but poor nutrient management and water scarcity are fundamentals to reach the highest potential (Mohamed, 2010). Water being a scarce commodity in Pakistan is to be used efficiently for maximum potential yield (Li-Ping et al.,

8450

Afr. J. Biotechnol.

Table 1. Soil physico-chemical properties.

Characteristic Sand (%) Silt (%) Clay(%) Saturation percentage (%) Electrical conductivity (dS m-1) pH Organic matter (%) -1 CEC (cmolc kg ) Total nitrogen (%) Available phosphorus (ppm) Extractable potassium (mg kg-1)

Value 27 38 43 31.6 1.79 8.5 0.95 8.9 0.23 1.00 186

*CEC, Cation exchange capacity.

2006). Maize cultivation requires large quantities of water seasonally for each developmental stages starting from seed germination to plant maturation (Rashid and Rasul, 2010). The requirements in irrigation water to achieve maximum seed production by a variety of medium maturity oscillate between 500 and 800 m3. Adequate amount of moisture availability at critical growth stages not only optimizes the metabolic process in plant cell but also increase the absorption of mineral nutrients by the crop. The water deficit at grain filling stage can decrease the maize grain yield about 33% by affecting the 1000grain weight, grain yield, harvest index and water use efficiency (Sajedi et al., 2009). The components of the photosynthetic apparatus and chlorophyll content could be damaged significantly in drought susceptible genotypes under drought stress conditions (Rong-hual et al., 2006). Corn is relatively insensate to water deficits imposed during early vegetative stages while grain yield is sensitive to water stress from just before silking to grain filling with the greatest degree of sensitivity occurring during period of kernel formation (Andrade et al., 1995). Poor nutrient management is the second main reason of low maize productivity. Increasing nitrogen fertilization rates led to a significant increase in ear length, number of kernel per rows, ear weight and grain yield. Moisture supply is most essential to maximize the nutrient use efficiency about 50% at critical growth stages of maize crop (Patel et al., 2006).This study was therefore planned to assess the optimum level of irrigation regimes and nitrogen rates to enhance the maize grain yield and its components under agro-climatic conditions of Faisalabad. MATERIALS AND METHODS Site description The planned study was performed at the Agronomic Research Area, University of Agriculture, Faisalabad, Pakistan during spring

season 2011. The experimental site was bounded by 73° 06ʹ E, 31° 26ʹ N and at altitude of 184.4 m above sea level with semi-arid climate. Before sowing the crop, the experimental soil was analyzed for their physic-chemical characteristics (Table 1). Meteorological data (rainfall, relative humidity and air temperatures) were recorded from meteorological observatory in the immediate vicinity of the field during the phase of crop development (Figure 1).

Experimental design and treatments The experiment was outlined in randomized complete block design (RCBD) with split plot arrangement with three replicates using a net plot size of 3.6 m × 5.0 m for collection of data. Nitrogen and moisture levels were randomized in main and sub-plots respectively. The experiment comprised the following treatment combinations; nitrogen rates: (N0 = 0, N1 = 100, N2 = 200) kg N ha-1; and irrigation levels: (I1 = 25 mm water deficit, I2 = 50 mm water deficit, I3 = three irrigations during vegetative development and one irrigation at tasseling stage, I4 = three irrigations during vegetative development, one irrigation at each tasseling, silking and grain filling stage).

Crop husbandry Maize crop (hybrid DK-5219) was sown in February, 2010 with the help of single row hand drill, keeping distances between rows and plants of 75 and 25 cm, respectively, using a seed rate of 25 kg ha1 . Phosphorus and potash were applied at 150 and 100 kg ha-1, respectively to all the plots. Maximum potential soil moisture deficit (D) was used as a criterion for irrigation application at 25 mm and 50 mm moisture deficit (French and Legg, 1979). Daily Penman’s potential evapotranspiration (PET) was calculated by using standard software “CROPWAT” (FAO, 1992; FAO, 1993). Daily sum of PET values over time gives a cumulative potential soil moisture deficit (D) as suggested by French and Legg (1979). The amount of water applied was equal to the difference between PET and rainfall + irrigation. Irrigation was applied manually by watering cane. All other agronomic practices were kept normal and uniform for all the treatment combinations. Nitrogen applied in two splits at sowing and 1st irrigation was side dressed at 5 cm depth and 10 cm away from the plant row with the help of single row hand drill. The crop was thinned out at three to four leaf stage in order to maintain the optimum plant population. Crop was harvested on June 15, 2010 and kept in the respective plots for sun drying. The cobs were removed from the dry stalks, unsheathed and threshed mechanically with the help of corn sheller.

Data collection and analysis Observations regarding plant height (cm), cob length (cm), number of grains per cob, 1000-grain weight (g), biological yield (t ha -1), grain yield (t ha-1) and radiation use efficiency (g MJ-1) were recorded during the course of study. Methods for measuring RUE of maize in the field, usually over periods of several weeks, are well established and involve destructive measurements of above ground crop dry matter combined with continuous (Tollenaar, 1992) or periodic (Westgate et al., 1997) measurements of canopy absorption of incident photosynthetic active radiation (PAR). It is sometimes of interest to evaluate changes in RUE over short periods of time (hours or days), which precludes the direct measurement of changes in whole crop dry matter. The data collected were analyzed statistically using Fisher’s analysis of variance technique and least significant difference (LSD) test at 5% probability level was employed to compare the differences among the treatments’ means (Steel et al., 1997).

Maqsood et al.

TempMax

TempMin

15 10

Fe b

Ju ly

Ju ne

100

120

35 30

Ap ril

ar ch

140

RainFall (mm), Relative Humidity (%)

R.H

ru ar y

TempMax, TempMin (°C)

RainFall

8451

Figure 1. Average minimum and maximum temperatures, relative humidity and monthly rainfall measured at the experimental station during the experiment.

RESULTS AND DISCUSSION Analysis of variance, means comparison of main effects and their interaction are shown in Tables 2 and 3 respectively. Highest plant height (147.64 cm) was found in treatment N2 parallel to the control (129.23 cm). These results are in accordance with those of Silva et al. (2000) who reported that plant height increased significantly with the application of different rates of nitrogen. Similarly, when irrigation was studied individually, maximum plant height (151.04 cm) was recorded in the case of I4 compared to I1 which showed minimum plant height (119.80 cm) (Table 2). The combined effect of nitrogen and irrigation (N2 × I4 and N2 × I2) also showed a significant increase in plant height compared to the other treatments (Table 3). These results are in conformity with those of Kassem et al. (1977) and Hussaini et al. (2001) who reported that plant height generally decreased with reduction in irrigation. The coefficient of correlation (R2) value (0.9399) for plant height and grain yield showed that both were highly correlated (Figure 2). Effect of different irrigation levels and nitrogen rates as well as their interaction on cob length was found to be significant (Tables 2 and 3). Cob length in I4 was found to be maximum (23.67 cm) and minimum cob length (11.00 cm) was found in the I1, and in case of nitrogen levels, N2 was found best (23.00 cm). Crop plants when irrigated with N0 × I1 severely reduced the cob length (6.67 cm) compared to maximum cob length (29.00 cm) which was obtained from N2 × I4 treatment. N0 × I2; N1 × I1 and N1 × I2 also reduced the cob length (14.00 cm; 11.00 cm;

14.00 cm), respectively, due to low irrigation levels. The maximum cob length (29.00 cm) was attained with N2 × I4 which was statistically at par with N2 × I2 with the highest (R2) value (0.8851) (Figure 2). Similar results were described by Oktem and Oktem (2005) who reported that cob length (20.88 cm) increased by applying nitrogen and irrigation. Number of grains per cob is a major yield contributing to the attribute of maize grain yield. N2 × I4 was found to have maximum number of grains per cob (308.33), whereas minimum grains per cob (120.67) were recorded in the treatment N0 × I1 in response to interactive effect of nitrogen and irrigation (Table 3). Individually, I4 showed maximum number of grains per cob (258.22) (Table 2). These results are in accordance with Ali (1991) and Shah (2001) who found that number of grains per cob was significantly affected by high levels of irrigation. The results of this variable were affected similarly by nitrogen that showed maximum values (240.75) in N2 treatment which are quite in agreement with the work done by Sabir et al. (2000), Mahmood et al. (2001) and Abbas et al. (2005) which observed that number of grains per cob increased significantly with increasing nitrogen rates. Regression line for number of grains per cob with grain yield showed a trend towards greater significance in the relationship with the highest (R2) value (0.9161) (Figure 2). Maximum 1000-grain weight (294.33 g) was found in the combination N2 × I4 which was followed by N1 × I4 having 253.0 g 1000-grain weight, while minimum values were observed in N0 × I1 (Tables 2 and 3). These results are in accordance with Hokmalipour et al. (2010) who

8452

Afr. J. Biotechnol.

Table 2. Yield response of maize (Zea mays L.) under different nitrogen and irrigation levels.

Plant height (cm) Nitrogen rates (N) kg ha-1 N0 129.23b N1 133.80b N2 147.64a LSD (P= 0.05) 10.13 Treatments

Irrigation levels (I) I1 I2 I3 I4 LSD (P=0.05)

119.80 b 136.09 140.63b 151.04a 7.75

Cob length (cm)

Number of grains per cob

1000-grain weight (g)

Biological yield (t ha-1 )

Radiation use efficiency (g MJ-1)

Grain yield (t ha-1)

14.16c 17.08b 23.00a 2.58

182.08b 195.17b 240.75a 34.33

172.89b 195.98b 230.77a 26.27

12.50b 13.92b 18.83a 2.61

2.52c 3.04b 3.82a 0.29

3.53b 4.05b 5.37a 0.92

142.56 b 201.67 221.56b 258.22a 23.02

140.73 b 182.38 224.79a 251.63a 26.88

10.11 b 13.89 16.11b 20.22a 2.51

1.67 b 2.98 3.43b 4.40a 0.47

2.62 b 4.20 4.58b 5.86a 0.78

11.00 b 18.33 19.33b 23.67a 3.52

Any two means not sharing a letter differ significantly at 5% probability level according to LSD test.

Table 3. Interactive effect of nitrogen and irrigation levels on yield and yield components of maize (Zea mays L.).

Treatments

Plant height (cm)

Interaction (N × I) N0 × I1 N0 × I2 N0 × I3 N0 × I4 N1 × I1 N1 × I2 N1 × I3 N1 × I4 N2 × I1 N2 × I2 N2 × I3 N2 × I4 LSD (P=0.05)

115.03e e 118.43 bcd 139.30 144.17bc e 118.67 129.66cde 138.70bcd ab 148.17 125.70de a 160.17 bc 143.90 160.80a 15.28

Cob length (cm)

No. of grains per cob

1000-grain weight (g)

Biological yield (t ha )

6.67f de 14.00 17.67cd 18.33bcd ef 11.00 14.00de 19.67bcd ab 23.67 cde 15.33 a 27.00 bc 20.67 29.00a 5.85

120.67f e 165.00 cd 211.00 231.67bc f 154.33e 173.33de 218.33c bc 234.67 152.67ef b 266.67 bc 235.33 308.33a 48.23

120.00d d 151.67 bc 212.33 207.57bc d 145.00 164.67cd 221.27b ab 253.00 157.20d b 230.80 b 240.77 294.33a 47.79

9.00e de 10.33 14.33cd 16.33bc de 10.00 11.00de 16.00bc bc 18.67 de 11.33 b 20.33 bc 18.00 25.67a 4.54

Any two means not sharing a letter differ significantly at 5% probability level according to (LSD) test.

-1

Radiation use efficiency -1 (g MJ ) 1.10f e 2.23 3.26d 3.46d e 1.93 2.36e 3.46d b 4.40 2.00e bc 4.36 cd 3.56 5.33a 0.77

Grain yield (t ha 1 ) 2.08f ef 3.03 cde 4.22 4.78bc f 2.50 3.25ef 4.68bcd ab 5.76 def 3.28 a 6.33 bc 4.85 7.04a 1.47

Maqsood et al.

8453

Figure 2. Relationship between maize (Zea mays L.) grain yield and its yield components viz. plant height, cob length, grains per cob, 1000-grain weight, biological yield and RUE; X and Y axis represent the grain yield and yield components, respectively as mentioned above each figure.

found that increasing irrigation frequency significantly increased 1000-grain weight. The results related to nitrogen rates are also in accordance with Khaliq et al. (2008) who found that 1000-grain weight increased significantly by the application of different rates of nitrogen. Linear correlation with the highest (R2 = 0.8743) value between1000-grain weight and grain yield was also found to be significant (Figure 2). There was a significant progressive increase in biological yield (grain plus straw yield) with each increase in irrigation level and nitrogen rates. In response to interaction effect, maximum biological yield (25.67 t ha-1) was achieved in the case of N2 Ă&#x2014; I4 interaction study which also showed a high

correlation between grain and biological yield with R2= 0.9126 (Figure 2), followed by the N2 Ă&#x2014; I2. Minimum value -1 (9.00 t ha ) was observed in the case of N0 Ă&#x2014; I1. When considering only the main effects, N2 and I4 were responsible for maximum biological yield (18.83 and 20.22 t ha-1), respectively (Tables 2 and 3). These findings are in conformity with those of Sabir et al. (2000) who reported that biological yield increased with increase in nitrogen rates while irrigation level are confirmed by the work of Khaliq et al. (2009) who reported that grain -1 yield and dry matter yield (17.61 t ha ) increased with increasing irrigation frequencies. Effect of different irrigation levels and nitrogen rates as

8454

Afr. J. Biotechnol.

well as their interactive effects on radiation use efficiency was found to be significant (Table 2 and 3). Maximum RUE value (5.33 g MJ-1) was obtained under N2 × I4 2 treatment with greater R = 0.9126 which showed a strong correlation between RUE and grain yield (Figure 2). Minimum RUE (1.10 g MJ-1) was recorded in N0 × I1 treatment. This shows that nitrogen and irrigation both increased radiation use efficiency of maize plants (Table 3). Individually, N2 and I4 treatments reported the maximum (3.82 g and 4.40 g MJ-1) while N0 and I1 accounted for the minimum (2.52 g and 1.67 g MJ-1) RUE respectively (Table 2). The increase in RUE may be ascribed to a greater assimilate production or a decreased partitioning of current assimilates to the root system (Whitfied,et al., 1989; Ahmad et al., 2008). These results are in accordance with the work by Ullah (2002) who reported that increase in irrigation level has a significant effect on radiation use efficiency of maize. Treatments N2 × I4 showed the highest grain yield values (7.04 t ha-1) which was statistically at par with the grain yield observed in N2 × I2 and N1 × I4 (6.33 and 5.76 t ha-1, respectively), while minimum value (2.08 t ha-1) was recorded in N0 × I1. Treatments N0 × I2 and N1 × I2 behaved statistically similar and did not respond well in terms of maize grain yield (Table 2). Water stress is actually the main cause of reduced grain yield of maize crop. Individual effects of nitrogen and irrigation are statistically significant for the variable grain yield (Table 3). Nitrogen application had much greater effect on maize grain yield and this could be due to the fact that application of nitrogen fertilizer in plants increases uptake of other nutrients. Actually, the supply of nitrogen enhanced the development of small roots and root hairs which, in turn facilitated the absorbing ability per unit of dry weight (Hammad et al., 2011). Satchithanantham and Bandara (2001) and Gheysari et al. (2009) also found that increasing irrigation frequency and nitrogen application significantly increased maize grain yield. Conclusions Adequate nutrition and proper soil moisture are important constraints in producing a good crop stand. Nitrogen is needed at high concentrations in the plants at critical growth stages to obtain maximum yield and quality in maize and its response to higher irrigation level is positive. It is recommended that we must utilize 200 kg nitrogen with three irrigations during vegetative development, irrigation at each tasseling, silking and grain filling stage to achieve higher grain yield. ACKNOWLEDGEMENTS The authors would like to thanks Mr. Iftikhar Ahmad, Department of Mathematical Sciences, Goteborg University, Sweden for the statistical analysis and Dr.

Abid Niaz, Soil Chemistry Section, Institute of Soil Chemistry and Environmental Sciences, Ayub Agricultural Research Institute (AARI), Faisalabad, Pakistan for the technical assistance during research work. REFERENCES Ahmad M, Ahmad R, Rehman A (2007). Crowding stress tolerance in maize hybrids, Economic and Business Rev., The Daily Dawn, Lahore, Pakistan, (3): 17-22. Ahmad S, Zia-ul-Haq M, Ali H, Shad SA, Ahmad A, Maqsood M, Khan MB, Mehmood S, Hussain A (2008). Water and radiation use efficiencies of transplanted rice (Oryza sativa L.) at different plant densities and irrigation regimes under semi-arid environment. Pak. J. Bot. 40: 199-209. Ali M (1991). Effect of irrigation stress at early growth stages on the growth and grain yield of spring maize. M. Sc. (Hons.) Agri. Thesis, Dept. Agron., Univ. Agri. Faisalabad. Abbas G, Hussain A, Ahmad A, Wajid SA (2005). Effect of irrigation schedules and nitrogen rates on yield and yield components of maize. J. Agric. Soc. Sci. 4: 335-338. Andrade FH, Echarte L, Rizzalli R, Della Maggiora A, Casanovas M (1995). Kernel number prediction in maize under nitrogen or water stress. Crop Sci. 42(4): 1173-1179. French BK, Legg BJ (1979). Rothamsted irrigation. 1964-76. J. Agric. Sci. Cambridge. 91: 47-60. FAO (1992). CROPWAT: a computer program for irrigation planning and management. Irrigation and Drainage Paper 46, Developed by: Martin Smith. Food and Agriculture Organization of the United Nations, Rome, Italy. FAO (1993). CLIMWAT for CROPWAT: a climatic database for irrigation planning and management. Irrigation and Drainage Paper No. 49, p. Developed by: Martin Smith. Food and Agriculture Organization of the United Nations, Rome, Italy. Govt. Pakistan (2011). Economic Survey of Pak. 2010-11. Finance Division, Economic Advisor’s Wing, Islamabad, Pak. p. 24. Gheysari M, Mirlatifi SM, Bannayan M, Homaee M, Hoogenboomb G (2009). Interaction of water and nitrogen on maize grown for silage. Agric. Water Manage. 96: 809-821. Hussaini MA, Ogunleta VB, Ramalan AA, Falaki AM (2001). Growth and development of maize (Zea mays L.) in response to different levels of nitrogen, phosphorous and irrigation. Crop Res. Hisar. 22(2): 141149. (CAB Absts). Hammad HM, Ahmad A, Khaliq T, Farhad W, Mubeen M (2011). Optimizing rate of nitrogen application for higher yield and quality in maize under semiarid environment. Crop Environ. 2(1): 38-41. Hokmalipour S, Shiri-e-Janagard M, Darbandi MH, Peyghami-eAshenaee F, Hasanzadeh M, Seiedi MN, Shabani R (2010). Comparison of agronomical nitrogen use efficiency in three cultivars of corn as affected by nitrogen fertilizer levels. World Appl. Sci. J. 8(10): 1168-1174. Kassem RS, Shidy MA, Khalifa MA (1977). Effects of some agri. Practices on stalkrot incidence and yield of maize. Irrigation and nitrogen fertilizer. Annal. Agric. Sce. Mashtorhor, 8(3): p. 217 [Field Crop Absts. 32(1): 79; 1979]. Khaliq T, Ahmad A, Hussain A, Ranjha AM, Ali MA (2008). Impact of nitrogen rates on growth, yield, and radiation use efficiency of maize under varying environments. Pak. J. Agric. Sci. 45(3): 1-7. Khaliq T, Ahmad A, Hussain A, Ali MA (2009). Maize hybrids response to nitrogen rates at multiple locations in semiarid environment. Pak. J. Bot. 41: 207-224. Li-Ping B, Fang-Gong S, Tida G, Zhao-Hui S, Yin-Yan L, Guang- Sheng Z (2006). Effect of soil drought stress on leaf water status, membrane permeability and enzymatic antioxidant system of maize. Pedosphere. 16(3): 326-332. Mohamed MY (2010). Development and stability of some Sudanese sunflower hybrids under irrigated conditions. Helia. 33, Nr. 52: 135144. Mahmood MT, Maqsood M, Awan TH, Sarwar R, Hussain MI (2001).

Maqsood et al.

Effect of different levels of nitrogen and intra-row plant spacing on yield and yield components of maize. Pak. J. Agric. Sci. 38(1-2): 4849. Oktem G, Oktem A (2005). Effect of nitrogen and intra row spaces on sweet corn (Zea mays L.) ear characteristics. Asian J. Plant Sci. 4(4): 361-364. Patel JB, Patel VJ, Patel RJ (2006). Influence of different methods of irrigation and nitrogen levels on crop growth rate and yield of maize (Zea mays L.). Ind. J. Crop Sci. 1(1-2): 175-177. Rong-haul L, Pei-Pol G, Baumz M, Grand S, Ceecarelli S (2006). Evaluation of chlorophyll content and florescence parameters as indicators of drought tolerance in barlay. Agric. Sci. 5(100): 751-757. Rashid K, Rasul G (2010). Rainfall variability and maize production over the potohar plateau of Pakistan. Pak. J. Meteorol. 8(15): 63-74. Sajedi MA, Arakani MR, Boojar MA (2009). Response of maize to nutrients foliar application under water deficit stress conditions. Am . J. Agric. Biol. Sci. 4(3): 242-248. Steel RGD, Torrie JH, Dickny DA (1997). Principles and Procedures rd of Statistics, A Biomatrical Approach. 3 Edition. McGraw Hill Book Co. Inc. New York, USA, pp. 352-358. Shah SAH (2001). Growth, yield and radiation use efficiency of maize (Zea mays L.) under variable irrigation schedules. M. Sc. (Hons.) Agric. Thesis, Deptt. Agron. Univ. Agric. Faisalabad. Sabir MR, Ahmed I, Shahzad MA (2000). Effect of nitrogen and phosphorous on yield and quality of two hybrids of maze (Zea mays L.). J. Agric. Res. 38(4): 339-346.

8455

Silva PSLE, Diniz-filho ET, Granjeiro LC (2000). Effects of nitrogen reates and deltamthrin application on yields of green ears and grain yield of maize. Revista Aagricult. de Mossoro, 47(269): 75-87, Field Crop Absts. 53(9): 5980; 2000. Satchithanantham S, Bandara DC (2001). Effect of nitrogen fertilizer and irrigation on growth performance of maize (Zea mays L.) in the mid country of Sri Lanka. Trop. Agric. Res. 13: 431-434 (CAB Absts.). Tollenaar M, Dwyer LM, Stewart DW (1992). Ear and kernel formation in maize hybrids representing three decades of grain yield improvements in Ontario. Crop Sci. 32: 432-438. Ullah S (2002). Effect of planting patterns and different irrigation levels on growth and yield of maize (Zea mays L.). M. Sc. (Hons.) Agric. Thesis, Deptt. Agron. Univ. Agric. Faisalabad. Westgate ME, Forcella F, Reicosky DC, Somsen J (1997). Rapid canopy closure for maize production in the northern US corn belt: Radiation use efficiency and grain yield. Field Crops Res. 49: 249-258. Whitfied DM, Smith CJ, Gyles OA, Wright GC (1989). Effects of irrigation, nitrogen and gypsum on yield, nitrogen accumulation and water use of wheat. Field Crops Res. 20: 261-277.

Full Length Research Paper

Physico-chemical properties of indigenous micro organism-composts and humic acid prepared from selected agro-industrial residues A. Norida Hanim1, A. M. Nik Muhamad2, O. H. Ahmed1*, K. Susilawati1 and A. Khairulmazmi1 1

Department of Crop Science, Faculty of Agriculture and Food Science, Universiti Putra Malaysia, Bintulu Sarawak Campus, 97008 Bintulu, Sarawak, Malaysia. 2 Department of Forest Management, Faculty of Forest, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. Accepted 23 February, 2012

Paddy husk (PH) and corn stalks (CS) residues are managed through burning. Besides contributing to environmental pollution, burning causes loss of vegetation cover, erosion, run off and loss of organic matter. In order to minimize this problem, a study was conducted to manage PH and CS residues through composting and to determine the physical and chemical properties of different composts and humic acid extracted from the final product. The study had six treatments namely: (T1) indigenous microorganisms (IMOIV)Steamed white rice (SWR)(30%)+PH (40%)+Chicken Dung (30%), (T2) SWR (30%)+CS (40%)+Chicken Dung (30%), (T3) IMOIVAerated Fish Pond Water (AFPW)(30%)+Paddy husk (40%)+Chicken Dung(30%), (T4) IMOIV AFPW (30%)+CS (40%)+Chicken Dung(30%), (T5) IMOIVKitchen Waste (KW)(30%)+PH (40%)+Chicken Dung (30%) and (T6) IMOIV KW (30%)+CS (40%)+Chicken Dung (30%). Composting was conducted in a white polystyrene box with a size of 30 x 15 x 25 cm. The composts produced in this study were analyzed for C:N and C:P ratio, pH (H2O and KCl), nutrients, heavy metals, organic carbon, organic matter, ash, cation exchange capacity (CEC), humic acid (HAs) and total microbial count. The HAs were evaluated for elemental composition, acidic functional groups, E 4/E6 ratio and spectral characteristics using standard procedures. Results show that all IMO-composts were granular, dark brown in colour without foul odour and attained an ambient temperature at 34 days of composting indicating the stable nature of the composts. The number of bacteria and filamentous fungi involved during composting decreased at the end of the all treatments. The E4/E6, acidic functional groups; carboxyl-COOH, phenolic-OH and total acidity of the compost were consistent with the standard range. IMO-compost from CS had better quality (chemical characteristics) compared to that of paddy husk. High quality compost could be produced from CS. Key words: Paddy husk (PH), corn stalks (CS), indigenous microorganisms (IMO)-compost, humid acid (HA).

INTRODUCTION Rice and corn make up 85% of the world grain production and rice is food staples for most of the world’s population while corn is the third most commonly consumed grain worldwide. 99% of harvested rice is used for human consumption with over half of the world’s population

*Corresponding author. E-mail: osman60@hotmail.com. Tel: +603086855406. Fax: +603086855415.

depending on rice for food and most corn is grown for food, livestock and other products such as corn syrup, sweeteners, corn oil, ethanol and industrial products, such as fuel. Both crops are cultivated globally and it is the most popular crop in Asia where the annual production is rapidly increasing to meet the domestic and export demand. However, Agro-industrial wastes have become a major problem in terms of disposal because most farmers dispose them through burning. This inexpensive method of crop residue disposal is practiced

Hanim et al.

in many parts of the world to clear the excess residue from land for faster crop rotation, control undesirable weeds, pests and diseases and to return some nutrient to the soil. Open burning emits a large amount of harmful air pollutants (particles and inorganic and organic gases), which have severe impact on human health, polycyclic aromatic hydrocarbons (PAHs) (Pope et al., 2009; Korenage et al., 2001) and the danger of soil erosion due to repeated burning (Kahlon and Dass, 1987). In addition, disposal in water bodies (for example, river or lake) may contribute to a decrease in water quality. Because of these concerns, there is a need to find efficient alternatives for agro-industrial wastes management. Many alternatives for the disposal of these residues have been proposed, composting being one of the most attractive on account of its low environmental impact and cost (Bustamente et al., 2008; Canet et al., 2008; Lu et al., 2008), as well as its capacity for generating a valuable product used for increasing soil fertility (Weber et al., 2007) or as a growing medium in agriculture and horticulture (Pérez-Murcia et al., 2005). The objectives of this study were: (1) to prepare compost with the residues of CS and paddy husk, (2) to assess the properties of the substrate during the composting process to get matured compost and (3) to assess the quality of humic acid extracted from the final product. MATERIALS AND METHODS Indigenous microbes were collected from three sites. (i) On undisturbed area under bamboo trees by using SWR, (ii) AFPW, UPM fish pond and (iii) KW from food stores at Universiti Putra Malaysia Bintulu Sarawak Campus. Four litres of water samples of AFPW were collected at seven different sampling points in the pond in sterile 5,000 mL bottles. KW was collected from Sri Rajang College Cafeteria (2) with a ratio of (rice, meat and a vegetable, 3:1:1). Distilled water was added gradually to equal the weight of the kitchen waste mass, 1:1 ratio and ground using food blender (Wang et al., 2005). The AFPW and KW were left to ferment at 30±2°C for 5 days until all the solid form changed to slurry form. Small wooden box (30 x 15 x 10 inches) was filled with 5 cm of SWR and covered with paper towel. Rubber bands were used around the top of the box to secure the paper towel in place. The top of the box was covered with wire screen to prevent animals from tampering with the rice. The top of the wire was covered with a sheet of plastic to protect the box from rain and it was placed under bamboo trees without direct sunlight. The box was partially buried 5 cm deep in the soil and covered with fallen leaves. The plastic sheet was anchored on all sides with small rocks to prevent it from being dislodged by wind. The box was left for 5 days. After this period, the moist rice was covered with white mold (mycelium) and during this phase; IMO, IMO (I) was obtained. The desired microbes from different sources (SWR, AFPW and KW) were cultured to increase their population. Granulated brown sugar was added gradually to equal the weight of the molded rice mass in a ratio of 1:1. A 1,300 g of molded rice and granulated brown sugar were weighed and hand kneaded until the material had the consistency of gooey molasses and then transferred to a clean glass bottle filled two-third full and covered with paper towel secured in place with rubber bands. The bottle was stored at

8457

30±2°C away from direct sunlight for 5 days to allow the mixture to ferment (Hoon and Michael, 2008). Similar procedure was used to process AFPW and KW. After this period, second phase of indigenous microorganisms called IMO (II) was carried out. A 2.5 g of fermented SWR, AFPW and KW were mixed with 1,000 mL fermented rice waste water for each followed by the addition of 2,500 g of ground corn until the mixture was semi moist (roughly 65 to 70% moisture). A mound of the mixture was placed in polystyrene box at 30±2°C to protect it from the sunlight and allow the microbes to propagate for 5 days and IMO (III) was produced in this phase. A 3,502.5 g of IMO (III) and air dried soil were mixed gradually and allowed to ferment for 15 days at 30±2°C. At this stage, IMO (IV) was produced. The two agro-industrial wastes; CS and PH were collected from university farm, Universiti Putra Malaysia Bintulu Campus Sarawak. The selected wastes were air dried and ground (approximately 2 mm in size) for composting. A mound of the substrate was placed inside a white polystyrene box with a size of 30 x 15 x 25 cm and protected from direct sunlight in a controlled condition. The study had the following treatments: 1. (T1) IMO(IV)Steamed white rice (SWR)(30%)+Paddy Husk(40%)+Chicken Dung(30%) 2. (T2) IMO(IV)Steamed white rice (SWR)(30%)+Corn Stalk(40%)+Chicken Dung(30%) 3. (T3) IMO(IV) AFPW (30%)+PH (40%)+Chicken Dung(30%) 4. (T4) IMO(IV) AFPW (30%)+CS (40%)+Chicken Dung(30%) 5. (T5) IMO(IV) KW (30%)+PH (40%)+Chicken Dung(30%) 6. (T6) IMO(IV)KW (30%)+CS (40%)+Chicken Dung(30%) Composting was carried out for 34 days until the temperature of pile was equalled ambient temperature. The external surface and internal pile was periodically examined in the morning, afternoon and evening daily using a digital thermometer. Each time the pile temperature declined after a peak, the mixture was manually turned and the moisture of the compost was maintained at 65%. The amount of added water was calculated on the basis of the material moisture content prior to turning. The compost was air-dried and analyzed. Kjedhal method was used to determine total N (Bremner, 1965). Decomposition was calculated after ignition of the dry sample at 550°C for 8 h (Tan, 2005). Compost total P was extracted using the single dry ashing method followed by blue method (Murphy and Riley, 1962). Cations were extracted using the leaching method (Tan, 2005) and their concentrations determined using atomic absorption spectrometry (AAS). Compost CEC was determined by the leaching method followed by steam distillation (Bremner, 1965). The pH of the compost was determined in 1:4 compost:distilled water suspension and KCl using a glass electrode (Tan, 2005). The HAs extraction was carried out by method of Stevenson (1994). The HA was purified by the method of Ahmed et al. (2004), using distilled water and through centrifugation at 10,000 rpm for 10 min to reduce mineral matter and HCl during acidification. After the purification, the HA was oven dried at 40°C until constant weight was attained. The ash, organic carbon and organic matter of the HA were determined by the dry combustion method (Chefetz et al., 1996). Carboxylic-COOH, phenolic-OH and total acidity of HA were determined using the method described by Inbar et al. (1990). Level of humification (E4/E6) of HA was determined by spectroscopy (Campitelli and Ceppi, 2008) and analyzed using ultraviolet/visible (UV-Vis) spectrophotometer (Perkin-Elmer Lambda 11). The transmission fourier transform infrared (FT-IR) spectra were recorded on pellets obtained by pressing a mixture of about 1 mg of HA and 100 mg of KBr (FT-IR grade). A pellet was prepared using a press and FT-IR spectra were recorded using Nicolet 380 FT-IR spectrometer. A spectrum was acquired in the 4000 to 400 cm-1 range with 2 cm-1 resolution

Afr. J. Biotechnol.

Temperature (°C) and relative humidity (%)

8458

Figure 1. Evolution of the temperature within the piles in different treatments of IMO-compost and ambient temperature with relative humidity.

and 32 scans were performed on each acquisition. All the experiments were conducted in a completely randomized design (CRD) with three replications. The data were subjected to analysis of variance (ANOVA) and tested for significance using Tukey’s Test (SAS version 9.2) by PC-SAS software (SAS Institute, Cary, NC, USA, 2008). A representative sub-sample (10 g) was taken from 4 different point of homogenized compost pile inside polystyrene box (bottom, surface, side and centre) at each stage of composting raw mixture (1, 2, 3, 4 and 5 weeks of composting) to determine the total aerobic mesophilic and filamentous fungi (USEPA, 1999). A sub-sample of 10 g biosolid was added to 90 mL sterile buffered peptone solution using an aseptic technique to allow the microorganism to migrate into the solution. Series of dilutions were prepared (10-1, 10-2 ... 10-10) using a sterile 0.8% NaCl solutions. Microorganisms were counted after plated sterile Petri dishes with 0.1 mL from diluted liquid and incubated at the temperatures (30±2°C) for 48 to 72 h for total aerobic mesophilic (plate count agar) and filamentous fungi (potato dextrose agar).

RESULTS AND DISCUSSION The temperature variation (Figure 1) went through typical changes for each type of substrate and process used (Miller, 1996) indicating the critical role temperature of in composting. During aerobic composting, the average temperature curve of the treatments showed four phases (Figure 1). Initial, mesophilic phase, psychrophilic and

mesophilic microorganisms in the piles increased during the second day of composting (Figure 1). During this phase, temperature increased to 10 to 42°C as a consequence of biodegradation of organic compounds (Morita, 1975) thermophilic phase. The temperature of the composts reached the thermophilic phase (>50°C) between 3 to 5 days of composting. This was the stage where temperature exceeds tolerance limit of mesophilic microorganisms and promoted the development of thermogenic microorganisms (Figure 1). The microorganisms consumed soluble organic matter and ambient nutrients, which then underwent aerobic degradation to generate heat, biomass and carbon dioxide (Middle mesophilic phase). The compost temperature of T1, T2 and T6 decreased from 65 to 50°C at day 8, while those of the other treatments decreased slowly at day 9 cooling phase. The composts temperature decreased after day 10. This decrease could be attributed to depletion of organic matter (Figure 1). The main physico-chemical properties of the composts are presented in Table 1. The pH values were within the optimal range for the development of bacteria 6 to 7.5 and fungi 5.5 to 8. Two phases of the composting process were recorded: a phase of stabilization (about 29 days) where temperature peaked

Hanim et al.

8459

Table 1. Physico-chemical properties of different (initial and final) IMO-composts.

Characteristic Initial pHwater pHKCl Total N (%) Total P (%) TOC (%) C:N ratio C:P ratio CEC (cmol kg-1) Ash (%) OM (%) HA (%)

6.84cb bc 6.60 a 4.46 0.68ab bc 38.70 a 9.06 a 56.76 b 45.00 ab 33.33 bc 66.67 cd 1.77

7.44abc a 7.12 a 3.49 0.84a ab 40.60 a 12.12 a 48.69 ab 53.33 bc 30.00 ab 70.00 ab 4.13

6.73bc abc 6.69 a 3.11 0.73ab bc 38.67 a 12.82 a 52.96 ab 52.67 ab 33.33 bc 66.67 bcd 2.53

7.85a ab 7.05 a 4.10 0.74ab a 42.15 a 10.39 a 56.83 ab 58.33 c 27.33 a 72.67 abc 3.77

6.64bc c 6.56 a 3.92 0.76ab c 37.12 a 9.49 a 49.46 ab 52.67 a 36.00 c 64.00 d 1.60

7.57ab a 7.13 a 3.17 0.67b abc 39.83 a 13.19 a 57.25 a 64.00 abc 31.33 abc 68.67 a 4.73

Macronutrients K (%) Ca (%) Na (mg kg-1) Mg (mg kg-1)

0.90 0.89 a 1656.70 a 2710.00 b

1.60 1.09 a 2040.00 a 3710.00 a

0.96 0.95 a 1710.00 a 2873.30 ab

1.49 1.06 a 2073.30 a 3316.70 ab

0.98 1.06 a 1900.00 a 3266.70 ab

1.34 1.06 a 1900.00 a 2990.00 ab

Heavy metals Fe (mg kg-1) Cu (mg kg-1) Zn (mg kg-1)

68.30 a 1480.00 a 85.00 a

370.00 a 1276.70 b 150.00 a

1066.70 a 1383.30 ab 86.67 a

728.30 a 1406.70 a 118.33 a

572.50 a 1483.30 a 83.33 a

1015.00 a 1470.00a 91.67 a

Final pHwater pHKCl Total N (%) Total P (%) TOC (%) C:N ratio C:P ratio CEC (cmol kg-1) Ash (%) OM (%) HA (%)

7.93 7.35b a 3.80 bc 0.89 31.71a 8.37 a 36.11 a 66.00b 45.33a a 54.67 c 3.97

Macronutrients K (%) Ca (%) Na (mg kg-1) Mg (mg kg-1)

1.12 0.97 b 1720.00 b 3453.30 c

Heavy metals -1 Fe (mg kg ) Cu (mg kg-1) -1 Zn (mg kg )

8.40 8.29a a 3.66 1.13a 36.73a 10.06 a 32.38 a 64.00b 36.67a a 63.33 ab 9.70

2.27 1.33 a 2476.70 a 5076.70 a

abc

2220.00 923.30 d cd 175.00

8.16 7.47b a 3.85 bc 0.88 33.25a 8.93 a 38.37 a 62.67b 42.67a a 57.33 c 5.47

1.11 1.01 b 1986.70 ab 3566.70 bc

3670.00 1220.00 b ab 281.67

8.27 8.10a a 5.75 ab 1.24 25.13a 4.44 a 20.04 a 83.33a 56.67a a 43.33 a 11.60

2.43 1.43 a 2493.30 a 5230.00 a

931.70 1073.30 c d 111.67

abc

7.96 7.47b a 3.75 0.86c 32.09a 8.63 a 38.38 a 59.33b 44.67a a 55.33 c 4.33

1.14 1.03 b 1800.00 b 3533.30 bc

abc

2006.70 1426.70 a a 308.33

8.58 8.25a a 4.33 abc 1.12 30.16a 7.60 a 27.09 a 89.67a 48.00a a 52.00 b 8.40

2.21 1.34 a 2380.00 ab 4696.70 ab

676.70 1193.30 bc cd 140.00

2778.30 1480.00 a bc 211.67

Different letters within a column indicate significant difference between means using Tukeyâ&#x20AC;&#x2122;s Test at p = 0.05. nd: Not determined.

Afr. J. Biotechnol.

% Transmittance

8460

Figure 2. FT-IR spectra of extracted HAs in different treatments final IMO-compost.

at 68째C after 5 days of processing and pH slightly increased to 8.5 due to biodegradation of acid compounds (carboxylic and phenolic groups) or because of the mineralization of protein, amino acids and so on. The change in the C:N and C:P ratios from 13.19 and 57.25 to 10.06 and 38.38 and the amount of ash could be attributed to microbial activity on the cellulosic substrate and nitrogen (Table 1). The high ash content suggests high mineral matter in the composts. The increase in total nitrogen during composting was caused by decrease in substrate carbon (Soumare et al., 2002). Organic matter is decomposed and transformed to stable humic compounds (Amir et al., 2004). The final compost had higher content of HAs suggesting stability of it (Auldry et al., 2009; Auldry et al., 2010). The high E4/E6 ratios had a lower degree of aromatic condensation and the presence of a relatively large proportion of aliphatic structure (Campitelli et al., 2006; Rivero et al., 2004) and this observation is consistent with a previous study (Wei et al., 2007) where it was reported that composts had lower degree of aromatization compared to the soil. The carbon content of the HA of the compost was in the range of standard values (Table 2). The values of acidic functional groups; carboxyl-COOH, phenolic-OH and total acidity of humic acid of the compost were consistent with the standard range. The

FT-IR spectra of HAs of the composts are shown in Figure 2. The FT-IR spectra showed that the HAs from the different composts had the features typical of HAs. In general, the spectra of the composts were similar. The major spectral bands were assigned as follows: the broad at about 3300 to 3400 cm-1 was due to O-H stretching of phenolic or alcoholic hydroxyl groups. The band at 2920 to 2930 cm-1 represents aliphatic C-H vibrations of aliphatic methyl and methylene groups (Orlov, 1986). The carboxylic band at 1730 cm -1 forms only a shoulder on the main band at about 1600 to 1660 cm-1 and it can be assigned to C=O vibrations of carboxylates, C=C vibrations aromatic and olefinic; amide (I), ketone and quinine groups (Piccolo et al., 1992; Stevenson, 1982). The bands at 1510 to 1550 cm-1; 1380 to 1480 cm-1; 1220 to 1280 cm-1 and 1030 to 1070 cm-1 could be attributed to N-H deformation of aromatic amine or amide (amide-II band); C-H deformation and CH3 symmetric and asymmetric stretching; carboxylic C-O stretching and phenol C-O-H deformation and C-O-C of carbohydrates, aromatic ethers, Si-O-C groups (Fukushima et al., 1996; Wang et al., 1990; Stevenson and Goh, 1971). Microbial activity during composting was mainly due to the aerobic mesophilic community. Regardless of treatments, they were between 4.76 x 108 to 3.17 x 108 CFUg-1 of fresh compost. That of filamentous fungi ranged between 4.92

Hanim et al.

8461

Table 2. Comparison of the chemical properties of HAs in different treatments of final IMO-composts.

Characteristic HA (%) E4/E6 Carbon (%) Phenolic Carboxylic Total acidity OM (%) Ash (%)

T1 c 3.97 9.77a d 53.94 133.33a 266.67a a 400.00 d 93.00 b 7.00

T2 ab 9.70 8.78a a 56.26 100.00a 250.00a a 350.00 a 97.00 e 3.00

T3 c 5.47 8.23a e 53.29 133.33a 283.33a a 416.67 e 92.00 a 8.00

T4 a 11.60 a 9.11 c 55.10 100.00a 266.67a a 366.67 c 95.00 c 5.00

T5 c 4.33 8.09a b 55.68 100.00a 316.67a a 416.67 b 96.00 d 4.00

T6 b 8.40 8.76a a 56.26 166.67a 266.67a a 433.33 a 97.00 e 3.00

Standard range* nd 7-8 56-62 240-540 150-440 500-700 nd nd

Different letters within a column indicate significant difference between means using Tukey’s Test at p = 0.05. *Standard dat a range (Tan, 2003). nd: Not determined.

Table 3. Microbial account in different treatments during composting (expressed as CFU g/fresh material).

Characteristics 1st week Aerobic mesophile (CFUg-1) Filamentous fungi (CFUg-1)

4.42 x 108 4.92 x 10⁶

4.59 x 108 4.23 x 10⁶

4.76 x 108 3.54 x 10⁶

4.37 x 107 3.44 x 10⁶

3.97 x 10⁷ 3.33 x 10⁶

3.17 x 108 2.25 x 10⁶

2nd week Aerobic mesophile (CFUg-1) -1 Filamentous fungi (CFUg )

2.66 x 106 6 3.21 x 10

2.95 x 106 5 1.11 x 10

3.24 x 106 5 1.96 x 10

2.80 x 106 5 1.76 x 10

2.36 x 106 5 1.55 x 10

1.92 x 106 1.98 x 10⁶

3rd week Aerobic mesophile (CFUg-1) Filamentous fungi (CFUg-1)

2.38 x 104 1.83 x 104

2.32 x 104 1.06 x 103

2.25 x 104 0.85 x 103

2.33 x 104 1.13 x 103

1.48 x 105 0.95 x 103

1.22 x 105 1.16 x 104

4th week Aerobic mesophile (CFUg-1) Filamentous fungi (CFUg-1)

1.35 x 103 1.08 x 103

1.80 x 103 <10

1.76 x 104 <10

1.16 x 104 <10

1.32 x 104 <10

1.20 x 104 1.15 x 103

5th week Aerobic mesophile (CFUg-1) -1 Filamentous fungi (CFUg )

1.20 x 102 <10

1.70 x 102 < 10

1.58 x102 <10

1.13 x 102 <10

1.12 x 102 <10

1.10 x 102 <10

CFU = Colony formed unit.

x 106 to 2.25 x 106 CFUg-1 of fresh compost (Table 3). The microbial density decreased after 4 weeks of composting. The range was between 1.80 x 103 and 1.16 x 104 of total aerobic mesophilic. No filamentous fungi were detected in T2 (IMOSWR-CS ), T3 (IMOAFPW-PH ) T4 (IMOAFPW-CS ) and T5 (IMOKW-PH) while the result shown 1.08 x 103 on T1 (IMOSWR-PH ) and 1.15 x 103 on T6 (IMOKW-CS). Results show that at the early phase of the composting process (temperature of 20 to 40°C) mesophilic bacteria were the dominant degraders of fresh organic residue. Mesophilic microorganisms were partially killed or inactivated during the thermogenic stage (temperature 40

to 60°C). On compost sanitation, pathogen fungi received more attention than any other microorganisms (Strauch, 1996). Fungi and spores are known to be resistant to adverse conditions and longevity in soil, although they are unable to withstand the temperature that prevails in compost piles during peak heating. Other major environmental factors such as temperature, moisture content and acidity may have caused elimination of fungi and their propagules during composting (Beffa et al., 1996; Bollen, 1993). In this study, the number of filamentous fungi decreased slowly which may be explained by the non-aggressive environmental factors prevailing in the residues heap at the end of the composting process:

8462

Afr. J. Biotechnol.

medium temperature and moisture content and a slight alkalinisation (pH around 7.9 to 8.2). Conclusion IMO-compost from CS had better quality (chemical characteristics) compared to that of PH. High quality compost could be produced from CS. ACKNOWLEDGEMENTS This research was partially supported by Fundamental Research Grant Scheme (FRGS) (No.: 91784-2) and Ministry of Higher Education. Abbreviations: PH, Paddy husk; CS, corn stalks; IMO, indigenous microorganisms; SWR, steamed white rice; AFPW, aerated fish pond water; KW, kitchen waste; HAs, humic acidS; CEC, cation exchange capacity.

REFERENCES Auldry CP, Ahmed OH, Nik Muhamad AM, Mohammad Nasir H, Jiwan M, Banta MG (2009). Chemical Characteristics of Compost and Humic Acid from Sago Waste (Metroxylon sagu).Am. J. Appl. Sci. 6(11): 1880-1884. Auldry CP, Ahmed OH, Nik Muhamad AM, Mohammad Nasir H, Jiwan M, Banta MG (2010). Effect of K-N-Humates on Dry Matter Production and Nutrient Use Efficiency of Maize. The Scientific World Journal: TSW Environment, 10:1282-1292. Ahmed OH, Husni MHA, Anuar AR, Hanafi MM, Angela EDS (2004). A modify way of producing humic acid from composed pineapple leaves. J. Sustain. Agric. 25: 129-139. Amir S, Hafidi M, Merlina G, Hamdi H, Revel JC (2004). Elemental analysis, FTIR, 13C-NMR of humic acids from sewage sludge composting. Agronomie, 24: 13-18. Beffa T, Blanc M, Marilley L, Lott Fisher J, Lyon PF, PF (1996). Taxonomic and metabolic microbial diversity during composting. In: De Bertoldi M, Sequi P, Lemmes B, Papi T (Eds.). The Sciences of Composting. Blackie Acad. Professional, Glasgow, UK, pp. 149-161. Bollen GJ (1993). Factors involved in inactivation of plant pathogens during composting of croip residues. In: Hoitink HAJ, Keener HM (Eds.), Science and Engineering of Composting. Renaissance Publications, Ohio, pp. 301-319. Bremner JM (1965). Total Nitrogen. In, Method of soil analysis, Black CA, Evants DD, Ensminger LE, White JL, Clark FE, Dinauer RC (eds.), Ame. Soc. Agron. Madison, Wisconcin. 2: 1149-1178. Bustamante MA, Moral R, Paredes C, Vargas-García MC, SuárezEstrella F, Moreno J (2008). Evolution of the pathogen content during co-composting of winery and distillery wastes. Bioresour. Technol. 99: 7299-7306. Campitelli P, Ceppi S (2008). Effects of composting technologies on the chemical and physicochemical properties of humic acids. Geoderma, DOI: 10.1016/j.geoderma.2007.12.003. 144: 325-333. Campitelli PA, Velasco MI, Ceppi SB (2006). Chemical and physicochemical characteristics of humic acids extracted from compost, soil and amended soil. Talanta, DOI: 10.1016/j.talanta.2005.12.048. 69: 1234-1239. Canet R, Pomares F, Cabot B, Chaves C, Ferrer E, Ribó M, Albiach MR

(2008). Composting olive mill pomace and other residues from rural southeastern Spain. Waste Manage. 28: 2585-2592. Chefetz B, Hatcher PH, Hadar Y, Chen Y (1996). Chemical and biological characterization of organic matter during composting of municipal solid waste. J. Environ. Qual. 25: 776-785. Fukushima M, Tanaka S, Nakamura H, Ho S (1996). Acid-base characterization of molecular weight fractionated humic acid. Talanta, 43: 383-390. Hoon P, Michael WD (2008). How to cultivate indigenous microorganisms. Biotechnology, 9: 1-7. Inbar Y, Chen Y, Hardar Y (1990). Humic substances formed during the compositing of organic matter. Soil Sci. Soc. Am. J. 54: 1316-1323. Kahlon SS, Dass SK (1987). Biological conversion of paddy straw into feed. Biological Wastes, 22: 11-21. Korenaga T, Liu X, Huang Z (2001). The influence of moisture content on polycyclic aromatic hydrocarbons emission during rice straw burning. Chemosphere-Global Change Science. 3: 117-122. Lu AL, Kumar M, Tsai JC, Lin JG (2008). High-rate composting of barley dregs with sewage sludge in a pilot scale bioreactor. Bioresour. Technol. 99: 2210-2217. Miller FC (1996). Composting of municipal solid waste and its components. In: Palmisano, A.C., Barlaz, M.A. (Eds.), Microbiol. Solid Waste. CRC Press, pp. 115-154. Murphy J, Riley JI (1962). A modified single solution method for the determination of phosphate in natural waters. Anal. Chim. Acta. 27: 31-36. Morita RY (1975). Psychrophilic bacteria. Bacteriological reviews, (1975 Jun) 39(2): 144-167. Orlov DS (1986). Humus acids of soils. Balkema, Rotterdam. Pérez-Murcia MD, Moreno-Caselles J, Moral R, Pérez-Espinosa C, Paredes B, Rufete A (2005). Use of composted sewage sludge as horticultural growth media: effects on germination and trace element extraction. Commun. Soil Sci. Plant Anal. 36: 571-582. Piccolo A, Zaccheo P, Genevini PG (1992). Chemical characterization of humic substances extracted from organic-waste-amended soils. Bioresour. Technol. 40: 275-282. Pope III CA, Ezzati M, Dockery DW (2009). Fine-particulate air pollution and life expectancy in the United States. N. Engl. J. Med. 360: 376386. Rivero C, Chirenje T, Ma LQ, Martinez G (2004). Influence of compost on soil organic matter quality under tropical conditions. Geoderma, DOI: 10.1016/j.geoderma. 03.002. 123: 355-361. Soumare M, Demeyer A, Tack FMG, Verloo MG (2002). Chemical characteristics of Malian and Belgian solid waste composts. Bioresour. Technol. 81: 97-101.Stevenson FJ (1994). Humus nd Chemistry: Genesis, Composition, Reactions. (2 Ed.), John wiley and Sons, New York, ISBN: 0471594741, p. 512. Stevenson FJ (1982). Humus Chemistry. Wiley, New York. Stevenson FJ, Goh KM, (1971). Infrared spectra of humic acids and related substances. Geochim. Cosmochim. Acta. 35: 471-483. Strauch D (1996). Occurrence of microorganisms pathogenic for man and animals in source separated biowaste and compost importance, control, limits and epidemiology. In: De Bertoldi, M., Sequi P, Lemmes B, Papi T (Eds.). The Sciences of Composting. Blackie Academic and Professional, Glasgow, UK, pp. 224-232. nd Tan KH (2005). Soil sampling, preparation, and analysis (2 ed.), Boca Raton, Florida, USA. Tan KH (2003). Humic Matter in Soil and the Environment: Principles and Controversies. Marcel Dekker, Inc., New York, ISBN: 0-82474272-9, p. 408. USEPA (1999). Environmental regulations and technology. Control of pathogens and vector attraction in sewage sludge (including domestic septage). Under 40 CFR part 503. Appendix F, G, and I. EPA/625/R-92-013. U.S. Environmental Protection Agency Office of Research and Development. National Risk Management Research Laboratory. Cincinnati, OH: Center Environ. Res. Infor. Wang XM, Wang QH, Ren NQ, Wang XQ (2005). Lactic acid production from kitchen waste with a newly characterized strain of Lactobacillus plantarum. Chem. Biochem. Eng. Qual. 19: 383-389. Wang ZD, Pant BC, Langford CH (1990). Spectroscopic and structural characterization of a Laurentian Fulvic acid: notes on origin of color.

Hanim et al.

Anal. Chim. Acta. 232: 43-49. Weber J, Karczewska A, Drozd J, Licznar M, Licznar S, Jamroz E , Kocowicz A (2007). Agricultural and ecological aspects of a sandy soil as affected by the application of municipal solid waste composts. Soil Biol. Biochem. 39: 1294-1302.

8463

Wei Z, Xi B, Zhao Y, Wang S, Liu H, Jiang Y (2007). Effect of inoculating microbes in municipal solid waste composting on characteristics of humic acid. Chemosphere, DOI: 10.1016/j. chemosphere.2006.12.067. 68: 368-374.

Full Length Research Paper

Biological control of Fusarium foot rot of wheat using fengycin-producing Bacillus subtilis isolated from salty soil REBIB Hanene1, HEDI Abdeljabbar1, ROUSSET Marc2, BOUDABOUS Abdellatif1, LIMAM Ferid3 and SADFI-ZOUAOUI Najla1* 1

Laboratoire Microorganismes et Biomolécules Actives, Faculté des Sciences de Tunis, Campus universitaire, 2092 Tunisia. 2 Laboratoire de Bioenergétique et Ingénierie des Protéines, CNRS UPR 9036, Marseille Cedex 20, Tunisia. 3 Centre de Biotechnologie, Technopole Borj-Cedria, BP-901, 2050 Hammam-lif, Tunisia. Accepted 23 March, 2012

Bacillus species are well known for their ability to control plant diseases through various mechanisms, including the production of secondary metabolites. Bacillus subtilis SR146 isolated from Tunisian salty soil showed in vitro activity against several species of Fusarium including Fusarium culmorum, Fusarium graminearum, Fusarium oxysporum, Fusarium melonis, Fusarium equiseti and Fusarium solani. Moreover, wheat seeds treated with SR146 strain was effective in controlling foot rot disease in wheat caused by F. culmorum under a glasshouse assay. The bacterial strain SR146 markedly increased the plant seedling emergence in comparison to the non-infested experimental series. Complete inhibition of F. culmorum spores germination by the strain SR146 was also observed. The highest levels of antifungal metabolites produced by B. subtilis SR146 were detected during bacterial stationary growth phase. The compounds which are responsible for antifungal activity were purified and characterized. Identification by mass spectrometry showed high similarity to fengycin, this result was confirmed by polymerase chain reaction (PCR) detection of the fenA gene of the fengycin operon. Key words: Bacillus subtilis, foot rot, Fusarium culmorum, fengycin, Matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS), polymerase chain reaction detection. INTRODUCTION Fusarium foot rot is an economically important disease of cereals in many grain-producing regions of the world (Cook, 1980; Wiese, 1987), especially in areas with low to intermediate rainfall such as North Africa. In Tunisia, a 44% yield loss was reported (Ghodbane et al., 1974) and a recent survey conducted showed that Fusarium culmorum was the principal causal agent (Gargouri et al., 2001, 2003). To control various phytopathogenic fungi, including F. culmorum, agrochemicals have been used for a long time. Widespread use of agrochemicals has

*Corresponding author. E-mail: zouaouinajla@yahoo.fr/ sadfi.najla@gmail.com. Tel: 216-70-50 553. Fax: 216-71-885 480.

certainly decreased the outbreak of fungal diseases, but at the same time has contributed to the development of resistant pathogens (Raposo et al., 2000). Moreover, such chemicals can be lethal to beneficial microorganisms in the rhizosphere and useful soil insects, and they may also enter food chain and accumulate in the human body as undesirable chemical residues (Barlett et al., 2002).To overcome the aforementioned problems, a non-hazardous alternative such as biological control has been extensively studied and the use of bacterial strains as biological control agents has received great attention because of the ability of such strains to suppress different plant diseases involving a blend of diverse mode of actions (Baehler et al., 2006; Cazorla et al., 2006). Members of the Bacillus genus are among the beneficial bacterial that can be exploited as biopesticides in plant

Rebib et al.

health care (Pérez-Garcia et al., 2011). In addition, many species of Bacillus are known to suppress several fungal pathogens growth such as Fusarium moniliforme (Bacon et al., 2001; Pal et al., 2001), Podosphaera fusca (Romero et al., 2004), Rhizoctonia, Sclerotinia, Gaeummanomyces, Nectria, Pythium and Phytophthora (McKnight, 1993). They assume their antagonistic effects mainly by the production of antifungal compounds (Sadfi et al., 2002; Pryor et al., 2006), which seem to play a major role in the biological control of fungal plant pathogens (Ongena et al., 2005a; Pryor et al., 2006) and post-harvest spoilage fungi (Klich et al., 1994; Janisiewicz and Korsten, 2002). Lipopeptides, oligopeptides synthesized in a nonribosomal manner (Moyne et al., 2001), represent the most common class of antifungal compounds produced by Bacillus spp. (Stachelhaus et al., 2002). These amphiphilic compounds share a common cyclic structure and are classified into three different families depending on the amino acid sequence: surfactins, iturins and fengycins (Ongena and Jacques, 2008). Moreover, these cyclic lipopeptides produced by Bacillus strains are also used as biocontrol agents for plant disease reduction (Arrebola et al., 2010; Romero et al., 2007; Yu et al., 2002; Zeriouh et al., 2011). Among them, fengycins have been shown to exhibit strong antifungal activity in the biocontrol of damping-off of bean seedling caused by Pythium ultimum and gray mold disease of apple caused by Botrytis cinerea (Ongena et al., 2005b). Similarly, bacillomycin D exhibits strong antifungal activity towards aflatoxin-producing fungi, such as Aspergillus flavus (Moyne et al., 2001). Other lipopeptides such as iturin A also exhibit a strong antifungal activity and they can be potential for biocontrol (Arrebola et al., 2010; Cho et al., 2003; Yoshida et al., 2002). In addition to this direct antifungal activity, lipopeptides might also contribute to plant disease control by suppressing biofilm formation by pathogens or by inducing a global defense response in the plant known as induced systemic resistance (ISR) (Ongena et al., 2007). In this study, an antagonistic bacterial strain SR146 isolated from salty soil was identified as Bacillus subtilis and characterized to function against F. culmorum in vitro and in wheat seeds for controlling foot rot disease in wheat. Antifungal active compounds from culture of SR146 were purified by reverse phase high performance liquid chromatography (HPLC) and identified by mass spectrometry. Finally, the gene produced by SR146 responsible for the antifungal trait was amplified.

MATERIALS AND METHODS Isolation of antagonistic bacteria and identification The methods used for screening various Bacillus strains were based mainly on the resistance of their endospores to elevated

8465

temperatures (Sadfi et al., 2001). Bacillus strains used in this paper were isolated from Tunisian salty soil located in the North of Tunisia (Sebkha of Raoued). To isolate and enumerate soil bacteria, we used three 10 g soil subsamples. These samples were treated in a water-bath at 80°C for 10 min so that endospores would be separated from vegetative cells (Walker et al., 1998). A decimal dilution series was prepared in sterile distilled water up to 10 -5. From each dilution, 0.1 ml aliquots were spread-plated onto tryptic soy agar (TSA, Difco) supplemented with 0.5% NaCl (w/v). The plates were then incubated at 30°C for 72 h. The distinct single colonies were picked and streaked several times to obtain pure cultures. Strains were then maintained on TSA slants at 4°C and subcultured every two-month intervals. For long term storage, strains were conserved in 75% glycerol at -80°C. The most effective isolate was identified using biochemical, physiological and 16S rDNA sequence analysis method. The 16S rDNA was amplified by PCR using two universal primers S-D-Bact0008-a-S-20 and S-D-Bact-1495-a-A-20. The polymerase chain reaction program was as follows: 95°C for 4 min, followed by 35 cycles of 94°C for 45 s, 55°C for 45 s, 72°C for 1 min, and a final 7 min extension at 72°C. The purified 16S rDNA was sequenced directly by the dideoxynucleotide chain-termination method (Sanger et al., 1977) using the ABI PRISM Big Dye Terminator Cycle sequencing Ready Reaction Kit (Applied Biosystems) as recommended by the manufacture. The purified sequencing reaction mixtures were automatically electrophoresed using an Applied Biosystems model 310 automatic DNA sequencer. Phylogenic trees were constructed by the neighbour-joining method (bioNJ) (Saitou and Nei, 1987), using CLUSTALX program, and maximum parsimony (Felsenstein, 1993).

Fungal isolates and culture conditions Fusarium culmorum, Fusarium graminearum, Fusarium oxysporum, Fusarium melonis, Fusarium equiseti, Fusarium solani and Botrytis cinerea were obtained from the collection of the Laboratory of Mycology of the Institut National de la Recherche Agronomique de Tunisie (INRAT). These fungi were routinely grown on potato dextrose agar (PDA, Difco) medium at 25°C and subcultured onto fresh PDA plates within a period of two months.

In vitro screening of isolates for antagonism Bacillus isolates were screened in vitro against different phytopathogenic fungi by applying a dual culture technique in Petri dishes on PDA medium. Bacillus isolates were streaked in a straight line at one side of the Petri dish (4 cm from the center). Simultaneously, a 1 cm mycelial plug cut from the edge of a seven day-old culture of the fungal strain was placed at the center of the plate. After seven days at 28°C the inhibition of fungal growth was assessed by measuring the inhibition zone (mm) using the method described by Sadfi-Zouaoui et al. (2008). All in vitro antagonism assays were made in triplicate.

Culture condition and antifungal production To confirm the presence of the antifungal agent in the culture supernatant, the active strain B. subtilis SR146 was cultivated overnight in tryptic soy broth (TSB) at 30°C with vigorous shaking. The culture was centrifuged (10000 g for 15 min) and filtered through a 0.22 µm filter. An agar well diffusion assay was used to determine qualitatively the ability of antifungal substances produced by B. subtilis SR146 to inhibit mycelial growth of various species of Fusarium. The inoculum of Fusarium species was prepared by

8466

Afr. J. Biotechnol.

harvesting fungal spores in Tween 20 water solution (0.1%) to give a concentration of 107 spores/ml. Then, the inoculum (0.1 ml) was added to 20 ml of PDA and plates were allowed to dry for 30 min. A well, with a diameter of 5 mm, was cut into the agar using a sterile cork borer and a 100 µl-aliquot of the cell-free supernatant culture of SR146 was deposed into the well. The control consisted of 50 µl of filter-sterilized distilled water. Plates were kept at 5°C for 24 h to allow for diffusion of the metabolite, then were inverted and incubated at 25°C for three to four days. They were examined for the presence of a clear inhibition zone around the wells. The diameter of the latter was measured to determine the level of production during the growth cycle. The number of units of antifungal substance was calculated and one arbitrary unit (AU) of antifungal metabolite was defined as the amount of antifungal metabolite preparation sufficient to give a zone of inhibition around the well and calculated as the reciprocal of the highest dilution factor of the sample. For antifungal production, B. subtilis SR146 was inoculated (1%, v/v) into 250 ml of sterile TSB and incubated at 30°C for 48 h on a rotary shaker. Two-milliliter samples were aseptically removed every 2 h. Cell growth was monitored spectrophotometrically (A600) and antifungal activity of the culture supernatant was evaluated against F. culmorum, by the well-diffusion method (Sadfi et al., 2002) and expressed as the inhibition zone diameter (mm) and as specific activity (AU ml-1).

Biochemical characterization of the antifungal compounds For biochemical characterization of the responsible compounds, the antifungal activity of cell-free filtrates was subjected to the following treatments: (1) Heat treatments at 55, 65, 75, 85 and 95°C for 30 min and at 121°C for 20 min. (2) To test the effect of pH, the extract was adjusted to pH values in the range of two to 12 separately using either 0.5 M HCl or NaOH and incubated for 24 h at 20°C. The samples were restored to neutral pH and subjected to bioassay. (3) Cell-free filtrates were extracted with one volume of methanol. Both fractions, soluble and insoluble, were evaporated to dryness, resuspended in distilled water and assayed against F. culmorum. (4) Sensitivity of the antifungal agent to proteolytic enzymes (proteinase K, pepsin and papain) was determined by incubation of cell-free supernatant samples for 1 h at 37°C with proteinase K (1 mg ml-1 in 100 mM Tris-HCL buffer, pH 7.5), pepsin (1 mg ml-1 in 100 mM Tris-HCL buffer, pH 3) and in the presence of papain (1 mg ml-1 in 50 mM phosphate buffer, pH 5). Following incubation, the enzymes were heat inactivated for 3 min at 100°C. For each test, untreated antifungal compounds plus buffer, antifungal compounds plus buffer were treated for 5 min at 100°C while buffer alone and enzyme solutions served as controls. After treatments, the presence/absence of antifungal activity was tested by using the bioassay against F. culmorum similar to the technique of dual culture analysis (Romero et al., 2004) but replacing bacterial colonies by culture filtrates (Arrebola et al., 2003), and measuring the diameter of the inhibition zone seven days after incubation.

Germination test Supernatant from SR146 culture, grown for 24 h, was concentrated by lyophilization to recover the excreted antifungal metabolites. The lyophilized substances were dissolved in distilled water to obtain concentrated preparation (5X) and were sterilized by filtration (0.2 µm pore-size membrane). The evaluation of their activity on the germination of F. culmorum macrospores was performed by mixing, on microslides, 12.5 and 25 µl of the concentrate preparation with 37.5 and 25 µl, respectively, of spore suspension adjusted at 107 spores/ml. Controls consisted of 25 µl of TSB filter-sterilized containing 25 µl of the same spore suspension. After incubation at

25°C for 22 h, germination of the spores was microspically evaluated. A conidium was considered germinated if the germ tube was longer than one-half of the diameter of the conidium. All assays were performed in triplicate.

Glasshouse assay Glasshouse assays were conducted under semi-controlled conditions of temperature and humidity. Wheat seeds (cv. Karim) were artificially infected with F. culmorum suspension (1 × 105 spores/ml, 0.1%Tween 20), then treated with a bacterial cell suspension and sown in sterile soil pots. After 24 h incubation on TSA medium, SR146 bacterial cells were scraped from the surface of the Petri dishes and diluted in sterilized saline solution (1% NaCl). Cultures of 48 and 72 h were also tested under the same conditions. Bacterial suspensions were adjusted to 108 CFU/ml. Bacterial concentrations (CFU/ml) were determined by plating of serial dilutions of bacterial suspension on TSA medium. Each 5 ml suspension was poured over 10 g of artificially inoculated wheat seeds ensuring full coverage of the seeds. Bacterial treated seeds were air-dried overnight. For each treatment, six seeds were sown in six 200 ml-pots containing pasteurized soil (⅓ loam, ⅓ sand and ⅓ compost). Wheat seeds were also treated with bacteria alone at the same concentration (108 CFU/ml) and planted in soil pots. A positive control treatment (treated control) has also been done using F. culmorum as inoculum. Non-infested seeds were qualified by untreated control. The pots were placed in boxes in a glasshouse. After 16 days, symptoms of brown were recorded and scored. Seedling foot rot disease symptoms were scored as lesion color (lesion color scale: 1, no disease; 2, very slight brown necrosis; 3, slight/moderate brown necrosis; 4, exclusive brown necrosis and plant faded and 5, extensive black necrosis plant dead). The glasshouse assay was repeated twice. The statistical analysis was done using analysis of variance, and mean comparisons were carried out using Statistica program version 5.0 based on least significant difference (LSD) test.

Extraction and purification of the lipopeptides SR146 was grown to stationary growth phase, in two 2000 ml flasks containing 500 ml of TSB medium amended with glucose (20 g/l), at 30°C for 26 h with stirring at 160 rev min-1. The cells were removed by centrifugation at 5000 g for 10 min at 4°C. The supernatant was discarded and stored at -20°C for further analysis. This solution was designated as crude supernatant (CS). The crude supernatant was dissolved in 20 mmol-1 Tris-HCl buffer (pH 7.4) and loaded onto a Sep-Pack Plus C18 cartridge. After washing with water, elution was performed successively with 20, 40, 60, 80 or 100% methanol in water. These fractions were then concentrated by rotary evaporator under vacuum and tested for antifungal activity against the indicator strain. The Sep-Pack fraction which eluted with 100% methanol provided the largest zone of inhibition. Protein concentration was determined according to Bradford method using bovine serum albumin as standard (Bradford, 1976). The active fraction obtained from Sep-Pack step was submitted to reverse phase HPLC on Vydac 218TP54 C18 column (5 μM, 300 Å, 4.6 × 250 mm). The elution was carried out with a linear gradient of 0 to 60% acetonitrile in water in the presence of 0.1% trifluoroacetic acid (TFA) within 50 min at a flow rate of 1 ml min-1. Absorbance was monitored at 220 nm. The peaks were collected manually, evaporated to dryness by speed vacuum concentrator and assayed for their antifungal activity par filter disc diffusion method.

Rebib et al.

8467

Table 1. Characteristics of specific primers developed for the detection of biosynthetic genes of fengycin synthetases.

Lipopeptide

Length (bp)

G+C (%)

Temperature (°C)

Position in GenBank sequence

Product length (bp)

gacagtgctgcctgatgaaa gtcggtgcatgaaatgtacg

20 20

50 50

60 60

8242 to 8261 9136 to 9117

876

10816

cagccgctgtcaacaagata acacgacattgcgattggta

20 20

50 50

60 60

982 to 1001 1931 to 1912

950

AJ011849

7681

tttggcagcaggagaagttt gctgtccgttctgctttttc

20 20

50 50

60 60

3687 to 3706 4650 to 4631

964

AF023465

3950

gccaaaaagaaacgagcaag gtcggagctaacgctgaaac

20 20

45 55

60 60

655 to 674 1410 to 1391

756

B. subtilis strain

Primer name

GeneBank accession No.

Region

F29-3

FENA1F FENA1R

AF023464

7774

F29-3

FENB1F FENB1R

L42523.1

F29-3

FEND1F FEND1R

F29-3

FENE1F FENE1R

Primer sequence (5’ to 3’)

Fengycin

Antifungal activity assay by filter disc diffusion method Purified substances were tested for their antifungal activity by spotting them on sterile paper discs placed around the fungal disc located at the center of PDA plates. Sterile filter paper discs were loaded with 10 µl of the purified fractions suspended in methanol. Sterile filter paper discs loaded with methanol were used as the negative control. The results were recorded when the fungal mycelium grew over the control disc.

Molecular mass determination Matrix-assisted laser desorption-ionization time-of-flight (MALDI-TOF) mass spectrometric analysis was performed by a Voyager MALDI-TOF DE-RP instrument equipped with pulsed extraction and a nitrogen laser operating at 337 nm. For mass spectrometric analysis, fraction (0.7 µl) of lipopeptides purified by Sep-Pack Plus C18 and reversephase HPLC were mixed with an equal volume of 0.1% solution of -cyano-4-hydroxycinnamic acid (CHCA) in acetonitrile-water-TFA (0.1:3:7, v/v/v) used as the matrix. Mass spectra were accumulated over 100 individual laser

shots and obtained in the reflector mode at an initial accelerating voltage of 20 kV. A molecular mass gate of 350 Da improved the measurement by filtering out most matrix ions. Design of specific primers for the detection of fengycin synthetase biosynthetic genes and PCR analysis Four primer pairs were designed for the detection of the fengycin synthetase biosynthetic cluster using the web software Primer3® (Table 1) (Rozen and Skaletsky, 2000). The DNA from bacterial cultures was extracted using Wizard Genomic DNA purification Kit (Promega). PCR reactions were carried out using the methodology established by Ramarathnam et al. (2007) with the positive control B. subtilis F29-3.

colonies were subcultured on TSA medium. Of the 69 isolates screened for antagonism in vitro, only one bacterial isolate SR146 showed distinct antagonism against F. culmorum. This effective isolate was Gram-positive motile rod forming endospores. The spores survived after heating at 80°C for at least 10 min. It grew under aerobic conditions and produced catalase and oxidase and capable of reducing nitrate to nitrite. From the 16S rDNA sequence analyses, the isolate SR146 showed 99% similarity to B. subtilis subsp. spizizenii NRRL B-23049T (Figure 1). The 16S rDNA sequence of this isolate has been deposited in the GenBank database under the accession number GQ273739.

RESULTS Growth and antifungal metabolites production In vitro screening of isolates for antagonism Using the combination of techniques for the isolation procedures described earlier, 69 distinct

B. subtilis SR146 inhibited effectively the growth of a large spectrum of phytopathogenic fungi including: F. culmorum, F. graminearum, F.

8468

Afr. J. Biotechnol.

Figure 1. Relationships between strain SR146 and several other strains of Bacillus based on their 16S rDNA sequences. Bootstrap values from 100 replicates are included.

Table 2. Inhibition of mycelial growth of phytopathogenic fungi by B. subtilis SR146.

Fungal pathogen Fusarium culmorum F. graminearum F. oxysporum F. melonis F. equiseti F. solani Botrytis cinerea

*Mycelial growth inhibition (%) 82.85 78.57 71.40 35.71 46.42 60.00 86.66

*Percent growth inhibition was determined after seven days of incubation using the method described by Sadfi-Zouaoui et al. (2008).

oxysporum, F. melonis, F. equiseti, F. solani and Botrytis cinerea (Table 2). The highest antifungal activity of -1 SR146 metabolites (2560 AU ml ) was reached at the stationary growth phase (24 h) (Figure 2). Biochemical supernatants

characterization

antagonistic

The antifungal activity of cell-free filtrates was subjected

to stability tests in order to gain insight into the chemical nature of the responsible compounds. The antifungal activity of the supernatants was stable at high temperatures (55 to 121Â°C) and resistant to enzymatic degradation (pepsine, papaĂŻne and proteinase K), all of which are well known characteristics associated with the lipopeptide compounds produced by Bacillus sp. (Grover et al., 2009; Stein, 2005). Compared with untreated controls, when they were subjected to extremely acidic pH (pH 2), a large precipitation occurred with a

8469

OD (660 nm)

Rebib et al.

Figure 2. Kinetics of antifungal metabolites production during the growth of Bacillus SR146 on TSB medium supplemented with 0.5% NaCl (w/v). Antifungal substance concentration expressed as AU ml -1. ♦, Kinetics of Bacillus SR146 growth on TSB medium; ■, kinetics of antifungal metabolites production.

consequent lost of antifungal activity in the soluble phase; however, the supernatant activity could be restored by immediately dissolving the precipitates in neutral phosphate-buffered saline. It is interesting to note that acidic precipitation is a typical feature of lipopeptides, which is often used in purification protocols (Ohno et al., 1992). Furthermore, as previously shown, antifungal activity was efficiently extracted with methanol, suggesting the presence of a hydrophobic moiety in the compound which also is typical of Bacillus lipopeptides. Taken together, these results demonstrated that lipopeptides could be the compounds responsible for the antifungal activity exhibited by the B. subtilis biocontrol strains. Inhibition of fungal germination During three experiments, 50 to 81% spores from F. culmorum consistently germinated in TSB after 22 h at 25°C. In presence of 25 and 50% of lyophilized supernatant, the percentage of germination decreased from 6 to 0%, respectively (Figure 3).

culmorum in wheat. Compared with the treated control, the strain SR146 inhibited better the foot rot disease when applied as a 24 or 48 h bacterial culture than older culture (72 h) (Figure 4). Moreover, the bacterial strain SR146 markedly increased the plant seedling emergence in comparison to the non infested experimental series. In addition, as observed in our experiments, non infested seeds (untreated control) germinated five days later than seeds coated with B. subtilis SR146. Purification and identification of the antifungal metabolites The CS was first fractionated on C18 Sep-Pack cartridge at 100% methanol. The active fraction was further submitted to reverse phase HPLC, two peaks, 1 and 2, were eluted at 46.40 and 47.90 min, respectively (Figure 5). These peaks showed inhibitory activity against F. culmorum phytopathogenic fungi (Figure 6). The purified peaks, 1 and 2, were analyzed in the positive mode using mass spectrometry. Mass data indicated two major + signals for [M+H] ions at m/z 1491.39 and 1505.52 Da, respectively (Figure 7).

Biological control of foot rot in wheat

Identification of fenA Gene by PCR

Inoculation of wheat seeds with strain of B. subtilis SR146 significantly reduced the pathogenic effect of F.

Particular band from strain SR146 was amplified using primers FENA1F/FENA1R with 876 pb product length,

8470

Afr. J. Biotechnol.

Figure 3. Germination of Fusarium culmorum in; ■, tryptic soy broth (TSB); ▲, TSB containing 25 and 50%; ♦, supernatant fluid of Bacillus subtilis SR146.

SR146 (24 h)

SR146 (48 h)

SR146 (72 h)

Figure 4. Effects of wheat seed treatments with Bacillus subtilis inoculated at a 24, 48 and 72 h bacterial culture, on the seedling foot rot disease infested with Fusarium culmorum or non-infested. Bars with the same letter did not differ significantly at P = 0.05 by LSD test. Treated control, seeds inoculated with Fusarium; untreated control, seeds not inoculated with Fusarium.

suggesting that this strain might harbor the gene cluster required for fengycin biosynthesis. The agreement between PCR and HPLC results suggest that the PCR method can be used as a reliable and quick screening tool to isolate fengycin producing Bacillus strains.

DISCUSSION Bacillus species produce a broad spectrum of bioactive peptides with a high potential for pharmaceutical application and plant protection. B. subtilis species are

Rebib et al.

nm) (220 Absorbance nm) (220 Absorbance

b b

100 100

46.40 46.40

0.6 0.6 0.4 0.4

50 50

0.2 0.2 0 0

0 0

20 40 20 40 Retention time (minutes) Retention time time (min) (minutes) Retention

Peak 2 Peak 2

1.2 1.2

60 60

0 0

100 100

47.90 47.90

0.8 0.8 50 50 0.4 0.4

0 0

20 20

40 40 Retention time Retention time(minutes) (min) Retention time (minutes)

(%) Acetonitrile(%) Acetonitrile

Peak 1 Peak 1

0.8 0.8

60 60

(%) Acetonitrile (%) Acetonitrile

nm) (220nm) Absorbance(220 Absorbance

a a

8471

0 0

Figure 5. Elution profile of SR146 antifungal compunds using HPLC reverse phase chromatography on C18 column monitoring by absorbance at 220 nm. Peak 1 (a) and peak 2 (b) corresponded to antifungal compounds elution.

well knownFigure for producing lipopetides such as infecting foot rot of wheat. To ourHPLC knowledge, this is the 5. Elution profile of surfactin, SR146 antifungal compunds using Figure Elutionof profile of SR146 compunds using HPLC fengycin and the 5.members iturin family (iturin, antifungal first study involving a halotolerant antagonistic bacterial mycosubtilin, bacillomycin) (Stellerphase and Vater, 2000). In strain from salty soil for controlling reverse chromatography on isolated C18 column monitoring by a foot wheat reverse phase chromatography on C18 column this study, the halotolerant isolate of SR146, identified as disease. In our recent monitoring earlier studies,by we demonstrated belonging to B. subtilis, absorbance effectively inhibited the mycelial the ability of halotolerant and moderately halophilic at 220 nm. Peak 1 (a) and Peak 2 (b) corresponded to growth of F. culmorum and other phytopathogens in vitro. strains the genus for controlling absorbance at 220 nm. Peak 1 (a) andofPeak 2 (b)Bacillus corresponded to B. cinerea on The inhibition zone couldantifungal be due to the effect of diffusible compounds elution. tomatoes and strawberries (Sadfi-Zouaoui et al., 2008; inhibitory substances produced by the bacteria, which antifungal compounds elution. Essghaier et al., 2009). Some strains of B. subtilis have suppressed the growth of F. culmorum. Indeed, been successfully used as biocontrol agents of according to Crawford et al. (1993), the presence and phytopathogens (Gueldner et al., 1988; Asaka and size of the zone of inhibition have been used as evidence Shoda, 1996; Nourozian et al., 2006). In fact, our data shows that strain of B. subtilis SR146 of the production of antibiotics by the bacteria. These results indicate that strain SR146 might have a broad inhibited better the foot rot disease on wheat when spectrum of antifungal activities. The glasshouse assay applied as a 24 or 48 h bacterial culture. This may undertaken under semi-controlled conditions demonindicate that the ability of these species to control strates the ability of this bacterium to control F. culmorum Fusarium foot rot is correlated with their growth phase. A

8472

Afr. J. Biotechnol.

Figure 6. Inhibition of radial mycelial growth of Fusarium culmorum by the purified peaks 1 and 2. Five microlitres of the purified lipopeptides was loaded onto sterile filter paper discs.

growing body of evidence indicates that production of antifungal metabolites by Bacillus species appears to be related to their physiological and development stages (vegetative growth, sporulation and germinating spore) (Walker et al., 1998; Sadfi et al., 2001). Moreover, the bacterial strain SR146 markedly increased the plant seedling emergence in comparison to the experimental series non-infested. This result was in concordance with works of Czaban et al. (2004) and in fact some works showed that B. subtilis strains had been found to be effective as plant growth-promoting rhizobacteria (PGPR) that increase plant growth after inoculation onto seeds (Bai et al., 2002). According to Berg (2009), PGPR are also employed for controlling plant pathogens, enhancing efficiency of fertilizers and degrading xenobiotic compounds. Identification of the growth stage under which the antagonist is the most effective will be useful to enhance the biocontrol potential of this Bacillus species against Fusarium foot rot development. The antifungal activity was also present in the supernatant filtrate of the culture of B. subtilis SR146 and it was due to the metabolite(s) being released from the

bacterium into the culture medium. The highest levels of antifungal metabolites produced by B. subtilis SR 146 were detected at the middle of bacterial stationary growth phase. A growing body of evidence indicates that production of antifungal metabolites by Bacillus species appears to be related to their physiological and development stages (Walker et al., 1998). The antifungal activity was very heat stable which is an extremely interesting feature in view of its potential use in agro-industries, resistant to the action of many hydrolytic enzymes. These characteristics indicate that the antifungal compounds may belong to lipopeptides (Souto et al., 2004), most of the known antifungal agents produced by B. subtilis are polypeptides (Munimbazi and Bullerman, 1998), including iturin (Moyne et al., 2001) and fengycin (Vanittanakom et al., 1986). The composition and relative concentrations of the lipopeptides produced are dependent on both the bacterial strain and the fermentation conditions in which it was cultivated (Akpa et al., 2001; Schimana et al., 2001). By HPLC, two major peaks were fractionated and their antifungal activity was examined. The purified peaks, 1 and 2, showed two major molecular ions [M+H] + with m/z of 1491.39 and 1505.52 Da, respectively. The mass data revealed differences of 14 Da, suggesting that the purified antifungal compounds had different carbon chain lengths and corresponded well to those of fengycins previously described (Steller and Vater, 2000; Vater et al., 2002; Kim et al., 2004). PCR amplification of biosynthetic gene corresponding to fengycin confirms the HPLC and the MALDI-TOF- MS concerning the fengycin production by B. subtilis SR146, in fact the detection of a particular antibiotic biosynthetic operon in bacterial strain would signify the function of the operon and the production of the antibiotics (Athukorala et al., 2009). Besides fengycins, no other antifungal compound was detected; suggesting that these last might play a main part in the biocontrol of the phytopathogenic fungus F. culmorum. It has been reported that the biological activity of iturins as well as fengycins produced by B. subtilis, depended on the chain length of their fatty acids and the composition of the amino acids in their peptide rings (Peypoux et al., 1978; Quentin et al., 1982). Whether fengycin homologues used the same characters as iturins requires more investigations. Fengycins have antifungal activity against some filamentous fungi in vitro (Vanittanakom et al., 1986). However, up to date, no report has been available on the antifungal application of fengycins in practice. It is noted that fengycin homologues are less toxic for erythrocytes than iturin A (Vanittanakom et al., 1986), and its hemolytic activity is 40-fold less than that of surfactin (Deleu et al., 2005). Thus, B. subtilis SR146 might be one of the ideal candidates to control wheat infection caused by F. culmorum.

Rebib et al.

1491.39

100

8473

8177.5

Peak11 A:A:Peak

% Intensity

Intensity (%)

80 70 60 50 40

30 20

1513.21 1461.67

1475.15 1536.59

0700

1260

1820

Mass (m/z)

2380

0 3500

2940

1505.52

100

7655.5

B: Peak 2

Intensity (%) % Intensity

80 70 1527.40 60

50 40 1489.33

1548.62 1561.96

20 10

1461.20

995.22 0700

1260

3006.97 1820

Mass (m/z)

2380

2940

0 3500

Figure 7. Mass of pure Fengycin corresponding to peaks 1 and 2, relative to intensity function of mass Figure 7. spectrum Mass spectrum of pure Fengycin corresponding peakas1a and peak 2: to charge ratio (m / z). The molecular mss of Fengycin is indicated.

relative intensity as a function of mass to charge ratio (m / z). The Conclusion

observed. molecular mss of Fengycin is indicated.

This study shows that an antagonistic bacterial strain SR146, isolated from salty soil and identified as B. subtilis, inhibited F. culmorum in vitro and controlled successfully the foot rot disease on wheat under semicontrolled conditions. Total inhibition of F. culmorum spores germination by the strain SR146 was also

The highest levels of antifungal metabolites produced by B. subtilis SR146 were detected during bacterial stationary growth phase and these may belong to fungycin lipopeptides based on results of biochemical and molecular purification. Actually, no fungicides are available to control Fusarium diseases efficiently; therefore, antifungal agents produced by microorganisms may be used as biocontrol agents. However, up to date,

8474

Afr. J. Biotechnol.

no report has been available on the antifungal application of fengycins in practice. Future works should be undertaken to study the stability of such antifungal metabolites under varying and unsterile environmental conditions. REFERENCES Akpa E, Jacques P, Wathelet B, Paquot M, Fuchs R, Budzikiewicz H, Thonart P (2001). Influence of culture conditions on lipopeptide production by Bacillus subtilis. Appl. Biochem. Biotech. 91-93: 551562. Arrebola E, Jacobs R, Korsten L (2010). Iturin A is the principal inhibitor in the biocontrol activity of Bacillus amyloliquefaciens PPCB004 against postharvest fungal pathogens. J. Appl. Microbiol. 108: 386395. Arrebola E, Cazorla FM, Durán VE, Rivera E, Olea F, Codina JC, Pérez-García A, de Vicente A (2003). Mangotoxin: A novel antimetabolite toxin produced by Pseudomonas syringae inhibiting ornithine/ arginine biosynthesis. Physiol. Mol. Plant. Pathol. 63: 117127. Asaka O, Shoda M (1996). Biocontrol of Rhizoctonia solani damping-off of tomato with Bacillus subtilis RB14. Appl. Environ. Microbiol. 62: 4081-4085. Athukorala SN, Fernando WG, Rashid KY (2009). Identification of antifungal antibiotics of Bacillus species isolated from different microhabitats using polymerase chain reaction and MALDI-TOF mass spectrometry. Can. J. Microbiol. 55: 1021-1032. Bacon CW, Yates IE, Hinton DM, Meredith F (2001). Biological control of Fusarium monliforme in maize. Environ. Health Persp. 2: 325-332. Baehler E, de Werra P, Wick, LY, Péchy-Tarr M, Mathys S, Maurhofer M, Keel C (2006). Two novel Mvat-like global regulators control exoproduct formation and biocontrol activity in root-associated Pseudomonas fluorescens CHAO. Mol. Plant-Microbe Interact. 19: 313-329. Bai Y, D'Aoust F, Smith DL, Driscoll BT (2002). Isolation of plant growth-promoting Bacillus strains from soybean root nodules. Can. J. Microbiol. 48: 230-238. Bartlett DW, Clough JM, Godwin J R, Hall AA, Hamer M, ParrDobrzanski B (2002). The strobilurin fungicides. Pest. Manage. Sci. 58: 649-662. Berg G (2009). Plant-microbe interactions promoting plant growth and health: perspectives for controlled use of microorganisms in agriculture. Appl. Microbiol. Biotechnol. 84: 11-18. Bradford MM (1976). A rapid and sensitive method for quantification of microgram quantities of protein utilising the principle of protein-dye binding. Analyt. Biochem. 72: 248-254. Cazorla FM, Dukett SB, Berström ET, Noreen S, Odijk R, Lugtenberg BJJ, Thomas-Oates JE, Bloemberg GV (2006). Biocontrol of avocado Dematophora root rot by antagonistic Pseudomonas fluorescens PCL1606 correlates with the production of 2-hexyl 5 propyl resorcinol. Mol. Plant-Microbe Interact. 10:79-86. Cho SJ, Lee SK, Cha BJ, Kim YH, Shin KS (2003). Detection and characterization of the Gleosporium gloeosporioides growth inhibitory compound iturin A from Bacillus subtilis strain KS03. FEMS Micobiol. Lett. 223: 47-51. Cook RJ (1980). Fusarium foot rot and its control in the Pacific northwest. Plant Dis. 64: 1061-1066. Crawford DL, Lynch JM, Whips JM, Ousley MA (1993). Isolation and characterization of actinomycetes antagonists of fungal root pathogen. Appl. Environ. Microbiol. 59: 3899-3909. Czaban J, Ksiezniak A, Perzynski A (2004). An attempt to protect Winter Wheat against Fusarium culmorum by the use of Rhizobacteria Pseudomonas fluorescens and Bacillus mycoides. Polish. J. Microbiol. 53: 175-182. Deleu M, Paquot M, Nylander T (2005). Fengycin interaction with lipid monolayers at the air-aqueous interface-implications for the effect of fengycin on biological membranes. J. Colloid. Interface. Sci. 283: 358365.

Essghaier B, Fardeau ML, Cayol JL, Hajlaoui MR, Boudabous A, Jijakli H, Sadfi-Zouaoui N (2009). Biological control of grey mould in strawberry fruits by halophilic bacteria. J. Appl. Microbiol. 106: 833846. Felsenstein J (1993). PHYLIP (Phylogeney Inference Package, version 35c). Department of Genetics, SK, University of Washinton, seattle, WA Gargouri S, Bernier L, Hajlaoui MR, Marrakchi M (2003). Genetic variability and population structure of the wheat foot rot fungus, Fusarium culmorum, in Tunisia. Eur. J. Plant Pathol. 109: 807-815. Gargouri S, Hajlaoui MR, Guermech A, Marrakchi M (2001). Identification des espèces fongiques associées à la pourriture du pied du blé et leur répartition selon les étages bioclimatiques. EPPO/OEPP Bull. 31: 499-503. Ghodbane A, Mahjoub M, Djerbi M, Mlaiki A, Sharen, A (1974). Project on Septoria and Root Rot. Montana state University. Bozeman (US). Grover M, Nain L, Saxena AK (2009). Comparision between Bacillus subtilis RP24 and its antibiotic-defective mutants. World J. Microbiol. Biotechnol. 25: 1329-1335. Gueldner RC, Reilly CC, Pusey PL, Costello CE, Arrendale RF, Cox RH, Himmelsbach DS, Crumley FG, Cutler HG (1988). Isolation and identification of iturins as antifungal peptides in biological control of peach brown rot with Bacillus subtilis. J. Agric. Food. Chem. 36: 366370. Janisiewicz WJ, Korsten L (2002). Biological control of post-harvest diseases of fruits. Ann. Rev. Phytopathol. 40: 411-441. Kim PI, Bai H, Chae H, Chung S, Kim Y, Park R, Chi YT (2004). Purification and characterization of a lipopeptide produced by Bacillus thringiensis CMB26. J. Appl. Microbiol. 97: 942-949. Klich MA, Arthur KS, Lax AR, Blang JM (1994). Iturin A: a potential new fungicide for soared grains. Mycopathology, 127: 123-127. McKnight SE (1993). Effects of Bacillus subtilis on cotton seedling development. Nottingham: University of Nottingham, PhD Thesis. Moyne AL, Shelby R, Cleveland TE, Tuzun S (2001). Bacillomycin D: an iturin with antifungal activity against Aspergillus flavus. J. Appl. Microbiol. 90: 622-629. Munimbazi C, Bullerman LB (1998). Isolation and partial characterization of antifungal metabolites of Bacillus pumilus. J. Appl. Microbiol. 84: 959-968. Nourozian J, Etebarian HR, Khodakaramian G (2006). Biological control of Fusarium graminearum on wheat by antagonistic bacteria, Nutraceut. Func. Food 28: 29-38. Ohno A, Ano T, Shoda M (1992). Production of a lipopeptide antibiotic surfactin with recombinant Bacillus subtilis. Biotechnol. Lett. 14: 1165-1168 Ongena M, Jacques P (2008). Bacillus lipopeptides: Versatile weapons for plant disease control. Trends Microbiol. 16: 115-125. Ongena M, Jourdan E, Adam A, Paquot M, Brans A, Joris B, Arpigny JL, Thonart P (2007). Surfactin and fengycin lipopeptides of Bacillus subtilis as elicitors of induced systemic resistance in plants. Environ. Microbiol. 9: 1084-1090. Ongena M, Duby F, Jourdan E, Beaudry T, Jadin V, Dommes J, Thonart P (2005a). Bacillus subtilis M4 decreases plant susceptibility towards fungal pathogens by increasing host resistance associated with differential gene expression. Appl. Microbiol. Biotechnol. 67: 692-698. Ongena M, Jacques P, Touré Y, Destain J, Jabrane A, Thonart P (2005b). Involvement of fengycin-type lipopeptides in the multifaceted biocontrol potential of Bacillus subtilis. Appl. Microbiol. Biotechnol. 69: 29-38. Pal KK, Tilak KV, Saxena AK, Dey R, Singh CS (2001). Suppression of maize root diseases caused by Macrophomina phaseolina, Fusarium moniliforme and Fusarium graminearum by plant growth promoting rhizobacteria. Microbiol. Res. 156: 209-223. Pérez-García A, Romero D, de Vicente A (2011). Plant protectionand growth stimulation by microorganisms: Biotechnological applications of Bacilli in agriculture. Curr. Opin. Biotechnol. 22: 187-193. Peypoux F, Guinand M, Michel G, Delcambe L, Das BC, Lederec E (1978). Structure of iturin A, an antibiotic from Bacillus subtilis. Biochem. 17: 3992-3996. Pryor SW, Gibson DM, Krasnoff SB, Walker LP (2006). Identification of antifungal compounds in a biological control product using a

Rebib et al.

microplate inhibition bioassay. Am. Soc. Agric. Biol. Eng. 49: 16431649. Quentin MJ, Besson F, Peypoux F, Michel G (1982). Action of peptidolipidic antibiotics of iturin group on erythrocytes. Effects of some lipids on hemolysis. Biochem. Biophys. Acta. 684: p. 207. Ramarathnam R, Bo S, Chen Y, Fernando WGD, Xuewen G, de Kievit T (2007). Molecular and biochemical detection of fengycin- and bacillomycin D-producing Bacillus spp., antagonistic to fungal pathogens of canola and wheat. Can. J. Microbiol. 53: 901-911. Raposo R, Gómez V, Urrutia T, Melgarejo P (2000). Fitness of Botrytis cinerea associated with dicarboximide resistance. Phytopathology, 90: 1246-1249. Romero D, Perez-Garcia A, Rivera ME, Cazorla FM, de Vicente A (2004). Isolation and evaluation of antagonistic bacteria towards the cucurbit powdery mildew fungus Podosphaera fusca. Appl. Micobiol. Biotechnol. 64: 263-269. Romero D, De Vicente A, Rakotoaly RV, Dufour SE, Veening JW, Arrebola E, Cazorla FM, Kuipers OP, Paquot M, Garcia AP (2007). The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis towards Podosphaera fusca. Mol. Plant. Microbe. Interact. 20: 430-440. Rozen S, Skaletsky HJ (2000). Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds), Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, N.J. pp. 365-386. Sadfi-Zouaoui N, Essghaier B, Hajlaoui MR, Fardeau ML, Cayol JL, Ollivier B, Boudabous A (2008). Ability of moderately halophilic bacteria to control Grey mould disease on tomato fruits. J. Phytopathol. 156: 42-52. Sadfi N, Cherif M, Boudabous A, Bélanger R (2002). Isolation and Partial Characterization of anti-Fusarium Antibiotics of Bacillus cereus. Ann. Microbiol. 52: 323-337. Sadfi N, Cherif M, Fliss I, Boudabous A, Antoun H (2001). Evaluation of Bacillus isolates from salty soils and Bacillus thuringiensis strains for the biocontrol of Fusarium dry rot of potato tubers. J. Plant Pathol. 83: 101-118. Saitou M, Nei M (1987). A neighbor- Joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 44: 406-425. Sanger F, Nicklen S, Coulson R (1977). DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA. 74: 5463-5467. Schimana J, Walker M, Zeeck A, Fiedler HP (2001). Simocyclinones: diversity of metabolites is dependent on fermentation conditions. J. Ind. Microbiol. Biotechnol. 27: 144-148. Souto GI, Correa OS, Montecchia MS, Kerber NL, Pucheu NL, Bachur M, Garcia AF (2004). Genetic and functional characterization of a Bacillus sp. strain excreting surfactin and antifungal metabolites partially identified as iturin-like compounds. J. Appl. Microbiol. 97: 1247-1256.

8475

Stachelhaus T, Mootz HD, Marahiel MA (2002). Nonribosomal assembly of peptide antibiotics on modular protein templates. In: Bacillus subtilis and Its Closest Relatives: From Genes to Cells. Sonenshein AL, Hoch JA and Losick R, eds. ASM Press, Washington, D.C., USA. pp. 415-435. Steller S, Vater J (2000). Purification of the fengycin synthetase multienzymz system from Bacillus subtilis b213. J. Chromatogr. B. 737: 267-275. Stein T (2005). Bacillus subtilis antibiotics: Structures, syntheses and specific functions. Mol. Microbiol. 56: 845-57. Vanittanakom N, Loeffler W, Koch U, Jung G (1986). Fengycin- a novel antifungal lipopeptide antibiotic produced by Bacillus subtilis F-29-3. J. Antibiol. 39: 888-901. Vater J, Kalbitz B, Wilde C, Franke P, Mehta N, Cameotra SS (2002). Matrix-assisted laser desorption ionization-time of flight mass spectrometry of lipopeptide biosurfactants in whole cells and culture filtrates of Bacillus subtilis C-1 isolated from petroleum sludge. Appl. Environ. Microbiol. 68: 6210-6219. Walker R, Powell AA, Seddon B (1998). Bacillus isolates from spermosphere of peas and dwarf French beans with antifungal activity against Botrytis cinerea and Pythium species. J. Appl. Micobiol. 84: 791-801. Wiese MV (1987) Compendium of Wheat Disease, 2nd edn. APS Press, St Paul (US). Yoshida S, Shirata A, Hiradate S (2002). Ecological characteristics and biological control of mulberry anthracnose. Jpn. Agric. Res. Q. 36: 89-95. Yu GY, Sinclair JB, Hartman GL, Bertagnolli BL (2002). Production of iturin A by Bacillus amyloliquefaciens suppressing Rhizoctonia solani. Soil Biol. Biochem 34: 955-963 Zeriouh H, Romero D, García-Gutiérrez L, Cazorla FM, de Vicente A, Pérez-García A (2011). The Iturin-like Lipopeptides Are Essential Components in the Biological Control Arsenal of Bacillus subtilis against Bacterial Diseases of Cucurbits. Am. Phytopathol. Soc. 24: 1540-1552.

Full Length Research Paper

Degrading capability and activity of extracellular xylanase secreted by a composite microbial system XDC-2 WANG Hui, GUO Peng, WANG Xiaofen, WANG Xiaojuan and CUI Zongjun* Center of Biomass Engineering, China Agricultural University, No. 2 Yuanmingyuan West Road, Haidian District, Beijing 100193, People’s Republic of China. Accepted 12 April, 2012

The natural lignocellulose degrading capabilities of extracellular enzyme secreted by a composite microbial system XDC-2 were studied. Peptone cellulose solution (PCS) medium was beneficial to the degradation of lignocellulosic materials and ATCC 1053 medium promoted enzyme production of XDC2. The exocellular xylanase activities of the crude enzymes were stable below 40°C. The crude enzyme has an effective capability of degrading natural lignocellulose, especially natural hemicellulose. The corn stalk core and rice straw lost 21.1 and 11.9% of its weight, respectively, after 48 h hydrolysis by the crude enzyme, and the weight loss of hemicellulose of corn stalk core and rice straw was 84.7 and 27.8%, respectively. Qualitative scanning electron microscopes (SEM) images indicated that after 48 h crude enzymes hydrolysis at 35°C, the material structure was modified. The production of the soluble carbohydrates was up to 2, 400 mg·L-1 for corn straw and 1, 300 mg·L-1 for rice straw. It would hold the potential of further development and application of XDC-2 with the ability to hydrolyze natural lignocelluloses and release soluble carbohydrates. Key words: Composite microbial system, lignocellulose degradation, exocellular xylanase, hydrolysis ability. INTRODUCTION Lignocelluloses are the most abundant and renewable biomass resources in the world (Wong et al., 1988). The crucial step of converting lignocellulose into bioenergy is the soluble sugar release. Microbial degradation and enzymatic hydrolysis of lignocellulosic materials to produce fermentable reducing sugars have been the focus of extensive research (Gan et al., 2002). However, most studies focused on a single isolated microorganism (Chen et al., 2010). Regularly, the pure cultures are characterized by unsatisfactory lignocellulolytic activities and cannot break down the complex natural lingocelluloses (Chang and Holtzapple, 2000; McMillan, 1994; Puri, 1984; Gregg and Saddler, 1996; Mansfiled et al., 1999). To date, the degradation of natural lignocellulose is the bottleneck of research and application. The rate-limiting

*Corresponding author. E-mail: acuizj@cau.edu.cn.

step in biomass degradation is the conversion of cellulose and hemicellulose polymers to sugars. In recent years, more attention has been paid to natural lignocellulose (rice straw, corn stalk and wheat straw) degradation by mixed microorganisms which are more enzymatically effective than any single isolate (Schwarz, 2001). Cui et al. (2002) constructed a microbial community (MC1) under artificial conditions based on the natural microflora, which could effectively degrade natural lignocellulose (Cui et al., 2002; Haruta et al., 2002). However, MC1 does not secrete extracellular enzymes. Degradation products such as reducing sugar were quickly utilized by the living microorganisms, resulting in inefficient accumulation of catabolism (Niu et al., 2005). Recent work showed that a mixture of several enzymes could improve the lignocellulolytic degradation capabilities (Seling et al., 2008), but there are only a few reports on enzymes that could effectively hydrolyze natural lignocellulose that were not treated under rigorous conditions. Therefore, the absence of enzymes with efficient degrading capacities is still the major limitation

Wang et al.

on the conversion of lignocellulosic materials into energy. Recently, a lignocellulose degrading composite microbial system (XDC-2), which could secrete extracellular xylanase effectively, was developed in our laboratory (Guo et al., 2010). Xylanase treatment removes reprecipitated xylan on the surface of the fiber thereby making the fiber more permeable to lignin removal (Subramaniyan and Prema, 2002), hence leading to significant enhancement of the hydrolysis of lingocellulose substrates. In the present work, we focused on degrading efficiency and accumulation of hydrolysates of the crude enzymes of XDC-2, described the characterization and degradation capabilities of the crude enzymes of XDC-2 and provided the experimental basis for preparing lignocellulose degrading composite enzymes from a lignocellulose degrading composite microbial system, which could have a significant impact on conversion of natural lignocellulose.

8477

the supernatants were filtered through a sterile 0.22 μM filter. One hundred milliliters of filtrate was placed in a 150-ml sterile flask (containing 1% milled corn stalk or rice straw). Each treatment was performed in quadruplicate. Xylanase activities were assayed according to Bailey et al. (1992). The substrate solution containing 1% (w/v) oat spelt xylan (Sigma) was dissolved in phosphate butter (pH 6.0). The reaction mixture consisted of 2.0 ml substrate solution and 0.5 ml of appropriately diluted enzyme. The reaction mixture was incubated at 40°C for 30 min prior to reducing sugar estimation. Enzyme and reagent blank were also simultaneously incubated with the test samples. Colour development was measured at 520 nm using the 3,5-dinitrosalicylic acid (DNS) method (Miller 1959). βglucosidase activities were assayed according to Shoemaker et al. (1978). The substrate solution contained 1% (w/v) D- salicin (Alfa Aesar) was dissolved in phosphate butter (pH 6.0). Similarly, the activity of carboxymethyl cellulose (CMCase) was assayed using 1% (w/v) CMC (Sigma) as substrate solution in the same conditions. The enzyme activities were expressed per milliliter of original volume of fermentation broth. One unit (U) of enzymatic activity was defined as the amount of enzyme required to liberate 1 μg of xylose or glucose in 1 min from xylan or carboxymethyl cellulose respectively.

MATERIALS AND METHODS Bacterial strains, media and growth conditions For obtaining bacterial strains, lignocellulose degradation composite microbial system XDC-2 was screened from composted agricultural and animal waste amended soil following a long-term directed acclimation (Guo et al., 2010). The XDC-2 was cultured in the modified peptone cellulose solution (M-PCS) (peptone 5 g, yeast extract 1 g, NaCl 5 g, K2HPO4 1 g, MgSO4·7H2O 0.35 g, CaCO3 3 g, and 1 L H2 O (pH 7.2)) which contained 1% (w/v) carbon source (corn stalk or rice straw). After inoculation (seed volume of 5%), the medium was cultured under static dark conditions at 35°C. Except for M-PCS used in the original screening of composite microbial system XDC-2, the following four media were used: ATCC 1053 medium (Bhat and Barker 1947), Mandels’ medium (Mandels and Reese 1960), Czapek's medium (Maghraby et al., 1991) and Cellulose-yeast extract medium (Cellulose-YE) (Mohagheghi et al., 1988). For all treatments, inoculation volume was 5% (v/v) and 1% (w/v) corn stalk was added. All systems were cultured at 35°C under static conditions. The samples were obtained at the same time for the further determination of relevant indicators. Each medium was tested in triplicate. Pretreatment of lignocellulosic materials and culture for enzyme production The air-dried lignocellulosic materials (rice straw and corn stalk) were obtained locally (Beijing, China). The materials were submerged in 1% (w/v) sodium hydroxide at 25°C for 48 h, washed with tap water to neutral pH, then oven-dried at 80°C. In some cases, after delignification, the dried pretreated materials were milled to 1 mm length. Subsequently, 20 ml XDC-2 after five-day cultivation was inoculated into 500 ml flask (containing 400 ml ATCC medium plus 4 g corn stalks). The system was cultured for 48 h at 35°C under static conditions for determination of xylanase and relevant indicators. Preparation of crude enzyme and hydrolytic treatment and extracellular xylanase assay Culture samples were centrifuged at 8000 × g for 10 min at 4°C and

Degradation of lignocellulosic materials by xylanase hydrolysis

extracellular

Degradation of lignocellulosic materials by extracellular xylanase hydrolysis were measured after 48 h, all enzymatic hydrolysis materials (including fermentation broth and residual lignocellulosic materials) were centrifuged at 5000 × g for 10 min. The precipitates were washed with deionized water, centrifuged at 5000 × g for 10 min, and then the supernatant was discarded. After repeating this process twice, the precipitates were dried at 80°C to constant mass and weighed. Afterward, 0.5 g sample was transferred into a special pocket (Model F57, USA). Components of residual lignocellulosic materials were analyzed using fiber analysator (Model ANKOM 220, USA) as previously described (Guo et al., 2008).

Determination of soluble carbohydrates production The water soluble carbohydrates produced during the hydrolytic process were determined according to the Anthrone colorimetry (Tomasm, 1977) method.

Scanning electron microscopy (SEM) Structures of the pretreated lignocellulosic materials (rice straw and corn stalk) and these materials after enzymatic hydrolysis were examined by SEM (HITACHI-S3400) as previously described (Seling, 2007). All the experimental results are the average of three replicates, unless specified otherwise.

RESULTS Determination of media for producing enzyme To determine a suitable culture medium for lignocellulose degradation by the composite microbial system XDC-2, we selected five types of media commonly used for lignocellulose degradation microbe culture. The results

8478

Afr. J. Biotechnol.

Figure 1. The effects of different media on xylanase activities and weight loss of corn stalk during degradation process.

show that after four days inoculation, the extracellular xylanase activities of ATCC medium (717.7 U·ml -1) were -1 significantly higher than the others (476.2 U·ml of -1 Mandels medium, 426.9 U·ml of Czapek's medium, -1 -1 622.8 U·ml of PCS medium and 587.2 U·ml of cellulose-yeast extract medium) (Figure 1). The total degradation ratio varied: ATCC medium was 41.6%, and the highest was 54.0% of PCS medium. There were no significant differences in degradation ratio among other three media. The extracellular enzyme activities of composite microbial system The extracellular activities (avicelase activity, CMCase activity and xylanase activity) of the XDC-2 were determined on day 0 (immediately after inoculation), three, six, nine, 12 and 15. The xylanase activities amounted to the highest value (738.3 U·ml -1), while avicelase activity and CMCase activity and were only

27.7 and 19.7 U·ml-1 and 3.11 U·ml-1 respectively (Table. 1). On the basis of this experiment result, we preliminarily infer that this composite microbial system has a high capability of degrading natural hemicellulose. Effect of temperature on extracellular xylanase activity stability To investigate the temperature stability of the enzymes, the crude enzyme was incubated at 35, 40 and 45°C, and extracellular xylanase activities were determined at 2, 6, 12, 24, 36 and 48 h. Results indicate that the dynamics of the crude extracellular xylanase activities were similar at 35 and 40°C. The relative extracellular xylanase activities amounted to 87.3 and 73.5% after 6 h. Following a slight decrease from 6 to 12 h, the relative extracellular xylanase activities were 63.1 and 55.1%, respectively. No significant change occurred from 12 to 36 h. After 48 h, the extracellular xylanase activities were closed to deactivation at 35 and 40°C (Figure 2). At 45°C, the

Wang et al.

8479

Table 1. Enzyme activity over time in rice straw degradation. -1

Time (day) 0 3 6 9 12 15

Enzymes activity (U·ml ) β-glucosidase Avicelase CMCase 0.00±0.00 0.00±0.00 0.00±0.00 10.20±0.60 6.90±0.72 14.90±1.08 3.11±0.21 27.7±0.62 19.70±0.85 1.27±0.11 7.20±0.44 5.40±0.36 0.00±0.00 5.93±0.38 0.61±0.29 0.00±0.00 3.30±0.20 0.34±0.12

Xylanase 0.00±0.00 583.20±12.22 738.27±6.42 645.07±4.92 351.87±4.54 308.53±11.81

Figure 2. Effect of temperature on xylanase activities.

extracellular xylanase activities ceased after 12 h. Soluble carbohydrates production by enzymatic hydrolysis To determine the production of the soluble carbohydrates, milled corn stalk core or rice straw was used as the sole carbon source. During 48 h hydrolysis, the production of the water soluble carbohydrates were measured every 12 h. The results show that the soluble carbohydrates were -1 increased to 2, 400 mg·L (Figure 3). With rice straw as the substrate, the content of soluble carbohydrates -1 increased to 1, 300 mg·L , while with corn stalk core as

the substrate, the content of soluble carbohydrates increased slowly from 0 to 12 h. There was a significant increase from 24 to 36 h. The production of soluble -1 carbohydrates reached 2, 400 mg·L at 36 h, but did not increase after this time-point. In contrast, when the corn stalk core was degraded by composite microbial system XDC-2, the content of soluble carbohydrates in fermentation broth was decreased to 300 mg·L-1. Degradation of rice straw and corn stalk core by crude enzymatic hydrolysis After 48 h enzymatic hydrolysis, extracellular xylanase

8480

Afr. J. Biotechnol.

Figure 3. Levels of soluble carbohydrates during enzymatic hydrolysis using corn stalk core and rice stalk as substrates.

activities decreased, while soluble carbohydrates content did not increase. At this time, we terminated the enzymatic hydrolysis process and determined total degradation ratio, weight loss of soluble substance, cellulose, hemicellulose, lignin and ash content of the solid residues. The total degradation ratio of corn stalk core was 21.1%, and for rice straw was 11.9% (Figure 4). The weight loss of hemicellulose of corn stalk core was 84.7%, whereas rice straw weight loss was only 27.8%. Cellulose weight loss was only 2.1 and 1.9%, respectively. Structural changes as determined by SEM The structure changes in rice straw and corn stalk before and after the enzymatic hydrolysis were shown by using SEM (Figure 5). The plant cell wall structure of rice straw and corn stalk core showed evidence of plant cell wall vascular bundles and a highly fibrillar structure(Figures 5A and C). Enzymatic hydrolysis disrupts the lingocellulosic structure by mainly dissolving hemicellulose. As a result, major microfibrous cellulose structures remain (Figures 5B and D) and some lignin or lignincarbohydrate complexes may be condensed on the surface of the cellulose fibers. Hydrolysis with crude enzymes significantly alters the fibrillar structure.

DISCUSSION XDC-2 is a novel lignocellulose-degrading composite microbial system. The composite microbial system could degrade lignocellulose such as corn stalk and rice straw as well as hemicelluloses; it also secreted extracellular xylanase effectively. The extracellular xylanase of the XDC-2 system was stable over a wide range of pH (3.0 to 10.0) at temperatures of 25 to 35째C. The extracellular xylanase of XDC-2 could maintain high activity at pH 5.0 to 9.0 and temperature of 25 to 35째C over three days (Guo et al., 2010). ATCC medium includes nutrients which accelerate the rapid growth of XDC-2 microbes. Therefore, extracellular xylanase activity after four-days cultivation was significantly higher than others. However, XDC-2 might give priority to utilize beef extract which was contained in ATCC medium, and resulted in lower corn stalk total degradation ratio. These results show that nutritive elements in the culture medium have significant influence on enzyme activities of XDC-2. The specific influences of different nutritive elements require further study. In addition, from the enzyme activities assays, we suggested that XDC-2 has a high capability to degrade natural hemicellulose. However, enzyme activity does not necessarily reflect the efficient degradation of the natural

Wang et al.

Figure 4. Degradation of lignocellulosic components of different substrates in enzymatic hydrolysis process.

Figure 5. SEM of rice straw and corn stalk samples. Rice straw before enzymatic hydrolysis (A), corn stalk before enzymatic hydrolysis (B); rice straw after enzymatic hydrolysis (C) and corn stalk (D). SignalName=SE, accelerating voltage=20000 volt, Deceleration voltage=0 v, Magnific ation=1000, working reistance=9400 um, Emission current=50000 nA.

8481

8482

Afr. J. Biotechnol.

lignocellulosic substrates (Yawada 1988; Johnson et al., 1982; Schwarz 2001). Therefore, the degrading capacity of the composite enzyme system of the XDC-2 was investigated in the degradation experiment, which suggested that the composite enzyme system has a high capability of degrading natural hemicellulose. The weight loss of corn stalk core was higher than rice straw (Figure 4). The loss of hemicellulose was the primary component of lost mass during the degradation of corn stalk and rice straw. Cellulose is a sturdy material, ideally suited to insure the structural stability of land plants, where it is a main component of the primary cell wall (Schwarz, 2001). The presence of hemicellulose and lignin is reported to make the access of cellulase enzymes to cellulose difficult, thus reducing the efficiency of hydrolysis (Solange et al., 2008). The composite enzyme system of the XDC-2 solubilized the hemicellulose significantly, and would result in the access of cellulase to cellulose easily, thus enhancing the cellulose enzymatic hydrolysis. Pure cultures microorganism has limited ability, while a composite microbial system can exhibit a synergistic effect where the degradation ability of the composite microbial system is greater than the sum of the degradation ability of the individual microorganism (Haruta et al., 2002). Much attention has been devoted to research on mixing different microorganisms to improve the capability to degrade natural lignocelluloses. Lewis et al. (1988) mixed rumen microorganisms to degrade rice straw with a weight loss of 55.8%, but the extracellular xylanase activity of this mixture was not described. The xylanase activities of XDC-2 were much higher than those previously reported. Temperature stability of the crude enzyme showed that this composite enzyme system were stable between 35 to 40°C. The result shows the importance of utilizing this composite enzyme system for enzymatic hydrolysis of lignocellulosic substrates to obtain good process economy than thermophilic enzymes. This characteristic could provide a convenient option to explore effective xylanase preparations. Corn stalk core is softer than rice straw and the content of hemicellulose is apparently higher (Guo et al., 2010). These differences lead to different enzymatic hydrolysis exhibition. XDC-2 was able to adhere to corn stalk core more easily than rice straw. As a result, the extracellular xylanase activities were high, and more soluble carbohydrates accumulated. However, increased levels of soluble carbohydrates may be utilized by microorganisms quickly, resulting in inefficient accumulation (Niu et al. 2005). Saving products by using enzymes instead of microorganisms in lignocelluloses utilization must not be made at the expense of the biomass convert, which is still the most important parameter in achieving lower utilization costs. Before enzymatic hydrolysis, the substrates exhibited rigid and highly ordered fibrils (Figures 5A and C). Qualitative SEM images indicate that after crude

enzymes hydrolysis at 35°C, the hemicellulose removal modified the material structure, but the main structures were not broken down (Figures 5B and D), and these substrates exhibited significant differences in their supramolecular structures. Hydrolyzed substrates show that a major destruction of the fibers is hemicellulose. These findings combined with the results earlier mentioned suggest that the effects of composite enzyme system are mainly attributed to the solubilization of the hemicellulose fractions, and to the beneficial effects that the enzymatic hydrolysis has on changing the morphology and fine structure of the cellulosic residue. This will be helpful for cellulosic residue conversion and utilization. ACKNOWLEDGEMENT This work was supported by the National Key Technology Research and Development Program of China during the 12th Five-Year Plan Period (No. 2011BAD15B01，No. 2012BAD1401). REFERENCES Bailey MJ, Peter B, Kaisa P (1992). Interlaboratory testing of methods for assay of xylanase activity. J. Biotechnol. 23(3): 257-270. Bhat JV, Barker HA (1947). Clostridium lactoacetophilum nov. spec. and the role of acetic acid in the butyric acid fermentation of lactate. J. Bacteriol. 54: 381-391. Chang VS, Holtzapple MT (2000). Fundamental factors affecting biomass enzymatic reactivity. Appl. Biochem. Biotechnol. 84(1): 5-37. Chen X, Ishida N, Todaka N, Nakamura R, Maruyama J, Takahashi H, Kitamoto K (2010). Promotion of efficient saccharification of crystalline cellulose by Aspergillus fumigatus swol. Appl. Environ. Microbiol. 76(8): 2556-2561. Cui ZJ, Li MD, Piao Z, Huang ZY, Ishii M, Igarasli Y (2002). Selection of a composite microbial system MC1 with efficient and stability cellulose degradation bacteria and its function. J. Environ. Sci. (China) 23: 36-39. (in Chinese with English abstract). Gan Q, Allen SJ, Taylor G (2002). Design and operation of an integrated membrane reactor for enzymatic cellulose hydrolysis. Biochem. Eng. J. 12: 223-229. Gregg DJ, Saddler JN (1996). Factors affecting cellulose hydrolysis and the potential of enzyme recycle to enhance the efficiency of an integrated wood to ethanol process. Biotechnol. Bioeng. 51: 375-383. Guo P, Wang XF, Zhu WB, Yang HY, Cheng X, Cui ZJ (2008). Degradation of corn stalk by the composite microbial system of MC1. J. Environ. Sci. 20(1): 67-73. Guo P, Zhu WB, Wang H, Lü YC, Wang XF, Zheng D, Cui ZJ (2010). Functional characteristics and diversity of a novel lignocelluloses degrading composite microbial system with high xylanase activity. J.Microbiol. Biotechnol. 20(2): 254-264. Harruta S, Cui ZJ, Huang Z, Li M, Ishii M, Igarasi Y (2002). Construction of a stable microbial community with high cellulose-degradation ability. Appl. Microbiol. Biotechnol. 59: 529-534. Johnson EA, Sakjoh M, HaHiwell G, Media A, Demain AL (1982). Sacchafification of complex cellulosic substrates by the cellulase system from Clostridium thermocellum. Appl. Environ. Microbiol. 43: 1125-1132． Maghraby OMO, Bean GA, Jarvis BB, Aboul-Nasr MB (1991). Macrocyclic trichothecenes produced by Stachybotrys isolated from Egypt and Eastern Europe. Mycopathol. 113: 109-115. Mandels M, Reese ET (1960). Induction of cellulose in fungi by

Wang et al.

cellobiose. J. Bacteriol. 79: 816-826. Mansfield SD, Mooney C, Saddler JN (1999). Substrate and enzyme characteristics that limit cellulose hydrolysis. Biotechnol Prog. 15: 804-816. McMillan JD (1994). Pretreatment of lignocellulosic biomass. In: Himmel ME, Baker JO, Overend RP, editors. onversion of hemicellulose hydrolyzates to ethanol. Washington: American Chemical Society Symposium. pp. 292-324. Miller GL (1959). Use of dinitrosalicylic acid reagent for determination of reducing sSugar. Anal. Chem. 31: 426-428. Mohagheghi A, Grohmann K, Wyman CE (1988). Production of cellulase on mixtures of xylose and cellulose. Appl. Biochem. Biotechnol. 17: 263-277. Niu JL, Cui ZJ, Li GX, Wang WD (2005). Selection and construction of composting consortia for degrading lignocellulose efficiently and its capability of straw degradation. J. Agro-Environ. Sci. (China). 24(4): 795-799. (in Chinese with English abstract). Puri VP. (1984). Effect of crystallinity and degree of polymerization of cellulose on enzymatic saccharification. Biotechnol. Bioeng. 26: 1219-1222. Schwarz WH (2001). The cellulosome and cellulose degradation by anaerobic bacteria. Appl. Microbiol. Biotechnol. 56: 634-649.

8483

Seling MJ, Knoshaug EP, Adney WS, Himmel ME, Decker SR (2008). Synergistic enhancement of cellobiohydrolase performance on pretreated corn stover by addition of xylanase and esterase activities. Bioresour. Technol. 99: 4997-5005. Subramaniyan S, Prema P (2002). Biotechnology of microbial xylanases: enzymology, molecular biology and application. Crit. Rev. Biotechnol. 22: 33-46. Tomasm TA (1977). An automated procedure for the determination of soluble carbohydrates in herbage. J. Sci. Food Agr. 28: 639-644.

Full Length Research Paper

Improving planting pattern for intercropping in the whole production span of rubber tree Zeng Xianhai, Cai Mingdao and Lin Weifu* Rubber Research Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou, Hainan 571737, People’s Republic of China. Accepted 30 March, 2012

A spatial arrangement for planting rubber was proposed in order to facilitate intercropping during the whole production span of rubber tree. A field experiment was established in the Experiment Farm, Chinese Academy of Tropical Agricultural Sciences, Danzhou, Hainan, China, with two planting patterns of rubber clone Reyan 7-20-59: (1) single row avenue planting pattern (SR) by 3 m × 7 m, and (2) double row avenue planting pattern (DR) by (2 m × 4 m) × 20 m. The experiment showed that the girth of rubber trees in the DR system at the first tapping year was slightly bigger than that in the SR system. Although rubber trees under tapping in per unit area in the DR system were relatively lesser, however, the yield per hectare with 98% of SR was not significantly affected due to its higher yield per tree. In addition, the DR system provided larger unshaded area of land and higher light penetration. Considering the overall performance of the two planting systems, the DR system proved to be a suitable planting system for long-term intercropping in rubber plantations. Key words: Hevea, whole production span, intercropping system.

INTRODUCTION The development of intercropping in rubber tree (Hevea brasiliensis Muell. Arg.) plantation began in the 1950s in China. In the 1950s, the expansion of rubber plantation area brought up issues of land use in immature rubber plantations, especially due to shortage of grain, so the main purpose of intercropping was to provide the rubber grower agricultural food products. During the 1970s1980s, intercropping was put on the agenda due to damages of natural disasters such as typhoon, and the scale, efficiency and techniques of intercropping had been developed in an unprecedented way until the mid of 1980s. With the development of economic reform and opening up to the outside world, people’s living standards have been greatly improved, and the productivity and product quality of intercrops in rubber plantations have been challenged or affected by other reasons, for instance, the lack of market of some intercrops such as tea, Alphinia in intercropping patterns rubber/tea and

*Corresponding author. E-mail: rubberL@163.com. Tel: +86898-23300495. Fax: +86-898-23300315.

rubber/Alpinia oxyphylla which gradually lost their market (Lin et al., 1999). In the past, intercrops were positioned as second-line crops to increase the land use capacity, yield per unit area, income and employment opportunities (Lin et al., 1999). However, with the increment of disastrous weather events due to global climate change and ecological awareness, and the decrement of land for growing other crops due to the fact that majority of lands have been covered with rubber tree, as well as the demand of agriculture industrialization due to marketization of products, it is also very important to stabilize income of farmers for whole production span, especially in the period after natural disaster or market stagnant, to produce food and vegetable for the people or to enrich biodiversity of rubber plantations in the area of hundred-miles rubber plantation in China so that intercrops are no longer as underpart and should be industrially planted as regular crops during the whole rubber production span of rubber tree. Nevertheless, most other crops generally do not grow as tall as rubber tree, and hence with the development of the rubber canopy, the practicality of inter-planting crops which demand fairly high amounts of radiation is not

Xianhai et al.

8485

7m 3m (SR)

20 m

4m 2m (DR)

28 m Figure 1. Schematic diagram showing the layout of different spatial arrangements of planting rubber. SR: Single row avenue planting pattern; DR: double row avenue planting pattern.

feasible (Rodrigo, 2001). Due to most economically important crops, most of which are heliophilous plants of which the photosynthetic characteristics are difficult to improve, cannot be grown under the heavy shade of a mature rubber tree, should rubber-based cropping systems be improved into rubber-intercrops commensal cropping systems, which are most feasible to form a new planting system and allow greater light penetration for intercrops, to instead of the traditional planting systems of rubber In this context, a new planting pattern in which more space and light would be provided to facilitate intercropping during the whole production span of rubber tree based on a new clone of rubber tree was studied. MATERIALS AND METHODS Eighteen-month-old seedling plants were bud-grafted with one of the fast-growing high-yielding clones bred and selected by Rubber Research Institute of Chinese Academy of Tropical Agricultural Sciences (RRI of CATAS), Reyan7-20-59. Successfully grafted plants were then transferred into poly bags and raised, and then transplanted in the field when they grew with two stable whorls of leaves.

Experimental layout The experiment was established in 2002 in the District 3 of the CATAS Experiment Farm situated in Danzhou, Hainan, China. Treatments comprised two spatial arrangements of planting rubber (Figure 1): (1) single row avenue planting pattern (SR, CK) with a row spacing of 7 m and plant spacing of 3 m; (2) double row avenue planting pattern (DR) with a plant spacing of 2 m and a double row spacing of 4 m and 20 m gap between double rows. The planting

density was 480 trees/ha in SR and 420 in DR. In row planting arrangements, crops could be planted in between the rows or in the gap. Treatments were laid out in three randomized blocks in an area of ca.2.1 ha. Each block comprised one set of all five treatments in an area of ca. 0.7 ha.

Crop husbandry Rubber plants were fertilized with about 10 to 20 kg per plant of organic fertilizers-based and 0.8 to 1.5 kg per plant of chemical fertilizers for all the treatments. Chemical fertilizer application was implemented in April, June and September each year and mulching was done once or twice per year in fertilizer hole. The fertilizer holes (0.6 m wide 0.6 m deep and 2 m long), were dug by one side of planting hole once a year for 4 year after planting, and dug at the middle of row space by one hole for 4 plants in SR plots, while only a ditch (1 m wide and 1 m deep) along the middle of double row space in treatment plots was used instead of fertilizer hole in DR plots. The fertilizer application for rubber trees is shown in Table 1.

Measurements All measurements were confined to the center part of the plots, and plants at the boundaries were disregarded in assessments. Considering the nature of the spatial arrangement and the plot size of each treatment, the number of plants could not be fixed. For instance, the plots of DR systems were larger and had more plants in order to maintain a reasonable number of effective trees in addition to boundary rows. Plant girth at the height of 100 cm from the bud-grafted union was measured at 1, 8 and 9 years after planting (YAP). Bark thickness at the height of 100 cm was measured in 2011 with a standard bark gauge. Canopy spread along the gap between the row systems was assessed in 2011. The distance of the spread of branches of rubber trees was determined using a pole placed vertically touching the end of the branches and taken as the canopy width. The rate of light penetration of undergrowth was calculated by

8486

Afr. J. Biotechnol.

Table 1. The fertilizer applied to rubber trees.

Fertilizer type Organic fertilizer Ammonium sulfate Super phosphate Potassium chloride Green manure

Amount of fertilizer (Kg/tree/year) applied to rubber trees Before four years Five years after planting Tapping period after planting to period before tapping 10.00 0.50-1.20 0.30-0.50 0.05-0.10 30.00

15.00 1.00-1.50 0.20-0.30 0.05-0.10 30.00

20.00 0.80-1.50 0.40-0.50 0.15-0.25 30.00

60.00 50.00 Girth(cm)

SR 40.00

30.00 20.00 10.00 0.00 1

Years after planting Figure 2. Effect of planting patterns on rubber tree girth. Error bars represent the standard error of means for three replicate plots. SR: Single row avenue planting pattern; DR: Double row avenue planting pattern.

dividing illumination measured in undergrowth from illumination measured in open ground. Illumination across a horizontal profile of each treatment (at a 2 m interval) was measured together with three measurements (east-west direction at 0.3 m intervals) under the open condition using a digital light meter (TES -1336A, Taiwan) for 3 days at 12:00-14:00 h. The number of trees that survived and were tapped for latex (that is the trees with a girth of 50 cm or above at 100 cm height) were assessed at 8 years after planting (YAP). A tapping system of half spiral cut every 3 days during the first year of tapping (that is 1/2S D/3) was practiced for latex harvest. Latex yield of each treatment was measured as the actual latex yield collected at three cuts per month from individual treatment plots for a full year at 8 YAP.

was biphasic with initial rapid linear increase before tapping, and thereafter marginal increases approaching a plateau (Figure 2). Mean rate of girth increase during tapping period in 8 years after planting (YAP) and 9 YAP was 54.42 and 53.62 cm for double row (DR) and Single row (SR) systems, respectively. Mean girth of the DR system was slightly better than that of the traditional SR and was 0.8 cm at 9YAP. However, the difference was not statistically significant (P = 0.353).

Data analysis

The mean rate of increase in bark thickness was similar among treatments with an average of 0.805 cm at 9 YAP. Similar to the girth values, bark thickness was slightly lower in the SR systems with an average of 0.80 cm at 9 YAP, but the difference was not statistically significant (Figure 3).

Data sets were subjected to analysis of variance of randomized blocks using the Proc. ANOVA procedure of the SAS statistical package (SAS Institute, Cary, NC).

Bark thickness

RESULTS Plant girth

Yield

In general, girth increase of rubber plants in all treatments

Percentage of trees under tapping was calculated by

Xianhai et al.

8487

1.00 0.90 Bark thichness(cm)

0.80 0.70 0.60 0.50 0.40 0.30 0.20 0.10 0.00 DR

SR Planting systems

Figure 3. Effect of planting systems on bark thickness. Error bars represent the standard error of means for three replicate plots. SR: Single row avenue planting pattern; DR: Double row avenue planting pattern.

Table 2. Effect of planting systems on rubber yield.

Planting patterns SR DR

Trees in tapping (%) 88.5 77.8

Yield per hectare(kg/ha) 1113.0 1097.9

Yield per tree(g/t/t) 26.2 29.4

SR: Single row avenue planting pattern; DR: Double row avenue planting pattern.

subtracting the percentages of dead, weak and TPD plants. Though not statistically different, a higher value was recorded in the SR system followed by that in the DR (88.5 and 77.8%, respectively). However, the mean yield per tree (g/t/t) was lower (26.2g/t/t) than that of the DR system (29.4g/t/t), and the mean yield per hectare in the SR system was similar to that in the DR system (1113.0 and 1097.9 kg/ha, respectively), equivalent to 98% of that of the SR system (Table 2). Canopy spread Canopy spread of rubber tree towards the space available between rows was observed, and a significantly (P = 0.0080) greater spread was recorded in the DR system, while a smaller spread in SR system (Figure 4). At 9YAP, the canopy of the DR system spread to about 4.58 m, while the SR system was 2.80 m. As shown by the unshaded distance, at 9 YAP, the gap without any canopy cover was found nearly 11 m in the DR system, while in the traditional SR system; only ca. 1.4 m was available. Overall, the unshaded area (%) with respect to total land area was 45 and 20% in the TR and DR systems, respectively.

Light penetration Continuous clear sky conditions could not be obtained when the radiation was measured due to moving clouds. This, together with variation in solar angle to the row position of treatment plots, resulted in increased standard error of means for percentage light penetration (Figures 5 and 6). The overall light penetration in the SR system was extremely poor, with similar value to that in the narrow row in the DR system. As determined over the different positions in each treatment, the mean percentage light penetration was 17.8 and 45.3% in the SR and DR treatments, respectively. Mean percentage of light penetration did not exceed 50% at any point measured in the SR, whilst it was always above 80% beyond 4.0 m from the rubber rows in the DR system. DISCUSSION Rubber is taller than most of other economical crops grown under similar conditions. Therefore, success of intercropping in rubber plantation with other sun semiperennials or perennials depends mostly on the amount of radiation penetrating the rubber canopy. In general, the

8488

Afr. J. Biotechnol.

Di st ance f r om r ubber r ow ( m)

12. 00 10. 00 DR

8. 00

6. 00 4. 00 2. 00 0. 00 shaded di st ance

unshaded di st ance

Shaded & Unshaded di st ances Figure 4. Effect of planting patterns on canopy spread. SR: Single row avenue planting pattern; DR: Double row avenue planting pattern.

60.0

Light penetration rate (%)

50.0

40.0 30.0 20.0

10.0 0.0 0

Distance from rubber row in SR (m) Figure 5. Radiation profile across the gap available for intercropping between rubber rows in SR system 9 years after planting. SR: Single row avenue planting pattern.

rubber canopy is quite dense allowing little radiation through to the understorey. According to Ibrahim (1991), only about 20% of incoming solar radiation is available under a 4 to 5-year-old rubber canopy. In intercropping systems, the heterogeneous nature of the canopy improves light use efficiency in the system (Rodrigo et al., 2001). However, if the understorey crop does not receive sufficient radiation, its agronomic performance and hence the financial viability of the return, is dubious. For

example, in the case of rubber, pepper did not provide sufficient yield under mature rubber canopies (Rodrigo, 2001). Considering the poor light penetration through the rubber canopy, rubber/tea intercropping system was designed with ca. 30% reduction of the standard density of rubber in order to provide improved light penetration. However, dramatic yield decline in tea was found after the sixth year of growth of rubber plants (Rodrigo, 2001). The planting density recommended for the rubber crop

Xianhai et al.

8489

100.0

Light penetration rate (%)

90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 0

Distance from middle of rubber narrow row in DR (m) Figure 6. Radiation profile across the gap available for intercropping between rubber rows in DR 9 years after planting. DR: Double row avenue planting pattern.

in China is 480 to 500 trees/ha. The present study was aimed to find suitable spatial arrangements for planting rubber to improve light penetration in order to facilitate long-term rubber-based intercropping systems without compromising the planting density of rubber. Obviously, the DR system provided the highest unshaded area and hence the highest light penetration, allowing the largest area for intercropping. As indicated by girth development and bark thickness, the DR system did not affect growth of rubber and gave good yield equivalent to 98.6% of that of the SR system. In general, latex yield at individual tree level tends to decrease with increased planting density (Westgarth and Buttery, 1965; Rodrigo et al., 1995). In the present study, the SR system with 480 rubber trees per hectare might have resulted in lower g/t/t than the DR system with 420 rubber trees per hectare. Under the same tapping days, rubber yield per hectare depended on latex yield per tapping at individual level and number of trees being tapped. Traditional single row avenue planting systems have minimum effect on rubber growth, and the mean percentage of tappable trees was greater in the SR system. However, the lower latex yield at individual tree level results in decline of rubber yield per hectare. In contrast, the interplant competition within the double row system was higher, but did not affect the growth of rubber trees, and the yield of rubber tree decreased slightly but not significantly. In addition, since the canopy of the SR system almost fully spread out, light penetration of these systems was extremely poor (less than 20%) and more or less the same across the gap between alleys. Light penetration improved dramatically between 8 to 16 m in the DR

system, similar in canopy spread to the SR system, indicating that the area could be utilized in long-term intercropping. The distance covered by the rubber canopy across this transect in the DR system was ca. 4.6 m at the same age (9 YAP), which may be related to the characters of rubber clones. However, light transmission in the present study was measured in the middle of the day and particularly at times when direct-light dominates the defused light. Light penetration through the canopy is stronger under the defused- than the direct-light. The fraction of defused-light is high under overcast conditions and at lower solar elevations (Monteith and Unsworth, 1990), and hence overall percentage of light penetration is expected to be greater than the values recorded in the present study. Moreover, according to the spatial distribution of light penetration across the transect of the DR system, it could be appropriate to plant other crops in avenues leaving a gap of 10.84 m on either side of the rubber alley (double rows). However, it is only 1.4 m in the SR system. The results showed that 45% of the land in mature rubber plantation in the DR system was available for growing other crops if output value of crop is similar to that of single crop rubber, which means that the output rate of land per unit is expected to be 143%. For a given density, if the gap between rows is increased by reducing the gap between trees within alleys, there will be more trees within a row resulting in a lower number of rows in the field planting. Undoubtedly, this will reduce the overall distance of travel required to be covered in a given area, hence the time taken for tapping (Nugawela, 1991). Therefore, despite the difficulties in field establishment, the systems with wider gaps are advantageous over those with narrower gaps with respect

8490

Afr. J. Biotechnol.

to tapping. Also in the case of sloped terrain, the systems with wider gaps (avenue systems) require fewer terraces, reducing the cost for land preparation. In addition, other agronomic advantages such as the feasibility of practicing intensive cultural methods for component crops in intercropping systems, acting as windbreaks and decrease in panel diseases of rubber with improved air circulation have been recorded in avenue planting (Dijkman, 1951). As a whole, the DR offers a practically feasible spatial system for incorporating perennials as rubber-based intercrops, provided the space within the double rows is increased. The gap between rubber rows (the avenue) in the presently recommended planting system for rubber/tea intercropping is 11 -18 m (Feng, 1986; Zheng and He, 1991; Zhimei et al., 2006) which is sufficient to provide required light for long-term tea cultivation. Similarly, some studies have also suggested that the double staggered row system with an plant spacing gap of 2.4 and 14.1 m between double rows used in rubberbanana intercropping provided the highest unshaded area and hence light penetration than traditional single row system with an row spacing of 8.1 m and a plant spacing of 2.4 m, but performed poor growth and yield of rubber trees (Rodrigo et al., 2004). Therefore, it is necessary to reduce the planting density of rubber trees. In this regard, the density of planting rubber in the present system would not have to be compromised. So far, the factors affecting the success of application of the DR system include: upright rubber tree species, sufficient spacing and relatively flat terrain. In addition, steep area could be suitable for promotion and any other clones of rubber tree could be used for the DR system, although more studies are needed to verify this. The DR system, an intercropping pattern in the whole rubber production period which provides more land and space available for crop intercropping without significant effect on rubber production, can effectively solve the issues of current intercropping systems, example short period, scattered distribution and competition with light, nutrients and space. As the gap between rows is wider, eople can engage in various agricultural activities of longterm crop production and normalize agricultural production, and thus attract planters to invest in rubber plantation, to improve production levels and to promote the standardization and industrial development of rubber plantation.

REFERENCES Dijkman MJ (1951). Hevea: Thirty Years of Research in the Far East. Florida, Coral Gables: Univ. Miami Press. 87-114 Feng Y (1986). Ecological studies on an artificial rubber-tea community. Intecol Bull. 13: 93-95. Ibrahim AG (1991). Influence of rubber canopy on intercrop productivity. Trans. Malaysian Soc. Plant Physiol. 2: 75-79. Lin Weifu, Zhou Zhongyu, Huang Shoufeng (1999). A review and prospect of intercropping in rubber plantation in China. Ecol. 18(1): 43-52. (in Chinese). Monteith JL, Unsworth MH (1990). Principles of Environmental Physics, 2nd ed. Edward Arnold, London. Nugawela A (1991). Review of the Plant Science Department A Review. The Rubber Research Institute of Sri Lanka. pp. 11-28. Rodrigo VHL (2001). Rubber based intercropping systems. In: Tillekeratne LMK, Nugawela A. (Eds.), Handbook of Rubber Agronomy, vol. 1. Rubber Research Institute of Sri Lanka. pp. 139155. Rodrigo VHL, Stirling CM, Teklehaimanot Z, Nugawela A (2001). Intercropping with banana to improve fractional interception and radiation-use efficiency of immature rubber plantations. Field Crops Res. 69: 237-249. Rodrigo VHL, Nugawela A, Pathirathne LSS, Waidyanatha UPdeS, Samaranayake ACI, Kodikara PB, Weeralal JLK (1995). Effect of planting density on growth, yield, yield related factors and profitability of rubber (Hevea brasiliensis Muell. Arg.). J. Rubber Res. Inst. Sri Lanka. 76: 55-71. Rodrigo VHL, Silva TUK, Munasinghe ES (2004). Improving the spatial arrangement of planting rubber (Hevea brasiliensis Muell. Arg.) for long-term intercropping. Field Crops Res. 89: 27-335. Westgarth PR, Buttery BR (1965). The effect of density on growth, yield and economic exploitation of Hevea brasiliensis. Part I. The effect on growth and yield. J. Rubber Res. Inst. Malaysia, 19: 62-73. Zheng H, He K (1991). Intercropping in rubber plantation and its economic benefit. In: Zhu Z, Cai M, Wang S, Jiang Y (eds). Agroforestry Systems in China. Chinese Acad. Sci. Int. Dev. Res. Centre, Canada, pp. 204-206. Zhimei G, Yaoqi Z, Peter D, Holm U (2006). Economic Analyses of rubber and tea plantations and rubber-tea intercropping in Hainan, China. Agroforest. Syst. 66: 117-127.

African Journal of Biotechnology Vol. 11(34), pp. 8491-8499, 26 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.1938 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Biocontrol properties of indigenous Trichoderma isolates from North-east India against Fusarium oxysporum and Rhizoctonia solani Th. Kamala and S. Indira Devi* Microbial Resources Division, Institute of Bioresources and Sustainable Development (IBSD), Autonomous DBT Research Institute, Govt. of India, Takyelpat, Imphal, Manipur. India. Accepted 5 March, 2012

Trichoderma is one of the best known and well described biocontrol fungi for its lytic activity and antagonistic properties against phytopathogens. In the present study, a total of 114 isolates of Trichoderma were isolated from the soil collected from diverse climatic conditions of Manipur on selective medium. Out of the total isolates, 80% shows high degree of antagonism against Fusarium oxysporum while 68% Trichoderma isolates gives strong activity against Rhizoctonia solani. Based on their antifungal activity in dual plate assay, 25 isolates were selected for further analysis. The interaction between the Trichoderma and fungal pathogens were examined microscopically. Several biocontrol mechanisms were studied and analysis data showed that the clearing zone diameter of protease activity of these indigenous Trichoderma isolates ranges from 10 to 60 mm. Among them, 84% gave high chitinase activity and their activity ranges between 10 to 85 mm. whereas, Ă&#x;-1,3-glucanases activity showed a clearing zone diameter ranging from 10 to 70 mm. Based on their relative biocontrol potency, three indigenous Trichoderma isolates (T10, T17 and T83) were selected for pot culture experiment for testing their biocontrol efficacy against wilting and damping off diseases of common beans. Among all the treatments, T83 showed better biocontrol efficacy against the two test fungus as compared to the exotic Trichoderma harzianum (ITCC No. 6276) strain. Key words: Antagonistic, Chitinase, Fusarium oxysporum, protease, Rhizoctonia solani, Trichoderma sp.

INTRODUCTION Plant diseases play a major role in the decrease of food production in agricultural scenario. Chemical compounds have been used to control plant diseases, but abuse in their employment has favored the development of pathogens resistant to fungicides. Biological control using potential microorganisms having strong antifungal activity is coming up as an alternative strategy for disease management, which is also ecology-conscious and environment friendly. Among all the microbial biocontrol agents (BCAs), Trichoderma

*Corresponding author. E-mail: E-mail:sidevi1@yahoo.co.in. Tel: 09436892491. Fax: 91-0385-2446120.

sp. is one of the most commonly used worldwide as safe BCAs. The success of Trichoderma strains as BCAs is due to their high reproductive capacity, ability to survive under very unfavourable conditions, efficiency in the utilization of nutrients, capacity to modify the rhizosphere, strong aggressiveness against phytopathogenic fungi and efficiency in promoting plant growth and defense mechanisms. So far, Trichoderma sp. is among the most studied fungal BCAs and commercially marketed as biopesticides (Harman, 2000).Trichoderma is a secondary opportunistic invader, a fast growing fungus, a strong spore producer, a source of cell wall degrading enzymes and important antibiotic producers (Francesco et al., 2008). The main biocontrol mechanisms exhibited by Trichoderma in direct confrontation with fungal patho-

8492

Afr. J. Biotechnol.

gens are mycoparasitism (Papavizas, 1985; Harman and Kubicek, 1998; Howell, 2003) and antibiosis (Howell, 1998; Sivasithamparam and Ghisalberti, 1998). As Manipur being in one of the rich Indo-Burma mega biodiversity hot-spot region of the world, is expected to occur diverse range of Trichoderma sp. having potential biocontrol activity. Bean (Phaseolus vulgaris L.) is one of the most important food legumes for direct human consumption in the world. Several soilborne fungi cause wilt and damping-off diseases in beans. The main pathogens responsible for causing wilt and damping off incidence in beans are Fusarium oxysporum f.sp.phaseoli and Rhizoctonia solani (Kuhn) respectively (El-Mougy et al., 2007). Yield losses in severely infested areas may be as high as 50% (Estevez et al., 2001). Many researchers have demonstrated the potential of Trichoderma sp. in controlling wilt and damping-off diseases of crop plants caused by Fusarium sp. and Rhizoctonia solani (Dubey et al., 2007 and Rojo et al., 2007). Therefore, the present study aimed to study the biocontrol efficacy of the local strains of Trichoderma for the control of wilt and damping off disease in beans. MATERIALS AND METHODS Isolation of Trichoderma sp. Soils from the agricultural fields of nine different districts of Manipur were collected and preserved on 4°C. Trichoderma strains were isolated using selective medium by following modified method given by Tate (1995). Then the colonies were transferred on potato dextrose agar (PDA) plates and incubated at 27°C for five to six days followed by morphological identification based on colony characteristics (Gams and Bisset, 1998) and microscopically according to the related literatures.

medium (51.5/lt.) was used for detection of protease activity. Culture disc from 5-6 days old Trichoderma cultures were inoculated on skim milk agar medium and incubated at 28°C ± 2°C for three to four days. Trichoderma which shows proteases activity gave a clearance zone indicating the production of protease enzymes.

Chitinase activity Chitinase activity of the Trichoderma isolates was determined according to the modified method given by Roberts and Selitrennikoff (1988) on chitin detection medium. Preparation of colloidal chitin: 5.0 g of chitin was added to 60 ml of concentrated HCl (acid hydrolysis) by constant stirring using a magnetic stirrer at 4°C and kept in refrigerator overnight. The resulting slurry was then added to 2000 ml. of ice-cold 95% ethanol and kept at 26°C for overnight (ethanol neutralization). Then it was centrifuged at 3000 rpm for 20 min at 4°C. The pellet was washed with sterile distilled H2O. The final colloidal chitin was stored at 4°C until further use. Final chitinase detection medium: The final chitinase detection medium per litre comprises of 4.5 g colloidal chitin, 0.3 g magnesium sulphate, 3.0 g ammonium sulphate, 2.0 g potassium dihydrogen phosphate, 1.0 g citric acid monohydrate, 15 g agar, 0.15 g bromocresol purple and 200 µl of tween-80. The pH of the media was maintained at 4.7 and autoclaved at 121°C for 15 min. The fresh culture plugs of Trichoderma isolates to be tested for chitinase activity were inoculated into the sterile plates containing chitinase detection medium and incubated at 28±2°C for two to three days and observed for the colored zone formation. Chitinase activity was identified due to the formation of purple colored zone. Color intensity and diameter of the purple colored zone were taken as the criteria to determine the chitinase activity after three days of incubation.

ß-1,3-Glucanases activity Evaluation of antifungal activity Fungal inhibition assay of the indigenous Trichoderma isolates were performed by dual plate assay against the test pathogens such as Fusarium oxysporum (C.O. of wilt) and Rhizoctonia solani (C.O. of damping off) isolated from the infected beans collected from the different crop fields of Manipur (Morton and Strouble, 1955) and plates were incubated at 28°C ± 2°C for five to six days on PDA plates. For each treatment, three triplicate plates were maintained. The treatment without antagonist served as control. In dual cultures, the Trichoderma isolates were categorized as effective biocontrol agents based on their ability to overgrow and inhibit the pathogens. The interaction between the Trichoderma and pathogens were examined under the microscope. Determination of different cell wall degrading enzymes of the Trichoderma isolates Protease activity Protease activity of Trichoderma isolates was determined according to the modified method given by Berg et al. 2002. Skim milk agar

For plate screening of ß-1,3-glucanases activity, carboxy methyl cellulose agar (CMC agar) medium amended with laminarin was used according to the modified method given by El-Ketatny et al. (2001). A 6 mm culture disc was placed at the center of the plate. Plates were incubated at 25°C for three days. ß-1,3-glucanases activity on the plates were observed by dipping in 0.1% congored dye for 15 to 20 min followed by distaining with 1 N NaCl and then with 1 N NaOH for 15 min. The destaining was repeated twice. ß-1, 3-glucanases activity was recorded with the clearance zone formation.

Biocontrol potential of the indigenous Trichoderma isolates in green house trial Based on the relative biocontrol potency such as antifungal activity and the production of enzymatic activities, only three Trichoderma isolates (T10, T17, and T83) were selected for pot culture experiment. A pot experiment was conducted during 2009 to 2010 in the greenhouse of Institute of Bioresources and Sustainable (IBSD), Takyelpat, Imphal using a completely randomized block design with different treatments. The disease control efficacy of the

Kamala and Devi

three local isolates was compared with a reference Trichoderma harzianum strain (ITCC No. 6276) against wilt (C.O. F. oxysporum) and damping off (C.O. R. solani) of beans. The surface sterilized bean seeds were planted in the plastic pot, which was filled with 3 kg of sterilized soil. Two days ahead of sowing the bean seeds, each pot was pretreated with seven to eight days-old fungal pathogens (Dubey et al., 2007). Bean seeds were treated with eight days old Trichoderma spores concentration of 10-9 along with 1% CMC and charcoal powder to ensure uniform distribution of the biocontrol agent on the seed surface and seeds were shade dried. The pots without pathogen application were taken as controls. Different treatments taken for pot experiments were named as: (i) control, (ii) F. O, (iii) F.O + T. harzianum, (iv) F. O. + T10, (v). F. O. + T17, (vi) F. O. + T83 (vii) R. S. (viii)R. S. + T. harzianum, (ix) R. S. + T10, (x). R. S. + T17 and (xi) R. S. + T83. The plants were observed for the occurrence of wilt and damping off incidence after 30 days of sowing and compared with the control pots. Increase in root and shoot lengths were recorded after 45 days of growth. The percentage reduction of roots lengths and shoot lengths were evaluated and compared with the control pots. Disease incidence (%) was calculated using the formula n/N × 100%, where, n = number of plants affected by disease, N = Number of plants assessed. Disease reduction (%) was also calculated using the formula: Disease reduction (%) = [(Growth in control – Growth in treatment) / Growth in control] × 100 The ANOVA approach was used to evaluate the biocontrol efficiency of Trichoderma biocontrol agent both in vitro and in vivo experiments. Comparison among treatment are means of appropriate control treatment which were made at P=0.05. In case of the green house experiment, pool data of the pot experiments were subjected at ANOVA.

RESULTS Isolation and characterization of Trichoderma strains A total of 114 Trichoderma isolates obtained from the different soil samples collected from diverse agricultural fields of Manipur were morphologically and microscopically characterized. The distinctive morphology of Trichoderma includes rapid growth, bright green or white conidial pigments and a repetitively branched, but some of them have poorly defined conidiophore structure. Cultures showed very fast growth rate between 25 to 30°C. Microscopically they were identified based on the shape of conidiophores, conidia and philiades using 100X in Olympus BX61 microscope. Some of the conidiophores were highly branched and difficult to define or measure. And others were loosely or compactly tufted, often formed in distinct concentric rings and borne along the scant aerial hyphae. Main branches of the conidiophores produce lateral side branches and often phialides arising directly from the main axis near the tip. Typically the conidiophore terminates in one or a few phialides. Phialides are typically enlarged in the middle, cylindrical or nearly subglobose (Figure 1).

8493

Antifungal activity The antifungal activities of 114 Trichoderma isolates against F. oxysporum and R. solani were determined by dual plate assay on PDA plates. Out of the total 114 isolates, 80% of the Trichoderma isolates showed high degree of antifungal activities against F.O while 68% of Trichoderma isolates gives strong antagonistic activity against R. solani (Table 1). Based on their adaptive focused acoustics (AFA) on dual plate assay 25 test isolates were selected for further analysis of different biocontrol mechanisms. Determination for the production of different cell wall degrading enzymes Each of the 25 selected biocontrol Trichoderma isolates were evaluated for the production of different enzymatic activities such as proteases, chitinases and β-1,3glucanases in vitro condition. Proteases activity The production of protease, a fungal cell wall degrading enzymes which is an important mechanism of fungal growth inhibition was detected for all selected isolates. Protease activity was evaluated from the clearance zone given on the skim milk agar plates and the degree of protease activities were measured based on the diameter of clearance zone which ranges from 10 to 60 mm. Out of the total 25 Trichoderma isolates, 72% of them gave maximum protease activity. Among them, T54 and T69 were the two isolates which showed highest protease activity with more than 50 mm zone width (Figure 2). Chitinases activity Chitinase activity, an important enzymatic activity to degrade the chitin which is a major structural polysaccharide of fungal pathogens was evaluated by using the chitin detection medium. The formation of purple colour zone on the chitin detection medium indicated the presence of chitinase activity. Chitinase activity of the 25 Trichoderma isolates was determined according to the diameter and intensity of the colour zone. The diameter of the colour zone ranged from 10 to 85 mm approximately and 84% out of the 25 Trichoderma showed maximum chitinase activity. T17, T69, T80 and T83 showed highest chitinase activity which were above 60 mm in zone diameter (Figure 3). β-1,3-Glucanases activity β-1,3-glucanases are enzymes which hydrolyzes the O-

8494

Afr. J. Biotechnol.

Figure 1. A, Colony morphology of T10 isolates on PDA plate; B, microscopic view of T10 isolate; C, colony morphology of T17 isolates on PDA plate; D, microscopic view of T17 isolate; E, colony morphology of T83 isolate on PDA plate; F, microscopic v iew of T83 isolate. PDA, Potato dextrose agar.

glycosidic linkages of β-glucan chains and are among the plant defense responses to pathogen attack. The production of β-1,3-glucanases activity by the 25 Trichoderma isolates were determined by using the CMC agar medium. The production of β-1,3-glucanases was detected according to the clearance zone formation. The diameter of the clearance zone ranged from 10 to 70 mm. Among the selected isolates, 60% showed maximum activity. T8, T10, T17, T72 and T83 were among the Trichoderma isolates which showed maximum activity with more than 50 mm in diameter (Figure 4) Biocontrol activity in green house trial Three Trichoderma isolates with high antagonistic activity against F. oxysporum and R. solani were selected for the evaluation of their biocontrol efficacy in a green house trial and compared their activity with the control untreated pot. In this test, no Trichoderma could completely protect

the plants against F. oxysporum and R. solani, although all isolates significantly increased shoot length, root length and fresh weight as compared to the infested control plants (Table 2). Plant height was recorded after 45 days of growth in the trial pots. In the F. oxysporum treated pots, the plants treated with T83 consistently provided significant increase in both root and shoot length, with a highest root and shoot length reduction percentage of 6.88 and 8.88, respectively. Whereas in case of R. solani treated plant, root length was found to increase when treated with the T10 but increase in shoot length was recorded in the plant treated with T83. Whereas in the pot of F. oxysporum treated with reference strain T. harzianum (ITCC No. 6276), the root length reduction value was found to be 12.05% and shoot length reduction value of 17.75% and in case of R. solani and T. harzianum (ITCC No. 6276) treated plants, the percentage reduction of root length and shoot length were 32.75 and 50.41, respectively. The least significant difference (LSD) (P=0.05) value for root length was 0.014

Kamala and Devi

8495

Table 1. Antifungal activity (% inhibition) against F. oxysporum and R. solani by the selected indigenous Trichoderma isolates using dual culture methods.

S/N

Name of Trichoderma

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25.

T1 T2 T4 T7 T8 T10 T15 T17 T20 T22 T34 T36 T38 T40 T47 T51 T54 T62 T69 T72 T75 T80 T83 T112 T114

Antifungal activity Fusarium oxysporum Rhizoctonia solani b b 74.33 ± 2.33 79.00 ± 3.78 b 71.67 ± 2.03 64.67 ± 2.60c 72.33 ± 1.45b 70.00 ± 3.60b e g 29.00 ± 2.08 19.67 ± 1.67 b b 75.33 ± 2.03 75.67 ± 4.70 b c 72.00 ± 3.51 62.33 ± 1.45 c b 65.33 ± 2.60 70.67 ± 0.67 c 62.33 ± 1.45 75.00 ± 2.89b e c 25.67 ± 3.48 60.67 ± 0.67 e 21.67 ± 6.00 15.00 ± 2.89g c 69.00 ± 2.08 41.67 ± 1.67d b b 72.33 ± 1.45 72.33 ± 4.33 c f 62.33 ± 1.45 21.67 ± 1.67 c b 69.67 ± 3.93 76.67 ± 4.41 64.67 ± 3.71c 78.33 ± 4.41b b c 79.00 ± 3.78 61.67 ± 4.41 d 45.00 ± 2.89 69.00 ± 2.08c a 82.33 ± 1.45 45.00 ± 2.89d b 79.33 ± 2.33 41.67 ± 1.67d b 79.00 ± 3.78 71.67 ± 4.41b b b 79.33 ± 2.33 75.00 ± 2.89 f 14.00 ± 3.05 31.67 ± 0.67e a 82.33 ± 1.45 81.67 ± 1.67a b 77.33 ± 3.93 69.00 ± 2.01c b 79.33 ± 1.76 42.33 ± 1.45d

Values are average of three replicates; ± SEM; values with the same letter do not differ significantly (P<0.05).

while for the shoot length, it was found to be 0.034 thereby indicating a significant increase in root and shoot length (Table 2). It is evident from Table 2 that the plant treated with F. oxysporum and T83 gave an effective disease control of wilt diseases of beans with a record of only 9% disease incidence as compared to control plants, and the highest disease reduction percentage of wilt diseases of bean was also recorded from T83 treated plant. Whereas the disease incidence of F. oxysporum with T. harzianum was 33.33% and the disease reduction percentage of this treatment was 51.5%. In case of the plant infested with R. solani, the treatment plant of R. solani and T83 showed the lowest disease incidence as well as highest disease reduction percentage of damping off disease of bean with a reading of 11 and 76.6% respectively. Whereas, the disease incidence percentage of R. S. + T. harzianum was 66.67% and their disease reduction percentage was 14.1%. This result shows that the indigenous Trichoderma T83 isolates gives better disease control

activity in both the wilt and damping off diseases of bean as compared to the reference T. harzianum.

DISCUSSION Among the fungal biocontrol agents, Trichoderma is one of the most commonly used organisms for the control of soil borne fungal pathogens (Harman, 2000). The aim of the current study was isolation, screening and selection of the potential indigenous Trichoderma from Manipur to be utilized as a potential antagonist against the F. oxysporum and R. solani associated with wilt and damping off diseases in beans. Isolation of local strains of Trichoderma is essential for successful identification of potential biocontrol agents (Williams and Asher, 1996). Field soil used in this study was collected from different agricultural fields of Manipur having pH ranging from 6.3 to 6.8 on selective medium (Elad et al., 1981). A total of 114 Trichoderma isolates were evaluated for their

8496

Afr. J. Biotechnol.

Figure 2. Specific activity of protease from different selected Trichoderma isolates. Each bar represents the average of three independent measurements.

Figure 3. Specific activity of chitinase from different selected Trichoderma isolates. Each bar represents the average of three independent measurements.

antifungal activity against F. oxysporum and R. solani. The characterization of all the Trichoderma isolates into species aggregates are made on the basis of cultural and morphological characters according to Rifai (1969). In a similar study, Sariah et al. (2005) morphologically identified T. harzianum, Trichoderma virens, Trichoderma koningii and Trichoderma longibrachiatum. Zakaria (1989) identified five species of Trichoderma from the rhizosphere of rubber in Malaysia. Similar studies by Lim and Tech (1990) isolated three species of Trichoderma in Malaysian soil, T. hamatum (Bon.) from cocoa grown on ex-rubber areas, T. koningii (Rifai) from rubber and cocoa and T. harzianum (Rifai) from rubber and oil palm. Antagonistic effect based on the dual culture

experiments showed that Trichoderma isolates significantly inhibited the mycelial growth of F. oxysporum and R. solani. 80% of Trichoderma isolates showed high degree of antagonism against F. oxysporum while 68% of Trichoderma isolates gave strong antagonistic activity against R. solani. Chung and Choi (1990) reported effective inhibition of F. oxysporum f. sp. sesame by T. viride. Perello et al. (2003) reported that Trichoderma sp. significantly inhibited Drechslera tricirepentis colony growth between 50 and 74% utilizing dual culture techniques on PDA. Hermosa et al (2000) deduced that T. harzianum had a potential biocontrol activity in a dual culture studies against the phytopathogenic fungi of Phoma betae, Rosellinia necatrix, Botrytis cinera and F.

Kamala and Devi

8497

Figure 4. Specific activity of β-1,3 glucanases from different selected Trichoderma isolates. Each bar represents the average of three independent measurements.

Table 2. Biological efficacy of different Trichoderma isolates against the F. oxysporum and R. solani in beans.

S/N

Treatment

Root length

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11.

Control F. oxysporum F. oxysporum +T. harzianum F. oxysporum + T10 F. oxysporum + T17 F. oxysporum + T83 R. solani R. solani + T. harzianum R. solani + T10 R. solani + T17 R. solani + T83 LSD (P=0.05)

82.67 ± 1.2a 30 ± 1.15f 68.33 ± 2.02c 73.33 ± 0.89b 74.33 ± 0.89b 75.33 ± 1.45b g 10.00 ± 1.15 42.00 ± 0.57e 51.33 ± 0.89d 57.33 ± 0.89d 57.33 ± 1.45d 0.014

% Reduction of root length 0 65.91 12.05 18.93 10.35 6.88 65.49 32.75 1.71 10.35 13.76

Shoot length 83.33 ± 0.89a 30.67 ± 0.67f 69.00 ± 0.67c 73.33 ± 1.45b 74.00 ± 1.15b 74.67 ± 1.45b g 10.00 ± 1.15 41.00 ± 0.57e 51.00 ± 1.73d 37.00 ± 1.15f 67.00 ± 1.15c 0.034

% reduction of shoot length 0 93.71 17.75 11.30 10.09 8.88 87.90 50.41 37.91 54.43 18.14

Disease incidence (%) 0 89 33.33 11 11 9 89 66.67 44.33 22.33 11

Values are average of three replicates; ± SEM; values with the same letter do not differ significantly (P<0.05).

oxysporum f, sp. dianthea in the three different media. Whipps (1987) stated that T. harzianum appears to be a promising organism, particularly for use against R. solani. Trichoderma sp. are known to act through several mechanisms such as hyperparasitism, inhibition and antibiosis (Weindling, 1932; Hadar et al., 1979). Different enzymatic activities such as proteases, chitinases and β-1,3-glucanases of the selected Trichoderma isolates were determined in vitro condition. Proteases activity of the 25 Trichoderma isolates ranges from 10 to 60 mm while for the chitinase activity, it ranges from 10 to 85 mm approximately. Out of the total 25 Trichoderma isolates, 60% of them showed maximum β-

1,3-glucanases activity and ranges from 10 to 70 mm in diameter. Benitez et al., (2004) demonstrated that Trichoderma strains that overproduce chitinases have been shown to be effective biocontrol agents against pathogens such as B. cinera and Rhizoctonia meloni. Howell (2003) reported that biocontrol of B. cinerea by T. harzianum has been attributed in plant to the action of proteases produced by the BCA that inactivate hydrolytic enzymes produced by this pathogen on bean leaves. Benitez et al. (1998) demonstrated that proteases from T. harzianum play an important role in biological control. Szekeres et al. (2004) reported the role of proteases in mycoparasitism and has

8498

Afr. J. Biotechnol.

been reinforced with the isolation of new proteasesoverproducing strains of T. harzianum. Howell (2003) tested the role of chitinases in mycoparasitism and believed that chitinases is a key enzyme in this process. Harman et al. (2004) also described the types of chtinases detected from T. harzianum, T. atroviride and T. virens. Simmoms, 1994 described that glucanases are among the plant defense responses to pathogen attack. Production of four β-1,3-glucanases by T. harzianum has been described by de la Cruz et al. (1995); Kitamoto et al. (1987); Lorito et al. (1994).The application of the indigenous Trichoderma isolates in our study against F. oxysporum and R. solani in beans shows good result and satisfactory reduction in the disease symptoms. Similarly, Singh and Singh (2004) screened the two strains, viz, T. harzianum (IMI. No. 359869) and T. virens (ITCC No. 106695) having the potential to control the collar rot disease of Mentha species caused by Sclerotium rolfsii. Larralde-Corona et al. (2008) reported the biocontrol potential of novel native Trichoderma strains against Macrophomina phaseolina isolated from sorghum and common bean. In the present study, the effect of treatment was found to be significant (LSD (P=0.05) of root length = 0.014 and LSD of shoot length = 0.034) against wilt and damping off incidence respectively. The maximum wilt and damping off disease reduction were observed in pots treated with F. O. + T83 and R. S. + T83, respectively (Table 2). This could be due to a high degree of mycoparasitism and production of some lytic enzymes by this Trichoderma isolate. Trichoderma sp. have been shown to decrease wilt incidence in chickpea plants (Dubey et al., 2007) and increase root development in numerous other plants (Harman, 2006).From the current study, it can be postulated that there is maximum disease reduction in the application of indigenous Trichoderma isolate (T83) against the wilt and damping off diseases of bean as compared to the reference T. harzianum (ITCC No.6276) strain. This may be due to a number of reasons, including pathogenecity of isolates, climatic adaptability, influence of the pathogen origin and even the influence of local bean cultivars use in this region (Harman, 2006; Sharon et al., 2007). Therefore, T83 isolate native to Manipur could be an excellent candidate for providing long-term biocontrol agent against F. oxysporum and R. solani in beans with the aim of reducing the use of chemical pesticides in this region. ACKNOWLEDGEMENT We thank DBT for providing financial support during this work programme. REFERENCES Benitez T, Delgado-Jarana J, Rincon AM, Rey M, Limon MC (1998).

Biofungicides: Trichoderma as a biocontrol agent against phytopathogenic fungi.In: Pandalai SG (ed). Recent Signpost Trivandrum. 129-150. Benitez T, Rincon AM, Limon MC, Codon AC (2004). Biocontrol mechanisms of Trichoderma strains. Int. Microbiol. 7: 249-260. Berg G, Krechel M, Ditz R, Sikora A, Ulrich Hallmann J (2002). Endophytic and ectophytic potato-associated bacterial communities differ in structure and antagonistic function against plant pathogenic fungi. FEMS Microbiol. Ecol. 51 no. 2: 215-229. Chung HS, Choi, WB (1990). Biological control of sesame damping off in the field by coating seed with antagonistic Trichoderma viride. Seed Sci. Technol. 18: 451-459. De la Cruz, JL, F Reyes, Perez-Leblic MI. (1989). Purification and properties of a β-glucanases, chitobiase and chitinase from Trichoderma harzianum. Arch. Microbiol. 159: 1-7. Dubey SC, Suresh M Singh (2007). Evaluation of Trichoderma species against Fusarium oxysporum f. sp. ciceris, for integrated management of chickpea wilt. Biol Control. 40: 118-127. Elad Y, Chet I, Henis Y (1981). A selective medium for improving quantitative isolation of Trichoderma sp. from soil. Phytoparasitica, 9: 59-67. El-Katatny MH, Gudelj M, Robra KH, Elnaghy MA, Gubitz GM (2001). Characterization of a chitinase and an endo-ß-1,3-glucanase from Trichoderma harzianum, Rifai T24 involved in control of the phytopathogen Sclerotium rolfsii. Appl Microbiol. Biotechnol. 56: 13743. .El-Mougy SN, Nadia GE (2007). Control of wilt and root rot incidence in Phaseolus vulgaris 1. By some plant volatile compounds, J Plant Prot. Res. 47: 0255-265. Estevez DE Jensen, C Kurle JE, Percich A (2001). Management of dry bean root rot in Minnesota. Northarvest grower. pp. 6-7. Francesco Vinale, Krishnapallai Sivasithamparam, Emiloi L, Ghisalberti Roberta Marra, Sheridan L, Woo Matteo Lorito (2008). TrichodermaPlant-pathogen interactions, Soil Biol. Biochemist. 40: 1-10. Gamms W, Bisset J (1998). Morphology and identification of Trichoderma.In: Trichoderma and Gliocladium : Basic biology, Taxonomy and genetics. E Kubicek , GE Harman eds, Taylor and Francis, London, UK. 1: 3-34. Hadar Y, Chet I, Henis Y (1979). Biological control of Rizhoctonia solani damping-off with wheat bran culture of Trichoderma harzianum. Phytopathology, 69: 64-68. Harman GE, Kubicek CP (1998). Trichoderma and Gliocladium, Taylor & Francis, London. p. 278. Harman GE (2000). Myths and dogmas of biocontrol: changes in perceptions derived from research on Trichoderma harzianum T22. Plant Dis. 84: 377-393. Harman GE, Howell CR, Viterbo A, Chet I, Lorito M (2004). Trichoderma species opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2: 45-56. Harman GE (2006). Overview of mechanisms and uses of Trichoderma sp. Phytopathology, 96: 190-194. Hermosa MR, Grondona I, Iturriaga EA, Diaz- Minguez LM, Casytro C, Mont E, Garcia–Acha I (2000). Molecular characterization and identification of biocontrol isolates of Trichoderma sp. Appl. Environ. Microbiol. 66: 1890-1898. Howell CR (1998). The role of antibiosis in biocontrol. In: Harman, GE., Kubicek, CP. (Eds). Trichoderma and Gliocladium. Enzymes, Biological control and commercial application, vol.2. Taylor and Francis Ltd., London pp. 173-183. Howell CR (2003). Mechanisms employed by Trichoderma species in the biological control of plant diseases: the history and evolution of current concepts. Plant Dis. 87: 4-10. Kitamoto Y, Kono R, A Shimoyori, N Mori, Ichikawa Y (1987). Purification and some properties of an exo-ß-glucanase from Trichoderma harzianum. Agric. Biol. Chem. 51: 3385-3386. Larralde CP, Santiago-Mena , Sifuentes-Rincon AM, Rodriguez-Luna, Rodriguez-Perez, Shirai K, Narvaez-Zapata JA (2008). Biocontrol potential and polyphasic characterization of novel native Trichoderma strains against Macrophomina phaseolina isolated from sorghum and common bean. Appl. Microbiol. Biotechnol. 80: 167-177.

Kamala and Devi

Lim TK, Teh BK (1990). Antagonism in vitro of Trichoderma species against several basidiomycetous soil-borne pathogens and Sclerotium rolfsii. Plant Dis. Prot. 97(10): 33-41. Lorito M, CK Hayes A, Di Pietro SL, Woo, Harman GE (1994). Purification, characterization and synergistic activity of a glucan 1,3ß-glucosidase and an N-actyl-ß-glucosaminidase from Trichoderma harzianum. Phytopathology, 84: 398-405. Morton DT, Stroube WH (1955). Antagonistic and stimulatory effects of microorganism upon Sclerotium rolfsii. Phytopathology, 45: 419-420. Papavizas GC (1985). Trichoderma and Gliocladium; biology, ecology and potential for biocontrol. Annual Review Phytopathology. 23: 2554. Perello A, Monaco C, Simond MR, Sisterna M, Bello GD (2003). Biocontrol efficacy of Trichoderma isolates for tan spot of wheat in Argentina. Crop Prot. 22: 1099-1106. Rifai MA (1969). A revision of the genus Trichoderma. Mycol Pap. 116: 1-56. Roberts WK, Selitrennikoff CP (1988). Plant and bacterial chitinases differ in antifungal activity. J. Gen. Microbiol. 134: 169-176. Rojo FG, Reynoso MM , Sofia M, Chulze IN, Torres AM (2007). Biological control by Trichoderma species of Fusarium solani causing peanut brown root rot under field conditions. Crop Prot. 26: 549-555. Sariah M, Choo CW, Zakaria H, Norihan MS (2005). Quantification and characterization of Trichoderma sp. from different ecosystems. Mycopathology, 159: 113-117. Sharon E, Chet A, Viterbo M, Bar-Eyal H, Nagan GJ, Samuels and Y, Spiegel Y (2007). Parasitism of Trichoderma on Meloidogyne javanica and role of the gelatinous matrix, Eur. J. Plant Pathol. 118: 247-258.

8499

Simmoms CR (1994). The physiology and molecular biology of plant 1,3-ß-D-glucanases and 1,3: 1,4-ß-D-glucanases. Crit. Rev. Plant Sci. 13: 325-387. Singh A, Singh HB (2004). Control of collar rot of mints ( Mentha sp.) caused by Sclerotium rolfsii by using biological means. Curr. Sci. 87(3): 362-366. Sivasithamparam K, Ghisalberti EL (1998). Secondary metabolism inTrichoderma and Gliocladium. Vol.I. Taylor and Francis Ltd., London, pp. 139-191. Szekers A, Kredics L, Antal Z, Kevei F, Manezinger L (2004). Isolation and characterization of protease overproducing mutants of Trichoderma harzianum. FEMS Microbiol. Lett. 233: 215-222. Tate RL (1995). Variation in microbial activity in histosols and its relationship to soil moisture. Appl. Environ. Microbiol. 40: 313-317. Weindling R (1932). Trichoderma lignorum as a parasite of other soil fungi. Phytopathology, 22: 837-845. Whipps JW (1987). Effect of Media on growth and interactions between a range of soilborne glasshouse pathogens and anatagonistic fungi. New Phytol. 107: 127-142. Williams GE, Asher MJC (1996). Selection of rhizobacteria for the control of Pythium ultimum and Aphanomyces cochlioides on sugarbeet seedlings. Crop Prot. 15: 479-486.

Full Length Research Paper

Enhanced accumulation of root hydrogen peroxide is associated with reduced antioxidant enzymes under isoosmotic NaCl and Na2SO4 salinities Mahmoudi Hela1*$, Baatour Olfa1$, Ben Salah Imen2, Nasri Nawel1, Wissal Abidi1, Huang Jun3, Zargouni Hanen1, Hannoufa Abdelali4, Lachaal Mokhtar1 and Ouerghi Zeineb1 1

Unité de Physiologie et Biochimie de la Tolérance au Sel des Plantes, Département des Sciences Biologiques, FST, Campus Universitaire, 2092 Tunis, Tunisie. 2 Laboratoire d’Adaptation des Plantes aux Stress Abiotiques, CBBC, BP901, 2050 Hammam-Lif,Tunisia. 3 Molecular Genetics, Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, Saskatchewan, Canada S7N 0X2. 4 Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, Ontario, Canada, N5V 4T3. Accepted 8 February, 2012

The inhibitory effect of salt stress on lettuce is one of the main reasons for the reduction of plant growth and crop productivity. In the present study, the response of two lettuce varieties Verte and Romaine to isoosmotic NaCl and Na2SO4 treatments were examined. Both varieties were grown in pots containing nutrient Hoagland solution with or without 100 mM NaCl or 77 mM Na2SO4. Relative growth rate (RGR), hydraulic parameters, root ion content, proline and several antioxidant activities in roots were measured after 12 days of treatment. After prolonged exposure to salt stress, relative growth rate and water content of lettuce significantly decreased. Roots accumulated high level of Na+ under both + 2+ + salts, whereas the accumulation of K and Ca decreased. High level of Na inside the cells inhibited + + + the K uptake and resulted in increased K /Na ratio. In addition, salt stress also caused an increase in the accumulation of proline. This result suggests that proline may play a crucial role in protecting lettuce under salt stress especially in response to Na2SO4 treatment. Membrane damage estimated by electrolyte leakage (EL) increased especially in response to Na2SO4 treatment in both varieties, but Verte had significantly lower EL relative to Romaine under 100 mM NaCl. A reduction in the activities of CAT in both varieties under 100 mM, and GPX activity in Verte under Na2SO4 treatment coincided with an increase in H2O2 level, indicative of cellular damage and a general depression of the antioxidant enzymatic system in lettuce roots. Key words: Lettuce, NaCl, Na2SO4, RGR, mineral nutrition, antioxidant activities, proline. INTRODUCTION Salinity affects plant growth by the osmotic stress induced by salt around the roots as well as the toxicity effects caused by excessive accumulation of salt in

*Corresponding author. E-mail: mahmoudihela@yahoo.fr.

#These two authors contributed equally to this work.

leaves. Growth response to salinity has two phases. The first phase is characterized by a large decrease in growth rate caused by the salt outside the roots, that is, an 'osmotic' response, whereas the second phase typically involves an additional decline in growth caused by salt having built up to toxic levels within plants, that is a 'saltspecific' response (Munns, 2005). As a consequence of these primary effects, secondary stresses such as oxidative damage and nutritional imbalance often occur (Zhu, 2001), also affecting plant growth. It has been

Hela et al.

shown that reduction of relative growth rate (RGR) is greater during the time immediately after salt treatment, and there is a partial difference in RGR between control and salt treatments during the long term (Cramer et al., 1994). Membrane damage, as measured by electrolyte leakage (EL) has been documented for salt-treated plants and can be alleviated by adding Ca (Leopold and Willing, 1984), although the exact mechanism of membrane injury has not been determined. Excess salt concentrations cause enhanced generation of reactive oxygen species (ROS) in plants (Muscolo et al., 2003; Kim et al., 2005). These ROS can cause serious oxidative damages by disrupting lipids, proteins and nucleic acids (Ghorbanli et al., 2004). Plants have developed various protective mechanisms to eliminate or reduce ROS, which are effective at different levels of stress-induced deterioration (Beak and Skinner, 2003). The enzymatic antioxidant system is one of these protective mechanisms, and includes superoxide dismutase (SOD: EC 1.15.1.1), which can be found in various cell compartments and catalyses the disproportion of two O2 ·- radicals to H2O2 and O2 (Scandalios, 1993). H2O2 is eliminated by various antioxidant enzymes such as catalases (CAT: EC 1.11.1.6) (Scandalios, 1993) and peroxidases (POX: EC 1.11.1.7) (Gara et al., 2003) which convert H2O2 to water. Moreover, increased POX enzyme activity in responses to salinity was reported by Neto et al. (2006). Several reports have suggested that the extent of oxidative cellular damage in plants exposed to abiotic stress is controlled by the capacity of their anti-oxidant systems (Silvana et al., 2003). We previously analyzed seedlings of two lettuce varieties (Verte and Romaine) for their physiological and biochemical responses to equivalent osmotic levels of two types of salinity (NaCl and Na2SO4) (Mahmoudi et al., 2010). In the present study, we aimed to study the implications of Na+ accumulation in the roots, and the limitations of essential nutrients acquisition. We also evaluated the effects of NaCl and Na2SO4 salts on antioxidant enzymes. MATERIALS AND METHODS Plant material and culture condition The experiments were carried out in a greenhouse under the following conditions: 16 h light/8 h dark photoperiod and day/night temperature cycle of 20°C/17°C). Seeds were germinated in Petri dishes at room temperature in the dark. Seven-day old seedlings were irrigated with distilled water during the first week. The tested plants (Verte and Romaine) were grown in pots containing Hoagland nutrient solution (Hoagland and Arnon, 1950) diluted 8fold as the control. After 7 days of acclimation, salt treatment was initiated by adding increments of 20 mM Na2 SO4 and 25 mM NaCl daily until the desired concentrations of 77 mM Na2 SO4 and 100 mM NaCl in order to avoid osmotic shock. Individual plants were grown in the control (without salt) , control plus 100 mM NaCl, or control plus 77 mM Na2SO4 for 12 days prior to harvest. Fresh

8501

weight (FW), dry weigh (DW) of roots and rosette leaves of six plants from each treatment were separately recorded. Tissue water content was expressed as a percentage of (fresh weight-dry weight)/fresh weight. Tissues were harvested and stored at -80°C until biochemical analysis. Relative growth rate (RGR) was calculated from the increase in the dry weight of plant at initial and final sampling. Plant harvests were taken of six replicate plants for each genotype and each treatment at two sampling times 0, and 12 days after final salt concentrations (100 mM NaCl and 77 mM Na2 SO4). Plant DW was determined after drying fresh tissues at 60°C for 48 h. Relative growth rate was calculated for each period as per the equation: RGR = (lnW 2 - lnW 1) / (t2 - t1) (1) Where, W is the plant dry weight and t is time in days at the start and finish of each period.

Nutrition parameters Ions were extracted with 0.5% HNO3; K+, Na+ and Ca2+ concentrations were assayed by flame photometry (Eppendorf apparatus) and Cl- by coulometry (Butcher Cotlove apparatus). The ability of the plants to maintain tissue K+ or Ca2+ concentration in saline conditions is indicated as K+ selectivity. It is defined as the ratio of K+/(K++Na+) in the tissue divided by the ratio of K +/(K++Na+) in the external medium (Ashraf and McNeilly, 1990).

Poline content Proline in root and leaf tissues was extracted and analysed according to Bates et al. (1973). Ten milligram (10 mg) of powder of dry plant material was mixed with 1.5 ml aqueous sulfosalicylic acid (3%, w/v). The homogenate was centrifuged at 14,000 x g for 10 min, and the supernatant was transferred to a fresh 1.5 ml tube. The extracted solution was reacted with an equal volume of glacial acetic acid and ninhydrin reagent (1.25 g ninhydrin in 30 ml glacial acetic and 20 ml 6 M H3PO4) and incubated at 100°C for 1 h. The reaction was terminated by placing the tube in an ice bath. The reaction mixture was vigorously mixed with 2 ml of toluene. After warming at 25°C, the chromophore was measured at 520 nm. Lproline was used as a standard.

Electrolyte leakage (Relative ion leakage ratio) EL was measured to assess membrane permeability according to the procedure of Lutts et al. (1996) using an Electrical Conductivity Meter (EC). Leaf samples were taken and cut into 1 cm sections. The samples were then placed in individual stoppered vials containing 10 ml of distilled water after three washes with distilled water to remove surface contamination and incubated at room temperature (Ca 25°C) on a shaker (100 rpm) for 24 h. Electrical conductivity (EC) of bathing solution (EC1) was recorded after incubation. The same samples were then placed in an autoclave at 120°C for 20 min and a second reading (EC2) was taken after cooling the solution to room temperature. The electrolyte leakage was calculated as EC1/EC2 and expressed as a percentage. Hydrogen peroxide assay The hydrogen peroxide (H2 O2) content was determined according to Kotchoni et al. (2006) and as described by Mahmoudi et al. (2011). Briefly, fresh tissue (100 mg) was homogenized with 1 ml of 25 mM H2SO4 and then centrifuged at 14000 rpm for 10 min at 4°C. Twenty

8502

Afr. J. Biotechnol.

microliter (20 µl) of the supernatant was added to 200 µl of working reagent (WR) using PeroXoquant Quantitative Peroxide Assay Kit (Cat no. 23285, Thermo Fisher Scientific, Ottawa, ON, Canada). The absorbance of the supernatant was measured at 560 nm in a spectrophotometer. H2O2 was used as a standard calibration curve. Antioxidant activities Fresh root samples were submersed for 5 min in liquid nitrogen. The frozen roots were kept at –80°C for further analyses. Enzymes were extracted from 0.5 g leaf tissue using a mortar and pestle with 5 ml extraction buffer containing 50 mM potassium phosphate buffer, pH 7.6 and 0.1 mM Na-EDTA. The homogenate was centrifuged at 15,000 g for 15 min and the supernatant fraction was used to assay for the various enzymes. All steps in the preparation of enzyme extracts were performed at 4°C Gaiacol peroxidase activity (GPX) according to Srinivas et al. (1999) was assayed using guaiacol as an electron donor with a reaction mixture containing 20 mM phosphate buffer (pH 7.0), and 30 mM H2O2. The increase of absorbance due to tetraguaiacol formation was recorded at 470 nm. One unit of peroxidase activity catalyzes the oxidation of 1 µmol of guaiacol.APX activity was determined by measuring the consumption of ascorbate following the absorbance at 290 nm. One unit of APX activity was defined as the amount of enzyme required to consume 1 μmole ascorbate min–1 (Cakmak and Marschner, 1992).SOD activity was estimated by recording the decrease in absorbance of superoxidenitro blue tetrazolium complex by the enzyme (Sairam and Srivastava, 2002). About 3 ml of reaction mixture, containing 0.1 ml of 200 mM methionine, 0.1 ml of 2.25 mM nitro-blue tetrazolium (NBT), 0.1 ml of 3 mM EDTA, 1.5 ml of 100 mM potassium phosphate buffer, 1ml distilled water and 0.05 ml of enzyme extraction were taken in test tubes in duplicates from each enzyme sample. Two tubes without enzyme extract were taken as the control. The reaction was started by adding 0.1 ml riboflavin (60 μM) and placing the tubes below a light source of two 15 W florescent lamps for 15 min. Reaction was stopped by switching off the light and covering the tubes with a black cloth. Tubes without enzyme developed maximal colour. A non-irradiated complete reaction mixture which did not develop colour served as blank. Absorbance was recorded at 560 nm and one unit of enzyme activity was taken as the quantity of enzyme which reduced the absorbance reading of samples to 50% in comparison with tubes lacking enzymes.CAT activity was measured according to Aebi (1984). About 3 ml reaction mixture containing 1.5 ml of 100 mM potassium phosphate buffer (pH=7), 0.5 ml of 75 mM H 2O2, 0.05 ml enzyme extraction and distilled water to make up the volume to 3 ml. Reaction was started by adding H2O2 and the decrease in absorbance was recorded at 240 nm for 1 min. Enzyme activity was computed by calculating the amount of decomposed H2 O2. Data analysis The values of the parameters were subjected to two-way analysis of variance (ANOVA) and the mean differences were compared by Duncan Test. Each data point was the mean of indicated replicates and comparisons with P-values <0.05 were considered significantly different.

RESULTS Effect of salts on growth Some growth related characteristics such as plant biomass, relative growth rate (RGR), rosette diameter,

leaf number, leaf area and root length of both lettuce varieties were studied to distinguish the effect of sodium sulfate on lettuce plants. In the control condition, relative growth rate was higher in Verte than in Romaine. Salinity significantly affected RGR in both lettuce varieties (Figure 1). However, a significant difference in RGR between genotypes and treatments was found but results showed that RGR reduced severely with Na2SO4. Verte showed higher relative growth rate at 100 mM NaCl than Romaine. Thus, Verte was more tolerant to NaCl than Romaine. Furthermore, RGR reduced more by Na2SO4 than by NaCl in both varieties suggesting that the toxic effect is more important with Na2SO4 than with NaCl. Dry weights (DW) of roots and leaves were reduced by both sodic salts (Mahmoudi et al., 2010). This reduction was due to a decrease in root length, in leaf number, in rosette diameter and in total surface area. DW reduction was more significant with Na2SO4 than with NaCl in both varieties (Table 1). However, total surface area decreased by 36 and 86% in comparison with the control plants in Verte, and by 48 and 84% in Romaine under NaCl and Na2SO4, respectively. Leaf number (Table 1) did not change in Verte treated with NaCl, but decreased significantly under Na2SO4 in both varieties. Growth of roots and leaves was similarly affected so that the roots/leaves ratio remained unchanged (Table 1) Sodium uptake and distribution Independently of the treatments, Na+ was accumulated in both leaves and roots of Verte and Romaine (Figure 2) suggesting a possible saturation of the root tissues at -1 approximately 1 mmol.g root DW. The accompanying anion did not exert a significant effect on Na+ uptake in Romaine. However, sodium concentration reached high values [about 3 mmol g–1 dry weight (DW)] in Romainetreated plants. In Verte, the increase in Na+ concentration was more pronounced in response to Na2SO4 (5 mmol.g 1 -1 DW) than to NaCl (3 mmol.g DW). Thus, Verte seemed inefficient or unable to limit the uptake or translocation of Na+ under Na2SO4. +

Effect of salts on Na , K and Ca accumulation Under control conditions, roots of both varieties had similar contents of Na+ (Table 2). Under NaCl treatment, + both lettuce varieties showed an increase in Na accumulation at equivalent concentrations of salt, but Verte roots showed a stronger capacity than Romaine roots to accumulate Na+ under Na2SO4 treatment (Table 2). Under control conditions, roots of both varieties had similar contents of Ca2+ and K+ (Table 2). Both salts decreased the K+ and Ca2+ levels in roots of both varieties especially under Na2SO4 treatment. However,

Hela et al.

8503

Table 1. growth characteristics of Verte and Romaine plants grown in the presence of 0, 100 mM NaCl or 77 mM Na2SO4 salts for 12 days.

Growth parameter 100 mM NaCl

Parameter

Genotype

Leaf number

Verte Romaine

8.50 a 9.00

Leaf area, cm2

Verte Romaine

31.75 30.86a

Rosette diameter, cm

Verte Romaine

15.79a 1.17 a 15.50 0.88

8.50b 0.88 b 8.63 0.93

5.08c 1.86 c 4.21 1.47

Root length, cm

Verte Romaine

22.75a 2.43 a 20.33 1.39

18.83a 4.33 a 18.08 2.58

14,17b 1,84 b 15.00 1.62

R/L ratio

Verte Romaine

0.29 ± 0.05 0.26a ± 0.05

No treatment a

0.57 0.00

2.73 2.43

7.5 0.57 b 8.00 0.00 b

20.40 16.00b

2.45 1.01

0.35 ± 0.08 0.36a ± 0.08

77 mM Na2SO4 6.17 c 6.17

0.43 0.43

0.54 0.52

4.50 5.07c

0.21 ± 0.08 0.21a ± 0.02

Means followed by different letters are significantly different at P inferior or equal to 0.05 as determined by two ways analysis (ANOVA). (mean ± S.E., n=6).

Table 2. Root ions concentrations and K/Na ratio of Verte and Romaine plants grown in the presence of 0, 100 mM NaCl or 77 mM Na2 SO4 salts for 12 days.

Parameter

Genotype

Ions concentrations, mmol.g-1DW No Treatment 100 mM NaCl 77 mM Na2SO4

Verte Romaine

0.38 0.38c

0.21 0.02

1.52 1.16b

0.12 0.24

Root Na

2.36 1.67a

0.03 0.08

Root K+

Verte Romaine

1.77a 1.78a

0.51 0.22

0.92b 1.13b

0.11 0.28

0.07c 0.35c

0.01 0.02

Root Ca2+

Verte Romaine

0.05a 0.02 0.05a 0.02

Root Na++K++Ca2+

Verte Romaine

2.19 a 2.21

Root K/Na ratio

Verte Romaine

0.82c 0.10 c 0,82 0,02

0.45 0.22

0.02b 0.01 0.02b 0.01 a

2.47 a 2.31

0.13 0.47

50.69a 5.23 a 66.33 5.43

0.02b 0.01 0.02b 0.01 a

2.45 a 2.04

0.03 0.10

5.77b 0.55 b 36.08 1.20

(Mean ± SE., n=6). Means followed by different letters are significantly different at P inferior or equal to 0.05 as determined by two ways analysis (ANOVA).

accumulation of K+ reduced by 48 and 96% in Verte roots, compared to 47 and 80% reduction in Romaine roots under NaCl and Na2SO4 treatments, respectively. 2+ The decrease of Ca was similar under both treatments. A significant increase in root K/Na selectivity (Table 2) was found in Verte and Romaine under both salt treatments indicative of differential selectivity of

favourable nutrient ions over toxic Na+ between Verte and Romaine. Water relationships The maintenance of cell turgor by osmotic adjustment is

8504

Afr. J. Biotechnol.

an important physiological adaptation to minimize the + detrimental effects of salt stress (Munns et al, 1983). K , + Na and Cl , as main soluble inorganic intracellular ions participate in the osmotic adjustment in glycophytes. In varieties, the leaf (Figure 3A, B) and root (Figure 3C, D) water content decreased by Na+ salt treatments. Thus, large Na+ accumulation was probably associated with the absence of ion compartmentalization into the leaf and root cells, permitting its accumulation in the cytosol. Effect of NaCl and Na2SO4 on proline accumulation Proline content was measured in both varieties under control and saline conditions. In control conditions, both varieties contained equivalent amounts of Proline in leaves but roots of Verte variety contained higher levels of Proline as compared to those of Romaine (Figure 4). In control conditions, both varieties contained equivalent amounts of Proline in leaves (Figure 4). Under salt stress, leaf Proline content increased significantly at 100 mM NaCl in Verte but remained unchanged in Romaine. Moreover, this increase was more pronounced in the presence of Na2SO4 than of NaCl. However, leaf Proline content increased by 2.71- and 4.99-fold in Verte in the presence of 100 mM NaCl and 77 mM Na2SO4 respectively. In Romaine, only an increase by 4.64-fold was observed in Proline content under Na2SO4. In Verte roots (Figure 4B), Proline contents increased by 2.2-fold at 100 mM NaCl and remained unchanged under Na2SO4 treatment , while in Romaine it increased by 2.8- and 2.2- fold in the presence of 100 mM and 77 mM Na2SO4, respectively. These results suggest that the relative sensitivity of proline accumulation to 100 mM NaCl in Verte compared to Romaine was related at least partially to transient leaf Proline accumulation. Salts effect on relative ion leakage ratio Electrolyte leakage (EL) was used to assess membrane permeability. The EL index of leaves and roots of the both varieties progressively increased in response to salt treatments (Figure 5A, 5B). Relative to the control, salt treatments increased EL by 1.6- and 3.2-fold in Verte leaves and by 3.1- and 3.5-fold in Romaine leaves under 100 mM NaCl and 77 mM Na2SO4, respectively. In roots (Figure 5B), EL increased by 4.5 and 13.5 in Verte under 100 mM NaCl and 77 mM Na2SO4 respectively. While in Romaine EL was increased by 6.7- and 11.4-fold compared to the control under both salt treatments. Root H2O2 accumulation under salt treatments Under control condition, root H2O2 content was 2-fold higher in Verte than in Romaine (Figure 6). Root H2O2 content increased significantly in plants treated with NaCl

(3.1- fold and 9.0-fold in Verte and Romaine respecttively). This increase was more pronounced in response to Na2SO4; it reached the values of 3.6- and 10.1-fold in Verte and Romaine, respectively. Effect of isoosmotic salts on root antioxidative enzyme activities GPX activity (Figure 7A) increased by 193% in Verte roots treated with 100 mM NaCl, but decreased by 52% in roots treated with 77 mM Na2SO4. In Romaine variety, GPX activity did not change irrespective of salt treatment. CAT activity (Figure 7B) decreased by 75 and 66% in comparison with the control under 100 mM NaCl treatment, in Verte and Romaine, respectively. Treatment with 77 mM Na2SO4, did not cause any change in CAT activity in the roots of either variety. APX activity (Figure 7C) remained unchanged in comparison with the control when plants were treated with 100 mM NaCl. However, increases of 14- and 13fold in Verte and Romaine, respectively were observed when plants were treated with 77 mM Na2SO4. SOD activity represents the most activity as compared with the other three enzymes under control and treatment condition (Figure 7D). Under control condition, both varieties have the same SOD activity. Both NaCl and Na2SO4 salts increased significantly SOD activity by 2.18and 1.87-fold respectively in Verte. In Romaine, SOD activity increased by 2.71- and 3.45- fold under the same conditions. DISCUSSION Lettuce showed a moderate tolerance to NaCl constraint than to Na2SO4, as shown by the reduction of RGR and a number of morphological traits (leaf area, rosette diameter, leaf number, and root length) (Table 1, Figure 1)). Green leaves and dry matter production per plant were reported to be reduced with the increase in soil salinity (Bal and Dutt, 1984). Inhibition of the formation of leaf primodia under salinity stress could be the probable reason for low leaf number. Moreover, RGR provides a relative basis to compare plant growth rates of plants because it takes into account both the initial and the final plant weights over a specified time. Our results show that plant biomass (RGR), leaf number and leaf area (Table 1) were particularly affected by both salts. This finding suggests that salinity modified growth through its effects on leaf expansion and on the initiation of new leaves. Indeed, salt-induced growth reduction might be related to salt osmotic effects, which affect cell turgor and expansion (Rozema, 1991). Our growth parameters data indicate that the inhibitory effect of Na2SO4 was stronger than that of NaCl. In contrast, in Sorghum bicolour (Khan et al., 1995), the inhibitory effect of NaCl on growth was more pronounced than that of Na2SO4. Sodium sulphate

Hela et al.

8505

0.16 0.12 0.08 0.04

Figure 1. Relative growth rate (RGR, d-1) of Verte and Romaine. Plants were grown for 12 days in the presence of the indicated salts medium,100 mM NaCl or 77 mM Na2SO4. Means of six replicates Âą SE. R, roots; L leaves.

Figure 2. Na+ content of the different plant organs of Verte and Romaine. Plants were grown for 12 days in the presence of the indicated salts medium,100 mM NaCl or 77 mM Na2 SO4. Means of six replicates Âą SE. R, roots; L leaves.

and sodium chloride have been found to have verydifferent effects on plant growth, pigment concentration, protein metabolism, cellular structure (Strogonov, 1973), nutrient interactions (Franklin et al., 2002b), and water relations (Renault et al., 2001; Redfield and Zwiazek 2002). Plants may avoid accumulation of potentially toxic ions in leaf tissues by restricting ion uptake or translocation, and our data suggest that lettuce has a limited ability to regulate both processes for both Na+ and Cl-. In our conditions, the capacity of the roots to sequester ions appears to be exceeded after 2 weeks of

treatment (Figure 2), resulting in increases of Na+ accumulation in roots and led to the dehydration of this organ (Figure 3, illustrated by high correlation R) especially in Verte under Na2SO4 despite the high proline accumulation (Figure 4). The important increase in the proline contents of leaves and roots of both varieties seemed to be related to a neo-synthesis and an inhibition of the catabolism of this compound (Abdul Jaleel et al., 2007). Our results showed that RGR decreased significantly with salt treatment. This result could indicate that proline accumulation would occur at the expense of

H2O (Ml/g)

Afr. J. Biotechnol.

H2O (Ml/g)

-1

Na (mmol.g ) DW

-1

Na (mmol.g ) DW

Figure 3. Relationship of leaf (Figure 3A, B) and root (Figure 3C,D) hydration (ml H 2O. g–1 DM) to Na+ concentration (mmol. g–1 DM) in the two lettuce varieties cultivated on the absence (control) or on presence of 100 mM NaCl or 77 mM Na2SO4. Individual value of six replicates.

Figure 3. Relationship of leaf (Figure 3A, B) and Root (Figure 3C,D) hydration (ml H2O. g–1 DM) to Na+ concentration (mmol. g–1 DM) in the two lettuce varieties cultivated on absence (control) or on presence of 100 mM NaCl or 77 mM Na2 SO4. Individual value of six replicates.

Proline, µmol.g-1DW

8506

Figure 4. Effect of salt on leaf Pro (Figure 4A) and root pro (Figure 4B) contents. Seedlings of Verte (empty bar) and Romaine (filled bar) lettuce were grown in the presence of 0, 100 mM NaCl or 77 mM Na2 SO4 for 12 days. Error bars represent standard error of the means of healthy leaves randomly selected from six plants for each genotype and treatment.

Hela et al.

Figure 5. Effect of salt on electrolyte leakage and in leaves (A) and roots (B). Seedlings of Verte (empty bar) and Romaine (filled bar) lettuce were grown under 0, 100 mM NaCl or 77 mM Na2 SO4 for 12 days. Error bars represent standard error of the means of 5 replicates for EL.

Figure 6. Root H2O2 content of Verte (empty bar) and Romaine (filled bar) lettuce grown under 0, 100 mM NaCl or 77 mM Na 2 SO4 for 12 d. Error bars represent standard error of the means of 4 independent replicates.

8507

Afr. J. Biotechnol.

APX ( µM g-1 Protein)

0.6

-1

0.4

SOD ( µM g Protein)

CAT ( µM g-1 Protein)

GPX ( µM g-1 Protein)

8508

0.2 0.0

Figure 7. Root antioxidant activities of Verte (empty bar) and Romaine (filled bar) lettuce grown under 0, 100 mM NaCl or 77 mM Na2SO4 for 12 days. Error bars represent standard error of the means of 4 independent replicates.

growth activity and thus it could not be sufficient by itself to confer salt tolerance (Poustini et al., 2007). Our previous data (Mahmoudi et al., 2010) showed a marked increase of leaf and root MDA content of both varieties subjected to 100 mM NaCl or 77 mM Na2SO4, which is indicative of severe oxidative injury to membrane lipids in these plants due to the inadequate response of the antioxidative systems. The apparent increase in membrane EL (Figure 5) seems to parallel the increase in salt content of the leaves in both NaCl and Na2SO4 treatments, and the movement of Na+ is closely associated with the movement of the anion. The observed reduction in control over ion movement could result from high external levels of Na+, since high Na+ levels can result in membrane depolarization and K+ efflux (Jacoby, 1994), but this does not explain the differences between NaCl and Na2SO4 treatments. Salinity can affect growth and yield of plants and can also generate secondary oxidative stress that occurs when there is a serious imbalance between the production of reactive oxygen species (ROS) and antioxidant defence, leading to oxidative damage of macromolecules and, eventually, of cellular structure. In agreement with growth parameters, the production of H2O2 increased

following the treatment (Figure 6), and was more significant in Na2SO4 than in NaCl treatments in both lettuce varieties, indicative of cellular damage. The increased production of H2O2 with both isoosmotic salts could be due to a significant decrease of GPX in Verte under Na2SO4 and CAT activities in Roots of Verte and Romaine under NaCl (Figure 7A, C). Although, APX activity was significantly increased in roots of both varieties in response to Na2SO4 associated with a significant increase in SOD activity under NaCl and Na2SO4 treatments associated to an increase of H2O2 level. These findings suggest a general depression of the antioxidant enzymatic system in lettuce roots. In conclusion, our data indicate that both salts induced oxidative damage in Lactuca sativa L. The damage inflicted by salinity on plant physiology and development was shown to be caused by osmotic stress due to high concentrations of Na+ ion in organs; leaves and roots associated with a nutritional disturbance (reduction of K+ 2+ and Ca accumulations) and the toxic effect promoted by + Na accumulation in plant tissues. However, despite concomitant increases in the activities of some antioxidant enzymes such as APX and SOD, an increase of H2O2 level was observed, indicative of cellular damage and a

Hela et al.

general depression of the antioxidant enzymatic system in lettuce roots. ACKNOWLEDGEMENTS This work was supported through a Tunisian-Canadian Cooperation Initiative. Ministry of Agriculture of Tunisia provided the lettuce seeds. Abbreviations: RGR, Relative growth rate; GPX, gaiacol peroxidase; CAT, catalase; SOD, superoxide dismutase; EL, electrolyte leakage.

REFERENCES Abdul Jaleel C, Gopi R, Sankar B, Manivannan P, Kishorekumar A, Sridharan R, Panneerselvam R (2007). Studies on germination, seedling vigour, lipid peroxidation and proline metabolism in Catharanthus roseus seedlings under salt stress. South Afr. J. Bot. 73: 190-195. Aebi H (1984). Catalase in vitro. Method of Enzymol.. 105: 121-126. Ashraf M, McNeilly T (1990). Responses of four Brassica species to Sodium chloride. Environ. Exp. Bot. 30(4): 475-487. Bates LS, Waldren RP, Teare ID (1973). Rapid determination of free proline for water-stress studies. Plant Soil, 39: 205-207 Beak KH, Skinner DZ (2003). Alteration of antioxidant enzyme gene expression during cold acclimation of near-isogenic wheat lines. Plant Sci. 165: 1221-1227 Cakmak I, Marschner H (1992). Magnesium deficiency and high light intensity enhance activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase in bean leaves. Plant Physiol. 98: 1222-1227. Cramer GR, Alberico GL, Schmidt C (1994). Salt tolerance is not associated with the sodium accumulation of two maize hybrids. Australian J. Plant Physiol. 21: 675-692. Gara LD, Pinto MC, Tommasi F (2003). The antioxidant systems vis-Ă vis reactive oxygen species during plant-pathogen interaction. Plant Physiol. Biochem. 41: 863-870. Ghorbanli M, Ebrahimzadeh H, Sharifi M (2004). Effects of NaCl and mycorrizal fungi on antioxidative enzymes in soybean. Biol. Plant. 48: 575-581. Hoagland DR, Arnon DI (1950). The water-culture method for growing plants without soil. Calif. Agric. Exp. Station Circ. Berkley) 347: 1-32. Jacoby B (1994). Mechanisms involved in salt tolerance by plants. In: Pessarakli M (ed) Handbook of Plant and Crop Stress. Marcel Dekker, New York, pp. 97-124 Khan AH, Ashraf MY, Naqvi SSM, Khanzada B, Ali M (1995). Growth, ion and solute contents of sorghum grown under NaCl and Na2SO 4 salinity stress. Acta Physiol. Plant. 17: 261-268 Kim SY, Lim J, Park MR, Kim YJ, Park TI, Seo YW, Choi KG, Yun SJ (2005). Enhanced Antioxidant Enzymes Are Associated with Reduced Hydrogen Peroxide in Barley Roots under Saline Stress. Biochem. Mol. Biol. 38: 218-224

8509

Kotchoni SO, Kuhns C, Ditzer A, Kirch HH, Bartels D (2006). Overexpression of different aldehyde dehydrogenase genes in Arabidopsis thaliana confers tolerance to abiotic stress and protects plants against lipid peroxidation and oxidative stress. Plant Cell Environ. 29: 1033-1048. Leopold AC, Willing RP (1984). Evidence for toxicity effects of salt on membranes. In: Staples RC, Toenniessen GH, editors. Salinity Tolerance in Plants. New York: John Wiley Sons. pp. 67-76 Lutts S, Kinet JM, Bouharmont J (1996). NaCl-induced senescence in leaves of rice Oryza sativa L.) cultivars differing in salinity resistance. Ann. Bot. 78: 389-398. Munns R, Greenway H, Kirst GO (1983). Halotolerant eukaryotes. In: OL Lang, PS Nobel, CB Osmond, H Ziegles (eds): Encyclopaedia of plant physiology, vol. 12C. New Series. Springer, New York, 59â&#x20AC;&#x201C;135 Munns R (2005). Genes and salt tolerance: bringing them together. New Phytologist. 176: 645-63. Muscolo A, Sidari M, Panuccio MR (2003). Tolerance of kikuyu grass to long term salt stress is associated with induction of antioxidant defenses. Plant Growth Regul. 41: 57-62. Neto ADA, Prisco JT, Eneas-Filho J, Abreu CEB, Gomes-Filho E (2006). Effect of salt stress on antioxidative enzymes and lipid peroxidation in leaves and roots of salt-tolerant and salt-sensitive maize genotypes. Environ. Exp. Bot. 56: 87-94. Poustini K, Siosemardeh A, Ranjbar M (2007). Proline accumulation as a response to salt stress in 30 wheat (Triticum aestivum L.) cultivars differing in salt tolerance. Genet. Res. Crop Evol. 54: 925-934. Redfield E, Zwiazek JJ (2002). Drought tolerance characteristics of black spruce (Picea mariana) seedlings in relation to sodium sulfate and sodium chloride injury. Can. J. Bot. 80: 773-778 Renault S, Crosser C, Franklin JA, Zwiazek J.J (2001). Effects of NaCl and Na2SO4 on red-osier dogwood (Cornus stolonifera Michx) seedlings. Plant Soil. 233: 261-268 Rozema J (1991). Growth, water and ion relationships of halophytic monocotyledonae and dicotyledonae: a unified concept. Aquat. Bot. 39: 3-16. Sairam RK, Srivastava GC (2002). Changes in antioxidant activity in sub-cellular fraction of tolerant and susceptible wheat genotypes in response to long term salt stress. Plant Sci. 162:897-904 Silvana BD, Gallego SM, Benavides MP, Tomaro ML (2003). Behaviour of antioxidant defense system in the adaptive response to salt stress in Helianthus annuus L. cells. Plant Growth Regul. 40: 81-88. Scandalios JG (1993). Oxygen stress and superoxide dismutase, Plant Physiol. 101: 7-12 Strogonov BS (1973). Structure and function of plant cells in saline habitats: New trends in the study of salt tolerance. Translated from Russian by A. Mercado. Translation edited by B. Gollek. John Wiley & Sons, New York Zhu JK (2001). Plant salt tolerance. Trends Plant Sci. 6: 66-71.

Full Length Research Paper

Crystal phases of calcium carbonate within otoliths of Cyprinus carpio. L. from Miyun Reservoir and Baiyangdian Lake, China Liang-Feng Yang1*, Sheng-Rong Li2, Guo-Wu Li2 and Jun-Yan Luo2 1

The Geological Museum of China, Beijing 100034, China. State Key Laboratory of Geological Processes and Mineral Resources China University of Geosciences, Beijing, 100083, China.

Accepted 2 April, 2012

Asteriscus (lagenar otolith) of Cyprinus Carpio. L. (Cyprinida, common carp) from the serious intermittent polluted Baiyangdian Lake and the little polluted Miyun Reservoir, all located in northern China, were chemically and mineralogically analyzed. All the analyzed fish showed that the composition of asterisci is dominated by calcium carbonate, with the minor elements As, Ba, Sr, and Zn; and the polymorph of CaCO3 in the asterisci is vaterite. Three different vaterite X-ray diffraction (XRD) patterns were found in the analyzed samples. For the 60% fish from both localities, two different vaterite XRD patterns coexist in the core area and the edge area in same asteriscus sample. Significant differences of the dimensions of crystalline cells of vaterites exist between these two localities, which reveals that crystal structure of vaterite polymorphs seem sensitive to water quality and water environment, its crystalline cell dimensions might be a potential proxy for monitoring the change of water quality. Key words: Vaterite, biocrystallization, otoliths, microchemistry, proxy, Cyprinus Carpio. L. INTRODUCTION Three type paired otoliths respectively exist in the sacculus, utriculus, and lagena of fish, each having an irregular unsymmetrical shape, used for balance and/or hearing (Carlström., 1963). Otoliths are metabolically inert concentric layer structure deposits, formed by alternating layers of protein and calcium carbonate grown around a nucleus (Campana and Neilson., 1985). Plenty of information recorded in otoliths have been studied to resolve fish ecological questions such as fish age, feeding and growth history, recruitment and migration, mortality and stock structure, and so forth (Campana and Neilson., 1985; Jenkins., 1987; Maillet and Checkley., 1991; Noichi et al., 1994; Bailey et al., 1995; Meekan and Fortier., 1996; Song et al., 2006); while microchemistry of otoliths may reflect elemental composition of ambient environments (Campana, 1999) and may also be

*Corresponding author. E-mail: liangfeng_yang@yahoo.com. Tel: +86 10 66557457. Fax: +861066557477.

controlled by temperature and salinity (Thorrold et al., 1997; Elsdon and Bronwyn., 2002; Zacherl and Georges., 2003; Martin and Thorrold., 2004). Recently, some authors have tried to demonstrate that otolith of common carp may be a potential proxy for monitoring changes in water quality (Yang et al., 2006, 2008; Li et al., 2007b, 2011). Many achievements have also been made with regard to the crystal phase of CaCO3 in the otoliths of fish, especially sea fish, in the past fifty years. Polymorphs of CaCO3 in otoliths may be related to the type of otoliths. X-Ray diffraction has confirmed that sagittae and lapilli are usually composed of polycrystalline aragonite, and most asterisci are composed of vaterite (Carlström., 1963; Lowenstam and Weiner., 1989; Oliveira et al., 1996; Irie, 1955; Degens et al., 1969; Mann et al., 1983; Morales, 1986; Maisey., 1987; Lecomte, 1992; Shichiri, 1986). Lenaz et al. (2006) reported that the different calcium carbonate polymorph for otoliths is strictly correlated with some microelements concentrations.

Yang et al.

8511

Figure 1. Macroscopical appearance of common carp asterisci. Asteriscii of the carp from Miyun Reservoir; weight = 148 g; length = 4.00 mm; width = 2.44 mm and height = 2.20 mm.

Nevertheless, few studies have examined the CaCO3 crystal phases in the otoliths of common carp, and there is no report about different XRD-type peak patterns of vaterites within same otolith. This study preliminarily focuses on the CaCO3 crystal phases in the asteriscus of common carp. The crystal phase and dimensions of crystalline cells of CaCO3 and trace elements within asterisci in wild common carp otoliths are reported in detail. Investigating the crystal phase of CaCO3 plays a key role in the study of the otoliths hierarchical structure, hydro-environmental chemistry and calcium carbonate biomineralization theory. Further studies on the relationship between the CaCO3 crystalline cell dimensions and the microchemistry concentration in the fish aquatic environment will be summarized in our next study.

Au and Co in the water of Baiyangdian Lake are all higher than those in the water of Miyun Reservoir, but for Cd (Yang, 2007). In total, 18 common carp were collected from Baiyangdian Lake and 24 from Miyun Reservoir. We measured the length and weight of the common carp. The asterisci were removed from each common carp with tweezers (Figure 1), cleaned by ultrasound, kept in 75% ethanol for 24 h and then dried in air for use. The fish ages were determined by scale and otoliths; all fish were between 2 and 5 years old. In order to get the minerals separately from the areas near both the core and the edge in the same asterisci of each common carps. One of paired asterisci was cut perpendicular to the sulcus and through its nucleus. A half of it was put on a piece of glass, then clamped by tweezers, and its' outer layer were scraped by bistoury. Collected dropped materials are the minerals near the edge of the asteriscus. While the middle area of section of one half of asteriscus was pierced by the sharp end of bistoury, collected dropped materials are the minerals near the core of the asteriscus. These two kinds of sample minerals were tested by XRD. Another one of paired astriscii was tested by nucleic acid amplification (NAA).

MATERIALS AND METHODS NAA analysis Collection of samples The adult wild freshwater common carps used in this study were collected from Baiyangdian Lake (N38.43°, E115.38°) and Miyun Reservoir (N40.23°, E116.50°). Baiyangdian Lake suffers from serious intermittent industrial waste. The main contamination are chemical oxygen demand (COD), total protein (TP), total nitrogen (TN), Zn, Pb, Hg, Ge, Cr, As and cyanide (Li, 2006). Miyun Reservoir supplies drinking water for Beijing and is less polluted. Both of these bodies of water are located in northern China. Concentrations of Sr, K, Na, Mn, Mg, Ni, Cu, Ba, Zn, Pb, Cr, Fe, As,

The NAA analysis was carried out at the Chinese Academy of Atomic Energy. The samples were powdered using agate pestle and mortar. The sample masses used were in the range of 13-20 mg. The samples were packed in high-purity aluminum foil and irradiated along with standard chemicals and standard reference material in a heavy water reactor, at a neutron flux of 4.83×1013 n/cm2·s. The samples were irradiated for 8 h. Following irradiation, the aluminum foils were removed from the samples, and an Ortec high-purity Germanium (HPGe) detector was used to test the γ energy spectrum. The resolving power of the HPGe detector is 1.80

8512

Afr. J. Biotechnol.

keV, and the testing time was 2 h for each sample. The amount of each element was calculated using the standard reference material as control.

Baiyangdian Lake were nearly all higher than those from Miyun Reservoir (Figure 4), being consistent with that concentrations of these elements in the water of Baiyangdian Lake are all higher than those in the water of Miyun Reservoir.

XRD analysis XRD analysis was carried out in the X-Ray Laboratory of China University of Geosciences. A new method for powder-like diffractograms of small single crystals developed by Li et al. (2005) was used in this study. According to this new method, an SMART APEX-CCD detector X-ray diffractometer was used with a special rotation method and a supporting software program. Using this method, many powder diffraction data of native Si-Fe alloy minerals from podiform chromites of the Luobusha ophiolite in Tibet have been obtained by Li et al. (2007a). The samples are irregular grains between 0.1-0.3 mm in diameter and white in color. For every sample, only one grain was selected in random to be test. The powder X-ray diffraction was performed on an SMART APEX-CCD area-detector diffractometer using MoKα 1 radiation, 45 kV, 35 mA, rotation with ∆ ω = 10° - 20°. The exposure time was 60 – 120 s. Li’s new method (2005) was used by taking powder diffraction Debye image with a small crystal grain, and very clear Debye ring images were obtained (Figure 2). The powder diffraction pattern and diffraction data were obtained using Gadds software. All crystal parameters were calculated based on the Checkcell software (Laugier and Bochu., 2005).

RESULTS AND DISCUSSION Biological characteristics of common carps A well-established relationship exists between the length and weight of the common carp from Miyun Reservoir and Baiyangdian Lake. The relationship is 1g(weight) = 2.8893 lg (length) - 4.5355; R is 0.9336 and b is 2.8893 (Figure 3). Normal fish usually displays a strong relationship: lgy= a +blgx, and b usually varies from 2.5 to 4.0; while the growth rate of length, the growth rate of width and the growth rate of height are the same, the value of b is approximately 3 (Brown, 1957). Furthermore, Yin (1995) confirmed that this relationship actually exist in many various normal fishes of the family Cyprinidae. In this work, b is 2.8893, near to 3. This can be demonstrated that the relationship of the weight and the length of all common carps from both localities is consistent with that of normal fish. The result can be further demonstrated that all common carp are normal. Composition of asterisci The results of NAA demonstrated that composition of asterisci from Miyun Reservoir and Baiyangdian Lake were absolutely dominated by calcium carbonate. The main element Ca and the minor elements As, Ba, Sr, and Zn were detected; values of these elements concentrations were all higher than the detection limits. Concentrations of these elements within asterisci from

Crystallographic aspects XRD peak patterns of calcium carbonate in asrerisci The results of current research demonstrate that three types of peak patterns of CaCO3 were found in the asterisci of fishes from both localities, separately represented by sample M19wai, M19nei and BYD06nei. Based on Search-Match result, in each of these three peak patterns, nearly all peaks were matched very well with one of these three corresponding standards in the PDF2 database which are synthetic vaterite with Pbnm space group (ICDD 74-1867), synthetic vaterite with P63/mmc space group (ICDD 74-1867) and vaterite with P63/mmc space group (ICDD 33-268). XRD peak patterns of these three standards have very similar peak position and shapes of the major reflections with 2θ among 9-25°, the remaining differences are weak reflections with 2θ around 26-37° and 42-45°. Weak reflections with 2θ among 26-37° exist both in the synthetic vaterite with P63/mmc space group (ICDD 741867) and in vaterite with P63/mmc space group (ICDD 33-268), weak reflections with 2θ among 42-45° only exist in vaterite with P63/mmc space group (ICDD 33268). The major reflections with 2θ among 9-25°were detected in M19wai, M19nei and BYD06nei. Four weak peaks with 2θ around 26, 27, 30 and 37° were detected both in the sample M19wai and in the sample M19nei, while three weak peaks with 2θ around 42, 43 and 44° were detected only in the sample M19wai (Figure 5). Each mineral species only has one crystal phase. Due to the controversial structure of vaterite, there are several spaces groups proposed for the crystal phase of vaterite based on the research of natural vaterite or synthesized vaterite, with different characteristic XRD peak patterns accordingly (Meyer, 1960, 1969; Kamhi, 1963; Medeiros et al., 2007; Tang et al., 2009) (Table 1). Based on firstprinciples calculations and molecular-dynamics simulations, Wang and Becker, (2009) considered that the vaterite structure is P6522 (no. 179) with disordered CO3 ions, which can be ordered in the a and b directions, resulting in two unique CO3 ions; and thus different degree of ordered CO3 ions caused different XRD patterns. Again from first-principles calculations, Demichelis et al. (2011) re-examined all of the possible ordered structures of vaterite, and located five stable structures, with the lowest energy one of P3221 symmetry. The XRD results of all samples demonstrated that one or more of these three peak patterns was found

Yang et al.

(a)

(b)

Figure 2. Debye ring of CaCO3 in the asterici of common carp from Miyun Reservoir and Baiyangdian Lake (a) M19 nei; (b) M19 wai.

Figure 3. A well-established relationship exists between the length and weight of the common carp from both sites; b is 2.8893, near to 3, being consistent with that of normal fish. The result can be further demonstrated that all common carp samples are normal.

8513

8514

Afr. J. Biotechnol.

Figure 4. Scatterplot of elemental concentrations within otoliths collected from two localities in 2004. Concentrations of Ca, As, Ba, Sr, and Zn within asterisci from Baiyangdian Lake were nearly all higher than those from Miyun Reservoir.

randomly near the core or near the edge of asterisci from both localities. Base on statistics, two different situations were found. Firstly, the only one peak pattern, vaterite with P63/mmc space group (ICDD 33-268), was found in 4 out of

10 fish, numbered M09, M24, BYD16 and BYD17. Secondly, two different peak patterns were respectively found near the core area and near the edge area in one asteriscus of 6 out of 10 fish. The fish samples numbered BYD07, BYD10, M19,

M21 and M22 have the same two peak patterns, synthetic vaterite with Pbnm space group (ICDD 74-1867) and vaterite with P63/mmc space group (ICDD 33-268); while fish sample BYD06 show another two peak patterns, synthetic vaterite

Yang et al.

Figure 5. XRD results of CaCO3 in the asterisci of common carp from Miyun Reservoir and Baiyangdian Lake. These three standards have very similar peak position and shapes of the major reflections with 2θ among 925°, except that weak reflections with 2θ among 26-37° exit both in 74-1867 and in 33-268, and weak reflections with 2θ among 42-45° only exit in 33-268. Four weak peaks with 2θ around 26, 27, 30 and 37° were detected both in M19wai and in M19nei; while three weak peaks with 2θ around 42, 43 and 44° were detected only in M19wai.

Table 1. Crystallographic data for vaterite from the literature.

Space group

Unit-cell parameters (Å)

Reference

ICDD Number

Nature/ Synthesized -

P63 /mmc

a= 7.169 a= 7.135

c = 16.98 c = 8.524

Dupont et al. (1997) McConnell (1960)

P6322 P63 /mmc P63 /mmc P63 /mmc Pbnm

a= 7.15 a= 7.151 a= 7.16 a= 4.13 a= 4.13

c = 8.47 c = 16.94 c = 16.98 c = 8.49 (pseudo-cell) c = 7.15 c = 8.48

12 12 2 4

Bradley et al. (1966) Meyer (1969) Kamhi (1963) Kamhi (1963) Meyer (1960)

330268

Vaterite

720506 741867

Vaterite, syn Vaterite, syn

8515

8516

Afr. J. Biotechnol.

Table 2. X-Ray diffraction results for asterisci of common carp from the Miyun Reservoir and Baiyangdian Lake. Sample number

Results of JCPD matching ICDD Card number

Refined results via Chekcell

Mineral species Space Group

Syngony

a0(Å)

b0(Å)

c0(Å)

Vol. 0

a(Å)

b(Å)

c(Å)

Vol. (Å)

M09wai* M09nei* M19wai

33-268 33-268 33-268

Vaterite Vaterite Vaterite

P63/mmc(no.194) P63/mmc(no.194) P63/mmc(no.194)

hexagonal hexagonal hexagonal

7.1473 7.1473 7.1473

16.917 16.917 16.917

748.407 748.407 748.407

7.1471 7.1456 7.1491

16.9051 16.9172 16.9216

747.835 748.058 748.991

M19nei M21wai M21nei M22wai M22nei M24wai

74-1867 74-1867 33-268 74-1867 33-268 33-268

Vaterite (S*) Vaterite (S) Vaterite Vaterite (S) Vaterite Vaterite

Pbnm (Pnma no.62) Pbnm (Pnma no.62) P63/mmc(no.194) Pbnm (Pnma no.62) P63/mmc(no.194) P63/mmc(no.194)

orthorhombic orthorhombic hexagonal orthorhombic hexagonal hexagonal

4.13 4.13 7.1473 4.13 7.1473 7.1473

7.15 7.15 7.1473 7.15 7.1473 7.1473

8.48 8.48 16.917 8.48 16.917 16.917

250.410 250.410 748.407 250.410 748.407 748.407

4.1281 4.1357 7.1471 4.1238 7.1473 7.1465

7.1341 7.1497 7.1471 7.1417 7.1473 7.1465

8.4830 8.4790 16.9185 8.4892 16.9227 16.9106

249.825 250.715 748.422 250.013 748.660 747.946

M24nei BYD06wai BYD06nei BYD07wai BYD07nei

33-268 33-268 72-506 74-1867 33-268

Vaterite Vaterite Vaterite (S) Vaterite (S) Vaterite

P63/mmc(no.194) P63/mmc(no.194) P63/mmc(no.194) Pbnm (Pnma no.62) P63/mmc(no.194)

hexagonal hexagonal hexagonal orthorhombic hexagonal

7.1473 7.1473 4.13 4.13 7.1473

7.1473 7.1473 4.13 7.15 7.1473

16.917 16.917 8.49 8.48 16.917

748.407 748.407 125.41 250.410 748.407

7.1526 7.1402 4.1220 4.1235 7.1489

7.1526 7.1402 4.1220 7.1343 7.1489

16.8968 16.9305 8.5026 8.4793 16.9178

748.617 747.512 125.11 249.446 748.768

BYD10wai BYD10nei BYD16wai BYD16nei BYD17wai BYD17nei

33-268 74-1867 33-268 33-268 33-268 33-268

Vaterite Vaterite (S) Vaterite Vaterite Vaterite Vaterite

P63/mmc(no.194) Pbnm (Pnma no.62) P63/mmc(no.194) P63/mmc(no.194) P63/mmc(no.194) P63/mmc(no.194)

hexagonal orthorhombic hexagonal hexagonal hexagonal hexagonal

7.1473 4.13 7.1473 7.1473 7.1473 7.1473

7.1473 7.15 7.1473 7.1473 7.1473 7.1473

16.917 8.48 16.917 16.917 16.917 16.917

748.407 250.410 748.407 748.407 748.407 748.407

7.1438 4.1310 7.1505 7.139 7.1425 7.1410

7.1438 7.1384 7.1505 7.1395 7.1425 7.1410

16.9415 8.4819 16.8860 16.9258 16.9203 16.9156

748.760 250.123 747.701 747.166 747.548 747.035

*-wai means sampling on the exterior of the asteriscus, nei means sampling near the inner core. *S = synthesized.

with P63/mmc space group (ICDD 72-506) and vaterite with P63/mmc space group (ICDD 33-268). In this study, it is interesting that two of three different XRD patterns of vaterites, coexist in the same asteriscus samples (Table 2). These phenomena exist in 60% asteriscus samples from both localities with different water quality: less polluted water and serious intermittent water. This suggests that the crystal phase of vaterite formed in vivo may be controlled by the organic matrix and may also be affected by water microchemistry which will influence on the concentrations of microelements in the otolith. The relationship

between the microchemistry and the crystal phase of vaterite is worthy of further research. Moreover, that different crystal phase of CaCO3 decided different morphologies and hierarchical structure of the otoliths is important for functional materials study; hence further study on the crystal phase of CaCO3 formed in otolith is necessary.

XRD analysis and caused by calculation based on Checkcell software, relative deviation of the crystal parameters of vaterites are defined by the authors as follow:

δa =

δb = The crystal parameters with morphological features In order to eliminate the system error caused by

δc =

a sample − a 0 a0

b sample − b 0 b0 c sample − c 0 c0

× 100 % ;

× 100 % ; × 100 % ;

Yang et al.

8517

Figure 6. Scatterplots show that significant differences of the dimensions of crystalline cells of vaterites exit between these two localities. The average dimensions of crystalline cells of vaterites in the otoliths from the Miyun Reservoir are much nearer to the standards than those from the Baiyangdian Lake, δa and δVol of the former is relatively bigger than the latter, but things are opposite for δc.

δVol =

Vol sample − Vol 0 Vol 0

× 100%

δa, δb, δc and δVol are relative deviations; asample, bsample,

csample and Volsample are crystal parameters of samples calculated based on the checkcell software; a0, b0, c0 and Vol0 are the crystal parameters of the corresponding standards in the PDF2 database. Scatterplots of δa and δc, δVol and δa, δVol and δb

8518

Afr. J. Biotechnol.

show that significant differences of the dimensions of crystalline cells of vaterites exit between these two localities. The average dimensions of crystalline cells of vaterites in the otoliths from the Miyun Reservoir are much nearer to the standards than those from the Baiyangdian Lake, and δa of the former is relatively bigger than the latter, but things are opposite for δc. Moreover, the δVol of vaterite from the Miyun Reservoir is bigger than that from the Baiyangdian Lake, and the former is nearer to zero than the latter (Figure 6). This result may be explained by concentrations of these elements As, Ba, Sr, and Zn, which is easily entered into crystal structure, within asterisci from Baiyangdian Lake, is nearly higher than that from Miyun Reservoir. As mentioned above, concentrations of these elements in the water of Baiyangdian Lake are also all higher than those in the water of Miyun Reservoir. The results demonstrate that the dimensions of vaterite polymorphs crystalline cell might be a potential proxy for monitoring the change of water quality. Feasibility of otoliths as a proxy for changes of the water quality and its potential usage Why need otoliths as a proxy for changes of the water quality? This can be done directly by measuring certain water parameters providing direct information about the chemical composition of a water body. Why is such a proxy necessary? Nowadays, there are many achieves made in the monitoring the water quality change. But the limitation for current methods of water quality monitor is obvious: a) large amount of monitor points must be distributed; b) limitation by manpower, material resources, weather, and hydrological conditions; c) continuous and fast monitor is difficult; d) historical changes of water quality may not be obtained. These all cause high expense and difficult work. Especially, the monitor points would be out of work when disaster or big accident occurs. Therefore, we want to find a new method to monitor the water quality changes. Is there an approach to solve the problem? We think if find a material recorded the information of the water change history; there is a hope to deal with the problem. As we know, otoliths are paired concentric deposit that protain layer and calcium carbonate layer alternatively grow surrounding a nucleus. The chemistry of fish otolith is derived directly from their living environment, and once deposited the elements will be fixed forever. Therefore, the otolith records the environmental information; analyzing the mineral information of otoliths is useful in chemical evaluation of waters where the fish lived. Being a common economic fish species in the fresh water, carp can be killed and easy to catch them from different fresh water area. Carp otolith might be a potential material for monitor

ambient water quality changes. Once such theory is established, otolith in fossil fish might also be used as the proxy for the paleoenvironment. Conclusion The polymorph of CaCO3 in the asterisci of fish from Miyun Reservoir and Baiyangdian Lake is vaterite. Different XRD patterns of vaterites coexist in the same asteriscus samples from both localities. It suggests that the crystal phase of vaterite formed in vivo may be controlled by the body and may also be affected by water microchemistry. Findings give important information for morphologies and hierarchical structure study, and also might help us to understand the different XRD patterns of vaterite. Significant differences of the dimensions of crystalline cells of vaterites exit between these two localities. The dimensions of crystalline cells of vaterites from the Miyun Reservoir are much nearer to the standards than those from the Baiyangdian Lake. Significant differences also exit in concentrations of As, Ba, Sr, and Zn within asterisci. These elements concentrations from Baiyangdian Lake were nearly all higher than that from Miyun Reservoir. Crystal structure of vaterite polymorphs seem sensitive to water quality and water environment, would be a potential proxy for monitoring the change of water quality. ACKNOWLEDGMENTS This paper was financially supported by the Chinese state basic research program (“973” project, 2007CB815604), and by the Land and Resource Ministry, China (Ministry Budget Project, 1211131181003). REFERENCES Bailey KM, Canino MF, Napp JM, Spring SM, Brown AL (1995). Contrasting years of prey levels, feeding conditions and mortality of larval walleye pollock Theragra chalcogramma in the western Gulf of Alaska. Mar. Ecol. Prog. Ser. 119: 11-23. Brown ME (1957). Experimental studies on growth. Physiol. Fish. Acad. Press, London. Campana SE (1999). Chemistry and composition of fish otoliths: pathway, mechanisms and applications. Mar. Ecol. Prog. Ser. 188: 263-297. Campana SE, Neilson JD (1985). Microstructure of fish otoliths. Can. J. Fish. Aquat. Sci. 42: 1014-1032. Carlström D (1963). A crystallographic study of vertebrate otoliths. Biol. Bull. 125: 441-463. Degens ET, Deuser WG, Haedrich RL (1969). Molecular structure and composition of fish otoliths. Mar. Biol. 2: 105-113. Demichelis R，Raiteri P, Galea JD, Dovesi R (2011). A new structural model for disorder in vaterite from first-principles calculations. Cryst. Eng. Commum. 14: 44-47. Elsdon TS, Bronwyn MG (2002). Interactive Effects of Temperature and Salinity on Otolith Chemistry: Challenges for Determining Environmental Histories of Fish. Can. J. Fish. Aquat. Sci. 59: 17961808. Irie T (1955). The crystal texture of the otolith of a marine teleost

Yang et al.

Pseudosciaena. J. Fac. Fish. Anim. 1: 1-8. Jenkins GP (1987). Age and growth of co-occurring larva of two flounder species, Rhombosolea tapirina and Ammotretis rostratus. Mar. Biol. 95: 157-166. Kamhi SR (1963). On the structure of vaterite CaCO3. Acta Crystallogr. 16: 770-772. Laugier J, Bochu B (2005). http:/www.ccp14.ac.uk/tutorial/lmgp Lecomte-Finiger R (1992). The crystalline ultrastructure of otoliths of the eel (A. anguilla). J. Fish. Biol. 40: 181-190. Lenaz D, Miletic M, Pizzul E, Vanzo S, Adami G (2006). Mineralogy and geochemistry of otoliths in freshwater fish from Northern Italy. Eur. J. Mineral. 18: 143–148. Li G, Shi N, Ma Z, Xiong M, Cheng R (2005). A new method for powder like diffractograms of small single crystals using a SMART APEX CCD detector. Acta. Mineralog. Sinica. 25(1): 9-14. Li YP (2006). Baiyangdian Marsh's water environment quality and protection research. Agriculture University of Hebei, China. (Master degree Paper, in Chinese with English abstract). Li G, Shi N, Xiong M, Ma Z, Bai W, Fang Q (2007a). X-ray diffraction investigation of native Si-Fe alloy minerals from Luobusha, Tibet. Front. Earth Sci. China. 1(1): 21–25. Li SR, Yang LF, Gao YH, Luo JY, Cao Y, Tong JG (2007b). The genetic mineralogical attribute of fish otoliths: Environmental typomorphism and Some new investigation methods. Acta. Mineralog. Sinica.1(27): 1241-248. Li S, Du F, Yan L, Cao Y, Luo J, Gao Y, Yang L, Tong J (2011). The genetic mineralogical characteristics of fish otoliths and their environmental typomorphism. Afr. J. Biotechnol. 10: 4405-4411. Lowenstam HA, Weiner S (1989). On Biomineralization. Oxford University Press, NY, USA. Maillet GL, Checkley .Jr. DM (1991). Storm-related variation in the growth rate of otoliths of larval Atlantic menhaden Brevoortia tyrannus: a time series analysis of biological and physical variables and implications for larva growth and mortality. Mar. Ecol. Prog. Ser. 79: 1-16. Maisey JG (1987). Notes on the structure and phylogeny of vertebrate otoliths. Copeia, 2: 495-499. Mann S, Parker SB, Ross MD, Skarnulis AJ, Williams RJP (1983). The ultrastructure of the calcium carbonate balance organs of the inner ear: an ultra-high resolution electron microscopy study. Proc. R. Soc. Lond. B. 218: 415-424. Martin GB, Thorrold SR (2004). Temperature and Salinity Effects on Stronitium Incorporation in Otoliths of Larval Spot (leiostomus Xanthurus). Can. J. Fish. Aquat. Sci. 61: 34-42. Medeiros SK, Albuquerque EL, Maia .Jr. FF, Caetano EWS, Freire VN (2007). First-principles calculations of structural, electronic, and optical absorption properties of CaCO3 Vaterite. Chem. Phys. Lett. 435: 59-64. Meekan MG, Fortier L (1996). Selection for fast growth during the larval life of Atlantic cod Gadus morhua on the Scotian shelf. Mar. Ecol. Prog. Ser. 137: 25-37.

8519

Meyer HJ (1960). Über Vaterit und seine Struktur. Fortsch. Mineral. 38: 186-187. Meyer HJ (1969). Struktur und Fehlordnung des Vaterits. Z. Kristallogr. 128: 183-212. Morales-Nin B (1986). Chemical composition of the otoliths of the sea bass (Dicentrarchus labrax Linnaeus, 1758) (Pisces, Serranidae), Cybium, 10: 115-120. Noichi T, Matsuo T, Senta T (1994). Hatching dates of the Japanese flounder settling at Yanagihama Beach in Nagasaki prefecture, Jpn. Fish Sci. Tokyo. 60: 369-372. Oliveira AM, Farina M, Ludka IP, Kacha B (1996). Vaterite, calcite and aragonite in the otoliths of three species of piranha. Naturwissen, 83(3): 133-135. Shichiri T (1986). Growth of statoliths in goldfish. J. Cryst. Growth, 78: 493-501. Song ZB, Fu ZD, Yue BS, Zhao EM (2006). Otolith microstructure of larval Gymnocypris potanini Herzenstein from the Minjiang River in China. Environ. Biol. Fish. 75: 431-438. Tang CC, Thompson SP, Parker JE, Lennie AR, Azough F, Kato K (2009). The ikaite-to-vaterite transformation: new evidence from diffraction and imaging. J. Appl. Cryst. 42: 225-233. Thorrold SR, Campana SE, Jones CM, Swart PK (1997). Factors determining δ13C and δ18O fractionation in aragonitic otoliths of marine fish. Geochim. et Cosmochim. Acta. 61: 2909-2919 Wang J, Becker U (2009). Structure and carbonate orientation of vaterite (CaCO3). Am. Mineral. 94: 380-386. Yang LF, Li SR, Luo JY, Cao Y (2008). Mineral chemistry of carp otoliths reflecting water quality change, in: Goldschmidt 2008 conference "From Sea to Sky"(Vancouver, Canada). Geochim. et Cosmochim. Acta. p. A1055. Yang LF (2007). Mineralogical study on the wild carp's otoliths from Baiyangdian Lake and Miyun Reservoir and their environmental responses. China University of Geosciences, Beijing, China. (Ph.D. Dissertation, in Chinese with English abstract). Yang LF, Li SR, Luo JY, Gao YH, Tong JG, Cao Y, Shen JF (2006). Microchemical characteristics of carp otoliths from two different water environments and their indication significance for environmental changes. Acta. Petrolog. Mineralog. 25: 511-517. Yin MC (1995). Fish Binomy. China Agriculture Press, Beijing. Zacherl AC, Georges A (2003). Barium and Strontium Uptake into Larval Protoconchs and Statoliths of the Marine Neogastropod Kelletia Kelletii. Geochim. et Cosmochim. Acta. 67: 4091-4099.

African Journal of Biotechnology Vol. 11(34), pp. 8520-8526, 26 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.551 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Synthesis of ZnO nanoparticles and their antibacterial effects Mohammad Reza Arefi1*, Saeed Rezaei-Zarchi2 and Saber Imani3 1

Department of Civil Engineering and Nano Research Center, Taft Branch, Islamic Azad University, Taft, Iran. 2 Department of Biology, Payame Noor University, Yazd, Iran. 3 Chemical Injuries Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran. Accepted 18 April, 2012

The zinc oxide nanoparticles with the average particle size of about 30 nm were synthesized by the chemical technique and their properties were studied with the help of scanning electron microscope and X-ray diffraction. The aim of this study was to detect the antibacterial properties of 0.01, 0.5 and 1% nano-ZnO against Escherichia coli. E. coli was cultured in liquid and agar nutrient medium to evaluate the antibacterial effects of 0.01, 0.05 and 1% of ZnO via the optical density (OD) and log CFU/ml measurements. Non-significant effect was seen for 0.01% of ZnO nano-particles, while 0.05 and 1% of nanoparticles showed considerably decreased bacterial number. A 4.385 and 2.04 times decrease in the OD value was found in the presence of 1 and 0.5% nano-ZnO, respectively (P<0.001) as compared to the control. In the second study, 6.3 log CFU/ml of E. coli were present in the cultures treated with 1% nanoZnO at 4Â°C in water. Control E. coli cells survived for 12 days, while complete cell death was seen when 1% nano-ZnO was applied for 24 h. In the third study, E. coli was grown in the agar medium with and without nanoparticles and suppressed growth (8.56 times; P<0.001) was seen in the presence of 1% nano-ZnO. Key words: ZnO-nanoparticle, antibacterial, bactericidal, Escherichia coli.

INTRODUCTION Nanomaterials are being used in many branches of science such as harmful microorganisms, recognition and treatment of various diseases (Sun et al., 2003). Nanotechnology has also invaded engineering, biology, chemistry, medicine, physics etc. Metallic nanoparticles have different functions, such as antibacterial characteristics (Te-Hsing et al., 2007). Metallic nanoparticles are continuously being used in the manufacture of manufacture of bactericides, but unfortunately the application in these processes reduces the antibacterial characteristics of nanoparticles. However, in the meantime, inorganic nanoparticles seem to have been good bactericides because of their tolerance to high temperatures (Wu et al., 2003).

*Corresponding author. E-mail: arefi@taftiau.ac.ir. Tel: +98-351623-9911, +98-913-154-8777.

Metal nano particles have various functions that are not observed in bulk phase (Sosa et al., 2003; Sun et al., 2003). Antibacterial agents used in textile industry are divided into two parts: the organic and inorganic matters. The organic antibacterial materials have been used as insecticides and bactericides for many years. Unfortunately, high temperatures in manufacturing process reduce their antibacterial properties. Nonetheless, inorganic antibacterial agents show excellent resistance against the bacterial and thermal stability (Te-Hsing et al., 2007). Over the past few decades, inorganic nanoparticles whose structures exhibit significantly novel and improved physical, chemical and biological properties, as well as functionality due to their nano-scale size, have elicited much interest. Nano-structured materials are attracting a great deal of attention because of their potential for achieving specific processes and selectivity, especially in biological and pharmaceutical applications (Wu et al., 2003; Fortner et al., 2005; Li et al., 2005).

Arefi et al.

At present, the use of nano-structured materials is becoming more widespread and a major advantage over either organic or inorganic nanoparticles offers many possibilities of applications in the areas of physics, chemistry, pharmacy, surface coating agents, textile sizing, agriculture, biochemistry and so on (Wu et al., 2003; Fortner et al., 2005; Li et al., 2005; Feng et al., 2000; Herrera et al., 2001; Hranisavljevic et al., 2002). It has been demonstrated that specially formulated metal oxide nanoparticles have good antibacterial activity, and antimicrobial formulations comprising nanoparticles could be effective bactericidal materials (Stoimenov et al., 2002). Nano-materials are called “a wonder of modern medicine”. It is stated that antibiotics kill perhaps a half dozen different disease-causing organisms but nanomaterials can kill some 650 cells (Sungkaworn et al., 2007). Resistant strains fail to develop if nanoparticlebased formulations are applied in their culture media. In laboratory tests with nanoparticles, the bacteria, viruses and fungi are killed within minutes of contact. The effect of nanoparticles on bacteria is very important since they constitute the lowest level and hence enter the food chain of the ecosystems (Fortner et al., 2005; Li et al., 2005; Feng et al., 2000; Herrera et al., 2001). Recent studies have demonstrated that specifically formulated nanoparticles demonstrate good antibacterial activity and constitute the antimicrobial formulations (Matsumura et al., 2003; Sondi and Salopek-Sondi, 2004; Lee et al., 2003). Since nano-silver has been used for imparting antibacterial properties (Lee et al., 2003; Dura´n et al., 2007), this study aimed to investigate the potent longlasting antibacterial activity of nano-ZnO toward the Gram-negative bacterium Escherichia coli, which is known as diarrhea-causing organism. MATERIALS AND METHODS

8521

heated at the temperature of about 55°C. The Zn (NO3)2 solutions were added drop wise (slowly for 1 h) to the above heated solution under high speed stirring. The beaker was sealed at this condition for 2 h. The precipitated ZnO nanoparticles were cleaned with deionized water and ethanol and then dried in air atmosphere at about 60°C. The scanning electron microscopic image of the synthesized ZnO nanoparticles was taken by a scanning electron microscope Model XL30- Philips Company, operated at 30 KV.

Bacterial susceptibility to nanoparticles To examine the susceptibility of E. coli to nano-ZnO, three different estimation methods were used with three tiles repetition.

Bacterial growth in the presence of nano-ZnO in liquid medium In the first method, the bacteria were grown in nutrient broth (NB). To start the growth, 2 ml of the overnight-cultured E. coli stock was added to 100 ml NB containing 0.12% glucose with and without 0.01, 0.5 and 1% nano-ZnO. The bacteria were aerobically cultured at 30°C for 24 h. Optical density (OD) measurements were taken at 600 nm to monitor the bacterial concentration.

Bacterial killing in the presence of nano-ZnO in liquid medium In the second method, the culture solution was centrifuged and the cells were washed and re-suspended in distilled water, reaching a final concentration of 6.3 log CFU/ml in each of the sample flasks and incubated at 4°C. The final concentration of the E. coli suspensions was made in 100 ml distilled water. Different amounts of nano-ZnO (0.01, 0.5 and 0.1%) were then separately added to the bacterial suspensions to keep in contact with the bacterial cells and shaken at 4°C for 48 h. Optical density (OD) was measured to obtain the results. Aliquots of 0.1 ml of the growth mixtures (water +bacterial cells+ nanoparticles) were sampled every 2 h. The number of resulting bacterial cells was noted after every 2 h of incubation. Bacterial number was determined by measuring the optical density (OD) at 600 nm. The OD values were converted into the E. coli concentration as log CFU/ml (Sondi and Salopek-Sondi, 2004).

Chemicals, growth media and bacterial strain E. coli (ATCC 25922) was used for the present experiment. Nutrient broth (BD234000; Becton Dickinson & Company, MD, USA) was used in growing and maintaining the bacterial cultures as per supplier’s protocol. Zinc nitrate, sodium hydroxide (NaOH), ethanol, potassium nitrate (KNO3), dihydrogen potassium phosphate (K2HPO4), potassium hydrogen phosphate (KHPO4), acetic acid (CH3COOH) and sodium acetate (CH3COONa) was purchased from Sigma and Merck Co. The chemicals such as ascorbic acid, sodium citrate tribasic dehydrate, ammonium sulphate, ethanol and cetyltrimethylammonium bromide (CTAB) were purchased from Sigma and were of the highest purity available. These reagents were used as received without further purification. All the solutions used in the study were prepared with double distilled water.

Bacterial growth in the presence of nano-ZnO in agar medium In the third method, the same bacteria strain was grown on a solid NB containing 0.12% glucose, 2% agar (control plates) alone or in the presence of 1% nano-ZnO. Bacterial cells were grown at 30°C for 48 h. Afterwards, the plates were visually estimated and bacterial colonies counted. The pictures were taken by an Olympus C2020Z digital camera. The data obtained in all tests were compared with the control. Student’s t-test was used to evaluate the significance of experimental results (P<0.05).

RESULTS AND DISCUSSION

Synthesis of ZnO nanoparticles

Size distribution of synthesized nanoparticles by SEM and XRD

To prepare ZnO nanoparticles, in a typical experiment, a 0.45 M aqueous solution of zinc nitrate (Zn (NO3)2.4H2O) and 0.9 M aqueous solution of sodium hydroxide (NaOH) were prepared in distilled water. Then, the beaker containing NaOH solution was

The Figure 1 shows the scanning electron microscope (SEM) image of the synthesized ZnO nanoparticles. SEM provided images of the particles by magnification of about

8522

Afr. J. Biotechnol.

Figure 1. Scanning electron microscope image of synthesized ZnO nanoparticles for corresponding sample 2 h 160 to 2-180°C

one million times greater. The assembly was attached with a computer software programming to analyze the mean size of the particles in sample. It should be noted that the particle diameter is always overestimated due to the distortion of SEM images (Dura´n et al., 2007). Figure 2a and b demonstrate the X-ray diffraction (XRD) patterns of the synthesized ZnO nanoparticles. The X-ray diffraction data were recorded by using Cu Kα o radiation (1.5406 A ). The intensity data were collected over a 2θ range of 20 to 80°. The average grain size of the samples was estimated with the help of Scherrer Equation using the diffraction intensity of (101) peak. Xray diffraction studies confirmed that the synthesized materials were ZnO with wurtzite phase and all the diffraction peaks agreed with the reported JCPDS data and no characteristic peaks were observed other than ZnO. The mean grain size (D) of the particles was determined from the XRD line broadening measurement using Scherrer equation (1): D=0.89λ / (βCosθ)

the particle morphology of as-prepared ZnO powders. The results of nanoparticle size measurement of samples by XRD and SEM indicate that the size of the ZnO nanoparticles was about 30 nm.

UV-visible absorption spectra of ZnO nanoparticles The UV-visible absorption spectra of ZnO nanoparticles are shown in Figure 3. Although the wavelength of our spectrometer is limited by the light source, the absorption band of the ZnO nanoparticles shows a blue shift due to the quantum confinement of the excitations present in the sample as compared with the bulk ZnO particles. This optical phenomenon indicates that these nanoparticles have a quantum size effect (Xin et al., 2004).

Effect of nano-ZnO on the growth of E. coli in liquid medium

(1)

Where, λ is the wavelength (Cu Kα), β is the full width at the half- maximum (FWHM) of the ZnO (101) line and θ is the diffraction angle. A definite line broadening of the diffraction peaks is an indication that the synthesized materials are in nanometer range. The lattice parameters calculated were also in agreement with the reported values. The reaction temperature greatly influences

In the first study, we investigated the effect of different concentrations of nanoparticles in liquid culture of E. coli. The optical density of the medium was investigated as the number of bacteria after contact with the nanoparticles. Figure 4 shows the effect of different concentration of (0.01, 0.5 and 1%) nano-ZnO on the in growth and killing of E. coli. As demonstrated by the Figure, 0.01% nano-ZnO did not have antibacterial

Arefi et al.

8523

Figure 2. XRD patterns of ZnO nanoparticles. (a) standard XRD pattern and (b) sample XRD pattern.

Figure 3. UV-visible absorption spectra for ZnO nanoparticles.

efficiency on E. coli but the concentrations of 0.5 and 0.1% nano-ZnO inhibited the bacterial growth. Figure 4 shows that 0.5% nano-ZnO showed 2.04 times decrease in the optical density of bacterial cultures (P<0.05) as compared to the control while in the presence of 1% nano- ZnO, the optical density of E. coli cultures decreased 4.385 times as compared to the control experiment.

Bactericidal effect of nano-ZnO on E. coli in liquid medium In the second study, estimation of the number of viable E. coli cells in contact with 1% nano-ZnO was carried out in water at 4째C for different contact time intervals. Our result show the reduction of E. coli cells from 6.3 log CFU/ml to undetectable levels after 12 days (data not shown). The

8524

Afr. J. Biotechnol.

OD 600 nm

0 0

0.01

0.5

Concentration of nano-ZnO % Figure 4. Escherichia coli concentration dependence upon different concentrations of nano-ZnO in the culture medium.

addition of these nano-materials to the bacterial culture showed decreased survival rate within 2 days as compared to that of 12-day experiment for control group. Figure 5 represents the number of viable E. coli cells in contact with 1% nano-ZnO suspended in water at 4Â°C for different contact times. From the Figure, it can be clearly observed that nano-ZnO exhibited different antibacterial properties. After the E. coli were suspended in water along with ZnO, the number of microbial cells reached zero after 24 h. These results demonstrate that nanoZnO have a high antibacterial efficiency against E. coli. Effect of nano-ZnO on the E. coli growth in agar medium In the third investigation, E. coli was grown on agar medium without (control) or with 1% nano-ZnO. Distinct 5 bacterial colonies were observed in 10 times dilution. The visual estimation and bacterial colony counts were performed at this dilution. In Figure 6, we can see smaller number of E. coli colonies on the agar medium with nanoZnO (plate B) as compared to the control group (plate A). In the control plates, 625 Âą 42 bacterial colonies were obtained, while in the experimental plates with 1% nanoZnO, 73 Âą14 bacterial colonies were seen. Hence,

nano-ZnO suppresses the bacterial growth 8.56 times (P<0.05) in the agar medium. DISCUSSION The antibacterial activities of different concentrations of nano-ZnO were investigated during the analysis. E. coli (ATCC 25922) was used as the test organism during the experiments. Good growth-inhibition results were observed when the bacterial cells were incubated with nanoparticles during the liquid and solid cultures. The quantitative examination of bacterial activity was estimated by the survival ratio as calculated from the number of viable cells, which formed colonies on the nutrient agar plates (Tsuang et al., 2008). The present data demonstrate that a formulation made with the biologically stabilized ZnO nanoparticles can be useful in the treatment of infectious diseases caused by E. coli. A strong binding of nanoparticles to the outer membrane of E. coli causes the inhibition of active transport, dehydrogenase and periplasmic enzyme activity and eventually the inhibition of RNA, DNA and protein synthesis, which finally leads to cell lysis as was seen for E. coli during the present study. Such effective and lesstime consuming formulations can be useful in the clinical

Log CFU/mL Log CFU/ml

Arefi et al.

8525

8 7 6 5 4 3 2 1 0 0

Time (h)

Time (Hours) Figure 5. Killing kinetics of 1% nano-ZnO on the E. coli cultures.

Figure 6. E. coli growth on the agar medium without nano-particles (A) and with 1% nano-ZnO (B).

practices where E. coli causes urinary tract infections (UTIs). It has been known that nano-materials exhibit strong inhibitory effects towards a broad spectrum of bacterial strains (Russell and Hugo, 1994). During the present study, different concentrations of nano-scale ZnO were tested to find out the best concentration that can have the most effective antibacterial property against the E. coli culture. Our data is in accordance with the previous studies; dealing with the antibacterial effects of nano-materials (Zhang and Chen, 2009; Cook and Costerton, 2000; Jones et al., 2006). Several investigations have suggested the possible mechanisms involving the interaction of nano-materials with the biological macromolecules. It is believed that microorganisms carry a negative charge while metal oxides carry a positive charge. This creates an â&#x20AC;&#x153;electromagneticâ&#x20AC;? attraction between the microbe and

treated surface. Once the contact is made, the microbe is oxidized and dies instantly. Generally, it is believed that nano-materials release ions, which react with the thiol groups (-SH) of the proteins present on the bacterial cell surface. Such proteins protrude through the bacterial cell membrane, allowing the transport of nutrients through the cell wall. Nano-materials inactivate the proteins, decreasing the membrane permeability and eventually causing the cellular death. Nano-materials also retard the bacterial adhesion and bio-film formation (Zhang and Chen, 2009). Antimicrobial modification to prevent the growth of detrimental microorganisms is a highly desired objective. Microbial cell growth and colonization result in the formation of a compact bio-film matrix, capable of protecting the underlying microbes from antibiotics and host defense mechanisms. Microbial infestation can

8526

Afr. J. Biotechnol.

result in serious infection (Cook and Costerton, 2000). Such infections are also implicated in food spoilage, spread of food-borne diseases, and bio fouling of materials (Jones et al., 2006). Hence, there is a significant interest in the development of antimicrobial materials and surfaces for applications in the health, biomedical, food and personal-hygiene industry. The nanomaterials based on the metal ions, exhibit broadspectrum biocides activity towards different bacteria, fungi, and viruses (Greenberg and Steffek, 2005). Nanomaterials are known to deactivate cellular enzymes and DNA by coordinating to electron-donating groups such as thiols, carboxylates, amides, imidazoles, indoles, hydroxyls and so forth. They cause pits in bacterial cell walls, leading to increased permeability and cell death (Holt and Bard, 2005). REFERENCES Baglioni P, Dei L, Fratoni L, Lo Nostro P, Moroni M (2003). Preparation of nano-and micro-particles of group II and transition metals oxides and hydroxides and their use in the ceramic,textile and paper industries. Patent, 8: 827-842. Cook G, Costerton JW (2000). Direct confocal microscopy studies of the bacterial colonization in vitro of a silver-coated heart valve sewing. Cuff Int. J. Antimicrob. Agents, 13(3): 169-173. Dura´n N, Marcato PD, De Souza GI, Alves OL, Esposito E (2007). Antibacterial effect of silver nanoparticles produced by fungal process on textile fabrics and their effluent treatment. J. Biomed. Nanotechnol. 3(2): 203-208. Fei B, Deng Z, Xin JH, Zhang Y, Pang G (2006). Room temperature synthesis of nanorods and their applications on cloth. Nanotechnology, 17(8): 1927-1931. Feng QL, Wu J, Chen GQ, Cui FZ, Kim TM, Kim JO (2000). A mechanistic study of the antibacterial effect of silver ions on Escherichia coli and Staphylococcus aureus. J. Biomed. Mater. Res. 52(4): 662-668. Fortner JD, Lyon DY, Sayes CM, Boyd AM, Falkner JC, Hotze EM (2005). C-60 in water: Nanocrystal formation and microbial response. Environ. Sci. Technol. 39(11): 4307-4316. Fu G, Vary PS, Lin C (2005) Anatase TiO2 nanocomposites for antimicrobial coatings. J. Phys. Chem. B. 109(18): 8889-8898. Greenberg CB, Steffek C (2005) Bio-adhesion to thin films in relation to cleaning. Thin Solid Films, 484(2): 324-327. Herrera M, Carrion P, Baca P, Liebana J, Castillo A (2001) In vitro antibacterial activity of glass-ionomer cements. Microbios, 104(409): 141-148. Holt KB, Bard AJ (2005). Interaction of silver (I) ions with the respiratory chain of Escherichia coli:An electrochemical and scanning electrochemical microscopy study of the antimicrobial mechanism of micromolar. Ag. Biochemistry, 44(39): 13214−1323. Hranisavljevic J, Dimitrijevic NM, Wurtz GA, Wiederrecht GP (2002). Photoinduced charge separation reactions of J-aggregates coated on silver nanoparticles. J. Am. Chem. Soc. 124(17): 4536-4537. Jones GL, Muller CT, O’Reilly M, Stickler DJ (2006). Effect of triclosan on the development of bacterial biofilms by urinary tract pathogens on urinary catheters. J. Antimicrob. Chemother. 57(2): 266-272.

Lee HJ, Yeo SY, Jeong SH (2003). Antibacterial effect of nanosized silver colloidal solution on textile fabrics. J. Mater. Sci. 38(10): 21992204. Li P, Li J, Wu C, Wu Q, Li J (2005). Synergistic antibacterial effects of lactam antibiotic combined with silver nanoparticles. Nanotechnology, 16(9): 1912-1917. Matsumura Y, Yoshikata K, Kunisaki S, Tsuchido T (2003). Mode of bactericidal action of silver zeolite and its comparison with that of silver nitrate. Appl. Environ. Microbiol. 69(7): 4278-4281. Qi K, Chen X, Liu Y, Xin JH, Mak CL, Daoud WA (2007). Facile preparation of anatase/SiO 2 spherical nanocomposites and their application in self-cleaning textiles. J. Mater. Chem. 17: 3504-3508. Russell AD, Hugo WB (1994) Antimicrobial activity and action of silver. Prog. Med. Chem. 31: 351-370. Sondi I, Salopek-Sondi B (2004). Silver nanoparticles as antimicrobial agent:a case study on E.coli as a model for Gram-negative bacteria. J. Colloid. Interface Sci. 275(1): 177-182. Sosa IO, Noguez C, Barrera RG (2003) Optical properties of metal nanoparticles with arbitrary shapes. J. Phys. Chem. B. 107(26): 6269-6275. Stoimenov PK, Klinger RL, Marchin GL, Klabunde KJ (2002) Metal. oxide nanoparticles as bactericidal agents. Langmuir. 18(17): 66796686. Sun YG, Mayers B, Herricks T, Xia YN (2003) Polyol synthesis of uniform silver nanowires:a plausible growth mechanism and the supporting evidence. Nano. Lett. 3(7): 955-960. Sungkaworn T, Triampo W, Nalakarn P, Triampo D, Tang IM, Lenbury Y (2007). The effects of TiO2 nanoparticles on tumor cell colonies: fractal dimension and morphological properties. Int. J. Biomed. Sci. 2(1): 67-12. Te-Hsing W, Yi-Der T, Lie-Hang S (2007). The novel methods for preparing antibacterial fabric composites containing nano-material. Solid State Phenomena. 124(12): 1241-1244. Tsuang YH, Sun JS, Huang YC, Lu CH, Chang WH, Wang CC (2008). Studies of photokilling of bacteria using titanium dioxide nanoparticles. Artif. Organs. 32(2): 167-174. Vigneshwaran N, Kumar S, Kathe AA, Varadarajan PV, Prasad V (2006). Functional finishing of cotton fabrics using zinc oxide-soluble starch nanocomposites. Nanotechnology, 17(13): 5087-5095. Wang RH, Xin JH, Tao XM, Daoud WA (2004). ZnO nanorods grown on cotton fabrics at low temperature. Chem. Phys. Lett. 398(18): 250255. Wu X, Liu H, Liu J, Haley KN, Treadway JA, Larson JP, Ge E, Peale F, Bruchez MP (2003). Immunofluorescent labeling of cancer marker Her2 and other cellular targets with semiconductor quantum dots. Nat. Biotechnol. 21(1): 41-46. Xin JH, Daoud WA, Kong YY (2004). A new approach to UV-blocking treatment for cotton fabrics. Text. Res. J. 74(2): 97-100. Zhang H, Chen G (2009). potent antibacterial activities of Ag/TiO2 nanocomposite powders synthesized by a one-pot sol-gel method. Environ Sci. Technol. 43(8): 2905-2910.

Full Length Research Paper

Characterization of polygalacturonases from fruit spoilage Fusarium oxysporum and Aspergillus tubingensis Ahmed R. Al-Najada1, Rashad R. Al-Hindi1 and Saleh A. Mohamed2,3* 1

Biology Department, Faculty of Science, King Abdulaziz University, Jeddah 21589, Kingdom of Saudi Arabia. Biochemistry Department, Faculty of Science, King Abdulaziz University, Jeddah 21589, Kingdom of Saudi Arabia. 3 Molecular Biology Department, National Research Center, Dokki, Cairo, Egypt.

Accepted 23 March, 2012

We reported the partial purification and characterization of polygalacturonases from fruit spoilage Fusarium oxysporum and Aspergillus tubingensis isolated from banana and peach, respectively. By using diethylaminoethyl (DEAE)-Sepharose column, one and two forms of polygalacturonases were separated from F. oxysporum (PGase) and A. tubingensis (PGaseI and PGaseII), respectively. The polygalacturonases examined had higher affinity toward various polygalacturonic acids and pectins. The apparent Km and Vmax values were reported for the enzymes. Acidic pH optima (4.0 to 6.0) was also reported for the enzymes. Optimal temperature and thermal stability of the enzymes showed a range from 40 to 60°C. The effect of metal cations on the enzymes was studied. The most chemical compounds caused moderate inhibitory effect except benzoic and citric acids which had strong inhibitory effect on the polygalacturonases. The benzoic and citric acids were used as antifungal compounds for F. oxysporum and A. tubingensis. The citric acid was found to be more effective against fungal growth than benzoic acid. Key words: Fruit, spoilage, Fusarium oxysporum, Aspergillus tubingensis, polygalacturonase. INTRODUCTION Pectin is an important component of middle lamella and primary cell wall of higher plants. Pectins are high molecular weight acid polysaccharide primary made up of α (1−4) linked D-galacturonic acid residues (TorresFanela et al., 2003). Pectinases are enzyme group that degrade pectic substances and are classified according to their mechanism of action in methylesterases (EC.3.1.11.1) that remove methoxyl groups from highly or partially esterified galacturonan. Polygalacturonases catalyse the hydrolysis of the glycosidic bonds in a random fashion (endopolygalacturonase-EC.3.2.1.15) or from nonreducing end of homogalacturonan releasing galacturonic or digalacturunic acid residues (exopolyglacturonases EC.3.2.1.67 and EC 3.2.1.82) (Alkorta et al., 1998).

*Corresponding author. E-mail: saleh38@hotmail.com.

Pectinases are naturally produced by many organisms, including bacteria, fungi, yeasts, insects, nematodes, protozoan and plants. Pectinase production has been reported from bacteria including streptomycetes (Beg et al., 2000). Pectinases are the first enzymes to be secreted by fungal pathogens when they attack plant cell walls (Collmer and Keen, 1986; Idnurm and Howlett, 2001). Pectinases are essential for fungal pathogens that do not have specialized penetration structures as well as for necrotrophic pathogens during the late stages of the invasion process (De Lorenzo et al., 1997). Secretion of pectinases during infection to the plants has been reported from various plant pathogenic fungi such as Fusarium oxysporum, Botrytis cinerea, Sclerotinia sclerotiorum (Di Pietro and Roncero, 1998; GarciaMaceira et al., 2001; ten Have et al., 2001; de las Heras et al., 2003; Li et al., 2004), from non-pathogenic fungus Rhizoctonia AG-G (Machinandiarena et al., 2005) and from several yeasts (da Silva et al., 2005).

8528

Afr. J. Biotechnol.

Polygalacturonases are important pathogenicity factors for fungi such as Aspergillus flavus, Alternaria citri and Claviceps purpurea, and for bacteria such as Agrobacterium tumefaciens and Ralstonia solanacearum (Di Matteo, 2006). The characterization of purified polygalacturonases is an important area of research since it focuses on being able to distinguish between the enzymatic complex components of the substrate degradation mechanism, optimum conditions for enzymatic activity, and the regulation of enzyme by inhibitors (Gummadi and Panda, 2003; Pedrolli et al., 2009). Previously, we isolated and identified F. oxysporum and Aspergillus tubingensis from banana and peach, respectively, and screened their polygalacturonases (AlHindi et al., 2011). In this work, the partial purification and characterization of polygalacturonases produced by F. oxysporum and A. tubingensis were studied. In addition, the effect of benzoic and citric acids on the development of these fungi was evaluated.

μmol of galacturonic acid per hour under standard assay conditions.

MATERIALS AND METHODS

Optimum temperature

Fruit spoilage fungi

Enzyme activity was determined at a temperature range of 20 to 70°C. The maximum activity was taken as 100% and percentage relative activity were plotted against different temperatures.

F. oxysporum and A. tubingensis were isolated and identified from banana and peach as previously described (Al-Hindi et al., 2011).

Cultivation of fungi F. oxysporum and A. tubingensis were inoculated under aseptic conditions in 250 ml Erlenmeyer flasks containing 5% banana and peach peels, respectively. The inoculated flasks were incubated at 28°C with shaking on a rotary incubator shaker at 150 rpm for five days. The cell-free broth was recovered by filtration using a polyamide tissue. The cell-free broth was subjected to dialysis against 20 mM Tris-HCl buffer, pH 7.2 over night. The dialyzate was centrifuged at 10,000 rpm for 12 min and the supernatant was designated as crude extract.

Partial purification of polygalacturonases Crude extracts from F. oxysporum and A. tubingensis were separately loaded on a diethylaminoethyl (DEAE) - Sepharose CL6B column (10 x 1.6 cm i.d.) equilibrated with 50 mM Tris-HCl buffer, pH 7.2. The enzyme was eluted with a stepwise gradient from 0.0 to 0.3 M NaCl in the same buffer. Fractions in 3 ml volume were collected at a flow rate of 60 ml/h. The eluted fractions were monitored at 280 nm for protein and assayed for enzyme activity. Protein fractions exhibiting enzyme activity were pooled.

Polygalacturonase activity assay Polygalacturonase (EC 3.2.1.15) activity was assayed according to Miller (1959). The reaction mixture (0.5 ml) contained 1% polygalacturonic acid, 0.05 M sodium acetate buffer pH 5.5 and a suitable amount of enzyme. Assay was carried out at 37°C for 1 h. Then, 0.5 ml dinitrosalicylic acid reagent was added and heated in a boiling water bath for 10 min. After cooling to room temperature, the absorbance was measured at 560 nm. One unit of enzyme activity was defined as the amount of enzyme which liberated 1

Protein determination Protein was determined according to Bradford (1976) and bovine serum albumin was used as standard.

Characterization of polygalacturonase Km The k m value was determined from Lineweaver-Burk plot by using polygalacturonic acid concentrations from 2 to 6 mg/ml.

Optimum pH Enzyme activity was determined at various pH using 50 mM each of sodium acetate (pH 4.0 to 6.0) and Tris-HCl (6.5 to 8.5). The maximum activity was taken as 100% and percentage relative activity were plotted against different pH values.

Thermal stability The enzyme was incubated at a temperature range of 20 to 70°C for 15 min prior to substrate addition. The % relative activity was plotted against different temperatures.

Effect of metal ions The enzyme was incubated with 2 mM solution of Co2+, Ca2+, Cu2+, Ni2+, Zn2+ and Hg2+ for 15 min prior to substrate addition. The enzyme activity without metal ions was taken as 100% and percentage relative activity was determined in the presence of metal ions.

Effect of chemical compounds Enzyme activity was determined in the presence of phenylmethanesulfonylfluoride (PMSF), p-HMB, β-mercaptoethanol, trypsin inhibitor, 1,10 phenanthroline, ethylenediaminetetraacetic acid (EDTA), sodium citrate, sodium oxalate, sodium benzoate, benzoic acid, gallic acid, tannic acid and citric acid at a concentration of 5 mM. The enzyme activity without chemical compound was taken as 100% and percentage relative activity was determined in the presence of chemical compound.

Effect of benzoic and citric acids on the growth of fruit spoilage fungi Benzoic and citric acids were used at the concentration of 5 mM as antifungal compounds. The fruits were divided into four groups: 1) injured banana and peach without acid, 2) injured banana and peach with each acid, 3) injured banana and peach with F.

Al-Najada et al.

B Absorbance at 280 nm

Units/fraction

0.5

0.3M NaCl

0.2M NaCl

0.05M NaCl 0.4

0.0M NaCl 0.3

0.2

Units / fraction

Absorbance at 280 nm

0.1M NaCl

250

U n its /fra c tio n

0 .1 M N a C l 0 .5

0 .3 M N a C l 0 .4

100

200

0 .0 5 M N a C l 150

0 .2 M N a C l 0 .3

0 .0 M N a C l 100

0 .2 50

0 .1

0.1

0.0

0 .6

U n its / fr a c tio n

A b s o rb a n c e a t 2 8 0 n m

A b so rb a n ce a t 2 8 0 n m

0.6

8529

0 .0

100

F ra c tio n n u m b e r

Fraction number

Figure 1. Elution profiles for the chromatography of polygalacturonases from F. oxysporum (a) and A. tubingensis (b) crude extracts on DEAE-Sepharose column (10 × 1.6 cm i.d.).

Table 1. Partial purification of polygalacturonases from F. oxysporum and A. tubingensis.

Purification step

Total units*

Total protein (mg)

Specific activity (unit/mg protein)

Fold purification

Recovery (%)

140 5000

0.32 4.5

434 1111

1.00 1.00

100 100

48 1011 675

0.034 0.051 0.036

1411 19823 18750

3.25 17.8 16.8

32 20 13

Crude extract F. oxysporum A. tubingensis DEAE-Sepharose F. oxysporum PGase A. tubingensis PGaseI PGaseII

*One unit of enzyme activity was defined as the amount of enzyme which produced one μmol galacturonic acid per h under standard assay conditions.

oxysporum and A. tubingensis, respectively and 4) injured banana and peach with each acid and F. oxysporum and A. tubingensis, respectively. The development of spoilage fungi was observed after three, five and seven days intervals of incubation at 28°C.

RESULTS AND DISCUSSION Partial purification of polygalacturonases from F. oxysporum and A. tubingensis By using DEAE-Sepharose column, one and two forms of polygalacturonase (PGase) were separated from F. oxysporum (PGase with specific activity 1411 units/mg protein) and A. tubingensis (PGaseI and PGaseII with specific activity 19,823 and 18,750 units/mg protein, respectively), respectively (Figure 1 and Table 1). Various numbers of PGases with different specific activities were

reported from Aspergillus niger (710 units/mg protein) (Murad and Azzaz, 2011), Trichoderma harzianum (881 units/mg protein) (Mohamed et al., 2009), Aspergillus carbonarius (7000 units/mg protein) (Nakkeeran et al., 2011) and A. flavus (3000 units/mg protein) (Gewali et al., 2007). Low specific activity was reported for polygalacturonases from F. moniliforme (18.6 units/mg protein) (Niture and Pant, 2004) and A. niger NRRL3 (34.7 units/mg protein) (Fahmy et al., 2008). Characterization of polygalacturonases oxysporum and A. tubingensis

from

With regard to substrate specificity, a variety of polygalacturonic acids (PGAs) and pectins (citrus pectin with 7.8% degree esterification and apple pectin with 6% degree estrification) have been tried as substrates. The

8530

Afr. J. Biotechnol.

Table 2. Substrate specificity of F. oxysporum PGase and A. tubingensis PGaseI and PGaseII.

Substrate

F. oxysporum

Polygalacturonic acid (Sigma) Citrus pectin (7.8% esterification) Polygalacturonic acid (BDH) Apple pectin (6% estrification)

100 184 126 194

% Relative activity A. tubingensis PGase PGaseI PGaseII 100 100 155 181 108 149 156 158

Each value represents the average of two experiments.

-0.2

1/mol galacturonic acid/assay

B 1/mol galacturonic acid/assay

0 0.0

0.2

0.4

0.6

0.8

1.0

1/mg polygalacturonic acid

-0.3

-0.2

-0.1

PGase I PGase II

0 0.0

0.1

0.2

0.3

0.4

0.5

0.6

1/mg polygalacturonic acid

Figure 2. Lineweaver-Burk plot relating F. oxysporum PGase (a) and A. tubingensis PGaseI and PGaseII (b) reaction velocities to polygalacturonic acid as substrate concentrations. Each point represents the average of two experiments.

enzyme activities were compared to the activity with PGA (Sigma) which was regarded as a 100% activity. Higher relative activities were reported for F. oxysporum PGase (citrus pectin 184%, PGA (BDH) 126% and apple pectin 194%), and A. tubingensis PGaseI (citrus pectin 155 %, PGA (BDH) 108% and apple pectin 156%) and PGaseII (citrus pectin 181%, PGA (BDH) 149% and apple pectin 158%) (Table 2). The substrate specificity was reported for polygalacturonases from Aspergillus giganteus (citrus pectin 100%, PGA 94.9%, citrus pectin 51.9%, citrus pectin 25.5% and apple pectin 23.9%) (Pedrolli and Carmona, 2010), A. niger NRRL3 (citrus pectins with different esterification 41 to 97%) (Fahmy et al., 2008), T. harzianum (citrus pectins with different esterification 11 to 187%) (Mohamed et al., 2009) and Mucor circinelloides ITCC 6025 (citrus pectin 11.0 % and apple pectin 22 %) (Thakur et al., 2010). The apparent Km and Vmax values were reported for F. oxysporum PGase (4.1 mg/ml and 5.5 µmol/ml) and A.

tubingensis PGaseI (7.0 mg/ml and 0.69 µmol/ml) and PGaseII (5.2 mg/ml and 0.5 µmol/ml) (Figure 2). Various Km and Vmax values were reported for polyglacturonases from F. moniliforme NCIM 1276 (Km 0.12 mg/ml and Vmax 111.11 µmol/min/mg protein) (Niture et al., 2008), Penicillium viridicatum (Km 1.30 mg/ml and Vmax 1.76 to 2.07 µmol/min/mg protein) (Gomes et al., 2009), A. giganteus (Km 3.25 and 1.16 mg/ml and Vmax 669.6 and 602.8 µmol/min/mg) (Pedrolli and Carmona, 2010), Paecilomyces variotii (Km 1.84 mg/ml and Vmax 432 µmol/min/mg protein) (Damasio et al., 2010) and A. niger (SA6) (Km 2.74 mg/ml and Vmax 0.78 µmol/min/mg protein) (Buga et al., 2010). Acidic pH optima have been reported for F. oxysporum PGase (pH 4.0) and A. tubingensis PGaseI and PGaseII (4.5 and 6.0, respectively) (Figure 3). Similar acidic pH optima were reported for polygalacturonase from P. variotii (pH 4.0) (Damasio et al., 2010), Sclerotium rolfsii (pH 4.5 to 5.0) (Schnitzhofer et al., 2007), Mucor rouxii

Al-Najada et al.

B 100 % Relative activity

% Relative activity

100 80 60 40

PGase I PGase II

80 60 40 20

20 0

8531

Figure 3. pH optima of F. oxysporum PGase (a) and A. tubingensis PGaseI and PGaseII (b). The reaction mixture contained in 0.5 ml were 2.5 mg polygalacturonic acid, suitable amount of enzyme and 50 mM sodium acetate buffer (pH 3.6 to 6.0), 50 mM Trsi-HCl buffer (6.5 to 8.5). Each point represents the average of two experiments.

100

% Relative activity

60 40

20 0

40 60 o Temperature ( C)

PGase I PGase II

60 40 20 0 0

40 Temperature (°C) o Temperature

60 C

Figure 4. Temperature optima of F. oxysporum PGase (a) and A. tubingensis PGaseI and PGaseII (b). The enzyme activity was measured at various temperatures using the standard assay method as previously described. Each point represents the average of two exp eriments.

NRRL 1894 (pH 4.5) (Saad et al., 2007), A. niger (pH 3.8) (Khairnar et al., 2009), Mucor circinelloides ITCC 6025 (pH 5.5) (Thakur et al., 2010), A. tubingensis (pH 4.2) (Gewali et al., 2007) and Aspergillus oryzae (pH 5.0) (Riou et al., 1998). Optimal temperatures of polygalacturonases for the examined species showed a range from 40 to 60°C (Figure 4). These optimal temperatures were similar to those observed for polygalacturonases from Streptomyces erumpens (50°C) (Kar and Ray, 2011), Aspergillus sojae (55°C) (Dogan and Tari, 2008), T.

harzianum (40°C) (Nabi et al., 2003) and A. niger NRRL3 (40°C) (Fahmy et al., 2008). The temperature stability for F. oxysporum PGase and A. tubingensis PGaseI and PGaseII was detected up to 60, 40 and 50°C, respectively (Figure 5). Similar thermal stability was reported for polygalacturonases from P. variotii (45 to 55°C) (Damasio et al., 2010), T. harzianum (60°C) (Nabi et al., 2003) and A. niger (45 to 55°C) (Dogan and Tari, 2008).The effect of metal cations on the examined polygalacturonases at 2 mM was studied (Table 3). For 2+ 2+ 2+ F. oxysporum PGase, Zn , Pb and Hg caused 12, 39

8532

Afr. J. Biotechnol.

% Relative activity

100

PGase I PGase II

80 60 40 20

0 0

40 60 o Temperature ( C)

50 60 0 Temperature Temperature (Â°C) C

Figure 5. Effect of temperature on the thermal stability of F. oxysporum PGase (a) and A. tubingensis PGaseI and PGaseII (b). Each point represents the average of two experiments.

Table 3. Effect of 2 mM metal cations on F. oxysporum PGase and A. tubingensis PGaseI and PGaseII.

Metal cation

F. oxysporum PGase

Zn2+ Pb2+ Ca2+ Hg2+ Cu2+ 2+ Co 2+ Ni

88 61 156 68 102 138 132

Relative acivity (%) A. tubingensis PGaseI PGaseII 144 133 88 61 134 117 49 71 72 78 139 134 98 167

Each value represents the average of two experiments.

and 32% inhibition, while Ca , Co and Ni were found to activate the enzyme by 156, 138 and 132%, respecttively. A. tubingensis PGaseI and PGaseII were activated by Zn2+, Ca2+ , Co2+, where Ni2+ only activated PGaseII. The other cations Cu2+, Hg2+ and Pb2+ had partially 2+ inhibitory effect. In P. viridicatum, Ca was foundto 2+ enhance the stability of polygalacturonase, while Hg , 2+ 2+ Zn and Cu were strongly inhibited (Gomes et al., 2009). Co2+ and Cu2+ had no inhibitory effects on the polygalacturonase activity of P. variotii (Damasio et al., 2010). Polygalacturonases from M. rouxii (Saeed et al., 2007) and A. niger NRRL3 (Fahmy et al., 2008) were partially inhibited by Ca2+, Zn2+, Cu2+, Co2+, Ni2+ and Hg2+. The effect of different compounds on the activities of the examined polygalacturonases was studied (Table 4). PMSF, p-HMB, Î˛-mercaptoethanol, trypsin inhibitor, 1,10 phenanthroline, EDTA, sodium citrate, sodium oxalate, sodium benzoate, gallic acid and tannic acid had moderate and partial inhibitory effects on polygalcturonases from F. oxysporum and A. tubingensis, while

benzoic and citric acids had strong inhibitory effects. However, tannic acid was a potent inhibitor of polygalacturonase produced by Alternaria alternata (Kotwal, 1981). P. oxalicum polygalacturonase at the level of 5 mM was not inhibited by PMSF and EDTA (Yadav and Shastri, 2005). For M. rouxii polygalacturonase, EDTA stimulated the activity up to 125% (Saeed et al., 2007). Effect of benzoic and citric acids on the growth of fungi From the results, it can be concluded that benzoic and citric acids had strong inhibitory effect, as compared with other compounds examined, on the examined polygalacturonases. Therefore, the benzoic and citric acids were used as antifungal compounds for F. oxysporum and A. tubingensis loaded on the injured banana and peach, respectively (Figures 6 and 7). Comparing the

Al-Najada et al.

Table 4. Effect of 5 mM chemical compounds on F. oxysporum PGase and A. tubingensis PGaseI and PGaseII.

Chemical compound Î˛-Mercaptoethanol PMSF Trypsin inhibitor p-HMB 1,10 Phenanthroline Benzoic acid Gallic acid Tannic acid EDTA Sodium benzoate Sodium citrate Sodium oxalate Citric acid

A. tubingensis PGaseI PGaseII 80 86 69 72 70 65 70 66 85 88 34 46 98 116 73 84 82 78 94 90 93 66 83 61 35 28

F. oxysporum PGase 92 95 93 79 100 21 78 98 93 89 47 48 13

Each value represents the average of two experiments. PMSF, phenylmethylsulfonyl fluoride; p-HMB, phydroxymercuribenzoic acid; EDTA, ethylenediamine tetraacetic acid.

Day 3 A

Day 5 A

Figure 6. Effect of benzoic acid (a) and citric acid (b) on the development of F. oxysporum after Day 7five and seven days intervals of incubation at 28Â°C. 1) Injured banana without acid, 2) three, injured banana with acid, 3) injured banana with F. oxysporum, and 4) injured banana with acid andAF. oxysporum.

8533

8534

Afr. J. Biotechnol.

Day 7 A

Figure 6. Contd.

Day 3 A

Day 5 A

Day 7 A

Figure 7. Effect of benzoic acid (a) and citric acid (b) on the development of A. tubingensis after three, five and seven days intervals of incubation at 28째C. 1) Injured peach without acid, 2) injured peach with acid, 3) injured peach with A. tubingensis, and 4) injured peach with acid and A. tubingensis.

effects of the two treatments, it appeared that citric acid was found to be more effective against fungal growth than benzoic acid. The reduction of fungal spoilage in

hard peel banana treated with citric acid was higher as compared with the same fruits treated with benzoic acid. However, the two acids had the same effect on fungal

Al-Najada et al.

spoilage of soft peel peach. Fruits treated with acids only, as compared with other treatments, showed more resistance to fungal spoilage development and less infection up to day three for soft peel peach, and up to day five for hard peel banana. The observation indicates that the formation of fungal spoilage in soft peel peach is faster than in hard peel banana. Similarly, benzoic acid was been found to be an antifungal agent (Pundir and Jain, 2010; Sofos et al., 1998), and is effective against A. niger, A. flavus and Aspergillus fumigatus (Doughari et al., 2007). Evaluation of inhibitory effects of citric acid on the growth inhibition of some important pathogenic fungi in vitro Trichophyton mentagrophytes var. mentagrophytes, Candida albicans, A. fumigatus, and Malassezia furfur was studied. The results demonstrate that citric acid had fungistatic and fungicidal activities against all pathogenic fungi tested, and its effect on filamentous fungi was higher than that on the yeasts (Shokri, 2011). Conclusion In conclusion, the study of the characterization of fungal polygalacturonases, especially the effect of citric and benzoic acids, which had strong inhibitory effect, may be used for the treatment of banana and peach spoilage fungi. REFERENCES Al-Hindi RR, Al-Najada AR, Mohamed SA (2011). Isolation and identification of some fruit spoilage fungi: Screening of plant cell wall degrading enzymes. Afr. J. Microbiol. Res. 5: 443-448. Alkorta I, Garbisu C, Llama MJ, Serra JL (1998). Industrial applications of pectic enzymes. Process Biochem. 33: 21-28. Beg QK, Bhushan B, Kapoor M Hoondal GS (2000). Production and characterization of thermostable xylanase and pectinase from a Streptomyces sp. QG-11-3. J. Ind. Microbiol. Biotechnol. 24: 396402. Bradford MM (1976). A rapid and sensitive for the quantitation of microgram quantitites of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254. Buga ML, Ibrahim S, Nok AJ (2010). Partially purified polygalacturonase from Aspergillus niger (SA6). Afr. J. Biotechnol. 9: 8944-8954 Collmer A, Keen N (1986). The role of pectic enzymes in plant pathogenesis. Ann. Rev. Phytopathol. 24: 383-409. Da Silva EG, de Fatima Borges M, Medina C, Piccoli RH, Schwan, RF (2005). Pectinolytic enzymes secreted by yeasts from tropical fruits. FEMS Yeast Res. 5: 859-865. Damasio A RL, da Silva TM, Maller A, Jorge JA, Terenzi HF, Polizeli MLTM (2010). Purification and partial characterization of an exopolygalacturonase from Paecilomyces variotii liquid cultures. Appl. Biochem. Biotechnol. 160: 1496-1507. De las Heras A, Patino B, Posada ML, Martinez MJ, Vazquez C, Gonzalez Jean MT (2003). Characterization and in vitro expression patterns of an exo-polygalacturonas encoding gene from Fusarium oxysporum f.sp. radicis lycopersici. J. Appl. Microbiol. 94: 856-864. De Lorenzo G, Castoria R, Bellincampi D, Cervone F (1997). Fungal invasion enzymes and their inhibition. In: Carroll GC, Tudzynski P (Eds.), The Mycota V, Part B: Plant Relationship. Springer, Berlin, pp. 61-83. Di Matteo (2006). Polygalacturonase-inhibiting protein (PGIP) in plant defence: a structural view. Phytochem. 67: 528-533.

8535

Di Pietro A, Roncero MI (1998). Cloning expression and role in pathogenicity of pgI encoding the major extracellular endopolygalacturonase of the vascular wilt pathogen Fusarium oxysporum. Mol. Plant Pathol. 11: 91-98. Dogan N, Tari C (2008). Characterization of three-phase partitioned exo-polygalacturonase from Aspergillus sojae with uniqu properties. J. Biochem. Eng. 39: 43-50. Doughari JH, Elmahmood AM, Manzara S (2007). Studies on the antibacterial activity of root extracts of Carica papaya L. Afr. J. Microbiol. Res. 7: 37-41. Fahmy AS, El-beih FM, Mohamed SA, Abdel-Gany SS, Abd-Elbaky EA (2008). Purification and characterization of an exo-polygalacturonase from Aspergillus niger. Appl. Biochem. Biotechnol. 149: 205-217. Garcia-Maceira FI, Pietro D, Huertas-Gonzalez A, Ruiz-Roldan MC, Roncero MI (2001). Mole of a low molecular mass pectate lyase from Fusarium moniliforme. Biochem. J. 319: 159-164. Gewali MB, Maharjan J, Thapa S, Shrestha JK (2007). Studies on polygalacturonase from Aspergllus flavus. Sci. World, 5: 19-22. Gomes E, Leite RSR, da Silva R, Silva D (2009). Purification of an exopolygalacturonase from Penicillium viridicatum RFC3 produced in submerged fermentation. Int. J. Microbiol. Article ID 631942, 8 pages, doi:10.1155/2009/631942. Gummadi SN, Panda T (2003). Purification and biochemical properties of microbial pectinases-a review. Process Biochem. 38: 987-996. Idnurm A, Howlett BJ (2001). Pathogenicity genes of phyto-pathogenic fungi. Mol. Plant Pathol. 2: 241-255. Kar S, Ray RC (2011). Purification, characterization and application of thermostable exo-polygalacturonase from Streptomyces erumpens MTCC 7317. J. Food Biochem. 35: 133-147. Khairnar Y, Vamsi KK, Boraste A, Gupta N, Trivedi S, Patil P, Gupta G, Gupta M, Jhadav A, Mujapara A, Joshi B, Mishra D (2009). Study of pectinase production in submerged fermentation using different strains of Aspergillus Niger. Int. J. Microbiol. Res.1: 13-17. Kotwal S (1981). Studies on organisms infecting tropical fruits with special reference to Alternaria alternata, an indeginously isolated strain causing soft-rot, PhD Thesis, Nagpur University, Nagpur. Li R, Rimmer R, Buchwaldt L, Sharpe AG, Seguin-Swartz G, Hegedus DD (2004). Interaction of Sclerotinia sclerotiorum with Brassica napus: cloning and characterization of endo- and exopolygalacturonases expressed during saprophytic and parasitic modes. Fungal Gene Biol. 41: 754-765. Machinandiarena MF, Wolski EA, Barrera V, Daleo GR, Andreu AB (2005). Characterization and in vitro expression patterns of extracellular degradative enzymes from non-pathogenic binucleate Rhizoctonia AG-G. Mycopathol. 159: 441-448. Miller GL (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31: 426-428. Mohamed SA, Al-Malki AL, Kumosani TA (2009). Characterization of a polygalacturonase from Trichoderma harzianum grown on citrus peel with application for apple juice. Aust. J. Basic Appl. Sci. 3: 27702777. Murad HA, Azzaz HH (2011). Microbial pectinases and ruminant nutrition. Res. J. Microbiol. 6: 246-269. Nabi NG, Asgher M, Shah AH, Sheikh MA, Asad MJ (2003). Production of pectinase by Trichoderma harzianum in solid state fermentation of citrus peel. Pakistan J. Agric. Sci. 40: 3-4. Nakkeeran E, Umesh-Kumar S, Subramanian R (2011). Aspergillus carbonarius polygalacturonases purified by integrated membrane process and affinity precipitation for apple juice production. Bioresour. Technol. 102: 3293-3297. Niture SK, Kumarb AR, Parabc PB, Panta A (2008). Inactivation of polygalacturonase and pectate lyase produced by pH tolerant fungus Fusarium moniliforme NCIM 1276 in a liquid medium and in the host tissue. Microbiol. Res. 163: 51-62. Niture SK, Pant A (2004). Purification and biochemical characterization of polygalacturonase 11 produced in semi-solid medium by a strain of Fusarium moniliforme. Microbiol. Res. 159: 305-314. Pedrolli DB, Carmona EC (2010). Purification and characterization of the exopolygalacturonase produced by Aspergillus giganteus in submerged cultures. J. Ind. Microbiol. Biotechnol. 37: 567-573. Pedrolli DB, Monteiro AC, Gomes E, Carmona EC (2009). Pectin and pectinases: production, characterization and industrial application of

8536

Afr. J. Biotechnol.

microbial pectinolytic enzymes. Open Biotechnol. J. 3: 9-18 Pundir RK, Jain P (2010). Screening for antifungal activity of commercially available chemical food preservatives. Int. J. Pharm. Sci. Rev. Res. 5: p. 2. Riou C, Salmon J-M, Vallier M-J, Gunata Z, Barre P (1998). Purification, characterization, and substrate specificity of a novel highly glucosetolerant β-glucosidase from Aspergillus oryzae. Appl. Environ. Microbiol. 64: 3607-3614. Saad N, Briand M, Gardarin C (2007). Production, Purification and characterization of an endopolygalacturonase from Mucor rouxii NRRL 1894. J. Enzyme Microbiol. Technol. 41: 800-805. Schnitzhofer W, Weber H-J, Vrsanska M, Biely P, Cavaco-Paulo A, Guebitz GM (2007). Purification and mechanistic characterisation of two polygalacturonases from Sclerotium rolfsii. J. Enzyme Microbiol. Technol. 40: 1739–1747. Shokri H (2011). Evaluation of inhibitory effects of citric and tartaric acids and their combination on the growth of Trichophyton mentagrophytes, Aspergillus fumigatus, Candida albicans, and Malassezia furfur. Comparative Clinical Pathology DOI: 10.1007/s00580-011-1195-6, Springer-Verlag London Limited.

Sofos JN, Beuchat LR, Davidson PM, Johnson EA (1998). Naturally occurring antimicrobials in Food. Regul. Pharmacol. Toxicol. 28: 7172. Ten Have A, Breuil WO, Wubben JP, Visser J, van Kan JA (2001). Botrytis cinerea endopolygalacturonase genes are differentially expressed in various plant tissues. Fungal Gene. Biol. 33: 97–105. Thakur A, Pahwa R, Singh S, Gupta R (2010). Production, purification, and characterization of polygalacturonase from Mucor circinelloides ITCC 6025. Enzyme Res. Article ID 170549, 7. Torres-Favela E, Aguilar C, Esquivel-Contreras CJ, Gustavo GV (2003). Pectinase. In Enzyme Technology. Asiatech Publisher Inc. Delhi., pp. 273-296. Yadav S, Shastri NV (2005). Partial purification and characterization of a pectin lyase produced by Penicillium oxalicum in solid-state fermentation (SSF). Indian J. Biotechnol. 4: 501-505.

Full Length Research Paper

Changes in photosynthesis and activities of enzymes involved in carbon metabolism during exposure to low light in cucumber (Cucumis sativus) seedlings Guoquan Mi1, Liying Liu2, Zhenxian Zhang2 and Huazhong Ren2* 1

Horticulture Institute, Henan Academy of Agricultural Sciences, Zhengzhou, China. College of Agriculture and Biotechnology, China Agricultural University, Beijing, China.

Accepted 9 March, 2012

Two cucumber genotypes, S404 and S1 with low light-sensitivity and low light-tolerance, respectively were used to investigate the oxygen consumption rate of photosystem I, the oxygen evolution rate of photosystem II, cab transcript levels, and activities of enzymes involved in photosynthetic carbon reduction cycle. The results show that short term (24 h) / long term (five and 10 days) low light stress had significant effect on PSII activities while PSI’s effect was not significant. Under the low light stress, S1 cab gene transcript levels were quickly recovered while S404 cab gene transcript levels were slowly recovered. The total dry mass and leaf area of S1 was lower than S404. Low light treatment decreased C3 photosynthetic carbon cycle enzyme activities involved in ribulose-1,5-bisphosphate carboxylase oxygenase (rubisco) carboxylation and fructose-1,6-bisphosphatase (FBPase), and increased C4 photosynthetic carbon cycle enzyme activities involved in nicotinamide adenine dinucleotide phosphate malate dehydrogenase (NADP-MDH). The NADP-MDH activity in S1 leaves increased significantly compared to S404. These observations suggest that S1 photosynthetic capacity is higher than S404 under low light conditions. Photosynthetic C4-microcycle possibly would have played a role in low light stress. Therefore, the transcript levels of cab and the involvement of NADP-MDH in low light-resistance need further research. Key words: Low light, oxygen consumption rate, oxygen evolution rate, cab gene, NADP-MDH.

INTRODUCTION Photosynthesis is a process that converts light energy to oxygen and carbohydrates. In photosynthesis, a series of redox reactions occur in the electron transport system present in the chloroplast thylakoid membranes. Oxidation of water is catalyzed by photosystem II (PSII), a multi-subunit pigment protein complex located in the thylakoid membrane (Hillier and Babcock, 2001). Low light tolerance is a hereditary trait, where the plant viability under low light conditions corresponds with its ability to achieve high photosynthetic rates (Dymova and

*Corresponding author. E-mail: renhuazhong@cau.edu.cn. Tel: +86-10-6273 1009, Fax: +86-10-6273 2825.

Golovko, 1998). Under low light conditions, plants must absorb and capture as much light energy to fix carbon dioxide and accumulate carbohydrates. The growth and development of plants are directly related to its light harvesting ability. The light-harvesting chlorophyll a/b pigment-protein (cab gene encoding) complexes of PSII (LHCII), which occupies approximately 50% of thylakoid chlorophyll, are the most abundant pigment proteins in the photosynthetic membrane. The primary function of LHCII is to harvest light energy and deliver it to the PSII reaction centre (Van Grondelle et al., 1994). Net photosynthetic rate descends with decreasing light intensity. Furthermore, the decreasing level of photosynthetic rate is correlated with tolerance to low light. Under low light conditions, plants having high tolerance

8538

Afr. J. Biotechnol.

to low light, maintain correspondingly high photosynthetic rate (Ody, 1997; Dymova and Golovko, 1998). Cucumber (Cucumis sativus) is a classical C3 plant. Under normal conditions, cucumber follows CalvinBenson cycle to process carbon assimilation. However, similar partitioning is not absolute for different carbon metabolism types (C3, C4, and Crassulacean acid metabolism (CAM)). The pathways involved in the photosynthetic carbon metabolism have adapted to the ecological environment in the course of evolution of plants (Wang and Zhang, 2000). Previous studies have indicated that the activities of photosynthetic carbon cycle enzymes involved in C4 or CAM metabolism enhanced at various degrees in the C3 plants, such as spinach, bean (low temperature stress, Holaday et al., 1992), wheatgrass (salt stress, Cushman, 1993), pigeon pea (cadimium and nickel, Sheoran et al., 1990), Casuarina equisetifolia (drought stress, Sánchez-Rodriguez et al., 1997), and pea (CO2-free air, Harbinson and Foyer, 1991). Li et al. (2001) indicated that the cultivars, which had high enzyme activities involved in C4 or CAM metabolism were selected and bred in order to improve the photosynthetic rate in C3 plants. Therefore, in this study we attempted to detect key enzymes (C3: ribulose1,5-bisphosphate carboxylase oxygenase (rubisco) and fructose-1,6-bisphosphatase (FBPase), C4: nicotinamide adenine dinucleotide phosphate malate dehydrogenase (NADP-MDH)) involved in low light stress, and investigate the differences in the photosynthetic carbon metabolism in two genotypes of cucumbers having low light sensitive and tolerant cultivars to study the role of C4 photosynthesis under low light conditions. MATERIALS AND METHODS Plants growth and stress treatment Cucumber (C. sativus L.cv. S1 and S404) seeds were germinated and grown in controlled growth chamber on substrate containing 50% turf and 50% vermiculite in day/light temperature at 25/18°C, relative humidity at 50/60%, with day/night regime of 10/14 h and a photon flux density at 800 μmol m-2 s-1. The nutrient solution (VinitDunand et al., 2002) containing 2.5 mM Ca(NO3)2·4H2O, 1.0 mM NH4NO3, 0.5 mM KH2PO4, 0.5 mM MgSO4·7H2O, 2.5 mM KCl, 0.064 mM NaFeEDTA, 0.025 mM H3 BO3, 10.0 mM MnCl2 ·4H2O, 1.5 mM ZnCl2, 0.5 mM CuCl2·2H2O, 0.2 mM Na2 MoO4, pH 5.2, was supplemented every four days. Stress treatments were carried out after the emergence of three primary leaves. 100 μmol photons m -2 s-1 was provided by a reflection-type sodium lamp (E40, Mengkaixia Company，China), at the same time, controls were treated under 800 μmol photons m-2 s-1.

low light illumination, and prepared for thylakoid membrane isolation and total RNA extraction.

Long term low light stress Mature adult leaves were sampled after 0, five, 10, 15 and 20 days exposure to either 100 μmol m-2 s-1 photon flux density (PFD) or 800 μmol photons m-2 s-1. The leaf samples were used for the isolation of thylakoid membrane and measurement of dry weight, leaf area, and activities of enzymes involved in the photosynthetic carbon cycle.

Isolation of thylakoid membranes and determination of chlorophyll concentration Thylakoid membranes were isolated under dark or green light conditions following a modified method adapted from Yang et al. (2004). Briefly, 10 g of leaf samples were homogenized in 15 ml of grinding buffer (0.4 mM sucrose, 2 mM EDTA, 20 mM Tris–HCl and pH 7.8) in a chilled kitchen blender under 4°C. Homogenate was filtered through two layers of Miracloth and the dark green filtrate was centrifuged at 3000 rpm for 5 min under 4°C. The supernatant solution was discarded, and the dark green pellet was homogenized in grinding buffer and centrifuged at 3000 rpm for 5 min. The resulting pellet was suspended in suspending buffer (20 mM Tris–HCl, 5 mM MgCl2·6H2 O, 15 mM NaCl, pH 7.8) and incubated on ice in dark for 5 min followed by centrifugation at 3000 rpm for 5 min. The pellet obtained was homogenized in preserving buffer (20 mM NaCl, 2 mM 2-(N-morpholino)ethanesulfonic acid (MES), 0.4 M sucrose and pH 6.5). Thylakoid membrane aliquots were frozen in liquid nitrogen, and stored at -80°C for further analysis. Chlorophyll concentrations in the thylakoid membrane preparations were measured in 80% acetone based on the method described by Arnon (1994). Measurement of PSI oxygen consumption rates The oxygen consumption rates of PSI were measured at 25°C using oxygen electrode unit (Hansatech light source power supply Oxy-Lab). The assays were conducted in 800 μmol photons m -2 s-1 light at 25°C, and in 1 ml of reaction solution containing reaction buffer (50 mM Tricine-NaOH pH 7.5, 0.4 M Sucrose, 10 mM NaCl, 5 mM MgCl2), freshly added reagents (1 mM NaN3, 0.5 mM MV, 10 μM DCMU, 1 mM ascorbic acid, and 200 μM DCPIP), and thylakoid membranes (20 μg chlorophyll ml-1).

Measurement of PSII oxygen evolution rates The oxygen evolution rates of PSII were measured at 25°C using oxygen electrode unit (Hansatech light source power supply OxyLab). The assays were conducted in 800 μmol photons m -2 s-1 light at 25°C, and in 1ml of reaction solution containing reaction buffer (50 mM MES-NaOH pH 6.5, 0.4 M Sucrose, 50 mM CaCl2), freshly added reagents (0.2 mM 2,6 dichlorobenzoquinone (DCBQ)), and thylakoid membranes (30 μg chlorophyll ml-1).

Short term low light stress Preparation of cab probes After treatment for 4 h under 800 μmol photons m -2 s-1, the seedlings were subjected to low light treatment (100 μmol photons m-2 s-1). Mature leaves (the third leaf under growing point) were excised at 0, 8, 16 and 24 h after the seedlings were exposed to

Total RNA was extracted from 200 mg fresh cucumber leaves using Trizol reagent (Gibco, BRL, USA) followed by synthesis of singlestrand cDNA using Reverse Transcription System Kit (TIANGEN,

Mi et al.

Beijing, China). Single-strand cDNA was subjected to PCR amplification. Primers were designed using published consensus sequence of cucumber cab: 5’ GAGAGTTCCCTGGTGACTACGGTTG 3’ as the forward primer and 5’AACCTTCAACTCAGCGAATGCCTCT 3’ as the reverse primer. The PCR mixture (50 l) contained 1 μl template cDNA, 0.2 mM of each dNTP, 1 mM MgSO4, 10 μM of each primer and 1 unit of KOD Plus (TOYOBO, Japan). After predenaturing at 94°C for 2 min, PCR amplification was accomplished in 30 cycles at the following temperatures: denaturing at 94°C for 15 s, annealing at 60°C for 30 s and 30 s at 68°C for elongation. At last elongating at 68°C for 10 min. PCR products were cloned into pGEM®-T Easy vector (Promega, USA) and were sequenced.

Northern blot analysis Total RNA for each treatment was extracted from 5 g frozen leaves of the samples using the hot phenol method (Kay et al., 1987). Isolated leaf RNA from low light stressed at different time points was used for RNA gel blot analysis. For Northern blot analysis, total RNA (25 g) was denatured with 50% formamide and 6.3% formaldehyde and separated on denaturing agarose gels (Sambrook et al., 1989). The RNA was transferred onto Hybond-N+ nylon membrane (Millipore Corporation, USA) and fixed by baking at 80°C (2 h). The cab probes were purified from PCR-amplified fragments of selected clones and labeled with [ 32P] dCTP using Amersham RediprimeTM II Random Prime Labelling Kit (GE Healthcare, USA) according to the manufacturer’s protocol. The membrane (ImmobilonTM-Ny+manual, Millipore, USA) was hybridized with the probe in hybridization buffer (7% SDS, 500 mM sodium-phosphate, pH7.2, 1 mM EDTA, pH 8.0) for 24 h at 65°C. Membranes were then washed four times with 2×SSC and 0.1% (w/v) SDS at room temperature for 15 min, followed by two washes in 0.2× SSC and 0.1% (w/v) SDS at 65°C for 15 min. For detection of the radioactive signals, the filters were exposed to a Fuji medical X-ray film (Fujifilm, Japan). Molecular dynamics scanner was used to detect and quantify signal.

Growth analysis The seedlings were harvested at 0, five, 10, 15 and 20 days after treatment. In all cases, the seedlings were divided into shoots and roots. Immediately after sampling the roots were carefully washed in three successive baths and dried in an oven at 60°C for 48 h and weighed. The leaf area was measured using an automatic leaf area meter (Li-3000, Li-cor, USA).

Enzyme assays NADP-MDH, FBPase, rubisco activities were measured in leaf disc extracts in which metabolism had been stopped by freezing and stored in liquid nitrogen. The leaves were pulverized in liquid nitrogen and the leaf powder was resuspended either in 0.1 M Tricine-KOH buffer (pH 8.0) containing 1 mM dithiothreitol (DTT), 10 mM MgCl2, 1 mM EDTA, and 1% Triton X-100 (v:v) in the NADPMDH and FBPase extraction buffer described by Harbinson and Foyer (1991). For rubisco assays extraction buffer was 100 mM Bicine-NaOH (pH 7.8) containing 10 mM MgCl2, 10 mM βthioethylene glycol, 2% PVP (w:v), 1% BSA (w:v) and 1% Triton X100 (v:v). An aliquot of the whole extract was taken to determine chlorophyll contents (Arnon, 1994). NADP-MDH and FBPase were measured as described by Harbinson and Foyer (1991). The assay for rubisco was adapted from that of Wang (2006).

8539

Statistical analysis All the dates were statistically analyzed by Excel and SPSS software. All treatments are carried with three entire plants and repeated three times.

RESULTS Growth analysis Total dry mass and leaf area of the two cucumber genotypes under control and low light stress conditions were measured and shown in Figures 1A and B, respectively. The S1 total dry mass decreased at 30.2, 32.7, 44.8 and 57.5%, respectively, in low light stress during five, 10, 15, and 20 days compared to the control and for S404 total dry mass decreased at 34.7, 60.8, 67.7 and 71.3%, respectively, compared to the control. This indicated that the effect of low light on total dry mass in S1 was significantly lower than that of S404. The leaf area of S1 was noticeably larger in contrast to S404 in response to low light (Figure 1B). During low light treatment for 15 days, S1 leaf area remained unaffected in comparison to control, and however, after 20 days, it declined to only 34.2%. However, the reduction in the leaf area of S404 was continuous compared to control during the whole low light treatment. PSI oxygen consumption rate and PSII oxygen evolution rate The PSII oxygen evolution rates (Figures 2C and D) was significantly higher than the PSI oxygen consumption rates (Figures 2A and B) under either short- or long-term light-stress condition. However, no change in PSI oxygen consumption rates was detected during the short-term stress period (Figure 2A). Therefore, it could be concluded that the 24 h exposure to low light in our experiment had no substantial effects on the rates of PSI oxygen consumption. The periodic trend of PSII oxygen evolution was similar in S1 and S404 during short-term stress (Figure 2C). The oxygen evolution rates ascended and reached maximal values, up to about 174.6% (S1) and 106.7% (S404) in 8 h in contrast to their respective rates under low light stress, after which the rates declined to their minimal values by 16 h, and subsequently rose after 24 h. Nevertheless, the whole trend of oxygen evolution rates in S1 and S404 decreased upon prolonged duration of low light-stress. The decline in the levels of S404 was markedly higher compared to S1. The PSII oxygen evolution rates of S1 and S404 dropped to 29.4 and 67.6%, respectively compared to the control during the fifth day after long-term low light stress (Figure 2D). On the tenth day of low light stress, S1 decreased to 7.9% compared to the control, while S404 increased by 6.1%. With prolonged low light stress, PSII

8540

Afr. J. Biotechnol.

Total dry mass (g)

S1-CK

S1-LL

S404-CK

S404-LL

3 2 1

Leaf area (cm2 plant-1)

1200 0 1000 800 600 400 200 0 0

Treatment time (days) Figure 1. Influence of control (CK) and low light (LL) on total dry mass and leaf area in cucumber seedlings. Values are meanÂąS.E. of six replicates.

oxygen evolution rates in S404 increased significantly compared to S1.

However, S404 still did not recover to reach its respective levels.

Effect of low light on the transcript levels of cab gene

Effect of low light on the enzymes activities of carbon metabolism

Polymerase chain reaction analysis indicated that the target product had single band with 422 bp (Figure 3). The influence of low light stress on cab gene is shown in Figure 4. The expression of cab to low light stress was similar both in S1 and S404. In S1 the transcript levels sharply declined during 8 h of low light stress, and then increased gradually to its highest levels by 24 h period.

Under low light stress conditions, reduction in the rubisco carboxylase activities was observed (Figure 5A). With prolonged stress, rubisco carboxylase activities declined to 10.4 to 19.8% in S1 leaves in comparison to the control. However, those of S404 leaves dropped to 30.6 to 47.2% compared to control. This showed that the S1

Mi et al.

8541

PSI oxygen consumption rates (Îźmol O2 mg-1 Chl h-1)

1400 1200

1000 800 600 400 200

PSII oxygen evolution rates (Îźmol O2 mg-1 Chl h-1)

14000

1200

1000 800 600 400 200 0 S1

S404

S1- CK

S1- LL

S404- CK

S404- LL

Figure 2. Effect of low light on PSI oxygen consumption rates (A and B) and PSII oxygen evolution rates (C and D) of cucumber seedlings during short- and long-term low light stress. The cut lines of A and C indicate hours, those of B and D indicate days.

M 1 2000 750 422 200

Figure 3. Agarose gel electrophoresis for the cloning of cab gene from cucumber leaves. M, DL2000 DNA marker. 1, cab fragment.

leaves maintained higher rubisco carboxylase activities than S404 under low light stress. Furthermore the biosynthesis of photosynthetic products were decreased and restricted in the S404 leaves. Under low light stress, the variation in the FBPase activities were similar in both S1 and S404 leaves (Figure 5B). During the fifth day of stress treatment, the FBPase activities of S1 and S404 declined to 1.65 and 12.2%, respectively, in relation to the control. During the tenth day of stress, FBPase activities of S1 and S404 increased by 23.3 and 11.7%, respectively compared to the control. The influence of low light stress on NADP-MDH activities of S1 and S404 leaves are shown in Figure 5C. During five, 10, 15, and 20 days under low light conditions, NADP-MDH activities of S1 leaves increased to 58.2, 45.3, 16.0 and 36.5%, respectively, compared to the

8542

Afr. J. Biotechnol.

Figure 4. Northern blot using a cab-specific probe confirming the translate levels of S1 and S404 under short-term low light stress.

control. Whereas S404 leaves increased only by 1.77, 15.3 and 16.5%, respectively, on 10, 15 and 20 days after low light stress when compared to the control. These observations indicated that both genotypes of cucumbers had C4-microcycle in their photosynthetic carbon cycle. The C4-microcycle had higher contribution rate to improve the S1 photosynthetic efficiency than S404 under low light stress. DISCUSSION It is well known that photosynthesis is one of the major factors affecting plant growth. Low light stress decreases the rate of photosynthesis in plants. In our study, the total dry mass and leaf area in the low-light sensitive line S1 decreased compared to the low light tolerant line S404. Adaptation to the low-light state occurs through loss of excitonic interaction between antennae of PSI and their reaction-centers. The fluorescence yield remains virtually constant during adaptation to the low-light state, suggesting the possibility of cyclic electron flow around PSII in this state. These showed that these antennae complexes participate directly in the adaptation to low light intensities (Canaani and Malkin, 1984). The substantial changes in the stroma lamellae/grana ratios in chloroplasts receiving low light, possibly as a mechanism for re-establishing optimal PSI/PSII ratios (Mazzuca et al., 2009). In this study, the effect of low light on PSII oxygen evolution was higher than the PSI oxygen consumption. PSII oxygen evolution increased markedly during 8 h of low light and subsequently decreased at 16 h, and then, its activity was reactivated in 24 h. PSII oxygen evolution rate at different time points (hours) in low light-tolerant line S1 was higher than that of low lightsensitive line S404. This indicated that chloroplast photochemical activity in S1 leaves was higher when compared to S404 leaves. In this study, both PSI oxygen consumption rate and PSII oxygen evolution rate were affected during long-term low light stress. By comparison, low light had pronounced

effect on PSII than PSI. After five days under low light, both rates decreased in not only S1 but also in the S404 leaves, and after which the rates in S404 declined compared to S1. This indicates that both photosynthetic reducing capacity (Jordan et al., 2001; Scheller et al., 2001) and photosynthetic driving capacity (Oxborough, 2004) in S404 leaves were inferior than that of S1. After 10 days, PSI oxygen consumption rate in leaves increased and the PSII oxygen consumption rate in S1 reduced in comparison to control. Contrasting results were observed in the S404 leaves. These observations implied that the photosynthetic reducing capacity in S1 leaves was reinforced, and more reactive oxygen species (ROS) were eliminated by any possibility. On the contrary, more ROS were generated in S404 leaves. If not promptly eliminated, they would cause damages to the chloroplast membrane. As a whole, both PSI and PSII activities were increased in S1 or S404 based on stress duration. This showed both cucumbers varieties were acclimating to low light stress conditions.In order to investigate the complexities involved in the PSII oxygen evolution during short-term low-light stress, the cab gene transcript levels were determined under low light conditions. The results show that the cab gene expression had a correlation with PSII oxygen evolution rates under low light. The cab transcript levels dropped significantly after 8 h under low light, while PSII oxygen evolution rates declined to minimum after 16 h. Later the levels gradually increased at 16 and 24 h. The effect of low light on cab transcript levels must be attributed to the LHCII. This hysteresis phenomenon displayed the relationship of LHCII and PSII reaction center by directly affecting the PSII activities. Since, cab transcript levels in S1 leaves were significantly higher than those of S404, the ability of capturing and utilizing low light in S1 leaves was stronger than that of S404. As a result, the inclusion of cab transcript level as an evaluation index of low light-resistance should be resolved after further analysis. Calvin cycle is also known as photosynthetic carbon cycle. Apart from supplying the energy for CO2

Mi et al.

700

A Rubisco (μmol h-1 mg-1 Chl)

600 500 400 300 200 100

S1-CK

S1-LL

S404-CK

S404-LL

0 2.4

(mg Pi h mg Chl)

-1

2.0 1.8

-1

FBPase

2.2

1.6 1.4 1.2 1.0 15

NADP-MDH (μmol h-1 mg-1 Chl)

14 13 12 11 10 9 8 7 6 5

Treatment time (days) Figure 5. Effect of low light on the enzymes activities of carbon metabolism in cucumber seedlings leaves. (A) rubisco carboxylase activities, (B) FBPase activities, (C) NADP-MDH activities. Values are mean±SE (n=3).

assimilation, light also regulated the activities of photosynthetic enzymes. Rubisco and FBPase are two

8543

key light regulatory enzymes in the photosynthetic carbon reduction cycle. Under the normal light intensity and temperature condition, high electron flow rate is propitious to the regeneration of ribulose-1,5-bisphosphate (RuBP), and could improve the activities of NADP-MDH and FBPase, followed by enhanced photosynthetic rate (Harbinson et al., 1990). Rubisco, stromal FBPase and NADP-MDH activities depends on the reducing ability of the electron transport machinery (Holaday et al., 1992). Low light induces the decrease in the net photosynthetic rate, and increase in the intercellular CO 2 concentration. The principal factor that caused the decline of photosynthesis under the low light is the nonstomatal restriction (Li et al., 2008; Krall and Edward, 1991; Allen and Ort, 2001). In this experiment, Rubisco carboxylation activity in the leaves of two cucumber genotypes decreased under the low light. This showed that low light strengthened the restriction of carboxylation. The regeneration capacity of RuBP could reflect the state of the photosynthetic electron transport and photophosphorylation since the regeneration of RuBP depended on the production of ATP and NADPH which came from photosynthetic electron transport and photophosphorylation (Shen et al., 1998). Under low light conditions, photosynthetic carbon assimilation in different varieties had various restriction factors (Sui, 2006). In S1, the non-stomatal restriction and the decrease in RuBP regeneration rate were affected, while in S404, the decline of rubisco carboxylation activity or rubisco content could be affected. The effect of low light stress on FBPase activity was intricate on the 5th day of low light treatment, the activity of FBPase decreased in the leaves of two cucumber lines, subsequently it increased by the th 10 day. This was likely due to an immediate response for maintaining carbon metabolism balance in the plant. Then the FBPase levels gradually dropped again. In general, low light stress induced the decrease of FBPase activity. In the photosynthetic carbon cycle, the influence of low light on activities of rubisco carboxylation and FBPase indicated that low light stress decreases C3 photosynthetic carbon assimilation. During long-term stress, it is still debatable if the C3 plants had C4 photosynthetic pathway. Scheibe et al. (1990) showed that NADP-MDH catalyzed the conversion of oxalic acid (OAA) into malic acid (MA), which exists comprehensively in the nature. Therefore was considered that NADP-MDH in C3 carbon metabolism had similar role compared to the C4 metabolism. In recent years, it was reported that angiosperms such as Hydrilla verticilata (Magnin et al., 1997) and Egeria densa (Casati et al., 2000) did not posses Kranz structure, but exhibited C4 photosynthetic metabolism. Therefore it is possible that individual photosynthetic cells in leaves could process a C4-microcycle. Similarly, C4 photosynthetic enzyme system had been found in the leaves of C3 crops such as soybean (Li et al., 2001), wheat (Hata and Matsuoka, 1987) and rice (Wang et al., 2002). As a result of low

8544

Afr. J. Biotechnol.

enzyme activity it was presumed that limited C4 photosynthetic approach may exist in C3 plants. Chen and Ye (2001) showed that OAA or MA, which was produced by the photosynthetic machinery, could improve the photosynthetic capacity in the leaves of spinach, a C3 plant. This validates that the leaf cells of C3 plant could have a turnover of C4 microcycle. In order to prove the presence of C4 microcycle and its physiological function, Li et al. (2001) fed low concentrations OAA or MA, which boosted the photosynthetic activity in wild rice. In this study, the NADP-MDH activities in two cucumber leaves, gradually increased with plant growth and development. However, NADP-MDH activities were enhanced under low light stress in comparison with the control. This indicated that low light stimulated C4 photosynthetic carbon assimilation microcycle. Although the increase was not significant, the observation could not be neglected under low light condition. Further studies are required to determine the role low light-tolerance to C4 photosynthetic dominance and NADP-MDH activity to be used as evaluation indices. Low light tolerance of cucumber is a complicated phenomenon which needs further experimental validation to identify new evaluation index.

ACKNOWLEDGEMENTS This work was supported by National Basic Research Program of China (2009CB119000) , Research Projects for the Areas of Public Interest (Agriculture, 201203003) , National Key Research Program of China 2011BAD12B03) and The Program of Innovative Team for Fruit vegetable productive technology of Beijing.

REFERENCES Allen DJ, Ort DR (2001). Impact of chilling temperatures on photosynthesis in warm climate plants. Trends Plant Sci. 6: 36-42. Arnon DI (1994). Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 24: 1-10. Canaani O, Malkin S (1984). Physiological adaptation to a newly observed low light intensity state in intact leaves, resulting in extreme imbalance in excitation energy distribution between the two photosystems. Biochimica et Biophysica Acta (BBA)-Bioenergetics, 766(3): 525-532. Casati P, Lara M, Andreo C (2000). Induction of a C4-like mechanism of CO2 fixation in Egeria densa, a submerged aquatic species. Plant Physiol. 123: 1611-1622. Chen GY, Ye JY (2001). Effects of oxaloacetate and malate on photosynthesis in leaves and in intact chloroplasts from spinach. Acta Phytophysiologica Sinica, 27(6): 478-482. Cushman JC (1993). Molecular cloning and expression of chloroplast NADP-malate dehydrogenase during Crassulacean acid metabolism induction by salt stress. Photosynth. Res. 35: 15-27. Dymova OV, Golovko TK (1998). Light adaptation of photosynthetic apparatus in Ajuga reptans L. a shade-tolerant plant as an example. Russ. J. Plant Physiol. 45: 440-446. Harbinson J, Foyer CH (1991). Relationships between the efficiencies of photosystems I and II and stromal redox state in CO2-free air.

Evidence for cyclic electron flow in vivo. Plant Physiol. 97: 41-49. Harbinson J, Genty B, Baker NR (1990). The relationship between CO2 assimilation and electron transport in leaves. Photosynth. Res. 25: 213-224. Hata S, Matsuoka M (1987). Immunological studies on pyruvate orthophosphate dikinase in C3 plants. Plant Cell Physiol. 28: 635641. Hillier W, Babcock GT (2001). Photosynthetic reaction centers. Plant Physiol. 125: 33-37. Holaday AS, Martindale W, Alred R, Brooks AL, Leegood RC (1992). Changes in activities of enzymes of carbon metabolism in leaves during exposure of plants to low temperature. Plant Physiol. 98: 1105-1114. Jordan P, Fromme P, Witt HT (2001). Three-dimensional structure of cyanobacterial photosystem I at 2.5 angstrom resolution. Nature, 411: 909-917. Kay R, Chan A, Daly M, Mcpherson J (1987). Duplication of CaMV 35S promoter sequences creats a strong enhancer for plant genes. Science, 236: 1299-1302. Krall JP, Edward GE (1991). Environmental effects on the relationship between the quantum yield of carbon assimilation and in vivo electron transport in maize. Aust. J. Plant Physiol. 18: 267-278. Li W, Sui XL, Wang SH, Guan QZ, Hu LP, Zhou M, Meng FZ, Zhang ZX (2008). Effects of low light on photosynthetic characteristics of different position leaves of cucumber seedlings. Sci. Agricult. Sinica 41: 3698-3707. Li WH, Lu QT, Hao NB, Ge QY, Zhang QD, Du WG, Kuang TY (2001). C4 Pathway Enzymes in Soybean Leaves. Acta Botanica Sinica, 43: 805-808. Magnin NC, Cooley BA, Reiskind JB, Bowes G (1997). Regulation and localization of key enzymes during the induction of Kranz-less，C4 photosynthesis in Hydrilla verticilata. Plant Physiol. 115: 1681-1689. Mazzuca S, Spadafora A, Filadoro D, Vannini C, Marsoni M, Cozza R, Bracale M, Pangaro T, Innocenti AM (2009). Seagrass light acclimation: 2-DE protein analysis in Posidonia leaves grown in chronic low light conditions. J. Exp. Mar. Bio. Eco. 374 : 113-122. Ody Y (1997). Effects of light intensity, CO2 concentration and leaf temperature on gas exchange of strawbery plants: feasibility studies on CO2 enrichment in Japanese conditions. ISHS Acta Horticultrae, 439: III International Strawberry Symposium pp. 563-573. Oxborough K (2004). Imaging of chlorophyll a fluorescence: Theoretical and practical aspects of an emerging technique for the monitoring of photosynthetic performance. J. Exp. Bot. 55: 1195-1205. Sambrook J, Fritsch EF, Maniatis T (1989). Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbour Laboratory Press, Cold Spring Harbour. Sánchez-Rodriguez J, Martínez-Carrasco R, Pérez P (1997). Photosynthetic electron transport and carbon-reduction-cycle enzyme activities under long-term drought stress in Casuarina equisetifolia Forst. & Forst. Photosynth. Res. 52: 255-262. Scheibe R, Reckmann U, Hedrich R, Raschke K (1990). Malate dehydrogenases in guard cells of Pisum sativum. Plant Physiol. 93: 1358-1364. Scheller HV, Jensen PE, Haldrup A (2001). Role of subunits in eukaryotic photosystem I. Biochim Biophys Acta 1507: 41-60. Shen YG, Shi JN, Xu DQ (1998). Dynamic photosynthesis. Beijing: Science press. Sheoran IS, Singal HR, Singh R (1990). Effect of cadmium and nickel on photosynthesis and the enzymes of the photosynthetic carbon reduction cycle in pigeonpea (Cajanus cajan L.). Photosynth. Res. 23: 345-351. Sui XL (2006). Studies on mechanism of resistance to low light in pepper (Capsicum annuum L.). China Agricultural University Ph.D. Dissertation. van Grondelle R, Dekker JP, Gillbro T, Sundström V (1994). Energy transfer and trapping in photosynthesis. Biochim. Biophys. Acta, 1187: 1-65. Vinit-Dunand F, Epron D, Alaoui-Sossé B, Badot PM (2002). Effects of copper on growth and on photosynthesis of mature and expanding leaves in cucumber plants. Plant Sci. 163: 53-58. Wang Q, Lu CM, Zhang QD, Hao XB, Ge QY, Dong FQ, Bai KZ, Kuang

Mi et al.

TY (2002). Photosynthesis, photoinhibition and enzyme characteristic of C4 pathway on super high yield hybrid rice â&#x20AC;&#x2DC;Liang youpeijiuâ&#x20AC;&#x2122;. Science in China (Series C) 32: 481-487. Wang XQ (2006). Experiments principle and technology on plant physiology and biochemistry (2nd edition). Beijing: Higher Education Press. Wang XY, Zhang FM (2000). Influence of poor light on the distribution pattern of assimilate of cucumber in solar greenhouse. J. Chin. Agric. Univ. 5: 36-41.

8545

Yang W, Liu S, Feng FY, Hou HT, Jiang GZ, Xu YN, Kuang TY (2004). Effects of phosphate deficiency on the lipid composition in cucumber thylakoid membranes and PSII particles. Plant Sci. 166: 1575-1579.

Full Length Research Paper

Optimization of lactic acid production with immobilized Rhizopus oryzae Muhammet Şaban Tanyıldızı*, Şule Bulut, Veyis Selen and Dursun Özer Department of Chemical Engineering, Faculty of Engineering, Fırat University, 23119 Elazıg, Turkey. Accepted 3 February, 2012

Lactic acid production by Rhizopus oryzae NRRL 395 immobilized in polyurethane foam was investigated by using response surface methodology. A 23 full-factorial central composite design was chosen to explain three independent variables; glucose concentration, pH and agitation rate. The model F-value (17.01) shows that predicted model is suitable for good fitting. Linear and quadratic effects of glucose concentration and quadratic effect of agitation rate were shown to be significant for lactic acid production. Maximum lactic acid production 93.2 g/l was obtained using a glucose concentration of 150 g/l, pH 6.39 and agitation rate 147 rpm. Glucose concentration and agitation rate were found as limiting parameters. So, little variation of these parameters alters production of lactic acid. Initial pH has no effect on lactic acid production due to neutralizing agent. Production of lactic acid from immobilized whole cells which are under optimum conditions was determined about 55% that is higher than production of lactic acid from suspension culture systems. Key words: Lactic acid, Rhizopus oryzae, immobilization, response surface methodology.

INTRODUCTION Lactic acid is the most widely utilized organic acid in the food, pharmaceutical, cosmetics and chemical industries. One of its most promising applications is for used biodegradable and biocompatible polylactate polymers, such as poly-lactic acid (PLA), an environmentally friendly alternative to biodegradable plastics (Datta et al., 1995; Hofvendahl et al., 1999). Physical properties of PLA are strongly influenced by the isomeric composition of lactic acid. Lactic acid occurs in two optical isomers which are D-(-)- and L-(+)-lactic acids naturally. Since elevated levels of the D-isomer are harmful to humans, L(+)-lactic acid is the preferred isomer of food and pharmaceutical industries (Hofvendahl and HahnHagerdal,2000). Microbial production of lactic acid produces either separately or a mixture in different proportions of two isomers depending on the microorganism, substrate and growth conditions used whereas the chemical production only results in a mixture of the two isomers (Tsao et al., 1999). Another significant

*Corresponding author. E-mail: mtanyildizi@firat.edu.tr. Tel:+90 424 2370000; Fax: +90424 2415526.

advantage over the chemical synthesis is that biological production can use cheap raw materials (Huang et al., 2005). Lactic acid production by fungi, such as Rhizopus oryzae has draw attention recently (Zhang et al., 2007). The immobilization of microorganisms has generally been attractive for industrial fermentation to improve the yield of the desired product. In contrast to ordinary suspension culture systems, immobilized whole cells have the merits of: Avoiding wash-out of cells at a high dilution rate, higher cell concentration in the reactor and easy separation of cells from the system or the product containing solution (Frusaki and Seki, 1992). Hence, the cells have been immobilized by means of adsorption on polymer supports, by embedding with natural polymers like alginate gels and synthetic polymers (Tamada et al., 1992). Several researchers have attempted to use immobilization techniques for L(+)-lactic acid production with R. oryzae. The entrapment methods using soft gels such as Ca-alginate have mostly been employed in these studies (Hang et al., 1989). In gel-entrapping methods, the limitation of oxygen supply because of diffusional resistance might decrease the fermentation rate and/or L(+)-lactic acid transformation efficiency (Dong et al.,

Tanyıldızı et al.

1996). The problems, associated with filamentous fungal fermentations can be overcome with cell immobilization on support polymer matrix. In this work, the cells were immobilized by physical entrapment in the open pore network of reticulated polyurethane foam which provides less diffusional resistance to substrate transfers. Spores would enter the loose matrices and grow inside the cubes. Then the mycelia were embraced by the matrices after growing up (Dong et al., 1996). The one factor at a time is the most frequently used operation in optimization process. This technique involves changing one independent variable while keeping the other factors constant. The conventional methods for multifactorial experimental design are timeconsuming and incapable of detecting the true optimum, especially due to the interactions among the factors (Liu and Tzeng, 1998). In contrast, experimental design offers a number of important advantages as the researchers could easily determine effects of factors with considerably less experimental effort, find real optimum value and facilitate system modeling (Bandaru et al., 2006). In the present study, we described optimized fermentation medium and conditions to obtain maximum lactic acid production with immobilized Rhizopus oryzae using response surface methodology (RSM). MATERIALS AND METHODS Microorganism, media and culture conditions A lactic acid producing strain of R. oryzae NRRL 395 was maintained on nutrient agar plates. It was incubated at 30°C for 96 h and then stored at 4°C. After growth and sporulation, 10 ml of distilled water was aseptically added to each agar plates which were then scraped to release the spores. This spore suspension was centrifuged at 4000 rpm for 10 min; the spores were washed and resuspended in 1 ml distilled water. Then, 500 μl spore suspension was used to provide spore inoculum for each of 250 ml shake-flask containing 50 ml of the medium. The flasks were then incubated on a rotary shaker at 30°C and 150 rpm. The fermentation medium contained per liter of distilled water: glucose variable (75 to 175 g), MgSO4.7H2O 0.25 g, KH2PO4 0.65 g, (NH4)2SO4 2 g. To avoid pH decrease due to lactic acid production, 50 g/l of sterile CaCO3 in powder form was added to each flask approximately 24 h after inoculation (Hamamci and Ryu, 1994).

Analytical procedure At the end of fermentation, the fermented materials were centrifuged and supernatants were analyzed for L(+)-lactic acid and residual carbohydrate. Lactic acid was analyzed using high performance liquid chromatography (HPLC) (Cecil Instruments 1100 series, Cambridge, UK) with A Bio-Rad (Torrance, CA) Aminex HPX 87C column and an IR detector at 210 nm. An Hewlett-Packard model 3395 integrator was used to record and analyze the data. The eluant, 4 mM H2 SO4 was used at a flow rate of 0.6 ml/min. Glucose was determined by using Beckman type glucose analyzer. The result of each point was determined as average value from different three flasks.

8547

Polyurethane foam preparation

Foam matrices (15 ppi; pore per inch) were used throughout the work. Prior to use, the support materials submerged in distilled water were autoclaved three times for 15 min at 121°C, the distilled water being replaced each time to remove any chemical that might have otherwise leached out into the culture medium. One foam slab (55 × 20 × 8 mm) was placed in each flask and held stationary by fixing onto a stiff L-shaped stainless steel wire. Each flask was placed in the incubator shaker after sterilization.

Experimental design and statistical analysis RSM is a collection of experimental strategies, mathematical methods, and statistical inference which enable an experimenter to make efficient empirical exploration of the system of interest. According to this design, 20 experiments were conducted containing six replications at the center point. The independent variables selected for the study of production of lactic acid were: glucose concentration, initial pH and agitation rate. Actual variables and their corresponding coded levels are presented in Table 1. The response variable was fitted by a second order model in order to correlate the response variable (Lactic acid concentration) to the independent variables. The model equation is represented as:

Y  0   i xi   ii xi 2   ij xi x j

(1)

Where, Y is the predicted response; βo is the intercept; βi is the linear coefficient; βii is the quadratic coefficient and βij is the interaction coefficient. The statistical analysis of the model was performed in the form of analysis of variance (ANOVA). This analysis included the Fisher’s F-test, correlation coefficient R, determination coefficient R2 which measures the goodness of fit regression model. It also includes the student’s t-value for the estimated coefficients and the associated probabilities p(t) (Dey et al., 2001). Analysis of variance (ANOVA) was performed and threedimensional response surface curves were plotted by Design Expert (version 6.0, Stat-Ease, Inc., Minneapolis, USA) statistical package to study the interaction among components.

RESULTS AND DISCUSSION In the present study, the relationship between four criteria of lactic acid production and three independent variables (glucose concentration, initial pH and agitation rate) were investigated. The optimum values of parameters for maximum lactic acid production were determined using statistical central composite design according to design matrix which is given in Table 1 and 2. For achieving a more realistic model in this method, prior knowledge obtained from previous studies are required. In our previous works, we showed that glucose concentration, initial pH and agitation rate are important factors for lactic acid production by immobilization on polyurethane foam matrices in fermentation medium (Bulut et al., 2004). The results obtained after CCD were analyzed by ANOVA which gave the following regression equation for the level of lactic acid production:

8548

Afr. J. Biotechnol.

Table 1. Experimental range and levels of the independent variables.

Variable

Symbol coded

Glucose (g/l) Initial pH Agitation rate (rpm)

X1 X2 X3

- 83 4.3 65

-1 100 5 100

Range and level 0 +1 125 150 6 7 150 200

+ 167 7.7 235

Table 2. Experimental design used in RSM studies by using three independent variables with six center points showing observed lac tic acid production.

9 10 11 12 13 14

-1.68 1.68 0.00 0.00 0.00 0.00

0.00 0.00 -1.68 1.68 0.00 0.00

0.00 0.00 0.00 0.00 -1.68 1.68

15 16 17 18 19 20

0.00 0.00 0.00 0.00 0.00 0.00

Lactic acid production (g/l) Fractional 23 factorial design

Agita. rate X3 -1.00 -1.00 -1.00 -1.00 1.00 1.00 1.00 1.00

52.5 90 58.75 92 46.25 80 52.5 90

Star points

Initial pH X2 -1.00 -1.00 1.00 1.00 -1.00 -1.00 1.00 1.00

50 86.25 76.25 77.5 52.5 52.5

Central points

1 2 3 4 5 6 7 8

Glucose X1 -1.00 1.00 -1.00 1.00 -1.00 1.00 -1.00 1.00

Run order

87.5 86.25 88.75 85 86.75 87.15

Y = 86.71 +14.86 X1 +1.95 X2 - 1.79 X3 - 5.43 X12 - 2.34 X22 - 10.96 X32 - 0.062 X1 X2 + 0.063 X1 X3 + X2 X3 Where, Y is the response that is lactic acid (g/l) and X1, X2, X3 are coded values of the test variables, glucose (g/l), initial pH, agitation rate (rpm), respectively. The ANOVA of quadratic regression model demonstrates that the model is highly significant, as is evident from the Fisher’s F-test with a very low probability value [(Pmodel>F) =0.01)] (Table 3). The model F-value, determined as 17.01, shows that predicted model is suitable for good fitting. For goodness of fit of the regression equation, the multiple correlation coefficient R and the determination coefficient R2 (93.9 %) are sufficient. Adjusted R2 is a modification of R2 that adjusts for the number of explanatory terms in a model. Unlike R2, the adjusted R2 increases only if the new term improves the model more than what would be expected by chance. The adjusted R2 was 0.88. The coefficient of

(2)

variation (CV) which indicates the degree of precision with which the treatments were compared, was 7.84%. Relatively lower value of CV indicates a better precision and reliability of the experiments carried out. The adequate precision which measures the signal to noise ratio was 12.2 and this ratio was greater than 4 as it indicates an adequate signal. The "Lack of fit F-Value" of 41.55 implies that it is significant, which means that the order of the regression was not secondary (the model may have not included all appropriate functions of independent variables or the experimental region may be too large for the quadratic model used) (Martinez and Pilosof, 2012). However, when a large amount of data was included in the analysis, a model with significant lack of fit could still be used (Box and Drapper, 1987). The high coefficient R2 shows the applicability of the

Tanyıldızı et al.

8549

Table 3. ANOVA for quadratic model.

Source Model Residual (error) Lack of Fit Pure Error Total

SS 5136.94 335.63 327.74 7.89 5472.57

DF 9 10 5 5 19

MS 570.77 33.56 65.55 1.58

F-value 17.01

Prob(p)>F 0.0001

41.55

0.0004

R = 0.9387; CV= 7.84 %; SS, sum of squares; DF, degrees of freedom; MS, mean square; Adj R = 0.8835.

Table 4. The least-squares fit and parameter estimates (significance of regression coefficient).

Model term

Parameter estimate

Standard error

Intercept

86.71

2.36

14.86

1.57

<0.0001

1.95

1.57

0.2424

-1.79

1.57

0.2791

X12

-5.43

1.53

0.0052

X22

-2.34

1.53

0.1560

X32

-10.96

1.53

<0.0001

X1X2

-0.063

2.05

0.9763

X1X3

0.063

2.05

0.9763

X2X3

1.00

2.05

0.6359

regression model between the ranges of variables included. The parameters which have small value of "Prob > F" less than 0.05 indicate that model terms are significant for obtaining higher lactic acid production. According to Table 4, the variables with largest effect were linear term of glucose consentration (X1), squared term of glucose 2 2 concentration (X1 ) and agitation rate (X3 ) on response (Y). These showed that the concentration of glucose has direct relationship with the production of lactic acid. It is well known that glucose is a readily metabolizable carbon source by many organism. Carbon source is a necessary microbial growth and lactic acid production but lactic acid production is known to be limited by product inhibition (Elibol, 2004). The squared term of glucose concentration can act as limiting factor. So, little variations in glucose concentration will alter the production of lactic acid. Although, initial pH is one of the most important factors affecting the fermentation process, the p-value of initial pH given in Table 4 shows that it has no significant effect on the production of lactic acid. In this study, calcium carbonate was used as a neutralizing agent to control the growth pH during fermentation. Therefore, the effect of initial pH on lactic acid production was not found significant. Different agitations seemed to provide different distribution and transportation of air and

P-value

nutrients to the cells. Metabolic products are susceptible to mechanical force, which may disturb the elaborate shape of complex molecule to such a degree that denaturation occurs (Tanyıldızı et al., 2007). Agitation rate has a squared effect on lactic acid production as shown in Table 4. The relationships between independent variables can be better understood by examining the series of the response surface plot and contour plots. Figures 1 to 3 represent the isoresponse contour and surface plots for the optimization of fermentation conditions of lactic acid. The main goal of response surface is to efficiently determine the optimum values of the variables to either maximize or minimize the response. Each contour curve represents an infinite number of combination of two test variables with the other two maintained at their respective zero level. The maximum predicted value is indicated by the surface confined in the smallest ellipse in the contour diagram (Tanyıldızı et al., 2005). The effects of the concentration of glucose and pH on the lactic acid production were shown in Figure 1. High production of lactic acid was observed at higher level of concentration glucose and intermediate level of pH. The interaction effect of agitation rate and glucose concentration on the lactic acid production in Figure 2 indicate that there is no significant effect on the response,

8550

Afr. J. Biotechnol.

Figure 1. Response surface plot showing the effect of glucose concentration, pH and their mutual effect on the production of lactic acid (g/l).

Figure 2. Response surface plot showing the effect of glucose concentration, agitation rate and their mutual effect on the production of lactic acid (g/l).

whereas, the lactic acid production increased with increase in glucose concentration as shown in Figure 1. It was found that maximum lactic acid production was

obtained at the higher levels of glucose concentration as shown in Figures 1 and 2. The 3D plot in Figure 3 and relatively smaller P-value (0.64) shows that the interact-

Tanyıldızı et al.

8551

Figure 3. Response surface plot showing the effect of pH, agitation rate and their mutual effect on the production of lactic acid (g/l).

Figure 4. Lactic acid production in optimized (○) and non-optimized medium (●).

tion between pH and agitation rate is more significant than the others. Elliptical contours are obtained when there is a perfect interaction between the independent variables (Muralidhar, 2001). The effect of pH on lactic acid production can be hindered by calcium carbonate which is used as a neutralizing agent. The optimum values of pH and agitation rate for maximum lactic acid production were observed near the central point.

A numerical method given by Meyers and Montgomery was used to solve the regression equation (Equation 2). The optimal natural values of the test variables are: glucose =150 g/l, pH =6.39, agitation rate=147 rpm. The maximum lactic acid production obtained by using the above optimized concentrations of the variables is 96.56 (g/l). The maximum enzyme activity obtained experimentally was found to be 93.2 (g/l) in Figure 4. This

8552

Afr. J. Biotechnol.

is obviously in close agreement with the model prediction. Conclusion The use of an experimental design where the main point was to reveal the influence of variables on lactic acid production allowed rapid screening of large experimental domain in search of the optimum glucose concentration and fermentation conditions for maximum lactic acid production. In this study, lactic acid production with R. oryzae by using RSM with CCD was successfully immobilized on polyurethane matrix. In our previous study, maximum lactic acid production was found to be 60 (g/l) by using suspension culture systems. Lactic acid production from R. oryzae which was immobilized on polyurethane foam matrix by using RSM with central composite design was found about 55% higher than lactic acid production obtained in the medium where free cells are used (Figure 4) (Bulut et al., 2004). REFERENCES Bandaru VVR, Somalanka SR, Mendu DR, Madicherla NR, Chityala A (2006). Optimization of fermentation conditions for the production of ethanol from sago starch by co-immobilized amyloglucosidase and cells of Zymomonas mobilis using response surface methodology. Enzyme Microb. Tech. 38: 209-214. Box GEP, Drapper NR (1987). Empirical model-building and response surfaces. Wiley, New York. Bulut Ş, Elibol M, Özer D (2004). Effect of different carbon sources on L(+) –lactic acid production by Rhizopus oryzae. Biochem. Eng. J. 21: 33-37. Datta R, Tsai SP, Bonsignore P, Moon SH, Frank JR (1995). Technological and economic potential of poly (lactic acid) and lactic acid derivatives. FEMS Microbiol. 16: 221-231. Dey G, Mitra A, Banerjee MBR (2001). Enhanced production of amylase by optimization of nutritional constituents using response surface methodology. Biochem. Eng. J. 7: 227-31. Dong XY, Bai S, Sun Y (1996). Production of L(+)-lactic acid with Rhizopus oryzae immobilized in polyurethane foam cubes. Biotechnol. Lett. 18: 225-228. Elibol M (2004). Optimization of medium composition for actinorhodin production by Streptomyces coelicolor A3(2) with response surface methodology. Process. Biochem. 39: 1-7. Frusaki S, Seki M (1992). Use and engineering aspect of immobilized cells in biotechnology. Adv. Biochem. Eng. Biotechol. 23: 161-85.

Hamamci H, Ryu DY (1994). Production of L(+)-lactic acid using immobilized Rhizopus oryzae reactor performance based on kinetic model and simulation. Appl. Biochem. Biotechnol. 44: 125-133. Hang YD, Hamamci H, Woodams EE (1989). Production of L(+)-lactic acid by Rhizopus oryzae immobilized in calcium alginate gels. Biotechnol. Lett. 11(2): 119-120. Hofvendahl C, Akerberg C, Zacchi G (1999). Simultaneous enzymatic wheat starch saccharification and fermentation to lactic acid by Lactococcus lactis. Appl. Microbiol. Biotechnol. 52: 163-169. Hofvendahl K, Hahn-Hägerdal B (2000). Factors affecting the fermentative lactic acid production from renewable resources Enzyme Microb. Technol. 26: 87-107. Huang LP, Jin B, Lant P, Jiti Z (2005). Simultaneous saccharification and fermentation of potato starch wastewater to lactic acid by Rhizopus oryzae and Rhizopus arrhizus. Biochem. Eng. J. 23: 265276. Liu BL,Tzeng YM (1998). Optimization of growth medium for production of spores from Bacillus thuringiensis using response surface methodology. Bioprocess Eng. 18: 413-418. Martínez KD , Pilosof AMR (2012). Relative viscoelasticity of soy protein hydrolysate and polysaccharides mixtures at cooling conditions analyzed by response surface methodology. Food Hydrocolloids, 26: 318-322. Muralidhar RV, Chirumamila RR, Marchant R, Nigam P (2001). A response surface approach for the comparison of lipase production by Candida cylindracea using to different carbon sources. Biochem. Eng. J. 9: 17-23. Tamada M, Begum AA, Sadi S (1992). Production of L(+)-lactic acid by immobilized cells of Rhizopus oryzae with polymer supports prepared by -ray induced polymerization. J. Ferment. Bioeng. 74: 379-383. Tanyıldızı MŞ, Özer D, Elibol M (2005). -amylase production by Bacillus sp. using response surface methodology. Process Biochem. 40: 2291-2296. Tanyıldızı MŞ, Özer D, Elibol M (2007). Production of bacterial αamylase by B. amyloliquefaciens under solid substrate fermentation. Biochem. Eng. J. 37(3): 294-297. Tsao GT, Cao NJ, Du J, Gong CS (1999). Production of multifunctional organic acids from renewable resources. Adv. Biochem. Eng. Biotechnol. 65: 245-277. Zhang YZ, Jin B, Kelly JM (2007). Production of lactic acid from renewable materials by Rhizopus fungi. Biochem. Eng. J. 35: 251263.

African Journal of Biotechnology Vol. 11(34), pp. 8560-8570, 26 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.2865 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Biofilm production and antibiotic susceptibility profile of Escherichia coli isolates from HIV and AIDS patients in the Limpopo Province Samie, A. and Nkgau, T. F. Department of Microbiology, University of Venda, Private Bag X5050, Thohoyandou 0950, Limpopo, South Africa. Accepted 30 March, 2012

In the present study, Escherichia coli strains were isolated from water, stool, sputum and urine samples from HIV and AIDS patients attending treatment centers in the Limpopo Province, using standard microbiological procedures and identified by polymerase chain reaction (PCR). Biofilm assay was performed using the Congo red agar and the microtiter plate methods. Beta-lactamase production was tested using the iodometric method, while the antibiotic susceptibility profiles of the organisms were determined by the disc diffusion method. Of the 139 isolates tested, 58 (42%) were biofilm producers with 22 (16%) of these being strong biofilm producers. Antibiotic resistance was common but kanamycin, meropenem and lomefloxacin were the most active with 6.6, 5.8 and 4.3% resistance rates respectively. The rate of biofilm formation was higher among E. coli isolates from water (55.5% pvalue=0.011). Antibiotic resistance was higher among biofilm producers compared to non producers particularly for penicillin (93.1%) and cefipime (50.0%). Lomefloxacin appeared to be the most active antibiotic against the biofilm producing strains with 1.7% resistance among the biofilm producers compared to 6.3% among the non-biofilm producers. Beta-lactamase production was higher among isolates from urine samples. This study suggests that E. coli strains that produce biofilm are common in water and urine samples. However, further studies are needed to determine the potential role of water in the production of urinary tract infections (UTIs) in HIV patients. Key words: Co-infections, HIV and AIDS, epidemiology, Venda, South Africa.

INTRODUCTION Human Immunodeficiency virus discovered in the 1980s is known to cause AIDS. From the discovery of AIDS to date, the pandemic has grown faster in the African continent compared to other areas of the world (Amico et al., 2010). The virus infects and destroys CD4 positive cells in humans, leaving the body defenseless. This increases the occurrence of opportunistic infections. Pathogenic Escherichia coli are responsible for a large number of infections including intestinal and extra intestinal infections, and recent studies have indicated that E. coli strains have emerged as important pathogens

*Corresponding author. E-mail: samieamidou@yahoo.com or samie.amidou@univen.ac.za. Tel: +27159628186. Fax: 27 15 962 4749.

among HIV and AIDS patients (Avelino et al., 2010). Although there have been reports on intestinal E. coli in South Africa, very few data exists on the occurrence and pathogenic mechanisms among extraintestinal E. coli. Such extra-intestinal E. coli include those responsible for urinary tract infections (UTIs) as well as those responsible for respiratory tract infections. Several studies have identified E. coli as the most common cause of UTIs (Vignesh et al., 2008). Organisms that produce biofilm show much greater resistance to antibiotics than their free living counterparts. This increase in drug resistance is partly due to the penetration barrier that biofilm present to antimicrobials (Mohamed et al., 2007). Transmission of pathogenic E. coli occurs through fecal oral route and person to person contact. Food and water have also been shown to be common reservoirs of pathogenic E. coli. Outbreaks of E.

Samie and Nkgau

8561

coli induced diarrhea involving contaminated water and food such as spinach, ground beef and dairy products have been documented (Vogt and Dippold, 2005). Cattles are the main reservoirs of E. coli 0157:H7 which is an enterohemorrhagic E. coli causing major food borne outbreaks in developed and developing countries (Buchanan and Doyle, 1997; Lim et al., 2010). Over the past years, E. coli has been implicated as a causative agent of respiratory tract infections/ pneumonia. Clinically, E. coli induced respiratory tract infections is manifested by fever, shortness of breath and increased respiratory secretions, and may often appear as bronchopneumonia of the lower lobes (Wang et al., 2000). However, the disease may also be community acquired in individuals with diabetes mellitus, chronic obstructive pulmonary diseases and E. coli UTIs (Donnerberg and Nataro, 2000). Although many antibiotics used in the treatment of E. coli infections are still effective as treatment, development of antibiotic resistance among different diarrheagenic and uropathogenic E. coli is fast becoming a problem (Boczek et al., 2007). Antibiotic resistance constitutes both a present and a future problem. This is because strains are acquiring resistance at a rate faster than the rates at which new drugs are developed. The present study was aimed to determine the capacity of E. coli strains isolated from HIV and AIDS patients to produce biofilm, beta lactamase and the antibiotic susceptibility profiles of the isolates.

(EMB) agar or MacConkey agar for 24 h at 37°C for the detection of E. coli. A single colony from positive samples was subcultured on nutrient agar for 24 h at 37°C. The cultures were kept in the freezer prior to the different tests and subcultured on a new nutrient agar when deemed necessary. The cultures were preliminary identified by the characteristic green metallic sheen on eosin-methylene blue (EMB) followed by standard biochemical tests. The final identification of the strains was made by polymerase chain reaction (PCR) as previously described by Juhna et al. (2007).

MATERIALS AND METHODS

Congo red agar (CRA) method

Ethical consideration

The Congo red agar method was carried out as described by Freeman et al. (1989).

Ethical clearance of the study was obtained from the University of Venda Health, Safety and Ethics Committee. Authorization to conduct the study was obtained from the Department of Health, Limpopo in Polokwane. Ethical clearance and authorization was also obtained from the ethical committees of the Donald Fraser, Elim and Tshilidzini Hospitals. The objectives of the study were explained to the patients and their right to say no to participate in the study was explained to them. Once the patients had agreed to participate in the study, they were requested to sign a consent form. To preserve their privacy, the patients were given a code and were referred to by that code. The patients in the community were also requested to sign a consent form after the study has been explained to them. Whenever possible, different samples including sputum, urine, mouth wash and stools were collected.

Biofilm testing Biofilm formation was tested using two different methods, namely the microtiter plate (MT), and the Congo red agar (CRA) methods. Microtiter plate (MT) method The MT biofilm assay was carried out as described by Christensen et al. (1982) with a few modifications. Briefly, a fresh culture of the bacteria was prepared in 10 ml of brain heart infusion broth (BHIB). In brief, 198 µL of sterile brain heart infusion broth (1% sucrose) was added to each individual well of the sterile 96 well-U shaped microtiter plate, and then 2 µL of the bacterial suspension was added to each well containing the BHIB. Each assay was performed in duplicate and repeated on at least three different occasions. Enteroaggregative E. coli strain 042 previously shown to be a biofilm producer was used as a positive control and a well with only BHIB was used as a negative control. Based on the obtained OD values, the samples were classified as biofilm producers if their OD values exceeded the average plus two standards deviation of the negative controls (Mohamed et al., 2007). The samples were classified into strong producers (OD>1), moderate producers (OD ≥0.4≤1) and non producers (OD<0.4).

Beta lactamase testing Two different methods based on the same principle were used to test for the production of beta lactamase, namely the iodometric agar method and the iodometric tube method. Both methods depend upon the ability of penicilloic acid (formed when the βlactamase enzyme hydrolyses the amide bond in the β-lactam ring of penicillin analogues) to reduce iodine to iodide, resulting in a decoloration of the blue iodine-starch complex (Koneman et al., 1983). The two methods including the iodometric agar and the iodometric tube methods were used and compared. Antibiotic susceptibility testing

Patients and sample collection Clinical samples such as stools, sputum and urine were collected from HIV positive patients in different communities in the Limpopo province and water samples were collected from households of HIV positive individuals.

The disc agar diffusion (DAD) method as described by Clinical and Laboratory standards institute (CLSI) was used to determine antibiotic susceptibility profile of E. coli isolates. The results were obtained by measuring the diameter of the inhibitory zone and analyzed according to the CLSI guidelines for Enterobacteriaceae (CSLI, 2008). A total of 16 antibiotics were used.

Bacterial isolates, cultures and maintenance

Statistical analysis

Collected samples were cultured on either eosine methylene blue

All the results obtained were typed on an excel sheet for further

8562

Afr. J. Biotechnol.

Figure 1. Pictures showing biofilm production on the CRA (A) and on the MT (B). On the CRA, black colonies indicate a positive biofilm producer whereas other colors constitute a negative result. For the microtitration method, a positive reaction was sh own by the colour on the wells as indicated by arrows: A, strong producer; B, moderate producer; C, none producer. PC is the positive control (EAEC 042) and NC is the negative control.

analysis. Statistical analysis was conducted using the SPSS software (version 17.1). Different test performed on the software such as the Chi square, confidence interval and the Fishers exact tests were used to determine correlation between the different results obtained. The difference between two variables was considered significant if the p value was less than 0.05.

RESULTS General characteristics of the study sample In this study, a total of 139 E. coli strains were isolated and characterized for their capacity to produce biofilm, their antibiotic susceptibility profiles, their capacity to produce Î˛-lactamase and their pathotypes. All the strains were confirmed by the PCR method to be E. coli. From these strains, 58(41.7%) were from stool samples, 45(32.4%) were from urine, 10 (7.2%) were from sputum and 26 (18.7%) were from water. Clinical samples were from HIV positive patients and water samples were collected from households of HIV patients from the Limpopo Province. From the stool samples collected, 41 were from females, while 17 were from males. Samples were collected from individuals aged between 4 and 79 years. Biofilm production among E. coli strains from clinical and water samples from HIV patients Two different methods were used to test for biofilm production, namely the microtiter plate (MT) and Congo

red agar (CRA) methods. Considering both methods, a total of 72 (51.8%) strains were found to be biofilm producers. Figure 1 shows pictures of biofilm detection using the microtiter plate and the Congo red agar methods. In the microtitration method, the optical density (OD) was measured at 595 nm. The value for the negative control was 0.079 and the positive control was 3.877. The MT method showed that 58 (41.7%) strains were positive, while 56 (40.3%) were positive with the CRA method. Among all the positive strains, 42 (72.0%) were positive by both methods whereas 16 (11.5%) of the isolates were positive by the MT method and negative by the CRA method. Similarly, 14 (10.1%) of the isolates were positive by the CRA method while negative for the MT method.The sensitivity of the MT method was 81% (58/72) while that of the CRA method was 78% (56/72). Because of the higher sensitivity of the MT methods, its ease to perform and the fact that the strains could easily be classified as strong and moderate producers, this method was therefore considered for the analysis of the results. Furthermore, this is a method commonly used to detect biofilm production in E. coli strains. Biofilm producers were further classified as strong and moderate producers. Among the 58 (41.7%) biofilm producers, 22 (38.0%) were strong producers and 36 (62.0%) were moderate producers. Biofilm production and sample type Biofilm

production

was

mostly

observed

among

Samie and Nkgau

8563

Table 1. Distribution of biofilm production by sample type.

Sample Stool (n=58) Sputum (n=10) Urine (n=45) Water (n=26)

None producer (n=81) 43 (74.1%) 6 (60.0%) 20 (44.4% ) 12 (46.2%)

Moderate producer (n=36) 12 (20.7%) 4 (40.0%) 13 (28.9%) 7 (26.9%)

Strong producer (n=22) 3(5.2%) 0(0%) 12 (26.7%) 7(26.9%)

P value 0.008 0.008 0.008 0.008

Table 2. Antibiotic susceptibility profile of Escherichia coli isolated from stool, water, urine and sputum samples from HIV patients in the Limpopo province.

Group

Antibiotic (con) Penicillin G (10 µg) Amoxicillin (10 µg)

Resistant (%) 127(91.4%) 90 (64.7%)

Susceptible (%) 12 (8.6%) 49 (35.3%)

RBP (mm) <14 <13

Cephalosporins Carbapenems

Cefepime (30 µg) Meropenem (10µg)

62 (44.6%) 8 (5.8%)

77 (55.4%) 131 (94.2%)

<14 <13

Aminoglycosides

Amikacin (30µg) Gentamycin (10µg) Kanamycin (30µg) Streptomycin (10µg)

22 (15.8%) 20 (14.4%) 9 (6.5%) 62 (44.6%)

117 (84.2%) 119 (85.6%) 130 (93.5%) 77 (55.4%)

<14 <12 <14 <11

Quinolones

Nalidixic acid (30µg) Lomefloxacin (10µg)

21(15.1%) 6 (4.3%)

118 (84.9%) 133 (95.7%)

<13 <13

Tetracyclines Macrolides Glycopeptide Phenicols Polymyxin Others

Tetracycline (30µg) Erythromycin (15µg) Vancomycin (30µg) Chloramphenicol (30µg) Polymyxin B (300µg) Rifampicin (5µg)

74 (53.2%) 119(85.6%) 118 (84.9%) 34 (24.5%) 80 (57.6%) 110 (79.1%)

65 (46.8%) 20 (14.4%) 21 (15.1%) 105 (75.5%) 59 (42.4%) 29 (20.9%)

<14 <13 <14 <12 <14 <13

Penicillins

Con= antibiotic content of the disc; RBP=resistance break point.

organisms isolated from water and urine. 25 (55.0%) of the organisms from urine formed biofilm of which 13 (52.0%) were moderate and 12 (48.0%) were strong producers. 14 (53.8%) of the organisms from water formed biofilm of which 7(50.0%) were moderate and 7 (50.0%) were strong producers. 15 (25.9%) of the organism from stools formed biofilm of which 12(80.0%) were moderate and 3(20.0%) were strong producers. Four (40%) of the organism from the sputum formed biofilm and were all moderate producers. The difference was statistically significant (p value=0.008). Table 1 shows the distribution of biofilm production by sample type. Biofilm was detected more in females although the difference was not statistically significant (p value=0.110). Antibiotic susceptibility profiles of E. coli isolates from clinical and water samples from HIV patients The antibiotic susceptibility profile of E. coli to 16 different

antibiotics was determined. A greater resistance was observed against penicillin (127, 91.4%), erythromycin (119, 85.6%) and rifampicin (110, 79.1%), while antibiotics such as cefipime (62, 44.6%) and streptomycin (74, 53.2%) had moderate resistance. The antibiotics lomefloxacin 6 (4.3%), meropenem 8 (5.8%) and kanamycin 9 (6.5%) were the most active. Table 2 shows the antibiotic susceptibility profiles of E. coli isolates to the different antibiotics used and the antibiotic content of the disc and the resistance breakpoint used. Distribution of antibiotic resistance by sample type Most water isolates showed higher resistance to amoxicillin, cefepime, meropenem, amikacin, gentamycin and nalidixic acid. However, resistance to erythromycin and rifampicin was higher among isolates from sputum. Resistance to lomefloxacin and polymyxinB was higher among isolates from stool, while isolates from urine were

8564

Afr. J. Biotechnol.

(A)

(B)

Figure 2. Comparative analysis of antibiotic resistance among E. coli isolates from different types of samples including stools, sputum, urine and water.

highly resistant to streptomycin and tetracycline. Figures 2A and B show the distribution of the antibiotic susceptibility profile of E. coli isolates according to the sample types. Antibiotic resistance and sex Resistance to penicillin and amoxicillin were much higher in females (92.4%; 63.4%) than in males (82.7%; 49.7%). Resistance to nalidixic acid and lomefloxacin were higher

in males (21.8%; 8.7%) as compared to females (15.2%; 4.5%). Resistance to some antibiotics belonging to the group aminoglycosides such as kanamycin (9.1%) and streptomycin (51.2%) were higher in females than males (4.3%; 21.8%). Overall resistance was higher in females as compared to males. However the p values were not statistically significant and hence resistance to these antibiotics was not associated with gender with the exception of streptomycin (p=0.045) and tetracycline (p=0.031) in which the difference were statistically significant. Figure 3 shows the distribution of antibiotic

Samie and Nkgau

8565

Figure 3. Comparative analysis of antibiotic resistance between isolates from males and females. Antibiotics such as streptomycin (p = 0.045) and tetracycline (p = 0.031) were associated with gender.

resistance by sex.

sample type.

Multiple drug resistance profile of E. coli strains

Distribution of antibiotic resistance among biofilm producers

Multiple drug resistance defined as resistance to at least three antibiotics was common among the organisms tested. Of the 139 isolates, none of the isolates were susceptible to all the 16 antibiotics, while only 2 (1.4%) were resistant to 1 and 2 antibiotics, respectively. The highest rate of multiple drug resistance was observed against 6 and 7 antibiotics at a time with 18.0% (25/139) and 15.1% (21/139), respectively, and the lowest multiple drug resistance rate was against 12 and 13 antibiotics (0.7%; 1/139). None of the isolates was resistant to more than 13 antibiotics. Figure 4 shows the rate of multiple drug resistance among the E. coli isolates. Distribution of multiple drug resistance by sample type Resistance to 3 antibiotics was found only in strains from stools and water. Majority of the strains resistant to 4 antibiotics were found in sputum (50.0%) and stool (13.8%), while only 7.7% from water and none from urine were resistant to 4 antibiotics at a time. Figure 5 shows the distribution of multiple drug resistant strains by

The antibiotic susceptibility profiles of E. coli were compared between the none, the moderate and the strong biofilm producers. Resistance to antibiotics such as cefepime (63.6%), Kanamycin (13.6%) and chloramphenicol was higher among the strong biofilm producers, while resistance to antibiotics such as nalidixic acid was higher among the moderate biofilm producers. Resistance to antibiotics such as erythromycin was higher among the non biofilm producers. Overall resistance was higher among the strong biofilm producers when compared to both the non producers and the moderate producers. However, the differences were not statistically significant with the exception of resistance to chloramphenicol (p value=0.024). Table 3 shows the results of the antibiotic susceptibility profile among the none and biofilm producers. Beta lactamase production using the iodometric agar and tube method Beta lactamase production was tested using two methods

8566

Afr. J. Biotechnol.

Figure 4. Multiple drug resistance among E. coli strains.

Figure 5. Comparative analysis of multiple drug resistance among E. coli isolates from different type of samples including stools, sputum, urine and water.

based on the same principle; namely the iodometric agar and iodometric tube method. When considering both methods, a total of 35 (25.2%) strains were found to be beta lactamase producers. With the tube method 25 (18.0%) strains tested positive, while 24 (17.3%) tested positive with the agar method. Among the positive strains, 18(13.0%) were positive for both methods, while 7 (5.0%) of the isolates were positive for the tube method and negative for the agar method and 6 (4.3%) of the isolates were positive for agar method while negative for the tube method. The tube method was chosen for

further analysis as it was found to be faster, easier to conduct and the interpretation of the results was easier. Amongst the different samples tested, urine isolates had the highest rate of beta lactamase production (22%) followed by isolates from stools (20.7%), and then water (7.7%). None of the isolates from sputum produced the beta lactamase enzyme. Among clinical samples, the rate of beta-lactamase production was higher in E. coli isolates from males (39.1%) compared to females (12.0%), however, the difference was statistically not significant (p=0.187).

Samie and Nkgau

8567

Table 3. Distribution of antibiotic resistance among biofilm producers.

Antibiotic Penicillin G Amoxicillin Cefepime Meropenem Nalidixic acid Lomefloxacin Amikacin Gentamycin Kanamycin Tetracycline Erythromycin Vancomycin Chloramphenicol Polymyxin B Streptomycin Rifampicin

None producers (n=81) 73 (90.1%) 52 (64.2%) (33 (40.7%) 5 (6.2%) 11 (13.6%) 5 (6.2%) 14 (17.3%) 14 (17.3%) 5 (6.2%) 45 (55.6%) 71 (87.7%) 69 (85.2%) 19 (23.5%) 48 (59.3%) 38 (46.9%) 69 (85.2%)

Moderate (n=36) 33 (91.7%) 23 (63.9%) 15 (41.7%) 2 (5.6%) 9 (25%) 1 (2.8%) 6 (16.7%) 5 (13.9%) 1 (2.8%) 16 (44.4%) 30 (83.3%) 30 (83.3%) 5 (13.9%) 18 (50.0%) 17 (47.2%) 24 (66.7%)

Distribution of beta-lactamase production amongst biofilm producers From the 58 biofilm producers, 9 (15.6%) were found to be beta-lactamase producers, of which 6 (10.4%) were among the moderate biofilm producers and 3 (5.2%) among the strong biofilm producers. However, the difference was not statistically significant (p=0.521). Association between beta lactamase and resistance to antibiotics The antibiotic susceptibility profiles of β-lactamase producing stains were compared with non β-lactamase producing strains. Resistance to antibiotics such as penicillin (92.0%), amoxicillin (76%), cefepime (48%) was higher among the β-lactamase producing strains, although the difference was not significant (p value> 0.05). Resistance to antibiotic such as nalidixic acid, streptomycin and erythromycin were higher amongst the non β-lactamase producing strains; the difference was also not significant. Multiple drug resistance positive strains

among

beta-lactamase

The rate of multiple drug resistance was compared between the β-lactamase positive and negative strains. Resistance to 3, 4, 5, 6 and 7 antibiotics was higher among the β-lactamase negative strains, while resistance to 8, 9, 10 and 11 antibiotics was higher amongst the βlactamase positive strains with greater resistance to 8 antibiotics. Strains resistant to 12 and 13 antibiotics were

Strong (n=22) 21 (95.6%) 16 (72.8%) 14 (63.6%) 1 (4.5%) 1 (4.5%) 0 (0%) 2 (9.1%) 1 (4.5%) 3 (13.6%) 13 (59.1%) 18 (81.8%) 19 (86.4%) 10 (45.6%) 14 (63.6%) 7 (32.8%) 17 (77.2%)

P value 0.730 0.737 0.147 0.957 0.090 0.392 0.638 0.318 0.261 0.450 0.711 0.946 0.024 0.530 0.421 0.049

found only among the β-lactamase negative stains. Figure 6 shows the rate of multiple drug resistance of βlactamase positive and negative strains. DISCUSSION Several studies have implicated E. coli as an important etiological agent of diarrhea and as an emerging opportunistic pathogen particularly among HIV positive patients in developing countries (Abong et al., 2008; Rossit et al., 2009). This study determined the antibiotic resistance profiles in association with biofilm-producing capacities as well as beta lactamase production of E. coli isolates obtained from HIV and AIDS patients in the Limpopo Province in South Africa. Biofilm formation has been described as an important pathogenic feature presented by different types of organisms including bacteria and fungi; the methods used for the detection vary between studies and include mainly the MT and the CRA methods. A study conducted by Mathur et al. (2006) showed that there was no correlation between the CRA and the MT plate methods and that the MT plate method was the most sensitive (97.1% compared to 6.8% CRA), accurate (97.2% compared to 40.9% CRA) and the most reproducible method for screening for biofilm formation. In the present study, both methods were used and compared for sensitivity and ease of application. Most studies conducted for biofilm formation among E. coli strains have used the microtiter plate method in combination with the detection of various virulence genes (Rijavec et al., 2008). Hence, the MT method remains the method of choice in terms of accuracy, sensitivity and ease of application for detecting biofilm formation among E. coli strains.

8568

Afr. J. Biotechnol.

Figure 6. Comparative analysis of multiple drug resistance between Î˛-lactamase positive and negative strains.

The prevalence and detection of biofilm producers have been showed to be dependent upon various factors such as the method, media and incubation period used (Mathur et al., 2006). In the present study, we found that the prevalence of biofilm producers was lower (41.7%) as compared to the findings by others such as Mohamed et al. (2007) (53.0%) who used Luria broth incubated for 18 h and fixed the bacteria with Bouin fixative prior to the rinsing step with phosphate buffered saline (PBS) and Merendez-arancibia et al. (2008) (78%) who used minimal glucose medium (M63) and incubated for 24 h. This could be because these studies were focused on one E. coli pathotypes, particularly the enteroaggregative E. coli (EAEC) previously known to be a biofilm producer. In addition, samples tested for biofilm were often collected from diarrheagenic stool samples and water samples whereas in this study water, stools, urine and sputum samples were used and could have resulted in lowering the overall percentages of biofilm producers. Biofilm producers were common among isolates from water and urine and among the clinical isolates, the prevalence was higher among female individuals. These findings are in agreement with the studies conducted by Sharma et al. (2009) who found a rate of 67.5% and Suman et al. (2007) who found a rate of 92.0%, which shows that there is an increased prevalence of biofilm formation by uropathogenic E. coli and females are in most cases at higher risks of acquiring E. coli induced UTIs. Several studies conducted on the antibiotic susceptibility profiles of E. coli have shown a steady increase of antibiotic resistance amongst clinical isolates which remains a growing problem (Boczek et al., 2007). In the

present study, higher resistance was observed against penicillin (~90%), followed by erythromycin, vancomycin, rifampicin (~80%) and amoxicillin (~60%), whereas lomefoxacin, kanamycin and meropenem (all less than 10%) were the most effective antibiotics against the isolates. These findings are in agreement with studies conducted by obi et al. (2004b, 2007) that showed that most E. coli strains isolated were highly resistant to penicillin (~90%) and amoxicillin (~60%) and susceptible to meropenem (~8%) and gentamycin (~10%). However, in this study, we found that there was a slight increase in resistance to the antibiotic gentamycin (14.4% compared to 10% found by obi et al. (2007). Majority of the resistant strains were isolated from stool followed by urine and water. Isolates from sputum had the least resistance. These findings are also in agreement with the study conducted by Obire et al. (2009) that showed that there was a slight increase in drug resistance in isolates from stool and urine (30.95%) and Walia et al. (2005) that showed an increase in drug resistance among isolates from water (92%) and urine (53%). E. coli induced pneumonia is less common than enteric and urinary tract infections, and in some cases, the organism is rarely isolated from sputum samples. In a study conducted by Khan et al. (2002), 22 sputum samples were collected from which no E. coli was isolated. The pathogenicity of E. coli induced pneumonia is poorly understood (Jeyaseelan et al., 2007). The disease results from micro aspiration of the upper airway secretions that have been colonized with the organisms in severely immunocompromised patients, thus making it a common cause of nosocomial pneumonia. Multiple drug resistance defined as resistance to three

Samie and Nkgau

or more antibiotics was also a common phenomenon among the isolates. In this study, it was found that 97.1% of the strains were resistant to multiple antibiotics. Although generally lower than our findings, Obi et al. (2007) also showed that close to 50% of the E. coli isolated were resistant to multiple antibiotics. A study conducted by Obire et al. (2009) also showed that multiple drug resistance was common among their isolates with most strains resistant to 7 followed by 6 and 4 antibiotics, similar to the results obtained in this study. Study on the production of the enzyme beta-lactamase and extended spectrum beta-lactamase is important as it has been shown through several studies that strains that produce these enzyme show greater resistance to betalactam antibiotics rendering many penicillins and cephalosporins ineffective as therapy (Ruppe et al., 2009). In this study, beta-lactamase production was tested using two methods based on the same principle to compare for sensitivity and ease of application. The tube method was found to be the better method as it is was rapid, accurate and more sensitive and hence is recommended for testing for beta lactamase production if the iodometric method is used. The prevalence of beta lactamase producing strains (18%) was found to be lower than that obtained by Shibi (1995) who found a rate of 64% in a study conducted in Saudi Arabia. The antibiotic resistance profile of B-lactamase positive strains was also analyzed to determine whether these strains had a higher rate of resistance within the beta-lactam antibiotics as well as other classes of antibiotics. It was found that majority of beta lactamase producing strains were resistant mainly to gentamycin, amikacin and polymyxin B. Multiple drug resistance to 8, 9, 10 and 11 antibiotics was found to be higher among the beta lactamase positive strains. These findings are in agreement with the study conducted by Bristianou et al. (2008) who noted that this enzyme might be responsible for multiple drug resistant E. coli strains. This study has for the first time described the capacity of local E. coli isolates to produce biofilm in relation to antibiotic susceptibility among E. coli isolates in the Limpopo Province. Increased drug resistance to some antibiotics as well as multiple drug resistance which may partially be due to production of the enzyme β-lactamase is of concern. Therefore, regular monitoring and further studies on multiple drug resistant E. coli strains is recommended to unveil the evolving nature of antibiotic resistance. ACKNOWLEDGEMENTS The authors are grateful to the staff and patients from Thsilidzini, Donald Fraser and ELIM hospitals. We are also grateful to the Department of Health in Polokwane. The present study was partially funded by a grant from the National Research Foundation to Dr Samie and other

8569

funding came from the University of Venda Research and Publication committee. REFERENCES Abong BO, Mwambakana TN, Momba MNB, Malakalo VK (2008). Prevalence of Escherichia coli 0157: H7 among diarrhoeic HIV/AIDS patients in the eastern cape province-South Africa. Pak. J. Biol. Sci. 118: 1066-1075. Khan AN, Saba N, Samad A, Qazilbash AA (2002). Incidence and Antibiogram Patterns of Escherichia coli Isolated from Various Clinical Samples from Patients at N.I.H. Islamabad. Pak. J. Biol. Sci. 5: 111-113. Amico P, Aran C, Avila C (2010). HIV spending as a share of total health expenditure: an analysis of regional variation in a multi-country study. PLoS One. 5(9): e12997. Avelino F, Saldaña Z, Islam S, Monteiro-Neto V, Dall'Agnol M, Eslava CA, Girón JA (2010). The majority of enteroaggregative Escherichia coli strains produce the E. coli common pilus when adhering to cultured epithelial cells. Int. J. Med. Microbiol. 300(7): 440-8. Boczek LA, Rice EW, Johnston B, Johnson JR (2007). Occurrence of antibiotic resistant Uropathogenic Escherichia coli clonal group A in wastewater effluents. J. Appl. Environ. Microbiol. 73: 4180-4184. Bristianou M, Panagou C, Adamisa T, Raftogiannis M, Antonopoulou A, Chrisofos C, Galani I, Kanellakopoulou K, Tsaganos T, Giamarellos Bourboulis EJ (2008). The impact of multidrug resistance on the pathogenicity of Escherichia coli: an experimental study. Int. J. Antimicrob. Ag. 31: 261-223. Buchanan RL, Doyle MP (1997). Foodborne disease significance of Escherichia coli O157:H7 and other enterohemorrhagic E. coli. A Scientific Status Summary of the Institute of Food Technologists’ Expert Panel on Food Safety and Nutrition, Chicago, Ill., Food Technol. 51(10): 69-76. Christensen GD, Simpson WA, Bisno AL, Beachery EH (1982). Adherence of slime producing strains of Staphylococcus epidermidis to smooth surface. J. Infect. Dis. Immunol. 37: 318-426. Clinical and Laboratory Standards Institute CLSI (2008). Performance standards for antimicrobial susceptibility testing: 18th informational supplement (M100-S18), CLSI, Wayne, PA. Donnerberg MS, Nataro JP (2000). The molecular Epidemiology of Escherichai coli infections. Microbial foodborne diseases: Pathogenesis and toxin synthesis. Cary JW, Linz JE, Bhatnagar D (Editors). Technomic publishing company. New Holland. 3: 87-115. Freeman DJ, Falkiner FR, Keane CT (1989). New method for detecting slime production by coagulase negative staphylococci. J. Clin. Pathol. 42: 872-874. Jeyaseelan S, Young SK, Fessler MB, Liu Y, Malcom KC, Yamamoto M, Akira S, Worthen GS (2007). Toll/IL-1 receptor domain containing adaptor inducing IFN-β (TRIF)-mediated signaling contributes to inate immune responses in the lung during Escherichia coli pneumonia. J. Immunol. 178: 3153-3160. Juhna T, Birzniece P, Larsson S, Zulenkovs D, Shapiro A, Azeredo NF, Menard-Szczebara F, Castaganet S, Feliers C, Keevil CW (2007). Detection of Escherichia coli in biofilm from pipe samples and coupons in drinking water distribution networks. J. Appl. Environ. Microbiol. 73: 7456-7464. Koneman EW, Allen SD, Dowell VR, Somers HN (1983). Colour atlas and textbook of diagnostic microbiology 2nd edition. JB lippin cott company USA. Lim JY, Yoon J, Hovde CJ (2010). A brief overview of Escherichia coli O157:H7 and its plasmid O157. J. Microbiol. Biotechnol. 20(1): 5-14. Mathur T, Singhal S, Khan S, Upadhyay DJ, Fatma T, Rattan A (2006). Detection of biofilm formation among the clinical isolates of staphylococci: an evaluation of three different screening methods. Indian J. Med. Microbiol. 24: 25-29. Mohamed JA, Huang DB, Jiang Z, DuPont HL, Nataro JP, BelkindGerson J, Okhuysen PC (2007). Association of putative Enteroaggregative Escherichia coli virulence genes and biofilm production in isolates from travelers to developing countries. J. Clin. Microbiol. 45: 121-126.

8570

Afr. J. Biotechnol.

Obi CL, Bessong PO, Momba MNB, Potgieter N, Samie A, Igumbor EO (2004). Profiles of antibiotic susceptibilities of bacterial isolates and physico-chemical quality of water supply in rural Venda communities, South Africa. Water SA. 4: 519-520. Obi CL, Ramalivhana J, Momba MNB, Onabolu B, Igumbor EO, Lukoto M, Mulaudzi TB, Bessong PO, Jansen van Rensburg EL, Green E, Ndou S (2007). Antibiotic resistance profiles and relatedness of enteric bacterial pathogens isolated from HIV/AIDS patients with and without diarrhoea and their household drinking water in rural communities in Limpopo Province South Africa. Afr. J. Biotechnol. 6: 1035-1047. Obire O, Dumka G, Putheti R (2009). Antibiotic resistance in Escherichia coli isolated from patients. Drug Invent. Today, 1(2): 140145. Rijavec M, Muller-premru M, Zakdnik B, Zgur-Bertok D (2008). Virulence factors and biofilm production among Escherichia coli strains causing bactereamia of urinary tract origin. J. Med. Microbiol. 57: 1329-1334. Rossit AB, Goncalves AC, Franco C, Machado RL (2009). Etiological agents of diarrhea in patients infected by the Human Immunodeficiency Virus-1. Rev. Inst. Med. Trop. Sao Paulo. 51: 5965. Ruppe E, Sophea H, Sovannarith L, Valerieh GA (2009). CTX-M(beta)lactamses in Escherichia coli from community-acquired urinary tract infections, Cambodia. Emerging infectious Diseases. The free library 2009. Available from http://www.thefreelibrary .com/ CTX-M(beta)lactamses in Escherichia coli from communityacquiredâ&#x20AC;Ś.90201212073. [Retrieved 10 February 2010]. Sharma M, Aparna, Yadav S, Chaudhary U (2009). Biofilm production in uropathogenic Escherichia coli. Indian J. Pathol. Microbiol. 52: 294294. Shibi AM (1995). Incidence of beta-lactamase production and antibiotic susceptibilities among clinical isolates in Saudi Arabian hospitals. Curr. Ther. Res. 56: 407-414.

Suman E, Jose J, Varghese S, Kotian MS (2007). Study of biofilm production in Escherichia coli causing urinary tract infection. Indian J. Med. Microbiol. 25: 305-306. Vignesh R, Shankar EM, Murugavel KG, Kumarasamy N, Sekar R, Irene P, Solomon S, Balakrishnan P (2008). Urinary infections due to multi-drug-resistant Escherichia coli among persons with HIV disease at a tertiary AIDS care centre in South India. Nephron. Clin. Pract. 110(1): c55-7. Vogt RL, Dippold L (2005). Escherichia coli 0157:H7 outbreak associated with consumption of ground beef, June-July 2002. Public Health Rep. 120: 174-178. Walia SK, Kaiser A, Parkash M, Shaundry GR (2005). Self transmissible and antibiotic resistance to ampicillin, streptomycin and tetracycline in Escherichia coli from contaminated drinking water. J. Environ. Sci. Health [A]. 31: 651-662. Wang J, Hseuh PR, Wang JT, Lee LA, Yang PC, Luh KT (2000). Recurrent infections and chronic colonisation by an Escherichia coli clone in the respiratory tract of a patient with severe cystic bronchiectasis. J. Clin. Microbiol. 38: 2766-2767.

Full Length Research Paper

Entomophaga maimaiga – New entomopathogenic fungus in the Republic of Serbia Mara Tabaković-Tošić¹*,Georgi Georgiev², Plamen Mirchev², Dragutin Tošić³ and Vesna Golubović-Ćurguz¹ ¹Institute of Forestry Belgrade, Serbia. ²Forest Research Institute of Bulgarian Academy of Sciences, Sofia, Bulgaria. ³Faculty of Geography, University of Belgrade, Serbia. Accepted 10 April, 2012

The higher mortality rate of the older gypsy moth larval instars was reported in the forest complexes of Belgrade and Valjevo region, in the culmination phase of the new outbreak of the gypsy moth in Serbia. By field and laboratory studies of the causes of their death, the presence of conidia and resting spores of the entomopathogenic fungus Entomophaga maimaiga was reported in the dead caterpillars. This has been the first report of occurrence of this species in Serbia, that is, Serbia is the third European country in which this fungus has been reported. It showed to be a powerful reducer of the population size of the gypsy moth, and in both regions it caused the collapse of the outbreak in 2011. Key words: Entomophaga maimaiga, Lymantria dispar, gypsy moth, biological control, epizootics. INTRODUCTION Classical biological control is simply a special case of a general pattern in which populations are regulated by density-dependent processes, a major class of which involves predator-prey and parasitoid-host interactions. Naturally occuring entomopathogens are important regulatory factors in insect population. Entomopathogenic organisms, various types of viruses, microsporidia, bacteria, protozoa, fungi, nematodes, which can under favourable conditions cause massive insect mortality and are of great breeding capacity, normally live in nature. Epizootics caused by naturally occurring viral and fungal pathogens are often responsible for spectacular crashes of insect pest populations (Evans, 1986; McCoy et al., 1988). Although there are numerous entomopathogenic microorganisms which cause insect mortality and in this way have one of the dominant roles in the regulation of their number in nature, relatively small number of them has so far being practically used in the harmful insect control (Tabakovic-Tosic, 2008).

Corresponding author. E-mail: mara.tabakovic@gmail.com. Tel: +381638370811. Fax: +381112545969.

Fungal entomopathogens have been used more frequently than other types of pathogens for classical biological control. Among 136 programs using different groups of arthropod pathogens, in 49.3% the fungal pathogens were introduced. The most comonly introduced species was Metarhizium anisopliae (Metschnikoff) Sorokin, which was released 13 times, followed by Entomophaga maimaiga Humber, Shimazu and Soper, which was released seven times (Hajek and Delalibera, 2010). The fungal order Entomophthorales in the class Zygomycetes is mainly composed of obligate pathogens that infect arthropods. More than 300 species infect a wide variety of hosts, and nearly every fungal species or strain is quite host specific. Species within the Entomophthorales are well-known for their ability to cause dramatic epizootics in populations of aphids, leafhoppers and planthoppers, flies, grasshoppers, cicadas, and coleopteren and lepidopteren larvae (Hajek, 1999). The entomopathogenic fungus E. maimaiga (Entomophtorales: Entomophtoraceae) was isolated and described as the natural enemy of the gypsy moth in Japan, where it causes periodical epizootics. It is also spread in some parts of China and the Russian Far East (Hajek et al., 2005). In spite of the fact that it was

8572

Afr. J. Biotechnol.

introduced in North America in 1910-1911 (Speare and Colley, 1912), its presence in the natural populations of gypsy moth was determined only in 1989 (Hajek et al., 1996), when the pathogen caused pandemic in several countries (Andreadis and Veseloh, 1990; Hajek et al., 1990b; Smitley et al., 1996; Reardon and Hajek, 1998). Today E. maimaiga is a very significant pathogen of gypsy moth in North America and in Canada (Balser and Baumgand, 2001; Hajek, 1997; Hajek et al., 2005; Howse, 2002; Hoover, 2000). Bulgaria has been the third country in the world and the first one in Europe in which E. maimaiga was introduced successfully. The first epizootic of it occurred in 2005, and the latest ones were reported in the very vicinity of the Bulgarian borders with Serbia, Greece and Turkey (Pilarska et al., 2000, 2006; Georgiev et al., 2007, 2010). It is assumed that this species is also present in oak forests in some Serbian regions. This hypothesis can be supported by the fact that the increased population size of gypsy moth during the latest outbreak (2003-2005) was not reported only in the oak stands of the border, Pirot region (Tabakovic-Tosic et al., 2011). We believed it was of vital importance to start the research program on the presence and spread of E. maimaiga in the Republic of Serbia, so that in this paper we present the first results of this program. MATERIALS AND METHODS During the growing season in 2011, in some forest areas of central Serbia, where the increased mortality rate of the gypsy moth larvae was reported and where there was no significant damage of the foliage caused by the feeding of them, the intensive research of the possible causes of this condition was done. The intensive research was conducted in the forest complexes located in Belgrade and Valjevo regions: Management Unit Košutnjačke šume (Public Enterprise Srbijašume, Forest Estate Belgrade, Forest Administration Lipovica) – Borački gaj (α: 44° 32' N, δ: 20° 21' E; from 120 to 170 m above sea level): Even-aged (about 65-yearold), well-preserved Quercus cerris L. (80%) and Quercus frainetto Tenore (20%) coppice stands; Management Unit Bogovadja (Diocese of Valjevo) – Monastery forests (α: 44° 19' N, δ: 20° 11' E; from 140 to 190 m above sea level): Approximately even-aged (up to 82-year-old), mixed coppice Quercus cerris L. (60%), Carpinus betulus L. (30%), and Quercus frainetto Tenore or Tilia argentea Desf. (10%) (Figure 1). Average values of climatic elements of the study area [data of the Republic Hydrometeorological Service of Serbia, Belgrade Meteorological Station (α: 44 48´ N; δ: 20 28´ E; the altitude of 132 m] are presented in the Figure 2. From both sites, the dead gypsy moth larvae of the L4-6 larval instars were sampled from the oak tree, in the summer and autumn 2011. Every seven days the caterpillars (alive and dead) were collected in order to grow under laboratory conditions and to determine the cause of the high mortality rate of them that is, to verify the presence of the permanent spores of the entomopathogenic fungus E. maimaiga on gypsy moth cadavers. The larvae were grown in the climate chamber under the laboratory conditions. During the experiment, temperature and light conditions were constant (temperature 21°C, light regime - 8 h a night, 16 h a day). The larvae were on daily basis fed on the fresh leaves of the oak, brought from the sample plots. The dead larvae were placed in Petri dishes with wet filter paper.

They were kept 7 days in the laboratory and then stored in the refrigerator. After the storage in the refrigerator for 3 months, in October 2011 the detailed microscope survey of the dead gypsy moth caterpillars was done. The evaluation of E. maimaiga infections was recorded as positive when azygospores and conidiospores were detected in the cadavers of dead gypsy moth larvae. The species identification was based on the size, shape and structural characteristics of different life forms of the fungus – azygospores, conidiospores and mycelia.

RESULTS AND DISCUSSION The Palearctic, economically harmful insect species Lymantria dispar is one of the major pests of broadleaf forests in Serbia, where the forest complexes cover an area of 2.4 million hectares, with the wood volume which is 235 million m 3 (Bankovic et al., 2009). The outbreak of gypsy moth, over the 150-year-period occurred 17 times (Tabakovic-Tosic and Jovanovic, 2007), and the 18th outbreak started in 2009-2010. In spring 2011, the selected forest areas in Belgrade and Valjevo regions where the great increase of the population size of the gypsy moth was reported (magnitude of attack in autumn 2010: 5,000 and 3,200 egg masses/ha) were observed in a great detail. It was first observed that there was no considerable damage of the foliage, which would normally be clearly visible. Even at the sample plots where the intensity of the attack was equal to several hundred egg masses per a hectare, which implies that the next instar can cause 100% defoliation, the trees looked as if the gypsy moth was in the latency phase. In addition, at some sample plots the increased mortality rate of the older larval instars in comparison with the expected one was reported. Then, the following question was posed: What prevent the larvae from the intensive feeding and doing harm and what has been killing them? In order to get the answer to this question, the detailed analysis of the possible causes was conducted. The following results were obtained from the weekly field studies conducted in May, June and July 2011, when the gypsy moth is in L4-6 instars: a huge amount of dead larvae was found on the trees. By the detailed study of the dead gypsy moth larvae, two groups of the characteristic symptoms were reported: The first group: The bodies tend to be stiff and straight, and the legs extend stiffly from the body (Figure 3A). Some of the dead larvae had tiny white conidia attached to the hairs on the body, characteristic symptoms caused by the entomopathogenic fungus E. maimaiga. The second group: The bodies of dead larvae are soft, filled with a brown liquid and disintegrate rapidly. Usually, they hang limply in an inverted ʺVʺ position, characteristic symptoms caused by the entomopatogenic baculovirus Lymantria dispar nuclear polyhedrosis virus – (LdNPV) (Table 1). The detailed microscope survey of the sampled dead

Tabaković-Tošić et al.

Figure 1. Geographical location of the investigated forest areas.

8573

Temperature (째C)

Afr. J. Biotechnol.

Relative humidty (%)

Time (days)

Precipitation (mm)

8574

Time (days) Figure 2. Climatic conditions of the study area during the experimental period. (A) Mean daily air temperature; (B) Mean daily relative humidity; (C) Precipitation.

Tabaković-Tošić et al.

8575

Figure 3. Pathogenic activity of E. maimaiga for larvae of Lymantria dispar. (A) Infected dead gypsy moth larvae; (B) Conidia and resting spores isolated from dead larvae.

Table 1. Larvae of Lymantria dispar with symptons of death caused by Entomophaga maimaiga and Lymantria dispar nuclear polyhedrosis virus in regions of Serbia.

Serbia region Management Unit Košutnjačke šume – Borački gaj Management Unit Bogovadja – Monastery forests

Place of death Entomophaga maimaiga symptoms Baculovirus LdNPV symptoms Laboratory Forest Laboratory Forest N % N % N % N % 212 91.8 436 85.0 19 8.2 77 15.0 98 94.2 269 92.4 6 5.8 22 7.6

gypsy moth larvae showed in all of them, without any exception, the presence of the numerous resting spores of the entomopathogenic fungus E. maimaiga. In addition, the presence of the conidia of this pathogen species was reported, but the number of them was considerably smaller (Figure 3B). Regardless of the fact that during the field research the clear symptoms of the disease, resulted in death (15% of the total number of the dead larvae), caused by the activity of LdNPV, were reported, during the laboratory microscope analysis the presence of them was not confirmed, which was expected, since the dead larvae in the decomposition phase were not sampled. The weather plays an important role in the anticipation of the effectiveness of E. maimaiga. Like most fungi, its spores need moisture and high humidity to germinate (Hajek et al., 1990a; Hajek and Soper, 1992). Frequent rainfall during May and June contributes to the start and spread of E. maimaiga through a gypsy moth population (Weseloh and Andreadis, 1992; Weseloh et al., 1993; Smitley et al., 1996; Hajek et al., 1996). The temperature around 20°C greatly enhances fungal growth (Hajek, 1999). It is clearly visible in the Chart 3 that May was the

favourable month to the germination of the resting spores and to the infection of the gypsy moth larvae. The frequency of the rainy days and the average daily air temperature around 21°C (Chart 1) in the second half of the month, caused the massive epizootics in the observed area. It is clearly visible in Figure 2B and C that May was the favourable month to the germination of the resting spores and to the infection of the gypsy moth larvae. The frequency of the rainy days and the average daily air temperature around 21°C (Figure 2A) in the second half of the month, caused the massive epizootics in the observed area. In September 2011, the number of the newly laid egg masses of the gypsy moth was determined. In the oak stand located in Borački gaj, the number of the newly laid egg masses of the gypsy moth is 15 per a hectare (333 times less in comparison with 2010 when more than 5,000 egg masses/hectare was reported), whereas the presence of them was not reported in Bogovadja (the intensity of the attack in 2010 was 3,200 egg masses/ hectare). The reduction of the intensity of the attack and the complete collapse of the outbreak of the gypsy moth are caused by the activity of the entomopathogenic

8576

Afr. J. Biotechnol.

fungus E. maimaiga. Conclusions By field and laboratory studies of the causes of the mortality of the older gypsy moth larval instars the presence of the conidia and resting spores of the entomopathogenic fungus E. maimaiga was confirmed in the dead larvae. It has been the first discovery of this kind is Serbia, that is, Serbia is the third European country in which this fungus has been reported. It proved to be a powerful reducer of the population size of the gypsy moth since the population size was reduced from 5,000 and 3,200 egg masses/hectare in 2010 to only 15, and zero in 2011 at Borački gaj and Bogovadja, respectively. By field and laboratory studies, the mortality of the older larval instars of L. dispar was confirmed throught the presence in the dead larvae of conidia and resting spores of the entomopathogenic fungus E. maimaiga. It has been the first record of this kind in Serbia, that is, Serbia is the third European country in which this fungus has been reported. It showed to be a powerful reducer of the population size of the gypsy moth since the population size was drastically reduced in Borački gaj and Bogovadja regions. ACKNOWLEDGMENTS The study was partly financed by the Minstry of Science of the Republic of Serbia, the Project 31070 SUBPROJECT: New technological methods in the integral protection of forests with the focus on the entomopathogenic fungus E. maimaiga, as the possible solution to the problem of the frequent occurrences of the outbreak of gypsy moth in the forest ecosystems of Serbia. We are very grateful to Prof. Dr. Ann Hajek, Cornell University, for the confirmation of E. maimaiga in October 2011 during her participation in the workshop of the Project DO-02-282/2008 of National Science Fund of Bulgaria. We are particularly grateful to the Hydrometeorological Service of Serbia, which provided us with the necessary daily weather data for the Belgrade Weather Station. REFERENCES Andreadis T, Weseloh R (1990). Discovery of Entomophaga maimaiga in Mitchigan. Proceedings, U.S. Dep. Agric. Interagency Gypsy Moth Res. Forum. 1994: p. 6. Balser D, Baumgard A (2001). Entomophaga: A New Tool In Gypsy Moth Management. http://www.hcs.ohio-state.edu/ODNR/Health/ ONLAArticle97.html. Bankovic S, Medarevic M, Pantic D, Petrovic N (2009). National Forest Inventory of the Republic of Serbia - Forests of the Republic of Serbia. Ministry of Agriculture, Forestry and Water Management Forest Directory, Belgrade, Serbia, pp. 1-244.

Evans HF (1986). Ecology and epizootiology of Baculoviruses. In ʺThe Biology of Baculovirusesʺ. Vol. II ʺPractical Application for Insect Controlʺ (Granados RR and Federici BA Eds.). CRC Press, Boca Raton, Fl., pp. 89-132. Georgiev G, Mirchev P, Pilarska D, Golemanski V, Pilarski P, Tomovski H, Bochev N (2007). The gypsy moth will be neutralized. Forestry. (in Bulgarian). 5: 8-10. Georgiev G, Pilarska D, Mirchev P, Rossnev B, Petkov P, Pilarski P, Golemanski V, Todorov M, Takov D, Hubenov Z, Georgieva M, Matova M, Kitanova S (2010). Entomophaga maimaiga-a factor for increasing stability and enhancing biodiversity in oak forests on the Balkan Peninsula. Proceed. Int. Sci. Confer. For. Ecosyst. Climate Changes, 1: 181-185. Hajek AE (1997). Ecology of terrestrial fungal enthomopathogens. Adv. Microb. Ecol. 15: 193-249. Hajek AE (1999). Pathology and Epizootiology of Entomophaga maimaiga Infections in Forest Lepidoptera. Microb. Mol. Biol. Rev. 63(4): 814-835. Hajek AE, Carruthers RI, Soper RS (1990a). Temperature and moisture relations of sporulation and germination by Entomophaga maimaiga (Zygomycetes: Entomophthoraceae), a fungal pathogen of Lymantria dispar (Lepidoptera: Lymantriidae). Environ. Entomol. 19: 85-90. Hajek AE, Delalibera IJ (2010). Fungal pathogens as classical biological control agents against arthropds. BioControl, 55: 147-158. Hajek AE, Elkinton JS, Witcosky JJ (1996). Introduction and spread of the fungal pathogen Entomophaga maimaiga (Zygomycetes: Entomophthorales) along the leading edge of gypsy moth (Lepidoptera: Lymantriidae) spread. Environ. Entomol. 25: 12351247. Hajek AE, Humber RA, Elkinton J, Walsh S, Silver J (1990b). Allozyme and restriction fragment length polymorphism analyses confirm Entomophaga maimaiga responsible for 1989 epizootics in North American gypsy moth populations. In: Proc. Natl. Acad. Sci. USA, 87: 6979-6982. Hajek AE, McManus M, Delalibera IJ (2005). Catalogue of Introductions of Pathogens and Nematodes for Classical Biological Control of Insects and Mites. FHTET, USDA Forest Service, Morgantown. p. 59. Hajek AE, Soper RS (1992). Temporal dynamics of Entomophaga maimaiga after death of gypsy moth (Lepidoptera: Lymantriidae) larval hosts. Environ. Entomol. 21: 129-135. Hoover GA (2000). Gypsy Moth. Penn State College of Agricultural Sciences, Entomological Notes. http://www.ento.psu.edu/extension/factsheets/gypsymoth.htm. Howse TS (2002). Status of important forest insects in Ontario in. Report prepared for the annual Forest Pest Management Forum, Ottawa, November 13-15, p. 24. McCoy CW, Samson RA, Boucias DG (1988). Entomogenous fungi. In ʺHandbook of Natural Pesticidesʺ, Vol. V: ʺMicrobial Insecticides, Part A: Entomogenous Protozoa and Fungiʺ (Ignoffo CM and Mandava NB, Eds.), CRC Press, Boca Raton. Fl. pp. 151-236. Pilarska D, McManus M, Hajek A, Herard F, Vega F, Pilarski P, Markova G (2000). Introduction of the entomopathogenic fungus Entomophaga maimaiga Hum., Shim. & Sop. (Zygomycetes: Entomophtorales) to a Lymantria dispar (L.) (Lepidoptera: Lymantriidae) population in Bulgaria. Pest Sci. 73: 125-126. Pilarska D, McManus M, Pilarski P, Georgiev G, Mirchev P, Linde A (2006). Monitoring the establishment and prevalence of the fungal entomopathogen Entomophaga maimaiga in two Lymantria dispar L. populations in Bulgaria. J. Pest Sci. 79: 63-67. Reardon R, Hajek A (1998). The Gypsy Moth Fungus Entomophaga maimaiga in North America. USDA Forest Service FHTET-97-11 June. Smitley DR, Bauer LS, Hajek AE, Sapio FJ, Humber RA (1996). Introduction and establishment of Entomophaga maimaiga, a fungal pathogen of Gypsy moth (Lepidoptera: Lymantriidae) in Michigan. Environ. Entomol. 24(6): 1685-1695. Speare AT, Colley RH (1912). The artificial use of the brown-tail fungus in Massachusetts with practical suggestions for private experiments, and a brief note on a fungous disease of the gypsy caterpillar. Wright & Potter, Boston. Tabakovic-Tosic M (2008). Entomopathogenic bacterium Bacillus thuringiensis ssp. kurstaki the important component of the integral

Tabaković-Tošić et al.

protection of forest ecosystems. Instit. For. Belgrade, Special Editions. pp. 1-148. Tabakovic-Tosic M, Golubovic-Curguz V, Tosic D (2011). New technological methods in the integrated forest protection in the Republic of Serbia. Proceedings of International scientific conference ʺIntegrated plant protection – Strategy and tacticsʺ, Minsk, pp. 4955. Tabakovic-Tosic M, Jovanovic V (2007). Gypsy moth (Lymantria dispar L.) outbreaks in the Republic of Serbia 2003-2005. - Plant protection (FYUR Macedonia), 17: 213-224.

8577

Weseloh RM, Andreadis TG (1992). Epizootiology of the fungus Entomophaga maimaiga, and its impact in gypsy moth populations. J. Invertebr. Pathol. 59: 133-141. Weseloh RM, Andreadis TG, Onstad DW (1993). Modeling the influence of rainfall and temperature on the phenology of infection of gypsy moth Lymantria dispar larvae by the fungus Entomophaga maimaiga. Biol. Control. 3: 311-318.

African Journal of Biotechnology Vol. 11(34), pp. 8578-8585, 26 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.226 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Toxicity bioassay and effects of sub-lethal exposure of malathion on biochemical composition and haematological parameters of Clarias gariepinus Zubair Ahmad Department of Zoology, College of Science, P. O. Box 2455, King Saud University, Riyadh 11451, Kingdom of Saudi Arabia. Email: zahmed@ksu.edu.sa or zubair.ahmad.ah@gmail.com. Accepted 23 March, 2012

Clarias gariepinus were exposed to different concentrations of malathion to determine the 96 h LC50 value and its sub-lethal effects on haematological parameters and biochemical composition were also investigated. The 96 h LC50 value concluded was 8.22 mg/L. Specimens of C. gariepinus were exposed to sub-lethal concentrations (0.5, 1.0 and 2.0 mg/L) of pesticide for 4 weeks, which revealed that the pesticide had an adverse effects on various blood parameters. Red blood cell (RBC) and white blood cell (WBC) counts, hemoglobin (Hb) concentration and haematocrit (Ht) values decreased after the exposure of malathion. Plasma glucose level was elevated as plasma protein decreased. Liver and muscle glycogen also decreased in the fish exposed to Malathion. Alanine amino transferase (ALT), glutamate oxaloacetate transaminase (GOT) and glutamate pyruvic transaminase (GPT) activities increased in the fish exposed to malathion. Magnesium and calcium ions were also affected, but the effects were insignificant. Key words: Malathion, bioassay, sub-lethal exposure, Clarias gariepinus, biochemical and haematological changes INTRODUCTION Centuries ago in most parts of the world, pesticides are used to improve crop production by eradicating unwanted insects and human health by controlling undesirable plants, animals as well as disease vectors (Prakasam et al., 2001). Two billion kilograms of pesticides are applied annually to forests, gardens, homes and agricultural lands in United States of America alone (Aspelin and Grube, 1999). Among these pesticides are organophosphorus (OP) compounds commonly used as insecticides. An organophosphorus insecticide, malathion (O-dimethyl S-[1,2-di-(ethoxycarbonyl)ethyl] phosphorodithioate) is commonly used in agriculture and houses to control the variety of insects including aphids, beetles, pill bugs and scales.

Abbreviations: RBC, Red blood cell; WBC, white blood cell; Hb, hemoglobin; Ht, haematocrit; ALT, alanine amino transferase; GOT, glutamate oxaloacetate transaminase; GPT, glutamate pyruvic transaminase

Non-target animals including fish are greatly affected by the indiscriminate use of these pesticides. Fish appear to posses the same biochemical pathways to deal with the toxic effects of endogenous and exogenous agents as mammalian species does (Lackner, 1998). Since the fish constitute an important link in food chain and their contamination by pesticides imbalance the aquatic system hence, it is important to examine the toxic effects of pesticides on them. The haematological parameters like hemoglobin, haematocrit, blood cell counts, glycemia and ion concentrations can be used to find physiological response of contaminated environment (Dethloff et al., 2001). Therefore, when a clinical diagnosis of fish physiology is applied to determine the sub-chronic effects of pollutants, the blood parameters are often measured (Venkataramana et al., 2006). The activities of some enzymes like alanine amino transferase (ALT), glutamate oxaloacetate transaminase (GOT) and glutamate pyruvic transaminase (GPT) also indicate the impacts of pollut-

Ahmad

8579

Table 1. Number of dead specimens of C. gariepinus and their percentage of mortality (in parentheses) in different concentrations of Malathion at different time intervals.

Concentration (mg/L) Control (0.0) 7.0 7.5 8.0 8.5 9.0 9.5

Time (h) 24 1 (3.33) 3 (10.00) 5 (16.66)

ants on fish (Bucher and Hofer, 1990). These enzymes are normally found within the cells of liver, heart, gills and kidneys (Shalaby, 2009) but their increase in plasma indicates the tissue injury or organ dysfunction (Wells et al., 1996). However, effects of different pollutants on the biochemical and haematological parameters of fish have been documented (Bucher and Hofer, 1990; Al-Attar, 2005; Ogueji and Auta, 2007; Shalaby, 2009; Abalaka et al., 2011; Al-Kahem Al-Balawi et al., 2011). Clarias gariepinus is an economically important freshwater fish, native to Africa and has been introduced all over the world including Saudi Arabia and form a substantial part of freshwater fishery. In the present study, an attempt was made to investigate the toxicity of malathion to this fish. The mortality of fish and changes in haematological parameters (hemoglobin concentration, cell counts and haematocrit values), biochemical changes (glucose, glycogen and protein content) and enzymes’ (ALT, GOT and GPT) activities were monitored after lethal and sub-lethal exposure of this pesticide.

48 3 (10.00) 3 (10.00) 5 (16.66) 15 (49.99)

72 3 (10.00) 6 (20.00) 8 (26.66) 14 (46.66) 22 (73.33)

96 3 (10.00) 7 (23.33) 12 (40.00) 17(56.67) 22 (73.33) 27 (90.00)

graph prepared by the method described by Finney (1971). The fishes were exposed for four weeks in triplicates to three different sub-lethal concentrations (0.5, 1.0 and 2.0 mg/L) selected considering the LC50 value, some blood and biochemical parameters of these exposed specimens were analyzed. A control set was also run for the same time and with the same number of fish but without Malathion. Three fishes from each concentration (one fish from every replicate) were removed after every week during whole experimental period. Blood samples were obtained in heparinized vials by cutting the caudal peduncle; samples of clotted blood were discarded. In case of insufficient quantity, the blood of two or more fishes was pooled. Hemoglobin was estimated by the cyano-methemoglobin method (Blaxhall and Daisley, 1973). Haematocrit values were determined by using a micro-haematocrit centrifuge. The red blood cell (RBC) and white blood cell (WBC) count was made using Neubar haemocytometer after diluting the blood with Dace's solution and Turk's solution, respectively. For biochemical analysis, blood was centrifuged at 6000 rpm for 10 min at 4°C and the collected plasma was stored at -20°C till analyzed. Glucose, total protein, calcium (Ca), magnesium (Mg), GOT, GPT and ALT were analyzed using their respective kits (BIOMERIEUX, FRANCE). For statistical analysis, one way analysis of variance (ANOVA) was applied to test the significance of difference among the control and treated values. P values less than 0.05 were considered statistically significant.

MATERIALS AND METHODS Healthy and active specimens of C. gariepinus were procured from a fish farm located at Mozamiah, west of Riyadh. The length and weight of fishes ranged from 12 to 14 cm and 55 to 60 g, respectively. The fishes were kept in glass aquaria (160 × 55 × 60 cm) for two weeks to get acclimatized to laboratory conditions. During this period, the commercial fish food were fed twice daily to satiety. Medium of aquaria renewed daily. The water used was analyzed weekly for temperature, dissolved oxygen, hardness and pH, which were recorded as 23.5 ± 1.5°C, 7.5 ± 0.4 mg/L, 230.5 ± 4.5 mg/L as CaCO3 and 7.8 ± 0.5, respectively. After two weeks of acclimatization, ten fishes were transferred in each aquarium (55 × 30 × 35 cm) containing 30 L of water. Different concentrations (7.0, 7.5, 8.0, 8.5, 9.0 and 9.5 mg/L) of malathion were prepared by adding required volume from the stock solution prepared by diluting the original formulation. The malathion (MW: 330.4, CAS number: 121-75-5) with 57% active ingredient was obtained from Delta Company, Riyadh. A control set was run with same volume of water and same number of fish. The experiment was run in triplicates. The water was aerated with mechanical pump and feeding was stopped. Dead fishes were removed immediately and their numbers registered. The medium of aquaria was renewed daily. The 96 h LC50 was computed from a

RESULTS Table 1 shows the mortality of fish as a function of Malathion concentrations. The 96 h LC50 value for C. gariepinus computed from the graph (Figure 1) constructed between log10 concentrations (X axis) and probit of kill (Y axis) was expressed as 8.22 mg/L. The present findings indicate that in the C. gariepinus sublethal chronic exposure to malathion altered various blood parameters. The fish exposed to different concentrations of malathion manifested decrease in the erythrocyte and leucocyte counts, hemoglobin concentration and haematocrit values as compared to the control fish (Table 2). A slight change in the value of different indices (MCV, MCH and MCHC) was noticed in C. gariepinus after malathion exposure. Significant hyperglycemia and hypo-proteinaemia was evident in the fish exposed to different levels of malathion (Table 3). These changes were more pronounced in the higher

8580

Afr. J. Biotechnol.

6.5 6.0

kill

Probit of kill

5.5 5.0 4.5 4.0 3.5 3.0 0.80

0.85 0.90 0.95 1.00 Log10 concentration of malathion (mg/L)

Figure 1. Graph showing the relationship of probit of kill with log10 concentration . 10 of malathion used to deduce the LC50.

of malathion used to deduce the LC 50

doses and in the last period of exposure (Table 3). Reduction in the concen-tration of Ca ions was registered in the fish exposed to high dose of malathion and in the last period of exposure whereas Mg ions remain unchanged. It is quite apparent from the present investigation that malathion exposure to C. gariepinus had markedly elevated the PALT activity (Table 3) in all concentrations tested especially in the last period of exposure. The data embodied in (Table 3) also revealed that the malathion exposure had significantly (P<0.05) enhanced the activity of PGOT and PGPT enzymes after 2 weeks at higher doses (1.0, 2.0 mg/L) and after 4 weeks in all exposed groups. DISCUSSION The LC50 value (8.22 mg/L) recorded in the present study for C. gariepinus is less than the values (9.14 mg/L for Ptychocheiilus lucius, 11700 µg/L for black bullhead, 11.8 mg/L for Heteropneustes. fossilis, 15.3 mg/L for Gila elegance and 17.0 mg/L for Ictalurus furcatus) documented by Durkin (2008) and Faria et al. (2010) for various fish species. In contrast to the aforementioned

values, Pathiratne and George (1998) reported a lower 96 h LC50 value (2.2 ppm) for Oreochromis niloticus. Newhart (2006) tabulated the LC50 values of malathion for different species of fish which ranges from 0.06 to 7620 µg/L. Malathion was found to be highly toxic to fry of Labeo rohita (LC50 value 9 µL, Patil and David, 2008); Opheocephalus punctatus (LC50 16 µg/L, Pugazhvendan et al., 2009); walleye (LC50 64 ppb), brown trout (LC50 101 ppb) and cutthroat trout (LC50 280 ppb) and moderately toxic to minnows (LC50 8.6 ppm) and murrels (LC50 5.93 ppm) as summarized by Durkin (2008). The difference in the toxic potential of the pesticides may be attributed mainly to the susceptibility of the test animals and factors like pH and hardness of water. The disparity in the toxic potential of malathion can also be related to the differences in susceptibility and tolerance related to its accumulation, biotransformation and excretion. Discrepancies in metabolic pathways among species may result in varied patterns of biotransformation, leading to more or less toxic metabolites (Johnsson and Toledo, 1993). The magnitude of toxic effects of pesticides also depends on length and weight, corporal surface/body weight ratio and breathing rate (Murty, 1986). Oh et al. (1991) reported three factors causing selective toxicity of pesticides for various fish

Ahmad

8581

Table 2. Effects of Malathion exposure on hematological parameters of Clarias gariepinus.

Parameter

Concentration (mg/L)

Erythrocytes (Cellx106/mm3)

Exposure time (week) st

2nd

3rd

4th

Control (0.0) 0.5 1.0 2.0

1.66 ± 0.05 1.61±0.05 1.58 ±0.08 1.55 ± 0.06*

1.64 ± 0.061 1.60 ± 0.042 1.58 ± 0.053 1.53 ± 0.061*

1.60 ± 0.054 1.60 ± 0.042 1.46 ± 0.058* 1.52 ± 0.045*

1.65 ± 0.046 1.61 ± 0.054 1.43 ± 0.061* 1.41 ± 0.046*

Leucocytes (Cellx103/mm3)

Control (0.0) 0.5 1.0 2.0

36.51 ± 0.51 33.02 ± 0.52 33.56 ± 0.44 31.45 ± 0.61*

37.23 ± 0.65 34.56 ± 0.52 31.89 ± 0.57* 31.01 ± 0.43*

37.21 ± 0.71 32.65 ± 0.65 31.12 ± 0.50* 30.25 ± 0.59*

38.54 ± 0.54 35.01 ± 0.62 30.01 ± 0.42* 28.54 ± 0.24*

Haematocrit (%)

Control (0.0) 0.5 1.0 2.0

33.06 ± 0.72 32.54 ± 0.51 32.65 ± 0.92 31.45 ± 0.94*

34.76 ± 0.50 33.21 ± 0.82 32.35 ± 1.10 31.85 ± 0.96*

33.44 ± 1.02 32.23 ± 0.56 32.21 ± 1.05 30.42 ± 1.20*

34.21 ± 0.62 33.80 ± 0.96 31.65 ± 1.10 30.25 ± 1.09*

Hemoglobin (g/dl)

Control (0.0) 0.5 1.0 2.0

5.65 ± 0.09 5.11 ± 0.11 4.54 ± 0.14* 4.24 ± 0.09*

6.01 ± 0.12 5.15 ± 0.13 4.64 ± 0.13* 4.29 ± 0.08*

5.95 ± 0.10 5.35 ± 0.10 5.66 ± 0.09 4.24 ± 0.12*

6.12 ± 0.61 5.56 ± 0.29 4.54 ± 0.11* 4.14 ± 0.12*

MCV (fl/cell)

Control (0.0) 0.5 1.0 2.0

199.92 ± 3.75 202.54 ± 3.44 206.65 ± 4.35 202.90 ± 4.33

211.96 ± 4.21 207.56 ± 4.21 204.74 ± 3.56 208.17 ± 4.25

209.00 ± 3.58 201.44 ± 4.23 206.47 ± 5.21 200.13 ± 5.65

207.33 ± 4.12 209.94 ± 5.56 221.33 ± 5.25* 209.60 ± 5.95

MCH (Pg/cell)

Control (0.0) 0.5 1.0 2.0

34.04 ± 1.75 31.74 ± 1.64 28.73 ± 2.55 27.35 ± 2.32*

36.65 ± 1.65 32.29 ± 2.33 29.36 ± 2.45 28.04 ± 1.45*

37.19 ± 2.11 33.44 ± 1.45 29.87 ± 1.75 27.89 ± 2.45*

37.09 ± 1.75 34.53 ± 2.25 31.75 ± 2.35* 27.42 ± 1.46*

MCHC (%)

Control (0.0) 0.5 1.0 2.0

17.09 ± 1.35 15.70 ± 0.65 13.90 ± 1.15 13.48 ± 1.15

17.29 ± 1.46 15.51 ± 0.95 14.34 ± 1.26 13.47 ± 1.45

17.79 ± 1.25 16.60 ± 1.15 14.47 ± 0.85 13.94 ± 1.65*

17.89 ± 1.01 16.45 ± 0.98 14.34 ± 0.75 13.80 ± 1.45*

*Significant difference with control (P<0.05). Values are mean ± standard error.

species which are varied inhibition of acetylcholinesterase, detoxification and absorption. In general, the toxicity varied with respect to species, size of fish and duration of exposure (Oh et al., 1991; Dutta et al., 1995). Blood parameters, generally, of fish are considered as suitable tool for evaluating the effects of chemicals. Past investigators have also identified changes in several haematological parameters as indicators of pollutants exposure specially metals (Cyriac et al., 1989). Reduction in different blood parameters might be due to malfunctioning of the haematopoietic system caused by Malathion exposure. Similar to the present results, a

decrease in the number of RBC, hemoglobin and haematocrit values of diazinon (an organophosphate pesticide) exposed fish was reported by Banaee et al. (2008, 2011) and related it to destruction of cells and/or decrease in size of cells due to the adverse effects of pesticide. Zaki et al. (2009) reported that RBC count, hemoglobin concentration and PVC values were dwindled in the fish exposed to malathion. Adeyemo (2007) reported decreased hemoglobin, RBC count and haematocrit values in C. gariepinus exposed to lead nitrate. Generally, toxicants exposure exerts an adverse effect on the haematopoietic organs which in turn alters

8582

Afr. J. Biotechnol.

Table 3. Effects of malathion exposure on biochemical composition of Clarias gariepinus.

Concentration (mg/L) Control (0.0) 0.5 1.0 2.0

1 28.75 ± 1.78 28.65 ± 1.86 27.98 ± 1.98 28.05 ± 1.88

Exposure time (week) nd rd 2 3 29.35 ± 1.87 29.65 ± 2.09 29.65 ± 1.68 27.25 ± 1.22 27.65 ± 1.02 27.05 ± 1.95 27.85 ± 1.75 26.25 ± 1.86

4 28.85 ± 2.05 26.56 ± 1.96 26.85 ± 1.75 22.60 ± 1.85*

Glucose (mg/100ml)

Control (0.0) 0.5 1.0 2.0

45.25 ± 7.25 55.25 ± 7.55 65.25 ± 8.68* 70.25 ± 7.56*

48.35 ± 6.68 58.25 ± 7.25 64.65 ± 8.25* 72.25 ± 7.54*

46.52 ± 6.88 65.55 ± 5.85* 78.54 ± 6.75* 90.25 ± 8.25*

45.95 ± 6.88 60.25 ± 7.88* 70.25 ± 7.52* 95.25 ± 6.25*

Liver glycogen (mg/g)

Control (0.0) 0.5 1.0 2.0

9.12 ± 0.12 8.76 ± 0.17 7.25 ± 0.16* 7.36 ± 0.15*

8.92 ± 0.21 8.25 ± 0.18 7.25 ± 0.19* 7.32 ± 0.17*

8.90 ± 0.17 8.45 ± 0.16 7.2 5 ± 0.16* 7.35 ± 0.15*

8.91 ± 0.18 8.44 ± 0.18 7.35 ± 0.18* 7.25 ± 0.18*

Muscle glycogen (mg/g)

Control (0.0) 0.5 1.0 2.0

3.45 ± 0.08 3.25 ± 0.06 2.15 ± 0.06* 2.05 ± 0.05*

3.35 ± 0.06 3.25 ± 0.06 2.12 ± 0.05* 2.06 ± 0.05*

3.35 ± 0.06 3.10 ± 0.07 2.10 ± 0.05* 2.06 ± 0.06*

3.31 ± 0.05 2.94 ± 0.05 2.00 ± 0.05* 2.15 ± 0.05*

Ca (mg/dl)

Control (0.0) 0.5 1.0 2.0

180.45 ± 12.3 175.35 ± 10.1 165.25 ± 11.2 155.65 ± 13.1*

190.25 ± 10.2 165.25 ± 11.2 162.45 ± 12.3 155.35 ± 09.6*

200.45 ± 11.2 180.95 ± 12.3 155.25 ± 10.6* 150.65 ± 08.9*

202.45 ± 10.6 190.65 ± 11.4 160.25 ± 12.3 143.35 ± 11.8*

Mg (mg/dl)

Control (0.0) 0.5 1.0 2.0

38.25 ± 3.12 42.45 ± 2.25 41.24 ± 5.31 40.23 ± 5.51

36.03 ± 2.15 35.24 ± 3.25 37.45 ± 5.21 36.56 ± 3.45

35.32 ± 4.25 36.24 ± 5.25 37.45 ± 5.23 36.45 ± 4.24

36.45 ± 4.56 37.54 ± 4.26 35.24 ± 5.35 3.25 ± 4.45

PALT (IU/l)

Control (0.0) 0.5 1.0 2.0

50.43 ± 3.56 55.32 ± 4.21 58.56 ± 3.21 62.35 ± 4.03*

53.25 ± 2.65 62.21 ± 3.23 63.21 ± 3.56* 65.32 ± 4.12*

47.53 ± 3.21 60.23 ± 3.54 63.21 ± 4.05* 67.25 ± 3.87*

51.23 ± 3.65 63.12 ± 3.68* 65.32 ± 4.36* 70.23 ± 4.06*

PGOT (IU/l)

Control (0.0) 0.5 1.0 2.0

80.25 ± 15.2 95.25 ± 13.3 97.25 ± 16.2* 101.25 ± 14.2*

85.32 ± 13.5 101.25 ± 16.2 105.35 ± 14.3* 120.25 ± 16.2*

85.26 ± 12.4 108.23 ± 11.2* 110.45 ± 10.5* 125.35 ± 14.2*

80.65 ± 10.5 111.35 ± 11.3* 115.65 ± 10.2* 135.12 ± 11.2*

PGPT (IU/l)

Control (0.0) 0.5 1.0 2.0

65.12 ± 5.66 75.21 ± 8.55 85.25 ± 11.3* 99.25 ± 11.2*

68.22 ± 8.11 75.44 ± 6.88 86.25 ± 10.3* 92.35 ± 12.1*

68.21 ± 6.84 82.23 ± 8.25 83.25 ± 11.2* 109.25 ± 11.1*

70.21 ± 7.66 80.25 ± 8.25 92.25 ± 6.21* 114.23 ± 11.3*

Parameter

Total Protein (g/dl)

*Significant difference with control (P<0.05). Values are mean ± standard error.

blood parameters. Changes in the leukocyte system manifest in the form of leukocytosis with heterophilia and lymphopenia, which are characteristics of leukocyte

response in animals exhibiting stress. Al-Kahem (1995) reported reduced WBC count in the fish exposed to chromium and acclaimed it to be a consequence of

Ahmad

significant decline in the number of lymphocytes and thrombocytes. Reduction in the number of lymphocytes count in the fish, Oreochromis niloticus, exposed to trichlorfon was attributed to fall in the delivery of these cells to the circulation because of reduced production or alternatively an increased rate of removal from circulation and subsequent rapid destruction of cells. Leukocyte count diminished in tilapia exposed to phosalone (Jaffar and Rani, 2009). The blood cell indices like mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH) and mean corpuscular hemoglobin concentration (MCHC) seem to be changes that are more sensitive and can cause reversible changes in the homeostatic system of fish. Fluctuations in these indices correspond with values of RBC count, hemoglobin concentration and packed cell volume. The values of blood cell indices were enhanced in common carp and other freshwater fish after the exposure of acute toxic level of pesticides (Rao, 2010). The elevated level of glucose expressed in the blood of Malathion exposed fish may be due to the mobilization of glycogen into glucose to meet the increased demand for energy. Glucocorticoids and catecholamine hormones are known to produce hyperglycemia in animals and stress stimuli elicit rapid secretion of these hormones from adrenal tissue of the fish (Pickering, 1981). Such elevation may be due to enhanced gluconeogenesis response of stressed fish in their attempt to satisfy their new energy demands (Winkaler et al., 2007). The hyperglycemic condition in the present study may also be attributed to increased secretion of these hormones which causes glycolysis in the fish exposed to Malathion. The present result agrees with the findings of Abalaka et al. (2011) and Alkahem-Al-Balawi et al. (2011). The pesticide may change the functions of vital organs like liver and kidney, disrupting the homeostatic condition of the body which may alters the concentrations of metals. Similar observations have been reported by AlAkel et al. (2010) in the carp, Cyprinus carpio, after the exposure of dietary copper and support to the present investigation. The reduction in the protein level in the fish exposed to toxicants can be attributed to the cellular destruction or necrosis with subsequent impairment of protein synthesis machineries (Bradbury et al., 1987) or due to pathological alterations in kidney leading to excessive loss of proteins (Salah El-Deen et al., 1996). However, the hypoproteinaemia in the present study may also be ascribed to the aforementioned factors. Omoniyi et al. (2002) and Shalaby (2009) have reported hypoproteinaemia in the fish exposed to pollutants. In contrast to the present findings, a hyperproteinaemia was reported by Al-Attar (2005), Omitoyin (2007) and Abalaka et al. (2011). They were of the opinion that hyperproteinaemia may be the repercussion of water loss in plasma, elevated de novo synthesis or relative changes in blood protein mobilization. They also mentioned that such observed hyperproteinaemia may be

8583

indicative of efficient immune response and body physiological reaction to pollutants. An elevated level of ALT activity in fish exposed to malathion and extract of Porkiabiglosa pods was documented by Zaki et al. (2009) and Abalaka et al. (2011), respectively. These authors believe that the increased activity of enzyme in the exposed fish is suggestive of hepatic damages leading to their leakage in circulation (Mousa et al., 2008) and /or increased synthesis of enzyme in liver. Contrary to this, some authors like Okechukwu and Auta (2007) and Hedayati et al. (2010) reported that the ALT activity in the fish exposed to different pollutants was inhibited. This reduction in the enzyme activity was attributed to liver necrosis caused by toxicants and a possible damage to hepaptocytes or low sub-lethal doses of toxicants used to expose the fish. SGPT and SGOT enzymes are supposed to be sensitive to any change in the environment. Therefore, the exposure of fish to the pollutants expresses elevated level of these enzymes. Jeney et al. (1991) reported an elevated level of these enzymes (SGOT, SGPT) in the serum of fish exposed to ammonia. Their conception was that SGPT is highly sensitive to alterations in the environmental condition. Similarly, significantly higher values of glutamate oxaloacetate acid transaminase (GOT) activities were recorded by lemaire et al. (1991) in the fish fed diet without docosahexaenoic acid (DHA). Contrary to this, the activity of GPT did not show any change. They found that hepatic parenchyma develop into generalized massive steatosis, exhibiting necrosis centers with docosahexaenoic acid free diet. Exposure of monocrotophos to Corydoras punctatus increased the activity of SGOT and SGPT (Agrahari et al., 2007). In addition, Palanivelu et al. (2005) suggested that liver is rich in SGOT and SGPT, and damage to it could result in liberation of large quantities of these enzymes into the blood. Hence, an increase in the activity of these enzymes (PGOT and PGPT) after the pollutants treatment is a sensitive indicator of cellular damage (Palanivelu et al., 2005; Alkahem Al-Balawi et al., 2011). Therefore, higher activities of these enzymes registered in the present investigation may be ascribed to damage caused to liver by malathion. Conclusion Malathion seems to be moderately toxic to C. gariepinus. The LC50 (8.22 mg/L) registered were within the values obtained for other species of fish. The present study enhanced the knowledge of biochemical and haematological alterations in fish due to chronic sub-lethal exposure of Malathion. The data obtained in the present investigation amply emphasized that malathion had adverse effects on the metabolism of macromolecule and haematopoietic

8584

Afr. J. Biotechnol.

organs of fish. Therefore, the use of pesticide in the field may be a threat to human, fauna and flora of the environment. ACKNOWLEDGEMENT The King Saud University, Deanship for Scientific Research, Research Center, College of Science, is gratefully acknowledged for supporting the present research work. REFERENCES Abalaka SE, Esievo KAN, Shoyinka SVO (2011). Evaluation of biochemical changes in Clarias gariepinus adults exposed to aqueous and ethanolic extracts of Parkia biglobosa pods. Afr. J. Biotechnol. 10: 234-240. Adeyemo OK (2007). Haematological profile of Clarias gariepinus (Burchell, 1822) exposed to lead. Turkish J. Fish Aquat. Sci. 7: 163169. Agrahari S, Pandey KC, Gopal K (2007). Biochemical alteration induced by monocrophos in the blood plasma of fish, Channa punctatus (Bloch). Pest. Biochem. Physiol. 88: 268-272. Al-Akel AS, Alkahem-Al-Balawi HF, Al-Misned F, Mahboob S, Ahmad Z, Suliman EM (2010). Effects of dietary copper exposure on accumulation, growth, and hematological parameters in Cyprinus carpio. Toxicol. Environ. Chem. 92: 1865-1878. Al-Attar AM (2005). Biochemical effects of short-term cadmium exposure on the freshwater fish, Oreochromis niloticus. J. Biol. Sci. 5: 260-265. Alkahem HF (1995). Behavioral responses and changes in some haematological parameters of the cichlid fish, Oreochromis niloticus, exposed to trivalent chromium. J. King Abdul Aziz Univ. Sci. 7: 5-13. Alkahem Al-Balawi HF, Ahmad Z, Al-Akel AS, Al-Misned F, Suliman EM, Al-Ghanim KA (2011). Toxicity bioassay of lead acetate and effects of its sub-lethal exposure on growth, haematological parameters and reproduction in Clarias gariepinus. Afr. J. Biotech. 10: 11039-11047. Aspelin AL, Grube AH (1999). Pesticide industry sales and usage 1996 and 1997 market estimates, EPA 733-R-99-001,Office of pesticide programs, Washington, DC. Banaee M, Mirvaghefi AR, Rafei GR, Majazi Amiri B (2008). Effects of sub-lethal diazinon concentrations on blood plasma biochemistry of common carp. Int. J. Environ. Res. 2: 189-198. Banaee M, Sureda A, Mirvaghefi AR, Ahmadi K (2011). Effects of diazinon on biochemical parameters of blood in rainbow trout (Onchorhynchus mykiss). Pest. Biochem. Physiol. 99:1-6. Blaxhall PC, Daisley KW (1973). Routine haematological methods for use with fish blood. J. Fish Biol. 5: 771-781. Bradbury SP, Symonic DM, Coats JR, Atchison GJ (1987). Toxicology of fenvalerete and its constituent isomers to the fathead minnow (Piephales promeos) and blue gill (Lepomis macrochirus). Bull. Environ. Cont. Toxicol. 38: 727-735. Bucher F, Hofer R (1990). Effect of domestic wastewater on serum enzyme activities of brown trout (Salmo truta). Comp. Biochem. Physiol. 97: 385-390. Cyriac PJ, Antony A, Nambison PNK (1989). Hemoglobin and hematocrit values in the fish Oreochromis mossambicus (Peters) after short term exposure to copper and mercury. Bull. Environ. Conta. Toxicol. 43: 315-320. Dethloff GM, Bailey HC, Maier KJ (2001). Effect of dissolved copper on selected haematological, biochemical and immunological parameters of wild rainbow trout (Oncorhynchus mykiss). Archi. Environ. Conta. Toxicol. 40: 371-380. Durkin PR (2008). Malathion; Human Health and ecological risk assessment. Final report submitted to Paul Mistretta, PCR, USDA/Forest Service, Suthern region, Atlanta Georgia. SERA TR-

052-02-02c, p. 325. Dutta HM, Munshi JSD, Dutta GR, Singh NK, Adhikari S, Richmonds CR (1995). Age related differences in the inhibition of brain acetylcholinesterase activity of Heteropneustes fossilis (Bloch) by malathion. Comp. Biochem. Physiol. 111A: 331-334. Faria IR, Palumbo AJ, Fojut TL, Tjeerdema RS (2010). Water quality criteria report for malathion. Phase III: Application of the pesticide water quality criteria methodology. UCDAVIS, 7: p. 64. Finney DJ (1971). Probit analysis. S. Chand and Company Ltd. Ram Nagar, Delhi. Hedayati A, Safahieh A, Savari A, Marammazi JG (2010). Assessment of aminotransferase enzymes in yellowfin sea bream (Acanthopagrus latus) under experimental condition as biomarkers of mercury pollution. World J. Fish Mar. Sci. 2:186-192. Jaffar Ali HA, Rani VJ (2009). Effect of phosalone on haematological indices in the tilapia, Oreochromis mossambicus. Turk. J. Vet. Anim. Sci. 33:407-411. Jeney G, Nemcsok J, Jeney ZS, Olah J (1991). Acute effect of sublethal ammonia concentrations on common carp (Cyprinus carpio L.). II. Effect of ammonia on blood plasma transminases (GOT, GPT), GDH enzyme activity and ATP value. Aquaculture, 104: 149-156. Johnsson CM, Toledo MCF (1993). Acute toxicity of endosulfan to the fish Hyphessobrycon bifasciatus and Brachydanio rerio. Archiv Environ. Conta. Toxicol. 24: 151-155. Lackner R (1998). Oxidative stress in fish by environmental pollutants. Ecotoxicol., pp. 203-224. Lemaire P, Drai P, Mathieu A, Carriere S, Giudicell J, Lafaurie M (1991). Changes with different diets in plasma enzymes (GOT, GPT, LDH, ALP) and plasma lipids (Cholesterol, triglycerides) of sea- bass (Dicentrarchus labrax). Aquaculture, 93: 63-75. Mousa MMA, El-Ashram AMM, Hamed M (2008). Effects of Neem leaf th extract on freshwater fishes and zooplankton community. 8 International symposium on tilapia in aquaculture. The Central Laboratory for Aquaculture Research, Cairo, Egypt. Oct. 12-14. Murty AS (1986). Toxicity of pesticides to fish. CRC Press Inc Boca Raton, FL. p. 143 Newhart KL (2006). Environmental fate of malathion. California Environmental protection Agency. p. 20. Ogueji EO, Auta J (2007). Investigations of biochemical effects of acute concentrations of Lamda-cyhalothrin on African catfish, Clarias gariepinus â&#x20AC;&#x201C;Teugels. J. Fish. Int. 2: 86-90. Oh HS, Lee SK, Kim YH, Roh JK (1991). Mechanism of selective toxicity of diazinon to killifish (Oryzias latipes) and loach (Misgurnus anguillicaudatus). Aquat. Toxicol. Risk Assess. 14: 343-353. Okechukwu EO, Auta J (2007). The effects of sublethal doses of Lambda- cyhalothrin on some biochemical characteristic of the African catfish, Clarias gariepinus. J. Biol. Sci. 7: 1473-1477. Omitoyin BO (2007). Plasma biochemistry changes in Clarias gariepinus (Buchell, 1822) fed poultry litter. Asian J. Anim. Sci. 7: 4552. Omoniyi I, Agbon AO, Sodunke SA (2002). Effects of lethal and sublethal concentrations of Tobacco (Nicotiana tobaccum) leaf dust extract on weight and haematological changes in Clarias gariepinus (Burchell) J. Appl. Sci. Environ. Manage. 6: 37-41. Palanivelu P, Vijayavel K, Ezhilarasibalasubramanian S, Balasubramanian MP (2005). Influence of insecticidal derivatives (Cartap Hydrochloride) from the marine polychaete on certain enzymes of the freshwater fish Oreochromis mossambicus. J. Environ. Biol. 26: 191-196. Pathiratne A, George SG (1998). Toxicity of malathion to Nile tilapia, Oreochromis niloticus and modulation by other environmental contaminants. Aquat. Toxicol. 43: 261-271. Patil VK, David M (2008). Behaviour and respiratory dysfunction as an index of malathion toxicity in the freshwater fish Labeo rohita (Hamilton). Turk. J. Fish. Aquat. Sci. 8: 233-237. Pickering AD (1981). Stress and compensation in teleostean fishes: Response to social and physical factors. In: Pickering, AD (ed.) Stress and fish. Academic Press, New York, USA. pp. 295-322. Prakasam A, Sethupathy S, Lalitha S (2001). Plasma and RBCs antioxidant status in occupational male pesticide sprayers. Clin. Chem. Acta. 310: 107-112. Pugazhvendan SR, Narendiran NH, Kumaran RG, Kumaran S,

Ahmad

Alagapan KM (2009). Effect of malathion toxicity in the freshwater fish Opheocephalus punctatus-A histological and histochemical study. World J. Fish Mar. Sci. 1: 218-224. Rao DS (2010). Carbaryl induced changes in the haematological, serum biochemical and immunological responses of common carp, Cyprinus carpio, (L.) with special emphasis on herbal extracts as immunomodulators. Ph. D. Thesis, Andhra University, India. p. 235. Salah El-Deen MA, Sharada HI, Abu-El-Ella SM (1996). Some metabolic alteration in grass carp (Ctenopharyngodon idella) induced by exposure to cadmium. J. Egypt. Ger. Soc. Zool. 21: 441-457. Shalaby AME (2009). The opposing effects of ascorbic acid (Vitamin C) on ochratoxin toxicity in Nile tilapia (Oreochromis niloticus). http://www.ag.arizona.edu/ista/ista6web/pdf/209.pdf. Rterieved: 0504 -09. Venkataramana GV, Sandhya Rani PN, Murthy PS (2006). Impact of malathion on the biochemical parameters of gobiid fish, Glossogobius giuris (Ham). J. Environ. Boil. 27: 119-122. Wells RM, McIntyre RH, Morgan AK, Davis PS (1996). Physiological stress responses in big gamefish after exposure: Observations on plasma chemistry and blood factors. Comp. Biochem. Physiol. 84: 565-571.

8585

Winkaler EU, Santosh TRM, Machdo-Neto JG, Martinez CBR (2007). Acute lethal and sub-lethal effects of neem leaf extracts on neotrapical freshwater fish, Prochilodus lineatus. Comp. Biochem. Physiol. Part C, 145: 236-244. Zaki MS, Mostafa SO, Nasr S, Noor El-Deen AI, Ata NS, Awad IM (2009). Biochemical, clinicopathological and microbial changes in Clarias gariepinus exposed to pesticide malathion and climate changes. Reports Opinion, pp. 6-11.

Full Length Research Paper

Influence of technological treatments on bacterial communities in tilapia (Oreochromis niloticus) as determined by 16S rDNA fingerprinting using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) MAÏWORE J.1, TATSADJIEU NGOUNE L.2*, GOLI T.3, MONTET D.3 and MBOFUNG C. M. F.1 1

Department of Food Science and Nutrition, Food Microbiology laboratory, National School of Agro-Industrial Sciences, University of Ngaoundere, P. O. Box. 455 Ngaoundere, Cameroon. 2 Department of Food Technology and Quality Control, University Institute of Technology, University of Ngaoundere, P. O. Box. 455 Ngaoundere, Cameroon. 3 CIRAD Montpellier, UMR 95 Qualisud, TA B-95/16, 73, rue JF Breton 34398 Montpellier cedex 5, France. Accepted 20 January, 2012

Food quality and safety are major concern among consumers throughout the world in the context of globalization. Hence, the origin and the history of a food item are of prime interest when food quality is questioned. Precise determination of contamination source relies on the use of efficient and reliable methods. This study was carried out to assess the microbial ecology of fish upon technological treatments using 16S rDNA polymerase chain reaction-denaturing gradient gel electrophoresis (PCRDGGE) fingerprinting. Samples of tilapia from Montpellier (South-east of France) and Yagoua (far north of Cameroon) were used for this purpose. The technological treatments applied on fillets were marinade, drying, smoking and deep-freezing. When the 16S rDNA profiles were analysed by multivariate analysis, distinct microbial communities were detected. The band profiles of fish bacteria after each treatment were different and specific. Technological treatments applied on fillets from Montpellier did not have an effect on the biological markers present on the fillets. These bands could be used as specific markers for this region. One of the treatments, the marinade applied on the samples of Yagoua induced the disappearance of some bands on the DGGE profile. In spite of treatment applied on samples, it is possible to recover the geographical origin by using DNA of the bacterial community in fish even if it was treated. Key words: Traceability, tilapia, polymerase chain reaction-denaturing gradient gel electrophoresis (PCRDGGE), bacterial community, technological treatments. INTRODUCTION Tilapia which belongs to the family of Cichlidae and order of perciformes is a vegetarian fish. It is mostly appreciated for the quality and the taste of its flesh, the tolerance to different environments and the resistance to

*Corresponding author. E-mail: tatsadjieu@yahoo.fr. Tel: (+237) 99 52 37 27.

illnesses. The interest in tilapia explains the tremendous increase of the production in the last decade: 400 000 tons in 1990 and 1 800 000 tons in 2004. However, it has been shown that the freshly collected fish is contaminated by high concentrations of microorganisms: 102 to 107 CFU/cm² of skin surface (Liston, 1980) and 103 9 to 10 CFU/g of gills or intestines (Shewan, 1962). The world, particularly Europe has undergone many food crises, among these are listerioses, bovine spongiform

Maïwore et al.

encephalopathy (BSE) and salmonelloses (Montet et al., 2004). Food quality and safety are major concern among consumers throughout the world in the context of globalization. Hence, the origin and the history of a food item are of prime interest when food quality is questioned. The determination of geographical origin is one demand of the traceability of import-export products. One hypothesis of tracing the source of a product is by analysing it in a global way the bacterial communities on the food sample. The predominant bacterial flora would permit the determination of the capture area, production process or sanitary or hygienic conditions during post harvest operations (Montet et al., 2004). Many studies have shown that there is a link between aquatic micro-organisms and those of the fish. So, water composition, temperature and weather conditions can influence the bacterial community in fish (Austin and Austin, 1999; Wong et al., 1999; Jallabert et al., 2000; De Souza and Silva-Souza, 2001). Traceability is the capacity to find the history, use and origin of a food by registered methods (ACTA-ACTIA, 1998). Genetic traceability is realised by the characterization of DNA, since the microbial flora of aquatic products reflects those of the environment (Shewan, 1977; Horsley, 1977). Traceability uses recent techniques of molecular genetics which permit to visualize some characteristics of hereditary patrimony of individuals. Among the techniques of microbial characterization in foods, there are methods of independent culture that provide a profile representing genetic diversity of a specific environment (Giovanni et al., 1990). Several techniques of DNA analysis are used and all are based on the amplification by polymerase chain reaction (PCR) from the DNA of ecosystem. The mixture of PCR products is then analyzed by various techniques of electrophoresis, either by methods based on the analysis of size fragments [randomly amplified polymorphic DNA (RADP), amplified ribosomal DNA restriction analysis (ARDRA), restriction fragments length polymorphism (RFLP) and terminal RFLP (T-RFLP)] or by methods based on the sequence of fragments [single strand chain polymorphism (SSCP), temperature gradient gel electrophoresis (TGGE)/ denaturing gradient gel electrophoresis DGGE)]. Polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) is a method that combines two stages: firstly a stage of amplification using a unique pair of primers by PCR and a second stage of electrophoresis in acrylamide gel in denaturing conditions. Separation of PCR products in DGGE is based on the decrease of the electrophoretic mobility of partially melted doubled-stranded DNA molecule in polyacrylamide gels containing a linear gradient like formamide and urea at 60°C. Molecules with different sequences will have a different melting behaviour and will stop migrating at different position in the gel (Muyzer et al., 1993; Leesing, 2005). PCR-DGGE method presents incontestable advantages; it is rapid and done without germ culture

8587

step in Petri dishes. The bacterial species differentiation is based on the differential migration in gel during the DGGE according to the percentage of guanine + cytosine. The result obtained is expressed as a code bar in which every band corresponds to a micro-organism of the microbial community (Muyzer et al., 1993; Muyzer et al., 1996). In previous studies, Leesing (2005), Le Nguyen et al. (2007), Montet et al. (2008) and Tatsadjieu et al. (2009) used this technique on fresh fishes and they found out that the band pattern of the bacterial communities isolated from fresh fish obtained by PCR-DGGE was strongly linked to the microbial environment of the fish. They showed also that this technique could be applied to differentiate geographical location. The fish can be cooked immediately or treated before cooking. In order to preserve the quality and prolong the shelf life of fresh fish, some technological treatments are used. Among these ones are deep-freezing, drying and smoking. Marinade is used in most cases to tenderize and flavour the fillet. We choose these four treatments because they are the most used all over the world. The purpose of our study was to apply the PCR-DGGE method in analyzing the bacterial community on dried, marinated, smoked, refrigerated and deep-frozen fishes in order to determine if technological treatments have an effect on microbial markers of geographical origin. MATERIALS AND METHODS Fish sample collection and treatment The biological material used during this analysis was tilapia (Oreochromis niloticus) collected in the Logone River of Yagoua (July, 2009) in Cameroon where the temperature average was 30.5°C and in an experimental pond of the Cirad of Montpellier (August, 2009); in this case, the fishes were bred in tropical conditions (temperature up to 23°C). At least four fishes were collected from the two different locations. The samples were taken from the river and/or the pound and transferred to storage sterile bags. The samples were maintained on ice and transported to the laboratory. On each fish sample, two fillets were cut off and shared in two lots. The first lot constituted of fillets to be refrigerated and the second lot was treated. Each part of the treated fillet and non treated were put in separate sealed plastic bags, then kept frozen at -20°C until further analysis. Four types of treatments were applied to these fillets: marinade, drying, deep-freezing and smoking (only for Yagoua samples). During the marinade, fillets were immersed in acetic acid 4% for 30 min. The samples were dried in an oven at 105°C for 3.5 h. For deep-freezing, the fillets were placed in an enclosed and ventilated space at -40°C for 30 min. Smoking was carried out for 24 h with a mixture of fresh avocado leaves laid down on embers.

Total DNA extraction The DNA extraction was based on the method of Ampe et al. (1999) and Leesing (2005) but modified and optimised. For all the samples, 2 g of treated fillet was introduced in a sterile stomacher bag and ground with microbiological stomacher 3500 grinder for 3 min in sterile peptone water. 6 ml of the resulting mixture was

8588

Afr. J. Biotechnol.

poured in four Eppendhorf tubes for DNA extraction. The previous mixture obtained was centrifuged at 10000 rpm/min (Biofugopico Heraeus, Germany) at 4°C for 10 min. To the pellet obtained, 100 µL of buffer tris/ethylenediaminetetraacetic acid (TE) (Promega, France), 100 µL of lysozyme solution (25 mg/mL, Eurobio, France) and 50 µL of proteinase K solution (20 mg/mL, Eurobio, France) were added. Samples were mixed in vortex for 1 min and incubated at 42°C for 20 min. 50 µL of 20% sodium dodecyl sulphate (SDS) was added and the mixture was incubated at 42°C for 20 min. 400 µL of mixed alkyl trimethyl ammonium bromide (MATAB) 2% was added to hydrolysis products (65°C/10 min). After cellular lyses, a volume of phenol/chloroform/isoamyl alcohol (25/24/1, Carlo Erba, France) was added and the mixture was centrifuged at 10000 rpm/min for 10 min to allow the DNA extraction. A volume of chloroform/isoamyl alcohol (24/1) mixture was added and centrifuged at 10 000 rpm/min for 10 min in order to purify the DNA and to remove the remaining phenol. Proteins and the remaining polysaccharides in the aqueous phase were recovered at the interface with the organic phase after centrifugation at 10000 rpm/min for 10 min. The total DNA was precipitated with isopropanol (-20°C) followed by centrifugation. A volume of ethanol 70% was added to remove water around the DNA molecule. The DNA obtained was suspended in 50 µL of TE and stored at -20°C.

DNA amplification by polymerase chain reaction (PCR) The 16S rDNA were specifically amplified by PCR using bacterial couple of primers described by Muyzer et al. (1993): Gc338f (5'CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGG GGAC TCCTACGGGAGGCAGCAG, Sigma, France) and 518r (5'ATTACCGCGGCTGCTGG, Sigma, France). Amplification of the V3 variable region of bacterial communities’ 16S rDNA of fishes was realized using a guanine + cytosine (GC) clamp of 40 nucleotides. Each mixture (final volume of 50 µL) contained about 100 ng of template DNA. All the primers were at 0.2 µM, all the deoxyribonucleotide triphosphate (dNTPs) at 200 µM, 1.5 mM MgCl2, 5 µL of 10X of Taq buffer MgCl2 free (Promega, France) and 5U of Taq polymerase (Promega, France). During PCR reaction, non-specific hybridizations could be created; these hybridizations are due to complementary microsequences. To improve the specificity of the reaction, a ‘’touchdown’’ PCR was performed according to the protocol of Diez et al. (2001). An initial denaturation at 94°C for 1 min and 10 touchdown cycles of denaturation at 94°C for 1 min, then annealing at 65°C (with an increasing temperature 1°C per cycle) for 1 min and extension at 72°C for 3 min followed by 20 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 3 min. PCR products (5 µL) were then analyzed by conventional electrophoresis in 2% (w/v) agarose gel with 1X tris-acetate EDTA (TAE) buffer. 5 µL of products and 2 µL of stain (Bromophenol Blue) were loaded in wells. The migration lasted for 60 min at 100 V and was quantified with DNA mass ladder of 100 pb (Promega G2101 France). At the end of migration, the agarose gel was immersed in ethidium bromide (50 mg/L) (ETB: Promega H5041, France) for 15 min (Ampe et al., 1999), rinsed with distilled water for 30 min and then, observed on ultraviolet (UV) transilluminator using Gel Smart 7.3 system (Clara Vision, Les Ulis, France).

Denaturing gradient gel electrophoresis (DGGE) PCR products were analyzed by DGGE using the DCodeTM detection system (Bio-Rad laboratory, Hercules, USA). Method first described by Muyzer et al. (1993) and improved by Leesing (2005).

Samples containing approximately equal quantities of amplicons were loaded into 8% w/v polyacrylamide gel (Promega, France) with a denaturing gradient urea formamide spreading 30 to 60% (100% corresponding to 7 M of urea and 40% v/v, formamide, Promega, France). Volumes of PCR products used were 10 and 20 µL. Electrophoresis was performed at 60°C in TAE buffer (2 M trisacetate, 0.05 M EDTA, pH 8.3) at 20 V for 10 min and then 80 V for 12 h. After electrophoresis, the gels were stained with ETB 50 mg/L for 30 min and rinsed in distilled water for 20 min. The gels were photographed on a UV transilluminator using Gel Smart 7.3 system (Clara Vision, Les Ulis, France).

Gels analysis Individual lanes of the gel images were straightened and aligned using ImageQuant TL software vision 2003 (Amesham Biosciences, USA). Gels were analyzed by the software Picture As for TL (Picture Analysis Software, 2003). The permits automatically situated bands on gels and generated their migration fronts (Rf) corresponding to volumes of the band. Banding patterns were standardised with the two reference patterns: Escherichia coli and Lactobacillus plantarum DNA amplicons included in all the gels. This software permitted the identification of the bands and their relative position compared with the standard patterns. The generated bands represent different species of bacteria in a population. On the gel, an individual discrete band refers to a unique phylotype (Muyzer et al., 1996). The DGGE were manually scored as presence of band (1) or by absence of band (0) independent of the intensity. Patterns were compared using the Dice similarity coefficient (SD) calculated according to the following formula given by Heyndrickx et al. (1996): SD = 2Nab / (Na+Nb) Where Nab represents the number of bands common to sample A and B, Na and Nb represent the number of bands detected in sample A and B, respectively. Similarities index were expressed within a range of 0 (completely dissimilar) to 1 (perfectly similar). Dendograms were constructed using Statgraphics plus version 5 software (Sigma plus, France). Similarities in community structure were determinate using the cluster analysis with Euclidian distance measure.

RESULTS Effect of technological treatments on French fish (Montpellier, France) The samples were collected in an experimental pound of Cirad in Montpellier. The fillets had undergone marinade, deep-freezing and drying as treatments. Non treated samples in this case were represented by the refrigerated fillets. Amplifications were been realized on the total DNA extracted from fish fillets by using a couple of primers Gc 338f and 518r. On the verification gel obtained, the bands observed were between 298 and 220 pb of the molecular leader. For the three treatments realized, there were differences in band intensity; so, intensity of patterns 2 and 9 were of lower intensity than the others (Figure 1). The PCR-DGGE patterns of three replicates for each treatment revealed the presence of 7 to 14 visible and distinct bands of bacteria in fish (Figure 2 and Table 1).

8589

CM3

CM2

CM1

CG3

CG2

CG1

CS3

CS2

CS1

CR3

CR2

CR1

Ma誰wore et al.

DNA bands situated between 298 and 220 pb

E .coli

C M3

C M2

CG 2 CG 3 C M1

CG 1

CS3

CS2

CS1

C R3

C R1 C R2

L. plantarum

Figure 1. Verification gel of PCR products from the total bacterial DNA extracted from French fish. 1, DNA molecular leader; CR, refrigerated samples; CS, dried samples; CG, deep-frozen samples; CM, marinated samples. PCR, Polymerase chain reaction.

a b c d e f

g h i j k l m n

Figure 2. PCR-DGGE of 16S rDNA banding profiles of treated fish from Montpellier (France). CR, Refrigerated samples; CS, dried samples; CG, deep-frozen samples; CM, marinated samples. PCR-DGGE, Polymerase chain reaction-denaturing gradient gel electrophoresis.

8590

Afr. J. Biotechnol.

Table 1. Rf of migration observed on DGGE gels of French fish (Montpellier, France).

Rf 0.11 0.21

Lp 0 0

CR1 0 0

CR2 0 0

CR3 0 1

CS1 1 1

CS2 1 1

CS3 1 1

CG1 1 1

CG2 1 1

CG3 1 1

CM1 1 1

CM2 1 1

CM3 1 1

Ec 0 0

0.25

0.36 0.43 0.47 0.50 0.54 0.58 0.65 0.68 0.72 0.83

0 1 0 0 0 0 0 0 0 0

0 1 1 1 1 0 1 1 1 0

1 1 1 1 0 1 1 1 1 1

1 1 1 1 1 0 1 1 1 1

1 1 1 1 0 1 1 1 1 1

0 0 0 0 0 0 0 0 1 0

Lp, Lactobacillus plantarum; Ec, Escherichia coli; CR, refrigerated samples; CS, dried samples; CG, deep-frozen samples; CM, marinated samples; Rf, migration fronts; DGGE, denaturing gradient gel electrophoresis.

CG2 CG3 CG1 CM3 G1

CM2 CM1 G1

CS2 G1 CS3 CS1 G1

CR3 CR3 CR2 G1 G1

CR1 G1

100

Similarity Figure 3. Cluster analysis of 16S rDNA banding profile for treated fish bacterial communities from Montpellier (France). CR, Refrigerated samples; CS, dried samples; CG, deep-frozen samples; CM, marinated samples.

The references E. coli and L. plantarum patterns confirmed a good migration in DGGE. There were about six bands (g, h, i, l, m and n) common to all the treated samples (Figure 2). The pattern obtained for the bacterial community for the three replicates of the same treatment was almost similar. High similarity was also observed between marinated and dried samples. The statistical analysis of DGGE gel patterns shows the community similarity among treated and non treated fish samples (Figure 3). At 90% similarity level, two main clusters were observed: the first cluster was constituted of refrigerated samples while; the second cluster included marinated,

dried and deep-frozen samples. The bacterial communities of marinated, deep-frozen and dried samples were closely related. These results show also that dried, marinated and deep-frozen samples were closer in term of bacteria ecology. Effect of technological treatments on Cameroon fish The samples were collected in the Logone River in the far north region of Cameroon. The fillets have undergone marinade, smoking and drying as treatments. Non treated

Ma誰wore et al.

8591

DNA bands between

298 and 220 pb

Figure 4. Verification gel of PCR products from the total bacterial DNA extracted from Yagoua treated fish. 1, DNA mol ecular leader; FY, smoked samples; SY, dried samples; Y, non treated samples; MY, marinated samples. PCR, Polymerase chain reaction

samples were represented by the refrigerated fillets. As been often investigated using culture dependant methods for the French samples, the bands observed on the gel and culture independent methods (Spanggaard et al., were between 298 and 220 pb of the standard patterns. Therebacterial are only few published works that analyzed Figure 4: Verification gel of PCR products from2000). the total DNA extracted from DNA amplicons of Yagoua had a good intensity (Figure the bacterial communities on fish samples by PCRYagoua treated fish. 1: DNA molecular leader; FY smoked samples; SY: dried samples; Y: 4). The PCR-DGGE patterns of three replicates for each DGGE methods (Spanggaard et al., 2000; Leesing, 2005; non treated samples; MY: marinated samples. treatment revealed the presence of two to six visible and Le Nguyen et al., 2007; Montet et al., 2008; Tatsadjieu et distinct bands of bacteria in fish (Figure 5). As for the first al., 2009; Ma誰wore et al. 2009). These studies were DGGE gel, the references E. coli and L. plantarum carried out on fresh and non treated samples of fish. patterns confirmed a good migration. The great number In our study, the treatments induced some differences. of bands was observed on non treated samples while The band patterns of the bacterial communities isolated marinated samples presented fewer bands. However, from fish obtained by PCR-DGGE were strongly linked to among the treated samples of fish fillets, some bands of microbial environment of the fish. The skin is directly in bacteria had disappeared. The DGGE pattern revealed contact with water. That explain why there were common distinct bands with Rf distances between 0.26 and 0.89 bands to all the treatments of the same location. (Table 2). There were two bands (f and h with Rf, For a specific treatment, the analysis of samples (apart respectively equal to 0.48 and 0.57) common to dried, from the location) showed some differences in the non treated and smoked samples (Figure 5). The pattern migration pattern on the DGGE gel. However, the obtained for the bacterial community for the four replicates for each treatment had almost similar DGGE replicates of the same treatment was almost similar. pattern throughout the study. The differences in the Statistical analysis of DGGE gel patterns shows a bands profiles could be attributed to the bacterial cell wall community similarity among treated and non treated fish sensibility to physical agents when the fillets were treated samples (Figure 5). The dendrogram obtained (Figure 3) (Mescle and Zucca, 1996; Giraud, 1998). These show that at 65% similarity level with two main clusters differences could also be attributed to the fact that during were formed; the first cluster included marinated samples the DNA extraction, the cellular membrane of bacteria while the second one included non treated, dried and undergo an enzymatic hydrolysis, and all microbial smoked samples. At 98% level, the dendogram revealed species do not have the same sensibility to lytic agents that dried and smoked samples were closely related. because of the differences in their cell wall organisation (Wilson, 1997). During verification of PCR products, it was shown that DISCUSSION some French samples had bands of low intensity than the others. This could be explained either by the fact that Analysis of bacterial communities in fish samples has while amplification was running, PCR reaction could be

L. plantarum

E. coli

FY2

FY1

MY2

MY1

SY2

SY1

Afr. J. Biotechnol.

SY1

8592

a b c d

e f g h i j k l

Figure 5. PCR-DGGE of 16S rDNA banding profiles of treated fish from Yagoua (Cameroon). FY, Smoked samples; SY, dried samples; Y, non treated samples; MY, marinated sample. PCR-DGGE, Polymerase chain reaction-denaturing gradient gel electrophoresis.

Table 2. Rf of migration observed on DGGE gels of Yagoua (Cameroon) fishes.

Rf 0.26 0.34 0.41 0.45 0.48 0.54 0.56 0.61 0.72 0.78 0.83 0.89

SY1 1 0 0 0 1 0 1 1 1 0 1 0

SY2 1 0 0 0 1 0 1 1 1 0 1 0

MY1 0 0 0 0 0 0 0 0 0 0 0 0

MY2 0 0 0 0 0 0 0 0 0 1 0 1

FY1 0 0 0 1 0 0 1 0 0 0 0 0

FY2 0 0 0 1 0 0 1 0 0 0 0 0

Y1 0 1 0 0 1 1 1 0 1 0 0 0

Y2 0 1 0 0 1 1 1 0 1 0 0 0

Ec 0 0 0 0 0 0 0 0 1 0 0 0

Lp 0 0 1 0 0 0 0 0 0 0 0 0

Lp, Lactobacillus plantarum; Ec, Escherichia coli; FY, smoked samples; SY, dried samples; Y, non treated samples; MY, marinated samples; Rf, migration fronts; DGGE, denaturing gradient gel electrophoresis.

Maïwore et al.

inhibited by impurities like polysaccharides, lipids and proteins (Wilson, 1997) or by the reduced quantity of DNA extracts injected. Technological treatments applied to French fish sample did not have a destructive effect on bacterial communities because the main bands present on non treated samples were represented on the profiles of treated samples. Technological treatments in this case have not affected traceability markers. Marinade applied on Cameroon fish samples induced disappearance of some bands on DGGE profile. This could be due probably to bacteria dilution in acetic acid used for technological treatment. As a result of this dilution, there was no revelation of bands after running DGGE probably because the bacterial population was less than 104 (Dewettinck et al., 2001; Ogier et al., 2002; Fontana et al., 2005). Conclusion The aim of this study was to evaluate the effect of some technological treatments on bacterial 16S DNA fingerprints of bacterial communities present on fishes samples collected from Yagoua (Cameroon) and Montpellier (France). For this study, the PCR-DGGE analysis was used. We showed that the biological markers in most cases stayed stable among the different treatments. This global technique is quicker (less than 24 h) and can be used to determine the origin of fish even if the fillets have undergone technological treatment. REFERENCES ACTA-ACTIA (1998). Traçabilité, guide pratique pour l’agriculture et l’industrie alimentaire. ACTA ; Paris 19 Av. du Maine, 75732 Cedex. 15: p. 80. Ampe F, Ben Omar N, Moizan C, Wacher C, Guyot JP (1999). Polyphasic study of the spatial distribution of microorganisms in mexican pozol, a fermented maize dough, demonstrated the need for cultivation-independent methods to investigate traditional fermentations. Appl. Environ. Microbiol. 65: 5464-5473. Austin B, Austin DA (1999). Bacterial fish pathogens. Disease of wild and farmed fish. Third edition (revises), Springer-Praxi, London. p. 457. De Souza JA, Silva-Souza AT (2001). Bacterial community associated with fish and water from Congonhas river, Sertaneja, Parana, Brasil. Braz. Arch. Biol. Technol. 44(4): 373-381. Dewettinck T, Hulsbosch W, Van Hege K, Top EM, Verstraete W (2001). Molecular fingerprinting of bacterial population in ground water and bottled mineral water. Appl. Microbiol. Biotechnol. 57: 412418. Diez B, Pedros-Alio C, Marsh TL, Massana R (2001). Application of denaturing gradient gel electrophoresis (DGGE) to study the diversity of marine Pico eukaryotic assemblages and comparison of DGGE with other molecular techniques. Appl. Environ. Microb. 67: 29422951. Fontana C, Vignolo G, Cocconcelli PS (2005). PCR-DGGE analysis for the identification of microbial population from Argentinian dry fermented sausage. J. Microbiol. Method. 63: 254-263. Giovanni SJ, Britschgi TB, Moye CL, Field KG (1990). Genetic diversity in Sargasso Sea bacterioplankton. Nature, 345: 60-63. Giraud JP (1998). Microbiologie alimentaire. Dunod/RIA. Paris, p. 696.

8593

Heyndrickx M, Vauterin L, Vandamme P, Kerster K, De Vos P (1996). Applicability of combined amplified ribosomal DNA restriction analysis (ARDRA) patterns in bacterial phylogeny and taxonomy. J. Microbiol. Method, 26: 247-259. Horsley RW (1977). The bacterial flora of the Atlantic salmon (Salmo salar L) in relation to its environment. J. Appl. Bacterial. 36: 377-386. Jallabert B, Baroiller JF, Breton B, Fostier A, Le Gac F, Guiguem Y, Monod G (2000). Main neuro-endocrine and paracrine regulations of fish reproduction and vulnerability to xenobiotics. Ecotoxicology, 9: 25-40. Leesing R (2005). Identification et validation des marqueurs spécifiques pour la traçabilité des poisons d’aquaculture lors de leur import/export. Thèse, Université de Montpellier II, p. 173. Le Nguyen DD, Hanh Ha N, Dijoux D, Loiseau G, Montet D (2007). Determination of fish origin by using 16S rDNA fingerprinting of bacterial communities by PCR-DGGE: An application on Pangasus fish from Viet Nam. Food Control, 19: 454-460. Liton J (1980). Microbiology in fishery sciences. In Connel JJ (Ed) Advances in Fishery Science and Technology. Fish News Book. Farnham, England, pp. 138-157. Maïworé J, Tatsadjieu NL, Montet D, Loiseau G, Mbofung CMF (2009). Comparison of bacterial communities of tilapia fish from Cameroon and Vietnam using PCR-DGGE (polymerase chain reactiondenaturing gradient gel electrophoresis). Afr. J. Biotechnol. 8: 71567163. Mescle JF, Zucca J (1996). Les facteurs du développement, chapitre 1. In Bourgeois CM, Mescle JF, Zucca J Ed. Microbiologie Alimentaire Tome : Aspect microbiologique de la sécurité et de la qualité des aliments, Tec et Doc-Lavoisier. pp. 3-39. Montet D, Leesing R, Gemrot F, Loiseau G (2004). Development of an efficient method for bacterial diversity analysis: Denaturing Gradient Gel Electrophoresis (DGGE). Seminar Food Safety Int. trade, Bankok, Thaïlande. Montet D, Le Nguyen DD, El Sheikha Aly F, Condur A, Métayer I, Loiseau G. (2008). Application of PCR-DGGE in determining food origin: Cases studies of fish and fruits. Aspects of Applied Biology 87, Greening the Food Chain, 3-4: 11-22. Muyzer G, De Waal EC, Uitterlinden AG (1993). Profiling of complex microbial populations by Denaturing Gradient Gel Electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rDNA. Appl. Environ. Microbiol. 59: 695-700. Muyzer G, Hottenträger Teske A, Wawer C (1996). Denaturing gradient gel electrophoresis of PCR-amplified 16S rDNA: a new approach to analyze the genetic diversity of mixed microbial communities, In Akermanns ADL, van Elsas JD and de Bruijn FJ (ed.). Molecular microbial ecology manual. Kluwer Acad. Pub. Dordrecht, Netherlands. pp. 1-23. Ogier JC, Son O, Grus A, Tailliez P, Delacroix-Buchet A (2002). Identification of bacterial microflora in diary products by temporal Temperature Gradient Gel Electrophoresis. Appl. Environ. Microbiol. 68: 3691-3701. Shewan JM (1962). The bacteriology of fresh and spoiling fish and some related chemical changes. In Recent advances in food science (eds Hawthorn J & Muil Leitch J). 1: 167-193. Shewan JM (1977). The bacteriological of fresh and spoilage fish and the biochemical changes induced by bacterial action. In: Proceeding of the conference on handling processing and marketing of tropical fish, Trop. Prod. Instit. London. Spanggaard B, Huber I, Nielsen T, Appel K, Gram L (2000). The microbiota of rainbow trout intestine: a comparison of traditional and molecular identification. Aquaculture, 182: 1-15. Tatsadjieu NL, Maïworé J, Hadjia MB, Loiseau G, Montet D, Mbofung CMF (2009). Study of the microbial diversity of Oreochromis niloticus of three lakes of Cameroon by PCR-DGGE: Application to the determination of the geographical origin. Food Control, 21: 673-678. Wilson IG (1997). Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63: 3741-375. Wong HC, Chen MC, Liu SH, Liu DP (1999). Incidence of highly genetically diversified Vibrio Parahaemoliticus in seafood imported from Asian countries. Int. J. Food Microbiol. 52: 181-188.

Full Length Research Paper

Development of rapid PCR-RFLP technique for identification of sheep, cattle and goat’s species and fraud detection in Iranian commercial meat products Hamideh Amjadi1, Mohammad Javad Varidi1, Seyed Hassan Marashi 2, Ali Javadmanesh3 and Shahrokh Ghovvati4* 1

Department of Food Science and Technology, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran. 2 Department of Crop Biotechnology, College of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran. 3 Department of Animal Science, School of Agriculture, Food and Wine, Faculty of Science, University of AdelaideSA5000, Australia. 4 Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad, P. O. Box 917751163, Iran. Accepted 24 January, 2012

Identification of animal species used in commercial meat products is important with respect to economic and sanitary issues. The aim of this research was to realize ruminant species in meat products using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. The universal CB7u primers pair was used for amplifying ~195 bp fragment from a variable region of cytochrome-b mitochondrial DNA gene by polymerase chain reaction. Species differentiation was realized by digestion of the amplified ~195 bp fragments with Sse9I restriction enzyme. The results indicate that 7/7 of Kebab loghmeh, 9/10 of minced meat, 4/8 of beef burger and 2/5 samples of canned stew samples, were contaminated with one of prohibited ruminant species residual. Furthermore, the results reveal that 5/30 of samples had cross-contamination with a mixture of meat originated from various species, which was against the labelled nutrition information. Our results indicate that the PCRRFLP technique is a powerful and reproducible test for detection and separation of ruminant species residuals in commercial meat products, especially in developing countries. Key words: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), mitochondrial DNA, ruminant species, commercial meat products, cytochrome-b gene. INTRODUCTION Species identification in food products by amplification of mitochondrial DNA was increasingly employed during the last decades. Identification of animal species used in meat products from consumer point of view is very important with respect to economic, religious and sanitary issues (Meyer et al., 1995). Sometimes, labels of the food products may not show their real contents and sometimes ingredients separation of food products through physical or chemical tests may not always be

*Corresponding author. E-mail: Ghovvati@stu-mail.um.ac.ir. Tel: +98 511 879 56 18. Fax: +98 511 879 68 45.

possible. Therefore, special methods are required to determine and authenticate food products to support consumers against any possible fraud. The European Union controls the foods' safety by establishing stringent laws for food products labeling (Di Pinto et al., 2005). Recently, the protein-based and DNA-based techniques were widely used to identify prohibited species in food products. Protein-based technique includes the immunological (Haza et al., 1999; LopezCalleja et al., 2007), electrophoretical (Addeo et al., 1995; Mayer, 2005), chromatography such as high performance liquid chromatography (HPLC) and DNA-based methods, including DNA hybridization (Armstrong et al., 1992; Ebbehoj and Thomsen, 1991; Hunt et al., 1997;

Amjadi et al.

8595

Table 1. Samples submitted for the assay.

Species Bos taurus Capra hircus Ovis aries Equus caballus Equus asinus Gallus gallus

Knuutinen and Harjula, 1998; Mayer et al., 1997), polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis (Fajardo et al., 2009; Murugaiah et al., 2009), species-specific PCR (Che Man et al., 2007; Haunshi et al., 2009), multiplex PCR (Bottero et al., 2003; Ghovvati et al., 2009) and real-time PCR (Dalmasso et al., 2007; Zhang et al., 2007). The advantage of PCR based tests are higher accuracy, timesaving, high sensitivity and flexibility compared to other methods. The main objective of this study was to introduce a new PCR-based method to identify and detect animal species in food products. Hence, PCR-RFLP method was optimized and successfully used along with one restriction enzyme to identify contamination of ruminant species (cow, sheep and goat) and fraud detection in some Iranian commercial meat products.

MATERIALS AND METHODS Sample collection and preparation Samples of raw meat and autoclaved treated meat (121°C for 15 min) from three ruminant species and three non-ruminant species (equine and poultry) were analyzed as positive and negative controls, respectively. The study species are presented in Table 1. Four types of commercial meat products including minced meat (N = 8), Kebab loghmeh (N = 10), beef burgers (N = 7) and canned stew (N = 5) obtained from different companies were collected in Mashhad and Tehran, in Iran. All of these products were labeled (beef ingredient) and stored at -20°C until used for DNA extraction in order to prevent the enzymatic degradation of DNA. The samples were prepared based on the Santaclara et al. (2007) method. DNA extraction from autoclaved samples did not require any preparation. The oil in minced meat, Kebab loghmeh, beef burgers and canned stew samples was extracted by suspending in methanol-chloroform-water (2:1:0.8) solution for 2 h to prevent the oil disturbance in DNA extraction process. Afterward, the supernatant was discarded and the samples were washed by ultrapure water to eliminate the remnants of the used solution.

DNA extraction The extraction of mitochondrial DNA from all samples was performed using Tissue mini kit (QIAGEN, Hilden, Germany). The procedure was followed according to the manufacturer’s instruction. Concentration and purity of DNA were also assessed by

Positive control + + + -

NanoDrop™ ND-2000 spectrophotometry (Thermo, Wilmington, USA).

Oligonucleotide primers and PCR amplification Two universal primers CB7u (5'-GCG TAC GCA ATC TTA CGA TCA A-3') and CB7I (5'-CTG GCC TCC AAT TCA TGT GAG-3') used in this study were targeted ~195 bp fragment of variable region of mitochondrial cytochrome-b (Burger et al., 2002). Amplification of species fragments was carried out in a total volume of 25 µL containing 75 mM Tris–HCl (pH 8.8), 1 U of platinum Taq DNA polymerase (Invitrogen, California, USA), 0.1 mg/ml bovine serum albumin (BSA) (Roche, Mannhein, Germany), 0.2 mM each of dATP, dCTP, dGTP and dTTP (Pharmacia, Uppsala, Sweden), 2 mM MgCl2, 10 pmol of each primer and 50 ng of template DNA. Amplification was performed in an ABI 9700 thermal cycler (Applied Biosystems, California, USA) with the following cycling conditions; after an initial heat denaturation step at 94°C for 2 min, 35 cycles were programmed as follows: 94°C for 1 min, 60°C for 1 min, 72°C for 1 min and final extension step at 72°C for 5 min. The PCR products were analyzed by electrophoresis on 2% agarose gel (Invitrogen, California, USA) run in TBE 1X Buffer for 80 min at 90 V and stained with ethidium bromide (10 ng/ml) for 20 min. The size of the amplified fragments was estimated by M50 and M100 molecular marker (Iso Gene, Moscow, Russia).

RFLP analysis 5 µl of PCR product, 2 U of restriction enzyme Sse9I (Sibenzyme, Moscow, Russia), 0.1 µL BSA (1 mg/ml) and 2 µL of 10X reaction buffer (Sibenzyme, Moscow, Russia) at the final volume of 20 µL were incubated for 2.5 h at 55°C and it was inactivated at 65°C for 20 min. Digestion products were separated by electrophoresis on non-denaturing 8% polyacrylamide gel stained with AgNO3. The obtained fragment lengths are shown in Table 2.

RESULTS AND DISCUSSION DNA extraction Many studies have evaluated the efficiency of various methods of DNA extraction from food materials (Ghovvati et al., 2009). In this research, DNA extraction was based on the binding of DNA to silica matrix in the presence of chaotropic agents. This technique was considered effective for elimination of PCR inhibitors that might interfere with polymerase chain reaction. The result demonstrates that extracted DNA was sufficient for Cyt-b

8596

Afr. J. Biotechnol.

Table 2. Fragments lengths for ruminant species in this study after digestion of the PCR products with restriction enzyme Sse9I.

Species Ovis aries (sheep) Capra hircus (goat) Bos taurus (cattle)

Amplicon (bp) 193 195 185

Fragment length (bp) 13, 75, 105 13,182 3, 68, 114

Figure 1. Specificity of primers for amplification of ~195 bp fragments of various species under varying conditions, Lane 1, Negative control reagent; lane 2, Capra hircus DNA; lane 3, Ovis aries DNA; lane 4, Bos taurus DNA; lane 5, Gallus gallus DNA; lane 6, Equus caballus DNA; lane 7, Equus asinus DNA; M, 100-bp ladder (100 to 1000 bp).

gene amplification. This approach was less timeconsuming than the one previously described by Matsunga et al. (1999). Polymerase Chain Reaction The CB7u and CB7I primer produced specific fragments of about 195 bp for ruminant species. The primer specificity for identification of the extracted DNA from species is indicated in Figure 1. The size of ruminant fragments depends on the number of deletions in each species sequence (Burger et al., 2002). In this study, Cytb gene sequence from mitochondrial DNA was used for ruminant DNAs identification and detection in food materials because mitochondrial DNA has numerous copies per each cell and it can provide the sequence variety for identification of closely related species faster than genomic DNA (Bellis et al., 2003; Ghovvati et al.,

2008). The primer binding sites were chosen so that it can generate specific amplimers less than 200 bp. Furthermore, it is feasible to present a method capable of identifying animal species DNAs in food materials which have undergone severe preparation processes. This degradation can, however, cause problems in using PCR method that have been reported by Bottero et al. (2003). Testing samples The applicability of this method in industrial food materials (Kebab loghmeh, minced meat, beef burgers and canned stew) has been proved by this study. The results are shown in Figure 2. Results of RFLP assay reveal that 6/7 (86%) of Kebab loghmeh samples, 6/10 (60%) of minced meat samples and 2/5 (40%) of canned stew samples were contaminated by sheep residuals, while 1/10 (10%) of minced meat samples and 1/8

Amjadi et al.

8597

Figure 2. PCR amplification in commercial industrial meat product samples (Kebab loghmeh, minced meat, beef burger and stew conserve). Lane 1, Positive control; lane 2, beef burger (A); lane 3, beef burger (B); lane 4, beef burger (C); lane 5, beef burger (E); lane 6, minced meat (A); lane 7, minced meat (B); lane 8, minced meat (C); lane 9, minced meat (D); lane 10, canned stew (A); lane 11, canned stew (E); lane 12, canned stew (B); lane 13, Kebab loghmeh (A); lane 14, Kebab loghmeh (B); lane 15, Kebab loghmeh (G); lane 16, Kebab loghmeh (C); lane 17, Kebab loghmeh (D); C -, negative control reagent; M, 50-bp ladder (50 to 500 bp)

Figure 3. Restriction profiles of ~195 bp Cyt-b PCR products obtained after treatment with Sse9I on 8.0% polyacrylamide gel. Lane 1, Bos taurus; lane 2, Ovis aries; lane 3, Capra hircus; lane 4, positive control (undigested); lane 5, negative control reagent; lane 6, minced meat (A); lane 7, minced meat (B); lane 8, Kebab loghmeh (F); lane 9, beef burger (A); lane 10, beef burger (B); lane 11, canned stew (C); lane 12, beef burger (E); lane 13, Kebab loghmeh (A); lane 14, canned stew (E); M50, 50-bp ladder (50 to 500 bp).

(12.5%) of beef burgers samples were contaminated by goat residuals in contrast to what was mentioned on their labels. Cross-contamination of goat and sheep residuals in Kebab loghmeh, minced meat and beef burgers were 14, 20 and 50%, respectively (Figure 3). In total, 80% of the collected samples were contaminated by prohibited ruminant residuals in contrast to what was labelled. With respect to all Iranian food producers, our results indicate that only 20% of the food labels were approved by DNA test. Fraud in meat based products and their side products by adding low quality and cheap meat has always been an issue in food industries (Girish et al., 2005; Zha et al., 2010). The PCR-RFLP method used in this research is very specific to be applied for food products that have endured severe heating condition during preparation process. Moreover, the PCR-RFLP is a cost-effective and reliable

method for samples which have been deformed and contain only scanty amounts of DNAs from various species. This method also plays an important role in the food industry regulation and legal issues. Direct sequence determination method for testing the samples is highly reliable and accurate; however, it is costly and time consuming (Meyer et al., 1995; Partis et al., 2000). The PCR-RFLP method as an alternative to direct sequence determination of PCR products, is an efficient technique for identification of animal species used in food materials (Fajardo et al., 2006; Pfeiffer et al., 2004; Rea et al., 2009). During judicial enquiries, limited amount of samples and also usually damaged samples during the production process, rRNA and mtDNA are generally used for fraud identification and species identification. This is due to the fact that these genes have more copies per each cell in these regions compared to genomic DNA,

8598

Afr. J. Biotechnol.

and this distinction is statistically significant. Consumer groups and food producers themselves are increasingly demanding regulations for food safety. In Iran, food products are controlled by established rigid laws for labeling of products and all industry managers are familiar with the laws. Therefore, the information claimed on the food products labels must exactly reflect the products' content. To control the quality of the food products, it is required to develop new methods capable of proving and detecting various species used in them (Ghovvati et al., 2009). A recent study by Doosti et al. (2011) reported a detected adulteration in industrial meat products by PCR-RFLP assay in Iranian commercial meat products. Their result indicate that 6 of 68 fermented sausages (8.82%), 4 of 48 frankfurters (8.33%), 4 of 55 hamburgers (7.27%), 2 of 33 hams (6.6%), and 1 of 20 cold cut meat (5%) were contaminated with prohibited meat. In addition, Chen et al. (2010) developed an efficient PCR-RFLP method for authenticating meat products from five farm animals on the basis of the mitochondrial 12S rRNA gene sequence variations. They successfully detected cattle DNA in yak DNA at ratios of 2:8 to 5:5 in one reaction, using this method. Di Pinto et al. (2005) also developed duplex PCR for detection of pork meat in horse meat fresh sausages. Their results reveal the presence of pork meat in 6/30 and the total absence of horse meat in 1/30 of the analyzed horse sausage samples. In this research, one universal primer pair along with one endonuclease enzyme was used for simultaneous identification of three ruminant species, while some studies used several different primers followed by enzymatic digestion (Myers et al., 2003; Santaclara et al., 2007; Stamoulis et al., 2010).

Conclusion The correlation between the obtained results and determined presumptions demonstrate that the PCRRFLP is a powerful method not only for genetic research and identification of different types of animal species based on mitochondrial DNA sequence, but can also be a powerful, reproducible and rapid test for detection and separation of ruminant species residuals in commercial meat products even in cases of mixtures of species, and thus can be widely used in diagnostic laboratories. PCRRFLP is a cost-effective and reliable method for heated and processed food products containing low concentrations of DNA. The PCR-RFLP method described herein was optimized and used to monitor and control the quality of food products and identified frauds in some of the collected samples. The results indicate the necessity of PCR-based tests in Iranian national standards to increase the quality of meat products, customers' health and satisfaction.

ACKNOWLEDGEMENTS The authors would like to thank the Excellent Center in Animal Science of Ferdowsi University of Mashhad, Iran and the Animal Biotechnology Institute of Ferdowsi University of Mashhad for kindly providing necessary facilities and equipments. This work was supported by a grant from the Agricultural Faculty of Ferdowsi University of Mashhad, Iran. REFERENCES Addeo F, Garro G, Intorcia N, Pellegrino L, Resmini P, Chianese L (1995). Gel electrophoresis immunoblotting for thedetection of casein proteolysis in cheese. J. Dairy Res. 62: 297-309. Armstrong SG, Leach DN, Wyllie SG (1992). The use of HPLC protein profiles in fish species identification. Food Chem. 44: 147-155. Bellis C, Ashton KJ, Freney L, Blair B, Griffiths LR (2003). A molecular genetic approach for forensic animal species identification. Forensic Sci. Int. 134: 99-108. Bottero MT, Dalmasso A, Nucera D, Turi RM, Rosati S, Squadrone S, Goria M, Civera T (2003). Development of a PCR assay for the detection of animal tissues in ruminant feeds. J. Food Prot. 66: 23072312. Burger J, Schoon R, Zeike B, Hummel S, Herrmann B (2002). Species determination using species-discriminating PCR-RFLP of ancient DNA from prehistoric skeletal remains. Anc. Biomol. 4: 19-23. Che Man YB, Aida AA, Raha AR, Son R (2007). Identification of pork derivatives in food products by species-specific polymerase chain reaction (PCR) for halal verification. Food Control, 18: 885-889. Dalmasso A, Fontanella E, Piatti P, Civera T, Secchi C, Bottero MT (2007). Identification of four tuna species by means of real-time PCR and melting curve analysis. Vet. Res. Commun. 31: 355-357. Di Pinto A, Forte VT, Conversano MC, Tantillo GM (2005). Duplex polymerase chain reaction for detection of meat in horse meat fresh sausages from italian ratail sources. Food Control, 16: 391-394. Doosti A, Dehkordi PG, Rahimi E (2011). Molecular assay to fraud identification of meat products. J. Food Sci. Technol. DOI 10.1007/s13197-011-0456-3. Ebbehoj KF, Thomsen PD (1991). Species differentiation of heated meat products by DNA hybridization. Meat Sci. 30: 221-234. Fajardo V, Gonzalez I, Dooley J, Garret S, M Brown H, Garcıaa T, Martın R (2009). Application of polymerase chain reaction–restriction fragment length polymorphism analysis and lab-on-a-chip capillary electrophoresis for the specific identification of game and domestic meats. J. Sci. Food Agric. 89: 843-847. Fajardo V, GonzaLez I, Lopez-Calleja I, Martian I, Hernandez PE, Garciaa TR, Martian R (2006). PCR–RFLP authentication of meats from red deer (Cervuselaphus), fallow deer (Dama dama), roe deer (Capreolus capreolus), cattle (Bostaurus), sheep (Ovis aries) and goat (Capra hircus). J. Agric.Food Chem. 54: 1144-1150. Ghovvati S, Nassiri MR, Mirhoseini SZ, Heravi Moussavi A, Javadmanesh A (2009). Fraud identification in industrial meat products by multiplex PCR assay. Food Control, 20: 696-699. Ghovvati S, Nassiri MR, Mirhoseini SZ, Heravi Moussavi A, Javadmanesh A, Soltani M, Abbasi H, Doosti M (2008). Fraud detection in fishmeal by 12S rRNA and 16S rRNA of mtDNA sequence. Modern Genetics, 14: 45-48. Girish PS, Anjaneyulu ASR, Shivakumar BM, Anand M, Patel M, Sharma B (2005). Meat species identification by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of mitochondrial 12s rRNA gene. Meat Sci. 70: 107-112. Haunshi S, Basumatary R, Girish PS, Doley S, Bardoloi RK, Kumar A (2009). Identification of chicken, duck, pigeon and pig meat by species-specific markers of mitochondrial origin. Meat Sci. 83: 454459. Haza AI, Morales P, Martın R, Garcıa T, Anguita G, Sanz B. Hernández PE (1999). Detection and quantification of goat’s cheese in ewe’s

Amjadi et al.

cheese using a monoclonal antibody and two ELISA formats. J. Sci. Food Agric. 79: 1043-1047. Hunt DJ, Parkes HC, Lumley ID (1997). Identification of the species of origin of raw and cooked meat products using oligonucleotide probes. Food Chem. 60: 437-442. Knuutinen J, Harjula P (1998). Identification of fish species by reversedphase high-performance liquid chromatography with photodiodearray detection. J.Chromatogr. B 705: 11-21. Lopez-Calleja IM, Gonzalez I, Fajardo V, Rodrıguez MA, Hernandez PE, Garcıa T, Martín R (2007). Application of an indirect ELISA and a PCR technique for detection of cows’ milk in sheep’s and goats’ milk cheeses. Int. Dairy J. 17: 87-93. Matsunga T, Chikuni K, Tanabe R, Muroya S, Shibata K, Yamada J, Shinmura Y (1999). A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Sci. 51: 143-148. Mayer HK (2005). Milk species identification in cheese varieties using lectrophoretic, chromatographic and PCR techniques. Int. Dairy J. 15: 595–604. Mayer HK, Heidler D, Rockenbauer C (1997). Determination of the percentages of cows’, ewes’ and goats’ milk in cheese by isoelectricfocusing and cation-exchange HPLC of g- and para-kcaseins. Int. Dairy J. 7: 619-628. Meyer R, Hoefelein C, Luethy J, Candrian U (1995). Polymerase chain reaction-restriction fragment length polymorphism analysis: a simple method for species identification in food. J. AOAC In. 78: 1542-1551. Murugaiah C, Mohd Noor Z, Mastakim M, Bilung LM, Selamat J, Radu S (2009). Meat species identification and Halal authentication analysis using mitochondrial DNA. Meat Sci. 83: 57-61. Myers M, Yancy HF, Farrell DE (2003). Characterization of a polymerase chain reaction-based approach for the simultaneous detection of multiple animal-derived materials in animal feed. J. Food Prot. 66: 1085-1089. Partis L, Croan D, Guo Z, Clark R, Coldham T, Murby J (2000). Evaluation of a DNA fingerprinting method for determining the species origin of meats. Meat Sci. 54: 369-376. Pfeiffer I, Burger J, Brenig B (2004). Diagnostic polymorphisms in the mitochondrial cytochrome b gene allow discrimination between cattle, sheep, goat, roe buck and deer by PCR-RFLP. BMC Genet, 5: 30-34.

8599

Rea S, Storani G, Mascaro N, Stocchi R, Loschi AR (2009). Species identification in anchovy pastes from the market by PCR-RFLP technique. Food Control, 20: 515-520. Santaclara FJ, Espineira M, Cabado AG, Vieites J (2007). Detection of land animal remains in fish meals by the polymerase chain reactionrestriction fragment length polymorphism technique. J. Agric. Food Chem. 55: 305-310. Stamoulis P, Stamatis C, Sarafidou T, Mamuris Z (2010). Development and application of molecular markers for poultry meat identification in food chain. Food Control, 21: 1061-1065. Zha D, Xing X, Yang F (2010). A multiplex PCR assay for fraud identification of deer products. Food Control, 21: 1402-1407. Zhang CL, Fowler MR, Scott NW, Lawson G, Slater A (2007). A TaqMan real-time PCR system for the identification and quantification of bovine DNA in meats, milks and cheeses. Food Control, 18: 11491158.

African Journal of Biotechnology Vol. 11(34), pp. 8600-8605, 26 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.2000 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

A new screening method for discovering antibacterial agents from filamentous fungi Guohua Chen1, Yehui Tan2, Kaizhi Li2, Fangqing Chen1*, Ruiping Li1, Chaoyin Yue1 and Wei Shao1 1

College of Chemistry & Life Science, China Three Gorges University, Yichang 443002, Hubei Province, China. Key Laboratory of Marine Bio-resources Sustainable Utilization, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301, China.

Accepted 10 April, 2012

Rapid development of resistance among major bacterial pathogens renders antibiotics more and more ineffective and it is crucial to find novel antibiotics for controlling these pathogens. Since highthroughput screening (HTS) that selects antibacterial agents according to targets in vitro rather than whole-cell have not proven effective in the discovery of new antibiotics; new approaches for discovering the next generation of antibiotics are urgently needed. Filamentous fungi are an important source for many of the antibiotics currently used, but screening them for novel antibiotics is difficult primarily due to the lack of efficient screening methods capable of maintaining whole bacterial cell metabolism. In this study, mixed agar plate culture (MAPC) screening method is described. The method maintains the advantages of traditional whole-cell screening but offers increased screening efficiency. Furthermore, its simplicity and convenience makes it suitable for many laboratories. MAPC screening increases the probability of discovering novel antibacterial agents from filamentous fungi under laboratory conditions. Key words: Drug-resistant bacterial pathogens, novel antibiotics; screening method, filamentous fungi products.

INTRODUCTION Evidence of antibiotic resistance is accumulating, increasing the urgency to develop new antibiotics (Knapp et al., 2010; Xuan et al., 2010; Alagesaboopathi, 2011). However, antibacterial drug discovery and development has slowed considerably in recent years. Traditional approaches have not continued to yield novel classes of antibacterial compounds and despite a wealth of new bacterial targets, the current framework of high-throughput screening (HTS) in major pharmaceutical industries has not been successful in discovering inhibitory compounds for therapeutic use (Opar, 2007; Payne, 2008). There is excitement whenever a new antibiotic target or a new antibiotic mechanism has been identified because it could lead to a new treatment for drugresistant bacterial pathogens by the HTS method (Bax et

*Corresponding author. E-mail: gotwan@yahoo.com.

al., 2010). However, many technical difficulties remain as indicated by the low probability of success in creating a new antibiotic approved for clinical use (Payne et al., 2007). An isolated target gives no indication of the complexity of developing a successful antimicrobial drug. As a result, some companies have turned away from HTS and returned to more traditional approaches (Opar, 2007). The discovery of penicillin in the 1940s was soon followed by the discovery of a large number of antibiotics from microbes using traditional approaches, in particular from fungi and actinomycetes. However, it is difficult to discover new antibiotics from natural products because core technologies had not evolved (Lam, 2007). Success in discovering new antibiotics from microbial communities should focus on how to maximize screening efficiency, especially at the early stage that is the slowest, most labor intensive, step in the screening process used to discover novel drugs (Casenghi,et al., 2007). To meet this urgent medical need, new drug discovery technologies

Chen et al.

8601

have proven to be a potent group for the discovery of new antibiotic products (Ho et al., 2003), they were selected for the research leading to this paper. A rapid screening method using mixed agar plate culture (MAPC) with the help of systematic screening by appropriate culture conditions, increases the chance of finding novel antibacterial agents by avoiding pure cultures as the first stage to increase screening efficiency.

MATERIALS AND METHODS Preparing mixed culture plates

Figure 1. Perpendicular lines and their numbers on the filter paper and the base of Petri dish.

must be developed that improve the efficiency of the discovery process (Peláez, 2006). Untapped biological resources coupled with “smart screening” methods could provide the means for so doing (Li and Vederas 2009). Fungi are one of the major antibiotic-producing organisms and one of the most diverse groups of organisms, so the search for novel antibiotics from fungi is promising. In 1995, six of the world’s 20 best-selling pharmaceuticals are fungal derived compounds (Ho et al., 2003). In recent years fungi have been shown to produce a plethora of bioactive secondary metabolites, some of them featuring new carbon frameworks hitherto unknown in nature. These compounds are of interest as they provide new structural frameworks for medical research, and the pharmaceutical industry has become increasingly interested in screening fungi for novel antibiotic activity (Kjer et al., 2010). In the past, discovery of novel medical compounds from fungi has often resulted from accidental discovery or from a ubiquitous fungus at the beginning of an antibiotic screening by pure culture. However, this approach is difficult to turn up new medical compounds again due to its unsystematic screening. The question is how to detect antibacterial agents produced by a filamentous fungus in nature, particularly if it is produced in the soil, the ultimate but highly complex reservoir of fungal diversity. Moreover, due to the large number of species in nature (Hawksworth, 2001), it is not feasible to evaluate the antibacterial activity of every pure strain, particularly since many filamentous fungi do not produce useful antibacterial agents. This may partially explain the failure of conventional screening to discover new antibiotics from filamentous fungi. Nevertheless, since filamentous fungi

Soil samples were collected from different locations covered with plant litter in the south of China, and all of these locations are common places, so every Chinese citizen is permitted to observe and study in field according to the Law of the People's Republic of China. Cultures were maintained on Potato Sucrose Agar (PSA, 20% potato, 3% sucrose, 1.5% agar). Potatoes were chopped, cooked, and the boiled solution was filtered. Sucrose and agar were added to the filtered solution to make PSA, and then 15 ml of warm liquid PSA was poured into a 100×15 mm sterilized Petri dish. When the agar solidified, two pieces of sterilized filter paper (diameter 9 cm) were laid on the surface and another 20 ml warm liquid PSA was poured into the Petri dish to cover the filter papers. Before the paper was laid, two perpendicular lines were drawn through center of the lower paper, number 1 or number 2 was given to each line, and this face was laid downward on the dish. After the second agar layer solidified, two perpendicular lines were also drawn and numbers were given to each line under base of the dish according to the filter paper (Figure 1). Each soil sample was spread on the surface of the PSA and cultured at 28°C for 8 days, allowing filamentous fungi to form colonies in MAPC. After 8 days of incubation, the upper layers, including the filter papers, upper PSA medium and microbial community were lifted up. The lower filter paper was carefully taken out and the other layers returned to its original position for later study. Evaluation of antibacterial activity from MAPC Antibacterial activity of fungal MAPC was evaluated using the lower filter paper by the conventional diffusion method. The lower filter paper was cut into two parts with zigzag shapes (Figure 2) and “line 1” was used as a symmetry line. Gram-positive bacteria (Bacillus subtilis) and Gram-negative bacteria (Escherichia coli) were used at this stage and the assays were carried out using Tryptic soy agar (TSA) medium (Tryptic Soy Broth, Guangdong Huankai Microbial. Sci. & Tech. Co., LTD., China; Agar, Tianjin Kermel Chemical Reagent Co., Ltd., China). Briefly, 25 ml of sterilized TSA was poured into a Petri dish (100×15 mm). After the medium was solidified, the test bacterium was streaked on the TSA surface using a sterile cotton swab. The zigzag-shaped paper was laid on the surface of the agar plate. Antibacterial activity was examined after 18 h of incubation at 37°C. Inhibition zones implied that there were antibacterial substances on the paper secreted by filamentous fungi (Figure 2).

Isolation of filamentous fungi producing antibacterial agents If the zigzag-shaped paper expressed antibacterial activity, its source was located. The relevant Petri dish was picked out and the active areas in this plate were marked according to the relative areas in the antibacterial test plate (Figure 3). Then the fungal

8602

Afr. J. Biotechnol.

(A)

(B)

Figure 2. Antibacterial activity of comb-like papers from MAPC. Area E showed inhibition against B. subtilis in plate A. Plate B did not show any antibacterial activity against E. coli.

F 1 Figure 3. Area F in MAPC plate corresponded to the relevant one (Area E in Figure 2A) expressing antibacterial activity.

colonies in the active areas were isolated following the method described by Zhu et al. (2008). Different types of fungi produce different-looking colonies, so different fungal colonies in the active areas were transferred to separate PSA plates. When hyphae grew into the medium, hyphal tips were transferred and serially transferred until a preliminarily pure culture was obtained. Using this process, antibacterial activity was analyzed with B. subtilis and E. coli for each pure fungus taken from active areas. After the test bacterium was streaked on the TSA surface, several small pieces of

agar media from pure culture plates were carefully put on the TSA surface. Inhibition zones were examined after incubating 18 h at 37째C (Figure 4). Using this technique, the fungi producing antibacterial agents were identified. When a colony of preliminarily pure fungus displayed high antibacterial activity, it was isolated continually to obtain pure fungus. This pure fungus was selected as a candidate for further study against a drug-resistant bacteria pathogen, example Staphylococcus aureus ATCC 43300 (MRSA, Methicillin-resistant S. aureus) or E. coli NDM-1(NDM-1, New Delhi

Chen et al.

9 10 11

6 14

8603

Figure 4. Antibacterial activities of fungi after preliminary purification. The tenth colony in this plate showed inhibition against B. subtilis.

metallo-ß- lactamase-1).

Testing antibacterial activity of compounds from filamentous fungi Using the MAPC method, fungal strains displaying high antibacterial activity were isolated. In this paper, one of these strains was cultured by liquid surface fermentation with potato sucrose (20% potato, 3% sucrose) at 28°C for 7 days. The fermentation broth was separated by filtering and the filtered broth was extracted with ethyl acetate. The ethyl acetate extract was fractionated by silica gel column chromatography and the second fraction eluted with petroleum ether - ethyl acetate (1:1) was recrystallized and dissolved in methanol for antibacterial testing (all chemical reagents were from Sinopharm Chemical Reagent Co., Ltd., China; silica gel from Qingdao Haiyang Chemical Co., Ltd., China). The crystal called THC, was assayed for antibacterial activity against S. aureus ATCC 43300 (MRSA) by disk and thinlayer chromatography (TLC) bioactivity assays (Figure 5). Sodium benzylpenicillin (benzylpenicillin sodium for injection (BSI), North China Pharmaceutical Group Corp., China), the most widely used antibiotic in the world, was dissolved in sterile physiological saline and used as the control. In order to increase antibacterial susceptibility, NaCl was added into the TSA to reach a final concentration of 4%.

Identification of the fungus using gene sequencing Fungal mycelia were picked from the liquid culture for DNA extraction, ground to a fine powder, and then transferred to a 2.0 ml tube. The sample (about 200 - 300 mg of mycelial powder) received 800 μL of extraction buffer (100 mM Tris-Cl, pH8.0, 20 mM ethylenediaminetetraacetic acid (EDTA), 200 mM NaCl, 1% sodium dodecyl sulphate (SDS)) and was incubated for 30 min at 65°C. After cooling to room temperature, an equal volume of phenol:

Figure 5. Antibacterial activity against S. aureus ATCC 43300**. 1, 5 μg BSI, inhibition zone 13 mm; 2, 5 μg THC, inhibition zone 18 mm; 3, 0.5 μg THC, no clear inhibition zone; G, 0.5 μg THC loaded on TLC; H, 5 μg THC loaded on TLC. **Disk diameter is 6 mm.

chloroform: isoamyl alcohol (25:24:1) was added and the tube was shaken vigorously to form an emulsion, followed by centrifugation for 10 min at 10000 rpm in a microfuge. The supernatant was transferred to a clean tube and mixed with an equal volume of isopropanol and left in the freezer at -20°C for 1 h. The precipitated DNA was centrifuged at 10000 rpm for 10 min and the pellet was washed twice with 70% ethanol. The dried DNA was dissolved in 500 μL of sterile double distilled H2O. The DNA samples were sent to Shanghai Gene Star Biotech Co. Ltd and Sangon Biotech (Shanghai) Co., Ltd. for polymerase chian reaction (PCR) and DNA sequencing. Five DNA sequences (18S rDNA, cal gene, act gene, Tef1 gene and rpb2 gene) were analyzed.

RESULTS Antibacterial testing For the first stage of the investigation, the aim was to study antibacterial activity displayed by filamentous fungi in mixed culture. Fungi from soil samples were incubated in a Petri dish at 28°C for 8 days. The hyphae of filamentous fungi can grow into their media and secret products into them. Small molecules can easily diffuse into the filter papers between the two layers of agar media, which can later be used to detect antibacterial activity. Fungal colonies form randomly in a plate, leading to unequal distributions of antibacterial agents in the paper, and the filter paper was cut into a comb-like shape to resolve this problem (Figure 2). The upper filter paper helped with the removal of the lower paper. In Figure 2A, the test bacterium B. subtilis was inhibited in area E, which implied that some fungal strains colonizing the plate produced antimicrobials against B. subtilis. In

8604

Afr. J. Biotechnol.

Figure 2B, the test bacterium E. coli, did not display antibacterial activity, although its comb-like paper was cut from the same lower paper as Figure 2A, suggesting that the antibiotics detected would be specific for Gram positive bacteria. These results demonstrate the value of the MAPC method as a screening tool for discovering new antibiotics produced by filamentous fungi.

Identifying fungi producing antibacterial agents In order to recover the fungi producing the observed antibacterial activity, the active areas in the Figure 2A plate were marked in the original plate (MAPC plate) and the fungal colonies on these areas were isolated (Figure 3, area marked as F is the active zone). After colonies of different appearance in the active area “F” were transferred to PSA plates, the colonies formed were used to assess the activity of isolated fungi. Fourteen small pieces of PSA media with fungal growth were placed on the TSA surface streaked with bacterium in advance. There was only one inhibition zone against B. subtilis (Figure 4). The ninth and tenth colonies were isolated from the active area F in the MAPC plate, while the others were isolated from inactive areas in the same plate. These results implied that the fungi expressing antibacterial activity can be isolated only from active area, but not from inactive area. The isolation process continued to obtain pure strains from this colony and its antibacterial activity was determined over the entire process of isolation. The other colonies did not exhibit activity against B. subtilis and were excluded from further analysis.

Analyzing the potential effectiveness of compounds produced by fungi Several filamentous fungi producing antibacterial activities were isolated by MAPC method and their antibacterial activities remained. One of them was further studied and its products were extracted and purified for preliminary characterization. In order to evaluate the potential value of these substances, their antibacterial activities were assayed against S. aureus ATCC 43300 (MRSA) by disk and thin layer chromatography (TLC) bioactivity assays. As shown in Figure 5, the fraction of the fungal extract THC showed higher activity than BSI with a larger and clearer inhibition zone at a load of 5 μg each disk, but the inhibition zone of 0.5 μg THC on disk was not clear. THC can be developed on a TLC plate (TLC eluent, petroleum ether: ethyl acetate: methanol = 1:1:1) to show that only one spot expressed antibacterial activity at a load of 5 μg and 0.5 μg. THC is stable at room temperature for 2 years, but its activity will lose after incubation for 30 min at 50°C. These results implied that THC was worthy of further study for the potential

function. Identifying the fungus by gene sequencing Five DNA sequences (18S rDNA, cal gene, act gene, Tef1 gene and rpb2 gene) were sequenced. From the information of a blast search against GenBank (GenBank accession number: 18S rDNA, HM000037; cal gene, HM016865; act gene, HM016866; Tef1 gene, HM016867; rpb2 gene, HM016868), 18S rDNA of this strain had maximum sequence identity (99%) with 30 strains of Trichoderma viride strain HS-F9 et al., but it had maximum sequence identity (＜97%) with all strains of Hypocrea virens species. However, all of the other genes (cal, act, Tef1 and rpb2) had maximum sequence identity (99%) with Hypocrea virens. It was deduced that this fungal strain belongs to genus Trichoderma and has not been reported previously. It was given the preliminary name, T. sp. H09. DISCUSSION A number of fungal metabolites such as penicillins and cephalothin are clearly an important source of useful secondary metabolites. However, most of them obtained from fungi have been encountered by application of random screening methods which often leads to reisolation of known metabolites in the search for new bioactive compounds. Therefore, screening of new fungi expressing activities from various ecological niches is the first step to isolate new fungal metabolites (Lee and Oh, 2006). In this paper, a new method, called MAPC is described that can be a valuable tool in the search for novel and more efficacious antibacterial agents derived from filamentous fungi. The method can select promising candidates more efficiently by eliminating less promising samples at the very first stage of screening. By using mixed cultures at the beginning of screening process, screening efficiency increases and a larger number of filamentous fungi taken from their natural habitats can be screened in a given period of time. The traditional method of screening antibacterial from fungi is that samples are suspended in sterile water and vortexed, and the dilutions are used for cultivation, and then pure fungi are obtained to detect their antibacterial activities (Takahashi et al., 2008; Jones, 2010; Kumar et al., 2010). In these processes, a long time will be spent from many samples to many pure fungi, but what is worse, most of them do not produce any antibiotics, which decrease the screening efficiency. Generally, in our screening experiments, we just only isolated one or two fungal strains producing antibacterial compounds directly from about 20 samples, while there are more strains not expressing activity in one sample (Figure 4). This MAPC

Chen et al.

method can help us to abandon many unpromising candidates at the first stage and avoid the time- and labor-consuming procedure as before. Another advantage of this method is that the lower paper can be cut into two parts, so that one part is used to test activity against Gram-positive bacteria and another against Gramnegative bacteria in the meantime. Therefore, the screening efficiency is increased by the MAPC method. Also, the compounds discovered with this technique using whole-cell screening give new hope for discovering antibiotics from natural products (Lam, 2007; Suqimoto et al., 2008). Many microorganisms cannot be cultured using traditional methods. It has been reported that the majority (99%) of microorganisms from the environment resist cultivation in the laboratory, but new techniques are rapidly improving cultivability (Kaeberlein et al. 2002). Suqimoto et al. (2008) established a new simple method using an anthracycline antibiotic that increased success in isolating rare funga genera. Zhu et al. (2008) described a technique for isolating mycorrhizal fungi from roots of orchids that increased the isolation efficiency of previously uncultivable fungi. Given the appropriate culture conditions, the MAPC technique can be employed to discover novel antibiotics produced by common, rare and “uncultivable” species from different ecological niches of soil, water, plants, etc (Warcup, 1950; Haque et al., 2005; Hageskal et al., 2009). Therefore, this method can systematically screen potential antibacterial produced by filamentous fungi from various ecological niches, if their metabolites reach a certain amount being up to the standard required for further research. Now that genome sequencing, new target identification and combinatorial chemistry have not had notable successes to discover effective antibacterial agents (Fernandes, 2006), the MAPC method, holding the advantages of whole-cell and systematic and efficient screening will help people to discover novel antibiotics to meet clinical needs, as more and more new fungal strains will be cultured under laboratory conditions with new culture techniques. ACKNOWLEDGEMENTS This work was supported by Innovation Group Project of Chinese Academy of Sciences (KZCX2-YW-Q07) and partially supported by Open Funding Project of the Key Laboratory of Aquatic Botany and Watershed Ecology, Chinese Academy of Sciences (Y152731s03). We gratefully thank Professor David M. Johnson for helpful suggestions on the manuscript and editorial support. And also, we thank Professor Peigui Liu for his advice on how to name the fungal strain. REFERENCES Alagesaboopathi C (2011). Phytochemical screening and antimicrobial

8605

potential of Andrographis ovata Clarke. Afr. J. Biotechnol. 10: 50335036. Bax BD, Chan PF, Eggleston DS, Fosberry A, Gentry DR, Gorrec F, Giordano I, Hann MM, Hennessy A, Hibbs M, Huang JZ, Jones E, Jones J, Brown KK, Lewis CJ, May EW, Saunders MR, Singh O, Spitzfaden CE, Shen C, Shillings A, Theobald AJ, Wohlkonig A, Pearson ND, Gwynn MN (2010). Type IIA topoisomerase inhibition by a new class of antibacterial agents. Nature, 46: 935-940. Casenghi M, Cole ST, Nathan CF (2007). New approaches to filling the gap in tuberculosis drug discovery. PLoS Med. 4, e293. Fernandes P (2006). Antibacterial discovery and development-the failure of success? Nat. Biotech. 24: 1497-1503. Hageskal G, Lima N, Skaar I (2009). The study of fungi in drinking water. Mycol. Res. 113: 165-172. Haque MA, Hossain MS, Rahman MZ, Rahman MR, Hossain MS, Mosihuzzaman M, Nahar N, Khan SI (2005). Isolation of bioactive secondary metabolites from the endophytic fungus of Ocimum basilicum. Dhaka Univ. J. Pharm. Sci. 4: 127-130. Hawksworth DL (2001). The magnitude of fungal diversity: the 1.5 million species estimate revisited. Mycol. Res. 105: 1422-1432. Ho WH, To PC, Hyde KD (2003). Induction of antibiotic production of freshwater fungi using mix-culture fermentation. Fungal Divers. 12: 45-51. Jones D (2010). The antibacterial lead discovery challenge. Nat. Rev. Drug Discov. 9: 751-752. Kaeberlein T, Lewis K, Epstein SS (2002). Isolating “uncultivable” microorganisms in pure culture in a simulated natural environment. Sci., 296: 1127–1129. Kjer J, Debbab A, Aly AH, Proksch P (2010). Methods for isolation of marine-derived endophytic fungi and their bioactive secondary products. Nat. Protoc. 5: 479-490. Knapp CW, Dolfing J, Ehlert PAI, Graham DW (2010). Evidence of increasing antibiotic resistance gene abundances in Archived soils since 1940. Environ. Sci. Technol. 44: 580-587. Kumar CG, Mongolla P, Joseph J, Nageswar YVD, Kamal A (2010). Antimicrobial activity from the extracts of fungal isolates of soil and dung samples from Kaziranga National Park, Assam, India. J. Med. Mycol. 20: 283-289. Lam KS (2007). New aspects of natural products in drug discovery. Trends Microbiol. 15: 279-289. Lee HB, Oh H (2006). Two new fungal metabolites from an epiphytic fungus Paraphaeosphaeria species. Bull. Korean Chem. Soc. 27: 779-782. Li JWH, Vederas JC (2009). Drug discovery and natural products: End of an era or an endless frontier? Science, 325: 161-165. Opar A (2007). Bad bugs need more drugs. Nat. Rev. Drug. Discov. 6: 943-944. Payne DJ, Gwynn MN, Holmes DJ, Pompliano DL (2007). Drugs for bad bugs: confronting the challenges of antibacterial discovery. Nat. Rev. Drug Discov. 6: 29-40. Payne DJ (2008). Desperately seeking new antibiotics. Science, 321: 1644-1645. Peláez F (2006). The historical delivery of antibiotics from microbial natural products-Can history repeat? Biochem. Pharmacol. 71: 981990. Suqimoto S, Watanabe Y, Isshiki K (2008). Application of a method incorporating treatment with daunomycin for the selective isolation of slower-growing fungi. Biosci. Biotechnol. Biochem. 72: 2385-2391. Takahashi JA, Castro MCM, Souza GG, Lucas EMF, Bracarense AAP, Abreu LM, Marriel IE, Oliveira MS, Floreano MB, Oliveira TS (2008). Isolation and screening of fungal species isolated from Brazilian cerrado soil for antibacterial activity against Escherichia coli, Staphylococcus aureus, Salmonella typhimurium, Streptococcus pyogenes and Listeria monocytogenes. J. Med. Mycol. 18: 198-204. Warcup JH (1950). The soil-plate method for isolation of fungi from soil. Nature, 166: 117-118. Xuan Q, Bao FK, Pan HM, Liu AH (2010). Isolating fungal endophyte from Paris polyphylla Smith var. yunnanensis and identifying their antibacterial ability. Afr. J. Microbiol. Res. 4: 1001-1004. Zhu GS, Yu ZN, Gui Y, Liu ZY (2008). A novel technique for isolating orchid mycorrhizal fungi. Fungal Divers. 33: 123-137.

Full Length Research Paper

Influence of turmeric rhizome and black pepper on blood constituents and performance of broiler chickens Abdollah Akbarian, Abolghasem Golian, Hassan Kermanshahi, Ali Gilani* and Sajad Moradi Animal Science Department, Faculty of Agriculture, Ferdowsi University of Mashhad, P.O. Box: 91775-1163, Mashhad, Khorasan Razavi, Iran. Accepted 27 February, 2012

The aim of this study was to evaluate the effects of turmeric rhizome powder (TRP) and black pepper (BP) on blood components and performance of male broiler chickens. A 2 × 3 factorial arrangement with two levels of TRP (0 and 0.5 g/kg) and three levels of BP (0, 0.5 and 1 g/kg) were used to provide six dietary treatments. Each diet was randomly fed to four groups of 12 chicks each, and performance and hematological criteria were measured. The results showed that weekly body weight gain (BWG), feed intake (FI) and feed conversion ratio (FCR) of broilers were not influenced by TRP. The addition of 0.5 g TRP to diet significantly decreased alanine aminotransferase (ALT) activity, but did not affect aspartate aminotransferase (AST) and lactate dehydrogenase (LDH) activities, and concentration of low density lipoproteins (LDL), high density lipoproteins (HDL), cholesterol, and triglycerides in serum. Serum chloride and total electrolyte balance significantly decreased by TRP, whereas sodium and potassium concentrations were unchanged. Supplementation of diet with 1 g BP significantly reduced FCR in the first week; however, this pronounced effect was not observed in the later weeks. The BWG and FI were not influenced by BP. Even though, the serum metabolites such as LDL, HDL, cholesterol, electrolytes and activity of AST, ALT and LDH enzymes were not influenced by the addition of BP to diet, serum triglycerides significantly reduced in birds fed diet containing 1 g BP as compared to those fed control diet. There was no significant interaction between TRP and BP on blood metabolites and performance of male broiler chickens. Key words: Turmeric rhizome, black pepper, hematological criteria, broiler chickens.

INTRODUCTION Different spices have been used as food additive all over the globe along the history. These botanicals have received a high attention as nutraceuticals and multifunctional feed supplements for various purposes in poultry production during recent years. Turmeric rhizome (Curcuma longa) is an extensively used spice, food preservative and coloring material that has biological actions and medicinal applications (Burt, 2004). The main component of turmeric is curcumin that is

*Corresponding author. E-mail: gilanipoultry@gmail.com. Abbreviations: TRP, Turmeric rhizome powder; BP, black pepper; BWG, body weight gain; FI, feed intake; FCR, feed conversion ratio; ALT, alanine aminotransferase; AST, aspartate aminotransferase; LDH, lactate dehydrogenase; LDL, low density lipoproteins; HDL, high density lipoproteins.

a good antioxidant (Karami et al., 2011) and antibacterial (Negi et al., 1999) with hypo-cholesterolemic properties. Emadi and Kermanshahi (2007 a, b) indicated that turmeric rhizome powder (TRP) is an inducer of immune response and aspartate aminotransferase (AST) and lactate dehydrogenase (LDH) activities in the serum of broiler chickens. Supplemented diets with TRP significantly decreased alanine aminotransferase (ALT) and alkaline phos-phatase (ALP) activities. Kermanshahi and Riasi (2006) and Abbas (2009) demonstrated that dietary TRP significantly reduced triglycerides, total cholesterol and low density lipoproteins (LDL)-cholesterol of serum in layers and broilers. Curcumin reduced the activity of reactive oxygen species and elevates the antioxidant enzymes like superoxide dismutase, catalase and glutathione peroxidase levels in blood (Joe and Lokesh, 1994). Although curcumin is the main active component, it does not share all effects of turmeric

Akbarian et al.

(Gilani et al., 2005). Black pepper (Piper nigrum) bioactive compounds such as piperine have different characteristics like antimutagenic properties (El Hamss et al., 2003). Piperine is an active alkaloid that modulates benzopyrene metabolism through cytochrome P450 enzyme (CYP), which is important for the metabolism and transport of xenobiotics and metabolites (Reen et al., 1996) and depresses aﬂatoxin B1 toxicity by suppressing CYP mediated bioactivation of the mycotoxin (Singh et al., 1994; Reen et al., 1997). Brenes and Roura (2010) indicated that botanicals interactions need to be investigated due to the complexity in terms of the number and the variability of bioactive compounds, and the interactions between essential oils, and feasible synergistic effects to maximize or minimize the concentrations required to achieve a particular impact of the botanicals. The objective of the current study was to evaluate the effect of supplementary TRP and BP and their interaction on serum components and performance of male broiler chickens. MATERIALS AND METHODS A total of 288 day-old Ross 308 male chicks were obtained from a commercial hatchery (Qouchan, Mashhad, Iran) and randomly distributed to 24 floor pens. Each pen (1 m2) was equipped with a manual feeder and two nipple drinkers, and the floor was covered with clean wood shavings. Chicks were vaccinated for Infectious Bronchitis on the first day, Newcastle Disease and Avian Influenza on 7 and Inflammatory Bursal Disease on day 14 of age. The initial house temperature was set at 32°C and gradually decreased by about 2.5°C per week. A lighting schedule of 24 h light with approximately 20 lx was used for the entire period. The birds were given starter and grower diets from day 1 to 21. The basal diets were formulated (Table 1) to meet the nutrient requirements of the broiler chickens as recommended by Ross 308 broiler management guide (Aviagen, 2009). A 2 × 3 factorial experiment with two levels of dietary TRP (0 and 0.5 g/kg) and three levels of BP (0, 0.5 and 1 g/kg) was used in a completely randomized design. Each of the 6 assay mash diets was fed to 4 replicates of 12 chicks each for 21 days. Feed and water were offered ad libitum throughout the experiment. The experimental protocol was approved by the Animal Care Committee of Ferdowsi University of Mashhad, Iran. Body weight gains (BWG), feed intake (FI) and feed conversion ratio (FCR) were measured weekly. The FI was determined from the difference between supplied and residual feed in each pen. The FCR was calculated from the ratio between FI and weight gain of chick, in each pen and was adjusted for mortality. Mortality was weighed and recorded daily. Blood samples were collected from wing vein and analyzed by an automatic analyzer (Bio Systems S. A. – Costa Brava 30, 08030 Barcelona, Spain) at 21 days of age. Sera were separated and obtained by centrifugation of the coagulated blood (2500 rpm: 10 min) within 30 min after sampling to measure serum chemical components. The reported procedures were used to measure the activity of LDH (Young, 1995), AST, ALT (IFCC, 1986 a, b), and concentrations of low density lipoprotein (LDL) (Nauck et al., 2002), high density lipoprotein (HDL), triglycerides, sodium, potassium and chloride in the serum (Burtis and Ashwood, 1999). Data were analyzed using the General Linear Model procedure of the Statistical Analysis System (SAS, 2004). Tukey’s Studentized

8607

Range (HSD) test was also used to compare the means (P<0.05).

RESULTS AND DISCUSSION Mortality data were not subjected to statistical analysis because just three chicks died throughout the trial (Gutierrez et al., 2007). The effects of TRP, BP and their interaction on weight gain, FI, and FCR of male broilers during the first 21 day of age are shown in Table 2. Body weight gain and FI of male broiler chicks during different weeks were not influenced by TRP, BP or their interactions. The addition of BP at the rate of 1 g/kg significantly improved FCR in the first week, but this effect did not continue in the later weeks. The TRP and its interaction with BP did not have a significant effect on FCR. These findings concur with the results of Mehala and Moorthy (2008b) who revealed that even though the addition of turmeric to the diet at the levels of 1 or 2 g/kg did not have a significant effect on FI and FCR, chicks weight gain significantly declined when 2 g turmeric was added to the diet during the first week. They also found that the abdominal fat percentage, breast and thigh muscle cholesterol were not changed among treatment groups (Mehala and Moorthy, 2008a). Wenk (2006) reported that many herbs and botanicals can increase FI and improve growth rate; however, Windisch et al. (2008) reviewed the topic and found no clear evidence of the effects of herbs and spices on improvement and palatability in farm animals. It has been observed that bile acid secretion increased in laboratory animals fed curcumin, but not in piperine fed animals (Platel and Srinivasan, 2000a, 2004). Piperine of black pepper is now recognized as a bioavailability enhancer of various structurally and therapeutically diverse drugs and phytochemicals (Suresh and Srinivasan, 2006). Moreover, it has been reported that some spices stimulate pancreatic digestive enzymes– lipase, amylase and proteases, which play a crucial role in digestion (Platel and Srinivasan, 2000b). A few of these spices were also found to enhance the activities of terminal digestive enzymes of small intestinal mucosa (Sharathchandra et al., 1995; Platel and Srinivasan, 1996, 2001a). Concomitant with such a stimulation of either bile secretion or activity of digestive enzymes by these spices, leading to an accelerated digestion, a reduction in feed transit time in the alimentary tract has also been observed (Platel and Srinivasan, 2001b). The improvement of broilers performance by these spices due to the above mentioned mechanisms was expected, whereas in the current research, any positive effect of these botanicals except the partial improvement of FCR by BP was not observed. It seems that these results are related to species of animal or inclusion rate of TRP or BP. Similarly, Mehala and Moorthy (2008b) revealed that dietary turmeric was not effective on overall BWG, FI and FCR of broiler chickens. The effects of TRP, BP and their interaction on

8608

Afr. J. Biotechnol.

Table 1. The composition of basal diets.

Item Ingredients (g/kg) Corn Soybean meal Vegetable oil Limestone Dicalcium phosphate Common salt L-Lysine HCl DL-Methionine Vitamin and mineral premix 1

Starter (1 to 10 day)

Grower (11 to 21 day)

503.2 413 42 13.6 16.5 4.3 1 1.4 5

561.9 360.7 40 11.2 14.7 4.3 1 1.2 5

Calculated contents (g/kg unless otherwise stated) ME (MJ/kg) 12.34 Crude protein 226 Calcium 10.2 Available phosphorus 4.9 Lysine 12.4 Methionine 4.6 Methionine + Cystine 9.2 DCAB (mEq/kg) 251

12.55 207 8.6 4.3 10.5 4.0 8.0 228

Vitamin and mineral premix supplied per kilogram of diet: vitamin A, 10000 IU; vitamin D3, 9800 IU; vitamin E, 121 IU; B12, 20 μg; riboflavin, 4.4 mg; calcium pantothenate, 40 mg; niacin, 22 mg; choline, 840 mg; biotin, 30 μg; thiamin, 4 mg; zinc sulfate, 60 mg; manganese oxide, 60 mg.

enzymes activity, lipids and electrolytes of male broiler chicks’ serum at 21 days of age are shown in Table 3. Enzyme activity of ALT in serum of chicks fed diet containing TRP significantly decreased as compared to those fed control diet (9 vs. 12 IU/L); however, no significant difference was observed for AST and LDH activities. The BP and its interaction with TRP did not have a considerable effect on these enzyme activities. Emadi and Kermanshahi (2007b) indicated that dietary inclusion of TRP significantly increased the activity of LDH and AST, whereas significantly decreased ALT and ALP activities. Fernandez et al. (1994) induced liver damage by aflatoxin in layers and broilers and an increase in serum ALT activity was observed. The reduction of ALT activity by TRP in our study can be indicative of better function of liver. The TRP, BP and their interaction did not have a significant effect on LDL, HDL and cholesterol in serum of chicks. In previous studies, dietary TRP significantly decreased triglycerides, total cholesterol and LDLcholesterol of serum in layers (Kermanshahi and Riasi, 2006) and broilers (Abbas, 2009). Curcumin (Srinivasan and Satyanarayana, 1987; Soudamini, et al 1992; Babu and Srinivasan, 1997) and turmeric extract (Deshpande et al., 1997; Ramirez-Tortosa et al., 1997) exhibited hypocholesterolemic effects, particularly in cholesterolfed animals. Emadi et al. (2007) reported that 2.5 g/kg turmeric supplementation in broilers diet significantly

increased total cholesterol and HDL-cholesterol and significantly decreased LDL-cholesterol at 42 days of age. Babu and Srinivasan (1997) have suggested that such a cholesterol-lowering effect could be mediated by the stimulation of hepatic cholesterol-7- hydroxylase which converts cholesterol to bile acids, facilitating the biliary cholesterol excretion. Conversion of cholesterol to bile acids is a multiple-step process in which the initial step, 7α-hydroxylation, is the rate limiting reaction. It is possible that in spice principles-fed animals whose liver microsomal aryl hydroxlase activity is stimulated, cholesterol-7-α-hydroxlase is also similarly activated (Suresh and Srinivasan, 2006). Higher activity of hepatic cholesterol-7-α-hydroxlase has been evidenced in animals fed curcumin, but not in animals fed piperine (Srinivasan and Sambaiah, 1991). Suresh and Srinivasan (2006) by in vitro trial revealed that aryl hydroxylase activity was reduced by piperine. These findings coincide with hypocholesterolemic properties of curcumin and not of piperine (Srinivasan et al., 2004). In addition, Emadi et al. (2007) concluded that incorporation of TRP into the male broiler diets significantly increased total cholesterol, HDL-cholesterol and hemoglobin and decreased LDLcholesterol, VLDL-cholesterol and red blood cells at 42 days of age (P<0.05). However, Mehala and Moorthy (2008a) reported that the serum glucose, total cholesterol, HDL-cholesterol, LDL-cholesterol and triglycerides level was not significantly influenced by turmeric. Dietary 0.2 to

Akbarian et al.

8609

Table 2. Effect of turmeric rhizome powder (TRP), black pepper (BP) and their interaction on body weight gain (g/b), feed intake (g/b) and feed c onversion ratio of male broilers during the first 21 days of age. Body weight gain (g/b)

Effect TRP (g/kg) 0 0.5 SEM BP (g/kg) 0 0.5 1 SEM S.O.V. TRP BP TRP × BP a,b

Feed intake (g/b)

Feed conversion ratio

1 to 7 day

8 to 14 day

15 to 21 day

1 to 21 day

1 to 7 day

8 to 14 day

15 to 21 day

1 to 21 day

1 to 7 day

8 to 14 day

15 to 21 day

1 to 21 day

74.16 76.83 1.879

159.04 152.60 5.343

336.70 315.15 10.008

569.90 544.55 11.957

103.09 106.11 2.823

208.71 197.13 15.267

527.87 548.95 18.519

839.68 582.18 20.380

0.89 0.90 0.022

1.20 1.30 0.044

1.58 1.75 0.075

1.38 1.45 0.034

75.27 162.28 323.37 560.93 105.88 187.48 519.86 813.21 0.91 1.15 1.62 a 73.57 159.28 329.22 562.27 107.85 202.36 571.95 882.15 0.94 1.26 1.74 b 77.65 145.67 325.18 548.49 100.07 218.92 523.42 842.43 0.84 1.34 1.63 2.301 6.544 6.544 12.257 3.457 18.698 22.682 24.960 0.022 0.053 0.092 ------------------------------------------------------------------------------------------- P-value ----------------------------------------------------------------------------------------------------------------------------0.328 0.405 0.145 0.151 0.458 0.598 0.431 0.669 0.797 0.162 0.117 0.468 0.186 0.942 0.766 0.280 0.506 0.220 0.175 0.043 0.091 0.604 0.693 0.917 0.077 0.141 0.436 0.647 0.308 0.505 0.693 0.084 0.931

1.35 1.46 1.43 0.047 0.137 0.222 0.875

Means within each column for every effect with uncommon superscript are significantly different (P<0.05).

Table 3. Effect of turmeric rhizome powder (TRP), black pepper (BP) and their interaction on some enzymes activity, concentration of some lipids and electrolytes of male broilers serum at 21 day of age. +

Effect

AST (IU/L)

ALT (IU/L)

TRP (g/kg) 0 0.5 SEM

192.88 207.11 8.298

12.11 b 9.00 0.711

BP (g/kg) 0 0.5 1 SEM S.O.V. TRP BP TRP × BP

193.00 11.66 4021.66 24.16 80.33 87.00 133.83 134.50 3.91 50.66 ab 197.00 10.33 4181.66 22.50 91.66 76.50 128.00 129.66 3.78 45.16 b 210.00 9.66 4242.50 22.33 90.16 60.33 125.83 132.83 4.10 47.33 10.163 0.871 283.346 3.143 4.955 6.783 6.552 3.693 0.206 7.816 ------------------------------------------------------------------------- P-value -------------------------------------------------------------------------------------------------------------------------------0.248 0.009 0.415 0.764 0.834 0.262 0.138 0.918 0.074 0.024 0.486 0.292 0.852 0.902 0.253 0.044 0.679 0.652 0.568 0.883 0.533 0.259 0.862 0.788 0.129 0.530 0.719 0.622 0.851 0.738

a,b

LDH (IU/L)

LDL (mg/dL)

HDL (mg/dL)

Triglyceride (mg/dL)

Cholesterol (mg/dL)

Na (mEq/L)

K (mEq/L)

Cl (mEq/L)

4010.55 4286.66 231.351

23.55 22.44 2.566

86.77 88.00 4.046

79.33 69.88 5.674

135.22 123.22 5.350

132.55 132.11 3.015

4.16 3.70 0.168

36.11 a 59.33 6.381

Electrolyte* (mEq/L) a

100.61 b 76.47 7.832

87.75 88.25 89.60 9.953 0.035 0.988 0.854

Means within each column for every effect with uncommon superscript are significantly different (P<0.05). *AST: Aspartate aminotransferase; ALT: alanine aminotransferase; LDH: lactate + + dehydrogenase; LDL: low density lipoprotein; HDL: high density lipoprotein; electrolytes = N + K - Cl .

8610

Afr. J. Biotechnol.

5 g black pepper or 0.5 g piperine did not affect blood and liver cholesterol of rats (Srinivasan and Satyanarayana, 1981). Samarasinghe et al. (2003) indicated that turmeric at the rate of 3 g/kg in chicks diet significantly reduced fat deposition. In this study without cholesterol supplementation, the blood lipoproteins concentration were not affected by dietary TRP which may be due to conventional balanced diet or low inclusion level of TRP. Serum triglycerides were significantly reduced in birds fed diet containing 1 g BP as compared to those fed control diet (63.33 vs. 87 mg/dL), but this significant effect was not observed for TRP or its interaction with BP. Chloride concentration and total electrolytes balance of serum were significantly decreased by TRP (P<0.05), but were not influenced by BP and its interaction with TRP. Sodium and potassium concentrations of serum were not influenced by TRP, BP or their interaction. There are some fluctuations in the influence of spices on blood constituents of chicks. Steiner (2009) indicated that dietary phytogenics may not always show an expected response in poultry. Conclusion Under the conditions of this study, there was no significant interaction between TRP and BP on blood metabolites and performance of male broiler chicks during 1 to 21 days of age. Based on our findings, due to large variation of composition and other feasible effective factors, it is concluded that the inclusion of herbs such as TRP and BP in the diet may not always exhibit an expected influence on bird performance.

REFERENCES Abbas KA (2009). Using of non-traditional plants and spices in broiler nutrition. Ph.D. Thesis. Slovak University of Agriculture in Nitra. Slovakia. Aviagen (2009). Ross 308 broiler management guide. Available at www.aviagen.com. Babu PS, Srinivasan K (1997). Hypolipidemic action of curcumin, the active principle of turmeric (Curcuma longa) in streptozotocin induced diabetic rats. Mol. Cell. Biochem. 166: 169-175. Brenes A, Roura E (2010). Essential oils in poultry nutrition: Main effects and modes of action. Anim. Feed Sci. Technol. 158:1-14. Burt S (2004). Essential oils: their antibacterial properties and potential applications in foods-a review. Int. J. Food Microb. 94: 223-253. Burtis CA, Ashwood ER (1999). Tietz textbook of clinical chemistry. 3rd Edition. W B Saunders Company. Philadelphia. Deshpande UR, Joseph LJ, Manjure SS, Smauel AL, Phillai D, Bhide SV (1997). Effects of turmeric extract on lipid profile in human subjects. Med. Sci. Res. 25: 695-698. El Hamss R, Idaomar M, Alonso-Moraga A, Muñoz Serrano A (2003). Antimutagenic properties of bell and black peppers. Food Chem. Toxicol. 41: 41-47. Emadi M, Kermanshahi H (2007a). Effect of turmeric rhizome powder on immunity responses of broiler chickens. J. Anim. Vet. Adv. 6: 833836. Emadi M, Kermanshahi H (2007b). Effect of turmeric rhizome powder on the activity of some blood enzymes in broiler chickens. Int. J. Poult. Sci. 6: 48-51.

Emadi M, Kermanshahi H, Maroufyan E. (2007). Effect of varying levels of turmeric rhizome powder on some blood parameters of broiler chickens fed corn-soybean meal based diets. Int. J. Poult. Sci. 6: 345-348. Fernandez A, Verde MT, Gascon M, Ramos JJ, Gomez J, Luco DF, Chavez G (1994). Variation of clinical biochemical parameters of laying hens and broiler chicks fed aflatoxin containing feed. Avian Pathol. 23: 37-47. Gilani AH, Shah AJ, Ghayur MN, Majeed K (2005). Pharmacological basis for the use of turmeric in gastrointestinal and respiratory disorders. Life Sci. 76: 3089-3105. Gutierrez O, Zhang C, Cartwright AL, Carey JB, Bailey CA (2007). Use of guar by-products in high-production laying hen diets. Poult. Sci. 86: 1115-1120. IFCC (1986a). Part 2: IFCC method for aspartate aminotransferase (EC 2.6.1.1). J. Clin. Chem. Clin. Biochem. 24: 497-510. IFCC (1986b). Part 3: IFCC method for alanine aminotransferase (EC 2.6.1.2). J. Clin. Chem. Clin. Biochem. 24: 481-495. Joe B, Lokesh BR (1994). Role of capsaicin, curcumin and dietary nfatty acids in lowering the generation of reactive oxygen species in rat peritoneal macrophages. Biochem. Biophys. Acta. 1224: 255263. Karami M, Alimon AR, Sazili AQ, Goh YM, Ivan M (2011). Effects of dietary antioxidants on the quality, fatty acid profile, and lipid oxidation of longissimus muscle in Kacang goat with aging time. Meat Sci. 88: 102-108. Kermanshahi H, Riasi A (2006). Effect of turmeric rhizome powder (Curcuma longa) and soluble NSP degrading enzyme on some blood parameters of laying hens. Int. J. Poult. Sci. 5: 494-498. Mehala C, Moorthy M (2008a). Effect of Aloe vera and Curcuma longa (Turmeric) on carcass characteristics and biochemical parameters of broilers. Int. J. Poult. Sci. 7: 857-861. Mehala C, Moorthy M (2008b). Production performance of broilers fed with Aloe vera and Curcuma longa (Turmeric). Int. J. Poult. Sci. 7: 852-856. Nauck M, Warnick G, Rifai N (2002). Methods for measurement of LDL-cholesterol: a critical assessment of direct measurement by homogeneous assays versus calculation. Clin. Chem. 48: 236-254. Negi PS, Jayaprakasha GK, Jagan Rao Mohan L, Sakariah KK (1999). Antibacterial activity of turmeric oil: a byproduct from curcumin. J. Agric. Food Chem. 47: 4297-4300. Platel K, Srinivasan K (1996). Influence of dietary spices or their active principles on digestive enzymes of small intestinal mucosa in rats. Int. J. Food Sci. Nutr. 47: 55-59. Platel K, Srinivasan K (2000a). Stimulatory influence of select spices on bile secretion in rats. Nutr. Res. 20: 1493-1503. Platel K, Srinivasan K (2000b). Influence of dietary spices or their active principles on pancreatic digestive enzymes in albino rats. Nahrung, 44: 42-46. Platel K, Srinivasan K (2001a). A study of the digestive stimulant action of select spices in experimental rats. J. Food Sci. Technol. 38: 358361. Platel K, Srinivasan K (2001b). Studies on the influence of dietary spices on food transit time in experimental rats. Nutr. Res. 21: 13091314. Platel K, Srinivasan K (2004). Digestive stimulant action of spices: a myth or reality?. Ind. J. Medic. Res. 119: 167-179. Ramirez-Bosca M, Carion MA, Soler A, Puerta C, Diez A, Quintanilla E, Bernd A, Miquel J (1997). Effects of the antioxidant turmeric on lipoprotein peroxides: implication for the prevention of atherosclerosis. Age, 20: 165-168 Reen RK, Roesch SF, Kiefer F, Wiebel FJ, Singh J (1996). Piperine impairs cytochrome P4501A1 activity by direct interaction with the enzyme and not by down regulation of CYP1A1 gene expression in the rat hepatoma 5L cell line. Biochem. Biophys. Res. Commun. 218: 562-569. Reen RK, Wiebel FJ, Singh J (1997). Piperine inhibits aflatoxin B1induced cytotoxicity and genotoxicity in V79 Chinese hamster cells genetically engineered to express rat cytochrome P4502B1. J. Ethnopharmacol. 58: 165-173. Samarasinghe K, Wenk C, Silva K, Gunasekera J (2003). Turmeric (Curcuma longa) root powder and mannanoligosaccharides as

Akbarian et al.

alternatives to antibiotics in broiler chicken diets. Asian-Austral. J. Anim. Sci. 16: 1495-1500. SAS Institute (2004). Statistical Analysis Systems user's guide ed.). SAS Institute Inc., Raleigh, North Carolina, USA, Version 9.1. Sharathchandra JNN, Platel K, Srinivasan K (1995). Digestive enzymes of rat pancreas and small intestine in response to orally administered mint leaf (Mentha spicata) and garlic (Allium sativum) oil. Ind. J. Pharmacol. 27: 156-160. Singh J, Reen RK, Wiebel FJ (1994). Piperine, a major ingredient of black and long peppers, protects against AFB1-induced cytotoxicity and micronuclei formation in H4IIEC3 rat hepatoma cells. Cancer Lett. 86: 195-200. Soudamini KK, Unnikrishnan MC, Soni KB, Kuttan R (1992). Inhibition of lipid peroxidation and cholesterol levels in mice by curcumin. Ind. J. Physiol. Pharmacol. 36: 239-43. Srinivasan K, Sambaiah K (1991). The effect of spices on cholesterol 7a-hydroxylase activity and on serum and hepatic cholesterol levels in the rats. Int. J. Vit. Nutr. Res. 61: 364-369. Srinivasan K, Sambaiah K, Chandrasekhara N (2004). Spices as beneﬁcial hypo-cholesterolemic food adjuncts: a review. Food Rev. Int. 20: 187-220. Srinivasan MR, Satyanarayana MN (1981). Effect of black pepper (Piper nigrum) and piperine on growth, blood constituents and organ weights in rats. Nutr. Rep. Int. 23: 871-876.

8611

Srinivasan MR, Satyanarayana MN (1987). Inﬂuence of capsaicin, curcumin and ferulic acid in rats fed high fat diets. J. Biosci. 12: 143152. Steiner T (2009). Phytogenics in animal nutrition. Nottingham University Press. Nattingham. UK. Suresh D, Srinivasan K (2006). Influence of curcumin, capsaicin, and piperine on the rat liver drug-metabolizing enzyme in vivo and in vitro. Can. J. Physiol. Pharmacol. 84: 1259-1265. Wenk C (2006). Are herbs, botanicals and other related substances adequate replacements for antimicrobial growth promoters? In: Barug D, de Jong J, Kies AK, Verstegen MWA (Eds.). Antimicrobial Growth Promoters. pp. 329–340. (Wageningen Academic Publishers. The Netherlands). Windisch W, Schedle K, Plitzner C, Kroismayr A (2008). Use of phytogenic products as feed additives for swine and poultry. J. Anim. Sci. 86: 140-148. Young D (1995). Effects of drugs on clinical laboratory tests. AACC Press.Washington DC., The USA.

African Journal of Biotechnology Vol. 11(34), pp. 8612-8615, 26 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.034 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Gastro-protective activity of aqueous Carica papaya seed extract on ethanol induced gastric ulcer in male rats OKEWUMI Tolunigba Abisola and OYEYEMI Adekunle Wahab* Department of Physiology, College of Medicine, Madonna University, Elele, Rivers state, Nigeria. Accepted 27 February, 2012

Gastro protective effects of aqueous Carica papaya seed extract on ethanol induced gastric ulcer were investigated in male rats. Thirty two (32) male rats weighing between 180 and 250 g were randomly divided into four groups. Group 1 served as the negative control (distilled water), groups 2 and 3 received 50mg/kg and 100mg/kg Carica papaya seed extract respectively, while group 4 received 200mg/kg cimetidine (positive control). Two weeks after the oral administration, gastric ulcer was induced in all rats with ethanol (1 ml of 80% orally). Gastric juice volume, gastric acidity, ulcer index and percentage ulcer inhibition were determined. The results showed that the extract protected the gastric mucosa against ethanol effect. C. papaya extract significantly reduced the gastric juice volume and gastric acidity (p<0.05) in dose dependent manner when compared with the control. The percentage ulcer inhibition was significantly high (p<0.05) in rats treated with the extract when compared with the control and the effect is similar to that of rats treated with cimetidine. This study shows that C. papaya seed extract may possess gastro protective effects against ethanol induced gastric ulcer in male rats. Key words: Carica papaya, gastro protective, gastric ulcer. INTRODUCTION Carica papaya Linn (family: Caricaceae) is a tropical and herbaceous succulent plants that posses self supporting stems (Dick, 2003), which grows in all tropical countries and many sub-tropical regions of the world, and it is largely used in tropical folk medicines (Jaime et al., 2007). The ripe fruit is edible and unripe (which is a rich source of vitamin A) can be eaten cooked (Lohiya et al., 2002). It contains bioactive compounds, namely, papain, chymopapain, alkaloids, flavonoids, benzylisothiocyanate and phenolic (Anaga and Onehi, 2010; Jaime et al., 2007). C. papaya fruits consist mostly of water and carbohydrate, low in calories and rich in natural vitamins and minerals, particularly vitamins A and C, ascorbic acid and potassium (Jaime et al., 2007). The plant has different traditional medicinal values. It is used in treating malarial fever, diabetes mellitus, bacterial

*Corresponding author. E-mail: oyeyemiwahab@gmail.com. Tel: +2347034891903.

infections and as a de-wormer agent (Lohiya and Goya, 1992; Kinyuy, 1993; Chinoy et al., 1985). It also improves digestion. Its fresh leaves are also efficacious in the treatment of gonorrhea, syphilis and amoebic dysentery (Gill, 1992). The seed is used for intestinal worms when chewed (Ayoola and Adeyeye, 2010). Scientific evidences have shown that C. papaya has the following activities: anti-diabetes (Gbolade, 2009; Robert et al., 2008), diuretic (Spripanidkulchai, 2001), antihyperlipidemic (Banerjee et al., 2006), antihelminthic, anti-amoebic (Okeniyi et al., 2007), contraceptive in mice rats (Verma et al., 2006; Lohiya et al., 2006; Chinoy et al., 1985), hypoglycemic (Adeneye and Olagunju, 2009), nephroprotective (Olagunju et al., 2009), bactericidal (Emeruwa, 1982) wound and burn healing (Nayak et al., 2007; Hewitt et al., 2000), anti-oxidant (Majdi and Luciana, 2010), anti-nociceptive, anti-inflammatory (Anaga and Onehi, 2010) and anti-ulcer (Ezike et al., 2009; Indran et al., 2008). Chymopapain and papain which are among the plant constituents are being useful for digestive disorders and disturbances of the

Okewumi and Oyeyemi

gastrointestinal tract (Huet et al., 2006). scientific report on the anti-ulcer activity extract of C. papaya seed extract. This study aimed at investigating the secretion and gastro-protective activity extract of C. papaya seeds on male rats induced acute gastric damage.

There is no of aqueous gastric acid of aqueous with ethanol

8613

Following method: 1 = erosions 1 mm or less, 2 = 1 to 2 mm, 3 = >2 mm. The overall score was divided by a factor of 10 which was designated as the ulcer index (Main and Whittle, 1975). The percentage of ulcer inhibition was calculated as follows:

(Mean ulcer index of control - Mean ulcer index of test) x 100 Ulcer inhibition (%) = Mean ulcer index of control

MATERIALS AND METHODS

Statistical analysis

The unripe fruits of C. papaya were bought from Elele market, Rivers state, Nigeria. They were cut open and the seeds were collected, dried on top of laboratory bench and pulverized into coarse powder using a hammer mill. About 200 g of the coarse powder was soaked in 1.0 L of distilled water with intermittent shaking for 48 h. The extract was filtered and the filtrate was evaporated to dryness using rotary evaporator. The yield was calculated to be 5.61 w/w dry matters and the extract was stored in a refrigerator at 4°C. Thirty two albino Wistar male rats weighing between 180 and 250 g were procured from the Laboratory Animal Unit of the Faculty of Veterinary Medicine, University of Nigeria, Nsukka. The rats were housed in wire mesh cages under standard laboratory conditions (temperature 25 to 29°C, 12 h light and 12 h darkness cycles) with standard feeds and had free access to tap water ad libitum. They were maintained in accordance with the recommendation in the Guidelines for the Care and Use of Laboratory Animals (DHHS, NIH Publication No. 85-23, 1985). They were allowed to acclimatize for 2 weeks before the start of the experiments.

The results of this study were expressed as mean and standard error of mean (mean ± SEM). Statistical significant between the groups was assessed by one way analysis of variance (ANOVA) followed by least significant difference (LSD) test with the level of significant, p< 0.01 and p< 0.05 using SPSS 16.

RESULTS

After two weeks of treatment, all the rats were fasted for 24 h with free access to water. Gastric ulcer was induced with 1 ml of 80% ethanol which was administered orally to each animal after 24 h fasting (Hawk and Ostor, 1995).

Figure 1 shows the effect of C. papaya seed extract on gastric acidity in male rats with ethanol induced gastric ulcer, the gastric acidity was significantly reduced in rats treated with 100 mg/kg of the extract (0.43 ± 0.018 meq/l) when compared with the control (0.61 ± 0.01 meq/l), also there was significant different between the control and the rats treated with 50 mg/kg of the extract (0.50 ± 0.014 meq/l). The gastric acidity in the rats treated with 200 mg/kg of cimetidine was significantly reduced when compared with the control. The gastric juice volume in ml/4 h reduced from 3.08 ± 0.037 in control rats to 2.82 ± 0.017, 2.42 ± 0.013 and 1.94 ± 0.022 in 50 mg/kg of extract, 100 mg/kg of extract and 200 mg/kg of cimetidine, respectively. The reduction in gastric juice observed in rats treated with the extract and cimetidine were significant (p<0.05) when compared with the control group (Table 1). As shown in Table 1, the ulcer index significantly decreased in groups treated with the extract (p<0.05) when compared with the control. The percentage ulcer inhibition was 44.9 and 63.9% in rats treated with 50 mg/kg and 100 mg/kg of the extract respectively while cimetidine treated rats have higher percentage inhibition of 75.0% (Table 1). Both ulcer index and percentage ulcer inhibition effect in the rats treated with the extract were dose dependent.

Determination of gastric secretion and ulcer index

DISCUSSION

This assay was performed as earlier described by Gehan et al. (2009). Four (4) hours after the induction of gastric ulcer, the rats were killed by cervical dislocation, the abdomen was opened to remove the stomach and gastric content was collected to determine the gastric juice volume (ml/4 h). Five milliliters (5 ml) of distilled water was added to the gastric juice and the resultant solution was centrifuged at 3,000 rpm for 10 min. Gastric acidity in meq/l was determined in the supernatant volume by titration to pH 7 with 0.0025 N of sodium hydroxide. After removal of gastric content from the stomach, the stomach was pinned onto a soft board. Scoring of ulcer was done by the

The antiulcer activity of the C. papaya seed extract was studied using ethanol ulcer model. This model is one of the common causes of gastric ulcer in human. Ethanol induced gastric injury is associated with significant production of oxygen free radicals leading to increased lipid peroxidation, which causes damage to cell and cell membrane (Allison et al., 1992). The C. papaya seed extract has significantly protected the gastric mucosa against ethanol challenge as shown by significant

Experimental procedure Thirty-two male rats were divided into four (4) groups, each group consisting of eight animals. Group 1 received distilled water (negative control), group 2 received 50 mg/kg of C. papaya seed extract, group 3 rats were given 100 mg/kg of C. papaya seed extract and the group 4 received 200 mg/kg of cimetidine (positive control). The dose of C. papaya extract used in this study has been reported by Adeneye and Olagunju, (2009) and Verma et al. (2006). The treatment in all the groups was single dose for fourteen consecutive days through gavages.

Ethanol-induced gastric ulcer

8614

Afr. J. Biotechnol.

50 mg/kg of Carica papaya

100 mg/kg of Carica papaya

Figure 1. Effect of C. papaya seed extract on gastric acidity in meq/l in male rats’ ethanol induced gastric ulcer. Each bar is expressed as mean ± SEM (n = 8). One way ANOVA and LSD revealed significant differences between the control and the treated groups with extract; **p<0.01, *p<0.05

Table 1. Effect of C. papaya seed extract on gastric juice volume, gastric ulcer index and percentage ulcer inhibition in male rats with ethanol induced gastric ulcer.

Group Control 50 mg/kg of extract 100 mg/kg of extract 200 mg/kg of cimetidine

Gastric juice volume (ml/4 h) 3.08 ± 0.037 2.82 ± 0.017* 2.42 ± 0.013* 1.94 ± 0.022**

Ulcer index (mm) 5.48 ± 0.32 3.02 ± 0.12* 1.98 ± 0.20** 1.37 ± 0.31**

Ulcer inhibition (%) 44.9%* 63.9%** 75.0%**

Values are expressed as mean ± SEM of 8 rats per group. One way ANOVA and LSD revealed significant differences between the control and the treated groups with extract; **p<0.01, *p<0.05.

reduction in gastric juice volume, gastric acidity, ulcer index and percentage ulcer inhibition as compared to control group suggesting its potent gastro-protective effect on ethanol induced gastric ulcer in rats. The observed effect of the extract is dose dependent, the high dose of the extract significantly produced more potent effect in reducing gastric secretion and protecting the gastric mucosa from noxious effect of ethanol, although the effect observed in rats treated with the extract were low as compared to that of cimetidine which is a well known drug for the treatment of gastric ulcer, there is tendency that further increase in the extract dose might produce the same effect as that of cimetidine. The mechanism of action of the extract in reducing gastric secretion may probably involve histaminic H2 receptor since it produced effect that is similar to cimetidine, the H2 antagonist. Also, is possible that the extract induced both mucous and HCO3- secretion to protect the stomach lining against alcohol assault apart from directly

neutralizing the stomach acidity. Cimetidine is also known to act via the same mechanism (Indran, 2008). Another possible reason for the action of this extract may be as a result of its antioxidant properties, although antioxidant assay was not investigated in this study, but some studies have revealed the antioxidant properties of the extract (Majdi and Luciana, 2010; Indrian et al., 2008). It is possible that the extract was able to reduce the noxious effect of ethanol by preventing the prooxidant effect of ethanol from damaging the gastric mucosa through its antioxidant effect that has been reported to be similar to that of vitamin C (Majdi and Luciana, 2010). The gastro protective effect and the reduction in gastric secretion of the extract may also be attributed to the active compounds of the extract polyphenols (antioxidant), alkaloids and flavonoids (Tona et al., 1998) which are widely known as being useful for digestive disorders and disturbances of the gastrointestinal tract

Okewumi and Oyeyemi

(Jaime et al., 2007; Huet et al., 2006) In conclusion, the results suggest that C. papaya seed extract reduces gastric secretion and protects gastric mucosa from ethanol noxious effect. REFERENCES Adeneye AA, Olagunju JA (2009). Preliminary hypoglycemic and hypolipidemic activities of the aqueous seed extract of Carica papaya Linn. Wistar rats. Biol. Med. 1(1): 1-10. Allison MC, Howastson AG, Torrance CJ, Lee FD, Russel RI (1992). N. Engl. J. Med. 327: 749-54. Anaga AO, Onehi EV (2010). Antinociceptive and anti-inflammatory effects of the methanol seed extract of Carica papaya in mice and rats. Afr. J. Pharm. Pharmacol. 4(4): 140-144. Ayoola PB, Adeyeye A (2010). Phytochemical and nutrient evaluation of Carica papaya (pawpaw) leaves. IJRRAS. 5 (3): 325-328. Banerjee A, Vaghasiya R, Shrivastava N, Podn H, Nivsarkas M (2006). Anti-hyperlipidemic affect of Carica papaya L. in sprague dawley rats. Niger. J. Nat. Prod. Med. 10: 69-72. Chinoy NJ, Verma RJ, Sam MG, Dsouza JM (1985). Reversible antifertility effects of papaya seed extract in male rodents. J. Androl. 6(2): 50. Dick G (2003). Papaya: A tantalising taste of the Tropics. Maricopa County Master Gardener Volunteer information, University of Arizona Cooperative Extension. www.papaya Maricopa-hort@ag.arizo.edu. Emeruwa AC (1982). Antibacterial substance from Carica papaya fruit extract. J. Nat. Prod. 45(2): 123-127. Ezike AC, Akah PA, Okoli CO, Ezeuchenne NA, Ezeugwu S (2009). Carica papaya (paw paw) unripe fruit may be beneficial in ulcer. J. Med. Food. 12(6): 1268-1273. Gbolade AA (2009). Inventory of antidiabetic plants in selected districts of Lagos state, Nigeria. J. Ethnopharmacol., 121 (1): 135-9. Gehan H, Magdy KAH, Rauuia SA (2009). Gastroprotective effect of simvastatin against indomethacin-induced gastric ulcer in rats: Role of nitric oxide and prostaglandins. Eur. J. Pharmacol. 607: 188-193. Gill LS (1992). Carica papaya L. In: Ethno-medicinal uses of plants in Nigeria. Hawk PB, Ostor BL (1995). Hawkâ&#x20AC;&#x2122;s Physiological Chemistry. 14th ed. New York, Mc Graw Hill. Hewitt H, Whittle S, Lopez S, Bailey E, Weaver S (2000). Tropical use of papaya in chronic skin ulcer therapy in Jamaica. West Indian Med. J. 49: 32-33. Huet J, Looze Y, Bartik K, Raussens V, Wintjens R, Boussard P (2006). Structural characterization of the papaya cysteine proteinases at low pH. Biochem. Biophysical Res. Commun., 341: 620-626. Indran M, Mahmood AA, Kuppusamy UR (2008). Protective effect of Carica papaya L leaf extract against Alcohol Induced Acute gastric damage and blood oxidative stress in rats. West Indian Med. J. 57(4): 323. Jaime A, Teixeira da S, Zinia R, Duong TN, Dharini S, Abed G, Manoel TS, Paula FT (2007). Papaya (Carica papaya L.) Biology and biotechnology. Tree Forest. Sci. Biotechnol. 1(1): 47-73. Kinyuy WC (1993). Through integrated biomedical ethno-medical preparations and ethnotaxonomy, effective malaria and diabetic treatments have evolved. Acta. Hortic. 344: 205-214.

8615

Lohiya NK, Goya BB (1992). Antifertility investigations on the crude chloroform extract of Carica papaya linn. seeds in male albino rats. Indian J. Exp. Biol. 30: 1051-1055. Lohiya NK, Manivanna B, Mishra PK, Pathak N, Sriram S, Bhande SS, Panneerdoss S (2002). Chloroform extract of Carica papaya seeds induce long-term reversible azoospermia in Langur monkey. Asian J. Androl. 4: 17-26. Lohiya NK, Manivannan B, Garg S (2006). Toxicological investigations on the methanol sub-fraction of the seeds of Carica papaya as a male contraceptive in albino rats. Reprod. Toxicol. 22(3): 461-468. Main IHM, Whittle BJR (1975). Investigation of the vasodilator and antisecretory role of prostaglandins in the rats gastric mucosa by use of non-steroidal anti-inflammatory drugs. Br. J. Pharmacol. 53(2): 217-224. Majdi D, Luciana D (2010). Antioxidant effect of Aqueous Carica papaya nd seeds extract. 2 Conference on Biotechnology Research and Applications in Palestine, 26-27th September, 2010. Nayak SB, Pinto PL, Maharaj D (2007). Wound healing activity of Carica papaya L. in experimentally induced diabetic rats. Indian J. Exp. Biol. 45(8): 739-743. Okeniyi JA, Ogunlesi TA, Oyelami QA, Adeyemi LA (2007). Effectiveness of dried Carica papaya seeds against human intestinal parasitosis: a pilot study. J. Med. Food. 10(1): 194-196. Olagunju JA, Adeneye AA, Fagbounka BS, Bisuga NA, Ketiku AO, Benebo AS, Olufowobi OM, Adeoye AG, Alimi MA, Adeleke AG (2009). Nephroprotective activities of the aqueous seed extract of Carica papaya Linn. in carbon tetrachloride induced renal injured wistar rats: a dose- and time dependent study. Biol. Med. 1(1): 11-19. Robert SD, Ismail AA, Winn T, Wolever TM (2008). Glycemic index of common Malaysian fruits. Asia. Pac. J. Clin. Nutr. 17(1): 35-39. Sripanidkulchai B, Wongpanich V, Laupattarakasem P, Suwansaksri J, Jirakulsomchok D (2001). Diuretic effects of selected Thai indigenous medicinal plants in rats. J. Ethnopharmacol. 75(3): 185-190. Tona LK, Kambu N, Ngimbi K, Cimanga K, Vlietinck AJ (1998). Antiamoebic and phytochemical screening of some Congolese medicinal plants. J. Ethnopharmacol. 61: 57-65. Verma RJ, Nambiar D, Chinoy NJ (2006). Toxicological effects of Carica papaya seed extract on spermatozoa of mice. J. Appl. Toxicol. 26(6): 533-535.

UPCOMING CONFERENCES 2012 International Conference on Biotechnology and Food Engineering ICBFE 2012 Dubai, UAE. August 4-5, 2012

15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012

Conferences and Advert August 2012 International Conference on Biotechnology and Food Engineering (ICBFE 2012) Dubai, UAE, 4 Aug 2012 September 2012 Agricultural Biotechnology International Conference (ABIC2012), Christchurch, New Zealand, 1 Sep 2012 15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012 October 2012 Biotechnology and Bioinformatics Symposium, Provo, USA, 25 Oct 2012

African Journal of

Biotechnology Related Journals Published by Academic Journals

■ ■ ■ ■ ■ ■

Journal of Evolutionary Biology Research Journal of Yeast and Fungal Research Journal of Brewing and Distilling African Journal of Biochemistry Research African Journal of Food Science African Journal of Plant Science