African Journal of Biotechnology - 12 April, 2012 Issue

African Journal of

Biotechnology Volume 11 Number 30 ISSN 1684-5315

12 April, 2012

ABOUT AJB The African Journal of Biotechnology (AJB) is published bi-weekly (one volume per year) by Academic Journals. African Journal of Biotechnology (AJB) a new broad-based journal, is an open access journal that was founded on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed.

Submission of Manuscript Submit manuscripts as e-mail attachment to the Editorial Office at: ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com. A manuscript number will be mailed to the corresponding author shortly after submission. For all other correspondence that cannot be sent by e-mail, please contact the editorial office (at ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com). The African Journal of Biotechnology will only accept manuscripts submitted as e-mail attachments. Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given the last name of the first author.

Editors George Nkem Ude, Ph.D Plant Breeder & Molecular Biologist Department of Natural Sciences Crawford Building, Rm 003A Bowie State University 14000 Jericho Park Road Bowie, MD 20715, USA N. John Tonukari, Ph.D Department of Biochemistry Delta State University PMB 1 Abraka, Nigeria Prof. Dr. AE Aboulata Plant Path. Res. Inst., ARC, POBox 12619, Giza, Egypt 30 D, El-Karama St., Alf Maskan, P.O. Box 1567, Ain Shams, Cairo, Egypt Dr. S.K Das Department of Applied Chemistry and Biotechnology, University of Fukui, Japan Prof. Okoh, A. I Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and Microbiology, University of Fort Hare. P/Bag X1314 Alice 5700, South Africa Dr. Ismail TURKOGLU Department of Biology Education, Education Faculty, Fırat University, Elazığ, Turkey Prof T.K.Raja, PhD FRSC (UK) Department of Biotechnology PSG COLLEGE OF TECHNOLOGY (Autonomous) (Affiliated to Anna University) Coimbatore-641004, Tamilnadu, INDIA. Dr. George Edward Mamati Horticulture Department, Jomo Kenyatta University of Agriculture and Technology, P. O. Box 62000-00200, Nairobi, Kenya.

Dr Helal Ragab Moussa Bahnay, Al-bagour, Menoufia, Egypt. Dr VIPUL GOHEL Flat No. 403, Alankar Apartment, Sector 56, Gurgaon122 002, India. Dr. Sang-Han Lee Department of Food Science & Biotechnology, Kyungpook National University Daegu 702-701, Korea. Dr. Bhaskar Dutta DoD Biotechnology High Performance Computing Software Applications Institute (BHSAI) U.S. Army Medical Research and Materiel Command 2405 Whittier Drive Frederick, MD 21702 Dr. Muhammad Akram Faculty of Eastern Medicine and Surgery, Hamdard Al-Majeed College of Eastern Medicine, Hamdard University, Karachi. Dr. M.MURUGANANDAM Departtment of Biotechnology St. Michael College of Engineering & Technology, Kalayarkoil, India. Dr. Gökhan Aydin Suleyman Demirel University, Atabey Vocational School, Isparta-Türkiye, Dr. Rajib Roychowdhury Centre for Biotechnology (CBT), Visva Bharati, West-Bengal, India. Dr.YU JUNG KIM Department of Chemistry and Biochemistry California State University, San Bernardino 5500 University Parkway San Bernardino, CA 92407

Editorial Board Dr. Takuji Ohyama Faculty of Agriculture, Niigata University

Dr. Mehdi Vasfi Marandi University of Tehran

Dr. FÜgen DURLU-ÖZKAYA Gazi Üniversity, Tourism Faculty, Dept. of Gastronomy and Culinary Art

Dr. Reza Yari Islamic Azad University, Boroujerd Branch

Dr. Zahra Tahmasebi Fard Roudehen branche, Islamic Azad University

Dr. Tarnawski Sonia University of Neuchâtel – Laboratory of Microbiology

Dr. Albert Magrí Giro Technological Centre

Dr. Ping ZHENG Zhejiang University, Hangzhou, China. Prof. Pilar Morata University of Malaga

Dr. Greg Spear Rush University Medical Center

Dr. Mousavi Khaneghah College of Applied Science and Technology-Applied Food Science, Tehran, Iran.

Prof. Pavel KALAC University of South Bohemia, Czech Republic.

Dr. Kürsat KORKMAZ Ordu University, Faculty of Agriculture, Department of Soil Science and Plant nutrition

Dr. Tugay AYAŞAN Çukurova Agricultural Research Institute, PK:01321, ADANA-TURKEY.

Dr. Shuyang Yu Asistant research scientist, Department of Microbiology, University of Iowa Address: 51 newton road, 3-730B BSB bldg.Tel：+319-3357982, Iowa City, IA, 52246, USA.

Dr. Binxing Li E-mail: Binxing.Li@hsc.utah.edu

Dr Hsiu-Chi Cheng National Cheng Kung University and Hospital.

Dr. Kgomotso P. Sibeko University of Pretoria, South Africa.

Dr. Jian Wu Harbin medical university , China.

Instructions for Author Electronic submission of manuscripts is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Arial font). The cover letter should include the corresponding author's full address and telephone/fax numbers and should be in an e-mail message sent to the Editor, with the file, whose name should begin with the first author's surname, as an attachment. Article Types Three types of manuscripts may be submitted: Regular articles: These should describe new and carefully confirmed findings, and experimental procedures should be given in sufficient detail for others to verify the work. The length of a full paper should be the minimum required to describe and interpret the work clearly. Short Communications: A Short Communication is suitable for recording the results of complete small investigations or giving details of new models or hypotheses, innovative methods, techniques or apparatus. The style of main sections need not conform to that of full-length papers. Short communications are 2 to 4 printed pages (about 6 to 12 manuscript pages) in length. Minireview: Submissions of mini-reviews and perspectives covering topics of current interest are welcome and encouraged. Mini-reviews should be concise and no longer than 4-6 printed pages (about 12 to 18 manuscript pages). Mini-reviews are also peer-reviewed.

Regular articles All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title page. The Title should be a brief phrase describing the contents of the paper. The Title Page should include the authors' full names and affiliations, the name of the corresponding author along with phone, fax and E-mail information. Present addresses of authors should appear as a footnote. The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. The Abstract should be 100 to 200 words in length.. Complete sentences, active verbs, and the third person should be used, and the abstract should be written in the past tense. Standard nomenclature should be used and abbreviations should be avoided. No literature should be cited. Following the abstract, about 3 to 10 key words that will provide indexing references should be listed. A list of non-standard Abbreviations should be added. In general, non-standard abbreviations should be used only when the full term is very long and used often. Each abbreviation should be spelled out and introduced in parentheses the first time it is used in the text. Only recommended SI units should be used. Authors should use the solidus presentation (mg/ml). Standard abbreviations (such as ATP and DNA) need not be defined.

Review Process All manuscripts are reviewed by an editor and members of the Editorial Board or qualified outside reviewers. Authors cannot nominate reviewers. Only reviewers randomly selected from our database with specialization in the subject area will be contacted to evaluate the manuscripts. The process will be blind review. Decisions will be made as rapidly as possible, and the journal strives to return reviewers’ comments to authors as fast as possible. The editorial board will re-review manuscripts that are accepted pending revision. It is the goal of the AJB to publish manuscripts within weeks after submission.

The Introduction should provide a clear statement of the problem, the relevant literature on the subject, and the proposed approach or solution. It should be understandable to colleagues from a broad range of scientific disciplines.

Materials and methods should be complete enough to allow experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. Capitalize trade names and include the manufacturer's name and address. Subheadings should be used. Methods in general use need not be described in detail.

Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the authors' experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. Discussion, speculation and detailed interpretation of data should not be included in the Results but should be put into the Discussion section. The Discussion should interpret the findings in view of the results obtained in this and in past studies on this topic. State the conclusions in a few sentences at the end of the paper. The Results and Discussion sections can include subheadings, and when appropriate, both sections can be combined. The Acknowledgments of people, grants, funds, etc should be brief. Tables should be kept to a minimum and be designed to be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes. Each table should be on a separate page, numbered consecutively in Arabic numerals and supplied with a heading and a legend. Tables should be self-explanatory without reference to the text. The details of the methods used in the experiments should preferably be described in the legend instead of in the text. The same data should not be presented in both table and graph form or repeated in the text. Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, TIFF, JPEG or Powerpoint before pasting in the Microsoft Word manuscript file. Tables should be prepared in Microsoft Word. Use Arabic numerals to designate figures and upper case letters for their parts (Figure 1). Begin each legend with a title and include sufficient description so that the figure is understandable without reading the text of the manuscript. Information given in legends should not be repeated in the text. References: In the text, a reference identified by means of an author‘s name should be followed by the date of the reference in parentheses. When there are more than two authors, only the first author‘s name should be mentioned, followed by ’et al‘. In the event that an author cited has had two or more works published during the same year, the reference, both in the text and in the reference list, should be identified by a lower case letter like ’a‘ and ’b‘ after the date to distinguish the works. Examples: Smith (2000), Blake et al. (2003), (Kelebeni, 1983), (Chandra and Singh,1992),(Chege, 1998; Steddy, 1987a,b;

Gold, 1993,1995), (Kumasi et al., 2001) References should be listed at the end of the paper in alphabetical order. Articles in preparation or articles submitted for publication, unpublished observations, personal communications, etc. should not be included in the reference list but should only be mentioned in the article text (e.g., A. Kingori, University of Nairobi, Kenya, personal communication). Journal names are abbreviated according to Chemical Abstracts. Authors are fully responsible for the accuracy of the references. Examples: Diaz E, Prieto MA (2000). Bacterial promoters triggering biodegradation of aromatic pollutants. Curr. Opin. Biotech. 11: 467-475. Dorn E, Knackmuss HJ (1978). Chemical structure and biodegradability of halogenated aromatic compounds. Two catechol 1, 2 dioxygenases from a 3chlorobenzoate-grown Pseudomonad. Biochem. J. 174: 73-84. Pitter P, Chudoba J (1990). Biodegradability of Organic Substances in the Aquatic Environment. CRC press, Boca Raton, Florida, USA. Alexander M (1965). Biodegradation: Problems of Molecular Recalcitrance and Microbial Fallibility. Adv. Appl. Microbiol. 7: 35-80. Boder ET, Wittrup KD (1997). Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotechnol. 15: 537-553.

Short Communications Short Communications are limited to a maximum of two figures and one table. They should present a complete study that is more limited in scope than is found in full-length papers. The items of manuscript preparation listed above apply to Short Communications with the following differences: (1) Abstracts are limited to 100 words; (2) instead of a separate Materials and Methods section, experimental procedures may be incorporated into Figure Legends and Table footnotes; (3) Results and Discussion should be combined into a single section. Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF file. Page proofs are considered to be the final version of the manuscript. With the exception of typographical or minor clerical errors, no changes will be made in the manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that the editorial office waive some of the handling fee under special circumstances. Copyright: Š 2012, Academic Journals. All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary bibliographic citation, including author attribution, date and article title. Submission of a manuscript implies: that the work described has not been published before (except in the form of an abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the publisher. Disclaimer of Warranties In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or not advised of the possibility of damage, and on any theory of liability. This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or information in this publication or of any other publication to which it may be linked.

African Journal of Biotechnology Table of Contents:

Volume 11

Number 30 12 April, 2012

International Journal of Medicine and Medical Sciences ences ARTICLES . Research Articles GENETICS AND MOLECULAR BIOLOGY Molecular cloning and characteristic analysis of a thioredoxin from Neobenedenia melleni Zhe-Liang Sheng, Xin-Jiang Lu and Jiong Chen

7582

Ultra-structural study of Egyptian Buffalo oocytes before and after in vitro maturation I. A. H. Barakat, H. M. El–Ashmaoui, A. Barkawi, S. A. Kandeal and E. EL-Nahass

7592

Optimization of plasmid electrotransformation into Escherichia coli using Taguchi statistical method Mohamad Heiat, Hossein Aghamollaei, Seeyed mostafa Hoseinei, Reza Abbasi Larki and Kheirollah Yari

7603

PLANT AND AGRICULTURAL TECHNOLOGY Isolation and identification of Metarhizium anisopliae from Chilo venosatus (Lepidoptera: Pyralidae) cadaver Lei Liu, Rulin Zhan, Laying Yang, Changcong Liang, Di Zeng and Junsheng Huang

7609

Purification of an elicitor from Magnaporthe oryzae inducing defense resistance in rice Chunyan Ji and Zhenzhong Wang

7618

Increasing the amylose content of maize through silencing of sbe2a genes Shuyan Guan, Yiyong Ma, Huijing Liu, Siyan Liu, Guangna Liu, Lina Zhao and Piwu Wang

7628

Table of Contents:

Volume 11

Number 30 12 April, 2012

ences ARTICLES Common vetch-wheat intercropping: Haylage yield and quality depending on sowing rates Karagic Dura, Mikic Aleksandar, Milosevic Branko, Vasiljevic Sanja and Dusanic Nenad

Physiology of seed yield in soybean: Growth and dry matter production M. A. Malek, M. M. A. Mondal, M. R. Ismail, M. Y. Rafii and Z. Berahim

7637

7643

Effect of heavy metal and EDTA application on heavy metal uptake and gene expression in different Brassica species Madiha Iqbal, Jehan Bakht, Mohammad Shafi and Rafi Ullah

7649

Genetic diversity in Chinese natural zoysiagrass based on inter-simple sequence repeat (ISSR) analysis Y. Xie, L. Liu, J. Fu and H. Li

7659

An investigation on mechanisms of blanked nut formation of hazelnut (Corylus heterophylla fisch) Jian-feng Liu, Yun-qing Cheng, Kun Yan and Qiang Liu

7670

Effects of soil flooding on photosynthesis and growth of Zea mays L. seedlings under different light intensities Xiuping Wang, Tianxue Liu, Chaohai Li and Hao Chen

7676

Propagation physiology of Juniperus phoenicea L. from Jordan using seeds and in vitro culture techniques: Baseline information for a conservation perspective Ezz AL-Dein Al-Ramamneh, Susan Dura and Nidal Daradkeh

7676

Table of Contents:

Volume 11

Number 30 12 April, 2012

ences ARTICLES ENVIRONMENTAL BIOTECHNOLOGY Lactic acid fermentation from refectory waste: Factorial design analysis Didem OMAY and Yuksel GUVENILIR

7693

INDUSTRIAL MICROBIOLOGY Optimization of growth parameters for increased yield of the edible mushroom Calocybe indica Gopinath Lakshmipathy, Arunkumar Jayakumar, Meera abhilash and Shantha Prema Raj

Isolation and characterization of toebicin 218, a bacteriocin, produced by Geobacillus toebii HBB-218 Gamze Başbülbül Özdemir and Haci Halil Biyik

7701

7711

FOOD TECHNOLOGY Proximate and mineral analysis of some wild edible mushrooms I. O. Okoro and F. I. Achuba

Stabilization and preservation of probiotic properties of the traditional starter of African opaque sorghum beers A. P. Polycarpe Kayodé, Deloris C. Deh, Lamine Baba-Moussa, Simeon O. Kotchoni and Joseph D. Hounhouigan

7720

7725

MEDICAL AND PHARMACEUTICAL BIOTECHNOLOGY Qianliening capsule treats benign prostatic hyperplasia (BPH) by down-regulating the expression of PCNA, CyclinD1 and CDK4 Xiaoyong Zhong, Jiumao Lin, Jianheng Zhou, Wei Xu, Zhenfeng Hong and Jun Peng

7731

Table of Contents:

Volume 11

Number 30 12 April, 2012

ences ARTICLES Isolation, purification and effects of hypoglycemic functional polysaccharides from Inonotus obliquus Tao Hu, Ping Liu, Yuanying Ni and Chuntao Lu

7738

FISHERY SCIENCE Morphological and chemical characteristics of tomato foliage as mechanisms of resistance to Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) larvae Muahmmad Ashfaq, Muhammad Sajjad, Muhammad Noor ul Ane and Noureen Rana

Bacterial content in the intestine of frozen common carp Cyprinus carpio Ahmed H. Al-Harbi and Md. Naim Uddin

Generation and characterization of a stable red fluorescent transgenic Tanichthys albonubes line Qing Jian, Min Chen, Jun-jie Bai, Peng Jiang, Jia-jia Fan, Xing Ye and Shi-ling Xia

7744

7751

7756

BIOTECHNIQUES Soybean (Glycine max) as a versatile biocatalyst for organic synthesis Luciana M. Bertini, Telma L. G. Lemos, Leonardo A. Alves, Francisco Jose Q. Monte, Marcos C. de Mattos and Maria da Conceição F. de Oliveira

7766

Passive and active immunity against parvovirus infection in piglets Nenad Stojanac, Mladen Gagrčin, Ognjen Stevančević, Ivan Stančić and Aleksandar Potkonjak

7771

ANIMAL SCIENCE The use of kefir as potential probiotic in Çoruh trout (Salmo coruhensis): Effects on growth performance and immunoglobulin (IgM) levels Erkan CAN, Filiz KUTLUYER, Fatma DELİHASAN SONAY and Özay KÖSE

7775

Table of Contents:

Volume 11

Number 30 12 April, 2012

ences ARTICLES Molecular cloning and characterization of a novel Cys2/His2-type zinc finger protein gene from chrysanthemum Qing-Lin Liu, Jiao Wu, Ke-Dong Xu, Liang-Jun Zhao and Hai-Qing Zhang

7781

African Journal of Biotechnology Vol. 11(30), pp. 7582-7591, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3098 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Molecular cloning and characteristic analysis of a thioredoxin from Neobenedenia melleni Zhe-Liang Sheng1,2, Xin-Jiang Lu1* and Jiong Chen1* 1

Faculty of Life Science and Biotechnology, Ningbo University, Ningbo 315211, People’s Republic of China. College of life sciences, Inner Mongolia Agricultural University, Hohhot, 010019, Inner Mongolia, People’s Republic of China.

2

Accepted 27 February, 2012

Thioredoxin (Trx) can regulate disulfide bond reduction of target proteins to maintain the reduced intracellular state in various organisms. Here, we cloned a cDNA sequence of thioredoxin from Neobenedenia melleni, which is a kind of platyhelminth parasite infecting many fishes of great economic value. The deduced N. melleni Trx (NmTrx) contained 170 amino acid residues with an active site consisting of four amino acid motif CPGC. Sequence comparison and phylogenetic tree analysis confirmed NmTrx as a distinct member of thioredoxin. Real-time quantitative polymerase chain reaction (PCR) revealed a significantly higher expression of NmTrx transcript in the adult stage compared with the egg and oncomiracidium stages. In the egg and adult stages, the NmTrx transcript level in the 32°C group was higher than those in the 18 and 25°C groups. NmTrx was expressed and purified from Escherichia coli, and antiserum against NmTrx was prepared. Western blot confirmed the higher NmTrx expression of the egg and adult stages in the 32°C group with respect to the other temperature groups. Recombinant NmTrx was able to reduce the disulfide bond in insulin, and its antioxidant capacity was determined to be 5.12 U/mg protein, similar to the classic thioredoxins. Trx activity was lower in the oncomiracidium stage and higher in the adult stage compared with the egg stage. These results indicate that NmTrx could function as an important antioxidant molecule under physiological conditions. Key words: Thioredoxin, Neobenedenia melleni, redox regulation, mRNA expression, prokaryotic expression. INTRODUCTION The cellular damage due to the formation of reactive oxygen species (ROS) results in the development of antioxidant systems to maintain the reduced intracellular state by protecting molecule structure. In the cells, the mitochondrial respiratory chain is the major source of ROS (Chen et al., 2003). ROS might get attached to protein molecules and damage their functions (Roos and Messens, 2011). Thioredoxin (Trx), a hydrogen-carrying protein, plays an important role in maintaining the cellular redox state by control of reactive oxygen. It is first

*Corresponding authors. E-mail: lxj711043@163.com. Tel: 086574-87609571. Fax: 086-574-87600167. Abbreviations: Trx, Thioredoxin; GSH, glutathione; NmTrx, a thioredoxin from N. melleni; ANOVA, one-way analysis of variance.

characterized as a hydrogen donor for ribonucleotide reductase in Escherichia coli (Holmgren, 1979). Trxs are characterized by a dithiol/disulfide active site (CGPC), which is conserved in bacteria, plants, and animals (Spyrou et al., 1997; Gelhaye et al., 2004). In human, there are three Trxs encoded by separate genes. Trx1, a cytosolic and nuclear form, is the most studied of the three forms of Trx (Nordberg and Arner, 2001). Trx2, a mitochondrial protein, contains a unique 60 amino acid Nterminal mitochondrial translocation signal (Spyrou et al., 1997). SpTrx, the third isoform of Trx, is highly expressed in spermatozoa (Miranda-Vizuete et al., 2001). Trx participates in a wide variety of physiological processes. Trx has shown anti-apoptotic functions by inhibiting apoptosis signal-regulating kinase-1 (Saitoh et al., 1998). Various oxidative stresses can induce Trx expression to perform an antioxidant effect (Nakamura et al., 2009). Trx shows redox regulatory functions in signal transduction

Sheng et al.

and regulates the DNA binding activity of transcription factors such as AP-1, NF-κB, p53 and hypoxia-inducible factor-1α (Watanabe et al., 2010). Trx can be secreted by antigen presenting cells to activate T lymphocytes (Angelini et al., 2002). In most organisms, antioxidant defenses include two major pathways: the glutathione (GSH) and the Trx systems (Toledano et al., 2007). The components of these pathways include GSH, Trx, and their enzymes glutathione reductase and thioredoxin reductase, both of which reduce the oxidized GSH and Trx. In parasites, the challenge for the control of ROS is greater because they must control not only their metabolic production but also the potential damage induced by the host immune attack. Some thioredoxin genes have been cloned and characterized in endoparasites, these includes, Opisthorchis viverrini (Suttiprapa et al., 2012), Haemonchus contortus (Sotirchos et al., 2008), Haemonchus contortus (Sotirchos et al., 2009) and Schistosoma mansoni (Alger et al., 2002). However, the Trx of body surface parasites is less known. Parasites possess unique antioxidant systems, which is different from conventional thioredoxin and glutathione systems (Otero et al., 2010). The platyhelminth S. mansoni, for example, lacks canonical thioredoxin and glutathione systems. Instead, it possesses a linked glutathione thioredoxin system that contains a selenoenzyme thioredoxin glutathione reductase for the provision of reducing equivalents to whole system (Bonilla et al., 2008). In trypanosomes, the two systems are joined to one system with a small peptide trypanothione [bis(glutathionyl)spermidine] which is oxidized by the enzyme tryparedoxin and is regenerated by the enzyme trypanothione reductase (Krauth-Siegel et al., 2005). Neobenedenia melleni, a kind of body surface platyhelminth parasite, can infect many important cage-cultured fishes, such as, the large yellow croaker (Pseudosciaena crocea), the miiuy croaker (Miichthys miiuy), the tilapia (Oreochromis mossambicus), the amberjack (Seriola dumerili), and Epinephelus awoara (Yang et al., 2001, 2007). Its outbreaks have caused fearful economic losses in fish mariculture. It would be beneficial to develop the potential method to control N. melleni infection by characterizing its antioxidant systems. However, no information is available for Trx in N. melleni. Here, we aimed to identify and characterize a thioredoxin from N. melleni (NmTrx). It is the first time that the thioredoxin of body surface platyhelminth parasite N. melleni was identified, and it is helpful to a better understanding of the antioxidant systems in this fish parasite. MATERIALS AND METHODS Parasite source Miiuy croaker (Miichthys miiuy) infected with N. melleni were maintained in 500 L tanks and fed with the basal diet, at Xiangshan Seaport Aquatic Seedling and fingerling Limited Company, Ningbo

7583

city, China. One hundred adult N. melleni worms were removed from the fish body surface using a scalpel blade. Adult parasites were placed in tissue culture dishes containing filtered seawater and were incubated at 25°C for a day to induce egg-laying (Lin et al., 2008). Deposited parasite eggs were collected in a 300 ml plastic beaker containing sand-filtered seawater and incubated at 25°C, with the water changed daily. After incubation for 5 to 9 days, the oncomiracidia were collected within 6 h of hatching. For the thermotolerance experiment, the N. melleni eggs and adults were incubated at 18, 25 and 32°C for 24 h, respectively. Collected eggs, oncomiracidia and adults samples were immediately frozen in liquid nitrogen before been stored at -70°C. Cloning of the full-length cDNA of NmTrx Express sequence tag (EST) sequence was employed to obtain important gene information in N. melleni. Total RNAs were extracted from the samples of eggs, oncomiracidia, and adults of N. melleni using RNAiso reagents (TaKaRa, Kyoto, Japan) and mRNA was purified using Oligotex-dT30<super> (TaKaRa), respectively. In order to generate EST resources with maximal efficiency of gene discovery, three individual mRNA samples were pooled together in equal amounts. The cDNA Library Construction Kit (TaKaRa) was used according to the manufacturer’s protocols. A total of 30649 selected clones were partially auto-sequenced by an ABI 3730 automated sequencer (Invitrogen) and analyzed with BLASTX search (http://www.ncbi.nlm.nih.gov/). Sequence analysis The cleavage site of signal peptides was predicted by the SignalP 3.0 program (http://www.cbs.dtu.dk/services/SignalP/). The incidence of conserved protein domains was assessed using InterProScan (http://www.ebi.ac.uk/Tools/InterProScan/). Multiple sequence alignment, phylogenetic and molecular evolutionary analyses were conducted using MEGA version 4 (Tamura et al., 2007). Transcripts analysis of NmTrx in different developmental stages of N. melleni Total RNA was isolated from eggs, oncomiracidia and adults of N. melleni, respectively using RNAiso reagent (TaKaRa, Kyoto, Japan), then treated with deoxyribonuclease I (TaKaRa) and reverse transcribed using Reverse Transcriptase M-MLV (RNase H¯) (TaKaRa). Primers NmTrx (+): 5’-AAATTAGAAGCCGTTCTGGC-3’ and NmTrx (-): 5’-GCTCTCTTTCTCCGCTTCTT-3’ were used to amplify a 105 bp fragment of the NmTrx gene. As an internal PCR control, primers 28S rRNA(+): 5’AAGCCACCATGCGTTTGTA-3’ and 28S rRNA(-): 5’TCATGCCAGAATACCAACC-3’ were used to amplify a 149 bp fragment of the housekeeping 28S rRNA gene (accession number: FJ972005). One microliter of the resultant solution from each reverse transcription reaction served as the template in a 20 µl realtime polymerase chain reaction (PCR) reaction using SYBR premix Ex Taq (Perfect Real Time) (TaKaRa). The real-time PCR reaction was performed in triplicate on the RT-Cycler™ Realtime Fluorescence Quantitative PCR machine (CapitalBio, Beijing, China) using the following conditions (10 min at 95°C at the beginning, 40 cycles of 95°C for 30 s, 58°C for 30 s, and finally 72°C for 30 s). The mRNA expression of the NmTrx was normalized against 28S rRNA expression. All data were expressed as means ± SEM and statistified by one-way analysis of variance (ANOVA) with SPSS (version 13.0, Chicago, IL, USA). The tests were considered statistically significant at p < 0.05.

7584

Afr. J. Biotechnol.

Prokaryotic expression and purification Based on the previously determined NmTrx sequence, a primer pair was designed that would amplify the ORF and which included restriction sites for Nde I and BamH I at the 5’ and 3’ ends of the upstream (NmTrx-F: 5’-CCATATGTACGATCATGTTACAACAGA3’) and downstream (NmTrx-R: 5’-CGGATCCTTAGTTTTTTGGTGTTGTTATAT-3’) primers respectively, in order to facilitate subsequent directional cloning into the NdeI/BamHI-digested pET28a vector (QIAGEN, Shanghai, China). Pfu DNA Polymerase (Fermentas) was used for gene amplification according to the manufacturer’s protocols. Prokaryotic over-expression of the protein was performed according to established protocols (Sambrook et al., 1989). The His-tagged recombinant proteins were purified by nickel-affinity chromatography according to the manufacturer's protocol (QIAGEN) and further analyzed by SDS-PAGE. Antiserum preparation and western blot The purified NmTrx protein was used as an antigen to immunize mice to produce antiserum (Han et al., 2007; Han and Zhang, 2007). Antigen was mixed with an equal volume of Freund’s complete adjuvant (Sigma, USA). The emulsion was injected intradermally into mice and two booster shots were administered at one week interval. One day after the last injection, blood was collected, clarified by overnight incubation at 4°C, and centrifuged at 1500 g for 15 min. The serum was stored at -70°C. Collected egg and adult samples were lysed at 4 °C in a buffer composed of 20 mM Hepes, 1.5 mM MgCl2, 0.2 mM EDTA, 100 mM NaCl, 0.2 mM DTT, 0.5 mM sodium orthovanadate, and 0.4 mM PMSF (pH 7.4). The lysate was then centrifuged at 10,000 g for 30 min. The protein concentration of the supernatant was measured in each soluble fraction by using the Bradford method, and samples were subjected to SDS-PAGE (15% acrylamide gel) and transferred to PVDF (Pall, NY, USA). Membranes were blocked for 1 h in a 10% non-fat dry milk solution in TBS-Tween. After 1.5 h incubation with NmTrx antiserum, membranes were washed and incubated for 1 h with HRP-conjugated secondary antibodies. Proteins were visualized by enhanced chemiluminescence (Santa Cruz Biotechnology, Santa Cruz, CA), and semiquantitative analysis was performed by scanning densitometry.

Thioredoxin activity The activity of NmTrx was measured by monitoring the reduction of insulin by the increase in turbidity (Holmgren, 1979). The reaction mixture contained 50 mM Tris (pH 7.5), 2 mM EDTA, 0.33 mM dithiothreitol (DTT), 0.13 mM insulin, and thioredoxin in concentrations 2 to 4 µM. The reaction was started by pipetting 3 ml DTT in all cuvettes. The measurements were performed at 650 nm using 2.0 min intervals for 60 min. The time for precipitation initiation was defined as an increase by 0.02 at A650 after a stable base-line recording. The antioxidant activity of NmTrx was detected by Fe3+ reducing power-based total antioxidant capacity Detection Kit (Jiancheng Bioengineering co., Ltd). An antioxidant capacity unit was defined as an increase by 0.01 at A520 min-1 per mg protein. Trx activities in the three development stages of N. melleni were measured with the insulin disulfide reduction assay as described elsewhere (Schulze et al., 2004). Total protein was extracted from egg, oncomiracidium, or adult with lysis buffer. Total protein extract was incubated with buffer (50 mmol/l HEPES pH 7.6, 1 mmol/l EDTA, 1 mg/ml BSA, 2 mmol/l DTT) at 37°C for 15 min before they were incubated with human Trx reductase (Sigma, St. Louis, MO) in the reaction buffer (0.3 mmol/l insulin, 200 µmol/l NADPH, 1 mmol/l EDTA, and 20 mmol/l HEPES pH 7.6) at 37°C for 20 min. The reaction was then terminated by adding 500 µl of stop mix (6 M

guanidine HCl, 1 mM DTNB in 0.2 M Tris-HCl pH 8.0) and then absorption at 412 nm was measured.

RESULTS NmTrx gene analysis To obtain the cDNA sequence of important genes in N. melleni, a total of 30649 selected clones were singlepass sequenced, resulting in the characterization of 26548 ESTs that were longer than 100 bp after eliminating vector sequences. The average insert size was estimated to be 673 bp by PCR amplification of inserts from 50 randomly selected clones. The NmTrx was identified by the BLASTX search. The nucleotide sequence obtained was deposited into the DDBJ/ GenBank/EMBL databases with the accession number GW920378 for the full-length cDNA sequence of NmTrx. The full-length cDNA sequence of NmTrx was 735 nt long (Figure 1). The predicted translation product contains 170 amino acids (aa) with a calculated Mr of 19.0 kDa and a theoretical isoelectric point (pI) of 4.83. The amino acid sequence was aligned with the corresponding published sequences of other animals. The N-terminal half of the protein contained the thioredoxin active-site motif which consisted of four amino acid CPGC. Amino acid sequence comparisons showed that NmTrx had a high degree of identity with the Trx of Xenopus (Silurana) tropicalis and Drosophila willistoni (47%) than that of other animals (36 to 46%). A phylogenetic tree was constructed using the reference amino acid sequences by the neighbor-joining method. Currently accepted relationships of the animal phyla were reflected in the phylogenetic tree. NmTrx is distantly related to other animal clusters (Figure 2). In Figure 2, the values at the branching points indicate the percentage of trees in which this grouping occurred after bootstrapping (1,000 replicates; shown only when > 60%). The scale bar shows the number of substitutions per base. Accession numbers of sequences used are Homo sapiens_Trx1, AAF86466; Nomascus leucogenys_Trx1, XP003260517; Callithrix jacchus_Trx1, AF353204; Rattus norvegicus_ Trx1, AAH58454; Mus musculus_Trx1, AAH94415; Anolis carolinensis_Trx1, XP003227375; Mesobuthus caucasicus_Trx1, CAE54119; Litopenaeus vannamei_ Trx1, EU499301; Fenneropenaeus chinensis_Trx1, ACX30746; Neobenedenia melleni_Trx, GW920378; Lycosa singoriensis_Trx2, ABX75495; Bombyx mori_ Trx2, NP_001040283; Xenopus laevis_Trx2, NP_ 001080066; Oreochromis mossambicus_Trx2, ABO26636; Homo sapiens_Trx2, AAF86467 and Mus musculus_Trx2, CAM23426. The analysis of NmTrx mRNA expression The transcript level of NmTrx was measured at the egg,

Sheng et al.

7585

Figure 1. Nucleotide and predicted amino acid sequences of NmTrx. The catalytic center is shaded in dark. The polyadenylation signal is underlined. An asterisk indicates the stop codon.

the oncomiracidium, and the adult stages of N. melleni while 28S rRNA gene expression was used as an internal control. Real-time PCR data showed that NmTrx transcript was markedly lower at the oncomiracidium stage than that at the egg stage (P < 0.01), and higher at the adult stage compared with that at the egg stage (P < 0.05). Moreover, NmTrx transcript was higher at the adult stage compared with that at the oncomiracidium stage (P < 0.001, Figure 3A). The environment temperature induced change of NmTrx transcripts were measured at the egg and adult stages of N. melleni. There was no significant difference of NmTrx mRNA expression in the eggs between the 18 and 25°C groups. The NmTrx

mRNA expression in the eggs in the 32°C group was higher than those in the 18 and 25°C groups (P < 0.001) (Figure 3B). In the adults, the NmTrx mRNA level in the 32°C groups was up-regulated compared with the 18 and 25°C groups (P < 0.01) (Figure 3C). Prokaryotic expression and purification of NmTrx The open reading frame (ORF) encoding NmTrx was amplified and cloned into the pET28a vector. For expression, plasmid was transformed into an E. coli strain BL21. The expression of recombinant proteins was

7586

Afr. J. Biotechnol.

Figure 2. Phylogenetic (neighbor-joining) analysis of complete amino acid sequence of different thioredoxin molecules using the MEGA 4.0 program.

induced with 1 mM IPTG (Figure 4). The observed MW from SDS-PAGE of recombinant NmTrx was about 27.4 kDa. The resulting protein has a higher molecular weight than our predicted one because of the His-tag insertion. The target protein was further purified by nickelnitrilotriacetic acid chromatography. The purity of recombinant NmTrx preparation was checked by SDSPAGE, which showed a single band moving at the position expected from its molecular size (Figure 4). An NmTrx antiserum was prepared in mice immunized with the purified recombinant protein. The temperature expression

dependent

NmTrx

protein

To investigate the temperature dependent NmTrx protein expression, whole eggs and adults were homogenized for protein preparation after 24 h induction under the 18°C, 25°C, or 32°C. Different incubation temperatures were found to be able to effectively change the protein

expression of NmTrx in the eggs and adults by Western blot method. In the eggs, the protein expression level of NmTrx showed a 2.35 fold increase at 32°C compared with 18 and 25°C (Figure 5A). There was no significant change of NmTrx protein expression in the eggs between the 18 and 25°C groups. In the adults, NmTrx protein expression was also 1.8-fold up-regulated in the 32°C group than the 18 and 25°C ones (Figure 5B). Activity analysis of NmTrx To estimate the activity of recombinant NmTrx, the ability to reduce the interchain disulfide of insulin was analyzed. In the control cuvette of no NmTrx, there was no precipitation throughout the whole test period. The addition of 2 and 4 µM rEsTrx1 resulted in rapid precipitation appearing after 12 and 8 min, respectively (Figure 6A). The Trx activities of eggs, oncomiracidia, and adults were further measured in whole homogenates. Compared with the eggs, the Trx activity was down-

Sheng et al.

18°C

18°C

25°C

25°C

32°C

32°C

Figure 3. RT-qPCR analysis of NmTrx mRNA expression. (A), NmTrx transcript levels were different in the three development stages. **P < 0.01 vs. Egg; *P < 0.05 vs. Egg; ### P < 0.001 vs. Oncomiracidium. (B), the environmental temperature induced the change of NmTrx mRNA expression in the egg stage. (C), the change of NmTrx mRNA expression in the adult stage was induced by the environmental temperature. *** P < 0.001 vs. 18°C; ** P < 0.01 vs. 18°C. NmTrx transcript levels were normalized dividing by the 28S rRNA content. Each bar represents the mean ± SEM of the results from four samples.

7587

7588

Afr. J. Biotechnol.

Figure 4. Prokaryotic expression and purification of recombinant NmTrx. The proteins were resolved using 15% SDSPAGE. Lane M: protein marker; lane 1: before IPTG induction; lane 2: after IPTG induction; lane 3: purified recombinant protein.

18°C

25°C

32°C

18°C

25°C

32°C

Figure 5. Analysis of NmTrx in the eggs (A) and adults (B) at different temperatures by Western blot. The eggs and adults of N. melleni were incubated at 18, 25, and 32°C for 24 h, respectively. The proteins were isolated from whole homogenates of eggs or adults and analyzed by Western blot (N = 3). **P < 0.01 vs. 18°C; ***P < 0.001 vs. 18°C; ## P < 0.01 vs. 25°C; ### P < 0.001 vs. 25°C.

regulated in the oncomiracidia, but up-regulated in the adults (Figure 6B). Fe3+ reducing power assay was

employed to evaluate the antioxidant capacity of NmTrx. The antioxidant capacity of NmTrx was determined to be

Sheng et al.

7589

Time (min) Figure 6. NmTrx-catalyzed reduction of insulin. (A) Activity analysis of recombinant NmTrx by by insulin turbidity assay. The absorbance at 650 nm was plotted against time. The cuvettes devoid of NmTrx at the 0 min served as blank and control. (B) Relative Trx activities in the lysates of the three developmental stages of N. melleni were assessed, normalized, and expressed as the percentage of the egg stage. Data represent as means ± SEM (N = 3). *P < 0.05 vs. Egg; **P < 0.01 vs. Egg; ### P < 0.001 vs. Oncomiracidium.

5.12 U/mg protein. DISCUSSION Here, we identified a thioredoxin from N. melleni, which is known for having the broadest host-specificity of any monogenean species. The characteristic active site sequence CGPC of thioredoxins, structurally important amino acid residues, is highly conserved in NmTrx. This motif can control protein function via the redox state of structural or catalytic thiol groups (Nkabyo et al., 2002). The NmTrx has a molecular weight of 19.0 kDa, which is higher than the molecular weight of classic thioredoxin in other animals. In a phylogenetic tree, the observed relationships reflected the taxonomic positions of the species. However, the NmTrx is distantly related to the thioredoxin of other animal clusters. The uniqueness of the NmTrx sequence may reflect the specific life environment of N. melleni as a body surface parasite. The study also supports the idea of considering the NmTrx as a drug target for the treatment of the parasite N. melleni. The expression of NmTrx at the transcriptional level revealed that NmTrx transcripts were all present in the three development stages examined, with the highest mRNA and protein expression level in the adult stage. The ubiquitous expression of NmTrx expression in the different developmental stages of N. melleni may suggest that the NmTrx is involved in important physiological functions. Thioredoxin, the crucial component of redox control systems, has versatile functions in DNA synthesis, defense against oxidative stress and apoptosis or redox signaling with reference to many diseases

(Holmgren and Lu, 2010). In addition, the high level of NmTrx expression at the adult stage suggests that the N. melleni possibly suffer from stronger oxidized stress in the adult stage. The life cycle of N. melleni involves a fish host and they mostly spread by way of eggs and freeswimming infective larvae (oncomiracidia) in the seawater (Bondad-Reantaso et al., 1995). Therefore, N. melleni in the egg and oncomiracidium stages are only required to control free radicals produced by their metabolism. They are required to control potential damage from metabolism and host immune attack together in the adult stage (Henkle-Dührsen and Kampkötter, 2001). We conclude that more NmTrx protein and activity in the adults is needed to control potential damage. It has been found that thioredoxin pathways differ in parasitic and free-living flatworms (Otero et al., 2010). This result may also suggest that NmTrx plays more important roles in the adult stage than in the egg and oncomiracidium stages. Thioredoxin functions are to regulate redox homeostasis in response to stresses, such as thermal stress, hypoxia, and osmotic stress (Kouwen et al., 2009; Muniyappa et al., 2009; Ying et al., 2010). In this study, the mRNA expression of NmTrx is higher in the egg stage at 32°C compared with 18 and 25°C. 25°C was the most suitable environment temperature to hatch N. melleni. The development of the N. melleni eggs will almost stop when the environment temperature is higher than 32°C (Lin et al., 2008). It has been found that heat exposure will influence the redox state (Hadzi-Petrushev et al., 2011). Our work supports the conception that thioredoxin participates in the thermal stress induced redox change. Thioredoxin possesses a general intracellular anti-

7590

Afr. J. Biotechnol.

oxidant activity and protects against oxidative stress (Holmgren et al., 2005). In this study, recombinant NmTrx is able to reduce insulin at 2 and 4 µM. Furthermore, the dithiol-reducing activity (5.12 U/mg) of NmTrx was comparable to the specific activity of Trx1 from E. coli (4.93 U/mg), calf thymus (6.50 U/mg) and calf liver (5.09 U/mg) (Holmgren, 1979). This result suggests that this thioredoxin from N. melleni is functionally similar to classic thioredoxins. In another platyhelminth parasite S. mansoni, two thioredoxins have been found by analyzing genome sequence (Berriman et al., 2009). It is still unknown whether other thioredoxins exist in N. melleni besides NmTrx. The Trx activity of N. melleni was lower in the oncomiracidia and higher in the adults than that in the eggs. The Trx activities in the three development stages are consistent with NmTrx mRNA. These results might suggest that NmTrx is the major Trx protein in N. melleni. In summary, we cloned and characterized the first thioredoxin from the fish parasite N. melleni and examined the mRNA expression of NmTrx in different developmental stages at different environmental temperatures. Moreover, the recombinant protein of NmTrx showed antioxidant activity. The NmTrx may play important roles in the physiological oxidation-reduction of disulfide bonds to maintain redox homeostasis. ACKNOWLEDGEMENTS The project was supported by the Program for New Century Excellent Talents in University (NCET-080928), the Ningbo Discipline Project (szx11069) and the KC Wong Magna Fund in Ningbo University. REFERENCES Alger HM, Sayed AA, Stadecker MJ, Williams DL (2002). Molecular and enzymatic characterisation of Schistosoma mansoni thioredoxin. Int. J. Parasitol. 32: 1285-1292. Angelini G, Gardella S, Ardy M, Ciriolo MR, Filomeni G, Di Trapani G, Clarke F, Sitia R, Rubartelli A (2002). Antigen-presenting dendritic cells provide the reducing extracellular microenvironment required for T lymphocyte activation. Proc. Natl. Acad. Sci. USA, 99: 1491-1496. Berriman M, Haas BJ, LoVerde PT, Wilson RA, Dillon GP, Cerqueira GC, Mashiyama ST, Al-Lazikani B, Andrade LF, Ashton PD, Aslett MA, Bartholomeu DC, Blandin G, Caffrey CR, Coghlan A, Coulson R, Day TA, Delcher A, DeMarco R, Djikeng A, Eyre T, Gamble JA, Ghedin E, Gu Y, Hertz-Fowler C, Hirai H, Hirai Y, Houston R, Ivens A, Johnston DA, Lacerda D, Macedo CD, McVeigh P, Ning Z, Oliveira G, Overington JP, Parkhill J, Pertea M, Pierce RJ, Protasio AV, Quail MA, Rajandream MA, Rogers J, Sajid M, Salzberg SL, Stanke M, Tivey AR, White O, Williams DL, Wortman J, Wu W, Zamanian M, Zerlotini A, Fraser-Liggett CM, Barrell BG, El-Sayed NM (2009). The genome of the blood fluke Schistosoma mansoni. Nature, 460: 352358. Bondad-Reantaso MG, Ogawa K, Fukudome M, Wakabayashi H (1995). Reproduction and growth of Neobenedenia girellae (Monogenea: Capsalidae), a skin parasite of cultured marine fishes of Japan. Fish Pathol. 30: 227-231. Bonilla M, Denicola A, Novoselov SV, Turanov AA, Protasio A, Izmendi D, Gladyshev VN, Salinas G (2008). Platyhelminth mitochondrial and

cytosolic redox homeostasis is controlled by a single thioredoxin glutathione reductase and dependent on selenium and glutathione. J. Biol. Chem. 283: 17898-17907. Chen Q, Vazquez EJ, Moghaddas S, Hoppel CL, Lesnefsky EJ (2003). Production of Reactive Oxygen Species by Mitochondria. J. Biol. Chem. 278: 36027-36031. Gelhaye E, Rouhier N, Jacquot JP (2004). The thioredoxin h system of higher plants. Plant. Physiol. Biochem. 42: 265-271. Hadzi-Petrushev N, Jankulovski N, Hristov K, Mladenov M (2011). l-2oxothiazolidine-4-carboxylate influence on age- and heat exposuredependent redox changes in rat’s blood plasma. J. Physiol. Sci. 61: 437-442. Han F, Xu J, Zhang X (2007). Characterization of an early gene (wsv477) from shrimp white spot syndrome virus (WSSV). Virus Genes 34: 193-198. Han F, Zhang X (2007). Characterization of a ras-related nuclear protein (Ran protein) up-regulated in shrimp antiviral immunity. Fish Shellfish. Immunol. 23: 937-944. Henkle-Dührsen K, Kampkötter A (2001). Antioxidant enzyme families in parasitic nematodes. Mol. Biochem. Parasit. 114: 129-142. Holmgren A (1979). Thioredoxin catalyzes the reduction of insulin disulfides by dithiothreitol and dihydrolipoamide. J. Biol. Chem. 254: 9627-9632. Holmgren A, Lu J (2010). Thioredoxin and thioredoxin reductase: Current research with special reference to human disease. Biochem. Bioph. Res. Commun. 396: 120-124. Holmgren A, Johansson C, Berndt C, Lonn ME, Hudemann C, Lillig CH (2005). Thiol redox control via thioredoxin and glutaredoxin systems. Biochem. Soc. Trans. 33: 1375-1377. Kouwen TRHM, Antelmann H, Van der Ploeg R, Denham EL, Hecker M, Van Dijl JM (2009). MscL of Bacillus subtilis prevents selective release of cytoplasmic proteins in a hypotonic environment. Proteomics, 9: 1033-1043. Krauth-Siegel RL, Bauer H, Schirmer RH (2005). Dithiol proteins as guardians of the intracellular redox milieu in parasites: old and new drug targets in trypanosomes and malaria-causing plasmodia. Angew. Chem. Int. Ed. 44: 690-715. Lin KB, He LB, Zhou C (2008). Effects of several physical and chemical factors on eggs development of Neobenedenia melleni. Mar. Sci. 32: 1-4. Miranda-Vizuete A, Ljung J, Damdimopoulos AE, Gustafsson JA, Oko R, Pelto-Huikko M, Spyrou G (2001). Characterization of Sptrx, a novel member of the thioredoxin family specifically expressed in human spermatozoa. J. Biol. Chem. 276: 31567-31574. Muniyappa H, Song S, Mathews CK, Das KC (2009). Reactive oxygen species-independent oxidation of thioredoxin in hypoxia. J. Biol. Chem. 284: 17069-17081. Nakamura H, Hoshino Y, Okuyama H, Matsuo Y, Yodoi J (2009). Thioredoxin 1 delivery as new therapeutics. Adv. Drug Deliv. Rev. 61: 303-309. Nkabyo YS, Ziegler TR, Gu LH, Watson WH, Jones DP (2002). Glutathione and thioredoxin redox during differentiation in human colon epithelial (Caco-2) cells. Am. J. Physiol. Gastrointest. Liver Physiol. 283: G1352-1359. Nordberg J, Arner ES (2001). Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Radic. Biol. Med. 31: 1287-1312. Otero L, Bonilla M, Protasio A, Fernandez C, Gladyshev V, Salinas G (2010). Thioredoxin and glutathione systems differ in parasitic and free-living platyhelminths. BMC Genomics, 11: p. 237. Roos G, Messens J (2011). Protein sulfenic acid formation: From cellular damage to redox regulation. Free Radic. Biol. Med. 51: 314326. Saitoh M, Nishitoh H, Fujii M, Takeda K, Tobiume K, Sawada Y, Kawabata M, Miyazono K, Ichijo H (1998). Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK) 1. Embo. J. 17: 2596-2606. Sambrook J, Fritsch EF, Maniatis T (1989). Molecular cloning: a laboratory manual, 2 nd Edition. Cold Spring Harbor Laboratory press, New York, USA. Schulze PC, Yoshioka J, Takahashi T, He Z, King GL, Lee RT (2004). Hyperglycemia promotes oxidative stress through inhibition of

Sheng et al.

thioredoxin function by thioredoxin-interacting protein. J. Biol. Chem. 279: 30369-30374. Sotirchos IM, Hudson AL, Ellis J, Davey MW (2008). Thioredoxins of a parasitic nematode: Comparison of the 16- and 12-kDA thioredoxins from Haemonchus contortus. Free Radic. Biol. Med. 44: 2026-2033. Sotirchos IM, Hudson AL, Ellis J, Davey MW (2009). A unique thioredoxin of the parasitic nematode Haemonchus contortus with glutaredoxin activity. Free Radic. Biol. Med. 46: 579-585. Spyrou G, Enmark E, Miranda-Vizuete A, Gustafsson J (1997). Cloning and expression of a novel mammalian thioredoxin. J. Biol. Chem. 272: 2936-2941. Suttiprapa S, Matchimakul P, Loukas A, Laha T, Wongkham S, Kaewkes S, Brindley PJ, Sripa B (2012). Molecular expression and enzymatic characterization of thioredoxin from the carcinogenic human liver fluke Opisthorchis viverrini. Parasitol. Int. 61: 101-106. Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599. Toledano MB, Kumar C, Le Moan N, Spector D, Tacnet F (2007). The system biology of thiol redox system in Escherichia coli and yeast: Differential functions in oxidative stress, iron metabolism and DNA synthesis. FEBS Lett. 581: 3598-3607. Watanabe R, Nakamura H, Masutani H, Yodoi J (2010). Anti-oxidative, anti-cancer and anti-inflammatory actions by thioredoxin 1 and thioredoxin-binding protein-2. Pharmacol. Therapeut. 127: 261-270.

7591

Yang TB, Chen AP, Chen W, Li AX, Yan YY (2007). Parasitic diseases of cultured marine finfishes and their surveillance in China. Parassitologia, 49: 193-199. Yang WC, Li LW, Shi L, Wang J, Su YQ (2001). Study on aetiology of Neobenedenia melleni (Monogenea: Capsalidae) from marine fishes in Fujian, China. J. Oceanogr. Taiwan Strait, 20: 205-209. Ying SH, Wang XH, Feng MG (2010). Characterization of a thioredoxin (BbTrx) from the entomopathogenic fungus Beauveria bassiana and its expression in response to thermal stress. Can. J. Microbiol. 56: 934-942.

African Journal of Biotechnology Vol. 11(30), pp. 7592-7602, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3829 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Ultra-structural study of Egyptian Buffalo oocytes before and after in vitro maturation I. A. H. Barakat1,2, H. M. El–Ashmaoui1,4, A. Barkawi3, S. A. Kandeal2,3 and E. EL-Nahass1 1

2

Department of Cell Biology, National Research Center, Giza, Egypt. Department of Zoology, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Kingdom of Saudi Arabia. 3 Department of Animal Production, Faculty of Agriculture, Cairo University, Egypt. 4 Department of Biological sciences, Faculty of Science, King Abdulaziz University, P. O. Box 80203,Jeddah 21589 Saudi Arabia. Accepted 14 March, 2012

The purpose of this study was to describe the changes occurring in the cytoplasmic organelles of the buffalo oocytes before and after in vitro maturation. The total number of oocytes used in this experiment was 250 oocytes; 50 in vivo matured oocytes, 100 immature oocytes, and the other 100 was in vitro matured oocytes cultured in TCM-199 + LH. The oocytes examined in this study showed normal ultra-structure of mitochondria, smooth endoplasmic reticulum (SER), zona pellucida (ZP), lipid droplets, vesicles and Golgi in the good type meanwhile, some differences and abnormalities in denuded oocytes were recorded. The most remarkable changes observed in the two different categories of oocytes (good and denuded) after maturation was the different complexes consisting endoplasmic reticulum, mitochondria (M), lipid droplets (L), vesicles (V) and ZP. Concerning the polar body (PB), group of in vitro matured oocytes showed a normal PB formation, vesicles, whereas mitochondria were dislocated towards the site of the PB. In vitro matured oocytes showed clusters of cortical granules which existed in aggregates throughout the peripheral ooplasm just beneath the oolemma. In vitro maturation of Egyptian buffalo oocytes could be elucidated by alterations that occurred in the cytoplasmic organelles of the oocytes as shown by transmission electron microscopy (TEM). Key words: Egyptian buffalo, oocytes, in vitro maturation, ultra-structure. INTRODUCTION In vitro embryo production (IVEP) technology represents the best tool to improve maternal contribution to genetic progress in buffalo. Besides the progress obtained in the percentage of in vitro produced transferrrable embryos (Gasparrini et al., 2006, Manjunatha et al., 2009), the pregnancy rate achieved by transferring these structures remains poor (Gasparrini, 2002; Nandi et al., 2002a). In vitro maturation (IVM) of oocytes from small antral follicles could reduce the need for exogenous

*Corresponding author. E-mail: ibrahimahb@yahoo.com, ibarakat@ksu.edu.sa. Tel: 00966541834774. Fax: 0096614678514.

gonadotrophin treatment and offer an alternative to hyperstimulation of ovulation during in vitro fertilization (IVF) (Yong-jie et al., 2009). Also, Yong-jie et al. (2009) showed that in vitro oocyte maturation is intended to stimulate the maturation of both the nucleus and the cytoplasm. Indices of the matured nucleus include breakdown of the nuclear envelop, segregation of chromosomes, and appearance of the first polar body. These changes are accompanied by a set of changes in the cytoplasm, such as nutrient accumulation and organelle redistribution. Maturation of the nucleus and cytoplasm synchronizes itself in vivo, whereas in vitro stimulation may only aid in the maturation of one or the other. Oocytes maturation is the first and most critical step

Barakat et al.

towards a successful in vitro production of embryos, but little information are available on in vitro maturation and fertilization of buffalo oocytes (Totey et al., 1991, 1992). Also, preliminary results obtained by various workers (Bacci et al., 1991; Chuangsoongneen and Kamonpatana, 1991; Lu and Hsu, 1990; Totey et al., 1992) on in vitro maturation and fertilization of buffalo oocytes reported poor results compared to cattle. During maturation, major changes took place in protein synthesis (Moor and Warnes, 1978; Crosby et al., 1981; Moor et al., 1981) and it has been proposed that such changes are essential for the continuation of cytoplasmic maturation (Thibault, 1977; Golbus and Stein, 1978; Moor et al., 1978). In addition to concomitant with nuclear maturation, cytoplasmic changes occur during oocyte maturation. At the ultra-structural level, cytoplasmic maturation encompasses morphological alterations in the distribution of organelles such as mitochondria, endoplasmic reticulum and cortical granules (Kruip et al., 1983; Blerkom and Bell, 1986; Loos et al., 1989). Ultrastructural changes in the oocyte during in vitro maturation have been studied in different mammalian species in detail [mouse (Merchant and Chang, 1971), human (Zamboni and Thomson, 1972) and cattle (Hyttel et al., 1997)]. Although, Ultra-structural studies on the oocyte during in vitro maturation in different mammalian species [mouse (Merchant and Chang, 1971), human (Zamboni and Thomson, 1972), cattle (Hyttel et al., 1997) and camel (Kafi et al., 2005)] have resulted in a better understanding of the biology of the oocyte and as a consequence, improvements in IVM and IVF. However, systematic studies on ultra-structure of buffalo oocytes during IVM have not been reported. Therefore, the objective of the present study was to describe the ultrastructure changes of Egyptian buffalo oocyte during in vitro oocyte maturation. MATERIALS AND METHODS Oocytes collection and in vitro maturation The ovaries were removed directly from abdominal cavity of Egyptian buffaloes after slaughtering and maintained in a thermo flask containing saline solution (0.9% NaCl) mixed with 50 µg/ml gentamycin sulphate at 30 to 38°C and were transported to laboratory within 2 h. At the laboratory, the ovaries were washed three times with pre-warmed isotonic saline solution supplemented with gentamycin sulfate to exclude adhering blood and other increment tissues. Immature oocytes were recovered by aspiration of the follicles on the ovaries using a 10 ml sterile syringe and an 18 G disposable needle. The oocytes were classified into three categories on basis of the presence of cumulus mass and homogeneity of cytoplasm (excellent, good and denuded oocytes) as described by Loos et al. (1989, 1991). The collected oocytes were washed three times with maturation medium (TCM-199 + 10% FCS + 0.02 IU FSH / ml + 0.023 IU LH / ml + 50 µg Gentamycin sulfate / ml + 1 µg Estradiol 17 β/ ml for 24 h at 38.5°C in 5% CO2, and 95% humidity). Oocytes were cultured in groups in 4–well sterile plastic Petri dishes. The culture dishes were incubated for 22 to 24 h at 38.5°C in 5% CO2, and 95% humidity.

7593

Experimental design A total of 200 buffalo oocytes were selected to study the ultrastructure of oocyte before and after in vitro maturation; half of the oocytes (50 good and 50 denuded oocytes) were studied before maturation while the other half examined were studied after maturation. This is in addition to 50 in vivo matured oocytes which had expanded cumulus cells, which were randomly selected to investigate some fine structures of oocytes. Oocytes matured in vitro were cultured in maturation medium, in order to determine the ultra-structure changes of oocytes after in vitro maturation. Preparation of oocytes for transmission electron microscopy (TEM) The procedure performed to study the ultrastructure of oocytes before and after in vitro maturation was that of Zaki (2000). This procedure was established and obtained from Electron Microscope Laboratory, Faculty of Science, Ain Shams University, Egypt. Ultra-structure evaluation Ultrastructural alterations were examined, interpreted and assessed according to the scheme based on previous works by Fuku et al. (1995 a and b) and Kanwal (1999).

RESULTS Ultra-structure of Egyptian buffalo oocytes matured in vivo Mitochondria were observed in a normal number and distribution in the cytoplasm. The hooded (H), and round (R) mitochondria (M) were observed (Figure 1a) but no pleomorphic mitochondria were observed throughout the cytoplasm. The most abundant form of endoplasmic reticulum (ER) appeared as associated with the surfaces of hooded mitochondria (HM). Also, in vivo matured oocytes showed low number of microvilli (Figure 1a) and the vesicles were located in close proximity to mitochondria. The cortical granules (CGs) were arranged just inside the oolemma. Golgi apparatus (G), and oval mitochondria were also detected (Figure 1b). A large number of small to medium size vesicles was also observed containing varying amounts of electron-dense material. The lipid droplets were randomly distributed with vesicles (Figure 1c). In vitro maturation of Egyptian buffalo oocytes Ultra-structure of oocytes before in vitro maturation Good quality oocytes: The result of this group revealed that the immature oocytes were characterized by the presence of non-expanded cumulus cells. Cumulus cells foot process endings extended from the cumulus cells through the zona pellucida. The mitochondria were located at the peripheral of the oocytes with a small number close to the center. They were,generally rounded

7594

Afr. J. Biotechnol.

a

b

c

d

Figure 1. The electron micrograph (TEM) of in vivo matured Egyptian buffalo oocytes showing; a) Hooded mitochondria (HM), round mitochondria (RM), endoplasmic reticulum (ER) and vesicles (V); b) oval mitochondria (OM), Golgi apparatus (G) and cortical granules (CGs); c) lipid droplets (LD) and vesicles (V) and d) hooded mitochondria (HM), oval mitochondria (OM), round mitochondria (RM), lipid droplets (LD), and endoplasmic reticulum (ER).

hooded, or oval shaped. Pleomorphic mitochondria were not found in this group (Figure 1d). The lipid droplets were found mainly near the mito-chondria; they were small in size and number (Figure 1d). Endoplasmic reticulum (ER) were detected both in association with

mitochondria and distributed throughout the ooplasm (Figure 1d). A large number of vesicles were distributed all over the oocyte except at the extreme periphery and large numbers of microvilli were found extended from the plasma membrane through foot

Barakat et al.

a

b

c

d

7595

Figure 2. The electron micrograph of in vivo matured Egyptian buffalo oocytes showing; a) vesicles (V) and microvilli (MV); b) a large number of vesicles (V) and cluster of cortical granules (CG); c) microvilli (MV), cortical granules (CGs), perivitelline space (PVS) and Zona pellucida (ZP) and d) vesicles (V) and lipid droplets (LDs).

processes into zona pellucida (Figure 2a). Cluster of cortical granules were observed in the deep cortex of ooplasm (Figure 2b). Moreover, immature good oocytes had a very large number of vesicles as shown in Figure (2b).

Denuded oocytes: Ultra-structural observation of denuded immature oocytes showed an enlarged perivitelline space (PVS), less number of microvilli and some of them were degenerated and detachment of foot

7596

Afr. J. Biotechnol.

processes. The populations of cortical granules were generally arranged individually or in small clusters of the oocytes. ZP showed irregularity fractures (Figure 2c). Large numbers and sizes of lipid droplets and empty vesicles were found and some of them contained electron dense materials. Also, the numbers of vesicles were very low (Figure 2d). While the hooded mitochondria were rarely observed, the rounded mitochondria were mainly seen in this group. Also, Golgi apparatus was seen in denuded oocytes (Figure 3a).

other groups (Figure 4b). Moreover, denuded oocytes had low number of vesicles, microvilli and lipid droplets (Figures 4b and c). Cortical granules were absent in this group. In denuded oocytes, Golgi apparatuses were distributed in cytoplasm of the oocytes (Figure 5d). Abnormal polar body formation (lightly stained and considered to be degenerated was found in in vitro matured denuded oocytes with no appearance of mitochondria or vesicles (Figure 6). DISCUSSION

Ultra-structure of oocytes after in vitro maturation Good quality oocytes: In good matured oocyte observed in this study, the electron micrographs showed the ER entering and closely related to the hooded mitochondria (Figure 3b) as well as associating with the outer surface of other mitochondrial and cytoplasmic inclusions. Vesicles, and mitochondria observed in the ooplasm were related to well developed cisternae of ER (Figure 3c). Ultra-structurally, in mature good oocytes, the zona pellucida was composed of a moderately staining homogenous material (Figure 3d). Cumulus cell processes and microvilli arising from the oocyte were observed within the zona pellucida. The perivitelline space appeared as a lighter staining band between the zona pellucida and vitelline membrane, this band appeared as a flocculent layer easily differentiated from zona pellucida. The cumulus cells had numerous projections and a structure similar to that of the zona pellucida were observed between these projections and the oolemma. A perivitelline space was small with a limited number of microvilli lying with their long axis; the cortical granules were dispersed to solitary positions forming a closure to the oolemma (Figure 4a). The lipid droplets were peripherally located in the good oocytes and bound layer of endoplasmic reticulum, but randomly distributed in more mature oocyte (Figure 4b). The Golgli apparatus was clearly observed in aggregating groups more than that in the in vivo matured oocytes and oocytes before maturation (Figure 4c). Concerning the polar body, the group of in vitro matured oocytes showed a normal polar body formation, vesicles, and the mitochondria was dislocated towards the site of polar body (Figure 4d). In vitro matured oocytes showed clusters of cortical granules found in aggregates throughout the peripheral ooplasm just beneath the oolemma (Figure 5a). Denuded oocytes: On the other hand, the denuded oocytes showed some abnormal mitochondria, extensive vacuolization, disappearance of cristae, dilated and pleomorphic shaped of mitochondria membrane, however, other mitochondria showed normal membrane and cristae which were clearly delineated (Figures 5b and c). Also, electron micrograph of denuded oocytes showed the vacuolated mitochondria which was not found in the

Available information about the ultra-structural changes in Egyptian buffalo oocytes after in vitro maturation is considered to be very limited. So, the results obtained in this study were compared to other related species. The low number of COCs collected probably might be due to the result of some peculiarities inherent to buffaloes, such as the reduced number of antral and preantral follicles, approximately ten times lower than in cattle (Drost, 2007; Mondadori et al., 2008). The results reveal that the mitochondria observed were similar to those of other domestic species, containing few cristae and frequently opposed vesicular of cisternal endoplasmic reticulum (Cran et al., 1980). Senger and Saacke (1970) had previously described the mitochondria in a study of bovine oocytes from tertiary follicles. It was apparent from their study that the membranes were actually continuous with the cisternae of the endoplasmic reticulum; ribosomes were occasionally associated with these cisternae. The close association of the cisternae with the outer surface of mitochondria appeared to be very similar to that reported by Fleming and Saacke (1972) in cattle oocytes. Also, Kruip et al. (1983) suggested that existence of mitochondrial clusters and vesicles were rearranged ~ 15 h after LH peak. Similar organelle rearrangements were reported in un-stimulated cattle as taking place more than 19 h after the LH peak (Kruip et al., 1983). Hence, in un-stimulated cattle and stimulated cattle, these major organelle rearrangements of the oocyte occur with an increase in the progesterone dominance in the follicular fluid. Immature COCs showed typical structure previously described for buffalo (Boni et al., 1992; Mondadori et al., 2008), as well as for bovine (Kacinskis et al., 2005; Nagano et al., 2006), ovine (O’Brien et al., 2005) and camel (Kafi et al., 2005) oocytes. Confirming previous observations (Mondadori et al., 2008), the most important difference observed between the species is the larger number of lipid droplets in buffalo ooplasm. The same sort of GC–oocyte junctions previously described for buffalo (Mondadori et al., 2008) and bovines (Fair and Hyttel, 1997) was also observed in some immature oocytes. It is well known that these junctions play an important role during oogenesis (Mondadori et al., 2007) and IVM in different species (Suzuki et al., 2000). Similar mitochondrial migrations have been reported in

Barakat et al.

a

b

c

d

7597

Figure 3. The electron micrograph of in vivo matured Egyptian buffalo oocytes showing; a) rounded mitochondria (RM) and Golgi apparatus (G); b) Endoplasmic reticulum (ER) entering and closely related to the hooded mitochondrial (HM) (indicated by arrow) as well as associating with outer surface of other mitochondrial and cytoplasmic inclusions; c) the mitochondria (M), clusters and spatial distribution of vesicles (V) and endoplasmic reticulum (ER) and d) the zona pellucida (ZP).

mice by Van Blerkom, and Runner (1984) who claimed this rearrangement as being essential for the pre-

ovulatory maturation and suggested then to be necessary for elevated concentrations of adenosine triphosphate for

7598

Afr. J. Biotechnol.

a

b

c

d

Figure 4. Electron micrograph of matured in vitro good oocyte of Egyptian buffaloes showing; a) granulosa cell processes associated with the surface of the ooplasm appear to be degenerating due to their very granular appearance. Pinocytotic vesicles (P) are apparent between cumulus cells. Numerous microvilli are seen; b) a lipid droplet (LD) and endoplasmic reticulum (ER); c) groups of Golgi apparatuses in cytoplasm and d) polar body (PB), vesicles (V) and mitochondria (M) which are dislocated towards the site of normal polar body formation.

localized activities in the ooplasm. The close association of the smooth endoplasmic reticulum to the inner surface

of the hood also suggests that the hood may provide a specific microenvironment, facilitating the exchange of

Barakat et al.

a

b

c

d

7599

Figure 5. Electron micrograph of in vitro matured good oocyte of Egyptian buffalo showing; a) cluster of cortical granules (CG); b) abnormal mitochondria exhibit extensive vacuolization, disappearance of cristae and dilated and pleomorphic mitochondrial (PM) membrane and vacuolated mitochondria (VM) other mitochondria showing normal membrane are continuous and cristae are clearly existed; c) undulating mitochondrial membranes and deformed cristae (DC), distorted mitochondrial membrane (DMM), and extensive vacuolization (EV) disappearance of most of cristae and damage of the mitochondrial membrane and microvilli (MV) and d) groups of Golgi apparatus (G).

metabolic intermediates between mitochondria and endoplasmic reticulum. The highly closure of endoplasmic reticulum and mitochondria to the surface of lipid droplet suggests that the oocyte may be utilizing lipid store and could be important in providing nutrients for the

final maturation of the oocyte (Kruip et al., 1983 and Fair et al., 2001), which can explain the success of good type in our results to reach maturation. On the other hand, degeneration or fusion and the observed dilation of the mitochondrial envelope may be an indication that some

7600

Afr. J. Biotechnol.

Figure 6: Electron micrograph of in vitro matured denuded oocyte of Egyptian buffalo showing abnormal polar body formation with no appearance of mitochondria or vesicles.

loss of mitochondria by degeneration was taking place, few markedly degenerate organelles was observed. It seems unlikely therefore that the reduction in number may be accounted for by this means (Kruip et al., 1983). Common feature of mitochondrial shape were seen in this study as showed by many authors such as pleomorphic mitochondria, hooded, and other shapes including dumbbell and cloverleaf shapes were noted, also vacuolated mitochondria described in compact bovine morulae (Crosier et al., 2000) were observed. Hooded mitochondria have been described previously as common in bovine oocytes (Senger and Saacke, 1970; Fleming and Saacke, 1972; Hyttel et al., 1987; Assey et al., 1994). Fleming and Saacke (1972) proposed that the hood served to increase surface area and facilitated transport from the endoplasmic reticulum to hooded mitochondria. They proposed that hooded mitochondria were a unique feature of ruminant oocytes as they were found also in oocytes from goats and sheep. Changes in mitochondrial morphology were observed in this study and at the same time the distribution of mitochondria became more clustered often in association with lipid droplets. These changes may represent a shift in oocyte metabolism from a dependence on the cumulus cells to a dependence on internal stores of energy sources and nutrients. Further studies focusing on oocyte mito-

chondrial function may yield interesting information about oocyte metabolism (Robert, 1999). Large aggregates of smooth endoplasmic reticulum (SER) surrounded by mitochondria are considered to be typical of in vivo matured oocytes 24 h after the LH peak (Gosing and Jonas, 1998). In vitro matured oocytes started to form such clusters at about 18 h of maturation and the aggregation was pronounced more than 24 h of in vitro maturation (Hyttel et al., 1986b). At that time it was considered to be sign of certain metabolic activities maintained throughout the culture period of cattle oocytes (Kruip et al., 1983). Generally, the main differences observed in follicles were cytoplasmic vesicles quantity, mitochondria shape and inner content, ZP deposition and granulosa cells–oocyte junctions (Mondadori et al., 2007). These morphological differences described could be responsible for some functional differences observed in Bubalus bubalis in vitro embryo production and follicular dynamics (Manik et al., 2002; Neglia et al., 2003; Mondadori et al., 2007). From the start of IVM, as a result of the resumption of meiosis, nucleus morphology changes and PVS grow, preparing to receive the polar body. In most oocytes studied, metaphase stage II was achieved after 24 h of IVM period as shown by earlier reports (Nandi et al., 2002b; Gasparrini et al., 2008) but in contrast to Rafael et al. (2010).

Barakat et al.

REFERENCES Assey RJ, Hyttle P, Greve T, Purwantara B (1994). Oocytes morphology in dominant and subordinate follicles. Mol. Reprod. Dev. 37: 335-344. Bacci ML, Galeat G, Mattoili M, Boni R, Seren E (1991). In vitro maturation and in vitro fertilization of buffalo oocytes. Proc., Third World Buffalo Congress, Varna, Bulgaria, 3: 599-603. Chuangsoongneen U, Kamonpatana M (1991). Oocytes maturation, in vitro fertilization and culture system for developing preimplantation swamp buffalo embryos using frozen-thawed semen. Buffalo J. 2: 189-198. Cran DG, Moor RM, Hay MF (1980). Fine structural of the sheep oocytes during antral follicle development. J. Reprod. Fertil. 59: 125132. Crosby IM, Osborn JC, Moor RM (1981). Follicle cell regulation of protein synthesis and development competence in sheep oocytes. J. Reprod. Fertil. 62: 575-582. Crosier AE, Farin PW, Dykstra MJ, Alexander JE, Farin CE (2000). Ultrastructural morphometry of bovine compact morula produced in vivo or in vitro. Biol. Reprod. 62: 1459-1465. De Loose FAM, Van Vliet C, Van Maurik P, Kruip TAM (1989). Morphology of immature bovine oocytes. Gamete Res. 24:197-204. Drost M (2007). Advanced reproductive technology in the water buffalo. Theriogenology, 68: 450-453. Fair T, Hyttel P (1997). Oocyte growth in cattle – ultrastructure, transcription and developmental competence. In: Motta, P (ed.). Microscopy of Reproduction and Development: A Dynamic Approach. pp. 109-118. Fair T, Lonergan P, Boland B (2001). The acquisition of developmental competence in bovine oocytes. Faculty Agric. Res. Report 20002001, pp. 30-32. Fleming WN, Saacke RG (1972). Fine structure of the bovine oocyte from the mature graafian follicle. J. Reprod. Fertil. 29: 203-213. Fuku E, Liu J, Downey BR (1995a). In vitro viability and ultrastructural changes in bovine oocytes treated with a vitrification solution. Mol. Reprod. Dev. 40: 177-185. Fuku E, Xia L, Downey BR (1995b). Ultrastructural changes in bovine oocytes cryopreserved by vitrification. Cryobiology, 32: 139-156. Gasparrini B (2002). In vitro embryo production in buffalo species: state of the art. Theriogenology, 7: 237-256. Gasparrini B, Boccia L, Marchandise J, Di Palo R, George F, Donnay I, Zicarelli L (2006). Enrichment of in vitro maturation medium for buffalo (Bubalus bubalis) oocytes with thiol compounds: effects of cystine on glutathione synthesis and embryo development. Theriogenology, 65: 275-287. Gasparrini B, De Rosa A, Attanasio L, Boccia L, Di Palo R, Campanile G, Zicarelli L (2008). Influence of the duration of in vitro maturation and gamete co-incubation on the efficiency on in vitro embryo development in Italian Mediterranean buffalo (Bubalus bubalis). Anim. Reprod. Sci. 105: 354-364. Golbus MS, Stein MP (1978). Qualitative patterns of protein synthesis in the mouse oocyte. J. Exp. Zool. 198: 337-342. Hyttel P, Fair T, Callesen H, Greve T (1997). Oocyte growth, capacitation and final maturation in cattle. Theriogenology, 47: 23-32. Hyttel P, Greve T, Callesen H (1989). Ultrastructural aspects of oocyte maturation and fertilization in cattle. J. Reprod. Fertil. 38: 35-47. Hyttel PH, Callesen H, Greve T (1986a). Ultrastructural features of preovulatory oocytes maturation in superovulated cattle. J. Reprod. Fertil. 76: 645-656. Hyttel PH, Xu KP, Smith S, Greve T (1986b). Ultrastructure of in vitro oocytes maturation in cattle. J. Reprod. Fertil. 78: 615-625. Hyttle P, Xu KP, Smith S, Callesen H, Greve T (1987). Ultrastructure of the final nuclear maturation of bovine oocytes in vitro. Anat. Embryol. 176: 35-40. Kacinskis MA, Lucci CM, Luque MCA, Bao SN (2005). Morphometric and ultrastructural characterization of Bos indicus preantral follicles. Anim. Reprod. Sci. 47: 45-57. Kafi M, Mesbah F, Nili H, Khalili A (2005). Chronological and ultrastructural changes in camel (Camelus dromedarius) oocytes during in vitro maturation. Theriogenology, 63: 2458-2470. Kanwal KDS (1999). Ultrastructural changes in bovine oocytes induced

7601

during in vitro production of embryos, Ph. D., Thesis, University Putra Malaysia. Kruip TAM, Cran DG, Beneden THV, Dieleman SJ (1983). Structural changes in bovine oocytes during final maturation in vitro. Gamete Res. 8: 29-47. Loos De F, Kastrop P, Van Maurik P, Van Beneden TH, Kruip TAM (1991). Heterologous cell contacts and metabolic coupling in bovine cumulus oocyte complexes. Mol. Reprod. Dev. 28: 255-259. Loos De F, Van Vliet C, Van Maurik P, Kruip TAM (1989). Morphology of immature bovine oocytes. Gamete Res. 24: 197-204. Lu G, Hsu TT (1990). IVF of oocytes in Taiwan water buffalo. Proceed. rd of the 3 World Buffalo Cong. pp. 604-609. Manik RS, Palta P, Singla SK, Sharma V (2002). Folliculogenesis in buffalo (Bubalus bubalis): a review. Reprod. Fertil. Dev. 14: 315-325. Manjunatha BM, Ravindra JP, Gupta PSP, Devaraj M, Nandi S (2009). Effect of breeding season on in vivo oocyte recovery and embryo production in non-descriptive Indian river buffaloes (Bubalus bubalis). Anim. Reprod. Sci. 111: 376-383. Merchant H, Chang MC (1971). An electron microscopic study of mouse eggs matured in vivo and in vitro. Anat. Rec. 171: 21-38. Mondadori RG, Luque MCA, Santin TR, B´ao SN (2007). Ultrastructural and morphometric characterization of buffalo (Bubalus bubalis) ovarian preantral follicles. Anim. Reprod. Sci. 97: 323-333. Mondadori RG, Santin TR, Fidelis AAG, Porfirio E, Bao SN (2008). Buffalo (Bubalus bubalis) preantral follicle population and ultrastructural characterization of antral follicle oocyte. Reprod. Dom. Anim. Epub ahead of print. Boni R, Santella L, Dale B, Roviello S, Di Palo R, Barbieri V (1992). Maturazione in vitro di oociti buffalini: indagine ultrastrutturale. Acta Med. Vet. 38: 153-161. Moor RM, Hay MF, Dott HM, Cran DG (1978). Macroscopic identification and steroidogenic function of atretic follicles in sheep. J. Endocrinol. 77: 309-318. Moor RM, Osborn JC, Cran DG, Walters DE (1981). Selective effect of gonadotrophins on cell coupling, nuclear maturation and protein synthesis in mammalian oocytes. J. Embryol. Exp. Morph. 61: 347365. Moor RM, Warnes GM (1978). Effect of oocyte maturation in mammals. In: Control of Ovulation. Crighton DB, Foxcroft GR, Haynes NB and Lamming GE (eds.). Butterworths, London, pp. 159-176. Nagano M, Katagiri S, Takahashi Y (2006). Relationship between bovine oocyte morphology and in vitro developmental potential. Zygote, 14: 53-61. Nandi S, Raghu HM, Ravindranatha BM, Chauan MS (2002a). Production of buffalo (Bubalus bubalis) embryos in vitro: premises and promises. Reprod. Dom. Anim. 37: 65-74. Nandi S, Ravindranatha BM, Gupta PSP, Sarma PV (2002b). Timing of sequential changes in cumulus cells and first polar body extrusion during in vitro maturation of buffalo oocytes. Theriogenology, 57: 1151-1159. Neglia G, Gasparrini B, Di Brienza VC, Di Palo R, Campanile G, Presicce GA, Zicarelli L (2003). Bovine and buffalo in vitro embryo production using oocytes derived from abattoir ovaries or collected by transvaginal follicle aspiration. Theriogenology, 59: 1123-1130. O’Brien JK, Dwarte D, Ryan JP, Maxwell WM, Evans G (2005). Developmental capacity, energy metabolism and ultrastructure of mature oocytes from prepubertal and adult sheep. Reprod. Fertil. Dev. 8: 1029-1037. Rafael GM, Tiago RS, Andrei AGF, Khesller PON, Juliana SS, Rodolfo R, Sˆonia NB (2010). Ultrastructure of in vitro oocyte maturation in buffalo (Bubalus bubalis). Zygote, 18: 309-314. Robert C (1999). Presence of Bcl-x and Bax mRNA in bovine cumulusoocyte complex. Theriogenology, 51: p. 191. Senger PL, Saacke RG (1970). Unique mitochondria in the bovine oocyte. J. Cell. Biol. 46: 405. Suzuki H, Jeong BS, Yang X (2000). Dynamic changes of cumulus– oocyte cell communication during in vitro maturation of porcine oocytes. Biol. Reprod. 63: 723-729. Thibault C (1977). Are follicular maturation and oocyte maturation independent processes? J. Reprod. Fertil. 51: 1-15. Totey SM, Singh G, Taneja M, Pawshe CH, Talwar GP (1992). In vitro maturation, fertilization and development of follicular oocytes from buffalo (Bubalus bubalis). J. Reprod. Fertil. 95: 597-607.

7602

Afr. J. Biotechnol.

Totey SM, Singh G, Taneja M, Talwar GP (1991). In vitro maturation and fertilization of follicular oocytes from buffalo. Theriogenology, 35: p. 284. Van Blerkom J, Runner MN (1984). Mitochondrial reorganization during resumption of arrested meiosis in the mouse oocyte. Am. J. Anat. 171: 335-355. Van Blerkom J, Bell H (1986). Regulation of development in the fully grown mouse oocyte: Chromosome-mediated temporal and spatial differentiation of the cytoplasm and the plasma membrane. J. Embryol. Exp. Morph. 93: 213-238. Yong-jie Y, Yan-jun Z, Yuan L (2009). Ultrastructure of human oocytes of different maturity stages and the alteration during in vitro maturation. Fertil Steril. 92: e1-e6.

Zaki M (2000). Light and electron microscopic studies on the retina of certain reptiles. M. Sc., Fac. Sci., Ain Shams Univ., Cairo, Egypt. Zamboni L, Thomson RS (1972). Fine morphology of human oocyte maturation in vitro. Biol. Reprod. 7: 425-457.

African Journal of Biotechnology Vol. 11(30), pp. 7603-7608, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4078 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Optimization of plasmid electrotransformation into Escherichia coli using Taguchi statistical method Mohamad Heiat1, Hossein Aghamollaei1*, Seeyed mostafa Hoseinei2, Reza Abbasi Larki3 and Kheirollah Yari4 1

Applied Biotechnology Research Center, Baqiyatallah University of Medical Science, Tehran, Iran. 2 Young Researchers Club, Science and Research Branch, Islamic Azad university, Tehran, Iran. 3 Department of microbiology, Islamic Azad university, Tonekabon Branch, Tonekabon, Iran. 4 Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran. Accepted 16 February, 2012

Electroporation is a mechanical method used to introduce polar molecules into a host cell through the cell membrane. In this procedure, a large electric pulse temporarily disturbs the phospholipid bilayer allowing molecules like DNA to pass into the cell. Application of statistical methods to determine the appropriate processes have been suggested for genetic engineering and biotechnology technique such as electroporation. This study explains the use of Taguchi statistical method to optimize the conditions for efficient plasmid transformation into Escherichia coli via electroporation. In order to improve electroporation, optical density of bacteria, recovery time and electrical parameter (field strength and capacitance) were optimized using the Taguchi statistical method. ANOVA of obtained data indicated that the optimal conditions of electrotransformation of pET-28a (+) plasmid into Escherichia coli BL21(DE3)pLysS was 0.7, 120 min, 12 kV/cm and 50 µF, for optical density of cell culture, recovery time, field strength and capacitance, respectively. The most significant alterations are decrease in field strength and increase in optical density in comparison with common electroporation protocol. The maximum level of plasmid transformation obtained under optimal condition was 8.7×108 transformants/µg DNA plasmid, which was 6.7 fold higher than the control condition. Kay words: Electroporation, Taguchi statistical method, Plasmid. INTRODUCTION Many techniques in molecular biology research require a foreign DNA to be inserted into a host cell. Since the phospholipid bilayer of the plasma membrane has a hydrophilic exterior and a hydrophobic interior, any polar molecules, including DNA and protein, are unable to freely pass through the membrane (Cserhati and Szogyi, 1995). Many methods have been developed to pass this barrier and allow the insertion of DNA and other molecules into the cells. One of these methods is electroporation. The concept of electroporation has been

*Corresponding author. E-mail: Tel/Fax: +98-21-88617712.

aghamolaei22@gmail.com.

Abbreviation: ANOVA, Analysis of variance.

capitalized on the relatively weak nature of the phospholipid bilayer's hydrophobic/hydrophilic interacttions and its ability to spontaneously reassemble after disturbance (Cserhati and Szogyi, 1995). Thus, a quick voltage shock may disrupt areas of the membrane temporarily, allowing polar molecules to pass, but sometimes the membrane may reseal quickly and leave the cell intact. Typically, 10,000 to 100,000 V/cm (varying with cell size) in a pulse lasting a few microseconds to a millisecond is necessary for electroporation. This electric pulse disturbs the phospholipid bilayer of the membrane and causes the formation of temporary aqueous pores. The electric potential across the membrane of the cell simultaneously rises by about 0.5 to 1.0 V so that charged molecules (such as DNA) are driven across the membrane through the pores in a manner similar to electrophoresis. Electroporation has some advantages

7604

Afr. J. Biotechnol.

including versatility with nearly all cell and species types, efficiency of cell transformation (Miller and Nickoloff, 1995) and small scale of required DNA (Withers, 1995). Electroporation has also some disadvantages just as cell damage at wrong length or intensity of pulses (Weaver, 1995) and nonspecific transport of material into and out of the cell during the time of electropermeability (Weaver, 1995). Electroporation is widely used in many areas of molecular biology research and in the medical field. Some applications of electroporation include: DNA transfection (Hoffmann et al., 2000), direct transfer of plasmids into the cells, induced cell fusion (Weber and Berg, 1995), trans-dermal drug delivery (Prausnitz et al., 1993), cancer tumor electrochemotherapy (Mir et al., 2003) and gene therapy. Development of optimized conditions is essential in biology and biotechnology project. Plasmid transformation is one of the most critical step in genetic engineering; the optimization of main factors in DNA plasmid transformation are vital for accessing to better results. Statistical methods are crucial to the improvement of efficiency because they play an important role in experimental design, evaluation and optimization of variables. Several statistical methods are widely used in biological processes (Rao et al., 2008). Among them, the Taguchi method is utilized as a screening filter, which examines the effects of variables and identifies those factors which have major effects on the process. By using this method, optimal conditions are obtained through the use of few experiments (Rao et al., 2008). It is known that compared to super efficient strains like Escherichia coli DH5α or Top 10, E. coli BL21 (DE3)pLysS, as a expression host, is a strain that gives much lower transformation efficiency. So transformation optimization for this strain is critical for obtaining maximum colony number. In this study, in order to increase the efficiency of plasmid electrotransformation into E. coli BL21(DE3)pLysS, Taguchi statistical design was used for the determination and optimization of main variables and how each variable affects conditions for plasmid electrotransformation. MATERIALS AND METHODS Bacteria, plasmid, medium and instruments The E. coli BL21(DE3) pLysS, as a host was purchased from Pasteur Institute of Iran, pET-28a(+) as cloning and expression plasmid was purchased from Novagen, Cat No: 69864-3. The pET28a(+) plasmid genetically engineered for high expression in E. coli, contains a kanamycin resistance gene for transformant selection. Luria-Bertani medium (LB) and SOC medium were used for cultivation and recovery of bacteria; gene pulser Xcell electroporation system (BioRad) was used as electroporator instrument.

NaCl (10 g/L) and tryptone (10 g/L), was used for cultivation. E. coli in shaking flask, LB agar (LB medium containing 15 g/L agar) was used for bacterial plate cultivations. The pH of the media were adjusted at 7.1 and then sterilized by autoclaving at 121°C for 20 min. SOC medium contains Bacto-tryptone (20 g/L), Bacto-yeast extract (5 g/L), NaCl (0.5 g/L), 1 M KCl (2.5 ml) and ddH2O to 1000 ml. The media was sterilized, then 10 ml sterile 1 M MgCl2, 10 ml 1 M MgSO4 and 20 ml 1 M glucose was added. Competent cell preparation E. coli BL21(DE3)pLysS cells were cultivated in 250 ml flask containing 50 ml of LB medium at 37°C up to optical density at 600 nm of 0.5, 0.7, 0.9 and 1.1. Then cultivation stopped and incubated in ice for 30 min. Thereafter, the bacterial cells were collected by centrifugation at 3000 g for 10 min at 4°C, and the pellet resuspended in 50 ml sterile ice cold 10% glycerol. The cells were collected again by centrifugation, and re-suspended in 5 ml sterile ice cold 10% glycerol. The cells were collected again and resuspended in 1 ml sterile ice cold 10% glycerol. Pellets were aliquot in 25 µl and stored at -70°C for subsequent procedure (Kahrizi and Salmanian 2008). Statistical design In order to maximize plasmid transformation, the common electroporation method was used and the effect of optical density of bacteria, electrical parameter (field strength and capacitance) and recovery time were selected for screening by using the Taguchi statistical method (Table 1). The L8 orthogonal array was used for examining of the aforementioned factors and interaction between two factors includes: Optical density and field strength at 2 levels (Table 2). After screening, the more effective factors and their interactions were optimized using L4 (Table 3) and L9 (Table 4) orthogonal arrays. L9 was designed for three different levels of optical density and field strength (Table 5). Qualitek-4 software was used for automatic design and standard analysis of variance (ANOVA) of Taguchi experiments. The results from ANOVA showed and identified the effect of each factor and estimated the performance of the optimum condition.

Plasmid transformation (optimum conditions) Two microliter (2 µl) of pET-28a(+) plasmid (500 pg/µl) was mixed with 25 µl of 10% glyserol-treated competent cell suspension (OD600nm = 0.7), after 10 min incubation in ice, suspension was transferred into the cold cuvette with 0.1 cm inter-electrode gap. Electroporation procedure performed with adjusted 12 kV/cm and 50 µF of field strength and capacitance respectively. Thereafter, 1 ml of SOC medium was added and the mixture was incubated at 37°C for 120 min. Then, the cultures were centrifuged and pellets were suspended in 100 µl of LB medium. 10 µl of each culture was plated on LB agar containing kanamycin (40 µg/ml). The resulting transformants colonies usually appeared after 15 h incubation at 37°C. The transformation efficiency (transformants/µg DNA) was calculated (Roychoudhury et al., 2009; Yari et al., 2010; Kahrizi et al., 2007).

RESULTS

Medium

L8 Orthogonal array for evaluation of interaction

The Luria-Bertani medium (LB) composed of yeast extract (5 g/L),

In order to optimize the conditions for plasmid DNA

Heiat et al.

7605

Table 1. Selected variables and their levels for the screening stage by the Taguchi experimental method.

Variable Optical density field strength ( kV/cm) apacitance (ÂľF) Recovery time (min)

Low level 0.5 10 25 60

High level 0.9 20 50 120

Table 2. L8 Orthogonal array of the Taguchi design for screening of selected factors.

Trial number 1 2 3 4 5 6 7 8

Optical density 1 1 1 1 2 2 2 2

Field strength 1 1 2 2 1 1 2 2

Capacitance 1 2 1 2 1 2 1 2

Recovery time 1 2 2 1 2 1 1 2

Table 3. L4 Orthogonal array for studying the interaction between optical density and field strength.

Trial number 1 2 3 4

Optical density 0.5 0.5 0.9 0.9

field strength 10 20 20 10

Table 4. L9 Orthogonal array of the Taguchi design for optimization of significant factors.

Trial number 1 2 3 4 5 6 7 8 9

Optical density 1 1 1 2 2 2 3 3 3

transformation into E. coli, the Taguchi statistical design was applied. The L8 orthogonal array was used for optimization of four variables including optical density of bacteria, recovery time and electrical parameter (field strength and capacitance). Interaction between optical density of bacteria and field strength was also consi-

Field strength 1 2 3 1 2 3 1 2 3

dered. Results were analyzed by standard ANOVA for the determination of the percentage contribution of each variable and the optimum level. These data show that the DNA plasmid transformation into E. coli cells was affected by the optical density of bacteria and field strength. The results show that optimum levels are 0.9,

7606

Afr. J. Biotechnol.

Table 5. Significant variables and their levels employed for optimization experiments using the L9 Taguchi design.

Variable Optical density field strength (kV/cm)

Low level 0.7 8

Medium 0.9 10

High level 1.1 12

Table 6. ANOVA of the effects of assigned variables and interaction on plasmid electrotransformation obtained from L8 orthogonal array.

Factor Optical density Field strength A×B Capacitance Recovery time

DOF (f) 1 1 1 1 1

Variance (V) 2312 1860.5 578 18 60.5

50 µF, 10 kV/cm and 120 min for OD, capacitance, voltage and time of the recovery, respectively. The ANOVA results indicate contribution percentages of variables are 47.70, 38.37, 0.911 and 1.162 for OD600 nm field strength, capacitance and recovery time respecttively. However, the interaction between OD and field strength was significant in electrotransformation (Table 6).

F – ratio (F) 544 437.764 136 4.235 14.235

Contribution (%) 47.705 38.372 11.86 0.911 1.162

Optimized level 2 1 2 2

mants colonies were about 6.7 fold more than the basic conditions (Table 8). Finally, optimal conditions for great transformation of pET-28a (+) plasmid into E. coli BL21(DE3) pLysS are 0.7, 120 min, 12 kV/cm and 50 µF, respectively optical density of cell culture, recovery time, field strength and capacitance. DISCUSSION

L4 Orthogonal array for evaluation of interaction While keeping the optimized conditions of recovery time and capacitance at the suggested level of the initial screening design, interaction between optical density of bacteria and field strength was studied by the L4 orthogonal array. The data were analyzed by standard ANOVA, and the percentage contribution of each variable and the optimum level were obtained. Hence, the optimum levels obtained for optical density of bacteria and field strength variables were 0.9 and 10 kV/cm, respectively (Data not shown). L9 Orthogonal array for optimization of significant variables After screening the significant variables, the effective factors (optical density of bacteria and field strength) were selected for the final optimization stage. The L9 orthogonal array was used to investigate the effects of two main factors, optical density of bacteria and field strength at three levels while the other variables were kept constant at optimum levels. The ANOVA of the obtained result indicated the optimal conditions of field strength and optical density are 12 kV/cm and 0.7, respectively (Table 7). After optimization, the transfor-

Because plasmid transferring is one of the most important steps in gene cloning, access to suitable conditions for high DNA transformation into bacterial cells is essential. Because the transformation of expression vector into a suitable host is a critical step in recombinant protein production, in this study, the pET28a (+) expression vector and E. coli BL21(DE3) pLysS as an expression host were examined. There are several methods such as ultrasound, hydro gel, electroporation and chemical transformation for introducing plasmid into the host. Among them, electroporation is the most effective method for transformation. In recent years, the use of electroporation for transformation of DNA into different host has been improved. Several important factors are involved in electroporation. In this study, the effect of optical density of bacterial culture, field strength, capacitance and recovery time as the important factors in electrotransformation rate were optimized by Taguchi method. Already this technique has been used for the optimization of an electroporation microchip system for gene transfection (Huang et al., 2007). After analysis of L8 orthogonal results by ANOVA for these factors, as shown in Table 6, OD and field strength have significant effects in the electro-transformation of plasmid. Based on Qualitek-4 software and standard ANOVA, 0.9 for OD600nm and 10 kV/cm for field strength were suggested.

Heiat et al.

7607

Table 7. ANOVA of the effects of assigned variables on plasmid electrotransformation obtained from L9 orthogonal array.

Factor Optical density Field strength

DOF (f) 2 2

Variance (V) 1011.11 786.112

Percent, P(%) 56.9 43.021

Optimized level 1 3

Table 8. Verification of the results obtained at control and optimal conditions.

Condition Basal (control) Optimum

Maximum rate of plasmid transformation (transformants/µg plasmid) 1.3 × 108 8.7 × 108

Interaction between these factors is important too. After selection of important factors, interaction between them was studied by L4 orthogonal array. By using L9 orthogonal array, the optimum level for the above factors was 0.7 and 12 kV/cm for OD600nm and field strength respectively. In comparison with basic condition, there was 6.7 fold increase in the number of transformant in optimized conditions, Some researchers have applied Taguchi method for optimization of molecular biology processes. Yari and Mostafaie (2010) reported the effect of various factors for optimization of plasmid transformation by chemical transformation using Taguchi method. The effect of the number of cell washes prior to electroporation, cell number, DNA amount, and cell growth phase on rate of electroporation was investigated by Wu et al. (2010). They reported that 0.15 is the best OD600 nm for electrotransformation of pUC19 plasmid into E. coli DH10B. Rodríguez et al. (2007) reported that optimized OD of Pediococcus acidilactici P60 culture for transformation of pRS4C1 plasmid is 1 to 1.2 in stationary phase. They reported that the optimal field strength is 20 kV/cm. In this study, based on instrument producer instruction (basal conditions: OD600 nm = 0.6, field strength: 18 kV/cm, capacitance: 50 µF and recovery time: 90 min), two levels of OD600 nm (0.5 and 0.9) by L8 and three levels (0.7, 0.9 and 1.1) by L9 orthogonal array were examined. Results show that 0.7 is the best level of OD600 nm in pET28a (+) plasmid transformation into E. coli BL21(DE3) pLysS. Our results are different from Wu report (Wu et al., 2010). It may be due to use of different plasmids and hosts. Our study results are more similar to Rodríguez et al. (2007) in the view point of the best stage of culture for electrotransformation of plasmid into bacteria is a stationary phase. For field strength, four levels, 8, 10, 12 and 20 kV/cm were examined using L8 and L9 orthogonal array and 12 kV/cm was selected as optimized field strength. In this study, the lower OD of bacteria rather than Rodríguez's investigation causes field strength to be less than 20

kV/cm. ANOVA from obtained result indicated that interaction between OD and field strength has the main effect on plasmid uptake by E. coli BL21 (DE3) pLysS. Recovery time after electrical shock is essential for bacterium survival and we showed that 120 min is better than 60 min in the rate of transformation. This time is suitable for host for membrane recovery and expression of the genes that rebound in antibiotic resistance. Conclusions In conclusion, our results show that minor alterations in conditions of main variables for plasmid transformation have positive effect in transformation efficiency. Analysis of variance for obtained data indicated that the optimal conditions for plasmid electrotransformation consist of 0.7, 120 min, 12 kV/cm and 50 µF of optical density of bacteria at 600 nm, recovery time, field strength and capacitance, respectively. The study presented here is apparently the first report to use the Taguchi statistical method for the optimization of conditions to introduce pET-28a(+) plasmid DNA molecules into E. coli BL21(DE3) pLysS cells by use of electroporation method. This work can thus be used as a basis of future investigations in molecular biology methods. REFERENCES Cserhati T, Szogyi M (1995). Role of hydrophobic and hydrophilic forces in peptide-protein interaction: new advances. Peptides, 16: 165-173. Hoffmann E, Neumann G, Kawaoka Y, Hobom G, Webster RG (2000). A DNA transfection system for generation of influenza A virus from eight plasmids. Proc. Natl. Acad. Sci. USA. 97: 6108-6113. Huang KS, Lin YC, Su KC, Chen HY (2007). An electroporation microchip system for the transfection of zebrafish embryos using quantum dots and GFP genes for evaluation. Biomed. Microdevices, 9: 761-768. Kahrizi D, Salmanian AH (2008) Substitution of Ala183Thr in aro A product of E. coli (k12) and transformation of rapeseed (Brassica napus L.) with altered gene confers tolerance to Roundup. Transgenic Plant J. 2(2): 170175.

7608

Afr. J. Biotechnol.

Kahrizi D, Salmanian AH, Afshari A, Moieni A, Mousavi A (2007). Simultaneous substitution of Gly96 to Ala and Ala183 to Thr in 5 enolpyruvylshikimate-3-phosphate synthase gene of E. coli (k12) and transformation of rapeseed (Brassica napus L.) in order to make tolerance to glyphosate. Plant Cell Rep. 26: 95-104. Miller EM, Nickoloff JA (1995). Escherichia coli electrotransformation. Methods. Mol. Biol. 47: 105-113. Mir LM, Morsli N, Garbay JR, Billard V, Robert C, Marty M (2003). Electrochemotherapy: a new treatment of solid tumors. J. Exp Clin. Cancer Res. 22: 145-148. Prausnitz MR, Bose VG, Langer R, Weaver JC (1993). Electroporation of mammalian skin: a mechanism to enhance transdermal drug delivery. Proc. Natl. Acad. Sci. USA. 90: 10504-10508. Rao RS, Kumar CG, Prakasham RS, Hobbs PJ (2008). The Taguchi methodology as a statistical tool for biotechnological applications: a critical appraisal. Biotechnol. J. 3: 510-523. Rodriguez MC, Alegre MT, Mesas JM (2007). Optimization of technical conditions for the transformation of Pediococcus acidilactici P60 by electroporation. Plasmid, 58: 44-50. Roychoudhury A, Basu S, Sengupta DN (2009). Analysis of comparative efficiencies of different transformation methods of E. coli using two common plasmid vectors. Indian. J. Biochem. Biophys. 46: 395-400.

Weaver JC (1995). Electroporation theory. Concepts and mechanisms. Methods Mol. Biol. 55: 3-28. Weber H, Berg H (1995). Electrofusion of yeast protoplasts. Methods Mol. Biol. 47: 93-104. Withers HL (1995). Direct plasmid transfer between bacterial species and electrocuring. Methods Mol. Biol. 47: 47-54. Wu N, Matand K, Kebede B, Acquaah G, Williams S (2010). Enhancing DNA electrotransformation efficiency in Escherichia coli DH10B electrocompetent cells. Electron. J. Biotechnol. Sep. 13(5): 15. Yari K, Fatemi SS, Tavallaei M (2010). Optimization of the BoNT/A-Hc expression in recombinant E scherichia coli using the Taguchi statistical method. Biotechnol. Appl. Biochem. 56: 35-42. Yari Kh, Mostafaie A (2010). Determination of Suitable Conditions for Great Plasmid Transformation into Escherichia Coli using Taguchi Statistical Method. Am. J. Sci. Res.17: 117-123.

African Journal of Biotechnology Vol. 11(30), pp. 7609-7617, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3514 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Isolation and identification of Metarhizium anisopliae from Chilo venosatus (Lepidoptera: Pyralidae) cadaver Lei Liu1, Rulin Zhan2, Laying Yang1, Changcong Liang1, Di Zeng3 and Junsheng Huang1* 1

Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences (Key Laboratory of Integrated Pest Management on Tropical crops, Ministry of Agriculture, Peoples Republic of China; Hainan Key Laboratory for Monitoring and Control of Tropical Agricultural Pests; Hainan Engineering Research Center for Biological Control of Tropical Crops Diseases and Insect Pests), Danzhou 571737, Hainan Province, China. 2 South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang 524091, Guangdong Province, China. 3 College of Applied Science and Technology, Hainan University, Danzhou 571737, Hainan Province, China. Accepted 23 March, 2012

Sugarcane stem borer, Chilo venosatus Walker (Lepidoptera: Pyralidae) is a significant sugarcane pest in South China. Conidia or mycelia collected from the surface of sugarcane stem borer cadavers were cultured. The colony morphology, mycelia and conidial yield were observed with three-agar culture media: potato dextrose agar medium (PDA), potato dextrose with 1% (w/v) peptone agar medium (PPDA), and oatmeal agar medium (OMA). 16 different isolates were identified as Metarhizium anisopliae (Metschnikoff) based on macromorphological, micromorphological, and molecular characteristics, and PPDA was the better culture medium for vegetative growth and conidial yield (109 conidia/ml) than PDA (108 conidia/ml) and OMA (108 conidia/ml). To confirm whether these isolates were pathogenic to C. venosatus, their virulence to the sugarcane stem borer was tested in the laboratory. Both HS (10 isolates) and LY (6 isolates) strains were pathogenic to C. venosatus. Several highly virulent strains were screened in vitro (the mortalities of the eight isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were from 96 to 100%), and tests for controlling the sugarcane stem borer were preliminarily performed in vivo. The results show that significant (p=0.01) reductions in adult population were caused by the strains. So, M. anisopliae isolated from the cadavers of C. venosatus Walker is a potential biocontrol agent against this pest in South China. Keywords: Metarhizium anisopliae, isolation, identification, Chilo venosatus, culture medium, biological control. INTRODUCTION Sugarcane is an important tropical crop and contributes to almost two-thirds of the world’s yield of sugar for hundreds of years (Menossi et al., 2008). The sugarcane stem borer, Chilo venosatus Walker (Lepidoptera: Pyralidae) is an important pest of sugarcane culture and many others crops (Graça, 1976; Long and Hensley,

*Corresponding author. E-mail: h888111@126.com. Tel: +86 13697502890. Abbreviations: PDA, Potato dextrose agar medium; PPDA, potato dextrose with 1% (w/v) peptone agar medium; OMA, oatmeal agar medium.

1972). Larvae of C. venosatus feed within the stem of sugarcane which may result in 25% (w/w) sugarcane production loss (Pan et al., 2009). This lepidopteran pest causes considerable harvest loss in the cane-growing areas of South Africa, Swaziland, Australia, Brazil, India, Antilles, Central and South America, and South China (Gerardo et al., 1994; Katrina et al., 2000; Chillar, 1993; Daniela et al., 2008; Shang and Huang, 2010). Due to a lack of natural antagonists and increasing resistance to chemical pesticides, the sugarcane stem borer has become a serious and devastating pest with significant economic impact (harvest losses with costs of up to several hundred million US $ per year) in South China. All important sugarcane-growing regions, such as

7610

Afr. J. Biotechnol.

Zhanjiang (Guangdong Province), Nanning (Guangxi Province) as well as Lingao and Danzhou (Hainan Province) have recently documented the occurrence of C. venosatus (Zhou et al., 2008; Pan et al., 2009; Shang and Huang, 2010; Zhang et al., 2008). In the past, various management strategies including treatment with chemical agents, such as chlorpyrifos (Zhou et al., 2008) and sumithion (Zhang et al., 2008) as well as the application of frequency vibration-killing lamp and other physical techniques have been used to control the adverse impact of the sugarcane stem borer (Yu et al., 2009; Pan et al., 2009; Shang and Huang, 2010). Although effective in controlling the sugarcane stem borer, chemical and physical approaches could result in serious environmental pollution and indiscriminate killing of ecologically important organisms (Pan et al., 2009). Biological control agents such as Trichogramma (Smith, 1996; Matthias and Paul, 2002; Zhen et al., 2001), Lixophaga diatraeae (Nicholls et al., 2002), Bacillus thuringiensis (Katrina et al., 2000), Metarhizium anisopliae (Gao, 1996) as well as sex attractants causing mating disruption (Lin, 2007), are environmentally friendly alternatives to control the outbreak and maintenance of the sugarcane stem borer. The entomopathogenic fungus M. anisopliae has been effective in controlling more than 200 species of insect pests (Pu and Li, 1996) such as Anopheles arabiensis, Anoplophora glabripennis, Ceratitis capitata, Psoroptes mites, Locusta migratoria migratorioides, Rhipicephalus evertsi evertsi, and Phthorimaea operculella (Dickson et al., 2010; Shanley et al., 2009; Dimbi et al., 2009; Quesada-Moraga et al., 2008; Brooks and Wall, 2005; Niassy et al., 2011; Marius et al., 2011; Sabbour, 2002). The application of M. anisopliae has several advantages over the conventional chemical pesticides, such as limited harm to humans, honey bees, livestock, and crops (Monique et al., 2011). However, there are no reports available if M. anisopliae strains isolated from different insect pests can effectively control C. venosatus in South China. In addition, exploratory surveys for the isolation of highly virulent M. anisopliae strains have been suggested. Our laboratory already had isolated M. anisopliae from natural infections of coconut hispid beetle Brontispa longissima (Gestro) (Coleoptera: Chrysomelidae), and preliminary studied on against this pest in Hainan island, China (Zhan et al., 2007). In this study, cadavers of C. venosatus were recovered from sugarcane, and mycelia and conidia were collected from the cuticle surfaces. Subsequently, fungi were isolated on selective medium and their identification, virulence to C. venosatus larvae in vitro, and effects of application in vivo were tested.

Xuwen, Zhanjiang (Guangdong Province, five isolates), Xianhu of W uming, Nanning (Guangxi Province, two isolates), Bohou of Lingao, and W angwu of Danzhou (Hainan Province, nine isolates) of China. Stems of sugarcane infected with C. venosatus were cut, and dead and healthy larvae were collected. Cadavers were transferred to sterilized Petri dishes and healthy larvae were transferred to sugarcane seedlings, which were planted in plastic boxes for further rearing. Cadavers were used to isolate the entomopathogenic fungi, and the living insects were used to evaluate the insecticide potential of isolated fungi against C. venosatus.

MATERIALS AND METHODS

Tests on biological characters of isolates

Collection of sugarcane stem borer

Tests on colony macromorphological aspects on different culture medium

Sugarcane stem borer larvae were collected from seriously infected regions, including the fields near W enfengyuan of

Preparation of culture media Three different culture media were prepared: potato dextrose agar (PDA), PDA with 1% (w/v) peptone (PPDA), and oatmeal agar medium (OMA). The dodine oatmeal agar medium (DOA) was prepared as the selective medium by adding elements (mainly contained 200 μgml-1 dodine (Beilharz et al., 1982; Fernandes et al., 2010), 100 μgml-1 penicillin, 50 μgml-1 streptomycin (Chase et al., 1986), and 200 μgml-1 chloromycetin) in OMA for screening entomopathogenic fungi (Beilharz et al., 1982; Chase et al., 1986; Liu et al., 2007; Du et al., 2008). Isolation and identification of M. anisopliae Cadavers of the sugarcane stem borer larvae were collected from the field. Sterile needles were used to isolate mycelia or conidia from the cuticles of cadavers and were transferred into a 1.5 ml Eppendorf tube containing sterile distilled water. Conidial suspension (5×105 conidia/ml) was prepared and 100 μl were transferred homogeneously spread with drigalski to a Petri dish containing 15 ml of DOA and incubated at 28°C. After three days, the dishes were checked daily until the eighth day. Fungal colonies appearing on each Petri dish were transferred to Eppendorf test tubes containing PPDA and incubated at the same conditions as earlier stated.Each isolate was isolated and observed with a light microscope. A single conidium on the surface of water-agar medium was collected with a sterile capillary tube and transferred onto PPDA to isolate the culture. Identification of the isolates were performed at a species level according to Pu and Li (1996), Tulloch (1976), Roddam and Rath (1997), Zimmerman (1993), and Driver et al. (2000). M. anisopliae DNA was isolated by using the method described by Pfeifer and Khachatourians (1993). Primer sequences (forward (TW81): GTTTCCGTAGGTGAACCTGC and reverse (AB21): ATATGCTTAAGTTCAGCGGGT) were synthesized by SBS Genetech Co., Ltd. (Curran et al., 1994). The PCR reaction mix (50.0 μl final volume) consisted of 37.3 μl of ddH2 O, 5.0 μl of 10×PCR Buffer (plus 20 mmol/L MgCl2), 4.0 μl of dNTP mixture (50 mmol/L), 1.0 μL of each primer (250 nM final concentration), 0.7 μl of Taq DNA polymerase (2 U/μl), and 1.0 μl of genomic DNA (10 ng/μl). A blank (no template control) was also incorporated in each assay. The thermo cycling program consisted of one hold at 94°C for 4 min, followed by 33 cycles of 30 s at 94°C and 30 s at 55°C centigrade and 60 s at 72°C. After completion of these cycles, melting-curve data were then collected to verify PCR specificity, contamination and the absence of primer dimers. In addition, the internal transcribed space of the strains was analyzed by comparing the sequence in the region of ITS1-5.8S-ITS2 with Vector NTI 9.0.

All isolates were cultured in Petri dishes containing PDA, PPDA, and

Liu et al.

OMA. Colony color and mycelia texture were evaluated daily (starting from the 5 th day after incubation) and documented by photography. The sizes of 50 conidia of each strain were measured with a Leica microscope and average values were compared for all strains.

7611

repeated experiments, the data from each experiment were pooled and evaluated by one-way analysis of variance (ANOVA) (SPSS 14.0 for Windows). Abbott (1925) was then used for correction.

RESULTS Tests on colony growth rate and conidia yield on different culture media All isolates were cultured on solid PDA, PPDA, and OMA. Conidia were harvested at the 12th day after culture by surface-scraping. Homogenous spore suspensions were made by placing harvested spores in 20 ml of sterile distilled water in glass bottles containing 0.1% (v/v) Tween-80 and agitated on a vortex mixer for 30 s. Spore concentrations were determined using a hemocytometer. The procedure was replicated three times for each strain.

Tests on virulence to C. venosatus All isolates were cultured and maintained on PPDA. Conidia were harvested and spore suspensions (1.0×105, 1.0×106, 1.0×107, and 1.0×108 conidia/ml) were prepared in sterile water with 0.1% (v/v) Tween-80. In addition, three and four instars larvae of C. venosatus were reared for one week, then, 30 larvae were selected for each treatment. Each 30 larvae were sprayed (used hand-held sprayers) with 5 ml of conidial suspension and then placed into sugarcane seedlings, which were planted in plastic boxes. The boxes were placed into an insect-rearing cage and incubated at ambient temperature (25 to 32°C). Each treatment was replicated three times. The control was sprayed with 5 ml of sterile water containing 0.1% (v/v) Tween-80. The commercial formulation (BioCane granule, Australia, 1.0×108 conidia/ml) suspension was also sprayed with 5 ml. After the 15th day, dead larvae were selected, and mortalities were calculated for every isolate. Abbott (1925) was then used for correction. Subsequently, all dead sugarcane stem borers were transferred to Petri dishes to evaluate mycosis growth on the surface. The procedure was replicated three times for each isolate. Preliminary applications on sugarcane stem borers in vivo Preliminary tests on sugarcane stem borer in vivo application was performed at the Bohou farm of Lingao, where sugarcane was seriously infected by C. venosatus. Each treatment was 130 m long by 25 m wide with a total area of 3250 m2. The conidial suspension which was prepared with the wettable powder of M. anisopliae (the highly virulent isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9), were used to control C. venosatus in vivo, which was mixed with 43% (w/w) additives (consisted of 25% (w/w) wetting agents, 18% (w/w) dispersant, 16% (w/w) suspending agents and 41% (w/w) stabilizing agents), and adjusted to ≥1.0×107 conidia/ml. The first control (Con 1) was BioCane granule (Australia). The second control (Con 2) was also brushed with only water with 43% (w/w) additives. After three months, the suspensions (15 ml/m2) were sprayed on the stem of each sugarcane twice with an interval of three months, especially at the bell site part of sugarcane and the eclosion hole part of sugarcane. The adult sugarcane stem borer was caught in water tray traps (20 to 30×7 to 10 cm) baited with synthetic sex pheromone with an interval of two months. Finally, the sugarcane was harvested and the fresh weight compared. The trials were replicated three times. Statistical analysis To analyze for significant (p=0.01) difference between the results of

Strains isolation 16 filamentous fungal isolates from cadavers were screened on DOA on different Petri dishes. The isolate from each Petri dish was regarded as a strain. All of these strains were purified and transferred to PPDA for further identification. As a result, all isolates were identified as M. anisopliae. According to the macromorphological and molecular characteristics, we found two distinct strains based on the differences in colony morphology and molecular characteristics, and were thus recorded as HS (10 isolates) and LY (six isolates) isolates. After four days of incubation, the colonies of all HS isolates on PPDA were nearly completely covered with mycelium, but few mycelium were present on the LY isolates under the same conditions. However, there were no significant differences in conidial shape and size of the two kinds of isolates: cylindrical with obtuse ends, slightly narrowing in the center, and the conidial width (1.5 to 3 μm) and length (4 to 8 μm). Also, the structure of conceptacles was not different from those described by Pu Zhelong (Pu and Li, 1996). Based on nucleic acid sequence analysis, both isolates, HS and LY, were M. anisopliae var. anisopliae (Figure 1) (Curran et al., 1994). Screening of optimal culture medium for isolates with colony growth and conidia yield The results show that PPDA was the optimal culture medium for colony growth and conidia yield for both M. anisopliae HS and LY strains. The results are summarized in Table 1. For three to seven days, colony growth rate on PPDA was faster than on the other media. The average conidial yield of M. anisopliae HS1 isolate was 1.02×109 conidia/ml on PPDA, which was significantly (p=0.01) more than 3.81×108 conidia/ml on PDA and 1.96×108 conidia/ml on OMA, other isolates had the same results. Pathogenicity to C. venosatus and application effects in vivo Both HS (10 isolates) and LY (six isolates) strains were pathogenic to C. venosatus (Figures 2a, b, c and d). Using 1.0×107 conidia/ml, the larvae mortality ranged from 60 to 100%. HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 isolates were the most pathogenic to C. venosatus and were significantly (p=0.01) higher than the two control treatments (Figure 2e). The mortality of the first control

7612

Afr. J. Biotechnol.

Figure 1. Nucleic acid sequence phylogenetic tree of new isolated strains and reported Metarhizium anisopliae strains. The codes following the names are the GenBank Accession numbers. The GenBank Accession number of HS strain sequence (10 isolates) was HM118821, and the GenBank Accession number of LY strain sequence (six isolates) was HM055582. The analysis, assembling, and similarity of nucleic acid sequence of the region of ITS1-5.8S-ITS2 search were used with Vector NTI 9.0 software.

(Con 1) was only 28%, and few mycelia growth was found on cadavers. In moist conditions, conidia and mycelia were observed on the surface of cadavers and identified as the same fungi species used in the initial inoculation. The high-virulence isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were also significantly (p=0.01) higher than the commercial formulation of M. anisopliae (the second control, Con 2). The results show that the strains isolated from endomopathogenic fungi in C. venosatus were pathogenic and that eight of the strains were highly virulent to C. venosatus. Then, the highly virulent isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were used to control C. venosatus in vivo. The averages of the eight sugarcane treatments after 300 days was significantly (p=0.01) higher than the two control treatments (Figure 3). The sugarcane fresh weight after harvesting the eight treatments using isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were from 2.35×104 to 2.80×104 kg; the first

control (Con 1) was 1.65×104 kg, and the second control 4 (Con 2) was 2.16×10 kg. The average population of the adult sugarcane stem borer taken before application varied from 59.3 to 29.4 after 120 days and to 17.0 after 300 days, and cadavers with mycosis were present at more than 75%. Few changes occurred at the first control (Con 1), in which the adult sugarcane stem borer population varied from 53.4 to 57.0 and to 54.1 at the same time, and few cadavers were found. The averages of adult sugarcane stem borers population of the second control (Con 2) varied from 56.3 to 37.4 and to 25.0 (Figure 4). DISCUSSION In this study, we reported 16 isolates of M. anisopliae, isolated from different fields in South China, which had high pathogenicity against C. venosatus. Strains of M.

Liu et al.

7613

Table 1. Yield of conidia of 16 M. anisopliae isolates on different culture media (PPDA, PDA, OMA).

Isolate

HS1 9

Yield (PPDA) (10 conidia/ml) 8

Yield (PDA) (10 conidia/ml) 8

Yield (OMA) (10 conidia/ml)

HS2

a

0.95

bc

3.79

c

1.77

1.02 *

0.83

3.81b

c

3.59

c

1.52

1.96

HS3

a

HS4

a

0.82

bc

3.74

c

1.49

HS5

a

0.76

bc

3.61

c

1.41

HS6

a

1.10

bc

4.11

c

2.23

HS7

a

1.06

bc

3.89

c

1.99

HS8

a

0.82

bc

3.71

c

1.66

HS9

a

0.71

bc

3.63

c

1.56

HS10

a

0.86

bc

3.59

c

1.45

LY1

a

0.62

bc

2.89

c

1.02

LY2

a

0.78

bc

3.12

c

1.35

LY3

a

0.76

bc

3.04

c

1.26

LY4

a

0.52

bc

2.88

c

0.96

LY5

a

0.59

bc

2.91

c

1.01

LY6

a

0.72a

bc

2.97

c

1.16

bc c

*The same capital letters indicate no significant difference for the mean value (Tukey窶適ramer test, F=1.25, p=0.01). Abbott (1925) was then used for mortality correction.

anisopliae have been isolated from soils (Roddam and Rath, 1997; Tarasco et al., 1997) and insects (Pedro and Candido, 1997; Poprawiski and Yule, 1991) from different regions of the world. Some strains have been used to control sugarcane pests, such as Acrididae, Dynastidae and Cercopidae (Zhang et al., 2006). This is the first study to report that strains of M. anisopliae were isolated from C. venosatus in South China. All isolated strains were M. anisopliae var. anisopliae, according to macromorphological and molecular characteristics analyses. The fungi have a broad-spectrum insecticidal activity (Wekesa et al., 2005; Alonso-Dﾃｭaz et al., 2007; Zhang et al., 2006). Our study reveals that PPDA is a better culture medium for colony growth and conidia yield than PDA and OMA. Before this study, PDA was commonly used as the medium to culture M. anisopliae (Liu et al., 2007; Du et al., 2008). The improved DOA is an effective selective medium for screening M. anisopliae from both soils and insects. The results show that the isolates were pathogenic to C. venosatus, based on the symptoms after inoculating the sugarcane stem borer with the isolates. In pathogenic tests, the mortality in treatments was significantly (p=0.01) higher than the controls (the first control was treated with chemical BioCane granule and the second control

was treated with water with 43% (w/w) additives). In addition, fungal outgrowth was found on the surface of dead sugarcane stem borer in humid conditions but not in the blank control (treated with water with 43% (w/w) additives). Eight highly pathogenic strains of HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were applied in vivo, which caused a significant (p=0.01) reduction in the adult population.Our studies show that M. anisopliae has potential as a biocontrol agent against the sugarcane pests. Recently, the effective strategies on C. venosatus control performed in Guangdong and Hainan Provinces and others, in 1990 to 2010, involved rearing of natural antagonists of Trichogramma, L. diatraeae, and spraying insecticides. However, the biological control effect of Trichogramma and L. diatraeae were easily affected by environmental elements (Zhang, 1997; Talekar and Shelton, 1993; David et al., 1991). It was reported that the transgenic sugarcane lines expressing high levels of synthetic Cry1Ac proteins were highly resistant to sugarcane stem borer attack (Weng et al., 2006). Biological control agents for the corn borer, such as the parasitic fungus Beauveria bassiana and the release of the parasitic wasp Trichogramma ostriniae, were used in cornfields (Cherry et al., 1999; Hoffmann et al., 2002). In contrast, M. anisopliae isolated from local sugarcane stem borer had better environmental resistance. As an important part of

an integrated pest management (IPM) strategy, M. anisopliae could be widely used. M. anisopliae can be considered promising for biological control of sugarcane stem borer by reducing the pest population and lessening the dependence on chemical control. Conclusion In conclusion, we have isolated 16 M. anisopliae isolates, in which eight have high pathogenicity against C. venosatus. Furthermore, all of these isolates could be used for controlling sugarcane stem borer. Biological studies, including the isolation and identification of M. anisopliae and the illustration of cultural process, are required for a better understanding of the pathogenic activities and roles. The role of M. anisopliae against C. venosatus has explicit evidence in natural conditions. ACKNOWLEDGMENTS This research was supported by the Key Project in the National Science and Technology Pillar Program of China (No. 2007BAD48B00). The authors thank Prof. Cheng Bai at the Environment and Plant Protection Institute, Chinese Academy

7614

Afr. J. Biotechnol.

HS1

A

HS2

HS3

HS3

HS4

LY2

10

100

1000

Dose (105 conidia/ml) HS9 HS10 LY1

C 100

Mortality (%)

50

1.0

10

LY2

100

HS5

HS6

1.0

HS7

D

HS8

5

Dose (10 conidia/ml)

50

100

1000

5

Dose (10 conidia/ml) LY3 LY4 LY5

D

LY6

100

1.0 50

10

100

1000

5

Dose (10 conidia/ml) LY3 LY4 LY5

LY6

0

100

1000

10

50

0

0 1.0

HS8

0

Mortality (%)

Mortality (%)

Dose (10 conidia/ml) HS9 HS10 LY1

50

0

1000

5

50

100

100

Mortality (%)

Mortality (%)

C

10

HS7

100

0 100 1.0

Mortality (%)

HS2

B

Mortality (%)

Mortality (%)

50

HS1

HS6

100

100

A

HS5

B

HS4

1.0

10

100

1000

5

Dose (10 conidia/ml)

50

Figure 2. Comparing mortalities of C. venosatus larvae infected by different doses of the 16 M. anisopliae isolates at 15th day after a* 5 conidia/ml showed 39 to 75% mortality, a* a* a* mortality, a* 1.0×107 conidia/mla* inoculation. 1.0×10 1.0×106 conidia/ml showed 50 to 92% showed ab ab 8 7 E60 to 100% 100 mortality, 1.0×10 conidia/ml showed 68 to 100% mortality, respectively (A, B, C and D). At 1.0×10 conidia/ml, there were abcof sterile water eight highly0pathogenic isolates 0 first control (Con 1) was sprayed with 5 ml bcdM. anisopliaeabc abcto C. venosatus larvae (E). The abc(Australia), used for controlling underground pests of containing 0.1% (v/v) Tween-80. The second control (Con 2) was BioCane granule 10 (Coleoptera: 100Scarabaeidae). 1000 *The same capital1.0 10 no significant 100abcd 1000for the mean sugarcane such as1.0 Apogonia sp. letters indicate difference value (Tukey–Kramer test, F=4.68, p=0.01). Abbott (1925) was then used for correction. 5 5

Dose (10 conidia/ml)

75

cd

Dose (10 conidia/ml)

cd

Mortality (%)

d

a*

E

a*

ab

a*

a*

ab

a*

a*

100 50

bcd

abc

abc

abc

abc abcd e

25

75

cd

cd

Mortality (%)

d

0

50 HS1

HS2

HS3

HS4

HS5

HS6

HS7

HS8

HS9

HS10

LY1

LY2

LY3

LY4

LY5

LY6

Con1

Treatment

e 25

0

HS1

HS2

HS3

HS4

HS5

HS6

HS7

HS8

HS9

HS10

Treatment

Figure 2. Contd.

LY1

LY2

LY3

LY4

LY5

LY6

Con1

Con2

Con2

Liu et al.

7615

3.50 A*

A*

Fresh weight of sugarcane (Ă— 104 kg)

3.00

A*

A*

A*

AB

AB

AB

2.50

B

2.00 C 1.50

1.00

0.50

0.00 HS1

HS6

HS7

LY2

LY3

LY6

HS3

HS9

Con1

Con2

Treatment Figure 3. Comparing sugarcane fresh weight after harvest with different treatments. The first control (Con 1) was also brushed with only water with 43% (w/w) additives. The second control (Con 2) represented BioCane granule (Australia). *The same capital letters indicate no significant difference for the mean value (Tukey–Kramer test, F = 3.71, p = 0.01). Abbott (1925) was then used for correction.

LY3

LY6

HS3

HS9

Con2

HS1

Con1

HS6

HS7

LY2

Con2

Con1

70

70

B

A

60 Adults density per monitoring region

Adults density per monitoring region

f

f

60

50

40

30

20

50

40

30

20

10

10

0

0 0

60

120 th

180

The x day after treatment (d)

240

300

0

60

120

180

240

300

th

The x day after treatment (d)

Figure 4. Comparing effects of M. anisopliae to the density of C. venosatus adults. By statistical analysis, the density of C. venosatus adults were closely related to the days after treatment. The first control (Con 1) was also brushed with only water with 43% (w/w) additives. The second control (Con 2) was BioCane granule (Australia).

7616

Afr. J. Biotechnol.

of Tropical Agricultural Science, for his critical review and helpful suggestions. REFERENCES Alonso-Díaz MA, García L, Galindo-Velasco E, Lezama-Gutierrez R, Angel-Sahagún CA, Rodríguez-Vivas RI, Fragoso-Sánchez H (2007). Evaluation of Metarhizium anisopliae (Hyphomycetes) for the control of Boophilus microplus (Acari: Ixodidae) on naturally infested cattle in the Mexican tropics. Vet. Parasitol. 147(3-4): 336-340. Beilharz VC, Parbery DG, Swart HJ (1982). Dodine: A selective agent for certain fungi. T. Br. Mycol. Soc. 79(3): 507-511. Brooks A, Wall R (2005). Horizontal transmission of fungal infection by Metarhizium anisopliae in parasitic Psoroptes mites (Acari: Psoroptidae). Biol. Control, 34(1): 58-65. Chase AR, Osborme LS, Ferguson VM (1986). Selective isolation of the entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium. Fla. Entomol. 69(2): 285-292. Cherry AJ, Lomer CJ, Djegui D, Schulthess F (1999). Pathogen incidence and their potential as microbial control agents in IPM of maize stem borers in West Africa. BioControl 44(3): 301-327. Chillar BS, Madan YP, Singh D (1993). Sugarcane leaf hopper, Pyrilla perpusilla Walker and its natural enemies. Indian Sugar, 43: 175-179. Curran J, Driver F, Ballard JWO, Milner RJ (1994). Phylogeny of Metarhizium: sequence analysis of the internally transcribed and 5.8s region of the ribosomal DNA repeat. Mycol. Res. 98(5): 547-552. Daniela OP, Irani QG, Elisa AG (2008). Morphological Regional Differences of Epithelial Cells along the Midgut in Diatraea saccharalis Fabricius (Lepidoptera: Crambidae) Larvae. Neotrop. Entomol. 37(4): 413-419. David H, Easwaramoorthy S, Jayanthi R (1991). Integrated pest management in sugarcane with special emphasis on biological control. Sugarcane breeding Institute, Coimbatore, pp. 94-101. Dickson WL, Robert DS, Edith PM, Deogratius RK, Ladslaus LM, Tanya LR, Fredros OO (2010). An extra-domiciliary method of delivering entomopathogenic fungus, Metarhizium anisopliae IP 46 for controlling adult populations of the malaria vector, Anopheles arabiensis. Parasite Vector, 3(18): 1-6. Dimbi S, Maniania NK, Ekesi S (2009). Effect of Metarhizium anisopliae inoculation on the mating behavior of three species of African Tephritid fruit flies, Ceratitis capitata, Ceratitis cosyra and Ceratitis fasciventris. Biol. Control, 50(2): 111-116. Driver F, Milner RJ, Trueman WH (2000). A taxonomic revision of Metarhizium based on a phylogenetic analysis of rDNA sequence data. Mycol. Res. 104(2): 134-150. Du KS, Chai LY, Xu YL, Lang JF (2008). Isolation of a Metarhizium Strain. J. Microbiol. 28(6): 57-60. Fernandes ÉKK, Keyser CA, Rangel DEN, Foster RN, Roberts DW (2010). CTC medium: A novel dodine-free selective medium for isolating entomopathogenic fungi, especially Metarhizium acridum, from soil. Biol. Control, 54(6): 197-205. Gao S (1996). Current Status of Studies on Metarhizium SPP. Chin. J. Biol. Control, 12(4): 182-187. Gerardo H, Sandra JS, Jennifer AT (1994). Construction of a Bioinsecticidal Strain of Pseudomonas fluorescens Active against the Sugarcane Borer, Eldana saccharina. Appl. Environ. Microbiol. 60(2): 682-690. Graça LR (1976). Estimativa econômica dos prejuízos causados pelo complexo broca-podridão na cana-de-açucar. Bras. Açucar. 88: 12-34. Hoffmann MP, Wright MG, Pitcher SA, Gardner J (2002) Inoculative releases of Trichogramma ostriniae for suppression of Ostrinia nubilalis (European corn borer) in sweet corn: field biology and population dynamics. Biol. Control, 25(3): 249-258. Katrina JD, Graeme L, Jennifer AT (2000). Biocontrol of the Sugarcane Borer Eldana saccharina by Expression of the Bacillus thuringiensis cry1Ac7 and Serratia marcescens chiA Genes in Sugarcane-Associated Bacteria. Appl. Environ. Microbiol. 66(7): 2804-2810.

Lin MJ (2007). Research and Application of Natural enemies and Sex attractant to Sugarcane Borer. Sugarcan, Canesugar, 4: 19-24. Liu SF, Ye ZH, Jiang SR (2007). Isolation and Virulence Test of Metarhizium. J. Anhui Agric. Sci. 35(17): 5058-5059, 5077. Long WH, Hensley SD (1972). Insect pests of sugarcane. Annu. Rev. Entomol. 17(1): 149-176. Marius H, Godwin PK, Michael S, Galina G, Itamar G (2011). Pathogenicity of the entomopathogenic fungus Metarhizium anisopliae to the red-legged tick, Rhipicephalus evertsi evertsi. Afr. J. Biotechnol. 3(7): 68-72. Matthias S, Paul F (2002). Screening of North American species of Trichogramma Westwood (Hymenoptera: Trichogrammatidae) for control of the Indian meal moth, Plodia interpunctella (Hübner) (Lepidoptera: Pyralidae). Proceedings of the Eighth International Working Conference of Stored-Product Protection, N.Y., U.K. July: 1-10. Menossi M, Silva-Filho MC, Vincentz M, Van-Sluys M-A, Souza GM (2008). Sugarcane Functional Genomics: Gene Discovery for Agronomic Trait Development. Int. J. Plant Genomics 2008: 458732. Monique MT, Ravely CO, Daniela AL, João AP (2011). Toxicity of the insect growth regulator lufenuron on the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin assessed by conidia germination speed parameter. Afr. J. Biotechnol. 10(47): 9661-9667. Niassy S, Diarra K, Ndiaye S, Niassy A (2011). Pathogenicity of local Metarhizium anisopliae var. acridum strains on Locusta migratoria migratorioides Reiche and Farmaire and Zonocerus variegatus Linnaeus in Senegal. Afr. J. Biotechnol. 10(1): 28-33. Nicholls CI, Perez N, Vasquez L, Altieri M (2002). The development and status of biologically based integrated pest management in Cuba. Integr. pest manage. Rev. 7(1): 1-16. Pan XH, Huang CH, Xin DY (2009). Dominant natural enemies and biological control of sugarcane borers. Guangxi Agric. Sci. 40(1): 49-52. Pedro HC, Candido SA (1997). Entomopathogenic fungi associated with natural populations of the Moroccan Locust Dociostaurus maroccanus (Thunberg) (Orthoptera: Gomphocerinae) and other Acridoidea in Spain. Biocontrol Sci. Technol. 7(3): 357-364. Pfeifer TA, Khachatourians GG (1993). Isolation of DNA from entomopathogenic fungi grown in liquid cultures. J. Invertebr. Pathol. 61(2): 113-116. Poprawiski TJ, Yule WN (1991). Incidence of fungi in natural populations of Phyllophaga spp. and susceptibility of Phyllophaga anxia (LeConte) (Col., Scarabalidae) to Beauveria bassiana and Metarhizium anisopliae (Deuteromycotina). J. Appl. Entomol. 112(3): 359-365. Pu ZL, Li ZZ (1996). Insect Mycology. Anhui Sci. Technol. Press, Hefei, Anhui, China, 95-97: 360-368. Quesada-Moraga E, Martin-Carballo I, Garrido-Jurado I, Santiago-Álvarez C (2008). Horizontal transmission of Metarhizium anisopliae among laboratory populations of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). Biol. Control, 47(6): 115-124. Roddam LF, Rath AC (1997). Isolation and characterization of Metarhizium anisopliae and Beauveria bassiana from Subantartic Macquarie Island. J. Invertebr. Pathol. 69(3): 285-288. Sabbour MM (2002). The role of chemical additives in enhancing the efficacy of Beauveria bassiana and Metarhizium anisopliae against the potato tuber moth Phthorimaea operculella (Zeller) (Lepidoptera: Gelechiidae). Pak. J. Biol. Sci. 5(11): 1155-1159. Shang XK, Huang CH (2010). Research Progress of the Control Techniques of Sugarcane Borer. J. Anhui Agric. Sci. 38(35): 20064-20066, 20069. Shanley RP, Keena M, Wheeler MM, Leland J, Hajek AE (2009). Evaluating the virulence and longevity of non-woven fiber bands impregnated with Metarhizium anisopliae against the Asian long horned beetle, Anoplophora glabripennis (Coleoptera: Cerambycidae). Biol. Control, 50(4): 94-102. Smith SM (1996). Biological control with Trichogramma：advances， successes and potential of their use. Annu. Rev. Entomol. 41: 375-406. Talekar NS, Shelton AM (1993). Biology, ecology and management of diamondback moth. Annu. Rev. Entomol. 38: 275-301. Tarasco E, Bievre CD, Papierok B (1997). Occurrence of

Liu et al.

entomopathogenic fungi in soils in Southern Italy. Entomology, 31:157-166. Tulloch M (1976). The genus Metarhizium. T. Br. Mycol. Soc. 66(3): 407-411. Wekesa VW, Maniania NK, Knapp M, Boga HI (2005). Pathogenicity of Beauveria bassiana and Metarhizium anisopliae to the tobacco spider mite Tetranychus evansi. Exp. Appl. Acarol. 36(1-2): 41-50. Weng LX, Deng HH, Xu JL, Li Q, Wang LH, Jiang ZD, Zhang HB, Li QW, Zhang LH (2006). Regeneration of sugarcane elite breeding lines and engineering of stem borer resistance. Pest Manage. Sci. 62(2): 178-187. Yu YH, Chen RZ, Wei DW, Chen XF, Zeng T, Wang ZY (2009). Trapping and killing of Dorysthenes granulosus adults using frequency vibration-killing lamp. Guangxi Agric. Sci. 40(12): 1552-1554. Zhan RL, Qing WQ, Song Y, Zhang SQ, HO HH, Xu TW, Huang JS (2007). Isolation and identification of Metarhizium anisopliae from natural infections of Coconut hispid beetle Brontispa longissima (Gestro) (Coleoptera: Chrysomelidae) and preliminary studies on against this pest in Hainan island, China. Acta Ecol. Sin. 27(4): 1558-1564. Zhang LS, Zhang ZH, Gao S, Nong XQ (2006). Application and Development of Metarhizium Biological Pesticide. Chinese J. Biol. Control, 22(s1): 141-146.

7617

Zhang ML (1997). Effects of 14 Insecticides on Adults, Larvae, Eggs, and Pupae of Trichogramma Confusum. Nat. Enemies Insects, 19(1): 11-14. Zhang YC, Yi DY, Lei CY, Xie HJ, Li XY (2008). Morphological Characteristic and Living Habit of Sugarcane Borers and Its Control Techniques in Guizhou. Guizhou Agric. Sci. 36(1): 95-96. Zhen GL, Yang FR, Yi LE, Yang LX (2001). Effect of Trichogramma Chilonis Ishii on Sugarcane Bores. J. Southwest Agric. Univ. 23(5): 398-400. Zhou RQ, Huang ZR, Yang JX, Liang L (2008). Effective test of 5% Zhelaijing GR against sugarcane borer. Guangdong Agric. Sci. 2008(1): 59-60. Zimmerman G (1993). The entomopathogenic fungus Metarhizium anisopliae and its potential as a biological agent. Pestic. Sci. 37(4): 375-379.

African Journal of Biotechnology Vol. 11(30), pp. 7618-7628, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3739 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Purification of an elicitor from Magnaporthe oryzae inducing defense resistance in rice Chunyan Ji and Zhenzhong Wang* Laboratory of Physiological Plant Pathology, South China Agricultural University, Guangzhou 510642, China. Accepted 1 March, 2012

Inducible defenses that contribute to overall resistance in plant can be triggered by elicitors. A novel elicitor, derived from the mycelia of the blast fungus Magnaporthe oryzae, was purified to homogeneity by HiPrep 16/20 DEAE-Sepharose FF, Concanavalin A-Sepharose 4B and HiPrep 16/60 Sephacryl S-100 column chromatography. The purified elicitor appeared as single band corresponding to a molecular weight of 48.53 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophresis (SDS-PAGE) and a pI of 6.01 on isoeletric focusing (IEF) gel. Treatment with the purified elicitor increased the activities of phenylalanine ammonium-lyase (PAL) and peroxidase (POD) in rice susceptible cultivar CO39. Timecourse analysis showed peak accumulation of PAL appeared at 24 h after treatment, and it was higher in challenge-inoculated plants than non-challenge plants. POD accumulation showed similar kinetics with PAL, but the largest peak appeared at 36 h after treatment. Compared to the untreated control plants, pretreatment of rice leaves with the purified elicitor provided an enhanced level of protection against M. oryzae. N-terminal blocked elicitor was identified as hypothetical protein MG 05155.4 with 26.28% mass fingerprint coverage by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). The results suggest that the purified elicitor is involved in inducing resistance against blast fungus. Key words: Magnaporthe oryzae, elicitor, purification, induced resistance. INTRODUCTION Plant innate immunity is generally divided into two branches that efficiently wards off dangerous microorganism. One uses transmembrane pattern recognition receptors (PRRs) that respond to slowly evolving microbial- or pathogen-associated molecular patterns (MAMPS or PAMPs), resulting in PAMP-triggered immunity (PTI). However, pathogens deploy effectors that interfere with PTI and ultimately enable a successful infection. In turn, plants evolved the ability to recognize effectors either directly or indirectly through NB-LRR proteins that activate effector-triggered immunity (ETI).

*Corresponding author. E-mail: zzwang@scau.edu.cn. Tel: +86 20 85281469. Fax: +86 20 85281107. Abbreviations: SDS-PAGE, Sodium dodecyl sulfatepolyacrylamide gel electrophresis; IEF, isoeletric focusing; PAL, phenylalanine ammonium-lyase; POD, peroxidase; MALDI-TOF MS, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

These two forms formerly called basal or horizontal disease resistance and resistance(R) gene-based or vertical disease resistance (Boller and Felix, 2009; Jones and Dangl, 2006). Rice blast, caused by the fungus Magnaporthe oryzae, is one of the most destructive diseases of rice and often reduces yields greatly in rice-growing countries (Ou, 1980; Rossman et al., 1990). Annual losses caused by M. oryzae vary between 10 and 30% of the harvest (Skamnioti and Gurr, 2009). Genetic resistance is the major method of disease control for blast (Martin et al., 2002). However, due to rapid adaptability and high variability of the fungal population in the field, frequent loss of resistance of rice cultivars is a major restraint in sustainable rice production. In practices, farmers usually go for chemical control which is comparatively expensive and environmentally unsafe. Concomitantly, increased public concerns to the possible negative health effects of chemical residues have forced policy changes in many countries. Therefore, it has become increasingly important to develop the efficient and environment-

Ji and Wang

friendly control strategy against rice blast. PAMPs usually represent highly conserved structures which carry essential functions. It is clear that “general elicitors” are conceptually equivalent to PAMPs (Nurnberger et al., 2004). Plant cells exposed to elicitors, whether crude fungal cell wall fragments or defined molecular, respond with a battery of cellular changes such as changes in ion fluxes, the generation of reactive oxygen species, the synthesis of phytoalexins, the accumulation of defense-related enzymes that including Peroxidase (POD) and Phenylalanine Ammonium-Lyase (PAL), and the activation of defense gene expression (Dixon and Lamb, 1990; Yang et al., 1997; Zhao et al., 2005). As an alternative and ecologically-friendly approach for plant protection, induced disease resistance has been shown to occur in plants in response to a localized pretreatment with elicitors thus making them resistant to subsequent pathogen infection (Hammerschmidt, 1999; Mohammadi and Kazemi 2002). In recent years, understanding the molecular basis of plant responses to PAMPs is an active area of research in the field of plant-microbe interactions. The rice-M. oryzae pathosystem has become a model system for genetic and molecular biology studies in plant pathology (Valent, 1990). Some biotic elicitors originating from fungi, oomycetes and bacteria have been described in a wide range of plant species (Garcia-Brugger et al., 2006). In this paper, a novel elicitor was purified from the mycelia of M. oryzae and characterized by Matrixassisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Treatment of rice leaves with the purified elicitor induced the accumulation of defense-related enzymes (POD and PAL), and increased resistance to blast fungus.

MATERIALS AND METHODS Plant and fungal material Rice blast fungus, M. oryzae, race ZC13, one of the primary blast physiological races found in Guangdong Province, P. R. China, and the susceptible indica cultivar CO39 were used in this study.

7619

Column chromatography HiPrep 16/20 DEAE-Sepharose FF column, HiPrep 16/60 Sephacryl S-100 column, XK 16/20 column and Concanavalin ASepharose 4B media were purchased from Pharmacia. The following described purification procedure was performed on an AKTA purifier system 100 (Amersham Pharmacia Biotech, USA). All operations were performed at 0 to 4°C. The crude elicitor solutions were loaded onto a HiPrep 16/20 DEAE-Sepharose FF column, which was equilibrated with 20 mM Tris- HCl buffer, pH7.4. Unbound material was washed out with 2 columns of Tris-HCl buffer. The bound fraction was eluted with 10 columns of a linear gradient of 0 to 0.75M NaCl at a flow rate of 3 ml/min. The fractions with the highest elicitor activity collected from the anion-exchange column were injected to Concanavalin A-Sepharose 4B column (2.6 × 20 cm), which was equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 0.5 M NaCl, 1 mM MgCl2, 1 mM MnCl2, and 1 mM CaCl2. The non-binding material was washed with equilibration buffer, and ConA-binding material was subsequently displaced by 0.15 M α-methyl-D-Mannoside in equilibration buffer at a flow rate of 0.2 ml/min. The highest elicitor active fractions collected from the ConA affinity column were subjected to a HiPrep 16/60 Sephacryl S-100 column. The column was eluted with 20 mM Tris-HCl buffer (pH 7.4) at a flow rate of 0.5 ml/min. The highest elicitor active fractions obtained from several separate gel filtration runs were pooled, lyophilized, and stored at -80°C until use. Protein concentration was determined according to the Bradford (1976) method using bovine serum albumin as a standard.

Assay for elicitor activity Elicitor activity was assayed by the method of Schaffrath (1995) using POD activity as a biomarker with some modifications. The rice seedlings (cv. CO39) were grown in the greenhouse at 26～22°C (day/night) with 70 to 80% relative humidity. At the fourleaf stage, the fully expanded fourth leaves were injected with the tested solutions using a syringe without needle. Control plants were infiltrated with distilled water. Treated rice seedlings were kept in a humidity chamber and sampled 36 h after treatment. The POD activity was assayed as described by Ryan et al., (1982) except that the 3-ml reaction mixture contained sodium phosphate buffer (20 mM, pH5.6), 18 mM guaiacol, 3.3 mM H2 O2 and 20 µl crude enzyme. An increase in the absorbance at 470 nm (△A470) of 2 min was recorded using a spectrophotometer. One unit of the POD activity was defined as the amount of enzyme that increased the absorbance by 0.01 per min at 470 nm. One unit of elicitor activity was defined as the amount of the sample required to induce one unit of POD activity.

Crude elicitor preparation

Sodium dodecyl sulfate polyacrylamide gel electrophoresis and N-terminal amino acid sequence analysis

The preparation of the crude elicitor was performed according to the method described by Schaffrath (1995) with some modifications. Mycelia were incubated in yeast liquid medium (yeast extract 5.0 g, sucrose 20 g, distilled water 1 L). Vegetative mycelia were harvested from 7-day-old liquid cultures. After thawing in a Waring-Blender, the material was stirred at 4°C overnight and centrifuged at 10,000 g for 30 min. The supernatants were filtered successively through Whatman No.1 qualitative filter paper and a 0.22-µm Millipore filter. The filtrates were concentrated by ultrafiltration (Amicon 8400 ultrafiltration system) using a PM-30 membrane (Millipore) and the biologically active residue (＞30 kDa) as crude elicitor fractions (CEF).

Discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed using 3% acrylamide stacking and 10% resolving gels on a mini-PROTEAN III gel system (Bio-Rad). After electrophoresis, gels were rinsed and subsequently silver stained (Oakley et al., 1980). The molecular masses of the purified elicitor were measured by SDS-PAGE. The purified elicitor was separated by SDS-PAGE and electroblotted onto polyvinylidene difluoride (PVDF) membranes. The membrane stained and protein band cut out for N-terminal sequence analysis with Procise 491 automatic sequencer (Applied Biosystems Inc., USA).

7620

Afr. J. Biotechnol.

Isoelectric focusing The obtained purified elicitor was analyzed by isoeletric focusing (IEF) as described by Garfin (1990) with some modifications. 10 mM phosphoric acid and 20 mM sodium hydroxide were used as anolyte and catholyte respectively. The sample focusing was conducted under a constant voltage of 100 V for 15 min, 250 V for an additional 15 min, and finally 450 V for 1.5 h. After focusing, the samples were stained with Coomassie brilliant blue R-250. The isoeletric point of the sample was determined by comigration with protein-pI markers. Mass spectrometry

described above. PAL activity was determined according to the method of Mozzetti (1995) with slight modifications. One gram (1 g) of the leaves was ground with 2 ml extracting buffer (20 mM potassium borate buffer containing 0.2 g PVPP, pH 8.8). The extracts were homogenized and centrifuged at 12,000 × g for 30 min, the supernatant was collected as crude enzyme extract. The reaction mixture consisted of 100 µl of crude enzyme, 3.65 ml of 100 mM potassium borate buffer (pH 8.8), and 1.25 ml of 20 mM Lphenylalanine solution. After incubation at 40°C for 30 min, the reaction was stopped by addition of 250 µl of 5 N HCl. One unit of PAL activity was defined as the amount causing an increase of 0.01 in A290 per min. PAL activity was expressed as enzyme units per mg protein (U mg protein-1).

The Coomassie G-250 stained protein band was excised from the SDS-PAGE gel and subjected to in-gel digestion with trypsin. Mass spectra were recorded on a Bruker Biflex III MALDI-TOF mass spectrometer in reflector mode. Protein identification was performed with Mascot search engine (http://www.matrixscience.com and SWISS-PROT database (http://www.expasy.ch/tools/peptident. html).

Statistical analysis

Rice infection assays

RESULTS

M. oryzae was cultured in Petri dishes containing 20 ml of medium composed of 20 g l-1 rice bran powder, 2.5 g l-1 yeast extract, 1.5% agar. The cultures were placed in a growth chamber with a 12 h photoperiod for 7 to 9 d. Conidia were harvested from plates by rinsing with sterile distilled water and filtering through two layers of gauze. Rice seedlings of susceptible cultivar CO39 at four-leaf-stage were pretreated with the purified elicitor or distilled water as described above, and challenge inoculated with M. oryzae 1 d later by spraying conidial suspensions at a concentration of 2 × 105 conidia per ml. The non-inoculated plants were sprayed with the same amount of distilled water. Inoculated and non-inoculated rice seedlings were kept in a moist chamber at 25°C for 24 h and then transferred to the glasshouse. Disease index of each replicate (containing 30 seedlings) and a total 90 seedlings in three replicates of each treatment were evaluated 5 to 9 d after inoculation according to IRRI (2002). Disease index and inducing effect (%) were calculated according to the formula: Disease index=［Σ(r×nr)/(9×Nr)］×100 Where, r is the score of scale; nr is the number of infected leaves with a rating of r; Nr is the total number of investigated leaves; and Σ is the sum numbers of infected leaves of different scores. Inducing effect (%) = (Control－Treated)/Control ×100.

Enzyme assays In order to elucidate the mechanism of induced resistance in elicitor-pretreated rice leaves, the time course of defense-related enzymes including POD and PAL activities was investigated. There were four treatment groups with three replications: (1) challenge inoculated with M. oryzae in elicitor-treated plants, (2) challenge inoculated with M. oryzae in water-treated plants, (3) elicitor-treated plants, (4) water-treated plants. The elicitor infiltration and pathogen inoculation were carried out as described above. At various times after treatment, the fresh leaves were pooled, frozen in liquid nitrogen and stored at -20℃ until used. All enzyme extract procedures were conducted at 4°C. POD activity was carried out as

All statistical analyses were performed using SPSS software version 10.0. Data were analyzed by one-way analysis of variance (ANOVA) and Duncan’s multiple range test (DMRT) was performed to determine significant difference between treatments. Differences at P < 0.05 were considered to be significant.

Purification of a 49 kDa elicitor from M. oryzae Vegetative mycelia of M. oryzae were harvested from 7day-old liquid culture. After centrifugation and ultrafiltration, the >30 kDa fractions were active and served as CEF for the further purification. CEF was applied to a HiPrep 16/20 DEAE-Sepharose FF column, the anion-exchange chromatographic profile is shown in Figure 1a. The elution of the bound fractions, including D3, D4, were pooled and tested for elicitor activity respectively. All these two fractions (D3, D4) were biologically active, while the highest active fraction was yielded in the peak D4. The active peak D4 was injected onto an affinity column (Concanavalin A-Sepharose 4B). The activity assay indicated that the non-binding fraction (peak C2) contained elicitor-active components (Figure 1b). Further purification of active peak C2 by the gel filtration column (Figure 1c) resulted in one sharp peak (S1) and one small diffused peak (S2), two peak fractions (S1，S2) were pooled and analyzed for elicitor activity, the peak S1 fraction showed the highest biological activity. The pooled peak S1 fractions showed only one band on a silver-stained SDS-polyacrylamide gel (Figure 2). The apparent molecular weight of peak S1 fraction estimated by SDS-PAGE was about 48.53 kDa. SDSPAGE with or without the reducing agent βmercaptoethanol had no effect on the migration of the peak S1 fraction, indicating there is no existence of the disulfide bridges in peak S1 fraction. Thus, one 48.53 kDa elicitor was purified to homogeneity from the mycelia of M. oryzae. A balance sheet of the elicitor purification is summarized in Table 1. Elicitor was purified with a recovery of 10.13% to a final specific activity of 35 U mg protein-1. The isoelectric point of the elicitor was estimated to be 6.01 by IEF (Figure 3).

Ji and Wang

7621

Figure 1. Purification of elicitor prepared from the crude CEF. CEF derived from the mycelia of M. oryzae was further purified by the column chromatography. The elution profiles were monitored at 280 nm. Each peak fraction was collected according to the elution profile and assayed for elicitor activity by detecting the ability to induce the accumulation of POD at 36h post-inoculation in susceptible cultivar CO39. (a): Elution profile of crude elicitor fraction on DEAE-Sepharose FF column. Four distinct peaks (D1, D2, D3, and D4) were obtained and tested for biological activity. Peak D4 was the main activity fraction. (b): Elution profile of DEAE-Sepharose FF fraction D4 on Concanavalin A-Sepharose 4B column. Two peaks (C1, C2) were obtained and assayed for biological activity. Unbounded fraction C2 showed the elicitor activity. (c): Elution profile of Concanavalin ASepharose 4B fraction C2 on Sephacryl S-100 column. Gel filtration yielded two peaks (S1, S2) and assayed for biological activity, Peak S1 showed the highest elicitor activity.

N-terminal sequencing and MALDI-TOF MS analysis Edman degradation is the conventional method for the Nterminal sequencing. Unfortunately, sequence analysis indicated the elicitor was N-terminal blocked. The genome of M. oryzae has been fully sequenced, proteomics approaches are most effective when

supported by complete genome sequence databases. The purified elicitor band from the Coomassie bule R-250 staining gel was excised and followed by MALDI-TOF MS analysis (Figure 4). The purified elicitor was identified as hypothetical protein MG 05155.4 with 26.28% mass fingerprint coverage (Table 2). Furthermore, search for sequence similarity using the BLAST program did not

7622

Afr. J. Biotechnol.

Figure 1. Contd.

affected rice blast disease development, the fully expanded fourth leaves of susceptible cultivar CO39 were injected with the purified elicitor or distilled water and subsequently challenged with M. oryzae. As shown in Table 3, the Disease index in water-treated control plants was higher than in plants pretreated with elicitor. In comparison to control plants, the application of elicitor reduced the Disease index of rice blast by 16.65, 38.99 and 44.65% at 5, 7 and 9 days post-inoculation, respectively. The results suggested the purified elicitor treatment induced resistance in rice plants against M. oryzae. The accumulation of defense related activities induced by the purified elicitor Figure 2. SDS-PAGE analysis of the purified elicitor. The active peak S1 (obtained from Sephacryl S-100 gel filtration) was examined on silver-stained SDS-polyacrylamide gel and displayed a clear single band with apparent relative molecular weight of 48.53 kDa. Lane 1: Low molecular weight standard molecular weight marker (Qiangen): 97,400, 66,200, 43,000, 31,000, 20,100 and 14,400. Lane 2: Purified elicitor.

reveal any significant sequence similarity to any known proteins. The purified elicitor increased resistance to M. oryzae In order to evaluate whether the application of elicitor

enzyme

POD activity has been reported to be a biochemical marker for resistance (Hiraga et al., 2001). PAL is the first enzyme in the phenylpropanoid pathway which has important functions in plants following exposure to environmental stresses and pathogen attack (Hahlbrock and Scheel, 1989). The time course measurement of POD and PAL accumulation induced by the purified elicitor against M. oryzae were carried out using leaf tissues of susceptible cultivar CO39. As shown in Figure 5a, in inoculated elicitor-treated plants, assays of POD activity revealed the highest peak appeared at 36 h after challenge inoculation, and the activity was nearly 1.19 times higher than that in inoculated water-treated plants. A similar pattern of increased activity of POD was observed in uninoculated elicitor-treated plants, the activity reached maximum at 36 h, then to decline gradually. There was no marked change in POD activity in uninoculated water-treated plants during the time

Ji and Wang

7623

Table 1. Purification of elicitor from the mycelia of M. oryzae.

Purification step Crude elicitor fraction DEAE ConA S-100

Total protein (mg) 512 97.5 30.6 6.82

Total activity (units) 2355 2033.9 736.5 238.7

a

-1 b

Specific activity (U mg protein ) 4.6 20.86 24.07 35

Yield (%) 100 86.36 31.27 10.13

a: One unit of elicitor activity is defined as the amount of the sample required to induce one unit of POD activity at 36 h post-inoculation in cultivar CO39, one unit of POD activity was defined as the increase of 0.01 ∆470 per min. b: The specific elicitor activity of the sample is defined as the number of units per mg protein of the sample.

course of experimental period. As shown in Figure 5b, in inoculated elicitor-treated plants, PAL activity increased quickly and reached its maximum level at 24 h after challenge inoculation, and was about 1.38 times more than that in inoculated watertreated plants. PAL activity was also significantly higher than that of the control plants and reached its maximum at 24 h after treatment with elicitor alone. DISCUSSION

Figure 3. Isoelectric focusing of the purified elicitor. Isoelectric focusing was performed in pH gradient 3.5 to 9.3, the purified elicitor migrated as a single band and focused at apparent isoelectric point (pI) 6.01. Line 1: purified elicitor. Line 2: pI standard marker, 3.5 to 9.3 pI range (Pharmacia).

To better understand the molecular mechanism of how plant cells perceive and transduce the elicitor signal, pure elicitor molecules are preferred to rule out effects of contaminants in the crude preparation. In the present paper, a novel elicitor, which has a molecular mass of 48.53 kDa and pI of 6.1, was purified to homogeneity form the mycelia of M. oryzae by HiPrep 16/20 DEAESepharose FF, Concanavalin A-Sepharose 4B and HiPrep 16/60 Sephacryl S-100 column chromatography. The availability of this pure elicitor offers more possibilities to further study the downstream defense reactions in rice host plants. Affinity chromatography separates proteins on the basis of a reversible interaction between a protein and a specific ligand coupled to a chromatography matrix. It offers high selectivity, and high capacity for the protein of interest. Unfortunately, the purified elicitor did not bind to Con-A Sepharose 4B column during the entire chromatography process, thus, in order to minimize loss of elicitor activity, it might be possible to establish a more rapid purification procedure for further study by eliminating any steps such as Con-A Sepharose 4B that might unfavorably affect yield. Different types of elicitors including oligosaccharides, glucans, glycoproteins and sphingolipids have been reported to induce defense responses in rice plants (Kishimoto et al., 2010; Koga et al., 1998; Matsumura et al., 2003; Peng et al., 2011; Schaffrath et al., 1995; Yamaguchi et al., 2002). Among them, chitin oligosaccharides elicitor like N-acetylchitooligosaccaride was given an extensive study, which could induce various cellular responses including phytoalexin production, oxidative burst, gene expression and HR induction. A high affinity binding site for N-acetylchitooligosaccaride

7624

Afr. J. Biotechnol.

Figure 4. MALDI-TOF MS analysis of the purified elicitor.

Table 2. Identification of the purified elicitor by MALDI-TOF MS analysis.

Protein

Hypothetical protein MG05155.4

Accession no.a

gi38106113

MW/pIb

Sequence coverage (%)c

48.9523kDa/5.94

Score

26.28

Peptide hit

106

12

Peptides identified FKVADLSLAAFGR;VADLSLAAFGR;VAD LSLAAFGRK;EIELAENEMPGLMQTR;G ETEEEYNWCLEQQLLAFK;LNLILDDGG DLTHLVHDK;SKFDNLYGCR;FDNLYGC R;AASVGQIFVTTTGCR;AASVGQIFVTT TGCRDILVGK;SVQNIKPQVDR;HIILLAE GR

a: Accession number in the NCBInr database. b: MW, molecular weight; pI, isoelectric point. c: Amino acid sequence coverage of the protein with respect to matched tryptic digest fragments

Table 3. Effects of the purified elicitor application on rice blast disease.

5th day Treatment Water-treated Elicitor-treated

Disease index 71.57 ± 1.63 59.65 ± 1.64*

7th day Inducing effect (%) 16.65

Disease index 82.94 ± 2.39 50.60 ± 1.32*

9th day Inducing effect (%)

Disease index 86.10 ± 1.61 47.65 ± 0.65*

38.99 5

Inducing effect (%) 44.65

The fully expanded fourth leaves (susceptible cv. CO39) were inoculated with M. oryzae at 2 × 10 conidia per ml 1 d after infiltrating with purified elicitor (100 µg/ml) or distilled water (as a control). The disease index was evaluated using a 0 to 9 scale standard at 5 to 7 days post-inoculation. Each experiment was performed with 30 plants and repeated three times with similar results. Each value represents the mean of three exprements±SD, Asterisks (*) show significant differences from the control at p < 0.05.

Ji and Wang

7625

a

70

-1

PA L activity (U mg protein )

12

24

36

48

60

72

96

Water

b

Elicitor

60

W+M.oryzae E+M.oryzae

50 40 30 20 10 0 0h

12 12h

24 24h

36 36h

48 48h

60 60h

72 72h

96 96h

Time after inoculation (h) Figure 5. Time-course curves for the induction of POD (a) and PAL (b) activities in the leaves of rice. The fully expanded fourth leaves of rice plants (cv. CO39) at the four-leafstage were infiltrated with elicitor (100 µg/ml) alone or elicitor at 1 d before challenge inoculated with M. oryzae (2 × 105 spores per ml), and infiltrated with water alone or water before challenge inoculation as controls. Rice leaves were harvested for enzyme assay at different time intervals after treatment. Vertical bars on the line represent standard deviations of the means.

was detected in the plasma membrane of rice plants (Yamada et al., 1993; Shibuya et al., 1996; Ito et al., 1997; Okada et al., 2002). Furthermore, CEBiP, a binding glycoprotein, for this elicitor was isolated from the plasma membrane of suspension cultured rice cells, knock-down experiment suggested that CEBiP was a functional receptor for the chitin oligosaccharide elicitor (Kishimoto

et al., 2010). Two oligosaccharide elicitors (N-acetylchitoheptaose and a tetraglucosyl glucitol) synergistically activated phytoalexin biosynthesis in rice cultured cells (Yamaguchi et al., 2002; Kaku et al., 2006). A β-glucan elicitor and two sphingolipid elicitors were found to cause cell death in rice suspension cells (Matsumura et al., 2003; Takahashi et al., 2008; Koga et al., 1998). To date,

7626

Afr. J. Biotechnol.

there are a few reports on potential protein elicitor derived from M. oryzae. A glycoprotein elicitor with a molecular weight of 15.6 kDa was purified from the culture filtrates of M. oryzae, and elicitor activity was due to the carbohydrate moiety (Schaffrath et al., 1995). A protein elicitor PemG1 from M. oryzae was recently found to improve resistance of rice and Arabidopsis to pathogen attack, and the PemG1-mediated systemic acquired resistance was modulated by SA- and Ca(2+)-related signaling pathways (Peng et al., 2011). In this paper, The Nterminal-blocked elicitor was identified as a hypothesis protein MG05155.4 by MALDI-TOF MS. The active part of elicitor appeared to be the protein moiety since the water-soluble elicitor was sensitive to heat treatment. The elicitor lost its biological activity after 10 min incubation under 100째C. Cloning the gene that encodes the purified elicitor is currently being pursued by using the MALDITOF MS information; meanwhile, the corresponding expression system is expected to be successfully constructed for further downstream research. POD and PAL enzymes play important roles in the plant defense reaction against pathogen. POD, a group of heme-containing glycosylated proteins, is involved in the scavenging of reactive oxygen species and the biosynthesis of cell wall. The last step in the synthesis of lignin and suberin has been proposed to be catalyzed by POD (Bolwell and Wojtaszek 1997; Quiroga et al., 2000). The phenylpropanoid pathway is one of the most important plant metabolic pathways. PAL represents the key enzyme of phenylpropanoid metabolism leading to biosynthesis of phytoalexins, precursor of lignin, and phenolic compounds (Jones, 1984; Hahlbrock and Scheel, 1989). The activities of POD and PAL enzymes in plants may be enhanced under the influence of various factors, such as pathogen attack and treatment with elicitors (Dixon and Lamb, 1990). Enhanced POD and PAL activities were reported in rice leaves infected by M. oryzae (Sekizawa et al., 1990). The partially Nacetylatedchitosan elicited both POD and PAL activities and led to lignin deposition in wheat leaves (Vander et al., 1998); Tobacco leaves infiltrated with a protein elicitor (PB90) exhibited an enhanced POD and PAL activities (Wang et al., 2003). The incompatible flagellin of Acidovorax avenae was a specific proteinaceous elicitor in rice, PAL activity was increased by the purified incomepatible flagellin (Tanaka et al., 2003), The accumulation of POD and PAL enzymes was observed in eggplants after elicitors such as chitosan, salicylic acid, methyl salicylate and methyl jasmonate treatment (Mandal, 2010). In our experiment, time-course analysis showed peak accumulation of PAL appeared at 24 h after treatment, and it was higher in challenge-inoculated plants than non-challenge plants. POD accumulation showed similar kinetics with PAL, but the largest peak appeared at 36 h after treatment. Our results suggest that POD and PAL may be involved in elicitor-mediated induced resistance against rice blast. Infection assay indicated the

purified elicitor was able to protect rice from infection by M. oryzae. In water-treated controls, the disease progressed and finally caused dead tissues, whereas, the disease development was significantly reduced in elicitortreated rice plants compared to the control plants. In conclusion, a novel elicitor, purified from the mycelia of M. oryzae was involved in the induction of resistance in rice plants against blast fungus. Clearly, much work such as how this purified elicitor is perceived by the rice plant and leading to the activation of the defense responses need to be thoroughly investigated in future. REFERENCES Boller T, Felix G (2009). A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant Biol. 60: 379-406. Bolwell GP, Wojtaszek P (1997). Mechanisms for the generation of reactive oxygen species in plant defence - A broad perspective. Physiol. Mol. Plant Pathol. 51: 347-366. Bradford MM (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254. Dixon RA, Lamb CJ (1990). Molecular communication in interactions between plants and microbial pathogens. Annu. Rev. Plant Physiol. Plant Mol. Biol. 41: 339-367. Garcia-Brugger A, Lamotte O, Vandelle E, Bourque S, David L, Benoit P, David W, Alain P (2006). Early signaling events induced by elicitors of plant defenses. Mol. Plant Microbe. Int. 9: 711-724. Garfin DE (1990). Isoelectirc Focusing. In: Deutscher MP (ed) Methods in enzymology, Academic Press, San Diego. 182: 459-476. Hahlbrock K, Scheel D (1989). Physiology and molecular biology of phenylpropanoid metabolism. Annu. Rev. Plant Pysiol. Mol. Biol. 40: 347-369. Hammerschmidt R (1999). Induced disease resistance: how do induced plants stop pathogens? Physiol. Mol. Plant. 55: 77-84. Hiraga S, Sasaki K, Ito H, Ohashi Y, Matsui H (2001). A large family of class III plant peroxidase. Plant Cell Physiol. 42: 462-468. IRRI (2002). Standard evaluation system for rice. International Rice Research Institute (IRRI). Los Banos, Philippines. pp. 37-48. Ito Y, Kaku H, Shibuya N (1997). Identification of a high-affinity binding protein for N-acetylchitooligosaccharide elicitor in the plasma membrane of suspension-cultured rice cells by affinity labeling. Plant J. 12: 347-356. Jones DH (1984). Phenylalanine ammonia-lyase: Regulation of its induction, and its role in plant development. Phytochemistry, 23: 1349-1359. Jones JD, Dangl JL (2006). The plant immune system. Nature, 444: 323-329. Kaku H, Nishizawa Y, Ishii-Minami N, Akimoto-Tomiyama C, Dohmae N, Takio K, Minami E, Shibuya N (2006). Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. PNAS, 103: 11086-11091. Kishimoto K, Kouzai Y, Kaku H, Shibuya N, Minami E, Nishizawa Y (2010). Perception of the chitin oligosaccharides contributes to disease resistance to blast fungus Magnaporthe oryzae in rice. Plant J. 64: 343-354. Koga J, Yamauchi T, Shimura M, Ogawa N, Oshima K, Umemura K, Kikuchi M, Ogasawara N (1998). Cerebrosides A and C, sphingolipid elicitors of hypersenstitive cell death and phytoalexin accumulation in rice plants. J. Biol. Chem. 273: 31985-31991. Mandal S (2010). Induction of phenolics, lignin and key defense enzymes in eggplant (Solanum melongena L.) roots in response to elicitors. Afr. J. Biotechnol. 9: 8038-8047. Martin SL, Blackmon BP, Rajagopalan R, Houfek TD, Sceeles RG, Denn SO, Mitchell TK, Brown DE, Wing RA, Dean RA (2002). MagnaportheDB: a federated solution for integrating physical and

Ji and Wang

genetic map data with BAC end derived sequences for the rice blast fungus Magnaporthe grisea. Nucleic Acids. Res. 30: 121-124. Matsumura H, Nirasawa S, Kiba A, Urasaki N, Saitoh H, Ito M, KawaiYamada M, Uchimiya H, Terauchi R (2003). Overexpression of Bax inhibitor suppresses the fungal elicitor-induced cell death in rice (Oryza sativa L.) cells. Plant J. 33: 425-434. Mohammadi M, Kazemi H (2002). Changes in peroxidase and polyphenol activity in susceptible and resistant wheat heads inoculated with Fusarium graminearum and induced resistance. Plant Sci. 62: 491-498. Mozzetti C, Ferraris L, Tamietti G, Matta A (1995). Variation in enzyme activities in leaves and cell suspensions as markers of incompatibility in different Phytophthora-pepper interactions. Physiol. Mol. Plant Pathol. 46: 95-107. Nurnberger T, Brunner F, Kemmerling B, Piater L (2004). Innate immunity in plants and animals: striking similarities and obvious differences. Immunol. Rev. 198: 249-266. Oakley BP, Kirsch DR, Morris NR (1980). A simplified ultrasensitive silver stain for detecting proteins in polyacrylamide gels. Anal. Biochem. 105: 361-363. Okada M, Matsumura M, Ito Y, Shibuya N (2002). Highi-affinity binding proteins for N-acetylchitooligosaccharide elicitor in the plasma membranes from wheat, barley and carrot Cells: conserved Presence and correlation with the responsiveness to the elicitor. Plant Cell Physiol. 43: 505-512. Ou SH (1980). Pathogenicity and host plant resistance in rice blast disease. Annu. Rev. Phytopathol. 18:167-187. Peng DH, Qiu DW, Ruan LF, Zhou CF, Sun M (2011). Protein elicitor PemG1 from Magnaporthe grisea induces systemic acquired resistance (SAR) in plants. Mol. Plant Microbe. Int. 24: 1239-1246. Quiroga M, Guerrero C, Botella MA, Barcelo A, Amaya I, Medina MI, Alonso FJ, De Forchetti SM, Tigier H, Valpuesta V (2000). A tomato peroxidase involved in the synthesis of lignin and suberin. Plant Physiol. 122: 1119-1127. Rossman AY, Howard RJ, Valent B (1990). Pyricularia oryzae, the correct name for the rice blast disease fungus. Mycologia, 82: 509512. Ryan JD, Gregory P, Tingey WM (1982). Phenolic oxidase activity in glandular trichomes of Solanum berthaultii. Phytochemistry, 21: 1885-1887. Schaffrath U. Scheinpflug H, Reisendr HJ (1995). An elicitor from Pyricularia oryzae induces resistance responses in rice: isolation, characterization and physiological properties. Physiol. Mol. Plant Pathol. 46: 293-307. Shibuya N, Ebisu N, Kamada Y, Kaku H, Cohn J, Ito Y (1996). Localization and binding characteristics of a high-affinity binding site for N-acetylchitooligosaccharide elicitor in the plasma membrane from suspension-cultured rice cells suggest a role as a receptor for the elicitor signal at the cell surface. Plant Cell Physiol. 37: 894-898.

7627

Skamnioti P, Gurr SJ (2009). Against the grain: safeguarding rice from rice blast disease. Trends Biotechnol. 27:141-150. Sekizawa Y, Haruyama T, Kano H, Urushizaki S, Saka H, Matsumoto K, Haga M (1990). Dependence on ethylene of the induction of peroxidase and lipoxygenase activity in rice leaf infected with blast fungus. Agric. Biol. Chem. 54: 471-478. Takahashi H, Matsumura H, Kawai-Yamada M, Uchimiya H (2008). The cell death factor, cell wall elicitor of rice blast fungus (Magnaporthe oryzae) causes metabolic alterations including GABA shunt in rice cultured cells. Plant Signal Behav. 3: 945-953. Tanaka N, Che FS, Watanabe N, Fujiwara S, Takayama S, Isogai A (2003). Flagellin from an incompatible strain of Acidovorax avenae mediates H2O2 generation accompanying hypersensitive cell death and expression of PAL, Cht-1, and PBZ1, but not of LOX in rice. Mol. Plant Microbe. Int. 16: 422-428. Valent B (1990). Rice blast as a model system for plant pathology. Phytopathology, 80: 33-36. Vander P, Varum KM, Domard A, EI Gueddari NE, Moerschbacher BM (1998). Comparison of the ability of partially N-acetylated chitosans and chitooligosaccharides to elicit resistance reactions in wheat leaves. Plant Physiol. 118: 1353-1359. Wang YC,Hu DW, Zhang ZG, Ma ZC, Zheng XB, Li DB (2003). Purification and immunocytolocalization of a novel Phytophthora boehmeriae protein inducing the hypersensitive response and systemic acquired resistance in tobacco and chinese cabbage. Physiol. Mol. Plant Pathol. 63: 223-232. Yamada A, Shibuya N, Kodama O, Akatsuka T (1993). Induction of phytoalexin formation in suspension-cultured rice cells by Nacetylchitooligosaccharides. Biosci. Biotechnol. Biochem. 57: 405409. Yamaguchi T, Maehara Y, Kodama O, Okada M, Matsumura M, Shibuya N (2002). Two purified oligosaccharide elicitors, Nacetylchitohepatose and tetraglucosyl glucitol, derived from Magnaporthe oryzae cell walls, synergistically activate biosynthesis of phytoalexin in suspension-cultured rice cells. J. Plant Physiol. 159:1147-1149. Yang Y, Shah J, Klessig DF (1997). Signal perception and transduction in plant defense responses. Genes Dev. 11: 1621-1639. Zhao J, Davis LC, Verpoorte R (2005). Elicitor signal transduction leading to production of plant secondary metabolites. Biotech. Adv. 23: 283-383.

African Journal of Biotechnology Vol. 11(30), pp. 7628-7637, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3807 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Increasing the amylose content of maize through silencing of sbe2a genes Shuyan Guan1, Yiyong Ma2, Huijing Liu1, Siyan Liu1, Guangna Liu1, Lina Zhao1 and Piwu Wang2* 1

College of Life Sciences, Jilin Agricultural University, Changchun 130118, China. 2 Agronomy College of Jilin Agricultural University, Changchun 130118, China. Accepted 23 March, 2012

Improved amylose content in maize has been achieved by reducing the starch branching enzyme (SBE) activity via transgenic maize inbred line transformed by a high-efficient RNAi expression vector, which may provide the foundation for maize quality improvement. The sense and anti-sense fragments of maize SBE gene sbe2a were cloned by reverse transcript PCR and high efficient RNAi expression vector was constructed based on plant expression plasmid pCAMBIA1301. Then the reconstruct was introduced into maize inbred line Tie7922 by pollen tube pathway transformation. Four transgenic plants were obtained. The integration of interest gene sbe2a into maize genome has been confirmed by PCR amplification and Southern hybridization. The sbe2a transcription was suppressed obviously by the analyses of RT-PCR, SBE activity and amylase content on the four transgenic plants. The SBE activity was significantly less than that of wild type maize, and was at most reduced by 77.9%; the amylose content was at most increased by 87.8%. In conclusion, RNAi expression vector pRSBE2a containing sbe2a gene was successfully constructed. Through genetic transformation, RNAi technique efficiently silences endogenous sbe2a gene to reduce the SBE activity, and high-amylose maize lines are obtained. Key words: Maize, starch branching enzyme gene sbe2a, RNA interference, genetic transformation. INTRODUCTION Corn starch, a main component of kernel, includes different molecular structures of amylose and amylopectin. Corn amylose, which is characterized by a high degree of polymerization and good film forming, is far superior to other amylose in the areas of support films, food, medical treatments, textiles, papermaking, packaging, petroleum, environmental protection, optical fibers, printed circuit boards, and electronic chips (Visser and Jacobsen, 1993). Corn high amylase is the best material for manufacture of photodissociative plastics and could potentially help to control serious "white pollution" (Smith et al., 1997). Currently, the amylose used for industry mainly comes

*Corresponding author. E-mail: peiwuw@yahoo.com.cn. Tel: 0431-84532908. Abbreviations: SBE, Starch branching enzyme.

from corn. Amylase for Chinese market mainly imports from the United States. Amylose extracted from normal maize is costly; therefore, breeding high-amylose maize varieties can significantly expand the applications of corn starch and promote development of the corn industry, improving economic benefits (Casey et al., 2000). Starches are produced by a synthetic process that is regulated by a series of enzymes. Starch branching enzyme (SBE) is a key enzyme in the process of starch biosynthesis, forming the branched structure by catalysis of glucose monomer binding through α-1,6 bonds (Denver et al., 2001). SBE is composed of two families; SBE(A) and SBE(B), and corn SBE has three isozymes; SBEI, SBEIIb and SBEIIa. SBEI and SBEIIb are mainly present in the endosperm and SBEIIa in the embryo, endosperm, leaves, and other nutritive tissues. Together, these three enzymes participate in the synthesis of amylopectin (Nunes et al., 2006; Qiao et al., 2007). Corn SBEIIa can directly participate in the synthesis of short chains of amylopectin, and has much higher activity than

Guan et al.

SBEIIb, indicating that the functions of SBEIIa and SBEIIb cannot be complementary (Yandeau-Nelson et al., 2011). In addition, deficiency of the SBEIIa isoform resulted in lower kernel yield (Blauth et al., 2001; Yandeau-Nelson et al., 2011). RNA interference (RNAi) is an effective and specific method of gene silencing, capable of posttranscriptionally regulating gene expression through the activity of doublestranded RNA molecules. This method has been widely applied in the area of unknown genetic function in both plants and animals, and in the area of crop improvement of rice (Qiao et al., 2007), maize, soybean (Nunes et al., 2006), barley (Schweizer et al., 2000), wheat (Sestili et al., 2010), patato and cotton (Sunilkumar et al., 2006), especially in the improvement of corn high amylose quantity and quality by sbe gene cloning and amylopectin suppression. Sestili et al. (2010) used RNAi of sbe2a to increase the amylose content of durum wheat. However, there are only few reports of corn starch composition changes as a result of RNAi of sbe2a, the gene for SBEIIa enzyme (Koga et al., 2006; Sestili et al., 2010). The present study was to clone corn SBE gene, sbe2a, and construct an efficient RNAi vector pRSBE2a. The pRSBE2a construct was transferred into inbred maize line Tie7922 by pollen tube pathway transformation, in order to achieve the inhibition of the SBE gene to produce high amylose. This study also investigated the genetic effect of gene interference, as well as potential applications of RNAi technology in crop improvement. MATERIALS AND METHODS Materials Waxy corn inbred line "W1" was a gift from Prof. Yu-Lan Wang, Jilin Agricultural University; recipient maize inbred line Tie7922, modified pCAMBIA1301 plasmid were preserved by the laboratory. ConcerTM plant RNA extract kit and reverse transcript kit were purchased from Invitrogen China (Shanghai); pMD18-T vector, PCR amplification kit, restriction enzymes, Escerichia coli DH5α from TaKaRa (China Dalian); T4 DNA ligase and DNA markers from Promega China (Beijing); nylon membranes, digoxin (DIG) labeling and testing kit from Roche China (Shanghai); amylose and amylopectin standard samples were purchased from Sigma Company; other reagents of analytic purity were obtained from China.

7629

the plant RNA extract kit, reverse transcription was performed to obtain cDNA, and PCR amplification was performed using the cDNA template. The reaction system, totally 50 µL, included ddH2O (37.6 µL), 10×buffer (Mg2+ plus, 5.0 µL), dNTP mixture (2.5 mmol/L, 4.0 µL), upper primer (50 pmol/L, 1.0 µL), lower primer (50 pmol/L, 1.0 µL), cDNA template (50 ng/µl, 1.0 µL), and EXTaq enzyme (5 U/µL, 0.4 µL). The reaction program was 94°C for 5 min; 35 cycles (94°C for 30 s, 56°C for 30 s, and 73°C for 90 s); and 72°C for 10 min for final extension. PCR products were separated by 1% agarose electrophoresis, recycled, and ligated to pMD18-T vector, forming pMD18-T-SBE2a, and the construct was transferred to E. coli DH5α. Positive white colonies were selected and cultured, plasmid DNA was extracted using the alkali lysis method, and DNA was identified via restriction enzymes and gene sequencing (TaKaRa Company Dalian, Chima). Nucleic acid sequences were analyzed using DNASIS (Medprobe, UK) software. RNAi vector constructs The RNAi construct pRSBE2a, consisting of the corn sbe2a gene, is shown in Figures 1a and b. The pMD18-T-SBE2a construct containing the sbe2a gene was digested with XbaI and BamHI. The modified pCAMBIA1301 vector, in which hygromycin resistance gene was removed, was also opened by the same endonucleases. The retrieved fragments containing the sbe2a fragments were forward and inversely inserted into the downstream adjacent to 35S promoter in modified pCAMBIA1301 vector forming pRSBE2a. The construct was transferred to DH5α, screened on Luria Bertani (LB) medium supplemented with kanamycin (50 µg/mL). Five positive colonies were screened out. To verify the constructs, plasmid DNA of positive colonies was extracted and digested. Plasmid was extracted using the mini DNA extraction kit, PCR amplification was performed using P1, P2 primers and pRSBE2a as templates. PCR products were digested with Xba I+BamH I and Sac I+Xho I, respectively, to identify the sense and antisense fragments.

Pollen tube pathway transformation of maize by RNAi vector An alkaline lysis method was used to extract plasmid DNA in a large scale, and then DNA introductory solution was prepared to a concentration of 500 to 1,000 µg/mL. In 8 to 12 h after selfpollination of recipient maize inbred line Tie7922, the stylus was removed, then 500 µL of DNA introductory solution was dropwise added to the incision, packaging quickly. One hour later, DNA solution was dropwise added again. Equivalent saline-sodium citrate (SSC) solution without DNA was served as the control which was treated with the same procedures.

Detection of transgenic T1 plants Cloning and sequencing of corn sbe2a The 562 bp of the total coding sequence (CDS) of sbe2a was used for designing primers (implying that the entire coding sequence was larger than 562 bp) (NCBI GenBank accession no. U65948), using Primer Premier 5.0 software (Premier, Canada). Primer sequences were as follows (restriction sites such as Sac I, Xho I, Xba I and BamH I are underlined): P1 upstream primer: 5′-TCTTG AGCTC ATAGG CGAGA ATCCC ACAT-3′ and downstream primer: 5′TAACC TCGAG CGTGT AAAGA TACGG ATGGA-3′; P2 upstream primer: 5′-TTTGT CGACC GTGT AAAGA TACGG ATGGA C-3′, and downstream primer: 5′-TTTGG ATTCA TAGG C GAGAA TCCC ACAT-3′. Total RNA was extracted from waxy maize inbred line "W1" using

Clusters with antibiotic resistance and good seeds were selected from Tie7922 T0 plants, which experienced pollen tube pathwaymediated transformation in the farm field, and then were planted in greenhouse. As transgenic T1 plants came into five to six leaves, every three plants were divided into one group. Genomic DNA was extracted from the mixed leaves of regenerative plants using a modified cetyltrimethylammonium bromide (CTAB) method. Primers were designed for the 35S promoter sequence of pRSBE2a. The primer sequences were as follows: P3 upstream, 5'-GTGAATCCGCACCTCT-3' and P3 downstream, 5'-ATCGCCGCTTTGGACATA-3'. PCR amplification was performed for primary screening of transgenic lines. Expression vector pCAMBIA1301 and non-transgenic plant genomic DNA served as the negative and

7630

Afr. J. Biotechnol.

a

b

35S Hind III CaMV35S promoter Xba I BamH I Sac I Bst XI CaMV35S promoter Xho I hygromycin(R)

GUS Nos poly-A T-Border(right)

Xho I CaMV35S polyA T-Border(left)

anti-sense

SacI

Xho I

562 bp

SacI +XhoI

kanamycin(R)

T4 DNA ligase

35S

Xba I

sense

Hind III CaMV35S promoter Xba I BamH I Sac I anti-sense Xho I CaMV35S polyA T-Border(left)

BamH I

562 bp

GUS

Nos poly-A T-Border(right)

kanamycin(R)

XbaI+BamHI

XbaI+BamHI

T4 DNA ligase

35S Hind III CaMV35S promoter Xba I sense BamH I Sac I anti-sense Xho I CaMV35S polyA T-Border(left)

GUS

Nos poly-A T-Border(right)

kanamycin(R)

Figure 1. (a) The structure map of the T-DNA region of the RNAi vector pRSBE2a, (b) diagram of constructing corn starch branch enzyme gene RNAi expression vector (pRSBE2a).

blank controls, respectively. The reaction system, totally 25 µL,

included ddH2 O (15.25 µL), 10×buffer (2.5 µL), MgCl2 solution (2

Guan et al.

7631

soaked in 0.05 mol/L citric acid buffer solution (pH 7.0), ground and homogenized in an ice bath (22 mL totally). Homogenates were then precipitated by centrifugation at 20,000× g for 20 min. Supernatant contained the gross enzyme extract. SBE activity assay was performed according to Sestili et al. (2010) report. The SBE activity of non-transgenic plant served as control. The percent of SBE activity decrease was calculated as follows: ∆OD660 % = (control OD660 – experimental OD660)/control OD660 × 100%. Starch content of transgenic T1 kernels The amylose and amylopectin contents were determined using a dual wavelength method. For amylose content determination, the major and contrast wavelengths were 620 and 480 nm, respectively; for amylopectin, the major and contrast wavelength were 550 and 760 nm respectively. Each treatment was repeated three times. Total starch was the sum of amylopectin and amylose. Analysis of transgenic T2 plants and kernels

Figure 2. Restriction enzyme analysis of the reconstructs. M, DNA Marker DL-2,000; 1 to 3, pMD18-T-SBE2a/Apa I+ Xba

µL), dNTP mixture (2.5 mmol/L, 2.0 µL), upper primer (25 pmol/L, 1.0 µL), lower primer (25 pmol/L, 1.0 µL), DNA template (25 ng/µl; 1.0 µL), and EXTaq (5 U/µL; 0.25 µL). The reaction program was 94°C for 10 min; 35 cycles (94°C for 1 min, 56°C for 40 s, and 72°C for 3 min); and 72°C for 10 min for final extension. A random single plant of each positive group was detected by Southern blotting. The 836 bp promoter fragment on the pRSBE2a was amplified by PCR and labeled with DIG to be used as the probe for the Southern blotting. Genomic DNA was extracted from PCR-positive plants, digested with BamH I, separated on 0.8% agarose, then transferred to nylon membranes in 20xSSC solutions, fixed at 80°C for 2 h, and hybridized with 35S promoter probes (830 bp). The DIG labeling and testing kit was used for probe labeling, hybridization, and color development as manufacture’s instructions. Reverse transcript PCR analysis of transgenic T1 kernels sbe2a mRNA accumulation in transgenic plants were detected by PCR method, using a non-transgenic plant as the blank control and corn EF-1a gene (213bp) as the inner control. Using the Plant RNA Extract Kit, total RNA was extracted from the kernels of transgenic T1 plants 20 days after pollination. cDNA was synthesized. PCR amplification of sbe2a fragment was conducted using cDNA as template. The sbe2a primer sequences were as follows: 5’-CGTGTAAAGATACGGATGGAC-3’ (upstream) and 5’-ATAGGCGAGAATCCCACAT-3’ (downstream), with an expected product of 562bp. The EF-1a primer sequences were as follows: 5’-GCTTCACGTCCCAGGTCATC-3’ (upstream) and 5’-TAGGCTTGGTGGGTATCATC-3’ (downstream), with an expected product of 213 bp (Kirchberger et al., 2007). The reaction systems were same as immediately abovementioned. The reaction program was 94°C for 5 min, 28 cycles (94°C for 30 s, 54°C for 30 s, 72°C for 1 min), and 72°C for 10 min for a final extension. Analysis of SBE activity in transgenic T1 kernels Five kernels of transgenic maize 20, 25, and 30 days after pollination (15 kernels totally), were harvested, weighed, and

Transgenic T1 plant corncob was covered with a plastic bag to allow inbreeding. A total of 20 random seeds of transgenic T1 plants (Tie7922-1, Tie7922-2, Tie7922-3, and Tie7922-4) were planted and grew up into transgenic T2 plants, respectively. Genomic DNA was extracted from the leaves of the transgenic T2 plants for PCR detection. SBE activity and starch content in the transgenic T2 kernels of PCR-positive T2 plants were detected as done to transgenic T1 kernels.

Statistical methods SPSS10.0 software was used for statistical analysis. Chi-square fitness test was performed to analyze the fitness of transgenic T2 plants to the Mendel law. Student t-test was used for comparing SBE activity and starch contents between transgenic kernels and non-transgenic kernels, respectively. P < 0.01 indicated statistically significant difference.

RESULTS Cloning and sequencing of sbe2a fragment As shown in Figure 2, specific and pure fragments of approximately 562 bp were obtained, as expected. After recycling, ligation into the vector, and transfer into E. coli, five positive colonies were obtained by screening. An insert fragment of approximately 562 bp was obtained via restriction digestion, suggesting that the target fragment had been inserted into the vector (Figure 2). The sequencing results were as follows: ATAGGCGAGA ATCCCACATC CTCGTGGACC TAATGTGTACGGTGCCATC AAACCATCCA AGGTATTATT CTATGAACAA TATCCATAAG CCAAGCTCAT GCGCTTTATC TTAGGTCCT CTGGAGTCCC CTTGGGGCAA AAAAATTCGT

CAATGATGGC ACCATGGAAG GAAACCATTC TGATGAATGA CACTAGCAAG AATAAGAGATT AAAACGGCTA AACATGGTA

7632

Afr. J. Biotechnol.

CTTTTTAATTCTTGGAAG CACCTCATCT CTGAAGTTAG CATATGTATT TATCTTTG GTTCCGGGCTAC TCATTCCAAC ATGTGATTCA TATATCCGCA GTGACTTGGG CCGCTTAGGT TGAGGGTGTT TGAATACATA TTTCTCCTCT TCAGGTGGGT CATAATATAT ACCGTTGTAT GGTATTTCAC CTGGAGCCTG CACAGAAAAC TTGATCCAGG CAGGAATGGAA TCCTTAACA CCAGATGGTGTGTCCATCCG TATCTTTACA (562 bp). Sequencing analysis showed that the interest fragment in the present paper had only one different base when compared to that reported in NCBI GenBank (U65948), that is, the homology was up to 99.8%. This implies that the cloned sequence was the same as the corn sbe2a fragment. Construcion of pRSBE2a

Figure 3. Restriction enzyme analysis of the reconstructs. M, DNA Marker DL-2,000, DL-15,000; 1, pRSBE2a/SacI+XhoI; 2, pRSBE2a/Xba I+BamH I.

Digestion produced approximate 562 bp fragments for all positive clones (Figure 3). A specific 1,110 bp fragment was produced after digestion with Xba I+Xho I to identify the interference-potent fragments (Figure 4). These results demonstrate that the interest fragments have been successfully inserted into the downstream site of 35S promoter, which was carried on plant expression vector pCAMBIA1301, namely, sbe2a-containing RNAi expression vector pRSBE2a. PCR detection of transgenic T1 plants A total of 800 seeds of T0 plants were selected and planted in the farm to grow transgenic T1 plants. The results verified total four resistant transgenic T1 plants (Tie7922-1, Tie7922-2, Tie7922-3 and Tie7922-4) and primarily demonstrated that the exogenous genes had been integrated into maize genomes. Southern blotting

Figure 4. Restriction enzyme analysis of the reconstructs. M1 and M2, DNA Marker DL-2,000, DL-15,000; 1: pRSBE2a/Xba I + Xho I.

DNA was extracted from leaves of each positive transgenic T1 plant, and digested with BamH I. As shown in Figure 5, hybrid signals appeared for each positive plant, in accordance with the results of PCR detection, whereas the signal was not present for non-transgenic plants. This result verifies that the exogenous gene was integrated into the genome of the transgenic plant and it implies that the exogenous gene may integrate one or two copies into the transgenic maize genome. RT-PCR analyses of transgenic T1 kernels

CCCAAAGCTTG CATAATAAGA GTGTTCCTGG ATTGCCATTA TCTGTACTGC ATTGTATCCAAG

The results of RT-PCR on transgenic T1 maize kernels

Guan et al.

1

2

3

4

5

7633

6

Figure 5. Southern blot of transgenic T1 plants. 1, Positive control; 2, non-transgenic plant; 3 to 6, transgenic plants (Tie7922-1, Tie7922-2, Tie7922-3 and Tie7922-4).

a

b

Figure 6. Reverse Transcript PCR analysis of transgenic T1 kernels. (a) 28 cycle reaction, (b) 30 cycle reaction. M, DNA marker DL-2,000; 1 to 4, transgenic kernels (Tie7922-1, Tie7922-2, Tie7922-3, Tie7922-4), 5, non-transgenic kernel; Sbe2a fragment, 562bp; EF-1a, 213bp.

are shown in Figure 6. The endogenous SBE mRNA content was decreased significantly in the transgenic plants, indicating the exogenous gene was transcripted normally to cause the endogenous sbe mRNA degradation. SBE activity and starch content in transgenic T1 kernels Kernels were harvested from transgenic plants (Tie79221, Tie7922-2, Tie7922-3, and Tie7922-4). The SBE activities for transgenic T1 kernels were 0.03556U, 0.04025U, 0.02231U and 0.0202U (n = 3), respectively, and 0.12721U for control (Figure 7a). SBE activities were reduced by 60.4, 55.1, 75.1 and 77.5% (average 65.3%), respectively. SBE activities in transgenic T1 kernels were significantly lower than that of the non-transgenic plant (P < 0.01 for each); suggesting that the translation of endogenous SBE mRNA was inhibited to some extent

by the RNAi vector and SBE activity was also reduced. The total starch contents of transgenic Tie7922-1, Tie7922-2, Tie7922-3, and Tie7922-4 were 670, 680, 690, and 680 mg/g DW (kernels), respectively, similar to that of control; however, the percent contents of amylose were 38.9, 35.5, 48.8, and 50.9%, respectively, higher than 27.1% for the non-transgenic plant (P < 0.01 for each; Figure 7b); the at most increase was 87.8% (50.9 vs. 27.1%) and the average growth was 60.6% (43.6 vs. 27.1%). PCR analysis of transgenic T2 plant PCR results for transgenic T2 plants are shown in Table 1. The results demonstrate that the exogenous gene was transmitted on to transgenic T2 plants, and the segregation ratio was complied with Mendel law (Chi-square = 6.37, P < 0.01).

7634

Afr. J. Biotechnol.

bb

aa

Figure 7. SBE activity and amylose contents in transgenic T1 kernels. (a) SBE activity; (b) Amylose contents. 1 to 4, Transgenic kernels (Tie7922-1, Tie7922-2, Tie7922-3, Tie7922-4); 5, non-transgenic kernel.

Table 1. PCR analysis of transgenic T2 plants.

T2 line Line 1 Line 2 Line 3 Line 4

No of seed 20 20 20 20

No路 of seedling 20 19 17 18

No路 of positive plant 15 14 13 14

SBE activity and starch content in transgenic T2 kernels In transgenic T2 plants, Tie7922-1-1, Tie7922-2-1, Tie7922-3-1, and Tie7922-4-1 plants were detected to have the down-regulated endogenous sbe mRNA, so their kernels were selected for the analyses of SBE activity and starch content. The SBE activities for transgenic T2 kernels were 0.03855U, 0.04106U, 0.02354U, and 0.02015U (n = 3), respectively, and 0.09152U for the non-transgenic plant (Figure 8a); the SBE activities were reduced by 57.8, 55.1, 74.3, and 77.9%, respectively, when compared to that of the non-transgenic plant (P < 0.01 for each). The total starch contents of transgenic T2 kernels were 680, 680, 670, and 690 mg/g DW (kernels), respectively, similar to that of blank control; however, the percent contents of amylose were 36.9, 34.8, 48.5, and 51.5%, respectively, significantly higher than 27.5% for the nontransgenic plant (P < 0.01 for each; Figure 8b); the maximum increase was 87.2% (51.5 vs. 27.5%) and the average increase was 56.1% (42.9 vs. 27.5%).

No路 of negative plant 5 5 4 4

Positive/negative 3:1 2.8:1 3.2:1 3.5:1

DISCUSSION In the present paper, sbe2a gene was cloned and the corresponding RNAi vector was constructed. Using pollen tube pathway transformation, the RNAi vector was successfully imported into maize inbred lines. Stoutjesdijk et al. (2002) achieved the suppression of FAD2 gene in Arabidopsis by using RNAi technology, and this depression effect could be transmitted to the offspring. This finding reveals the potential of RNAi technology to apply in crop seed quality and properties improvement for the first time. Andika et al. (2005) used RT-PCR to clone rape PEP gene fragment and construct RNAi vector of PEPase gene to suppress PEPase gene expression in rape, making the metabolic flux deflect towards oil synthesis, consequently increasing oil content in rapeseed. Generally, RNAi as a focus issue in molecular biology and genetic engineering opens up a new approach in fundamental and applied research. The results in the present paper have shown that SBE activity was significantly decreased (by an averaged 65.3 and 65.3%, respectively) in transgenic T1 and T2 kernels

Guan et al.

a

7635

b

Figure 8. SBE activity and amylose contents in transgenic T2 kernels. (a) SBE activity; (b) amylose contents. 1 to 4, Transgenic kernels (Tie7922-1-1, Tie7922-2-1, Tie7922-3-1, Tie7922-4-1); 5, non-transgenic kernel.

when compared to the non-transgenic plant, suggesting that the translation of endogenous Sbe2a mRNA was inhibited by RNAi expression vector effectively. Meanwhile, the content of amylose was significantly increased (by an averaged 60.6 and 56.1%; 87.8% at most) in transgenic T1 and T2 kernels under the condition of the total starch content. These findings indicate that RNAi technology can effectively regulate the corn starch synthesis. It inhibits the synthesis of amylopectin and greatly enhances the amylose content in order to produce high-amylose maize inbred lines and provide a new way to improve corn high amylose. Breeding of high-amylose

maize hybrid is in progress for the further studies. Conclusion In the present study, a portion of sbe2a gene fragments were forward and inversely inserted into plant expression vector and an RNAi vector for sbe2a was successfully constructed. As these reconstructs were successfully introduced into maize inbred lines by pollen tube pathway transformation, gene expression was suppressed by dsRNA that was formed by sense and antisense RNA annealing; thereby leading to the

specific posttranscriptional degradation of homologous mRNA and leading to efficient and specific sbe2a gene repression. RNAi as an efficient means for gene silencing can regulate the metabolic pathway of corn starch and inhibit target gene expression. By inhibiting sbe2a gene expression, the RNAi vector can effectively reduce SBE activity to improve the corn amylose content. ACKNOWLEDGEMENTS This

study is funded by National Transgenic

7636

Afr. J. Biotechnol.

Special Project (No. 20082x08003-005); Jilin Provincial Division of Finance Project (No. 200806); Provincial Division of Science and Technology Project (No. 20095044). REFERENCES Andika IB, Kondo H, Tamada T(2005). Evidence that RNA silencingmediated resistance to Beet necrotic yellow vein virus is less effective in roots than in leaves. Mol. Plant Microbe In. 18: 194-204. Blauth SL, Yao Y, Klucinec JD, Shannon JC, Thompson DB, Guilitinan MJ (2001). Identification of Mutator Insertional Mutants of StarchBranching Enzyme 2a in Corn. Plant Physiol. 125: 1396-1405 Casey J, Slattery I, Kavakli H, Okita TW (2000). Engineering starch for increased quantity and quality. Trends Plant Sci. 5: 291-298. Denver K, Johnson P, Samuel Z, Alison MS (2001). The control of amylose synthesis. Plant Physiol. 158: 479-487. Yandeau-Nelson M, Laurens L, Shi Z, Xia H, Smith AM, Guiltinan M (2011). Starch Branching Enzyme IIa is required for proper diurnal cycling of starch in leaves of Zea mays. Plant Physiol. 156: 479-490 Kirchberger S, Leroch M, Huynen MA, Wahl M, Neuhaus HE, Tjaden J (2007). Molecular and biochemical analysis of the plastidic ADPglucose transporter (ZmBT1) from Zea mays. J. Biol. Chem. 282: 22481-22491 Koga A, Ishibashi T, Kimura S, Uchiyama Y, Sakaguchi K (2006). Characterization of T-DNA insertion mutants and RNAi silenced plants of Arabidopsis thaliana UV-damaged DNA binding protein 2 (AtUV-DDB2). Plant Mol Biol. 61(1-2): 227-240. Nunes AC, Vianna GR, Cuneo F, Amaya-Farfn J, deCapadeville G, Rech EL, Aragรกo FJ (2006). RNAi-mediated silencing of the myoinosit-1-phosphate synthase gene (GmMIPS1) in transgenic soybean inhibited seed development and reducedphytate content. Planta, 224: 125-132.

Qiao F, Yang Q, Wang CL, Fan YL, Wu XF, Zhao KJ (2007). Modification of plant height via RNAi suppression of OsGA20ox2 gene in rice. Euphytica, 158(1-2): 35-45 Schweizer P, Pokorny J, Schulze-Lefert P, Dudler R (2000). Doublestranded RNA interferes with gene function at the single-cell revel in cereals. Plant J. 24: 895-903 Sestili F, Janni M, Doherty A, Botticella E, D'Ovidio R, Masci S, Jones HD, Lafiandra D (2010). Increasing the amylose content of durum wheat through silencing of the SBEIIa genes. BMC Plant Biol. 10: p. 144. Smith AM, Denver K, Martin C (1997). The synthesis of the starch granule. An. Rev. Plant Physiol. Plant Mol. Biol. 48: 67-87 Stoutjesdijk PA, Singh SP, Liu Q, Hurlstone CJ, Waterhouse PA, Green AG (2002). hpRNA-mediated targeting of the Arabidopsis FAD2 gene gives highly efficient and stable silencing. Plant Physiol. 129: 17231731 Sunikumar G, Campbell LM, Puckhaber L, Stipanovic RD, Rathore KS(2006). Engineering cotton seed for use in human nutrition by tissue-specific reduction of toxic gossypol. Proc. Nat. Acad. Sci. USA. 103: 18054-18059. Visser RGF, Jacobsen E (1993). Towards modifying plants for altered starch content and composition. Trends Biotechnol. 11: 63-68

African Journal of Biotechnology Vol. 11(30), pp. 7637-7642, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3862 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Common vetch-wheat intercropping: Haylage yield and quality depending on sowing rates Karagic Dura*, Mikic Aleksandar, Milosevic Branko, Vasiljevic Sanja and Dusanic Nenad Institute of Field and Vegetable Crops, Maksima Gorkog 30, 21000 Novi Sad, Serbia. Accepted 17 February, 2012

The winter-sowing genotypes of common vetch (Vicia sativa L.) are very susceptible to lodging and therefore are sown in mixtures with small grains that serve as supporting crops. In order to determine an optimum ratio of vetch and wheat (Triticum aestivum L.) components in their mixture, a four-year trial (autumn 2005 to spring 2009) was carried out, aiming at the yield and quality of winter vetch haylage. The sowing rate of winter vetch was 120 kg ha-1, while the sowing rate of winter wheat was 0, 15, 20, 25 and 30 kg ha-1. An increased proportion of the cereal in its mixture with vetch significantly decreased the stand lodging, have a positive influence on forage yield, but haylage quality is of a poorer quality. Quality characteristics such as crude protein and lignin content, total digestible nutrients, dry matter intake and relative feed value were highest in monoculture common vetch followed by mixture with the lowest rate of wheat. Neutral detergent fiber content was positively affected by intercropping. There were no significant differences among treatments for acid detergent fiber content, digestible dry matter and net energy for lactation. The most favorable balance between the haylage yield and quality, as well as the highest crude protein yield (1482 kg ha-1), was achieved with the mixture of 120 kg ha-1 of the vetch seed and 15 kg ha-1 of wheat. Key words: Common vetch, crude protein, forage quality, haylage, mixture, nutritive value. INTRODUCTION Winter form of common vetch (Vicia sativa L.), is an annual legume crop rich in protein that is traditionally used in the regions of South east Europe as high quality roughage, that is, green forage or hay. Recently, it was increasingly used in the form of haylage, due to numerous advantages of conservation it has (Seven and Cerci, 2006). Also, the enhanced quality of the conserved forage allowed a greater milk yield and a reduction in the winter feeding costs. Carefully managing the haylage during storage prevented the risk of clostridial or other bacterial contamination in the milk and produced cheeses (Borreani et al., 2007). However, vetch has a vine growing habit and if sown as monocrop, it lodges heavily (Caballero et al., 1995). As a result, forage yield and quality start to decrease due to the decomposition of herbage

*Corresponding author. E-mail: djura.karagic@ifvcns.ns.ac.rs. Tel: +381 64 8205 745. Fax: +381 21 4898 373.

(Gulcan et al., 1988; Aydin and Tosun, 1991;). Due to this, it is sown with winter-sown small grains, such as oats (Avena sativa L.), wheat (Triticum aestivum L.), barley (Hordeum vulgare L.) and triticale (x Triticosecale Wittmack).In mixtures, companion cereals provide structural support for common vetch growth, improve light interception and facilitate mechanical harvest, whereas common vetch in mixtures improves the quality of forage (Roberts et al., 1989; Caballero et al., 1995; Lithourgidis et al., 2006). So far, there has been no report on what cereal is the best companion crop for vetch (Caballero and Goicoechea, 1986; Thompson et al., 1992). Roberts et al. (1989) reported that the most suitable cereal for mixtures with common vetch is wheat. Due to a problematic response to low temperatures in oats in Serbia, it was wheat that was most often used as a companion crop for winter vetch. Although numerous studies have examined the effects of varying seeding ratios (Aydogdu and Acikgoz, 1995; Tukel et al., 1997; Karadag and Buyukburc, 2003; Lithourgidis et al., 2006; Tuna and Orak, 2007; Kokten

7638

Afr. J. Biotechnol.

et al., 2009), the optimum seeding rates for these combinations are not well-defined. The conclusions these authors have drawn are highly influenced by the climatic conditions on which their testing was carried out. Common vetch produces low yields, particularly in areas with low rainfall (Hadjichristodoulou, 1978) and seriously hinders harvest because of lodging in areas with high rainfall (Robinson, 1969; Caballero et al., 1995). For the prevailing agro-ecological conditions of Serbia, Miskovic (1986) recommends that the sowing rates are 150 kg ha-1 for common vetch and 30 to 35 kg ha-1 for cereals. However, it has been demonstrated that these sowing rates are too high for the contemporary agriculture. By this reason, the objective of this study was to compare the haylage yield and quality of mixed stands of vetch and wheat obtained when several seeding rates of wheat were combined with constant seeding ratio of vetch.

Quality measurements The cut and dried biomass was placed in a silo trench without inoculants. After 60 days of fermenting (Van Ranst et al., 2009), the haylage samples of 400 g each were taken, with an analysis of the basic quality parameters. Total N was determined using the Kjeldahl method and crude protein (CP) was calculated by multiplying the N content by 6.25 (AOAC, 1980). Neutral and acid detergent fiber (NDF and ADF) and acid detergent lignin (ADL) were determined using the procedure by Goering and van Soest (1970). Total digestible nutrients (TDN), digestible dry matter (DDM), dry matter intake (DMI), relative feed value (RFV) and net energy for lactation (NEL) were estimated according to the following equations adapted from Horrocks and Vallentine (1999): TDN = 73.5 + 0.62(%CP) – 0.71 (%ADF) DDM (%) = 88.9 – (%ADF x 0.779) DMI (%DM) = 120: %NDF RFV = (%DDM x %DMI) : 1.29

MATERIALS AND METHODS

NEL = (1.044-(0.0119 x %ADF)) x 2.205

Field experiment Data analysis A field experiment was conducted during four growing seasons (2005/06, 2006/07, 2007/08 and 2008/09) at the experimental field of the Institute of Field and Vegetable Crops, Novi Sad, in northern Serbia (45°20’N, 19°51’E). The area has a continental semiarid to semi humid climate, the long-term average temperature from October to May is 6.87°C, and sum of precipitation is 359.6 mm. The experiment was established in a loamy soil with pH 7.2, and organic matter content of 2.82%, N-NO3 17.2 mg kg-1, P2O5 20.7 mg kg-1 and K2O 29.1 mg kg-1 (0 to 30 cm depth). Nitrogen and P2 O5 at 15 and 78 kg ha-1, respectively, were incorporated as monoammonium phosphate (10–52–0) into the soil before ploughing. In all the years, the previous crop was oilseed rape, with harvest residues chopped and incorporated into the soil. The experimental design was a randomized complete block with five treatments (vetch monoculture and four mixtures of common vetch with wheat) replicated four times. The sowing rate of vetch in all treatments was 120 kg ha-1, while the sowing rates of wheat were 0 kg ha-1 (SRW 0), 15 kg ha-1 (SRW 15), 20 kg ha-1 (SRW 20), 25 kg ha-1 (SRW 25) and 30 kg ha-1 (SRW 30). The plot size was 60 m2 (5 x 12 m) and the treatments were separated by a 2 m buffer zone. The seeds of vetch and wheat were mixed before the sowing which was done in the first day of October in all four years, using Amazone AD 253 Special seed drill made in Germany and with 12.5 cm between rows traditionally practiced in Serbia (Miskovic, 1986; Mihailovic et al., 2006). Mean seed weights were 50.2 and 39.8 g per 1000 seeds for common vetch and wheat, respectively. Usual modern agronomic practices of vetch production were applied.

Yield measurements The cutting and chopping of the forage were done by hand with a scythe in the stage of first pods forming (the last day of May) and on the area of 10 m2 in the middle of each plot. The cut biomass was dried in situ until it had a moisture content of 55% (Plue and Haley, 1988; Dordevic and Dinic, 2003; Cavallarin et al., 2005), when the haylage yield was measured. Samples of 1 kg biomass from each plot were dried at 65°C for 72 h in order to determine the dry matter content.

The results were processed by the analysis of variance (ANOVA). The treatment mean differences were separated by the least significant difference (LSD) test at the 0.05 probability level. For the entire statistical analysis, the MSTAT-C software was used (MSTAT-C 1988). Due to the fact that the analyses of variance for haylage yield and quality indicated no treatment x experimental time interaction, the values are reported as means of the four growing seasons.

RESULTS The influence of the wheat sowing rate on the vetch haylage yield was significant (Table 1). The highest vetch haylage yield (18938 kg ha-1) was achieved in the treatment with the highest wheat sowing rate. By decreasing the wheat sowing rate, the haylage yield was also decreased, that is, from 9.4% in SRW 25 to 35.4% in the vetch monocrop. There were no significant differences in the vetch haylage yield between the treatments SRW 15 and SRW 20. An identical trend, to that of haylage yield was observed for the dry matter yield (Table 1). The influence of the wheat sowing rate on the vetch proportion in the total yield was significant for all treatments (Table 1). The highest CP content was in the vetch monocrop (251.8 g kg-1 DM) with the lowest wheat sowing rate (223.1 g kg-1 DM), with no significant differences between these two treatments (Table 2). With a further increase of the wheat sowing rate, there was a significantly lower CP content in dry matter. The decrease of the CP content varied from 30.8% with SRW 20 to 59.0% with SRW 30. The influence of the wheat sowing rate on CP yield was significant in all treatments. The highest yield was -1 achieved with SRW 15 (1482 kg ha ). The decrease of CP

Dura et al.

7639

Table 1. Haylage yield, dry matter yield and vetch contribution of monoculture and mixtures of common vetch with wheat*.

Treatment SRW0 SRW15 SRW20 SRW25 SRW30 Average LSD 0.05

-1

Haylage yield (kg ha )

-1

Dry matter yield (kg ha )

d

d

12240 c 14970 15366c 17151b 18938a 15733 1378

5430 c 6641 6816c 7718b 8400a 7001 623

Vetch proportion in the total yield (%) a 100.00 b 80.66 74.27c 62.91d 56.12e 74.79 3.73

*Values within the columns followed by the same letter do not differ significantly at the 0.05 level of probability according to least significant difference (LSD) test.

Table 2. Crude protein (CP) content, crude protein yield, neutral acid detergent fiber (NDF), acid detergent fiber (ADF) and acid detergent lignin (ADL) in haylage of monoculture and mixtures of common vetch with wheat*.

Treatment SRW0 SRW15 SRW20 SRW25 SRW30 Average LSD 0.05

CP (g kg-1 DM) 251.8a 223.1a b 174.3 123.4c 103.2d 175.2 13.8

CP yield (kg ha-1) 1367b 1482a c 1188 d 952 867e 1171 69

NDF (g kg-1 DM) 421.2d 448.4cd c 466.9 521.3b 564.7a 484.5 37.5

ADF (g kg-1 DM) 356.3a 362.0a a 371.9 355.4a 352.1a 359.5 25.6

ADL (g kg-1 DM) 98.9a 93.3ab b 89.2 64.6c 61.7c 81.5 9.3

*Values within columns followed by the same letter do not differ significantly at the 0.05 level of probability according to least significant difference (LSD) test.

yield ranged between 7.8% in the vetch monocrop to 41.5% in the treatment with the highest wheat sowing rate. The highest NDF content (564.7 g kg-1 DM) was in the treatment with the highest wheat sowing rate (Table 2). The decrease of the wheat sowing rate caused the decrease of NDF content, from 7.7% with SRW 25 to 25.4% in the vetch monocrop. At the same time, there were significant differences in NDF content either between the treatments SRW 20 and SRW 15, or between the treatments SRW 15 and SRW 0. The average ADF content -1 in the vetch haylage was 359.5 g kg DM, with no significant differences between the treatments. The lignin content was highest in the vetch monocrop (98.9 g kg-1 DM). The increase in the wheat sowing rate above 20 kg ha-1 caused a significant decrease in the lignin content, from 9.2 to 37.6% (Table 2). The highest TDN was determined in the vetch monocrop (Table 3). There were no significant differences in the TDN content between the treatments SRW 0 and SRW 15. The increase of the wheat sowing rate above 15 kg ha-1 caused a significant decrease of the TDN content

in haylage, from 9.3 to 14.0%, in comparison with SRW 0. The average DDM was 608.9 g kg-1 DM, with no significant differences between the treatments (Table 3). The highest DMI was in the vetch monocrop and the lowest wheat sowing rate, 28.5 and 26.8 g kg-1 of BW, respectively. In comparison with the vetch monocrop, the values of the other treatments were significantly lower, from 9.8 to 25.3% (Table 3). The highest RFV was determined in the vetch monocrop and the lowest wheat sowing rate, 135.04 and 126.07%, respectively. In comparison with the vetch monocrop, the values of the other treatments were significantly lower. The average NEL was 1.359 Mcal kg-1 without significant differences between the treatments (Table 3). DISCUSSION The increase of the cereal in its mixture with vetch significantly increased the yields of both haylage and DM, which agrees with the results of Roberts et al. (1989) who found that DM decreased with increasing common vetch

7640

Afr. J. Biotechnol.

Table 3. Total digestible nutrients (TDN), digestible dry matter (DDM), dry matter intake (DMI), relative feed value (RFV) and net energy for lactation (NEL) of the haylage of monoculture and mixtures of common vetch with wheat*.

Treatment SRW 0 SRW 15 SRW 20 SRW 25 SRW 30 Average LSD 0.05

TDN -1 (g kg DM) a 638.1 ab 616.3 bc 579.0 559.2c c 549.0 588.3 43.7

DDM -1 (g kg DM) a 611.4 a 607.0 a 599.3 612.1a a 614.7 608.9 38.6

DMI -1 (g kg of body weight) a 28.5 ab 26.8 b 25.7 23.0c c 21.3 25.0 1.7

RFV (%) a 135.04 ab 126.07 b 119.37 109.11c c 101.47 118.21 9.31

NEL -1 (Mcal kg ) a 1.367 a 1.352 a 1.326 1.369a a 1.378 1.359 0.114

*Values within columns followed by the same letter do not differ significantly at the 0.05 level of probability according to least significant difference (LSD) test.

ratios in mixtures with wheat. Caballero et al. (1995) determined that the mixtures produced 34% more dry matter than monocrop of vetch, but 57% less than oat monocrop. Unlike our results, Kokten et al. (2009) determined the lowest DM yield in the mixture of 20% vetch and 80% triticale and the highest DM yield in the mixture of 80% vetch and 20% triticale. Vetch monocrop had the highest crude protein content. In all mixtures, the CP content decreased as cereal proportion increased, which responds with the results of numerous authors (Roberts et al., 1989; Caballero et al., 1995; Balabanli and Turk, 2006; Lithourgidis et al., 2006; Kokten et al., 2009). Karadag and Buyukburc (2003) determined that the CP content was 19.22% in a vetch monocrop and 9.77% in an oat monocrop. However, CP yield is one of the most important criteria for forage evaluation. Although the mixture of vetch and wheat (SRW 15) had lower CP content than monocrop of vetch, it gave the highest CP yield than all crops because of its higher haylage yield (Tables 1 and 2). Similarly, Lithourgidis et al. (2006) showed that the highest CP yield was in the mixture of common vetch–oat (1100 kg ha-1) followed by monoculture common vetch (1000 kg ha-1). According to Lauk and Lauk (2006), the extra gains in protein yield obtained from mixed crops as compared to wheat monocultures were 100 to 500 kg ha-1. Unlike our results, Tuna and Orak (2007) recommended the mixture of 25% vetch and 75% oat, on the basis of solely -1 DM yield (6.5 t ha ). In addition, Tukel et al. (1997) determined the lowest CP yield (0.54 t ha-1) in pure vetch sowing and the highest CP yield (0.98 t ha-1) in a triticale monocrop. The lowest NDF concentration was in vetch monocrop and the increase of the wheat sowing rate caused increase of NDF content, which is in agreement with most studies (Caballero et al., 1995; Castro et al., 2000; Assefa and Ledin, 2001). However, Lithourgidis et al. (2006) showed that the monoculture of common vetch had higher NDF concentration. This can be attributed to the different cultivar used in this study and possibly to the different growth stage of common vetch at harvest as compared with the other studies. After testing the wheat

monocrop silage quality, Siefers and Bolsen (1997) determined a relatively low forage quality as evidenced by high NDF and ADF percentages (higher than 60% NDF and 40% ADF contents). In the case of ADF, much smaller differences were observed. The actual values for ADF found in this study and the lack of significant differences agree with other studies (Caballero et al., 1995; Castro et al., 2000; Lithourgidis et al., 2006). The increase in wheat sowing rate decreased the lignin content and increased the NDF content in DM (Table 2). This may be explained by significant differences between chemical composition in wheat and vetch dry matter. According to Lopez et al. (2005), the wheat DM has NDF content higher for 25% and lignin content lower for 96% in comparison with the vetch DM. The results obtained respond with those from other studies (Caballero et al., 1995, 2001; Rebole et al., 2004; Lithourgidis et al., 2006). The vetch monocrop and SRW 15 had higher TDN than all other mixtures (Table 3). Similar values and trends were reported by others where legumes included in the intercropping system significantly increased the TDN (Osman and Nersoyan, 1986; Roberts et al., 1989). Having tested the ruminal degradability of DM and CP, Mahida et al. (2000), concluded that the vetch proportion in hay was positively correlated with effective degradability (ED) of DM and ED of CP. However, Lithourgidis et al. (2006) showed that triticale and oat monocultures had higher TDN than monoculture common vetch, and TDN decreased as the common vetch seeding proportion increased in the mixtures. The differences in this research were as a result of various methods used to determine TDN. A similar trend was observed for the DMI and RFV. The RFV was much higher in vetch monocrop and SRW 15 than in other mixtures, which is consistent with results of Hackman et al. (2008). According to Dunham (1998), the best use of RFV is for selecting forages to be used in rations which require high nutrient density such as high producing dairy cows. Using alfalfa with a RFV less than 140 should not be considered for early lactation

Dura et al.

cows. However, alfalfa with a RFV of 125 to 140 could be fed to dairy cows in late lactation. Lower RFV alfalfa could be adequate for growing heifers. The different content of common vetch did not affect DDM and NEL as there were no significant differences among treatments, which is in agreement with results of Lithourgidis et al. (2006). Conclusion For forage crops, it is important to produce greater forage yields per hectare, higher nutritional quality (percentage composition of selected nutrients) or combined nutrient yields. On the basis of the results obtained from this research, it can be concluded that the most favorable balance between haylage yield and quality, as well as the highest CP yield (1482 kg ha-1), was achieved by sowing the mixture of 120 kg ha-1 of vetch and 15 kg ha-1 of wheat, thus recommending this combination to the farmers for the agro-ecological conditions of South east Europe. ACKNOWLEDGEMENT This research was supported by Ministry of Science, Technology and Development of the Republic of Serbia (Project No. TR 31024). REFERENCES AOAC (1980). Official Methods of Analysis. Association of Official Analytical Chemists, Washington. Assefa G, Ledin I (2001). Effect of variety, soil type and fertilizer on the establishment, growth, forage yield, quality and voluntary intake by cattle of oats and vetches cultivated in pure stands and mixtures. Anim. Feed Sci. Technol. 92: 95-111. Aydin I, Tosun F (1991). The effect of the ratios of common vetch and cereals in the mixtures upon the yields of hay and crude protein and crude protein ratio under the ecological conditions of Samsun-Turkey. In: Proceedings of the 2nd National Congress of Grassland and Forage Crops in Turkey. Izmir, pp. 332-341. Aydogdu L, Acikgoz E (1995). Effect of seeding rate on seed and hay yield in common vetch (Vicia sativa L.), J. Agron. Crop Sci. 174: 181187. Balabanli C, Turk M (2006). The effects of different harvesting periods in some forage crops mixture on herbage yield and quality. J. Biol. Sci. 6(2): 265-268. Borreani G, Giaccone D, Mimosi A, Tabacco E (2007). Comparison of hay and haylage from permanent Alpine meadows in winter dairy cow diets. J. Dairy Sci. 90: 5643-5650. Caballero R, Goicoechea EL (1986). Utilization of winter cereals as companion crops for common vetch and hairy vetch. In: Proceedings of the 11th General Meeting of the European Grassland Federation. Setubal, pp. 379-384. Caballero R, Goicoechea EL, Hernaiz PJ (1995). Forage yields and quality of common vetch and oat sown at varying seeding ratios and seeding rates of common vetch. Field Crop Res. 41: 135-140. Caballero R, Alzueta C, Ortiz LT, Rodrique ML, Baro C, Rebole A (2001). Carbohydrate and protein fractions of fresh and dried common vetch at three maturity stages, Agron. J. 93: 1006-1013.

7641

Castro MP, Pineiro J, Sau F (2000). Effect of seeding rates of oats, wheat and common vetch on the yield, botanic composition and nutritive value of the mixture. In: Legumes for Mediterranean forage crops, pastures and alternative uses (Ed. Sulas L). CIHEAM-IAMZ, Zaragoza, pp. 207-211. Cavallarin L, Antoniazzi S, Borreani G, Tabacco E (2005). Effects of wilting and mechanical conditioning on proteolysis in sainfoin (Onobrychis vicifolia Scop) wilted herbage and silage. J. Sci. Food Agric. 85: 831-838. Dordevic N, Dinic B (2003). Siliranje leguminoza. Institut za istrazivanja u poljoprivredi Srbija, Belgrade. Dunham JR (1998). Relative feed value measures forage quality. Forage Facts 41: p. 3. Goering HK, van Soest PJ (1970). Forage fiber analysis. In: Agricultural handbook No. 37. USDA, Washington. Gulcan H, Saglamtimur T, Anlarsal AE, Tansi V (1988). Research on hay yield of different vetch + oat mixture ratios and seeding times under Cukurova conditions. Agric. Fac. Cukurova Univ. Publ. Adana, 3: 108-118. Hackman TJ, Sampson JD, Spain JN (2008). Comparing relative feed value with degradation parameters of grass and legume forages. J. Anim. Sci. 86: 2344-2356. Hadjichristodoulou A (1978). Genotype, environment and rainfall effects on common vetch varieties in a semiarid region. Exp. Agric. 14: 8187. Horrocks RD, Vallentine JF (1999). Harvested Forages. Academic Press, London, UK. Karadag Y, Buyukburc U (2003). Effects of seed rates on forage production, seed yield and hay quality of annual legume-barley mixtures. Turk. J. Agric. For. 27: 169-174. Kokten K, Toklu F, Atıs I, Hatipoglu R (2009). Effects of seeding rate of forage yield and quality of Vetch (Vicia sativa L.)-Triticale (Triticosecale Wittm.) mixtures under East Mediterranean rainfed conditions. Afr. J. Biotechnol. 8(20): 5367-5372. Lauk R, Lauk E (2006). Yields in vetch-wheat mixed crops and sole crops of wheat. Agron. Res. 4: 37-44. Lithourgidis AS, Vasilakoglou IB, Dhima KV, Dordas CA, Yiakoulaki MD (2006). Forage yield and quality of common vetch mixtures with oat and triticale in two seeding ratios. Field Crop Res. 99: 106-113. Lopez S, Davies DR, Giraldez FJ, Dhanoa MS, Dijkstra J, France J (2005). Assessment of nutritive value of cereal and legume straws based on chemical composition and in vitro digestibility. J. Sci. Food Agric. 85: 1550-1557. Mahida HA, Gonzales J, Caballero R, Alvir MR (2000). Nutritive value of on-farm common vetch-oat hay, II. Ruminal degradability of dry matter and crude protein, Anim. Res. 49: 391-398. Mihailovic V, Mikic A, Cupina B, Katic S, Karagic D, Pataki I, Eric P (2006). Yield and forage yield components in winter vetch cultivars. Grassl. Sci. Eur. 11: 255-257. Miskovic B (1986). Krmno bilje. Naučna knjiga, Belgrade. MSTAT-C (1988). A Microcomputer Program for Design, Management, and Analysis of Agronomic Research Experiments. Crop and Soil Sciences Department, Michigan State University, East Lansing. Osman AE, Nersoyan N (1986). Effect of the proportion of species on the yield and quality of forage mixtures, and on the yield of barley in the following year. Exp. Agric. 22: 345-351. Plue PS, Haley D (1988). Harvesting and storing big bale haylage. OMARFA Factsheet, 88-094. Rebole A, Alzueta C, Ortiz LT, Barro C, Rodriguez ML, Caballero R (2004). Yields and chemical composition of different parts of the common vetch at flowering and at two seed filling stages. Span. J. Agric. Res. 2(4): 550-557. Roberts CA, Moore KJ, Johnson KD (1989). Forage quality and yield of wheat-common vetch at different stages of maturity and common vetch seeding rate. Agron. J. 81: 57-60. Robinson RC (1969). Annual legume: cereal mixtures for forage and seed. Agron. J. 61: 759-761. Seven PT, Cerci IH (2006). The effects on nutrient digestibility of hay and silages made in different conditions in lambs, Vet. Arch. 76(2): 111-117. Siefers MK, Bolsen KK (1997). Agronomic and silage quality traits of winter cereals. In: Proceedings of the XVIII International Grassland

7642

Afr. J. Biotechnol.

Congress. Winnipeg, pp. 91-92. Thompson DJ, Stout DG, Moore T (1992). Forage production by four annual cropping sequences emphasizing barley irrigation in southern interior British Columbia. Can. J. Plant Sci. 72: 181-185. Tukel T, Hasar E, Hatipoglu R (1997). Effect of mixture rates and cutting dates on the forage yield and quality of vetch-triticale mixtures and their seed yields under lowland conditions of Cukurova. In: Proceedings of the XVIII International Grassland Congress. Winnipeg, pp. 25-26.

Tuna C, Orak A (2007). The role of intercropping on yield potential of common vetch (Vicia sativa L.)/oat (Avena sativa L.) cultivated in pure stand and mixtures. J. Agric. Biol. Sci. 2(2): 14-19. Van Ranst G, Fievez V, De Riek J, Van Bockstaele E (2009). Influence of ensiling forages at different dry matters and silage additives on lipid metabolism and fatty acid composition. Anim. Feed Sci. Technol. 150: 62-74.

African Journal of Biotechnology Vol. 11(30), pp. 7643-7649, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3879 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Physiology of seed yield in soybean: Growth and dry matter production M. A. Malek*1, 2, M. M. A. Mondal1, M. R. Ismail2, M. Y. Rafii2 and Z. Berahim2 1Bangladesh Institute of Nuclear Agriculture, Bangladesh Agricultural University Campus, Mymensingh- 2202, Bangladesh. 2Institute of Tropical Agriculture, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor, Malaysia. Accepted 27 February, 2012

A field study was conducted to assess the growth parameters controlling the dry matter and seed yield of soybean. The result shows that growth rate was slow during vegetative phase in all genotypes. A relatively smaller portion of total dry mass (TDM) was produced before flower initiation and the bulk of it after anthesis. Maximum absolute growth rate (AGR) was observed during pod filling stage in all genotypes due to maximum leaf area (LA) development and leaf area index (LAI) at this stage. Plant characters like LAI and AGR contributed to higher TDM production. Results indicate that a high yielding soybean genotype should possess larger LAI, higher TDM production ability and higher AGR at all growth stages. Key words: Soybean seed yield, total dry mass (TDM), leaf area index (LAI), absolute growth rate (AGR), relative growth rate (RGR). INTRODUCTION Soybean (Glycine max (L.) Merr.), one of nature’s most versatile crops, is increasingly becoming an important food and cash crop in the tropics due to its high protein content (40%), high oil content (20%) and adaptability to various growing environments (Smith et al., 1995; Tukamuhabwa et al., 2001; FAO, 2004; McKevith, 2005). The crop has a variety of uses including for human food, livestock feed, vegetable oil, and many industrial products and is a major crop in several developing and developed countries (McKevith, 2005). It ranks 4th in acreage and production among the oilseed crops grown in Bangladesh (MOA, 2010). Oilseed crops cover an area of about 569,000 ha, where soybean occupies only 55,000 ha in Bangladesh (MOA, 2010). Oilseed crops cover an area of about 569,000 hectares, where soybean occupies only 55,000 hectares in Bangladesh (MOA,

*Corresponding author. E-mail: mamalekbina@yahoo.com. Tel: +603-8946 8967. Fax: +603-8946 8968. Abbreviations: TDM, Total dry mass; AGR, absolute growth rate; LA, leaf area; LAI, leaf area index.

2010). Despite suitable climatic and edaphic conditions, the yield of soybean is very low in Bangladesh. The average yield of soybean in the world is about 3.0 t ha-1, while that in Bangladesh is only 1.64 t ha-1 (SAIC, 2007). There are many factors responsible for its lower acreage and yield but the most important one is the nonavailability of high yielding varieties. In spite of the best efforts to improve the soybean varieties, the yield of this crop remains low. Several studies have been made to understand their performances which mainly include the contribution of various yield components towards yield (Das et al., 1992; Mehta et al., 2000; Chettri, 2003; Jian et al., 2007). The yield components depend on some physiological traits. To understand the physiological basis of yield difference among the genotypes of soybean, it is essential to quantify the components of growth, and the relevant variables, which is useful in crop improvement. Variation in dry matter accumulation and pod production in different genotypes may be related to some factors such as leaf area (LA), crop growth rate (CGR), net assimilation rate (NAR) and relative growth rate (RGR). Pandey et al. (1978) analyzed growth parameters of five varieties of

7644

Afr. J. Biotechnol.

Table 1. Average monthly rainfall, air temperature and relative humidity during the experimental period from January to April 2009 at the experimental area, Mymensingh, Bangladesh.

Month January February March April

Monthly average air temperature (°C) Maximum Minimum Average 23.43 12.93 18.18 27.34 16.41 21.87 29.61 20.57 25.09 30.56 22.14 26.35

blackgram in order to study the physiological causes of yield differences and observed the differences in CGR, NAR, RGR and LA among the varieties. Egli and Zhenwen, (1991) suggested that seeds per unit area were related to canopy photosynthesis during flowering and pod set and canopy photosynthesis rate is determined through LAI and CGR. A plant with optimum LAI and NAR may have higher biological yield as well as seed yield (Mondal et al., 2007). The dry matter accumulation may be the highest if LAI reaches its maximum value within the shortest possible time (Khan and Khalil, 2010). Not only TDM production, but also the capacity of efficient partitioning between the vegetative and reproductive parts may produce high economic yield (Shiraiwa et al., 2004; Oh et al., 2007). A better understanding of crop growth and yield parameters and the partitioning of assimilates into seed would help to expedite yield improvement of field crops. Very little work has been done in this regard in soybean in tropic areas. A detailed analysis of growth and yield parameters of five soybean genotypes was therefore undertaken. MATERIALS AND METHODS Experiment was carried out at the experimental field of Bangladesh Agricultural University (BAU), Mymensingh (24°8´ N 90°0´ E), Bangladesh in Rabi (January - April) season of 2009. Weather data (monthly average temperature, rainfall and relative humidity) during the experimental period was recorded (Table 1). With five soybean genotypes, three advanced lines (BAU-21, BAU-70 and BAU-80) and two widely cultivated varieties of Bangladesh (Shohag and BARIsoybean-5), were used as planting materials. The soil of the experimental field was silty loam having a total of 0.07% nitrogen, 1.13% organic matter, 18.60 mg kg-1 available phosphorus, 105.57 mg kg-1 exchangeable potassium, 18 ppm sulphur and 6.8 pH. Seeds were sown on 3 January 2009. A randomized complete block design with three replicates was followed. The plot size was 4 m × 3 m. Row to row and plant to plant distances were 30 and 10 cm, respectively. Seeds were sown in line and thinned to a density of 30 to 35 plants m-2 two weeks after germination. Urea, triple superphosphate, muriate of potash and gypsum were used as a source of nitrogen, phosphorus, potassium and sulphur at the rate of 40, 120, 80 and 30 kg ha-1, respectively at the time of final land preparation. No biofertilizer was applied in the experiment because farmers do not use biofertilizer for soybean cultivation in Bangladesh. First weeding was done followed by thinning at about 21 days after sowing (DAS). A single irrigation was applied at 25 DAS. Insecticide (Ripcord 50 EC @ 0.025%) was sprayed at flowering and fruiting stages to control shoot and pod borer.

Average rainfall (mm) 00.0 26.6 63.6 96.6

Average relative humidity (%) 78.0 73.9 80.6 79.9

To study ontogenetic growth characteristics, a total of six harvests were made. Data were collected on some morpho-physiological parameters such as plant height, branch and nodule number plant-1, LA and TDM plant-1, LAI, AGR, RGR, harvest index (HI), chlorophyll content and photosynthesis (Pn) in leaves, yield attributes such as number of pods plant-1, seeds pod-1, 100-seed weight and seed yield. The first crop sampling was started at 35 DAS and continued at an interval of 15 days up to 110 DAS, that is till physiological maturity. From each sampling, five plants were selected randomly and uprooted from each plot for collecting necessary parameters. Selected plants were separated into leaves, stems, pods and roots, and the corresponding dry weight were recorded after oven drying at 80 ± 2°C for 72 h. Leaf area of each sample was measured by LiCOR automatic leaf area meter (Model: Li-COR 3000, USA). Leaf area index was measured by canopy analyzer (Model: LI 1400, USA). Calculations of AGR and RGR were carried using the formulae of Hunt (1978). Photosynthetic rate was measured at the flowering and pod development stages by automatic photosynthesis meter (Li-COR 200, USA). Chlorophyll was extracted in 80% acetone from the leaves of upper two nodes of a plant and the chlorophyll was determined following the method of Yoshida et al. (1976). Yield components were recorded at harvest from ten randomly selected plants of each plot. Seed yield was recorded from six inner rows of each plot to avoid border effects and converted into t ha-1. All data were analyzed statistically following the analysis of variance (ANOVA) technique and the mean differences were adjusted with Duncan’s multiple range test (DMRT) using the statistical computer package programme, MSTAT-C (Russell, 1986).

RESULTS AND DISCUSSION Effect of genotypes on plant height, branch and nodule -1 -1 number plant and leaf area plant was significant at all growth stages (Figure 1). Results reveal that plant height increased with age till 95 DAS followed by plateau. Branch number increased with age till 80 DAS in four out of five genotypes. Branch number of BAU-70 increased till 90 DAS. Nodule number and leaf area (LA) plant-1 increased with age till 65 and 80 DAS, respectively followed by a decline in all genotypes due to nodule degeneration and leaf shading. Genotype BAU-70 had higher plant height, branch and nodule number and LA plant-1 and also had higher seed yield. These results indicate that plant height, LA, branch and nodule number are the most important morphological parameters for increasing seed yield in soybean. Shorter plant, lower number of nodules and lower LA was recorded in BAU-80 and BARIsoybean-5. These results are consistent with

Malek et al.

A

B

C

D

7645

Figure 1. (A) Plant height, (B) branch production, (C) nodule production and (D) leaf area development at different days after sowing of soybean genotypes. Vertical bars represent LSD (0.05).

the study of Chettri (2003) who observed that seed yield -1 depends on LA, branch and nodule number plant in soybean. Differences among the genotypes for total dry mass (TDM), leaf area index (LAI), absolute growth rate (AGR)

and relative growth rate (RGR) were significant at all growth stages (Figure 2). Differential genotypic performance for LAI and their relation to the DM production, at each growth stage could be associated with the genetic make-up of the genotypes. A common feature of

7646

Afr. J. Biotechnol.

A

C

B

D

Figure 2. Pattern of (A) leaf area index, (B) total dry mass production, (C) absolute growth rate and (D) relative growth rate in five soybean genotypes during their growth period. Vertical bars represent LSD (0.05). AGR and RGR for 95110 DAS were negative.

soybean genotypes was slow TDM accumulation and LAI during the first 35 DAS followed by a rapid increase after commencement of flowering. Flowering was started at 45 to 50 DAS, depending on genotypes. Faster TDM accumulation after the beginning of reproductive stage was the result of increased LAI (Khan and Khalil, 2010). Total dry matter production in all genotypes increased with age till the beginning of maturity (95 DAS) followed by a decline due to heavy leaf shading. Leaf area index

followed a typical sigmoid pattern with respect to time and increased with age till 80 DAS in all genotypes followed by a decline because of abscission of old leaves. Results indicate that high yielding genotypes always showed superiority in TDM production and LAI as compared to low yielding ones at most of the growth stages. These results also indicate that LAI and TDM are the most important parameters for increasing seed yield in soybean. These results are consistent with that of

Malek et al.

7647

Table 2. Some physiological parameters yield components and yield in five soybean genotypes.

Genotype/ cultivar BAU-21 BAU-70 BAU-80 Shohag BARIsoybean-5 F-test CV (%)

Chlorophyll (mg g-1 fw)

Photosynthesis (Âľmol CO2 s-1 dm -2)

2.16 2.17 2.21 2.12 2.09 NS 3.06

20.66b 24.24a 19.22b 21.45b 19.89b * 6.90

Pods plant-1 (no.) 24.10b 31.23a 21.40bc 17.90d 20.8c ** 6.57

Seeds pod-1 (no.)

100-seed weight (g)

Seed weight plant-1 (g)

Seed yield -1 (t ha )

Harvest index (%)

2.12 2.19 2.17 2.19 2.13 NS 2.59

15.11ab 14.55b 16.08a 15.51ab 15.88a * 3.44

7.71b 9.95a 7.47bc 6.08d 7.03c ** 4.43

2.57b 3.31a 2.49b 2.02d 2.34c ** 5.55

33.22ab 37.73a 33.24ab 28.28b 34.16a * 8.11

Same letter (s) in a column does not differ significantly at P ≤ 0.05 by DMRT; NS = Not significant; ** and * indicate significance at 1 and 5% level of probability, respectively.

Tandale and Ubale (2007) who observed that seed yield depends on LA and TDM production in soybean. Absolute growth rate (AGR) tended to increase with the advancement of stage till 65 to 80 DAS in three genotypes of BAU-70, BAU-80 and BARIsoybean-5, whereas AGR increased with age till maturity in BAU-21 (Figure 2). It is evident that soybean had three distinct growth phases: early slow growth (up to 35 DAS, before flowering start), followed by a rapid growth (50 to 80 DAS, flowering and pod filling stage respectively) and then decline growth phase at pod maturity stage. Slow growth rate at early growth stage was associated with lower LA and TDM production. Initial slow growth favors weed growth and development; thus, crop ultimately suffers a loss. So, selection of genotypes with rapid growth rate in early part of a crop life is therefore warranted. In the present experiment, the high yielding genotype, BAU-70 had greater AGR than low yielding ones which is the desirable character. At the later stages of development (80-95 DAS), there was a decline in AGR, possibly owing to similar decline in LA during this stage (Figure 1). Relative growth rate (RGR) declined with

increasing age in all genotypes (Figure 2) and it decreased rapidly from 50 to 65 DAS till physiological maturity. At 35 to 50 DAS, RGR was higher in Shohag which was the low yielding genotype followed by BAU-70 and the lowest RGR was recorded in BAU-80 which was the third highest yielding genotype. Result indicates that there is no relation between RGR and seed yield. Kollar et al. (1970) observed a decrease in RGR as the season advanced. Sharp decline in RGR during reproductive stage was probably due to increased demand of assimilate by the growing seed fraction (Hamid et al., 1991). However, the RGR was maximum between 35 and 50 DAS. RGR declined at later growth stages (reproductive stage) which may be attributed to excessive mutual shading as the LA was maximum during this period and increased number of old leaves could have lowered the photosynthetic efficiency (Salam et al., 1987). In grain legume, excess LA was reported to have lower RGR and resulted in a decrease of dry matter accumulation, which probably resulted from excessive mutual shading (Pandey et al., 1978). There were no significant differences in chlorophyll content in leaves but there were significant

differences in photosynthesis in leaves among the genotypes (Table 2). BAU-70 had greater photosynthesis in leaves than the other genotypes. Pod number plant-1 and 100-seed weight, seed yield (both plant-1 and hectare-1) and harvest index showed significant difference among the genotypes except number of seeds pod-1 (Table 2). Among the genotypes, BAU-70 produced the highest seed yield plant-1 (9.95 g) and ha-1 (3.31 t) due to production of higher number of pods plant-1 (31.23) and greater dry matter partitioning of seeds (harvest index, 37.73%) though it produced slightly smaller seed size than the others. Mehta et al. (2000) observed that seed yield of soybean had no positive relationship with pod and seed size. In the present experiment, similar result was also observed. Results further revealed that those genotypes had higher nodule number, LA, LAI, TDM and AGR also had higher seed yield. Further, TDM production and CGR depends on source strength by photosynthetic capacity (Egli and Crafts-Brandner, 1996). In the present experiment, the high yielding genotype, BAU-70 showed high TDM production for higher Pn rate and vice versa for BAU-80 and BARIsoybean-5. These results are consistent with that of Egli and

7648

Afr. J. Biotechnol.

Zhen-wen (1991) and Tandale and Ubale (2007) who reported that high yielding genotypes of soybean had greater capacity of TDM for higher LAI and CGR. From the results of the present study, it can be concluded that in addition to superior characters of yield components, a high yielding soybean genotype possess a relatively larger leaf area with superior growth parameters, harvest index and leaf photosynthesis. REFERENCES Chettri SS (2003). Study of variation for yield and yield contributing characters in soybean. Soybean Sci. 23: 6-9. Das ML, Rahman A, Azam MA, Khan MHR, Miah AJ (1992). Comparative performance of some soybean cultivars and the influence of seasons on seed yield. SABRAO J. 24: 137-142. Egli DB, Craft-Brandner SJ (1996). Soybean. pp. 595-623. In: Zamski E and Schaffer AA (ed.). Photoassimilate distribution in plants and Crops. Source-sink relationship. Marcel Dekker Inc. New York, USA. Egli DB, Zhen-wen Y (1991). Crop growth rate and seeds per unit area in soybean. Crop Sci. 31: 439-442. FAO (2004). FAOSTAT: FAO statistical databases. FAO, UN, Rome. Available via DIALOG. http://faostat.fao.org/ Hamid A, Agata W, Maniruzzaman AFM, Ahad AM (1991). Physiological aspects of yield improvement in mungbean. In: Advances in pulses research in Bangladesh. Proceedings of the second national workshop on pulses. June 6-8, 1989, BARI, Gazipur1701, Bangladesh, pp. 95-102. Hunt R (1978). Plant growth analysis Studies in biology. Edward Arnold Ltd. London, pp. 65-67. Jian J, GuangHua W, XiaoBing L, YanXia X, Liang M, Herbert SJ (2007). Yield and quality changes from 50 years of genetic improvement of soybean cultivars in Heilongjiang Province. Res. Agric. Modern. 28(6): 757-761. Khan A, Khalil A (2010). Effect of leaf area on dry matter production in aerated mungbean seed. Int. J. Plant Physiol. Biochem. 2: 52-61. Koller HR, Nyquist WE, Chorash IS (1970). Growth analysis of soybean community. Crop Sci. 10: 407-412. McKevith B (2005). Nutritional aspects of oilseeds. Nutr. Bull. 30: p. 1326. Mehta N, Bohar ABL, Raneat GS, Mishra Y (2000). Variability and character association in soybean. Bangladesh J. Agric. Res. 25: 1-7. MOA (2010). Hand Book of Agricultural Statistics, December 2010. Market Monitoring and Information System, Ministry of Agriculture (MOA), Govt. People’s Repub. Bangladesh. p. 193.

Mondal MMA, Howlader MHK, Akter MB, Dutta RK (2007). Evaluation of five advanced lentil mutants in relation to morpho-physiological characters and yield. Bangladesh J. Crop Sci. 18: 367-372. Oh EI, Uwagoh R, Jyo S, Saitoh K, Kuroda T (2007). Effect of risisng temperature on flowering, pod set, dry matter production and seed yield in soybean. Japanese J. Crop Sci. 76(3): 433-444. Pandey RK, Saxena MC, Singh VB (1978). Growth analysis of blackgram genotypes. Indian J. Agric. Sci. 48: 466-473. Russell DF (1986). MSTAT-C Pakage Programme. Crop and Soil Science Department, Michigan University, USA. Salam MA, Moniruzzaman AFM, Chowdhury SI (1987). Growth analysis in mungbean. Bangladesh J. Nuclear Agric. 3: 58-64. SAIC (2007). SAARC Agricultural Statistics of 2006-07. SAARC Agric. Inform. Centre (SAIC), Farmgate, Dhaka-1215, Bangladesh. p. 23. Shiraiwa T, Ueno N, Shimada S, Horie T (2004). Correlation between yielding ability and dry matter productivity during initial seed filling stage in various soybean genotypes. Plant Prod. Sci. 7: 138-142. Smith J, Woodworth JB, Dashiell KE (1995). Government policy and farm-level technologies: the expansion of soybean in Nigeria. IITA Res. 11: 14-18. Tandale MD, Ubale SS (2007). Effect of growth parameters, leaf area index, leaf area duration, crop growth rate on seed yield of soybean during Kharif season. Int. J. Agric. Sci. 3(1): 119-123. Tukamuhabwa P, Dashiell KE, Assafo-Adjei B (2001). Determination of yield loss caused by soybean rust (Phakopsora pachyrhizi Syd.) in four genotypes of soybeans. Afr. Crop Sci. Conf. Proc. 5: 423-426. Yoshida S, Forno DA, Cock JA, Gomes KA (1976). Laboratory manual for physiological studies of rice. 3rd ed., IRRI, Los Banos, Philippines.

African Journal of Biotechnology Vol. 11(30), pp. 7649-7658, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3223 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Effect of heavy metal and EDTA application on heavy metal uptake and gene expression in different Brassica species Madiha Iqbal1, Jehan Bakht1*, Mohammad Shafi2 and Rafi Ullah1 1

Institute of Biotechnology and Genetic Engineering, KPK Agricultural University, Peshawar, Pakistan. 2 Department of Agronomy, KPK Agricultural University, Peshawar, Pakistan. Accepted 20 February, 2012

The present study investigates the effect of different concentration of heavy metals (Cd, Cr and Pb) and ethylenediaminetetraacetic acid (EDTA) application on two Brassica species (Brassica carinata and Brassica juncea). EDTA application had significant (p<0.05) effect on shoot length, shoot fresh weight, shoot dry weight, root length, root fresh weight, root dry weight and accumulation of heavy metals in both species. Species also produced significant (p<0.05) effect on all parameters except shoot length of the plant. The effect of heavy metals on shoot length, shoot fresh weight, root fresh weight and accumulation of heavy metals was also reported to be significant (p<0.05). Interaction between heavy metals × species showed a significant (p<0.05) effect on shoot fresh weight, shoot dry weight, root length and accumulation of heavy metal in both Brassica species. The data reveal that maximum shoot length, shoot fresh weight, shoot dry weight, root fresh weight and root dry weight was achieved by -1 control plants. In addition, maximum heavy metals (142.88 mg kg ) were observed for B. juncea that -1 were grown under 150 mg kg Pb and 0 mM EDTA stress. Exposure of Brassica species to heavy metals and EDTA resulted in the expression of newly synthesized and abundantly expressed polypeptides, which may play a role in phytoremediation. Key words: Brassica, phytoextraction, heavy metals, EDTA, gene expression.

INTRODUCTION Industrialization and modern lifestyle have led to increased pollution of air, water and soil (Siegel, 2002). A major cause of contamination of soil is the dispersal of industrial and urban wastes generated by anthropogenic activities. Agricultural soils are being contaminated pollutants from the contaminated sites as dust or leachate. Both controlled and uncontrolled disposal of waste, accidental and process spillage, mining and smelting of metalliferous ores, sewage sludge application to agricultural soils etc. are the main causes of contamination of our ecosystem (Alloway, 1990). A variety of organic and inorganic pollutants exist (Prasad and

*Corresponding author. E-mail: jehanbakht@yahoo.co.uk.

Freitas, 1999; Alcantara et al., 2000; Glass, 1999, 2000a, b; Raskin and Ensley, 2000; Watanabe, 1997), amongst which heavy metals, combustible and putrescible substances, hazardous wastes, explosives and petroleum products are of major concern. (Alloway, 1990). Enhanced uptake of heavy metals by crops means excessive metals in human nutrition that can be toxic and cause acute and chronic diseases (Geldmacher, 1984). (Prasad and Freitas, 2003). Cadmium, lead and chromium are the major toxic pollutants even at very low concentrations. They enter the water streams and other components of ecosystem through various indu-strial operations. The potential sources of chromium wastes are effluents from metallurgy, electroplating, leather tanning, textile dyeing, paint, ink, and aluminium

7650

Afr. J. Biotechnol.

manufacturing industries (Bhattacharyya and Gupta, 2006; Verma et al., 2006). Lead is used as industrial raw material in the manufacturing of storage batteries, pigments, leaded glass, fuels, photographic materials, solder and steel products (Nadeem et al., 2006). The presence of Pb, even in very low concentrations, causes anemia, hepatitis and nephritic syndrome (Zulkali et al., 2006). Moderate Pb poisoning leads to severe damage to kidney, nervous system, reproductive system, liver and brain (Ozer, 2007; Chen et al., 2007). Different chemical, physical and biological techniques can be employed to remedy soil polluted by metal. In phytoremediation naturally occurring or genetically engineered plants are used for cleaning contaminated environments (Flathman and Lanza, 1998). Phytoremediative technologies is low-cost, efficient and environmental-friendly (Ensley, 2000). (Ebbs et al., 1997). Plants may behave like metal excluders, metal indicators or metal hyperaccumulators (Raskin et al., 1994). Phyto-remediation may consider different strategies like rhizofiltration, phytostabilization, phytovolatilization, phytodegradation and phytoextraction individually or in combination; (Raskin and Ensley, 2000; Berti and Cunningham, 2000; Henry, 2000; Bañuelos, 2000; Dushenkov, 2003). Phyto-extraction is the best approach for removing pollutants primarily from soil without damaging soil structure and fertility. It is also referred as phytoaccumulation. (Rulkens et al., 1998). Two basic strategies for phytoextraction of heavy metals include natural or continuous phytoextraction and chelate assisted phytoextraction. Chelating agent increases the uptake of heavy metals and various other ions by plants from soil or water. Synthetic chelates are used to increase the supply of micronutrients to plants in both soil and water. These chelating agents can also be used for phytoaccumulation by increasing heavy metals bioavailability and translocation of heavy metals from roots to upper parts of the plants (Epstein et al., 1999). Among these, ethylenediaminetetraacetic acid (EDTA) is found to be the most effective agent in enhancing the accumulation of heavy metals in plants (Blaylock et al., 1997; Madrid et al., 2004; Turgut et al., 2004; Nowack et al., 2006; Liphadzi and Kirkham, 2006; Wahla and Kirkham, 2008). Natural phytoaccumulation uses the natural ability of the plant to remediate metal polluted sites. In this method, only the number of plant growth repetitions is controlled (Salt et al., 1997). While in chelate induced phytoextraction, artificial chelates are added to increase the uptake of metal contaminants (Salt et al., 1997; Rafi et al., 2011)). In order to make this technology feasible, the plants must, extract large concentrations of heavy metals into their roots and translocate the heavy metals to surface biomass, (Brooks,1983; Brooks et al., 1998; Chen et al., 2004). The roots of Brassica juncea are effective in the removal of Cd, Cr, Cu, Ni, Pb, and Zn (Prasad and

Freitas, 2003). Brassica carinata is known for its phytoextraction potential (Quartacci et al., 2007; Purakayastha et al., 2008 and Panwar et al., 2005). B. carinata is also known for its oil containing seeds but suffers from limitations like low oil quality characterized by high level of erucic acid (Velasco et al., 1998) and unacceptable level of meal glucosinolates (Getinet et al., 1997). This could make it an attractive plant species for phytoremediation. The present study was initiated to investigate the effect of different concentration of heavy metals (Cd, Cr and Pb) and EDTA application on the growth and heavy metal accumulation on two Brassica species. MATERIALS AND METHODS The present study was conducted at the Institute of Biotechnology and Genetic Engineering, KPK Agricultural University Peshawar Pakistan. The aim of the study was to investigate the response of two species of Brassica (B. carinata and B. juncea) towards heavy metals and EDTA application and the phytoaccumulation capacity of both Brassica species for different heavy metals (Cd, Cr and Pb) at different metal concentrations. For this purpose a pot experiment was conducted under greenhouse conditions using completely randomized design (CRD) with three replications. Seeds of two Brassica species (B. carinata and B. juncea) were grown for 30 days on artificially contaminated soil with different concentration of heavy metals (Table 1). 30 days after sowing, 5 mM EDTA was added and the plants were allowed to grow for additional ten days. Forty days after sowing, samples were collected for different growth parameters, that is, shoot length, shoot fresh weight, shoot dry weight, root fresh weight and root dry weight. Samples were also collected for the analysis of heavy metal concentrations of Cd, Cr and Pb and protein analysis by SDS-PAGE. Before sowing, a composite soil sample was collected for heavy metal concentration. Standard agronomic practices were observed throughout the experiment.

Procedures for heavy metal analyses Samples were dried at 80°C for 48 h and then finely grinded by electric grinder. One gram (1 g) of dried and crushed sample was prepared for atomic absorption spectrophotometer analysis. For this purpose samples were acid digested with 15 ml of concentrated HNO3 overnight. Digested samples were then heated to 250°C until white fumes appeared. They were then heated for another one hour. The samples were then cooled down to room temperature and diluted to 25 ml with distilled water and then filtered. The concentrations of CD, Cr and Pb were determined by atomic absorption spectrophotometer at wavelengths of 228, 357 and 283 nm, respectively. Analysis of the soil before sowing revealed that the concentrations of Cd, Cr and Pb were 1.94, 28.75, 59.25 mg kg-1.

Protein analysis For sodium dodecyl sulfate–polyacrylamide gel electrophresis (SDS-PAGE), young leaves of the plants were collected from each treatment. Leaves were washed with distilled water and were stored at -80°C until used. One hundred millgram (100 mg) of leaf tissues was first homogenized with 1 ml protein extraction buffer (50 mM

Iqbal et al.

7651

Table 1. Different levels and sources of heavy metals used in the experiment. -1

-1

S/N 1

Heavy metal Cadmium (Cd)

Source Cadmium nitrate

Molecular formula Cd (NO3)2. 4H2O

Molar mass (g mol ) 308.47

Concentration (mg kg ) 10, 20, 40

2 3

Chromium (Cr) Lead (Pb)

Chromium nitrate Lead nitrate

Cr (NO3)3. 9H2O Pb (NO3)2

400.15 331.21

50, 100, 150 100, 150, 200

Table 2. Shoot length (cm) of Brassica species as affected by heavy metals and EDTA application.

Heavy metal -1 (mg kg ) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 mM) B. carinata B. juncea 20.92 17.44 19.53 17.47 20.42 19.87 22.08 29.33 17.92 27.00 22.75 27.65 25.50 22.33 24.92 19.32 23.33 21.02 31.50 32.50 23.14 a (25.76 a)

EDTA (5 mM) B. carinata B. juncea 28.58 22.57 25.92 24.50 23.33 22.33 31.17 26.08 28.50 28.20 22.42 23.63 33.27 28.92 29.42 29.52 31.33 24.70 32.33 26.50 27.16 b (24.54 b)

Mean 22.38def 21.85ef 21.49f 27.17bc 25.40bcd 24.11cdef 27.50ab 25.79bc 25.10bcde 30.71a

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

Tris-HCl; pH 8.00; 25 mM DTT; 1, 4-dithio-DL-Threitol; 1% SDS and 1% β-mercaptoethanol) in a chilled mortar and pestle. After grinding, samples were mixed well by vortex. Samples were then centrifuged at 10,000 rpm for 10 min. Supernatant containing proteins were stored at -20°C for analysis. Samples for protein quantification were prepared by mixing 10 µL protein samples with 2 ml CBB solution (CBB powder G250-10%; 95% ethanol; 85% phosphoric acid). Samples were then analyzed for concentration of protein by UV absorption spectrophotometer. Spectrophotometric data was collected for the samples as well as standard protein solution of BSA (Bovine Serum Albumin). Fifty microgram (50 µg) samples were then run on 12% polyacrylamide gel containing 4% stacking gel. After electrophoration, protein gels were stained in staining solution (0.25 g CBB powder R250, 125 ml methanol, 25 ml glacial acetic acid and 100 ml distilled water) for 40 min followed by overnight destaining, in destaining solution (30% methanol; 10% acetic acid and 60% distilled water). The banding profile of the gels was recorded by gel documentation system.

Statistical analyses All data are presented as mean values of three replicates. Data was analyzed statistically for analysis of variance (ANOVA) following the method described by Gomez and Gomaz (1984). MSTATC computer software was used to carry out statistical analysis (Russel and Eisensmith, 1983). The significance of differences among means was compared by using Least Significant Difference (LSD) test (Steel and Torrie, 1997).

RESULTS AND DISCUSSION Statistical analysis of the data revealed that heavy metal, EDTA and interaction of heavy metal × EDTA and EDTA × species had a significant (p<0.05) effect on shoot length of Brassica species (Table 2). Interaction between heavy metal × EDTA × species did not significantly (p>0.05) affect shoot length. The data obtained indicate that maximum shoot length (30.71 cm) was attained by control plants followed by treatment of 100 mg kg-1 of Pb (27.50 cm). While minimum shoot length (21.49 cm) was noted in plants treated with 40 mg kg-1 Cd. In case of EDTA application, maximum shoot length (27.16 cm) was recorded in those treatments which were applied with 5 mM EDTA. Between species, maximum shoot length (25.76 cm) was observed in B. carinata when compared with B. juncea (24.54 cm). These results are in agreement with Qadir et al. (2004) who studied B. juncea cultivar for their phytoextraction efficiency and found a reduction in shoot length of B. juncea cultivar subjected to Cd (0.0–2.0 mM). Heavy metal, EDTA, species and interactions of heavy metal × EDTA, heavy metal × species, EDTA × species and heavy metal × EDTA × species had a significant (p<0.05) effect on shoot fresh weight of Brassica species (Table 3). The data indicated

7652

Afr. J. Biotechnol.

Table 3. Shoot fresh weight (g) of Brassica species as affected by heavy metals and EDTA application.

Heavy metal -1 (mg kg ) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 m M) B. carinata B. juncea 9.74 26.55 8.73 25.80 12.77 27.90 10.53 42.29 18.37 33.65 16.53 32.23 20.71 34.57 16.43 22.96 16.78 21.32 33.83 70.63 25.12 a (18.97 a)

EDTA (5 m M) B. carinata B. juncea 27.22 25.27 17.39 35.24 20.43 23.67 24.15 52.14 15.76 50.96 12.21 52.79 24.62 57.25 24.47 50.62 26.45 44.62 22.37 60.18 33.39 b (39.53 b)

Mean 22.20de 21.79e 21.19e 32.28bc 29.68bc 28.44bcd 34.29b 28.62bc 27.29cde 46.75a

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

that maximum shoot fresh weight (46.75 g) was noted in control plants followed by plants treated with 100 mg kg-1 of Pb (34.29 g). Minimum shoot fresh weight (21.19 g) was recorded for 40 mg kg-1 of Cd treatment. Plants produced maximum shoot fresh weight (33.39 g) when treated with 5 mM EDTA. Similarly, maximum shoot fresh weight (39.53 g) was observed in B. juncea compared with B. carinata (18.97 g). When interaction between heavy metal × EDTA × species was considered, maximum shoot fresh weight (70.63 g) was observed in 0 mg kg-1 heavy metal treated plants (Table 3). Similar results were also reported by Lombi et al. (2001). They revealed that B. juncea suffered from severe phytotoxicity when exposed to heavy metals, that is, Cd and Pb while addition of EDTA increased the phytotoxicity. Qadir et al. (2004) observed reduction in biomass accumulation of B. juncea exposed to Cd stress. While these findings are contradictory to Quartacci et al. (2007) who reported that B. carinata accumulates high concentrations of heavy metals in shoots without showing biomass reduction in 9 different plant species. Analysis of the data indicated that EDTA, species and interaction between heavy metal and species had a significant (p<0.05) effect on shoot dry weight. While heavy metal and interactions of heavy metal × EDTA, EDTA × species and heavy metal × EDTA × species did not significantly (p>0.05) affect shoot dry weight of Brassica plant (Table 4). Maximum shoot dry weight (3.19 g) was observed for control plants followed by -1 plants grown in 50 mg kg of Cr. Minimum shoot dry weight data (2.39 g) was recorded for plants under 200 -1 mg kg Pb stress. When EDTA was applied, maximum shoot dry weight (2.82 g) was noted in plants exposed to 5 mM EDTA. Maximum shoot dry weight was attained by B. carinata (10.89 g) in comparison with B. juncea plants (9.98 g). These results are in conformity with Ebbs and

Kochian (1997) who observed that the shoot dry weight of 3 Brassica species decreased significantly in the presence of heavy metals. Similar results are also reported by Quartacci et al. (2006) who revealed that B. juncea shoots dry weights was reduced significantly followed by NTA application EDTA, species and interaction between heavy metal × species significantly (p<0.05) affected root length while heavy metal and interactions of heavy metal × EDTA, EDTA × species, heavy metal × EDTA × species showed a non-significant (p> 0.05) effect on root length (Table 5). Maximum mean root length (10.84 cm) was observed for the treatments of 5 mM EDTA. Between species, maximum root length was achieved by B. carinata plants (10.89 cm) compared with B. juncea (9.98 cm). Purakayastha et al. (2008) also observed that root length, among root parameters, appeared as the most powerful parameter to dictate the uptake of metals by Brassica species during his research on different Brassica species. Statistical analysis of the data obtained also indicated that heavy metal, EDTA, species and interaction between EDTA × species significantly (p<0.05) affected root fresh weight of Brassica plants while the effect of interactions of heavy metal × EDTA, heavy metal × species and heavy metal × EDTA × species on root fresh weight was not significant (p>0.05) (Table 6). Maximum root fresh weight (1.89 g) was produced by control plants whereas minimum root fresh weight (0.82 g) was observed for plants grown under 10 or 20 mg kg-1 concentration of Cd. In the case of EDTA addition, maximum mean root fresh weight value (1.28 g) was achieved by plants which were amended with 5 mM EDTA. Similarly, between species, maximum root fresh weight of 1.55 g was noted in B. juncea grown in 5 mM EDTA compared with B. carinata (0.57 g). These results are confirmed by Wong and Bradshaw (2006) who noted significant toxic effect of

Iqbal et al.

7653

Table 4. Shoot dry weight (g) of Brassica species as affected by heavy metals and EDTA application.

Heavy metal (mg kg-1) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 m M) B. carinata B. juncea 1.25 3.71 0.82 4.26 1.06 3.35 1.34 3.97 1.76 3.40 1.82 4.00 1.77 1.44 2.32 2.79 1.92 1.98 2.32 4.40 2.48 a (1.92 a)

EDTA (5 m M) B. carinata B. juncea 1.90 3.23 1.62 3.47 2.65 3.10 2.37 3.88 1.34 3.65 1.79 3.42 2.71 3.81 2.59 3.16 2.84 2.81 2.15 3.91 2.82 b (3.39 b)

Mean 2.52 2.54 2.54 2.89 2.54 2.76 2.43 2.71 2.39 3.19

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

Table 5. Root length (cm) of Brassica species as affected by heavy metals and EDTA application.

Heavy metals (mg kg-1) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 m M) B. carinata B. juncea 9.92 8.70 10.67 8.43 11.50 8.05 9.00 10.75 10.08 8.30 9.83 11.33 10.50 8.43 11.50 11.42 12.00 8.40 10.67 11.00 10.02 a (10.89 a)

EDTA (5 m M) B. carinata B. juncea 13.75 10.50 11.33 8.50 13.92 9.80 10.17 9.75 11.25 10.98 10.67 10.42 10.67 11.30 10.33 11.83 11.17 10.67 8.83 11.00 10.84 b (9.98 b)

Mean 10.72 9.73 10.82 9.92 10.15 10.56 10.23 11.27 10.56 10.38

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

heavy metals on the growth of rye grass roots. Analysis of the data also suggested that root dry weight was significantly (p<0.05) affected by EDTA and species while heavy metals and interactions of heavy metal × EDTA, heavy metal × species, EDTA × species and heavy metal × species × EDTA had a non-significant (p>0.05) effect on root dry weight (Table 7). Maximum root dry weight (0.25 g) was achieved at 5 mM EDTA concentration. Between species, maximum root dry weight (0.26 g) was noted in B. juncea compared with B. carinata (0.15 g). Similar results were also reported by Ebbs and Kochian (1997) who reported significant decrease in root dry weight in 3 Brassica species. Table 8 indicates heavy metal accumulation levels in

the shoots of Brassica species as affected by heavy metals and EDTA application. Statistical analysis of the data revealed that heavy metal, EDTA, species, interaction between heavy metal × species, EDTA × species and heavy metal × EDTA × species significantly (p<0.05) affected the accumulation of heavy metals in shoots of Brassica plants while the effect of interaction between heavy metal × EDTA was non-significant (p>0.05). It is evident from the data that maximum accumulation of heavy metals (95.42 mg kg-1) was achieved by plants exposed to 150 mg kg-1 of Pb, followed by 88.34 mg kg-1, -1 by plants grown on 200 mg kg Pb concentration. -1 Minimum accumulation (0.82 mg kg ) was noticed for Cd in control plants. When subjected to EDTA, maximum

7654

Afr. J. Biotechnol.

Table 6. Root fresh weight (g) of Brassica species as affected by heavy metals and EDTA application.

EDTA (0 m M) B. carinata B. juncea 0.34 0.72 0.27 0.75 0.27 0.76 0.30 1.31 0.61 1.07 0.53 1.39 0.52 0.43 0.72 1.01 0.55 0.79 1.52 2.84 0.84 a (0.57 a)

Heavy metal (mg kg-1) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (5 m M) B. carinata B. juncea 0.58 1.63 0.38 1.89 0.69 1.76 0.49 1.43 0.27 2.13 0.35 1.57 0.79 2.70 0.64 2.47 0.78 1.83 0.77 2.42 1.28 b (1.55 b)

Mean 0.82b 0.82b 0.87b 0.88b 1.02b 0.96b 1.11b 1.21b 0.99b 1.89a

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

Table 7. Root dry weight (g) of Brassica species as affected by heavy metals and EDTA application.

Heavy Metals (mg kg1 ) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 m M) B. carinata B. juncea 0.08 0.14 0.05 0.14 0.06 0.13 0.07 0.30 0.15 0.21 0.11 0.29 0.13 0.06 0.26 0.14 0.21 0.09 0.23 0.43 0.16 a (0.15 a)

EDTA (5 m M) B. carinata B. juncea 0.13 0.28 0.08 0.44 0.27 0.38 0.15 0.21 0.11 0.31 0.15 0.22 0.23 0.50 0.20 0.40 0.20 0.23 0.17 0.34 0.25 b (0.26 b)

Mean 0.16 0.18 0.21 0.18 0.20 0.19 0.23 0.25 0.18 0.29

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

Table 8. Heavy metals (mg kg-1) accumulation by Brassica species as affected by heavy metals and EDTA application.

Heavy metal (mg kg-1) Cd 10 Cd 20 Cd 40 Control Cr 50 Cr 100 Cr 150 Control Pb 100

EDTA (0 m M) B. carinata B. juncea 5.97 6.47 5.67 6.19 6.05 6.29 0.90 0.75 8.67 11.59 8.58 13.96 9.57 6.83 3.75 8.00 28.32 108.25

EDTA (5 m M) B. carinata B. juncea 10.55 14.57 10.69 16.62 10.52 15.59 0.00 0.00 10.75 11.33 11.01 10.75 11.52 12.92 0.00 0.00 84.13 122.58

Mean 9.39b 9.79b 9.61b 0.82 10.59b 11.08b 10.21b 5.88 85.82a

Iqbal et al.

7655

Table 8. Contd.

Pb 150 Pb 200 Control

29.70 142.88 29.54 115.12 35.00 71.75 27.48 a (24.39 a)

108.50 100.58 98.13 110.58 0.00 0.00 38.57 b (41.66 b)

95.42a 88.34a 53.38

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

1

2

3

4

5

6

7

8

9

10

72 69 63 57 55 46 43 37 31 26 20 17 13 8

Figure 1. SDS-PAGE protein profile of Brassica carinata grown under different heavy metals (mg kg-1) and EDTA (0 mM). Lane 1, Control; lane 2, Cd10; lane 3, Cd20; lane 4, Cd40; lane 5, Cr50; lane 6, Cr100; lane 7, Cr150; lane 8, Pb100; lane 9, Pb150; lane 10, Pb200.

accumulation occurred in plants (38.57 mg kg-1) when 5 mM EDTA was applied. Between species, maximum accumulation was found to be 41.66 mg kg-1 in B. -1 carinata when compared with B. juncea (24.39 mg kg ). For interaction between heavy metal Ă— EDTA Ă— species, -1 maximum accumulation (142.88 mg kg ) was observed -1 for those plants that were grown under 150 mg kg Pb stress (B. juncea; 0 mM EDTA) while minimum accumulation (0.75 mg kg-1) was noted for Cd in control plants (B. juncea; 0 mM EDTA). The results are in agreement with Blaylock et al. (1997) who reported that accumulation of Pb in the plant tissue corresponds to the Pb and EDTA concentrations in soil after working with B. juncea. Ahmed et al. (2001) found that EDTA increases

the solubility of Cd helping its enhanced accumulation in B. juncea roots, shoots and stem. These results agree with Kos et al. (2003) and Lesage et al. (2005). Protein analysis by SDS-PAGE Protein profile by SDS-PAGE of Brassica species exposed to different levels of heavy metals and EDTA application showed that B. carinata plants treated with Cd (20 mg kg-1) and Pb (100 and 150 mg kg-1) and EDTA expressed one polypeptide each of molecular weight 57 and 60 kDa when compared with other treatments (Figure 2). Similarly, B. carinata when exposed to 100 mg

7656

Afr. J. Biotechnol.

1

2

3

4

5

6

7

8

9

10

72 69 63 57 55 47 43 37 31 26 20 17 13 8 Figure 2. SDS-PAGE protein profile of Brassica carinata grown under different heavy metals (mg kg-1) and 5 mM EDTA. Lane 1, Control; lane 2, Cd10; lane 3, Cd20; lane 4, Cd40; lane 5, Cr50; lane 6, Cr100; lane 7, Cr150; lane 8, Pb100; lane 9, Pb150; lane 10, Pb200.

1

2

3

4

5

6

7

8

9

10

72 69 63 57 55 47 43 37 31 26 20 17 13 8

Figure 3. SDS-PAGE Protein profile of Brassica juncea grown under different heavy metals (mg kg-1) and EDTA (0 mM). Lane 1, Control; lane 2, Cd10; lane 3, Cd20; lane 4, Cd40; lane 5, Cr50; lane 6, Cr100; lane 7, Cr150; lane 8, Pb100; lane 9, Pb150; lane 10, Pb200.

kg-1 and 5 mM EDTA revealed that a band of 55 kDa disappeared when compared with other treatments (Figure 3). The same brassica specie when treated with Cr (100 mg kg-1) indicated that 63 kDa protein was not expressed when compared with other treatments (Figure 1). The data further suggested that B. carinata when

exposed to Pb (100 mg kg-1) and 5 mM EDTA abundantly expressed two polypeptides of molecular weight 69 and 72 kDa (Figure 2). Banding profile of the treated plants revealed that the same Brassica (B. carinata) two polypeptides (20 and 43 kDa) were highly expressed -1 -1 when treated with 20 mg kg Cd and Cr (100 mg kg ),

Iqbal et al.

1

2

3

4

5

6

7

8

9

7657

10

72 69 63 57 55 47 43 37 31 26 20 17 13 8

Figure 4. SDS-PAGE Protein profile of Brassica juncea grown under different heavy metals (mg kg-1) and 5 mM EDTA. Lane 1, Control; lane 2, Cd10; lane 3, Cd20; lane 4, Cd40; lane 5, Cr50; lane 6, Cr100; lane 7, Cr150; lane 8, Pb100; lane 9, Pb150; lane 10, Pb200.

respectively (Figure 2). The data also suggested that plants treated with Cr (150 mg kg-1) abundantly expressed 13, 43 and 72 kDa protein when compared with other treatments (Figures 3 and 4). Similarly, 69 kDa protein was highly expressed in the case of Cr (50 mg kg1 ) treatment (Figure 4). Wu et al. (2011) reported that CAXcd-expressing petunia plants showed significantly greater Cd tolerance and accumulation than the controls.

REFERENCES Ahmed K., Panwar BS, Gupta SP (2001). Phytoremediation of cadmium-contaminated soil by Brassica species. Acta Agron. Hungarica 49: 351-360. Alcantara E, Barra R, Benlloch M, Ginhas A, Jorrin J, Lopez JA, Lora A, Ojeda MA, Pujadas A, Requejo R, Romera J, Sancho ED, Shilev S, Tena M (2000). Phytoremediation of a metal contaminated area in southern Spain. In: Intercost workshop. (15th - 18th November, 2000, Sorrento, Italy). Pp 121-123. Alloway BJ (1990). Heavy metals in soils. Blackie, Glasgow UK. Ba単uelos GS (2000). Phytoextraction of selenium from soils irrigated with selenium-laden effluent. 224: 251-258. Ba単uelos GS, Meek DW (1989). Selenium accumulation in selected vegetables. J. Plant Nutr. 12: 1255-1272. Ba単uelos GS, Cardon G, Mackey B, Ben-asher J, Wu LP, Beuselinck P, Akohoue S, Zambrzuski S (1993a). Boron and selenium removal in B-laden soils by four sprinkler irrigated plant species. J. Environ. Qualit. 22: 786-797. Berti WR, Cunningham SD (2000). Phytostabilization of metals. In: Phytoremediation of toxic metals: using plants to clean-up the environment. Edited by Raskin I and Ensley BD. New York, John Wiley & Sons, Inc., pp. 71-88. Blaylock MJ, Salt DE, Dushenkov S, Ussman CD, Kapulnik Y, Ensley

BD, Raskin I (1997). Enhanced accumulation of Pb in Indian mustard by soil- applied chelating agents. Environ. Sci. Technol. 31: 860-865. Brooks RR (1983). Biological methods of prospecting for minerals. New York, Wiley-Interscience, p. 313. Brooks RR, Chambers MF, Nicks LJ, Robinson BH (1998). Phytomining. Trends Plant Sci. 1: 359-362. Chen Y, Li X, Shen Z (2004). Leaching and uptake of heavy metals by ten different species of plants during an EDTA- assisted phytoextraction process. Chemosphere, 57: 187-196. Ebbs SD, Kochian LV (1997). Toxicity of zinc and copper to Brassica species: implications for phytoremediation. J. Environ. Qual. 26: 776781. Ebbs SD, Lasat MM, Brady DJ, Cornish J, Gordon R, Kochian LV (1997). Phytoextraction of cadmium and zinc from a contaminated soil. J. Environ. Qual. 26: 1424-1430. Ensley BD (2000). Rational for use of Phytoremediation. In: Phytoremediation of toxic metals: using plants to clean-up the environment. Edited by Raskin I and Ensley BD. New York, John Wiley & Sons, Inc. pp. 3-12. Flathman PE, Lanza GR (1998). Phytoremediation: current views on an emerging green technol. J. Soil Contamin. 7: 415-432. Geldmacher VM (1984). Meaning of the heavy metals in the toxicology. Anal. Chem. 317: 427-432. Getinet A, Rakow G, Raney JP, Downey RK (1997). Glucosinolate content in interspecific crosses of Brassica carinata with B. juncea and B. napus. Plant Breed. 116: 39-46. Glass DJ (1999). U.S. and international markets for phytoremediation, 1999-2000. Needham, Mass., D. Glass Associates, 1999, p. 266. Glass DJ (2000a). Economic potential of phytoremediation. In: Phytoremediation of toxic metals: using plants to clean-up the environment. Edited by Raskin I and Ensley BD. New York, John Wiley & Sons, pp. 15-32. Glass DJ (2000b). The 2000 Phytoremediation Industry. Needham, Mass., D. Glass Associates, p. 100. Gomez KA, Gomez AA (1984). Statistical Procedures for Agricultural nd Research 2 Ed. John Willey & Sons, Inc. New York USA. Henry JR (2000). In an overview of phytoremediation of lead and

7658

Afr. J. Biotechnol.

mercury. NNEMS Report. Washington, D.C., pp. 3-9. Kos B, Grcman H, Lestan D (2003). Phytoextraction of lead, zinc and cadmium from soil by selected plants. Plant Soil Environ. 49: 548553. Lesage E, Meers E, Vervaeke P, Lamsal S, Hopgood M, Tack FMG, Verloo MG (2005). Enhanced phytoextraction: II. effect of EDTA and Citric Acid on heavy metal uptake by Helianthus annuus from a calcareous soil. Int. J. Phytoremed. 7: 143-152. Liphadzi MS, Kirkham MB (2006). Heavy metal displacement in chelatetreated soil with sludge during phytoremediation. J. Plant Nutr. Soil Sci. 169: 737-744. Lombi E, Zhao FJ, Dunham SJ, McGrath SP ( 2001). Phytoremediation of heavy metal-contaminated soils natural hyperaccumulation versus chemically enhanced phytoextraction. J. Environ. Qual. 30: 19191926. Nadeem M, Mahmood A, Shahid SA, Shah SS, Khalid AM, Mckay G (2006). Sorption of lead from aqueous solution by chemically modified carbon adsorbents. J. Hazard. Mat. 138: 604-613. Ozer A (2007). Removal of Pb(II) ions from aqueous solutions by sulphuric acid-treated wheat bran. 2007. J. Hazard. Mat. 141: 753761. Panwar BS, Ahmed KS, Sihag D, Patel AL (2005). Distribution of cadmium and nickel among various forms in natural and contaminated soils amended with EDTA. Earth Environ. Sci. 7: 153160. Prasad MNV, Freitas H (1999). Feasible biotechnological and bioremediation strategies for serpentine soils and mine spoils. Electronic J. Biotechnol. 2: 35-50. Prasad MNV, Freitas HMO (2003). Metal hyperaccumulation in plants biodiversity prospecting for phytoremediation technology. Electronic J. Biotechnol. 6: 275-321. Prasad MNV, Strzalka K (2002). Physiology and biochemistry of metal toxicity and tolerance in plants. Dordrecht, Kluwer Academic Publishers. p. 432. Purakayastha TJ, Viswanath T, Bhadraray S, Chhonkar PK, Adhikari PP, Suribabu K (2008). Phytoextraction of zinc, copper, nickel and lead from a contaminated soil by different species of Brassica. Intl. J. Phytoremed.10: 61-72. Qadir S, Qureshi MI, Javed S, Abdin MZ (2004). Genotypic variation in phytoremediation potential of Brassica juncea cultivars exposed to Cd stress. J. Plant Sci. 167: 1171-1181. Quartacci MF, Argilla A, Baker AJM, Navari-Izzo F (2006). Phytoextraction of metals from a multiply contaminated soil by Indian mustard. Chemosphere, 63: 918-925. Quartacci MF, Irtelli B, Baker AJM, Navari-Izzo F ( 2007). The use of NTA and EDDS for enhanced phytoextraction of metals from a multiply contaminated soil by Brassica carinata. Chemosphere, 68: 1920-1928. Raskin I, Ensley BD (2000). Phytoremediation of toxic metals: using plants to clean up the environment. New York, John Wiley and Sons, p. 352. Raskin I, Kumar PBAN, Dushenkov S, Salt DE (1994). Bioconcentration of heavy metals by plants. Curr. Opin. Biotechnol. 5: 285-290. Rulkens WH, Tichy R, Grotenhuis JTC (1998). Remediation of polluted soil and sediment: perspective and failures. Water Sci. Technol. 37: 27-35.

Russel DF, Eisensmith SP (1983). MSTATC. Crop and Soil Science Department, Michigan State University, USA. Salt DE, Pickering IJ, Prince RC, Gleba D, Dushenkov S, Smith RD, Raskin I (1997). Metal accumulation by aquacultured seedlings of Indian mustard. Environ. Sci. Technol. 31: 1636-1644. Salt DE, Blaylock M, Kumar NPBA, Dushenkov V, Ensley D, Chet I, Raskin I (1995a). Phytoremediation: a novel strategy for the removal of toxic metals from the environment using plants. Biotechnology, 13: 468-474. Salt DE, Smith RD, Raskin I (1998). Phytoremediation. Ann. Rev. Plant Physiol. Plant Mol. Biol. 49: 643-668. Steel RGD. Torrie JH (1997). Principles and procedures of statistics: A Biometrical Approach. McGraw Hill, New York USA. Turgut C, Pepe MK, Teresa JC (2004). The effect of EDTA and citric acid on phytoremediation of Cd, Cr, and Ni from soil using Helianthus annuus. Environ. Pollut. 131: 147-154. Velasco L, Goffman F, Becker HC (1998). Variability for the fatty acid composition of the seed oil in a germplasm collection of the genus Brassica. Gene Resour. Crop Evol. 45: 371-382. Wahla IH, Kirkham MB (2008). Heavy metal displacement in salt-waterirrigated soil during phytoremediation. Environ. Pollut. 155: 271-283. Watanabe ME (1997). Phytoremediation on the brink of commercialization. Environ. Sci. Technol. 31: 182-186. Wong MH, Bradshaw AD (2006). A comparison of toxicity of heavy metals, using root elongation of rye grass, Lolium perenne. New phytol. 91: 255-261. Wu Q, Toshiro S, Kimberly, William A, Jeung-Sul H, Chang KK, Kendal DH, Sungun P (2011). J. Plant Physiol. 168: 167-173. Zulkali, MMD, Ahmad AL, Norulakmal NH (2006). Oryza sativa L. husk as heavy metal adsorbent: Optimization with lead as model-solution. Bioresour. Technol. 97: 21-25.

African Journal of Biotechnology Vol. 11(30), pp. 7659-7669, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3743 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Genetic diversity in Chinese natural zoysiagrass based on inter-simple sequence repeat (ISSR) analysis Y. Xie, L. Liu, J. Fu* and H. Li* Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden/Wuhan Institute of Botany, Chinese Academy of Sciences, Wuhan 430074, Hubei, China. Accepted 14 March, 2012

Zoysiagrass (Zoysia sp.) is extensively used in turf establishment and livestock herbage due to its many outstanding characters. Native Zoysia sp. are widely distributed in China. Inter-simple sequence repeat (ISSR) markers were used to investigate the genetic diversity and genetic relationships of 81 Chinese wild zoysiagrass accessions and three commercial cultivars. The results show that 33 ISSR primers produced 388 clear bands, among which 375 were polymorphic. The genetic similarity coefficients (GSCs) among 84 zoysiagrass accessions or cultivars ranged from 0.644 to 0.866 with an average of 0.751. The GSCs within species were significantly higher than that among species. Cluster analysis using an unweighted pair group method with arithmetic mean (UPGMA) method showed that the 84 zoysiagrass accessions could be classified into 10 major groups. Accessions from similar geographic regions were generally clustered together, which indicated a correlation between molecular groupings and the geographical origin. The investigation demonstrated the genetic diversity of different germplasm, and that ISSR markers are an effective tool for the study of genetic variation in zoysiagrass. Key words: Chinese accessions, genetic diversity, inter-simple sequence repeat (ISSR) markers, zoysiagrass.

INTRODUCTION Zoysiagrass (Zoysia sp.), with well-developed stolon and short culm, is able to form a dense swards (Weng et al., 2007). It was extensively used in turf establishment and livestock herbage. The genus zoysia consists of 16 species that are naturally distributed on sea coasts and grasslands around the East Asia. Five species have been identified from southern Hokkaido to the southwest islands in Japan (Kitamura, 1989). Of these, Zoysia japonica Steud., Zoysia matrella Merr., and Zoysia tenuifolia Wild are utilized as turfgrass. In addition, Z. japonica is also used as forage grass in Japan and other countries in East Asia (Shoji, 1983; Fukuoka, 1989). In China, Zoysia sp. are distributed from north eastern area of Liaoning province in the north to Fujian province in the south (Jin et al., 2004), with a variety of ecological types. These wild resources survived through long-term natural selection, and thereby had strong environmental

*Corresponding author. E-mail: lihuiying@wbgcas.cn. Tel/Fax: +86 27 87510525.

suitability and stress resistance (Jin and Han, 2004). Previous researchers investigated the genetic variation of some zoysiagrass germplasm. The Zoysia sp. grown in various environments of coastal areas in Tanwan had a great variation in morphology, isozyme pattern, and salt tolerance (Weng et al., 1995; Weng and Chen, 2001; Weng, 2002). Kitamura (1989) and Choi et al. (1997a, b) evaluated the morphology and isozyme pattern of Zoysia sp. collected from Japan and Korea, respectively. However, morphological characteristics are not adequate to reveal genetic differences among cultivars because phenotypic traits are easily influenced by environment. Kitamura (1970) investigated morphological characteristics of natural zoysiagrass populations and found that the classification criteria of Zoysia sp. should be reconsidered because morphological characteristics varied continuously among species. With the development of molecular techinique, molecular marker has been considered as a preferred method for evaluating the genetic diversity of plant germplasm because it could even distinguish closely related genotypes (Nybom, 1994). Molecular markers are not easily affected by

7660

Afr. J. Biotechnol.

environmental factors or by development stages (Bebeli and Kaltsikes, 1993). Molecular data can contribute to a more holistic picture of genetic diversity within a collection of populations (Curley and Jung, 2004). Yaneshite et al. (1997) employed restriction fragment length polymorphism (RFLP) markers to study the genetic diversity within 17 zoysiagrass accessions from Japan. Choi and Yang, (1996) and Weng (2007) found extensive diversity of wild zoysiagrass accessions collected from Korea and Taiwan based on randomly amplified polymorphic DNA (RAPD) technique by investigating morphological characteristics in natural populations. Guo et al. (2007, 2009) evaluated genetic diversity and interspecific relationship of 96 China Zoysia sp. wild germplasm by applying simple sequence repeat (SSR) and sequence related amplified polymorphism (SRAP) markers. However, compared to its wide distribution, the research of molecular variation in Chinese wild zoysiagrass is limited. The ISSR marker is a widely used molecular marker technique, in terms of its high reproducibility, low cost, and less complexity (Reddy et al., 2002). It has been used in identification and genetic relationship estimation of many plant species. However, there are limited reports on the genetic diversity among zoysiagrass species based on ISSR markers. In China, wild zoysiagrass is abundant and extensively distributed. However, there is very limited information on the general genetic variation among indigenous Chinese zoysiagrass germplasm. In this study, we used ISSR markers; (i) to estimate the genetic relationship among 81 Chinese natural zoysiagrass accessions and three cultivars, and (ii) to classify them and provide the basic information for conservation and breeding strategies for zoysiagrass. MATERIALS AND METHODS Plant materials Eighty-four accessions of four species of zoysiagrass [81 were natural zoysiagrass accessions collected from seven provinces of China (Table 1), and three commercial cultivars (Zenith, Meyer and Grif16454)] were used in this study. Of these materials, there were 50 Z. japonica, 21 Zoysia sinica, six Zoysia macrostachya, and seven Z. matrella (L.) based on morphology identification (Table 1). According to their provinces of collection, these natural zoysiagrass accessions were classified into seven groups. All the accessions were propagated asexually in Wuhan Botanical Garden, Chinese Academy of Sciences. They were grown in a mixture of 9 sand: 1 organic material in pots (15 cm in diametre and 20 cm deep). The pots were kept in a greenhouse with a daily maximum/ minimum temperature of 30/25°C, a 12 h photoperiod.

Genomic DNA extraction Total DNA was isolated from young fresh zoysiagrass leaves (0.1 g) using the cetyl trimethylammonium bromide (CTAB) method as described by Doyle (1991) with slight modification. Leaf tissues were directly ground in liquid nitrogen with a mortar and pestle. The

powder was transferred into 2 ml centrifuge tubes with 0.9 ml of CTAB extraction buffer (containing 2% CTAB, 5 M NaCl, 0.5 M EDTA pH 8.0, 1 M Tris–HCl pH 8.0). After 30 min of incubation at 65°C, equal volume of chloroform/isoamyl alcohol (24:1) was added into each tube. After being vortexed gently for three min, the mixtures were centrifuged at 12,000 rpm for 10 min at 4°C. The supernatant was transferred to new tubes and cold isopropanol was added to ⅔ volume of supernatant. After 30 min on ice, DNA was precipitated by centrifugation at 12,000 rpm for 10 min at 4°C. The pellets were washed with 70% ethanol, and dissolved in TE buffer. DNA concentration was quantified using UV spectrophotometer, and the integrity was examined on 0.8% agarose gel electrophoresis.

ISSR analysis According to previous reports (Zeng et al., 2006; Fan et al., 2007; Liu et al., 2007; Xiao et al., 2007), 60 ISSR primers were synthesized. These primers were screened with six accessions for polymorphism and reproducibility. 33 primers producing clear, stable and polymorphic fragments were used for ISSR analysis. PCR amplification was performed in a total volume of 25 μl. The reaction mixture included 40 ng DNA template, 0.5 μM primer, 0.2 mM dNTP (Pharmacia, America), 1.5 μM MgCl2 (Fermentas, EU), 1×Tap buffer (with (NH4)2SO4) (Fermentas, EU), and 1.0 U Taq DNA polymerase (Fermentas, EU). The PCR was carried out in a Mastercycler gradient PCR machine (Eastwin, China). All the PCRs were performed using a programme for denaturing at 94°C for 5 min; 5 cycles at 94°C for 45 s, 60°C for 45 s, 72°C for 1.5 min decreasing by increments of 1°C for annealing with each cycle; 38 cycles at 94°C for 45 s, 55°C for 45 s, 72°C for 1.5 min; and then extending at 72°C for 7 min. After amplification, 2 μL loading buffer was added to the PCR products. The mixture was then analysed on 1.8% agarose gel in 1×Tris-aceticacid-EDTA (TAE) buffer and stained with ethidium bromide (0.5 μg/ml). The image bands were acquired through UV light using Gel Doc XR system (Bio-rad, America). DL2000 molecular marker was used to estimate the size of the fragments amplification. All testing was repeated at least twice.

Data analysis Distinct and reproducible bands produced by ISSR primers were scored in terms of a binary code [present (1) or absent (0)] among all accessions. Jaccard’s coefficient of genetic similarity was calculated based on the binary data (matrix) (Sneath and Sokal, 1973) between all possible pairs of accessions. Each of the seven geographical groups was subjected to the following analyses: the actual number (na) of alleles was counted for each amplified locus. The effective number of alleles was estimated as ne =1 + 4Neu for each locus, where Ne is the effective population size and u is the average mutation rate (Kimura and Crow, 1964). The Shannon diversity index (I) is a common diversity index used to account for both abundance and evenness of the alleles present, and is useful for understanding allele structure at an ISSR locus (Shannon, 1949; Cai et al., 2010). Shannon’s information index was estimated for each locus using the formula

I

PiLnPi i 1 S

, where S is

the total number of alleles in the locus, and Pi is the proportion of S made up of the ith allele. Nei’s gene diversity (He) is another common diversity index in population genetics (Nei, 1973). In this study, gene diversity was estimated according to the formula of Nei (1973) for each locus, He

1

Pij2 , where Pij is the frequency

of the jth allele for ith locus summed across all alleles of the locus.

Xie et al.

7661

Table 1. Details of 84 germplasm accessions used in this study.

Sample number

Origin

Habitat

Species

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44

Rizhao,Shandong Juxian,Shandong Jiaozhou,Shandong Jiaonan,Shandong Jiaonan,Shandong Qingdao,Shandong Jiaonan,Shandong Jiaonan,Shandong Jimo,Shandong Jimo,Shandong Jimo,Shandong Jimo,Shandong Rushan,Shandong Rushan,Shandong Muping,Shandong Muping,Shandong Penglai,Shangdong Penglai,Shangdong Yantai,Shandong Chizhou,Anhui Chizhou,Anhui Nanlin,Anhui Nanlin,Anhui Nanlin,Anhui Hefei,Anhui Hefei,Anhui Feidong,Anhui Chaohu,Anhui Chaohu,Anhui Chaohu,Anhui Jurong,Jiangsu Jurong,Jiangsu Zhengjiang,Jiangsu Lianyungang,Jiangsu Lianyungang,Jiangsu Lianyungang,Jiangsu Guanyun,Jiangsu Dongtai,Jiangsu Dongtai,Jiangsu Dongtai,Jiangsu Dongtai,Jiangsu Dongtai,Jiangsu Gongjinggang,Jiangsu Gongjinggang,Jiangsu

Wilderness Mountain Ditch Hillside Roadside Hillside Alkaline land Alkaline land Roadside Alkaline land Hillside Roadside,ditch Cliff,rock tunnels Ridge,hillside Woodland Hillside Hillside Hillside Roadside Roadside,ditch Foot of a hill Hirst Hillside Hirst Roadside Nature meadow Hillside Hillside Roadside Nature meadow Nature meadow Country road Country road Mountain road Mountain road Roadside Hillside Country road Beside the pond Beside the pond Benches Benches Alkaline land Alkaline land

Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. macrostachya Franch. Et Sav Z. matrella (L.) Merr. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. sinica Hance Z. macrostachya Franch. Et Sav Z. macrostachya Franch. Et Sav Z. macrostachya Franch. Et Sav Z. macrostachya Franch. Et Sav

All these analyses were conducted using the Popgene 1.32. A clustering analysis of all accessions was performed using UPGMA method, and then principal coordinate analysis (PCA) was carried

Latitude (H) 35º17′914″ 35º29′244″ 36º12′647″ 36º06′258″ 35º59′002″ 36º18′436″ / / 36º18′976″ 36º24′286″ 36º32′324″ 36º34′123″ 36º47′931″ 37º00′255″ 37º08′806″ 37º15′789″ 37º43′298″ 37º38′765″ 37º23′861″ / 30º32′073″ 30º48′488″ 30º48′490″ 30º50′774″ 31º52′075″ 31º49′644″ 31º48′320″ 31º45′423″ 31º40′382″ 31º45′326″ 32º00′620″ 31º58′605″ 32º08′361″ 34º41′819″ 34º41′944″ 34º41′944″ 34º18′305″ 32º53′608″ 32º54′723″ 32º53′797″ 32º51′785″ 32º51′785″ 32º44′586″ 32º45′552″

Longitude (E) 119º26′164″ 119º17′954″ 120º00′611″ 119º59′635″ 119º59′109″ 120º30′786″ / / 120º37′826″ 120º41′783″ 120º38′846″ 120º38′755″ 121º21′305″ 121º29′930″ 121º29′807″ 121º31′784″ 120º49′870″ 120º50′783″ 121º21′640″ / 117º25′352″ 118º16′485″ 118º16′487″ 118º18′456″ 117º29′923″ 117º35′332″ 117º38′690″ 117º47′304″ 117º51′863″ 118º09′619″ 119º06′023″ 119º13′462″ 119º20′756″ 119º24′382″ 119º24′627″ 119º24′627″ 119º14′240″ 120º34′650″ 120º53′368″ 120º54′004″ 120º34′039″ 120º34′039″ 120º51′878″ 120º51′928″

Altitude (m) 6 106 44 35 72 99 / / 72 7 50 66 61 59 75 71 71 131 20 / 54 30 30 22 17 66 50 26 75 21 39 30 30 16 84 84 31 7 10 11 4 4 9 7

out using the software package NTSYSpc 2.1. The confidence limits for the dendrogram groupings were performed by bootstrapping using the Win Boot programme.

7662

Afr. J. Biotechnol.

Table 1. Contd.

Latitude (H) 30º36′562″ 30º34′730″ 30º34′731″ 30º36′563″

Longitude (E) 119º53′077″ 119º31′661″ 119º31′662″ 119º53′078″

Altitude (m) 146 74 -70 -142

29º03′782″

119º44′885″

39

26º05′180″ 26º05′171″ 26º05′171″ 25º48′794″ 23º13′662″ 23º25′145″ 23º25′172″ 23º25′128″ 23º02′660″ 22º53′435″ 21º01′209″ 41º33′580″ 41º03′100″ 40º12′400″ 40º12′400″ 40º16′203″ 40º19′047″ 40º18′457″ 40º19′194″ 40º22′867″

119º14′194″ 119º14′334″ 119º14′334″ 119º36′642″ 116º41′094″ 116º59′325″ 117º00′364″ 116º58′126″ 112º24′819″ 112º16′945″ 110º27′251″ 123º19′045″ 123º08′334″ 123º17′194″ 123º17′194″ 123º21′222″ 123º25′535″ 123º34′602″ 123º43′597″ 123º79′141″

30 68 68 13 23 9 9 9 12 18 19 36 77 88 88 71 92 80 96 119

Z. japonica Steud.

40º24′984″

124º03′142″

112

Z. sinica Hance Z. sinica Hance Z. sinica Hance Z. sinica Hance Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance

40º02′080″ 39º56′000″ 39º52′035″ 39º52′889″ 39º51′766″ 39º41′770″ 39º31′989″ 39º27′574″ 39º07′559″ 38º57′771″ 39º58′178″

124º21′450″ 124º16′040″ 123º54′143″ 123º42′961″ 123º31′779″ 122º55′848″ 122º28′737″ 122º24′911″ 121º43′544″ 121º19′762″ 121º19′650″

16 16 20 17 8 22 38 20 22 65 14

cultivar

Z. japonica Steud.

/

/

/

Meyer

cultivar

Z. japonica Steud.

/

/

/

Grif16454

cultivar

Z. matrella (L.) Merr.

/

/

/

Sample number

Origin

Habitat

Species

45 46 47 48

Huzhou,Zhejiang Xiaofeng,Zhejiang Xiaofeng,Zhejiang Huzhou,Zhejiang

Roadside Tea garden Tea garden Roadside

49

Jinhua,Zhejiang

Hillside

50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69

Fuzhou,Fujian Fuzhou,Fujian Fuzhou,Fujian Changle,Fujian Shantou,Guangdong Shantou,Guangdong Shantou,Guangdong Shantou,Guangdong Gaoyao,Guangdong Yunfu,Guangdong Donghai,Guangdong Shenyang,Liaoning Anshan,Liaoning Xiuyan,Liaoning Xiuyan,Liaoning Xiuyan,Liaoning Xiuyan,Liaoning Xiuyan,Liaoning Fengcheng,Liaoning Fengcheng,Liaoning

70

Fengcheng,Liaoning

71 72 73 74 75 76 77 78 79 80 81

Dandong,Liaoning Dandong,Liaoning Dandong,Liaoning Dandong,Liaoning Dandong,Liaoning Dalian,Liaoning Dalian,Liaoning Dalian,Liaoning Dalian,Liaoning Dalian,Liaoning Dalian,Liaoning

Rock tunnels Botanical garden Botanical garden Seaside Seaside Seaside Seaside Seaside Hillside Coentry road Nature meadow Dike Foot of hill Hillside Hillside Hirst Hillside Hillside Roadside Hirst Rangeland with spare forest Wilderness Roadside Mountain road Roadside Beside the pond Mountain Corn field Hillside Roadside Hillside Seaside

Z. sinica Hance Z. sinica Hance Z. japonica Steud. Z. sinica Hance Z. macrostachya Franch. Et Sav Z. japonica Steud. Z. sinica Hance Z. matrella (L.) Merr. Z. sinica Hance Z. sinica Hance Z. sinica Hance Z. matrella (L.) Merr. Z. sinica Hance Z. matrella (L.) Merr. Z. matrella (L.) Merr. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud.

82

Zenith

83 84

RESULTS ISSR analysis 33

primers

generated

388

bands

ranging

from

approximately 100 to 2000 bp in size, of which, 375 bands were polymorphic (96.65%) (Table 2). Figure 1 shows a typical PCR amplification patterns by primer I3 in 84 Zoysia accessions. Each primer produced five to 18 polymorphic bands, and the largest amount of bands was

Xie et al.

7663

Table 2. ISSR primers used in this study.

Primer P2 P3 P5 P8 P9 P10 P12 P13 P14 P20 P21 P22 P23 P25 P26 P32 P36 P39 P42 P43 P45 N1 N11 N14 N17 N20 N22 N23 N24 N25 N26 I1 I3 Total Mean

Primer sequence (5’-3’) (TG) 8RA (CA) 8A (GT) 8T (GGGGT) 3 (AC) 8YT (AC) 8YA (AC) 8YG (CCCT) 4 HVH(TG) 7 (AC) 8TG (AG) 8GCC (GACA) 4 (CA) 8TA (AC) 8GA (AC) 8C (AG) 8GC (AC) 8GT (GA) 8GCC ACTCGTACT(AG) 7 CGTAGTCGT(CA) 7 AGTCGTAGT(AC) 7 (GA) 8C (AG) 8YC (AG) 8YA (GA) 8RC (GA) 8YG (GA) 8YA (GA) 8YT (GT) 8YC (GT) 8YG (GT) 8YA (CT) 8G (AC) 8CG

Tm (°C)

Total band

61.1 61.1 61.1 69.3 61.1 61.1 63.5 70.1 53.8 64.5 69.7 59.8 62.2 64.5 63.5 66.8 64.5 69.7 71.8 73.5 71.8 63.5 63.5 61.1 63.5 63.5 61.1 61.1 63,5 63.5 61.1 63.5 66.8

18 15 16 11 17 14 8 8 16 13 9 18 9 17 7 14 7 11 7 15 11 9 9 11 10 13 8 10 15 14 8 5 15 388 11.76

produced by P2 and P22. 21 of the 33 primers showed 100% polymorphism. None of the pair of accessions exhibited identical band patterns, indicating that these ISSR primers could discriminate all the 84 accessions. 17 bands were unique to a single accession. The primer P23 amplified three unique bands, and the primer P22 produced two unique bands. Genetic similarities Jaccard’s genetic similarity coefficients (GSCs) were caculated based on the original matrix data. Pair-wise

Phlymorphism Band % 18 100 15 100 16 100 11 100 17 100 13 92.9 6 75 8 100 16 100 13 100 8 88.9 18 100 9 100 17 100 6 85.7 14 100 7 100 11 100 6 85.7 15 100 10 90.9 9 100 8 88.9 11 100 9 90 12 92.3 8 100 10 100 15 100 13 92.9 7 87.5 4 80 15 100 375 11.36 96.65

Bands size (bp) 250 - 2000 140 - 1000 250 - 2000 250 - 1200 190 - 1500 250 - 2000 250 - 1500 500 - 1700 250 - 2000 250 - 2000 250 - 1000 170 - 1900 250 - 500 210 - 1750 250 - 1700 190 - 1500 250 - 750 250 - 1000 250 - 1500 270 - 1750 150 - 1500 350 - 1600 250 - 900 210 - 1700 250 - 2000 110 - 1500 340 - 1600 250 - 1000 200 - 2000 430 - 2000 250 - 1700 300 - 1600 250 - 2000

comparison of accessions indicated GSCs between accessions ranged from a minimum of 0.644 (between 2 and 56) to a maximum of 0.866 (between 35 and 36), with a mean of 0.751. The GSCs within or among the species are shown in Table 3. The mean GSCs within the species of Z. japonica, Z. sinica, Z. macrostachya and Z. matrella (L.) was 0.760, 0.745, 0.778 and 0.749, respectively. The species Z. japonica had the most widely GSCs range (from 0.649 to 0.866). The GSCs within the Z. sinica, Z. macrostachya and Z. matrella (L.) species were changed from 0.649 to 0.845, 0.727 to 0.840, and 0.691 to 0.835, respectively. Among the species, the maximum mean GSCs (0.751) was between Z. japonica and Z. sinica (Z.

7664

Afr. J. Biotechnol.

Figure 1. PCR amplification patterns by primer I3 in 84 Zoysia accessions.

japonica vs. Z. sinica). The mean GSCs of Z. japonica vs. Z. macrostachya (0.746) was similar to that of Z. sinica vs Z. macrostachya (0.748). Meanwhile, the mean GSCs of Z. japonica vs Z. matrella (0.739) was similar to that of Z. sinica vs. Z. matrella (0.738). The mean GSCs of Z. macrostachya vs. Z. matrella (0.732) was the minimum.

Genetic diversity among different geographic groups Based on different geographic origin, the 81 accessions were divided into seven groups. Genetic parameters among the seven groups were analyzed by ISSR marker (Table 4). As shown in Table 4, polymorphism rate significantly varied with geographical groups, from 40.22% in Zhejiang to 75.98% in Liaoning. The observed

number of alleles per locus (na) varied from 1.40 in Zhejiang group to 1.76 in liaonign group. Consequently, it was shown that there was also variation for the effective number of alleles (ne), ranging from 1.22 in Anhui, Zhejiang, Fujian to 1.28 in Liaoning (Table 4). There existed varitions for I within and among the geographical groups, ranging from 0.13 in Zhejiang to 0.18 in Liaoning with an average of 0.15. He did also vary with the geographical groups, ranging from 0.20 in Zhejiang to 0.30 in Liaoning, with an average of 0.25 (Table 4). According to the polymorphism rate and gene diversity index (He and I ), the trend of genetic diversity among the seven groups was as follows: Liaoning group > Shandong group > Jiangsu and Guangdong group > Anhui group > Fujian group > Zhejiang group. The similar results were also obtained by other genetic parameters.

Xie et al.

7665

Table 3. Variance range of genetic similarity coefficient between different species of zoysiagrass.

Genetic similarity coefficient

Species comparison

Within species

Between species

Mean

Minimum

Maximum

Z. japonica vs Z. japonica

0.760

0.649

0.866

Z. sinica vs Z. sinica

0.745

0.649

0.845

Z. macrostachya vs Z. macrostachya

0.778

0.727

0.840

Z. matrella (L.) vs Z. matrella (L.)

0.749

0.691

0.835

Z. japonica vs Z. sinica Z. japonica vs Z. macrostachya

0.751 0.746

0.664 0.662

0.851 0.832

Z. japonica vs Z. matrella (L.)

0.739

0.644

0.827

Z. sinica vs Z. macrostachya

0.748

0.686

0.825

Z. sinica vs Z. matrella (L.)

0.738

0.662

0.802

Z. macrostachya vs Z. matrella (L.)

0.732

0.686

0.804

Table 4. Population genetic parameters of Zoysia sp. germplasm in China.

Parameter GS NPL PR（%） na ne I He

Shandong 19 126 70.39

Liaoning 21 136 75.98

1.70 1.26 0.17 0.27

1.76 1.28 0.18 0.30

Geographical group Anhui Zhejiang Jiangsu 11 5 14 99 72 114 55.31 40.22 63.69 1.55 1.22 0.14 0.22

1.40 1.22 0.13 0.20

1.64 1.25 0.16 0.26

Fujian 4 74 41.34

Guangdong 7 103 57.54

1.41 1.22 0.14 0.21

1.58 1.26 0.16 0.26

GS, Group size; NPL, number of polymorphic loci; PR, polymorphism rate; na, observed number of alleles; ne, effective number of alleles; I, Shannon’s information index; He, average Nei’s gene diversity.

Cluster analysis An UPGMA dendrogram was constructed based on the ISSR data (Figure 2). As a result, all the zoysiagrass accessions could be grouped into ten groups (A to J) and some of these groups (A and C) could be further clustered into subgroups. The results show that the accessions from the same geographic regions were generally, but not completely clusted in the same cluster, indicating a correlation between molecular groupings and the geographical origin. Most of these accessions (52/84=61.9%) were clustered into the group A, which can be futher divided into two sub-groups, A1 and A2. These 52 accessions were collected from Shandong, Jiangsu, Anhui and Liaoning province, respectively (Figure 2). Accessions from the same province or neighboring regions were generally clustered together in the same subgroup. For example, Subgroups A1 comprised 13 accessions from Shandong,

10 from Anhui and six from Jiangsu province. Actually, these three provinces are adjacent in geography. Subgroup A2 included all the 21 accessions (61 to 81) collected from Liaoning province, one accession from Shandong province (3) and one commercial cultivar (Grif16454). Also, all of these 52 accessions are Z. japonica and Z. sinica, except one accession of Z. matrella. As for group B, it contained eight accessions collected from Jiangsu province (37 to 44), and two accessions from Zhejiang province. Two of these accessions are Z. japonica, four are Z. sinica and the other four are Z. macrostachya. There were 11 accessions in the group C. Cluster C could be further separated into two subgroups. Subgroup C1 included the seven accessions from Zhejiang, Fujian, Guangdong province, and these accessions belong to four species. Subgroup C2 comprised four accessions and all of these are Z. sinica. The group D was composed of only two accessions collected from Shandong province. Cluster E, G, H, and J

7666

Afr. J. Biotechnol.

Figure 2. Dendrogram of 84 accessions of zoysia derived from an UPGMA cluster analysis based on Jaccard’s similarity coefficient matrix. R1, Province including: ☆, ShanDong; ★, AnHui; ◇, JiangSu; ◆, ZheJiang; □, LiaoNing; △, GuangDong; ▲, FuJian; ■, cultivated species; R2: species including ○, Z. japonica Steud.; ◎, Z. sinica Hance; ¤, Z. macrostachya Franch. Et Sav; ⊿, Z. matrella(L.) Merr.

all had only one accession from Shandong (6), Fujian (51), and Guangdong (60 and 56) province, respectively. Cluster F was composed of two commercial cultivars and

both of these cultivars are Z. japonica, while cluster I contained three accessions from Shandong and Anhui province.

Xie et al.

7667

Figure 3. Principle coordinate analysis (PCA) based on the genetic similarity coefficients derived from the polymorphic ISSR results for the 84 zoysiagrass accessions.

PCA was also performed to display the relationship among the 84 zoysiagrass types on two coordinate axes (Figure 3). The PCA revealed the similar grouping of accessions as the dendrogram constructed by UPGMA and placed the 84 genotypes into four distinct groups. Those accessions in subgroup A2 and cluster F were gathered together. Among the other Chinese natural accessions, those in cluster B and C were separated from others. Both 6 and 60 were separated from the other accessions, which were located in genetic cluster E and H

in the dendrogram, respectively. The cluster D, F, I and the sub cluster A1 of similar origin were grouped together. DISCUSSION In this study, ISSR marker was successfully used to differentiate the 81 Chinese wild zoysia accessions and three commercial cultivars. The 33 selected primers generated 388 bands with an average of 11.76 bands per

7668

Afr. J. Biotechnol.

primer. The polymorphic bands (PPB) accounted for 96.65% of total bands. The high PPB was in agreement with many investigations using ISSR technique in other plant species (Hess et al., 2000; Belaid et al., 2006; Terzopoulos and Bebeli, 2008). Therefore, it suggested that ISSR molecular markers could be effectively used to assess the genetic diversity of wild zoysia genus accessions. In this study, GSCs between each pair of the 84 accessions ranged from 0.644 to 0.866, with a mean of 0.751, suggesting a great level of genetic diversity among Chinese wild zoysiagrass accessions. Guo et al. (2007) also found a wide GSCs ranging from 0.592 to 0.936 among 96 zoysiagrass accessions collected from 12 provinces in China by SSR analysis. The difference in GSCs between these two studies could be due to the difference in accessions amount, the sampling sites, the molecular marker method, and variety of species. Moreover, similar to our findings, Guo et al. (2009) also observed that GSCs within species were higher than that among species by using SRAR markers. In this study, Z. japonica had the most widely GSCs range, followed by Z. sinica. Among the species, the maximum mean GSCs was between Z. japonica and Z. sinica. The mean GSCs of Z. japonica vs Z. macrostachya was similar to that of Z. sinica vs Z. macrostachya and the mean GSCs of Z. japonica vs Z. matrella was similar to that of Z. sinica vs Z. matrella. This was consistent with the distribution range of these four species (Li et al., 2004). Our study indicate that the mean GSCs between the species of Z. japonica and Z. sinica was significantly higher than the other five combinations, which is in agreement with the results of previous studies (Choi et al., 1997a, b; Guo et al., 2007; 2009). Both previous and our results show that zoysiagrass accessions had a great genetic variation regardless of their origination. This might be attributed to the wide distribution of zoysia, north-south across about 20 degrees in latitude (43째22 N to 23째30 N), east-west across about 34 degrees in longitude (109째E to 143째E). Therefore, with the long-term evolution, zoysiagrass formed great genetic variation in order to adapt to the different environment and weather conditions. The study indicates that there was great genetic diversity within and among the geographical groups. The genetic diversity level of seven groups is related to the sample size, the group with more samples which generally had higher genetic diversity level (Sankar and Moore, 2001). The investigations showed that Liaoning and Shandong population possessed richer genetic diversity than other populations. In China, wild zoysiagrass germplasm were distributed mainly in Liaoning and Shandong province. However, the genetic diversity of these two populations was destroyed gradually by human activities. Thereby, it was no surprise that the genetic diversity within these two populations is decreasing. The clustering results demonstrated also that the accessions belonging to the same species were not

completely clustered in the same cluster. For instance, the mean GSCs between Z. japonica and Z. sinica was higher than others, so the majority accessions of these two species were classified together. Cluster A comprised of most of these two species. Cluster B comprised two Z. japonica, four Z. macrostachya and four Z. matrella (L.) accessions. Both clusters D and F comprised two species whereas cluster E, G, H and J had only a single accessions belonging to Z. japonica, Z. sinica, Z. japonica, Z. matrella, respectively. This result indicates that the genetic differentiation in Zoysia sp. in China is less related to the taxonomic status. The same tendency was found by RAPD analysis (Lin, 2000), isozyme analysis (Weng, 2002), and SSR and SRAP analysis (Guo, 2007, 2009). Weng et al. (2007) also reported that UPGMA analysis result was inconsistent with the morphological classification of zoysia in conventional taxonomy. This phenomenon may be related with specific adaptation, flowering habit and pollination system. Probably, due to the high ability of zoysia sp. to hybridize interspecifically, the gene flow might have occurred among species. Numerous previous studies indicated that there might be certain mechanisms to promote cross-pollination in zoysia species (Hong and Yean, 1985). Thus, the outcrossing breeding system perhaps accounted for high levels of genetic variation within species and high levels of genetic similarity coefficient among species. The UPGMA clustering analysis indicated that the zoysiagrass acessions from same or adjacent regions were inclined to be classified together. This indicated that those accessions grown in a similar environment also tended to be classified together. It seems that there is some correlation between the molecular groups and geographic origins. Similar results were also found by Weng et al. (2007) in zoysia accessions collected in Taiwan, Penghu Islands and Lanyu using RAPD markers. However, there are some exceptions; the 6, 51 and 56 accessions which originated from Shandong, Fujian and Guangdong province respectively were separated from the main groups. Those accessions perhaps have some special genetic feature that is distinct from other zoysia accessions. On the other side, those exceptions might attribute to gene mutation or asexual propagation in regions other than origin area through human activities of river run-off (Yi et al, 2008). Surprisingly, three commercial cultivars were not clustered together although they were all introduced from America. Accession Grif16454 is Z. matrella (L.) which was collected originally from China while the others are Z. japonica gathered from North Korea (Meyer) and other country (Zenith) (Xu et al., 2004). The result shows that Grif16454 was clustered togther with those accessions from Liaoning Province. Therefore, Grif16454 might have been collected from Liaoning province by previous American scholars. To conclude, this study indicates abundant genetic variation among Chinese wild zoyiagrass germplasm. The majority of Chinese natural accessions from the adjacent

Xie et al.

regions were clustered into one group, showing a correlation between molecular groups and geographic origins but differentiated into species. The results might provide valuable information for the conservation of Chinese natural zoyiagrass resources. In addition, this study may also provide useful information for the selection of parental combinations in the zoysia breeding program. ACKNOWLEDGEMENT This research was supported by Innovative Program of The Chinese Academy of Sciences (Project #: KSCX2-YW-N-068) and the National Natural Science Foundation of China (Grant No. 31071822/C150302). REFERENCES Bebeli PJ, Kaltsikes PJ (1993). New developments in varietal identification. In: van Gastel AJG, Pagnotta MA, Porceddu E (Eds.). Seed Sci. Technol. ICARDA. Aleppo. Syria. pp. 161-172. Belaid Y, Chtourou-Chorbel N, Marrakchi M, Trifi-Farah N (2006). Genetic diversity within and between populations of La thyrus genus (Fabaceae) revealed by ISSR markers. Gen. Res. Crop Evol. 53: 1413-1418. Cai Y, Sun DK, Wu GJ, Peng JH (2010). ISSR-based genetic diversity of Jatropha curcas germplasm in China. Biomass and Bioenergy. Doi:10.1016/ j.biombioe. 07.001. Choi JS, Ahn BJ, Yang GM (1997a). Distribution of zoysiagrass (Zoysia sp) in the south and west coastal regions of Korea and classification using morphological characteristics. J. Korean Soc. Hortic. 38: 399-407. Choi JS, Ahn BJ, Yang GM (1997b). Classification of zoysiagrass (Zoysia. sp.) native to the southwest coastal of Korea using RAPDs. J. Korean Soc. Hort. Sci. 38: 789-795. Choi JS, Yang GM (1996). PCR conditions for effective identification of Korean native zoysiagrass (Zoysia sp.) species by DNA polymorphism. J. Korean Soc. Hort. Sci. 37: 166-170. Curley J, Jung G (2004). RAPD-based genetic relationships in Kentucky bluegrass comparison of cultivars, interspecific hybrids, and plant introductions. Crop Sci. 44: 1299-1306. Doyle JJ (1991). DNA protocols for plantsd CTAB total DNA isolation. In: Hewitt GM, Johnston A (Eds.). Molecular Techniques in Taxonomy. Springer- Verlag, Berlin, pp. 283-293. Fan Y, Li F, Zhang XQ, Ma X (2007). Genetic diversity of Hemarthria compress a germplasm detected by inter-simple sequence repeat (ISSR). Acta Pratacult. Sinica. 8: 76-81. Fukuoka H (1989). Breeding of Zoysia sp (in Japanese). J. Jpn. Soc. Turfgrass Sci. 17: 183-190. Guo HL, Liu JX, Zhou ZF, Xuan JP (2007). Interspecific Relationship and Genetic Diversity of Zoysiagrass Revealed by SSR Markers. Acta Agrestia Sinica, 16: 552-558. Guo HL, Zheng YQ, Chen X, Xue DD, Liu JX (2009). Genetic diversity and relationships of zoysiagrass as revealed by SRAP markers. Acta Agrestia Sinica, 18: 201-210. Hess J, Kadereit W, Vargas P (2000). The colonization history of Olea europaea L. in Macaronesia based on internal transcribed spacer 1 (ITS-1) sequences, randomly amplified polymorphic DNAs (RAPD) and inter-simple sequence repeats (ISSR). Mol. Ecol. 9: 857-868. Hong K, Yean DY (1985). Studies on interspecific hybridization in Korean lowngrasses (Zoysia sp.). J. Korean Soc. Hort. Sci. 26: 169-178. Jin H, Han LB (2004). Progress on genetic diversity of Zoysia japonica Steud. J. Bejing For. Uni. 26: 91-95. Jin H, Han LB, Zhang YM (2004). Studies on the Morphological Variation of Zoysia japonica in Populations. Grassland of China. 26: 50-56.

7669

Kitamura F (1970). Studies on the horticultural classification and development of Japanese lawn grasses. Bull, Kemigawa Arboretum, Fac. Agric. Univ. Tokyo. 3: 1-60. Kitamura F (1989). The climate of Japan and its surrounding areas and the distribution and classification of zoysiagrasses. Int. Turfgrass Soc. Res. J. 6: 17-21. Kimura M, Crow JF (1964). Number of alleles that can be maintained in finite population. Genetics. 49(4): 725-738. Li Y, Geng L, Liu JX (2004). Assessment on Salt-tolerance of Zoysia sp. in China. Acta Agrestia Sinica. 12: 8-16. Lin CY (2000). The response of Zoysia sp. to salinity and it’s genetic variation. MS. thesis, National Chung-Hsing University, Taichung, Taiwan. Liu W, Zhang XQ, Li F, Ma X, Fan Y (2007). Genetic diversity of bermudagrass accessions in southwest China by ISSRs molecular markers and geographic provenance. Acta Pratacult. Sinica. 16: 55-61. Nei M (1973). Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA. 70(12): 3321-3323. Nybom H (1994). DNA ingerpringting-a useful tool in fruit breeding. Euphytica, 77: 59-64. Reddy MP, Sarla N, Siddiq EA (2002). Inter simple sequence repeat (ISSR) polymorphism and its application in plant breeding. Euphytica, 128: 9-17. Sankar AA, Moore GA (2001). Evaluation of inter-simple sequence repeat analysis for mapping in Citrus and extension of the genetic linkage map.Theor. Appl. Genet. 102: 206-214. Shoji S (1983). Species ecology of zoysiagrass. J. Jpn. Soc. Turfgrass Sci. 12: 105-110. Shannon CWW (1949). The mathematical theory of communication. Urbana. University of Illinois Press. Sneath PHA, Sokal RR (1973). Numerical Taxonomy. Freeman, San Francisco CA. Terzopoulos PJ, Bebeli PJ (2008). Genetic diversity analysis of Mediterranean faba bean (Vicia faba L.) with ISSR markers. Field Crop Res. 108: 39-44. Weng JH, Chen YC (2001). Variation of salinity tolerance in Zoysia clones collected from different habitats in Taiwan. Plant Prod. Sci. 4: 313-316. Weng JH, Fan MJ, Lin CY (2007). Genetic Variation of Zoysia as revealed by random amplified polymorphic DNA (RAPD) and Isozyme pattern. Plant Prod. Sci. 10: 80-85. Weng JH (2002). Genetic variation of Zoysia in Taiwan as analyzed by isozyme patterns and salinity toerance. Plant Prod. Sci. 5: 236-241. Weng JH, Liao TS, Chen YC (1995). Distribution and morphological variation of Zoysia sp. grown in Taiwan. J. Agric. Assoc. China, 169: 44-54. Xiao HJ, Xu Z, Li LH, Ma YB, Cao SJ (2007). Genetic Diversity of Roegneria Genera Studied by ISSR Markers. Acta Agric. Boreali-Sinica, 22: 146-150. Xu LG, Tan ZJ, Tan JQ (2004). The Origin and Applied Region of Zoysiagrasses in USA. Acta Horticult Sin. 31(1): 124-129. Yaneshita M, Nagasawa R, Engelke MC (1997). Genetic variation and interspecific hybridization among natural populations of zoysia-grasses detected by RFLP analyses of chloroplast and nuclear DNA. Gene. Genet. Syst. 72: 173-179. Yi YJ, Zhang XQ, Huang LK, Ling Y, Ma X, Liu W (2008). Genetic diversity of wild Cynodon dactylon germplasm detected by SRAP markers. Hereditas, 30: 94-100. Zeng B, Zhang XQ, Fan Y, Lan Y, Ma X, Peng Y, Liu W (2006). Genetic diversity of Dactylis glomerata germplasm resources detected by inter-simple sequence repeats (ISSRs) Molecular Markers. Hereditas, 28: 1093-1100.

African Journal of Biotechnology Vol. 11(30), pp. 7670-7675, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.1192 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

An investigation on mechanisms of blanked nut formation of hazelnut (Corylus heterophylla fisch) Jian-feng Liu, Yun-qing Cheng*, Kun Yan and Qiang Liu College of Life Sciences, Jilin Normal University, Siping 136000, China. Accepted 22 July, 2011

The occurrence of blank nuts is common in Corylus heterophylla Fisch orchards of China. This study was aimed to find the possible mechanisms involved in blank nuts formation in wild C. heterophylla Fisch species. The effects of pollination, defoliation and girdling on fruit production of C. heterophylla Fisch were studied from northern China. The effect of pollination on various aspects of the reproductive output of C. heterophylla Fisch was studied by performing hand pollination, open pollination and no pollination. Different pollination types significantly affected flower cluster set including no flower cluster set produced in no pollination treatment. However, pollination type had no direct effect on nut and kernel traits. Three defoliation treatments (control, 50 and 100% leaf removal) were applied at branch level on 10 trees. Six branches were used per treatment in each tree and half of these branches were girdled (a ring of bark and cambium was removed from the branch base). Leaf removal from ungirdled branches had little effect on pistillate flower cluster set, fruit cluster set and nuts per cluster. However, these variables decreased as the extent of 100% defoliation increased on girdled branches. Defoliation and girdling reduced nut and kernel weight which was the result of a reduction in the kernel weight rather than nut coat reduction. Control of the carbohydrate supply to the reproductive shoots by girdling and defoliation made no difference to nut number and size but the kernel percent and blank nut ratio were highly sensitive to carbohydrate availability. Resource importation not exportation by fruiting branches might be a mechanism to reduce blank nut in this species. Key words: Corylus heterophylla Fisch, pollination, defoliation, girdling, blank nut.

INTRODUCTION Corylus heterophylla Fisch, the Asian Hazel is a species of hazel native to eastern Asia including northern China, eastern Mongolia, Korea, Japan and southeastern Siberia (Whitcher and Wen, 2001). Although the nuts of C. heterophylla Fisch have smaller and thicker shells characteristics; the important wild species in China was cultivated commercially for some desirable and economically important traits such as flavor, nonsuckering growth habit, and tolerance to alkaline soil, and exceptionally early maturation and cold hardiness. C. heterophylla Fisch is at present an expanding crop in China due to increased demand by the processing industry. Fruit production of hazelnuts mainly depends on

*Corresponding author. E-mail address: chengyunqing1977@163.com Tel: +86-434-3294489.

the number of female flower setting fruit. Thus, maximizing fruit set is an important measure to increase hazel production. The occurrence of blank nuts is common in C. heterophylla Fisch orchards. Shell-kernel weight ratio is the main determinate of quality and price of hazelnuts. The most common defect “blank nuts” in Chinese cultivar have a significant effect on the shell-kernel weight ratio. “Blank” means a filbert containing no kernel or a kernel filling less than one-fifth capacity of the shell. Most species of hazelnut are largely self-incompatible and a number of studies have suggested that self-incompatibility was often associated with a higher frequency of blanks (Erdogan and Mehlenbacher, 2001; Beyhan and Marangoz, 2007). One of the more intriguing aspects of the reproductive biology of hazelnuts is the temporal separation of pollination and fertilization. At the time of pollination, the ovary is not formed and grows only if the flower is pollinated.

Liu et al.

The formation of ovules begins in March and fertilization occurs by the end of May or during the first three weeks of June; two to three months after pollination when the diameter of the nuts is 7 to 10 mm (Germain, 1994). Therefore, different environmental stressors often occur at different stages between pollination and fertilization and lead to poor nut set and higher frequency of blanks (Solar and Stampar, 2001). Hazelnuts fill their fruits in the months of June, July and August. C. heterophylla Fisch has high fruit set and large amount of photosynthates are needed during kernel filled stage while photosynthate sinks closest to the leaves tend to be the strongest, so insufficient photosynthates importing into nuts in the filled stage can result in shriveled kernels (Kholupenko et al., 2003). Thus, some authors suggested that the limited resource translocation of carbohydrates from the photosynthetic pool was a possible cause of blank nuts. We investigated possible mechanisms involved in the blank kernels formation in wild C. heterophylla Fisch species. The following two hypotheses were set and tested: H1: The self-incompatible characteristics in C. heterophylla Fisch have an effect on the cluster set of nuts but not the reason of blanked nut. H2: The lack of assimilate substances during development of fertilization fruits is the possible cause of blanks and shriveled kernels.

MATERIALS AND METHODS The study was conducted at an area located in the Siping region (Jilin, China, 43° 09′ 20″ N, 124° 30′ 16″ E) from March 2008 to October 2009. The area has a slope around 5% with a southwestern aspect. The adjacent vegetation is mainly natural evergreen forest with some cleared farmland nearby. The C. heterophylla Fisch species are grown in the shrub growing form in China, thus the experimental unit was shrub growing system. Samples were collected from five systems (six plants per shrub system). All studied individuals were exposed to sunlight. Plant height ranged from approximately 1.2 to 2.3 m. Pistillate flower clusters (cymule) and fruit clusters of wild C. heterophylla Fisch species were examined from 2008 to 2009. The effect of pollination on various aspects of the reproductive output of C. heterophylla Fisch was studied by performing hand pollination, open pollination and no pollination. Open-pollinated flowers were collected weekly during the flowering period. For artificial pollination, one to two branches of each tester tree were emasculated by clipping catkins and were covered with Tyvek bags (1*0.5 m) in late March. This was done to isolate female inflorescence and prevent exposure to air-borne pollen. A second Tyvek bag was used to cover and protect the inner bag from damage by wind. Only female flowers from covered branches were used for hand pollination and no pollination test. Abrasion of the styles of flowers by the bag renders them unsuitable for testing. When staminate catkins elongate and are about to shed pollen, they were collected, placed on a sheet of paper in the laboratory and allowed to dry overnight at room temperature (20°C). The following morning the catkins were discarded and pollen was collected and stored in cotton-stoppered vials in the freezer (4°C) for pollination. Hand pollination was made by dusting self-pollen over receptive stigmas with a thin soft brush.

7671

No pollination was made on individual branches or the entire trees depending on plant size. Some unpollinated flowers were collected when styles were visible. Hand pollinated flowers were collected after hand pollination for 24 h. When staminate catkins elongate and are about to shed pollen, they were collected, placed on a sheet of paper in the laboratory and allowed to dry overnight at room temperature (24°C). The following morning, the catkins were discarded and pollen was collected from testers and stored in cotton stopper glass vials at 0°C until used. Some female flowers were pollinated by hand when styles were visible outside the bud or were exerted beyond the red dot stage (>2 mm). The numbers of treated flowers and harvested nut clusters were counted and percent cluster set was calculated as the ratio of nut clusters to flowers pollinated. Pistillate flower clusters were harvested 24 h after hand and no pollination, and styles were processed for fluorescence microscopy for pollen germination and tube growth as follows: for cytochemical assays with bright field and epifluorescence observations using a light microscope, the sampled material was fixed in formalin-acetoalcohol (FAA) for 48 h and then transferred to 70% ethanol for storage. Fixed samples were then dehydrated in an ethanol series (50, 80, 95, 100, 100%: 12 h each) and transferred to an embedding solvent (xylene; Panreac Quimica SA, Montcada i Reixac, Spain) through a xylene-ethanol series (30, 50, 80, 100, 100%: 12 h each) and finally saturated with paraffin (Paraplast Xtra; Sigma, St Louis, USA). Sections (10 µm thick) were cut with a rotary microtome (Nahita 534; Auxilab SA, Beriain, Spain) and attached to adhesive-treated microscope slides (polysine slides; Menzel GmbH & Co KG, Braunschweig, Germany). Samples were embedded in paraffin, sectioned at 10 mm in a rotary microtome and stained with hematoxylin or safranin-fast green (Odabas, 1976). A girdling treatment was applied to the fruit branch to inhibit the supply of assimilates and/or other substances to the fruit via phloem transport. The effect of this girdling on the occurrence of blanks on the tree was then investigated. The effect of defoliation and girdling on nut characteristics of C. heterophylla was studied after flowering finished. From 28 May 2008, we selected 10 trees for study. After measuring the number of leaves and the fruits on these twigs, 18 tagged shoots per tree were selected for defoliation. Three defoliation treatments (control, 50 and 100% leaf removal) were applied at branch level in 10 trees. Six branches were used per treatment in each tree and half of these branches were girdled. A subset of reproductive shoots was girdled by removing a ring of bark and cambium approximately 1.0 cm wide from the base of the shoot and 5 mm in diameter. This procedure interrupts phloem transport but does not affect xylem transport (Obeso, 1998). Other tagged shoots that were neither defoliated nor girdled, acted as controls. The presence or absence of fruit developed from each flower was recorded so as to determine the fruit set in late-May (the green fruit period just after flowering, hereafter called initial fruit set), in mid-July (the middle stages of seed maturation, hereafter called middle fruit set) and in mid-September (the final stages of seed maturation, hereafter called final fruit set). To examine the effect of assimilate limitation and pollination on fruit traits, the following variables were determined; the green fruits were counted on 28 May as the time for defoliation and girdled. The tagged branches with ripe nuts were harvested on 28 September and the following variables were determined after oven drying; for each sample, the following characters were examined: nuts per cluster, nut and kernel weights, kernel percent (%), shell thickness (mm), good kernel (%) and blank nut (%). In addition, flower cluster drop (%) and fruit cluster drop (%) were examined in the pollination samples. The design of each experiment was completely randomized with a one-way ANOVA arrangement. Statistical analyses were performed with SAS system 8.0 software and the means were compared using Duncan’s multiple range test at 5% level (Duncan, 1955) and values expressed as a percentage were previously

7672

Afr. J. Biotechnol.

Table 1. Cluster set in different pollinations treatments of hazelnuts for the period of 2008 to 2009.

Hand pollination Open pollination No pollination

Number of pollination 120 120 60

Pistillate flower cluster drop ratio/percentage e 10.83±0.41 31.67±1.50c 100.00a

Fruit cluster drop ratio/percentage b 29.47±1.15 22.50±0.96d -

Total drop ratio/percentage e 40.30±2.10 54.17±2.65c 100.00a

Hand pollination Open pollination No pollination

120 120 60

13.33±0.68d b 35.83±1.63 a 100.00

34.17±1.50a c 25.00±1.30 -

47.50±2.95d b 60.83±3.47 a 100.00

1.95

2.22

3.54

Year

Treatment

2008

2009

LSD at 0.05

Values are means ± SD. Different letters within a column indicate significant difference at 5% level by Duncan’s multiple range tests.

Table 2. Cluster set and frequency of blank nuts at different defoliation and girdling treatments.

Parameter

Control Ungirdled Girdled

Pistillate flower cluster 26.43±1.35bc drop ratio/percentage Fruit cluster drop 35.26±1.87b ratio/percentage c total drop ratio/percentage 61.69±1.67

50% defoliation Ungirdled Girdled

100% defoliation Ungirdled Girdled

LSD at 0.05

25.45±1.58c

28.67±1.35ab

30.32±1.18a

30.09±1.29a

29.43±1.62a

2.64

34.23±1.91b

37.73±1.77b

37.56±1.53b

35.39±1.94b

52.27±2.97a

3.85

b

b

c

59.68±1.77

b

66.4±1.60

67.88±1.39

65.48±1.71

a

81.7±2.58

4.29

Values are means ±SD. Different letters within a line indicate significant difference at 5% level by Duncan’s multiple range tests.

transformed by calculating the angular transformation.

RESULTS AND DISCUSSION The different pollination treatment had significant effect on the flower and nut cluster set (Table 1). No flower cluster set was observed in the no-pollinated hazelnut shoots in both years. The total cluster drop varied from 54.17 to 60.83% in both years in the open pollination treatment and there was significant difference for total cluster drop between 2008 and 2009. In C. heterophylla Fisch, hand pollination significantly decreased the pistillate flower cluster drop when compared with the open pollination and no pollination treatments but the fruit cluster drop ratio in the hand pollination treatment was higher than the open pollination in both years. Both pistillate flower cluster drop ratio and fruit cluster drop ratio were relatively high in the control treatment, and defoliation and girdling affected both the pistillate flower cluster drop ratio and the fruit cluster drop (Table 2). Defoliation had little effect on the fruit cluster drop of the ungirdled branches but reduced the fruit cluster set on girdled branches especially the final fruit cluster set. Considering the ungirdled branches alone, 50 and 100% defoliation treatment showed no reduced fruit cluster production compared with the control branches. When girdled branches are considered, fruit cluster drop

increased from 34.23 to 52.27% as the extent of defoliation increased from 0 to 100 % (Table 2). Beyhan and Marangoz, (2007) reported that cluster droppings were caused by the genetic constitution of the cultivar, alternate bearing habit, pollen source, sexual incompatibility, cultural practices (nutritional deficiencies, lack of irrigation, disease and insect pests) and environmental conditions. According to our result, difference in the percentage of the pistillate flower cluster dropping between different pollination types in the same cultivar was evident. No flower cluster set (initial fruit set) was observed in the no-pollinated hazelnut shoots in both years. Thus, we believed that pollination and fertilization had a direct effect on the flower cluster set. Thompson (1979) also reported that some ovaries could not grow more than 0.5 mm and these no pollination pistillate flowers dropped in April and May. Thus, lack of fertilization directly led to flower or nut drop. Hand pollination, open pollination and no pollination was performed in the field to verify the effect of pollination and fertilization on the empty of hazelnuts (Table 3 and Figure 1). Fluorescing pollen tubes can be seen at the base of the style after pollinations for 24 h (Figure 1A). We can observe the complete embryo even in the blank nuts (Figure 1F). Hand pollination significantly increased the nuts per cluster compared with the open pollination. But the open pollination was beneficial for the kernel weight and the kernel percent compared to hand pollination

Liu et al.

Table 3. Nut and kernel traits in controlled and open pollinations of hazelnuts for the period of 2008 to 2009.

Hand pollination Open pollination No pollination

Number of nuts per cluster a 4.22±0.15 3.57±0.15b -

Nut weight (g) a 1.61±0.06 1.45±0.06b -

Kernel weight (g) b 0.41±0.02 0.36±0.01c -

Kernel percent (%) bc 25.47±0.99 24.83±1.01c -

Good Blank kernel (%) nut (%) a a 60.4±2.35 44.6±1.54 ab 56.7±2.32 43.3±1.77a -

Hand pollination Open pollination No pollination

4.19±0.15a b 3.32±0.12 -

1.69±0.06a b 1.47±0.05 -

0.46±0.02a b 0.42±0.02 -

27.22±1.27ab a 28.57±1.11 -

61.2±2.87a b 54.5±2.12 -

43.8±1.82a a 45.5±1.77 -

0.36

0.12

0.03

2.08

5.24

3.27

Year

Treatment

2008

2009

LSD at 0.05

Values are means ± SD. Different letters within a column indicate significant difference at 5% level by Duncan’s multiple range tests.

Figure 1. Pollen tubes in a pollinated pistil, and development of full and empty nut of Corylus heterophylla. A) control style; B) fluorescing pollen tubes can be seen in style; C) complete embryo could be observed in full nut; D) blank nut, arrow showed the embryo location in blank nut; E) embryo filling the entire ovule; F) complete embryo could be observed in blank nuts (D).

7673

7674

Afr. J. Biotechnol.

Table 4. Nut and kernel traits at different defoliation and girdling treatments.

Parameter Number of nuts per cluster Nut weight (g) Kernel weight (g) Nut coat (g) Kernel percent (%) Good kernel (%) Blank nut (%)

Control Ungirdled Girdled

50% defoliation Ungirdled Girdled

4.72±0.18ab

4.92±0.24a

4.56±0.15bc

4.62±0.18abc

ab

a

b

ab

1.45±0.06 b 0.36±0.01 b 1.09±0.04 b 34.83±1.32 b 46.5±1.95 53.5±2.08c

1.53±0.06 a 0.47±0.02 b 1.06±0.04 a 38.83±1.86 a 59.3±3.44 40.7±1.54d

1.38±0.05 c 0.30±0.01 b 1.08±0.04 c 29.70±0.95 c 41.7±1.54 58.3±2.09c

100% defoliation Ungirdled Girdled

1.47±0.07 c 0.29±0.01 a 1.18±0.06 c 29.72±1.15 c 44.6±2.18b c 55.4±2.82

4.63±0.20abc c

1.21±0.06 d 0.17±0.01 b 1.04±0.05 d 21.05±0.90 d 25.3±1.19 74.7±3.51b

LSD at 0.05

4.34±0.20c

0.33

c

0.10 0.02 0.08 2.22 3.39 7.46

1.14±0.05 e 0.08±0.00 b 1.06±0.05 e 16.45±0.76 e 11.3±0.52 88.7±4.08a

Note: values are means ±SD. Different letters within a line indicate significant difference at 5% level by Duncan’s multiple range tests.

(Table 3). The ratio of blank nut changed from 43.8 to 45.6% between the hand and open pollination in 2008 and 2009; different pollination model had no significant effect on the blank ratio. A higher frequency of blanks was believed from sexual incompatibility (Erdogan and Mehlenbacher, 2001; Silva et al., 1996) but in our study, no nuts formation can be observed if the flower were not pollinated and fertilized. Furthermore, complete embryo structure can be observed even in the blank nut (Figure 1). So we concluded that unpollinated flower never reaches the size of a blank nut (Thompson, 1967). We could easily see the fluorescing pollen tubes at the base of the style after pollinations for 24 h; hence, we deduced the high frequency of blank nuts not caused by selfpollination. The results of nut and kernel traits at different defoliation and girdling are shown in Table 4. Girdling and defoliation had little effect on the nuts of per cluster; when 100% defoliated branches were girdled, the branches decreased 9% of their nut production per cluster in proportion to the control ungirdled branches and they produced 88.2% of nut production per cluster in the control girdled branches. The detrimental effect of defoliation and girdling consisted in a reduction of nut and kernel weight which was the result of a reduction in the kernel weight rather than nut coat reduction. The proportion of the good kernel made up by the kernel and nut coat varied among treatments from 16.45 to 38.83%. The ratio of blank nut and kernel percent were significantly affected by defoliation and girdling. In the control treatment, girdling branch produced more kernel percent and low blank nut ratio than girdled branch. But in 50 defoliation treatment, there was no significant different in the kernel percent and blank nut ratio. But in 100 defoliation treatment, the kernel percent (16.45%) and blank nut ratio (88.7%) in the girdled branch was higher than the ungirdled branch (11.3 and 74.7%). Girdling and defoliation and their reaction had little effect on the nuts of per cluster. There was little reduction in nut production in the girdled-100% defoliated branches when compared with the control branches.

There are two alternative explanations for this result: either the nuts of per cluster was not decided by assimilates content but by fertilization or the only sources of assimilates for these branches were the reserves stored in the shoots and/or photosynthesis on green fruits (Hogewoning et al., 2007; Obeso, 1998; Hoch, 2005). Defoliation and girdling and their reaction significantly affected nut mass, which was the result of a reduction in the mass of the kernel rather than the nut coat reduction. Kernel weight proportion of the fruit made up by the kernel mass and nut mass varied among treatment from 16.45 to 38.83%, which means that nut coat was maintained despite whole nut mass reduction (Table 4). When girdling in the control branch was applied, the branches increased the kernel percent and decreased the blank ratio in proportion to the ungirdling branch. However, when 100% defoliated branches were girdled, they produced lower kernel percent (16.45%) and higher blank nut ratio (88.7%) than the ungirdled branch which means that they exported some assimilates to other branches in the cultivation practices (Rivas et al., 2007; Goren et al., 2004). Increase kernel percent and decrease in the blank nut ratio may be the import of resources from other branches rather than export. The ability of resource importation developed by fruiting branches might be a mechanism to increase nut and kernel trait in this species. ACKNOWLEDGEMENT The authors thank the National Natural Science Foundation of China for the financial support (Grant numbers: 31070610/C161102). REFERENCES Beyhan N, Marangoz D (2007). An investigation of the relationship between reproductive growth and yield loss in hazelnut. Sci. Hortic. 113(2): 208-215. Erdogan V, Mehlenbacher SA (2001). Incompatibility in wild Corylus species. Acta. Hort. (ISHS) 556: 163-170.

Liu et al.

Germain E (1994). The reproduction of hazelnut (Corylus avellana L.): a review. Acta Hortic. (ISHS)351: 195-210. Goren R, Huberman M, Goldschmidt EE (2004). Girdling: physiological and horticultural aspects. Hortic. Rev. 30: 1-36. Hoch G (2005). Fruit-bearing branchlets are carbon autonomous in mature broad-leaved temperate forest trees. Plant Cell Environ. 28: 651-659. Hogewoning SW, Trouwborst G, Engbers GJ, Harbinson J, Van Ieperen W, Ruijsch J, Van kooten O, Schapendonk AHCM, Pot CS (2007). Plant physiological acclimation to irradiation by light-emitting diodes (LEDS). Acta Hort. (ISHS)761: 183-191. Kholupenko IP, Voronkova NM, Burundukova OL, Zhemchugova VP (2003). Demand for assimilates determines the productivity of intensive and extensive rice crops in primorskii krai. Russian J. Plant Physiol. 50(1): 112-118. Obeso JR (1998). Effects of defoliation and girdling on fruit production in ilex aquifolium. Funct. Ecol. 12(3): 486-491.

7675

Rivas F, Gravina A, Augustí M (2007). Girdling effects on fruit set and quantum yield efficiency of PSII in two Citrus cultivars. Tree Physiol. 27: 527-535. Silva AP, Riberio RM, Santos A, Rosa E (1996). Blank fruits in hazelnut (Corylus avellana L.) cv. ‘Butler’: characterization and influence of climate. J. Hort. Sci. 71(5): 709-720. Solar A, Stampar F (2001). Influence of boron and zinc application on flowering and nut set in Tonda di gifoni hazelnut. Acta Hortic. 556: 307-309. Thompson MM (1967). Role of pollination in nut development. Proc. Nut Growers Soc. Ore. Wash. 53: 31-36. Thompson MM (1979). Growth and development of the pistillate flower and nut in 'Barcellona' filbert. J. Am. Soc. Hort. Sci. 104: 427-432. Whitcher IN, Wen J (2001). Phylogeny and biogeography of Corylus (Betulaceae): inferences from ITS sequences. Syst. Bot. 26: 283-298.

African Journal of Biotechnology Vol. 11(30), pp. 7676-7685, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3345 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Effects of soil flooding on photosynthesis and growth of Zea mays L. seedlings under different light intensities Xiuping Wang1,2, Tianxue Liu1,2, Chaohai Li1,2* and Hao Chen1,2 1

Agronomy College, Henan Agricultural University, Zhengzhou 450002, P. R. China. Huanghuaihai Regional Innovation Center for Maize Technology, Ministry of Agriculture, Zhengzhou 450002, P. R. China.

2

Accepted 14 March, 2012

Soil flooding is one of the major abiotic stresses that repress maize (Zea mays L.) growth and yield, and other environmental factors often influence soil flooding stress. This paper reports an experimental test of the hypothesis that light intensity can influence the responses of maize seedlings to soil flooding. In this experiment, maize seedlings were subjected to soil flooding at the two-leaf stage under control light (600 µmol m-2 s-1) or low light (150 µmol m-2 s-1) conditions. Under control light growth conditions, the average photosynthetic rate (PN), transpiration rate (E) and water use efficiency (WUE) were 70, 26 and 59%, respectively, higher in non-flooded than in flooded seedlings; and the average chlorophyll a (Chl a), chlorophyll b (Chl b) and Chl a+b were 31, 42 and 34%, respectively, higher in non-flooded than in flooded seedlings; and the average belowground biomass and total biomass were 52 and 34%, respectively, higher in non-flooded than in flooded seedlings. There was a slight decrease of seedling biomass in six days flooded seedlings under low light growth conditions. The effects of flooding on photosynthetic, seedling growth and shoot/root ratio were more pronounced under control light growth conditions than under low light growth conditions, which indicate that even for maize which is a C4 plant, relatively high light intensity still aggravated soil flooding stress, while low light growth condition mitigated soil flooding stress, and suggests that light effects should be considered when we study maize responses to soil flooding. Key words: Biomass accumulation, gas exchange, light limitation, maize, stress. INTRODUCTION Flooding is one of the remarkable abiotic stresses and yield-limiting factor following water shortage, salinity and extreme temperatures in most arable farmland for many crops (Rosenzweig et al., 2002; Huang and Rozelle,1995; Visser et al., 2003). Soil flooding rapidly depletes soil oxygen and lowers soil redox pote-ntial; thereby, the roots

*Corresponding author. E-mail: lichaohai2005@yahoo.com.cn. Tel: 86-0371-63555629. Fax: 86-0371-63555629. Abbreviations: C4, C4 Plants; Chl, chlorophyll; Ci, intercellular CO2 concentration; E, transpiration rate; Fv/Fm, maximum photochemical efficiency of PSII; gs, stomata conductance; NF, non-flooded; PN, net photosynthetic rate; PPFD, photosynthetic photon flux density; PSII, photosystem 2; RuBPCO, ribulose-1,5-bisphosphate carboxylase/oxygenase; WUE, water use efficiency.

suffer a shortage of oxygen and roots aerobic respiration is dramatically decreased. This will result in a sharp decline in ATP level (Vartapetian and Jackson, 1997). Insufficient energy reduces mineral elements, water absorption and transportation, thereby, altering diverse aspects of plant metabolism such as accelerating lipid peroxidation and leaf senescence and inhibiting growth (Kozlowski, 1984; Pezeshki, 2001; Boru et al., 2003; Yan et al., 1996; Vartapetian and Jackson, 1997). The reduction of net photosynthetic rate (PN) is one of the most important responses of plants to soil flooding which could be caused by stomata and non-stomata limitations to photosynthesis and lead to severe yield reduction (Yordanova and Popova, 2007; Rosenzweig et al., 2002).The stomata limitation occurs in the first few hours after soil flooding and leads to a rapid decrease in photosynthesis and transpiration by monitoring stomata morphometric, intercellular CO2 (Ci) and stomata

Wang et al.

conductance (gs) (Yordanova et al., 2005; Jackson, 2002). With prolonged flooding stress, non-stomata limitation also plays an important role in photosynthesis reduction. The non-stomata limitation is mainly caused by the damage of photosynthetic apparatus and lower biochemical reactions efficiency of the photosynthesis. This includes lipid peroxidation caused by chloroplast membrane structure destruction, ribulose-1,5bisphosphate carboxylase/oxygenase (RuBPCO) activity and maximum photochemical efficiency of PSII (Fv/Fm reduction) (Yordanova and Popova, 2007; Pociecha et al., 2008; Yordanova and Popova, 2001; Mielke and Schaffer, 2010a). Leaf chlorophyll destruction of flooded plants was also confirmed by a great deal of studies (Yan et al., 1996; Yordanova and Popova, 2001; Mielke and Schaffer, 2011; Jing et al., 2009). Responses to soil flooding could also be influenced by other environmental factors such as temperature and light (Ojeda et al., 2004; Mielke and Schaffer, 2011; Mielke and Schaffer, 2010a, b, 2011; Lavinsky et al., 2007). The interaction effects between soil flooding and light intensity on photosynthesis have been discovered on C3 species (Mielke and Schaffer, 2010a, b, 2011; Lavinsky et al., 2007). However, little attention was paid to C4 species because the C4 species have a higher light saturation point and light use efficiency. During the crop growth period, flooding stress was often caused by heavy precipitation or prolonged rainfall accompanied by dense clouds and low irradiance for photosynthesis. Since most of the cereal crops are fond of light, lots of agronomists did a lot of studies on the effects of low irradiance on crops photosynthesis physiology (Li et al., 2005; Zhang et al., 2007; Drozak and Romanowska, 2006) and yield (Lazaro et al., 2010; Earley et al., 1966; Gerakis and Papakostatasopoulou, 1980; Kiniry and Ritchie, 1985; Reed et al., 1988; Jia et al., 2011). The authors are aware of few published work on the effects of both flooding and different irradiance on photosynthesis physiology of mesophyte C4 species. To test the hypothesis that different light intensities can alter the response of mesophyte C4 species to soil flooding on photosynthesis, we conducted an experiment aiming at investigating the effects of soil flooding under control light (600 µmol m-2 s-1) and low light (150 µmol m-2 s-1) conditions on chlorophyll fluorescence, leaf chlorophyll content and leaf gas exchange of Zea mays L., which is an important high light demanding crop and most sensitive to soil flooding at two-leaf stage (Liu et al., 2010).

MATERIALS AND METHODS Plants cultivation and treatments Maize elite hybrid

ZhengDan958

(ZD958)

was

used

in

this

7677

experiment. Seeds were sown in plastic pots (6 L) with Eutric Cambisol sandy loam soil (USDA), which was taken from the Experimental Farm of the Henan Agricultural University, China, amended with 1.0 g (NH4)2SO4, 0.8 g P2O5 and 0.6 g K2O per kg soil and cultivated at light intensity of 600 µmol m-2 s-1 at canopy height, 14/10 h day/night, 28/22°C day/night and about 60% relative humidity in a growth chamber until the second leaf fully expanded. The low light treatment was grown at light intensity of 150 µmol m-2 s-1 at canopy height with other environmental factors kept the same with the high light treatment. Flooding stress was initiated at the two-leaf stage by filling with water to 20 to 30 mm above the soil surface. The controls were irrigated as needed to avoid drought stress or flooding stress.

Gas exchange measurements Leaf gas exchange was measured on the second leaf at six days after flooding treatment. PN, gs, Ci and E were simultaneously recorded with a portable photosynthesis measurement system (CIRAS-1, PP-System, Hitchin, UK) under uniform conditions [28°C, 450 ± 10 µmol (CO2) mol–1, 60% RH]. The photosynthetic photon flux density (PPFD) was maintained at 600 µmol m-2 s-1. Chlorophyll content analysis and maximum quantum efficiency of PSII determination Leaf pigments were extracted in 20 ml 95% ethanol in the dark by using 0.1 g leaf samples at 25 Leaf pigments were extracted in 20 ml 95% ethanol in the dark by using 0.1 g leaf samples at 25°C till fully blanched. The concentrations of leaf chlorophyll content were determined according to Lichtenthaler (1987), where absorbance was measured at 470, 649 and 664 nm using spectrometer (TU-1810SPC, Purkinje General, China). At various flooding intervals (0, 2, 4 and 6 days), chlorophyll fluorescence was measured with a pulse modulated fluorometer (FMS-2, Hansatech Instruments, Norfolk, UK) in the same leaves previously used for gas-exchange measurements. Minimal fluorescence of darkadapted state (F0) was measured under the low modulating light over a 1.6-s period on leaves adapted to dark for 20 min, and maximal fluorescence of dark-adapted state (Fm) was induced by a single saturating pulse of light (8,000 µmol m-2 s-1) applied over 0.8 s. The Fv/Fm was determined as (Fm - F0)/Fm.

Biomass allocation Plant biomass was measured using five seedlings per pot. After separating plants into shoots and roots, biomass accumulation was determined after drying to a constant weight at 70°C, and the shoot/root ratio was calculated as the ratio of shoot to root biomass.

Statistical analysis General linear model univariate analysis was used to assess the relationships between flood and light intensity treatments simultaneously. When interactive effects between flooding and light intensity were observed, independent-samples T-test was used for comparisons of flooding effects within light environments and light intensity effects within flood treatments. When interactive effects were not observed, only comparisons between flood treatments within light environments were analyzed by independent-samples T-test. Data were expressed as mean ± standard deviations (SD) of four replications within each factor. All analyses were performed using SPSS 16.0 for Windows (SPSS, Inc., Chicago, IL).

7678

Afr. J. Biotechnol.

Table 1. Responses of net photosynthetic rate (PN), intercellular CO2 concentration (Ci), stomata conductance (gs), transpiration rate (E) and water use efficiency (WUE) to soil flooding under control light (CL, 600 µmol m-2 s-1) and low light (LL, 100 µmol m-2 s-1) conditions.

Variable PN (µmol m-2 s-1) Ci (µmol mol-1) -2 -1 gs (mmol m s ) -2 -1 E (mmol m s ) WUE [mmol (CO2) mol (H2O)]

CL NF FL 18.9±1.5a 5.1±2.5b 127.2±27.5b 210.4±31.8a a a 126.8±23.8 110.8±22.3 a b 3.3±0.3 2.43±0.2 a 5.9±1.0 2.1±1.2b

LL NF FL 17.1±0.3a 14.2±3.0a 121.4±38.4a 111.7±11.2a a a 97.5±26.3 75.0±13.5 a a 2.8±0.6 2.3±0.3 a 6.4±1.3 6.2±0.5a

L * * * * *

ANOVA F L*F * * * * ns ns * * * *

Different letters show significant differences among means at p<0.05. Means ± SD (n = 4). NF, non-flooded; FL, flooded; ns,p>0.05; *, p<0.05.

RESULTS Gas exchange Six days after flooding treatment, there were significant differences between control light and low light grown seedlings for PN, Ci, gs, E and WUE (p<0.05) and significant differences between non-flooded and flooded seedlings for PN, Ci, E and WUE (p<0.05) (Table 1). There were significant interactions between flood and light treatments for PN, Ci, E and WUE (p<0.05). The average values of PN, E and WUE were significantly higher (p< 0.05), and Ci was significantly lower (p< 0.05) in non-flooded than in flooded seedlings under control light growth conditions. However, all the parameters related to photosynthesis were similar in both non-flooded and flooded seedlings under low light growth conditions. The average PN, E and WUE were 70, 26 and 59%, respectively, higher, whereas Ci was 57% lower in non-flooded than in flooded seedlings under control light growth conditions. Chlorophyll content and chlorophyll fluoresce Six days after flooding treatment, chlorophyll contents in low light growth seedlings were similar to that of the control light growth seedlings, while there were significant differences between non-flooded and flooded seedlings for Chl a, Chl b and Chl a+b (p<0.05) (Figure 1). There were significant interactions between flood and light treatments for Chl a, Chl b, Chl a+b and Chl a/b (p<0.05) (Figure 1). The average values of Chl a, Chl b, and Chl a+b were significantly higher (p<0.05) in non-flooded than in flooded seedlings under control light growth conditions. However, chlorophyll contents were similar in both non-flooded and flooded seedlings under low light growth condition. The average Chl a, Chl b and Chl a+b were 31, 42 and 34%, respectively, higher in non-flooded than in flooded seedlings under control light growth conditions. There was no significant variation in Fv/Fm among the treatments two days after flooding treatment. The average

values of Fv/Fm in flooded seedlings were significantly lower at four (p<0.05) and six (p<0.001) days after flood treatment than the control under control light grown conditions (Figure 2). There was a slight decrease of Fv/Fm in the seedlings of six days flooding period under low light growth conditions. Seedling biomass and allocation Six days after flood treatment, there were significant differences between control light and low light grown seedlings for shoot biomass, belowground biomass and total biomass (p<0.05) and significant differences between non-flooded and flooded seedlings for belowground biomass, total biomass and shoot/root ratio (p<0.05) (Figure 3). There were significant interactions between flood and light treatments for belowground biomass, total biomass and shoot/root ratio (p<0.05). The average values of belowground biomass and total biomass were significantly higher (p<0.05) and shoot/root ratio was significantly lower in non-flooded than in flooded seedlings under control light growth conditions (Figure 3). However, seedling biomass and shoot/root ratio were similar in both non-flooded and flooded seedlings under low light growth conditions. The average belowground biomass and total biomass were 52 and 34%, respectively, higher in non-flooded than in flooded seedlings under control light growth condition. There was a slight decrease of seedling biomass in six days flooded seedlings under low light growth conditions. DISCUSSION Results of this experiment show that control light grown seedlings were more sensitive to soil flooding, which is in agreement with previous studies on Eugenia uniflora L. (Mielke and Schaffer 2010a, b, 2011), even for the plant used here which is a C4 pathway. There was an interactive effect of soil flooding and light intensities on maize seedling photosynthesis and growth (Table 1 and

Wang et al.

3.0

Chl a [mg g-1 FW]

2.5

A

NF FL

2.0 1.5 1.0 0.5 0.0 CL

LL

B

Chl b [mg g-1 FW]

1.0 0.8 0.6 0.4 0.2

Chl a+b [mg g-1 FW]

0.0 CL

LL

CL

LL

CL

LL

C

3

2

1

0

D

2.5

Chl a/b

2.0 1.5 1.0 0.5 0.0

Figure 1. Responses of Chl a (A), Chl b (B), Chl a+b (C) and, Chl a/b (D) to soil flooding under control light (CL, 600 µmol m-2 s-1) and low light (LL, 100 µmol m-2 s-1) conditions. Means ± SD (n = 4). NF, non-flooded; FL, flooded.

7679

7680

Afr. J. Biotechnol.

0.84

NF FL

B

A

Fv/Fm

0.82

0.80

0.78

0.76 0

2

4

6

Days after treatment

0

2

4

6

Days after treatment

Figure 2. Responses of maximum photochemical efficiency of PSII, and Fv/Fm of maize seedlings after zero, two, four and six days exposure to soil flooding under control light (600 µmol m-2 s-1, A) and low light (100 µmol m-2 s-1, B) conditions. Means ± SD (n = 4). NF, non-flooded; FL, flooded.

Figure 3), which is similar to the previous study on Genipa americana L. (Lavinsky et al., 2007). Effects of soil flooding on photosynthesis of Z. mays L. seedlings under different light intensities The markedly decrease of PN was observed in flooded seedlings with non-significant changes in the E and gs under low light growth conditions. These results are in agreement with that of Yordanova and Popova (2007) for maize seedlings subjected to flooding under 160 µmol m-2 s-1 PAR. Ci value was higher in flooded seedlings than non-flooded seedlings under control light growth conditions and similar in both flooded and non-flooded seedlings under low light growth conditions. This indicates that stomata closure was not the primary limitation for the reduction of PN. A non-stomatal effect on the photosynthetic process can play a more important role in the PN decrease. We also found a significant interaction effect of light irradiance level and flood treatment of photosynthesis of maize seedlings as there are several reports on tree species (Wagner and Dreyer, 1997; Lavinsky et al., 2007; Mielke and Schaffer, 2010a, b). Despite the fact that maize is a C4 pathway plant, a relatively higher light irradiance still aggravating flooding stress induced photosynthesis capacity decrease. PN is positively correlated with leaf chlorophyll content (Hidema et al., 1991; Kura-Hotta et al., 1987). Six days after flooding treatment, chlorophyll content in the leaves of control light grown seedlings decreased significantly. This is possibly because flooding stress resulted in a significant increase in chlorophyll breakdown (Yan et al., 1996; Yordanova and Popova, 2001; Pociecha et al., 2008). However, contrary to the result of Yordanova and Popova (2007), chlorophyll contents in the leaves of low

light grown seedlings were similar both for flooded and non-flooded treatments. This might be because the samples in their experiment were all leaf tissues, but we only sampled the second leaf. In fact, we did observe that the first leaf was senescence and turned yellow. According to Ashraf and Arfan (2005), Chl a/b in flooded seedlings was higher than non-flooded seedlings under high light grown conditions because the declining extent of chl b was more than chl a. So, here in our experiment, the reduction of PN was accompanied by chlorophyll content decrease, showing another evidence for their correlation. Fv/Fm values for non-stressed leaves are remarkably consistent (about 0.83) (Björkman and Demmig, 1987). A decline of Fv/Fm provides very useful information to reflect the effects of biotic and abiotic stresses in light on photosynthesis (Lavinsky et al., 2007; Baker, 2008; Balachandran and Osmond, 1994). The significant decrease of Fv/Fm at four (p<0.05) and six (p<0.001) days in flooded than non-flooded seedlings under control light growth conditions (Figure 2) indicate that an important portion of photosynthetic electron transport system was destroyed whereas, the average value of Fv/Fm was similar between flooded and non-flooded seedlings under low light growth conditions indicating that leaves of flooded seedlings grown under high light were more susceptible to the photoinhibition of photosynthesis (Mielke and Schaffer, 2011; Baker, 2008). Effects of soil flooding on growth of Z. mays L. seedlings under different light intensities Flood significantly repressed root growth under both control light and low light growth conditions, and increased shoot/root ratio under control light growth

Wang et al.

0.5

Shoot biomass [g plant-1]

NF FL

A

0.4

0.3

0.2

0.1

0.0 CL

LL

CL

LL

CL

LL

CL

LL

B

Root biomass [g plant-1]

1.0 0.8 0.6 0.4 0.2 0.0

Total biomass [g plant-1]

1.4

C

1.2 1.0 0.8 0.6 0.4 0.2 0.0 D

Shoot/Root Ratio

1.0 0.8 0.6 0.4 0.2 0.0

Figure 3. Responses of shoot biomass (A), root biomass (B), total biomass (C) and shoot/root ratio (D) to soil flooding under control light (CL, 600 µmol m-2 s-1) and low light (LL, 100 µmol m-2 s-1) conditions. Means ± SD (n = 5). NF– non-flooded; FL– flooded. Means ± SD (n = 5). NF– non-flooded; FL– flooded.

7681

7682

Afr. J. Biotechnol.

conditions but shoot/root ratio was similar between flooded and non-flooded low light grown seedlings (Figure 3). Repressed root growth is a common response to flood stress for many plants (Mielke and Schaffer, 2010b; Chen et al., 2002; Wagner and Dreyer, 1997). As flooding leads to lack of oxygen around the roots, insufficient oxygen inhibits mitochondrial respiration and ATP synthesis, and enhances a less efficient metabolism pathway-glycolysis. In turn, energy limitation decreases the ability of roots to absorb water and nutrients, then decrease root growth rate and dry matter accumulation under hypoxic conditions (Mielke and Schaffer, 2010b; Kozlowski, 2002) whereas, decreased biomass allocation to root is an adaptive mechanism to soil flooding of the plant by diminishing the metabolic requirement of roots for oxygen (Naidoo and Naidoo, 1992). In summary, an interactive effect of flood and light intensity was found in maize in laboratory conditions, although the control light we used was 600 µmol m-2 s-1 photosynthetically active radiation (PAR), which is much lower than maize light saturation point. Plant undergoing flood stress was more sensitive when grown under relative high light conditions than low light conditions, demonstrating that the responses of the C4 plant to flooding stress may be also dependent on light availability during the growth period. Interactions between flooding stress and light intensity on photosynthesis and growth of the plant should be considered in studies aimed at predicting changes in the plant production as a function of changes in rainfall associated with global climate change. ACKNOWLEDGEMENTS This work was financed by the Commonweal Scientific Research Project of Henan Province (No.091100910100).

REFERENCES Ashraf M, Arfan M (2005). Gas exchange characteristics and water relations in two cultivars of Hibiscus esculentus under waterlogging. Biol. Plant. 49(3): 459-462. Baker NR (2008). Chlorophyll Fluorescence: A Probe of Photosynthesis In Vivo. Annu. Rev. Plant Biol. 59(1): 89-113. Balachandran S, Osmond CB (1994). Susceptibility of Tobacco Leaves to Photoinhibition following Infection with Two Strains of Tobacco Mosaic Virus under Different Light and Nitrogen Nutrition Regimes. Plant Physiol. 104(3): 1051-1057. Björkman O, Demmig B (1987). Photon yield of O2 evolution and chlorophyll fluorescence characteristics at 77K among vascular plants of diverse origins. Planta, 170(4): 489-504. Boru G, Vantoai T, Alves J, Hua D, Knee M (2003). Responses of Soybean to Oxygen Deficiency and Elevated Root-zone Carbon Dioxide Concentration. Ann. Bot. 91(4): 447-453. Chen H, Qualls RG, Miller GC (2002). Adaptive responses of Lepidium latifolium to soil flooding: biomass allocation, adventitious rooting, aerenchyma formation and ethylene production. Environ. Exp. Bot. 48(2): 119-128. Drozak A, Romanowska E (2006). Acclimation of mesophyll and bundle sheath chloroplasts of maize to different irradiances during growth. Biochim. Biophys. Acta Bioenerg. 1757(11): 1539-1546.

Earley EB, Miller RJ, Reichert GL, Hageman RH, Seif RD (1966). Effect of Shade on Maize Production Under Field Conditions. Crop Sci. 6(1): 1-7. Gerakis PA, Papakostatasopoulou D (1980). Effects of Dense Planting and Artificial Shading on 5 Maize Hybrids. Agric. Meteorol. 21(2): 129-137. Hidema J, Makino A, Mae T, Ojima K (1991). Photosynthetic Characteristics of Rice Leaves Aged under Different Irradiances from Full Expansion through Senescence. Plant Physiol. 97(4): 1287-1293. Huang J, Rozelle S (1995). Environmental stress and grain yields in China. Am. J. Agric. Econ. 77(4): 853-864. Jackson MB (2002). Long distance signalling from roots to shoots assessed: the flooding story. J. Exp. Bot. 53(367): p. 175. Jia SF, Li CF, Dong ST, Zhang JW (2011). Effects of Shading at Different Stages After Anthesis on Maize Grain Weight and Quality at Cytology Level. Agric. Sci. China, 10(1): 58-69. Jing YX, Li GL, Gu BH, Yang DJ, Xiao L, Liu RX, Peng CL (2009). Leaf gas exchange, chlorophyll fluorescence and growth responses of Melaleuca alternifolia seedlings to flooding and subsequent recovery. Photosynthetica, 47(4): 595-601. Kiniry JR, Ritchie JT (1985). Shade-Sensitive Interval of Kernel Number of Maize. Agron. J. 77(5): 711-715. Kozlowski T (1984). Plant responses to flooding of soil. BioSci. 34(3): 162-167. Kozlowski T (2002). Physiological-ecological impacts of flooding on riparian forest ecosystems. Wetl. 22(3): 550-561. Kura-Hotta M, Satoh K, Katoh S (1987). Relationship between Photosynthesis and Chlorophyll Content during Leaf Senescence of Rice Seedlings. Plant Cell Physiol. 28(7): 1321-1329. Lavinsky A, De Souza Sant’Ana C, Mielke M, De Almeida AA, Gomes F, França S, Da Costa Silva D (2007). Effects of light availability and soil flooding on growth and photosynthetic characteristics of Genipa americana L. seedlings. New For. 34(1): 41-50. Lazaro L, Abbate PE, Cogliatti DH, Andrade FH (2010). Relationship between yield, growth and spike weight in wheat under phosphorus deficiency and shading. J. Agric. Sci. 148(1): 83-93. Li CH, Luan LM, Wang Q, Li N, Zhao YL (2005). Effects of Seedling Shangding and Light Intensity Transfer on Photosynthetic Efficiency of Different Maize (Zea mays L.) Hybrids (In Chinese with english abstract). Acta Agron. Sin. 31(3): 381-385. Lichtenthaler HK (1987). Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol. 148: 350-382. Liu YZ, Tang B, Zheng YL, Ma KJ, Xu SZ, Qiu FZ (2010). Screening Methods for Waterlogging Tolerance at Maize (Zea mays L.) Seedling Stage. Agric. Sci. China, 9(3): 362-369. Mielke M, Schaffer B (2011). Effects of soil flooding and changes in light intensity on photosynthesis of Eugenia uniflora L. seedlings. Acta Physiol. Plant. 33(5): 1661-1668. Mielke MS, Schaffer B (2010a). Leaf gas exchange, chlorophyll fluorescence and pigment indexes of Eugenia uniflora L. in response to changes in light intensity and soil flooding. Tree Physiol. 30(1): 45-55. Mielke MS, Schaffer B (2010b). Photosynthetic and growth responses of Eugenia uniflora L. seedlings to soil flooding and light intensity. Environ. Exp. Bot. 68(2): 113-121. Naidoo G, Naidoo S (1992). Waterlogging responses of Sporobolus virginicus (L.) Kunth. Oecologia, 90(3): 445-450. Ojeda M, Schaffer B, Davies FS (2004). Flooding, root temperature, physiology and growth of two Annona species. Tree Physiol. 24(9): 1019-1025. Pezeshki SR (2001). Wetland plant responses to soil flooding. Environ. Exp. Bot. 46(3): 299-312. Pociecha E, Koscielniak J, Filek W (2008). Effects of root flooding and stage of development on the growth and photosynthesis of field bean (Vicia faba L. minor). Acta Physiol. Plant. 30(4): 529-535. Reed AJ, Singletary GW, Schussler JR, Williamson DR, Christy AL (1988). Shading Effects on Dry Matter and Nitrogen Partitioning, Kernel Number, and Yield of Maize. Crop Sci. 28(5): 819-825. Rosenzweig C, Tubiello FN, Goldberg R, Mills E, Bloomfield J (2002). Increased crop damage in the US from excess precipitation under climate change. Glob. Environ. Change, 12(3): 197-202. Vartapetian BB, Jackson MB (1997). Plant Adaptations to Anaerobic

Wang et al.

Stress. Ann. Bot. 79(suppl 1): 3-20. Visser EJW, Voesenek LACJ, Vartapetian BB, Jackson MB (2003). Flooding and Plant Growth. Ann. Bot. 91(2): 107-109. Wagner PA, Dreyer E (1997). Interactive effects of waterlogging and irradiance on the photosynthetic performance of seedlings from three oak species displaying different sensitivities (Quercus robur, Q-petraea and Q-rubra). Ann. Sci. Forest. 54(5): 409-429. Yan B, Dai QJ, Liu XZ, Huang SB, Wang ZX (1996). Flooding-induced membrane damage, lipid oxidation and activated oxygen generation in corn leaves. Plant Soil. 179(2): 261-268. Yordanova R, Uzunova A, Popova L (2005). Effects of short-term soil flooding on stomata behaviour and leaf gas exchange in barley plants. Biol. Plant, 49(2): 317-319.

7683

Yordanova RY, Popova LP (2001). Photosynthetic Response of Barley Plants to Soil Flooding. Photosynthetica, 39(4): 515-520. Yordanova RY, Popova LP (2007). Flooding-induced changes in photosynthesis and oxidative status in maize plants. Acta Physiol. Plant, 29(6): 535-541. Zhang JW, Dong ST, Wang KJ, Hu CH, Liu P (2007). Effects of Shading in Field on Photosynthetic Characteristics in Summer Corn (In Chinese with english abstract). Acta Agron. Sin. 33(2): 216-222.

African Journal of

Biotechnology Volume 11

Number 30

ISSN 1684-5315

12 April, 2012

ABOUT AJB The African Journal of Biotechnology (AJB) is published bi-weekly (one volume per year) by Academic Journals. African Journal of Biotechnology (AJB) a new broad-based journal, is an open access journal that was founded on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed.

Submission of Manuscript Submit manuscripts as e-mail attachment to the Editorial Office at: ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com. A manuscript number will be mailed to the corresponding author shortly after submission. For all other correspondence that cannot be sent by e-mail, please contact the editorial office (at ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com). The African Journal of Biotechnology will only accept manuscripts submitted as e-mail attachments. Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given the last name of the first author.

Editors George Nkem Ude, Ph.D Plant Breeder & Molecular Biologist Department of Natural Sciences Crawford Building, Rm 003A Bowie State University 14000 Jericho Park Road Bowie, MD 20715, USA N. John Tonukari, Ph.D Department of Biochemistry Delta State University PMB 1 Abraka, Nigeria Prof. Dr. AE Aboulata Plant Path. Res. Inst., ARC, POBox 12619, Giza, Egypt 30 D, El-Karama St., Alf Maskan, P.O. Box 1567, Ain Shams, Cairo, Egypt Dr. S.K Das Department of Applied Chemistry and Biotechnology, University of Fukui, Japan Prof. Okoh, A. I Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and Microbiology, University of Fort Hare. P/Bag X1314 Alice 5700, South Africa Dr. Ismail TURKOGLU Department of Biology Education, Education Faculty, Fırat University, Elazığ, Turkey Prof T.K.Raja, PhD FRSC (UK) Department of Biotechnology PSG COLLEGE OF TECHNOLOGY (Autonomous) (Affiliated to Anna University) Coimbatore-641004, Tamilnadu, INDIA. Dr. George Edward Mamati Horticulture Department, Jomo Kenyatta University of Agriculture and Technology, P. O. Box 62000-00200, Nairobi, Kenya.

Dr Helal Ragab Moussa Bahnay, Al-bagour, Menoufia, Egypt. Dr VIPUL GOHEL Flat No. 403, Alankar Apartment, Sector 56, Gurgaon122 002, India. Dr. Sang-Han Lee Department of Food Science & Biotechnology, Kyungpook National University Daegu 702-701, Korea. Dr. Bhaskar Dutta DoD Biotechnology High Performance Computing Software Applications Institute (BHSAI) U.S. Army Medical Research and Materiel Command 2405 Whittier Drive Frederick, MD 21702 Dr. Muhammad Akram Faculty of Eastern Medicine and Surgery, Hamdard Al-Majeed College of Eastern Medicine, Hamdard University, Karachi. Dr. M.MURUGANANDAM Departtment of Biotechnology St. Michael College of Engineering & Technology, Kalayarkoil, India. Dr. Gökhan Aydin Suleyman Demirel University, Atabey Vocational School, Isparta-Türkiye, Dr. Rajib Roychowdhury Centre for Biotechnology (CBT), Visva Bharati, West-Bengal, India. Dr.YU JUNG KIM Department of Chemistry and Biochemistry California State University, San Bernardino 5500 University Parkway San Bernardino, CA 92407

Editorial Board Dr. Takuji Ohyama Faculty of Agriculture, Niigata University

Dr. Mehdi Vasfi Marandi University of Tehran

Dr. FÜgen DURLU-ÖZKAYA Gazi Üniversity, Tourism Faculty, Dept. of Gastronomy and Culinary Art

Dr. Reza Yari Islamic Azad University, Boroujerd Branch

Dr. Zahra Tahmasebi Fard Roudehen branche, Islamic Azad University

Dr. Tarnawski Sonia University of Neuchâtel – Laboratory of Microbiology

Dr. Albert Magrí Giro Technological Centre

Dr. Ping ZHENG Zhejiang University, Hangzhou, China. Prof. Pilar Morata University of Malaga

Dr. Greg Spear Rush University Medical Center

Dr. Mousavi Khaneghah College of Applied Science and Technology-Applied Food Science, Tehran, Iran.

Prof. Pavel KALAC University of South Bohemia, Czech Republic.

Dr. Kürsat KORKMAZ Ordu University, Faculty of Agriculture, Department of Soil Science and Plant nutrition

Dr. Tugay AYAŞAN Çukurova Agricultural Research Institute, PK:01321, ADANA-TURKEY.

Dr. Shuyang Yu Asistant research scientist, Department of Microbiology, University of Iowa Address: 51 newton road, 3-730B BSB bldg.Tel：+319-3357982, Iowa City, IA, 52246, USA.

Dr. Binxing Li E-mail: Binxing.Li@hsc.utah.edu

Dr Hsiu-Chi Cheng National Cheng Kung University and Hospital.

Dr. Kgomotso P. Sibeko University of Pretoria, South Africa.

Dr. Jian Wu Harbin medical university , China.

Instructions for Author Electronic submission of manuscripts is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Arial font). The cover letter should include the corresponding author's full address and telephone/fax numbers and should be in an e-mail message sent to the Editor, with the file, whose name should begin with the first author's surname, as an attachment. Article Types Three types of manuscripts may be submitted: Regular articles: These should describe new and carefully confirmed findings, and experimental procedures should be given in sufficient detail for others to verify the work. The length of a full paper should be the minimum required to describe and interpret the work clearly. Short Communications: A Short Communication is suitable for recording the results of complete small investigations or giving details of new models or hypotheses, innovative methods, techniques or apparatus. The style of main sections need not conform to that of full-length papers. Short communications are 2 to 4 printed pages (about 6 to 12 manuscript pages) in length. Minireview: Submissions of mini-reviews and perspectives covering topics of current interest are welcome and encouraged. Mini-reviews should be concise and no longer than 4-6 printed pages (about 12 to 18 manuscript pages). Mini-reviews are also peer-reviewed.

Regular articles All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title page. The Title should be a brief phrase describing the contents of the paper. The Title Page should include the authors' full names and affiliations, the name of the corresponding author along with phone, fax and E-mail information. Present addresses of authors should appear as a footnote. The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. The Abstract should be 100 to 200 words in length.. Complete sentences, active verbs, and the third person should be used, and the abstract should be written in the past tense. Standard nomenclature should be used and abbreviations should be avoided. No literature should be cited. Following the abstract, about 3 to 10 key words that will provide indexing references should be listed. A list of non-standard Abbreviations should be added. In general, non-standard abbreviations should be used only when the full term is very long and used often. Each abbreviation should be spelled out and introduced in parentheses the first time it is used in the text. Only recommended SI units should be used. Authors should use the solidus presentation (mg/ml). Standard abbreviations (such as ATP and DNA) need not be defined.

Review Process All manuscripts are reviewed by an editor and members of the Editorial Board or qualified outside reviewers. Authors cannot nominate reviewers. Only reviewers randomly selected from our database with specialization in the subject area will be contacted to evaluate the manuscripts. The process will be blind review. Decisions will be made as rapidly as possible, and the journal strives to return reviewers’ comments to authors as fast as possible. The editorial board will re-review manuscripts that are accepted pending revision. It is the goal of the AJB to publish manuscripts within weeks after submission.

The Introduction should provide a clear statement of the problem, the relevant literature on the subject, and the proposed approach or solution. It should be understandable to colleagues from a broad range of scientific disciplines.

Materials and methods should be complete enough to allow experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. Capitalize trade names and include the manufacturer's name and address. Subheadings should be used. Methods in general use need not be described in detail.

Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the authors' experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. Discussion, speculation and detailed interpretation of data should not be included in the Results but should be put into the Discussion section. The Discussion should interpret the findings in view of the results obtained in this and in past studies on this topic. State the conclusions in a few sentences at the end of the paper. The Results and Discussion sections can include subheadings, and when appropriate, both sections can be combined. The Acknowledgments of people, grants, funds, etc should be brief. Tables should be kept to a minimum and be designed to be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes. Each table should be on a separate page, numbered consecutively in Arabic numerals and supplied with a heading and a legend. Tables should be self-explanatory without reference to the text. The details of the methods used in the experiments should preferably be described in the legend instead of in the text. The same data should not be presented in both table and graph form or repeated in the text. Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, TIFF, JPEG or Powerpoint before pasting in the Microsoft Word manuscript file. Tables should be prepared in Microsoft Word. Use Arabic numerals to designate figures and upper case letters for their parts (Figure 1). Begin each legend with a title and include sufficient description so that the figure is understandable without reading the text of the manuscript. Information given in legends should not be repeated in the text. References: In the text, a reference identified by means of an author‘s name should be followed by the date of the reference in parentheses. When there are more than two authors, only the first author‘s name should be mentioned, followed by ’et al‘. In the event that an author cited has had two or more works published during the same year, the reference, both in the text and in the reference list, should be identified by a lower case letter like ’a‘ and ’b‘ after the date to distinguish the works. Examples: Smith (2000), Blake et al. (2003), (Kelebeni, 1983), (Chandra and Singh,1992),(Chege, 1998; Steddy, 1987a,b;

Gold, 1993,1995), (Kumasi et al., 2001) References should be listed at the end of the paper in alphabetical order. Articles in preparation or articles submitted for publication, unpublished observations, personal communications, etc. should not be included in the reference list but should only be mentioned in the article text (e.g., A. Kingori, University of Nairobi, Kenya, personal communication). Journal names are abbreviated according to Chemical Abstracts. Authors are fully responsible for the accuracy of the references. Examples: Diaz E, Prieto MA (2000). Bacterial promoters triggering biodegradation of aromatic pollutants. Curr. Opin. Biotech. 11: 467-475. Dorn E, Knackmuss HJ (1978). Chemical structure and biodegradability of halogenated aromatic compounds. Two catechol 1, 2 dioxygenases from a 3chlorobenzoate-grown Pseudomonad. Biochem. J. 174: 73-84. Pitter P, Chudoba J (1990). Biodegradability of Organic Substances in the Aquatic Environment. CRC press, Boca Raton, Florida, USA. Alexander M (1965). Biodegradation: Problems of Molecular Recalcitrance and Microbial Fallibility. Adv. Appl. Microbiol. 7: 35-80. Boder ET, Wittrup KD (1997). Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotechnol. 15: 537-553.

Short Communications Short Communications are limited to a maximum of two figures and one table. They should present a complete study that is more limited in scope than is found in full-length papers. The items of manuscript preparation listed above apply to Short Communications with the following differences: (1) Abstracts are limited to 100 words; (2) instead of a separate Materials and Methods section, experimental procedures may be incorporated into Figure Legends and Table footnotes; (3) Results and Discussion should be combined into a single section. Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF file. Page proofs are considered to be the final version of the manuscript. With the exception of typographical or minor clerical errors, no changes will be made in the manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that the editorial office waive some of the handling fee under special circumstances. Copyright: Š 2012, Academic Journals. All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary bibliographic citation, including author attribution, date and article title. Submission of a manuscript implies: that the work described has not been published before (except in the form of an abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the publisher. Disclaimer of Warranties In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or not advised of the possibility of damage, and on any theory of liability. This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or information in this publication or of any other publication to which it may be linked.

African Journal of Biotechnology Table of Contents:

Volume 11

Number 30 12 April, 2012,

International Journal of Medicine and Medical Sciences

ences

ARTICLES

. Research Articles GENETICS AND MOLECULAR BIOLOGY Molecular cloning and characteristic analysis of a thioredoxin from Neobenedenia melleni Zhe-Liang Sheng, Xin-Jiang Lu and Jiong Chen Ultra-structural study of Egyptian Buffalo oocytes before and after in Vitromaturation I. A. H. Barakat, H. M. El–Ashmaoui, A. Barkawi, S. A. Kandeal and E. EL-Nahass Optimization of plasmid electrotransformation into Escherichia coli using Taguchi statistical method Mohamad Heiat, Hossein Aghamollaei, Seeyed mostafa Hoseinei, Reza Abbasi Larki and Kheirollah Yari Isolation and identification of Metarhizium anisopliae from Chilo venosatus (Lepidoptera: Pyralidae) cadaver Lei Liu, Rulin Zhan, Laying Yang, Changcong Liang, Di Zeng and Junsheng Huang

7582

7592

7603

7609

PLANT AND AGRICULTURAL TECHNOLOGY Purification of an elicitor from Magnaporthe oryzae inducing defense resistance in rice Chunyan Ji and Zhenzhong Wang Increasing the amylose content of maize through silencing of sbe2agenes Shuyan Guan, Yiyong Ma, Huijing Liu, Siyan Liu, Guangna Liu, Lina Zhao and Piwu Wang Common vetch-wheat intercropping: Haylage yield and quality depending on sowing rates Karagic Dura, Mikic Aleksandar, Milosevic Branko, Vasiljevic Sanja and Dusanic Nenad

7618

7628

7637

Table of Contents:

Volume 11

Number 30

12 April, 2012

ences ARTICLES Physiology of seed yield in soybean: Growth and dry matter production M. A. Malek, M. M. A. Mondal, M. R. Ismail, M. Y. Rafii and Z. Berahim

7643

PLANT AND AGRICULTURAL TECHNOLOGY Effect of heavy metal and EDTA application on heavy metal uptake and gene expression in different Brassica species Madiha Iqbal, Jehan Bakht, Mohammad Shafi and Rafi Ullah

7649

Genetic diversity in Chinese natural zoysiagrass based on inter-simple sequence repeat (ISSR) analysis Y. Xie, L. Liu, J. Fu and H. Li

7659

An investigation on mechanisms of blanked nut formation of hazelnut (Corylus heterophylla fisch) Jian-feng Liu, Yun-qing Cheng, Kun Yan and Qiang Liu

7670

FOOD TECHNOLOGY Effects of soil flooding on photosynthesis and growth of Zea mays L. seedlings under different light intensities 7676 Xiuping Wang, Tianxue Liu, Chaohai Li and Hao Chen

APPLIED BIOCHEMISTRY Propagation physiology of Juniperus phoenicea L. from Jordan using seeds and in vitro culture techniques: Baseline information for a conservation perspective 7684 Ezz AL-Dein Al-Ramamneh, Susan Dura and Nidal Daradkeh

Table of Contents:

Volume 11

Number 30

12 April, 2012

ences ARTICLES ENVIRONMENTAL BIOTECHNOLOGY Lactic acid fermentation from refectory waste: Factorial design analysis Didem OMAY and Yuksel GUVENILIR Optimization of growth parameters for increased yield of the edible mushroom Calocybe indica Gopinath Lakshmipathy, Arunkumar Jayakumar, Meera abhilash and Shantha Prema Raj Isolation and characterization of toebicin 218, a bacteriocin, produced by Geobacillus toebii HBB-218 Gamze Başbülbül Özdemir and Haci Halil Biyik

7693

7701

7711

APPLIED BIOCHEMISTRY Proximate and mineral analysis of some wild edible mushrooms I. O. Okoro and F. I. Achuba Stabilization and preservation of probiotic properties of the traditional starter of African opaque sorghum beers A. P. Polycarpe Kayodé, Deloris C. Deh, Lamine Baba-Moussa, Simeon O. Kotchoni and Joseph D. Hounhouigan Qianliening capsule treats benign prostatic hyperplasia (BPH) by down-regulating the expression of PCNA, CyclinD1 and CDK4 Xiaoyong Zhong, Jiumao Lin, Jianheng Zhou, Wei Xu, Zhenfeng Hong and Jun Peng

7720

7725

7731

MEDICAL AND PHARMACEUTICAL BIOTECHNOLOGY Isolation, purification and effects of hypoglycemic functional polysaccharides from Inonotus obliquus Tao Hu, Ping Liu, Yuanying Ni and Chuntao Lu

7738

Table of Contents:

ences

Volume 11

Number 30 12 April, 2012

ARTICLES

BIOTECHNIQUES Morphological and chemical characteristics of tomato foliage as mechanisms of resistance to Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) larvae 7744 Muahmmad Ashfaq, Muhammad Sajjad, Muhammad Noor ul Ane and Noureen Rana

PHARMACEUTICAL SCIENCE Bacterial content in the intestine of frozen common carp Cyprinus carpio Ahmed H. Al-Harbi and Md. Naim Uddin Generation and characterization of a stable red fluorescent transgenicTanichthys albonubes line Qing Jian, Min Chen, Jun-jie Bai, Peng Jiang, Jia-jia Fan, Xing Ye and Shi-ling Xia Soybean (Glycine max) as a versatile biocatalyst for organic synthesis Luciana M. Bertini, Telma L. G. Lemos, Leonardo A. Alves, Francisco Jose Q. Monte, Marcos C. de Mattos and Maria da Conceição F. de Oliveira

7751

7756

7766

ENTOMOLOGY Passive and active immunity against parvovirus infection in piglets Nenad Stojanac, Mladen Gagrčin, Ognjen Stevančević, Ivan Stančić and Aleksandar Potkonjak

7771

BIOTECHNIQUES The use of kefir as potential probiotic in Çoruh trout (Salmo coruhensis): Effects on growth performance and immunoglobulin (IgM) levels Erkan CAN, Filiz KUTLUYER, Fatma DELİHASAN SONAY and Özay KÖSE

7775

ANIMAL SCIENCE Molecular cloning and characterization of a novel Cys2/His2-type zinc finger protein gene from chrysanthemum Qing-Lin Liu, Jiao Wu, Ke-Dong Xu, Liang-Jun Zhao and Hai-Qing Zhang

7781

African Journal of Biotechnology Vol. 11(30), pp. 7582-7591, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3098 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Molecular cloning and characteristic analysis of a thioredoxin from Neobenedenia melleni Zhe-Liang Sheng1,2, Xin-Jiang Lu1* and Jiong Chen1* 1

Faculty of Life Science and Biotechnology, Ningbo University, Ningbo 315211, People’s Republic of China. College of life sciences, Inner Mongolia Agricultural University, Hohhot, 010019, Inner Mongolia, People’s Republic of China.

2

Accepted 27 February, 2012

Thioredoxin (Trx) can regulate disulfide bond reduction of target proteins to maintain the reduced intracellular state in various organisms. Here, we cloned a cDNA sequence of thioredoxin from Neobenedenia melleni, which is a kind of platyhelminth parasite infecting many fishes of great economic value. The deduced N. melleni Trx (NmTrx) contained 170 amino acid residues with an active site consisting of four amino acid motif CPGC. Sequence comparison and phylogenetic tree analysis confirmed NmTrx as a distinct member of thioredoxin. Real-time quantitative polymerase chain reaction (PCR) revealed a significantly higher expression of NmTrx transcript in the adult stage compared with the egg and oncomiracidium stages. In the egg and adult stages, the NmTrx transcript level in the 32°C group was higher than those in the 18 and 25°C groups. NmTrx was expressed and purified from Escherichia coli, and antiserum against NmTrx was prepared. Western blot confirmed the higher NmTrx expression of the egg and adult stages in the 32°C group with respect to the other temperature groups. Recombinant NmTrx was able to reduce the disulfide bond in insulin, and its antioxidant capacity was determined to be 5.12 U/mg protein, similar to the classic thioredoxins. Trx activity was lower in the oncomiracidium stage and higher in the adult stage compared with the egg stage. These results indicate that NmTrx could function as an important antioxidant molecule under physiological conditions. Key words: Thioredoxin, Neobenedenia melleni, redox regulation, mRNA expression, prokaryotic expression. INTRODUCTION The cellular damage due to the formation of reactive oxygen species (ROS) results in the development of antioxidant systems to maintain the reduced intracellular state by protecting molecule structure. In the cells, the mitochondrial respiratory chain is the major source of ROS (Chen et al., 2003). ROS might get attached to protein molecules and damage their functions (Roos and Messens, 2011). Thioredoxin (Trx), a hydrogen-carrying protein, plays an important role in maintaining the cellular redox state by control of reactive oxygen. It is first

*Corresponding authors. E-mail: lxj711043@163.com. Tel: 086574-87609571. Fax: 086-574-87600167. Abbreviations: Trx, Thioredoxin; GSH, glutathione; NmTrx, a thioredoxin from N. melleni; ANOVA, one-way analysis of variance.

characterized as a hydrogen donor for ribonucleotide reductase in Escherichia coli (Holmgren, 1979). Trxs are characterized by a dithiol/disulfide active site (CGPC), which is conserved in bacteria, plants, and animals (Spyrou et al., 1997; Gelhaye et al., 2004). In human, there are three Trxs encoded by separate genes. Trx1, a cytosolic and nuclear form, is the most studied of the three forms of Trx (Nordberg and Arner, 2001). Trx2, a mitochondrial protein, contains a unique 60 amino acid Nterminal mitochondrial translocation signal (Spyrou et al., 1997). SpTrx, the third isoform of Trx, is highly expressed in spermatozoa (Miranda-Vizuete et al., 2001). Trx participates in a wide variety of physiological processes. Trx has shown anti-apoptotic functions by inhibiting apoptosis signal-regulating kinase-1 (Saitoh et al., 1998). Various oxidative stresses can induce Trx expression to perform an antioxidant effect (Nakamura et al., 2009). Trx shows redox regulatory functions in signal transduction

Sheng et al.

and regulates the DNA binding activity of transcription factors such as AP-1, NF-κB, p53 and hypoxia-inducible factor-1α (Watanabe et al., 2010). Trx can be secreted by antigen presenting cells to activate T lymphocytes (Angelini et al., 2002). In most organisms, antioxidant defenses include two major pathways: the glutathione (GSH) and the Trx systems (Toledano et al., 2007). The components of these pathways include GSH, Trx, and their enzymes glutathione reductase and thioredoxin reductase, both of which reduce the oxidized GSH and Trx. In parasites, the challenge for the control of ROS is greater because they must control not only their metabolic production but also the potential damage induced by the host immune attack. Some thioredoxin genes have been cloned and characterized in endoparasites, these includes, Opisthorchis viverrini (Suttiprapa et al., 2012), Haemonchus contortus (Sotirchos et al., 2008), Haemonchus contortus (Sotirchos et al., 2009) and Schistosoma mansoni (Alger et al., 2002). However, the Trx of body surface parasites is less known. Parasites possess unique antioxidant systems, which is different from conventional thioredoxin and glutathione systems (Otero et al., 2010). The platyhelminth S. mansoni, for example, lacks canonical thioredoxin and glutathione systems. Instead, it possesses a linked glutathione thioredoxin system that contains a selenoenzyme thioredoxin glutathione reductase for the provision of reducing equivalents to whole system (Bonilla et al., 2008). In trypanosomes, the two systems are joined to one system with a small peptide trypanothione [bis(glutathionyl)spermidine] which is oxidized by the enzyme tryparedoxin and is regenerated by the enzyme trypanothione reductase (Krauth-Siegel et al., 2005). Neobenedenia melleni, a kind of body surface platyhelminth parasite, can infect many important cage-cultured fishes, such as, the large yellow croaker (Pseudosciaena crocea), the miiuy croaker (Miichthys miiuy), the tilapia (Oreochromis mossambicus), the amberjack (Seriola dumerili), and Epinephelus awoara (Yang et al., 2001, 2007). Its outbreaks have caused fearful economic losses in fish mariculture. It would be beneficial to develop the potential method to control N. melleni infection by characterizing its antioxidant systems. However, no information is available for Trx in N. melleni. Here, we aimed to identify and characterize a thioredoxin from N. melleni (NmTrx). It is the first time that the thioredoxin of body surface platyhelminth parasite N. melleni was identified, and it is helpful to a better understanding of the antioxidant systems in this fish parasite. MATERIALS AND METHODS Parasite source Miiuy croaker (Miichthys miiuy) infected with N. melleni were maintained in 500 L tanks and fed with the basal diet, at Xiangshan Seaport Aquatic Seedling and fingerling Limited Company, Ningbo

7583

city, China. One hundred adult N. melleni worms were removed from the fish body surface using a scalpel blade. Adult parasites were placed in tissue culture dishes containing filtered seawater and were incubated at 25°C for a day to induce egg-laying (Lin et al., 2008). Deposited parasite eggs were collected in a 300 ml plastic beaker containing sand-filtered seawater and incubated at 25°C, with the water changed daily. After incubation for 5 to 9 days, the oncomiracidia were collected within 6 h of hatching. For the thermotolerance experiment, the N. melleni eggs and adults were incubated at 18, 25 and 32°C for 24 h, respectively. Collected eggs, oncomiracidia and adults samples were immediately frozen in liquid nitrogen before been stored at -70°C. Cloning of the full-length cDNA of NmTrx Express sequence tag (EST) sequence was employed to obtain important gene information in N. melleni. Total RNAs were extracted from the samples of eggs, oncomiracidia, and adults of N. melleni using RNAiso reagents (TaKaRa, Kyoto, Japan) and mRNA was purified using Oligotex-dT30<super> (TaKaRa), respectively. In order to generate EST resources with maximal efficiency of gene discovery, three individual mRNA samples were pooled together in equal amounts. The cDNA Library Construction Kit (TaKaRa) was used according to the manufacturer’s protocols. A total of 30649 selected clones were partially auto-sequenced by an ABI 3730 automated sequencer (Invitrogen) and analyzed with BLASTX search (http://www.ncbi.nlm.nih.gov/). Sequence analysis The cleavage site of signal peptides was predicted by the SignalP 3.0 program (http://www.cbs.dtu.dk/services/SignalP/). The incidence of conserved protein domains was assessed using InterProScan (http://www.ebi.ac.uk/Tools/InterProScan/). Multiple sequence alignment, phylogenetic and molecular evolutionary analyses were conducted using MEGA version 4 (Tamura et al., 2007). Transcripts analysis of NmTrx in different developmental stages of N. melleni Total RNA was isolated from eggs, oncomiracidia and adults of N. melleni, respectively using RNAiso reagent (TaKaRa, Kyoto, Japan), then treated with deoxyribonuclease I (TaKaRa) and reverse transcribed using Reverse Transcriptase M-MLV (RNase H¯) (TaKaRa). Primers NmTrx (+): 5’-AAATTAGAAGCCGTTCTGGC-3’ and NmTrx (-): 5’-GCTCTCTTTCTCCGCTTCTT-3’ were used to amplify a 105 bp fragment of the NmTrx gene. As an internal PCR control, primers 28S rRNA(+): 5’AAGCCACCATGCGTTTGTA-3’ and 28S rRNA(-): 5’TCATGCCAGAATACCAACC-3’ were used to amplify a 149 bp fragment of the housekeeping 28S rRNA gene (accession number: FJ972005). One microliter of the resultant solution from each reverse transcription reaction served as the template in a 20 µl realtime polymerase chain reaction (PCR) reaction using SYBR premix Ex Taq (Perfect Real Time) (TaKaRa). The real-time PCR reaction was performed in triplicate on the RT-Cycler™ Realtime Fluorescence Quantitative PCR machine (CapitalBio, Beijing, China) using the following conditions (10 min at 95°C at the beginning, 40 cycles of 95°C for 30 s, 58°C for 30 s, and finally 72°C for 30 s). The mRNA expression of the NmTrx was normalized against 28S rRNA expression. All data were expressed as means ± SEM and statistified by one-way analysis of variance (ANOVA) with SPSS (version 13.0, Chicago, IL, USA). The tests were considered statistically significant at p < 0.05.

7584

Afr. J. Biotechnol.

Prokaryotic expression and purification Based on the previously determined NmTrx sequence, a primer pair was designed that would amplify the ORF and which included restriction sites for Nde I and BamH I at the 5’ and 3’ ends of the upstream (NmTrx-F: 5’-CCATATGTACGATCATGTTACAACAGA3’) and downstream (NmTrx-R: 5’-CGGATCCTTAGTTTTTTGGTGTTGTTATAT-3’) primers respectively, in order to facilitate subsequent directional cloning into the NdeI/BamHI-digested pET28a vector (QIAGEN, Shanghai, China). Pfu DNA Polymerase (Fermentas) was used for gene amplification according to the manufacturer’s protocols. Prokaryotic over-expression of the protein was performed according to established protocols (Sambrook et al., 1989). The His-tagged recombinant proteins were purified by nickel-affinity chromatography according to the manufacturer's protocol (QIAGEN) and further analyzed by SDS-PAGE. Antiserum preparation and western blot The purified NmTrx protein was used as an antigen to immunize mice to produce antiserum (Han et al., 2007; Han and Zhang, 2007). Antigen was mixed with an equal volume of Freund’s complete adjuvant (Sigma, USA). The emulsion was injected intradermally into mice and two booster shots were administered at one week interval. One day after the last injection, blood was collected, clarified by overnight incubation at 4°C, and centrifuged at 1500 g for 15 min. The serum was stored at -70°C. Collected egg and adult samples were lysed at 4 °C in a buffer composed of 20 mM Hepes, 1.5 mM MgCl2, 0.2 mM EDTA, 100 mM NaCl, 0.2 mM DTT, 0.5 mM sodium orthovanadate, and 0.4 mM PMSF (pH 7.4). The lysate was then centrifuged at 10,000 g for 30 min. The protein concentration of the supernatant was measured in each soluble fraction by using the Bradford method, and samples were subjected to SDS-PAGE (15% acrylamide gel) and transferred to PVDF (Pall, NY, USA). Membranes were blocked for 1 h in a 10% non-fat dry milk solution in TBS-Tween. After 1.5 h incubation with NmTrx antiserum, membranes were washed and incubated for 1 h with HRP-conjugated secondary antibodies. Proteins were visualized by enhanced chemiluminescence (Santa Cruz Biotechnology, Santa Cruz, CA), and semiquantitative analysis was performed by scanning densitometry.

Thioredoxin activity The activity of NmTrx was measured by monitoring the reduction of insulin by the increase in turbidity (Holmgren, 1979). The reaction mixture contained 50 mM Tris (pH 7.5), 2 mM EDTA, 0.33 mM dithiothreitol (DTT), 0.13 mM insulin, and thioredoxin in concentrations 2 to 4 µM. The reaction was started by pipetting 3 ml DTT in all cuvettes. The measurements were performed at 650 nm using 2.0 min intervals for 60 min. The time for precipitation initiation was defined as an increase by 0.02 at A650 after a stable base-line recording. The antioxidant activity of NmTrx was detected by Fe3+ reducing power-based total antioxidant capacity Detection Kit (Jiancheng Bioengineering co., Ltd). An antioxidant capacity unit was defined as an increase by 0.01 at A520 min-1 per mg protein. Trx activities in the three development stages of N. melleni were measured with the insulin disulfide reduction assay as described elsewhere (Schulze et al., 2004). Total protein was extracted from egg, oncomiracidium, or adult with lysis buffer. Total protein extract was incubated with buffer (50 mmol/l HEPES pH 7.6, 1 mmol/l EDTA, 1 mg/ml BSA, 2 mmol/l DTT) at 37°C for 15 min before they were incubated with human Trx reductase (Sigma, St. Louis, MO) in the reaction buffer (0.3 mmol/l insulin, 200 µmol/l NADPH, 1 mmol/l EDTA, and 20 mmol/l HEPES pH 7.6) at 37°C for 20 min. The reaction was then terminated by adding 500 µl of stop mix (6 M

guanidine HCl, 1 mM DTNB in 0.2 M Tris-HCl pH 8.0) and then absorption at 412 nm was measured.

RESULTS NmTrx gene analysis To obtain the cDNA sequence of important genes in N. melleni, a total of 30649 selected clones were singlepass sequenced, resulting in the characterization of 26548 ESTs that were longer than 100 bp after eliminating vector sequences. The average insert size was estimated to be 673 bp by PCR amplification of inserts from 50 randomly selected clones. The NmTrx was identified by the BLASTX search. The nucleotide sequence obtained was deposited into the DDBJ/ GenBank/EMBL databases with the accession number GW920378 for the full-length cDNA sequence of NmTrx. The full-length cDNA sequence of NmTrx was 735 nt long (Figure 1). The predicted translation product contains 170 amino acids (aa) with a calculated Mr of 19.0 kDa and a theoretical isoelectric point (pI) of 4.83. The amino acid sequence was aligned with the corresponding published sequences of other animals. The N-terminal half of the protein contained the thioredoxin active-site motif which consisted of four amino acid CPGC. Amino acid sequence comparisons showed that NmTrx had a high degree of identity with the Trx of Xenopus (Silurana) tropicalis and Drosophila willistoni (47%) than that of other animals (36 to 46%). A phylogenetic tree was constructed using the reference amino acid sequences by the neighbor-joining method. Currently accepted relationships of the animal phyla were reflected in the phylogenetic tree. NmTrx is distantly related to other animal clusters (Figure 2). In Figure 2, the values at the branching points indicate the percentage of trees in which this grouping occurred after bootstrapping (1,000 replicates; shown only when > 60%). The scale bar shows the number of substitutions per base. Accession numbers of sequences used are Homo sapiens_Trx1, AAF86466; Nomascus leucogenys_Trx1, XP003260517; Callithrix jacchus_Trx1, AF353204; Rattus norvegicus_ Trx1, AAH58454; Mus musculus_Trx1, AAH94415; Anolis carolinensis_Trx1, XP003227375; Mesobuthus caucasicus_Trx1, CAE54119; Litopenaeus vannamei_ Trx1, EU499301; Fenneropenaeus chinensis_Trx1, ACX30746; Neobenedenia melleni_Trx, GW920378; Lycosa singoriensis_Trx2, ABX75495; Bombyx mori_ Trx2, NP_001040283; Xenopus laevis_Trx2, NP_ 001080066; Oreochromis mossambicus_Trx2, ABO26636; Homo sapiens_Trx2, AAF86467 and Mus musculus_Trx2, CAM23426. The analysis of NmTrx mRNA expression The transcript level of NmTrx was measured at the egg,

Sheng et al.

7585

Figure 1. Nucleotide and predicted amino acid sequences of NmTrx. The catalytic center is shaded in dark. The polyadenylation signal is underlined. An asterisk indicates the stop codon.

the oncomiracidium, and the adult stages of N. melleni while 28S rRNA gene expression was used as an internal control. Real-time PCR data showed that NmTrx transcript was markedly lower at the oncomiracidium stage than that at the egg stage (P < 0.01), and higher at the adult stage compared with that at the egg stage (P < 0.05). Moreover, NmTrx transcript was higher at the adult stage compared with that at the oncomiracidium stage (P < 0.001, Figure 3A). The environment temperature induced change of NmTrx transcripts were measured at the egg and adult stages of N. melleni. There was no significant difference of NmTrx mRNA expression in the eggs between the 18 and 25°C groups. The NmTrx

mRNA expression in the eggs in the 32°C group was higher than those in the 18 and 25°C groups (P < 0.001) (Figure 3B). In the adults, the NmTrx mRNA level in the 32°C groups was up-regulated compared with the 18 and 25°C groups (P < 0.01) (Figure 3C). Prokaryotic expression and purification of NmTrx The open reading frame (ORF) encoding NmTrx was amplified and cloned into the pET28a vector. For expression, plasmid was transformed into an E. coli strain BL21. The expression of recombinant proteins was

7586

Afr. J. Biotechnol.

Figure 2. Phylogenetic (neighbor-joining) analysis of complete amino acid sequence of different thioredoxin molecules using the MEGA 4.0 program.

induced with 1 mM IPTG (Figure 4). The observed MW from SDS-PAGE of recombinant NmTrx was about 27.4 kDa. The resulting protein has a higher molecular weight than our predicted one because of the His-tag insertion. The target protein was further purified by nickelnitrilotriacetic acid chromatography. The purity of recombinant NmTrx preparation was checked by SDSPAGE, which showed a single band moving at the position expected from its molecular size (Figure 4). An NmTrx antiserum was prepared in mice immunized with the purified recombinant protein. The temperature expression

dependent

NmTrx

protein

To investigate the temperature dependent NmTrx protein expression, whole eggs and adults were homogenized for protein preparation after 24 h induction under the 18°C, 25°C, or 32°C. Different incubation temperatures were found to be able to effectively change the protein

expression of NmTrx in the eggs and adults by Western blot method. In the eggs, the protein expression level of NmTrx showed a 2.35 fold increase at 32°C compared with 18 and 25°C (Figure 5A). There was no significant change of NmTrx protein expression in the eggs between the 18 and 25°C groups. In the adults, NmTrx protein expression was also 1.8-fold up-regulated in the 32°C group than the 18 and 25°C ones (Figure 5B). Activity analysis of NmTrx To estimate the activity of recombinant NmTrx, the ability to reduce the interchain disulfide of insulin was analyzed. In the control cuvette of no NmTrx, there was no precipitation throughout the whole test period. The addition of 2 and 4 µM rEsTrx1 resulted in rapid precipitation appearing after 12 and 8 min, respectively (Figure 6A). The Trx activities of eggs, oncomiracidia, and adults were further measured in whole homogenates. Compared with the eggs, the Trx activity was down-

Sheng et al.

18°C

18°C

25°C

25°C

32°C

32°C

Figure 3. RT-qPCR analysis of NmTrx mRNA expression. (A), NmTrx transcript levels were different in the three development stages. **P < 0.01 vs. Egg; *P < 0.05 vs. Egg; ### P < 0.001 vs. Oncomiracidium. (B), the environmental temperature induced the change of NmTrx mRNA expression in the egg stage. (C), the change of NmTrx mRNA expression in the adult stage was induced by the environmental temperature. *** P < 0.001 vs. 18°C; ** P < 0.01 vs. 18°C. NmTrx transcript levels were normalized dividing by the 28S rRNA content. Each bar represents the mean ± SEM of the results from four samples.

7587

7588

Afr. J. Biotechnol.

Figure 4. Prokaryotic expression and purification of recombinant NmTrx. The proteins were resolved using 15% SDSPAGE. Lane M: protein marker; lane 1: before IPTG induction; lane 2: after IPTG induction; lane 3: purified recombinant protein.

18°C

25°C

32°C

18°C

25°C

32°C

Figure 5. Analysis of NmTrx in the eggs (A) and adults (B) at different temperatures by Western blot. The eggs and adults of N. melleni were incubated at 18, 25, and 32°C for 24 h, respectively. The proteins were isolated from whole homogenates of eggs or adults and analyzed by Western blot (N = 3). **P < 0.01 vs. 18°C; ***P < 0.001 vs. 18°C; ## P < 0.01 vs. 25°C; ### P < 0.001 vs. 25°C.

regulated in the oncomiracidia, but up-regulated in the adults (Figure 6B). Fe3+ reducing power assay was

employed to evaluate the antioxidant capacity of NmTrx. The antioxidant capacity of NmTrx was determined to be

Sheng et al.

7589

Time (min) Figure 6. NmTrx-catalyzed reduction of insulin. (A) Activity analysis of recombinant NmTrx by by insulin turbidity assay. The absorbance at 650 nm was plotted against time. The cuvettes devoid of NmTrx at the 0 min served as blank and control. (B) Relative Trx activities in the lysates of the three developmental stages of N. melleni were assessed, normalized, and expressed as the percentage of the egg stage. Data represent as means ± SEM (N = 3). *P < 0.05 vs. Egg; **P < 0.01 vs. Egg; ### P < 0.001 vs. Oncomiracidium.

5.12 U/mg protein. DISCUSSION Here, we identified a thioredoxin from N. melleni, which is known for having the broadest host-specificity of any monogenean species. The characteristic active site sequence CGPC of thioredoxins, structurally important amino acid residues, is highly conserved in NmTrx. This motif can control protein function via the redox state of structural or catalytic thiol groups (Nkabyo et al., 2002). The NmTrx has a molecular weight of 19.0 kDa, which is higher than the molecular weight of classic thioredoxin in other animals. In a phylogenetic tree, the observed relationships reflected the taxonomic positions of the species. However, the NmTrx is distantly related to the thioredoxin of other animal clusters. The uniqueness of the NmTrx sequence may reflect the specific life environment of N. melleni as a body surface parasite. The study also supports the idea of considering the NmTrx as a drug target for the treatment of the parasite N. melleni. The expression of NmTrx at the transcriptional level revealed that NmTrx transcripts were all present in the three development stages examined, with the highest mRNA and protein expression level in the adult stage. The ubiquitous expression of NmTrx expression in the different developmental stages of N. melleni may suggest that the NmTrx is involved in important physiological functions. Thioredoxin, the crucial component of redox control systems, has versatile functions in DNA synthesis, defense against oxidative stress and apoptosis or redox signaling with reference to many diseases

(Holmgren and Lu, 2010). In addition, the high level of NmTrx expression at the adult stage suggests that the N. melleni possibly suffer from stronger oxidized stress in the adult stage. The life cycle of N. melleni involves a fish host and they mostly spread by way of eggs and freeswimming infective larvae (oncomiracidia) in the seawater (Bondad-Reantaso et al., 1995). Therefore, N. melleni in the egg and oncomiracidium stages are only required to control free radicals produced by their metabolism. They are required to control potential damage from metabolism and host immune attack together in the adult stage (Henkle-Dührsen and Kampkötter, 2001). We conclude that more NmTrx protein and activity in the adults is needed to control potential damage. It has been found that thioredoxin pathways differ in parasitic and free-living flatworms (Otero et al., 2010). This result may also suggest that NmTrx plays more important roles in the adult stage than in the egg and oncomiracidium stages. Thioredoxin functions are to regulate redox homeostasis in response to stresses, such as thermal stress, hypoxia, and osmotic stress (Kouwen et al., 2009; Muniyappa et al., 2009; Ying et al., 2010). In this study, the mRNA expression of NmTrx is higher in the egg stage at 32°C compared with 18 and 25°C. 25°C was the most suitable environment temperature to hatch N. melleni. The development of the N. melleni eggs will almost stop when the environment temperature is higher than 32°C (Lin et al., 2008). It has been found that heat exposure will influence the redox state (Hadzi-Petrushev et al., 2011). Our work supports the conception that thioredoxin participates in the thermal stress induced redox change. Thioredoxin possesses a general intracellular anti-

7590

Afr. J. Biotechnol.

oxidant activity and protects against oxidative stress (Holmgren et al., 2005). In this study, recombinant NmTrx is able to reduce insulin at 2 and 4 µM. Furthermore, the dithiol-reducing activity (5.12 U/mg) of NmTrx was comparable to the specific activity of Trx1 from E. coli (4.93 U/mg), calf thymus (6.50 U/mg) and calf liver (5.09 U/mg) (Holmgren, 1979). This result suggests that this thioredoxin from N. melleni is functionally similar to classic thioredoxins. In another platyhelminth parasite S. mansoni, two thioredoxins have been found by analyzing genome sequence (Berriman et al., 2009). It is still unknown whether other thioredoxins exist in N. melleni besides NmTrx. The Trx activity of N. melleni was lower in the oncomiracidia and higher in the adults than that in the eggs. The Trx activities in the three development stages are consistent with NmTrx mRNA. These results might suggest that NmTrx is the major Trx protein in N. melleni. In summary, we cloned and characterized the first thioredoxin from the fish parasite N. melleni and examined the mRNA expression of NmTrx in different developmental stages at different environmental temperatures. Moreover, the recombinant protein of NmTrx showed antioxidant activity. The NmTrx may play important roles in the physiological oxidation-reduction of disulfide bonds to maintain redox homeostasis. ACKNOWLEDGEMENTS The project was supported by the Program for New Century Excellent Talents in University (NCET-080928), the Ningbo Discipline Project (szx11069) and the KC Wong Magna Fund in Ningbo University. REFERENCES Alger HM, Sayed AA, Stadecker MJ, Williams DL (2002). Molecular and enzymatic characterisation of Schistosoma mansoni thioredoxin. Int. J. Parasitol. 32: 1285-1292. Angelini G, Gardella S, Ardy M, Ciriolo MR, Filomeni G, Di Trapani G, Clarke F, Sitia R, Rubartelli A (2002). Antigen-presenting dendritic cells provide the reducing extracellular microenvironment required for T lymphocyte activation. Proc. Natl. Acad. Sci. USA, 99: 1491-1496. Berriman M, Haas BJ, LoVerde PT, Wilson RA, Dillon GP, Cerqueira GC, Mashiyama ST, Al-Lazikani B, Andrade LF, Ashton PD, Aslett MA, Bartholomeu DC, Blandin G, Caffrey CR, Coghlan A, Coulson R, Day TA, Delcher A, DeMarco R, Djikeng A, Eyre T, Gamble JA, Ghedin E, Gu Y, Hertz-Fowler C, Hirai H, Hirai Y, Houston R, Ivens A, Johnston DA, Lacerda D, Macedo CD, McVeigh P, Ning Z, Oliveira G, Overington JP, Parkhill J, Pertea M, Pierce RJ, Protasio AV, Quail MA, Rajandream MA, Rogers J, Sajid M, Salzberg SL, Stanke M, Tivey AR, White O, Williams DL, Wortman J, Wu W, Zamanian M, Zerlotini A, Fraser-Liggett CM, Barrell BG, El-Sayed NM (2009). The genome of the blood fluke Schistosoma mansoni. Nature, 460: 352358. Bondad-Reantaso MG, Ogawa K, Fukudome M, Wakabayashi H (1995). Reproduction and growth of Neobenedenia girellae (Monogenea: Capsalidae), a skin parasite of cultured marine fishes of Japan. Fish Pathol. 30: 227-231. Bonilla M, Denicola A, Novoselov SV, Turanov AA, Protasio A, Izmendi D, Gladyshev VN, Salinas G (2008). Platyhelminth mitochondrial and

cytosolic redox homeostasis is controlled by a single thioredoxin glutathione reductase and dependent on selenium and glutathione. J. Biol. Chem. 283: 17898-17907. Chen Q, Vazquez EJ, Moghaddas S, Hoppel CL, Lesnefsky EJ (2003). Production of Reactive Oxygen Species by Mitochondria. J. Biol. Chem. 278: 36027-36031. Gelhaye E, Rouhier N, Jacquot JP (2004). The thioredoxin h system of higher plants. Plant. Physiol. Biochem. 42: 265-271. Hadzi-Petrushev N, Jankulovski N, Hristov K, Mladenov M (2011). l-2oxothiazolidine-4-carboxylate influence on age- and heat exposuredependent redox changes in rat’s blood plasma. J. Physiol. Sci. 61: 437-442. Han F, Xu J, Zhang X (2007). Characterization of an early gene (wsv477) from shrimp white spot syndrome virus (WSSV). Virus Genes 34: 193-198. Han F, Zhang X (2007). Characterization of a ras-related nuclear protein (Ran protein) up-regulated in shrimp antiviral immunity. Fish Shellfish. Immunol. 23: 937-944. Henkle-Dührsen K, Kampkötter A (2001). Antioxidant enzyme families in parasitic nematodes. Mol. Biochem. Parasit. 114: 129-142. Holmgren A (1979). Thioredoxin catalyzes the reduction of insulin disulfides by dithiothreitol and dihydrolipoamide. J. Biol. Chem. 254: 9627-9632. Holmgren A, Lu J (2010). Thioredoxin and thioredoxin reductase: Current research with special reference to human disease. Biochem. Bioph. Res. Commun. 396: 120-124. Holmgren A, Johansson C, Berndt C, Lonn ME, Hudemann C, Lillig CH (2005). Thiol redox control via thioredoxin and glutaredoxin systems. Biochem. Soc. Trans. 33: 1375-1377. Kouwen TRHM, Antelmann H, Van der Ploeg R, Denham EL, Hecker M, Van Dijl JM (2009). MscL of Bacillus subtilis prevents selective release of cytoplasmic proteins in a hypotonic environment. Proteomics, 9: 1033-1043. Krauth-Siegel RL, Bauer H, Schirmer RH (2005). Dithiol proteins as guardians of the intracellular redox milieu in parasites: old and new drug targets in trypanosomes and malaria-causing plasmodia. Angew. Chem. Int. Ed. 44: 690-715. Lin KB, He LB, Zhou C (2008). Effects of several physical and chemical factors on eggs development of Neobenedenia melleni. Mar. Sci. 32: 1-4. Miranda-Vizuete A, Ljung J, Damdimopoulos AE, Gustafsson JA, Oko R, Pelto-Huikko M, Spyrou G (2001). Characterization of Sptrx, a novel member of the thioredoxin family specifically expressed in human spermatozoa. J. Biol. Chem. 276: 31567-31574. Muniyappa H, Song S, Mathews CK, Das KC (2009). Reactive oxygen species-independent oxidation of thioredoxin in hypoxia. J. Biol. Chem. 284: 17069-17081. Nakamura H, Hoshino Y, Okuyama H, Matsuo Y, Yodoi J (2009). Thioredoxin 1 delivery as new therapeutics. Adv. Drug Deliv. Rev. 61: 303-309. Nkabyo YS, Ziegler TR, Gu LH, Watson WH, Jones DP (2002). Glutathione and thioredoxin redox during differentiation in human colon epithelial (Caco-2) cells. Am. J. Physiol. Gastrointest. Liver Physiol. 283: G1352-1359. Nordberg J, Arner ES (2001). Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Radic. Biol. Med. 31: 1287-1312. Otero L, Bonilla M, Protasio A, Fernandez C, Gladyshev V, Salinas G (2010). Thioredoxin and glutathione systems differ in parasitic and free-living platyhelminths. BMC Genomics, 11: p. 237. Roos G, Messens J (2011). Protein sulfenic acid formation: From cellular damage to redox regulation. Free Radic. Biol. Med. 51: 314326. Saitoh M, Nishitoh H, Fujii M, Takeda K, Tobiume K, Sawada Y, Kawabata M, Miyazono K, Ichijo H (1998). Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK) 1. Embo. J. 17: 2596-2606. Sambrook J, Fritsch EF, Maniatis T (1989). Molecular cloning: a laboratory manual, 2 nd Edition. Cold Spring Harbor Laboratory press, New York, USA. Schulze PC, Yoshioka J, Takahashi T, He Z, King GL, Lee RT (2004). Hyperglycemia promotes oxidative stress through inhibition of

Sheng et al.

thioredoxin function by thioredoxin-interacting protein. J. Biol. Chem. 279: 30369-30374. Sotirchos IM, Hudson AL, Ellis J, Davey MW (2008). Thioredoxins of a parasitic nematode: Comparison of the 16- and 12-kDA thioredoxins from Haemonchus contortus. Free Radic. Biol. Med. 44: 2026-2033. Sotirchos IM, Hudson AL, Ellis J, Davey MW (2009). A unique thioredoxin of the parasitic nematode Haemonchus contortus with glutaredoxin activity. Free Radic. Biol. Med. 46: 579-585. Spyrou G, Enmark E, Miranda-Vizuete A, Gustafsson J (1997). Cloning and expression of a novel mammalian thioredoxin. J. Biol. Chem. 272: 2936-2941. Suttiprapa S, Matchimakul P, Loukas A, Laha T, Wongkham S, Kaewkes S, Brindley PJ, Sripa B (2012). Molecular expression and enzymatic characterization of thioredoxin from the carcinogenic human liver fluke Opisthorchis viverrini. Parasitol. Int. 61: 101-106. Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599. Toledano MB, Kumar C, Le Moan N, Spector D, Tacnet F (2007). The system biology of thiol redox system in Escherichia coli and yeast: Differential functions in oxidative stress, iron metabolism and DNA synthesis. FEBS Lett. 581: 3598-3607. Watanabe R, Nakamura H, Masutani H, Yodoi J (2010). Anti-oxidative, anti-cancer and anti-inflammatory actions by thioredoxin 1 and thioredoxin-binding protein-2. Pharmacol. Therapeut. 127: 261-270.

7591

Yang TB, Chen AP, Chen W, Li AX, Yan YY (2007). Parasitic diseases of cultured marine finfishes and their surveillance in China. Parassitologia, 49: 193-199. Yang WC, Li LW, Shi L, Wang J, Su YQ (2001). Study on aetiology of Neobenedenia melleni (Monogenea: Capsalidae) from marine fishes in Fujian, China. J. Oceanogr. Taiwan Strait, 20: 205-209. Ying SH, Wang XH, Feng MG (2010). Characterization of a thioredoxin (BbTrx) from the entomopathogenic fungus Beauveria bassiana and its expression in response to thermal stress. Can. J. Microbiol. 56: 934-942.

African Journal of Biotechnology Vol. 11(30), pp. 7592-7602, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3829 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Ultra-structural study of Egyptian Buffalo oocytes before and after in vitro maturation I. A. H. Barakat1,2, H. M. El–Ashmaoui1,4, A. Barkawi3, S. A. Kandeal2,3 and E. EL-Nahass1 1

2

Department of Cell Biology, National Research Center, Giza, Egypt. Department of Zoology, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Kingdom of Saudi Arabia. 3 Department of Animal Production, Faculty of Agriculture, Cairo University, Egypt. 4 Department of Biological sciences, Faculty of Science, King Abdulaziz University, P. O. Box 80203,Jeddah 21589 Saudi Arabia. Accepted 14 March, 2012

The purpose of this study was to describe the changes occurring in the cytoplasmic organelles of the buffalo oocytes before and after in vitro maturation. The total number of oocytes used in this experiment was 250 oocytes; 50 in vivo matured oocytes, 100 immature oocytes, and the other 100 was in vitro matured oocytes cultured in TCM-199 + LH. The oocytes examined in this study showed normal ultra-structure of mitochondria, smooth endoplasmic reticulum (SER), zona pellucida (ZP), lipid droplets, vesicles and Golgi in the good type meanwhile, some differences and abnormalities in denuded oocytes were recorded. The most remarkable changes observed in the two different categories of oocytes (good and denuded) after maturation was the different complexes consisting endoplasmic reticulum, mitochondria (M), lipid droplets (L), vesicles (V) and ZP. Concerning the polar body (PB), group of in vitro matured oocytes showed a normal PB formation, vesicles, whereas mitochondria were dislocated towards the site of the PB. In vitro matured oocytes showed clusters of cortical granules which existed in aggregates throughout the peripheral ooplasm just beneath the oolemma. In vitro maturation of Egyptian buffalo oocytes could be elucidated by alterations that occurred in the cytoplasmic organelles of the oocytes as shown by transmission electron microscopy (TEM). Key words: Egyptian buffalo, oocytes, in vitro maturation, ultra-structure. INTRODUCTION In vitro embryo production (IVEP) technology represents the best tool to improve maternal contribution to genetic progress in buffalo. Besides the progress obtained in the percentage of in vitro produced transferrrable embryos (Gasparrini et al., 2006, Manjunatha et al., 2009), the pregnancy rate achieved by transferring these structures remains poor (Gasparrini, 2002; Nandi et al., 2002a). In vitro maturation (IVM) of oocytes from small antral follicles could reduce the need for exogenous

*Corresponding author. E-mail: ibrahimahb@yahoo.com, ibarakat@ksu.edu.sa. Tel: 00966541834774. Fax: 0096614678514.

gonadotrophin treatment and offer an alternative to hyperstimulation of ovulation during in vitro fertilization (IVF) (Yong-jie et al., 2009). Also, Yong-jie et al. (2009) showed that in vitro oocyte maturation is intended to stimulate the maturation of both the nucleus and the cytoplasm. Indices of the matured nucleus include breakdown of the nuclear envelop, segregation of chromosomes, and appearance of the first polar body. These changes are accompanied by a set of changes in the cytoplasm, such as nutrient accumulation and organelle redistribution. Maturation of the nucleus and cytoplasm synchronizes itself in vivo, whereas in vitro stimulation may only aid in the maturation of one or the other. Oocytes maturation is the first and most critical step

Barakat et al.

towards a successful in vitro production of embryos, but little information are available on in vitro maturation and fertilization of buffalo oocytes (Totey et al., 1991, 1992). Also, preliminary results obtained by various workers (Bacci et al., 1991; Chuangsoongneen and Kamonpatana, 1991; Lu and Hsu, 1990; Totey et al., 1992) on in vitro maturation and fertilization of buffalo oocytes reported poor results compared to cattle. During maturation, major changes took place in protein synthesis (Moor and Warnes, 1978; Crosby et al., 1981; Moor et al., 1981) and it has been proposed that such changes are essential for the continuation of cytoplasmic maturation (Thibault, 1977; Golbus and Stein, 1978; Moor et al., 1978). In addition to concomitant with nuclear maturation, cytoplasmic changes occur during oocyte maturation. At the ultra-structural level, cytoplasmic maturation encompasses morphological alterations in the distribution of organelles such as mitochondria, endoplasmic reticulum and cortical granules (Kruip et al., 1983; Blerkom and Bell, 1986; Loos et al., 1989). Ultrastructural changes in the oocyte during in vitro maturation have been studied in different mammalian species in detail [mouse (Merchant and Chang, 1971), human (Zamboni and Thomson, 1972) and cattle (Hyttel et al., 1997)]. Although, Ultra-structural studies on the oocyte during in vitro maturation in different mammalian species [mouse (Merchant and Chang, 1971), human (Zamboni and Thomson, 1972), cattle (Hyttel et al., 1997) and camel (Kafi et al., 2005)] have resulted in a better understanding of the biology of the oocyte and as a consequence, improvements in IVM and IVF. However, systematic studies on ultra-structure of buffalo oocytes during IVM have not been reported. Therefore, the objective of the present study was to describe the ultrastructure changes of Egyptian buffalo oocyte during in vitro oocyte maturation. MATERIALS AND METHODS Oocytes collection and in vitro maturation The ovaries were removed directly from abdominal cavity of Egyptian buffaloes after slaughtering and maintained in a thermo flask containing saline solution (0.9% NaCl) mixed with 50 µg/ml gentamycin sulphate at 30 to 38°C and were transported to laboratory within 2 h. At the laboratory, the ovaries were washed three times with pre-warmed isotonic saline solution supplemented with gentamycin sulfate to exclude adhering blood and other increment tissues. Immature oocytes were recovered by aspiration of the follicles on the ovaries using a 10 ml sterile syringe and an 18 G disposable needle. The oocytes were classified into three categories on basis of the presence of cumulus mass and homogeneity of cytoplasm (excellent, good and denuded oocytes) as described by Loos et al. (1989, 1991). The collected oocytes were washed three times with maturation medium (TCM-199 + 10% FCS + 0.02 IU FSH / ml + 0.023 IU LH / ml + 50 µg Gentamycin sulfate / ml + 1 µg Estradiol 17 β/ ml for 24 h at 38.5°C in 5% CO2, and 95% humidity). Oocytes were cultured in groups in 4–well sterile plastic Petri dishes. The culture dishes were incubated for 22 to 24 h at 38.5°C in 5% CO2, and 95% humidity.

7593

Experimental design A total of 200 buffalo oocytes were selected to study the ultrastructure of oocyte before and after in vitro maturation; half of the oocytes (50 good and 50 denuded oocytes) were studied before maturation while the other half examined were studied after maturation. This is in addition to 50 in vivo matured oocytes which had expanded cumulus cells, which were randomly selected to investigate some fine structures of oocytes. Oocytes matured in vitro were cultured in maturation medium, in order to determine the ultra-structure changes of oocytes after in vitro maturation. Preparation of oocytes for transmission electron microscopy (TEM) The procedure performed to study the ultrastructure of oocytes before and after in vitro maturation was that of Zaki (2000). This procedure was established and obtained from Electron Microscope Laboratory, Faculty of Science, Ain Shams University, Egypt. Ultra-structure evaluation Ultrastructural alterations were examined, interpreted and assessed according to the scheme based on previous works by Fuku et al. (1995 a and b) and Kanwal (1999).

RESULTS Ultra-structure of Egyptian buffalo oocytes matured in vivo Mitochondria were observed in a normal number and distribution in the cytoplasm. The hooded (H), and round (R) mitochondria (M) were observed (Figure 1a) but no pleomorphic mitochondria were observed throughout the cytoplasm. The most abundant form of endoplasmic reticulum (ER) appeared as associated with the surfaces of hooded mitochondria (HM). Also, in vivo matured oocytes showed low number of microvilli (Figure 1a) and the vesicles were located in close proximity to mitochondria. The cortical granules (CGs) were arranged just inside the oolemma. Golgi apparatus (G), and oval mitochondria were also detected (Figure 1b). A large number of small to medium size vesicles was also observed containing varying amounts of electron-dense material. The lipid droplets were randomly distributed with vesicles (Figure 1c). In vitro maturation of Egyptian buffalo oocytes Ultra-structure of oocytes before in vitro maturation Good quality oocytes: The result of this group revealed that the immature oocytes were characterized by the presence of non-expanded cumulus cells. Cumulus cells foot process endings extended from the cumulus cells through the zona pellucida. The mitochondria were located at the peripheral of the oocytes with a small number close to the center. They were,generally rounded

7594

Afr. J. Biotechnol.

a

b

c

d

Figure 1. The electron micrograph (TEM) of in vivo matured Egyptian buffalo oocytes showing; a) Hooded mitochondria (HM), round mitochondria (RM), endoplasmic reticulum (ER) and vesicles (V); b) oval mitochondria (OM), Golgi apparatus (G) and cortical granules (CGs); c) lipid droplets (LD) and vesicles (V) and d) hooded mitochondria (HM), oval mitochondria (OM), round mitochondria (RM), lipid droplets (LD), and endoplasmic reticulum (ER).

hooded, or oval shaped. Pleomorphic mitochondria were not found in this group (Figure 1d). The lipid droplets were found mainly near the mito-chondria; they were small in size and number (Figure 1d). Endoplasmic reticulum (ER) were detected both in association with

mitochondria and distributed throughout the ooplasm (Figure 1d). A large number of vesicles were distributed all over the oocyte except at the extreme periphery and large numbers of microvilli were found extended from the plasma membrane through foot

Barakat et al.

a

b

c

d

7595

Figure 2. The electron micrograph of in vivo matured Egyptian buffalo oocytes showing; a) vesicles (V) and microvilli (MV); b) a large number of vesicles (V) and cluster of cortical granules (CG); c) microvilli (MV), cortical granules (CGs), perivitelline space (PVS) and Zona pellucida (ZP) and d) vesicles (V) and lipid droplets (LDs).

processes into zona pellucida (Figure 2a). Cluster of cortical granules were observed in the deep cortex of ooplasm (Figure 2b). Moreover, immature good oocytes had a very large number of vesicles as shown in Figure (2b).

Denuded oocytes: Ultra-structural observation of denuded immature oocytes showed an enlarged perivitelline space (PVS), less number of microvilli and some of them were degenerated and detachment of foot

7596

Afr. J. Biotechnol.

processes. The populations of cortical granules were generally arranged individually or in small clusters of the oocytes. ZP showed irregularity fractures (Figure 2c). Large numbers and sizes of lipid droplets and empty vesicles were found and some of them contained electron dense materials. Also, the numbers of vesicles were very low (Figure 2d). While the hooded mitochondria were rarely observed, the rounded mitochondria were mainly seen in this group. Also, Golgi apparatus was seen in denuded oocytes (Figure 3a).

other groups (Figure 4b). Moreover, denuded oocytes had low number of vesicles, microvilli and lipid droplets (Figures 4b and c). Cortical granules were absent in this group. In denuded oocytes, Golgi apparatuses were distributed in cytoplasm of the oocytes (Figure 5d). Abnormal polar body formation (lightly stained and considered to be degenerated was found in in vitro matured denuded oocytes with no appearance of mitochondria or vesicles (Figure 6). DISCUSSION

Ultra-structure of oocytes after in vitro maturation Good quality oocytes: In good matured oocyte observed in this study, the electron micrographs showed the ER entering and closely related to the hooded mitochondria (Figure 3b) as well as associating with the outer surface of other mitochondrial and cytoplasmic inclusions. Vesicles, and mitochondria observed in the ooplasm were related to well developed cisternae of ER (Figure 3c). Ultra-structurally, in mature good oocytes, the zona pellucida was composed of a moderately staining homogenous material (Figure 3d). Cumulus cell processes and microvilli arising from the oocyte were observed within the zona pellucida. The perivitelline space appeared as a lighter staining band between the zona pellucida and vitelline membrane, this band appeared as a flocculent layer easily differentiated from zona pellucida. The cumulus cells had numerous projections and a structure similar to that of the zona pellucida were observed between these projections and the oolemma. A perivitelline space was small with a limited number of microvilli lying with their long axis; the cortical granules were dispersed to solitary positions forming a closure to the oolemma (Figure 4a). The lipid droplets were peripherally located in the good oocytes and bound layer of endoplasmic reticulum, but randomly distributed in more mature oocyte (Figure 4b). The Golgli apparatus was clearly observed in aggregating groups more than that in the in vivo matured oocytes and oocytes before maturation (Figure 4c). Concerning the polar body, the group of in vitro matured oocytes showed a normal polar body formation, vesicles, and the mitochondria was dislocated towards the site of polar body (Figure 4d). In vitro matured oocytes showed clusters of cortical granules found in aggregates throughout the peripheral ooplasm just beneath the oolemma (Figure 5a). Denuded oocytes: On the other hand, the denuded oocytes showed some abnormal mitochondria, extensive vacuolization, disappearance of cristae, dilated and pleomorphic shaped of mitochondria membrane, however, other mitochondria showed normal membrane and cristae which were clearly delineated (Figures 5b and c). Also, electron micrograph of denuded oocytes showed the vacuolated mitochondria which was not found in the

Available information about the ultra-structural changes in Egyptian buffalo oocytes after in vitro maturation is considered to be very limited. So, the results obtained in this study were compared to other related species. The low number of COCs collected probably might be due to the result of some peculiarities inherent to buffaloes, such as the reduced number of antral and preantral follicles, approximately ten times lower than in cattle (Drost, 2007; Mondadori et al., 2008). The results reveal that the mitochondria observed were similar to those of other domestic species, containing few cristae and frequently opposed vesicular of cisternal endoplasmic reticulum (Cran et al., 1980). Senger and Saacke (1970) had previously described the mitochondria in a study of bovine oocytes from tertiary follicles. It was apparent from their study that the membranes were actually continuous with the cisternae of the endoplasmic reticulum; ribosomes were occasionally associated with these cisternae. The close association of the cisternae with the outer surface of mitochondria appeared to be very similar to that reported by Fleming and Saacke (1972) in cattle oocytes. Also, Kruip et al. (1983) suggested that existence of mitochondrial clusters and vesicles were rearranged ~ 15 h after LH peak. Similar organelle rearrangements were reported in un-stimulated cattle as taking place more than 19 h after the LH peak (Kruip et al., 1983). Hence, in un-stimulated cattle and stimulated cattle, these major organelle rearrangements of the oocyte occur with an increase in the progesterone dominance in the follicular fluid. Immature COCs showed typical structure previously described for buffalo (Boni et al., 1992; Mondadori et al., 2008), as well as for bovine (Kacinskis et al., 2005; Nagano et al., 2006), ovine (O’Brien et al., 2005) and camel (Kafi et al., 2005) oocytes. Confirming previous observations (Mondadori et al., 2008), the most important difference observed between the species is the larger number of lipid droplets in buffalo ooplasm. The same sort of GC–oocyte junctions previously described for buffalo (Mondadori et al., 2008) and bovines (Fair and Hyttel, 1997) was also observed in some immature oocytes. It is well known that these junctions play an important role during oogenesis (Mondadori et al., 2007) and IVM in different species (Suzuki et al., 2000). Similar mitochondrial migrations have been reported in

Barakat et al.

a

b

c

d

7597

Figure 3. The electron micrograph of in vivo matured Egyptian buffalo oocytes showing; a) rounded mitochondria (RM) and Golgi apparatus (G); b) Endoplasmic reticulum (ER) entering and closely related to the hooded mitochondrial (HM) (indicated by arrow) as well as associating with outer surface of other mitochondrial and cytoplasmic inclusions; c) the mitochondria (M), clusters and spatial distribution of vesicles (V) and endoplasmic reticulum (ER) and d) the zona pellucida (ZP).

mice by Van Blerkom, and Runner (1984) who claimed this rearrangement as being essential for the pre-

ovulatory maturation and suggested then to be necessary for elevated concentrations of adenosine triphosphate for

7598

Afr. J. Biotechnol.

a

b

c

d

Figure 4. Electron micrograph of matured in vitro good oocyte of Egyptian buffaloes showing; a) granulosa cell processes associated with the surface of the ooplasm appear to be degenerating due to their very granular appearance. Pinocytotic vesicles (P) are apparent between cumulus cells. Numerous microvilli are seen; b) a lipid droplet (LD) and endoplasmic reticulum (ER); c) groups of Golgi apparatuses in cytoplasm and d) polar body (PB), vesicles (V) and mitochondria (M) which are dislocated towards the site of normal polar body formation.

localized activities in the ooplasm. The close association of the smooth endoplasmic reticulum to the inner surface

of the hood also suggests that the hood may provide a specific microenvironment, facilitating the exchange of

Barakat et al.

a

b

c

d

7599

Figure 5. Electron micrograph of in vitro matured good oocyte of Egyptian buffalo showing; a) cluster of cortical granules (CG); b) abnormal mitochondria exhibit extensive vacuolization, disappearance of cristae and dilated and pleomorphic mitochondrial (PM) membrane and vacuolated mitochondria (VM) other mitochondria showing normal membrane are continuous and cristae are clearly existed; c) undulating mitochondrial membranes and deformed cristae (DC), distorted mitochondrial membrane (DMM), and extensive vacuolization (EV) disappearance of most of cristae and damage of the mitochondrial membrane and microvilli (MV) and d) groups of Golgi apparatus (G).

metabolic intermediates between mitochondria and endoplasmic reticulum. The highly closure of endoplasmic reticulum and mitochondria to the surface of lipid droplet suggests that the oocyte may be utilizing lipid store and could be important in providing nutrients for the

final maturation of the oocyte (Kruip et al., 1983 and Fair et al., 2001), which can explain the success of good type in our results to reach maturation. On the other hand, degeneration or fusion and the observed dilation of the mitochondrial envelope may be an indication that some

7600

Afr. J. Biotechnol.

Figure 6: Electron micrograph of in vitro matured denuded oocyte of Egyptian buffalo showing abnormal polar body formation with no appearance of mitochondria or vesicles.

loss of mitochondria by degeneration was taking place, few markedly degenerate organelles was observed. It seems unlikely therefore that the reduction in number may be accounted for by this means (Kruip et al., 1983). Common feature of mitochondrial shape were seen in this study as showed by many authors such as pleomorphic mitochondria, hooded, and other shapes including dumbbell and cloverleaf shapes were noted, also vacuolated mitochondria described in compact bovine morulae (Crosier et al., 2000) were observed. Hooded mitochondria have been described previously as common in bovine oocytes (Senger and Saacke, 1970; Fleming and Saacke, 1972; Hyttel et al., 1987; Assey et al., 1994). Fleming and Saacke (1972) proposed that the hood served to increase surface area and facilitated transport from the endoplasmic reticulum to hooded mitochondria. They proposed that hooded mitochondria were a unique feature of ruminant oocytes as they were found also in oocytes from goats and sheep. Changes in mitochondrial morphology were observed in this study and at the same time the distribution of mitochondria became more clustered often in association with lipid droplets. These changes may represent a shift in oocyte metabolism from a dependence on the cumulus cells to a dependence on internal stores of energy sources and nutrients. Further studies focusing on oocyte mito-

chondrial function may yield interesting information about oocyte metabolism (Robert, 1999). Large aggregates of smooth endoplasmic reticulum (SER) surrounded by mitochondria are considered to be typical of in vivo matured oocytes 24 h after the LH peak (Gosing and Jonas, 1998). In vitro matured oocytes started to form such clusters at about 18 h of maturation and the aggregation was pronounced more than 24 h of in vitro maturation (Hyttel et al., 1986b). At that time it was considered to be sign of certain metabolic activities maintained throughout the culture period of cattle oocytes (Kruip et al., 1983). Generally, the main differences observed in follicles were cytoplasmic vesicles quantity, mitochondria shape and inner content, ZP deposition and granulosa cells–oocyte junctions (Mondadori et al., 2007). These morphological differences described could be responsible for some functional differences observed in Bubalus bubalis in vitro embryo production and follicular dynamics (Manik et al., 2002; Neglia et al., 2003; Mondadori et al., 2007). From the start of IVM, as a result of the resumption of meiosis, nucleus morphology changes and PVS grow, preparing to receive the polar body. In most oocytes studied, metaphase stage II was achieved after 24 h of IVM period as shown by earlier reports (Nandi et al., 2002b; Gasparrini et al., 2008) but in contrast to Rafael et al. (2010).

Barakat et al.

REFERENCES Assey RJ, Hyttle P, Greve T, Purwantara B (1994). Oocytes morphology in dominant and subordinate follicles. Mol. Reprod. Dev. 37: 335-344. Bacci ML, Galeat G, Mattoili M, Boni R, Seren E (1991). In vitro maturation and in vitro fertilization of buffalo oocytes. Proc., Third World Buffalo Congress, Varna, Bulgaria, 3: 599-603. Chuangsoongneen U, Kamonpatana M (1991). Oocytes maturation, in vitro fertilization and culture system for developing preimplantation swamp buffalo embryos using frozen-thawed semen. Buffalo J. 2: 189-198. Cran DG, Moor RM, Hay MF (1980). Fine structural of the sheep oocytes during antral follicle development. J. Reprod. Fertil. 59: 125132. Crosby IM, Osborn JC, Moor RM (1981). Follicle cell regulation of protein synthesis and development competence in sheep oocytes. J. Reprod. Fertil. 62: 575-582. Crosier AE, Farin PW, Dykstra MJ, Alexander JE, Farin CE (2000). Ultrastructural morphometry of bovine compact morula produced in vivo or in vitro. Biol. Reprod. 62: 1459-1465. De Loose FAM, Van Vliet C, Van Maurik P, Kruip TAM (1989). Morphology of immature bovine oocytes. Gamete Res. 24:197-204. Drost M (2007). Advanced reproductive technology in the water buffalo. Theriogenology, 68: 450-453. Fair T, Hyttel P (1997). Oocyte growth in cattle – ultrastructure, transcription and developmental competence. In: Motta, P (ed.). Microscopy of Reproduction and Development: A Dynamic Approach. pp. 109-118. Fair T, Lonergan P, Boland B (2001). The acquisition of developmental competence in bovine oocytes. Faculty Agric. Res. Report 20002001, pp. 30-32. Fleming WN, Saacke RG (1972). Fine structure of the bovine oocyte from the mature graafian follicle. J. Reprod. Fertil. 29: 203-213. Fuku E, Liu J, Downey BR (1995a). In vitro viability and ultrastructural changes in bovine oocytes treated with a vitrification solution. Mol. Reprod. Dev. 40: 177-185. Fuku E, Xia L, Downey BR (1995b). Ultrastructural changes in bovine oocytes cryopreserved by vitrification. Cryobiology, 32: 139-156. Gasparrini B (2002). In vitro embryo production in buffalo species: state of the art. Theriogenology, 7: 237-256. Gasparrini B, Boccia L, Marchandise J, Di Palo R, George F, Donnay I, Zicarelli L (2006). Enrichment of in vitro maturation medium for buffalo (Bubalus bubalis) oocytes with thiol compounds: effects of cystine on glutathione synthesis and embryo development. Theriogenology, 65: 275-287. Gasparrini B, De Rosa A, Attanasio L, Boccia L, Di Palo R, Campanile G, Zicarelli L (2008). Influence of the duration of in vitro maturation and gamete co-incubation on the efficiency on in vitro embryo development in Italian Mediterranean buffalo (Bubalus bubalis). Anim. Reprod. Sci. 105: 354-364. Golbus MS, Stein MP (1978). Qualitative patterns of protein synthesis in the mouse oocyte. J. Exp. Zool. 198: 337-342. Hyttel P, Fair T, Callesen H, Greve T (1997). Oocyte growth, capacitation and final maturation in cattle. Theriogenology, 47: 23-32. Hyttel P, Greve T, Callesen H (1989). Ultrastructural aspects of oocyte maturation and fertilization in cattle. J. Reprod. Fertil. 38: 35-47. Hyttel PH, Callesen H, Greve T (1986a). Ultrastructural features of preovulatory oocytes maturation in superovulated cattle. J. Reprod. Fertil. 76: 645-656. Hyttel PH, Xu KP, Smith S, Greve T (1986b). Ultrastructure of in vitro oocytes maturation in cattle. J. Reprod. Fertil. 78: 615-625. Hyttle P, Xu KP, Smith S, Callesen H, Greve T (1987). Ultrastructure of the final nuclear maturation of bovine oocytes in vitro. Anat. Embryol. 176: 35-40. Kacinskis MA, Lucci CM, Luque MCA, Bao SN (2005). Morphometric and ultrastructural characterization of Bos indicus preantral follicles. Anim. Reprod. Sci. 47: 45-57. Kafi M, Mesbah F, Nili H, Khalili A (2005). Chronological and ultrastructural changes in camel (Camelus dromedarius) oocytes during in vitro maturation. Theriogenology, 63: 2458-2470. Kanwal KDS (1999). Ultrastructural changes in bovine oocytes induced

7601

during in vitro production of embryos, Ph. D., Thesis, University Putra Malaysia. Kruip TAM, Cran DG, Beneden THV, Dieleman SJ (1983). Structural changes in bovine oocytes during final maturation in vitro. Gamete Res. 8: 29-47. Loos De F, Kastrop P, Van Maurik P, Van Beneden TH, Kruip TAM (1991). Heterologous cell contacts and metabolic coupling in bovine cumulus oocyte complexes. Mol. Reprod. Dev. 28: 255-259. Loos De F, Van Vliet C, Van Maurik P, Kruip TAM (1989). Morphology of immature bovine oocytes. Gamete Res. 24: 197-204. Lu G, Hsu TT (1990). IVF of oocytes in Taiwan water buffalo. Proceed. rd of the 3 World Buffalo Cong. pp. 604-609. Manik RS, Palta P, Singla SK, Sharma V (2002). Folliculogenesis in buffalo (Bubalus bubalis): a review. Reprod. Fertil. Dev. 14: 315-325. Manjunatha BM, Ravindra JP, Gupta PSP, Devaraj M, Nandi S (2009). Effect of breeding season on in vivo oocyte recovery and embryo production in non-descriptive Indian river buffaloes (Bubalus bubalis). Anim. Reprod. Sci. 111: 376-383. Merchant H, Chang MC (1971). An electron microscopic study of mouse eggs matured in vivo and in vitro. Anat. Rec. 171: 21-38. Mondadori RG, Luque MCA, Santin TR, B´ao SN (2007). Ultrastructural and morphometric characterization of buffalo (Bubalus bubalis) ovarian preantral follicles. Anim. Reprod. Sci. 97: 323-333. Mondadori RG, Santin TR, Fidelis AAG, Porfirio E, Bao SN (2008). Buffalo (Bubalus bubalis) preantral follicle population and ultrastructural characterization of antral follicle oocyte. Reprod. Dom. Anim. Epub ahead of print. Boni R, Santella L, Dale B, Roviello S, Di Palo R, Barbieri V (1992). Maturazione in vitro di oociti buffalini: indagine ultrastrutturale. Acta Med. Vet. 38: 153-161. Moor RM, Hay MF, Dott HM, Cran DG (1978). Macroscopic identification and steroidogenic function of atretic follicles in sheep. J. Endocrinol. 77: 309-318. Moor RM, Osborn JC, Cran DG, Walters DE (1981). Selective effect of gonadotrophins on cell coupling, nuclear maturation and protein synthesis in mammalian oocytes. J. Embryol. Exp. Morph. 61: 347365. Moor RM, Warnes GM (1978). Effect of oocyte maturation in mammals. In: Control of Ovulation. Crighton DB, Foxcroft GR, Haynes NB and Lamming GE (eds.). Butterworths, London, pp. 159-176. Nagano M, Katagiri S, Takahashi Y (2006). Relationship between bovine oocyte morphology and in vitro developmental potential. Zygote, 14: 53-61. Nandi S, Raghu HM, Ravindranatha BM, Chauan MS (2002a). Production of buffalo (Bubalus bubalis) embryos in vitro: premises and promises. Reprod. Dom. Anim. 37: 65-74. Nandi S, Ravindranatha BM, Gupta PSP, Sarma PV (2002b). Timing of sequential changes in cumulus cells and first polar body extrusion during in vitro maturation of buffalo oocytes. Theriogenology, 57: 1151-1159. Neglia G, Gasparrini B, Di Brienza VC, Di Palo R, Campanile G, Presicce GA, Zicarelli L (2003). Bovine and buffalo in vitro embryo production using oocytes derived from abattoir ovaries or collected by transvaginal follicle aspiration. Theriogenology, 59: 1123-1130. O’Brien JK, Dwarte D, Ryan JP, Maxwell WM, Evans G (2005). Developmental capacity, energy metabolism and ultrastructure of mature oocytes from prepubertal and adult sheep. Reprod. Fertil. Dev. 8: 1029-1037. Rafael GM, Tiago RS, Andrei AGF, Khesller PON, Juliana SS, Rodolfo R, Sˆonia NB (2010). Ultrastructure of in vitro oocyte maturation in buffalo (Bubalus bubalis). Zygote, 18: 309-314. Robert C (1999). Presence of Bcl-x and Bax mRNA in bovine cumulusoocyte complex. Theriogenology, 51: p. 191. Senger PL, Saacke RG (1970). Unique mitochondria in the bovine oocyte. J. Cell. Biol. 46: 405. Suzuki H, Jeong BS, Yang X (2000). Dynamic changes of cumulus– oocyte cell communication during in vitro maturation of porcine oocytes. Biol. Reprod. 63: 723-729. Thibault C (1977). Are follicular maturation and oocyte maturation independent processes? J. Reprod. Fertil. 51: 1-15. Totey SM, Singh G, Taneja M, Pawshe CH, Talwar GP (1992). In vitro maturation, fertilization and development of follicular oocytes from buffalo (Bubalus bubalis). J. Reprod. Fertil. 95: 597-607.

7602

Afr. J. Biotechnol.

Totey SM, Singh G, Taneja M, Talwar GP (1991). In vitro maturation and fertilization of follicular oocytes from buffalo. Theriogenology, 35: p. 284. Van Blerkom J, Runner MN (1984). Mitochondrial reorganization during resumption of arrested meiosis in the mouse oocyte. Am. J. Anat. 171: 335-355. Van Blerkom J, Bell H (1986). Regulation of development in the fully grown mouse oocyte: Chromosome-mediated temporal and spatial differentiation of the cytoplasm and the plasma membrane. J. Embryol. Exp. Morph. 93: 213-238. Yong-jie Y, Yan-jun Z, Yuan L (2009). Ultrastructure of human oocytes of different maturity stages and the alteration during in vitro maturation. Fertil Steril. 92: e1-e6.

Zaki M (2000). Light and electron microscopic studies on the retina of certain reptiles. M. Sc., Fac. Sci., Ain Shams Univ., Cairo, Egypt. Zamboni L, Thomson RS (1972). Fine morphology of human oocyte maturation in vitro. Biol. Reprod. 7: 425-457.

African Journal of Biotechnology Vol. 11(30), pp. 7603-7608, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4078 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Optimization of plasmid electrotransformation into Escherichia coli using Taguchi statistical method Mohamad Heiat1, Hossein Aghamollaei1*, Seeyed mostafa Hoseinei2, Reza Abbasi Larki3 and Kheirollah Yari4 1

Applied Biotechnology Research Center, Baqiyatallah University of Medical Science, Tehran, Iran. 2 Young Researchers Club, Science and Research Branch, Islamic Azad university, Tehran, Iran. 3 Department of microbiology, Islamic Azad university, Tonekabon Branch, Tonekabon, Iran. 4 Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran. Accepted 16 February, 2012

Electroporation is a mechanical method used to introduce polar molecules into a host cell through the cell membrane. In this procedure, a large electric pulse temporarily disturbs the phospholipid bilayer allowing molecules like DNA to pass into the cell. Application of statistical methods to determine the appropriate processes have been suggested for genetic engineering and biotechnology technique such as electroporation. This study explains the use of Taguchi statistical method to optimize the conditions for efficient plasmid transformation into Escherichia coli via electroporation. In order to improve electroporation, optical density of bacteria, recovery time and electrical parameter (field strength and capacitance) were optimized using the Taguchi statistical method. ANOVA of obtained data indicated that the optimal conditions of electrotransformation of pET-28a (+) plasmid into Escherichia coli BL21(DE3)pLysS was 0.7, 120 min, 12 kV/cm and 50 µF, for optical density of cell culture, recovery time, field strength and capacitance, respectively. The most significant alterations are decrease in field strength and increase in optical density in comparison with common electroporation protocol. The maximum level of plasmid transformation obtained under optimal condition was 8.7×108 transformants/µg DNA plasmid, which was 6.7 fold higher than the control condition. Kay words: Electroporation, Taguchi statistical method, Plasmid. INTRODUCTION Many techniques in molecular biology research require a foreign DNA to be inserted into a host cell. Since the phospholipid bilayer of the plasma membrane has a hydrophilic exterior and a hydrophobic interior, any polar molecules, including DNA and protein, are unable to freely pass through the membrane (Cserhati and Szogyi, 1995). Many methods have been developed to pass this barrier and allow the insertion of DNA and other molecules into the cells. One of these methods is electroporation. The concept of electroporation has been

*Corresponding author. E-mail: Tel/Fax: +98-21-88617712.

aghamolaei22@gmail.com.

Abbreviation: ANOVA, Analysis of variance.

capitalized on the relatively weak nature of the phospholipid bilayer's hydrophobic/hydrophilic interacttions and its ability to spontaneously reassemble after disturbance (Cserhati and Szogyi, 1995). Thus, a quick voltage shock may disrupt areas of the membrane temporarily, allowing polar molecules to pass, but sometimes the membrane may reseal quickly and leave the cell intact. Typically, 10,000 to 100,000 V/cm (varying with cell size) in a pulse lasting a few microseconds to a millisecond is necessary for electroporation. This electric pulse disturbs the phospholipid bilayer of the membrane and causes the formation of temporary aqueous pores. The electric potential across the membrane of the cell simultaneously rises by about 0.5 to 1.0 V so that charged molecules (such as DNA) are driven across the membrane through the pores in a manner similar to electrophoresis. Electroporation has some advantages

7604

Afr. J. Biotechnol.

including versatility with nearly all cell and species types, efficiency of cell transformation (Miller and Nickoloff, 1995) and small scale of required DNA (Withers, 1995). Electroporation has also some disadvantages just as cell damage at wrong length or intensity of pulses (Weaver, 1995) and nonspecific transport of material into and out of the cell during the time of electropermeability (Weaver, 1995). Electroporation is widely used in many areas of molecular biology research and in the medical field. Some applications of electroporation include: DNA transfection (Hoffmann et al., 2000), direct transfer of plasmids into the cells, induced cell fusion (Weber and Berg, 1995), trans-dermal drug delivery (Prausnitz et al., 1993), cancer tumor electrochemotherapy (Mir et al., 2003) and gene therapy. Development of optimized conditions is essential in biology and biotechnology project. Plasmid transformation is one of the most critical step in genetic engineering; the optimization of main factors in DNA plasmid transformation are vital for accessing to better results. Statistical methods are crucial to the improvement of efficiency because they play an important role in experimental design, evaluation and optimization of variables. Several statistical methods are widely used in biological processes (Rao et al., 2008). Among them, the Taguchi method is utilized as a screening filter, which examines the effects of variables and identifies those factors which have major effects on the process. By using this method, optimal conditions are obtained through the use of few experiments (Rao et al., 2008). It is known that compared to super efficient strains like Escherichia coli DH5α or Top 10, E. coli BL21 (DE3)pLysS, as a expression host, is a strain that gives much lower transformation efficiency. So transformation optimization for this strain is critical for obtaining maximum colony number. In this study, in order to increase the efficiency of plasmid electrotransformation into E. coli BL21(DE3)pLysS, Taguchi statistical design was used for the determination and optimization of main variables and how each variable affects conditions for plasmid electrotransformation. MATERIALS AND METHODS Bacteria, plasmid, medium and instruments The E. coli BL21(DE3) pLysS, as a host was purchased from Pasteur Institute of Iran, pET-28a(+) as cloning and expression plasmid was purchased from Novagen, Cat No: 69864-3. The pET28a(+) plasmid genetically engineered for high expression in E. coli, contains a kanamycin resistance gene for transformant selection. Luria-Bertani medium (LB) and SOC medium were used for cultivation and recovery of bacteria; gene pulser Xcell electroporation system (BioRad) was used as electroporator instrument.

NaCl (10 g/L) and tryptone (10 g/L), was used for cultivation. E. coli in shaking flask, LB agar (LB medium containing 15 g/L agar) was used for bacterial plate cultivations. The pH of the media were adjusted at 7.1 and then sterilized by autoclaving at 121°C for 20 min. SOC medium contains Bacto-tryptone (20 g/L), Bacto-yeast extract (5 g/L), NaCl (0.5 g/L), 1 M KCl (2.5 ml) and ddH2O to 1000 ml. The media was sterilized, then 10 ml sterile 1 M MgCl2, 10 ml 1 M MgSO4 and 20 ml 1 M glucose was added. Competent cell preparation E. coli BL21(DE3)pLysS cells were cultivated in 250 ml flask containing 50 ml of LB medium at 37°C up to optical density at 600 nm of 0.5, 0.7, 0.9 and 1.1. Then cultivation stopped and incubated in ice for 30 min. Thereafter, the bacterial cells were collected by centrifugation at 3000 g for 10 min at 4°C, and the pellet resuspended in 50 ml sterile ice cold 10% glycerol. The cells were collected again by centrifugation, and re-suspended in 5 ml sterile ice cold 10% glycerol. The cells were collected again and resuspended in 1 ml sterile ice cold 10% glycerol. Pellets were aliquot in 25 µl and stored at -70°C for subsequent procedure (Kahrizi and Salmanian 2008). Statistical design In order to maximize plasmid transformation, the common electroporation method was used and the effect of optical density of bacteria, electrical parameter (field strength and capacitance) and recovery time were selected for screening by using the Taguchi statistical method (Table 1). The L8 orthogonal array was used for examining of the aforementioned factors and interaction between two factors includes: Optical density and field strength at 2 levels (Table 2). After screening, the more effective factors and their interactions were optimized using L4 (Table 3) and L9 (Table 4) orthogonal arrays. L9 was designed for three different levels of optical density and field strength (Table 5). Qualitek-4 software was used for automatic design and standard analysis of variance (ANOVA) of Taguchi experiments. The results from ANOVA showed and identified the effect of each factor and estimated the performance of the optimum condition.

Plasmid transformation (optimum conditions) Two microliter (2 µl) of pET-28a(+) plasmid (500 pg/µl) was mixed with 25 µl of 10% glyserol-treated competent cell suspension (OD600nm = 0.7), after 10 min incubation in ice, suspension was transferred into the cold cuvette with 0.1 cm inter-electrode gap. Electroporation procedure performed with adjusted 12 kV/cm and 50 µF of field strength and capacitance respectively. Thereafter, 1 ml of SOC medium was added and the mixture was incubated at 37°C for 120 min. Then, the cultures were centrifuged and pellets were suspended in 100 µl of LB medium. 10 µl of each culture was plated on LB agar containing kanamycin (40 µg/ml). The resulting transformants colonies usually appeared after 15 h incubation at 37°C. The transformation efficiency (transformants/µg DNA) was calculated (Roychoudhury et al., 2009; Yari et al., 2010; Kahrizi et al., 2007).

RESULTS

Medium

L8 Orthogonal array for evaluation of interaction

The Luria-Bertani medium (LB) composed of yeast extract (5 g/L),

In order to optimize the conditions for plasmid DNA

Heiat et al.

7605

Table 1. Selected variables and their levels for the screening stage by the Taguchi experimental method.

Variable Optical density field strength ( kV/cm) apacitance (ÂľF) Recovery time (min)

Low level 0.5 10 25 60

High level 0.9 20 50 120

Table 2. L8 Orthogonal array of the Taguchi design for screening of selected factors.

Trial number 1 2 3 4 5 6 7 8

Optical density 1 1 1 1 2 2 2 2

Field strength 1 1 2 2 1 1 2 2

Capacitance 1 2 1 2 1 2 1 2

Recovery time 1 2 2 1 2 1 1 2

Table 3. L4 Orthogonal array for studying the interaction between optical density and field strength.

Trial number 1 2 3 4

Optical density 0.5 0.5 0.9 0.9

field strength 10 20 20 10

Table 4. L9 Orthogonal array of the Taguchi design for optimization of significant factors.

Trial number 1 2 3 4 5 6 7 8 9

Optical density 1 1 1 2 2 2 3 3 3

transformation into E. coli, the Taguchi statistical design was applied. The L8 orthogonal array was used for optimization of four variables including optical density of bacteria, recovery time and electrical parameter (field strength and capacitance). Interaction between optical density of bacteria and field strength was also consi-

Field strength 1 2 3 1 2 3 1 2 3

dered. Results were analyzed by standard ANOVA for the determination of the percentage contribution of each variable and the optimum level. These data show that the DNA plasmid transformation into E. coli cells was affected by the optical density of bacteria and field strength. The results show that optimum levels are 0.9,

7606

Afr. J. Biotechnol.

Table 5. Significant variables and their levels employed for optimization experiments using the L9 Taguchi design.

Variable Optical density field strength (kV/cm)

Low level 0.7 8

Medium 0.9 10

High level 1.1 12

Table 6. ANOVA of the effects of assigned variables and interaction on plasmid electrotransformation obtained from L8 orthogonal array.

Factor Optical density Field strength A×B Capacitance Recovery time

DOF (f) 1 1 1 1 1

Variance (V) 2312 1860.5 578 18 60.5

50 µF, 10 kV/cm and 120 min for OD, capacitance, voltage and time of the recovery, respectively. The ANOVA results indicate contribution percentages of variables are 47.70, 38.37, 0.911 and 1.162 for OD600 nm field strength, capacitance and recovery time respecttively. However, the interaction between OD and field strength was significant in electrotransformation (Table 6).

F – ratio (F) 544 437.764 136 4.235 14.235

Contribution (%) 47.705 38.372 11.86 0.911 1.162

Optimized level 2 1 2 2

mants colonies were about 6.7 fold more than the basic conditions (Table 8). Finally, optimal conditions for great transformation of pET-28a (+) plasmid into E. coli BL21(DE3) pLysS are 0.7, 120 min, 12 kV/cm and 50 µF, respectively optical density of cell culture, recovery time, field strength and capacitance. DISCUSSION

L4 Orthogonal array for evaluation of interaction While keeping the optimized conditions of recovery time and capacitance at the suggested level of the initial screening design, interaction between optical density of bacteria and field strength was studied by the L4 orthogonal array. The data were analyzed by standard ANOVA, and the percentage contribution of each variable and the optimum level were obtained. Hence, the optimum levels obtained for optical density of bacteria and field strength variables were 0.9 and 10 kV/cm, respectively (Data not shown). L9 Orthogonal array for optimization of significant variables After screening the significant variables, the effective factors (optical density of bacteria and field strength) were selected for the final optimization stage. The L9 orthogonal array was used to investigate the effects of two main factors, optical density of bacteria and field strength at three levels while the other variables were kept constant at optimum levels. The ANOVA of the obtained result indicated the optimal conditions of field strength and optical density are 12 kV/cm and 0.7, respectively (Table 7). After optimization, the transfor-

Because plasmid transferring is one of the most important steps in gene cloning, access to suitable conditions for high DNA transformation into bacterial cells is essential. Because the transformation of expression vector into a suitable host is a critical step in recombinant protein production, in this study, the pET28a (+) expression vector and E. coli BL21(DE3) pLysS as an expression host were examined. There are several methods such as ultrasound, hydro gel, electroporation and chemical transformation for introducing plasmid into the host. Among them, electroporation is the most effective method for transformation. In recent years, the use of electroporation for transformation of DNA into different host has been improved. Several important factors are involved in electroporation. In this study, the effect of optical density of bacterial culture, field strength, capacitance and recovery time as the important factors in electrotransformation rate were optimized by Taguchi method. Already this technique has been used for the optimization of an electroporation microchip system for gene transfection (Huang et al., 2007). After analysis of L8 orthogonal results by ANOVA for these factors, as shown in Table 6, OD and field strength have significant effects in the electro-transformation of plasmid. Based on Qualitek-4 software and standard ANOVA, 0.9 for OD600nm and 10 kV/cm for field strength were suggested.

Heiat et al.

7607

Table 7. ANOVA of the effects of assigned variables on plasmid electrotransformation obtained from L9 orthogonal array.

Factor Optical density Field strength

DOF (f) 2 2

Variance (V) 1011.11 786.112

Percent, P(%) 56.9 43.021

Optimized level 1 3

Table 8. Verification of the results obtained at control and optimal conditions.

Condition Basal (control) Optimum

Maximum rate of plasmid transformation (transformants/µg plasmid) 1.3 × 108 8.7 × 108

Interaction between these factors is important too. After selection of important factors, interaction between them was studied by L4 orthogonal array. By using L9 orthogonal array, the optimum level for the above factors was 0.7 and 12 kV/cm for OD600nm and field strength respectively. In comparison with basic condition, there was 6.7 fold increase in the number of transformant in optimized conditions, Some researchers have applied Taguchi method for optimization of molecular biology processes. Yari and Mostafaie (2010) reported the effect of various factors for optimization of plasmid transformation by chemical transformation using Taguchi method. The effect of the number of cell washes prior to electroporation, cell number, DNA amount, and cell growth phase on rate of electroporation was investigated by Wu et al. (2010). They reported that 0.15 is the best OD600 nm for electrotransformation of pUC19 plasmid into E. coli DH10B. Rodríguez et al. (2007) reported that optimized OD of Pediococcus acidilactici P60 culture for transformation of pRS4C1 plasmid is 1 to 1.2 in stationary phase. They reported that the optimal field strength is 20 kV/cm. In this study, based on instrument producer instruction (basal conditions: OD600 nm = 0.6, field strength: 18 kV/cm, capacitance: 50 µF and recovery time: 90 min), two levels of OD600 nm (0.5 and 0.9) by L8 and three levels (0.7, 0.9 and 1.1) by L9 orthogonal array were examined. Results show that 0.7 is the best level of OD600 nm in pET28a (+) plasmid transformation into E. coli BL21(DE3) pLysS. Our results are different from Wu report (Wu et al., 2010). It may be due to use of different plasmids and hosts. Our study results are more similar to Rodríguez et al. (2007) in the view point of the best stage of culture for electrotransformation of plasmid into bacteria is a stationary phase. For field strength, four levels, 8, 10, 12 and 20 kV/cm were examined using L8 and L9 orthogonal array and 12 kV/cm was selected as optimized field strength. In this study, the lower OD of bacteria rather than Rodríguez's investigation causes field strength to be less than 20

kV/cm. ANOVA from obtained result indicated that interaction between OD and field strength has the main effect on plasmid uptake by E. coli BL21 (DE3) pLysS. Recovery time after electrical shock is essential for bacterium survival and we showed that 120 min is better than 60 min in the rate of transformation. This time is suitable for host for membrane recovery and expression of the genes that rebound in antibiotic resistance. Conclusions In conclusion, our results show that minor alterations in conditions of main variables for plasmid transformation have positive effect in transformation efficiency. Analysis of variance for obtained data indicated that the optimal conditions for plasmid electrotransformation consist of 0.7, 120 min, 12 kV/cm and 50 µF of optical density of bacteria at 600 nm, recovery time, field strength and capacitance, respectively. The study presented here is apparently the first report to use the Taguchi statistical method for the optimization of conditions to introduce pET-28a(+) plasmid DNA molecules into E. coli BL21(DE3) pLysS cells by use of electroporation method. This work can thus be used as a basis of future investigations in molecular biology methods. REFERENCES Cserhati T, Szogyi M (1995). Role of hydrophobic and hydrophilic forces in peptide-protein interaction: new advances. Peptides, 16: 165-173. Hoffmann E, Neumann G, Kawaoka Y, Hobom G, Webster RG (2000). A DNA transfection system for generation of influenza A virus from eight plasmids. Proc. Natl. Acad. Sci. USA. 97: 6108-6113. Huang KS, Lin YC, Su KC, Chen HY (2007). An electroporation microchip system for the transfection of zebrafish embryos using quantum dots and GFP genes for evaluation. Biomed. Microdevices, 9: 761-768. Kahrizi D, Salmanian AH (2008) Substitution of Ala183Thr in aro A product of E. coli (k12) and transformation of rapeseed (Brassica napus L.) with altered gene confers tolerance to Roundup. Transgenic Plant J. 2(2): 170175.

7608

Afr. J. Biotechnol.

Kahrizi D, Salmanian AH, Afshari A, Moieni A, Mousavi A (2007). Simultaneous substitution of Gly96 to Ala and Ala183 to Thr in 5 enolpyruvylshikimate-3-phosphate synthase gene of E. coli (k12) and transformation of rapeseed (Brassica napus L.) in order to make tolerance to glyphosate. Plant Cell Rep. 26: 95-104. Miller EM, Nickoloff JA (1995). Escherichia coli electrotransformation. Methods. Mol. Biol. 47: 105-113. Mir LM, Morsli N, Garbay JR, Billard V, Robert C, Marty M (2003). Electrochemotherapy: a new treatment of solid tumors. J. Exp Clin. Cancer Res. 22: 145-148. Prausnitz MR, Bose VG, Langer R, Weaver JC (1993). Electroporation of mammalian skin: a mechanism to enhance transdermal drug delivery. Proc. Natl. Acad. Sci. USA. 90: 10504-10508. Rao RS, Kumar CG, Prakasham RS, Hobbs PJ (2008). The Taguchi methodology as a statistical tool for biotechnological applications: a critical appraisal. Biotechnol. J. 3: 510-523. Rodriguez MC, Alegre MT, Mesas JM (2007). Optimization of technical conditions for the transformation of Pediococcus acidilactici P60 by electroporation. Plasmid, 58: 44-50. Roychoudhury A, Basu S, Sengupta DN (2009). Analysis of comparative efficiencies of different transformation methods of E. coli using two common plasmid vectors. Indian. J. Biochem. Biophys. 46: 395-400.

Weaver JC (1995). Electroporation theory. Concepts and mechanisms. Methods Mol. Biol. 55: 3-28. Weber H, Berg H (1995). Electrofusion of yeast protoplasts. Methods Mol. Biol. 47: 93-104. Withers HL (1995). Direct plasmid transfer between bacterial species and electrocuring. Methods Mol. Biol. 47: 47-54. Wu N, Matand K, Kebede B, Acquaah G, Williams S (2010). Enhancing DNA electrotransformation efficiency in Escherichia coli DH10B electrocompetent cells. Electron. J. Biotechnol. Sep. 13(5): 15. Yari K, Fatemi SS, Tavallaei M (2010). Optimization of the BoNT/A-Hc expression in recombinant E scherichia coli using the Taguchi statistical method. Biotechnol. Appl. Biochem. 56: 35-42. Yari Kh, Mostafaie A (2010). Determination of Suitable Conditions for Great Plasmid Transformation into Escherichia Coli using Taguchi Statistical Method. Am. J. Sci. Res.17: 117-123.

African Journal of Biotechnology Vol. 11(30), pp. 7609-7617, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3514 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Isolation and identification of Metarhizium anisopliae from Chilo venosatus (Lepidoptera: Pyralidae) cadaver Lei Liu1, Rulin Zhan2, Laying Yang1, Changcong Liang1, Di Zeng3 and Junsheng Huang1* 1

Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences (Key Laboratory of Integrated Pest Management on Tropical crops, Ministry of Agriculture, Peoples Republic of China; Hainan Key Laboratory for Monitoring and Control of Tropical Agricultural Pests; Hainan Engineering Research Center for Biological Control of Tropical Crops Diseases and Insect Pests), Danzhou 571737, Hainan Province, China. 2 South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang 524091, Guangdong Province, China. 3 College of Applied Science and Technology, Hainan University, Danzhou 571737, Hainan Province, China. Accepted 23 March, 2012

Sugarcane stem borer, Chilo venosatus Walker (Lepidoptera: Pyralidae) is a significant sugarcane pest in South China. Conidia or mycelia collected from the surface of sugarcane stem borer cadavers were cultured. The colony morphology, mycelia and conidial yield were observed with three-agar culture media: potato dextrose agar medium (PDA), potato dextrose with 1% (w/v) peptone agar medium (PPDA), and oatmeal agar medium (OMA). 16 different isolates were identified as Metarhizium anisopliae (Metschnikoff) based on macromorphological, micromorphological, and molecular characteristics, and PPDA was the better culture medium for vegetative growth and conidial yield (109 conidia/ml) than PDA (108 conidia/ml) and OMA (108 conidia/ml). To confirm whether these isolates were pathogenic to C. venosatus, their virulence to the sugarcane stem borer was tested in the laboratory. Both HS (10 isolates) and LY (6 isolates) strains were pathogenic to C. venosatus. Several highly virulent strains were screened in vitro (the mortalities of the eight isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were from 96 to 100%), and tests for controlling the sugarcane stem borer were preliminarily performed in vivo. The results show that significant (p=0.01) reductions in adult population were caused by the strains. So, M. anisopliae isolated from the cadavers of C. venosatus Walker is a potential biocontrol agent against this pest in South China. Keywords: Metarhizium anisopliae, isolation, identification, Chilo venosatus, culture medium, biological control. INTRODUCTION Sugarcane is an important tropical crop and contributes to almost two-thirds of the world’s yield of sugar for hundreds of years (Menossi et al., 2008). The sugarcane stem borer, Chilo venosatus Walker (Lepidoptera: Pyralidae) is an important pest of sugarcane culture and many others crops (Graça, 1976; Long and Hensley,

*Corresponding author. E-mail: h888111@126.com. Tel: +86 13697502890. Abbreviations: PDA, Potato dextrose agar medium; PPDA, potato dextrose with 1% (w/v) peptone agar medium; OMA, oatmeal agar medium.

1972). Larvae of C. venosatus feed within the stem of sugarcane which may result in 25% (w/w) sugarcane production loss (Pan et al., 2009). This lepidopteran pest causes considerable harvest loss in the cane-growing areas of South Africa, Swaziland, Australia, Brazil, India, Antilles, Central and South America, and South China (Gerardo et al., 1994; Katrina et al., 2000; Chillar, 1993; Daniela et al., 2008; Shang and Huang, 2010). Due to a lack of natural antagonists and increasing resistance to chemical pesticides, the sugarcane stem borer has become a serious and devastating pest with significant economic impact (harvest losses with costs of up to several hundred million US $ per year) in South China. All important sugarcane-growing regions, such as

7610

Afr. J. Biotechnol.

Zhanjiang (Guangdong Province), Nanning (Guangxi Province) as well as Lingao and Danzhou (Hainan Province) have recently documented the occurrence of C. venosatus (Zhou et al., 2008; Pan et al., 2009; Shang and Huang, 2010; Zhang et al., 2008). In the past, various management strategies including treatment with chemical agents, such as chlorpyrifos (Zhou et al., 2008) and sumithion (Zhang et al., 2008) as well as the application of frequency vibration-killing lamp and other physical techniques have been used to control the adverse impact of the sugarcane stem borer (Yu et al., 2009; Pan et al., 2009; Shang and Huang, 2010). Although effective in controlling the sugarcane stem borer, chemical and physical approaches could result in serious environmental pollution and indiscriminate killing of ecologically important organisms (Pan et al., 2009). Biological control agents such as Trichogramma (Smith, 1996; Matthias and Paul, 2002; Zhen et al., 2001), Lixophaga diatraeae (Nicholls et al., 2002), Bacillus thuringiensis (Katrina et al., 2000), Metarhizium anisopliae (Gao, 1996) as well as sex attractants causing mating disruption (Lin, 2007), are environmentally friendly alternatives to control the outbreak and maintenance of the sugarcane stem borer. The entomopathogenic fungus M. anisopliae has been effective in controlling more than 200 species of insect pests (Pu and Li, 1996) such as Anopheles arabiensis, Anoplophora glabripennis, Ceratitis capitata, Psoroptes mites, Locusta migratoria migratorioides, Rhipicephalus evertsi evertsi, and Phthorimaea operculella (Dickson et al., 2010; Shanley et al., 2009; Dimbi et al., 2009; Quesada-Moraga et al., 2008; Brooks and Wall, 2005; Niassy et al., 2011; Marius et al., 2011; Sabbour, 2002). The application of M. anisopliae has several advantages over the conventional chemical pesticides, such as limited harm to humans, honey bees, livestock, and crops (Monique et al., 2011). However, there are no reports available if M. anisopliae strains isolated from different insect pests can effectively control C. venosatus in South China. In addition, exploratory surveys for the isolation of highly virulent M. anisopliae strains have been suggested. Our laboratory already had isolated M. anisopliae from natural infections of coconut hispid beetle Brontispa longissima (Gestro) (Coleoptera: Chrysomelidae), and preliminary studied on against this pest in Hainan island, China (Zhan et al., 2007). In this study, cadavers of C. venosatus were recovered from sugarcane, and mycelia and conidia were collected from the cuticle surfaces. Subsequently, fungi were isolated on selective medium and their identification, virulence to C. venosatus larvae in vitro, and effects of application in vivo were tested.

Xuwen, Zhanjiang (Guangdong Province, five isolates), Xianhu of W uming, Nanning (Guangxi Province, two isolates), Bohou of Lingao, and W angwu of Danzhou (Hainan Province, nine isolates) of China. Stems of sugarcane infected with C. venosatus were cut, and dead and healthy larvae were collected. Cadavers were transferred to sterilized Petri dishes and healthy larvae were transferred to sugarcane seedlings, which were planted in plastic boxes for further rearing. Cadavers were used to isolate the entomopathogenic fungi, and the living insects were used to evaluate the insecticide potential of isolated fungi against C. venosatus.

MATERIALS AND METHODS

Tests on biological characters of isolates

Collection of sugarcane stem borer

Tests on colony macromorphological aspects on different culture medium

Sugarcane stem borer larvae were collected from seriously infected regions, including the fields near W enfengyuan of

Preparation of culture media Three different culture media were prepared: potato dextrose agar (PDA), PDA with 1% (w/v) peptone (PPDA), and oatmeal agar medium (OMA). The dodine oatmeal agar medium (DOA) was prepared as the selective medium by adding elements (mainly contained 200 μgml-1 dodine (Beilharz et al., 1982; Fernandes et al., 2010), 100 μgml-1 penicillin, 50 μgml-1 streptomycin (Chase et al., 1986), and 200 μgml-1 chloromycetin) in OMA for screening entomopathogenic fungi (Beilharz et al., 1982; Chase et al., 1986; Liu et al., 2007; Du et al., 2008). Isolation and identification of M. anisopliae Cadavers of the sugarcane stem borer larvae were collected from the field. Sterile needles were used to isolate mycelia or conidia from the cuticles of cadavers and were transferred into a 1.5 ml Eppendorf tube containing sterile distilled water. Conidial suspension (5×105 conidia/ml) was prepared and 100 μl were transferred homogeneously spread with drigalski to a Petri dish containing 15 ml of DOA and incubated at 28°C. After three days, the dishes were checked daily until the eighth day. Fungal colonies appearing on each Petri dish were transferred to Eppendorf test tubes containing PPDA and incubated at the same conditions as earlier stated.Each isolate was isolated and observed with a light microscope. A single conidium on the surface of water-agar medium was collected with a sterile capillary tube and transferred onto PPDA to isolate the culture. Identification of the isolates were performed at a species level according to Pu and Li (1996), Tulloch (1976), Roddam and Rath (1997), Zimmerman (1993), and Driver et al. (2000). M. anisopliae DNA was isolated by using the method described by Pfeifer and Khachatourians (1993). Primer sequences (forward (TW81): GTTTCCGTAGGTGAACCTGC and reverse (AB21): ATATGCTTAAGTTCAGCGGGT) were synthesized by SBS Genetech Co., Ltd. (Curran et al., 1994). The PCR reaction mix (50.0 μl final volume) consisted of 37.3 μl of ddH2 O, 5.0 μl of 10×PCR Buffer (plus 20 mmol/L MgCl2), 4.0 μl of dNTP mixture (50 mmol/L), 1.0 μL of each primer (250 nM final concentration), 0.7 μl of Taq DNA polymerase (2 U/μl), and 1.0 μl of genomic DNA (10 ng/μl). A blank (no template control) was also incorporated in each assay. The thermo cycling program consisted of one hold at 94°C for 4 min, followed by 33 cycles of 30 s at 94°C and 30 s at 55°C centigrade and 60 s at 72°C. After completion of these cycles, melting-curve data were then collected to verify PCR specificity, contamination and the absence of primer dimers. In addition, the internal transcribed space of the strains was analyzed by comparing the sequence in the region of ITS1-5.8S-ITS2 with Vector NTI 9.0.

All isolates were cultured in Petri dishes containing PDA, PPDA, and

Liu et al.

OMA. Colony color and mycelia texture were evaluated daily (starting from the 5 th day after incubation) and documented by photography. The sizes of 50 conidia of each strain were measured with a Leica microscope and average values were compared for all strains.

7611

repeated experiments, the data from each experiment were pooled and evaluated by one-way analysis of variance (ANOVA) (SPSS 14.0 for Windows). Abbott (1925) was then used for correction.

RESULTS Tests on colony growth rate and conidia yield on different culture media All isolates were cultured on solid PDA, PPDA, and OMA. Conidia were harvested at the 12th day after culture by surface-scraping. Homogenous spore suspensions were made by placing harvested spores in 20 ml of sterile distilled water in glass bottles containing 0.1% (v/v) Tween-80 and agitated on a vortex mixer for 30 s. Spore concentrations were determined using a hemocytometer. The procedure was replicated three times for each strain.

Tests on virulence to C. venosatus All isolates were cultured and maintained on PPDA. Conidia were harvested and spore suspensions (1.0×105, 1.0×106, 1.0×107, and 1.0×108 conidia/ml) were prepared in sterile water with 0.1% (v/v) Tween-80. In addition, three and four instars larvae of C. venosatus were reared for one week, then, 30 larvae were selected for each treatment. Each 30 larvae were sprayed (used hand-held sprayers) with 5 ml of conidial suspension and then placed into sugarcane seedlings, which were planted in plastic boxes. The boxes were placed into an insect-rearing cage and incubated at ambient temperature (25 to 32°C). Each treatment was replicated three times. The control was sprayed with 5 ml of sterile water containing 0.1% (v/v) Tween-80. The commercial formulation (BioCane granule, Australia, 1.0×108 conidia/ml) suspension was also sprayed with 5 ml. After the 15th day, dead larvae were selected, and mortalities were calculated for every isolate. Abbott (1925) was then used for correction. Subsequently, all dead sugarcane stem borers were transferred to Petri dishes to evaluate mycosis growth on the surface. The procedure was replicated three times for each isolate. Preliminary applications on sugarcane stem borers in vivo Preliminary tests on sugarcane stem borer in vivo application was performed at the Bohou farm of Lingao, where sugarcane was seriously infected by C. venosatus. Each treatment was 130 m long by 25 m wide with a total area of 3250 m2. The conidial suspension which was prepared with the wettable powder of M. anisopliae (the highly virulent isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9), were used to control C. venosatus in vivo, which was mixed with 43% (w/w) additives (consisted of 25% (w/w) wetting agents, 18% (w/w) dispersant, 16% (w/w) suspending agents and 41% (w/w) stabilizing agents), and adjusted to ≥1.0×107 conidia/ml. The first control (Con 1) was BioCane granule (Australia). The second control (Con 2) was also brushed with only water with 43% (w/w) additives. After three months, the suspensions (15 ml/m2) were sprayed on the stem of each sugarcane twice with an interval of three months, especially at the bell site part of sugarcane and the eclosion hole part of sugarcane. The adult sugarcane stem borer was caught in water tray traps (20 to 30×7 to 10 cm) baited with synthetic sex pheromone with an interval of two months. Finally, the sugarcane was harvested and the fresh weight compared. The trials were replicated three times. Statistical analysis To analyze for significant (p=0.01) difference between the results of

Strains isolation 16 filamentous fungal isolates from cadavers were screened on DOA on different Petri dishes. The isolate from each Petri dish was regarded as a strain. All of these strains were purified and transferred to PPDA for further identification. As a result, all isolates were identified as M. anisopliae. According to the macromorphological and molecular characteristics, we found two distinct strains based on the differences in colony morphology and molecular characteristics, and were thus recorded as HS (10 isolates) and LY (six isolates) isolates. After four days of incubation, the colonies of all HS isolates on PPDA were nearly completely covered with mycelium, but few mycelium were present on the LY isolates under the same conditions. However, there were no significant differences in conidial shape and size of the two kinds of isolates: cylindrical with obtuse ends, slightly narrowing in the center, and the conidial width (1.5 to 3 μm) and length (4 to 8 μm). Also, the structure of conceptacles was not different from those described by Pu Zhelong (Pu and Li, 1996). Based on nucleic acid sequence analysis, both isolates, HS and LY, were M. anisopliae var. anisopliae (Figure 1) (Curran et al., 1994). Screening of optimal culture medium for isolates with colony growth and conidia yield The results show that PPDA was the optimal culture medium for colony growth and conidia yield for both M. anisopliae HS and LY strains. The results are summarized in Table 1. For three to seven days, colony growth rate on PPDA was faster than on the other media. The average conidial yield of M. anisopliae HS1 isolate was 1.02×109 conidia/ml on PPDA, which was significantly (p=0.01) more than 3.81×108 conidia/ml on PDA and 1.96×108 conidia/ml on OMA, other isolates had the same results. Pathogenicity to C. venosatus and application effects in vivo Both HS (10 isolates) and LY (six isolates) strains were pathogenic to C. venosatus (Figures 2a, b, c and d). Using 1.0×107 conidia/ml, the larvae mortality ranged from 60 to 100%. HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 isolates were the most pathogenic to C. venosatus and were significantly (p=0.01) higher than the two control treatments (Figure 2e). The mortality of the first control

7612

Afr. J. Biotechnol.

Figure 1. Nucleic acid sequence phylogenetic tree of new isolated strains and reported Metarhizium anisopliae strains. The codes following the names are the GenBank Accession numbers. The GenBank Accession number of HS strain sequence (10 isolates) was HM118821, and the GenBank Accession number of LY strain sequence (six isolates) was HM055582. The analysis, assembling, and similarity of nucleic acid sequence of the region of ITS1-5.8S-ITS2 search were used with Vector NTI 9.0 software.

(Con 1) was only 28%, and few mycelia growth was found on cadavers. In moist conditions, conidia and mycelia were observed on the surface of cadavers and identified as the same fungi species used in the initial inoculation. The high-virulence isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were also significantly (p=0.01) higher than the commercial formulation of M. anisopliae (the second control, Con 2). The results show that the strains isolated from endomopathogenic fungi in C. venosatus were pathogenic and that eight of the strains were highly virulent to C. venosatus. Then, the highly virulent isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were used to control C. venosatus in vivo. The averages of the eight sugarcane treatments after 300 days was significantly (p=0.01) higher than the two control treatments (Figure 3). The sugarcane fresh weight after harvesting the eight treatments using isolates HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were from 2.35×104 to 2.80×104 kg; the first

control (Con 1) was 1.65×104 kg, and the second control 4 (Con 2) was 2.16×10 kg. The average population of the adult sugarcane stem borer taken before application varied from 59.3 to 29.4 after 120 days and to 17.0 after 300 days, and cadavers with mycosis were present at more than 75%. Few changes occurred at the first control (Con 1), in which the adult sugarcane stem borer population varied from 53.4 to 57.0 and to 54.1 at the same time, and few cadavers were found. The averages of adult sugarcane stem borers population of the second control (Con 2) varied from 56.3 to 37.4 and to 25.0 (Figure 4). DISCUSSION In this study, we reported 16 isolates of M. anisopliae, isolated from different fields in South China, which had high pathogenicity against C. venosatus. Strains of M.

Liu et al.

7613

Table 1. Yield of conidia of 16 M. anisopliae isolates on different culture media (PPDA, PDA, OMA).

Isolate

HS1 9

Yield (PPDA) (10 conidia/ml) 8

Yield (PDA) (10 conidia/ml) 8

Yield (OMA) (10 conidia/ml)

HS2

a

0.95

bc

3.79

c

1.77

1.02 *

0.83

3.81b

c

3.59

c

1.52

1.96

HS3

a

HS4

a

0.82

bc

3.74

c

1.49

HS5

a

0.76

bc

3.61

c

1.41

HS6

a

1.10

bc

4.11

c

2.23

HS7

a

1.06

bc

3.89

c

1.99

HS8

a

0.82

bc

3.71

c

1.66

HS9

a

0.71

bc

3.63

c

1.56

HS10

a

0.86

bc

3.59

c

1.45

LY1

a

0.62

bc

2.89

c

1.02

LY2

a

0.78

bc

3.12

c

1.35

LY3

a

0.76

bc

3.04

c

1.26

LY4

a

0.52

bc

2.88

c

0.96

LY5

a

0.59

bc

2.91

c

1.01

LY6

a

0.72a

bc

2.97

c

1.16

bc c

*The same capital letters indicate no significant difference for the mean value (Tukey窶適ramer test, F=1.25, p=0.01). Abbott (1925) was then used for mortality correction.

anisopliae have been isolated from soils (Roddam and Rath, 1997; Tarasco et al., 1997) and insects (Pedro and Candido, 1997; Poprawiski and Yule, 1991) from different regions of the world. Some strains have been used to control sugarcane pests, such as Acrididae, Dynastidae and Cercopidae (Zhang et al., 2006). This is the first study to report that strains of M. anisopliae were isolated from C. venosatus in South China. All isolated strains were M. anisopliae var. anisopliae, according to macromorphological and molecular characteristics analyses. The fungi have a broad-spectrum insecticidal activity (Wekesa et al., 2005; Alonso-Dﾃｭaz et al., 2007; Zhang et al., 2006). Our study reveals that PPDA is a better culture medium for colony growth and conidia yield than PDA and OMA. Before this study, PDA was commonly used as the medium to culture M. anisopliae (Liu et al., 2007; Du et al., 2008). The improved DOA is an effective selective medium for screening M. anisopliae from both soils and insects. The results show that the isolates were pathogenic to C. venosatus, based on the symptoms after inoculating the sugarcane stem borer with the isolates. In pathogenic tests, the mortality in treatments was significantly (p=0.01) higher than the controls (the first control was treated with chemical BioCane granule and the second control

was treated with water with 43% (w/w) additives). In addition, fungal outgrowth was found on the surface of dead sugarcane stem borer in humid conditions but not in the blank control (treated with water with 43% (w/w) additives). Eight highly pathogenic strains of HS1, HS6, HS7, LY2, LY3, LY6, HS3 and HS9 were applied in vivo, which caused a significant (p=0.01) reduction in the adult population.Our studies show that M. anisopliae has potential as a biocontrol agent against the sugarcane pests. Recently, the effective strategies on C. venosatus control performed in Guangdong and Hainan Provinces and others, in 1990 to 2010, involved rearing of natural antagonists of Trichogramma, L. diatraeae, and spraying insecticides. However, the biological control effect of Trichogramma and L. diatraeae were easily affected by environmental elements (Zhang, 1997; Talekar and Shelton, 1993; David et al., 1991). It was reported that the transgenic sugarcane lines expressing high levels of synthetic Cry1Ac proteins were highly resistant to sugarcane stem borer attack (Weng et al., 2006). Biological control agents for the corn borer, such as the parasitic fungus Beauveria bassiana and the release of the parasitic wasp Trichogramma ostriniae, were used in cornfields (Cherry et al., 1999; Hoffmann et al., 2002). In contrast, M. anisopliae isolated from local sugarcane stem borer had better environmental resistance. As an important part of

an integrated pest management (IPM) strategy, M. anisopliae could be widely used. M. anisopliae can be considered promising for biological control of sugarcane stem borer by reducing the pest population and lessening the dependence on chemical control. Conclusion In conclusion, we have isolated 16 M. anisopliae isolates, in which eight have high pathogenicity against C. venosatus. Furthermore, all of these isolates could be used for controlling sugarcane stem borer. Biological studies, including the isolation and identification of M. anisopliae and the illustration of cultural process, are required for a better understanding of the pathogenic activities and roles. The role of M. anisopliae against C. venosatus has explicit evidence in natural conditions. ACKNOWLEDGMENTS This research was supported by the Key Project in the National Science and Technology Pillar Program of China (No. 2007BAD48B00). The authors thank Prof. Cheng Bai at the Environment and Plant Protection Institute, Chinese Academy

7614

Afr. J. Biotechnol.

HS1

A

HS2

HS3

HS3

HS4

LY2

10

100

1000

Dose (105 conidia/ml) HS9 HS10 LY1

C 100

Mortality (%)

50

1.0

10

LY2

100

HS5

HS6

1.0

HS7

D

HS8

5

Dose (10 conidia/ml)

50

100

1000

5

Dose (10 conidia/ml) LY3 LY4 LY5

D

LY6

100

1.0 50

10

100

1000

5

Dose (10 conidia/ml) LY3 LY4 LY5

LY6

0

100

1000

10

50

0

0 1.0

HS8

0

Mortality (%)

Mortality (%)

Dose (10 conidia/ml) HS9 HS10 LY1

50

0

1000

5

50

100

100

Mortality (%)

Mortality (%)

C

10

HS7

100

0 100 1.0

Mortality (%)

HS2

B

Mortality (%)

Mortality (%)

50

HS1

HS6

100

100

A

HS5

B

HS4

1.0

10

100

1000

5

Dose (10 conidia/ml)

50

Figure 2. Comparing mortalities of C. venosatus larvae infected by different doses of the 16 M. anisopliae isolates at 15th day after a* 5 conidia/ml showed 39 to 75% mortality, a* a* a* mortality, a* 1.0×107 conidia/mla* inoculation. 1.0×10 1.0×106 conidia/ml showed 50 to 92% showed ab ab 8 7 E60 to 100% 100 mortality, 1.0×10 conidia/ml showed 68 to 100% mortality, respectively (A, B, C and D). At 1.0×10 conidia/ml, there were abcof sterile water eight highly0pathogenic isolates 0 first control (Con 1) was sprayed with 5 ml bcdM. anisopliaeabc abcto C. venosatus larvae (E). The abc(Australia), used for controlling underground pests of containing 0.1% (v/v) Tween-80. The second control (Con 2) was BioCane granule 10 (Coleoptera: 100Scarabaeidae). 1000 *The same capital1.0 10 no significant 100abcd 1000for the mean sugarcane such as1.0 Apogonia sp. letters indicate difference value (Tukey–Kramer test, F=4.68, p=0.01). Abbott (1925) was then used for correction. 5 5

Dose (10 conidia/ml)

75

cd

Dose (10 conidia/ml)

cd

Mortality (%)

d

a*

E

a*

ab

a*

a*

ab

a*

a*

100 50

bcd

abc

abc

abc

abc abcd e

25

75

cd

cd

Mortality (%)

d

0

50 HS1

HS2

HS3

HS4

HS5

HS6

HS7

HS8

HS9

HS10

LY1

LY2

LY3

LY4

LY5

LY6

Con1

Treatment

e 25

0

HS1

HS2

HS3

HS4

HS5

HS6

HS7

HS8

HS9

HS10

Treatment

Figure 2. Contd.

LY1

LY2

LY3

LY4

LY5

LY6

Con1

Con2

Con2

Liu et al.

7615

3.50 A*

A*

Fresh weight of sugarcane (Ă— 104 kg)

3.00

A*

A*

A*

AB

AB

AB

2.50

B

2.00 C 1.50

1.00

0.50

0.00 HS1

HS6

HS7

LY2

LY3

LY6

HS3

HS9

Con1

Con2

Treatment Figure 3. Comparing sugarcane fresh weight after harvest with different treatments. The first control (Con 1) was also brushed with only water with 43% (w/w) additives. The second control (Con 2) represented BioCane granule (Australia). *The same capital letters indicate no significant difference for the mean value (Tukey–Kramer test, F = 3.71, p = 0.01). Abbott (1925) was then used for correction.

LY3

LY6

HS3

HS9

Con2

HS1

Con1

HS6

HS7

LY2

Con2

Con1

70

70

B

A

60 Adults density per monitoring region

Adults density per monitoring region

f

f

60

50

40

30

20

50

40

30

20

10

10

0

0 0

60

120 th

180

The x day after treatment (d)

240

300

0

60

120

180

240

300

th

The x day after treatment (d)

Figure 4. Comparing effects of M. anisopliae to the density of C. venosatus adults. By statistical analysis, the density of C. venosatus adults were closely related to the days after treatment. The first control (Con 1) was also brushed with only water with 43% (w/w) additives. The second control (Con 2) was BioCane granule (Australia).

7616

Afr. J. Biotechnol.

of Tropical Agricultural Science, for his critical review and helpful suggestions. REFERENCES Alonso-Díaz MA, García L, Galindo-Velasco E, Lezama-Gutierrez R, Angel-Sahagún CA, Rodríguez-Vivas RI, Fragoso-Sánchez H (2007). Evaluation of Metarhizium anisopliae (Hyphomycetes) for the control of Boophilus microplus (Acari: Ixodidae) on naturally infested cattle in the Mexican tropics. Vet. Parasitol. 147(3-4): 336-340. Beilharz VC, Parbery DG, Swart HJ (1982). Dodine: A selective agent for certain fungi. T. Br. Mycol. Soc. 79(3): 507-511. Brooks A, Wall R (2005). Horizontal transmission of fungal infection by Metarhizium anisopliae in parasitic Psoroptes mites (Acari: Psoroptidae). Biol. Control, 34(1): 58-65. Chase AR, Osborme LS, Ferguson VM (1986). Selective isolation of the entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium. Fla. Entomol. 69(2): 285-292. Cherry AJ, Lomer CJ, Djegui D, Schulthess F (1999). Pathogen incidence and their potential as microbial control agents in IPM of maize stem borers in West Africa. BioControl 44(3): 301-327. Chillar BS, Madan YP, Singh D (1993). Sugarcane leaf hopper, Pyrilla perpusilla Walker and its natural enemies. Indian Sugar, 43: 175-179. Curran J, Driver F, Ballard JWO, Milner RJ (1994). Phylogeny of Metarhizium: sequence analysis of the internally transcribed and 5.8s region of the ribosomal DNA repeat. Mycol. Res. 98(5): 547-552. Daniela OP, Irani QG, Elisa AG (2008). Morphological Regional Differences of Epithelial Cells along the Midgut in Diatraea saccharalis Fabricius (Lepidoptera: Crambidae) Larvae. Neotrop. Entomol. 37(4): 413-419. David H, Easwaramoorthy S, Jayanthi R (1991). Integrated pest management in sugarcane with special emphasis on biological control. Sugarcane breeding Institute, Coimbatore, pp. 94-101. Dickson WL, Robert DS, Edith PM, Deogratius RK, Ladslaus LM, Tanya LR, Fredros OO (2010). An extra-domiciliary method of delivering entomopathogenic fungus, Metarhizium anisopliae IP 46 for controlling adult populations of the malaria vector, Anopheles arabiensis. Parasite Vector, 3(18): 1-6. Dimbi S, Maniania NK, Ekesi S (2009). Effect of Metarhizium anisopliae inoculation on the mating behavior of three species of African Tephritid fruit flies, Ceratitis capitata, Ceratitis cosyra and Ceratitis fasciventris. Biol. Control, 50(2): 111-116. Driver F, Milner RJ, Trueman WH (2000). A taxonomic revision of Metarhizium based on a phylogenetic analysis of rDNA sequence data. Mycol. Res. 104(2): 134-150. Du KS, Chai LY, Xu YL, Lang JF (2008). Isolation of a Metarhizium Strain. J. Microbiol. 28(6): 57-60. Fernandes ÉKK, Keyser CA, Rangel DEN, Foster RN, Roberts DW (2010). CTC medium: A novel dodine-free selective medium for isolating entomopathogenic fungi, especially Metarhizium acridum, from soil. Biol. Control, 54(6): 197-205. Gao S (1996). Current Status of Studies on Metarhizium SPP. Chin. J. Biol. Control, 12(4): 182-187. Gerardo H, Sandra JS, Jennifer AT (1994). Construction of a Bioinsecticidal Strain of Pseudomonas fluorescens Active against the Sugarcane Borer, Eldana saccharina. Appl. Environ. Microbiol. 60(2): 682-690. Graça LR (1976). Estimativa econômica dos prejuízos causados pelo complexo broca-podridão na cana-de-açucar. Bras. Açucar. 88: 12-34. Hoffmann MP, Wright MG, Pitcher SA, Gardner J (2002) Inoculative releases of Trichogramma ostriniae for suppression of Ostrinia nubilalis (European corn borer) in sweet corn: field biology and population dynamics. Biol. Control, 25(3): 249-258. Katrina JD, Graeme L, Jennifer AT (2000). Biocontrol of the Sugarcane Borer Eldana saccharina by Expression of the Bacillus thuringiensis cry1Ac7 and Serratia marcescens chiA Genes in Sugarcane-Associated Bacteria. Appl. Environ. Microbiol. 66(7): 2804-2810.

Lin MJ (2007). Research and Application of Natural enemies and Sex attractant to Sugarcane Borer. Sugarcan, Canesugar, 4: 19-24. Liu SF, Ye ZH, Jiang SR (2007). Isolation and Virulence Test of Metarhizium. J. Anhui Agric. Sci. 35(17): 5058-5059, 5077. Long WH, Hensley SD (1972). Insect pests of sugarcane. Annu. Rev. Entomol. 17(1): 149-176. Marius H, Godwin PK, Michael S, Galina G, Itamar G (2011). Pathogenicity of the entomopathogenic fungus Metarhizium anisopliae to the red-legged tick, Rhipicephalus evertsi evertsi. Afr. J. Biotechnol. 3(7): 68-72. Matthias S, Paul F (2002). Screening of North American species of Trichogramma Westwood (Hymenoptera: Trichogrammatidae) for control of the Indian meal moth, Plodia interpunctella (Hübner) (Lepidoptera: Pyralidae). Proceedings of the Eighth International Working Conference of Stored-Product Protection, N.Y., U.K. July: 1-10. Menossi M, Silva-Filho MC, Vincentz M, Van-Sluys M-A, Souza GM (2008). Sugarcane Functional Genomics: Gene Discovery for Agronomic Trait Development. Int. J. Plant Genomics 2008: 458732. Monique MT, Ravely CO, Daniela AL, João AP (2011). Toxicity of the insect growth regulator lufenuron on the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin assessed by conidia germination speed parameter. Afr. J. Biotechnol. 10(47): 9661-9667. Niassy S, Diarra K, Ndiaye S, Niassy A (2011). Pathogenicity of local Metarhizium anisopliae var. acridum strains on Locusta migratoria migratorioides Reiche and Farmaire and Zonocerus variegatus Linnaeus in Senegal. Afr. J. Biotechnol. 10(1): 28-33. Nicholls CI, Perez N, Vasquez L, Altieri M (2002). The development and status of biologically based integrated pest management in Cuba. Integr. pest manage. Rev. 7(1): 1-16. Pan XH, Huang CH, Xin DY (2009). Dominant natural enemies and biological control of sugarcane borers. Guangxi Agric. Sci. 40(1): 49-52. Pedro HC, Candido SA (1997). Entomopathogenic fungi associated with natural populations of the Moroccan Locust Dociostaurus maroccanus (Thunberg) (Orthoptera: Gomphocerinae) and other Acridoidea in Spain. Biocontrol Sci. Technol. 7(3): 357-364. Pfeifer TA, Khachatourians GG (1993). Isolation of DNA from entomopathogenic fungi grown in liquid cultures. J. Invertebr. Pathol. 61(2): 113-116. Poprawiski TJ, Yule WN (1991). Incidence of fungi in natural populations of Phyllophaga spp. and susceptibility of Phyllophaga anxia (LeConte) (Col., Scarabalidae) to Beauveria bassiana and Metarhizium anisopliae (Deuteromycotina). J. Appl. Entomol. 112(3): 359-365. Pu ZL, Li ZZ (1996). Insect Mycology. Anhui Sci. Technol. Press, Hefei, Anhui, China, 95-97: 360-368. Quesada-Moraga E, Martin-Carballo I, Garrido-Jurado I, Santiago-Álvarez C (2008). Horizontal transmission of Metarhizium anisopliae among laboratory populations of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). Biol. Control, 47(6): 115-124. Roddam LF, Rath AC (1997). Isolation and characterization of Metarhizium anisopliae and Beauveria bassiana from Subantartic Macquarie Island. J. Invertebr. Pathol. 69(3): 285-288. Sabbour MM (2002). The role of chemical additives in enhancing the efficacy of Beauveria bassiana and Metarhizium anisopliae against the potato tuber moth Phthorimaea operculella (Zeller) (Lepidoptera: Gelechiidae). Pak. J. Biol. Sci. 5(11): 1155-1159. Shang XK, Huang CH (2010). Research Progress of the Control Techniques of Sugarcane Borer. J. Anhui Agric. Sci. 38(35): 20064-20066, 20069. Shanley RP, Keena M, Wheeler MM, Leland J, Hajek AE (2009). Evaluating the virulence and longevity of non-woven fiber bands impregnated with Metarhizium anisopliae against the Asian long horned beetle, Anoplophora glabripennis (Coleoptera: Cerambycidae). Biol. Control, 50(4): 94-102. Smith SM (1996). Biological control with Trichogramma：advances， successes and potential of their use. Annu. Rev. Entomol. 41: 375-406. Talekar NS, Shelton AM (1993). Biology, ecology and management of diamondback moth. Annu. Rev. Entomol. 38: 275-301. Tarasco E, Bievre CD, Papierok B (1997). Occurrence of

Liu et al.

entomopathogenic fungi in soils in Southern Italy. Entomology, 31:157-166. Tulloch M (1976). The genus Metarhizium. T. Br. Mycol. Soc. 66(3): 407-411. Wekesa VW, Maniania NK, Knapp M, Boga HI (2005). Pathogenicity of Beauveria bassiana and Metarhizium anisopliae to the tobacco spider mite Tetranychus evansi. Exp. Appl. Acarol. 36(1-2): 41-50. Weng LX, Deng HH, Xu JL, Li Q, Wang LH, Jiang ZD, Zhang HB, Li QW, Zhang LH (2006). Regeneration of sugarcane elite breeding lines and engineering of stem borer resistance. Pest Manage. Sci. 62(2): 178-187. Yu YH, Chen RZ, Wei DW, Chen XF, Zeng T, Wang ZY (2009). Trapping and killing of Dorysthenes granulosus adults using frequency vibration-killing lamp. Guangxi Agric. Sci. 40(12): 1552-1554. Zhan RL, Qing WQ, Song Y, Zhang SQ, HO HH, Xu TW, Huang JS (2007). Isolation and identification of Metarhizium anisopliae from natural infections of Coconut hispid beetle Brontispa longissima (Gestro) (Coleoptera: Chrysomelidae) and preliminary studies on against this pest in Hainan island, China. Acta Ecol. Sin. 27(4): 1558-1564. Zhang LS, Zhang ZH, Gao S, Nong XQ (2006). Application and Development of Metarhizium Biological Pesticide. Chinese J. Biol. Control, 22(s1): 141-146.

7617

Zhang ML (1997). Effects of 14 Insecticides on Adults, Larvae, Eggs, and Pupae of Trichogramma Confusum. Nat. Enemies Insects, 19(1): 11-14. Zhang YC, Yi DY, Lei CY, Xie HJ, Li XY (2008). Morphological Characteristic and Living Habit of Sugarcane Borers and Its Control Techniques in Guizhou. Guizhou Agric. Sci. 36(1): 95-96. Zhen GL, Yang FR, Yi LE, Yang LX (2001). Effect of Trichogramma Chilonis Ishii on Sugarcane Bores. J. Southwest Agric. Univ. 23(5): 398-400. Zhou RQ, Huang ZR, Yang JX, Liang L (2008). Effective test of 5% Zhelaijing GR against sugarcane borer. Guangdong Agric. Sci. 2008(1): 59-60. Zimmerman G (1993). The entomopathogenic fungus Metarhizium anisopliae and its potential as a biological agent. Pestic. Sci. 37(4): 375-379.

African Journal of Biotechnology Vol. 11(30), pp. 7618-7628, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3739 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Purification of an elicitor from Magnaporthe oryzae inducing defense resistance in rice Chunyan Ji and Zhenzhong Wang* Laboratory of Physiological Plant Pathology, South China Agricultural University, Guangzhou 510642, China. Accepted 1 March, 2012

Inducible defenses that contribute to overall resistance in plant can be triggered by elicitors. A novel elicitor, derived from the mycelia of the blast fungus Magnaporthe oryzae, was purified to homogeneity by HiPrep 16/20 DEAE-Sepharose FF, Concanavalin A-Sepharose 4B and HiPrep 16/60 Sephacryl S-100 column chromatography. The purified elicitor appeared as single band corresponding to a molecular weight of 48.53 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophresis (SDS-PAGE) and a pI of 6.01 on isoeletric focusing (IEF) gel. Treatment with the purified elicitor increased the activities of phenylalanine ammonium-lyase (PAL) and peroxidase (POD) in rice susceptible cultivar CO39. Timecourse analysis showed peak accumulation of PAL appeared at 24 h after treatment, and it was higher in challenge-inoculated plants than non-challenge plants. POD accumulation showed similar kinetics with PAL, but the largest peak appeared at 36 h after treatment. Compared to the untreated control plants, pretreatment of rice leaves with the purified elicitor provided an enhanced level of protection against M. oryzae. N-terminal blocked elicitor was identified as hypothetical protein MG 05155.4 with 26.28% mass fingerprint coverage by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). The results suggest that the purified elicitor is involved in inducing resistance against blast fungus. Key words: Magnaporthe oryzae, elicitor, purification, induced resistance. INTRODUCTION Plant innate immunity is generally divided into two branches that efficiently wards off dangerous microorganism. One uses transmembrane pattern recognition receptors (PRRs) that respond to slowly evolving microbial- or pathogen-associated molecular patterns (MAMPS or PAMPs), resulting in PAMP-triggered immunity (PTI). However, pathogens deploy effectors that interfere with PTI and ultimately enable a successful infection. In turn, plants evolved the ability to recognize effectors either directly or indirectly through NB-LRR proteins that activate effector-triggered immunity (ETI).

*Corresponding author. E-mail: zzwang@scau.edu.cn. Tel: +86 20 85281469. Fax: +86 20 85281107. Abbreviations: SDS-PAGE, Sodium dodecyl sulfatepolyacrylamide gel electrophresis; IEF, isoeletric focusing; PAL, phenylalanine ammonium-lyase; POD, peroxidase; MALDI-TOF MS, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

These two forms formerly called basal or horizontal disease resistance and resistance(R) gene-based or vertical disease resistance (Boller and Felix, 2009; Jones and Dangl, 2006). Rice blast, caused by the fungus Magnaporthe oryzae, is one of the most destructive diseases of rice and often reduces yields greatly in rice-growing countries (Ou, 1980; Rossman et al., 1990). Annual losses caused by M. oryzae vary between 10 and 30% of the harvest (Skamnioti and Gurr, 2009). Genetic resistance is the major method of disease control for blast (Martin et al., 2002). However, due to rapid adaptability and high variability of the fungal population in the field, frequent loss of resistance of rice cultivars is a major restraint in sustainable rice production. In practices, farmers usually go for chemical control which is comparatively expensive and environmentally unsafe. Concomitantly, increased public concerns to the possible negative health effects of chemical residues have forced policy changes in many countries. Therefore, it has become increasingly important to develop the efficient and environment-

Ji and Wang

friendly control strategy against rice blast. PAMPs usually represent highly conserved structures which carry essential functions. It is clear that “general elicitors” are conceptually equivalent to PAMPs (Nurnberger et al., 2004). Plant cells exposed to elicitors, whether crude fungal cell wall fragments or defined molecular, respond with a battery of cellular changes such as changes in ion fluxes, the generation of reactive oxygen species, the synthesis of phytoalexins, the accumulation of defense-related enzymes that including Peroxidase (POD) and Phenylalanine Ammonium-Lyase (PAL), and the activation of defense gene expression (Dixon and Lamb, 1990; Yang et al., 1997; Zhao et al., 2005). As an alternative and ecologically-friendly approach for plant protection, induced disease resistance has been shown to occur in plants in response to a localized pretreatment with elicitors thus making them resistant to subsequent pathogen infection (Hammerschmidt, 1999; Mohammadi and Kazemi 2002). In recent years, understanding the molecular basis of plant responses to PAMPs is an active area of research in the field of plant-microbe interactions. The rice-M. oryzae pathosystem has become a model system for genetic and molecular biology studies in plant pathology (Valent, 1990). Some biotic elicitors originating from fungi, oomycetes and bacteria have been described in a wide range of plant species (Garcia-Brugger et al., 2006). In this paper, a novel elicitor was purified from the mycelia of M. oryzae and characterized by Matrixassisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Treatment of rice leaves with the purified elicitor induced the accumulation of defense-related enzymes (POD and PAL), and increased resistance to blast fungus.

MATERIALS AND METHODS Plant and fungal material Rice blast fungus, M. oryzae, race ZC13, one of the primary blast physiological races found in Guangdong Province, P. R. China, and the susceptible indica cultivar CO39 were used in this study.

7619

Column chromatography HiPrep 16/20 DEAE-Sepharose FF column, HiPrep 16/60 Sephacryl S-100 column, XK 16/20 column and Concanavalin ASepharose 4B media were purchased from Pharmacia. The following described purification procedure was performed on an AKTA purifier system 100 (Amersham Pharmacia Biotech, USA). All operations were performed at 0 to 4°C. The crude elicitor solutions were loaded onto a HiPrep 16/20 DEAE-Sepharose FF column, which was equilibrated with 20 mM Tris- HCl buffer, pH7.4. Unbound material was washed out with 2 columns of Tris-HCl buffer. The bound fraction was eluted with 10 columns of a linear gradient of 0 to 0.75M NaCl at a flow rate of 3 ml/min. The fractions with the highest elicitor activity collected from the anion-exchange column were injected to Concanavalin A-Sepharose 4B column (2.6 × 20 cm), which was equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 0.5 M NaCl, 1 mM MgCl2, 1 mM MnCl2, and 1 mM CaCl2. The non-binding material was washed with equilibration buffer, and ConA-binding material was subsequently displaced by 0.15 M α-methyl-D-Mannoside in equilibration buffer at a flow rate of 0.2 ml/min. The highest elicitor active fractions collected from the ConA affinity column were subjected to a HiPrep 16/60 Sephacryl S-100 column. The column was eluted with 20 mM Tris-HCl buffer (pH 7.4) at a flow rate of 0.5 ml/min. The highest elicitor active fractions obtained from several separate gel filtration runs were pooled, lyophilized, and stored at -80°C until use. Protein concentration was determined according to the Bradford (1976) method using bovine serum albumin as a standard.

Assay for elicitor activity Elicitor activity was assayed by the method of Schaffrath (1995) using POD activity as a biomarker with some modifications. The rice seedlings (cv. CO39) were grown in the greenhouse at 26～22°C (day/night) with 70 to 80% relative humidity. At the fourleaf stage, the fully expanded fourth leaves were injected with the tested solutions using a syringe without needle. Control plants were infiltrated with distilled water. Treated rice seedlings were kept in a humidity chamber and sampled 36 h after treatment. The POD activity was assayed as described by Ryan et al., (1982) except that the 3-ml reaction mixture contained sodium phosphate buffer (20 mM, pH5.6), 18 mM guaiacol, 3.3 mM H2 O2 and 20 µl crude enzyme. An increase in the absorbance at 470 nm (△A470) of 2 min was recorded using a spectrophotometer. One unit of the POD activity was defined as the amount of enzyme that increased the absorbance by 0.01 per min at 470 nm. One unit of elicitor activity was defined as the amount of the sample required to induce one unit of POD activity.

Crude elicitor preparation

Sodium dodecyl sulfate polyacrylamide gel electrophoresis and N-terminal amino acid sequence analysis

The preparation of the crude elicitor was performed according to the method described by Schaffrath (1995) with some modifications. Mycelia were incubated in yeast liquid medium (yeast extract 5.0 g, sucrose 20 g, distilled water 1 L). Vegetative mycelia were harvested from 7-day-old liquid cultures. After thawing in a Waring-Blender, the material was stirred at 4°C overnight and centrifuged at 10,000 g for 30 min. The supernatants were filtered successively through Whatman No.1 qualitative filter paper and a 0.22-µm Millipore filter. The filtrates were concentrated by ultrafiltration (Amicon 8400 ultrafiltration system) using a PM-30 membrane (Millipore) and the biologically active residue (＞30 kDa) as crude elicitor fractions (CEF).

Discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed using 3% acrylamide stacking and 10% resolving gels on a mini-PROTEAN III gel system (Bio-Rad). After electrophoresis, gels were rinsed and subsequently silver stained (Oakley et al., 1980). The molecular masses of the purified elicitor were measured by SDS-PAGE. The purified elicitor was separated by SDS-PAGE and electroblotted onto polyvinylidene difluoride (PVDF) membranes. The membrane stained and protein band cut out for N-terminal sequence analysis with Procise 491 automatic sequencer (Applied Biosystems Inc., USA).

7620

Afr. J. Biotechnol.

Isoelectric focusing The obtained purified elicitor was analyzed by isoeletric focusing (IEF) as described by Garfin (1990) with some modifications. 10 mM phosphoric acid and 20 mM sodium hydroxide were used as anolyte and catholyte respectively. The sample focusing was conducted under a constant voltage of 100 V for 15 min, 250 V for an additional 15 min, and finally 450 V for 1.5 h. After focusing, the samples were stained with Coomassie brilliant blue R-250. The isoeletric point of the sample was determined by comigration with protein-pI markers. Mass spectrometry

described above. PAL activity was determined according to the method of Mozzetti (1995) with slight modifications. One gram (1 g) of the leaves was ground with 2 ml extracting buffer (20 mM potassium borate buffer containing 0.2 g PVPP, pH 8.8). The extracts were homogenized and centrifuged at 12,000 × g for 30 min, the supernatant was collected as crude enzyme extract. The reaction mixture consisted of 100 µl of crude enzyme, 3.65 ml of 100 mM potassium borate buffer (pH 8.8), and 1.25 ml of 20 mM Lphenylalanine solution. After incubation at 40°C for 30 min, the reaction was stopped by addition of 250 µl of 5 N HCl. One unit of PAL activity was defined as the amount causing an increase of 0.01 in A290 per min. PAL activity was expressed as enzyme units per mg protein (U mg protein-1).

The Coomassie G-250 stained protein band was excised from the SDS-PAGE gel and subjected to in-gel digestion with trypsin. Mass spectra were recorded on a Bruker Biflex III MALDI-TOF mass spectrometer in reflector mode. Protein identification was performed with Mascot search engine (http://www.matrixscience.com and SWISS-PROT database (http://www.expasy.ch/tools/peptident. html).

Statistical analysis

Rice infection assays

RESULTS

M. oryzae was cultured in Petri dishes containing 20 ml of medium composed of 20 g l-1 rice bran powder, 2.5 g l-1 yeast extract, 1.5% agar. The cultures were placed in a growth chamber with a 12 h photoperiod for 7 to 9 d. Conidia were harvested from plates by rinsing with sterile distilled water and filtering through two layers of gauze. Rice seedlings of susceptible cultivar CO39 at four-leaf-stage were pretreated with the purified elicitor or distilled water as described above, and challenge inoculated with M. oryzae 1 d later by spraying conidial suspensions at a concentration of 2 × 105 conidia per ml. The non-inoculated plants were sprayed with the same amount of distilled water. Inoculated and non-inoculated rice seedlings were kept in a moist chamber at 25°C for 24 h and then transferred to the glasshouse. Disease index of each replicate (containing 30 seedlings) and a total 90 seedlings in three replicates of each treatment were evaluated 5 to 9 d after inoculation according to IRRI (2002). Disease index and inducing effect (%) were calculated according to the formula: Disease index=［Σ(r×nr)/(9×Nr)］×100 Where, r is the score of scale; nr is the number of infected leaves with a rating of r; Nr is the total number of investigated leaves; and Σ is the sum numbers of infected leaves of different scores. Inducing effect (%) = (Control－Treated)/Control ×100.

Enzyme assays In order to elucidate the mechanism of induced resistance in elicitor-pretreated rice leaves, the time course of defense-related enzymes including POD and PAL activities was investigated. There were four treatment groups with three replications: (1) challenge inoculated with M. oryzae in elicitor-treated plants, (2) challenge inoculated with M. oryzae in water-treated plants, (3) elicitor-treated plants, (4) water-treated plants. The elicitor infiltration and pathogen inoculation were carried out as described above. At various times after treatment, the fresh leaves were pooled, frozen in liquid nitrogen and stored at -20℃ until used. All enzyme extract procedures were conducted at 4°C. POD activity was carried out as

All statistical analyses were performed using SPSS software version 10.0. Data were analyzed by one-way analysis of variance (ANOVA) and Duncan’s multiple range test (DMRT) was performed to determine significant difference between treatments. Differences at P < 0.05 were considered to be significant.

Purification of a 49 kDa elicitor from M. oryzae Vegetative mycelia of M. oryzae were harvested from 7day-old liquid culture. After centrifugation and ultrafiltration, the >30 kDa fractions were active and served as CEF for the further purification. CEF was applied to a HiPrep 16/20 DEAE-Sepharose FF column, the anion-exchange chromatographic profile is shown in Figure 1a. The elution of the bound fractions, including D3, D4, were pooled and tested for elicitor activity respectively. All these two fractions (D3, D4) were biologically active, while the highest active fraction was yielded in the peak D4. The active peak D4 was injected onto an affinity column (Concanavalin A-Sepharose 4B). The activity assay indicated that the non-binding fraction (peak C2) contained elicitor-active components (Figure 1b). Further purification of active peak C2 by the gel filtration column (Figure 1c) resulted in one sharp peak (S1) and one small diffused peak (S2), two peak fractions (S1，S2) were pooled and analyzed for elicitor activity, the peak S1 fraction showed the highest biological activity. The pooled peak S1 fractions showed only one band on a silver-stained SDS-polyacrylamide gel (Figure 2). The apparent molecular weight of peak S1 fraction estimated by SDS-PAGE was about 48.53 kDa. SDSPAGE with or without the reducing agent βmercaptoethanol had no effect on the migration of the peak S1 fraction, indicating there is no existence of the disulfide bridges in peak S1 fraction. Thus, one 48.53 kDa elicitor was purified to homogeneity from the mycelia of M. oryzae. A balance sheet of the elicitor purification is summarized in Table 1. Elicitor was purified with a recovery of 10.13% to a final specific activity of 35 U mg protein-1. The isoelectric point of the elicitor was estimated to be 6.01 by IEF (Figure 3).

Ji and Wang

7621

Figure 1. Purification of elicitor prepared from the crude CEF. CEF derived from the mycelia of M. oryzae was further purified by the column chromatography. The elution profiles were monitored at 280 nm. Each peak fraction was collected according to the elution profile and assayed for elicitor activity by detecting the ability to induce the accumulation of POD at 36h post-inoculation in susceptible cultivar CO39. (a): Elution profile of crude elicitor fraction on DEAE-Sepharose FF column. Four distinct peaks (D1, D2, D3, and D4) were obtained and tested for biological activity. Peak D4 was the main activity fraction. (b): Elution profile of DEAE-Sepharose FF fraction D4 on Concanavalin A-Sepharose 4B column. Two peaks (C1, C2) were obtained and assayed for biological activity. Unbounded fraction C2 showed the elicitor activity. (c): Elution profile of Concanavalin ASepharose 4B fraction C2 on Sephacryl S-100 column. Gel filtration yielded two peaks (S1, S2) and assayed for biological activity, Peak S1 showed the highest elicitor activity.

N-terminal sequencing and MALDI-TOF MS analysis Edman degradation is the conventional method for the Nterminal sequencing. Unfortunately, sequence analysis indicated the elicitor was N-terminal blocked. The genome of M. oryzae has been fully sequenced, proteomics approaches are most effective when

supported by complete genome sequence databases. The purified elicitor band from the Coomassie bule R-250 staining gel was excised and followed by MALDI-TOF MS analysis (Figure 4). The purified elicitor was identified as hypothetical protein MG 05155.4 with 26.28% mass fingerprint coverage (Table 2). Furthermore, search for sequence similarity using the BLAST program did not

7622

Afr. J. Biotechnol.

Figure 1. Contd.

affected rice blast disease development, the fully expanded fourth leaves of susceptible cultivar CO39 were injected with the purified elicitor or distilled water and subsequently challenged with M. oryzae. As shown in Table 3, the Disease index in water-treated control plants was higher than in plants pretreated with elicitor. In comparison to control plants, the application of elicitor reduced the Disease index of rice blast by 16.65, 38.99 and 44.65% at 5, 7 and 9 days post-inoculation, respectively. The results suggested the purified elicitor treatment induced resistance in rice plants against M. oryzae. The accumulation of defense related activities induced by the purified elicitor Figure 2. SDS-PAGE analysis of the purified elicitor. The active peak S1 (obtained from Sephacryl S-100 gel filtration) was examined on silver-stained SDS-polyacrylamide gel and displayed a clear single band with apparent relative molecular weight of 48.53 kDa. Lane 1: Low molecular weight standard molecular weight marker (Qiangen): 97,400, 66,200, 43,000, 31,000, 20,100 and 14,400. Lane 2: Purified elicitor.

reveal any significant sequence similarity to any known proteins. The purified elicitor increased resistance to M. oryzae In order to evaluate whether the application of elicitor

enzyme

POD activity has been reported to be a biochemical marker for resistance (Hiraga et al., 2001). PAL is the first enzyme in the phenylpropanoid pathway which has important functions in plants following exposure to environmental stresses and pathogen attack (Hahlbrock and Scheel, 1989). The time course measurement of POD and PAL accumulation induced by the purified elicitor against M. oryzae were carried out using leaf tissues of susceptible cultivar CO39. As shown in Figure 5a, in inoculated elicitor-treated plants, assays of POD activity revealed the highest peak appeared at 36 h after challenge inoculation, and the activity was nearly 1.19 times higher than that in inoculated water-treated plants. A similar pattern of increased activity of POD was observed in uninoculated elicitor-treated plants, the activity reached maximum at 36 h, then to decline gradually. There was no marked change in POD activity in uninoculated water-treated plants during the time

Ji and Wang

7623

Table 1. Purification of elicitor from the mycelia of M. oryzae.

Purification step Crude elicitor fraction DEAE ConA S-100

Total protein (mg) 512 97.5 30.6 6.82

Total activity (units) 2355 2033.9 736.5 238.7

a

-1 b

Specific activity (U mg protein ) 4.6 20.86 24.07 35

Yield (%) 100 86.36 31.27 10.13

a: One unit of elicitor activity is defined as the amount of the sample required to induce one unit of POD activity at 36 h post-inoculation in cultivar CO39, one unit of POD activity was defined as the increase of 0.01 ∆470 per min. b: The specific elicitor activity of the sample is defined as the number of units per mg protein of the sample.

course of experimental period. As shown in Figure 5b, in inoculated elicitor-treated plants, PAL activity increased quickly and reached its maximum level at 24 h after challenge inoculation, and was about 1.38 times more than that in inoculated watertreated plants. PAL activity was also significantly higher than that of the control plants and reached its maximum at 24 h after treatment with elicitor alone. DISCUSSION

Figure 3. Isoelectric focusing of the purified elicitor. Isoelectric focusing was performed in pH gradient 3.5 to 9.3, the purified elicitor migrated as a single band and focused at apparent isoelectric point (pI) 6.01. Line 1: purified elicitor. Line 2: pI standard marker, 3.5 to 9.3 pI range (Pharmacia).

To better understand the molecular mechanism of how plant cells perceive and transduce the elicitor signal, pure elicitor molecules are preferred to rule out effects of contaminants in the crude preparation. In the present paper, a novel elicitor, which has a molecular mass of 48.53 kDa and pI of 6.1, was purified to homogeneity form the mycelia of M. oryzae by HiPrep 16/20 DEAESepharose FF, Concanavalin A-Sepharose 4B and HiPrep 16/60 Sephacryl S-100 column chromatography. The availability of this pure elicitor offers more possibilities to further study the downstream defense reactions in rice host plants. Affinity chromatography separates proteins on the basis of a reversible interaction between a protein and a specific ligand coupled to a chromatography matrix. It offers high selectivity, and high capacity for the protein of interest. Unfortunately, the purified elicitor did not bind to Con-A Sepharose 4B column during the entire chromatography process, thus, in order to minimize loss of elicitor activity, it might be possible to establish a more rapid purification procedure for further study by eliminating any steps such as Con-A Sepharose 4B that might unfavorably affect yield. Different types of elicitors including oligosaccharides, glucans, glycoproteins and sphingolipids have been reported to induce defense responses in rice plants (Kishimoto et al., 2010; Koga et al., 1998; Matsumura et al., 2003; Peng et al., 2011; Schaffrath et al., 1995; Yamaguchi et al., 2002). Among them, chitin oligosaccharides elicitor like N-acetylchitooligosaccaride was given an extensive study, which could induce various cellular responses including phytoalexin production, oxidative burst, gene expression and HR induction. A high affinity binding site for N-acetylchitooligosaccaride

7624

Afr. J. Biotechnol.

Figure 4. MALDI-TOF MS analysis of the purified elicitor.

Table 2. Identification of the purified elicitor by MALDI-TOF MS analysis.

Protein

Hypothetical protein MG05155.4

Accession no.a

gi38106113

MW/pIb

Sequence coverage (%)c

48.9523kDa/5.94

Score

26.28

Peptide hit

106

12

Peptides identified FKVADLSLAAFGR;VADLSLAAFGR;VAD LSLAAFGRK;EIELAENEMPGLMQTR;G ETEEEYNWCLEQQLLAFK;LNLILDDGG DLTHLVHDK;SKFDNLYGCR;FDNLYGC R;AASVGQIFVTTTGCR;AASVGQIFVTT TGCRDILVGK;SVQNIKPQVDR;HIILLAE GR

a: Accession number in the NCBInr database. b: MW, molecular weight; pI, isoelectric point. c: Amino acid sequence coverage of the protein with respect to matched tryptic digest fragments

Table 3. Effects of the purified elicitor application on rice blast disease.

5th day Treatment Water-treated Elicitor-treated

Disease index 71.57 ± 1.63 59.65 ± 1.64*

7th day Inducing effect (%) 16.65

Disease index 82.94 ± 2.39 50.60 ± 1.32*

9th day Inducing effect (%)

Disease index 86.10 ± 1.61 47.65 ± 0.65*

38.99 5

Inducing effect (%) 44.65

The fully expanded fourth leaves (susceptible cv. CO39) were inoculated with M. oryzae at 2 × 10 conidia per ml 1 d after infiltrating with purified elicitor (100 µg/ml) or distilled water (as a control). The disease index was evaluated using a 0 to 9 scale standard at 5 to 7 days post-inoculation. Each experiment was performed with 30 plants and repeated three times with similar results. Each value represents the mean of three exprements±SD, Asterisks (*) show significant differences from the control at p < 0.05.

Ji and Wang

7625

a

70

-1

PA L activity (U mg protein )

12

24

36

48

60

72

96

Water

b

Elicitor

60

W+M.oryzae E+M.oryzae

50 40 30 20 10 0 0h

12 12h

24 24h

36 36h

48 48h

60 60h

72 72h

96 96h

Time after inoculation (h) Figure 5. Time-course curves for the induction of POD (a) and PAL (b) activities in the leaves of rice. The fully expanded fourth leaves of rice plants (cv. CO39) at the four-leafstage were infiltrated with elicitor (100 µg/ml) alone or elicitor at 1 d before challenge inoculated with M. oryzae (2 × 105 spores per ml), and infiltrated with water alone or water before challenge inoculation as controls. Rice leaves were harvested for enzyme assay at different time intervals after treatment. Vertical bars on the line represent standard deviations of the means.

was detected in the plasma membrane of rice plants (Yamada et al., 1993; Shibuya et al., 1996; Ito et al., 1997; Okada et al., 2002). Furthermore, CEBiP, a binding glycoprotein, for this elicitor was isolated from the plasma membrane of suspension cultured rice cells, knock-down experiment suggested that CEBiP was a functional receptor for the chitin oligosaccharide elicitor (Kishimoto

et al., 2010). Two oligosaccharide elicitors (N-acetylchitoheptaose and a tetraglucosyl glucitol) synergistically activated phytoalexin biosynthesis in rice cultured cells (Yamaguchi et al., 2002; Kaku et al., 2006). A β-glucan elicitor and two sphingolipid elicitors were found to cause cell death in rice suspension cells (Matsumura et al., 2003; Takahashi et al., 2008; Koga et al., 1998). To date,

7626

Afr. J. Biotechnol.

there are a few reports on potential protein elicitor derived from M. oryzae. A glycoprotein elicitor with a molecular weight of 15.6 kDa was purified from the culture filtrates of M. oryzae, and elicitor activity was due to the carbohydrate moiety (Schaffrath et al., 1995). A protein elicitor PemG1 from M. oryzae was recently found to improve resistance of rice and Arabidopsis to pathogen attack, and the PemG1-mediated systemic acquired resistance was modulated by SA- and Ca(2+)-related signaling pathways (Peng et al., 2011). In this paper, The Nterminal-blocked elicitor was identified as a hypothesis protein MG05155.4 by MALDI-TOF MS. The active part of elicitor appeared to be the protein moiety since the water-soluble elicitor was sensitive to heat treatment. The elicitor lost its biological activity after 10 min incubation under 100째C. Cloning the gene that encodes the purified elicitor is currently being pursued by using the MALDITOF MS information; meanwhile, the corresponding expression system is expected to be successfully constructed for further downstream research. POD and PAL enzymes play important roles in the plant defense reaction against pathogen. POD, a group of heme-containing glycosylated proteins, is involved in the scavenging of reactive oxygen species and the biosynthesis of cell wall. The last step in the synthesis of lignin and suberin has been proposed to be catalyzed by POD (Bolwell and Wojtaszek 1997; Quiroga et al., 2000). The phenylpropanoid pathway is one of the most important plant metabolic pathways. PAL represents the key enzyme of phenylpropanoid metabolism leading to biosynthesis of phytoalexins, precursor of lignin, and phenolic compounds (Jones, 1984; Hahlbrock and Scheel, 1989). The activities of POD and PAL enzymes in plants may be enhanced under the influence of various factors, such as pathogen attack and treatment with elicitors (Dixon and Lamb, 1990). Enhanced POD and PAL activities were reported in rice leaves infected by M. oryzae (Sekizawa et al., 1990). The partially Nacetylatedchitosan elicited both POD and PAL activities and led to lignin deposition in wheat leaves (Vander et al., 1998); Tobacco leaves infiltrated with a protein elicitor (PB90) exhibited an enhanced POD and PAL activities (Wang et al., 2003). The incompatible flagellin of Acidovorax avenae was a specific proteinaceous elicitor in rice, PAL activity was increased by the purified incomepatible flagellin (Tanaka et al., 2003), The accumulation of POD and PAL enzymes was observed in eggplants after elicitors such as chitosan, salicylic acid, methyl salicylate and methyl jasmonate treatment (Mandal, 2010). In our experiment, time-course analysis showed peak accumulation of PAL appeared at 24 h after treatment, and it was higher in challenge-inoculated plants than non-challenge plants. POD accumulation showed similar kinetics with PAL, but the largest peak appeared at 36 h after treatment. Our results suggest that POD and PAL may be involved in elicitor-mediated induced resistance against rice blast. Infection assay indicated the

purified elicitor was able to protect rice from infection by M. oryzae. In water-treated controls, the disease progressed and finally caused dead tissues, whereas, the disease development was significantly reduced in elicitortreated rice plants compared to the control plants. In conclusion, a novel elicitor, purified from the mycelia of M. oryzae was involved in the induction of resistance in rice plants against blast fungus. Clearly, much work such as how this purified elicitor is perceived by the rice plant and leading to the activation of the defense responses need to be thoroughly investigated in future. REFERENCES Boller T, Felix G (2009). A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant Biol. 60: 379-406. Bolwell GP, Wojtaszek P (1997). Mechanisms for the generation of reactive oxygen species in plant defence - A broad perspective. Physiol. Mol. Plant Pathol. 51: 347-366. Bradford MM (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254. Dixon RA, Lamb CJ (1990). Molecular communication in interactions between plants and microbial pathogens. Annu. Rev. Plant Physiol. Plant Mol. Biol. 41: 339-367. Garcia-Brugger A, Lamotte O, Vandelle E, Bourque S, David L, Benoit P, David W, Alain P (2006). Early signaling events induced by elicitors of plant defenses. Mol. Plant Microbe. Int. 9: 711-724. Garfin DE (1990). Isoelectirc Focusing. In: Deutscher MP (ed) Methods in enzymology, Academic Press, San Diego. 182: 459-476. Hahlbrock K, Scheel D (1989). Physiology and molecular biology of phenylpropanoid metabolism. Annu. Rev. Plant Pysiol. Mol. Biol. 40: 347-369. Hammerschmidt R (1999). Induced disease resistance: how do induced plants stop pathogens? Physiol. Mol. Plant. 55: 77-84. Hiraga S, Sasaki K, Ito H, Ohashi Y, Matsui H (2001). A large family of class III plant peroxidase. Plant Cell Physiol. 42: 462-468. IRRI (2002). Standard evaluation system for rice. International Rice Research Institute (IRRI). Los Banos, Philippines. pp. 37-48. Ito Y, Kaku H, Shibuya N (1997). Identification of a high-affinity binding protein for N-acetylchitooligosaccharide elicitor in the plasma membrane of suspension-cultured rice cells by affinity labeling. Plant J. 12: 347-356. Jones DH (1984). Phenylalanine ammonia-lyase: Regulation of its induction, and its role in plant development. Phytochemistry, 23: 1349-1359. Jones JD, Dangl JL (2006). The plant immune system. Nature, 444: 323-329. Kaku H, Nishizawa Y, Ishii-Minami N, Akimoto-Tomiyama C, Dohmae N, Takio K, Minami E, Shibuya N (2006). Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. PNAS, 103: 11086-11091. Kishimoto K, Kouzai Y, Kaku H, Shibuya N, Minami E, Nishizawa Y (2010). Perception of the chitin oligosaccharides contributes to disease resistance to blast fungus Magnaporthe oryzae in rice. Plant J. 64: 343-354. Koga J, Yamauchi T, Shimura M, Ogawa N, Oshima K, Umemura K, Kikuchi M, Ogasawara N (1998). Cerebrosides A and C, sphingolipid elicitors of hypersenstitive cell death and phytoalexin accumulation in rice plants. J. Biol. Chem. 273: 31985-31991. Mandal S (2010). Induction of phenolics, lignin and key defense enzymes in eggplant (Solanum melongena L.) roots in response to elicitors. Afr. J. Biotechnol. 9: 8038-8047. Martin SL, Blackmon BP, Rajagopalan R, Houfek TD, Sceeles RG, Denn SO, Mitchell TK, Brown DE, Wing RA, Dean RA (2002). MagnaportheDB: a federated solution for integrating physical and

Ji and Wang

genetic map data with BAC end derived sequences for the rice blast fungus Magnaporthe grisea. Nucleic Acids. Res. 30: 121-124. Matsumura H, Nirasawa S, Kiba A, Urasaki N, Saitoh H, Ito M, KawaiYamada M, Uchimiya H, Terauchi R (2003). Overexpression of Bax inhibitor suppresses the fungal elicitor-induced cell death in rice (Oryza sativa L.) cells. Plant J. 33: 425-434. Mohammadi M, Kazemi H (2002). Changes in peroxidase and polyphenol activity in susceptible and resistant wheat heads inoculated with Fusarium graminearum and induced resistance. Plant Sci. 62: 491-498. Mozzetti C, Ferraris L, Tamietti G, Matta A (1995). Variation in enzyme activities in leaves and cell suspensions as markers of incompatibility in different Phytophthora-pepper interactions. Physiol. Mol. Plant Pathol. 46: 95-107. Nurnberger T, Brunner F, Kemmerling B, Piater L (2004). Innate immunity in plants and animals: striking similarities and obvious differences. Immunol. Rev. 198: 249-266. Oakley BP, Kirsch DR, Morris NR (1980). A simplified ultrasensitive silver stain for detecting proteins in polyacrylamide gels. Anal. Biochem. 105: 361-363. Okada M, Matsumura M, Ito Y, Shibuya N (2002). Highi-affinity binding proteins for N-acetylchitooligosaccharide elicitor in the plasma membranes from wheat, barley and carrot Cells: conserved Presence and correlation with the responsiveness to the elicitor. Plant Cell Physiol. 43: 505-512. Ou SH (1980). Pathogenicity and host plant resistance in rice blast disease. Annu. Rev. Phytopathol. 18:167-187. Peng DH, Qiu DW, Ruan LF, Zhou CF, Sun M (2011). Protein elicitor PemG1 from Magnaporthe grisea induces systemic acquired resistance (SAR) in plants. Mol. Plant Microbe. Int. 24: 1239-1246. Quiroga M, Guerrero C, Botella MA, Barcelo A, Amaya I, Medina MI, Alonso FJ, De Forchetti SM, Tigier H, Valpuesta V (2000). A tomato peroxidase involved in the synthesis of lignin and suberin. Plant Physiol. 122: 1119-1127. Rossman AY, Howard RJ, Valent B (1990). Pyricularia oryzae, the correct name for the rice blast disease fungus. Mycologia, 82: 509512. Ryan JD, Gregory P, Tingey WM (1982). Phenolic oxidase activity in glandular trichomes of Solanum berthaultii. Phytochemistry, 21: 1885-1887. Schaffrath U. Scheinpflug H, Reisendr HJ (1995). An elicitor from Pyricularia oryzae induces resistance responses in rice: isolation, characterization and physiological properties. Physiol. Mol. Plant Pathol. 46: 293-307. Shibuya N, Ebisu N, Kamada Y, Kaku H, Cohn J, Ito Y (1996). Localization and binding characteristics of a high-affinity binding site for N-acetylchitooligosaccharide elicitor in the plasma membrane from suspension-cultured rice cells suggest a role as a receptor for the elicitor signal at the cell surface. Plant Cell Physiol. 37: 894-898.

7627

Skamnioti P, Gurr SJ (2009). Against the grain: safeguarding rice from rice blast disease. Trends Biotechnol. 27:141-150. Sekizawa Y, Haruyama T, Kano H, Urushizaki S, Saka H, Matsumoto K, Haga M (1990). Dependence on ethylene of the induction of peroxidase and lipoxygenase activity in rice leaf infected with blast fungus. Agric. Biol. Chem. 54: 471-478. Takahashi H, Matsumura H, Kawai-Yamada M, Uchimiya H (2008). The cell death factor, cell wall elicitor of rice blast fungus (Magnaporthe oryzae) causes metabolic alterations including GABA shunt in rice cultured cells. Plant Signal Behav. 3: 945-953. Tanaka N, Che FS, Watanabe N, Fujiwara S, Takayama S, Isogai A (2003). Flagellin from an incompatible strain of Acidovorax avenae mediates H2O2 generation accompanying hypersensitive cell death and expression of PAL, Cht-1, and PBZ1, but not of LOX in rice. Mol. Plant Microbe. Int. 16: 422-428. Valent B (1990). Rice blast as a model system for plant pathology. Phytopathology, 80: 33-36. Vander P, Varum KM, Domard A, EI Gueddari NE, Moerschbacher BM (1998). Comparison of the ability of partially N-acetylated chitosans and chitooligosaccharides to elicit resistance reactions in wheat leaves. Plant Physiol. 118: 1353-1359. Wang YC,Hu DW, Zhang ZG, Ma ZC, Zheng XB, Li DB (2003). Purification and immunocytolocalization of a novel Phytophthora boehmeriae protein inducing the hypersensitive response and systemic acquired resistance in tobacco and chinese cabbage. Physiol. Mol. Plant Pathol. 63: 223-232. Yamada A, Shibuya N, Kodama O, Akatsuka T (1993). Induction of phytoalexin formation in suspension-cultured rice cells by Nacetylchitooligosaccharides. Biosci. Biotechnol. Biochem. 57: 405409. Yamaguchi T, Maehara Y, Kodama O, Okada M, Matsumura M, Shibuya N (2002). Two purified oligosaccharide elicitors, Nacetylchitohepatose and tetraglucosyl glucitol, derived from Magnaporthe oryzae cell walls, synergistically activate biosynthesis of phytoalexin in suspension-cultured rice cells. J. Plant Physiol. 159:1147-1149. Yang Y, Shah J, Klessig DF (1997). Signal perception and transduction in plant defense responses. Genes Dev. 11: 1621-1639. Zhao J, Davis LC, Verpoorte R (2005). Elicitor signal transduction leading to production of plant secondary metabolites. Biotech. Adv. 23: 283-383.

African Journal of Biotechnology Vol. 11(30), pp. 7628-7637, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3807 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Increasing the amylose content of maize through silencing of sbe2a genes Shuyan Guan1, Yiyong Ma2, Huijing Liu1, Siyan Liu1, Guangna Liu1, Lina Zhao1 and Piwu Wang2* 1

College of Life Sciences, Jilin Agricultural University, Changchun 130118, China. 2 Agronomy College of Jilin Agricultural University, Changchun 130118, China. Accepted 23 March, 2012

Improved amylose content in maize has been achieved by reducing the starch branching enzyme (SBE) activity via transgenic maize inbred line transformed by a high-efficient RNAi expression vector, which may provide the foundation for maize quality improvement. The sense and anti-sense fragments of maize SBE gene sbe2a were cloned by reverse transcript PCR and high efficient RNAi expression vector was constructed based on plant expression plasmid pCAMBIA1301. Then the reconstruct was introduced into maize inbred line Tie7922 by pollen tube pathway transformation. Four transgenic plants were obtained. The integration of interest gene sbe2a into maize genome has been confirmed by PCR amplification and Southern hybridization. The sbe2a transcription was suppressed obviously by the analyses of RT-PCR, SBE activity and amylase content on the four transgenic plants. The SBE activity was significantly less than that of wild type maize, and was at most reduced by 77.9%; the amylose content was at most increased by 87.8%. In conclusion, RNAi expression vector pRSBE2a containing sbe2a gene was successfully constructed. Through genetic transformation, RNAi technique efficiently silences endogenous sbe2a gene to reduce the SBE activity, and high-amylose maize lines are obtained. Key words: Maize, starch branching enzyme gene sbe2a, RNA interference, genetic transformation. INTRODUCTION Corn starch, a main component of kernel, includes different molecular structures of amylose and amylopectin. Corn amylose, which is characterized by a high degree of polymerization and good film forming, is far superior to other amylose in the areas of support films, food, medical treatments, textiles, papermaking, packaging, petroleum, environmental protection, optical fibers, printed circuit boards, and electronic chips (Visser and Jacobsen, 1993). Corn high amylase is the best material for manufacture of photodissociative plastics and could potentially help to control serious "white pollution" (Smith et al., 1997). Currently, the amylose used for industry mainly comes

*Corresponding author. E-mail: peiwuw@yahoo.com.cn. Tel: 0431-84532908. Abbreviations: SBE, Starch branching enzyme.

from corn. Amylase for Chinese market mainly imports from the United States. Amylose extracted from normal maize is costly; therefore, breeding high-amylose maize varieties can significantly expand the applications of corn starch and promote development of the corn industry, improving economic benefits (Casey et al., 2000). Starches are produced by a synthetic process that is regulated by a series of enzymes. Starch branching enzyme (SBE) is a key enzyme in the process of starch biosynthesis, forming the branched structure by catalysis of glucose monomer binding through α-1,6 bonds (Denver et al., 2001). SBE is composed of two families; SBE(A) and SBE(B), and corn SBE has three isozymes; SBEI, SBEIIb and SBEIIa. SBEI and SBEIIb are mainly present in the endosperm and SBEIIa in the embryo, endosperm, leaves, and other nutritive tissues. Together, these three enzymes participate in the synthesis of amylopectin (Nunes et al., 2006; Qiao et al., 2007). Corn SBEIIa can directly participate in the synthesis of short chains of amylopectin, and has much higher activity than

Guan et al.

SBEIIb, indicating that the functions of SBEIIa and SBEIIb cannot be complementary (Yandeau-Nelson et al., 2011). In addition, deficiency of the SBEIIa isoform resulted in lower kernel yield (Blauth et al., 2001; Yandeau-Nelson et al., 2011). RNA interference (RNAi) is an effective and specific method of gene silencing, capable of posttranscriptionally regulating gene expression through the activity of doublestranded RNA molecules. This method has been widely applied in the area of unknown genetic function in both plants and animals, and in the area of crop improvement of rice (Qiao et al., 2007), maize, soybean (Nunes et al., 2006), barley (Schweizer et al., 2000), wheat (Sestili et al., 2010), patato and cotton (Sunilkumar et al., 2006), especially in the improvement of corn high amylose quantity and quality by sbe gene cloning and amylopectin suppression. Sestili et al. (2010) used RNAi of sbe2a to increase the amylose content of durum wheat. However, there are only few reports of corn starch composition changes as a result of RNAi of sbe2a, the gene for SBEIIa enzyme (Koga et al., 2006; Sestili et al., 2010). The present study was to clone corn SBE gene, sbe2a, and construct an efficient RNAi vector pRSBE2a. The pRSBE2a construct was transferred into inbred maize line Tie7922 by pollen tube pathway transformation, in order to achieve the inhibition of the SBE gene to produce high amylose. This study also investigated the genetic effect of gene interference, as well as potential applications of RNAi technology in crop improvement. MATERIALS AND METHODS Materials Waxy corn inbred line "W1" was a gift from Prof. Yu-Lan Wang, Jilin Agricultural University; recipient maize inbred line Tie7922, modified pCAMBIA1301 plasmid were preserved by the laboratory. ConcerTM plant RNA extract kit and reverse transcript kit were purchased from Invitrogen China (Shanghai); pMD18-T vector, PCR amplification kit, restriction enzymes, Escerichia coli DH5α from TaKaRa (China Dalian); T4 DNA ligase and DNA markers from Promega China (Beijing); nylon membranes, digoxin (DIG) labeling and testing kit from Roche China (Shanghai); amylose and amylopectin standard samples were purchased from Sigma Company; other reagents of analytic purity were obtained from China.

7629

the plant RNA extract kit, reverse transcription was performed to obtain cDNA, and PCR amplification was performed using the cDNA template. The reaction system, totally 50 µL, included ddH2O (37.6 µL), 10×buffer (Mg2+ plus, 5.0 µL), dNTP mixture (2.5 mmol/L, 4.0 µL), upper primer (50 pmol/L, 1.0 µL), lower primer (50 pmol/L, 1.0 µL), cDNA template (50 ng/µl, 1.0 µL), and EXTaq enzyme (5 U/µL, 0.4 µL). The reaction program was 94°C for 5 min; 35 cycles (94°C for 30 s, 56°C for 30 s, and 73°C for 90 s); and 72°C for 10 min for final extension. PCR products were separated by 1% agarose electrophoresis, recycled, and ligated to pMD18-T vector, forming pMD18-T-SBE2a, and the construct was transferred to E. coli DH5α. Positive white colonies were selected and cultured, plasmid DNA was extracted using the alkali lysis method, and DNA was identified via restriction enzymes and gene sequencing (TaKaRa Company Dalian, Chima). Nucleic acid sequences were analyzed using DNASIS (Medprobe, UK) software. RNAi vector constructs The RNAi construct pRSBE2a, consisting of the corn sbe2a gene, is shown in Figures 1a and b. The pMD18-T-SBE2a construct containing the sbe2a gene was digested with XbaI and BamHI. The modified pCAMBIA1301 vector, in which hygromycin resistance gene was removed, was also opened by the same endonucleases. The retrieved fragments containing the sbe2a fragments were forward and inversely inserted into the downstream adjacent to 35S promoter in modified pCAMBIA1301 vector forming pRSBE2a. The construct was transferred to DH5α, screened on Luria Bertani (LB) medium supplemented with kanamycin (50 µg/mL). Five positive colonies were screened out. To verify the constructs, plasmid DNA of positive colonies was extracted and digested. Plasmid was extracted using the mini DNA extraction kit, PCR amplification was performed using P1, P2 primers and pRSBE2a as templates. PCR products were digested with Xba I+BamH I and Sac I+Xho I, respectively, to identify the sense and antisense fragments.

Pollen tube pathway transformation of maize by RNAi vector An alkaline lysis method was used to extract plasmid DNA in a large scale, and then DNA introductory solution was prepared to a concentration of 500 to 1,000 µg/mL. In 8 to 12 h after selfpollination of recipient maize inbred line Tie7922, the stylus was removed, then 500 µL of DNA introductory solution was dropwise added to the incision, packaging quickly. One hour later, DNA solution was dropwise added again. Equivalent saline-sodium citrate (SSC) solution without DNA was served as the control which was treated with the same procedures.

Detection of transgenic T1 plants Cloning and sequencing of corn sbe2a The 562 bp of the total coding sequence (CDS) of sbe2a was used for designing primers (implying that the entire coding sequence was larger than 562 bp) (NCBI GenBank accession no. U65948), using Primer Premier 5.0 software (Premier, Canada). Primer sequences were as follows (restriction sites such as Sac I, Xho I, Xba I and BamH I are underlined): P1 upstream primer: 5′-TCTTG AGCTC ATAGG CGAGA ATCCC ACAT-3′ and downstream primer: 5′TAACC TCGAG CGTGT AAAGA TACGG ATGGA-3′; P2 upstream primer: 5′-TTTGT CGACC GTGT AAAGA TACGG ATGGA C-3′, and downstream primer: 5′-TTTGG ATTCA TAGG C GAGAA TCCC ACAT-3′. Total RNA was extracted from waxy maize inbred line "W1" using

Clusters with antibiotic resistance and good seeds were selected from Tie7922 T0 plants, which experienced pollen tube pathwaymediated transformation in the farm field, and then were planted in greenhouse. As transgenic T1 plants came into five to six leaves, every three plants were divided into one group. Genomic DNA was extracted from the mixed leaves of regenerative plants using a modified cetyltrimethylammonium bromide (CTAB) method. Primers were designed for the 35S promoter sequence of pRSBE2a. The primer sequences were as follows: P3 upstream, 5'-GTGAATCCGCACCTCT-3' and P3 downstream, 5'-ATCGCCGCTTTGGACATA-3'. PCR amplification was performed for primary screening of transgenic lines. Expression vector pCAMBIA1301 and non-transgenic plant genomic DNA served as the negative and

7630

Afr. J. Biotechnol.

a

b

35S Hind III CaMV35S promoter Xba I BamH I Sac I Bst XI CaMV35S promoter Xho I hygromycin(R)

GUS Nos poly-A T-Border(right)

Xho I CaMV35S polyA T-Border(left)

anti-sense

SacI

Xho I

562 bp

SacI +XhoI

kanamycin(R)

T4 DNA ligase

35S

Xba I

sense

Hind III CaMV35S promoter Xba I BamH I Sac I anti-sense Xho I CaMV35S polyA T-Border(left)

BamH I

562 bp

GUS

Nos poly-A T-Border(right)

kanamycin(R)

XbaI+BamHI

XbaI+BamHI

T4 DNA ligase

35S Hind III CaMV35S promoter Xba I sense BamH I Sac I anti-sense Xho I CaMV35S polyA T-Border(left)

GUS

Nos poly-A T-Border(right)

kanamycin(R)

Figure 1. (a) The structure map of the T-DNA region of the RNAi vector pRSBE2a, (b) diagram of constructing corn starch branch enzyme gene RNAi expression vector (pRSBE2a).

blank controls, respectively. The reaction system, totally 25 µL,

included ddH2 O (15.25 µL), 10×buffer (2.5 µL), MgCl2 solution (2

Guan et al.

7631

soaked in 0.05 mol/L citric acid buffer solution (pH 7.0), ground and homogenized in an ice bath (22 mL totally). Homogenates were then precipitated by centrifugation at 20,000× g for 20 min. Supernatant contained the gross enzyme extract. SBE activity assay was performed according to Sestili et al. (2010) report. The SBE activity of non-transgenic plant served as control. The percent of SBE activity decrease was calculated as follows: ∆OD660 % = (control OD660 – experimental OD660)/control OD660 × 100%. Starch content of transgenic T1 kernels The amylose and amylopectin contents were determined using a dual wavelength method. For amylose content determination, the major and contrast wavelengths were 620 and 480 nm, respectively; for amylopectin, the major and contrast wavelength were 550 and 760 nm respectively. Each treatment was repeated three times. Total starch was the sum of amylopectin and amylose. Analysis of transgenic T2 plants and kernels

Figure 2. Restriction enzyme analysis of the reconstructs. M, DNA Marker DL-2,000; 1 to 3, pMD18-T-SBE2a/Apa I+ Xba

µL), dNTP mixture (2.5 mmol/L, 2.0 µL), upper primer (25 pmol/L, 1.0 µL), lower primer (25 pmol/L, 1.0 µL), DNA template (25 ng/µl; 1.0 µL), and EXTaq (5 U/µL; 0.25 µL). The reaction program was 94°C for 10 min; 35 cycles (94°C for 1 min, 56°C for 40 s, and 72°C for 3 min); and 72°C for 10 min for final extension. A random single plant of each positive group was detected by Southern blotting. The 836 bp promoter fragment on the pRSBE2a was amplified by PCR and labeled with DIG to be used as the probe for the Southern blotting. Genomic DNA was extracted from PCR-positive plants, digested with BamH I, separated on 0.8% agarose, then transferred to nylon membranes in 20xSSC solutions, fixed at 80°C for 2 h, and hybridized with 35S promoter probes (830 bp). The DIG labeling and testing kit was used for probe labeling, hybridization, and color development as manufacture’s instructions. Reverse transcript PCR analysis of transgenic T1 kernels sbe2a mRNA accumulation in transgenic plants were detected by PCR method, using a non-transgenic plant as the blank control and corn EF-1a gene (213bp) as the inner control. Using the Plant RNA Extract Kit, total RNA was extracted from the kernels of transgenic T1 plants 20 days after pollination. cDNA was synthesized. PCR amplification of sbe2a fragment was conducted using cDNA as template. The sbe2a primer sequences were as follows: 5’-CGTGTAAAGATACGGATGGAC-3’ (upstream) and 5’-ATAGGCGAGAATCCCACAT-3’ (downstream), with an expected product of 562bp. The EF-1a primer sequences were as follows: 5’-GCTTCACGTCCCAGGTCATC-3’ (upstream) and 5’-TAGGCTTGGTGGGTATCATC-3’ (downstream), with an expected product of 213 bp (Kirchberger et al., 2007). The reaction systems were same as immediately abovementioned. The reaction program was 94°C for 5 min, 28 cycles (94°C for 30 s, 54°C for 30 s, 72°C for 1 min), and 72°C for 10 min for a final extension. Analysis of SBE activity in transgenic T1 kernels Five kernels of transgenic maize 20, 25, and 30 days after pollination (15 kernels totally), were harvested, weighed, and

Transgenic T1 plant corncob was covered with a plastic bag to allow inbreeding. A total of 20 random seeds of transgenic T1 plants (Tie7922-1, Tie7922-2, Tie7922-3, and Tie7922-4) were planted and grew up into transgenic T2 plants, respectively. Genomic DNA was extracted from the leaves of the transgenic T2 plants for PCR detection. SBE activity and starch content in the transgenic T2 kernels of PCR-positive T2 plants were detected as done to transgenic T1 kernels.

Statistical methods SPSS10.0 software was used for statistical analysis. Chi-square fitness test was performed to analyze the fitness of transgenic T2 plants to the Mendel law. Student t-test was used for comparing SBE activity and starch contents between transgenic kernels and non-transgenic kernels, respectively. P < 0.01 indicated statistically significant difference.

RESULTS Cloning and sequencing of sbe2a fragment As shown in Figure 2, specific and pure fragments of approximately 562 bp were obtained, as expected. After recycling, ligation into the vector, and transfer into E. coli, five positive colonies were obtained by screening. An insert fragment of approximately 562 bp was obtained via restriction digestion, suggesting that the target fragment had been inserted into the vector (Figure 2). The sequencing results were as follows: ATAGGCGAGA ATCCCACATC CTCGTGGACC TAATGTGTACGGTGCCATC AAACCATCCA AGGTATTATT CTATGAACAA TATCCATAAG CCAAGCTCAT GCGCTTTATC TTAGGTCCT CTGGAGTCCC CTTGGGGCAA AAAAATTCGT

CAATGATGGC ACCATGGAAG GAAACCATTC TGATGAATGA CACTAGCAAG AATAAGAGATT AAAACGGCTA AACATGGTA

7632

Afr. J. Biotechnol.

CTTTTTAATTCTTGGAAG CACCTCATCT CTGAAGTTAG CATATGTATT TATCTTTG GTTCCGGGCTAC TCATTCCAAC ATGTGATTCA TATATCCGCA GTGACTTGGG CCGCTTAGGT TGAGGGTGTT TGAATACATA TTTCTCCTCT TCAGGTGGGT CATAATATAT ACCGTTGTAT GGTATTTCAC CTGGAGCCTG CACAGAAAAC TTGATCCAGG CAGGAATGGAA TCCTTAACA CCAGATGGTGTGTCCATCCG TATCTTTACA (562 bp). Sequencing analysis showed that the interest fragment in the present paper had only one different base when compared to that reported in NCBI GenBank (U65948), that is, the homology was up to 99.8%. This implies that the cloned sequence was the same as the corn sbe2a fragment. Construcion of pRSBE2a

Figure 3. Restriction enzyme analysis of the reconstructs. M, DNA Marker DL-2,000, DL-15,000; 1, pRSBE2a/SacI+XhoI; 2, pRSBE2a/Xba I+BamH I.

Digestion produced approximate 562 bp fragments for all positive clones (Figure 3). A specific 1,110 bp fragment was produced after digestion with Xba I+Xho I to identify the interference-potent fragments (Figure 4). These results demonstrate that the interest fragments have been successfully inserted into the downstream site of 35S promoter, which was carried on plant expression vector pCAMBIA1301, namely, sbe2a-containing RNAi expression vector pRSBE2a. PCR detection of transgenic T1 plants A total of 800 seeds of T0 plants were selected and planted in the farm to grow transgenic T1 plants. The results verified total four resistant transgenic T1 plants (Tie7922-1, Tie7922-2, Tie7922-3 and Tie7922-4) and primarily demonstrated that the exogenous genes had been integrated into maize genomes. Southern blotting

Figure 4. Restriction enzyme analysis of the reconstructs. M1 and M2, DNA Marker DL-2,000, DL-15,000; 1: pRSBE2a/Xba I + Xho I.

DNA was extracted from leaves of each positive transgenic T1 plant, and digested with BamH I. As shown in Figure 5, hybrid signals appeared for each positive plant, in accordance with the results of PCR detection, whereas the signal was not present for non-transgenic plants. This result verifies that the exogenous gene was integrated into the genome of the transgenic plant and it implies that the exogenous gene may integrate one or two copies into the transgenic maize genome. RT-PCR analyses of transgenic T1 kernels

CCCAAAGCTTG CATAATAAGA GTGTTCCTGG ATTGCCATTA TCTGTACTGC ATTGTATCCAAG

The results of RT-PCR on transgenic T1 maize kernels

Guan et al.

1

2

3

4

5

7633

6

Figure 5. Southern blot of transgenic T1 plants. 1, Positive control; 2, non-transgenic plant; 3 to 6, transgenic plants (Tie7922-1, Tie7922-2, Tie7922-3 and Tie7922-4).

a

b

Figure 6. Reverse Transcript PCR analysis of transgenic T1 kernels. (a) 28 cycle reaction, (b) 30 cycle reaction. M, DNA marker DL-2,000; 1 to 4, transgenic kernels (Tie7922-1, Tie7922-2, Tie7922-3, Tie7922-4), 5, non-transgenic kernel; Sbe2a fragment, 562bp; EF-1a, 213bp.

are shown in Figure 6. The endogenous SBE mRNA content was decreased significantly in the transgenic plants, indicating the exogenous gene was transcripted normally to cause the endogenous sbe mRNA degradation. SBE activity and starch content in transgenic T1 kernels Kernels were harvested from transgenic plants (Tie79221, Tie7922-2, Tie7922-3, and Tie7922-4). The SBE activities for transgenic T1 kernels were 0.03556U, 0.04025U, 0.02231U and 0.0202U (n = 3), respectively, and 0.12721U for control (Figure 7a). SBE activities were reduced by 60.4, 55.1, 75.1 and 77.5% (average 65.3%), respectively. SBE activities in transgenic T1 kernels were significantly lower than that of the non-transgenic plant (P < 0.01 for each); suggesting that the translation of endogenous SBE mRNA was inhibited to some extent

by the RNAi vector and SBE activity was also reduced. The total starch contents of transgenic Tie7922-1, Tie7922-2, Tie7922-3, and Tie7922-4 were 670, 680, 690, and 680 mg/g DW (kernels), respectively, similar to that of control; however, the percent contents of amylose were 38.9, 35.5, 48.8, and 50.9%, respectively, higher than 27.1% for the non-transgenic plant (P < 0.01 for each; Figure 7b); the at most increase was 87.8% (50.9 vs. 27.1%) and the average growth was 60.6% (43.6 vs. 27.1%). PCR analysis of transgenic T2 plant PCR results for transgenic T2 plants are shown in Table 1. The results demonstrate that the exogenous gene was transmitted on to transgenic T2 plants, and the segregation ratio was complied with Mendel law (Chi-square = 6.37, P < 0.01).

7634

Afr. J. Biotechnol.

bb

aa

Figure 7. SBE activity and amylose contents in transgenic T1 kernels. (a) SBE activity; (b) Amylose contents. 1 to 4, Transgenic kernels (Tie7922-1, Tie7922-2, Tie7922-3, Tie7922-4); 5, non-transgenic kernel.

Table 1. PCR analysis of transgenic T2 plants.

T2 line Line 1 Line 2 Line 3 Line 4

No of seed 20 20 20 20

No路 of seedling 20 19 17 18

No路 of positive plant 15 14 13 14

SBE activity and starch content in transgenic T2 kernels In transgenic T2 plants, Tie7922-1-1, Tie7922-2-1, Tie7922-3-1, and Tie7922-4-1 plants were detected to have the down-regulated endogenous sbe mRNA, so their kernels were selected for the analyses of SBE activity and starch content. The SBE activities for transgenic T2 kernels were 0.03855U, 0.04106U, 0.02354U, and 0.02015U (n = 3), respectively, and 0.09152U for the non-transgenic plant (Figure 8a); the SBE activities were reduced by 57.8, 55.1, 74.3, and 77.9%, respectively, when compared to that of the non-transgenic plant (P < 0.01 for each). The total starch contents of transgenic T2 kernels were 680, 680, 670, and 690 mg/g DW (kernels), respectively, similar to that of blank control; however, the percent contents of amylose were 36.9, 34.8, 48.5, and 51.5%, respectively, significantly higher than 27.5% for the nontransgenic plant (P < 0.01 for each; Figure 8b); the maximum increase was 87.2% (51.5 vs. 27.5%) and the average increase was 56.1% (42.9 vs. 27.5%).

No路 of negative plant 5 5 4 4

Positive/negative 3:1 2.8:1 3.2:1 3.5:1

DISCUSSION In the present paper, sbe2a gene was cloned and the corresponding RNAi vector was constructed. Using pollen tube pathway transformation, the RNAi vector was successfully imported into maize inbred lines. Stoutjesdijk et al. (2002) achieved the suppression of FAD2 gene in Arabidopsis by using RNAi technology, and this depression effect could be transmitted to the offspring. This finding reveals the potential of RNAi technology to apply in crop seed quality and properties improvement for the first time. Andika et al. (2005) used RT-PCR to clone rape PEP gene fragment and construct RNAi vector of PEPase gene to suppress PEPase gene expression in rape, making the metabolic flux deflect towards oil synthesis, consequently increasing oil content in rapeseed. Generally, RNAi as a focus issue in molecular biology and genetic engineering opens up a new approach in fundamental and applied research. The results in the present paper have shown that SBE activity was significantly decreased (by an averaged 65.3 and 65.3%, respectively) in transgenic T1 and T2 kernels

Guan et al.

a

7635

b

Figure 8. SBE activity and amylose contents in transgenic T2 kernels. (a) SBE activity; (b) amylose contents. 1 to 4, Transgenic kernels (Tie7922-1-1, Tie7922-2-1, Tie7922-3-1, Tie7922-4-1); 5, non-transgenic kernel.

when compared to the non-transgenic plant, suggesting that the translation of endogenous Sbe2a mRNA was inhibited by RNAi expression vector effectively. Meanwhile, the content of amylose was significantly increased (by an averaged 60.6 and 56.1%; 87.8% at most) in transgenic T1 and T2 kernels under the condition of the total starch content. These findings indicate that RNAi technology can effectively regulate the corn starch synthesis. It inhibits the synthesis of amylopectin and greatly enhances the amylose content in order to produce high-amylose maize inbred lines and provide a new way to improve corn high amylose. Breeding of high-amylose

maize hybrid is in progress for the further studies. Conclusion In the present study, a portion of sbe2a gene fragments were forward and inversely inserted into plant expression vector and an RNAi vector for sbe2a was successfully constructed. As these reconstructs were successfully introduced into maize inbred lines by pollen tube pathway transformation, gene expression was suppressed by dsRNA that was formed by sense and antisense RNA annealing; thereby leading to the

specific posttranscriptional degradation of homologous mRNA and leading to efficient and specific sbe2a gene repression. RNAi as an efficient means for gene silencing can regulate the metabolic pathway of corn starch and inhibit target gene expression. By inhibiting sbe2a gene expression, the RNAi vector can effectively reduce SBE activity to improve the corn amylose content. ACKNOWLEDGEMENTS This

study is funded by National Transgenic

7636

Afr. J. Biotechnol.

Special Project (No. 20082x08003-005); Jilin Provincial Division of Finance Project (No. 200806); Provincial Division of Science and Technology Project (No. 20095044). REFERENCES Andika IB, Kondo H, Tamada T(2005). Evidence that RNA silencingmediated resistance to Beet necrotic yellow vein virus is less effective in roots than in leaves. Mol. Plant Microbe In. 18: 194-204. Blauth SL, Yao Y, Klucinec JD, Shannon JC, Thompson DB, Guilitinan MJ (2001). Identification of Mutator Insertional Mutants of StarchBranching Enzyme 2a in Corn. Plant Physiol. 125: 1396-1405 Casey J, Slattery I, Kavakli H, Okita TW (2000). Engineering starch for increased quantity and quality. Trends Plant Sci. 5: 291-298. Denver K, Johnson P, Samuel Z, Alison MS (2001). The control of amylose synthesis. Plant Physiol. 158: 479-487. Yandeau-Nelson M, Laurens L, Shi Z, Xia H, Smith AM, Guiltinan M (2011). Starch Branching Enzyme IIa is required for proper diurnal cycling of starch in leaves of Zea mays. Plant Physiol. 156: 479-490 Kirchberger S, Leroch M, Huynen MA, Wahl M, Neuhaus HE, Tjaden J (2007). Molecular and biochemical analysis of the plastidic ADPglucose transporter (ZmBT1) from Zea mays. J. Biol. Chem. 282: 22481-22491 Koga A, Ishibashi T, Kimura S, Uchiyama Y, Sakaguchi K (2006). Characterization of T-DNA insertion mutants and RNAi silenced plants of Arabidopsis thaliana UV-damaged DNA binding protein 2 (AtUV-DDB2). Plant Mol Biol. 61(1-2): 227-240. Nunes AC, Vianna GR, Cuneo F, Amaya-Farfn J, deCapadeville G, Rech EL, Aragรกo FJ (2006). RNAi-mediated silencing of the myoinosit-1-phosphate synthase gene (GmMIPS1) in transgenic soybean inhibited seed development and reducedphytate content. Planta, 224: 125-132.

Qiao F, Yang Q, Wang CL, Fan YL, Wu XF, Zhao KJ (2007). Modification of plant height via RNAi suppression of OsGA20ox2 gene in rice. Euphytica, 158(1-2): 35-45 Schweizer P, Pokorny J, Schulze-Lefert P, Dudler R (2000). Doublestranded RNA interferes with gene function at the single-cell revel in cereals. Plant J. 24: 895-903 Sestili F, Janni M, Doherty A, Botticella E, D'Ovidio R, Masci S, Jones HD, Lafiandra D (2010). Increasing the amylose content of durum wheat through silencing of the SBEIIa genes. BMC Plant Biol. 10: p. 144. Smith AM, Denver K, Martin C (1997). The synthesis of the starch granule. An. Rev. Plant Physiol. Plant Mol. Biol. 48: 67-87 Stoutjesdijk PA, Singh SP, Liu Q, Hurlstone CJ, Waterhouse PA, Green AG (2002). hpRNA-mediated targeting of the Arabidopsis FAD2 gene gives highly efficient and stable silencing. Plant Physiol. 129: 17231731 Sunikumar G, Campbell LM, Puckhaber L, Stipanovic RD, Rathore KS(2006). Engineering cotton seed for use in human nutrition by tissue-specific reduction of toxic gossypol. Proc. Nat. Acad. Sci. USA. 103: 18054-18059. Visser RGF, Jacobsen E (1993). Towards modifying plants for altered starch content and composition. Trends Biotechnol. 11: 63-68

African Journal of Biotechnology Vol. 11(30), pp. 7637-7642, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3862 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Common vetch-wheat intercropping: Haylage yield and quality depending on sowing rates Karagic Dura*, Mikic Aleksandar, Milosevic Branko, Vasiljevic Sanja and Dusanic Nenad Institute of Field and Vegetable Crops, Maksima Gorkog 30, 21000 Novi Sad, Serbia. Accepted 17 February, 2012

The winter-sowing genotypes of common vetch (Vicia sativa L.) are very susceptible to lodging and therefore are sown in mixtures with small grains that serve as supporting crops. In order to determine an optimum ratio of vetch and wheat (Triticum aestivum L.) components in their mixture, a four-year trial (autumn 2005 to spring 2009) was carried out, aiming at the yield and quality of winter vetch haylage. The sowing rate of winter vetch was 120 kg ha-1, while the sowing rate of winter wheat was 0, 15, 20, 25 and 30 kg ha-1. An increased proportion of the cereal in its mixture with vetch significantly decreased the stand lodging, have a positive influence on forage yield, but haylage quality is of a poorer quality. Quality characteristics such as crude protein and lignin content, total digestible nutrients, dry matter intake and relative feed value were highest in monoculture common vetch followed by mixture with the lowest rate of wheat. Neutral detergent fiber content was positively affected by intercropping. There were no significant differences among treatments for acid detergent fiber content, digestible dry matter and net energy for lactation. The most favorable balance between the haylage yield and quality, as well as the highest crude protein yield (1482 kg ha-1), was achieved with the mixture of 120 kg ha-1 of the vetch seed and 15 kg ha-1 of wheat. Key words: Common vetch, crude protein, forage quality, haylage, mixture, nutritive value. INTRODUCTION Winter form of common vetch (Vicia sativa L.), is an annual legume crop rich in protein that is traditionally used in the regions of South east Europe as high quality roughage, that is, green forage or hay. Recently, it was increasingly used in the form of haylage, due to numerous advantages of conservation it has (Seven and Cerci, 2006). Also, the enhanced quality of the conserved forage allowed a greater milk yield and a reduction in the winter feeding costs. Carefully managing the haylage during storage prevented the risk of clostridial or other bacterial contamination in the milk and produced cheeses (Borreani et al., 2007). However, vetch has a vine growing habit and if sown as monocrop, it lodges heavily (Caballero et al., 1995). As a result, forage yield and quality start to decrease due to the decomposition of herbage

*Corresponding author. E-mail: djura.karagic@ifvcns.ns.ac.rs. Tel: +381 64 8205 745. Fax: +381 21 4898 373.

(Gulcan et al., 1988; Aydin and Tosun, 1991;). Due to this, it is sown with winter-sown small grains, such as oats (Avena sativa L.), wheat (Triticum aestivum L.), barley (Hordeum vulgare L.) and triticale (x Triticosecale Wittmack).In mixtures, companion cereals provide structural support for common vetch growth, improve light interception and facilitate mechanical harvest, whereas common vetch in mixtures improves the quality of forage (Roberts et al., 1989; Caballero et al., 1995; Lithourgidis et al., 2006). So far, there has been no report on what cereal is the best companion crop for vetch (Caballero and Goicoechea, 1986; Thompson et al., 1992). Roberts et al. (1989) reported that the most suitable cereal for mixtures with common vetch is wheat. Due to a problematic response to low temperatures in oats in Serbia, it was wheat that was most often used as a companion crop for winter vetch. Although numerous studies have examined the effects of varying seeding ratios (Aydogdu and Acikgoz, 1995; Tukel et al., 1997; Karadag and Buyukburc, 2003; Lithourgidis et al., 2006; Tuna and Orak, 2007; Kokten

7638

Afr. J. Biotechnol.

et al., 2009), the optimum seeding rates for these combinations are not well-defined. The conclusions these authors have drawn are highly influenced by the climatic conditions on which their testing was carried out. Common vetch produces low yields, particularly in areas with low rainfall (Hadjichristodoulou, 1978) and seriously hinders harvest because of lodging in areas with high rainfall (Robinson, 1969; Caballero et al., 1995). For the prevailing agro-ecological conditions of Serbia, Miskovic (1986) recommends that the sowing rates are 150 kg ha-1 for common vetch and 30 to 35 kg ha-1 for cereals. However, it has been demonstrated that these sowing rates are too high for the contemporary agriculture. By this reason, the objective of this study was to compare the haylage yield and quality of mixed stands of vetch and wheat obtained when several seeding rates of wheat were combined with constant seeding ratio of vetch.

Quality measurements The cut and dried biomass was placed in a silo trench without inoculants. After 60 days of fermenting (Van Ranst et al., 2009), the haylage samples of 400 g each were taken, with an analysis of the basic quality parameters. Total N was determined using the Kjeldahl method and crude protein (CP) was calculated by multiplying the N content by 6.25 (AOAC, 1980). Neutral and acid detergent fiber (NDF and ADF) and acid detergent lignin (ADL) were determined using the procedure by Goering and van Soest (1970). Total digestible nutrients (TDN), digestible dry matter (DDM), dry matter intake (DMI), relative feed value (RFV) and net energy for lactation (NEL) were estimated according to the following equations adapted from Horrocks and Vallentine (1999): TDN = 73.5 + 0.62(%CP) – 0.71 (%ADF) DDM (%) = 88.9 – (%ADF x 0.779) DMI (%DM) = 120: %NDF RFV = (%DDM x %DMI) : 1.29

MATERIALS AND METHODS

NEL = (1.044-(0.0119 x %ADF)) x 2.205

Field experiment Data analysis A field experiment was conducted during four growing seasons (2005/06, 2006/07, 2007/08 and 2008/09) at the experimental field of the Institute of Field and Vegetable Crops, Novi Sad, in northern Serbia (45°20’N, 19°51’E). The area has a continental semiarid to semi humid climate, the long-term average temperature from October to May is 6.87°C, and sum of precipitation is 359.6 mm. The experiment was established in a loamy soil with pH 7.2, and organic matter content of 2.82%, N-NO3 17.2 mg kg-1, P2O5 20.7 mg kg-1 and K2O 29.1 mg kg-1 (0 to 30 cm depth). Nitrogen and P2 O5 at 15 and 78 kg ha-1, respectively, were incorporated as monoammonium phosphate (10–52–0) into the soil before ploughing. In all the years, the previous crop was oilseed rape, with harvest residues chopped and incorporated into the soil. The experimental design was a randomized complete block with five treatments (vetch monoculture and four mixtures of common vetch with wheat) replicated four times. The sowing rate of vetch in all treatments was 120 kg ha-1, while the sowing rates of wheat were 0 kg ha-1 (SRW 0), 15 kg ha-1 (SRW 15), 20 kg ha-1 (SRW 20), 25 kg ha-1 (SRW 25) and 30 kg ha-1 (SRW 30). The plot size was 60 m2 (5 x 12 m) and the treatments were separated by a 2 m buffer zone. The seeds of vetch and wheat were mixed before the sowing which was done in the first day of October in all four years, using Amazone AD 253 Special seed drill made in Germany and with 12.5 cm between rows traditionally practiced in Serbia (Miskovic, 1986; Mihailovic et al., 2006). Mean seed weights were 50.2 and 39.8 g per 1000 seeds for common vetch and wheat, respectively. Usual modern agronomic practices of vetch production were applied.

Yield measurements The cutting and chopping of the forage were done by hand with a scythe in the stage of first pods forming (the last day of May) and on the area of 10 m2 in the middle of each plot. The cut biomass was dried in situ until it had a moisture content of 55% (Plue and Haley, 1988; Dordevic and Dinic, 2003; Cavallarin et al., 2005), when the haylage yield was measured. Samples of 1 kg biomass from each plot were dried at 65°C for 72 h in order to determine the dry matter content.

The results were processed by the analysis of variance (ANOVA). The treatment mean differences were separated by the least significant difference (LSD) test at the 0.05 probability level. For the entire statistical analysis, the MSTAT-C software was used (MSTAT-C 1988). Due to the fact that the analyses of variance for haylage yield and quality indicated no treatment x experimental time interaction, the values are reported as means of the four growing seasons.

RESULTS The influence of the wheat sowing rate on the vetch haylage yield was significant (Table 1). The highest vetch haylage yield (18938 kg ha-1) was achieved in the treatment with the highest wheat sowing rate. By decreasing the wheat sowing rate, the haylage yield was also decreased, that is, from 9.4% in SRW 25 to 35.4% in the vetch monocrop. There were no significant differences in the vetch haylage yield between the treatments SRW 15 and SRW 20. An identical trend, to that of haylage yield was observed for the dry matter yield (Table 1). The influence of the wheat sowing rate on the vetch proportion in the total yield was significant for all treatments (Table 1). The highest CP content was in the vetch monocrop (251.8 g kg-1 DM) with the lowest wheat sowing rate (223.1 g kg-1 DM), with no significant differences between these two treatments (Table 2). With a further increase of the wheat sowing rate, there was a significantly lower CP content in dry matter. The decrease of the CP content varied from 30.8% with SRW 20 to 59.0% with SRW 30. The influence of the wheat sowing rate on CP yield was significant in all treatments. The highest yield was -1 achieved with SRW 15 (1482 kg ha ). The decrease of CP

Dura et al.

7639

Table 1. Haylage yield, dry matter yield and vetch contribution of monoculture and mixtures of common vetch with wheat*.

Treatment SRW0 SRW15 SRW20 SRW25 SRW30 Average LSD 0.05

-1

Haylage yield (kg ha )

-1

Dry matter yield (kg ha )

d

d

12240 c 14970 15366c 17151b 18938a 15733 1378

5430 c 6641 6816c 7718b 8400a 7001 623

Vetch proportion in the total yield (%) a 100.00 b 80.66 74.27c 62.91d 56.12e 74.79 3.73

*Values within the columns followed by the same letter do not differ significantly at the 0.05 level of probability according to least significant difference (LSD) test.

Table 2. Crude protein (CP) content, crude protein yield, neutral acid detergent fiber (NDF), acid detergent fiber (ADF) and acid detergent lignin (ADL) in haylage of monoculture and mixtures of common vetch with wheat*.

Treatment SRW0 SRW15 SRW20 SRW25 SRW30 Average LSD 0.05

CP (g kg-1 DM) 251.8a 223.1a b 174.3 123.4c 103.2d 175.2 13.8

CP yield (kg ha-1) 1367b 1482a c 1188 d 952 867e 1171 69

NDF (g kg-1 DM) 421.2d 448.4cd c 466.9 521.3b 564.7a 484.5 37.5

ADF (g kg-1 DM) 356.3a 362.0a a 371.9 355.4a 352.1a 359.5 25.6

ADL (g kg-1 DM) 98.9a 93.3ab b 89.2 64.6c 61.7c 81.5 9.3

*Values within columns followed by the same letter do not differ significantly at the 0.05 level of probability according to least significant difference (LSD) test.

yield ranged between 7.8% in the vetch monocrop to 41.5% in the treatment with the highest wheat sowing rate. The highest NDF content (564.7 g kg-1 DM) was in the treatment with the highest wheat sowing rate (Table 2). The decrease of the wheat sowing rate caused the decrease of NDF content, from 7.7% with SRW 25 to 25.4% in the vetch monocrop. At the same time, there were significant differences in NDF content either between the treatments SRW 20 and SRW 15, or between the treatments SRW 15 and SRW 0. The average ADF content -1 in the vetch haylage was 359.5 g kg DM, with no significant differences between the treatments. The lignin content was highest in the vetch monocrop (98.9 g kg-1 DM). The increase in the wheat sowing rate above 20 kg ha-1 caused a significant decrease in the lignin content, from 9.2 to 37.6% (Table 2). The highest TDN was determined in the vetch monocrop (Table 3). There were no significant differences in the TDN content between the treatments SRW 0 and SRW 15. The increase of the wheat sowing rate above 15 kg ha-1 caused a significant decrease of the TDN content

in haylage, from 9.3 to 14.0%, in comparison with SRW 0. The average DDM was 608.9 g kg-1 DM, with no significant differences between the treatments (Table 3). The highest DMI was in the vetch monocrop and the lowest wheat sowing rate, 28.5 and 26.8 g kg-1 of BW, respectively. In comparison with the vetch monocrop, the values of the other treatments were significantly lower, from 9.8 to 25.3% (Table 3). The highest RFV was determined in the vetch monocrop and the lowest wheat sowing rate, 135.04 and 126.07%, respectively. In comparison with the vetch monocrop, the values of the other treatments were significantly lower. The average NEL was 1.359 Mcal kg-1 without significant differences between the treatments (Table 3). DISCUSSION The increase of the cereal in its mixture with vetch significantly increased the yields of both haylage and DM, which agrees with the results of Roberts et al. (1989) who found that DM decreased with increasing common vetch

7640

Afr. J. Biotechnol.

Table 3. Total digestible nutrients (TDN), digestible dry matter (DDM), dry matter intake (DMI), relative feed value (RFV) and net energy for lactation (NEL) of the haylage of monoculture and mixtures of common vetch with wheat*.

Treatment SRW 0 SRW 15 SRW 20 SRW 25 SRW 30 Average LSD 0.05

TDN -1 (g kg DM) a 638.1 ab 616.3 bc 579.0 559.2c c 549.0 588.3 43.7

DDM -1 (g kg DM) a 611.4 a 607.0 a 599.3 612.1a a 614.7 608.9 38.6

DMI -1 (g kg of body weight) a 28.5 ab 26.8 b 25.7 23.0c c 21.3 25.0 1.7

RFV (%) a 135.04 ab 126.07 b 119.37 109.11c c 101.47 118.21 9.31

NEL -1 (Mcal kg ) a 1.367 a 1.352 a 1.326 1.369a a 1.378 1.359 0.114

*Values within columns followed by the same letter do not differ significantly at the 0.05 level of probability according to least significant difference (LSD) test.

ratios in mixtures with wheat. Caballero et al. (1995) determined that the mixtures produced 34% more dry matter than monocrop of vetch, but 57% less than oat monocrop. Unlike our results, Kokten et al. (2009) determined the lowest DM yield in the mixture of 20% vetch and 80% triticale and the highest DM yield in the mixture of 80% vetch and 20% triticale. Vetch monocrop had the highest crude protein content. In all mixtures, the CP content decreased as cereal proportion increased, which responds with the results of numerous authors (Roberts et al., 1989; Caballero et al., 1995; Balabanli and Turk, 2006; Lithourgidis et al., 2006; Kokten et al., 2009). Karadag and Buyukburc (2003) determined that the CP content was 19.22% in a vetch monocrop and 9.77% in an oat monocrop. However, CP yield is one of the most important criteria for forage evaluation. Although the mixture of vetch and wheat (SRW 15) had lower CP content than monocrop of vetch, it gave the highest CP yield than all crops because of its higher haylage yield (Tables 1 and 2). Similarly, Lithourgidis et al. (2006) showed that the highest CP yield was in the mixture of common vetch–oat (1100 kg ha-1) followed by monoculture common vetch (1000 kg ha-1). According to Lauk and Lauk (2006), the extra gains in protein yield obtained from mixed crops as compared to wheat monocultures were 100 to 500 kg ha-1. Unlike our results, Tuna and Orak (2007) recommended the mixture of 25% vetch and 75% oat, on the basis of solely -1 DM yield (6.5 t ha ). In addition, Tukel et al. (1997) determined the lowest CP yield (0.54 t ha-1) in pure vetch sowing and the highest CP yield (0.98 t ha-1) in a triticale monocrop. The lowest NDF concentration was in vetch monocrop and the increase of the wheat sowing rate caused increase of NDF content, which is in agreement with most studies (Caballero et al., 1995; Castro et al., 2000; Assefa and Ledin, 2001). However, Lithourgidis et al. (2006) showed that the monoculture of common vetch had higher NDF concentration. This can be attributed to the different cultivar used in this study and possibly to the different growth stage of common vetch at harvest as compared with the other studies. After testing the wheat

monocrop silage quality, Siefers and Bolsen (1997) determined a relatively low forage quality as evidenced by high NDF and ADF percentages (higher than 60% NDF and 40% ADF contents). In the case of ADF, much smaller differences were observed. The actual values for ADF found in this study and the lack of significant differences agree with other studies (Caballero et al., 1995; Castro et al., 2000; Lithourgidis et al., 2006). The increase in wheat sowing rate decreased the lignin content and increased the NDF content in DM (Table 2). This may be explained by significant differences between chemical composition in wheat and vetch dry matter. According to Lopez et al. (2005), the wheat DM has NDF content higher for 25% and lignin content lower for 96% in comparison with the vetch DM. The results obtained respond with those from other studies (Caballero et al., 1995, 2001; Rebole et al., 2004; Lithourgidis et al., 2006). The vetch monocrop and SRW 15 had higher TDN than all other mixtures (Table 3). Similar values and trends were reported by others where legumes included in the intercropping system significantly increased the TDN (Osman and Nersoyan, 1986; Roberts et al., 1989). Having tested the ruminal degradability of DM and CP, Mahida et al. (2000), concluded that the vetch proportion in hay was positively correlated with effective degradability (ED) of DM and ED of CP. However, Lithourgidis et al. (2006) showed that triticale and oat monocultures had higher TDN than monoculture common vetch, and TDN decreased as the common vetch seeding proportion increased in the mixtures. The differences in this research were as a result of various methods used to determine TDN. A similar trend was observed for the DMI and RFV. The RFV was much higher in vetch monocrop and SRW 15 than in other mixtures, which is consistent with results of Hackman et al. (2008). According to Dunham (1998), the best use of RFV is for selecting forages to be used in rations which require high nutrient density such as high producing dairy cows. Using alfalfa with a RFV less than 140 should not be considered for early lactation

Dura et al.

cows. However, alfalfa with a RFV of 125 to 140 could be fed to dairy cows in late lactation. Lower RFV alfalfa could be adequate for growing heifers. The different content of common vetch did not affect DDM and NEL as there were no significant differences among treatments, which is in agreement with results of Lithourgidis et al. (2006). Conclusion For forage crops, it is important to produce greater forage yields per hectare, higher nutritional quality (percentage composition of selected nutrients) or combined nutrient yields. On the basis of the results obtained from this research, it can be concluded that the most favorable balance between haylage yield and quality, as well as the highest CP yield (1482 kg ha-1), was achieved by sowing the mixture of 120 kg ha-1 of vetch and 15 kg ha-1 of wheat, thus recommending this combination to the farmers for the agro-ecological conditions of South east Europe. ACKNOWLEDGEMENT This research was supported by Ministry of Science, Technology and Development of the Republic of Serbia (Project No. TR 31024). REFERENCES AOAC (1980). Official Methods of Analysis. Association of Official Analytical Chemists, Washington. Assefa G, Ledin I (2001). Effect of variety, soil type and fertilizer on the establishment, growth, forage yield, quality and voluntary intake by cattle of oats and vetches cultivated in pure stands and mixtures. Anim. Feed Sci. Technol. 92: 95-111. Aydin I, Tosun F (1991). The effect of the ratios of common vetch and cereals in the mixtures upon the yields of hay and crude protein and crude protein ratio under the ecological conditions of Samsun-Turkey. In: Proceedings of the 2nd National Congress of Grassland and Forage Crops in Turkey. Izmir, pp. 332-341. Aydogdu L, Acikgoz E (1995). Effect of seeding rate on seed and hay yield in common vetch (Vicia sativa L.), J. Agron. Crop Sci. 174: 181187. Balabanli C, Turk M (2006). The effects of different harvesting periods in some forage crops mixture on herbage yield and quality. J. Biol. Sci. 6(2): 265-268. Borreani G, Giaccone D, Mimosi A, Tabacco E (2007). Comparison of hay and haylage from permanent Alpine meadows in winter dairy cow diets. J. Dairy Sci. 90: 5643-5650. Caballero R, Goicoechea EL (1986). Utilization of winter cereals as companion crops for common vetch and hairy vetch. In: Proceedings of the 11th General Meeting of the European Grassland Federation. Setubal, pp. 379-384. Caballero R, Goicoechea EL, Hernaiz PJ (1995). Forage yields and quality of common vetch and oat sown at varying seeding ratios and seeding rates of common vetch. Field Crop Res. 41: 135-140. Caballero R, Alzueta C, Ortiz LT, Rodrique ML, Baro C, Rebole A (2001). Carbohydrate and protein fractions of fresh and dried common vetch at three maturity stages, Agron. J. 93: 1006-1013.

7641

Castro MP, Pineiro J, Sau F (2000). Effect of seeding rates of oats, wheat and common vetch on the yield, botanic composition and nutritive value of the mixture. In: Legumes for Mediterranean forage crops, pastures and alternative uses (Ed. Sulas L). CIHEAM-IAMZ, Zaragoza, pp. 207-211. Cavallarin L, Antoniazzi S, Borreani G, Tabacco E (2005). Effects of wilting and mechanical conditioning on proteolysis in sainfoin (Onobrychis vicifolia Scop) wilted herbage and silage. J. Sci. Food Agric. 85: 831-838. Dordevic N, Dinic B (2003). Siliranje leguminoza. Institut za istrazivanja u poljoprivredi Srbija, Belgrade. Dunham JR (1998). Relative feed value measures forage quality. Forage Facts 41: p. 3. Goering HK, van Soest PJ (1970). Forage fiber analysis. In: Agricultural handbook No. 37. USDA, Washington. Gulcan H, Saglamtimur T, Anlarsal AE, Tansi V (1988). Research on hay yield of different vetch + oat mixture ratios and seeding times under Cukurova conditions. Agric. Fac. Cukurova Univ. Publ. Adana, 3: 108-118. Hackman TJ, Sampson JD, Spain JN (2008). Comparing relative feed value with degradation parameters of grass and legume forages. J. Anim. Sci. 86: 2344-2356. Hadjichristodoulou A (1978). Genotype, environment and rainfall effects on common vetch varieties in a semiarid region. Exp. Agric. 14: 8187. Horrocks RD, Vallentine JF (1999). Harvested Forages. Academic Press, London, UK. Karadag Y, Buyukburc U (2003). Effects of seed rates on forage production, seed yield and hay quality of annual legume-barley mixtures. Turk. J. Agric. For. 27: 169-174. Kokten K, Toklu F, Atıs I, Hatipoglu R (2009). Effects of seeding rate of forage yield and quality of Vetch (Vicia sativa L.)-Triticale (Triticosecale Wittm.) mixtures under East Mediterranean rainfed conditions. Afr. J. Biotechnol. 8(20): 5367-5372. Lauk R, Lauk E (2006). Yields in vetch-wheat mixed crops and sole crops of wheat. Agron. Res. 4: 37-44. Lithourgidis AS, Vasilakoglou IB, Dhima KV, Dordas CA, Yiakoulaki MD (2006). Forage yield and quality of common vetch mixtures with oat and triticale in two seeding ratios. Field Crop Res. 99: 106-113. Lopez S, Davies DR, Giraldez FJ, Dhanoa MS, Dijkstra J, France J (2005). Assessment of nutritive value of cereal and legume straws based on chemical composition and in vitro digestibility. J. Sci. Food Agric. 85: 1550-1557. Mahida HA, Gonzales J, Caballero R, Alvir MR (2000). Nutritive value of on-farm common vetch-oat hay, II. Ruminal degradability of dry matter and crude protein, Anim. Res. 49: 391-398. Mihailovic V, Mikic A, Cupina B, Katic S, Karagic D, Pataki I, Eric P (2006). Yield and forage yield components in winter vetch cultivars. Grassl. Sci. Eur. 11: 255-257. Miskovic B (1986). Krmno bilje. Naučna knjiga, Belgrade. MSTAT-C (1988). A Microcomputer Program for Design, Management, and Analysis of Agronomic Research Experiments. Crop and Soil Sciences Department, Michigan State University, East Lansing. Osman AE, Nersoyan N (1986). Effect of the proportion of species on the yield and quality of forage mixtures, and on the yield of barley in the following year. Exp. Agric. 22: 345-351. Plue PS, Haley D (1988). Harvesting and storing big bale haylage. OMARFA Factsheet, 88-094. Rebole A, Alzueta C, Ortiz LT, Barro C, Rodriguez ML, Caballero R (2004). Yields and chemical composition of different parts of the common vetch at flowering and at two seed filling stages. Span. J. Agric. Res. 2(4): 550-557. Roberts CA, Moore KJ, Johnson KD (1989). Forage quality and yield of wheat-common vetch at different stages of maturity and common vetch seeding rate. Agron. J. 81: 57-60. Robinson RC (1969). Annual legume: cereal mixtures for forage and seed. Agron. J. 61: 759-761. Seven PT, Cerci IH (2006). The effects on nutrient digestibility of hay and silages made in different conditions in lambs, Vet. Arch. 76(2): 111-117. Siefers MK, Bolsen KK (1997). Agronomic and silage quality traits of winter cereals. In: Proceedings of the XVIII International Grassland

7642

Afr. J. Biotechnol.

Congress. Winnipeg, pp. 91-92. Thompson DJ, Stout DG, Moore T (1992). Forage production by four annual cropping sequences emphasizing barley irrigation in southern interior British Columbia. Can. J. Plant Sci. 72: 181-185. Tukel T, Hasar E, Hatipoglu R (1997). Effect of mixture rates and cutting dates on the forage yield and quality of vetch-triticale mixtures and their seed yields under lowland conditions of Cukurova. In: Proceedings of the XVIII International Grassland Congress. Winnipeg, pp. 25-26.

Tuna C, Orak A (2007). The role of intercropping on yield potential of common vetch (Vicia sativa L.)/oat (Avena sativa L.) cultivated in pure stand and mixtures. J. Agric. Biol. Sci. 2(2): 14-19. Van Ranst G, Fievez V, De Riek J, Van Bockstaele E (2009). Influence of ensiling forages at different dry matters and silage additives on lipid metabolism and fatty acid composition. Anim. Feed Sci. Technol. 150: 62-74.

African Journal of Biotechnology Vol. 11(30), pp. 7643-7649, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3879 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Physiology of seed yield in soybean: Growth and dry matter production M. A. Malek*1, 2, M. M. A. Mondal1, M. R. Ismail2, M. Y. Rafii2 and Z. Berahim2 1Bangladesh Institute of Nuclear Agriculture, Bangladesh Agricultural University Campus, Mymensingh- 2202, Bangladesh. 2Institute of Tropical Agriculture, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor, Malaysia. Accepted 27 February, 2012

A field study was conducted to assess the growth parameters controlling the dry matter and seed yield of soybean. The result shows that growth rate was slow during vegetative phase in all genotypes. A relatively smaller portion of total dry mass (TDM) was produced before flower initiation and the bulk of it after anthesis. Maximum absolute growth rate (AGR) was observed during pod filling stage in all genotypes due to maximum leaf area (LA) development and leaf area index (LAI) at this stage. Plant characters like LAI and AGR contributed to higher TDM production. Results indicate that a high yielding soybean genotype should possess larger LAI, higher TDM production ability and higher AGR at all growth stages. Key words: Soybean seed yield, total dry mass (TDM), leaf area index (LAI), absolute growth rate (AGR), relative growth rate (RGR). INTRODUCTION Soybean (Glycine max (L.) Merr.), one of nature’s most versatile crops, is increasingly becoming an important food and cash crop in the tropics due to its high protein content (40%), high oil content (20%) and adaptability to various growing environments (Smith et al., 1995; Tukamuhabwa et al., 2001; FAO, 2004; McKevith, 2005). The crop has a variety of uses including for human food, livestock feed, vegetable oil, and many industrial products and is a major crop in several developing and developed countries (McKevith, 2005). It ranks 4th in acreage and production among the oilseed crops grown in Bangladesh (MOA, 2010). Oilseed crops cover an area of about 569,000 ha, where soybean occupies only 55,000 ha in Bangladesh (MOA, 2010). Oilseed crops cover an area of about 569,000 hectares, where soybean occupies only 55,000 hectares in Bangladesh (MOA,

*Corresponding author. E-mail: mamalekbina@yahoo.com. Tel: +603-8946 8967. Fax: +603-8946 8968. Abbreviations: TDM, Total dry mass; AGR, absolute growth rate; LA, leaf area; LAI, leaf area index.

2010). Despite suitable climatic and edaphic conditions, the yield of soybean is very low in Bangladesh. The average yield of soybean in the world is about 3.0 t ha-1, while that in Bangladesh is only 1.64 t ha-1 (SAIC, 2007). There are many factors responsible for its lower acreage and yield but the most important one is the nonavailability of high yielding varieties. In spite of the best efforts to improve the soybean varieties, the yield of this crop remains low. Several studies have been made to understand their performances which mainly include the contribution of various yield components towards yield (Das et al., 1992; Mehta et al., 2000; Chettri, 2003; Jian et al., 2007). The yield components depend on some physiological traits. To understand the physiological basis of yield difference among the genotypes of soybean, it is essential to quantify the components of growth, and the relevant variables, which is useful in crop improvement. Variation in dry matter accumulation and pod production in different genotypes may be related to some factors such as leaf area (LA), crop growth rate (CGR), net assimilation rate (NAR) and relative growth rate (RGR). Pandey et al. (1978) analyzed growth parameters of five varieties of

7644

Afr. J. Biotechnol.

Table 1. Average monthly rainfall, air temperature and relative humidity during the experimental period from January to April 2009 at the experimental area, Mymensingh, Bangladesh.

Month January February March April

Monthly average air temperature (°C) Maximum Minimum Average 23.43 12.93 18.18 27.34 16.41 21.87 29.61 20.57 25.09 30.56 22.14 26.35

blackgram in order to study the physiological causes of yield differences and observed the differences in CGR, NAR, RGR and LA among the varieties. Egli and Zhenwen, (1991) suggested that seeds per unit area were related to canopy photosynthesis during flowering and pod set and canopy photosynthesis rate is determined through LAI and CGR. A plant with optimum LAI and NAR may have higher biological yield as well as seed yield (Mondal et al., 2007). The dry matter accumulation may be the highest if LAI reaches its maximum value within the shortest possible time (Khan and Khalil, 2010). Not only TDM production, but also the capacity of efficient partitioning between the vegetative and reproductive parts may produce high economic yield (Shiraiwa et al., 2004; Oh et al., 2007). A better understanding of crop growth and yield parameters and the partitioning of assimilates into seed would help to expedite yield improvement of field crops. Very little work has been done in this regard in soybean in tropic areas. A detailed analysis of growth and yield parameters of five soybean genotypes was therefore undertaken. MATERIALS AND METHODS Experiment was carried out at the experimental field of Bangladesh Agricultural University (BAU), Mymensingh (24°8´ N 90°0´ E), Bangladesh in Rabi (January - April) season of 2009. Weather data (monthly average temperature, rainfall and relative humidity) during the experimental period was recorded (Table 1). With five soybean genotypes, three advanced lines (BAU-21, BAU-70 and BAU-80) and two widely cultivated varieties of Bangladesh (Shohag and BARIsoybean-5), were used as planting materials. The soil of the experimental field was silty loam having a total of 0.07% nitrogen, 1.13% organic matter, 18.60 mg kg-1 available phosphorus, 105.57 mg kg-1 exchangeable potassium, 18 ppm sulphur and 6.8 pH. Seeds were sown on 3 January 2009. A randomized complete block design with three replicates was followed. The plot size was 4 m × 3 m. Row to row and plant to plant distances were 30 and 10 cm, respectively. Seeds were sown in line and thinned to a density of 30 to 35 plants m-2 two weeks after germination. Urea, triple superphosphate, muriate of potash and gypsum were used as a source of nitrogen, phosphorus, potassium and sulphur at the rate of 40, 120, 80 and 30 kg ha-1, respectively at the time of final land preparation. No biofertilizer was applied in the experiment because farmers do not use biofertilizer for soybean cultivation in Bangladesh. First weeding was done followed by thinning at about 21 days after sowing (DAS). A single irrigation was applied at 25 DAS. Insecticide (Ripcord 50 EC @ 0.025%) was sprayed at flowering and fruiting stages to control shoot and pod borer.

Average rainfall (mm) 00.0 26.6 63.6 96.6

Average relative humidity (%) 78.0 73.9 80.6 79.9

To study ontogenetic growth characteristics, a total of six harvests were made. Data were collected on some morpho-physiological parameters such as plant height, branch and nodule number plant-1, LA and TDM plant-1, LAI, AGR, RGR, harvest index (HI), chlorophyll content and photosynthesis (Pn) in leaves, yield attributes such as number of pods plant-1, seeds pod-1, 100-seed weight and seed yield. The first crop sampling was started at 35 DAS and continued at an interval of 15 days up to 110 DAS, that is till physiological maturity. From each sampling, five plants were selected randomly and uprooted from each plot for collecting necessary parameters. Selected plants were separated into leaves, stems, pods and roots, and the corresponding dry weight were recorded after oven drying at 80 ± 2°C for 72 h. Leaf area of each sample was measured by LiCOR automatic leaf area meter (Model: Li-COR 3000, USA). Leaf area index was measured by canopy analyzer (Model: LI 1400, USA). Calculations of AGR and RGR were carried using the formulae of Hunt (1978). Photosynthetic rate was measured at the flowering and pod development stages by automatic photosynthesis meter (Li-COR 200, USA). Chlorophyll was extracted in 80% acetone from the leaves of upper two nodes of a plant and the chlorophyll was determined following the method of Yoshida et al. (1976). Yield components were recorded at harvest from ten randomly selected plants of each plot. Seed yield was recorded from six inner rows of each plot to avoid border effects and converted into t ha-1. All data were analyzed statistically following the analysis of variance (ANOVA) technique and the mean differences were adjusted with Duncan’s multiple range test (DMRT) using the statistical computer package programme, MSTAT-C (Russell, 1986).

RESULTS AND DISCUSSION Effect of genotypes on plant height, branch and nodule -1 -1 number plant and leaf area plant was significant at all growth stages (Figure 1). Results reveal that plant height increased with age till 95 DAS followed by plateau. Branch number increased with age till 80 DAS in four out of five genotypes. Branch number of BAU-70 increased till 90 DAS. Nodule number and leaf area (LA) plant-1 increased with age till 65 and 80 DAS, respectively followed by a decline in all genotypes due to nodule degeneration and leaf shading. Genotype BAU-70 had higher plant height, branch and nodule number and LA plant-1 and also had higher seed yield. These results indicate that plant height, LA, branch and nodule number are the most important morphological parameters for increasing seed yield in soybean. Shorter plant, lower number of nodules and lower LA was recorded in BAU-80 and BARIsoybean-5. These results are consistent with

Malek et al.

A

B

C

D

7645

Figure 1. (A) Plant height, (B) branch production, (C) nodule production and (D) leaf area development at different days after sowing of soybean genotypes. Vertical bars represent LSD (0.05).

the study of Chettri (2003) who observed that seed yield -1 depends on LA, branch and nodule number plant in soybean. Differences among the genotypes for total dry mass (TDM), leaf area index (LAI), absolute growth rate (AGR)

and relative growth rate (RGR) were significant at all growth stages (Figure 2). Differential genotypic performance for LAI and their relation to the DM production, at each growth stage could be associated with the genetic make-up of the genotypes. A common feature of

7646

Afr. J. Biotechnol.

A

C

B

D

Figure 2. Pattern of (A) leaf area index, (B) total dry mass production, (C) absolute growth rate and (D) relative growth rate in five soybean genotypes during their growth period. Vertical bars represent LSD (0.05). AGR and RGR for 95110 DAS were negative.

soybean genotypes was slow TDM accumulation and LAI during the first 35 DAS followed by a rapid increase after commencement of flowering. Flowering was started at 45 to 50 DAS, depending on genotypes. Faster TDM accumulation after the beginning of reproductive stage was the result of increased LAI (Khan and Khalil, 2010). Total dry matter production in all genotypes increased with age till the beginning of maturity (95 DAS) followed by a decline due to heavy leaf shading. Leaf area index

followed a typical sigmoid pattern with respect to time and increased with age till 80 DAS in all genotypes followed by a decline because of abscission of old leaves. Results indicate that high yielding genotypes always showed superiority in TDM production and LAI as compared to low yielding ones at most of the growth stages. These results also indicate that LAI and TDM are the most important parameters for increasing seed yield in soybean. These results are consistent with that of

Malek et al.

7647

Table 2. Some physiological parameters yield components and yield in five soybean genotypes.

Genotype/ cultivar BAU-21 BAU-70 BAU-80 Shohag BARIsoybean-5 F-test CV (%)

Chlorophyll (mg g-1 fw)

Photosynthesis (Âľmol CO2 s-1 dm -2)

2.16 2.17 2.21 2.12 2.09 NS 3.06

20.66b 24.24a 19.22b 21.45b 19.89b * 6.90

Pods plant-1 (no.) 24.10b 31.23a 21.40bc 17.90d 20.8c ** 6.57

Seeds pod-1 (no.)

100-seed weight (g)

Seed weight plant-1 (g)

Seed yield -1 (t ha )

Harvest index (%)

2.12 2.19 2.17 2.19 2.13 NS 2.59

15.11ab 14.55b 16.08a 15.51ab 15.88a * 3.44

7.71b 9.95a 7.47bc 6.08d 7.03c ** 4.43

2.57b 3.31a 2.49b 2.02d 2.34c ** 5.55

33.22ab 37.73a 33.24ab 28.28b 34.16a * 8.11

Same letter (s) in a column does not differ significantly at P ≤ 0.05 by DMRT; NS = Not significant; ** and * indicate significance at 1 and 5% level of probability, respectively.

Tandale and Ubale (2007) who observed that seed yield depends on LA and TDM production in soybean. Absolute growth rate (AGR) tended to increase with the advancement of stage till 65 to 80 DAS in three genotypes of BAU-70, BAU-80 and BARIsoybean-5, whereas AGR increased with age till maturity in BAU-21 (Figure 2). It is evident that soybean had three distinct growth phases: early slow growth (up to 35 DAS, before flowering start), followed by a rapid growth (50 to 80 DAS, flowering and pod filling stage respectively) and then decline growth phase at pod maturity stage. Slow growth rate at early growth stage was associated with lower LA and TDM production. Initial slow growth favors weed growth and development; thus, crop ultimately suffers a loss. So, selection of genotypes with rapid growth rate in early part of a crop life is therefore warranted. In the present experiment, the high yielding genotype, BAU-70 had greater AGR than low yielding ones which is the desirable character. At the later stages of development (80-95 DAS), there was a decline in AGR, possibly owing to similar decline in LA during this stage (Figure 1). Relative growth rate (RGR) declined with

increasing age in all genotypes (Figure 2) and it decreased rapidly from 50 to 65 DAS till physiological maturity. At 35 to 50 DAS, RGR was higher in Shohag which was the low yielding genotype followed by BAU-70 and the lowest RGR was recorded in BAU-80 which was the third highest yielding genotype. Result indicates that there is no relation between RGR and seed yield. Kollar et al. (1970) observed a decrease in RGR as the season advanced. Sharp decline in RGR during reproductive stage was probably due to increased demand of assimilate by the growing seed fraction (Hamid et al., 1991). However, the RGR was maximum between 35 and 50 DAS. RGR declined at later growth stages (reproductive stage) which may be attributed to excessive mutual shading as the LA was maximum during this period and increased number of old leaves could have lowered the photosynthetic efficiency (Salam et al., 1987). In grain legume, excess LA was reported to have lower RGR and resulted in a decrease of dry matter accumulation, which probably resulted from excessive mutual shading (Pandey et al., 1978). There were no significant differences in chlorophyll content in leaves but there were significant

differences in photosynthesis in leaves among the genotypes (Table 2). BAU-70 had greater photosynthesis in leaves than the other genotypes. Pod number plant-1 and 100-seed weight, seed yield (both plant-1 and hectare-1) and harvest index showed significant difference among the genotypes except number of seeds pod-1 (Table 2). Among the genotypes, BAU-70 produced the highest seed yield plant-1 (9.95 g) and ha-1 (3.31 t) due to production of higher number of pods plant-1 (31.23) and greater dry matter partitioning of seeds (harvest index, 37.73%) though it produced slightly smaller seed size than the others. Mehta et al. (2000) observed that seed yield of soybean had no positive relationship with pod and seed size. In the present experiment, similar result was also observed. Results further revealed that those genotypes had higher nodule number, LA, LAI, TDM and AGR also had higher seed yield. Further, TDM production and CGR depends on source strength by photosynthetic capacity (Egli and Crafts-Brandner, 1996). In the present experiment, the high yielding genotype, BAU-70 showed high TDM production for higher Pn rate and vice versa for BAU-80 and BARIsoybean-5. These results are consistent with that of Egli and

7648

Afr. J. Biotechnol.

Zhen-wen (1991) and Tandale and Ubale (2007) who reported that high yielding genotypes of soybean had greater capacity of TDM for higher LAI and CGR. From the results of the present study, it can be concluded that in addition to superior characters of yield components, a high yielding soybean genotype possess a relatively larger leaf area with superior growth parameters, harvest index and leaf photosynthesis. REFERENCES Chettri SS (2003). Study of variation for yield and yield contributing characters in soybean. Soybean Sci. 23: 6-9. Das ML, Rahman A, Azam MA, Khan MHR, Miah AJ (1992). Comparative performance of some soybean cultivars and the influence of seasons on seed yield. SABRAO J. 24: 137-142. Egli DB, Craft-Brandner SJ (1996). Soybean. pp. 595-623. In: Zamski E and Schaffer AA (ed.). Photoassimilate distribution in plants and Crops. Source-sink relationship. Marcel Dekker Inc. New York, USA. Egli DB, Zhen-wen Y (1991). Crop growth rate and seeds per unit area in soybean. Crop Sci. 31: 439-442. FAO (2004). FAOSTAT: FAO statistical databases. FAO, UN, Rome. Available via DIALOG. http://faostat.fao.org/ Hamid A, Agata W, Maniruzzaman AFM, Ahad AM (1991). Physiological aspects of yield improvement in mungbean. In: Advances in pulses research in Bangladesh. Proceedings of the second national workshop on pulses. June 6-8, 1989, BARI, Gazipur1701, Bangladesh, pp. 95-102. Hunt R (1978). Plant growth analysis Studies in biology. Edward Arnold Ltd. London, pp. 65-67. Jian J, GuangHua W, XiaoBing L, YanXia X, Liang M, Herbert SJ (2007). Yield and quality changes from 50 years of genetic improvement of soybean cultivars in Heilongjiang Province. Res. Agric. Modern. 28(6): 757-761. Khan A, Khalil A (2010). Effect of leaf area on dry matter production in aerated mungbean seed. Int. J. Plant Physiol. Biochem. 2: 52-61. Koller HR, Nyquist WE, Chorash IS (1970). Growth analysis of soybean community. Crop Sci. 10: 407-412. McKevith B (2005). Nutritional aspects of oilseeds. Nutr. Bull. 30: p. 1326. Mehta N, Bohar ABL, Raneat GS, Mishra Y (2000). Variability and character association in soybean. Bangladesh J. Agric. Res. 25: 1-7. MOA (2010). Hand Book of Agricultural Statistics, December 2010. Market Monitoring and Information System, Ministry of Agriculture (MOA), Govt. People’s Repub. Bangladesh. p. 193.

Mondal MMA, Howlader MHK, Akter MB, Dutta RK (2007). Evaluation of five advanced lentil mutants in relation to morpho-physiological characters and yield. Bangladesh J. Crop Sci. 18: 367-372. Oh EI, Uwagoh R, Jyo S, Saitoh K, Kuroda T (2007). Effect of risisng temperature on flowering, pod set, dry matter production and seed yield in soybean. Japanese J. Crop Sci. 76(3): 433-444. Pandey RK, Saxena MC, Singh VB (1978). Growth analysis of blackgram genotypes. Indian J. Agric. Sci. 48: 466-473. Russell DF (1986). MSTAT-C Pakage Programme. Crop and Soil Science Department, Michigan University, USA. Salam MA, Moniruzzaman AFM, Chowdhury SI (1987). Growth analysis in mungbean. Bangladesh J. Nuclear Agric. 3: 58-64. SAIC (2007). SAARC Agricultural Statistics of 2006-07. SAARC Agric. Inform. Centre (SAIC), Farmgate, Dhaka-1215, Bangladesh. p. 23. Shiraiwa T, Ueno N, Shimada S, Horie T (2004). Correlation between yielding ability and dry matter productivity during initial seed filling stage in various soybean genotypes. Plant Prod. Sci. 7: 138-142. Smith J, Woodworth JB, Dashiell KE (1995). Government policy and farm-level technologies: the expansion of soybean in Nigeria. IITA Res. 11: 14-18. Tandale MD, Ubale SS (2007). Effect of growth parameters, leaf area index, leaf area duration, crop growth rate on seed yield of soybean during Kharif season. Int. J. Agric. Sci. 3(1): 119-123. Tukamuhabwa P, Dashiell KE, Assafo-Adjei B (2001). Determination of yield loss caused by soybean rust (Phakopsora pachyrhizi Syd.) in four genotypes of soybeans. Afr. Crop Sci. Conf. Proc. 5: 423-426. Yoshida S, Forno DA, Cock JA, Gomes KA (1976). Laboratory manual for physiological studies of rice. 3rd ed., IRRI, Los Banos, Philippines.

African Journal of Biotechnology Vol. 11(30), pp. 7649-7658, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3223 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Effect of heavy metal and EDTA application on heavy metal uptake and gene expression in different Brassica species Madiha Iqbal1, Jehan Bakht1*, Mohammad Shafi2 and Rafi Ullah1 1

Institute of Biotechnology and Genetic Engineering, KPK Agricultural University, Peshawar, Pakistan. 2 Department of Agronomy, KPK Agricultural University, Peshawar, Pakistan. Accepted 20 February, 2012

The present study investigates the effect of different concentration of heavy metals (Cd, Cr and Pb) and ethylenediaminetetraacetic acid (EDTA) application on two Brassica species (Brassica carinata and Brassica juncea). EDTA application had significant (p<0.05) effect on shoot length, shoot fresh weight, shoot dry weight, root length, root fresh weight, root dry weight and accumulation of heavy metals in both species. Species also produced significant (p<0.05) effect on all parameters except shoot length of the plant. The effect of heavy metals on shoot length, shoot fresh weight, root fresh weight and accumulation of heavy metals was also reported to be significant (p<0.05). Interaction between heavy metals × species showed a significant (p<0.05) effect on shoot fresh weight, shoot dry weight, root length and accumulation of heavy metal in both Brassica species. The data reveal that maximum shoot length, shoot fresh weight, shoot dry weight, root fresh weight and root dry weight was achieved by -1 control plants. In addition, maximum heavy metals (142.88 mg kg ) were observed for B. juncea that -1 were grown under 150 mg kg Pb and 0 mM EDTA stress. Exposure of Brassica species to heavy metals and EDTA resulted in the expression of newly synthesized and abundantly expressed polypeptides, which may play a role in phytoremediation. Key words: Brassica, phytoextraction, heavy metals, EDTA, gene expression.

INTRODUCTION Industrialization and modern lifestyle have led to increased pollution of air, water and soil (Siegel, 2002). A major cause of contamination of soil is the dispersal of industrial and urban wastes generated by anthropogenic activities. Agricultural soils are being contaminated pollutants from the contaminated sites as dust or leachate. Both controlled and uncontrolled disposal of waste, accidental and process spillage, mining and smelting of metalliferous ores, sewage sludge application to agricultural soils etc. are the main causes of contamination of our ecosystem (Alloway, 1990). A variety of organic and inorganic pollutants exist (Prasad and

*Corresponding author. E-mail: jehanbakht@yahoo.co.uk.

Freitas, 1999; Alcantara et al., 2000; Glass, 1999, 2000a, b; Raskin and Ensley, 2000; Watanabe, 1997), amongst which heavy metals, combustible and putrescible substances, hazardous wastes, explosives and petroleum products are of major concern. (Alloway, 1990). Enhanced uptake of heavy metals by crops means excessive metals in human nutrition that can be toxic and cause acute and chronic diseases (Geldmacher, 1984). (Prasad and Freitas, 2003). Cadmium, lead and chromium are the major toxic pollutants even at very low concentrations. They enter the water streams and other components of ecosystem through various indu-strial operations. The potential sources of chromium wastes are effluents from metallurgy, electroplating, leather tanning, textile dyeing, paint, ink, and aluminium

7650

Afr. J. Biotechnol.

manufacturing industries (Bhattacharyya and Gupta, 2006; Verma et al., 2006). Lead is used as industrial raw material in the manufacturing of storage batteries, pigments, leaded glass, fuels, photographic materials, solder and steel products (Nadeem et al., 2006). The presence of Pb, even in very low concentrations, causes anemia, hepatitis and nephritic syndrome (Zulkali et al., 2006). Moderate Pb poisoning leads to severe damage to kidney, nervous system, reproductive system, liver and brain (Ozer, 2007; Chen et al., 2007). Different chemical, physical and biological techniques can be employed to remedy soil polluted by metal. In phytoremediation naturally occurring or genetically engineered plants are used for cleaning contaminated environments (Flathman and Lanza, 1998). Phytoremediative technologies is low-cost, efficient and environmental-friendly (Ensley, 2000). (Ebbs et al., 1997). Plants may behave like metal excluders, metal indicators or metal hyperaccumulators (Raskin et al., 1994). Phyto-remediation may consider different strategies like rhizofiltration, phytostabilization, phytovolatilization, phytodegradation and phytoextraction individually or in combination; (Raskin and Ensley, 2000; Berti and Cunningham, 2000; Henry, 2000; Bañuelos, 2000; Dushenkov, 2003). Phyto-extraction is the best approach for removing pollutants primarily from soil without damaging soil structure and fertility. It is also referred as phytoaccumulation. (Rulkens et al., 1998). Two basic strategies for phytoextraction of heavy metals include natural or continuous phytoextraction and chelate assisted phytoextraction. Chelating agent increases the uptake of heavy metals and various other ions by plants from soil or water. Synthetic chelates are used to increase the supply of micronutrients to plants in both soil and water. These chelating agents can also be used for phytoaccumulation by increasing heavy metals bioavailability and translocation of heavy metals from roots to upper parts of the plants (Epstein et al., 1999). Among these, ethylenediaminetetraacetic acid (EDTA) is found to be the most effective agent in enhancing the accumulation of heavy metals in plants (Blaylock et al., 1997; Madrid et al., 2004; Turgut et al., 2004; Nowack et al., 2006; Liphadzi and Kirkham, 2006; Wahla and Kirkham, 2008). Natural phytoaccumulation uses the natural ability of the plant to remediate metal polluted sites. In this method, only the number of plant growth repetitions is controlled (Salt et al., 1997). While in chelate induced phytoextraction, artificial chelates are added to increase the uptake of metal contaminants (Salt et al., 1997; Rafi et al., 2011)). In order to make this technology feasible, the plants must, extract large concentrations of heavy metals into their roots and translocate the heavy metals to surface biomass, (Brooks,1983; Brooks et al., 1998; Chen et al., 2004). The roots of Brassica juncea are effective in the removal of Cd, Cr, Cu, Ni, Pb, and Zn (Prasad and

Freitas, 2003). Brassica carinata is known for its phytoextraction potential (Quartacci et al., 2007; Purakayastha et al., 2008 and Panwar et al., 2005). B. carinata is also known for its oil containing seeds but suffers from limitations like low oil quality characterized by high level of erucic acid (Velasco et al., 1998) and unacceptable level of meal glucosinolates (Getinet et al., 1997). This could make it an attractive plant species for phytoremediation. The present study was initiated to investigate the effect of different concentration of heavy metals (Cd, Cr and Pb) and EDTA application on the growth and heavy metal accumulation on two Brassica species. MATERIALS AND METHODS The present study was conducted at the Institute of Biotechnology and Genetic Engineering, KPK Agricultural University Peshawar Pakistan. The aim of the study was to investigate the response of two species of Brassica (B. carinata and B. juncea) towards heavy metals and EDTA application and the phytoaccumulation capacity of both Brassica species for different heavy metals (Cd, Cr and Pb) at different metal concentrations. For this purpose a pot experiment was conducted under greenhouse conditions using completely randomized design (CRD) with three replications. Seeds of two Brassica species (B. carinata and B. juncea) were grown for 30 days on artificially contaminated soil with different concentration of heavy metals (Table 1). 30 days after sowing, 5 mM EDTA was added and the plants were allowed to grow for additional ten days. Forty days after sowing, samples were collected for different growth parameters, that is, shoot length, shoot fresh weight, shoot dry weight, root fresh weight and root dry weight. Samples were also collected for the analysis of heavy metal concentrations of Cd, Cr and Pb and protein analysis by SDS-PAGE. Before sowing, a composite soil sample was collected for heavy metal concentration. Standard agronomic practices were observed throughout the experiment.

Procedures for heavy metal analyses Samples were dried at 80°C for 48 h and then finely grinded by electric grinder. One gram (1 g) of dried and crushed sample was prepared for atomic absorption spectrophotometer analysis. For this purpose samples were acid digested with 15 ml of concentrated HNO3 overnight. Digested samples were then heated to 250°C until white fumes appeared. They were then heated for another one hour. The samples were then cooled down to room temperature and diluted to 25 ml with distilled water and then filtered. The concentrations of CD, Cr and Pb were determined by atomic absorption spectrophotometer at wavelengths of 228, 357 and 283 nm, respectively. Analysis of the soil before sowing revealed that the concentrations of Cd, Cr and Pb were 1.94, 28.75, 59.25 mg kg-1.

Protein analysis For sodium dodecyl sulfate–polyacrylamide gel electrophresis (SDS-PAGE), young leaves of the plants were collected from each treatment. Leaves were washed with distilled water and were stored at -80°C until used. One hundred millgram (100 mg) of leaf tissues was first homogenized with 1 ml protein extraction buffer (50 mM

Iqbal et al.

7651

Table 1. Different levels and sources of heavy metals used in the experiment. -1

-1

S/N 1

Heavy metal Cadmium (Cd)

Source Cadmium nitrate

Molecular formula Cd (NO3)2. 4H2O

Molar mass (g mol ) 308.47

Concentration (mg kg ) 10, 20, 40

2 3

Chromium (Cr) Lead (Pb)

Chromium nitrate Lead nitrate

Cr (NO3)3. 9H2O Pb (NO3)2

400.15 331.21

50, 100, 150 100, 150, 200

Table 2. Shoot length (cm) of Brassica species as affected by heavy metals and EDTA application.

Heavy metal -1 (mg kg ) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 mM) B. carinata B. juncea 20.92 17.44 19.53 17.47 20.42 19.87 22.08 29.33 17.92 27.00 22.75 27.65 25.50 22.33 24.92 19.32 23.33 21.02 31.50 32.50 23.14 a (25.76 a)

EDTA (5 mM) B. carinata B. juncea 28.58 22.57 25.92 24.50 23.33 22.33 31.17 26.08 28.50 28.20 22.42 23.63 33.27 28.92 29.42 29.52 31.33 24.70 32.33 26.50 27.16 b (24.54 b)

Mean 22.38def 21.85ef 21.49f 27.17bc 25.40bcd 24.11cdef 27.50ab 25.79bc 25.10bcde 30.71a

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

Tris-HCl; pH 8.00; 25 mM DTT; 1, 4-dithio-DL-Threitol; 1% SDS and 1% β-mercaptoethanol) in a chilled mortar and pestle. After grinding, samples were mixed well by vortex. Samples were then centrifuged at 10,000 rpm for 10 min. Supernatant containing proteins were stored at -20°C for analysis. Samples for protein quantification were prepared by mixing 10 µL protein samples with 2 ml CBB solution (CBB powder G250-10%; 95% ethanol; 85% phosphoric acid). Samples were then analyzed for concentration of protein by UV absorption spectrophotometer. Spectrophotometric data was collected for the samples as well as standard protein solution of BSA (Bovine Serum Albumin). Fifty microgram (50 µg) samples were then run on 12% polyacrylamide gel containing 4% stacking gel. After electrophoration, protein gels were stained in staining solution (0.25 g CBB powder R250, 125 ml methanol, 25 ml glacial acetic acid and 100 ml distilled water) for 40 min followed by overnight destaining, in destaining solution (30% methanol; 10% acetic acid and 60% distilled water). The banding profile of the gels was recorded by gel documentation system.

Statistical analyses All data are presented as mean values of three replicates. Data was analyzed statistically for analysis of variance (ANOVA) following the method described by Gomez and Gomaz (1984). MSTATC computer software was used to carry out statistical analysis (Russel and Eisensmith, 1983). The significance of differences among means was compared by using Least Significant Difference (LSD) test (Steel and Torrie, 1997).

RESULTS AND DISCUSSION Statistical analysis of the data revealed that heavy metal, EDTA and interaction of heavy metal × EDTA and EDTA × species had a significant (p<0.05) effect on shoot length of Brassica species (Table 2). Interaction between heavy metal × EDTA × species did not significantly (p>0.05) affect shoot length. The data obtained indicate that maximum shoot length (30.71 cm) was attained by control plants followed by treatment of 100 mg kg-1 of Pb (27.50 cm). While minimum shoot length (21.49 cm) was noted in plants treated with 40 mg kg-1 Cd. In case of EDTA application, maximum shoot length (27.16 cm) was recorded in those treatments which were applied with 5 mM EDTA. Between species, maximum shoot length (25.76 cm) was observed in B. carinata when compared with B. juncea (24.54 cm). These results are in agreement with Qadir et al. (2004) who studied B. juncea cultivar for their phytoextraction efficiency and found a reduction in shoot length of B. juncea cultivar subjected to Cd (0.0–2.0 mM). Heavy metal, EDTA, species and interactions of heavy metal × EDTA, heavy metal × species, EDTA × species and heavy metal × EDTA × species had a significant (p<0.05) effect on shoot fresh weight of Brassica species (Table 3). The data indicated

7652

Afr. J. Biotechnol.

Table 3. Shoot fresh weight (g) of Brassica species as affected by heavy metals and EDTA application.

Heavy metal -1 (mg kg ) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 m M) B. carinata B. juncea 9.74 26.55 8.73 25.80 12.77 27.90 10.53 42.29 18.37 33.65 16.53 32.23 20.71 34.57 16.43 22.96 16.78 21.32 33.83 70.63 25.12 a (18.97 a)

EDTA (5 m M) B. carinata B. juncea 27.22 25.27 17.39 35.24 20.43 23.67 24.15 52.14 15.76 50.96 12.21 52.79 24.62 57.25 24.47 50.62 26.45 44.62 22.37 60.18 33.39 b (39.53 b)

Mean 22.20de 21.79e 21.19e 32.28bc 29.68bc 28.44bcd 34.29b 28.62bc 27.29cde 46.75a

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

that maximum shoot fresh weight (46.75 g) was noted in control plants followed by plants treated with 100 mg kg-1 of Pb (34.29 g). Minimum shoot fresh weight (21.19 g) was recorded for 40 mg kg-1 of Cd treatment. Plants produced maximum shoot fresh weight (33.39 g) when treated with 5 mM EDTA. Similarly, maximum shoot fresh weight (39.53 g) was observed in B. juncea compared with B. carinata (18.97 g). When interaction between heavy metal × EDTA × species was considered, maximum shoot fresh weight (70.63 g) was observed in 0 mg kg-1 heavy metal treated plants (Table 3). Similar results were also reported by Lombi et al. (2001). They revealed that B. juncea suffered from severe phytotoxicity when exposed to heavy metals, that is, Cd and Pb while addition of EDTA increased the phytotoxicity. Qadir et al. (2004) observed reduction in biomass accumulation of B. juncea exposed to Cd stress. While these findings are contradictory to Quartacci et al. (2007) who reported that B. carinata accumulates high concentrations of heavy metals in shoots without showing biomass reduction in 9 different plant species. Analysis of the data indicated that EDTA, species and interaction between heavy metal and species had a significant (p<0.05) effect on shoot dry weight. While heavy metal and interactions of heavy metal × EDTA, EDTA × species and heavy metal × EDTA × species did not significantly (p>0.05) affect shoot dry weight of Brassica plant (Table 4). Maximum shoot dry weight (3.19 g) was observed for control plants followed by -1 plants grown in 50 mg kg of Cr. Minimum shoot dry weight data (2.39 g) was recorded for plants under 200 -1 mg kg Pb stress. When EDTA was applied, maximum shoot dry weight (2.82 g) was noted in plants exposed to 5 mM EDTA. Maximum shoot dry weight was attained by B. carinata (10.89 g) in comparison with B. juncea plants (9.98 g). These results are in conformity with Ebbs and

Kochian (1997) who observed that the shoot dry weight of 3 Brassica species decreased significantly in the presence of heavy metals. Similar results are also reported by Quartacci et al. (2006) who revealed that B. juncea shoots dry weights was reduced significantly followed by NTA application EDTA, species and interaction between heavy metal × species significantly (p<0.05) affected root length while heavy metal and interactions of heavy metal × EDTA, EDTA × species, heavy metal × EDTA × species showed a non-significant (p> 0.05) effect on root length (Table 5). Maximum mean root length (10.84 cm) was observed for the treatments of 5 mM EDTA. Between species, maximum root length was achieved by B. carinata plants (10.89 cm) compared with B. juncea (9.98 cm). Purakayastha et al. (2008) also observed that root length, among root parameters, appeared as the most powerful parameter to dictate the uptake of metals by Brassica species during his research on different Brassica species. Statistical analysis of the data obtained also indicated that heavy metal, EDTA, species and interaction between EDTA × species significantly (p<0.05) affected root fresh weight of Brassica plants while the effect of interactions of heavy metal × EDTA, heavy metal × species and heavy metal × EDTA × species on root fresh weight was not significant (p>0.05) (Table 6). Maximum root fresh weight (1.89 g) was produced by control plants whereas minimum root fresh weight (0.82 g) was observed for plants grown under 10 or 20 mg kg-1 concentration of Cd. In the case of EDTA addition, maximum mean root fresh weight value (1.28 g) was achieved by plants which were amended with 5 mM EDTA. Similarly, between species, maximum root fresh weight of 1.55 g was noted in B. juncea grown in 5 mM EDTA compared with B. carinata (0.57 g). These results are confirmed by Wong and Bradshaw (2006) who noted significant toxic effect of

Iqbal et al.

7653

Table 4. Shoot dry weight (g) of Brassica species as affected by heavy metals and EDTA application.

Heavy metal (mg kg-1) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 m M) B. carinata B. juncea 1.25 3.71 0.82 4.26 1.06 3.35 1.34 3.97 1.76 3.40 1.82 4.00 1.77 1.44 2.32 2.79 1.92 1.98 2.32 4.40 2.48 a (1.92 a)

EDTA (5 m M) B. carinata B. juncea 1.90 3.23 1.62 3.47 2.65 3.10 2.37 3.88 1.34 3.65 1.79 3.42 2.71 3.81 2.59 3.16 2.84 2.81 2.15 3.91 2.82 b (3.39 b)

Mean 2.52 2.54 2.54 2.89 2.54 2.76 2.43 2.71 2.39 3.19

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

Table 5. Root length (cm) of Brassica species as affected by heavy metals and EDTA application.

Heavy metals (mg kg-1) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 m M) B. carinata B. juncea 9.92 8.70 10.67 8.43 11.50 8.05 9.00 10.75 10.08 8.30 9.83 11.33 10.50 8.43 11.50 11.42 12.00 8.40 10.67 11.00 10.02 a (10.89 a)

EDTA (5 m M) B. carinata B. juncea 13.75 10.50 11.33 8.50 13.92 9.80 10.17 9.75 11.25 10.98 10.67 10.42 10.67 11.30 10.33 11.83 11.17 10.67 8.83 11.00 10.84 b (9.98 b)

Mean 10.72 9.73 10.82 9.92 10.15 10.56 10.23 11.27 10.56 10.38

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

heavy metals on the growth of rye grass roots. Analysis of the data also suggested that root dry weight was significantly (p<0.05) affected by EDTA and species while heavy metals and interactions of heavy metal × EDTA, heavy metal × species, EDTA × species and heavy metal × species × EDTA had a non-significant (p>0.05) effect on root dry weight (Table 7). Maximum root dry weight (0.25 g) was achieved at 5 mM EDTA concentration. Between species, maximum root dry weight (0.26 g) was noted in B. juncea compared with B. carinata (0.15 g). Similar results were also reported by Ebbs and Kochian (1997) who reported significant decrease in root dry weight in 3 Brassica species. Table 8 indicates heavy metal accumulation levels in

the shoots of Brassica species as affected by heavy metals and EDTA application. Statistical analysis of the data revealed that heavy metal, EDTA, species, interaction between heavy metal × species, EDTA × species and heavy metal × EDTA × species significantly (p<0.05) affected the accumulation of heavy metals in shoots of Brassica plants while the effect of interaction between heavy metal × EDTA was non-significant (p>0.05). It is evident from the data that maximum accumulation of heavy metals (95.42 mg kg-1) was achieved by plants exposed to 150 mg kg-1 of Pb, followed by 88.34 mg kg-1, -1 by plants grown on 200 mg kg Pb concentration. -1 Minimum accumulation (0.82 mg kg ) was noticed for Cd in control plants. When subjected to EDTA, maximum

7654

Afr. J. Biotechnol.

Table 6. Root fresh weight (g) of Brassica species as affected by heavy metals and EDTA application.

EDTA (0 m M) B. carinata B. juncea 0.34 0.72 0.27 0.75 0.27 0.76 0.30 1.31 0.61 1.07 0.53 1.39 0.52 0.43 0.72 1.01 0.55 0.79 1.52 2.84 0.84 a (0.57 a)

Heavy metal (mg kg-1) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (5 m M) B. carinata B. juncea 0.58 1.63 0.38 1.89 0.69 1.76 0.49 1.43 0.27 2.13 0.35 1.57 0.79 2.70 0.64 2.47 0.78 1.83 0.77 2.42 1.28 b (1.55 b)

Mean 0.82b 0.82b 0.87b 0.88b 1.02b 0.96b 1.11b 1.21b 0.99b 1.89a

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

Table 7. Root dry weight (g) of Brassica species as affected by heavy metals and EDTA application.

Heavy Metals (mg kg1 ) Cd 10 Cd 20 Cd 40 Cr 50 Cr 100 Cr 150 Pb 100 Pb 150 Pb 200 Control

EDTA (0 m M) B. carinata B. juncea 0.08 0.14 0.05 0.14 0.06 0.13 0.07 0.30 0.15 0.21 0.11 0.29 0.13 0.06 0.26 0.14 0.21 0.09 0.23 0.43 0.16 a (0.15 a)

EDTA (5 m M) B. carinata B. juncea 0.13 0.28 0.08 0.44 0.27 0.38 0.15 0.21 0.11 0.31 0.15 0.22 0.23 0.50 0.20 0.40 0.20 0.23 0.17 0.34 0.25 b (0.26 b)

Mean 0.16 0.18 0.21 0.18 0.20 0.19 0.23 0.25 0.18 0.29

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

Table 8. Heavy metals (mg kg-1) accumulation by Brassica species as affected by heavy metals and EDTA application.

Heavy metal (mg kg-1) Cd 10 Cd 20 Cd 40 Control Cr 50 Cr 100 Cr 150 Control Pb 100

EDTA (0 m M) B. carinata B. juncea 5.97 6.47 5.67 6.19 6.05 6.29 0.90 0.75 8.67 11.59 8.58 13.96 9.57 6.83 3.75 8.00 28.32 108.25

EDTA (5 m M) B. carinata B. juncea 10.55 14.57 10.69 16.62 10.52 15.59 0.00 0.00 10.75 11.33 11.01 10.75 11.52 12.92 0.00 0.00 84.13 122.58

Mean 9.39b 9.79b 9.61b 0.82 10.59b 11.08b 10.21b 5.88 85.82a

Iqbal et al.

7655

Table 8. Contd.

Pb 150 Pb 200 Control

29.70 142.88 29.54 115.12 35.00 71.75 27.48 a (24.39 a)

108.50 100.58 98.13 110.58 0.00 0.00 38.57 b (41.66 b)

95.42a 88.34a 53.38

Means followed by different letters are statistically different at p<0.05. Means in parenthesis refers to species while the other refers to EDTA application.

1

2

3

4

5

6

7

8

9

10

72 69 63 57 55 46 43 37 31 26 20 17 13 8

Figure 1. SDS-PAGE protein profile of Brassica carinata grown under different heavy metals (mg kg-1) and EDTA (0 mM). Lane 1, Control; lane 2, Cd10; lane 3, Cd20; lane 4, Cd40; lane 5, Cr50; lane 6, Cr100; lane 7, Cr150; lane 8, Pb100; lane 9, Pb150; lane 10, Pb200.

accumulation occurred in plants (38.57 mg kg-1) when 5 mM EDTA was applied. Between species, maximum accumulation was found to be 41.66 mg kg-1 in B. -1 carinata when compared with B. juncea (24.39 mg kg ). For interaction between heavy metal Ă— EDTA Ă— species, -1 maximum accumulation (142.88 mg kg ) was observed -1 for those plants that were grown under 150 mg kg Pb stress (B. juncea; 0 mM EDTA) while minimum accumulation (0.75 mg kg-1) was noted for Cd in control plants (B. juncea; 0 mM EDTA). The results are in agreement with Blaylock et al. (1997) who reported that accumulation of Pb in the plant tissue corresponds to the Pb and EDTA concentrations in soil after working with B. juncea. Ahmed et al. (2001) found that EDTA increases

the solubility of Cd helping its enhanced accumulation in B. juncea roots, shoots and stem. These results agree with Kos et al. (2003) and Lesage et al. (2005). Protein analysis by SDS-PAGE Protein profile by SDS-PAGE of Brassica species exposed to different levels of heavy metals and EDTA application showed that B. carinata plants treated with Cd (20 mg kg-1) and Pb (100 and 150 mg kg-1) and EDTA expressed one polypeptide each of molecular weight 57 and 60 kDa when compared with other treatments (Figure 2). Similarly, B. carinata when exposed to 100 mg

7656

Afr. J. Biotechnol.

1

2

3

4

5

6

7

8

9

10

72 69 63 57 55 47 43 37 31 26 20 17 13 8 Figure 2. SDS-PAGE protein profile of Brassica carinata grown under different heavy metals (mg kg-1) and 5 mM EDTA. Lane 1, Control; lane 2, Cd10; lane 3, Cd20; lane 4, Cd40; lane 5, Cr50; lane 6, Cr100; lane 7, Cr150; lane 8, Pb100; lane 9, Pb150; lane 10, Pb200.

1

2

3

4

5

6

7

8

9

10

72 69 63 57 55 47 43 37 31 26 20 17 13 8

Figure 3. SDS-PAGE Protein profile of Brassica juncea grown under different heavy metals (mg kg-1) and EDTA (0 mM). Lane 1, Control; lane 2, Cd10; lane 3, Cd20; lane 4, Cd40; lane 5, Cr50; lane 6, Cr100; lane 7, Cr150; lane 8, Pb100; lane 9, Pb150; lane 10, Pb200.

kg-1 and 5 mM EDTA revealed that a band of 55 kDa disappeared when compared with other treatments (Figure 3). The same brassica specie when treated with Cr (100 mg kg-1) indicated that 63 kDa protein was not expressed when compared with other treatments (Figure 1). The data further suggested that B. carinata when

exposed to Pb (100 mg kg-1) and 5 mM EDTA abundantly expressed two polypeptides of molecular weight 69 and 72 kDa (Figure 2). Banding profile of the treated plants revealed that the same Brassica (B. carinata) two polypeptides (20 and 43 kDa) were highly expressed -1 -1 when treated with 20 mg kg Cd and Cr (100 mg kg ),

Iqbal et al.

1

2

3

4

5

6

7

8

9

7657

10

72 69 63 57 55 47 43 37 31 26 20 17 13 8

Figure 4. SDS-PAGE Protein profile of Brassica juncea grown under different heavy metals (mg kg-1) and 5 mM EDTA. Lane 1, Control; lane 2, Cd10; lane 3, Cd20; lane 4, Cd40; lane 5, Cr50; lane 6, Cr100; lane 7, Cr150; lane 8, Pb100; lane 9, Pb150; lane 10, Pb200.

respectively (Figure 2). The data also suggested that plants treated with Cr (150 mg kg-1) abundantly expressed 13, 43 and 72 kDa protein when compared with other treatments (Figures 3 and 4). Similarly, 69 kDa protein was highly expressed in the case of Cr (50 mg kg1 ) treatment (Figure 4). Wu et al. (2011) reported that CAXcd-expressing petunia plants showed significantly greater Cd tolerance and accumulation than the controls.

REFERENCES Ahmed K., Panwar BS, Gupta SP (2001). Phytoremediation of cadmium-contaminated soil by Brassica species. Acta Agron. Hungarica 49: 351-360. Alcantara E, Barra R, Benlloch M, Ginhas A, Jorrin J, Lopez JA, Lora A, Ojeda MA, Pujadas A, Requejo R, Romera J, Sancho ED, Shilev S, Tena M (2000). Phytoremediation of a metal contaminated area in southern Spain. In: Intercost workshop. (15th - 18th November, 2000, Sorrento, Italy). Pp 121-123. Alloway BJ (1990). Heavy metals in soils. Blackie, Glasgow UK. Ba単uelos GS (2000). Phytoextraction of selenium from soils irrigated with selenium-laden effluent. 224: 251-258. Ba単uelos GS, Meek DW (1989). Selenium accumulation in selected vegetables. J. Plant Nutr. 12: 1255-1272. Ba単uelos GS, Cardon G, Mackey B, Ben-asher J, Wu LP, Beuselinck P, Akohoue S, Zambrzuski S (1993a). Boron and selenium removal in B-laden soils by four sprinkler irrigated plant species. J. Environ. Qualit. 22: 786-797. Berti WR, Cunningham SD (2000). Phytostabilization of metals. In: Phytoremediation of toxic metals: using plants to clean-up the environment. Edited by Raskin I and Ensley BD. New York, John Wiley & Sons, Inc., pp. 71-88. Blaylock MJ, Salt DE, Dushenkov S, Ussman CD, Kapulnik Y, Ensley

BD, Raskin I (1997). Enhanced accumulation of Pb in Indian mustard by soil- applied chelating agents. Environ. Sci. Technol. 31: 860-865. Brooks RR (1983). Biological methods of prospecting for minerals. New York, Wiley-Interscience, p. 313. Brooks RR, Chambers MF, Nicks LJ, Robinson BH (1998). Phytomining. Trends Plant Sci. 1: 359-362. Chen Y, Li X, Shen Z (2004). Leaching and uptake of heavy metals by ten different species of plants during an EDTA- assisted phytoextraction process. Chemosphere, 57: 187-196. Ebbs SD, Kochian LV (1997). Toxicity of zinc and copper to Brassica species: implications for phytoremediation. J. Environ. Qual. 26: 776781. Ebbs SD, Lasat MM, Brady DJ, Cornish J, Gordon R, Kochian LV (1997). Phytoextraction of cadmium and zinc from a contaminated soil. J. Environ. Qual. 26: 1424-1430. Ensley BD (2000). Rational for use of Phytoremediation. In: Phytoremediation of toxic metals: using plants to clean-up the environment. Edited by Raskin I and Ensley BD. New York, John Wiley & Sons, Inc. pp. 3-12. Flathman PE, Lanza GR (1998). Phytoremediation: current views on an emerging green technol. J. Soil Contamin. 7: 415-432. Geldmacher VM (1984). Meaning of the heavy metals in the toxicology. Anal. Chem. 317: 427-432. Getinet A, Rakow G, Raney JP, Downey RK (1997). Glucosinolate content in interspecific crosses of Brassica carinata with B. juncea and B. napus. Plant Breed. 116: 39-46. Glass DJ (1999). U.S. and international markets for phytoremediation, 1999-2000. Needham, Mass., D. Glass Associates, 1999, p. 266. Glass DJ (2000a). Economic potential of phytoremediation. In: Phytoremediation of toxic metals: using plants to clean-up the environment. Edited by Raskin I and Ensley BD. New York, John Wiley & Sons, pp. 15-32. Glass DJ (2000b). The 2000 Phytoremediation Industry. Needham, Mass., D. Glass Associates, p. 100. Gomez KA, Gomez AA (1984). Statistical Procedures for Agricultural nd Research 2 Ed. John Willey & Sons, Inc. New York USA. Henry JR (2000). In an overview of phytoremediation of lead and

7658

Afr. J. Biotechnol.

mercury. NNEMS Report. Washington, D.C., pp. 3-9. Kos B, Grcman H, Lestan D (2003). Phytoextraction of lead, zinc and cadmium from soil by selected plants. Plant Soil Environ. 49: 548553. Lesage E, Meers E, Vervaeke P, Lamsal S, Hopgood M, Tack FMG, Verloo MG (2005). Enhanced phytoextraction: II. effect of EDTA and Citric Acid on heavy metal uptake by Helianthus annuus from a calcareous soil. Int. J. Phytoremed. 7: 143-152. Liphadzi MS, Kirkham MB (2006). Heavy metal displacement in chelatetreated soil with sludge during phytoremediation. J. Plant Nutr. Soil Sci. 169: 737-744. Lombi E, Zhao FJ, Dunham SJ, McGrath SP ( 2001). Phytoremediation of heavy metal-contaminated soils natural hyperaccumulation versus chemically enhanced phytoextraction. J. Environ. Qual. 30: 19191926. Nadeem M, Mahmood A, Shahid SA, Shah SS, Khalid AM, Mckay G (2006). Sorption of lead from aqueous solution by chemically modified carbon adsorbents. J. Hazard. Mat. 138: 604-613. Ozer A (2007). Removal of Pb(II) ions from aqueous solutions by sulphuric acid-treated wheat bran. 2007. J. Hazard. Mat. 141: 753761. Panwar BS, Ahmed KS, Sihag D, Patel AL (2005). Distribution of cadmium and nickel among various forms in natural and contaminated soils amended with EDTA. Earth Environ. Sci. 7: 153160. Prasad MNV, Freitas H (1999). Feasible biotechnological and bioremediation strategies for serpentine soils and mine spoils. Electronic J. Biotechnol. 2: 35-50. Prasad MNV, Freitas HMO (2003). Metal hyperaccumulation in plants biodiversity prospecting for phytoremediation technology. Electronic J. Biotechnol. 6: 275-321. Prasad MNV, Strzalka K (2002). Physiology and biochemistry of metal toxicity and tolerance in plants. Dordrecht, Kluwer Academic Publishers. p. 432. Purakayastha TJ, Viswanath T, Bhadraray S, Chhonkar PK, Adhikari PP, Suribabu K (2008). Phytoextraction of zinc, copper, nickel and lead from a contaminated soil by different species of Brassica. Intl. J. Phytoremed.10: 61-72. Qadir S, Qureshi MI, Javed S, Abdin MZ (2004). Genotypic variation in phytoremediation potential of Brassica juncea cultivars exposed to Cd stress. J. Plant Sci. 167: 1171-1181. Quartacci MF, Argilla A, Baker AJM, Navari-Izzo F (2006). Phytoextraction of metals from a multiply contaminated soil by Indian mustard. Chemosphere, 63: 918-925. Quartacci MF, Irtelli B, Baker AJM, Navari-Izzo F ( 2007). The use of NTA and EDDS for enhanced phytoextraction of metals from a multiply contaminated soil by Brassica carinata. Chemosphere, 68: 1920-1928. Raskin I, Ensley BD (2000). Phytoremediation of toxic metals: using plants to clean up the environment. New York, John Wiley and Sons, p. 352. Raskin I, Kumar PBAN, Dushenkov S, Salt DE (1994). Bioconcentration of heavy metals by plants. Curr. Opin. Biotechnol. 5: 285-290. Rulkens WH, Tichy R, Grotenhuis JTC (1998). Remediation of polluted soil and sediment: perspective and failures. Water Sci. Technol. 37: 27-35.

Russel DF, Eisensmith SP (1983). MSTATC. Crop and Soil Science Department, Michigan State University, USA. Salt DE, Pickering IJ, Prince RC, Gleba D, Dushenkov S, Smith RD, Raskin I (1997). Metal accumulation by aquacultured seedlings of Indian mustard. Environ. Sci. Technol. 31: 1636-1644. Salt DE, Blaylock M, Kumar NPBA, Dushenkov V, Ensley D, Chet I, Raskin I (1995a). Phytoremediation: a novel strategy for the removal of toxic metals from the environment using plants. Biotechnology, 13: 468-474. Salt DE, Smith RD, Raskin I (1998). Phytoremediation. Ann. Rev. Plant Physiol. Plant Mol. Biol. 49: 643-668. Steel RGD. Torrie JH (1997). Principles and procedures of statistics: A Biometrical Approach. McGraw Hill, New York USA. Turgut C, Pepe MK, Teresa JC (2004). The effect of EDTA and citric acid on phytoremediation of Cd, Cr, and Ni from soil using Helianthus annuus. Environ. Pollut. 131: 147-154. Velasco L, Goffman F, Becker HC (1998). Variability for the fatty acid composition of the seed oil in a germplasm collection of the genus Brassica. Gene Resour. Crop Evol. 45: 371-382. Wahla IH, Kirkham MB (2008). Heavy metal displacement in salt-waterirrigated soil during phytoremediation. Environ. Pollut. 155: 271-283. Watanabe ME (1997). Phytoremediation on the brink of commercialization. Environ. Sci. Technol. 31: 182-186. Wong MH, Bradshaw AD (2006). A comparison of toxicity of heavy metals, using root elongation of rye grass, Lolium perenne. New phytol. 91: 255-261. Wu Q, Toshiro S, Kimberly, William A, Jeung-Sul H, Chang KK, Kendal DH, Sungun P (2011). J. Plant Physiol. 168: 167-173. Zulkali, MMD, Ahmad AL, Norulakmal NH (2006). Oryza sativa L. husk as heavy metal adsorbent: Optimization with lead as model-solution. Bioresour. Technol. 97: 21-25.

African Journal of Biotechnology Vol. 11(30), pp. 7659-7669, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3743 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Genetic diversity in Chinese natural zoysiagrass based on inter-simple sequence repeat (ISSR) analysis Y. Xie, L. Liu, J. Fu* and H. Li* Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden/Wuhan Institute of Botany, Chinese Academy of Sciences, Wuhan 430074, Hubei, China. Accepted 14 March, 2012

Zoysiagrass (Zoysia sp.) is extensively used in turf establishment and livestock herbage due to its many outstanding characters. Native Zoysia sp. are widely distributed in China. Inter-simple sequence repeat (ISSR) markers were used to investigate the genetic diversity and genetic relationships of 81 Chinese wild zoysiagrass accessions and three commercial cultivars. The results show that 33 ISSR primers produced 388 clear bands, among which 375 were polymorphic. The genetic similarity coefficients (GSCs) among 84 zoysiagrass accessions or cultivars ranged from 0.644 to 0.866 with an average of 0.751. The GSCs within species were significantly higher than that among species. Cluster analysis using an unweighted pair group method with arithmetic mean (UPGMA) method showed that the 84 zoysiagrass accessions could be classified into 10 major groups. Accessions from similar geographic regions were generally clustered together, which indicated a correlation between molecular groupings and the geographical origin. The investigation demonstrated the genetic diversity of different germplasm, and that ISSR markers are an effective tool for the study of genetic variation in zoysiagrass. Key words: Chinese accessions, genetic diversity, inter-simple sequence repeat (ISSR) markers, zoysiagrass.

INTRODUCTION Zoysiagrass (Zoysia sp.), with well-developed stolon and short culm, is able to form a dense swards (Weng et al., 2007). It was extensively used in turf establishment and livestock herbage. The genus zoysia consists of 16 species that are naturally distributed on sea coasts and grasslands around the East Asia. Five species have been identified from southern Hokkaido to the southwest islands in Japan (Kitamura, 1989). Of these, Zoysia japonica Steud., Zoysia matrella Merr., and Zoysia tenuifolia Wild are utilized as turfgrass. In addition, Z. japonica is also used as forage grass in Japan and other countries in East Asia (Shoji, 1983; Fukuoka, 1989). In China, Zoysia sp. are distributed from north eastern area of Liaoning province in the north to Fujian province in the south (Jin et al., 2004), with a variety of ecological types. These wild resources survived through long-term natural selection, and thereby had strong environmental

*Corresponding author. E-mail: lihuiying@wbgcas.cn. Tel/Fax: +86 27 87510525.

suitability and stress resistance (Jin and Han, 2004). Previous researchers investigated the genetic variation of some zoysiagrass germplasm. The Zoysia sp. grown in various environments of coastal areas in Tanwan had a great variation in morphology, isozyme pattern, and salt tolerance (Weng et al., 1995; Weng and Chen, 2001; Weng, 2002). Kitamura (1989) and Choi et al. (1997a, b) evaluated the morphology and isozyme pattern of Zoysia sp. collected from Japan and Korea, respectively. However, morphological characteristics are not adequate to reveal genetic differences among cultivars because phenotypic traits are easily influenced by environment. Kitamura (1970) investigated morphological characteristics of natural zoysiagrass populations and found that the classification criteria of Zoysia sp. should be reconsidered because morphological characteristics varied continuously among species. With the development of molecular techinique, molecular marker has been considered as a preferred method for evaluating the genetic diversity of plant germplasm because it could even distinguish closely related genotypes (Nybom, 1994). Molecular markers are not easily affected by

7660

Afr. J. Biotechnol.

environmental factors or by development stages (Bebeli and Kaltsikes, 1993). Molecular data can contribute to a more holistic picture of genetic diversity within a collection of populations (Curley and Jung, 2004). Yaneshite et al. (1997) employed restriction fragment length polymorphism (RFLP) markers to study the genetic diversity within 17 zoysiagrass accessions from Japan. Choi and Yang, (1996) and Weng (2007) found extensive diversity of wild zoysiagrass accessions collected from Korea and Taiwan based on randomly amplified polymorphic DNA (RAPD) technique by investigating morphological characteristics in natural populations. Guo et al. (2007, 2009) evaluated genetic diversity and interspecific relationship of 96 China Zoysia sp. wild germplasm by applying simple sequence repeat (SSR) and sequence related amplified polymorphism (SRAP) markers. However, compared to its wide distribution, the research of molecular variation in Chinese wild zoysiagrass is limited. The ISSR marker is a widely used molecular marker technique, in terms of its high reproducibility, low cost, and less complexity (Reddy et al., 2002). It has been used in identification and genetic relationship estimation of many plant species. However, there are limited reports on the genetic diversity among zoysiagrass species based on ISSR markers. In China, wild zoysiagrass is abundant and extensively distributed. However, there is very limited information on the general genetic variation among indigenous Chinese zoysiagrass germplasm. In this study, we used ISSR markers; (i) to estimate the genetic relationship among 81 Chinese natural zoysiagrass accessions and three cultivars, and (ii) to classify them and provide the basic information for conservation and breeding strategies for zoysiagrass. MATERIALS AND METHODS Plant materials Eighty-four accessions of four species of zoysiagrass [81 were natural zoysiagrass accessions collected from seven provinces of China (Table 1), and three commercial cultivars (Zenith, Meyer and Grif16454)] were used in this study. Of these materials, there were 50 Z. japonica, 21 Zoysia sinica, six Zoysia macrostachya, and seven Z. matrella (L.) based on morphology identification (Table 1). According to their provinces of collection, these natural zoysiagrass accessions were classified into seven groups. All the accessions were propagated asexually in Wuhan Botanical Garden, Chinese Academy of Sciences. They were grown in a mixture of 9 sand: 1 organic material in pots (15 cm in diametre and 20 cm deep). The pots were kept in a greenhouse with a daily maximum/ minimum temperature of 30/25°C, a 12 h photoperiod.

Genomic DNA extraction Total DNA was isolated from young fresh zoysiagrass leaves (0.1 g) using the cetyl trimethylammonium bromide (CTAB) method as described by Doyle (1991) with slight modification. Leaf tissues were directly ground in liquid nitrogen with a mortar and pestle. The

powder was transferred into 2 ml centrifuge tubes with 0.9 ml of CTAB extraction buffer (containing 2% CTAB, 5 M NaCl, 0.5 M EDTA pH 8.0, 1 M Tris–HCl pH 8.0). After 30 min of incubation at 65°C, equal volume of chloroform/isoamyl alcohol (24:1) was added into each tube. After being vortexed gently for three min, the mixtures were centrifuged at 12,000 rpm for 10 min at 4°C. The supernatant was transferred to new tubes and cold isopropanol was added to ⅔ volume of supernatant. After 30 min on ice, DNA was precipitated by centrifugation at 12,000 rpm for 10 min at 4°C. The pellets were washed with 70% ethanol, and dissolved in TE buffer. DNA concentration was quantified using UV spectrophotometer, and the integrity was examined on 0.8% agarose gel electrophoresis.

ISSR analysis According to previous reports (Zeng et al., 2006; Fan et al., 2007; Liu et al., 2007; Xiao et al., 2007), 60 ISSR primers were synthesized. These primers were screened with six accessions for polymorphism and reproducibility. 33 primers producing clear, stable and polymorphic fragments were used for ISSR analysis. PCR amplification was performed in a total volume of 25 μl. The reaction mixture included 40 ng DNA template, 0.5 μM primer, 0.2 mM dNTP (Pharmacia, America), 1.5 μM MgCl2 (Fermentas, EU), 1×Tap buffer (with (NH4)2SO4) (Fermentas, EU), and 1.0 U Taq DNA polymerase (Fermentas, EU). The PCR was carried out in a Mastercycler gradient PCR machine (Eastwin, China). All the PCRs were performed using a programme for denaturing at 94°C for 5 min; 5 cycles at 94°C for 45 s, 60°C for 45 s, 72°C for 1.5 min decreasing by increments of 1°C for annealing with each cycle; 38 cycles at 94°C for 45 s, 55°C for 45 s, 72°C for 1.5 min; and then extending at 72°C for 7 min. After amplification, 2 μL loading buffer was added to the PCR products. The mixture was then analysed on 1.8% agarose gel in 1×Tris-aceticacid-EDTA (TAE) buffer and stained with ethidium bromide (0.5 μg/ml). The image bands were acquired through UV light using Gel Doc XR system (Bio-rad, America). DL2000 molecular marker was used to estimate the size of the fragments amplification. All testing was repeated at least twice.

Data analysis Distinct and reproducible bands produced by ISSR primers were scored in terms of a binary code [present (1) or absent (0)] among all accessions. Jaccard’s coefficient of genetic similarity was calculated based on the binary data (matrix) (Sneath and Sokal, 1973) between all possible pairs of accessions. Each of the seven geographical groups was subjected to the following analyses: the actual number (na) of alleles was counted for each amplified locus. The effective number of alleles was estimated as ne =1 + 4Neu for each locus, where Ne is the effective population size and u is the average mutation rate (Kimura and Crow, 1964). The Shannon diversity index (I) is a common diversity index used to account for both abundance and evenness of the alleles present, and is useful for understanding allele structure at an ISSR locus (Shannon, 1949; Cai et al., 2010). Shannon’s information index was estimated for each locus using the formula

I

PiLnPi i 1 S

, where S is

the total number of alleles in the locus, and Pi is the proportion of S made up of the ith allele. Nei’s gene diversity (He) is another common diversity index in population genetics (Nei, 1973). In this study, gene diversity was estimated according to the formula of Nei (1973) for each locus, He

1

Pij2 , where Pij is the frequency

of the jth allele for ith locus summed across all alleles of the locus.

Xie et al.

7661

Table 1. Details of 84 germplasm accessions used in this study.

Sample number

Origin

Habitat

Species

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44

Rizhao,Shandong Juxian,Shandong Jiaozhou,Shandong Jiaonan,Shandong Jiaonan,Shandong Qingdao,Shandong Jiaonan,Shandong Jiaonan,Shandong Jimo,Shandong Jimo,Shandong Jimo,Shandong Jimo,Shandong Rushan,Shandong Rushan,Shandong Muping,Shandong Muping,Shandong Penglai,Shangdong Penglai,Shangdong Yantai,Shandong Chizhou,Anhui Chizhou,Anhui Nanlin,Anhui Nanlin,Anhui Nanlin,Anhui Hefei,Anhui Hefei,Anhui Feidong,Anhui Chaohu,Anhui Chaohu,Anhui Chaohu,Anhui Jurong,Jiangsu Jurong,Jiangsu Zhengjiang,Jiangsu Lianyungang,Jiangsu Lianyungang,Jiangsu Lianyungang,Jiangsu Guanyun,Jiangsu Dongtai,Jiangsu Dongtai,Jiangsu Dongtai,Jiangsu Dongtai,Jiangsu Dongtai,Jiangsu Gongjinggang,Jiangsu Gongjinggang,Jiangsu

Wilderness Mountain Ditch Hillside Roadside Hillside Alkaline land Alkaline land Roadside Alkaline land Hillside Roadside,ditch Cliff,rock tunnels Ridge,hillside Woodland Hillside Hillside Hillside Roadside Roadside,ditch Foot of a hill Hirst Hillside Hirst Roadside Nature meadow Hillside Hillside Roadside Nature meadow Nature meadow Country road Country road Mountain road Mountain road Roadside Hillside Country road Beside the pond Beside the pond Benches Benches Alkaline land Alkaline land

Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. macrostachya Franch. Et Sav Z. matrella (L.) Merr. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. sinica Hance Z. macrostachya Franch. Et Sav Z. macrostachya Franch. Et Sav Z. macrostachya Franch. Et Sav Z. macrostachya Franch. Et Sav

All these analyses were conducted using the Popgene 1.32. A clustering analysis of all accessions was performed using UPGMA method, and then principal coordinate analysis (PCA) was carried

Latitude (H) 35º17′914″ 35º29′244″ 36º12′647″ 36º06′258″ 35º59′002″ 36º18′436″ / / 36º18′976″ 36º24′286″ 36º32′324″ 36º34′123″ 36º47′931″ 37º00′255″ 37º08′806″ 37º15′789″ 37º43′298″ 37º38′765″ 37º23′861″ / 30º32′073″ 30º48′488″ 30º48′490″ 30º50′774″ 31º52′075″ 31º49′644″ 31º48′320″ 31º45′423″ 31º40′382″ 31º45′326″ 32º00′620″ 31º58′605″ 32º08′361″ 34º41′819″ 34º41′944″ 34º41′944″ 34º18′305″ 32º53′608″ 32º54′723″ 32º53′797″ 32º51′785″ 32º51′785″ 32º44′586″ 32º45′552″

Longitude (E) 119º26′164″ 119º17′954″ 120º00′611″ 119º59′635″ 119º59′109″ 120º30′786″ / / 120º37′826″ 120º41′783″ 120º38′846″ 120º38′755″ 121º21′305″ 121º29′930″ 121º29′807″ 121º31′784″ 120º49′870″ 120º50′783″ 121º21′640″ / 117º25′352″ 118º16′485″ 118º16′487″ 118º18′456″ 117º29′923″ 117º35′332″ 117º38′690″ 117º47′304″ 117º51′863″ 118º09′619″ 119º06′023″ 119º13′462″ 119º20′756″ 119º24′382″ 119º24′627″ 119º24′627″ 119º14′240″ 120º34′650″ 120º53′368″ 120º54′004″ 120º34′039″ 120º34′039″ 120º51′878″ 120º51′928″

Altitude (m) 6 106 44 35 72 99 / / 72 7 50 66 61 59 75 71 71 131 20 / 54 30 30 22 17 66 50 26 75 21 39 30 30 16 84 84 31 7 10 11 4 4 9 7

out using the software package NTSYSpc 2.1. The confidence limits for the dendrogram groupings were performed by bootstrapping using the Win Boot programme.

7662

Afr. J. Biotechnol.

Table 1. Contd.

Latitude (H) 30º36′562″ 30º34′730″ 30º34′731″ 30º36′563″

Longitude (E) 119º53′077″ 119º31′661″ 119º31′662″ 119º53′078″

Altitude (m) 146 74 -70 -142

29º03′782″

119º44′885″

39

26º05′180″ 26º05′171″ 26º05′171″ 25º48′794″ 23º13′662″ 23º25′145″ 23º25′172″ 23º25′128″ 23º02′660″ 22º53′435″ 21º01′209″ 41º33′580″ 41º03′100″ 40º12′400″ 40º12′400″ 40º16′203″ 40º19′047″ 40º18′457″ 40º19′194″ 40º22′867″

119º14′194″ 119º14′334″ 119º14′334″ 119º36′642″ 116º41′094″ 116º59′325″ 117º00′364″ 116º58′126″ 112º24′819″ 112º16′945″ 110º27′251″ 123º19′045″ 123º08′334″ 123º17′194″ 123º17′194″ 123º21′222″ 123º25′535″ 123º34′602″ 123º43′597″ 123º79′141″

30 68 68 13 23 9 9 9 12 18 19 36 77 88 88 71 92 80 96 119

Z. japonica Steud.

40º24′984″

124º03′142″

112

Z. sinica Hance Z. sinica Hance Z. sinica Hance Z. sinica Hance Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. sinica Hance

40º02′080″ 39º56′000″ 39º52′035″ 39º52′889″ 39º51′766″ 39º41′770″ 39º31′989″ 39º27′574″ 39º07′559″ 38º57′771″ 39º58′178″

124º21′450″ 124º16′040″ 123º54′143″ 123º42′961″ 123º31′779″ 122º55′848″ 122º28′737″ 122º24′911″ 121º43′544″ 121º19′762″ 121º19′650″

16 16 20 17 8 22 38 20 22 65 14

cultivar

Z. japonica Steud.

/

/

/

Meyer

cultivar

Z. japonica Steud.

/

/

/

Grif16454

cultivar

Z. matrella (L.) Merr.

/

/

/

Sample number

Origin

Habitat

Species

45 46 47 48

Huzhou,Zhejiang Xiaofeng,Zhejiang Xiaofeng,Zhejiang Huzhou,Zhejiang

Roadside Tea garden Tea garden Roadside

49

Jinhua,Zhejiang

Hillside

50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69

Fuzhou,Fujian Fuzhou,Fujian Fuzhou,Fujian Changle,Fujian Shantou,Guangdong Shantou,Guangdong Shantou,Guangdong Shantou,Guangdong Gaoyao,Guangdong Yunfu,Guangdong Donghai,Guangdong Shenyang,Liaoning Anshan,Liaoning Xiuyan,Liaoning Xiuyan,Liaoning Xiuyan,Liaoning Xiuyan,Liaoning Xiuyan,Liaoning Fengcheng,Liaoning Fengcheng,Liaoning

70

Fengcheng,Liaoning

71 72 73 74 75 76 77 78 79 80 81

Dandong,Liaoning Dandong,Liaoning Dandong,Liaoning Dandong,Liaoning Dandong,Liaoning Dalian,Liaoning Dalian,Liaoning Dalian,Liaoning Dalian,Liaoning Dalian,Liaoning Dalian,Liaoning

Rock tunnels Botanical garden Botanical garden Seaside Seaside Seaside Seaside Seaside Hillside Coentry road Nature meadow Dike Foot of hill Hillside Hillside Hirst Hillside Hillside Roadside Hirst Rangeland with spare forest Wilderness Roadside Mountain road Roadside Beside the pond Mountain Corn field Hillside Roadside Hillside Seaside

Z. sinica Hance Z. sinica Hance Z. japonica Steud. Z. sinica Hance Z. macrostachya Franch. Et Sav Z. japonica Steud. Z. sinica Hance Z. matrella (L.) Merr. Z. sinica Hance Z. sinica Hance Z. sinica Hance Z. matrella (L.) Merr. Z. sinica Hance Z. matrella (L.) Merr. Z. matrella (L.) Merr. Z. japonica Steud. Z. sinica Hance Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud. Z. japonica Steud.

82

Zenith

83 84

RESULTS ISSR analysis 33

primers

generated

388

bands

ranging

from

approximately 100 to 2000 bp in size, of which, 375 bands were polymorphic (96.65%) (Table 2). Figure 1 shows a typical PCR amplification patterns by primer I3 in 84 Zoysia accessions. Each primer produced five to 18 polymorphic bands, and the largest amount of bands was

Xie et al.

7663

Table 2. ISSR primers used in this study.

Primer P2 P3 P5 P8 P9 P10 P12 P13 P14 P20 P21 P22 P23 P25 P26 P32 P36 P39 P42 P43 P45 N1 N11 N14 N17 N20 N22 N23 N24 N25 N26 I1 I3 Total Mean

Primer sequence (5’-3’) (TG) 8RA (CA) 8A (GT) 8T (GGGGT) 3 (AC) 8YT (AC) 8YA (AC) 8YG (CCCT) 4 HVH(TG) 7 (AC) 8TG (AG) 8GCC (GACA) 4 (CA) 8TA (AC) 8GA (AC) 8C (AG) 8GC (AC) 8GT (GA) 8GCC ACTCGTACT(AG) 7 CGTAGTCGT(CA) 7 AGTCGTAGT(AC) 7 (GA) 8C (AG) 8YC (AG) 8YA (GA) 8RC (GA) 8YG (GA) 8YA (GA) 8YT (GT) 8YC (GT) 8YG (GT) 8YA (CT) 8G (AC) 8CG

Tm (°C)

Total band

61.1 61.1 61.1 69.3 61.1 61.1 63.5 70.1 53.8 64.5 69.7 59.8 62.2 64.5 63.5 66.8 64.5 69.7 71.8 73.5 71.8 63.5 63.5 61.1 63.5 63.5 61.1 61.1 63,5 63.5 61.1 63.5 66.8

18 15 16 11 17 14 8 8 16 13 9 18 9 17 7 14 7 11 7 15 11 9 9 11 10 13 8 10 15 14 8 5 15 388 11.76

produced by P2 and P22. 21 of the 33 primers showed 100% polymorphism. None of the pair of accessions exhibited identical band patterns, indicating that these ISSR primers could discriminate all the 84 accessions. 17 bands were unique to a single accession. The primer P23 amplified three unique bands, and the primer P22 produced two unique bands. Genetic similarities Jaccard’s genetic similarity coefficients (GSCs) were caculated based on the original matrix data. Pair-wise

Phlymorphism Band % 18 100 15 100 16 100 11 100 17 100 13 92.9 6 75 8 100 16 100 13 100 8 88.9 18 100 9 100 17 100 6 85.7 14 100 7 100 11 100 6 85.7 15 100 10 90.9 9 100 8 88.9 11 100 9 90 12 92.3 8 100 10 100 15 100 13 92.9 7 87.5 4 80 15 100 375 11.36 96.65

Bands size (bp) 250 - 2000 140 - 1000 250 - 2000 250 - 1200 190 - 1500 250 - 2000 250 - 1500 500 - 1700 250 - 2000 250 - 2000 250 - 1000 170 - 1900 250 - 500 210 - 1750 250 - 1700 190 - 1500 250 - 750 250 - 1000 250 - 1500 270 - 1750 150 - 1500 350 - 1600 250 - 900 210 - 1700 250 - 2000 110 - 1500 340 - 1600 250 - 1000 200 - 2000 430 - 2000 250 - 1700 300 - 1600 250 - 2000

comparison of accessions indicated GSCs between accessions ranged from a minimum of 0.644 (between 2 and 56) to a maximum of 0.866 (between 35 and 36), with a mean of 0.751. The GSCs within or among the species are shown in Table 3. The mean GSCs within the species of Z. japonica, Z. sinica, Z. macrostachya and Z. matrella (L.) was 0.760, 0.745, 0.778 and 0.749, respectively. The species Z. japonica had the most widely GSCs range (from 0.649 to 0.866). The GSCs within the Z. sinica, Z. macrostachya and Z. matrella (L.) species were changed from 0.649 to 0.845, 0.727 to 0.840, and 0.691 to 0.835, respectively. Among the species, the maximum mean GSCs (0.751) was between Z. japonica and Z. sinica (Z.

7664

Afr. J. Biotechnol.

Figure 1. PCR amplification patterns by primer I3 in 84 Zoysia accessions.

japonica vs. Z. sinica). The mean GSCs of Z. japonica vs. Z. macrostachya (0.746) was similar to that of Z. sinica vs Z. macrostachya (0.748). Meanwhile, the mean GSCs of Z. japonica vs Z. matrella (0.739) was similar to that of Z. sinica vs. Z. matrella (0.738). The mean GSCs of Z. macrostachya vs. Z. matrella (0.732) was the minimum.

Genetic diversity among different geographic groups Based on different geographic origin, the 81 accessions were divided into seven groups. Genetic parameters among the seven groups were analyzed by ISSR marker (Table 4). As shown in Table 4, polymorphism rate significantly varied with geographical groups, from 40.22% in Zhejiang to 75.98% in Liaoning. The observed

number of alleles per locus (na) varied from 1.40 in Zhejiang group to 1.76 in liaonign group. Consequently, it was shown that there was also variation for the effective number of alleles (ne), ranging from 1.22 in Anhui, Zhejiang, Fujian to 1.28 in Liaoning (Table 4). There existed varitions for I within and among the geographical groups, ranging from 0.13 in Zhejiang to 0.18 in Liaoning with an average of 0.15. He did also vary with the geographical groups, ranging from 0.20 in Zhejiang to 0.30 in Liaoning, with an average of 0.25 (Table 4). According to the polymorphism rate and gene diversity index (He and I ), the trend of genetic diversity among the seven groups was as follows: Liaoning group > Shandong group > Jiangsu and Guangdong group > Anhui group > Fujian group > Zhejiang group. The similar results were also obtained by other genetic parameters.

Xie et al.

7665

Table 3. Variance range of genetic similarity coefficient between different species of zoysiagrass.

Genetic similarity coefficient

Species comparison

Within species

Between species

Mean

Minimum

Maximum

Z. japonica vs Z. japonica

0.760

0.649

0.866

Z. sinica vs Z. sinica

0.745

0.649

0.845

Z. macrostachya vs Z. macrostachya

0.778

0.727

0.840

Z. matrella (L.) vs Z. matrella (L.)

0.749

0.691

0.835

Z. japonica vs Z. sinica Z. japonica vs Z. macrostachya

0.751 0.746

0.664 0.662

0.851 0.832

Z. japonica vs Z. matrella (L.)

0.739

0.644

0.827

Z. sinica vs Z. macrostachya

0.748

0.686

0.825

Z. sinica vs Z. matrella (L.)

0.738

0.662

0.802

Z. macrostachya vs Z. matrella (L.)

0.732

0.686

0.804

Table 4. Population genetic parameters of Zoysia sp. germplasm in China.

Parameter GS NPL PR（%） na ne I He

Shandong 19 126 70.39

Liaoning 21 136 75.98

1.70 1.26 0.17 0.27

1.76 1.28 0.18 0.30

Geographical group Anhui Zhejiang Jiangsu 11 5 14 99 72 114 55.31 40.22 63.69 1.55 1.22 0.14 0.22

1.40 1.22 0.13 0.20

1.64 1.25 0.16 0.26

Fujian 4 74 41.34

Guangdong 7 103 57.54

1.41 1.22 0.14 0.21

1.58 1.26 0.16 0.26

GS, Group size; NPL, number of polymorphic loci; PR, polymorphism rate; na, observed number of alleles; ne, effective number of alleles; I, Shannon’s information index; He, average Nei’s gene diversity.

Cluster analysis An UPGMA dendrogram was constructed based on the ISSR data (Figure 2). As a result, all the zoysiagrass accessions could be grouped into ten groups (A to J) and some of these groups (A and C) could be further clustered into subgroups. The results show that the accessions from the same geographic regions were generally, but not completely clusted in the same cluster, indicating a correlation between molecular groupings and the geographical origin. Most of these accessions (52/84=61.9%) were clustered into the group A, which can be futher divided into two sub-groups, A1 and A2. These 52 accessions were collected from Shandong, Jiangsu, Anhui and Liaoning province, respectively (Figure 2). Accessions from the same province or neighboring regions were generally clustered together in the same subgroup. For example, Subgroups A1 comprised 13 accessions from Shandong,

10 from Anhui and six from Jiangsu province. Actually, these three provinces are adjacent in geography. Subgroup A2 included all the 21 accessions (61 to 81) collected from Liaoning province, one accession from Shandong province (3) and one commercial cultivar (Grif16454). Also, all of these 52 accessions are Z. japonica and Z. sinica, except one accession of Z. matrella. As for group B, it contained eight accessions collected from Jiangsu province (37 to 44), and two accessions from Zhejiang province. Two of these accessions are Z. japonica, four are Z. sinica and the other four are Z. macrostachya. There were 11 accessions in the group C. Cluster C could be further separated into two subgroups. Subgroup C1 included the seven accessions from Zhejiang, Fujian, Guangdong province, and these accessions belong to four species. Subgroup C2 comprised four accessions and all of these are Z. sinica. The group D was composed of only two accessions collected from Shandong province. Cluster E, G, H, and J

7666

Afr. J. Biotechnol.

Figure 2. Dendrogram of 84 accessions of zoysia derived from an UPGMA cluster analysis based on Jaccard’s similarity coefficient matrix. R1, Province including: ☆, ShanDong; ★, AnHui; ◇, JiangSu; ◆, ZheJiang; □, LiaoNing; △, GuangDong; ▲, FuJian; ■, cultivated species; R2: species including ○, Z. japonica Steud.; ◎, Z. sinica Hance; ¤, Z. macrostachya Franch. Et Sav; ⊿, Z. matrella(L.) Merr.

all had only one accession from Shandong (6), Fujian (51), and Guangdong (60 and 56) province, respectively. Cluster F was composed of two commercial cultivars and

both of these cultivars are Z. japonica, while cluster I contained three accessions from Shandong and Anhui province.

Xie et al.

7667

Figure 3. Principle coordinate analysis (PCA) based on the genetic similarity coefficients derived from the polymorphic ISSR results for the 84 zoysiagrass accessions.

PCA was also performed to display the relationship among the 84 zoysiagrass types on two coordinate axes (Figure 3). The PCA revealed the similar grouping of accessions as the dendrogram constructed by UPGMA and placed the 84 genotypes into four distinct groups. Those accessions in subgroup A2 and cluster F were gathered together. Among the other Chinese natural accessions, those in cluster B and C were separated from others. Both 6 and 60 were separated from the other accessions, which were located in genetic cluster E and H

in the dendrogram, respectively. The cluster D, F, I and the sub cluster A1 of similar origin were grouped together. DISCUSSION In this study, ISSR marker was successfully used to differentiate the 81 Chinese wild zoysia accessions and three commercial cultivars. The 33 selected primers generated 388 bands with an average of 11.76 bands per

7668

Afr. J. Biotechnol.

primer. The polymorphic bands (PPB) accounted for 96.65% of total bands. The high PPB was in agreement with many investigations using ISSR technique in other plant species (Hess et al., 2000; Belaid et al., 2006; Terzopoulos and Bebeli, 2008). Therefore, it suggested that ISSR molecular markers could be effectively used to assess the genetic diversity of wild zoysia genus accessions. In this study, GSCs between each pair of the 84 accessions ranged from 0.644 to 0.866, with a mean of 0.751, suggesting a great level of genetic diversity among Chinese wild zoysiagrass accessions. Guo et al. (2007) also found a wide GSCs ranging from 0.592 to 0.936 among 96 zoysiagrass accessions collected from 12 provinces in China by SSR analysis. The difference in GSCs between these two studies could be due to the difference in accessions amount, the sampling sites, the molecular marker method, and variety of species. Moreover, similar to our findings, Guo et al. (2009) also observed that GSCs within species were higher than that among species by using SRAR markers. In this study, Z. japonica had the most widely GSCs range, followed by Z. sinica. Among the species, the maximum mean GSCs was between Z. japonica and Z. sinica. The mean GSCs of Z. japonica vs Z. macrostachya was similar to that of Z. sinica vs Z. macrostachya and the mean GSCs of Z. japonica vs Z. matrella was similar to that of Z. sinica vs Z. matrella. This was consistent with the distribution range of these four species (Li et al., 2004). Our study indicate that the mean GSCs between the species of Z. japonica and Z. sinica was significantly higher than the other five combinations, which is in agreement with the results of previous studies (Choi et al., 1997a, b; Guo et al., 2007; 2009). Both previous and our results show that zoysiagrass accessions had a great genetic variation regardless of their origination. This might be attributed to the wide distribution of zoysia, north-south across about 20 degrees in latitude (43째22 N to 23째30 N), east-west across about 34 degrees in longitude (109째E to 143째E). Therefore, with the long-term evolution, zoysiagrass formed great genetic variation in order to adapt to the different environment and weather conditions. The study indicates that there was great genetic diversity within and among the geographical groups. The genetic diversity level of seven groups is related to the sample size, the group with more samples which generally had higher genetic diversity level (Sankar and Moore, 2001). The investigations showed that Liaoning and Shandong population possessed richer genetic diversity than other populations. In China, wild zoysiagrass germplasm were distributed mainly in Liaoning and Shandong province. However, the genetic diversity of these two populations was destroyed gradually by human activities. Thereby, it was no surprise that the genetic diversity within these two populations is decreasing. The clustering results demonstrated also that the accessions belonging to the same species were not

completely clustered in the same cluster. For instance, the mean GSCs between Z. japonica and Z. sinica was higher than others, so the majority accessions of these two species were classified together. Cluster A comprised of most of these two species. Cluster B comprised two Z. japonica, four Z. macrostachya and four Z. matrella (L.) accessions. Both clusters D and F comprised two species whereas cluster E, G, H and J had only a single accessions belonging to Z. japonica, Z. sinica, Z. japonica, Z. matrella, respectively. This result indicates that the genetic differentiation in Zoysia sp. in China is less related to the taxonomic status. The same tendency was found by RAPD analysis (Lin, 2000), isozyme analysis (Weng, 2002), and SSR and SRAP analysis (Guo, 2007, 2009). Weng et al. (2007) also reported that UPGMA analysis result was inconsistent with the morphological classification of zoysia in conventional taxonomy. This phenomenon may be related with specific adaptation, flowering habit and pollination system. Probably, due to the high ability of zoysia sp. to hybridize interspecifically, the gene flow might have occurred among species. Numerous previous studies indicated that there might be certain mechanisms to promote cross-pollination in zoysia species (Hong and Yean, 1985). Thus, the outcrossing breeding system perhaps accounted for high levels of genetic variation within species and high levels of genetic similarity coefficient among species. The UPGMA clustering analysis indicated that the zoysiagrass acessions from same or adjacent regions were inclined to be classified together. This indicated that those accessions grown in a similar environment also tended to be classified together. It seems that there is some correlation between the molecular groups and geographic origins. Similar results were also found by Weng et al. (2007) in zoysia accessions collected in Taiwan, Penghu Islands and Lanyu using RAPD markers. However, there are some exceptions; the 6, 51 and 56 accessions which originated from Shandong, Fujian and Guangdong province respectively were separated from the main groups. Those accessions perhaps have some special genetic feature that is distinct from other zoysia accessions. On the other side, those exceptions might attribute to gene mutation or asexual propagation in regions other than origin area through human activities of river run-off (Yi et al, 2008). Surprisingly, three commercial cultivars were not clustered together although they were all introduced from America. Accession Grif16454 is Z. matrella (L.) which was collected originally from China while the others are Z. japonica gathered from North Korea (Meyer) and other country (Zenith) (Xu et al., 2004). The result shows that Grif16454 was clustered togther with those accessions from Liaoning Province. Therefore, Grif16454 might have been collected from Liaoning province by previous American scholars. To conclude, this study indicates abundant genetic variation among Chinese wild zoyiagrass germplasm. The majority of Chinese natural accessions from the adjacent

Xie et al.

regions were clustered into one group, showing a correlation between molecular groups and geographic origins but differentiated into species. The results might provide valuable information for the conservation of Chinese natural zoyiagrass resources. In addition, this study may also provide useful information for the selection of parental combinations in the zoysia breeding program. ACKNOWLEDGEMENT This research was supported by Innovative Program of The Chinese Academy of Sciences (Project #: KSCX2-YW-N-068) and the National Natural Science Foundation of China (Grant No. 31071822/C150302). REFERENCES Bebeli PJ, Kaltsikes PJ (1993). New developments in varietal identification. In: van Gastel AJG, Pagnotta MA, Porceddu E (Eds.). Seed Sci. Technol. ICARDA. Aleppo. Syria. pp. 161-172. Belaid Y, Chtourou-Chorbel N, Marrakchi M, Trifi-Farah N (2006). Genetic diversity within and between populations of La thyrus genus (Fabaceae) revealed by ISSR markers. Gen. Res. Crop Evol. 53: 1413-1418. Cai Y, Sun DK, Wu GJ, Peng JH (2010). ISSR-based genetic diversity of Jatropha curcas germplasm in China. Biomass and Bioenergy. Doi:10.1016/ j.biombioe. 07.001. Choi JS, Ahn BJ, Yang GM (1997a). Distribution of zoysiagrass (Zoysia sp) in the south and west coastal regions of Korea and classification using morphological characteristics. J. Korean Soc. Hortic. 38: 399-407. Choi JS, Ahn BJ, Yang GM (1997b). Classification of zoysiagrass (Zoysia. sp.) native to the southwest coastal of Korea using RAPDs. J. Korean Soc. Hort. Sci. 38: 789-795. Choi JS, Yang GM (1996). PCR conditions for effective identification of Korean native zoysiagrass (Zoysia sp.) species by DNA polymorphism. J. Korean Soc. Hort. Sci. 37: 166-170. Curley J, Jung G (2004). RAPD-based genetic relationships in Kentucky bluegrass comparison of cultivars, interspecific hybrids, and plant introductions. Crop Sci. 44: 1299-1306. Doyle JJ (1991). DNA protocols for plantsd CTAB total DNA isolation. In: Hewitt GM, Johnston A (Eds.). Molecular Techniques in Taxonomy. Springer- Verlag, Berlin, pp. 283-293. Fan Y, Li F, Zhang XQ, Ma X (2007). Genetic diversity of Hemarthria compress a germplasm detected by inter-simple sequence repeat (ISSR). Acta Pratacult. Sinica. 8: 76-81. Fukuoka H (1989). Breeding of Zoysia sp (in Japanese). J. Jpn. Soc. Turfgrass Sci. 17: 183-190. Guo HL, Liu JX, Zhou ZF, Xuan JP (2007). Interspecific Relationship and Genetic Diversity of Zoysiagrass Revealed by SSR Markers. Acta Agrestia Sinica, 16: 552-558. Guo HL, Zheng YQ, Chen X, Xue DD, Liu JX (2009). Genetic diversity and relationships of zoysiagrass as revealed by SRAP markers. Acta Agrestia Sinica, 18: 201-210. Hess J, Kadereit W, Vargas P (2000). The colonization history of Olea europaea L. in Macaronesia based on internal transcribed spacer 1 (ITS-1) sequences, randomly amplified polymorphic DNAs (RAPD) and inter-simple sequence repeats (ISSR). Mol. Ecol. 9: 857-868. Hong K, Yean DY (1985). Studies on interspecific hybridization in Korean lowngrasses (Zoysia sp.). J. Korean Soc. Hort. Sci. 26: 169-178. Jin H, Han LB (2004). Progress on genetic diversity of Zoysia japonica Steud. J. Bejing For. Uni. 26: 91-95. Jin H, Han LB, Zhang YM (2004). Studies on the Morphological Variation of Zoysia japonica in Populations. Grassland of China. 26: 50-56.

7669

Kitamura F (1970). Studies on the horticultural classification and development of Japanese lawn grasses. Bull, Kemigawa Arboretum, Fac. Agric. Univ. Tokyo. 3: 1-60. Kitamura F (1989). The climate of Japan and its surrounding areas and the distribution and classification of zoysiagrasses. Int. Turfgrass Soc. Res. J. 6: 17-21. Kimura M, Crow JF (1964). Number of alleles that can be maintained in finite population. Genetics. 49(4): 725-738. Li Y, Geng L, Liu JX (2004). Assessment on Salt-tolerance of Zoysia sp. in China. Acta Agrestia Sinica. 12: 8-16. Lin CY (2000). The response of Zoysia sp. to salinity and it’s genetic variation. MS. thesis, National Chung-Hsing University, Taichung, Taiwan. Liu W, Zhang XQ, Li F, Ma X, Fan Y (2007). Genetic diversity of bermudagrass accessions in southwest China by ISSRs molecular markers and geographic provenance. Acta Pratacult. Sinica. 16: 55-61. Nei M (1973). Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA. 70(12): 3321-3323. Nybom H (1994). DNA ingerpringting-a useful tool in fruit breeding. Euphytica, 77: 59-64. Reddy MP, Sarla N, Siddiq EA (2002). Inter simple sequence repeat (ISSR) polymorphism and its application in plant breeding. Euphytica, 128: 9-17. Sankar AA, Moore GA (2001). Evaluation of inter-simple sequence repeat analysis for mapping in Citrus and extension of the genetic linkage map.Theor. Appl. Genet. 102: 206-214. Shoji S (1983). Species ecology of zoysiagrass. J. Jpn. Soc. Turfgrass Sci. 12: 105-110. Shannon CWW (1949). The mathematical theory of communication. Urbana. University of Illinois Press. Sneath PHA, Sokal RR (1973). Numerical Taxonomy. Freeman, San Francisco CA. Terzopoulos PJ, Bebeli PJ (2008). Genetic diversity analysis of Mediterranean faba bean (Vicia faba L.) with ISSR markers. Field Crop Res. 108: 39-44. Weng JH, Chen YC (2001). Variation of salinity tolerance in Zoysia clones collected from different habitats in Taiwan. Plant Prod. Sci. 4: 313-316. Weng JH, Fan MJ, Lin CY (2007). Genetic Variation of Zoysia as revealed by random amplified polymorphic DNA (RAPD) and Isozyme pattern. Plant Prod. Sci. 10: 80-85. Weng JH (2002). Genetic variation of Zoysia in Taiwan as analyzed by isozyme patterns and salinity toerance. Plant Prod. Sci. 5: 236-241. Weng JH, Liao TS, Chen YC (1995). Distribution and morphological variation of Zoysia sp. grown in Taiwan. J. Agric. Assoc. China, 169: 44-54. Xiao HJ, Xu Z, Li LH, Ma YB, Cao SJ (2007). Genetic Diversity of Roegneria Genera Studied by ISSR Markers. Acta Agric. Boreali-Sinica, 22: 146-150. Xu LG, Tan ZJ, Tan JQ (2004). The Origin and Applied Region of Zoysiagrasses in USA. Acta Horticult Sin. 31(1): 124-129. Yaneshita M, Nagasawa R, Engelke MC (1997). Genetic variation and interspecific hybridization among natural populations of zoysia-grasses detected by RFLP analyses of chloroplast and nuclear DNA. Gene. Genet. Syst. 72: 173-179. Yi YJ, Zhang XQ, Huang LK, Ling Y, Ma X, Liu W (2008). Genetic diversity of wild Cynodon dactylon germplasm detected by SRAP markers. Hereditas, 30: 94-100. Zeng B, Zhang XQ, Fan Y, Lan Y, Ma X, Peng Y, Liu W (2006). Genetic diversity of Dactylis glomerata germplasm resources detected by inter-simple sequence repeats (ISSRs) Molecular Markers. Hereditas, 28: 1093-1100.

African Journal of Biotechnology Vol. 11(30), pp. 7670-7675, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.1192 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

An investigation on mechanisms of blanked nut formation of hazelnut (Corylus heterophylla fisch) Jian-feng Liu, Yun-qing Cheng*, Kun Yan and Qiang Liu College of Life Sciences, Jilin Normal University, Siping 136000, China. Accepted 22 July, 2011

The occurrence of blank nuts is common in Corylus heterophylla Fisch orchards of China. This study was aimed to find the possible mechanisms involved in blank nuts formation in wild C. heterophylla Fisch species. The effects of pollination, defoliation and girdling on fruit production of C. heterophylla Fisch were studied from northern China. The effect of pollination on various aspects of the reproductive output of C. heterophylla Fisch was studied by performing hand pollination, open pollination and no pollination. Different pollination types significantly affected flower cluster set including no flower cluster set produced in no pollination treatment. However, pollination type had no direct effect on nut and kernel traits. Three defoliation treatments (control, 50 and 100% leaf removal) were applied at branch level on 10 trees. Six branches were used per treatment in each tree and half of these branches were girdled (a ring of bark and cambium was removed from the branch base). Leaf removal from ungirdled branches had little effect on pistillate flower cluster set, fruit cluster set and nuts per cluster. However, these variables decreased as the extent of 100% defoliation increased on girdled branches. Defoliation and girdling reduced nut and kernel weight which was the result of a reduction in the kernel weight rather than nut coat reduction. Control of the carbohydrate supply to the reproductive shoots by girdling and defoliation made no difference to nut number and size but the kernel percent and blank nut ratio were highly sensitive to carbohydrate availability. Resource importation not exportation by fruiting branches might be a mechanism to reduce blank nut in this species. Key words: Corylus heterophylla Fisch, pollination, defoliation, girdling, blank nut.

INTRODUCTION Corylus heterophylla Fisch, the Asian Hazel is a species of hazel native to eastern Asia including northern China, eastern Mongolia, Korea, Japan and southeastern Siberia (Whitcher and Wen, 2001). Although the nuts of C. heterophylla Fisch have smaller and thicker shells characteristics; the important wild species in China was cultivated commercially for some desirable and economically important traits such as flavor, nonsuckering growth habit, and tolerance to alkaline soil, and exceptionally early maturation and cold hardiness. C. heterophylla Fisch is at present an expanding crop in China due to increased demand by the processing industry. Fruit production of hazelnuts mainly depends on

*Corresponding author. E-mail address: chengyunqing1977@163.com Tel: +86-434-3294489.

the number of female flower setting fruit. Thus, maximizing fruit set is an important measure to increase hazel production. The occurrence of blank nuts is common in C. heterophylla Fisch orchards. Shell-kernel weight ratio is the main determinate of quality and price of hazelnuts. The most common defect “blank nuts” in Chinese cultivar have a significant effect on the shell-kernel weight ratio. “Blank” means a filbert containing no kernel or a kernel filling less than one-fifth capacity of the shell. Most species of hazelnut are largely self-incompatible and a number of studies have suggested that self-incompatibility was often associated with a higher frequency of blanks (Erdogan and Mehlenbacher, 2001; Beyhan and Marangoz, 2007). One of the more intriguing aspects of the reproductive biology of hazelnuts is the temporal separation of pollination and fertilization. At the time of pollination, the ovary is not formed and grows only if the flower is pollinated.

Liu et al.

The formation of ovules begins in March and fertilization occurs by the end of May or during the first three weeks of June; two to three months after pollination when the diameter of the nuts is 7 to 10 mm (Germain, 1994). Therefore, different environmental stressors often occur at different stages between pollination and fertilization and lead to poor nut set and higher frequency of blanks (Solar and Stampar, 2001). Hazelnuts fill their fruits in the months of June, July and August. C. heterophylla Fisch has high fruit set and large amount of photosynthates are needed during kernel filled stage while photosynthate sinks closest to the leaves tend to be the strongest, so insufficient photosynthates importing into nuts in the filled stage can result in shriveled kernels (Kholupenko et al., 2003). Thus, some authors suggested that the limited resource translocation of carbohydrates from the photosynthetic pool was a possible cause of blank nuts. We investigated possible mechanisms involved in the blank kernels formation in wild C. heterophylla Fisch species. The following two hypotheses were set and tested: H1: The self-incompatible characteristics in C. heterophylla Fisch have an effect on the cluster set of nuts but not the reason of blanked nut. H2: The lack of assimilate substances during development of fertilization fruits is the possible cause of blanks and shriveled kernels.

MATERIALS AND METHODS The study was conducted at an area located in the Siping region (Jilin, China, 43° 09′ 20″ N, 124° 30′ 16″ E) from March 2008 to October 2009. The area has a slope around 5% with a southwestern aspect. The adjacent vegetation is mainly natural evergreen forest with some cleared farmland nearby. The C. heterophylla Fisch species are grown in the shrub growing form in China, thus the experimental unit was shrub growing system. Samples were collected from five systems (six plants per shrub system). All studied individuals were exposed to sunlight. Plant height ranged from approximately 1.2 to 2.3 m. Pistillate flower clusters (cymule) and fruit clusters of wild C. heterophylla Fisch species were examined from 2008 to 2009. The effect of pollination on various aspects of the reproductive output of C. heterophylla Fisch was studied by performing hand pollination, open pollination and no pollination. Open-pollinated flowers were collected weekly during the flowering period. For artificial pollination, one to two branches of each tester tree were emasculated by clipping catkins and were covered with Tyvek bags (1*0.5 m) in late March. This was done to isolate female inflorescence and prevent exposure to air-borne pollen. A second Tyvek bag was used to cover and protect the inner bag from damage by wind. Only female flowers from covered branches were used for hand pollination and no pollination test. Abrasion of the styles of flowers by the bag renders them unsuitable for testing. When staminate catkins elongate and are about to shed pollen, they were collected, placed on a sheet of paper in the laboratory and allowed to dry overnight at room temperature (20°C). The following morning the catkins were discarded and pollen was collected and stored in cotton-stoppered vials in the freezer (4°C) for pollination. Hand pollination was made by dusting self-pollen over receptive stigmas with a thin soft brush.

7671

No pollination was made on individual branches or the entire trees depending on plant size. Some unpollinated flowers were collected when styles were visible. Hand pollinated flowers were collected after hand pollination for 24 h. When staminate catkins elongate and are about to shed pollen, they were collected, placed on a sheet of paper in the laboratory and allowed to dry overnight at room temperature (24°C). The following morning, the catkins were discarded and pollen was collected from testers and stored in cotton stopper glass vials at 0°C until used. Some female flowers were pollinated by hand when styles were visible outside the bud or were exerted beyond the red dot stage (>2 mm). The numbers of treated flowers and harvested nut clusters were counted and percent cluster set was calculated as the ratio of nut clusters to flowers pollinated. Pistillate flower clusters were harvested 24 h after hand and no pollination, and styles were processed for fluorescence microscopy for pollen germination and tube growth as follows: for cytochemical assays with bright field and epifluorescence observations using a light microscope, the sampled material was fixed in formalin-acetoalcohol (FAA) for 48 h and then transferred to 70% ethanol for storage. Fixed samples were then dehydrated in an ethanol series (50, 80, 95, 100, 100%: 12 h each) and transferred to an embedding solvent (xylene; Panreac Quimica SA, Montcada i Reixac, Spain) through a xylene-ethanol series (30, 50, 80, 100, 100%: 12 h each) and finally saturated with paraffin (Paraplast Xtra; Sigma, St Louis, USA). Sections (10 µm thick) were cut with a rotary microtome (Nahita 534; Auxilab SA, Beriain, Spain) and attached to adhesive-treated microscope slides (polysine slides; Menzel GmbH & Co KG, Braunschweig, Germany). Samples were embedded in paraffin, sectioned at 10 mm in a rotary microtome and stained with hematoxylin or safranin-fast green (Odabas, 1976). A girdling treatment was applied to the fruit branch to inhibit the supply of assimilates and/or other substances to the fruit via phloem transport. The effect of this girdling on the occurrence of blanks on the tree was then investigated. The effect of defoliation and girdling on nut characteristics of C. heterophylla was studied after flowering finished. From 28 May 2008, we selected 10 trees for study. After measuring the number of leaves and the fruits on these twigs, 18 tagged shoots per tree were selected for defoliation. Three defoliation treatments (control, 50 and 100% leaf removal) were applied at branch level in 10 trees. Six branches were used per treatment in each tree and half of these branches were girdled. A subset of reproductive shoots was girdled by removing a ring of bark and cambium approximately 1.0 cm wide from the base of the shoot and 5 mm in diameter. This procedure interrupts phloem transport but does not affect xylem transport (Obeso, 1998). Other tagged shoots that were neither defoliated nor girdled, acted as controls. The presence or absence of fruit developed from each flower was recorded so as to determine the fruit set in late-May (the green fruit period just after flowering, hereafter called initial fruit set), in mid-July (the middle stages of seed maturation, hereafter called middle fruit set) and in mid-September (the final stages of seed maturation, hereafter called final fruit set). To examine the effect of assimilate limitation and pollination on fruit traits, the following variables were determined; the green fruits were counted on 28 May as the time for defoliation and girdled. The tagged branches with ripe nuts were harvested on 28 September and the following variables were determined after oven drying; for each sample, the following characters were examined: nuts per cluster, nut and kernel weights, kernel percent (%), shell thickness (mm), good kernel (%) and blank nut (%). In addition, flower cluster drop (%) and fruit cluster drop (%) were examined in the pollination samples. The design of each experiment was completely randomized with a one-way ANOVA arrangement. Statistical analyses were performed with SAS system 8.0 software and the means were compared using Duncan’s multiple range test at 5% level (Duncan, 1955) and values expressed as a percentage were previously

7672

Afr. J. Biotechnol.

Table 1. Cluster set in different pollinations treatments of hazelnuts for the period of 2008 to 2009.

Hand pollination Open pollination No pollination

Number of pollination 120 120 60

Pistillate flower cluster drop ratio/percentage e 10.83±0.41 31.67±1.50c 100.00a

Fruit cluster drop ratio/percentage b 29.47±1.15 22.50±0.96d -

Total drop ratio/percentage e 40.30±2.10 54.17±2.65c 100.00a

Hand pollination Open pollination No pollination

120 120 60

13.33±0.68d b 35.83±1.63 a 100.00

34.17±1.50a c 25.00±1.30 -

47.50±2.95d b 60.83±3.47 a 100.00

1.95

2.22

3.54

Year

Treatment

2008

2009

LSD at 0.05

Values are means ± SD. Different letters within a column indicate significant difference at 5% level by Duncan’s multiple range tests.

Table 2. Cluster set and frequency of blank nuts at different defoliation and girdling treatments.

Parameter

Control Ungirdled Girdled

Pistillate flower cluster 26.43±1.35bc drop ratio/percentage Fruit cluster drop 35.26±1.87b ratio/percentage c total drop ratio/percentage 61.69±1.67

50% defoliation Ungirdled Girdled

100% defoliation Ungirdled Girdled

LSD at 0.05

25.45±1.58c

28.67±1.35ab

30.32±1.18a

30.09±1.29a

29.43±1.62a

2.64

34.23±1.91b

37.73±1.77b

37.56±1.53b

35.39±1.94b

52.27±2.97a

3.85

b

b

c

59.68±1.77

b

66.4±1.60

67.88±1.39

65.48±1.71

a

81.7±2.58

4.29

Values are means ±SD. Different letters within a line indicate significant difference at 5% level by Duncan’s multiple range tests.

transformed by calculating the angular transformation.

RESULTS AND DISCUSSION The different pollination treatment had significant effect on the flower and nut cluster set (Table 1). No flower cluster set was observed in the no-pollinated hazelnut shoots in both years. The total cluster drop varied from 54.17 to 60.83% in both years in the open pollination treatment and there was significant difference for total cluster drop between 2008 and 2009. In C. heterophylla Fisch, hand pollination significantly decreased the pistillate flower cluster drop when compared with the open pollination and no pollination treatments but the fruit cluster drop ratio in the hand pollination treatment was higher than the open pollination in both years. Both pistillate flower cluster drop ratio and fruit cluster drop ratio were relatively high in the control treatment, and defoliation and girdling affected both the pistillate flower cluster drop ratio and the fruit cluster drop (Table 2). Defoliation had little effect on the fruit cluster drop of the ungirdled branches but reduced the fruit cluster set on girdled branches especially the final fruit cluster set. Considering the ungirdled branches alone, 50 and 100% defoliation treatment showed no reduced fruit cluster production compared with the control branches. When girdled branches are considered, fruit cluster drop

increased from 34.23 to 52.27% as the extent of defoliation increased from 0 to 100 % (Table 2). Beyhan and Marangoz, (2007) reported that cluster droppings were caused by the genetic constitution of the cultivar, alternate bearing habit, pollen source, sexual incompatibility, cultural practices (nutritional deficiencies, lack of irrigation, disease and insect pests) and environmental conditions. According to our result, difference in the percentage of the pistillate flower cluster dropping between different pollination types in the same cultivar was evident. No flower cluster set (initial fruit set) was observed in the no-pollinated hazelnut shoots in both years. Thus, we believed that pollination and fertilization had a direct effect on the flower cluster set. Thompson (1979) also reported that some ovaries could not grow more than 0.5 mm and these no pollination pistillate flowers dropped in April and May. Thus, lack of fertilization directly led to flower or nut drop. Hand pollination, open pollination and no pollination was performed in the field to verify the effect of pollination and fertilization on the empty of hazelnuts (Table 3 and Figure 1). Fluorescing pollen tubes can be seen at the base of the style after pollinations for 24 h (Figure 1A). We can observe the complete embryo even in the blank nuts (Figure 1F). Hand pollination significantly increased the nuts per cluster compared with the open pollination. But the open pollination was beneficial for the kernel weight and the kernel percent compared to hand pollination

Liu et al.

Table 3. Nut and kernel traits in controlled and open pollinations of hazelnuts for the period of 2008 to 2009.

Hand pollination Open pollination No pollination

Number of nuts per cluster a 4.22±0.15 3.57±0.15b -

Nut weight (g) a 1.61±0.06 1.45±0.06b -

Kernel weight (g) b 0.41±0.02 0.36±0.01c -

Kernel percent (%) bc 25.47±0.99 24.83±1.01c -

Good Blank kernel (%) nut (%) a a 60.4±2.35 44.6±1.54 ab 56.7±2.32 43.3±1.77a -

Hand pollination Open pollination No pollination

4.19±0.15a b 3.32±0.12 -

1.69±0.06a b 1.47±0.05 -

0.46±0.02a b 0.42±0.02 -

27.22±1.27ab a 28.57±1.11 -

61.2±2.87a b 54.5±2.12 -

43.8±1.82a a 45.5±1.77 -

0.36

0.12

0.03

2.08

5.24

3.27

Year

Treatment

2008

2009

LSD at 0.05

Values are means ± SD. Different letters within a column indicate significant difference at 5% level by Duncan’s multiple range tests.

Figure 1. Pollen tubes in a pollinated pistil, and development of full and empty nut of Corylus heterophylla. A) control style; B) fluorescing pollen tubes can be seen in style; C) complete embryo could be observed in full nut; D) blank nut, arrow showed the embryo location in blank nut; E) embryo filling the entire ovule; F) complete embryo could be observed in blank nuts (D).

7673

7674

Afr. J. Biotechnol.

Table 4. Nut and kernel traits at different defoliation and girdling treatments.

Parameter Number of nuts per cluster Nut weight (g) Kernel weight (g) Nut coat (g) Kernel percent (%) Good kernel (%) Blank nut (%)

Control Ungirdled Girdled

50% defoliation Ungirdled Girdled

4.72±0.18ab

4.92±0.24a

4.56±0.15bc

4.62±0.18abc

ab

a

b

ab

1.45±0.06 b 0.36±0.01 b 1.09±0.04 b 34.83±1.32 b 46.5±1.95 53.5±2.08c

1.53±0.06 a 0.47±0.02 b 1.06±0.04 a 38.83±1.86 a 59.3±3.44 40.7±1.54d

1.38±0.05 c 0.30±0.01 b 1.08±0.04 c 29.70±0.95 c 41.7±1.54 58.3±2.09c

100% defoliation Ungirdled Girdled

1.47±0.07 c 0.29±0.01 a 1.18±0.06 c 29.72±1.15 c 44.6±2.18b c 55.4±2.82

4.63±0.20abc c

1.21±0.06 d 0.17±0.01 b 1.04±0.05 d 21.05±0.90 d 25.3±1.19 74.7±3.51b

LSD at 0.05

4.34±0.20c

0.33

c

0.10 0.02 0.08 2.22 3.39 7.46

1.14±0.05 e 0.08±0.00 b 1.06±0.05 e 16.45±0.76 e 11.3±0.52 88.7±4.08a

Note: values are means ±SD. Different letters within a line indicate significant difference at 5% level by Duncan’s multiple range tests.

(Table 3). The ratio of blank nut changed from 43.8 to 45.6% between the hand and open pollination in 2008 and 2009; different pollination model had no significant effect on the blank ratio. A higher frequency of blanks was believed from sexual incompatibility (Erdogan and Mehlenbacher, 2001; Silva et al., 1996) but in our study, no nuts formation can be observed if the flower were not pollinated and fertilized. Furthermore, complete embryo structure can be observed even in the blank nut (Figure 1). So we concluded that unpollinated flower never reaches the size of a blank nut (Thompson, 1967). We could easily see the fluorescing pollen tubes at the base of the style after pollinations for 24 h; hence, we deduced the high frequency of blank nuts not caused by selfpollination. The results of nut and kernel traits at different defoliation and girdling are shown in Table 4. Girdling and defoliation had little effect on the nuts of per cluster; when 100% defoliated branches were girdled, the branches decreased 9% of their nut production per cluster in proportion to the control ungirdled branches and they produced 88.2% of nut production per cluster in the control girdled branches. The detrimental effect of defoliation and girdling consisted in a reduction of nut and kernel weight which was the result of a reduction in the kernel weight rather than nut coat reduction. The proportion of the good kernel made up by the kernel and nut coat varied among treatments from 16.45 to 38.83%. The ratio of blank nut and kernel percent were significantly affected by defoliation and girdling. In the control treatment, girdling branch produced more kernel percent and low blank nut ratio than girdled branch. But in 50 defoliation treatment, there was no significant different in the kernel percent and blank nut ratio. But in 100 defoliation treatment, the kernel percent (16.45%) and blank nut ratio (88.7%) in the girdled branch was higher than the ungirdled branch (11.3 and 74.7%). Girdling and defoliation and their reaction had little effect on the nuts of per cluster. There was little reduction in nut production in the girdled-100% defoliated branches when compared with the control branches.

There are two alternative explanations for this result: either the nuts of per cluster was not decided by assimilates content but by fertilization or the only sources of assimilates for these branches were the reserves stored in the shoots and/or photosynthesis on green fruits (Hogewoning et al., 2007; Obeso, 1998; Hoch, 2005). Defoliation and girdling and their reaction significantly affected nut mass, which was the result of a reduction in the mass of the kernel rather than the nut coat reduction. Kernel weight proportion of the fruit made up by the kernel mass and nut mass varied among treatment from 16.45 to 38.83%, which means that nut coat was maintained despite whole nut mass reduction (Table 4). When girdling in the control branch was applied, the branches increased the kernel percent and decreased the blank ratio in proportion to the ungirdling branch. However, when 100% defoliated branches were girdled, they produced lower kernel percent (16.45%) and higher blank nut ratio (88.7%) than the ungirdled branch which means that they exported some assimilates to other branches in the cultivation practices (Rivas et al., 2007; Goren et al., 2004). Increase kernel percent and decrease in the blank nut ratio may be the import of resources from other branches rather than export. The ability of resource importation developed by fruiting branches might be a mechanism to increase nut and kernel trait in this species. ACKNOWLEDGEMENT The authors thank the National Natural Science Foundation of China for the financial support (Grant numbers: 31070610/C161102). REFERENCES Beyhan N, Marangoz D (2007). An investigation of the relationship between reproductive growth and yield loss in hazelnut. Sci. Hortic. 113(2): 208-215. Erdogan V, Mehlenbacher SA (2001). Incompatibility in wild Corylus species. Acta. Hort. (ISHS) 556: 163-170.

Liu et al.

Germain E (1994). The reproduction of hazelnut (Corylus avellana L.): a review. Acta Hortic. (ISHS)351: 195-210. Goren R, Huberman M, Goldschmidt EE (2004). Girdling: physiological and horticultural aspects. Hortic. Rev. 30: 1-36. Hoch G (2005). Fruit-bearing branchlets are carbon autonomous in mature broad-leaved temperate forest trees. Plant Cell Environ. 28: 651-659. Hogewoning SW, Trouwborst G, Engbers GJ, Harbinson J, Van Ieperen W, Ruijsch J, Van kooten O, Schapendonk AHCM, Pot CS (2007). Plant physiological acclimation to irradiation by light-emitting diodes (LEDS). Acta Hort. (ISHS)761: 183-191. Kholupenko IP, Voronkova NM, Burundukova OL, Zhemchugova VP (2003). Demand for assimilates determines the productivity of intensive and extensive rice crops in primorskii krai. Russian J. Plant Physiol. 50(1): 112-118. Obeso JR (1998). Effects of defoliation and girdling on fruit production in ilex aquifolium. Funct. Ecol. 12(3): 486-491.

7675

Rivas F, Gravina A, Augustí M (2007). Girdling effects on fruit set and quantum yield efficiency of PSII in two Citrus cultivars. Tree Physiol. 27: 527-535. Silva AP, Riberio RM, Santos A, Rosa E (1996). Blank fruits in hazelnut (Corylus avellana L.) cv. ‘Butler’: characterization and influence of climate. J. Hort. Sci. 71(5): 709-720. Solar A, Stampar F (2001). Influence of boron and zinc application on flowering and nut set in Tonda di gifoni hazelnut. Acta Hortic. 556: 307-309. Thompson MM (1967). Role of pollination in nut development. Proc. Nut Growers Soc. Ore. Wash. 53: 31-36. Thompson MM (1979). Growth and development of the pistillate flower and nut in 'Barcellona' filbert. J. Am. Soc. Hort. Sci. 104: 427-432. Whitcher IN, Wen J (2001). Phylogeny and biogeography of Corylus (Betulaceae): inferences from ITS sequences. Syst. Bot. 26: 283-298.

African Journal of Biotechnology Vol. 11(30), pp. 7676-7685, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3345 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Effects of soil flooding on photosynthesis and growth of Zea mays L. seedlings under different light intensities Xiuping Wang1,2, Tianxue Liu1,2, Chaohai Li1,2* and Hao Chen1,2 1

Agronomy College, Henan Agricultural University, Zhengzhou 450002, P. R. China. Huanghuaihai Regional Innovation Center for Maize Technology, Ministry of Agriculture, Zhengzhou 450002, P. R. China.

2

Accepted 14 March, 2012

Soil flooding is one of the major abiotic stresses that repress maize (Zea mays L.) growth and yield, and other environmental factors often influence soil flooding stress. This paper reports an experimental test of the hypothesis that light intensity can influence the responses of maize seedlings to soil flooding. In this experiment, maize seedlings were subjected to soil flooding at the two-leaf stage under control light (600 µmol m-2 s-1) or low light (150 µmol m-2 s-1) conditions. Under control light growth conditions, the average photosynthetic rate (PN), transpiration rate (E) and water use efficiency (WUE) were 70, 26 and 59%, respectively, higher in non-flooded than in flooded seedlings; and the average chlorophyll a (Chl a), chlorophyll b (Chl b) and Chl a+b were 31, 42 and 34%, respectively, higher in non-flooded than in flooded seedlings; and the average belowground biomass and total biomass were 52 and 34%, respectively, higher in non-flooded than in flooded seedlings. There was a slight decrease of seedling biomass in six days flooded seedlings under low light growth conditions. The effects of flooding on photosynthetic, seedling growth and shoot/root ratio were more pronounced under control light growth conditions than under low light growth conditions, which indicate that even for maize which is a C4 plant, relatively high light intensity still aggravated soil flooding stress, while low light growth condition mitigated soil flooding stress, and suggests that light effects should be considered when we study maize responses to soil flooding. Key words: Biomass accumulation, gas exchange, light limitation, maize, stress. INTRODUCTION Flooding is one of the remarkable abiotic stresses and yield-limiting factor following water shortage, salinity and extreme temperatures in most arable farmland for many crops (Rosenzweig et al., 2002; Huang and Rozelle,1995; Visser et al., 2003). Soil flooding rapidly depletes soil oxygen and lowers soil redox pote-ntial; thereby, the roots

*Corresponding author. E-mail: lichaohai2005@yahoo.com.cn. Tel: 86-0371-63555629. Fax: 86-0371-63555629. Abbreviations: C4, C4 Plants; Chl, chlorophyll; Ci, intercellular CO2 concentration; E, transpiration rate; Fv/Fm, maximum photochemical efficiency of PSII; gs, stomata conductance; NF, non-flooded; PN, net photosynthetic rate; PPFD, photosynthetic photon flux density; PSII, photosystem 2; RuBPCO, ribulose-1,5-bisphosphate carboxylase/oxygenase; WUE, water use efficiency.

suffer a shortage of oxygen and roots aerobic respiration is dramatically decreased. This will result in a sharp decline in ATP level (Vartapetian and Jackson, 1997). Insufficient energy reduces mineral elements, water absorption and transportation, thereby, altering diverse aspects of plant metabolism such as accelerating lipid peroxidation and leaf senescence and inhibiting growth (Kozlowski, 1984; Pezeshki, 2001; Boru et al., 2003; Yan et al., 1996; Vartapetian and Jackson, 1997). The reduction of net photosynthetic rate (PN) is one of the most important responses of plants to soil flooding which could be caused by stomata and non-stomata limitations to photosynthesis and lead to severe yield reduction (Yordanova and Popova, 2007; Rosenzweig et al., 2002).The stomata limitation occurs in the first few hours after soil flooding and leads to a rapid decrease in photosynthesis and transpiration by monitoring stomata morphometric, intercellular CO2 (Ci) and stomata

Wang et al.

conductance (gs) (Yordanova et al., 2005; Jackson, 2002). With prolonged flooding stress, non-stomata limitation also plays an important role in photosynthesis reduction. The non-stomata limitation is mainly caused by the damage of photosynthetic apparatus and lower biochemical reactions efficiency of the photosynthesis. This includes lipid peroxidation caused by chloroplast membrane structure destruction, ribulose-1,5bisphosphate carboxylase/oxygenase (RuBPCO) activity and maximum photochemical efficiency of PSII (Fv/Fm reduction) (Yordanova and Popova, 2007; Pociecha et al., 2008; Yordanova and Popova, 2001; Mielke and Schaffer, 2010a). Leaf chlorophyll destruction of flooded plants was also confirmed by a great deal of studies (Yan et al., 1996; Yordanova and Popova, 2001; Mielke and Schaffer, 2011; Jing et al., 2009). Responses to soil flooding could also be influenced by other environmental factors such as temperature and light (Ojeda et al., 2004; Mielke and Schaffer, 2011; Mielke and Schaffer, 2010a, b, 2011; Lavinsky et al., 2007). The interaction effects between soil flooding and light intensity on photosynthesis have been discovered on C3 species (Mielke and Schaffer, 2010a, b, 2011; Lavinsky et al., 2007). However, little attention was paid to C4 species because the C4 species have a higher light saturation point and light use efficiency. During the crop growth period, flooding stress was often caused by heavy precipitation or prolonged rainfall accompanied by dense clouds and low irradiance for photosynthesis. Since most of the cereal crops are fond of light, lots of agronomists did a lot of studies on the effects of low irradiance on crops photosynthesis physiology (Li et al., 2005; Zhang et al., 2007; Drozak and Romanowska, 2006) and yield (Lazaro et al., 2010; Earley et al., 1966; Gerakis and Papakostatasopoulou, 1980; Kiniry and Ritchie, 1985; Reed et al., 1988; Jia et al., 2011). The authors are aware of few published work on the effects of both flooding and different irradiance on photosynthesis physiology of mesophyte C4 species. To test the hypothesis that different light intensities can alter the response of mesophyte C4 species to soil flooding on photosynthesis, we conducted an experiment aiming at investigating the effects of soil flooding under control light (600 µmol m-2 s-1) and low light (150 µmol m-2 s-1) conditions on chlorophyll fluorescence, leaf chlorophyll content and leaf gas exchange of Zea mays L., which is an important high light demanding crop and most sensitive to soil flooding at two-leaf stage (Liu et al., 2010).

MATERIALS AND METHODS Plants cultivation and treatments Maize elite hybrid

ZhengDan958

(ZD958)

was

used

in

this

7677

experiment. Seeds were sown in plastic pots (6 L) with Eutric Cambisol sandy loam soil (USDA), which was taken from the Experimental Farm of the Henan Agricultural University, China, amended with 1.0 g (NH4)2SO4, 0.8 g P2O5 and 0.6 g K2O per kg soil and cultivated at light intensity of 600 µmol m-2 s-1 at canopy height, 14/10 h day/night, 28/22°C day/night and about 60% relative humidity in a growth chamber until the second leaf fully expanded. The low light treatment was grown at light intensity of 150 µmol m-2 s-1 at canopy height with other environmental factors kept the same with the high light treatment. Flooding stress was initiated at the two-leaf stage by filling with water to 20 to 30 mm above the soil surface. The controls were irrigated as needed to avoid drought stress or flooding stress.

Gas exchange measurements Leaf gas exchange was measured on the second leaf at six days after flooding treatment. PN, gs, Ci and E were simultaneously recorded with a portable photosynthesis measurement system (CIRAS-1, PP-System, Hitchin, UK) under uniform conditions [28°C, 450 ± 10 µmol (CO2) mol–1, 60% RH]. The photosynthetic photon flux density (PPFD) was maintained at 600 µmol m-2 s-1. Chlorophyll content analysis and maximum quantum efficiency of PSII determination Leaf pigments were extracted in 20 ml 95% ethanol in the dark by using 0.1 g leaf samples at 25 Leaf pigments were extracted in 20 ml 95% ethanol in the dark by using 0.1 g leaf samples at 25°C till fully blanched. The concentrations of leaf chlorophyll content were determined according to Lichtenthaler (1987), where absorbance was measured at 470, 649 and 664 nm using spectrometer (TU-1810SPC, Purkinje General, China). At various flooding intervals (0, 2, 4 and 6 days), chlorophyll fluorescence was measured with a pulse modulated fluorometer (FMS-2, Hansatech Instruments, Norfolk, UK) in the same leaves previously used for gas-exchange measurements. Minimal fluorescence of darkadapted state (F0) was measured under the low modulating light over a 1.6-s period on leaves adapted to dark for 20 min, and maximal fluorescence of dark-adapted state (Fm) was induced by a single saturating pulse of light (8,000 µmol m-2 s-1) applied over 0.8 s. The Fv/Fm was determined as (Fm - F0)/Fm.

Biomass allocation Plant biomass was measured using five seedlings per pot. After separating plants into shoots and roots, biomass accumulation was determined after drying to a constant weight at 70°C, and the shoot/root ratio was calculated as the ratio of shoot to root biomass.

Statistical analysis General linear model univariate analysis was used to assess the relationships between flood and light intensity treatments simultaneously. When interactive effects between flooding and light intensity were observed, independent-samples T-test was used for comparisons of flooding effects within light environments and light intensity effects within flood treatments. When interactive effects were not observed, only comparisons between flood treatments within light environments were analyzed by independent-samples T-test. Data were expressed as mean ± standard deviations (SD) of four replications within each factor. All analyses were performed using SPSS 16.0 for Windows (SPSS, Inc., Chicago, IL).

7678

Afr. J. Biotechnol.

Table 1. Responses of net photosynthetic rate (PN), intercellular CO2 concentration (Ci), stomata conductance (gs), transpiration rate (E) and water use efficiency (WUE) to soil flooding under control light (CL, 600 µmol m-2 s-1) and low light (LL, 100 µmol m-2 s-1) conditions.

Variable PN (µmol m-2 s-1) Ci (µmol mol-1) -2 -1 gs (mmol m s ) -2 -1 E (mmol m s ) WUE [mmol (CO2) mol (H2O)]

CL NF FL 18.9±1.5a 5.1±2.5b 127.2±27.5b 210.4±31.8a a a 126.8±23.8 110.8±22.3 a b 3.3±0.3 2.43±0.2 a 5.9±1.0 2.1±1.2b

LL NF FL 17.1±0.3a 14.2±3.0a 121.4±38.4a 111.7±11.2a a a 97.5±26.3 75.0±13.5 a a 2.8±0.6 2.3±0.3 a 6.4±1.3 6.2±0.5a

L * * * * *

ANOVA F L*F * * * * ns ns * * * *

Different letters show significant differences among means at p<0.05. Means ± SD (n = 4). NF, non-flooded; FL, flooded; ns,p>0.05; *, p<0.05.

RESULTS Gas exchange Six days after flooding treatment, there were significant differences between control light and low light grown seedlings for PN, Ci, gs, E and WUE (p<0.05) and significant differences between non-flooded and flooded seedlings for PN, Ci, E and WUE (p<0.05) (Table 1). There were significant interactions between flood and light treatments for PN, Ci, E and WUE (p<0.05). The average values of PN, E and WUE were significantly higher (p< 0.05), and Ci was significantly lower (p< 0.05) in non-flooded than in flooded seedlings under control light growth conditions. However, all the parameters related to photosynthesis were similar in both non-flooded and flooded seedlings under low light growth conditions. The average PN, E and WUE were 70, 26 and 59%, respectively, higher, whereas Ci was 57% lower in non-flooded than in flooded seedlings under control light growth conditions. Chlorophyll content and chlorophyll fluoresce Six days after flooding treatment, chlorophyll contents in low light growth seedlings were similar to that of the control light growth seedlings, while there were significant differences between non-flooded and flooded seedlings for Chl a, Chl b and Chl a+b (p<0.05) (Figure 1). There were significant interactions between flood and light treatments for Chl a, Chl b, Chl a+b and Chl a/b (p<0.05) (Figure 1). The average values of Chl a, Chl b, and Chl a+b were significantly higher (p<0.05) in non-flooded than in flooded seedlings under control light growth conditions. However, chlorophyll contents were similar in both non-flooded and flooded seedlings under low light growth condition. The average Chl a, Chl b and Chl a+b were 31, 42 and 34%, respectively, higher in non-flooded than in flooded seedlings under control light growth conditions. There was no significant variation in Fv/Fm among the treatments two days after flooding treatment. The average

values of Fv/Fm in flooded seedlings were significantly lower at four (p<0.05) and six (p<0.001) days after flood treatment than the control under control light grown conditions (Figure 2). There was a slight decrease of Fv/Fm in the seedlings of six days flooding period under low light growth conditions. Seedling biomass and allocation Six days after flood treatment, there were significant differences between control light and low light grown seedlings for shoot biomass, belowground biomass and total biomass (p<0.05) and significant differences between non-flooded and flooded seedlings for belowground biomass, total biomass and shoot/root ratio (p<0.05) (Figure 3). There were significant interactions between flood and light treatments for belowground biomass, total biomass and shoot/root ratio (p<0.05). The average values of belowground biomass and total biomass were significantly higher (p<0.05) and shoot/root ratio was significantly lower in non-flooded than in flooded seedlings under control light growth conditions (Figure 3). However, seedling biomass and shoot/root ratio were similar in both non-flooded and flooded seedlings under low light growth conditions. The average belowground biomass and total biomass were 52 and 34%, respectively, higher in non-flooded than in flooded seedlings under control light growth condition. There was a slight decrease of seedling biomass in six days flooded seedlings under low light growth conditions. DISCUSSION Results of this experiment show that control light grown seedlings were more sensitive to soil flooding, which is in agreement with previous studies on Eugenia uniflora L. (Mielke and Schaffer 2010a, b, 2011), even for the plant used here which is a C4 pathway. There was an interactive effect of soil flooding and light intensities on maize seedling photosynthesis and growth (Table 1 and

Wang et al.

3.0

Chl a [mg g-1 FW]

2.5

A

NF FL

2.0 1.5 1.0 0.5 0.0 CL

LL

B

Chl b [mg g-1 FW]

1.0 0.8 0.6 0.4 0.2

Chl a+b [mg g-1 FW]

0.0 CL

LL

CL

LL

CL

LL

C

3

2

1

0

D

2.5

Chl a/b

2.0 1.5 1.0 0.5 0.0

Figure 1. Responses of Chl a (A), Chl b (B), Chl a+b (C) and, Chl a/b (D) to soil flooding under control light (CL, 600 µmol m-2 s-1) and low light (LL, 100 µmol m-2 s-1) conditions. Means ± SD (n = 4). NF, non-flooded; FL, flooded.

7679

7680

Afr. J. Biotechnol.

0.84

NF FL

B

A

Fv/Fm

0.82

0.80

0.78

0.76 0

2

4

6

Days after treatment

0

2

4

6

Days after treatment

Figure 2. Responses of maximum photochemical efficiency of PSII, and Fv/Fm of maize seedlings after zero, two, four and six days exposure to soil flooding under control light (600 µmol m-2 s-1, A) and low light (100 µmol m-2 s-1, B) conditions. Means ± SD (n = 4). NF, non-flooded; FL, flooded.

Figure 3), which is similar to the previous study on Genipa americana L. (Lavinsky et al., 2007). Effects of soil flooding on photosynthesis of Z. mays L. seedlings under different light intensities The markedly decrease of PN was observed in flooded seedlings with non-significant changes in the E and gs under low light growth conditions. These results are in agreement with that of Yordanova and Popova (2007) for maize seedlings subjected to flooding under 160 µmol m-2 s-1 PAR. Ci value was higher in flooded seedlings than non-flooded seedlings under control light growth conditions and similar in both flooded and non-flooded seedlings under low light growth conditions. This indicates that stomata closure was not the primary limitation for the reduction of PN. A non-stomatal effect on the photosynthetic process can play a more important role in the PN decrease. We also found a significant interaction effect of light irradiance level and flood treatment of photosynthesis of maize seedlings as there are several reports on tree species (Wagner and Dreyer, 1997; Lavinsky et al., 2007; Mielke and Schaffer, 2010a, b). Despite the fact that maize is a C4 pathway plant, a relatively higher light irradiance still aggravating flooding stress induced photosynthesis capacity decrease. PN is positively correlated with leaf chlorophyll content (Hidema et al., 1991; Kura-Hotta et al., 1987). Six days after flooding treatment, chlorophyll content in the leaves of control light grown seedlings decreased significantly. This is possibly because flooding stress resulted in a significant increase in chlorophyll breakdown (Yan et al., 1996; Yordanova and Popova, 2001; Pociecha et al., 2008). However, contrary to the result of Yordanova and Popova (2007), chlorophyll contents in the leaves of low

light grown seedlings were similar both for flooded and non-flooded treatments. This might be because the samples in their experiment were all leaf tissues, but we only sampled the second leaf. In fact, we did observe that the first leaf was senescence and turned yellow. According to Ashraf and Arfan (2005), Chl a/b in flooded seedlings was higher than non-flooded seedlings under high light grown conditions because the declining extent of chl b was more than chl a. So, here in our experiment, the reduction of PN was accompanied by chlorophyll content decrease, showing another evidence for their correlation. Fv/Fm values for non-stressed leaves are remarkably consistent (about 0.83) (Björkman and Demmig, 1987). A decline of Fv/Fm provides very useful information to reflect the effects of biotic and abiotic stresses in light on photosynthesis (Lavinsky et al., 2007; Baker, 2008; Balachandran and Osmond, 1994). The significant decrease of Fv/Fm at four (p<0.05) and six (p<0.001) days in flooded than non-flooded seedlings under control light growth conditions (Figure 2) indicate that an important portion of photosynthetic electron transport system was destroyed whereas, the average value of Fv/Fm was similar between flooded and non-flooded seedlings under low light growth conditions indicating that leaves of flooded seedlings grown under high light were more susceptible to the photoinhibition of photosynthesis (Mielke and Schaffer, 2011; Baker, 2008). Effects of soil flooding on growth of Z. mays L. seedlings under different light intensities Flood significantly repressed root growth under both control light and low light growth conditions, and increased shoot/root ratio under control light growth

Wang et al.

0.5

Shoot biomass [g plant-1]

NF FL

A

0.4

0.3

0.2

0.1

0.0 CL

LL

CL

LL

CL

LL

CL

LL

B

Root biomass [g plant-1]

1.0 0.8 0.6 0.4 0.2 0.0

Total biomass [g plant-1]

1.4

C

1.2 1.0 0.8 0.6 0.4 0.2 0.0 D

Shoot/Root Ratio

1.0 0.8 0.6 0.4 0.2 0.0

Figure 3. Responses of shoot biomass (A), root biomass (B), total biomass (C) and shoot/root ratio (D) to soil flooding under control light (CL, 600 µmol m-2 s-1) and low light (LL, 100 µmol m-2 s-1) conditions. Means ± SD (n = 5). NF– non-flooded; FL– flooded. Means ± SD (n = 5). NF– non-flooded; FL– flooded.

7681

7682

Afr. J. Biotechnol.

conditions but shoot/root ratio was similar between flooded and non-flooded low light grown seedlings (Figure 3). Repressed root growth is a common response to flood stress for many plants (Mielke and Schaffer, 2010b; Chen et al., 2002; Wagner and Dreyer, 1997). As flooding leads to lack of oxygen around the roots, insufficient oxygen inhibits mitochondrial respiration and ATP synthesis, and enhances a less efficient metabolism pathway-glycolysis. In turn, energy limitation decreases the ability of roots to absorb water and nutrients, then decrease root growth rate and dry matter accumulation under hypoxic conditions (Mielke and Schaffer, 2010b; Kozlowski, 2002) whereas, decreased biomass allocation to root is an adaptive mechanism to soil flooding of the plant by diminishing the metabolic requirement of roots for oxygen (Naidoo and Naidoo, 1992). In summary, an interactive effect of flood and light intensity was found in maize in laboratory conditions, although the control light we used was 600 µmol m-2 s-1 photosynthetically active radiation (PAR), which is much lower than maize light saturation point. Plant undergoing flood stress was more sensitive when grown under relative high light conditions than low light conditions, demonstrating that the responses of the C4 plant to flooding stress may be also dependent on light availability during the growth period. Interactions between flooding stress and light intensity on photosynthesis and growth of the plant should be considered in studies aimed at predicting changes in the plant production as a function of changes in rainfall associated with global climate change. ACKNOWLEDGEMENTS This work was financed by the Commonweal Scientific Research Project of Henan Province (No.091100910100).

REFERENCES Ashraf M, Arfan M (2005). Gas exchange characteristics and water relations in two cultivars of Hibiscus esculentus under waterlogging. Biol. Plant. 49(3): 459-462. Baker NR (2008). Chlorophyll Fluorescence: A Probe of Photosynthesis In Vivo. Annu. Rev. Plant Biol. 59(1): 89-113. Balachandran S, Osmond CB (1994). Susceptibility of Tobacco Leaves to Photoinhibition following Infection with Two Strains of Tobacco Mosaic Virus under Different Light and Nitrogen Nutrition Regimes. Plant Physiol. 104(3): 1051-1057. Björkman O, Demmig B (1987). Photon yield of O2 evolution and chlorophyll fluorescence characteristics at 77K among vascular plants of diverse origins. Planta, 170(4): 489-504. Boru G, Vantoai T, Alves J, Hua D, Knee M (2003). Responses of Soybean to Oxygen Deficiency and Elevated Root-zone Carbon Dioxide Concentration. Ann. Bot. 91(4): 447-453. Chen H, Qualls RG, Miller GC (2002). Adaptive responses of Lepidium latifolium to soil flooding: biomass allocation, adventitious rooting, aerenchyma formation and ethylene production. Environ. Exp. Bot. 48(2): 119-128. Drozak A, Romanowska E (2006). Acclimation of mesophyll and bundle sheath chloroplasts of maize to different irradiances during growth. Biochim. Biophys. Acta Bioenerg. 1757(11): 1539-1546.

Earley EB, Miller RJ, Reichert GL, Hageman RH, Seif RD (1966). Effect of Shade on Maize Production Under Field Conditions. Crop Sci. 6(1): 1-7. Gerakis PA, Papakostatasopoulou D (1980). Effects of Dense Planting and Artificial Shading on 5 Maize Hybrids. Agric. Meteorol. 21(2): 129-137. Hidema J, Makino A, Mae T, Ojima K (1991). Photosynthetic Characteristics of Rice Leaves Aged under Different Irradiances from Full Expansion through Senescence. Plant Physiol. 97(4): 1287-1293. Huang J, Rozelle S (1995). Environmental stress and grain yields in China. Am. J. Agric. Econ. 77(4): 853-864. Jackson MB (2002). Long distance signalling from roots to shoots assessed: the flooding story. J. Exp. Bot. 53(367): p. 175. Jia SF, Li CF, Dong ST, Zhang JW (2011). Effects of Shading at Different Stages After Anthesis on Maize Grain Weight and Quality at Cytology Level. Agric. Sci. China, 10(1): 58-69. Jing YX, Li GL, Gu BH, Yang DJ, Xiao L, Liu RX, Peng CL (2009). Leaf gas exchange, chlorophyll fluorescence and growth responses of Melaleuca alternifolia seedlings to flooding and subsequent recovery. Photosynthetica, 47(4): 595-601. Kiniry JR, Ritchie JT (1985). Shade-Sensitive Interval of Kernel Number of Maize. Agron. J. 77(5): 711-715. Kozlowski T (1984). Plant responses to flooding of soil. BioSci. 34(3): 162-167. Kozlowski T (2002). Physiological-ecological impacts of flooding on riparian forest ecosystems. Wetl. 22(3): 550-561. Kura-Hotta M, Satoh K, Katoh S (1987). Relationship between Photosynthesis and Chlorophyll Content during Leaf Senescence of Rice Seedlings. Plant Cell Physiol. 28(7): 1321-1329. Lavinsky A, De Souza Sant’Ana C, Mielke M, De Almeida AA, Gomes F, França S, Da Costa Silva D (2007). Effects of light availability and soil flooding on growth and photosynthetic characteristics of Genipa americana L. seedlings. New For. 34(1): 41-50. Lazaro L, Abbate PE, Cogliatti DH, Andrade FH (2010). Relationship between yield, growth and spike weight in wheat under phosphorus deficiency and shading. J. Agric. Sci. 148(1): 83-93. Li CH, Luan LM, Wang Q, Li N, Zhao YL (2005). Effects of Seedling Shangding and Light Intensity Transfer on Photosynthetic Efficiency of Different Maize (Zea mays L.) Hybrids (In Chinese with english abstract). Acta Agron. Sin. 31(3): 381-385. Lichtenthaler HK (1987). Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol. 148: 350-382. Liu YZ, Tang B, Zheng YL, Ma KJ, Xu SZ, Qiu FZ (2010). Screening Methods for Waterlogging Tolerance at Maize (Zea mays L.) Seedling Stage. Agric. Sci. China, 9(3): 362-369. Mielke M, Schaffer B (2011). Effects of soil flooding and changes in light intensity on photosynthesis of Eugenia uniflora L. seedlings. Acta Physiol. Plant. 33(5): 1661-1668. Mielke MS, Schaffer B (2010a). Leaf gas exchange, chlorophyll fluorescence and pigment indexes of Eugenia uniflora L. in response to changes in light intensity and soil flooding. Tree Physiol. 30(1): 45-55. Mielke MS, Schaffer B (2010b). Photosynthetic and growth responses of Eugenia uniflora L. seedlings to soil flooding and light intensity. Environ. Exp. Bot. 68(2): 113-121. Naidoo G, Naidoo S (1992). Waterlogging responses of Sporobolus virginicus (L.) Kunth. Oecologia, 90(3): 445-450. Ojeda M, Schaffer B, Davies FS (2004). Flooding, root temperature, physiology and growth of two Annona species. Tree Physiol. 24(9): 1019-1025. Pezeshki SR (2001). Wetland plant responses to soil flooding. Environ. Exp. Bot. 46(3): 299-312. Pociecha E, Koscielniak J, Filek W (2008). Effects of root flooding and stage of development on the growth and photosynthesis of field bean (Vicia faba L. minor). Acta Physiol. Plant. 30(4): 529-535. Reed AJ, Singletary GW, Schussler JR, Williamson DR, Christy AL (1988). Shading Effects on Dry Matter and Nitrogen Partitioning, Kernel Number, and Yield of Maize. Crop Sci. 28(5): 819-825. Rosenzweig C, Tubiello FN, Goldberg R, Mills E, Bloomfield J (2002). Increased crop damage in the US from excess precipitation under climate change. Glob. Environ. Change, 12(3): 197-202. Vartapetian BB, Jackson MB (1997). Plant Adaptations to Anaerobic

Wang et al.

Stress. Ann. Bot. 79(suppl 1): 3-20. Visser EJW, Voesenek LACJ, Vartapetian BB, Jackson MB (2003). Flooding and Plant Growth. Ann. Bot. 91(2): 107-109. Wagner PA, Dreyer E (1997). Interactive effects of waterlogging and irradiance on the photosynthetic performance of seedlings from three oak species displaying different sensitivities (Quercus robur, Q-petraea and Q-rubra). Ann. Sci. Forest. 54(5): 409-429. Yan B, Dai QJ, Liu XZ, Huang SB, Wang ZX (1996). Flooding-induced membrane damage, lipid oxidation and activated oxygen generation in corn leaves. Plant Soil. 179(2): 261-268. Yordanova R, Uzunova A, Popova L (2005). Effects of short-term soil flooding on stomata behaviour and leaf gas exchange in barley plants. Biol. Plant, 49(2): 317-319.

7683

Yordanova RY, Popova LP (2001). Photosynthetic Response of Barley Plants to Soil Flooding. Photosynthetica, 39(4): 515-520. Yordanova RY, Popova LP (2007). Flooding-induced changes in photosynthesis and oxidative status in maize plants. Acta Physiol. Plant, 29(6): 535-541. Zhang JW, Dong ST, Wang KJ, Hu CH, Liu P (2007). Effects of Shading in Field on Photosynthetic Characteristics in Summer Corn (In Chinese with english abstract). Acta Agron. Sin. 33(2): 216-222.

African Journal of Biotechnology Vol. 11(30), pp. 7684-7692, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.485 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Propagation physiology of Juniperus phoenicea L. from Jordan using seeds and in vitro culture techniques: Baseline information for a conservation perspective Ezz AL-Dein Al-Ramamneh1*, Susan Dura2 and Nidal Daradkeh2 1

Department of Agricultural Sciences, AL-Shouback University College, Al-Balqa Applied University, AL -Shouback, Maan, Jordan. 2 Department of Biotechnology, National Center for Agricultural Research and Extension, Baq'a 19381, Jordan. Accepted 22 March, 2012

Seeds of Juniperus phoenicea L. collected from Shouback city, south of Jordan, were cold-moist stratified at 5°C for 1 and 3 months. Non-stratified seeds were used as the control. The recalcitrant nature of J. phoenicea was clear as shown by low germinability of seeds. The highest germination percentage was recorded for seeds stratified for three months. Germination bioassay of wheat grains indicated that stratification is a prerequisite for the germination of J. phoenicea seeds and that reduction in inhibitors found in mature seeds occurred with longer stratification periods. In a separate set of experiments, in vitro culture of J. phoenicea, using shoot tips with axillary buds from young seedlings and mature seeds from adult trees as explants was attempted. Explants were established on Murashige and Skoog (MS), and Rugni Olive (OM) media. The effects of kinetin (kin), 6-benzyl amino purine (BAP) and thidiazuron (TDZ) on the differentiation of axillary buds were tested at 0.5 mg/L and compared with that using plane media without hormones. Mature seeds were completely contaminated one month after culture establishment. The grooves along the surface of the seeds may have increased the chance for latent microbes to grow with prolonged culture time. In contrast, shoot tips with axillary buds responded better than seeds in vitro. Key words: Germination, in vitro culture, recalcitrance, seed morphology, thidiazuron (TDZ).

INTRODUCTION The genus Juniperus consists of 67 species and 37 varieties. All the taxa grow in the northern hemispheres, except J. procera, which grows along the Rift Mountains in east Africa into the southern hemisphere (Adams, 2004). J. phoenicea is an evergreen monoecious or dioecious tree native to some regions of the Mediterranean basin from Portugal to Lebanon, Jordan and Western Saudi Arabia, and North Africa in Algiers, Morocco and Egypt, as well as the Canary Islands

*Corresponding author. E-mail: ezznew@hotmail.com. Tel: +962 775211825. Fax: +962 32165035. Abbreviations: MS, Murashige and Skoog; OM, Rugni Olive media; Kin, kinetin; BAP, 6-benzyl amino purine; TDZ, thidiazuron.

(Adams et al., 2002; Adams, 2004; El-Bana et al., 2010). J. phoenicea is a small tree, normally 6 to 8 m tall, or sometimes only a shrub with scaly leaves and brown to reddish 8 to 14 mm cones that usually contain on average five seeds (Adams, 2004; Mazur et al., 2003; Piotto et al., 2003). These plants grow in areas characterized by persistent drought and arid climate with high temperature ranges (El-Bana et al., 2010). A reproductive cycle of about 20 months, from cone differentiation to seed dispersal has been reported in J. phoenicea subsp. phoenicea, while in J. phoenicea subsp. turbinata it is two years (Arista et al., 1997). J. phoenicea occurs in the southern part of Jordan, usually at high altitudes, over 1000 m, on sandy rocks (Syouf and Duwayri, 1996; AlQura’n, 2005). Juniperus species are used for many purposes including landscaping, wood and medicinal purposes (Dale and Greenway, 1961; Lind and Morrison,

Al-Ramamneh et al.

1974; Loureiro et al., 2007). J. phoenicea is used largely in traditional medicine to treat diarrhea (Qnais et al., 2005). Leaves and berries of this plant are used to prepare mixtures that act as an oral hypoglycaemic agent (Amer et al., 1994). Oils isolated from leaves showed also inhibition effects against bacteria and fungi (Mazari et al., 2010). Lack of pollination, low pollen viability and / or embryo degeneration are important causes for reduced seed production in Juniperus (Ortiz et al., 1998). Furthermore, it is reported for the genus Juniperus like J. communis and J. sabina L. that seed quality tends to decrease in drier and or colder regions (Garcia et al., 2000; Wesche et al., 2005) and only very small percentage of the collected cones contain viable seeds (Wesche et al., 2005). J. phoenicea, similar to other Juniperus species, does not have a high rate of plant production through seed germination (Ortiz et al., 1998). Moreover, it is not efficiently propagated by traditional methods and results are extremely inconsistent and not reproducible (Brito, 2000). Piotto et al. (2003) reported that no completely effective pre-treatments are known that will improve germination for J. phoenicea from Mediterranean countries. However, they suggested cold treatments of naked seeds at 3 or 4°C for 30 to 90 days. Moreover, some nurseries in Sardinia sow seeds of J. phoenicea in October and transplanting of the seedlings usually occurs the following March (Piotto et al., 2003). Stratification was also recommended at 3 to 5°C for 6 to 8 weeks to get good germination in seeds of J. procera depending on the collection site and seed lot (Tigabu et al., 2007). Tissue culture had emerged as a tool to improve the propagation of many plants. Gomez and Segura (1995) reported the proliferation of J. oxycedrus by axillary shoots and later found some morphogenic capacity in calluses derived from single cell culture of the same species (Gomez and Segura, 1996). Harry et al. (1995), reported plantlet regeneration using embryogenic explants of J. cedrus. The induction of adventitious buds was achieved on excised cotyledon segments and embryo explants of J. excelsa (Negussie, 1997). Explants with axillary buds prepared from microcuttings of mature plants were used for the micropropagation of Portuguese J. phoenicea and J. narvicularis (Loureiro et al., 2007; Castro et al., 2011). The shoot branching process generally involves the formation of axillary meristems in leaf axils and the growth of axillary buds (Shimizo -Sato and Mori, 2001). The mechanisms of axillary bud growth depend on the ratio of the plant hormones auxin and cytokinin. Regulation of initiation and outgrowth of axillary meristems is important for controlling the overall plant growth and architecture (Shimizo-Sato and Mori, 2001). Due to the prevailing drought conditions in the southern part of Jordan and the difficulty of J. phoenicea plant regeneration through seeds, this plant is considered as an endangered plant species. This is true as Jordanian J. phoenicea trees were noticed to dry in the last few years

7685

in its natural habitats. Furthermore, the over-exploitation of forest trees timber as heat-generating source in winter, in light of the increasing prices of oil, has contributed to the gradual decline of this plant species. To the best of our knowledge, Juniperus species have not been investigated in relation to their level of physiological dormancy. Furthermore, only one study on the in vitro regeneration of J. phoenicea using explants with axillary buds from mature trees has been reported (Loureiro et al., 2007). In Jordan, no reports were published on the propagation of J. phoenicea. This research, therefore, was undertaken to understand the propagation physiology of J. phoenicea in order to develop methods for mass production through seeds and vegetative means. For this purpose the following objectives were investigated: the effects of stratification on the germination of seeds collected from Shouback south of Jordan, physiology of seed germination and dormancy in J. phoenicea utilizing wheat grains germination bioassay, and the effects of hormones and media on the in vitro regeneration of J. phoenicea using mature seeds and axillary buds of young seedlings. MATERIALS AND METHODS Study area and cones collection Mature reddish Cones of J. phoenicea were collected from its habitat (Al-Jhayer Mountains), approximately 1700 m above sea level, latitude 30° 31′ N, longitude 32° 35′ E, in Shouback region in the Southern part of Jordan. The soil of the seed collection site is silt loam with pH of 7.7 and EC of 0.47 (dS/m). The mean annual temperature, precipitation and relative humidity of shouback were 13.3°C, 176.5 mm and 59.9%, respectively (the data was obtained from the National Meteorological Department of Jordan). Cones were harvested from the periphery of infections- and insects- free trees based on visual inspection. Usually, cones were collected from the upper part of small to medium-sized trees. The height and diameter measured at breast height of J. phoenicea trees were variable and ranged from (2 to 10 m) and (30 to 80 cm), respectively. The cone and seed characteristics are given in Table 1. The cones served as the starting material for seed germination tests. Seed extraction Cones of J. phoenicea were soaked in distilled water for 24 h, which allowed for the softening of the hard pericarp of the fruits. The seeds were then manually extracted from cones and kept at room temperature for later experiments. Morphological features of the seeds The morphological features of seeds obtained from mature cones were observed and photographs were taken to identify seed coat morphology using Labomed 7GA9 microscope (USA, SN: 09010289) (Program Software::Progres Capture Pro 2.7.7). Cold-moist stratification and nursery experiments Seeds collected in 2008 were soaked in distilled water for 24 h.

7686

Afr. J. Biotechnol.

Then un-imbibed or damaged seeds were excluded. Seeds were placed in perforated plastic bags filled with moistened perlite and were placed in a refrigerator at 5°C for 1 and 3 months. Nonstratified seeds served as the control. Bags containing seeds were checked periodically for moisture availability and were moistened with the fungicide Seed Guard at 1g/L. The seeds stratified for 1 and 3 months as well as non-stratified seeds (control) were allowed to germinate in plastic trays filled with peat and perlite at (2:1) ratio, respectively. The seeds were placed in the greenhouse in National Center for Agricultural Research and Extension (NCARE) in Baqa´a city North of Jordan. The trays were irrigated when needed with tap water and every two weeks with 1g/L benomyl fungicide. The germination process was monitored every two days for 100 days and considered as the emergence of new seedlings. The following parameters were determined: germination capacity (GC) and mean germination time (MGT). GC is the proportion of total number of germinated seeds to that of sown seeds expressed in percentage. MGT was calculated as follows: MGT (days) = ∑(tini)/ ∑ni Where, ti is the number of days starting from the date of sowing and ni is the number of seeds germinated at each day (Bewley and Black, 1994). The total number of seeds per treatment was 216 seeds in four replicates (54 seeds per replicate) and the experiment had a completely randomized design. Biological determination of inhibitors to J. phoenicea seeds germination (wheat germination bioassay) To determine the promotion or inhibition in germination of wheat grains by extracts obtained from seeds of J. phoenicea stratified for 1 and 3 months as well as extracts of non-stratified seeds. The promotion in grains germination acted as an indicator for the change in seed inhibitors of J. phoenicea in response to increased stratification period. This, in turn, could explain the germination behavior of seeds of J. phoenicea stratified for the assigned durations. This procedure was based on several reports utilizing wheat coleoptiles bioassay, barley endosperm bioassay and bioassay utilizing Brassica camprestris L. seeds (Al-Ramamneh, 1998; Boucaud and Ungar, 1973; Zhou and Bau, 2011) Sensitivity of wheat grains to filtrates of J. phoenicea seeds This aimed at determining extract concentration of J. phoenicea seeds that can induce minimum germination of wheat grains. Extracts of J. phoenicea from seeds collected in 2010 were prepared using a modified procedure of Saxena et al. (1996). Seeds were ground in a blender to give a fine powder. The dry tissue was extracted with distilled water to prepare concentrations of 100, 33 and 20 g/L. The seed powder solutions were homogenized by stirring gently for 10 min. The extract was then filtered through Whatman no. 1 filter paper and the filtrate was collected. Wheat grains cv. Hourani were germinated on filter paper on 9-cm Petri dishes. Then 5 ml of each prepared extract (100, 33 and 20 g/L filtrates) was added to each Petri dish containing wheat grains. Distilled water was used as a positive control for the germination of wheat grains. The Petri dishes were kept at 23 to 25°C. Each treatment consisted of three replicates of 10 grains each in a completely randomized design (a total of 30 grains). At the end of a 5-day germination period, the following parameters were recorded for wheat grains: GC, coleoptiles length, number and length of seminal roots. In vitro culture Microcuttings from young seedlings of J. phoenicea (3-year old)

obtained from the Forestry Department in Shouback and mature seeds from adult plants provided explants for tissue culture techniques.

Preparation and sterilization of the plant material Cuttings from terminal branches of the young seedlings were first washed in tap water, and then treated with household detergent for five minutes. This was followed by washing cuttings with tap water to remove all the traces of the detergent. Cuttings were immersed in 2.5% active chlorine from sodium hypochlorite for 15 min and then washed three times with sterilized distilled water. Cuttings were then divided to provide explants that consisted of shoot tips 1.5 cm in length (containing three axillary buds). The mature seeds were sterilized using the same procedure employed for the cuttings.

Influence of medium composition and growth regulators The resulting explants were cultured in tubes (25 mm × 150 mm) on approximately 20 ml of either MS (Murashige and Skoog, 1962) or OM (Rugini, 1984) media supplemented with kinetin, thidiazuron (TDZ) and 6-benzyl amino purine (BAP) at 0.0 or 0.5 mg/L. All cultures were incubated in growth chamber at 25±2°C, with a 16-h photoperiod and illuminated by 40 W (watts) white fluorescent lights. The experiments were arranged in a completely randomized design with ten replicates. Each replicate was the average readings for three explants (total 30 explants for each treatment). Shoot survival and morphological characters as number of shoots per explant, shoot length, number of branches per explant and branch length were evaluated three weeks after culture establishment. In vitro cultures lasted for two months to collect more observations. The formation of callus on explants was also evaluated.

Statistical analysis All the described experiments were repeated twice. The data were analyzed with a general linear model using the Statistical Analysis System (SAS, 2001) and least significant difference (LSD) test at 5% probability level was applied to compare the treatment means.

RESULTS Morphological features of the seeds J. phoenicea trees produce small cones (mean cone weight equals 0.25 g), each containing 5 small seeds (Table 1). The cones are green-colored and become reddish when mature. The shape of seeds in J. phoenicea is ovoid. However, seeds tend sometimes to be tapered at both ends. They are wrinkled and characterized by the presence of protrusions and furrow-like grooves along their surface (Figure 1A to C). Seed germination stratification

in

response

to

cold-moist

Stratification had a significant effect (P<0.01) on GC and MGT for seeds collected from Shouback region (Table 2). Seeds stratified for three months had significantly higher

Al-Ramamneh et al.

7687

Table 1. Morphological characteristics of cones and seeds of J. phoenicea collected from Al-Jhayer in Shouback south of Jordan.

Cone and seed characters No. of seeds / cone Cone weight (g) Seed size (mm × mm × mm) 1000 seed weight (g)

Overall mean a 4.65 ± 0.24 b 0.25 ± 0.01 c (5.03 ± 0.17) × (3.18 ± 0.13) × (2.58 ± 0.08) d 16.27 ± 0.25 a

b

c

d

The values are the mean ± standard error of (n:20), (n:30), (n:20) and (n:3).

A

B

C

Figure 1. Morphology of J. phoenicea seeds (A) Ovoid seed shape, wrinkled surface of the seed (arrow) and furrow-like grooves (arrowhead). (B) Tapered ends of the seed (arrows). (C) furrow-like grooves (arrowheads). Scale bars: 1 mm.

Table 2. Germination capacity (GC) and mean germination time (MGT) of J. phoenicea seeds from Shouback stratified at 5°C for 0, 1 and 3 months.

Parameter Control 5°C × 1 month 5°C × 3 month LSD (P=0.05)

GC 0.0±0.0c 3.2±0.8b 9.3±1.3a 2.9

MGT 0.0±0.0b 74.9±2.1a 73.4±3.6a 7.7

Control: Non-stratified seeds of J. phoenicea. Means in each column followed by the same letter are not significantly different at P<0.05.

GC (9.3%) than seeds stratified for one month (3.2%). However, MGT was on the same level of significance for seeds stratified for one and three months (74.9 and 73.4, respectively). Meanwhile, the non-stratified seeds failed to germinate. Sensitivity of wheat grains to filtrates of J. phoenicea seeds The germination of wheat grains was highly sensitive to increase in filtrate concentration of J. phoenicea seeds (P<0.01) (Table 3). The filtrate concentration of 100 g/L resulted significantly in the least germination response of

wheat grains (GC=23%). This was also coupled with the least average length (0.5 cm) of the seminal roots of the germinated grains. Wheat grains germinated in distilled water free of J .phoenicea filtrate recorded significantly the highest GC (77%), coleoptiles length (2.1 cm), mean number and length of seminal roots (4.1 seminal roots and 2.7 cm, respectively). However, data from further experiments indicated that 110 g/L filtrate of J. phoenicea seeds resulted in 10 % GC of wheat grains (Table 4) and therefore, was used as the concentration of J. phoenicea filtrate required to induce the minimum accepted germination of wheat seeds. Biological determination of inhibitors to germination of J. phoenicea seeds It is shown in Table 4 that germination of wheat grains was significantly stimulated when moistened with seedfiltrates of J. phoenicea that received longer stratification periods. In this sense, germination percentages of 10, 53 and 77 were obtained when wheat grains were moistened with filtrates of J. phoenicea seeds that were nonstratified, stratified for 1 month and those stratified for 3 months in that order, respectively. Moreover, germination efficiency of wheat seeds as indicated by coleoptile length, number and length of seminal roots was also enhanced for wheat grains that were treated with seed-

7688

Afr. J. Biotechnol.

Table 3. Effects of seed filtrate of J. phoenicea on the germination of wheat grains cv. Hourani.

Filtrate concentration (g/L) 0 20 33 100 LSD (P=0.05)

GC (%) a 77 55b 57b c 23 14.1

Coleoptile length (cm) a 2.1 0.8b 0.4b b 0.8 0.6

Number of seminal root a 4.1 ab 3.2 2.5bc c 1.7 1.4

Length of seminal root (cm) a 2.7 1.8b 1.5b c 0.5 0.7

0: Distilled water used as positive control. Means in each column followed by the same letter are not significantly different at P<0.05.

Table 4. Effects of seed filtrates (110 g/L) of J. phoenicea stratified for 0, 1 and 3 months on the germination of wheat grains cv. Hourani.

Stratification period Control 5°C × 1 month 5°C × 3 month LSD (P=0.05)

GC 10.0c b 53.3 76.7a 14.8

Coleoptile length (cm) 0.9b b 1.1 2.6a 1.3

Number of seminal roots 0.6b ab 2.3 4.0a 2.2

Length of seminal roots (cm) 0.1b ab 0.5 0.7a 0.5

Control: Non-stratified seeds of J. phoenicea. Means in each column followed by the same letter are not significantly different at P<0.05.

Table 5. Effect of basal media and growth regulators on the growth parameters of J. phoenicea three weeks after culture establishment.

Medium

MS

Growth regulator (mg/L) 0.0 0.5 KIN 0.5 BAP 0.5 TDZ

Number of shoots per explant

0.0 0.5 KIN 0.5 BAP 0.5 TDZ

OM

Number of branches per explant

0e 2.6cd 0e 2.9c

Shoot length (cm) 0d 1.3c 0d 1.5c

4.6b b 5.3 d 1.6 6.6a

LSD (P=0.05)

Callus a

0d 3.6b 0d 4.4b

Branch length (cm) 0c 1.8b 0c 2.2b

2.1b ab 2.6 c 0.9 a 3

2.4bc a 7.0 cd 0.7 8.3a

1.4b a 3.3 c 0.3 a 3.6

+ +

0.6

2.1

1.0

1.2

+ +

a

Explants consisted of shoot tips 1.5±0.2 cm with three axillary buds. Qualitative characterization of callus production: -, absence; +, presence. Means in each column followed by the same letter are not significantly

filtrates of J. phoenicea that were stratified for up to three months (Table 4). In vitro culture - Mature seed explants Mature seed explants showed microbial contamination few days after culture irrespective of media and hormones used. The contamination developed gradually to cover all cultures one month after culture establishment. Contamination varied from creamy to green areas In vitro culture - Microcutting explants Microcuttings grown on MS medium without hormones or

with 0.5 mg/L BAP failed to show any morphogenic response. These explants showed progressively necrotic areas and were browned at the end of the culture. Explants growth on OM medium without hormones were significantly better than explants grown on the same medium containing 0.5 mg/L BAP (Table 5). The best response was for explants that were grown on OM medium supplemented with 0.5 mg/L TDZ (Table 5). This medium-hormone combination stimulated axillary bud differentiation and thus significantly produced the highest number of shoots per explant (6.6). However, shoot length, number of secondary branches per explant and secondary branch length were on the same level of significance for explants grown in the presence of 0.5 mg/L TDZ or 0.5 mg/L kinetin in both media with

Al-Ramamneh et al.

significantly higher response in OM compared to MS medium. Shoots and secondary branches developed in the presence of 0.5 mg/L TDZ were thick, swelled and dark green compared to shoots formed in media containing 0.5 mg/L Kinetin. However, irrespective of the media and hormones used, it was necessary to perform sub-culturing after three to four weeks from start of the experiment. After this, shoots began browning starting from the base of the explants which gradually spread to the whole shoots and secondary branches. Prolong exposure of shoots to TDZ (2 months) caused callusing of shoots (data not shown). Callus production in the present study formed in OM and MS media when containing 0.5 mg/L Kin or TDZ. DISCUSSION Seed germination stratification

in

response

to

cold-moist

Stratification of seeds in a cold-moist medium at 5°C is recommended to overcome dormancy in many plant species, especially those from temperate regions (Baskin and Baskin, 2004). In the present study, stratification for one and three months significantly raised the GC of J. phoenicea seeds collected from Shouback region compared to non-treated seeds. However, the GC was poor and did not exceed 9.3% for seeds that was stratified for three months. In agreement with the results of the present study, seeds of J. procera collected from five provenances in Ethiopia have shown significant differences in seed germinability in response to stratification at 5°C (Tigabu et al., 2007). Furthermore, seeds of J. procera collected from Gra-Kassu, Wolf-Washa and AribGebeya provenances in Ethiopia germinated poorly (< 8%) (Tigabu et al., 2007) which is similar to the germination response of J. phoenicea seeds collected from shouback region and cold-stratified for up to three months. However, Tigabu et al. (2007) recorded a GC between 60 and 80% for seeds stratified for 6 weeks and collected from Hirna and Yabelo provenances characterized by high temperature. High temperature that prevails during seed maturation can induce an afterripening effect, which in turn enhances the growth of the embryo necessary for seed germination (Tigabu et al., 2007). The collection site (Al-Jhayer) for J. phoenicea seeds in this study is characterized by the decrease in temperature during seed maturation (from October to December), which induces dormancy and poor germination response in seeds when they mature. Physiology of J. phoenicea seed germination Grains of wheat germinated poorly when moistened with filtrate of non-stratified J. phoenicea seeds. However,

7689

germination of wheat grains was enhanced when grains were moistened with filtrate obtained from J. phoenicea seeds stratified for one month and was significantly the highest (GC: 77%) for grains that were treated with filtrate of J. phoenicea seeds stratified for up to three months. These results indicate clearly that mature seeds of J. phoenicea contained high amounts of inhibitors and that stratification was associated with a reduction in the inhibitors found in the mature seeds. Consistence with this, dormancy release of seeds in many plants involves the decrease in sensitivity of seeds to inhibitors involved in the signal transduction pathway controlling germination (Chien et al., 1998; Goggin et al., 2009; Koornneef et al., 2002; Nonogaki et al., 2010). These results highlighted the fact that stratification is a prerequisite for the successful germination of J. phoenicea seeds. This is understood by the gradual significant increase in the germination of J. phoenicea seeds that received stratification for one and three months in that order. The length of the chilling moist treatment necessary to break seed dormancy varies among different plant species. The present study indicated that mature seeds of J. phoenicea possess deep physiological dormancy as indicated by slow germination (MGT; 73.4) and poor GC (9.3%) of J. phoenicea seeds that were stratified for up to three months. This, when compared to the enhanced germination of wheat grains that were moistened with filtrate of J. phoenicea seeds stratified for up to three month, indicated that the effect of changes in inhibitors in repressing/stimulating germination of J. phoenicea seeds is probably modulated by the inhibitor/promoter ratio alongside other minor factors, in response to stratification (Piotto et al., 2003). The role of promoters, in particular gibberellins (GA), in breaking seed dormancy is well documented in many plant species (Dissanayake et al., 2010; Fang et al., 2006; Güleryüz et al., 2011; Nadjafi et al., 2006; Penfield et al., 2005; Goggin et al., 2011). This principle of inhibitors/promoters ratio was supported in earlier studies by barley endosperm bioassay and wheat coleoptile bioassay that supported the presence of an inhibitor activity and the absence of gibberellin-like activity in dormant non-treated varieties of the genus Suaeda (Boucaud and Ungar, 1973). AlRamamneh (1998) reported an increase in the germination of Tilia argentea seeds with cold stratification for up to four months, and found by utilizing wheat germination bioassay, a significant decrease in free ABA with stratification of T. argentea seeds for up to four months. Moreover, Piotto et al. (2003), pointed out that after breaking dormancy of J. phoenicea seeds, germination may be encouraged by the temperature of about +15 °C, while higher temperatures (+20/25 °C) do not seem optimal. In this respect, the germination temperature that prevailed throughout the present study (22±2) may not be optimal to induce the required increase in seed germination of J. phoenicea. The recalcitrant nature of seeds of J. phoenicea as indicated in this study could

7690

Afr. J. Biotechnol.

result from the adaptation to the particular environment where these trees grow in Al-Jhayer Mountains (approximately 1700 m above Sea level) with both cold winters and summers.

In vitro culture The contamination noticed in mature seed cultures involved, although not identified, bacterial and fungal contaminant. The failure to establish seed cultures in vitro in the present study indicates that sterilization techniques employed needs fine tuning. The morphological features of seeds in J. phoenicea seem to play a role in the contamination of the established cultures. The grooves along the surface of seeds reduced the effectiveness of surface sterilization and thus latent microbes can have the chance to develop with prolonged culture time. This is further understood in light of the fact that Juniperus species can be attacked by pest insects (GarcĂ­a, 1998; Tigabu et al., 2007) and pest-damaged seeds, in turn, may harbor infective pathogens (El Atta, 1993). The results of the present study showed that MS medium without hormones was not suitable to establish axillary bud multiplication in vitro using shoot tips as explants from young seedling of J. phoenicea. For the two media tested in this investigation, growing explants on OM medium resulted in significantly highest response in terms of shoot number per explants, shoot length, number of secondary branches and average length of secondary branches. Loureiro et al. (2007) showed the favorable response of OM medium compared to MS medium on explants from microcuttings collected from old trees of J. phoenicea in Portugal. The browning of explants that extends to shoots and secondary branches made it necessary to do subculturing after three to four weeks from the start of the experiment in the present study. Adverse conditions were also reported for the in vitro cultures of J. excelsa (Negussie, 1997). Original explants, undifferentiated adventitious domes and well differentiated buds / shoots of J. excelsa showed gradual yellowing and subsequent death. This condition might be due to physiological and / or physical causes (Negussie, 1997). Axillary bud differentiation on explants in the present study was favored in the presence of TDZ and kinetin in the media. When BAP was included in OM media, it was noticed that number of shoots, number of secondary branches and shoot elongation were significantly less than in the presence of either TDZ or kinetin. This led us to conclude that the concentration of BAP (0.5 mg/L) used in the present study was too high and toxic to the explants especially when using MS medium. BAP at 0.09 mg/L produced a better response for the in vitro culture of J. phoenicea and J. navicularis on explants from adult trees (Castro et al., 2011; Loureiro et al., 2007). TDZ effects appeared to be promising on the

stimulation of axillary bud differentiation using microcuttings from young seedling of J. phoenicea. Although how TDZ functions as a cytokinin is not known, improved regeneration using TDZ rather than cytokinins like BA is well documented in many plants (Canli and Tian, 2008; Huetteman and Preece, 1993; Wojtania et al., 2004). Similar to the results of the present study, TDZ was also reported to induce thickened and swelled tissues in many plants (Mundhara and Rashid, 2006; Singh et al., 2003). Conclusion The results of the present study provide evidence that seeds of J. phoenicea have deep physiological dormancy. In this sense, cold-moist stratification of mature seeds for up to three months was not sufficient to produce efficient germination response. Therefore, further studies should be carried out to investigate the effects of longer stratification periods on germination of J. phoenicea seeds. These studies should also investigate the effects of using various temperature regimes throughout the germination process on subsequent GC. However, studies concerning treatment of seeds with plant growth promoters or other stimulants of seed germination should be of high priority to replace longer stratification periods. In vitro culture techniques provide a great potential for the conservation of J. phoenicea. The use of OM medium combined with TDZ was promising for the multiplication and elongation of shoots using shoot tips containing few axillary buds from young seedlings as explants. And in conclusion, the surface-sterilization of mature seeds of J. phoenicea should be further optimized to reduce contamination. ACKNOWLEDGEMENTS This project was supported by the Deanship of Scientific Research in Al Balqa Applied University. Additional requirements and instruments were also provided by NCARE. The authors would like to thank the employees in Al Shouback University College and the Department of Forestry in Al Shouback for the help they provided in the collection of the plant material. REFERENCES Adams RP (2004). Junipers of the world: The genus Juniperus. Trafford, Vancouver. Adams RP, Pandey N, Rezzi S, Casanova J (2002). Geographic variation in the random amplified polymorphic DNAs (RAPDs) of Juniperus phoenicea, J.p. var. canariensis, J.p. subsp. eumediterranea, and J.p. var. turbinata. Biochem. Syst. Ecol. 30: 223229. Al-Qura’n S (2005). Vegetation dynamics in the Tafilah woodlands of southern Jordan. Am. J. Environ. Sci. 1: 46-49. Al-Ramamneh E (1998). Influence of seed treatments on germination of Tilia argentea and its propagation by stem cuttings. Master Thesis,

Al-Ramamneh et al.

University of Jordan, Jordan. Amer MMA, Wasif MM, Abo-Aytta AM (1994). Chemical and biological evaluation of Juniperus phoenicea as a hypoglycaemic agent. J. Agric. Res. 21: 1077-1091. Arista M, Ortiz PL, Talavera S (1997). Reproductive isolation of two sympatric subspecies of Juniperus phoenicea (Cupressaceae) in southern Spain. Plant Syst. Evol. 208: 225-237. Baskin CC, Baskin JM (2004). Determining dormancy breaking and germination requirements from the fewest seeds. In: Guerrant EO, Havens K, Maunder M (Eds.), Ex situ Plant Conservation: Supporting Species Survival in the Wild. Island Press, Washington, DC. Bewley JD, Black M (1994). Seeds: physiology of development and germination. Plenum press, New York. Boucaud J, Ungar IA (1973). The role of hormones in controlling the mechanically induced dormancy of Suaeda spp. Plysiol. Plant. 29: 97-102. Brito G (2000). Micropropagação de duas espécies autóctones da Ilha de Porto Santo (Olea europaea L. ssp. maderensis Lowe e Juniperus phoenicea L.) e estudo da resposta de rebentos in vitro a stress osmótico. Master Thesis, University of Aveiro, Aveiro. Canli FA, Tian L (2008). In vitro shoot regeneration from stored mature cotyledons of sweet cherry (Prunus avium L.) cultivars. Sci. Hortic. 116: 34-40. Castro MR, Belo AF, Afonso A, Zavattieri MA (2011). Micropropagation of Juniperus navicularis, an endemic and rare species from Portugal SW coast. Plant Growth Regul. 65: 223-230. Chien CT, Kuo-Huang LL, Piaolin T (1998). Changes in ultrastructure and abscisic acid level, and response to applied gibberellins in Taxus mairei seeds treated with warm and cold stratification. Ann. Bot. 81: 41-47. Dale IR, Greenway PJ (1961). Kenya trees and shrubs. Buchanan's Kenya Estate limited, Nairobi. Dissanayake P, George DL, Gupta ML (2010). Effect of light, gibberellic acid and abscisic acid on germination of guayule (Parthenium argentatum Gray) seed. Ind. Crop. Prod. 32: 111-117. El-Atta HA (1993). The effect of Caryedon serratus Olivier (Col., Bruchidae) on viability and germination of seeds of Acacia nilotica (L. Willd. ex Del.) in the Sudan. Forest Ecol. Manage. 57: 169-177. El-Bana M, Shaltout K, Khalafallah A, Mosallam H (2010).Ecological status of the Mediterranean Juniperus phoenicea L. relicts in the desert mountains of north Sinai, Egypt. Flora, 205: 171-178. Fang S, Wang J, Wei Z, Zhu Z (2006). Methods to break seed dormancy in Cyclocasrya paliurus (Batal) Iljinskaja. Sci. Hortic. 110: 305-309. García D (1998). Interaction between juniper Juniperus communis L. and its fruit insects: Pest abundance, fruit characteristics and seed viability. Acta Oecol. 19: 517-525. Garcia D, Zamora R, Gomez JM, Jordano P, Hodar JA (2000). Geographical variation in seed production, predation and abortion in Juniperus communis throughout its range in Europe. J. Ecol. 88: 436446. Goggin DE, Powles SB, Toorop PE, Steadman K (2011). Darkmediated dormancy release in stratified Lolium rigidum seeds is associated with higher activities of cell wall-modifying enzymes and an apparent increase in gibberellin sensitivity. J. Plant Physiol. 168: 527-533. Goggin DE, Steadman KJ, Emery RJN, Farrow SC, Benech-Arnold RL, Powles SB (2009). ABA inhibits germination but not dormancy release in mature imbibed seeds of Lolium rigidum Gaud. J. Exp. Bot. 60: 3387-3396. Gomez MP, Segura J (1995). Axillary shoot proliferation in cultures of explants from mature Juniperus oxycedrus trees. Tree Physiol. 15: 625-628. Gomez MP, Segura J (1996). Morphogenesis in leaf and single-cell cultures of mature Juniperus oxycedrus. Tree Physiol. 16: 681-686. Güleryüz G, Kirmizi S, Arslan H, Sakar FS (2011). Dormancy and germination in Stachys germanica L. subsp. bithynica (Boiss) Bhattacharjee seeds: Effects of short-time moist chilling and plant growth regulators. Flora 206: 943-948. Harry IS, Pulido CM, Thorpe TA (1995). Plantlet regeneration from mature embryos of Juniperus cedrus. Plant Cell. Tissue Org. Cult. 41: 75-78.

7691

Huetteman CA, Preece JE (1993). Thidiazuron: a potent cyctokinin for woody plant tissue culture. Plant Cell. Tissue Org. Cult. 33: 105-119. Koornneef M, Bentsink L, Hilhorst H (2002). Seeds dormancy and germination. Curr. Opin. Plant Biol. 5: 33-36. Lind EM, Morrison MES (1974). East African vegetation. Longman Group, London. Loureiro J, Capelo A, Brito G, Rodriguez E, Silva S, Pinto G, Santos C (2007). Micropropagation of Juniperus phoenicea from adult plant explants and analysis of ploidy stability using flow cytometry. Biol. Plant. 51: 7-14. Mazari k, Bendimerad N, Bekhechi C, Fernandez X (2010). Chemical composition and antimicrobial activity of essential oils isolated from Algerian Juniperus phoenicea L. and Cupressus sempervirens L. J. Med. Plant Res. 4: 959-964. Mazur M, Boratyńska K, Marcysiak K, Gómez D, Tomaszewski D, Didukh J, Boratyński A (2003). Morphological variability of Juniperus phoenicea (Cupressaceae) from three distant locations on Iberian Peninsula. Acta Soc. Bot. Pol. 1: 71-78. Mundhara R, Rashid A (2006). TDZ-induced triple-response and shoot formation on intact seedlings of Linum, putative role of ethylene in regeneration. Plant Sci. 170: 185-190. Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15: 473-497. Nadjafi F, Bannayan M, Tabrizi L, Rastgoo M (2006). Seed germination and dormancy breaking techniques for Ferula gummosa and Teucrium polium. J. Arid Environ. 64: 542-547. Negussie A (1997). In vitro induction of multiple buds in tissue culture of Juniperus excelsa. For. Ecol. Manage. 98: 115-123. Nonogaki H, Bassel GW , Bewley JD (2010). Germination-Still a mystery. Plant Sci. 179: 574-581. Ortiz PL, Arista M, Talavera S (1998). Low reproductive success in two subspecies of Juniperus oxycedrus L. Int. J. Plant Sci. 159: 843-847. Penfield S, Josse EM, Kannangard R, Gilday AD, Halliday KJ, Graham IA (2005). Cold and light control seed germination through the bHLH transcription factor Spatula. Curr. Biol. 15: 1998-2006. Piotto B, Bartolini G, Bussotti F, García AA, Chessa I, Ciccarese C, Ciccarese L, Crosti R, Cullum FJ, Di Noi A, García-Fayos P, Lambardi M, Lisci M, Lucci S, Melini S, Reinoso JCM, Murranca S, Nieddu G, Pacini E, Patumi GPM, García FP, Piccini C, Rossetto M, Tranne G, Tylkowski T (2003). Fact sheets on the propagation of Mediterranean trees and shrubs from seeds. In: Piotto B, Di Noi A (Eds.), Seed propagation of Mediterranean trees and shrubs. Agency for the Protection of the Environment and for Technical Services (APAT), Roma, Italy. Qnais EY, Abdulla FA, Abu Ghalyun YY (2005). Antidiarrheal effects of Juniperus phoenicea L. leaves extract in rats. Pak. J. Biol. Sci. 8: 867-871. Rugini E (1984). In vitro propagation of some olive (Olea europaea L. var. sativa) cultivars with different root-ability, and medium development using analytical data from developing shoots and embryos. Sci. Hortic. 24: 123-134. SAS Institute Inc (2001). SAS/STAT, Statistical guide release. Cary, NC, USA. Saxena A, Singh DV, Joshi NL (1996). Autotoxic effects of pearl millet aqueous extracts on seed germination and seedling growth. J. Arid Environ. 33: 255-260. Shimizo-Sato S, Mori H (2001). Control of outgrowth and dormancy in axillary buds. Plant Physiol. 127: 1405-1413. Singh ND, Sahoo L, Sarin NB, Jaiwal PK (2003). The effects of TDZ on organogenesis and somatic embryogenesis in pigeonpea (Cajanus cajan L. Millsp). Plant Sci.164: 341-347. Syouf MQ, Duwayri MA (1996). Jordan: Country report to the FAO international technical conference on plant genetic resources. Leipzig. Tigabu M, Fjellström J, Odén PC, Teketay D (2007). Germination of Juniperus procera seeds in response to stratification and smoke treatments, and detection of insect-damaged seeds with VIS + NIR spectroscopy. New Forest. 33: 155-169. Wesche K, Ronnenberg K, Hensen I (2005). Lack of sexual reproduction within mountain steppe populations of the clonal shrub Juniperus sabina L. in semi-arid southern Mongolia. J. Arid Environ. 63: 390-405.

7692

Afr. J. Biotechnol.

Wojtania A, Gabryszewska E, Marasek A (2004). Regeneration of Pelargonium x hederaefolium ‘Bonete’ from petiol explants. Acta Physiol. Plant. 26: 255-262. Zhou Z, Bao W (2011). Levels of physiological dormancy and methods for improving seed germination of four rose species. Sci. Hortic. 129: 818-824.

African Journal of Biotechnology Vol. 11(30), pp. 7693-7700, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.3740 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Lactic acid fermentation from refectory waste: Factorial design analysis Didem OMAY1* and Yuksel GUVENILIR2 1

Yalova University, Faculty of Engineering, Chemical and Process Engineering, Yalova, Turkey Istanbul Technical University, Faculty of Chemical and Metallurgical Engineering, Department of Chemical Engineering, Istanbul, Turkey

2

Accepted 30 March, 2012

A factorial experimental design method was used to optimize the lactic acid production using Lactobacillus bulgaricus from refectory waste obtained from Istanbul Technical University mess hall, Turkey. Fermentation experiments were carried out in a batch type reactor system which contains refectory waste with Lactobacillus bulgaricus bacteria during an exposition time of 30 h. Factorial design of experiments was employed to study the effect of three factors namely temperature (30 and 45°C), substrate concentration (10 and 60 g/L) and pH (4.0 and 6.0) at two markedly different levels. The main effects and interaction effects of the three factors were analysed using statistical techniques. A regression model was recommended and it was found to fit the experimental data very well. The results were analysed statistically using Student’s t-test, and analysis of variance was used to define the most important process variables affecting the production of lactic acid by fermentation. In the present study, the most significant factor affecting lactic acid fermentation was found to be the initial substrate concentration. Key words: Refectory waste, lactic acid, factorial design, Lactobacillus bulgaricus. INTRODUCTION Lactic acid is an organic acid (α-hydroxy-propionic acid) used for a wide variety of industrial applications. In food industry, it is used as an acidulant, a preservative and an antimicrobial agent. For pharmaceutical applications, lactic acid can be used as electrolytes and mineral sources. For technical applications lactic acid can be used as neutralizers, solvents, cleaning agents, slow acid release agents and metal complexing agents. It has also been used in cosmetic industry as pH buffer, antimicrobial, skin rejuvenating and skin lightening. A large number of carbohydrate materials have been used, tested or proposed for the manufacture of lactic acid by fermentation (Vick Roy, 1985). There are two isomers of lactic acid, these are D(-) and L(+) forms, which differ only in their optical properties, but are identical in their physical and chemical characteristics. L(+)-Lactic acid is biodegradable and can be metabolized by the human

*Corresponding author. E-mail: didem.omay@yalova.edu.tr.

body and this property has resulted in the application of lactic acid in biomaterial and biomedical field (Hunger, 1984). Lactic acid is produced by chemical synthesis and by microbial fermentation. By chemical synthesis method, racemic mixture of lactic acid is produced, while by microbial fermentation method L(+) and D(-) lactic acids can be produced according to the type of microorganism which may be homofermentative or heterofermentative. This is an important advantage of the microbial fermentation method compared to the chemical synthesis method. At the end of the fermentation process, lactic acid exists in the complex medium of fermentation broth that contains whey proteins, biomass, salts and other impurities. Lactic acid is then recovered from this complex medium. Since the high cost of lactic acid purification process limits the utilization of this chemical, in a large scale application, a system with less raw material and fewer unit operations are needed (Narayanan et al., 2004). Sucrose from cane and beet sugar, whey containing

7694

Afr. J. Biotechnol.

lactose, and maltose and dextrose from hydrolysed starch are presently used commercially for lactic acid production. Over the years, authors have studied a large number of carbohydrates and nitrogenous materials for production of lactic acid. These have been investigated on the basis of high lactic acid yields, optimum biomass production, negligible by-product formation, fast fermentation rate, less pre-treatment, easy downstream processing, low cost, ease of availability etc. The choice of the raw material to be used depends on the microorganisms studied and also on the product desired. Sucrose, lactose, maltose, glucose, mannitol etc. have been commercially used (Narayanan et al., 2004). Batch fermentations are widely used method for the production of lactic acid. Fermentation conditions are different for each industrial producer but are typically in the range of 45 to 60°C with a pH of 5.0 to 6.5 for Lactobacillus delbrueckii; 43°C and a pH of 6.0 to 7.0 for Lactobacillus bulgaricus. The acid formed is neutralized by calcium hydroxide or calcium carbonate. The fermentation time is 1 to 2 days for 5% sugar sucrose such as whey and 2 to 6 days for a 15% sugar source such as glucose or sucrose. Under optimal laboratory conditions the fermentation takes 1 to 2 days. The yield of lactic acid after the fermentation stage is 90 to 95 wt% based on the initial sugar or starch concentration (John et al., 2006). The fermentation rate depends primarily on the temperature, pH, concentration of nitrogenous nutrients, and initial substrate concentration. The undissociated, electroneutral form of lactic acid rather than lactate appears to be the components which inhibits the fermentation (Vick Roy, 1985). In the present study, lactic acid was produced from refectory waste, which was collected from Istanbul Technical University mess hall, through fermentation process and convenient conditions were optimized for the production of the highest lactic acid yield via experimental design analysis. The most important factors for the production of lactic acid using fermentation process are the substrate concentration, pH and temperature. Factorial design of experiments was employed to study the effect of these three factors on the lactic acid production. Also, this work represents the first in the literature to follow the factorial experimental design of lactic acid production using Lactobacillus bulgaricus from refectory waste. MATERIALS AND METHODS Microorganism and culture conditions L. bulgaricus (DSMZ 20081) was used through the study. The microorganism was maintained on De Man, Rogosa and Sharpe (MRS) agar plates at 4°C and sub-cultured every 15 days. Cells for inoculation of the production medium at a level of 10% (v/v) were obtained from cultures grown on MRS broth (pH 7.0) at 37°C for 24 h in the incubator and kept at 4°C in the refrigerator. Twenty-four hour (24 h) old fresh cultures were used as the inoculum for the

fermentations. Composition of refectory waste Reducing sugar and total carbohydrates of refectory waste was estimated by dinitrosalicylic acid and phenol sulphuric acid methods, respectively. Physiochemical properties of refectory waste were determined using standard protocols. The pH of the sample was determined using a digital pH meter. Lactic acid fermentation Batch experiments were performed in a temperature-controlled incubator shaker operated at 160 rpm, at 37°C. The shake flasks were 250 ml Erlenmeyer flasks containing 100 ml of refectory waste as fermentation medium (initial pH 6). Unless otherwise indicated, refectory waste was dissolved to attain 58 g/L of initial sucrose concentration and supplemented with (g/L) yeast extract (10), K2HPO4 (0.5), KH2PO4 (0.5), MgSO4 (0.2) and MnSO4.H2 O (0.05). Refectory waste medium (pH 6.0) and all salt solutions were sterilized separately at 121°C for 15 min. Sterile CaCO3 (10% (w/v) of the initial sucrose concentration) was added to the medium to neutralize the acid. The shake flasks were inoculated aseptically with 30-h-old fresh culture propagated in medium at 30 and 45°C (Mel et al., 2008). Lactic acid determination Lactic acid concentrations were analysed by high performance liquid chromatography (HPLC). The HPLC system was composed of Agilent 1100 Series. The mobile phase was 5 mM H2 SO4 for Aminex HPX-87H column. Mobile phase was filtered through 45 µM cellulose acetate filter papers after solution preparation (Okano et al., 2009). Experimental design and statistical analysis In the optimization studies using factorial design analysis, initial substrate concentration, pH and temperature were varied as parameters, while the levels of other medium components were kept constant. The statistical analysis of the data was performed using Minitab Statistical Software (Release 14). In this design, there were two experimental levels (-1, +1) where –1 and +1 corresponded to low level and high level of each variable, respectively (Kotzamanidis et al., 2002).

RESULTS Composition of refectory waste Samples of waste collected from Istanbul Technical University mess hall were analysed for moisture, ash, protein, total reducing sugar and total carbohydrates, nitrogen and protein contents (Table 1). The refectory waste contained mainly carbohydrate components. Total carbohydrate (total reducing sugar + sucrose) and total reducing sugar content of the refectory waste were confirmed as 61.38 and 0.47% respectively. During the inversion of 1 mole of sucrose, it reacts with 1 mole of water and 95 g of sucrose to produce 100 g of reducing

Omay and Guvenilir

7695

Table 1. Composition of refectory waste.

Composition of medium Moisture content Total Ash Total reducing sugar Total carbohydrate Nitrogen Protein

Percentage (%) 7.50 5.68 0.47 61.38 2.85 10.41

Table 2. Levels of factors.

Factor pH Temperature, T (°C) Initial substrate concentration, S0 (g/L)

Low (-1) 4.0 30 10

High (+1) 6.0 45 60

Table 3. Experimental factorial design results for lactic acid.

T -1 +1 -1 +1 -1 +1 -1 +1

Factor S0 -1 -1 +1 +1 -1 -1 +1 +1

pH -1 -1 -1 -1 +1 +1 +1 +1

Produced lactic acid (g/L) SF1 SF2 SF3 8 6 6 13 10 17 20 18 22 29 32 30 15 12 13 24 18 23 27 25 29 43 47 40

T, Temperature; S0, ınitial substrate concentration.

sugar. From this principle, sucrose content of the refectory waste was calculated as difference between total carbohydrates and reducing sugar multiplied by 0.95 and sucrose content and was estimated at 58 g/L. The moisture content of refectory waste was found in the range of 5 to 10%, the nitrogen content in waste was 2.85% and ash content at range 5 to 6%. The lactic acid bacteria require substrates with high nitrogen content during fermentation. The nutrients were added in the form of malt sprout, corn steep liquor, and yeast extract. Lactic acid production increased with the concentration of the supplement especially yeast extract. The highest production rate was found with addition of 5 to 15 g/L yeast extract (Lund et al., 1992). Although the refectory waste contained very little nitrogen, this concentration was adequate for lactic acid bacteria growth in the present study. Experimental analysis

determined. The effect of a factor was in the change in response and production of lactic acid by a change in the level of a factor, pH, temperature and initial substrate concentration from lower to higher level (Table 2). Eight experiments were carried out and each of them was replicated three times. All possible combinations of factors were used and a matrix was established according to the high and low levels represented by +1 and -1 respectively (Table 3). The main effects represented deviations of the average between high and low levels for each one of them. When the effect of a factor was positive, production of lactic acid increased as the factor was changed from low to high levels. The results were analysed using the software for a 95% confidence level (α = 0.05) and main effects and interactions between factors were examined. The effects, regression coefficients, standard errors and p were shown in Table 4. The mathematical model 3 employed for the 2 factorial design was:

The results were analysed using Minitab 14 for windows. The main effects and interaction between factors were

SF = A0 + A1*T + A2*S0 + A3*pH + A4*T*S0 + A5*T*pH + A6*S0*pH + A7*T*S0*pH........................ (1)

7696

Afr. J. Biotechnol.

Table 4. Statistical parameters for 23 design.

Term Constant T S0 pH T*S0 T*pH S0*pH T*S0*pH

Effect 21.9583 10.4167 16.4167 8.7500 2.9167 1.9167 1.2500 1.0833

Coefficient 21.9583 5.2083 8.2083 4.3750 1.4583 0.9583 0.6250 0.5417

Standart error 0.5052 0.5052 0.5052 0.5052 0.5052 0.5052 0.5052 0.5052

t-statistic 43.47 10.31 16.25 8.66 2.89 1.90 1.24 1.07

p 0.000 0.000 0.000 0.000 0.011 0.076 0.234 0.300

Figure 1. Main effects plot for produced lactic acid. T, Temperature; S0, ınitial substrate concentration.

Where A0 represents the global mean and Ai represents the other regression coefficients. Substituting the coefficient Ai in Equation (1) by their values from Table 4 we got model equation: SF = 21.9583 + 5.2083T + 8.2083S0 + 4.3750pH + 1.4583T*S0 + 0.9583T*pH + 0.6250S0*pH + 0.5417T*S0*pH…………………………………………… (2) Equation (2) presented that effects of all factors were positive and results in an increase in the value of the produced lactic acid. The main effects of the control factors were presented in Figure 1. A horizontal line

(parallel to the x-axis) indicated that no main effect was present (the control factor does not influence the objective function). If the line was not horizontal, there could be a main effect present and in this case the control factors influence the objective function. The greater the slope of the line, the stronger the effect produced. Student’s t-test The Pareto chart (Figure 2) gave the relative importance of the individual and interactions effect. Student’s t-test

Omay and Guvenilir

7697

2.12

Figure 2. Pareto chart of standardized effects on the produced lactic acid concentration. T, Temperature; S0, ınitial substrate concentration.

Table 5. Analysis of variance.

Source Main effects 2-way interactions 3-way interactions Residual error Pure error Total 2

R = SSMODEL/SSTOTAL; R

Degrees of freedom 3 3 1 16 16 23 2

Sum of square 2727.46 82.46 7.04 98.00 98.00 2914.96

Mean square 909.153 27.486 7.042 6.125 6.125 2

adj

= 1 – [(SSERROR/DFERROR)/(SSTOTAL/DFTOTAL)]; R = % 96.64

was performed in order to determine whether the calculated effects were significantly different from zero and these values for each effect were shown in Pareto chart by horizontal columns. In our case, all control factors with a significant influence were located over the line marked at 2.12 (p = 0.05). The vertical line in the chart indicated the minimum statistically significant effect magnitude for 95% confidence level. Analysis of variance (ANOVA) In Table 5, the sum of squares used to estimate the factors’ effects and F ratios are shown. It can be said

R

2 (adj)

F 148.43 4.49 1.15

p 0.000 0.018 0.300

=% 95.17.

that R2 and R2(adj) values which were important due to test obtained mathematical model were close to each other 2 2 and approximately 1.0 (R = 96.64%, R (adj) =95.17%) that of expected result statistically. Another important aspect was the interaction among the control factors. The interaction between the control factors can be estimated from experimental design and the results were presented in Figure 3. If the lines were parallel to each other, there was no interaction present. With the increase of the deviation degree of line from being parallel, the interactions among control factors increase. The residues were also examined for normal distribution. Figure 4 shows the normal probability plot of residual values. It could be seen that the experimental points were

7698

Afr. J. Biotechnol.

Figure 3. Interaction effects for produced lactic acid. T, Temperature; S0, ınitial substrate concentration.

reasonably aligned, thus suggesting normal distribution. DISCUSSION Lactic acid starters are currently produced using pH controlled pure cultures (Beal et al., 1989), during which pH is generally regulated at an optimal value by continuously adding sodium hydroxide or ammonia in the bioreactor (Savoie et al., 2007). Various growth characteristics such as maximal biomass concentration, specific growth rate, fermentation time, substrate consumption and product yields are influenced by the pH value (Adamberg et al., 2003). Optimal pH ranges were therefore determined for several lactic acid bacteria, such as Streptococcus thermophilus (pH 6.5), Lactococcus lactis subsp. cremoris (pH 6.3 to 6.9) and L. bulgaricus (pH 5.8 to 6) (Beal et al., 1989). The effect of initial pH on the cell growth of L. bulgaricus during the fermentation of refectory waste was investigated and optimized in the present study. According to the experimental results, at the initial pH of 4.0, the bacteria exhibited a prolonged lag phase and bacteria did not grow as well as at higher initial pH value. Moreover, as the initial pH increased above 4.0, the cell

growth increased, however, until up to a certain limit. Beyond initial pH 6.5, its growth rate decreased again. Therefore, the optimal initial pH for the refectory waste fermentation of L. bulgaricus was 6.0, which is similar to those reported by Goksungur and Guvenc (1997) by using beet molasses as a substrate. Various researchers have studied the effect of pH on lactic acid production and found that the optimum pH for lactic acid production is in the range of 5.0 to 7.0 (Hofvendahl and Hagerdal, 2000; Goksungur and Guvenc, 1997). Goksungur and Guvenc (1997) showed that the effect of pH on lactic acid production was important and the optimal pH was 6.0 with the yield value 79%. That is why when the statistical analysis of the data was performed using Minitab, the levels of pH factors used in the experimental design were chosen as pH 4.0 and 6.0 (Table 2). Also, temperature is one of the most important environment factors that effect the lactic acid production. Various studies on the effect of temperatureon the lactic acid production have reported an optimal temperature between 40 to 45°C (Hofvendahl and Hagerdal, 2000). Goksungur and Guvenc (1997) reported that the optimal temperature was 45°C and this might be due to the different substrates used in the lactic acid fermentation. Maximum yield obtained with 53.61 g/L of lactic acid when the temperature was 45°C, and the

Omay and Guvenilir

7699

Figure 4. Normal probability plot of residual values for concentration of lactic acid vs. their expected values when the distribution is normal.

lactic acid production decreased rapidly to 25.14 g/L Lactobacillus helveticus used in a temperature range of 35°C. For similar reason the causes of choosing the pH levels, temperature levels were chosen as 30 and 45°C (RakĹn et al., 2004). In the present study, the Pareto chart showed that substrate concentration has a highly significant effect on the produced lactic acid concentration (Figure 2). Additionally, for initial substrate concentration at 60 g/L, concentration of lactic acid was estimated as 20 g/L. This value was considerably higher than the obtained value using initial substrate concentration as 10 g/L (Table 3); this situation was considered ideal in batch type fermentations. It was observed that as the initial substrate concentration increased to a very high point, production of lactic acid decreased clearly (results were not given), a phenomenon that can occur by substrate inhibition, product inhibition or exhaustion of one restricting nutrient or their combined effect. It was reported that in batch type, lactic fermentations have varying substrate concentrations from 20 to 100 g/L; the results for lactic acid concentrations and sucrose conversion obtained were similar to those reported in this study. It was also reported inhibition by substrate in fermentations occur using Lactobacillus casei NRRL B-441, and varying the glucose concentration between 80 and 160 g/L (Hujanen et al., 2001). According to these results, the effects of the high and low levels for the initial substrate concentration were chosen as 10 and 60 g/L in paralleling to the other variables. It was observed that initial substrate concentration (S0)

whose value was 16.4167, was the most significant effect on the production of lactic acid. After that respectively T and pH main effects and T*S0 binary interaction presented the statistical significance. Other binary and trio interactions were not statistically significant: T*pH, S0*pH and T*S0*pH. Similar results were obtained when p values were evaluated. From the p value which was defined as the smallest level of significance leading to rejection of the null hypothesis, it appears that the main effect of each factor and the interaction effects were statistically significant when p<0.05. So, it can be said that the main effects of T, S0, pH, and interaction effect T*S0 were statistically significant. On the other hand, p values of T*pH, S0*pH and T*S0*pH interaction effects were higher than 0.05, so these interaction effects were not statistically significant (Table 4). The effects of the all variables (pH, temperature and initial substrate concentration) and their interactions on the formation of the lactic acid production were illustrated with analysis of variance (Table 5). The goodness of fit of the analysis of variance model was checked by the 2 determination coefficient (R ). In this case, the value of 2 the R (0.9664) for ANOVA indicates that the sample variation of nearly 97% for lactic acid was attributed to the independent variables and only 3% of the total variation could not be explained by the model. The value of the adjusted determination co efficient (R2adj = 0.9517) was also high, which stressed the significance of the model. The high value of R (0.9664) demonstrated a high degree of agreement between the experimental observations and predicted values.

7700

Afr. J. Biotechnol.

Conclusion In this study, important process variable factors which affect fermentative lactic acid production were determined using a factorial experimental design technique. The results of statistical study clearly showed that initial substrate concentration was the most important parameter. Moreover the main effect of temperature, pH and interaction between temperature-initial substrate concentrations had a considerable effect on the amount of lactic acid produced. Other two-way and three-way interactions did not exhibit any statistical significance. REFERENCES Adamberg K, Kask S, Laht TM, Paalme T (2003). The effect of temperature and pH on the growth of lactic acid bacteria: a pHauxostat study. Int. J. Food Microbiol. 85: 171-183. Béal C, Louvet P, Corrieu G (1989). Influence of controlled pH and temperature on the growth and acidification of pure cultures of Streptococcus thermophilus 404 and Lactobacillus bulgaricus 398. Appl. Microbiol. Biotechnol. 32: 148-154. Goksungur Y, Guvenc U (1997). Continuous production of lactic acid from beet molasses by L. Delbrueckii IFO 3202. J. Chem Eng. Biotechnol. 69: 399-404. Hofvendahl K, Hagerdal BH (2000). Factors affecting the fermantative lactic acid production from renewable resources. J. Enzymes, Microbial Technol. 26: 87-107. Hujanen M, Linko S, Linko Y, Leisola M (2001). Optimization of media and cultivation conditions for L(+) (S)-lactic acid production by Lactobacillus casei NRRL B- 441. Appl. Microbiol. Biotechnol. 56(12): 126-130. Hunger W (1984). Dextro-rotatory and levo-rotatory lactic acid: Their significance and occurrence in sour milk products. Danish Dairy Food Industry Worldwide, 4: 39-42. John RP, Nampoothiri KM, Pandey A (2006). Simultaneous saccharification and L(+) lactic acid fermentation of protease-treated wheat bran using mixed culture of lactobacilli, Biotechnol. Lett. 28(2): 1823-1826. Kotzamanidis Ch, Roukas T, Skaracis G (2002). Optimization of lactic acid production from beet molasses by Lactobacillus delbrueckii NCIMB 8130. World J. Microb. Biot. 18(5): 441-448.

Lund B, Nordahl B, Ahring B (1992). Production of lactic acid from whey using hydrolysed whey protein as nitrogen source. Biotechnol. Lett. 14: 851-856. Mel M, Karim MIA, Salleh MRM, Amin NAM (2008). Optimizing media of Lactobacillus rhamnosus for lactic acid fermentation. J. Appl. Sci. 8(17): 3055-3059. Narayanan N, Roychoudhury PK, Srivastava A (2004). L(+) lactic acid fermentation and its product polymerization. Electron. J. Biotechnol. 7(2): 167-179. Okano K, Zhang Q, Shinkawa S, Yoshida S, Tanaka T, Fukuda H, Kondo A (2009). Efficient production of optically pure D-Lactic acid from raw corn starch by using a genetically modified L-Lactate dehydrogenase gene deficient and alpha amylase secreting Lactobacillus plantarum strain. Appl. Environ. Microbiol. 75(2): 462467. Rakın M, Baras J, Vukasinovic M, Maksimovic M (2004). The examination of parameters for lactic acid fermentation and nutritive value of fermented juice of beetroot, carrot and brewer’s yeast autolysate. J. Serb. Chem. Soc. 69(8-9): 625-634. Savoie S, Champagne CP, Chiasson S, Audet P (2007). Media and process parameters affecting the growth, strain ratios and specific acidifying activities of a mixed lactic starter containing aromaproducing and probiotic strains. J. Appl. Microbiol. 103: 163-174. Vick Roy TB (1985). Lactic acid. in Comprehensive biotechnology: the principles, applications, and regulations of biotechnology in industry, agriculture and medicine, ed Moo-Young M. (Pergamon Press, New York), 2: 761-776.

African Journal of Biotechnology Vol. 11(11), pp. 7701-7710, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.2874 ISSN 1684–5315 © 2011 Academic Journals

Full Length Research Paper

Optimization of growth parameters for increased yield of the edible mushroom Calocybe indica Gopinath Lakshmipathy*, Arunkumar Jayakumar, Meera abhilash and Shantha Prema Raj Department of Industrial Biotechnology, Dr. MGR Educational and Research University, Maduravoyal, Chennai - 600095, India. Accepted 25 November, 2011

This study was conducted to enhance the yield performance of Calocybe indica through optimization of the cultivation parameters by utilizing cheaper substrates that are available in Tamil Nadu, India. The total fresh mushroom yield obtained with a change in spawn substrate, spawn running bed substrate (SRBS), sterilization procedure and casing soil with different amendments were studied. Sorghum grains provided the highest yield of 1.58 ± 0.06 g fresh mycelia after 17 ± 0.75 days of incubation. The protein, fat, carbohydrate, dietary fiber, moisture and ash content of mushrooms were also analyzed. The maximum amount of nutritive value was obtained from the paddy straw and the lowest from sugarcane leaves as substrate. The fat, protein, carbohydrate, dietary fiber, moisture and ash (g/100 g dried matter) values of C. indica were 0.66 ± 0.02 g, 31.29 ± 1.56 g, 58.40 ± 1.75 g, 38.21 ± 1.91 g, 84.91% and 8.47 ± 0.25 g, respectively, when cultivated in paddy straw. Furthermore, the chemical sterilization yielded 1.16 kg of mushroom with a contamination rate of <8 of 30 bags. The different chemical compositions were used in the preparation of casing soil; however, it produced the highest yield of 1648 ± 49.44 g/kg (w/w) for paddy straw. Key words: Calocybe indica, chemical sterilization, growth parameters, physical sterilization, substrate. INTRODUCTION Mushrooms have been favored as food by mankind for a long time. Mushrooms supply a rich addition to the diet in the form of protein, carbohydrates, valuable salts, minerals and vitamins. As food, the nutritional value of mushrooms deceit in between meat and vegetables. Calocybe indica, commonly known as milky white mushroom, grows during the summer and it is a tropical mushroom known for its nutritive value. Its robust size, sustainable yield, attractive colour, delicacy, long shelflife and lucrative market value have attracted the attention of both mushroom consumers and prospective growers. C. indica is rich in protein, lipids, fiber, carbohydrates and vitamins and contains an abundant amount of essential amino acids and low fat product (Ruhul et al., 2010). These qualities make it suitable for food supplement in diet.

*Corresponding author. E-mail: snehamgp@gmail.com. Tel: +91 9003271819.

Commercial milky white mushroom growers are mostly confined to Tamil Nadu, India, particularly in Erode, Salem, Coimbatore, Trichy, Madurai and other districts (Krishnamoorthy, 2003). Among vital growth requirements, environmental factors play a major role in the growth and reproduction of edible fungi. Cultivation of C. indica is influenced by temperature and relative humidity for its yield. However, optimum conditions favorable for the growth of C. indica have not been clearly defined under controlled conditions. Growing edible mushrooms is the most efficient method of bioremediation of the large quantity of lignocellulosic wastes generated annually through agricultural and allied activities (Stamets, 2000). Considering these facts, this research work was committed towards the optimization of the growth parameters to increase yield and to bioremediate agricultural wastes. Synthetic substrates using different cellulosic waste formulations are used to study their effect on the yield of mushroom. The aim was to investigate the effect of various substrates, casing materials and other supplements that can be used to optimize the growth conditions

7702

Afr. J. Biotechnol.

Table 1. Design summary for optimizing the concentration of chemicals for sterilization of substrate.

Variable

Units

Formaldehyde (A) Carbendazim (B)

ml/L g/L

-1 100 30

-α -65.68 11.36

Level 0 500 75

+1 900 120

+-α 1065.69 138.64

Table 2. Experimendal design and of 22 factorial design.

No of Run

A: Formaldehyde (ppm)

B: Carbendazim (g)

1 2 3 4 5 6 7 8 9 10 11 12

500 500 500 1065.68 500 900 100 500 100 900 500 500

75 138.63 75 75 75 120 30 75 120 30 75 11.36

13

0

75

and enhance the yield of C. indica. Additionally, it was intended to compare the quality attributes of conventional methods of mushroom cultivation.

Substrates for cultivation of C. indica

MATERIALS AND METHODS

Coir pith, maize straw, paddy straw, sugarcane bagasse, sugarcane leaves and vettivera leaves were used as substrates for this study. All the substrates except coir pith were chopped into 2 to 3inch pieces and soaked in water. The substrates were sterilized by physical and chemical methods.

The commercial edible mushroom, C. indica, procured from Tamil Nadu Agricultural University, Coimbatore was used for this study.

Physical sterilization

Preparation of spawn Clean grains such as sorghum, wheat, bajra and rice husk were selected for spawn preparation. The grains were washed and soaked for 6 to 8 h in cold water and then boiled for 40 min. The boiled grains were drained and supplemented with 2% of calcium carbonate (CaCO3), and then the excess moisture was reduced through air drying to 60%. The treated grains (250 g) were packed in poly propylene bags (of size 200 × 300 mm in dimensions) with necks made from cut PVC pipes in place of the commercial plastic neck to hold the cotton plug and autoclaved at 121°C for about 45 min. The bags were taken out of the autoclave and allowed to cool for a day. After sterilization and cooling, the bags were inoculated with pure culture of C. indica from the potato dextrose agar (PDA) Petri plates. The culture and grains were mixed by shaking to uniformly distribute the mycelium. Inoculated bags were incubated at 27 ± 2°C for mycelial growth without light for 17 to 23 days until the mycelium fully covered the grains.

The chopped substrates were soaked in water for 3 to 4 h. Steam sterilization was done by autoclaving the substrates at 121°C for various durations such as 15, 30, 45, 60, 75 and 90 min. Substrates were air-dried so that a moisture content of about 65% was allowed in the wet substrate prior to spawning.

Chemical sterilization Statistical optimization of the concentration of chemicals by response surface methodology (RSM) The optimum concentration of chemicals required for sterilization of the substrate was analyzed by RSM using the central composite design. The experiments were carried out by using Design-Expert 7.1.6 software package (Tables 1 and 2). RSM is a collection of statistical and mathematical techniques useful for developing, improving and optimizing the process. RSM defines the effects of the independent variables alone or in combination, on the process. In addition to analyzing the effects of the independent variables, this experimental methodology generates a mathematical model

Lakshmipathy et al.

that accurately describes the overall process. It has been successfully applied to optimizing conditions in food, chemical and biological processes.

Experimental design of RSM for optimizing the concentration of chemicals for sterilization of substrate The levels of two variables like temperature and pH were optimized for chemical sterilization of substrates. For that purpose, the response surface approach by using a set of experimental design (central composite design with five coded levels) was performed. The factors were at the level of 0. The axial distance α, was chosen to be 1.68 to make this design orthogonal. A set of 13 experiments was done for two variables. The central values (0 level) chosen for experimental design were given as gram per liter (g/L). In developing the regression equation, the test factors were coded according to the following equation:

7703

Preparation of casing material The casing material was prepared with various combinations of farm-yard manure. Different supplements were tried for the increased yield. Different combinations of supplements such as CaCO3 and gypsum were mixed with the casing soil to promote growth of the mushroom. After mycelial colonization, the mouth of the spawn ran bed was cut into two equal parts. Casing layer of half an inch thickness was laid over the spawn ran open part of bed. After casing, the bags were transferred in to the cultivation sheds for fruiting at 32 to 37°C temperatures and 80 to 90% humidity. Controlled environment such as temperature light and ventilation were maintained during the cropping period in the cultivation chamber. Water was also sprayed regularly to keep the surface of the substrate to maintain moisture. Fruiting bodies once after maturation were harvested from two flushes by twisting them slightly near the base and fresh weights were recorded immediately. Bits and pieces of harvested sporophores were not allowed to remain in the substrate. Biological efficiency was calculated as the ratio between the fresh weight of mushrooms and the dry weight of substrate per bag and was expressed as percent.

(1)

(1) Proximate analysis

Where xi is the coded value of the ith independent variable, Xi the natural value of the ith independent variable, X0 the natural value of the ith independent variable at the center point, and ∆Xi the step change value of variables. For a two-factor system, the model equation is:

Estimation of the moisture content (Ranganna, 1977), crude fibre content (Maynard, 1970), total carbohydrates content (Anthrone method), ash content (Horsefall and Ayebaemi, 2004), protein content (Bradford method) and fat content (Soxhlet method), of the samples were done by the standard methods.

Experimental design (2) Where Y is the predicted response; b0 is the intercept; b1, b2, and b3 are linear coefficients; b11, b22, and b33 are squared coefficients; and b12, b13, and b23 are the interaction coefficients (Myers and Montgomery, 2002). Based on the concentrations of the chemicals, the chemical sterilization was carried on with the substrates. The substrates were soaked in the different concentration of the chemicals for 16 to 18 h. Excess moisture was removed. Moisture content of about 60% was allowed in the wet substrate prior to spawning.

Each experiment had three replicates. The following data were collected; mycelial growth in the different substrates, change in nutritive value while using different substrates, the number of contaminated bags after subjecting to different sterilization methods and variation, number of days required for the initiation of primordial in different substrates, the number of days required for total harvest, the number of effective fruiting bodies, economic yield, and biological efficiency and nutritional difference while using different combinations of casing soil.

Statistical analysis Preparation of cultivation bed Substrates (500 g) were added to polypropylene bags (7 × 10'' sizes) as different layers, spawns (100 g) were sowed over the six layers of substrate, and nearly 16.6 g of spawn was laid on each layer. The openings of the bags were plugged with cotton and secured with plastic rings. The spawned bags were incubated in dark under normal room temperature (25 to 35°C) for spawn run.

All values were expressed as means ± standard deviation. The results were analyzed using one-way analysis of variance (ANOVA) and the differences among the treatments means were analyzed using the Tukey-Kramer multiple comparison test. P value<0.05 was considered as least significant. The software GraphPad InStat was employed for the statistical analysis.

RESULTS AND DISCUSSION Cultivation chamber Once after the spawn run and casing, the beds were incubated in the dome shaped partially sunken chamber lined with blue coloured sylphalein sheet which was used as the roofing material. The chamber’s pit walls were built with hollow blocks from the bottom, with smooth flooring and convenient steps near the entrance with good cross ventilation. The skeleton structures of the chamber were made by waste polymer (Procured from Texnova, Chennai).

The effect of spawn grains on the rates of mycelial production of C. indica The differences in the means due to grain were highly significant (p<0.05) wet weight, and maximum mycelial growth was observed. The wet mycelial weight of C. indica was significantly increased in media containing sorghum. Wheat, rice husk and bajra induced lesser mean weights than sorghum. Sorghum was found to be

7704

Afr. J. Biotechnol.

Table 3. Optimization of spawn on different substrate.

Types of Substrate Wheat Bajara Rice husk Sorghum

Mycelial fresh weight (g) a 0.717 ± 0.035 0.761 ± 0.041a a 0.844 ± 0.036 b 1.583 ± 0.06

Mycelia formation (days) a 18 ± 0.8 20 ± 0.86ab b 23 ± 0.95 17 ± 0.75a

Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

Table 4. Nutritional analysis of C. indica grown on different substrates.

Substrates Coir pith Maize straw Paddy straw Sugarcane bagasse Sugarcane leaves vettivera leaves

Moisture (%) a 79.2 ± 3.96 c 83.4 ± 4.17 c 84.9 ± 4.24 a 78.6 ± 3.93 a 78 ± 3.9 81.3 ± 4.06b

Protein (g/100g) b 28.8 ± 1.44 c 30.5 ± 1.52 c 31.2 ± 1.56 a 27.4 ± 1.09 b 29.5 ± 1.18 28.2 ± 1.12b

Fat (g/100g) d 0.85 ± 0.034 c 0.77 ± 0.0308 a 0.66 ± 0.026 b 0.72 ± 0.021 bc 0.74 ± 0.02 0.8 ± 0.024d

Carbohydrate (g/100g) a 53.2 ± 1.59 ab 54.5 ± 1.63 c 58.4 ± 1.75 b 55 ± 2.2 a 53.2 ± 2.12 55.6 ± 2.22b

Fibre (g/100g) a 35.6 ± 1.78 bc 37.5 ± 1.87 c 38.2 ± 1.91 a 35.3 ± 1.05 a 35.1 ± 1.05 36.5 ± 1.09b

Ash (g/100g) b 8.17 ± 0.24 c 8.3 ± 0.24 c 8.47 ± 0.25 b 8.07 ± 0.32 a 7.87 ± 0.31 7.97 ± 0.31a

Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

most favorable to mycelial extension of C. indica. The result of the analysis of variance (Table 3) show that the mycelial weight was 1.58 ± 0.06 g for C. indica on the 17th day of incubation when sorghum was used as substrate. Rice husk was next to sorghum with mycelial weight of 0.844 ± 0.036 g, although it obtained the yield on 23rd day. The substrates wheat and bajra least supported the growth of mycelia with average mycelial weight of 0.717 ± 0.035 g and 0.761 ± 0.041 g on the 18th and 20th day, respectively, after incubation. Nwanze et al. (2005) observed that in the case of Lentinus squarrosulus, wheat (1.17 g) and corn spawn (1.37 g) were similar and induced mycelial wet weights (Jiskani et al. 2007).

paddy straw substrate. The biological yield for this study was 1.019 ± 5.1 kg for paddy substrate subsequently maize substrate with 0.979 ± 4.9 kg. The data is significantly more than the previous studies with substrates without supple-mentation. Work done by Pani (2010) revealed that paddy straw was the best among the substrates as it produced the maximum yield (0.712 kg) and biological efficiency (71.2% BE) of C. indica, and it took 30 days for pinhead appearance. Similarly Nuhu et al. (2010) observed 0.918 kg of biological yield per W/W of nutrient supplemented substrate. Nutritional analysis of C. indica

Effect of different substrates on yield and yieldcontributing characteristics The results reveal the yield, B.E. and nutrient content of the C. indica cultivated on different agro-wastes. The shortest time required to complete mycelial growth was observed in the paddy straw substrate (20 ± 2 days), followed by the Vettivera leaves (26 ± 2 days) and sugarcane bagasse (27 ± 2 days) substrates. The longest time (30 ± 2 days) required to complete mycelial growth was observed in the coconut coir substrate Pani 2010. The minimum time for first flush was observed in paddy straw substrate (8 ± 1 days), which was statistically similar to that of the coconut coir, maize straw, and rice straw substrates. The longest time was recorded in sugarcane leaf substrate (14 ± 1 day). Alam et al. (2010) observed that 19.3 days was required for the primordial initiation of C. indica in a previous study conducted on

The aim was to obtain the increased nutrient and yield of C. indica. The moisture content of the mushroom cultivated in paddy straw, maize straw, vettivera leaves and coir pith were found about 84.9, 83.4, 81.2 and 79.2%, respectively (Table 4). For the substrate paddy straw, 100 g of fresh C. indica contained 31.29 ± 1.56 g of proteins, 38.2 ± 1.91 g of fiber and 58.4 ± 1.75 g of carbohydrates. Least amount of protein was observed for the sugarcane bagasse with 27.4 ± 1.09 g. Moreover, 35.1 ± 1.05 g of fiber and 53.2 ± 2.12 g of carbohydrates was the least values found in sugarcane leaves. While comparing the fat content, mushrooms harvested from coir pith had elevated amount of 0.85 ± 0.03 g and the lowest was recorded in paddy straw with a value of 0.66 ± 0.02 g, which was a significant observation. According to Nuhu et al. (2008) C. indica contained 2.6 to 2.9 g of proteins, 0.6 to 0.7 g of lipids, 1.5 to 1.8 g of fiber and 6.3 to 7.3 g of carbohydrates. Based on the study results, it

Lakshmipathy et al.

7705

Table 5. Effect of physical sterilization.

Substrate

Paddy straw

Sterilization temperature

Autoclaved at 121 °C

Time of steaming (min) 15 30 45 60 75 90

Contamination (%) d 76 ± 3.2 60 ± 2.9c 30 ± 1.7b a 0.6 ± 0.025 a 0.5 ± 0.02 a 0.5 ± 0.019

pH 7.5 7.5 7.5 7.5 7.5 7.5

Temp °C ~35 ~35 ~35 ~35 ~35 ~35

RH % ~85 ~85 ~85 ~85 ~85 ~85

Total no. of flushes a 9.7 ± 0.38 c 15 ± 0.62 16.66 ± 0.94c d 20.33 ± 0.86 c 16.7 ± 0.74 b 13.65 ± 0.63

Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation. RH, Relative humidity.

Table 6. Optimizing the concentration of chemicals for sterilization of substrate.

No. of run 1 2 3 4 5 6 7 8 9 10 11 12 13

A: Formaldehyde [ppm] 500 500 500 1065.68 500 900 100 500 100 900 500 500 0

B: Carbendazim [ppm] 75 138.63 75 75 75 120 30 75 120 30 75 11.36 75

was concluded that paddy straw was the effective substrate for the cultivation of C. indica and it was used for further studies. Effects on sterilization methods on substrates for cultivation of C. indica Physical sterilization Current study explored that 6 h of soaking the substrate and steaming for 60 min yielded the maximum production with 0.6% contamination which was found to be economically viable (Table 5). The previous experiment done by Pathan (2009) revealed that the maximum percent yield was in case of soaking and boiling for 75 min (61.75%). Chemical sterilization The results of central composite design experiments for

Contamination % 5.5 3.3 6.6 6.6 6.6 3.3 70 13.3 40 36.6 10 43.3 50

Total yield % 1.11 0.67 1.16 0.66 1.02 0.45 0.45 1.05 0.65 0.56 0.9 0.35 0.25

Bio-efficiency % 111 67 116 66 102 45 45 105 65 56 90 35 25

studying the effects of chemical sterilization of substrate on the contamination percentage are presented in Table 6. The F-value of 24.01 showed the model as significant. There was only chance of 0.01% variation in "model-F value" due to noise (Table 7). The values of "Prob > F" and less than 0.05 indicated that the model terms were significant. In this case, A2 and B2 are significant model terms. However, values greater than 0.1 indicated that the model terms are not significant. The "lack of fit Fvalue" of 9.26 was exhibited as significant and there was only slight chance of 0.03% variation in "Lack of Fit Fvalue" due to noise. Moreover, the lack of fit value was not significant, so the model has to be change to fit as significant. The "Pred R-Squared" of 0.65 is in reasonable agreement with the "Adj R-Squared" of 0.905. "Adeq Precision" measures the signal to noise ratio and a ratio greater than 4 is desirable. The ratio of 13.486 indicates an adequate signal (Table 8). This model can be used to navigate the design space. The model coefficient was estimated by linear regression (Table 9). The following equations were used: Final Equation in terms of coded

7706

Afr. J. Biotechnol.

Table 7. F-test analysis ( ANOVA for response surface quadratic model).

Source Model A-Formaldehyde B-carbendazim AB A^2 B^2 Residual Lack of Fit Pure Error Cor Total

Sum of squares 5646.03 2160.77 1796.05 2.72 1152.03 747.90 329.24 287.78 41.46 5975.28

df 5 1 1 1 1 1 7 3 4 12

Mean square 1129.20 2160.77 1796.05 2.72 1152.03 747.90 47.03 95.92 10.36

F value 24.00 45.94 38.19 0.05 24.49 15.90

p-value Prob > F 0.0003 0.0003 0.0005 0.8168 0.0017 0.0053

9.25

0.0285

Table 8. Comparition of R2 predicted and estimated.

Parameter Std. Dev. Mean C.V. % PRESS

Value 6.9 22.7 30.21 2111.266

Parameter R-Squared Adj R-Squared Pred R-Squared Adeq Precision

Value 0.945 0.905 0.647 13.486

Table 9. Model coefficient estimated by linear regression.

Factor Intercept A-Formaldehyde B-carbendazim AB A^2 B^2

Coefficient estimate 8.4 -16.43 -14.98 -0.82 12.86 10.36

df 1 1 1 1 1 1

Standard error 3.06 2.42 2.42 3.42 2.60 2.60

95% CI Low 1.147479 -22.16 -20.71 -8.93 6.72 4.22

95% CI High 15.65 -10.70 -9.24 7.28 19.01 16.51

VIF 1 1 1 1.017 1.017

df, Degree of freedom;

factors: Contamination = +8.40-16.43 * A-14.98 * B-0.8 * A * B+12.87 * A2+10.37 * B2 Final equation in terms of actual factors: Contamination = +101.10663-0.11808 * Formaldehyde1.07811 * carbendazim-4.58333E-005 * Formaldehyde * carbendazim +8.04297E-005 * 2 2 Formaldehyde +5.12037E-003 * carbendazim

Effect of chemical sterilization on total yield The results of central composite design experiments for studying the effects of chemical sterilization of substrate on the contamination percentage are presented in Table

6. The F-value of 12.12 showed the model is significant. There is only a chance of 0.24% variation in "model-F value" due to noise (Table 10). The values of "Prob > F" and less than 0.05 indicated that the model terms are significant. In this case, A2 and B2 are significant model terms. However, values greater than 0.1 indicated that the model terms are not significant. The "Lack of Fit F-value" of 9.26 indicated significance and there is only slight chance of 0.08% variation in "Lack of Fit F-value" due to noise. The lack of fit value was not significant, so the model has to be change to fit as significant. The "Pred R-Squared" of 0.46 was in reasonable agreement with the "Adj R-Squared" of 0.82. "Adeq Precision" measures the signal to noise ratio and a ratio greater than 4 is desirable. The ratio of 8.58 indicated an adequate signal (Table 11). This model can be used to navigate the design space. The model coefficient was estimated by linear regression (Table 12) using the following equations: final equation in terms of coded

Lakshmipathy et al.

7707

Table 10. F-test analysis ( ANOVA for Response Surface Quadratic Model).

Source Model A-Formaldehyde B-carbendazim AB A^2 B^2 Residual Lack of Fit Pure Error Cor Total

Sum of squares 1.001 0.02 0.03 0.02 0.56 0.46 0.11 0.077 0.03 1.11

df 5 1 1 1 1 1 7 3 4 12

Mean square 0.2 0.02 0.03 0.024 0.56 0.46 0.01 0.025 0.009

F value 12.11 1.81 2.22 1.45 34.26 27.97

Prob > F 0.0024 0.2198 0.1792 0.2670 0.0006 0.0011

2.61

0.1882

Table 11. Comparition of R2 predicted and estimated.

Parameter Std. Dev. Mean C.V. % PRESS

Value 0.128 0.713 18.005 0.605

Parameter R-Squared Adj R-Squared Pred R-Squared Adeq Precision

Value 0.896 0.822 0.457 8.58

Table 12. Model coefficient estimated by linear regression.

Factor Intercept A-Formaldehyde B-carbendazim AB A^2 B^2

Coefficient estimate 1.04 0.061 0.067 -0.077 -0.285 -0.257

df 1 1 1 1 1 1

Standard error 0.057 0.045 0.045 0.064 0.0487 0.0487

factors;

95% CI low 0.912 -0.046 -0.039 -0.229 -0.400 -0.37298

95% CI high 1.183 0.168 0.175 0.074 -0.170 -0.142

VIF 1 1 1 1.017 1.017

Final equation in terms of actual factors;

improved total yield, when compared to single factor analysis. Physical and chemical sterilizations produced the best and similar results. Comparing the cost effectiveness and least usage of chemical sterilizers, the chemical sterilization could be considered as a method for sterilizing substrates.

R2 Total Yield in Kg = -0.46470+2.25880E003*Formaldehyde+0.02275* carbendazim-4.30556E006*Formaldehyde*carbendazim-1.78281E-006 *Formaldehyde2 1.27284E-004*carbendazim2

Effect of different casing materials along with supplements on yield and yield-contributing characteristics

The contour and three-dimensional response surface curves were plotted and presented in the Figures 1 and 2. Minimum contamination (2.03 %) and total yield of (1.04 Kg) was observed for formaldehyde (620 ppm) and carbendazim (82.79 ppm). Response surface methodology reduced the contamination and significantly

Farm-yard manure, red soil and sand were used as casing materials to evaluate the yield and yieldcontributing characteristics of C. indica. Maximum biological efficiency was recorded in farm-yard manure, red soil and sand at the proportion of (1:3:1) which yielded 145.1% and followed by the farm-yard manure

R2 Total Yield in Kg = +1.05 +0.06 * A +0.068 * B -0.078* A * B 0.29* A2 -0.26 * B2

7708

Afr. J. Biotechnol.

Design-Expert速 Software Factor Coding: Actual R1 Contamination Design points above predicted value Design points below predicted value 70 3.3 X1 = A: Formaldehyde X2 = B: carbendazim

R 1 C o n ta m in a tio n

80 60 40 20 0 -20

900.00 820.00 740.00

120.00 111.00 102.00 93.00 84.00 75.00 66.00 57.00 48.00 39.00 B: carbendazim 30.00

660.00 580.00 500.00 420.00 340.00

A: Formaldehyde

260.00 180.00 100.00

Figure 1. The contour and 3D response surface plot showing the effect of chemical sterilization on contamination.

Design-Expert速 Software Factor Coding: Actual R2 Total Yield in Kg Design points above predicted value Design points below predicted value 1.16 0.25 X1 = A: Formaldehyde X2 = B: carbendazim

R 2 T o ta l Y ie ld in K g

1.2

1

0.8

0.6

0.4

0.2 900.00 820.00 740.00 660.00 120.00 111.00 102.00

580.00 500.00 93.00

420.00

84.00 75.00

340.00

66.00 48.00

180.00

39.00

B: carbendazim

A: Formaldehyde

260.00

57.00 30.00

100.00

Figure 2. The contour and 3D response surface plot showing the effect of chemical sterilization on contamination.

and red soil (3:1) with yield 128% and farm-yard manure and sand (3:1) 104.1% casing materials (Figure 3). Previous studies conducted by Ruhul et al. (2010)

indicated that a maximum biological efficiency was recorded in cow dung and soil (62.94%) followed by the farm-yard manure (62.64%), spent mushroom substrate

Lakshmipathy et al.

1600 1400 1200 1000 800 600 400 200 0

c

25

b

20

7709

b a a

15

a

10 5 0 Farm yard manure Farm yard manure Red Soil & Farm and sand (3:1) and Red Soil (3:1) yard manure with sand (1:3:1) Total no of fushes

Casing soil with caco3

Total yield (g of mushroom / 1 Kg of substrate)

1800 1600 1400 1200 1000 800 600 400 200 0

b

25

a

a

20

b a

a

‌

15 10

No of flushes

Total yield

Figure 3. Effect of different composition of soils on the yield of C. indica. Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

5 0 1

2

3

caco3 concentration Economic yield (g of mushroom / 1 Kg of substrate)

Total no of fushes

Figure 4. Effect of different concentration of CaCO3 in casing soil on the yield of C .indica. Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

(61.66%), and soil and sand (61.46%) casing materials. Hence, farm-yard manure, red soil and sand at the proportion of (131) with 2% CaCO3 and 1.75% of gypsum brought a significant yield of 1.64 Âą 49.4 Kg (Figures 4 and 5) of mushroom per dry weight of substrate. Previous studies done by Kassim et al. (1990) stated that the

number and yield of mushrooms was increased when the supplements were added to the casing soil. The yield was significant when nutrient supplements were added to the casing material. Days of primordial formation, total cropping days gets reduced and BE increases as a result of amendment.

7710

Afr. J. Biotechnol. casing soil with gypsum 1800 b

b

a

1400

Total yield

1200

a

a

25

a b

b

20

c d

1000

e 15

800 600

No of flushes

1600

30

c

10

400 5 200 0

0 1

1.5

1.75

2

2.5

2.75

concentation of gypsum Economic yield (g of mushroom / 1 Kg of substrate)

Total no of fushes

Figure 5. Effect of different concentration of gypsum in casing soil on the yield of C. indica. Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

Effect of casing soil on the nutritive value Casing soil amendments supported the yield significantly, porous loam texture coupled with farmyard manure, CaCO3 and gypsum contributed for the yield. 31.42 ± 1.57 g of proteins, 37.68 ± 1.50 g of fiber, 0.74 ± 0.03 g of fat, 8.75 ± 0.35 g and 56.73 ± 2.83 g of carbohydrates was observed. Studies conducted earlier described that the casing layer is an essential component for the artificial cultivation of C. indica. According to Sassine et al. (2010) the casing layer must be very loose; otherwise, the primordia cannot penetrate from the bottom to the top of the casing layer. ACKNOWLEDGEMENTS The authors are grateful to Dr. MGR Educational and Research Institute University for supporting this research. Thanks also to Tamil Nadu Agricultural University and Karunya University, for providing the facilities for carrying out the research work. REFERENCES Alam N, amin R, khan A, Ara I, Shim MJ, Lee Mw, Lee TS (2010). Nutritional analysis of cultivated mushrooms in bangladesh: pleurotus ostreatus, pleurotus sajor-caju, pleurotus florida and calocybe indica. Mycobiology, 36: 228-32.

Kassim MY, khaliel AS, Al-rahmah AN (1990). Effects of casing soil amendments and nutrient supplementation on mushroom cropping. J. King Saudi University, Agric. Sci. 2(2): 225-230. Jiskani MM, Bhatti ML, Wagan KH, Pathan MA, Bhatti AG (2007). Determination of sorghum grains for spawn growth of oyster mushroom, pleurotus ostreatus (jacq. Ex. Fr) kummer. Pak. J. Bot. 39(7): 2681-2684. Maynard AJ (1970). Methods in food analysis, academic press, New York, p. 176. Nuhu A, Ruhul A, Abul K, Tae SL (2010). Influence of different supplements on the commercial cultivation of milky white Mushroom. Mycobiology, 38(3): 184-188. Nuhu A, Ruhul A, Asaduzzaman K, Ismot A, Mi JS, Min WL, Tae SL (2008). Nutritional analysis of cultivated mushrooms in Bangladeshpleurotus ostreatus, pleurotus sajor-caju, pleurotus florida and calocybe indica. Mycobiol. 36(4): 228-232. Nwanze PI, Khan AU, Ameh JB, Umoh VJ (2005). The effect of spawn grains, culture media, oil types and rates on carpophore production of lentinus squarrosulus (mont.) Singer. Afr. J. Biotechnol. 4(6): 472477. Pathan AA, Pathan MA, Wagan KH, Nizamani ZA (2009). Effect of soaking and boiling of substrate on the growth and productivity of oyster mushroom. Pakistan J. Phytopathol. Pani BK (2010). Evaluation of some substrates for cultivation of white summer mushroom (calocybe indica). Res. J. Agric. Sci. 1(4): 357359. Pani BK (2010). Optimal in vitro environmental conditions for the growth of white summer mushroom (calocybe indica). Res. J. Agric. Sci. 1(3): 280-281. Ruhul A, Abul K, Nuhu A, Tae SL (2010). Effect of different substrates and casing materials on the growth and yield of calocybe indica. Mycobiol. 38(2): 97-101 Sassine YN, Cosette Karam, Dima Mounayar, Ghassan AbdelMenhem (2010). Prospective of local Oyster mushroom production in Lebanon. J. Appl. Sci. Res. 6(12): 2139-2142.

African Journal of Biotechnology Vol. 11(30), pp. 7711-7719, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.1331 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Isolation and characterization of toebicin 218, a bacteriocin, produced by Geobacillus toebii HBB-218 Gamze Başbülbül Özdemir* and Haci Halil Biyik Biology Department, Faculty of Arts and Science, Adnan Menderes University, 09010 Aydin, Turkey. Accepted 22 July, 2011

A novel bacteriocin Toebicin 218 was isolated from Geobacillus toebii HBB-218, a soil inhabiting Gram positive bacterium. The cell free culture supernatants of G. toebii HBB-218 showed antibacterial activity against many Gram positive bacteria including thermophilic strains. Purification of the bacteriocin was achieved after ammonium sulphate precipitation, gel filtration and ion exchange chromatography. Tricine-SDS-PAGE yielded a single protein band observed with a molecular mass of 5.5 kDa. The antibacterial compound was heat stable and sensitive to proteolytic enzymes. Bacteriocin production started at the early logarithmic phase and maximum production was observed at the end of the stationary phase. Bacteriocin was found to be effective especially against thermophilic bacteria and it may have a potential for use as a biopreservative in canned foods. This study provides the first data on bacteriocin produced by a strain of G. toebii. Key words: bacteriocin, Geobacillus toebii, toebicin 218, thermophilic, characterization. INTRODUCTİON Bacteriocins are a heterogeneous group of ribosomally synthesized antibacterial peptides that inhibit strains and species that are usually, but not always, closely related to producing bacteria (Tagg et al., 1976). Both Gram positive and Gram negative bacteria produce small, heatstable bacteriocins. Bacteriocins produced by Gram positive bacteria are often membrane permeabilizing cationic peptides with fewer than 60 amino acid residues (Jack et al., 1995). The bacteriocins produced by lactic acid bacteria offer several desirable properties that make them suitable for food preservation: (1) Are generally recognised as safe substances, (2) Are not active and nontoxic on eukaryotic cells, (3) Become inactivated by digestive proteases, having little influence on the gut microbiota, (4) Are usually pH and heat-tolerant, (5) Have a relatively broad antimicrobial spectrum, against many food-borne pathogenic and spoilage bacteria, (6) Show a bactericidal mode of action, usually acting on the bacterial cytoplasmic membrane: No cross resistance with antibiotics, and (7) Their genetic determinants are

*Corresponding author. E-mail: gbasbulbul@adu.edu.tr Tel: 0090 256 218 2000-1937. Fax: 0090 256 213 53 79.

usually plasmid-encoded, facilitating genetic manipulation (Galvez et al., 2007). According to the Klaenhammer classification scheme, bacteriocins produced by lactic acid bacteria are grouped into four main classes: Class I is the modified bacteriocins which are known as lantibiotics. Class II is the heat-stable, minimally modified bacteriocins. Class III is the larger heat labile bacteriocins and Class IV is complex bacteriocins, these are carrying lipid or carbohydrate moieties (Klaenhammer, 1993). Although, reported bacteriocins are generally isolated from food-grade, mesophilic microorganisms, there are a few examples of bacteriocins produced by thermophilic bacteria and archea (Shafia, 1966; Sharp et al., 1979; Becker et al., 1986; Novotny and Perry, 1992; Prangishvilli et al., 2000; Martirani et al., 2002; Pokusaeva et al., 2009). Thermophilic bacteria belonging to Bacillus genetic group 5 have been reclassified as members of Geobacillus gen. nov., with G. stearothermophilus as the type species (Nazina et al., 2001). Geobacillus species, literally named as earth or soil Bacillus, are widely distributed and readily isolated from natural or man made thermophilic biotopes (McMullan et al., 2004). Geobacillus toebii was firstly identified as a thermophilic, aerobic, spore forming Gram positive bacteria by Sung et al. (2002). The aim of this

7712

Afr. J. Biotechnol.

study was to evaluate the antibacterial activity of a bacteriocin produced by Geobacillus toebii HBB-218 isolated from soil collected from a the thermal spring in Denizli, Turkey. The antibacterial spectrum, characterization and purification of the bacteriocin are described in this report. MATERİALS AND METHODS Bacteria and media Strain HBB-218 was isolated from soil that was collected around thermal spring in Denizli,Turkey. Soil samples were inoculated into Thermus broth and then incubated aerobically at 65°C for 48 h. One mililiter of culture was mixed with Caso agar cooled at 45°C, and then poured onto the plates. Colonies grown after 24 h were purified two times and pure culture of isolate was obtained. Indicator strains used in this study were obtained from different sources and were maintaned in skim milk 20% (v/v) at -20°C. Thermophilic isolates used as indicator strain from our culture collection were identified by partial 16S rDNA analysis, enterococci were identified by API 20E (Biomerieux, France). All the indicator strains were propagated in appropriate media and at temperatures before conducting the experiments (Table 1).

Identification of strain HBB-218 Strain HBB-218 was identified with biochemical tests and 16S rDNA analysis. API 50 CH (BioMerieux, France) kit was used to determine the carbohydrate utilization pattern of the strain. Genomic DNA of strain was isolated as described by Ronimus et al. (1997), 16S rRNA gene was amplified via PCR and then amplicon was sequenced. The primers used for the amplification were: 20F (5'- AGA GTT TGA TCC TGG CTC AG-3') and 1390R (5'- GAC GGG CGG TGT GTA CAA-3') (Orphan et al., 2000). The partial 16S rRNA gene sequence of strain HBB-218 was submitted to GenBank Nucleotide Sequence Database and accession number GQ255948 has been assigned.

Antibacterial activity assays The antibacterial activity of cell free culture supernatants (CFS) were obtained from 24, 48, 72 and 96 h cultures of HBB-218 were detected by modified agar-well diffusion method (Hechard et al., 1992). For this purpose, HBB-218 was grown in BHI broth, and samples were centirifuged at 8 000 × g for 10 min. The supernatant was then sterilized through a milipore filter (Sartorius) with 0.45 µm pore size. 350 µl bacterial suspension (0.5 McFarland) was mixed with appropriate 35 ml agar media for each strain and then poured into plates. Wells with 6 mm diameter were cut into agar media by using cork borer and then 50 µl bacteriocin were placed into each well. The plates were kept at 4°C for 2 h for bacteriocin diffusion then incubated at the given temperatures for each bacterial strain and examined for zones of inhibition.

Effects of heat, enzymes, pH and chemicals on bacteriocin activity In order to obtain crude bacteriocin sample, HBB-218 was grown in BHI broth at 60°C which is the optimum temperature detected for bacteriocin production (data not shown) for 24 h and then cell-free culture supernatants were prepared by centrifuge at 8 000 × g for

10 min. Both CFSs and purified samples were used for characterization of antibacterial substance. To determine the thermal stability, bacteriocin samples were heated for 30 min and 2 h at 30, 45, 60 and 95°C, also autoclaved for 20 min at 121°C, cooled and assayed for activity. Aliquots were also maintained for one month at 4°C, and then activity was tested. Untreated samples served as control (Powell et al., 2007). The effects of various enzymes on bacteriocin activity were also tested. Aliquots were treated with pronase E, proteinase K, papain, RNase, Lipase, B-glucoronidase, lactase at final concentration of 1 and 10 mg/ml, catalase at final concentration of 300 IU/ml for 1 and 24 h. An untreated bacteriocin and the enzyme in the buffer were both served as controls (Riosen et al., 2005). In a separate experiment, the effect of the pH on bacteriocin activity was tested by adjusting each of the aliquots to between 3.0 and 11.0 with sterile 1 mol L-1 NaOH or 1 mol L-1 HCl. After 24 h of incubation at 4°C, the treated samples were adjusted to pH 7.0 with sterile 1 mol L-1 NaOH or 1 mol L-1 HCl and tested for activity (Deraz et al., 2005). Acetone, chloroform, dimethyl sulfoxide (DMSO), ethanol, methanol and xylol were added to 24 hold cell-free culture supernatants at final concentration of 10% (v/v) and then incubated for 1 h at 30°C. Trichloroacetic acid (TCA) was added at a final concentration of 100 mg/ml, incubated for 1 h at 30°C. After treatment with TCA, samples were centrifugated at 10 000 × g for 5 min and the supernatants were neutralized to pH 7.0 before testing for antibacterial activity. Tween 80 and urea were used at final concentration of 1 mg/ml, and ethylenediaminetetraacetic acid (EDTA) was used at 0.1 mmol l-1. Chemicals and bacteriocin aliquots diluted with sterile distilled water at same final concentration were used as control (Todorov and Dicks, 2005). After each treatment, the samples were tested for antibacterial activity against G. stearothemophilus DSMZ 22 using well diffusion method.

Growth and bacteriocin production A 24 h-old culture of strain HBB-218 was inoculated (2%, v/v, OD600 nm = 0.1) into BHI broth and incubated at 65°C without agitation. Samples were taken at 3 h intervals and absorbencies were recorded. To determine the bacteriocin titers, samples were centrifugated at 8 000 × g for 10 min and then put into wells. The titer was defined as the reciprocal of the highest dilution that exhibit inhibition of the sensitive strain and was expressed in arbitrary units (AU) per mililiter.

Purification of bacteriocin Purification of bacteriocin was achieved by ammonium sulphate precipitation, gel-filtration chromatography and ion-exchange chromatography, sequentially. All the purification steps were performed at 4°C. Strain HBB-218 was grown in 500 ml modified media (soja peptone 3%, galactose 0.1%, NaCl 5 g l-1; di-sodium phosphate 2.5 g l-1) at 60°C for 72 h, then cells were harvested by centrifugation at 8 000 × g for 10 min. 450 ml culture supernatant were autoclaved at 121°C for 20 min, precipitants were removed again via centrifugation at 8 000 × g for 10 min. Ammonium sulphate was added to the resulting culture supernatant at 80% saturation. The pelleted amonnium sulphate precipitate was dissolved in 20 mmol l-1 sodium phosphate buffer (pH 7.0), and dialyzed against the same buffer by using a 1000 Da dialysis membrane (ZelluTrans-Roth E887.1). The dialyzed sample was stirred for 24 h in 20 mmol l-1 sodium phosphate buffer (pH 7.0), then concentrated by using 5 000 MWCO ultrafiltration membrane (Sartorius). 3 ml concentrated sample was applied to a gel filtration column (100 cm length and 1-cm internal diameter), Sephadex G50, previously equilibrated with 20 mmol l-1 sodium phosphate buffer (pH 7.0) and eluted at a flow rate of 0.35 ml min-1 with the

Özdemir and Biyik.

7713

Table 1. Indicator strains used in the study

Strain Geobacillus stearothermophilus Bacillus sphaericus Bacillus sp. B. mycoides B. thrungiensis B. cereus B. subtilis Serratia marcescens Pseudomonas fluorescens Proteus sp. Pectobacterium carotovorum Enterococcus faecalis Listeria sp. Staphylococcus aureus Micrococcus luteus Streptococcus vestibularis Escherichia coli Listeria innocua Lactobacillus plantarum L. acidophilus L. sakei Leuconostoc mesenteroides Brochothrix thermosphacta Cellulomonas fimi Clostridium pasteurianum Geobacillus sp. Anoxybacillus sp. Anoxybacillus sp. Anoxybacillus sp. Anoxybacillus sp. Geobacillus sp. Geobacillus sp. Geobacillus sp. Geobacillus sp. Geobacillus sp. E. faecium E. faecium E. faecium Enterococcus gallinarium E. gallinarium E. faecalis E.faecalis Enterococcus avium Enterococcus durans E. durans

Strain number DSMZ 22 DSM 396 Soil isolate DSM 299 Soil isolate ATCC 11778 ATCC 6633 Soil isolate DSM 50090 Clinical isolate DSM 30168 ATCC 51299 Food isolate ATCC 25923 ATCC 9341 DSM 5636 ATCC 35218 DSM 20649 DSM 20174 DSM 20079 DSM 6333 DSM 20343 DSM 20171 DSM 20114 DSM 525 HBB-103 HBB-134 HBB-225 HBB-226 HBB-229 HBB-269 HBB-270 HBB-301 HBB-247 HBB-234 HBB-M-1 HBB-MS-1 HBB-KT-2 HBB-MÇ-3 HBB-LC-M1 HBB-NÇ HBB-AS-1 HBB-AS-3 HBB-KT-1 HBB-K-1

same buffer containing 0.15 mol l-1 NaCl. Fractions were pooled and their absorbancies at 280 nm were measured using spectrophotometer (Shimadzu UV-1601) and bacteriocin activities were detected. One of the fractions obtained by gel chromatography, fraction B, was concentrated and then applied to DEAE-

Media Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar MRS Agar MRS Agar MRS Agar MRS Agar Corynebacterium agar Trypticase soy yeast Agar Glucose yeast extract Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar

Temperature (ºC) 55 30 30 30 30 30 30 37 30 37 26 37 37 37 37 37 37 37 37 37 30 30 30 30 37 65 65 65 65 65 65 65 65 65 65 37 37 37 37 37 37 37 37 37 37

sepharose column (Sigma, C-3794), eluted with 20 mmol l-1 sodium phosphate buffer (pH 7.0) followed by a gradient from 0 to 1 mol l-1 NaCl at a flow rate of 0.6 ml min-1 . Protein concentrations were determined by Bradford method using bovine serum albumin as the standart (Bradford, 1967).

7714

Afr. J. Biotechnol.

Bacteriocin activities were tested against G. stearothermophilus DSMZ 22 as indicator strain.

SDS-PAGE The Tricine-SDS-PAGE method (4 and 16% acrylamide for the stacking and separating gel, respectively) was performed to control the purification steps and to determine the molecular weight of the bacteriocin (Schagger, 2006). Molecular weight standarts were from Sigma (M3546). One half of the gel was stained with Coomasie blue, and the other half was used for direct detection of bacteriocin activity. The gel, assayed for antibacterial activity was overlaid with soft (0.7%) BHI agar, inoculated with the indicator strain G. sterathermophilus DSMZ 22 (1 % v/v). Plate was incubated at 55°C for 14 h, and observed for the formation of inhibition zone.

RESULTS

bacteriocin activity was stable after incubation for 24 h with pH values ranging from 3 to 11, while partial inactivation was observed for purified bacteriocin at pH 3, 4 and 5. Among the tested chemicals, only TCA was able to fully inactivate both of the crude and pure bacteriocin. Tween 80 and chloroform treatment resulted with decrease in activity (20 and 13%, respectively) (Table 4). Bacteriocin production The production of bacteriocin was found to be starting at early logarithmic phase of growth and it reached to the maximum level (320 AU/ml) after 72 h of cultivation. Figure 1 represents the correlation between bacteriocin activity and growth of G. toebii HBB-218.

Identification of the strain HBB-218

Purification of the bacteriocin

The strain HBB-218 is a Gram-positive, aerobic, endospore forming thermophilic bacterium. According to the biochemical test results, HBB-218 was found to be catalase and oxidase positive, and produced acid from glucose, ribose and glycerol. The 16S rDNA sequence of the strain HBB-218 showed highest similarity (99.6%) with G. toebii according to BLAST results.

The bacteriocin was purified from cell free culture supernatants by a combination of ammonium sulphate precipitation, gel filtration and ion exchange chromatography. As a result of gel filtration chromatography, active fractions were collected at four different parts. Fraction B which is the mostly active one and has lower protein content applied to anion exchange column. On the anion exchange column, fractions with inhibitor activity were detected at initial samples without using NaCl gradient. The data for recovery and degree of purification are summarized in Table 5.

Antibacterial spectrum of bacteriocin The bacteriocin produced by G. toebii HBB-218 showed inhibition of a wide range of Gram positive bacteria whereas none of the tested Gram negative strains were inhibited. Bacteriocin inhibits some clinically important bacteria like Enterococcus faecalis and Micrococcus luteus and it is more active against thermophilic bacterial isolates. The cell-free supernatans obtained from 72 and 96 h-old culture were effective especially against enterococcal species. The antibacterial spectrum of bacteriocin produced by strain HBB-218 is compiled in Table 2. Effects of heat, pH, enzymes and chemicals on bacteriocin activity As a result of enzyme treatment, inhibitory agent was found to be sensitive to pronase E and proteinase K; the crude bacteriocin was found to be relatively resistant to proteolytic enzymes. Also, the activity was partially or completely lost by lipase and B-glucoronidase enzymes depending on the enzyme concentration and incubation time (Table 3). Inhibitory agent was found to be a very heat stable, a loss of activity (31%) of the purified bacteriocin was determined after testing at 121°C for 20 min. Storage of either crude or purified bacteriocins at 4°C did not affect the activity after one month. Crude

Molecular weight determination According to Tricine-SDS-PAGE analysis, the purified bacteriocin provided only one band which corresponds to a molecular mass of approximately 5.5 kDa. On the other, for half of the identical gel, this band was active against the indicator strain G. stearothermophilus DSMZ 22 (Figure 2). DİSCUSSİON In this study, a bacteriocin tentatively named as Toebicin 218 produced by G. toebii HBB-218 was isolated, characterized and purified. HBB-218 isolated from soil collected around the thermal spring (Denizli, Turkey) was identified as G. toebii according to 16S rDNA results. To our knowledge, this is the first description of a bacteriocin produced by a G. toebii strain. Bacteriocin produced by strain HBB-218 was active against many of the tested Gram positive bacteria, especially the thermophilic species. One of the most sensitive strains, G. stearothermophilus is a canned food spoilage bacterium and spores of this bacterium are extremely resistant to

Ă–zdemir and Biyik.

7715

Table 2. Antibacterial spectrum of toebicin 218.

Indicator strain G. stearothermophilus DSMZ 22 B. sphaericus DSM 396 M. luteus ATCC 934 Lact. plantarum DSM 20174 Listeria sp. E. faecalis ATCC 51299 E. gallinarium MÇ-3 E. gallinarium LC-M1 E.faecium MS-1 E. faecium KT-2 E. durans K-1 E.durans KT-1 E. avium AS-3 Brochothrix thermosphacta DSM 20171 Cellulomonas fimi DSM 20114 Clostridium pasteurianum DSM 525 Anoxybacillus sp. HBB-134 Geobacillus sp. HBB-234 Geobacillus sp.HBB-247 Geobacillus sp. HBB-269 Geobacillus sp. HBB-270 Anoxybacillus sp.HBB-229 Geobacillus sp. HBB-301 Bacillus sp. (soil isolate) B. mycoides DSM 299 B.cereus ATCC 11778 B. subtilis ATCC 6633 S. marcescens (soil isolate) Pseudomonoas fluorescence DSM 50090 Pectobacterium carotovorum DSM 30168 Staphylococcus aureus ATCC 25923 Streptococcus vestibularis DSM 5636 E.coli ATCC 35218 Listeria innocua DSM 20649 Lact. acidophilus DSM 20079 Lact. sakei DSM 6333 Leuconostoc mesenteroides DSM 20343 Geobacillus sp. HBB-103 Anoxybacillus sp. HBB-225 Anoxybacillus sp. HBB-226

24 h CFS 20 9 9 10 11 9 16 20 10 8 18 8 15 15 -

heat treatment. Low-acid foods such as meat and marine products, milk, vegetables, meat and vegetable mixtures (such as soups) can be spoiled by G. stearothermophilus under improper storage conditions (Ayres et al., 1980). Toebicin 218 is also heat stable and active over a wide range of pH values. Because of these properties, it can be very useful in canned food industry against some thermophilic, endospore former spoilage-causing bacteria.

Zone of inhibition (mm) 48 h CFS 72 h CFS 20 20 9 9 9 9 10 10 9 9 11 11 12 14 10 13 10 12 14 14 10 20 22 20 24 16 18 11 11 18 21 12 8 10 16 18 18 18 -

96 h CFS 20 9 9 10 9 11 13 14 10 13 13 14 13 8 24 25 18 11 21 12 15 20 18 -

The results obtained from the bacteriocin treatment with different enzymes revealed the proteinaceous nature of the analyzed antimicrobial substances. Inhibitory agent is sensitive to pronase E and proteinase K, which indicates that a bacteriocin is indeed responsible for the antibacterial activity observed. Both purified and crude bacteriocins were also inactivated by TCA treatment. Among tested enzymes, lipase and B-glucuronidase also

7716

Afr. J. Biotechnol.

Table 3. Effects of different enzymes on activity.

Residual activity (%) 1 h incubation CFS Pure CFS Pure 1 mg/ml 10 mg/ml 100 0 100 0 100 80 100 69 100 100 87,5 0 62,5 80 62,5 0 100 100 62,5 100 100 100 100 100 100 100 100 100 100 100 100 100

Enzyme

Proteinase K Pronase E Papain Lipase β-Glucuronidase Lactase RNAse Catalase (300IU/mL) a

a

24 h incubation CFS Pure CFS Pure 1 mg/ml 10 mg/ml 100 0 0 0 100 0 75 0 100 100 87,5 0 62,5 0 0 0 100 100 0 50 100 100 100 100 100 100 100 100 100 100 100 100

Residual activity was estimated according to formula “zone diameter of treated bacteriocin x100 / zone diameter of control”

Table 4. Effects of heat, pH and chemicals on toebicin 218 activity.

Treatment

Residual activitya Crude (%) Pure (%)

Organic solvent (10%) Acetone, xylol, DMSO, methanol, ethanol, Chloroform TCA (100 mg/ml)

100 100 0

100 87 0

Detergent EDTA (0.1 mM), urea (1 mg/ml) Tween 80 (1 mg/ml)

100 100

100 80

pH 3-5 6-11

100 100

86 100

Temperature (°C) 30, 45, 60, 95 for 30 min 30, 45, 60, 95 for 2 h 121 for 20 min +4 for 1 month

100 100 100 100

100 100 69 100

a

Residual activity was estimated according to formula “zone diameter of treated bacteriocin x100 / zone diameter of control

affected the antibacterial activity which may be indicating that carbohydrate and lipid moieties are essential for bacteriocin activity. Reduction in the activity can be related to longer incubation times or bacteriocin instability. Similar results on bacteriocin activity and carbohydrate or lipid related enyzmes were reported for other bacteriocins produced by Lactobacillus curvatus L422, Streptococcus thermophilus ST110, L. paracasei and L. rhamnosus, G. stearothermophilus 17 (Xiraphi et al., 2005; Gilbert and Somkuti, 2005; Gulahmadov et al., 2006; Pokusaeva et al., 2009).

Production of bacteriocin starts at logarithmic growth phase and it reaches maximum level at the end of the stationary phase. Our results are similar to those described for bacteriocins produced by Lactobacillus salivarius, Lactobacillus plantarum TF711, S. auerus AB188, E. faecium MMT21 (Ocana et al., 1999; Hernandez et al., 2005; Saeed et al., 2006; Ghrairi et al., 2007). The reduction observed at the end of the stationary phase may be due to the proteolytic degradation or other environmental factors such as pH level or adsorption to the producer cell. To understand the

Özdemir and Biyik.

7717

Figure 1. Kinetics of growth and bacteriocin production by G. toebii HBB-218 in BHI broth; (■) OD600, (●) bacteriocin activity (AU/mL) against G. stearothermophilus DSM22.

Table 5. Purification of the bacteriocin produced by G. toebii HBB-218.

Fraction CFS Autoclaved CFS Dyalisate Concentrated dyalisate Fraction B (gel chromatography) Fraction 1 (anion exchange)

Volume (ml)

Activity (AU/ml)

Protein (mg/ml)

450 400 21 3 12.5 3

160 160 2560 10240 640 320

0.234 0.154 2.03 11.35 0.240 0.029

correlation between lyses of cells and increasing bacteriocin activity, we also investigated the intracellular bacteriocin activity (data not shown). As a result of sonication of 24 h-old culture of strain, bacteriocin activities were detected in all three fractions including extracellular (80 AU/ml), intracellular (<40 AU/ml) and membrane-bound (<40 AU/ml) aliquots. These results are similar with some bacteriocins produced by B. linens ATCC 9171, Sulfolobus islandicus HEN2/2, and L. curvatus (Kato et al., 1991; Prangishvilli et al., 2000; Chung and Yousef, 2005). Toebicin 218 was purified by sequential precipitation, gel filtration, and ion exchange chromotography process with a purification fold of approximately 16. A single band of about 5.5 kDa was observed after purification corres-

Total activity (AU) 72000 64000 53760 30720 8000 960

Total protein (mg/ml) 105.3 61.6 42.63 34.05 3.00 0.087

Spesific activity (AU/mg)

Purification fold

Recovery (%)

6 84 1039 1261 902 2667 11035

1 1.52 1.84 1.32 3.90 16

100 89 75 43 11.1 1.33

ponded to the activity detected after incubation of the indicator strain with a gel slice containing bacteriocin. During anion exchange chromatography experiments, aliquots with antibacterial activity were obtained at first fractions. Bacteriocins produced by Gram positive bacteria are known as cationic molecules and our results are in agreement with this nature of bacteriocins. Pokusaeva et al. (2009) estimated the molecular weights of bacteriocins produced by some strains of G. stearothermophilus about 6.8, 5.6, 7.1 and 7.2 kDa (strain 17, 30, 31 and 32A, respectively) and indicated that these values differ from all bacteriocins produced by endospore-forming strains described previously. Toebicin 218 has some similarities to that produced by G. stearothermophilus strain 30 in terms of its molecular

7718

Afr. J. Biotechnol.

Figure 2. Tricine SDS-PAGE visualization of purified bacteriocin. M, Marker. Right line corresponds to zone of inhibition on the portion of the gel overlaid with the G. stearothermophilus DSM22.

wiehgt and antibacterial spectrum (Pokusaeva et al., 2009). Bacillocin 490 produced by a thermophilic strain of Bacillus licheniformis is also a small (2 kDa) and heat stable bacteriocin (Martirani et al., 2002). On the other hand, some examples of high molecular weight bacteriocins produced by thermophiles, such as thermoleovorine-S2 (42 kDa) and thermoleovorine-N9 (36 kDa), isolated from B. thermoleovorans and sulfolobicin purified from S. islandicus HEN2/2 had a molecular mass of about 20 kDa (Novotny and Perry, 1992; Prangishvilli et al., 2000). The bacteriocin, designated toebicin 218, is inhibitory to several food spoilage and pathogenic bacteria and shows a remarkable stability to heat treatment. In conclusion, toebicin 218 appears to be a potential biopreservative for food products subjected to pasteurization, sterilization and other heat processing treatments. Our study increases recent knowledge about bacteriocins produced by thermophilic bacteria, which were not previously investigated in depth. Further studies regarding the genetic determinants of bacteriocin production and its usefulnes in food systems are required to accumulate knowledge on bacteriocins produced by thermophilic bacteria. ACKNOWLEDGEMENTS This work is supported by projects granted by TUBİTAK (project no 106T581) and ADU-BAP (6009). The authors

would like to thank Dr. Bulent BOZDOGAN and Erman ORYASIN for their cooperation in the field and the sequencing studies and Dr. Kubilay METİN for purification of bacteriocin. REFERENCES Ayres JC, Mundt JO, Sandine WE (1980). Microbiology of Foods. Freeman, San Francisco, CA. Becker RJ, Becker DA, Starzyk MJ (1986). Bacteriocin like activity within the genus Thermus. Appl. Environ. Microbiol. 52: 1203-1205. Bradford MM (1967). Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of ProteinDye Binding. Anal. Biochem. 72: 248-254. Chung HJ, Yousef AE (2005). Lactobacillus curvatus produces a bacteriocin-like agent active against Gram negative pathogenic bacteria. J. Food Safety 25: 59-79. Deraz SF, Karlssoni EN, Hedstörm M, Andersson MM, Mattiasson B (2005). Purification and characterization of acidocin D20079, a bacteriocin produced by Lactobacillus acidophilus DSM 20079. J. Biotechnol. 117: 343-354. Galvez A, Abriouel H, Lopez RL, Omar NB (2007). Bacteriocin-based strategies for food biopreservation. Int. J. Food Microbiol. 120: 51-70. Ghrairi T, Frere J, Berjeaud JM, Manai M (2007). Purification and characterization of bacteriocins produced by Enterococcus faecium from Tunisian rigouta cheese. Food Control 19: 162-169. Gilbert SE, Somkuti GA (2005). Thermophilin 110: A bacteriocin of Streptococcus thermophilus ST 110. Curr Microbiol 51: 175-182. Gulahmadov SG, Batdorj B, Dalagalarrondo M, Chobert JM, Kuliev AA, Haertle T. (2006). Characterization of bacteriocin-like inhibitory substances (BLIS) from lactic acid bactera isolated from traditional Azerbaijani cheeses. Eur. Food Res. Technol. 224: 229-235. Hechard Y, Derijard B, Letellier F, Cenatiempo Y (1992). Characterization and purification of mesentericin Y105, an antilisteria bacteriocin from Leuconostoc mesenteroides. J. Gen. Microbiol. 138:

Ă–zdemir and Biyik.

2725-2731. Hernandez D, Cardell E, Zarate V (2005). Antimicrobial activity of lactic acid bacteria isolated from Tenerife cheese: initial characterization of plantaricin TF711, a bacteriocin-like substance produced by Lactobacillus plantarum TF711. J. Appl. Microbiol. 99: 77-84 Jack RW, Tagg JR, Ray B (1995). Bacteriocins of Gram positive bacteria. Microbiol Rev. 59: 171-200. Kato F, Eguchi Y, Nakano M, Oshima T, Murata A (1991). Purification and characterization of Linecin A, a bacteriocin of Brevibacterium linens. Agric. Biol. Chem. 55: 161-166 Klaenhammer TR (1993). Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol. Rev. 12: 39-85. Martirani L, Varcamonti M, Naclerio G, Felice MD (2002). Purification and partial characterization of bacillocin 490, a novel bacteriocin produced by a thermophilic strain of Bacillus licheniformis. Microbial Cell Factories, 1: 1-5 McMullan G, Christie JM, Rahman TJ, Banat IM, Ternan NG, Marchant R (2004). Habitat, applications and genomics of the aerobic, thermophilic genus Geobacillus. Biochem. Soc. Transistions, 32: 214217. Nazina TN, Tourova TP, Poltaraus AB, Novikova EV, Grigoryan AA, Ivanova AE, Lysenko AM, Petrunyaka VV, Osipov GA, Belyaev SS, Ivanov MV (2001). Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen. nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus thermoglucosidasius and B. thermodenitrificans. Int. J. Syst. Evol. Microbiol. 51: 433-446. Novotny JF, Perry JJ (1992). Characterization of bacteriocins from two strains of Bacillus thermoleovorans, a thermophilic hydrocarbonutilizing species. Appl. Environ. Microbiol. 58: 2393-2396. Ocana V, Ruiz Holdago A, Nader-Macias ME (1999). Characterization of a Bacteriocin-Like Substance Produced by a Vaginal Lactobacillus salivarius Strain. Appl. Environ. Microb. 65: 5631-5635. Orphan VJ, Taylor LT, Hafenbradl D, Delong EF (2000). Culture dependent and Culture-Ä°ndependent Characterization of Microbial Assemblages Asociated with High-Temperature Petroleum Reservoirs. Appl. Environ. Microbiol. 66(2): 700-711 Pokusaeva K, Kuisiene N, Jasinskyte D, Rutiene K, Saleikiene J, Chitavichius D (2009). Novel bacteriocins produced by Geobacillus stearothermophilus. Cent. Eur. J. Biol. 4: 196-203

7719

Powell JE, Witthun RC, Todorov SD, Dicks LMT (2007). Characterization of bacteriocin ST8KF produced by a kefir isolate Lactobacillus plantarum ST8KF. Int. Dairy J. 17: 190-198. Prangishvilli D, Holz I, Stieger E, Nickell S, Kristjansson JK, Zillig W (2000). Sulfolobicins, specific proteinaceous toxins produced by strains of the extremely thermophilic archaeal genus Sulfolobus. J. Bacteriol. 182: 2985-2988. Riosen PA, Ronning P, Hegna IK, Kolsto AB (2005). Characterization of a broad range antimicrobial substance from Bacillus cereus. J. Appl. Microbiol. 96: 648-655. Ronimus RS, Parker LE, Morgan HW (1997). The utilization of RAPDPCR for identifying thermophilic and mesophilic Bacillus species. FEMS Microbiol. Lett. 147: 75-79. Saeed S, Rasool SA, Ahmed S, Khanum T, Khan MB, Abbasi A, Ali SA (2006). New insight in staphylococcin research: bacteriocin and/or bacteriocin-like inhibitory substances produced by S. aureus AB188. World J. Microbiol. Biotechnol. 22: 713-732. Schagger H (2006). Tricine-SDS-PAGE. Nat Protocols, 1: 16-23. Shafia F (1966). Thermocins of Bacillus stearothermophilus. J. Bacteriol. 92: 524-525. Sharp RJ, Bingham AHA, Comer MJ, Atkinson A (1979). Partial characterization of bacteriocin (thermocin) from Bacillus stearothermophilus RS93. J. Gen. Microbiol. 111: 449-451 Sung MH, Kim H, Bae JW, Rhee SK, Jeon CO, Kim K, Kim KK, Hong SP, Lee SG, Yoon JH, Park YH, Baek DH (2002). Geobacillus toebii sp. nov., a novel thermophilic bacterium isolated from hay compost. Int. J. Syst. Evol. Microbiol. 52: 2251-2255. Tagg JR, Dajani AS, Wannamaker LW (1976). Bacteriocins of grampositive bacteria. Bacteriol. Rev. 40: 722-756. Todorov SD, Dicks LM (2005). Characterization of bacteriocins produced by lactic acid bacteria isolated from spoiled black olives. J . Basic Microbiol. 45: 312-322. Xiraphi N, Georgalaki M, Van Driessche G, Devreese B, Van Beeumen J, Ttsakalidou E, Metaxopoulos J, Drosinos E (2005). Purification and characterization of curvaticin L442, a bacteriocin produced by Lactobacillus curvatus L442. Antonie van Leuwenhook, 89: 19-26.

African Journal of Biotechnology Vol. 11(30), pp. 7720-7724, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.590 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Proximate and mineral analysis of some wild edible mushrooms I. O. Okoro* and F. I. Achuba Department of Biochemistry, Faculty of Science, Delta State University, Abraka, Delta state, Nigeria. Accepted 11 August, 2011

Proximate and mineral analysis of five species of mushroom, Lentinus squarrosulus, Volvariella volvacea, Coprinus micaceus, Lepiota procera, and Auricularia auricula were examined in this study to determine their nutritional value. These mushrooms were found to contain on the average, 3.24 to 8.70% of crude fibre; 4.12 to 11.12% of ash; 0.90 to 2.58% of fats and oil; 12.02 to 27.00% of protein; 13.01 to 92.02% of moisture and 21.11 to 68% of carbohydrate. The average mineral element content of the mushrooms was found to be 144 to 1321 mg/100 g of potassium; 122 to 364 mg/100 g of sodium; 164 to 549 mg/100 g of calcium; 26 to 53 mg/100 g of magnesium; 738 to 1537 mg/100 g of phosphorus and 120 to 432 mg/100 g of iron. The overall nutritional potential of the five mushroom species was quite good. These results show that these species of mushroom are highly nutritive. These findings were discussed in line with the importance and implications of the uses of edible mushrooms to man. Key words: Edible mushroom, mineral composition, proximate analysis.

INTRODUCTION The consumption of mushrooms is now assuming greater importance in human diet worldwide, but many people are apprehensive about mushrooms as a food source. Ignorance has led many to become sceptical about whether food of fungal origin can hold any great nutritional promise. It seems much education is needed before full advantage can be taken of this readily available, nutritionally rich food source (Chang and Mshigeni, 2001; Crisan and Sands, 1978). Mushroom eating is still not popular in some parts of Nigeria today. This is due to the fact that mushrooms and fungus in general grow on decaying organic matter and waste substrates, coupled with the fact that some mushrooms are poisonous. However, in other parts of Nigeria, mushrooms are regular source of food to them (Oso, 1975; Nwokolo, 1987). Mushrooms have assumed greater importance in the diets of both rural and urban dwellers, unlike previously when consumption was confined to rural dwellers. Mushrooms are now marketed along highways and urban centres (Aremu et al., 2008). Most of the mushrooms consumed in Nigeria are picked by rural dwellers from farmlands, forests and around waste dump sites when

*Corresponding author. E-mail: israelik@yahoo.com.

environmental conditions particularly humidity favour their sporocarp formation. They are relatively much cheaper than beef, pork and chicken that contain similar nutrients. Also, Africa is very rich in edible species of mushroom and many people in African countries still depend on collection of wild edible mushrooms (Peter, 1991; Masuka and Utete, 1996). Mushrooms represent one of the world's greatest untapped resources of nutritious food. Cultivation of saprophytic edible mushrooms may be the only currently economical biotechnology for lignocellulose organic waste recycling that combines the production of protein rich food with the reduction of environmental pollution (Obodai et al., 2003). Mushrooms are rich in protein, minerals, and vitamins, and they contain an abundance of essential amino acids (Sadler, 2003). Therefore, mushrooms can be a good supplement to cereals (Chang and Buswell, 1996). Mushrooms are saprophytes. They include members of the Basidiomycota and some members of the Ascomycota. They consist of two main parts, the mycelium and the fruity body (sporocarp). The mycelium consists of a treelike structure called hyphae hidden in the soil. The mycelium absorbs food nutrients while the hyphae form into mycelia which forms the fruit (sporocarp) structure on the surface when atmospheric conditions particularly

Okoro and Achuba

humidity is favourable. The spore producing tissue is called the hymenium (Etang et al., 2006). Mushrooms vary in sizes, colour, texture and structure that favour their spore formation. The cap is called the cuticle and varies among different mushroom species, being sticky or slimy in texture. The stalk is the stem-like structure on which the cap is mounted and this varies in length depending on the species (Gyar and Ogbonna, 2006). Many species of mushrooms are edible, for example, Plevritis sp., Agricus bisporus (J. Lange) Imbach and Volvariella volvaceae (Bulliard ex Fries) Singer. Some are medicinal like Tremella fuciformis Berk., for maintaining healthy lung tissue, while others are poisonous like Pholiota semarrasa and Amanta vaginata (Bull.: Fr.) Lam. (Chang and Buswell, 1996). Mushrooms have been a food supplement in various cultures and they are cultivated and eaten for their edibility and delicacy. They fall between the best vegetables and animal protein source. Mushrooms are considered as source of proteins, vitamins, fats, carbohydrates, amino acids and minerals (Jiskani, 2001). All essential amino acids are present as well as water soluble vitamins and all the essential minerals (Buigut, 2002). Mushrooms are good sources of vitamins like riboflavin, biotin and thiamine (Chang and Buswell, 1996). It has been indicated that mushroom is about 16.5% dry matter out of which 7.4% is crude fibre, 14.6% is crude protein and 4.48% is fat and oil. The protein value of mushrooms is twice as that of asparagus and potatoes, four times as that of tomatoes and carrots, and six times as that of oranges (Jiskani, 2001). Their energy value also varies according to species, which is about equal to that of an apple. A common species of mushroom found in southern part of Nigeria is Pleurotus tuber-regium. It is useful in some combinations to cure headache, stomach ailents, colds and fever (Oso, 1977), asthma, smallpox and high blood pressure (Oso, 1977; Fasidi and Olorunmaiye, 1994), while Lentinus tuber-regium and Lentinus tigrinus are used for treating dysentery and blood cleansing respectively. Auricularia specie has been traditionally used for treating hemorrhoids and various stomach ailments (Chang and Buswell, 1996). Chanterelles, Boletus edulis and Lactarius spp. are used for killing flies, while the puffballs are used for healing wounds (Harkonen, 1998; Delena, 1999). They are also recommended to diabetic and anaemic persons, owing to their low carbohydrate and high folic acid content. Some mushrooms are reputed to possess anti-allergic, anticholesterol, anti-tumor and anti-cancer properties (Jiskani, 2001). With the present high cost of meat and fish, many Nigerians are turning to mushrooms as an alternative source of protein. A limited amount of research has been carried out on the nutritive value of Nigerian mushrooms (Oke, 1966; Oso, 1977; Ogundana and Fagade, 1982). The objective of this study was to determine the

7721

biochemical composition of five different wild edible mushrooms species, in terms of moisture, protein, crude fat, carbohydrate, fibre, ash and micronutrient elements. It is hoped that the results may be valuable for chemotaxonomical and will encourage people to embark on their husbandry. MATERIALS AND METHODS Collection and treatment of samples Mushrooms grow abundantly in the wild during the rainy season in every part of Delta State, Nigeria. Fruiting of five mushroom species were harvested from decaying logs and oil palm stalks dump site inside a bush located at Abraka, Delta State, Nigeria. The mushroom species were identified by a mycologist in the Department of Botany, Faculty of Science, University of Benin, Benin City, Edo State, Nigeria as Lentinus squarrosulus, V. volvacea, Coprinus micaceus, Lepiota procera and Auricularia auricula. Sample preparation was done as follows: after harvest, the fruit bodies were cleaned by gentle wiping with a cloth to remove any debris. Except for moisture and ascorbic acid determination, which were performed immediately after harvesting, dried samples were used. Dried samples were ground using a laboratory mill to pass through 1 mm sieve. All ground samples were transferred to airtight plastic bottles with well fitting caps, labelled and then sealed in polythene bags to prevent any water intake and were stored in a refrigerator at 4째C until required for analysis. The cold stored samples were allowed to attain room temperature and mixed thoroughly with a spatula before withdrawing samples for further proximate constituent analysis. Proximate analysis was done on ground samples in triplicate for each sample to yield results from which mean compositions were computed. All reagents were of analytical grade and used as obtained.

Analytical methods Standard procedures of AOAC were used to determine the moisture content, crude fibre, crude fat, total nitrogen (Kjeldahl method) and ash (AOAC, 2002). In the fruit body of edible mushrooms, a large amount of nitrogen is actually contained in non-protein compounds; hence, the conversion factor of total nitrogen into crude protein is 3.45 to 4.38 (Braaksman and Schaap, 1996; Shah et al., 1997). In this study, crude protein was calculated using the conversion factor of (N x 4.38); a correlation factor adopted for mushrooms in food composition tables (Crisan and Sands, 1978). The content of ascorbic acid was determined by a titration method using the 2, 6 dichlorophenolindophenol Tillmans reagent (Tillman's method) (AOAC, 2002). The results were expressed in milligram of ascorbic acid per 100 g of sample. Mineral constituents (calcium, phosphorous, sodium, potassium, magnesium and iron) were determined by atomic absorption spectrophotometry (AOAC, 2002). The percentage of crude protein, crude fat, minerals and ash were combined and subtracted from 100 to obtain the total carbohydrate percentage for each sample.

Statistical analysis The data on nutritive content determined for the five edible wild mushrooms species were subjected to analyses of variance (one way ANOVA) significance was accepted at the 5% probability level using the Statistical Package for Social Sciences (SPSS) Program

7722

Afr. J. Biotechnol.

100 90

Concentration

80 70 60 50 40

Lentinus squarrosulus

30

Volvariella volvacea Coprinus micaceus

20

Lepiota procera

10

Auricularia auricula

0

Figure 1. Proximate nutrient compositions of the mushroom samples.

10.1 version (SPSS, 1999). Data for proximate nutrient composition and for mineral constituents were reported as the mean ± SD for three determinations per sample. The results were given as mean ± SD.

RESULTS The results of the proximate composition are presented in Figure 1. V. volvacea had the highest concentration of protein (27±1.02%) followed by L. procera and L. squarrosulus, while A. auricular had the least value of 12.02±2.1%. With respect to moisture content, V. volvacea had the highest value (92±0.12%) and L. procera the least value (13.01±0.2%). A. auricular had the highest carbohydrate value (61±0.32) and crude fibre was highest in V. volvacea (8.7±0.22). The ether extract (lipid) of V. volvacea gave the highest value of 2.80±0.21% and the least was C. micaceus (0.90±0.01%). Minimum and maximum ascorbic levels in the present study were 1.34±0.2 mg/100 g d.w. and 58±0.14 mg/100 g d.w. for A. auricular and L. squarrosulus, respectively. Results in Figure 2 showed values of the mineral compositions. Calcium content was 549±0.6 mg/100 g dry weight for L. squarrosulus and 164±2.01 mg/100 g d. w. for A. auricular. L. procera and C. micaceus had the highest sodium content of 364±0.12

and 289±3.1 mg/100 g dry weights respectively. V. volvacea had the highest potassium concentration (1321±1.05 mg/100 g) and A. auricular had the least content (151.26±1.3 mg/100 g). V. volvacea had the highest phosphorus content, followed by L. squarrosulus and C. micaceus. V. volvacea had the highest magnesium content (53±1.40 mg/100g). The iron content varied from L. procera with 119±2.1 mg/100 g d.w to V. volvacea with 432±1.40 mg/100 g. DISCUSSION Proximate analysis was carried out on five edible mushroom species: L. squarrosulus, V. volvacea, C. micaceus, L. procera and A. auricular. They were selected based on their availability at the time of analysis. The results of the proximate analysis of the five species of edible mushroom showed that the mushroom are richly endowed with protein, fibre, ash, moisture, fat, carbohydrates and mineral elements. This agrees with the finding of Moore and Chi (2005) that edible mushrooms have high nutritional attributes and potential applications in industries. The crude protein, ash and crude fibre values of most mushrooms compared favourably with and in some instances surpassed those reported for most legumes except groundnut and soybeans grown in West

Concentration (mg/100 g dry weight)

Okoro and Achuba

7723

1800 1600 1400 1200 1000 800 600

400 200 0

Lentinus squarrosulus Volvariella volvacea Coprinus micaceus Lepiota procera

Auricularia auricula

Figure 2. Concentrations of Na, K, Ca, Mg, P, Fe and ascorbic acid of analyzed mushroom samples (mg/100 g dry weight).

Africa (FAO, 1970; Aletor and Aladetimi, 1989). The mineral levels, mainly potassium, phosphorous, sodium and iron in these mushrooms were higher than those reported for several cowpea varieties (Aletor and Aladetimi, 1989), but lower than those reported for fish, snails and broiler meat (Imevbore, 1992). Using this proximate analysis, the mineral and analytical food value as approximate indices of nutritional quality, it would appear that some of these mushrooms fall between most legumes and meat. In earlier studies, Gruen and Wong (1982) indicated that edible mushrooms were highly nutritional and compared favourably with meat, egg and milk. Some of the mushrooms are known to possess antitumorigenic and hypocholesterolaemic agents, which implies that mushrooms could hold special attraction for and may be recommended for people with cholesterolrelated ailments (Chihara, 1993). The results of the study showed appreciable levels of fibre which is known as anti-tumorigenic and hypochlestrolaemic agent. This implies that mushrooms hold special attraction and may be recommended for people with cholesterol related ailment (Kadiri and Fasidi, 1990). The moisture contents of some of the mushrooms analyzed are high, indicating that mushrooms are highly perishable. High moisture contents promote susceptibility to microbial growth and enzyme activity. V. volvacea has the highest protein, moisture, ash and crude fibre content of the five species. The high moisture and protein content especially in V. volvacea suggests that great care must be taken in their handling and epresentation as high moisture contents promote susceptibility to microbial growth and enzyme activity. The results show that the five species of

mushrooms were rich in nitrogen and were found to contain reasonable levels of the minerals analysed. This is in agreement with results of the study of some cultivated mushrooms (Agaricus bisporus and Pleurotus osterotus) by Edeoga and Gomina (2000). In addition, it is also known that the moisture content of mushrooms depends on their harvesting time, maturation period and environmental conditions such as humidity and temperature in growing period, and storage conditions, Crisan and Sands (1978). The moisture content of all studied mushroom species ranged from 13.01Âą0.2 to 92Âą0.12. Mushrooms are consumed for low-calorie diet because of their low crude fat content. The major compounds of mushrooms are proteins and carbohydrates. It is reported that the protein contents of mushrooms are affected by a number of factors, namely the type of mushrooms, the stage of development, the part sampled, level of nitrogen available and the location, Flegg and Maw (1977). It can be understood from the data that the studied mushrooms are good protein source. Mushroom carbohydrates include glucans, mono- and disaccharides, sugar alcohol, glycogen and chitin (Kurztman, 1997). The trace metal content of mushrooms are related to species of mushroom, collecting site of the sample, age of fruiting bodies and mycelium, distance from sources of pollution (Kalac et al., 1991) and are mainly affected by acidic and organic matter content of the soil. Metal ion uptake of mushrooms is considerably higher than plants because of their effective take up mechanism (Lepsova and Mejstrik, 1988). The results of mineral values of the five edible species of mushrooms clearly indicate the potential for their use as sources of good quality food. Minerals in the

7724

Afr. J. Biotechnol.

diet are required for metabolic reactions, transmission of nerve impulses, rigid bone formation and regulation of water and salt balance among others. Conclusion The results of the proximate analysis of the five species showed that V. volvacea had the highest levels of crude protein, moisture and crude fibre. It can be said following the results of this study that these edible mushrooms hold tremendous promise in complementing the protein and minerals supply deficiencies prevalent in developing countries since mushrooms are highly nutritional and can compare favourably with egg, meat and milk. However, for the nutritional potential of mushrooms to be realized, sustained efforts must be geared towards the cultivation and popularization of these studied mushrooms (L. squarrosulus, V. volvacea, C. micaceus, L. procera and A. auricular). Edible mushrooms are grown with little efforts in their husbandry: they are grown on straw based compost, and sawdust supplemented with other nutrients. It can be conclude that the investigated wild edible mushrooms are good food sources in terms of protein, carbohydrate, crude fat, and crude fibre and may be cultivated. REFERENCES Aletor VA, Aladetimi OO (1989). Compositional evaluation of some cowpea varieties and some underutilized edible legumes in Nigeria. Die Nahrun 33: 99-1007. th AOAC (2002). Official Methods of Analysis -17 ed. Association of Official Analytical Chemist, Maryland. Aremu MO, Basu SK, Toma GA, Olowoniyi FD (2008). Evaluation of the nutritional value of three types of edible mushrooms found in Nasarawa State, Nigeria. Bangladesh J. Prog. Sci. Tech. 6(2): 305– 308. Braaksman A, Schaap DJ (1996). Protein analysis of the common mushrooms Agaricus bisporus. Post. Harv. Biol. Technol. 7: 119-127. Buigut SK (2002). Mushroom production in sustainable small-scale farming system-opportunities and constraints: a survey of Uasin Gishu district. In: Proceedings of the Holticulture seminar on Sustainable Horticultural Production in the Tropics at Jomo Kenyatta University of Agriculture & Technology, Juja, Kenya 3rd-6th October, 2001. Eds. Wesonga JM, Losenge T, Ndung’u CK, Fricke A, Hau B, Stützel H (2002). pp. 1-5. Chang ST, Buswell JA (1996). Mushroom neutraceuticals. World J. Microbiol Biotechnol. 12(5): 473 – 476. Chang ST, Mshigeni KE (2001).Mushroom and their human health: their growing significance as potent dietary supplements. The University of Namibia, Windhoek. pp. 1-79. Chihara G (1993). Medicinal aspects of Lentian Isolated from Lentinus edodes (Berk). Hong Kong, Chinese University Press. pp. 261-266. Crisan EV, Sands A (1978). Nutritional value. In: Chang ST and Hayes WA (Eds). The Biology and Cultivation of Edible Mushrooms. London, Academic Press Inc, pp 137-165. Delena T (1999). Edible and Useful Plants of Texas and the SouthWestA Practical Guide. 2003-5 University of Texas Press. p. 542. Edeoga HO, Gomina A (2000). Nutritional values of some nonconventional leaf vegetables of Nigeria .Journal of Economic Botany 24: 7-12

Etang BB , Essian JP, Odejimi RAO (2006). Nutritional and bacteriological quality of mushroom from Niger-Delta rainforest of Nigeria. Nig. J. Microbiol. 20(2): 965 – 975. FAO (1970). Food and agricultural Organization (No 12) FAO, Rome, Italy. Fasidi IA, Olorunmaiye KS (1994). Studies on the requirements for vegetative growth of Pleurotus tuber-regium (Fr.) Singer, a Nigerian mushroom. Food Chem. 50: 397-401. Flegg PB, Maw G (1977). Mushrooms and their possible contribution to world protein needs. Mushroom J. 48: 395-403. Gruen VEC, Wong HX (1982). Immunodulatory and Antitumour activities of a polysaccharide-peptide complex from a mycelial culture of Trichoderma sp. Sciences, 57: 269-281. Gyar SD, Ogbonna CIC (2006). Comparative study on nutrient and mineral profiles of mushroom species Macrolepiota procerus cultivated on two Mansonia altissima sawdust formulations. Adv. Food Sci. 28(4): 1 – 4. Harkonen M (1998). Uses of mushrooms by Finns and Karelians. Int. J. Circumpolar Health, 57 (1): 40-55. Imevbore EA (1992). Perspectives of snail farming in tropical Africa: the Nigerian situation. In: Proc. Invertebrates (Microlivestock) Farming Seminar, La Union, Philippines. Jiskani MM (2001). Energy potential of mushrooms. The DAWN Economic and Business Review, Oct. 15-21, 2001. p. IV. Kadiri M, Fasidi IC (1990). Studies on enzyme activities of Plerotus tuber regium Hein at various fruitbody stages. Nahrung, 34(8): 695999. Kalac P, Burda J, Staskova I (1991). Concentrations of lead, cadmium, mercury and Cooper in mushrooms in the vicinity of a lead smelter. Sci. Total Environ. 105: 109-119. Kurztman RH (1997). Nutrition from mushrooms, understanding and reconciling available data. Mycoscience, 38: 247-253. Lepsova A, Mejstrik V (1988). Accumulation of trace-elements in the fruiting bodies of macrofungi in the Krusnehory Mountains, Czechoslovakia. Sci. Total Environ. 76: 117-128. Masuka AJ, Utete D (1996). Overview of mushroom production in Africa: Constraints, opportunities and strategies. Paper presented at the regional workshop on mushroom production and mushroom germplasm collection and conservation. Harare, 23-27 September, 1996. Moore D, Chi SW (2005). Fungi products as food (eds) pointing, S.B and Hyde, K.O. In Bio-Explotation of filamentous fungi. Fungi Diversity Res. Lenis, 6: 223-251. Nwokolo E (1987). Composition of nutrients in the sclerotium of mushroom pleurotuus tuber-regium. Plant Foods Human Nutr. 37: 133-139. Obodai M, Cleland-Okine J, Vowotor KA (2003). Comparative study on the growth and yield of Pleurotus ostreatus mushroom on different lignocellulosic by-products. J. Ind. Microbiol. Biotechnol.; 30: 146149. Ogundana SK, Fagade OE (1982). Nutritive value of some Nigerian edible mushroom J. Food Chem. 8: 263-268. Oke OL (1966). Chemical studies on the more commonly used leaf vegetables in Nigeria.West Afr. Sci. Assoc. 2: 42-49. Oso BA (1975). Mushrooms and the Yoruba people of Nigeria, Mycolgia, 67: 311-319 Oso BA (1977). Pleurotus tuber-regium from Nigeria. Mycologia, 69: 271. Peter O (1991). Manual on mushroom cultivation. Tool publications sarphat Istraat 650, 1018 AV Amsterdam. The Netherlands pp 1725. Sadler M (2003). Nutritional properties of edible fungi. British Nutrition Foundation Nutrition Bulletin, 28: 305-308. Shah H, Khalil IA, Jabeen S (1997).Nutritional composition and protein quality of Pleurotus mushroom. Sarhad J. Agric. 13:621-627. SPSS. Statistical package for Social Sciences (1999) Computer Program, MS for Windows. SPSS 10 for Windows, Chicago, Illinois, USA.

African Journal of Biotechnology Vol. 11(30), pp. 7725-7730, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3231 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Stabilization and preservation of probiotic properties of the traditional starter of African opaque sorghum beers A. P. Polycarpe Kayodé1, Deloris C. Deh1, Lamine Baba-Moussa2, Simeon O. Kotchoni3 and Joseph D. Hounhouigan1 1

Département de Nutrition et Sciences Alimentaires, Faculté des Sciences Agronomiques, Université d’Abomey-Calavi, 01 BP 526 Cotonou, Bénin. 2 Laboratoire de Biologie et de Typage Moléculaire en Microbiologie; Faculté des Sciences et Techniques, Université d’Abomey-Calavi, 05 BP 1604 Cotonou, Bénin. 3 Department of biology and Center for Computational and Integrative Biology, Rutgers University, 315 Penn St., Camden, NJ 08102, USA. Accepted 28 February, 2012

This present study assessed the impact of drying process parameters, that is temperature and drying duration, on the dry matter content, pH, titratable acidity, yeasts and lactic acid bacteria content of granule starter of African opaque sorghum beer. Probiotic properties of the dry starter were tested. The aim was to establish levels of temperature and duration of drying that lead to a longer shelf life and optimum activity of the starter. Results show that the drying temperature has significant effects on the titratable acidity, yeasts and lactic acid bacteria contents of the granule starter while the level of dry matter was significantly affected by both temperature and duration of drying. The optimal drying conditions providing a stable granule starter with optimum viability of lactic acid bacteria and yeasts were established to 43°C and 24 h. Both wet and dried starters showed inhibitory effect on the meticillin resistant Staphylococcus aureus. Key words: sorghum, opaque beer, starter, yeats, probiotic, Response Surface Methodology.

INTRODUCTION Opaque sorghum beers are popular alcoholic beverages in Africa. They are known as tchoukoutou in Benin, dolo in Burkina-Faso, pito in Ghana, and burukutu or otika in Nigeria (Odunfa, 1985; Kayodé et al., 2005). The beers have a sour taste, a relatively high dry matter content and low alcohol content, which make them suitable beverages for adults (Agu and Palmer, 1998; Briggs et al., 2004). The nutritional attributes of eight commercial sorghum beers were reported by Novellie and De Schaepdrijver (1986) as follows: protein 5.4 g L-1, ash 1.13 g L-1, carbohydrate 47.6 g L-1, iron (Fe) 1.4 g L-1 and zinc (Zn) -1 1.4 g L . This suggests that such beer can be a significant source of dietary nutrients, considering the rather large quantity that is consumed daily in certain

*Corresponding author: E-mail: polykap@yahoo.fr. Tel +229 97870734.

locations (Briggs et al., 2004; Kayode et al., 2005). The sorghum beers are largely consumed by the poorest people and therefore contribute to their dietary needs. Tchoukoutou, the Benin opaque sorghum beer, is produced by women using various processes. In general, as in the conventional lager beer process, the manufacturing process consists of three phases: malting, mashing and fermentation. The grain is soaked in water overnight (9 to 12 h), germinated (72 to 85 h), sun dried (7 to 15 h), ground in a disc mill, mixed with water, decanted and divided into slurry and supernatant. The slurry is mashed under gradual heating until the boiling point is reached after 2 h, mixed with supernatant and allowed to ferment overnight, then filtered, boiled (6 to 9 h), cooled, and inoculated with a starter called kpetekpete, which is generally harvested from the bottom of a previous fermenting beer (resulting from 13 to 14 h overnight fermentation). The fermentation step is a critical step in the process, and its success depends on the

7726

Afr. J. Biotechnol.

accurate knowledge of the processor in terms of the starter handling. Several researches reported that the microorganisms contained in the traditional starters of African opaque beers mainly consist of yeasts and lactic acid bacteria (Van der Aa Kühle et al., 2001; Demuyakor and Ohta, 1991; Sefa-Deheh et al., 1999; Sanni and Lönner, 1993). The microorganisms are kept alive by replacing the supernatant on a daily basis. The preservation of such starter is a tedious and a risky business since it is common that the starter to loose its fermenting properties and therefore fail to make the beer effervescent, because the involved microorganisms would have died. Preliminary data demonstrated that rural and urban women’s groups in the processing chain of opaque sorghum beers derive a direct benefit from increased marketing opportunities (Kayodé et al., 2007). Thus, innovations in the traditional brewing technology and the product quality could significantly improve income and livelihood of rural households involved in this activity. This present study aims at improving the shelf life of the traditional starter used to ferment opaque African beers. More specifically, the objective was to evaluate the effect of temperature and duration of drying, on several quality determining factors such as the dry matter content; titratable acidity, as well as yeast and lactic acid bacteria content of granule starter. It is quite likely that these factors are interdependent. However, interactions between factors cannot be detected using the one-factorat-a-time approach (Giovani, 1983). Therefore, we decided to use a design methodology that is able to detect such interactions. The response surface methodology (RSM) was used applying a central composite design. Central composite designs are the basis for RSM and are used to estimate parameters of a full second-degree model. Such a quadratic model is usually sufficient for accuracy in product and process design (Giovani, 1983). In addition, the probiotic properties of the dry granules were evaluated by testing the anti-microbial effect of the starter extracts on methicillin resistant Staphylococcus aureus grown on agar plates. MATERIALS AND METHODS

Experimental design Response surface methodology is a statistical method that uses quantitative data derived from an appropriate experimental design with quantitative factors to estimate the relationship between a response and the factors in order to optimize processes or products (Giovani, 1983). In this study, an orthogonal rotatable central composite design (Montgomery, 2001) for K = 2 factors was used to estimate the simultaneous effect of two process variables on titratable acidity, lactic acid bacteria, yeasts, and total mesophilic aerobic bacteria in a quadratic function. The variables (factors) were the drying temperature (35 to 50°C), and duration of drying (5 to 24 h). The responses were titratable acidity, dry mater, yeasts, lactic acid bacteria, and total mesophilic aerobic bacteria counts. The design generated 14 observations which are distributed as follows: four kernel points, four star points and six replications at the central point. The design matrix and variable combinations are presented in Table 1.

Experimental processing 4 kg of cleaned sorghum grains were dehulled using a mini-PRL dehuller (Thiès, Sénégal) and then ground. The flour obtained is mixed with distilled water (45% w/w), inoculated with 10% (w/w ) of kpete-kpete, kneaded into dough and allowed to ferment in a plastic bucket with lid for 24 h. Fermented dough samples were oven dried for an indicated time and temperature as specified in the next experimental design (Table 1). Samples were withdrawn when the predefined time and temperature were reached and immediately analyzed for microbiological characteristics.

Counts of viable microorganisms Total counts of mesophilic aerobic bacteria, lactic acid bacteria (LAB), yeasts, moulds and Enterobacteriaceae were enumerated according to the method described by Nout et al. (1987). Duplicate samples of stabilized starter (10 g) were diluted in 90 ml sterile peptone physiological saline solution (5 g peptone, 8.5 g NaCl, and 1000 ml distilled water, pH = 7.0) and homogenised with a Stomacher lab-blender (type 400, London, UK). Decimal dilutions were plated. Total mesophilic aerobic bacteria counts were determined on plate count agar (PCA, oxoid, CM 325, Hampshire, England) after incubation at 30°C for 72 h. Viable counts of lactic acid bacteria were determined on de Man, Rogosa and Sharpe Agar (MRSA, CM 361, Oxoid, Hampshire, England) containing 0.1% (w/v) natamycin (Delvocid, DSM, The Netherlands) with incubation in anaerobic jar (Anaerocult A, Merck KGaA, Germany). Viable yeasts were determined on oxytetracyclin glucose yeast extract agar (OGYA, Oxoid CM 0545, Basingstoke, Hampshire, England) containing oxytetracycline. Enterobacteriaceae were enumerated on violet red bile agar (VRBA) after incubation at 37°C for 24 h.

Starter sampling Traditional starter, locally known as kpete-kpete, was harvested from one processing site in Abomey-Calavi. This consists of wet slurry from an actively fermenting sorghum beer. The samples were collected in sterile bottles, packed in ice cold box and transported to laboratory for microbiological and physicochemical analysis. To check for the variability in the starter, four samples were collected from the same processor on different days and analysed for pH, titratable acidity, total mesophilic aerobic bacteria, lactic acid bacteria, yeasts and enterobacteriaceae counts. The coefficients of variation for the measured parameters were consistently below 7% in the different samples. One batch of starter was sampled from this processor and use for the stabilization study.

Physico-chemical analysis Dry matter was determined according to the American Association of Cereal Chemists (AACC) approved methods (AACC, 1984). Titratable acidity and pH were determined as described by Nout et al. (1989).

Evaluation of probiotic properties The probiotic properties of the dry granules were evaluated by testing the anti-microbial effect of the starter extracts on methicillin

Kayodé et al.

7727

Table 1. Design matrix and variable combinations.

Treatment code 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Level code Temperature 0 0 0 0 0 0 +1 -1 -1 +1 +α 0 -α 0

resistant S. aureus grown on agar plates (Baba-Moussa et al., 2008). In order to confirm the preservation of the functional properties of the starter, we tested the starter before and after the drying under the optimum condition (43°C, 24 h). The dry starter was resuspended in water before use. The starters were centrifuged (13,000 rpm, at room temperature, for 5 min) and respective supernatants were used as probiotic extracts for the antimicrobial test. For the test, a drop (30 µl) of the supernatant was allowed to diffuse from a paper disk deposited at the center of S. aureus grown agar plate. The plate was incubated overnight at 37°C and the inhibition zone induced by the extract on the bacterial plate was recorded. A bacterial grown plate containing a paper disk with a drop (30 µl) of water was used as control.

Statistical analysis Data were analyzed using the Minitab 14 statistical program. A second order polynomial model was proposed to establish the relationship between the responses (Y) and the variables (X) as follows: Y = b0 + b1 x1 + b2 x2 + b 3 x12 + b4 x22 + b5 x1 x2 In which b0 is a constant, b1 and b2 are linear effect coefficients, b3 and b4 are quadratic effect coefficients, b5 is an interaction effect coefficient. The fitted polynomial equations were expressed in a 3D response surface in which the response is presented on the vertical axis and two factors at the two horizontal perpendicular axes.

RESULTS AND DISCUSSION Effect of drying parameters on dry matter The response values for the different treatments are presented in Table 2. The polynomial equation was fitted to the experimental data using the Minitab program, and the linear regression coefficients estimates are presented in Table 3. The water content of a food product is a good

Time 0 0 0 0 0 0 +1 +1 -1 -1 0 +α 0 -α

Variable level Temperature (°C) 42.5 42.5 42.5 42.5 42.5 42.5 47.0 38.0 38.0 47.0 50.0 42.5 35.0 42.5

Time (h) 14.5 14.5 14.5 14.5 14.5 14.5 20.2 20.2 8.79 8.79 14.5 24.0 14.5 5.0

indicator of its storage ability. After the drying treatments applied, the water content of the granules ranged between 6.19 and 49.36% (Table 2). The analysis of variance showed that the drying temperature (X1) as well as the drying duration (X2) significantly affected (P ≤ 0.05) the dry mater content of the granules. Particularly, the linear and the quadratic effects of these factors are significant on the product dry matter content (Table 3). Figure 1 shows the trends in dry matter content of the granules as function of temperature, the drying duration, and their mutual interaction. At drying duration < 12 h, the dry matter content of the product is quite stable for temperatures values between 35°C and 44°C. Between 12 h and 24 h of drying duration, there is a significant increase in the granule dry matter content which reaches 80% (Figure 1a). Such increase in the product dry matter content, due to water loss, is desirable since it could improve shelf life of the product. Previous research demonstrated that cereal products preserve well with water content < 12% (Cecil, 1992). From our experiment it is apparent from the response surface plot that such level of water content could be achieved at drying temperature between 42 and 44°C. Effect of drying parameters on viable yeast and lactic acid bacteria The number of viable microorganisms varied among treatments and the major variation in the microorganisms counts were explained by the model. The coefficient of variation (R2) was 0.75, 0.74, and 0.75 for total count of viable lactic acid bacteria, yeasts, and total mesophilic aerobic bacteria respectively. The analysis of variance showed that only the temperature exerted a significant effect on the viability of microorganisms contained in the granule starter. The number of viable microorganisms is

7728

Afr. J. Biotechnol.

Table 2. Response for pH, titratable acidity, dry matter, lactic acid bacteria, yeasts, and total count.

Code 1 2 3 4 5 6 7 8 9 10 11 12 13 14

pH 3.92 3.90 4.24 4.54 4.62 4.30 3.64 4.00 3.85 3.65 3.96 4.20 4.31 3.61

Titratable acidity (% lactic acid) 0.21 0.34 0.22 0.2 0.16 0.22 0.18 0.26 0.34 0.19 0.17 0.16 0.41 0.24

Lactic acid bacteria (log cfu/g) 7.86 7.84 8.02 7.82 7.89 7.9 7.19 7.46 7.52 7.50 6.90 7,82 7.76 8.60

Dry matter (%) 60.09 58.83 59.29 59.17 61.78 60.18 82.28 55.04 51.72 60.10 93.81 85.43 50.64 55.01

Yeasts (log cfu/g) 7.82 7.92 7.90 7.89 7.86 7.84 7.30 7.46 7.52 7.39 0.00 7.51 8.08 8.71

Total mesophilic aerobic bacteria count (log cfu/g) 7.91 8.13 7.90 7.95 7.83 7.92 7.37 7.74 7.82 7.62 0.00 7.90 8.41 8.83

Table 3. Coefficients of the variables in the model and their corresponding R 2.

Coefficient

pH

Titratable acidity

Dry matter

Lactic acid bacteria

Yeast

Total mesophilic aerobic bacteria count

b0

-4.031

0.225

398.549

-13.2092

-90.737

-86.63

b1

0.329

-0.109a

-15.844a

1.0371a

5.044a

4.873a

b2

0.232

-0.038

-9.099a

0.0119

-0.193

-0.195

b3

-0.004

0.066

0.184a

-0.0123b

-0.063a

-0.061a

b4 b5

-0.005 -0.002

-0.023 0.048

0.093a 0.184

0.0021 -0.0024

0.0058 -0.0003

0.008 -0.001

0.75

0.94

0.75

0.74

0.75

R2 c

0.46 2

2

Y = b0 + b1 x1 + b2 x2 + b 3 x1 + b4 x2 + b5 x1 x2 where, X1 = temperature (°C), X2 = time (h); a, significatif at 5 %; b, significatif at 1 %; c; 2 coefficient of determination R .

relatively constant at drying temperature between 36 and 44°C. At these temperatures, the level of viable yeasts, lactic acid bacteria and total mesophilic aerobic bacteria is in the range between 8.1 and 9.0 log cfu/g. These values are comparable to values reported for these microorganisms in the traditional starter of the African opaque sorghum beer (Hounhouigan, 2007). The effect of temperature on viability of the microorganisms is more pronounced between 44 and 50°C. At this temperature interval, viable yeasts decrease from 7.3 to 2.0 log cfu/g and the total mesophilic aerobic bacteria decreased from 7.19 to 6.6 log cfu/g. Similar to findings by Fields et al. (1981), our results confirm the relative susceptibility of yeasts to temperature compared to lactic acid bacteria which are able to survive at temperatures as high as 45°C (Giudici et al., 1998; Frazier, 1958). No significant effect of the drying duration was observed on the pH, while the titratable acidity of the granules was only affected by the temperature.

Optimization of the drying conditions In order to identify the drying conditions that lead to the optimum viability and functionality of the microorganisms of the granule starter, we used the desirability function to optimize the drying duration and temperature. The target characteristics of the granule starter, except the dry matter content, were selected on the basis of the properties of the traditional starter and were as follows: viable yeasts 7.6 to 8.64 log cfu/g, viable lactic acid bacteria 7.19 to 8.26 log cfu/g and pH 3.20 to 4.62. The level of the dry matter was set to 80 to 89%. The optimum drying conditions for the granule starter were found to be: drying temperature: 42.84°C and drying duration: 24 h with a desirability of 0.78. To check for the adequacy of the predicted model, we conducted additional independent experiments at the suggested optimal drying conditions. The predicted and the experiment values for viable yeast and lactic acid bacteria, pH

Kayodé et al.

7729

Figure 1. Response surfaces showing the effects of temperature and drying duration on (A) dry matter, (B) lactic acid bacteria, (C) yeast viability, and (D) titratable acidity of starter of opaque beer.

Table 4. Predicted and experimental value for pH, dry matter, lactic acid bacteria and yeasts.

Variable pH Dry matter (%) Lactic acid bacteria (Log cfu/g) Yeasts (Log cfu/g)

Limit 3.20- 4.62 80.0 – 89.0 7.19 – 8.26 7.62 – 8.64

Desirability (%) 0.88 0.95 0.65 0.69

and dry matter are presented in Table 4. The experimental and the predicted values are in close agreement with a desirability ranging between 0.65 and 0.95. A Chi-square test indicated that the observed values were statistically the same as the predicted values. Consequently the generated model adequately predicted the viability of the microorganisms as well as the pH and dry matter content of the granule starter. Probiotic properties of the dry granule The probiotic properties of the traditional starter have been here demonstrated (Figure 2). We hypothesized

Predicted value 3.94 82.00 7.72 8.00

Experimental value 4.15 ± 0.09 84.39 ± 0.99 7.95 ± 0.76 7.6 ± 0,10

that the starter represents a biologically stable probiotic matter that can inhibit opportunist and disease inducing microorganisms. We tested our hypothesis by assessing the inhibitory effect of the undried and the dried starters on disease inducing S. aureus (Baba-Moussa et al., 2008). Our results show that even when dried, the starter was able to inhibit the meticillin resistant S. aureus (Figures 2A, B and C) as expected. The diameter of the inhibition zone can easily be seen on the agar plates (Figures 2B and C) compared to the control plate (Figure 2A) indicating the potential benefits of the starter as a powerful health promoting matter. Our results demonstrate the stability and preservation of the probiotic properties of the traditional starter under the optimum

7730

Afr. J. Biotechnol.

Figure 2. Inhibitory effects of probiotic on methicillin resistant S. aureus. The undried starter (B) and dried starter (43°C, 24 h) (C) inhibits the bacterial growth as revealed by significant inhibitory zone (B, C) compared to control plate (A) where we observed no inhibitory zone but a uniform growth of the bacteria.

drying conditions established. Conclusion This present study shows that the temperature of drying has significant effects on tritratable acidity; yeasts and lactic acid contents of the starter granules while the level of dry matter was significantly affected by both temperature and duration of drying. The optimal drying conditions ensuring a stable granules starter with optimum viability of lactic acid bacteria and yeasts were established to 43°C and 24 h. These drying conditions have no effect on the probiotic properties of the starter. The response surface methodology could be used to establish prediction model that adequately describe the changes in viability of microorganisms, pH and dry matter content of the granule starter for the fermentation of African opaque beers. AKNOWLEDGEMENTS The authors thank the Projet Aires Sud Grant N° 7190, IRD, France, for financial support. REFERENCES AACC (1984). Approved methods of the American Association of cereal th chemists, 8 Edition, St. Paul, MN, USA. Agu RC, Palmer GH (1998). A reassessment of sorghum for lager-beer brewing. Bioresour. Technol. 66: 253-261. Baba-Moussa L, Anani L, Scheftel JM, Couturier M, Riegel P, Haıkou N, Hounsou F, Monteil H, Sanni A, Prevost G (2008). Virulence factors produced by strains of Staphylococcus aureus isolated from urinary tract infections. J. Hosp. Infect. 68: 32-38. Briggs DE, Boulton CA, Brookes PA, Stevens R (2004). Native African beers. In Brewing: Science and practice Woodhead publishing Ltd, Cambridge, UK. pp. 589-605. Demuyakor B, Ohta Y (1991). Characteristics of pito yeasts from Ghana. Food Microbiol. 8: 183-193.

Fields ML, Ahmed M, Hamad K, Duane KG (1981). Natural lactic acid fermentation of corn meal. J. Food Sci. 46: 900-902. Giovanni M (1983). Response Surface Methodology and product optimization. Food Technol. 11: 41-45. Giudici P, Caggia C, Pulvirenti A, Rainieri S (1998). Karyotyping of Saccharomyces strains with different temperature profiles. J. Appl. Microbiol. 84: 811-819. Hounhouigan H (2007). Evaluation et amélioration de la technologie traditionnelle de production de kpètè-kpètè, un ferment utilisé pour la fermentation du tchoukoutou. Thèse d’Ingénieur Agronome, FSA / UAC. Kayodé APP, Hounhouigan DJ, Nout MJR, Niehof A (2007). Household production of sorghum beer in Benin: technological and socioeconomical aspects. Int. J. Cons. Stud. 3: 258-264. Montogomery DC (2001). Design and analysis of experiments, 5 ed.; John Wiley and Sons: New York. Nout MJR, Beernink G, Bonants-Van Laarhoven TMG (1987). Growth of Bacillus cereus in soyabean tempeh. Int. J. Food Microbiol. 4: 293301. Nout MJR, Rombouts FM, Havelaar A (1989). Effect of accelerated natural lactic fermentation of infant food ingredients on some pathogenic micro-organisms. Int. J. Food Microbiol. 8: 351-361. Novellie L, De Schaepdrijver P (1986). Modern developments in traditional African beers. Progr. Ind. Microbiol. 23: 74-157. Odunfa SA (1985). African fermented foods. In Wood BJB (ed.) Microbiology of Fermented Foods Elsevier Applied Science, London, UK. pp. 167-195. Sanni AI, Lönner C (1993). Identification of yeast isolated from Nigerian traditional alcoholic beverages. Food Microbiol. 10: 517-523. Sefa-Dedeh S, Sanni AI, Tetteh G, Sakyi-Dawson E (1999). Yeasts in the traditional brewing of pito in Ghana. World J. Microbiol. Biotechnol. 15: 593-597. Van der Aa Kuhle A, Jesperen L, Glover RLK, Diawara B, Jakobsen M (2001). Identification and characterization of Saccharomyces cerevisiae strains isolated from West African Sorghum beer. Yeast, 18: 1069-1079.

African Journal of Biotechnology Vol. 11(30), pp. 7731-7737, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4112 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Qianliening capsule treats benign prostatic hyperplasia (BPH) by down-regulating the expression of PCNA, CyclinD1 and CDK4 Xiaoyong Zhong1, Jiumao Lin1,2, Jianheng Zhou3, Wei Xu4, Zhenfeng Hong1* and Jun Peng1,2 1

Academy of Integrative Medicine Biomedical Research Center, Fujian University of Traditional Chinese Medicine, 1 Huatuo Road, Minhou Shangjie, Fuzhou, Fujian 350108, China. 2 Fujian Key Laboratory of Integrative Medicine on Geriatrics, Fujian University of Traditional Chinese Medicine, 1 Huatuo Road, Minhou Shangjie, Fuzhou, Fujian 350108, China. 3 Department of Integrative Medicine, Fujian University of Traditional Chinese Medicine, 1 Huatuo Road, Minhou Shangjie, Fuzhou, Fujian 350108, China. 4 Department of Pharmacology, Fujian University of Traditional Chinese Medicine, 1 Huatuo Road, Minhou Shangjie, Fuzhou, Fujian 350108, China. Accepted 8 March, 2012

Benign prostatic hyperplasia (BPH) is characterized by abnormal proliferation of epithelial and stromal cells in prostatic tissue, which is closely correlated with increased expression of PCNA, CyclinD1 and CDK4. Therefore, inhibition of cell proliferation by suppressing the expression of the above genes is a promising strategy in the development of novel anti-BPH therapies. The aim of this study was to investigate the effect of Qianliening capsule (QC), a traditional Chinese formulation that has been shown to be clinically effective in the treatment of BPH, on the expression of PCNA, CyclinD1 and CDK4 in prostatic tissues of BPH rats. Male Sprage-Dawley (SD) rats were castrated and subcutaneously injected with testosterone propionate to generate BPH model. Meanwhile, BPH rats were orally treated with QC, or with finasteride that was used as a positive control drug. Treatment with QC or finasteride significantly reduced the PI (Prostate Index, PI = prostate wet weight / body weight × 100%) in BPH rats (P<0.05). In addition, QC or finasteride treatment significantly inhibited model construction-induced upregulation of expression of PCNA, CyclinD1 and CDK4 in prostatic tissues of BPH rats (P<0.05). Our findings for the first time demonstrated that QC can obviously reduce the PI, the expression of PCNA, CyclinD1 and CDK4 in the prostatic tissues of BPH rats, which may in part explain its anti-BPH activity. Key words: Qianliening capsule, benign prostatic hyperplasia, cell proliferation, PCNA, CyclinD1, CDK4.

INTRODUCTION Benign prostatic hyperplasia (BPH) is a pathological overgrowth of the human prostate that develops in a majority of aging men older than 50 years. BPH causes increased resistance to urine flow through the urethra and sometimes kidney damage, bladder stones and

*Corresponding author. E-mail: zfhong1953@163.com. Tel: (+86) 591-22861012. Fax: (+86) 591-22861012 Abbreviations: QC, Qianliening capsule; BPH, benign prostatic hyperplasia; PI, prostatic index; DHT, 5-dihihydrotestosterone; LUTS, lower urinary tract symptoms

urinary tract infections, and thereby affects the quality of life (Djavan, 2003). BPH is a proliferative process of both the stromal and epithelial elements of the prostate arising in the periurethral and transition zones of the gland, and is hormonally dependent on testosterone and dihydrotestosterone production (Berry et al., 1984). Despite the prevalence of BPH, its pathogenesis remains controversial. Multiple partially overlapping and complementary theories have been proposed, such as embryonic reawakening, stem cell defects, chronic inflammation, imbalance between androgen/estrogen signaling and increased TGF-β signaling, all of which seem to partly reveal the abnormal growth in BPH.

7732

Afr. J. Biotechnol.

However, recently, it was widely accepted that increase in the total number of stromal and epithelial cells, which resulted from excessive cell proliferation and/or reduction of cell apoptosis, plays a critical role in the development of BPH (Zhang et al., 2009; Kyprianou et al., 1996; Claus et al., 1997; Roehrborn, 2008). The cell cycle takes place in prostatic stromal and epithelial cells leading to their division and duplication. G1/S transition is one of the two main checkpoints used by cells to regulate the cell cycle progress and thus the cell proliferation. G1/S progression is highly regulated by Cyclin D1 and Cyclin-dependent kinase 4 (CDK4) (Chen et al., 1996; Grana and Redy, 1995). PCNA is an acidic nuclear protein that has been recognized as a histological marker for the G1/S phase in the cell cycle (Zhong et al., 2008). Therefore, the expression of PCNA, CDK4 and CyclinD1 can reflect the proliferation state of BPH cells to some extent. To date, there is no completely effective treatment for BPH. The mainstay of pharmacotherapy is the combination of 5α-reductase inhibitors, such as finasteride and dutasteride which regulate the levels of 5-dihhichydrotestosterone (DHT), and alpha adrenergic-blockers, including terazosin, doxazosin and tamsulosin which inhibit α-adrenergic receptors, relaxing smooth muscle in the prostate and the bladder neck, thus decreasing the blockage of urine flow. Moreover, in some patients, surgery, transurethral resection of the prostate, is the only effective intervention (Tiwari et al., 2005). However, all these therapies may have troubling side effects such as orthostatic hypotension, decreased libido and ejaculation or erectile dysfunction. Because of these adverse effects, natural products that appear to have limited adverse events are becoming more and more important in treatments of BPH, such as Saw palmetto, Pygeum africanum and Hypoxis rooperi (Boyle et al., 2000; Wilt et al., 2000, 2002) which have long been used to treat BPH successfully. Qianliening capsule (QC) is a traditional Chinese medicine formulation consisting of wine rhubarb, leech, Milkvetch root, Achyranthes aspera and dodders. These components together confer QC properties of heatclearing, detoxification, promotion of blood circulation, removal of blood stasis, tonifying the kidney and nourishing vitality (replenishing the kidney qi in Chinese). It has been shown that QC can obviously improve a series of lower urinary tract symptoms (LUTS) in BPH patients, such as frequency of urination, urinary urgency, thin urine flow, urinary endless and some other voiding disorders. In addition, QC can ameliorate the urodynamic evaluation indexes of BPH patients such as maximum free urinary flow rate and average urinary flow rate. Our preliminary study on BPH model rats showed that QC could significantly decrease the prostatic volume and weight, and inhibit enlargement of prostate (Lin et al.,2010; Zhou et al., 2008, 2010a, b, 2012), further confirming that QC has a good therapeutic effect on BPH.

However, the mechanism of its anti-BPH activity still remains largely unknown. Therefore, using a rat model of BPH which was generated by castration and subcutaneous injection with testosterone propionate, in this study, we evaluated the therapeutic effect of QC on BPH, and investigated the underlying molecular mechanism. MATERIALS AND METHODS Thirty-two SPF grade male adult Sprague-Dawley (SD) rats (200 to 220 g) were purchased from Shanghai Si-Lai-Ke Experimental Animal Ltd. (Shanghai, China). The rats were housed in clean pathogen-free rooms in an environment with controlled temperature (22°C), humidity and a 12 h light/dark cycle with free access to water and standard laboratory food. All animal treatments were strictly in accordance with international ethical guidelines and the National Institutes of Health Guide concerning the Care and Use of Laboratory Animals, and the experiments were approved by the Institutional Animal Care and Use Committee of Fujian University of Traditional Chinese Medicine. Except for the eight control group (Cont) rats, orchiectomy was carried out for the other 24 rats under napental anesthesia through the scrotal route in an asepsis condition. Seven days after castration, they were randomly assigned to three experimental groups with eight animals in each: the model group (Model), the finasteride group (Finast) and the QC group (QC). Testosterone propionate (Shanghai GM Pharmaceutical Co., Ltd. China) were given to the castrated rats by daily intraperitoneal injections at a does of 5 mg/kg for 4 weeks to generate BPH model. Following BPH induction, the finasteride group received finasteride (Hangzhou Merck. China) at a does of 0.5 mg/kg every day and QC group received the Qianliening capsules (QC, Fujian, China, FDA approval No.: Z09104065) at a dose of 4.5 mg/kg (equivalent to 6 times the dose for a human adult) for 4 weeks. After 4 weeks of treatment, the prostates from the rats in all groups were removed, weighed and subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) assays and immunohistochemistry examination.

Prostatic index (PI) An analytical balance was used to measure the prostate weight (PW) and the prostatic index (PI) was calculated as: PW / BW × 100%.

RNA extraction and RT-PCR analysis Total RNA was isolated from fresh prostate tissues with TriZol Reagent (Invitrogen, Carlsbad, CA, USA). Oligo(dT)-primed RNA (2 µg) was reverse-transcribed with SuperScript II reverse transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The obtained cDNA was used to determine the mRNA amount of PCNA, cyclinD1 and CDK4 by PCR with Taq DNA polymerase (Fermentas). β-Actin was used as an internal control. The sequences of the primers used for amplification of PCNA, cyclinD1 and CDK4 are as follows: PCNA forward 5 - GA CAC ATA CCG CTG CGA TCG -3 and reverse 5 - TCA CCA CAG CAT CTC CAA TAT -3 (Tm = 59°C, 307 bp); Cyclin D1 forward 5 GGA GCA GAA GTG CGA AGA-3 and reverse 5 - GGG TGG GTT GGA AAT GAA-3 (Tm = 57°C,394 bp); CDK 4 forward 5 -CTT CCC GTC AGC ACA GTT C-3 and reverse 5 - GGT CAG CAT TTC CAG TAG C (Tm = 55°C, 687 bp); -actin forward 5 -ACT GGC ATT GTG ATG GAC TC-3 and reverse 5 -CAG CAC TGT GTT GGC

Zhong et al.

7733

Table 1. Comparison of the prostate wet weight and PI among different groups ( ±s).

Group

N

PI (%)

Control group

8

0.13 ± 0.0225

Model group Finasteride group

8 8

0.25 ± 0.01356 * 0.20 ± 0.019272) **

QC group

8

0.21 ± 0.01885 **

1)

2)

PI = PW (prostate wet weight) / BW (body weight) ×100%. *P < 0.05 for the difference between PI in normal group and model group. **P<0.05 versus model group.

ATA GA-3 (Tm = 55°C, 453 bp). Samples were analyzed by gel electrophoresis (1.5% agarose). The DNA bands were examined using a Gel Documentation System (BioRad, Model Gel Doc 2000, USA).

Immunohistochemistry analysis A 0.5 × 0.5 × 0.1 cm block of tissue was collected from the lateral lobe of the prostate gland of each rat. The tissue blocks were rinsed with phosphate buffer solution (PBS), fixed with 10% formaldehyde for 12 to 24 h, and subsequently embedded in paraffin, archived, and finally, sliced. The paraffin sections were processed for PCNA, cyclinD1 and CDK4 immunohistochemistry using streptavidinperosidase (SP) method: endogenous peroxidase activity was blocked by 0.3% hydrogen peroxide for 10 min, followed by incubation with 10% serum for 30 min at room temperature. Sections were incubated with primary antibodies at room temperature for 2 h. Primary antiserum was detected after incubation with a biotinylated secondary antibody. The primary antibodies employed were polyclonal rabbit anti-rat PCNA, cyclinD1 and CDK4 (Bohai Biotechnology Development Co., Ltd. Hebei, China). Secondary antibody, SP was purchased from Bohai Biotechnology Development Co., Ltd. (Hebei, China). PBS was used to replace the primary antibody as a negative control. Color was developed using DAB chromogen (Bohai Biotechnology Development Co., Ltd. Hebei, China). After staining, five high-power fields (400x) were randomly selected in each slide and the immunohistochemistry slides were examined with the method of immunohistochemical score (IHS), which was calculated by combining an estimate of the percentage of immunoreactive cells (quantity score) with an estimate of the staining intensity (staining intensity score), as follows: no staining is scored as 0, 1 to 10% of cells stained scored as 1, 11 to 50% as 2, 51 to 80% as 3 and 81 to 100% as 4. Staining intensity is rated on a scale of 0 to 3, with 0 = negative; 1 = weak; 2 = moderate and 3 = strong. The raw data were converted to the IHS by multiplying the quantity and staining intensity scores: 0 as “-”, 1 to 4 as “+”, 5 to 8 as “++” and 9 to 12 as “+++” (Table 3).

Statistical analysis Data were expressed as means ± standard deviation (s.d). The comparisons between the four groups were performed using the one-way ANOVA (analysis of variance) with a post hoc test. For categorical variables, data were presented by number and percentage. The associations between categorical variables were tested using Fisher’s exact test. All statistical hypothesis tests were set with a significance level of 0.05. Statistical analyses were performed using SPSS 15.0 statistics software (SPSS Inc, Chicago, IL, USA).

RESULTS QC treatment reduced prostatic index (PI) in BPH rats To evaluate the efficacy of QC in treatment of BPH, we first examined the effect of QC on prostatic index (PI) in BPH rats by calculating the ratio of prostatic weight to body weight. As shown in Table 1, the mean PI in the model group was significantly elevated when compared with that in the control group (P<0.05). However, administration with either QC or finasteride significantly reduced PI in BPH rats (p < 0.05). QC treatment suppressed the mRNA expressions of PCNA, CyclinD1 and CDK4 in the prostatic tissue of BPH rats The mRNA expression was determined by RT-PCR assay. As shown in Figure 1 and Table 2, model construction obviously enhanced the mRNA expression of PCNA, CyclinD1 and CDK4 in rat prostatic tissues which however, was significantly neutralized by both QC and finasteride treatment. QC treatment inhibited the protein expressions of PCNA, CyclinD1 and CDK4 in the prostatic tissue of BPH rats and quantitative analysis Data from immunohistochemistry analysis (IHC) showed that the protein expression level of PCNA, CyclinD1 and CDK4 in prostatic tissues of model group was significantly higher than that of the control group (P<0.05) (Figures 2 to 4 and Table 3), whereas treatment with QC or finasteride profoundly inhibited the protein expression of PCNA, CyclinD1 and CDK4 in the prostatic tissues of BPH rats (P<0.05; Figures 2 to 4 and Table 3). DISCUSSION BPH, also known as benign prostatic hypertrophy, is a non-cancerous enlargement of the prostate that involves hyperplasia of prostatic stromal and epithelial cells. As

7734

Afr. J. Biotechnol.

Figure 1. Effects of QC on the mRNA expressions of PCNA, Cyclind1 and CDK4 in the prostate cells. QC treatment was able to downregulate the expression of PCNA, CyclinD1 and CDK4.

Table 2. Quantitative analysis of PCNA, CyclinD1, CDK4 mRNA expression in each group (

Group Control group Model group Finasteride group QC group

N 8 8 8 8

PCNA/β- actin 0.65±0.22 0.93±0.13* 0.56±0.15** 0.45±0.26**

CyclinD1/β- actin 0.29±0.18 0.61±0.11* 0.42±0.15** 0.28±0.21**

±s).

CDK4/β- actin 0.25±0.19 0.44±0.08* 0.25±0.18** 0.10±0.16**

* P<0.05 versus control group; ** P<0.05 versus model group.

Table 3. Expression of PCNA, CyclinD1, CDK4 in the prostate tissues of different groups of rats.

Group

N

Control group Model group Finasteride group QC group

8 8 8 8

0 0 1 2

PCNA + ++ 6 2 0 5 5 2 4 2

+++ 0 3* 0 ** 0 **

2 0 2 1

Cyclin D1 + ++ 6 0 3 3 4 1 3 4

CK4 +++ 0 2* 1 ** 0 **

3 0 2 1

+ 5 3 5 5

++ 0 3 1 2

+++ 0 2* 0 ** 0 **

* P<0.05 versus control group; ** P<0.05 versus model group.

the volume of the prostate sufficiently enlarges, the nodules compress the urethral canal to cause partial or sometimes virtually complete obstruction of the urethra, which interferes with the normal flow of urine. It leads to the symptoms of urinary hesitancy, frequent urination, dysuria (painful urination), increased risk of urinary tract infections and urinary retention. Treatment options for BPH include surgery and medications to reduce the amount of tissue and increase the flow of urine. Usually, medication treatments are the most common choice for BPH patients with slight or midrange symptoms. The two main medications for management of BPH are alpha blockers and 5α-reductase inhibitors. But both two of these medicines have their own side effects. So people

often seek herbal remedies for BPH since they usually generate less negative effects and display therapeutic efficacy (Lieber, 1998). As a traditional Chinese herbal formulation which has been used for a long time in clinical practice, QC has been shown to be effective in the treatment of BPH (Lin et al., 2010; Zhou et al., 2008, 2010a, b). In this study, we calculated the PI of each group to observe the general changes of prostate tissues. The result shows that both QC and finasteride significantly reduced PI in BPH rats, which validate the clinical effect of QC. However, the mechanism of QC action is still largely unknown. BPH is considered to be a proliferative process of both the stromal and epithelial elements. Cell proliferation is

Zhong et al.

Figure 2. Immunohistochemical staining of PCNA in the prostate tissues of different groups of rats (immunohistochemistry 400Ă—). There were more PCNA positive cells in model group than that in the control group prostates (P<0.05, Table 3). Few PCNA positive cells were found in the QC group and finasteride group prostates (P<0.05, Table 3).

Figure 3. Immunohistochemical staining of in the prostate tissues of different groups of rats (immunohistochemistry 400Ă—). There were more Cyclind1 positive cells in model group than that in the control group prostates (P<0.05, Table 3). Few CyclinD1 positive cells were found in the QC group and finasteride group prostates (P<0.05, Table 3).

7735

7736

Afr. J. Biotechnol.

Figure 4. Immunohistochemical staining of CDK4 in the prostate tissues of different groups of rats (immunohistochemistry 400Ă—). There were more CDK4 positive cells in model group than that in the control group prostates (P<0.05, Table 3). Few CDK4 positive cells were found in the QC group and finasteride group prostates (P<0.05, Table 3).

highly regulated by the cell cycle, which consists of four periods: S phase (DNA synthesis phase), M phase (mitosis), G1 and G2 phase. G1/S transition is one of the two main checkpoints of cell cycle (Nurse, 1994), which is responsible for initiation and completion of DNA replication. G1/S progression is precisely regulated by Cyclin D1 that exerts its function via forming an active complex with its CDK major catalytic partners (CDK4/6) (Morgan, 1995; Nurse, 2000). An unchecked or hyperactivated Cyclin D1/CDK4 complex may be responsible for enhanced cellular proliferation and the alteration of Cyclin D1/CDK4 complexes is becoming a possible target for the anti-proliferation therapies (Day et al., 2009; Sridhar et al., 2006; Dobashi, 2004; Nurse et al., 1998). PCNA is a 36 kD DNA polymerase delta auxiliary protein that involves proliferation and it is specifically expressed in proliferating cell nuclei. PCNA has been recognized as a histologic marker for the G1/S phase in the cell cycle (Bantis et al., 2004). Using immunohistochemistry and RT-PCR analyses, in this study, we found that the expression of PCNA, Cyclin D1 and CDK4 was significantly increased in the BPH model group which however, could be significantly inhibited by QC treatment. In conclusion, here, we reported for the first time that Qianliening capsule can inhibit cell proliferation by downregulating the expression of PCNA, Cyclin D1 and CDK4, which might be one of the mechanisms by which QC treats BPH.

ACKNOWLEDGEMENT This work was supported by the Nature Science Foundation of China (81072927 and 81173433), the Natural Science Foundation of Fujian Province of China (2010J01199 and 2009J01169). REFERENCES Bantis A, Giannopoulos A, Gonidi M (2004). Expression of P120, Ki –67 and PCNA as proliferation biomarkers in imprint smears of prostate carcinoma and their prognostic smears of prostate carcinoma and their prognostic value. Cytopathol. 15(1): 25-31. Berry SJ, Coffey DS, Walsh PC, Ewing LL (1984). The development of human benign prostatic hyperplasia with age. J. Urol. 132: 474-479. Boyle P, Robertson C, Lowe F, Roehrborn C (2000). Meta-analysis of clinical trials of Permixon in the treatment of symptomatic benign prostatic hyperplasia. Urology, 55(4): 533-539. Claus S, Berges R, Senge T, Schulze H (1997). Cell kinetic in epithelium and stroma of benign prostatic hyperplasia. J. Urol. 158(1): 217-221. Chen Y, Robles AI, Martinez LA, Liu F, Gimenez-Conti IB, Conti CJ (1996). Expression of G1 cyclins, cyclin-dependent kinases, and cyclin-dependent kinase inhibitors in androgen-induced prostate proliferation in castrated rats. Cell Growth Differ. 7(11): 1571-1578. Day PJ, Cleasby A, Tickle IJ, O'Reilly M, Coyle JE, Holding FP, McMenamin RL, Yon J, Chopra R, Lengauer C, Jhoti H (2009). Crystal structure of human CDK4 in complex with a D-type cyclin. Proc. Natl. Acad. Sci. USA. 106(11): 4166-4170. Djavan B (2003). Lower urinary tract symptoms/benign prostatic hyperplasia: fast control of the patient's quality of life. Urology, 62: 614.

Zhong et al.

Dobashi Y, Goto A, Fukayama M, Abe A, Ooi A (2004). Overexpression of cdk4/cyclin D1, a possible mediator of apoptosis and an indicator of prognosis in human primary lung carcinoma. Int. J. Cancer, 110(4): 532-541. Grana X, Redy EP (1995). Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CKIs). Oncogene, 11(2): 211219. Kyprianou N, Tu H, Jacobs SC (1996). Apoptotic versus proliferative activities in human benign prostatic hyperplasia. Hum. Pathol. 27(7): 668-675. Lieber MM (1998). Pharmacologic therapy for prostatism. Mayo Clin. Proc. 73(6): 590-596. Lin Jianheng, Zhong Xiaoyong, Pen Jun, Xu Wei, Zheng Yin, Zhao Yan, Hong Zhenfeng (2010). Effects of Qianliening capsule on the expression of EGF and EGFR in BPH Rats. Fujian J. Traditional Chinese Med. 41(6): 45-47. Morgan DO (1995). Principles of CDK regulation. Nature, 374(6518):131-134. Nurse P, Masui Y, Hartwell L (1998). Understanding the cell cycle. Nat. Med. 4(10): 1103-1106. Nurse P (1994). Ordering S phase and M phase in the cell cycle. Cell, 79: 947-550. Nurse P (2000). A long twentieth century of the cell cycle and beyond. Cell, 100(1): 71-78. Nurse P, Masui Y, Hartwell L (1998). Understanding the cell cycle. Nat. Med. 4(10): 1103-1106. Roehrborn CG (2008). Pathology of benign prostatic hyperplasia. Int. J. Impot. Res. 20(3): S11-18. Sridhar J, Akula N, Pattabiraman N (2006). Selectivity and potency of cyclin-dependent kinase inhibitors. AAPS J. 8: 204-221. Tiwari A, Krishna NS, Nanda K, Chugh A (2005). Benign prostatic hyperplasia: an insight into current investigational medical therapies. Expert Opin. Invest. Drugs, 14: 1359-1372.

7737

Wilt T, Ishani A, MacDonald R, Stark G, Mulrow C, Lau J (2000). Betasitosterols for benign prostatic hyperplasia. Cochrane DB. Syst. Rev. (2): CD001043. Wilt T, Ishani A, Mac Donald R, Rutks I, Stark G (2002). Pygeum africanum for benign prostatic hyperplasia. Cochrane DB. Syst. Rev. (1): CD001044. Zhang MD, Zhao YN, An LW (2009). B-cell lymphoma/leukemia-2 and benign prostatic hyperplasia. Zhonghua Nan Ke Xue. 15(5): 452-454. Zhong W, Peng J, He H, Wu D, Han Z, Bi X, Dai Q (2008). Ki-67 and PCNA expression in prostate cancer and benign prostatic hyperplasia. Clin. Invest. Med. 31(1): E8-E15. Zhou J, Lin J, Xu W, Zhong X, Xie J, Hong Z (2010a). Effects of Qianliening capsule on the expression of IL-10 and TNF-ι in benign prostatic hyperplasia. Chinese Arch. Tradit. Chin. Med. 28(12): 26572569. Zhou J, Hong Z, Lin J, Zhao J, Zhou H (2008). Effect of Qianliening Granule on Experimental Hyperplasia of Prostate. Fujian Coll. Tradit. Chin. Med. 18(5): 45-47. Zhou H, Lin J, Zhao J, Zhou J, Hong Z (2010b). Inhibition Effects of Qianliening Granule on IL-1β and its mRNA Expression in Model Rats. Fujian Coll. Traditional Chinese Med. 20(3): 21-24. Zhou J, Lin J, Xu W, Zhong X (2012). Qianliening capsule treats benign prostatic hyperplasia through regulating the expression of sex hormones, estrogen receptor and androgen receptor. Afr. J. Pharm. Pharmacol. 6(3): 173-180.

African Journal of Biotechnology Vol. 11(30), pp. 7738-7743, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3536 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Isolation, purification and effects of hypoglycemic functional polysaccharides from Inonotus obliquus Tao Hu, Ping Liu*, Yuanying Ni and Chuntao Lu College of Food Science and Nutritional Engineering, China Agricultural University, P. O. Box 398, 17 Qinghua Donglu, Haidian District, Beijing 100083, China. Accepted 12 March, 2012

Inonotus obliquus is generally used for the treatment of diseases such as cancers, angiocardiopathy and diabetes. However, few studies are available on its functional components. The objective of this study was to isolate and purify hypoglycemic functional polysaccharides from I. obliquus (HPIO) and study their hypoglycemic activities. I. obliquus powder was used to obtain crude polysaccharides at room temperature (HPIO-R) and at high temperature (HPIO-H) using diethylaminoethyl cellulose (DEAE) cellulose -52 column chromatography for purification. Streptozotocin (STZ)-induced hyperglycemic mice were used to evaluate the in vivo antihyperglycemic and antilipidperoxidative effects of HPIOs at each eluted level. The results show that HPIO was a uniform compound and HPIO (0.2 mol/L NaCl) had antihyperglycemic effects and regulated lipid metabolism. Key words: Hypoglycemic activity, polysaccharides, Inonotus obliquus, isolation, purification.

INTRODUCTION Obesity, high blood glucose and diabetes which are the significant chronic diseases and causes of death in modern society and they are largely caused by diet. Worldwide, scientists have focused on how to reduce blood glucose levels (Bjorntorp et al., 1999). The worldwide incidence of diabetes mellitus is expected to continue growing by 6% annually and to become a leading cause of human death (Kang et al., 2008). Therefore, new drugs to manage this condition are needed. Many drugs are available to manage diabetes; however, most are expensive and have side effects. To find new drugs and meet patient needs, scientists have studied herbs with no side effects. Studies have shown that fungi are highly edible and have medicinal value,

*Corresponding author. E-mail: liuping@cau.edu.cn. Tel: +86 10 62737131. Fax: +86 10 62737131. Abbreviations: HPIO, Hypoglycemic functional polysaccharides from I. obliquus; HPIO-R, hypoglycemic functional polysaccharides at room temperature; HPIO-H, hypoglycemic functional polysaccharides at high temperature; DEAE, diethylaminoethyl cellulose; STZ, streptozotocin.

especially Inonotus obliquus, a well-known medicinal plant traditionally used for antihyperglycemic effects.I. obliquus is a white rot fungus that grows under the bark of Betula (birch), Ulmus, Alnus and dry dead trees (Mao, 2000). It is a typical disease fungus of trees and is widely distributed over the latitude 45° N to 50° N area, such as in Northern Russia, Europe, China and Hokkaido, Japan. It has been used as a folk remedy to prevent digestive system diseases; cancers of the stomach, colon and liver; angiocardiopathy; diabetes; and viral diseases. Studies have shown that a glycoprotein and a water extraction of polysaccharides isolated from the fruiting bodies of I. obliquus have significant antihyperglycemic effects. In particular, an extract of I. obliquus can sustain antihyperglycemic effects for 48 h (Huang, 2002). Extracts from I. obliquus have protective and prosthetic effects on the pancreatic islands, and on hepatic and kidney injury in STZ-induced diabetic rats (Zhang et al., 2008). Studies have also shown that dry matter from the culture broth of I. obliquus and fruiting bodies, and sclerotia and polysaccharide extracts of I. obliquus have significant antihyperglycemic, antilipid-peroxidative, and antioxidant effects on diabetic mice (Sun and Ao 2008; Chen et al., 2006). Mizuno et al. 1999; Mizuno and Zhuang 2005) found that soluble or non-water-soluble

Hu et al.

polysaccharides isolated from the scleritis and mycelia of I. obliquus showed antihyperglycemic effects. This was confirmed by further studies that concluded that trametenolic acid in the water extract of I. obliquus has an effect on non-insulin-dependent diabetes mellitus. Most patients with diabetes have hypercholesterolemia and hyperglycemia and a higher risk of heart disease and dyslipidaemia. Diabetes is primarily characterized by fasting hyperglycemia and can lead to severe health problems (Tamrakar et al., 2008). While many drugs to prevent and treat diabetes are in trials, none are highly effective. Oral hypoglycemia agents can reduce blood sugar levels, but they have long-term toxic effects (Mitra et al., 1996). Many new agents and methods have been used to treat diabetes. In recent years, mushroom polysaccharides have received attention and shown to have antitumor effects (Borchers et al., 1999; Leung et al., 1997). Previous studies found that I. obliquus, a kind of mushroom has therapeutic effects but the active ingredients have not been clearly elucidated.I. obliquus polysaccharides that might defend against cancers and obesity are needed; however, little research is available on the isolation and purification of I. obliquus polysaccharides and their hypoglycemic activity. In this article, a preparation method was established for purification of room-temperature and high-temperature extracts of crude polysaccharides (HPIO-R and HPIO-H) from I. obliquus fruiting bodies by DEAE cellulose-52 column chromatography. The hypoglycemic activity of different fractions was studied in mice, providing a theoretical and experimental basis for the application of I. obiquus extracts in treatment and further research. MATERIALS AND METHODS Plant material I. obliquus harvested at Changbai Mountain, Jilin, China, were crushed and sieved by 40 mesh and stored in the laboratory.

7739

Experimental procedures Preparation of I. obliquus total crude polysaccharide extracts The powdered fruiting bodies of I. obliquus were extracted with water at 30 times volume at 90°C for 3 h, and centrifuged at 4000 rpm for 20 min. The precipitated fraction was dried at 50°C and total polysaccharide determined. This was used to compare the antihyperglycemic effects to fractionated polysaccharide.

Preparation of crude polysaccharide from I. obliquus fruiting bodies Polysaccharides at room temperature: For HPIO-R, I. obliquus powdered fruiting bodies were extracted with water at room temperature at 30 times volume for 48 h and centrifuged at 4000 rpm for 20 min. The aqueous phase was evaporated, reduced to an appropriate volume and mixed with absolute ethyl alcohol (1:4, v/v). The precipitated fraction was dried at 50°C and total polysaccharide was determined. Polysaccharide at high temperature: For HPIO-H, after polysaccharide extraction at room temperature, the powder was washed three times with water at room temperature, then extracted with water at 90°C at 30 times volume for 3 h and centrifuged at 4000 rpm for 20 min. The aqueous phase was evaporated, reduced to an appropriate volume and mixed with absolute ethyl alcohol (1:4, v/v). The precipitated fraction was dried at 50°C and total polysaccharide was determined.

Isolation and purification of polysaccharide HPIO-R and HPIO-H were dissolved in distilled water. And then they were loaded into an anion-exchange DEAE cellulose DEAE-52 column (2.6×25 cm), after that they were eluted stepwise with H 2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl at 120 ml/h to give rise to three fractions. Polysaccharide was determined at 495 nm by using phenol-sulfuric acid method (Li et al., 1997). Fractions were collected, concentrated, and centrifuged. Precipitated polysaccharides were dialyzed for 24 h in distilled water, and then they were obtained for the subsequent studies.

Measuring in vivo antihyperglycemic effects of polysaccharide fractions

Reagents

Establishment of the diabetes mice model

Metformin hydrochloride tablets were from Beijing Pharmaceutical Co., Ltd. (China; 0.25 g × 50 pieces/box). DEAE cellulose-52 column chromatography reagents were from Pharmacia Inc. (USA). Streptozotocin (STZ) was from Sigma-Aldrich Inc. (USA). All other chemicals were analytical grade. Assay kits for glucose oxidase, triglyceride (TG) and enzymatic determination of total cholesterol (TC) were purchased separately from Beijing Strong Biotechnologies, Inc. Beijing Kang Tai clinical reagent Co., Ltd. and BioSino Bio-technology and Science Inc.

ICR mice were acclimatized under controlled conditions for 1 week before experiments. Mice were given intraperitoneal injections of freshly prepared STZ (35 mg/kg in 0.01 mol/L citrate buffer) 4 times per day for 3 days while normal control groups were injected with buffer only. On the sixth day, only water was offered to the animals for 6 h, then blood was collected from the tail vein, and glucose level measured.

Antihyperglycemic effects analysis Animals Male ICR mice (20 ± 2 g) were from the Chinese Academy of Military Sciences Experimental Animal Center, license number SCXK (Army) 2002-001. All animal handling procedures were in strict accordance with the PR China legislation on the use and care of laboratory animals, with guidelines established by the Experimental Animal Center of Peking University.

Mice with blood glucose levels above 12 mmol/L were deemed to be hyperglycemic and randomly divided into 10 groups with 12 animals in each group. Both the normal and diabetic control groups were fed a basal diet and sodium chloride solution. Model animals were fed with crude total polysaccharide (100 or 300 mg/kg body weight), HPIO-R elution fractions, or HPIO-H elution fractions (4.5 mg/kg body weight, in H2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl). The positive control group was given metformin hydrochloride tablets

Afr. J. Biotechnol.

ofofpolysaccharide(mg/ml) concentration polysaccharide (mg/ml) Concentration

7740

0.18 0.16 0.14 0.12 0.10 0.08 0.06 0.04 0.02 0.00 -0.02

H2O Nacl 0.2mol/L Nacl 0.5mol/L

0

15

30

45

60

75

90 105 120

Tube number tube number

Figure 1. Elution profile of HPIO-R with the anion-exchange chromatography of DEAE-cellulose DEAE-52. Tubes (40 ml) of each fraction were assayed for polysaccharide at 495 nm by phenol-sulfuric acid method (Li et al., 1997).

(125 mg/kg body weight) for 21 days.During the experiments, fasting blood glucose levels and body weight were measured at weekly intervals for 21 days. Mice were sacrificed by cervical dislocation after the last administration, and then the blood was centrifuged to separate serum for measuring TG and TC levels. All of the fasting blood glucose, total cholesterol (TC) and triglyceride (TG) levels were measured following the instructions of commercial kits.

Statistical analysis In the experiment, all the data was expressed as means Âą standard deviation (Mean Âą SD) and the statistical software statistical package for social sciences 17.0 (SPSS 17.0) was used for performing the statistical methods. Values of P < 0.05 used were considered to be significant.

RESULTS HPIO was extracted from I. obliquus and isolated by DEAE cellulose-52 column chromatography. HPIO-R was isolated by DEAE cellulose-52 column chromatography Figure 1 shows the results of HPIO-R eluted with H2O, 0.2 mol/L NaCl and 0.5 mol/L NaCl. As shown in Figure 1, polysaccharide was isolated in several fractions, in which

water elution gave three peaks, with peak-I having a high polysaccharide content, and the others with a low content. NaCl (0.2 mol/L) isolated a complete and single fraction that might be a single compound. Multiple fractions were isolated by NaCl 0.5 mol/L; peak-II had the highest polysaccharide concentrations. However, the polysaccharide concentrations of all the peaks were little. And the eluted fractions for HPIO-R-H2O-peak-I NaClpeak-I, HPIO-R-0.2 mol/L NaCl and HPIO-R-0.5 mol/L NaCl-peak-II were collected and refrigerated respectively. HPIO-H isolated chromatography

by DEAE

cellulose-52

column

Figure 2 shows the results of HPIO-H isolation. As shown in Figure 2, polysaccharide was isolated in several fractions with many peaks and complex compounds with water solution, in which Peak-I had a high polysaccharide content. NaCl 0.2 mol/L isolated a complete single fraction that might be a single compound. Three fractions with small peaks were isolated with NaCl 0.5 mol/L. The main HPIO-H-H2O-peak-I and HPIOH-0.2 mol/L NaCl-peaks were collected and refrigerated respectively. Our results show that fractions could be purified by DEAE-52 anion-exchange chromatography, and fractions

(mg/ml) Concentration polysaccharide(mg/ml) concentration of polysaccharide

Hu et al.

7741

H2O NaCl 0.2mol/L NaCl 0.5mol/L

0.06

0.04

0.02

0.00

0

15 30 45 60 75 90 105 120 135 150 Tube tubenumber number

Figure 2. Elution profile of HPIO-H with the anion-exchange chromatography of DEAE-cellulose DEAE-52 Tubes (50 ml) of each fraction were assayed for polysaccharide at 495 nm by phenolsulfuric acid method (Li et al., 1997).

Table 1. Effect of I. obliquus crude total polysaccharide and fractions on fasting blood glucose levels of STZ-induced diabetic mice.

Group Normal control Diabetic control Metformin A B C D E F H1 H2

Number

Dose (mg/kg b.w.)

12 12 12 12 12 12 12 12 12 12 12

0 0 125 4.5 4.5 4.5 4.5 4.5 4.5 100 300

0 day 7.74±5.3 19.02±7.05* 19.95±6.23* 19.35±8.28* 18.7±7.26* 18.25±6.87* 18.24±7.49* 18.53±7.21* 18.26±7.76* 19.37±6.97* 19.39±6.58*

Blood glucose (mmol/L) 7 day 14 day 8.72±1.24 9.96±1.8 22.81±2.02 34.25±1.94 18.24±3.95** 25.92±5.98** 20.76±4.33 26.54±7.44 20.97±8.15 25.92±9.38 20.83±5.73 30.58±6.28 21.79±5.02 28.04±7.32 18.59±7.69 28.25±10.78 22.64±7.23 30.42±5.5 24.31±3.82 32.69±4.73 16.56±5.53** 23.57±5.85**

21 day 9.70±1.70 19.50±1.86 16.62±3.2** 17.92±3.70 17.82±3.64 17.73±4.04 18.35±3.02 14.9±5.26** 18.53±2.46 17.76±2.41 18.60±2.53

Mean ± S.D; b.w., body weight. *P < 0.05 vs. normal control group. **P < 0.05 vs. diabetic control group. A, B, C (HPIO-R elution fractions: H2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl); D, E, F (HPIO-H elution fractions: H 2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl); H1, H2 (Crude total polysaccharide).

might include a single compound isolated by 0.2 mol/L NaCl. Hypoglycemic activity of crude total polysaccharide and fractions Effect of I. obliquus crude total polysaccharide and fractions from fasting blood glucose in STZ-induced diabetic mice The antihyperglycemic effect of I. obliquus crude total polysaccharide and fractions on fasting blood glucose

levels of STZ-induced diabetic mice are shown in Table 1. Mice in the diabetic modeling groups initially had significantly (P < 0.05) increased blood glucose levels compared to the normal control group, and Table 1 showed the establishment of diabetes mice model was succeeded. Compared to diabetic control mice, the blood glucose level of the H2 diabetic groups significantly decreased (P < 0.05) after 7 and 14 days. However, a rebound occurred after 21 days, while the blood glucose level of the E diabetic groups was significantly decreased (P < 0.05) after 21 days. Moreover, the blood glucose levels of the other diabetic groups were not significantly

7742

Afr. J. Biotechnol.

Table 2. Effect of I. obliquus crude total polysaccharide and fractions on lipid profile of STZ-induced diabetic mice.

Number

Dose (mg/kg b.w.)

TC (mmol L−1)

TG (mmol L−1)

Normal control

12

0

4.2±0.74

1.74±0.62

Diabetic control

12

0

4.05±0.8

4.11±3.24

Metformin

12

125

4.48±0.76

3.53±2.65

A

12

4.5

3.83±0.57

3.04±1.31

B

12

4.5

4.18±1.94

1.82±0.91**

C

12

4.5

4.86±0.66

3.01±0.99

D

12

4.5

4.21±0.71

3.09±0.9

E

12

4.5

4.15±0.81

2.1±0.98

F

12

4.5

4.69±1.1

2.61±0.99

H1

12

100

4.73±1.14

3.05±1.01

H2

12

300

5.58±1.33

3.16±1.56

Group

Mean ±S.D; b.w., body weight; TC, total cholesterol; TG, triglyceride. *P < 0.05 vs. normal control group. **P < 0.05 vs. diabetic control group. A, B, C (HPIO-R elution fractions: H2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl); D, E, F (HPIO-H elution fractions: H2O, 0.2 mol/L NaCl, 0.5 mol/LNaCl); H1, H2 (crude total polysaccharide).

Table 3. Effect of I. obliquus crude total polysaccharide and fractions on STZ-induced diabetic mice weight.

Group Normal control Diabetic control Metformin A B C D E F H1 H2

Number

Dose (mg/kg b.w.)

12 12 12 12 12 12 12 12 12 12 12

0 0 125 4.5 4.5 4.5 4.5 4.5 4.5 100 300

0 day 24.89±1.35 23.41±1.78 24.41±1.63 24.36±2.27 24.14±1.61 24.38±1.99 24.50±2.39 23.95±1.69 24.96±1.66 24.46±1.35 23.76±2.23

b.w./g 7 day 14 day 30.05±2.87 32.23±2.83 25.15±1.73 27.51±1.92 26.75±2.01 28.39±2.15 26.74±2.56 27.69±2.54 24.34±2.62 25.24±2.84 26.02±2.88 26.47±2.90 27.58±2.34 28.29±2.38 25.59±3.29 26.97±2.75 26.64±2.26 28.33±2.28 26.41±2.32 26.33±2.13 23.96±3.43 24.16±3.35

21 day 34.84±2.87 29.22±2.55 30.25±2.74 27.90±2.35 29.82±2.64 28.73±2.02 28.41±2.61 28.31±2.92 28.41±2.61 26.10±1.35 26.77±3.58

Mean ±S.D; b.w., body weight. *P < 0.05 vs. normal control group. **P < 0.05 vs. diabetic control group. A, B, C (HPIO-R elution fractions: 0 mol/L, 0.2 mol/L, 0.5 mol/l NaCl); D, E, F (HPIO-H elution fractions: 0 mol/L, 0.2 mol/L, 0.5 mol/L NaCl); H1, H2 (crude total polysaccharide).

decreased (P > 0.05) compared to diabetic control mice, except for the STZ+metformin group. Effect of I. obliquus crude total polysaccharide and fractions on lipid profile of STZ-induced diabetic mice TC and TG levels in serum were determined. Compared to diabetic control mice, the TG level of the STZ+ metformin group was not significantly decreased, while the TG level of the diabetic groups E and B decreased. The B diabetic groups significantly decreased (P < 0.05) the TG level compared with the diabetic control groups (Table 2). The results show that I. obliquus extracts had antihyperglycemic effects and regulated lipid metabolism.

Effect of I. obliquus crude total polysaccharide and fractions on body weight of STZ-induced diabetic mice As shown in Table 3, no obvious differences in body weight were seen between the different groups. The body weight of the diabetic groups was not significantly different than the diabetic control mice. Table 3 shows that I. obliquus extract had no side effects on the physiological condition of the mice. DISCUSSION In this study, the effects of DEAE-52 fractions of I.

Hu et al. obliquus in normal, diabetic normal and STZ-induced diabetic mice were evaluated. Traditionally, a small piece of I. obliquus (1 to 2 g) or one tablespoon of crushed extract in hot water was taken (Park et al., 2005). In this study, we showed that oral administration of 4.5 mg/kg HPIO isolated by NaCl 0.2 mol/L had a significant hypoglycemic or hypolipidemic effects in vivo. The body weight of the groups revealed no obvious differences. This meant that HPIO had no side effects on the physiological condition of the mice. This amount of HPIO 0.2 mol/L NaCl elution might be reasonable compared to the dose recommended in traditional medicinal use. In conclusion, our results found that DEAE-52 fractions of I. obliquus had significant antihyperglycemic effects in STZ-induced mice, as well as anti-TG effects, especially the fraction with a single peak isolated by NaCl 0.2 mol/L. Thus, I. obliquus extracts might have important prophylactic benefits to humans through their potential diabetes-preventing effects. However, more efforts are needed to characterize and evaluate the extract. ACKNOWLEDGEMENTS The authors thank the Chinese Academy of Military Sciences Experimental Animal Center for providing the experimental animals. This work was supported by the Lab of Fermentation Engineering, Institute of Food Science and Nutritional Engineering, China Agricultural University, Beijing, China and the Experimental Animal Center of Peking University, Beijing, China. REFERENCES Bjorntorp P, Holm G, Rosmond R (1999). Hypothalamic arousal, insulin resistance and type 2 diabetes mellitus. Diabetic Med. 16: 373-383. Borchers AT, Stern JS, Hackman RM, Keen CL, Gershwin ME (1999). Mushrooms, Tumors, and Immunity. P. Soc. Exp. Biol. Med. 221(4): 281-293. Cheng YQ, Zhou LJ, Li Y (2006). The comparative analysis of antihyperglycemic effect of submerge cultured mycelia, sclerotium and wild Fruit bodies of Inonotus obliquus. Edible Fungi, 3: 52-54. Huang NL (2002). Civilian medicinal fungi in Russia. Edible Fungi of China 21(4): 7-8.

7743

Kang SI, Jin Y, Ko HC, Choi SY, Hwang JH, Whang I, Kim MH, Shin HS, Jeong HB, Kim SJ(2008). Petalonia improves glucose homeostasis in streptozotocin-induced diabetic mice. Biochem. Bioph. Res. CO. 373: 265-269. Leung YM, Fung KP, Choy YM (1997). The isolation and characterization of an immunomodulatory and anti-tumor polysaccharide preparation from Flammulina velutipes. Immunopharmacol. 35: 255-263. Li XH, Li SP, He YQ, Li RZ, Cui SM (1997). On the determination of polysaccharides in Lingzhi (Ganoderma lucidum). Chin. Tradit. Herbal Drugs, 28(3): 530-531. Mao XL (2000). The Macrofungi in China. Henan Science and Technology Press, Zhengzhou, Henan, China. Mitra SK, Gopumadhavan S, Muralidhar TS, Anturlikar SD, Sujatha MB (1996). Effect of a herbomineral preparation D-400 in streptozotocininduced diabetic Rats. J. Ethnopharmacol. 54: 41-46. Mizuno T, Zhuang C, Abe K, Okamoto H, Kiho T, Ukai S, Leclerc S, Meijer L (1999). Antitumor and hypoglycaemic activities of polysaccharides from the scleritia and mycelia of Inonotus obliquus. Int. J. Med. Mushrooms 1(4): 301-316. Mizuno T, Zhuang C (2005). Antitumor and hypoglycemic activities of polysaccharides from the scleritia and mycelia of Inonotus obliquus. J. Ethnopharmacol. 101(3): 120-121. Park YM, Won JH, Kim YH, Choi JW, Park HJ, Lee KT (2005). In vivo and in vitro anti-inflammatory and anti-nociceptive effects of the methanol extract of Inonotus obliquus. J. Ethnopharmacol. 101: 120128. Sun JN, Ao ZH (2008). Antihyperglycemic and antilipidperoxidative effects of dry matter of culture broth of Inonotus obliquus in submerged culture on normal and alloxan-diabetes mice. J. Ethnopharmacol. 118: 7-13. Tamrakar AK, Yadav PP, Tiwari P, Maurya P, Srivastava AK (2008). Identification of pongamol and karanjin as lead compounds with antihyperglycemic activity from Pongamia pinnata fruits. J. Ethnopharmacol. 118: 435-439. Zhang XH, Sun DZ, Chen HY, Cui JC, Liu SS (2008). The protective effects of Inonotus obliquus on tissue injury in diabetic mice. Edible Fungi of China 27(2): 31-33.

African Journal of Biotechnology Vol. 11(30), pp. 7744-7750, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3511 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Morphological and chemical characteristics of tomato foliage as mechanisms of resistance to Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) larvae Muahmmad Ashfaq1,2*, Muhammad Sajjad1, Muhammad Noor ul Ane 1 and Noureen Rana3 1

Department of Agricultural Entomology, University of Agriculture, Faisalabad, Punjab, Pakistan. 2 Faculty of Agriculture, University of Agriculture, Faisalabad, Pakistan. 3 Department of Zoology and Fisheries, University of Agriculture, Faisalabad, Punjab, Pakistan. Accepted 1 February, 2012

Morphological characters and chemical composition of tomato (Lycopersicon esculentum Miller) leaves were measured and compared among nine tomato varieties (Roma VFN, NARC-1, Fs-8802, Tommy, Pant Babr, Rio Grande, Nova Mecb, Pakit and Sahil) exhibiting varying levels of host plant resistance to Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) as based on fruit infestation. The variety, Sahil, was resistant, whereas Roma VFN was the susceptible variety. Hair length and hair density on lower leaf surface, as well as thickness of leaf lamina significantly correlated with larval population and fruit infestation. Leaf hair density accounted for 92.0% of the variation in fruit infestation and 77.0% of the variation in larval population. Ferrous (Fe2+) and phosphorous content in the leaves were negatively correlated with fruit infestation and larval population; whereas, nitrogen, calcium, magnesium, manganese and zinc content were positively correlated with fruit infestation and larval population. The resistant variety, Sahil, produced the maximum yield as compared to susceptible variety, Roma VFN. Key words: Helicoverpa armigera, tomato fruit borer, host plant resistance, Lycopersicon esculentum. INTRODUCTION Tomato (Lycopersicon esculentum Miller) is an important solanaceous crop grown throughout the world, including Pakistan where total production was 468,146 MT on 46,200 ha in 2005 to 2006 (Agricultural Statistics of Pakistan, 2007). Yield of Pakistan-grown tomatoes is limited by arthropod pests including Helicoverpa sp., Spodoptera sp., and tomato russet mites [Aculops lycopersici (Massee)] (Hartz et al., 2008). Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) feeds primarily on the tomato fruit causing reported yield losses as high as 35% in Pakistan (Ahmad and Mohsin, 1969; Latif et al., 1997) and 38% in neighboring India (Selvanarayanan and Narayanasamy, 2006). Insecticides use to manage H. armigera poses health, safety, environmental and economic concerns. Host plant resistance

*Corresponding author. E-mail: drashfaqti@yahoo.com. Tel: +92-41-9200161-170. Fax: +92-41-9201083.

has proven to be a valuable tool for crop protection (Kennedy, 1984) and may provide a viable pest management tactic for managing H. armigera in Pakistan-grown tomatoes (Jallow et al., 1998), with reducing deleterious effects of uncontrolled use of pesticides. Cultivation of Helicoverpa-resistant tomato cultivars is limited due to a lack of data on potential genetic sources and plant mechanisms (antixenosis) of resistance. Laterinstar H. armigera larvae feed on developing tomato fruit, while neonates and early instars usually start feeding on tender leaves before moving to the fruit (Liu et al., 2004; Perkins et al., 2009) and are often impacted by leaf characteristics (Sheloni et al., 2010, Simmons et al., 2004). Role of physio-chemical factors is important to identify a source of resistance in plants against pests (Dhilllon et al., 2005). Based upon preliminary screening data (Sajjad and Ashfaq, unpublished data), Roma VFN, NARC-1, and Fs-8802 were found susceptible, Nova Mecb, Pakit and Sahil were resistant, and Tommy, Pant Babr, and Rio Grande exhibited intermediate levels of

Ashfaq et al.

resistance based on the fruit-infestation data. Therefore, the study reported herein was undertaken to: (1) determine the relative resistance of these nine commerciallyavailable tomato varieties to H. armigera, (2) correlate morphological and chemical characteristics of leaves with the observed resistance to H. armigera, and (3) compare marketable yield of resistant and susceptible varieties. MATERIALS AND METHODS

7745

leaves. The Kjeldahl method was used to determine % nitrogen in the leaves. Individual 0.5 g samples were removed from the dried and ground leaf tissue for digestion, distillation and titration. Magnesium and phosphorous content was determined using calorimetric methods, calcium and potassium content was determined using photometric analyses, while copper, manganese and zinc content were measured using spectrophotometric analyses. Percentage lipid content was determined using a soxhlet extractor. Carbohydrate content and fiber content were estimated using formulas based upon residuals remaining after measurement of other major components of the leaves.

Varietal infestation screening Based upon preliminary screening data (Sajjad and Ashfaq, unpublished data), nine varieties of tomato were planted in field trials to screen for possible H. armigera resistance. These were; Roma VFN, NARC-1, Fs-8802, Tommy, Pant Babr, Rio Grande, Nova Mecb, Pakit and Sahil (Ali Akbar Group, Pakistan). Nurserygrown seedlings of these varieties were transplanted on the 17th of March 2008 and 15th of March 2009, in a randomized complete block design with four replications per variety. Individual plots were 6.11 × 12.23 m with a row width of 102 cm and a distance of 26 cm between adjacent plants within a row. Standard cultivation practices were used throughout the study, and no plant protection measures were used. Plants were monitored weekly starting one week after transplanting. At each observation, the number of H. armigera larvae per plant from five randomly-selected plants in each plot was recorded. Once tomato fruit appeared on the plants, the numbers of damaged and undamaged fruits were recorded weekly from five randomlyselected plants in each plot to calculate percent of fruit infestation.

Leaf morphological factors Three leaves (top, middle and lower portions of the plant) from each of three randomly-selected plants per plot were excised and transported to the laboratory. Six areas on the upper surface of each leaf and six areas on the lower surface of each leaf were microscopically examined. The density of leaf hairs and length of the hairs was measured at each location. In addition, a crosssection of the leaf lamina was cut using a razor blade to measure the thickness of the lamina at six locations on each leaf. All measurements were made with a Carl Zeiss™ binocular microscope equipped with an ocular micrometer. Non glandular trichomes were recorded in the present study.

Leaf chemical factors To determine selected chemical content of the leaves, leaf samples weighing 500 g each were removed from the top and bottom portions of randomly-selected plants in each plot. These samples were transferred to the laboratory, washed with distilled water, air dried under shade for 3 h, and oven-dried at 70 ± 5°C for 12 h. The oven-dried material was cut, then ground and passed through a 1mm sieve. These ground samples were stored in dry polythene bags. Furthermore, for each of these samples, 2 g of dried and ground leaf tissue was placed in a boron-free, silica-fused crucible and then placed in a muffle furnace at 600°C for 5 h. The combusted material was weighed and returned to the furnace for an additional 5 h. This was repeated until the material was completely combusted yielding a grayish-white ash with a constant weight. The percentage of total minerals in the leaf tissue was determined by comparison of weight of combusted ash to weight of the dried

Statistical analyses Larval population and fruit damage as response to tomato varieties were subjected to analysis of variance using MSTAT statistical software. Where applicable, treatment means were separated by Tukey’s honestly significant difference (HSD) tests for paired comparisons (P = 0.05). SPSS software was used for data analysis (one-way ANOVA) of morphological and chemical leaf characters (O’Connor, 2000). Larval population and fruit damage data were also correlated with the various morphological and chemical leaf factors using correlation analysis and stepwise multiple regression analysis.

RESULTS AND DISCUSSION Varietal infestation screening There were significant differences (F = 45.7, 61.2; df = 8; P < 0.05) among the nine tomato varieties with respect to H. armigera larval population per 10 plants and % tomato fruit damaged by H. armigera larvae (Table 1). Both characteristics were similarly expressed across the nine varieties. Varieties ‘Sahil’, ‘Pakit’ and Nova Mecb, seem to be more resistant to H. armigera than other varieties. Less than one-half of the larvae were found on the most susceptible varieties ‘Roma VFN’ and NARC-1 followed by FS-8802, while less than one-third of the fruit damage incurred on Roma VFN, NARC-1 and FS-8802. This result is in accordance with the Khanam et al. (2003) and Mishra et al. (1988). Numerous studies have also shown variation among the varieties for their susceptible/ resistant response towards the pest infestation (Sarfraz et al., 2007; Ashfaq et al., 2010). Influence of physical leaf characteristics on larval population and fruit infestation Significant variations were recorded for some physiomorphic leaf characteristics among tomato varieties (Table 2). Hair density and hair length on lower surface, and thickness of leaf lamina ranged from 49.8 to 23.7 per ½ cm2, 32.5 to 19.4 micron, and 6.1 to 4.9 micron, respectively. These values were higher for ‘Sahil’, ‘Pakit’, and Nova Mecb than others varieties. However, there were no differences between tomato varieties in hair density and hair length on upper leaf surface.

7746

Afr. J. Biotechnol.

Table 1. Comparison of average means of the data for 2008 and 2009 regarding larval population per 10 plants and the fruit-infestation (%), caused by the fruit-borer in various varieties of tomato.

Variety Roma VFN NARC-1 FS-8802 Tommy Pant Bahr Rio Grande Nova Mecb Pakit Sahil

Fruit infestation (%) 36.0a ab 32.0 29.3b 22.7c 20.3c 19.1c d 11.7 10.8d 10.7d

No. of larvae per 10 plant 5.7a a 5.7 5.6a 3.5b 3.5b 3.5b c 1.4 1.3c 1.3c

Means sharing same letter are not significantly different (P = 0.05).

Table 2. A comparison of means for the data on physio-morphic characteristics of the leaves between selected varieties of tomato. 2

Variety Roma VFN NARC-1 FS-8802 Mommy Pant Babr Rio Grande Nova Mecb Pakit Sahil

Hair density (no. per ½ cm ) Upper leaf Lower leaf 22.6ns 23.7h 23.2 25.8g 23.7 27.4f 24.0 33.9e 24.1 36.3d 24.1 37.2d 24.4 43.7c 24.4 47.0b 24.5 49.8a

Length of hair (µM) Upper leaf Lower leaf 12.9ns 19.4f 12.8 21.9e 12.7 23.7d 12.7 25.3c 12.7 26.0c 12.6 27.8b 12.6 31.7a 12.3 32.1a 12.1 32.5a

Thickness of Leaf Lamina (µM) 4.9c 4.9c 4.9c 5.3b 5.3b 5.5b 5.9a 6.0a 6.1a

Ns, Non-significant; means sharing similar letter are not significantly different (P = 0.05).

Table 3. The correlation coefficient (r) for different physical leaf characteristics, on the larval population of fruit borer and fruits infestation in tomato.

correlation coefficient (r) Larval population HDus HDls HLup HLls Tlf

Fruit Infestation 0.89** -0.22ns -0.96** ns 0.42 -0.95** -0.91**

Larval population -0.31ns -0.88** ns 0.33 -0.86** -0.87**

**, Significant at P≤0.01; *, significant at P≤0.05; ns, non-significant. HDus, Hair density on upper surface; HLup, hair length on upper surface; HDls, hair density on lower surface; HLls, hair length on lower surface; Tlf, thickness of leaf lamina.

Furthermore, the correlation coefficient values between physical leaf characteristics and fruit infestation and larval population are presented in Table 3. The hair density and

length of hair on the lower surface showed a significant negative correlation with the fruit-infestation and larval population, showing r-value of -0.96**, -0.88**; -0.95**

Ashfaq et al.

7747

Table 4. Stepwise regression model showing effect of different physical leaf character on larval population and fruit infestation.

R2

Regression equation Larval population Y = 10.6 - 0.19X1

0.77

Percentage fruit infestation Y = 57.2 - 0.99X1

0.92

X1, Hair density.

Table 5. A comparison of means for the data on chemical characteristics of the leaves of various selected varieties of tomato.

Chemical trait Total Minerals (%) Nitrogen (%) Phosphorous (%) Potassium (%) Calcium (%) Magnesium (%) Ferrous (%) Manganese (%) Zinc (%) Fat (%) Crude Fiber (%) Carbohydrate (%)

Roma VFN 7.40h a 2.73 0.36d 2.73e 0.33a 0.29ns 0.14c 0.39a 0.13ns d 2.60 16.27b 48.76c

NARC-1 FS-8802 7.47h 7.70g b bc 2.66 2.61 d 0.36 0.36d 2.79d 2.79d ab 0.22 0.22ab 0.28 0.28 0.15c 0.15c 0.38ab 0.37bc 0.13 0.12 c c 2.62 2.62 ab 16.45 16.50ab c 48.64 49.37b

Tomato Variety Tom-my Pant Babr Rio Grande Nova Mecb Pakit 7.98f 8.26e 8.32d 8.34c 8.53b cd cd cde cde de 2.59 2.58 2.57 2.55 2.54 cd cd bc bc 0.37 0.37 0.38 0.38 0.40b 2.80cd 2.82bcd 2.83abc 2.84ab 2.84ab abc abc bc c 0.21 0.21 0.21 0.20 0.20c 0.28 0.28 0.27 0.27 0.27 0.16bc 0.16bc 0.17ab 0.18a 0.18a 0.36cd 0.35de 0.35de 0.35de 0.33ef 0.12 0.12 0.12 0.12 0.11 b b ab ab a 2.64 2.64 2.65 2.66 2.67 ab ab a a 16.60 16.64 16.67 16.71 16.74a ab ab ab ab 49.55 49.58 49.58 49.64 49.68a

Sahil 8.62a e 2.52 0.43a 2.86a 0.18d 0.27 0.18a 0.33f 0.11 a 2.67 16.76a 49.71a

Ns, Non-significant; means sharing similar letter are not significantly different (P = 0.05).

and -0.86** respectively. These findings are in lined with the findings of Juvik et al. (1982), Selvanarayanan and Narayanasamy (2006) and Peter (1995). This may be due to the reason that exudates of trichomes interfere in larval feeding (Dimoch et al., 1983; Kennedy and Sorenson, 1985) and reduced larval weight (Sunitha et al., 2008). Thickness of leaf lamina is negatively correlated with fruit infestation (r = 0.91**) and larval population (r = -0.87**). Similar findings were also reported by Coley (1983) and Morrow (1983). According to Larsson and Ohmart (1988), tough leaves prohibit feeding of early larval instars and reduce their development (Clissold et al., 2006). Moreover, stepwise regression analysis indicated that hair density on lower surface explained 92.0 and 77.0% variation in fruit infestation and larval population respectively (Table 4). These can be used as marker trait to develop resistant varieties against tomato fruit worm. Influence of chemical traits on larval population and fruit infestation Nitrogen, calcium and manganese ranged from 2.52 to

2.73%, 0.18 to 0.33% and 0.33 to 0.39%, respectively, with values significantly lower in resistant varieties and higher in susceptible varieties. Contrarily, phosphorous and ferrous ranged from 0.43 to 0.36% and 0.18 to 0.14%, respectively and were higher in resistant varieties than in susceptible varieties (Table 5). According to Table 6, fruit infestation and larval population were positively correlated with nitrogen (r = 0.74**, 0.65**), calcium (r = 0.59**, 0.59**), magnesium (r = 0.44*, 0.49**), manganese (r = 0.75**, 0.72**) and zinc content (r = 0.57**, 0.49**). In contrast, phosphorous and ferrous was negatively correlated with fruit infestation (r = -0.43**, 0.81** respectively) and larval population (r = -0.46**, 0.73** respectively). Stepwise regression analysis indicated that ferrous and calcium explained 74.0 and 65.0% variation in fruit infestation and larval population, respectively (Table 7). Therefore, these can be selected as marker traits to develop resistant varieties against H. armigera in tomato crop. There are no available data on relation between H. armigera and chemical leaf characteristics investigated in this study; therefore, it is discussed with reference to other systems. Our study showed that high concentration of nitrogen, manganese and calcium increases fruit

7748

Afr. J. Biotechnol.

Table 6. Effect of chemical plant characteristics (%) on the larval population and infestation (%) of fruit borer on tomato crop.

Chemical factor Total Minerals Nitrogen Phosphorus Potassium Calcium Magnesium Ferrous Manganese Zinc Fat Crude fiber Carbohydrate

Larval population -0.07ns 0.65** -0.46* ns -0.31 0.59** 0.49** -0.73** 0.72** 0.49** ns -0.22 ns 0.03 ns -0.30

Fruit infestation (%) -0.11ns 0.74** -0.43 * ns -0.20 0.59** 0.44 * -0.81** 0.75** 0.57** ns -0.07 -0.00ns ns -0.36

**, Significant at P≤0.01; *, significant at P≤0.05; ns, non-significant.

Table 7. Stepwise regression model showing effect of different chemical leaf characteristics on larval population and fruit infestation.

R2

Regression equation Larval population Y = 4.4 - 72.8X1 + 52.0X2

0.65

Percentage Fruit Infestation Y = 38.6 - 392.1X1 + 219.9X2

0.74

2+

X1, Ferrous (Fe ); X2, calcium.

infestation and larval population density. This is similar to findings of Grafton-Cardwell and Ouyang (1996) who stated that high concentration of nitrogen and manganese increases the reproduction of predaceous mite, and Khaliq et al. (2001) who reports the similar kind of relationship between calcium and Chilo partellus (Swinhoe) infestation. Moreover, the decrease of concentration of zinc (Phelan et al., 1995) and magnesium (McKinnon et al., 1999) decreases the pest’s oviposition. This supports the findings of our present study that fruit infestation and larval population can be decreased with the decrease in concentration of zinc and magnesium. Marketable fruit-yield of tomato An analysis of variance revealed a significant difference in the yield among the varieties at P>-0.01 (Figure 1). The variety, Sahil, which showed a resistant trend against the fruit-borer, showed a maximum fruit-yield of 99.56 kg/plot. The variety, Roma VFN, showing a susceptible trend, against the fruit-borer, had a minimum yield of 39.50 kg/plot. Generally, varieties Sahil, Pakit and Nova

Mecb provide higher fruit yield than others. These results are similar to findings of Heinrichs (1994) who reports that resistant varieties show high yield response. Effect of the larval population and infestation of the fruit borer on the yield of tomato Table 8 shows the results regarding the effect of larval population and infestation on the yield of tomato. The larval-population and fruits infestation exerted a significant and negative effect on the fruit-yield, with r-values of -0.81** and -0.86**, respectively, and this was in line with findings of Phillips et al. (1979). Our results clearly suggest that resistant varieties’, having less fruit infestation than susceptible varieties, is due to physical and chemical leaf characteristics. Conclusion The presented study indicates that morphological characteristics such as leaf hair density, and chemical traits

Ashfaq et al.

7749

Yield (kg/plot) 120

a

Yield (kg/plot)

100

a

a

80

60

c

c

bc

b

bc

bc

40

20

0 Roma VFN

NARC-1

FS-8802

Mommy

Pant Babr

Rio Grande Nova Mecb

Pakit

Sahil

Genotypes Figure 1. Marketable fruit-yield of different tomato varieties.

Table 8. Effect of the larval population and fruit infestation on the yield of tomato.

Independent factor Larval population Fruit infestation (%)

Yield (kg/plot) r = -0.81 ** r = -0.86 **

**, Significant at P ≤ 0.01.

like iron and calcium concentration, can be used as maker traits to develop insect resistant varieties of tomato through breeding programs. Further research is needed to study the physical and chemical characteristics of tomato fruit in relation to H. armigera and its natural enemies, so that combination of host plant resistance and biological control can be used to attain maximum yield. Acknowledgement We are grateful to the Chairman, Dr. Muhammad Inayat Khan, Department of Mathematics & Statistics for guiding the statistical analysis of this study. REFERENCES Ahmad F, Mohsin MD (1969). Control of cotton boll worm. Heliothis armigera_ (Hb.) by air in Multan District of West Pakistan. International Pest Control Nov. /Dec. Anonymous (2007). Agriculture statistics of Pakistan 2005-06. Government of Pakistan, Ministry of Food, Agriculture and Livestock. Food, Agri. and Livestock Div. (Economic Wing) Islamabad. pp. 84-

85. Ashfaq M, Noor ul Ane M, Zia K, Nasreen A, Mansoor-ul-Hasan (2010). The correlation of abiotic factors and physio-morphic characteristics of (Bacillus thuringiensis) BT transgenic cotton with whitefly, Bemisia tabaci (Homoptera: Aleyrodidae) and jassid, Amrasca devastans (Homoptera: Jassidae) populations. Afr. J. Agric. Res. 5: 3102-3107. Clissold F, Sanson GD, Read J (2006). The paradoxical effects of nutrient ratios and supply rates on an outbreaking insect herbivore, the Australian plague locust. J. Anim. Ecol. 75: 1000-1013. Coley PD (1983). Herbivory and defensive characteristics of tree species in a lowland tropical forest. Ecol. Monog. 53: 209-233. Dhillon MK, Singh R, Naresh JS, Sharma NK (2005). The influence of physico-chemical traits of bitter gourd, Momordica charantia L. on larval density and resistance to melon fruit fly, Bactrocera cucurbitae (Coquillett). J. Appl. Entomol. 129: 393-399. Dimoch MB, Kennedy GG (1983). The role of glandular trichomes in the resistance of Lycopersicum hirsutum f. glabratum to Heliothis zea. Entomol. Exp. Appl. 33: 263-268. Grafton-Cardwell E, Ouyang Y (1996). Influence of citrus leaf nutrition on survivorship, sex ratio, and reproduction of Euseius tularensis (Acari: Phytoseidae). Environ. Entomol. 25: 1020-1025. Hartz T, Miyao G, Mickler J, Lestrange M, Stoddard S, Nunez J (2008). Processing tomato production in California. University of California Repository, ANR Publication [Cited 10 Sept 2009.] Available from URL: http:// ucanr.org/freepubs/docs/7228.pdf. 7228: p. 5. Heinrichs EA (1994). Development of Multiple Pest Resistant Crop Cultivarsl. J. Agric. Entomol. 11(3): 225-253 Jallow MFA (1998). Host-plant selection and use by Helicoverpa

7750

Afr. J. Biotechnol.

armigera (Hübner) (Lepidoptera: Noctuidae): Individual variation within and among populations. Aust. J. Ecol. 23: 187-188. Jallow MFA, Cunningham JP, Zalucki MP (2004). Intra-specific variation for host plant use in Helicoverpa armigera (Hubner) (Lepidoptera: Noctuidae): implications for management. Crop Prot. 23: 955-964. Juvik JA, Berlinger MJ, Ben David T, Rudich J, David T (1982). Resistance among accessions of the genera Lycopersicon and Solanum to four of the main pests of tomato in Israel. Phytoparasitica, 10: 145-146. Kennedy GG (1984). 2-Tridecanone, tomatoes and Heliothis zea. Potential incompatibility of plant antibiosis with insecticidal control. Entomol. Exp. Appl. 35: 305-311. Kennedy GG, Sorenson CF (1985). Role of glandular trichomes in the resistance of Lycopersicon hirsutum f. glabratum to Colorado potato beetle (Coleoptera: Chrysomelidae). J. Econ. Entomol. 8: 547-551. Khaliq A, Ashfaq M, Akram, W, CHOI JK, Jong-Jin L (2001). Effect of Plant Factors, Sugar Contents, and Control Methods on the Top Borer (Scirpophaga nivella F.) Infestation in Selected Varieties of Sugarcane. Entomol. Res. 5: 153-160. Khanam UKS, Hossain M, Ahmad N, Uddin MM, Hussain MS (2003). Varietal screening of Tomato to Tomato Fruit Borer, Helicoverpa armigera (Hub.) and Associated Tomato Plant Characters. Pak. J. Biol. Sci. 6(4): 413-412. Larsson S, Ohmart CP (1988). Leaf age and larval performance of the leaf beetle Paropsis atomaria. Environ. Entomol. 13: 19-24. Latif M, Ahecr GM, Saeed M (1997). Quantitative losses in tomato fruits by Heliothis armigera Hb. Abstr. PM-9. Third Intern Congr Entomol Sci., by Pakistan Entomol. Society held during March 18-20, 1997 at NARC, Islamabad. Liu Z, Li D, Gong P, Wu K (2004). Life table studies of the cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae), on different host plants. Environ. Entomol. 33: 1570-1576. Shelomi M, Perkins LE, Cribb BW, Zalucki MP (2010). Effects of leaf surfaces on first-instar Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) behaviouraen_7. Aust J. Entomol. 49: 289-295. McKinnon ML, Quiring DT, Bauce E (1999). Influence of tree growth rate, shoot size and foliar chemistry on the abundance and performance of a galling adelgid. Funct. Ecol. 13: 859-867. Mishra PN, Singh YV, Nautiyal MC (1988). Screening of brinjal varieties for resistance to shoot and fruit borer, Leucinodes orbonalis Guen. (Lepidoptera: Pyralidae). South Ind. Hort. 36: 182-88. Morrow PA (1983). The role of sclerophyllous leaves in determining insect grazing damage. In Kruger FJ, Mitchell DT, Jarvis JUM [eds.], Mediterranean-type ecosystems-the role of nutrients. SpringerVerlag, Berlin, Germany, pp. 509-524.

O’Connor BP (2000). SPSS and SAS programs for determining the number of components using parallel analysis and Velicer’s MAP test, Behavior Res. Methods Instrum. Comput. 32: 396-402. Perkins LE, Cribb BW, Hanan J, Glaze E, Beveridge C, Zalucki MP (2009). Where to from here? The mechanisms enabling the movement of first instar caterpillars on whole plants using Helicoverpa armigera (Hübner). Arthropod-Plant Interactions, 2: 197207. Peter JA (1995). Pigeonpea trichomes a promising source for pod borer resistance. IPM and IRM News Letter for Legume Crops in Asia. 2: 45. Phelan PL, Mason JF, Stinner RF (1995). Soil-fertility management and host preference by European corn borer, Ostrinia nubilalis. Agric. Ecosyst. Environ. 56: 1-8. Phillips JR, Clower DF, Hopkins AR, Pfrimmer TR (1979). Economic thresholds of Heliothis species on indeterminate cottons, In Economic thresholds and sampling of Heliothis Species on cotton, corn, soybeans and other host crops. South. Coop. Ser. Bull. 231: 44-49. Sarfraz M, Dosdall LM, Keddie BA (2007). Resistance of some cultivated Brassicaceae to infestations by Plutella xylostella (Lepidoptera: Plutellidae). J. Econ. Entomol. 100: 215-224. Selvanarayanan V, Narayanasamy P (2006). Factors of resistance in tomato accessions against the fruit worm, Helicoverpa armigera (Hubner). Crop Prot. 25: 1075-1079. Simmons AT, Gurr GM, McGrath D, Martin PM, Nicol HI (2004). Entrapment of Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) on glandular trichomes of Lycopersicon species. Aust. J. Entomol. 43: 196-200. Sunitha V, Rao1 GVR, Lakshmi KV, Saxena KB, Rao VR, Reddy YVR (2008). Morphological and biochemical factors associated with resistance to Maruca vitrata (Lepidoptera: Pyralidae) in short-duration pigeonpea. Int. J. Trop. Insect Sci. 28: 45-52.

African Journal of Biotechnology Vol. 11(30), pp. 7751-7755, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.002 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Bacterial content in the intestine of frozen common carp Cyprinus carpio Ahmed H. Al-Harbi* and Md. Naim Uddin Natural Resources and Environment Research Institute, King Abdulaziz City for Science and Technology, Riyadh, Saudi Arabia. Accepted 23 February, 2012

The quantitative and qualitative analyses of bacterial flora associated with the intestine of common carp Cyprinus carpio in fresh and frozen storage conditions for 16 months was determined. Aerobic plate counts (APC) ranged from 1.8 ± 2.7 × 109 to 1.1 ± 2.9 x 104 colony forming unit (CFU) g-1, 2.0 ± 2.1 x 1010 to 6.1 ± 1.4 x 104 CFU g-1, and 1.3 ± 3.2 x 1010 to 4.3 ± 3.3 x 104 CFU g-1 each of 3 storage tank, respectively from the intestine of common carp in fresh and frozen storage. The APC decreased c. 3log cycles after 1 month storage and then counts declined more slowly during frozen storage over 16 months. In total, 14 bacterial genera with 18 species were identified. Gram-negative rods bacteria (77%) dominated the population. Aeromonas hydrophila, Aeromonas sp., Bacillus sp., Enterobacter sp., Micrococcus sp., Photobacterium damselae, Serratia liquefaciens, Shewanella putrefaciens, Staphylococcus sp., Streptococcus sp. and Vibrio sp. survived after prolonged freezing. Two bacterial species viz. Shewanella putrefaciens and Aeromonas hydrophila were dominant with a prevalence of > 10% both in fresh and frozen fish. S. putrefaciens was the dominant bacteria (19% of the total isolates) throughout the period of study. Key words: Bacterial enumeration, species composition, intestine, frozen common carp. INTRODUCTION Dense microbial populations occur within the intestinal content, with numbers of bacteria much higher than those in the surrounding water, indicating that the intestines provide favorable ecological niches for these organisms (Austin and Austin, 1999). For high quality fresh fish, the number of bacteria present on the surface varies from 3 to 4 log10 CFU g-1. Counts are normally one or two orders of magnitude higher in the gills and intestinal counts can reach 9 log10 CFU g-1 (Sikorski, 1990). Microbiological quality of fresh and frozen fish can be assessed using several criteria (Kramer and Liston, 1987). Some seafood processors specify a 2-class plan for the acceptance of frozen fish, where APC should not be higher than 5 log10 -1 CFU g (Elliot, 1987). For fish, ICMSF (1986) proposed microbiological lower

*Corresponding author. E-mail: aalharbi@kacst.edu.sa. Tel: +966 1 4813605. Fax: +966-1-481 3638.

(m) and maximum (M) limits of aerobic plate counts at 30°C as 5x105 (5.69 log) and 107 (7 log) CFU g-1 or cm-2 respectively. Aeromonas hydrophila, Shewanella putrefaciens, Vibrio spp., Corynebacterium urealyticum, Staphylococcus sp. and Streptococcus sp. were the major bacteria in the intestine of common carp (Al-Harbi and Uddin, 2008). Cahill (1990) reported the presence of A. hydrophila, Flavobacterium sp., Pseudomonas sp. and Vibrio sp. in common carp. Contamination of edible portions of fish may originate from gastrointestinal sources. The shelf-life of raw fish depends on the storage conditions, the intrinsic factors, and the qualitative and quantitative composition of the initial microflora, related to the environment where the fish live and are caught, the season, the fishing method and the early conditions of handling (Ward, 1988). Freezing is one method of preserving fish for long periods and frozen fish have become an important commodity both for domestic and export markets in a number of countries. The duration of bacterial viability in frozen fish tissues or the length of

7752

Afr. J. Biotechnol.

time tissues can remain frozen and still yield viable bacteria; upon partial thawing is an area warranting further study. In local markets, storage of frozen common carp without evisceration is most common. The quality of fish can be measured by bacterial numbers in fish organs, as these affect the storage life and fish product quality. Despite the number of surveys on the microbiology of fish, there have been few studies on frozen fish. Limited information on microbiological conditions of fish during frozen storage in Saudi Arabia led to this research. Scientific knowledge on quality changes in fish during freezing and subsequent frozen storage will provide a basis for supplying good quality fish. The objective of this research study was to evaluate quantitative and qualitative bacteriological results from the analysis of the intestine of both fresh and frozen common carp. MATERIALS AND METHODS Fish Four hundred and fifty of common carp Cyprinus carpio weighing between 700 to 1100 g were collected from three 10 m2 (3.8 x 2.64 x 1.2 m) outdoor aerated concrete tanks (150 fish from each tank). The tanks water level was 1 m, and about 20% of the tanks water was exchanged daily with fresh water (ground water) to maintain good water quality. The fish for all the three tanks were fed daily with a tilapia pelleted feed (34% crude protein) at the rate of 3% of body weight. The water temperature was 30°C.

whole intestines to standardize the sampling. Around 2 g of homogenate was suspended to a bottle containing 25 ml of sterile (121°C, 15 min) 0.85% (w/v) NaCl prepared in de-ionized water. One milliter (1 ml) of the suspension was serially diluted to 10-9. Volumes (0.1 ml) of the dilutions were spread onto tryptone soya agar plates (TSA, Oxoid, UK) in duplicate.

Total viable count (TVC) Total aerobic heterotrophic bacterial counts of common carp intestine were determined by incubation of all the inoculated plates at 25°C for 48 h and colony forming units (CFU) were counted with a Quebec Darkfield Colony Counter (Leica, Inc., Buffalo, New York) equipped with a guide plate ruled in square centimeters. The plates having ≥ 30 to 300 colonies were used to calculate bacterial population numbers, expressed as CFU.

Isolation of bacteria Bacterial isolates were recovered from the intestine of fresh and frozen common carp. To determine the percent composition of bacteria types in the samples, we divided the bacterial colonies into different groups according to colony characteristics (shape, size, elevation, structure, surface, age, color, and opacity), and counted the number of colonies of each recognizable type. With some exceptions, 3 to 5 representatives of each colony type were then streaked on TSA plate repeatedly until pure cultures were obtained. Around 2% of primary isolates failed to grow despite repeated attempts on subsequent sub-culturing. Purified cultures were inoculated onto TSA slants and kept at 4°C for stock; these were sub-cultured on slants every 6 weeks.

Identification of bacteria Bacteriological sampling and analyses Three samplings, one in each tank were done simultaneously to harvest the fish by hand net for microbial investigations of common carp intestine for fresh and frozen conditions. Immediately after catch, 16 sample bags of each of the 3 tanks, a total of 48 bags and each containing 9 representatives (size, condition, sex etc.) fish were preserved in a freezer at -20 ± 1°C for frozen sampling from May, 2005 to August, 2006. Samples were tested monthly for quantitative bacterial analyses and every four months for qualitative analyses. One bag of frozen fish was randomly taken from each unit and microbial quality determined.

To identify the selected bacterial isolates to genus or species level, the purified isolates were observed for cell shape, motility, flagellation, spores, encapsulation, and Gram staining. The isolates were then subjected to biochemical tests (oxidase, catalase, amylase, gelatinase, lipase, indole, H2S production and nitrate reduction) following the criteria described in the Bergey’s Manual of Determinative Bacteriology (Holt et al., 1994). The presumptive vibrio species were confirmed by their growth in different concentrations of NaCl, thiosulphate-citrate-bile sucrose (TCBS) agar (Oxoid) and by their sensitivity to the vibriostatic agent (0/129) (Oxoid). In parallel, the commercial API 20E, API 20 STREP, (bioMerieux, France) and Biolog (biolog, Hayward, CA, USA) methods were also used.

Common carp intestine Microbial examination of fresh fish was done initially at the beginning of the storage period (fresh) and at 4, 8, 12, and 16 months following storage at -20 ± 1°C. From each of the 3 tanks, 15 representative fish (three replicates, three x five sample times in each tank) were used. They were killed by physical destruction of the brain. At each sample time, 9 fish collected from each of 3 tanks (three fish in each replication) were used for bacteriological tests. Frozen fish were thawed at room temperature (c. 1 to 2 h) until it was soft enough to take out the intestine. The number of incidental organisms was reduced by washing the fish skin with 70% ethanol before opening the ventral surface with sterile scissors to expose the body cavity. Around 5 g of intestine from sampled fish was taken aseptically, mixed, and homogenized in a mortar. Intestines were taken from three (interior, mid and posterior) parts of the

RESULTS Quantitative bacterial flora Quantitative results of APC in common carp intestine at fresh and different storage conditions for 16 months are summarized in Table 1. APC decreased from 1.8 ± 2.7 x 109 to 1.1 ± 2.9 x 104 CFU g-1, 2.0 ± 2.1 x 1010 to 6.1 ± 4 -1 10 4 1.4 x 10 CFU g , and 1.3 ± 3.2 x 10 to 4.3 ± 3.3 x 10 -1 CFU g in the intestine of common carp collected from tank 1, tank 2, and tank 3 respectively during the period of study. For all groups of fish, APC decreased c. 3-log

Al-Harbi and Uddin

7753

Table 1. Counts of bacteria in the intestine of Cyprinus carpio in fresh and frozen storage conditions for 16 months.

Month frozen (CFU g-1) 7th 8th 9th 10th

Tank number

Fresh intestine CFU g-1

1

1.8x10 (2.7)

5.2x10 (3.4)

1.3x10 (2.8)

5.8x10 (3.8)

8.3x10 (1.4)

3.2x10 (2.4)

1.9x10 (3.6)

2.2x10 (4.0)

3.4x10 (3.1)

2.0x10 (1.7)

5.5x10 (3.1)

1.9x10 (2.2)

8.0x10 (2.9)

1.8x10 (2.5)

3.2x10 (3.7)

5.3x10 (3.1)

1.1x10 (2.9)

2

2.0x1010 (2.1)

1.0x107 (2.1)

4.8x106 (2.7)

2.1x106 (2.6)

2.7x106 (3.4)

1.0x106 (2.2)

4.2x106 (1.9)

1.4x106 (2.5)

8.9x105 (2.0)

1.5x105 (1.0)

6.1x104 (1.4)

1.1x105 (2.3)

1.2x105 (0.9)

7.9x104 (1.7)

8.1x104 (3.5)

6.4x104 (2.8)

2.3x105 (4.1)

3

1.3x1010 (3.2)

1.3x107 (2.9)

6.2x106 (3.3)

3.1x106 (3.0)

1.3x106 (2.0)

1.4x106 (2.8)

7.5x105 (2.7)

6.8x105 (1.6)

1.1x106 (1.8)

6.6x105 (2.3)

3.7x105 (3.5)

7.2x105 (3.8)

4.3x104 (3.3)

3.6x105 (2.4)

8.9x104 (4.2)

1.1x105 (3.9)

6.7x104 (2.5)

9

1st

3rd

2nd 6

6

4th 5

5th 5

6th 5

5

5

5

5

11th 4

12th 5

13th 4

14th 4

15th 4

16th 4

4

Parentheses indicate SD.

cycles after 1 month frozen storage; thereafter, counts slowly declined during frozen storage. Each count was the mean value of viable colonies that appeared in duplicate agar plates for each sample. Analysis of variance of the regressions showed no statistically signifi-cant difference between the tanks in the slopes with a common regression co-efficient of -0.129, but there was a significant difference in intercepts. The data for tanks 2 and 3 were not significantly different from each other with a mean value of 6.83, but that for tank 1 at 6.27 was significantly different from the other two. But the reasons were not clear. Qualitative bacterial flora Bacterial isolates recovered from the intestine of fresh and frozen common carp were identified to

genus or species level. Their percentage distribution (Table 2) is given as the mean bacterial flora of 3 tanks because in all the tanks and data obtained from each was very similar. Table 2 reports the isolation frequency of the recognized bacterial groups at fresh and different storage times. There were wide variations in the types of bacteria taken at different sampling times. Bacteria identified in this study were predominantly Gramnegative rods (77%). In total, 14 bacterial genera and 18 species were identified from the intestine of common carp. For fresh and frozen conditions, two bacterial species viz. S. putrefaciens, and A. hydrophila were the dominant bacteria with a prevalence of > 10% at all time. S. putrefaciens was the most dominant organisms (19% of the total isolates). Out of 18 species of bacteria 11 survived 16 months frozen storage. Pseudomonas fluorescens, Vibrio alginolyticus, and Vibrio

vulnificus were not recovered after 12 months frozen storage while after 16 months, Cellulomonus sp., Corynebacterium urealyticum, Escherichia coli, and Pseudomonas sp. were not found. DISCUSSION In this trial, bacterial load in common carp intestine varied in fresh and frozen conditions. The APC for all the groups of fish decreased c. 3log cycles after 1 month frozen storage and c. 5logs after 16 months. Al-Harbi and Uddin (2005) observed that the APC decreased c. 2-log cycles in frozen tilapia after 1 month storage and c. 3logs after 1 year. According to Suvanich et al. 7 5 -1 (2000), APC decreased from c. 10 to 10 CFU g after 2 months frozen storage of channel catfish

7754

Afr. J. Biotechnol.

Table 2. Composition and percentage distribution of bacteria in the intestine of Cyprinus carpio in fresh and frozen storage conditions at 4 month intervals for 16 months.

Bacteria Aeromonas hydrophila Aeromonas sp. Bacillus sp. Cellulomonus sp. Corynebacterium urealyticum Enterobacter sp. Escherichia coli Micrococcus sp. Photobacterium damselae Pseudomonas fluorescens Pseudomonas sp. Serratia liquefaciens Shewanella putrefaciens Staphylococcus sp. Streptococcus sp. Vibrio alginolyticus Vibrio sp. Vibrio vulnificus Unidentified Gram-negative rods

Fresh intestine Number % 38 18.18 12 5.74 4 1.91 0 0 7 3.35 8 3.83 9 4.31 6 2.87 4 1.91 3 1.44 10 4.79 4 1.91 39 18.66 5 2.39 9 4.31 12 5.74 17 8.13 15 7.18 7 3.35

frame mince and then remained nearly unchanged. The initial killing rate of microorganism during freezing is rapid then followed by a gradual reduction (Frazier and Westhoff 1990). This research appears closer to our work due to similar observation in the decrease of viable microorganisms with the frozen storage period of common carp. Throughout the period studied in this trial, Gram-negative rods in particular two bacterial species viz. S. putrefaciens, and A. hydrophila dominated the bacterial flora with a prevalence of > 10% as shown in Table 2. In

4 month frozen Number % 17 11.26 9 5.96 6 3.97 2 1.33 8 5.30 10 6.62 5 3.31 7 4.64 5 3.31 4 2.65 6 3.97 7 4.64 20 13.25 8 5.30 11 7.29 4 2.65 9 5.96 5 3.31 8 5.30

8 month frozen Number % 14 10.45 8 5.97 2 1.49 4 2.99 5 3.73 11 8.21 4 2.99 6 4.48 7 5.22 2 1.49 6 4.48 3 2.24 24 17.91 6 4.48 5 3.73 4 2.99 9 6.72 4 2.99 10 7.46

another study, S. putrefaciens, Coryne. urealyticum, A. hydrophila, and Flavobacterium sp. were the dominant bacteria with a prevalence of c. 10% in tilapia frozen for 1 year (Al-Harbi and Uddin, 2005). Streptococcus agalactiae was recovered from frozen tilapia after 6 months storage (Evans et al., 2004). Recovery and revival of different types of bacteria from frozen common carp after prolonged freezing in the present study supports the idea that frozen fish is a viable alternative to fresh fish for microbiological sampling in instances when fresh, healthy or moribund fish are unavailable or impractical

12 month frozen Number % 17 10.18 9 5.39 4 2.40 5 2.99 10 5.99 13 7.78 14 8.38 4 2.40 9 5.39 0 0 4 2.40 2 1.20 41 24.55 12 7.19 10 5.99 0 0 7 4.19 0 0 6 3.59

16 month frozen Number % 13 10.66 7 5.74 3 2.46 0 0 0 0 14 11.48 0 0 4 3.28 3 2.46 0 0 0 0 8 6.56 23 18.85 8 6.56 16 13.11 0 0 12 9.84 0 0 11 9.02

(Evans et al., 2004). Brady and Vinitnantharat (1990) found viable pathogenic Gram negative bacteria could be recovered from channel catfish Ictalurus punctatus frozen at -20°C for over 20 days. The high prevalence of S. putrefaciens, Aeromonas spp., Vibrio spp., Enterobacter sp., Streptococcus sp., and Staphylococcus sp. in this study suggests that these bacteria may be common in the intestine of carp. S. putrefaciens is considered as one of the main spoilage bacteria in fish (Gennary et al., 1999). Jørgensen and Huss (1989) characterized S. putrefaciens cultures in order to examine the spoilage activity and found a

Al-Harbi and Uddin

good correlation between bacterial counts, detection time in conductance measurements and production of trimethylamine and off-odour. López-Caballero et al. (2001) also reported a correlation between the highest microbial counts (>9 log cfu/ml) of S. putrefaciens and TMA concentrations (45 mg N- TMA/100 ml), and strong putrid off-odours. S. putrefaciens and Pseudomonas spp. are the specific spoilage bacteria of iced fresh fish regardless of the origin of the fish (Gram and Huss, 1996). P. fluorescens is an important odour producer and the most frequently isolated proteolytic species (Edwards et al., 1987). Although, S. putrefaciens counts alone are not a sufficient predictor of shelf-life, they can be used as a quality determinant of fish. Although the numbers of food-borne outbreaks caused by Aeromonas spp. are low (Altwegg et al., 1991; Krovacek et al., 1992), the presence of Aeromonas spp. in the food chain should not be ignored. A. hydrophila have been recovered in other studies on frozen fish (Figueras et al., 2000, CastroEscarpulli et al., 2003) and the significance of the bacteria isolated varies. The bacteria isolated included S. putrefaciens, A. hydrophila, Enterobacter sp., Streptococcus sp., Staphylococcus sp., E. coli, V. vulnificus, and P. fluorescens which are facultative pathogens or agents of food poisoning and spoilage. Shannon (1986) reported the presence of pathogenic Bacillus cereus, E. coli, Staphylococcus aureus and V. cholerae in catfish. The vibrios can cause different types of disease and are transmitted through foods and through cross-contamination during handling and processing of foods. Al-Harbi (2003) reported significant coliform bacteria including E. coli in fish ponds. Note that in the present study, E. coli could not be recovered after 16 months frozen storage. This research helps understand the quality of fish during frozen storage. During processing and handling of fish products, the presence of pathogenic bacteria is of concern to fish processors. ACKNOWLEDGMENT The authors are grateful to King Abdulaziz City for Science and Technology (KACST), KSA for research support. REFERENCES Al-Harbi AH (2003). Faecal coliforms in pond water, sediments and hybrid tilapia (Oreochromis niloticus x O. aureus) in Saudi Arabia. Aquacult. Res. (34): 517-524. Al-Harbi AH, Uddin MN (2005). Microbiological quality changes in the intestine of hybrid tilapia (Oreochromis niloticus x O. aureus) in fresh and frozen storage condition. Lett. Appl. Microbiol. (40): 486-490. Al-Harbi AH, Uddin MN (2008). Aerobic bacterial flora of common carp (Cyprinus carpio L) cultured in earthen ponds in Saudi Arabia. J. Appl. Aquacult. (20): 108-119.

7755

Altwegg M, Martinetti Lucchini G, Luthi-Hottenstein J, Rohrbach M (1991). Aeromonas associated gastroenteritis after consumption of contaminated shrimp. Eur. J. Clin. Microbiol. Infect. Dis. (10): 44-45. Austin B, Austin DA (1999). Bacterial fish pathogens: Disease of farmed and wild fish. 3rd edn. Springer –praxis, London, p. 457 Brady YL, Vinitnantharat S (1990). Viability of bacterial pathogens in frozen fish. J. Aquat. Anim. Health, (2): 149-150. Cahill MM (1990). Bacterial flora of fishes: a review. Microb. Ecol. (19): 21-41. Castro-Escarpulli G, Figueras MJ, Aguilera-Arreola G, Solar L, Fernandez-Rendon E, Aparicio GO, Guarro G, Chacon MR (2003). Characterization of Aeromonas spp. isolated from frozen fish intended for human consumption in Mexico. Int. J. Food Microbiol. (84): 41-49. Edwards RA, Dainty RH, Hibbard CM (1987). Volatile compounds produced by meat pseudomonads and related reference strains during growth on beef stored in air at chilled temperature. J. Appl. Bacteriol. (62): 403-412. Elliot EL (1987). Microbiological quality of Alaska pollack surumi. In Seafood quality determination ed. Kramar DE. and Liston, New York: Elsevier Science Publishing, J. pp. 269-281. Evans JJ, Wiedenmayer AA, Klesius PH, Shoemaker CA (2004). Survival of Streptococcus agalactiae from frozen fish following natural and experimental infections. Aquaculture, (233): 15-21. Figueras MJ, Soler L, Chacon MR, Guarro J, Martinez-Murcia AJ (2000). Extended method for discrimination of Aeromonas spp. By 16S rDNA-RFLP analysis. Int. J. Syst. Evol. Microbiol. (50): 20692073. rd Frazier WC, Westhoff DC (1990). Food Microbiology (3 ed. Tata McGraw Hill Publishing Co. Ltd. New Delhi.) p. 247. Gennary M, Tomaselli S, Cotrona V (1999). The microflora of fresh and spoiled sardines (Sardina pilchardus) caught in Adriatic (Mediterranean) Sea and stored in ice. Food Microbiol. (16): 15-28. Gram L, Huss HH (1996). Microbiological spoilage of fish and fish products. Int. J. Food Microbiol. (33): 121-137. Holt JG, Krieg NR, Sneath PHA, Williams ST (ed.) (1994). Bergey's th manual of determinative bacteriology, 9 edn. Williams and Wilkins, Baltimore. International Commission on Microbiological Specifications for Foods (ICMSF). (1986). Microorganisms in foods, 2: sampling for nd microbiological analysis: principles and specific applications, 2 ed. Black-well Scientific Publications, London. Jørgensen BR, Huss HH (1989). Growth and activity of Shewanella putrefaciens isolated from spoiling fish. Int. J. Food Microbiol. (9): 51-62. Kramer DE, Liston J (1987). Seafood quality determination. New York: Elsevier Science Publishing, p.677. Krovacek K, Faris A, Baloda SB, Peterz M, Lindberg T, Mansson I (1992). Prevalence and characterization of Aeromonas spp. isolated from foods in Uppsala, Sweden. Food Microbiol. (9): 29-36. López-Caballero ME, Sánchez-Fernández JA, Moral A (2001). Growth and metabolic activity of Shewanella putrefaciens maintained under different CO2 and O2 concentrations. Int. J. Food Microbiol. (3): 277287. Shannon CW (1986). Pathogenic microorganisms: a menace to the th food industry. In proceedings of the 15 annual catfish processing workshop Mississippi, USA, Mississippi State University. p. 13. Sikorski ZE (1990). Seafood: Resources, nutritional composition and preservation. Boca Raton, Fla.: CRC press Inc. p. 248 Suvanich V, Marshall DL, Jahncke ML (2000). Microbiological and color quality changes of channel catfish frame mince during chilled and frozen storage. J. Food Sci. (65): 151-154. Ward DR, Baj NJ (1988). Factors affecting microbiological quality of seafood. Food Technol. (3): 85-89.

African Journal of Biotechnology Vol. 11(30), pp. 7756-7765, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3273 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Generation and characterization of a stable red fluorescent transgenic Tanichthys albonubes line Qing Jian, Min Chen, Jun-jie Bai*, Peng Jiang, Jia-jia Fan, Xing Ye and Shi-ling Xia Key Laboratory of Tropical and Subtropical Fishery Resource Application and Cultivation, Ministry of Agriculture, Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, Guangdong 510380, China. Accepted 16 March, 2012

White cloud mountain minnow (Tanichthys albonubes) is a small cyprinid oviparous fresh-water fish in Southern China. For ornamental purpose, the red fluorescent protein (RFP) transgenic T. albonubes was generated by microinjection of a pMYLZ2-RFP gene construct containing zebrafish myosin light polypeptide 2 (mylz2) promoter into the fertilized eggs, and a transgenic line was established. For this line, segregation of RFP gene followed Mendelian single-gene inheritance, confirming transgene integration into the T. albonubes genome at a single locus. Results of reverse transcriptase-polymerase chain reaction (RT-PCR) analyses showed that RFP transgene was expressed in almost all body tissues, revealing an ectopic transgene expression. Based on ordinary and quantitative PCR analyses, integration pattern of RFP gene was determined to be three copies and head-to-tail multimers. An approximately 1.0 kb fragment amplified from 5'-flanking sequence of transgenes was identified in wildtype T. albonubes genome, and bears no homologous sequence in the GenBank database. In the 3'flanking region, an approximately 1.2 kb fragment with unidentified source was amplified which has 99% homology to enterobacteria phage P1. The above results well demonstrated the pMYLZ2-RFP constructs have being inserted as a stable DNA fragment in the T. albonubes genome and could be stably inherited and expressed in transgenic progenies. Key words: Transgenic fish, Tanichthys albonubes, RFP, expression, flanking sequence, copy number. INTRODUCTION Fluorescent proteins originally isolated from marine invertebrates are widely used as noninvasive probes for cell and molecular biology (Matz et al., 1999; Stewart, 2006). In recent years, researchers opened up their novel application for ornamental fish by transgenic technology, such as the fluorescent transgenic zebrafish (Danio rerio) and Japanese medaka (Oryzias latipes) (Gong et al., 2003; Kinoshita, 2004). This novel application benefits from the expression of fluorescent proteins in a wide range of cell types without apparent toxic effects and the vivid fluorescent colors that are readily visible to unaided eyes (Liu et al., 1999; Shaner et al., 2004).Tanichthys albonubes, “white cloud mountain minnow”, is a small cyprinid oviparous fresh-water fish in Southern China

*Corresponding author. E-mail: baijj2005@21cn.com. Tel: +86 20 81616129. Fax: +86 20 81616162.

(Liang et al., 2008), which have been cultured around the world as a popular aquarium fish (Yi et al., 2004). To develop new varieties of ornamental fish, our laboratory generated the red fluorescent protein (RFP) transgenic T. albonubes by microinjecting fertilized eggs with RFP gene under the control of zebrafish myosin light polypeptide 2 (mylz2) promoter. Germ-line transmitted transgenic T. albonubes was obtained, which displays a visible red fluorescent color instead of the original body color of wild-type fish. To date, microinjection is still the most common method used for gene transfer in fish (Zbikowska, 2003). However, this classical transgenic approach is linked to the random and uncontrolled integration of transgenes into the host genome (Sin, 1997). The integration behavior would inevitably disrupt the neighboring sequences and may be accompanied by some mutations (Tzfira et al., 2004; Wilson et al., 2006). In addition, the introduced foreign DNA can be modified in many ways

Jian et al.

7757

Figure 1. Plasmid map of pMYLZ2-RFP for generating the red fluorescent transgenic T. albonubes.

before, during, and even after the integration process (Würtele et al., 2003). As a result, transgenic organisms often have unexpected and unstable traits. For example, transgenic expression may vary across different sites of transgenic integration, a phenomenon called “positional effects” (Lin et al., 1994; Iyengar et al., 1996). Therefore, in establishing a transgenic line, integration of transgenes into host genome and their stable transmission and expression in offspring are the most important issues (Kinoshita et al., 1996). Nevertheless, to our knowledge there is little published information on the detailed characterization of integration site and expression pattern in the fluorescent transgenic ornamental fish. In the present study, we describe the generation of a germline RFP transgenic T. albonubes and attempt to investigate its characterization in terms of transgene inheritance, expression and integration pattern. Both upstream and downstream flanking regions of the insertion site were also examined. These obtained data provide a basis for analyzing whether the inserted foreign genes can be stably inherited and expressed in transgenic progenies. MATERIALS AND METHODS Fish maintenance and transgene constructs T. albonubes, purchased from a local ornamental fish market (Guangzhou, China), were maintained in well-aerated glass aquaria

containing dechlorinated tap water under fluorescent lighting on a 12L: 12D cycle. Fish were fed flake food to satiation daily, supplemented with live brine shrimp nauplius (Artemia salina). Fertilized eggs of T. albonubes were collected from pair spawning in tanks and subjected to gene transfer. An approximate of 6.0 kb gene construct pMYLZ2-RFP used in this study (Figure 1) was made by insertion of a 1.9 kb zebrafish mylz2 promoter into the multiple cloning site of pDsRed2-1 vector (BD Biosciences Clontech, USA). The zebrafish mylz2 promoter was isolated by PCR (Jian et al., 2004) and digested with EcoRI and BamHI. For microinjection, the recombinant vector was linearized by BglII and then purified by PCR Clean-Up Kit (Roche, USA). Generation and screening of transgenic T. albonubes The linear pMYLZ2-RFP expression vector was diluted in ddH2 O to a final concentration of 100 ng/μl for microinjection. The detailed procedure was carried out as previously described (Jian et al., 2004). Injected eggs were incubated at 25-26°C in pure water under laboratory conditions. Living embryos were screened under a fluorescence microscope (with 2,072 filter combination) and all the selected RFP-positive embryos were raised to sexual maturity. Transgenic founders (F0) were mated individually with wild-type fish to produce the F1 generation. The F1 transgenic individuals with red body color were again crossed to wild-type fish to produce the F2 generation. F3 were produced by crossing two F2 red transgenic siblings. In the present study, we chose transgenic F 3 generation and its progenies (self- or test-cross) from a germline transgenic T. albonubes as research objects. To confirm the inheritance pattern of RFP gene in this line, the randomly chosen five F 3 individuals (3 female and 2 male) were crossed with wild-type mates. The frequencies of pMYLZ2-RFP transgene transmission to F4 progeny were examined under the fluorescence microscope. In addition, dot

7758

Afr. J. Biotechnol.

Table 1. Primers used in this study.

Primer name

Sequence (5'-3')

Purpose

Expected size (bp)

Red-F Red-R

CAGGACGGCTGCTTCATCTA GGTGTAGTCCTCGTTGTGGG

RT-PCR

288

β-actin-F β-actin-R

GCTTTGTCACTCCAGCACCG GGGCATCATCTCCAGCGAAT

RT-PCR

220

AP1 AP2

GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT

Adaptor primers

—

szq1 szq2

AAATAAAGGGTGTAAACTGTCACTGGG CATTGTTTTGCTTCTCTTGATTTTTCCC

Upstream junction cloning

—

xzzt2 xzzt2

CCACCACTTCAAGAACTCTGTAGCACC CGACCTACACCGAACTGAGATACCTAC

Downstream junction cloning

—

Dsredf Dsredr

TCAGATTCATCCCATTCCAAGAC GACCGAGAGAGAAAGAGGAAAAACT

Quantitative PCR

127

Upstrf Upstrr

CACACACCCACACATAAAGATTCAG CATCCGCTGCATAAAAAATACACT

Quantitative PCR

143

SZYS-SY SZYS-XY

CTGGGATACATTGAGCCT GTATCCGCCAGAGTTAG

Sequence detection

722

xzxl-sy xzxl-xy

CGCCTGGCACACTGGATACG CAGTTGGCAGAATCAGTATC

Sequence detection

911

blot method was employed to determine whether there exists silent integration in the non-transgenic offspring.

Detection of transgene expression by RT-PCR Total RNA was extracted from muscle, liver, gonad, spleen, gill, intestine, swim bladder and heart of adult F3 transgenic T. albonubes and non-transgenic siblings using Trizol Reagent (Invitrogen, USA). Reverse transcription was performed according to the protocol of PrimeScript TM 1st strand cDNA Synthesis Kit (TaKaRa, Japan). The synthesized cDNA (2 μl) from each tissue was used as template in a 20 μl PCR mixture. The PCR primers for RFP mRNA were Red-F and Red-R shown in Table 1. A region of the endogenous β-actin mRNA as an internal control was amplified using primers β-actin-F and β-actin-R (Table 1). PCR was performed with an initial denaturation of 3 min at 94°C and then 30 s of denaturation at 94°C, 30 s of annealing at 64°C (55°C for βactin amplified), and 1 min of extension at 72°C for 34 (RFP gene) or 30 cycles (β-actin gene), followed by a final extension of 7 min at 72°C. The reacted products were electrophoresed on a 1.5% agarose gel.

PCR analysis of transgene arrangement Single-primer xzzt2, szq1 and their combination (Table 1) were

used to amplify the pMYLZ2-RFP construct-to-construct junctions in F3 transgenic and non-transgenic fish, respectively. An amount of 20 μl PCR reaction contained 0.2 μl template DNA, 0.4 μl each of forward and reverse primers, 0.3 μl dNTP (10 μmol/l), 2.0 μl 10 × PCR buffer (Mg2+ 25 mmol/l), 1.0 U Taq polymerase. The reaction was denatured for 3 min at 94°C and then cycled 30 times at 94°C for 30 s, 55°C for 30 s and 72°C for 1 min, followed by a final extension of 7 min at 72°C.

Cloning of flanking regions of the transgene by genomic walking A total of 100 μl blood sample was collected from the heart ventricle of five F3 transgenic siblings with a capillary tubule. Genomic DNA was isolated from the whole blood sample using Blood and Cell Culture DNA Kit (QIAGEN, Germany). Briefly, EcoR V and Dra I genome walker libraries were constructed including digestion, purification of genomic DNA, and ligation of genomic DNA to GenomeWalker Adaptors. To obtain the 5' flanking region of the transgene insertion locus, primers szq1 and szq2 (Table 1) were designed according to the known pMYLZ2-RFP sequence. The first-round PCR was performed using EcoR V library as template with Adaptor primer AP1 and primer szq2 (Table 1). An amount of 50 μl PCR reaction contained 1 μl template DNA, 1 μl each primer (20 μmol/l), 8 μl dNTP (10 μmol/l), 5.0 μl 10 × PCR buffer (Mg 2+ 25 mmol/l), 0.5 μl LA Taq polymerase and 33.5 μl ddH2O. Amplification

Jian et al.

conditions for the primary PCR were 25 s at 94°C; 3 min at 72°C for 7 cycles, 25 s at 94°C, 3 min at 67°C for 32 cycles, and 7 min at 67°C for the final extension. The second-round PCR with Adaptor primer AP2 and primer szq1 was performed using a 1 in 50 dilution of the primary amplification as template. Secondary PCR had the same reaction composition and parameters as described above except amplification was allowed to proceed for 5 and 20 cycles. Also, the 3'-flanking region of the transgene was isolated employing the genome walking techniques as described above. The two rounds of PCR were performed using Dra I library as template with Adaptor primers AP1/AP2 and specific primers xzzt1/xzzt2 (Table 1). The resulting PCR products were electrophoresed on a 0.8% agarose gel and then purified using a gel extraction kit (Omega, USA). The purified PCR products were subcloned into the pMD18-T Vector and sequenced. Determination of transgene copy number by quantitative PCR (qPCR) Genomic DNA templates were isolated from fin samples of one F 5 and one F6 transgenic hemizygotes, respectively. For the transgene amplification, primers Dsredf and Dsredr (Table 1) were used to amplify a 127-bp fragment from RFP gene. Based on the obtained 5'-integration junction sequence, primers Upstrf (locating at the 5'flanking genomic sequence) and Upstrr (locating at the upstream transgene sequence) (Table 1) were designed to amplify a 143-bp single copy fragment as a reference. Both primer pairs were tested to ensure amplification of single discrete bands with no primerdimers. PCR products were subcloned into the pMD18-T vector for sequencing. The purified plasmids were quantified by spectrophotometry using an Eppendorf BioPhotometer (Germany) and copy numbers were calculated by the formula: plasmid DNA (copies /ml) = [Concentration of plasmid DNA (g/ml) ×6.02×1023 (copies/mol)]/ Molecular weight of plasmid DNA (g/mol); Molecular weight of plasmid DNA (g/mol) = Length (bp) × 660 (g/mol/bp), where 6.02×1023 is the Avogadro constant, 660 is the average molecular weight of one base-pair (double strand DNA). Serial dilutions were performed to give final concentrations ranging from 104 to 109 copies. Standard curves were generated for both target and internal control based on six 10-fold dilutions. Quantitative PCR analysis was performed using Platinum ® SYBR® Green qPCR SuperMix-UDG kit (Invitrogen, USA) and monitored on an ABI PRISM® 7300 Sequence Detection System (Applied Biosystems). The qPCR reactions were carried out in 96well plates using a 25-μl volume per well that included 12.5 μl SYBR PCR Master Mix, 0.5 μl ROX Reference Dye, 0.25 μl each primer (20 μmol/l), 0.4 μl of plasmid or genomic DNA template and 11.1 μl ddH2 O. The qPCR reactions were performed under the following conditions: 2 min at 50°C, 2 min at 95°C and 42 cycles of 15 s at 95°C, 30 s at 60°C and 30 s at 72°C. Each reaction was repeated four times to ensure the reproducibility of the results. To prevent all possible false-positive results, including primer-dimerinduced positive results, all qPCR procedures were followed by melting curve analysis. According to each standard curve, the CT values were converted to the initial copy number in the samples. Transgene copy number was calculated using the double standard curves method, following the formula: Transgene copy number = initial copies of target RFP gene / initial copies of internal reference sequence. Data were expressed as means ± standard deviation (S.D.).

RESULTS Generation of transgenic T. albonubes In the spring-summer of 2003, the linear pMYLZ2-RFP

7759

expression vector was microinjected into wild-type T. albonubes fertilized eggs at 1-2 cell stage. Out of a total of 719 eggs microinjected, 321 embryos (45%) survived after injected, 265 embryos hatched out normally and 83 fry had RFP expression under the fluorescence microscope (31% RFP-positive rate). At 25 to 26°C, the survival T. albonubes embryos hatched out by 36 h post-fertilization (hpf), and no fluorescence signal was detected under the fluorescence microscope. RFP expression was initially observed at around 48 hpf. Subsequently, RFP expression gradually expanded to developing somite and skeletal muscles (Figure 2A, B). After 7 days post-hatching (dph), red fluorescent color was visible to unaided eyes under normal daylight (Figure 2C). Up to 30 dph, RFP expression increased continuously, and transgenic founders displayed the patched RFP expression in body muscles (Figure 2D, E). Germline transmission constructs

of

pMYLZ2-RFP

gene

The randomly chosen five F3 individuals from the germline transgenic T. albonubes were used to analyze the genetic character of RFP gene. When three F3 female and two F3 male were crossed with wild-type fish, 100, 45.2, 51.5, 51.1 and 52% of their F4 transgenic progeny showed uniform RFP expression (Figure 2F), respectively. Segregation studies indicated that the transgene follows Mendelian single-gene inheritance in this line (Table 2). Furthermore, dot blot analysis showed that no hybridization signal was observed in all the RFPnegative offspring (data not shown). These results reveal that the pMYLZ2-RFP transgene DNA is integrated into the T. albonubes genome and exists at a single locus. Expression levels of RFP in different tissues To examine the characteristic of transgene expression in different tissues of adult F3 transgenic individuals, the presence of RFP mRNA was determined by RT-PCR. An expected 288 bp band of RFP was specifically amplified from transgenic fish, while no band was observed in the non-transgenic siblings. As shown in Figure 3, relatively higher RFP expression levels were detected in muscle, liver and gonad, while a lower expression was detected in spleen, gill, intestine, swim bladder and heart. Furthermore, similar expression patterns were observed between male and female transgenic fish. The arrangement of pMYLZ2-RFP gene constructs in transgenic fish The quantitative PCR analysis revealed that multiple copies of the pMYLZ2-RFP construct were inserted into the host genome. To further characterize the arrangement

7760

Afr. J. Biotechnol.

Figure 2. Expression of RFP in T. albonubes injected with the linearized pMYLZ2-RFP vector. Red fluorescence in transgenic larva was observed under a fluorescence microscope (A) and an anatomical lens (B). RFP expression in 7 dph (C) and adult (D, E) transgenic founder fish was observed under normal daylight. The arrows indicate muscle-specific expression of RFP in transgenic fish. Wild-type fish as controls are also shown in (C), (D) and (E). (F) Adult transgenic F 4 progeny with uniform RFP expression photographed under normal daylight.

of the expression vector, single primer szq1 binds in the promoter region and extends in the upstream direction whereas single primer xzzt2 binds in the terminator region and extends in the downstream direction. If the constructs were arranged in a head-to-head fashion, single primer szq1 would be anticipated to amplify an 892 bp band. Likewise, single primer xzzt2 would be anticipated to amplify a 748 bp band if the constructed were arranged in a tail-to-tail fashion. However, as shown in Figure 4, no product was

amplified by either single primer while an approximate 800 bp band was amplified using their combination. These results indicated that the constructs were not organized in either a head-tohead or a tail-to-tail arrangement fashion but in a head-to-tail orientation (Figure 5). Flanking DNA sequence analysis Approximately 1.5 kb fragment was generated

from EcoR V library, which contained 1075 bp of 5'-flanking region of the transgene insertion locus and 442 bp of the transgene sequence. Compared to the corresponding 5'-end sequence of pMYLZ2-RFP vector, the 442-bp transgenic sequence was no major modification but the deletion of cohesive terminus of BglII at the upstream transgene-host genomic DNA junction. The 5'-flanking sequence analysis showed that there was no significant homology to sequences present in the GenBank database. In addition,

Jian et al.

Table 2. Segregation of pMYLZ2-RFP transgene from transgenic F3 generation to F4 progenies.

Trial

Sex

1 2 3 4 5

Female Female Female Male Male

Positive 96 28 34 24 39

Negative 0 34 32 23 36

Crosses with wild-type fish Total Transgene transmission / % 96 100.0 62 45.2 66 51.5 47 51.1 75 52.0

Figure 3. RT-PCR analysis of RFP expression in various tissues of male and female F 3 transgenic T. albonubes. The endogenous β-actin mRNA was used as an internal control.

Figure 4. The arrangement of pMYLZ2-RFP constructs in transgenic fish. Lane M: Marker III; lanes 1, 4: single-primer PCR with primer szq1 in transgenic individuals; lanes 2, 5: single-primer PCR with primer xzzt2 in transgenic individuals; lanes 3, 6: PCR with both szq1 and xzzt2 primers in transgenic individuals; lane N: PCR with both szq1 and xzzt2 primers in non-transgenic fish.

7761

7762

Afr. J. Biotechnol.

Figure 5. Genetic structure of transgenic T. albonubes. The boxes made up of dotted lines represent flanking regions of transgene insertion locus. Three complete copies of the 6.0 kb pMYLZ2-RFP construct were integrated into T. albonubes genome, and arranged in a head-to-tail fashion. The arrows represent the amplified direction and location of primers.

primers SZYS-SY and SZYS-XY (Table 1) were designed according to the obtained 5'-flanking sequence, and an expected size fragment was specifically amplified from wild-type genome (data not shown). This further demonstrated that the amplified 1075-bp fragment existed in the host genome DNA. Approximately 1.6 kb fragment was generated from Dra I library, which contained 374 bp of the transgene sequence and 1233 bp of 3'-flanking region of the transgene insertion locus. Compared to the corresponding 3'-end sequence of pMYLZ2-

RFP vector, the 374-bp transgenic sequence was not found the mutations including base substitution and insertion, and BglII restriction site was well preserved at the downstream junction. Sequence analysis showed that the 3'-flanking sequence was 99% identical to that of phage P1 partial genome. Furthermore, the same sequence was also amplified using PvuII genome walker library. It indicated that the amplified 1.6-kb fragment belonged to the 3'-flanking region of the insertion point. Nevertheless, PCR analysis revealed that no product was amplified from wild-

type T. albonubes genome DNA with primers xzxlsy and xzxl-xy (Table 1), which were designed according to the obtained 3'-flanking sequence. Transgene copy numbers estimated by qPCR In the qPCR assay, standard curves for target gene and internal reference sequence were produced by using ABI 7300 System SDS software. The correlation coefficient (R2) between CT value and log DNA concentration was 0.9992 for target gene and 0.9982 for internal reference sequence.

Jian et al.

7763

Table 3. Estimation of transgene copy number in F5 and F6 transgenic T. albonubes.

F5 generation Trial 1 2 3 4 Mean ± SD

Initial copy of internal reference 3.40E+5 3.34E+5 2.99E+5 3.44E+5 (3.29±0.21)E+5

Initial copy of target gene 8.96E+5 9.74E+5 9.26E+5 9.75E+5 (9.43±0.39)E+5

F6 generation Transgene copy number 2.64 2.92 3.10 2.83 2.87±0.19

The PCR reaction efficiencies were 95.29 and 100.39% for target gene and internal reference sequence PCR assay, respectively. Good linearity between DNA quantities and CT values indicated that the established assays were well suited for quantitative measurements. Copy number value for RFP gene is shown in Table 3. The initial copies for RFP gene and internal reference sequence were (9.43 ± 0.39) × 105 and (3.29 ± 0.21) × 105 in the F5 sample, and (2.72 ± 0.20) × 105 and (9.31 ± 0.51) × 104 in the F6 sample, respectively. From these data, transgene copy number value was determined to be three per haploid genome. DISCUSSION In this study, 45% of T. albonubes eggs survived after microinjection and 31% of the hatched fry tested RFPpositive which represents a relative high efficiency of transgenic fish production. Nonetheless, most transgenic founders displayed the patched RFP expression in body muscles. This mosaic phenomenon has been widely reported (Chou et al., 2001; Pan et al., 2008) and thought to result from delayed transgenic integration after the precleavage stage of embryonic development (Gross et al., 1992; Figueiredo et al., 2007). In fact, the stable transgenic T. albonubes line described in this paper, although mosaic, was able to transmit RFP gene to the offspring because the transgene was integrated into its germ cells. In addition, Mendelian transmission pattern suggested the transgene exists at a single locus in this line. Results of RT-PCR analysis revealed that RFP gene driven by zebrafish mylz2 promotor was expressed in most T. albonubes tissues, but previous studies reported that this muscle-specific promoter can drive reporter gene expression solely in the skeletal muscle (Gong et al., 2003; Ju et al., 2003; Zeng et al., 2005). Such ectopic expression may be due to lack of putative tissue-specific or repressor elements in our isolated zebrafish mylz2 promoter (Jian et al., 2004; Hobbs and Fletcher, 2008). On the other hand, the influence of integration site context also may result in ectopic expression (Clark et al., 1994). For example, expression patterns often differ

Initial copy of internal reference

Initial copy of target gene

9.14E+4 8.80E+4 1.00 9.32E+4 (9.31±0.51)E+4

2.71E+5 2.48E+5 2.97E+5 2.73E+5 (2.72±0.20)E+5

Transgene copy number 2.96 2.82 2.97 2.93 2.92±0.07

among transgenic lines carrying the same gene construct (Nam et al., 1999). Yet, the possible mechanism for ectopic transgene expression needs further study. Traditionally, Southern blot hybridization is the conventional method for transgene copy number determination (Rahman et al., 2000). But this method is time consuming, costly, and requires a large amount of DNA sample for each assay (Ballester et al., 2004; Yuan et al., 2007). To avoid these drawbacks, we adopted quantitative PCR to determine RFP gene copy number in transgenic T. albonubes, characterized by speediness, sensitivity and accurateness. For qualitative PCR assays, an endogenous reference gene of known copy number is always considered as necessity, but it is relatively difficult to screen a suitable gene in T. albonubes. Specifically, this study developed a 143-bp fragment from the 5' transgene-host junction region used as an internal control, which was validated to be present as a single copy per haploid transgenic T. albonubes genome. This novel design has also been applied to the detection of genetically modified foods (Hernández et al., 2003; Zhu et al., 2008). Meanwhile, the same result obtained for the different generations demonstrated the feasibility of qPCR method to estimate transgene copy number. Both flanking sequences were obtained from the transgene insertion locus using genome walking technology. BLAST analysis showed that the 5'-flanking sequence bore no significant homology to sequences present in the GenBank database, while the 3'-flanking sequence was 99% identical to that of phage P1 partial genome. A similar event was reported by Uh et al. (2006) that the downstream flanking sequences of an insertion site in transgenic coho salmon (Oncorhynchus kisutch) has high homology to the cercaria antigen (CA) membrane protein gene from Schistosoma japonicum. One explanation is that the P1 phage sequences had existed in the genome DNA of the wild-type T. albonubes receptor prior to injecting the pMYLZ2-RFP gene constructs. This phenomenon indicates the possible presence of “hot spot” for DNA integration. Indeed, a few studies reveal some interesting trends that integration of foreign DNA preferentially occurs near the repetitive regions, AT-rich regions, ends of chromosomes, etc (Hamada et al., 1993; Rijkers et al., 1994). Nevertheless,

7764

Afr. J. Biotechnol.

most transgene integration events are often viewed as a random process (Merrihew et al., 1996; Smith, 2001). Certainly, it is impossible to ignore an alternative possibility that the 3'-flanking sequence may be from the original sample for injection, which was inserted together with the pMYLZ2-RFP construct. The presumptive evidences are listed as follows: (1) No product was amplified from some other wild-type T. albonubes individuals with primers xzxl-sy and xzxl-xy, which were designed according to the obtained 3'flanking sequence. (2) P1 is a temperate phage which infects and lysogenizes Escherichia coli and other enteric bacteria (Łobocka et al., 2004). This provides the probability that phage P1 genomic DNA was blended into the purified recombinant vector because of the employment of E. coli DH5α competence cells in the experiment. (3) When the exogenous DNA sequences are integrated into the host genome, the deletion or modification of nucleotides always take place at the transgene-host DNA junction (Gheysen et al., 1991; Mayerhofer et al., 1991). However, sequence analysis showed that the downstream transgene region adjacent to the P1 phage homologous sequences was not found any kind of alteration at nucleotide level, and BglII restriction site was well preserved at the downstream junction. If this assumption is true, it not only puts a higher safety requirement for transgenic manipulation, but also shows the unpredictable nature of transgenesis. In summary, this germline transgenic T. albonubes is of some unique features such as ectopic expression and an unusual 3'-flanking sequence, however, Mendelian transmission, consistent expression, complete pMYLZ2RFP constructs and an appropriate genomic integration context well demonstrated the transgenes have been inserted as a stable DNA fragment in the T. albonubes genome and can be stably inherited and expressed in transgenic progenies. ACKNOWLEDGMENTS Research results reported in this paper were supported by grants from the National Facilities and Information Infrastructure for Science and Technology Program of China (Grant No. 2005DKA21103 and 2010B20308002), Science and Technology Plan Projects of Guangdong Province, China (Grant No. 2005B20301018), Fish Germplasm Improvement and Evaluation Research (Grant No. A200899F01) and National High-Tech Research and Development Program 863 of China (Grant No.2009AA10Z105). REFERENCES Ballester M, Castelló A, Ibáñez E, Sánchez A, Folch JM (2004). Realtime quantitative PCR-based system for determining transgene copy

number in transgenic animals. Biotechniques, 37: 610-613. Chou CY, Horng LS, Tsai HJ (2001). Uniform GFP-expression in transgenic medaka (Oryzias latipes) at the F0 generation. Transgenic Res. 10: 303-315. Clark AJ, Bissinger P, Bullock DW, Damak S, Wallace R, Whitelaw CB, Yull F (1994). Chromosomal position effects and the modulation of transgene expression. Reprod. Fertil. Dev. 6: 589-598. Figueiredo MA, Lanes CFC, Almeida DV, Marins LF (2007). Improving the production of transgenic fish germlines: in vivo evaluation of mosaicism in zebrafish (Danio rerio) using a green fluorescent protein (GFP) and growth hormone cDNA transgene co-injection strategy. Genet. Mol. Biol. 30: 31-36. Gheysen G, Villarroel R, Van Montagu M (1991). Illegitimate recombination in plants: a model for T-DNA integration. Genes Dev. 5: 287-297. Gong ZY, Wan HY, TayTL, Wang H,Chen M, Yan T (2003). Development of transgenic fish for ornamental and bioreactor by strong expression of fluorescent proteins in the skeletal muscle. Biochem. Biophys. Res. Commun. 308: 58-63. Gross ML, Schneider JF, Moav N, Moav B, Alvarez C, Myster SH, Liu Z, Hallerman EM, Hackett PB, Guise KS, Faras AJ, Kapuscinski AR (1992). Molecular analysis and growth evaluation of northern pike (Esox lucius) microinjected with growth hormone genes. Aquaculture, 103: 253-273. Hamada T, Sasak H, Seki R, Sakak Y (1993). Mechanism of chromosomal integration of transgenes in microinjected mouse eggs: sequence analysis of genome-transgene and transgene-transgene junctions at two loci. Gene, 128: 197-202. Hernández M, Pla M, Esteve T, Prat S, Puigdomènech P, Ferrando A (2003). A specific real-time quantitative PCR detection system for event MON810 in maize Yield Gard based on the 3'-transgene integration sequence. Transgenic Res. 12: 179-189. Hobbs RS, Fletcher GL (2008). Tissue specific expression of antifreeze protein and growth hormone transgenes driven by the ocean pout (Macrozoarces americanus) antifreeze protein OP5a gene promoter in Atlantic salmon (Salmo salar). Transgenic Res. 17: 33-45. Iyengar A, Müller F, Maclean N (1996). Regulation and expression of transgenes in fish–a review. Transgenic Res. 5: 147-166. Jian Q, Bai JJ, Ye X, Xia SL, Liang XF, Luo JR (2004). Cloning of Mylz2 promoter and generation of green fluorescence transgenic zebrafish. J. Fish. Sci. China, 11: 391-395. Ju B, Chong SW, He J, Wang X, Xu Y, Wan H, Tong Y, Yan T, Korzh V, Gong Z (2003). Recapitulation of fast skeletal muscle development in zebrafish by transgenic expression of GFP under the mylz2 promoter. Dev. Dyn. 227: 14-26. Kinoshita M, Toyohara H, Sakaguchi M, Inoue K, Yamashita S, Satake M, Wakamatsu Y, Ozato K (1996). A stable line of transgenic medaka (Oryzias latipes) carrying the CAT gene. Aquaculture, 143: 267-276. Kinoshita M (2004). Transgenic medaka with brilliant fluorescence in skeletal muscle under normal light. Fish. Sci. 70: 645-649. Liang XF, Chen GZ, Chen XL, Yue PQ (2008). Threatened fishes of the world: Tanichthys albonubes Lin 1932 (Cyprinidae). Environ. Biol. Fish. 82: 177–178. Lin S, Yang S, Hopkins N (1994). LacZ expression in germline transgenic zebrafish can be detected in living embryos. Dev. Biol. 161: 77-83. Liu H-S, Jan M-S, Chou C-K, Chen P-H, Ke H-J (1999). Is green fluorescent protein toxic to the living cells? Biochem. Biophys. Res. Commun. 260: 712-717. Łobocka MB, Rose DJ, Plunkett G, Rusin M, Samojedny A, Lehnherr H, Yarmolinsky MB, Blattner FR (2004). Genome of bacteriophage P1. J. Bacteriol. 186: 7032-7068. Matz MV, Fradkov AF, Labas YA, Savitsky AP, Zaraisky AG, Markelov ML, Lukyanov SA (1999). Fluorescent proteins from nonbioluminescent Anthozoa species. Nat. Biotechnol. 17: 969-973. Mayerhofer R, Koncz-Kalman Z, Nawrath C, Bakkeren G, Crameri A, Angelis K, Redei GP, Schell J, Hohn B, Koncz C (1991). T-DNA integration: a mode of illegitimate recombination in plants. EMBO J. 10: 697-704. Merrihew RV, Marburger K, Pennington SL, Roth DB, Wilson JH (1996). High-frequency illegitimate integration of transfected DNA at preintegrated target sites in a mammalian genome. Mol. Cell. Biol.

Jian et al.

16: 10-18. Nam YK, Noh CH, Kim DS (1999). Transmission and expression of an integrated reporter construct in three generations of transgenic mud loach (Misgurnus mizolepis). Aquaculture, 172: 229-245. Pan X, Zhan H, Gong Z (2008). Ornamental expression of red fluorescent protein in transgenic founders of white skirt tetra (Gymnocorymbus ternetzi). Mar. Biotechnol. 10: 497-501. Rahman MA, Hwang G-L, Razak SA, Sohm F, Maclean N (2000). Copy number related transgene expression and mosaic somatic expression in hemizygous and homozygous transgenic tilapia (Oreochromis niloticus). Transgenic Res. 9: 417-427. Rijkers T, Peetz A, Rüther U (1994). Insertional mutagenesis in transgenic mice. Transgenic Res. 3: 203-215. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol. 22: 1567-1572. Sin FYT (1997). Transgenic Fish. Rev. Fish Biol. Fish. 7: 417-441. Smith K (2001). Theoretical mechanisms in targeted and random integration of transgene DNA. Reprod. Nutr. Dev. 41: 465-485. Stewart CN Jr (2006). Go with the glow: fluorescent proteins to light transgenic organisms. Trends Biotechnol. 24: 155-162. Tzfira T, LiJ, Lacroix B, Citovsky V (2004). Agrobacterium T-DNA integration: molecules and models. Trends Genet. 20: 375-383. Uh M, Khattra J, Devlin RH (2006). Transgene constructs in coho salmon (Oncorhynchus kisutch) are repeated in a head-to-tail fashion and can be integrated adjacent to horizontally-transmitted parasite DNA. Transgenic Res. 15: 711-727. Wilson AK, LathamJR, Steinbrecher RA (2006). Transformation-induced mutations in transgenic plants: Analysis and biosafety implications. Biotechnol. Genet. Eng. Rev. 23: 209-237.

7765

Würtele H, Little KCE, Chartrand P (2003). Illegitimate DNA integration in mammalian cells. Gene Theor. 10: 1791-1799. Yi ZS, Chen XL, Wu JX, Yu SC, Huang CE (2004). Rediscovering the wild population of white cloud mountain minnows (Tanichthys albonubes Lin) on Guangdong province. Zool. Res. 25: 551-555. Yuan JS, Burris J, Stewart NR, Mentewab A, Stewart CN (2007). Statistical tools for transgene copy number estimation based on realtime PCR. BMC Bioinformatics, 8: S6. Zbikowska HM (2003). Fish can be first- advances in fish transgenesis for commercial applications. Transgenic Res. 12: 379-389. Zeng Z, Liu X, Seebah S, Gong Z (2005). Faithful expression of living color reporter genes in transgenic medaka under two tissue-specific zebrafish promoters. Dev. Dyn. 234: 387-392. Zhu H, Zhao X, Jia J, Sun J, Zhao K (2008). A specific qualitative and real-time PCR detection of MON863 maize based on the 5'-transgene integration sequence. J. Cereal Sci. 48: 592-597.

African Journal of Biotechnology Vol. 11(30), pp. 7766-7770, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.2400 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Soybean (Glycine max) as a versatile biocatalyst for organic synthesis Luciana M. Bertini, Telma L. G. Lemos*, Leonardo A. Alves, Francisco Jose Q. Monte, Marcos C. de Mattos and Maria da Conceição F. de Oliveira Departamento de Química Orgânica e Inorgânica- Laboratório de Biotransformações e Produtos Naturais- LBPN, Universidade Federal do Ceará, 60.451-970, Fortaleza - CE, Brazil. Accepted 8 March, 2012

A series of aliphatic and aromatic aldehydes and ketones were reduced using plant cell preparations of Glycine max seeds (soybean). The biotransformation of five aromatic aldehydes in water, at room temperature afforded the corresponding alcohols in excellent yields varying from 89 to 100%. Two prochiral aromatic ketones yielded the alcohol in very low conversion, 1% and to 4%; however with good enantiomeric excess (ee) of 99 and 79%, respectively. Additionally, three prochiral and one cyclic aliphatic ketones produced the corresponding alcohols in moderate yields varying from 10 to 58% and ee varying from 73 to 99%. Hydrolysis of two aromatic esters yielded the expected carboxylic acids in 49 and 66%. Most of the obtained alcohols have commercial value as cosmetic fragrances. Although, the enzymes present in soybean (reductase/lipase) has not been defined, the reaction is an important route for the preparation of pure alcohols and carboxylic acid, with low cost and environmental impact. Key words: Glycine max, biocatalysis, bioreduction, aldehydes and ketones, ester hydrolysis.

INTRODUCTION During the last decades chemical reactions using plant cell cultures, whole plants or microorganisms as biocatalysts have received a great deal of attention. The current interest in applying biocatalysis into organic chemistry is related to the preparation of optically active compounds with high stereoselectivity under environmentally friendly conditions. The chiral alcohols obtained by plant-mediated reductions of carbonyl groups, are in great demand by various industries, since they are precursors of drugs, agrochemicals (pheromones), specialty materials (for example, liquid crystals), flavors and fragrances (Yadav et al., 2002, 2007; Ishihara et al., 2003; Caron et al., 2005). The use of different plant species for biotransformation in particular is an increasing practice and it represents an interesting route for the synthesis of useful compounds (Giri et al., 2001; Longo and Sanromaín, 2006). General advantages of plants as reagents are their easy disposal

*Corresponding author. E-mail: tlemos@ufc.br. Tel: +55 8533669366. Fax +55 85-33669782.

after use, as they are biodegradable with mild reaction conditions, as well as their wide availability at low cost (Bohman et al., 2009). In order to determine the potential source of enzymes from Brazilian northeastern plants to be used as biocatalysts, an investigation of different tropical fruits and vegetables as bioreduction agents was carried out. Recently, plant parts and microorganisms have been used directly as biocatalysts in sources of reductase activity with alcohol dehydrogenase systems, such as Daucus carota (Yadav et al., 2002b, 2008), Manihot species (Machado et al., 2006), Saccharum officinarum (Assunção et al., 2008), Passiflora edulis (Machado et al., 2008), Cocos nucifera (Fonseca et al., 2009), Lentinus strigellus (Barros-Filho et al., 2009) and Candida tropicalis (Vieira et al., 2010). Seeds of Vigna unguiculata was recently investigated as biocatalyst and showed promising agent for the reduction of carbonyl and nitro group (Bizerra et al., 2010). Glycine max (Leguminosae) has been economically used as a source of proteins for an industrial purpose (Kumar et al., 2009). Therefore, the aim of this work was to study the biocatalytic properties of seeds from soybean

Bertini et al.

7767

Table 1. Glycine max seeds biocatalyzed reduction and hydrolysis of organic compound

Entry 1

2 3 4 5 6 7 8 9 10 11 12 13 a

Product 1a 1b 1c

c (%) 56 28 14

2a 3a 4a 5a 6a 7a 8a 9a 10a 11a 12a 13a

100 89 100 4 1 47 49 10 77 24 58 100

eeP (%)

a

Configuration alcohol

>99 79

S S

>99 73 76

S S S

Enantiomeric excesses (ee) were determined by GC using chiral column.

(Glycine max), as an alternative to produce important intermediates for organic synthesis. As far as we are concerned, this is the first report on the use of seeds as a biocatalyst in organic reactions. MATERIALS AND METHODS General All substrates were obtained from commercial suppliers. The products were obtained and the pure starting materials were analyzed by gas chromatography-mass spectroscopy (GC–MS) on a Hewlett–Packard Model 5971, using a (5%-phenyl)-methylpolysiloxane DB-5 capillary column (30 m x 0.25 mm) with film thickness 0.1 m; carrier gas helium, flow rate 1 mL/min with split mode. The injector temperature and a detector temperature was 250 and 200°C, respectively. The column temperature was programmed at 4°C /min from 35 to 180°C, and then at 10°C /min from 180 to 250°C. Enantiomeric excess (ee) was determined from chiral gas chromatography-flame ionization detector (GC-FID) analysis, as well as measuring of the optical rotations, being measured on a Perkin–Elmer 341 digital polarimeter, followed by a comparison with literature values. The products were analyzed by GC-FID on Thermo Electron GC-FID model Trace GC Ultra, using a Varian Chirasil-Dex CB capillary column (25 m x 0.25 mm x 0.25 µm). Column chromatography was run using silica gel 60 (70 to 230 mesh, Vetec), while thin layer chromatography (TLC) was conducted on precoated silica gel polyester sheets (Kieselgel 60 F254, 0.20 mm, Merck). Compounds were detected by spraying vanillin followed by heating at 120°C.

Reduction of substrates Seeds were rinsed with 5% of a sodium hypochlorite solution and distilled water. The seeds were tritured in blender until obtaining uniform not pieces approximately 0.5 cm and fats were removed by extraction with hexane for 24 h. Substrates 1 to 20 (200 mg) were added to the triturated seeds (23 g) in 150 mL of water, and the reaction mixtures were incubated in an orbital shaker (175 rpm) at room temperature for 72 h, according to the literature procedures (Machado et al., 2006). The mixture was then filtered off, and the seeds were washed with water. Filtrates were extracted with EtOAc (3 x 100 mL). Then, the organic phase was dried (Na2 SO4) and there after evaporated in a vacuum. The final products were purified by silica gel column using Hex:EtOAc (9:2, v/v) as eluent to afford reduced product: 1a, 1b and 1c (146 mg), 2a (123 mg), 3a (158 mg), 4a (142 mg), 5a (161 mg), 6a (154 mg), 7a (138 mg), 8a (164 mg), 9a (139 mg), 10a (149 mg), 11a (143 mg), 12a (158 mg), 13a (162 mg), 14a (165 mg), 15a (153 mg), 16a (144 mg), 17a (157 mg), 18a (163 mg), 19a (172 mg) and 20a (159 mg). Conversions were quantified by GC-MS, and its results are shown on Table 1.

Bioconversion versus time In the kinetics experiments, compounds 1 was submitted to the same procedure, as previously described in the reduction of substrates. Samples were analyzed by GC-MS after 12, 24, 36, 48, 60, 72, 84, 96, 108, 120, 132 and 144 h to compound 1. Experiments were performed in duplicate and the results are presented in Figure 1.

Plant material

Acylation of compounds 9a, 10a and 11a to determination of enantiomeric excess

Commercial seeds from Glycine max were purchase in a local market and were identified by botanist at the Federal University of Ceara, Fortaleza-Ceara-Brazil.

The enantiomeric excess of 9a, 10a and 11a were determined through the corresponding acylated derivative. The racemate alcohols were prepared by the reduction of the carbonylic

Figure 1. 7768

Afr. J. Biotechnol.

100

Bioconversion yield (%)

90 80 70

Hydrocinnamic alcohol (1b)

60

(1c)

50

Cinnamaldehyde (1) Cinnamyl alcohol (1a)

40 30

(1a)

20

(1b)

Cinnamic acid (1c)

10

(1) 0 0

12

24

36

48

60

72

84

96 108 120 132 144

Reaction time (h) Figure 1. Bioconversion of cinnamaldehyde (1) to the corresponding hydrocinnamic alcohol (1b), cinnamyl alcohol (1a) and cinnamic acid (1c), using Glycine max seeds at room temperature. Error bars represent the standard error of mean.

A series of simple aromatic and aliphatic, such as aldehydes, ketones and esters (Scheme 1) were treated with Glycine max seeds as biocatalyst.

or benzaldehyde containing a methoxy group in the para position (100%). The chemoselectivity was not observed with cinnamaldehyde (1), where the reduction reaction generated three products after 72 h; first (1a, 56%) resulting from selective reduction of the carbonyl group; second (1b, 28%) related to non-chemoselective reduction of the carbonyl and olefinic bonds, as well as one minor product (1c, 14%), resulted from oxidation of the carbonyl group or alcohols to carboxylic acids. The products 1a and 1b were previously observed with Saccharum officinarum bioreduction (Assunção et al., 2008).

Insert scheme 1

Insert Table 1

Crude reactions were analyzed by GC-MS and the results are presented in Table 1. All tested aldehydes (1 to 4) produced the corresponding alcohols in excellent yield, varying from 89 to 100% comparable to others previously published (Machado et al., 2008; Fonseca et al., 2009). Two aromatic ketones (acetophenone and mmethoxy-acephenone) 5 and 6 yielded the corresponding alcohols in very low conversion 1 and to 4%, however with good ee of 99 and 79%, respectively. Aliphatic ketones 9 to 12 produced the corresponding alcohols in moderate yield varying from 10 to 58% and ee varying from 73 to 99%. As expected, aldehydes were more reactive than ketones, and the presence of methoxy group in the meta position cause a decrease on the reaction yield (89%) when compared with unsubstituted benzaldehyde (100%)

A kinetic investigation of biotransformation of cinnamaldehyde (1) was performed during seven days. Aliquots were analyzed by GC-MS with reaction times varied from 12, 24, 36, 48, 60, 72, 84, 96, 108, 120, 132 and 144 h. The results show the production of cinnamic acid (1c), hydrocinnamic alcohol (1b) and cinnamyl alcohol (1a). The results show it was important to extended reaction time in order to observe oxidation reaction. The results of kinetic studies are shown in Figure 1.

compounds 9 to 11 with sodium borohydride in methanol. Racemate and the reaction product obtained by reduction were separately acylated with Ac 2O/ pyridine at room temperature (Almeida et al., 2010). Both acylated products were analyzed by Chiral GC and the ee of the bioreduction process was determined. GC conditions: 100°C, 2°C /min until 180°C.

RESULTS AND DISCUSSION

Insert Figure 1 For reduction of the aromatic ketone, 5 and 6, respectively the bioconversion afforded the corresponding

Bertini et al.

7769

Scheme 1. Reaction of Glycine max seeds with aromatic and aliphatic carbonyl compounds (aldehydes, ketones an esters).

secondary alcohols in low yields (4% of 5a and 1% of 6a). However, excellent and moderate enantioselectivity were obtained, with 99% ee for the (S)-isomer (5a) and

79% ee for the (S)-isomer (6a). Bioreduction of aliphatic ketones (9 and 11) were carried out producing the corresponding alcohols at low yields and excellent to

7770

Afr. J. Biotechnol.

moderate enantioselectivity [10% (ee 99%) and 24% (ee 76%), respectively]. A moderated bioconversion (58%) was obtained with cyclohexanone 12, but no reaction was observed for menthone (14), carvone (15) α,βunsaturated ketone and cyclopentanone (16). The reductase enzyme system present in soybean was also evaluated for effects on the β-keto-ester 10, having two different carbonyl groups. Complete chemio- and enantioselectivity were observed through the exclusive reduction of the keto group at C-3 yielding 3S(+)-hydroxy-ethylbutyrate 10a (77% yield), as a product showing an ee value of 73%. Finally, the enzymatic reaction was extended to other functionable compounds: esters (methyl benzoate, 7 and ethyl benzoate, 8), an acid carboxylic (benzoic acid, 17), one nitrile (benzonitrile, 18), an amide (benzamide, 19), and a nitro derivative (nitrobenzene, 20). The aromatic ester produced the corresponding carboxylic acid (47% for 7a and 49% for 8a). No reaction product was observed for the benzoic acid, benzamide, benzonitrile and nitrobenzene. Conclusion In summary, this work duly demonstrated that Glycine max seeds can act as a promising stereoselective biocatalyst to reduce carbonyl compounds to the corresponding alcohols with medium or high conversions suggesting that this vegetable may have interesting potential as a cheap sustainable alternative. It is encouraging to use the vast abundance of Brazilian biodiversity biocatalysts, calling an attention for selectivity and simplicity. ACKNOWLEDGMENTS The authors thank the Brazilian agencies CNPq, FUNCAP, PRONEX, and CAPES for fellowships and financial supports. REFERENCES Almeida MCS, Alves LA, Souza LGS, Matos MC, Oliveira MCF, Lemos TLG, Braz-Filho R (2010). Flavonoides e outras substâncias de Lippia sidoides e suas atividades antioxidantes. Quim. Nova. 33:1877-1881. Assunção JCC, Machado LL, Lemos TLG, Cordell GA, Monte FJQ (2008). Sugar cane juice for the bioreduction of carbonyl compounds. J. Mol. Cat. B: Enzyme, 52:194-198. Barros-Filho, BA, de Oliveira MCF, Lemos TLG, de Mattos MC, Gonzalo G, Gotor-Fernández V, Gotor V (2009). Lentinus strigellus: a new versatile stereoselective biocatalyst for the bioreduction of prochiral ketones. Tetrahedron. Assym. 20: 1057-1061. Bizerra AMC, Gonzalo G, Lavandera I, Gotor-Fernadez V, de Mattos MC, de Oliveira MCF, Lemos TLG, Gotor V (2010). Reduction processes biocatalyzed by Vigna unguiculata. Tetrahedron. Assym. 21: 566-570.

Bohman B, Cavonius LR, Unelius CR (2009). Vegetables as biocatalysts in stereoselective hydrolysis of labile organic compounds. Green Chem. 11:1900-1905. Caron D, Coughlan AP, Simard M, Bernier J, Piché Y, Chênevert R (2005). Stereoselective reduction of ketones by Daucus carota hairy root cultures. Biotechnol. Lett. 27: 713-716. Fonseca AM, Monte FJQ, de Oliveira MCF, de Mattos MC, Cordell GA, Braz-Filho R, Lemos TLG (2009). Coconut water (Cocos nucifera L.) - A new biocatalyst system for organic synthesis. J. Mol. Cat.. B: Enzyme, 57: 78-82. Giri A, Dhingra V, Giri CC, Singh A, Ward OP, Narasu ML (2001). Biotransformation Using Plant Cells, Organ Cultures and Enzyme Systems: Current Trends and Future Prospects. Biotechnol. Adv. 19: 175-199. Ishihara K, Hamada H, Hirata T, Nakajima N (2003). Biotransformation using plant cultured cells. J. Mol. Cat. B: Enzyme, 23: 145-170. Kumar S, Dwevedi A, Kayastha AM (2009). Immobilization of soybean (Glycine max) urease on alginate and chitosan beads showing improved stability: Analytical applications. J. Mol. Cat. B: Enzyme, 58: 138-145. Longo MA, Sanromaín MA (2006). Production of Food Aroma Compounds: Microbial and Enzymatic Methodol. Food Technol. Biotechnol. 44: 335-353. Machado LL (2004). Estudo Fitoquimico e Atividade Biológicaos dos Frutos de Passiflora edulis e Redução Seletiva de Aldeídos e Cetonas Aromáticas Utilizando a Casca da Passiflora como Biocatalisador. MS Thesis, Edições UFC, Fortaleza, Brazil, 2003. Machado LL, Monte FJQ, de Oliveira MCF, de Mattos MC, Lemos TLG, Gotor-Fernández V, Gonzalo G, Gotor V (2008). Bioreduction of aromatic aldehydes and ketones by fruits’ barks of Passiflora edulis. J. Mol. Cat. B: Enzyme, 54:130-133. Machado LL, Souza JSN, Mattos MC, Sakata SK, Cordell GA, Lemos TLG (2006). Bioreduction of aldehydes and ketones using Manihot species. Phytochemistry, 67: 1637-1643. Maciel CDG, Poletine JP, Pereira JP, Mondini ML (2005). Avaliação da qualidade de sementes de soja (Glycine max (l.) Merrill) cultivar IAC18.Revista Científica Eletrônica de Agronomia 7: 1-5. Vieira GAB, Araujo DMF, Lemos TLG, de Mattos MC, de Oliveira MCF, Melo VMM, De Gonzalo G, Gotor-Fernández V, Gotor V (2010). Candida tropicalis CE017: a new Brazilian enzymatic source for the bioreduction of aromatic prochiral ketones. J. Braz. Chem. Soc. 21: 1509-1516. Yadav JS, Reddy GSKK, Sabitha G, Krishna AD, Prasad AR, Rahaman HUR, Rao KV, Rao AB (2007). Daucus carota and baker’s yeast mediated bio-reduction of prochiral ketones. Tetrahedron. Asymm. 18: 717-723. Yadav JS, Nanda S, Thirupathi R, Bhaskar R (2002a). Efficient enantioselective reduction of ketones. J. Org. Chem. 67: 3900-3903. Yadav JS, Nanda S, Thirupathi R, Bhaskar R (2002b). Efficient enantioselective reduction of ketones. J. Org. Chem. 67: 3900-3903. Yadav JS, Reddy BVS, Sreelakshmi GC, Kumar GGKSN, Rao AB (2008). Enantioselective reduction of substituted tetrahydropyran-4ones using Daucus carota plant cells. Tetrahedron. Lett. 49: 27682771.

African Journal of Biotechnology Vol. 11(30), pp. 7771-7774, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4207 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Passive and active immunity against parvovirus infection in piglets Nenad Stojanac*, Mladen Gagrčin, Ognjen Stevančević, Ivan Stančić and Aleksandar Potkonjak Faculty of Agriculture, Department of Veterinary Medicine, University of Novi Sad, Serbia. Accepted 23 March, 2012

The aim of this study was to come to a closer understanding of the origination, dynamics of movement and cessation of colostral immunity to parvovirus infection in swine (PPV) on the basis of an analysis of antibody titres in the blood serum of piglets in their first 6 months. On the third day of life in the blood serum of newborn piglets, an average antibody titer of 13.37 was recorded. An antibody level of 13.30 was maintained until the 10th day of life, when it started to decline to 12.02 on the seventeenth and to 11.80 on the twenty-fourth day of life. A seronegative result was ascertained on the 38th and 45th day of life (8.40 and 5.48). On the 55th day of life, the titer increased to 10.86 and slowly continued to rise to 11.61 on the 180th day of life. Because negative results are the sign of a complete catabolism of colostral antibodies whose absorption was completed in the first 2 to 3 days of life, the antibodies th recorded on the 55 day are to be considered as a result of active immunological reaction formed st between 31 and 55th day of life. The research was done on 60 piglets descending from vaccinated mothers and it was expected of the piglets to obtain enough immunity through colostrum which would protect them against PPV infection until they developed their own immunological response. On the basis of the given results, we conclude that colostral immunity to parvovirus infection in swine lasts for about one month and that antibodies found in the blood serum of piglets after the first month of life are a result of the activation of the immune system. Key words: Porcine parvovirus, colostral immunity, reproductive efficiency, antibody.

INTRODUCTION Porcine parvovirus (PPV) infection is widely spread in swine around the world and has an enzootic character. The virus attacks swine at all ages and the most endangered categories are gilts before insemination due to the disappearance of passive immunity and of inadequately developed active immunity (Mengeling, 2006). Parvovirus infection is constantly present in Serbia, especially in herds of clinically healthy swine in intensive breeding in the form of a persistent and in-apparent infection (Došen et al., 2000). Porcine parvovirus infection lowers reproductive efficiency which puts into question the continuity, amount, and feasibility of pig production in Serbia. Literature duly suggests the importance of the diagnosis of swine infection caused by

*Corresponding author. E-mail: stojanac.n@gmail.com. Tel: +381638526510.

parvovirus and the implementation of immunoprevention in order to inhibit its spread (Antonis et al., 2006; Oravainen et al., 2006). For these reasons, etiology, pathogenesis, and the route of the transmission of parvovirus infection in swine have been studied by many authors (Clark, 1996; Mengeling et al., 2000; Rogan et al., 2002), with special emphasis on the investigation of a protective character of immunity achieved with seropositive and persistently infected swine without the clinical manifestation of the symptoms of the disease after vaccination with inactive vaccine against parvovirus, and the persistency of specific maternal antibodies in their piglets. Newborn piglets are not protected against parvovirus infection because the specific maternal antibodies are only absorbed through colostrum in the first hours of life (Dividich, 2007). Colostrum is the only source of antibodies for piglets (Damm et al., 2002; Rooke et al., 2003), because many

7772

Afr. J. Biotechnol.

of the layered structures of the placenta do not allow transplacental transmission of antibodies against parvovirus from mother onto fetus, whereas pathogenic agents easily pass the placenta. The aim of this research was to follow immunity formation (active and passive) in piglets from the day they were born up until they were 6 months old. Having in mind the data given by many authors that colostral immunity with parvoviral infections may last up to 5 months (Mengeling et al., 1999; Fenati et al., 2009), the main postulate about this type of immunity is a natural passive immunity whose effectors are synthesized in another organism of the same species. The carriers of this immunity are immunoglobulins of class G (IgG). Half life of these immunoglobulins is 15 days, which results in colostral immunity lasting for about 30 days, regardless of their concentration in colostrum itself. Hence, we thought that the reasons for finding antibodies in blood serum of 5 months old piglets have to be searched for elsewhere. On the basis of this, it was decided to study the onset, dynamics of movement and ending of colostrum immunity in pigs. MATERIALS AND METHODS Experimental animals The experiment was performed on a pig farm, with a capacity of 2500 sows, with an intensive way of keeping the pigs infected with PPV enclosed. The experiment was performed on 60 piglets originating from mothers (5 gilts and 5 sows) of the breeds Swedish Landras hybrid (F1), Large Yorkshire, and Swedish Landrace. All experimental animals were clinically healthy and in good condition. From every mother, six piglets were randomly chosen for monitoring of the onset, development and length of passive and active immunity to parvovirus infection. During the experiment, a few piglets died, so the number of researched piglets dropped in time. All the piglets had tags on their ears and a tattooed number. Blood sampling was performed on day 0, 3, 10, 17, 24, 31, 38, 45, 55, 65, 100, 130 and 180 of life. Blood was taken by the puncture of the brachiocephalic plexus of the piglets.

Immunization of mothers A regular vaccination against PPV infection of all the mothers was performed on the farm. Sows were vaccinated with inactivated monovalent vaccine against swine parvovirus according to the manufacturer’s instructions (Intervet, Holland) two weeks before insemination, while gilts were vaccinated twice, 8 and 2 weeks prior to insemination. The vaccine had inactivated swine parvovirus, subtype 014, which was diluted in water adjuvance. The vaccine was applied in 2 ml dosages, deeply intramuscularly, behind the ear. Two milliliter dosage contained >2560 HA units.

Determination of the presence of antibodies Antibodies against parvovirus were detected with a HI test (Ašanin et al., 2006), with slight modifications: only guinea pig erythrocytes and V-bottom microplates were used and no bovine serum albumin was used for a clearer end-point. Animals were considered to have

low antibody levels when HI titres were ≤1:512. Titres >1:512 were considered high. The Scientific Veterinary Institute, Novi Sad diagnostic guidelines for PPV viruses, based on evaluations of vaccinated animals and field cases, are as follows: antibody titres ≤1:8 indicate that the animal has not seroconverted, 1:16 to 1:512 indicate intermediate seroconversion, and titres beyond this represent a high level of antibodies.

Statistical analyses During the processing of the results, antibody values characteristic of PPV were calculated on logarithm values - log2. After log2 results, titres ≤1:512, were considered negative and were given 0, log 2 titre 1:512 was 9, 1:1024 was 10, 1:2048 was 11, 1:4096 was 12, 1:8192 was 13 and 1:16384 was 14. After processing the results, and on the basis of referent values administered by accredited laboratories for testing, the obtained antibody titer results characteristic for PPV in blood serum of examined animals with the value less than 9, were considered as seronegative results. For the evaluation of the results, statistical methods were used: average and interval variation. Data handling was done in Excel 2007. The results were transformed to logarithmic values with the base logarithm 2 (log2).

RESULTS The obtained results showed titre values of characteristic antibodies for PPV and represent the diluting of the serum where antibodies were detected, so, there is no unit in which they could be measured. The obtained results of the diluting were transformed into logarithmic values (log2). Table 1 shows the levels of antibodies specific for PPV in blood serum of newborn piglets. Before the uptake of colostrum, antibodies were not found in any piglet. In the blood serum of three days old piglets, antibodies specific for PPV were found. A total of 60 blood serum samples were checked, and the defined titre values of specific antibodies ranged between 11 to 14 (Table 2). In three days old piglets, the antibody level was 13.37. With the same 10 days old piglets, an antibody level of 13.30 specific for PPV was diagnosed. In blood serum of 17 days old piglets, the average titer value of antibodies specific for PPV was 12.02, which is a lower level compared to an average level of antibodies specific to PPV in the blood serum of 10 days old piglets (13.30). From the results in Table 2, it can be concluded that an average antibody titer specific for PPV in the blood serum of 24 days old piglets was 11.80. With 31 days old piglets, the determined antibody titer values specific for PPV was 8.70. The antibody titer value characteristic of PPV in blood serum of examined 38 days old piglets was 8.40. In blood serum of 45 days old fatlings, the lowest antibody titre value characteristic of PPV was found, and it measured 5.48. The average value of antibody titer characteristic of PPV with 55 days old fatlings was 10.86. The average antibody titer specific for PPV in blood serum of 65 days old fatlings was 10.63. With 100 days old fatlings, the antibody titre specific for PPV was found

Stojanac et al.

7773

Table 1. Antibody titer specific for PPV in blood serum of piglets.

Titer value 14 13 12 11 10 9 0

*0 0 0 0 0 0 0 60

3 36 14 6 4 0 0 0

10 38 16 4 0 1 0 1

17 7 13 20 14 6 0 0

24 11 8 14 13 13 1 0

Number of piglets 31 38 45 0 0 0 0 0 0 2 6 0 9 7 10 21 22 10 21 15 12 7 10 26

55 4 6 5 13 21 8 0

65 2 2 8 15 21 9 0

100 2 4 7 15 9 10 0

130 12 2 1 8 12 15 0

180 3 10 14 9 13 0 0

* Age (days).

Table 2. The average antibody titer values specific for PPV in the blood serum of piglets.

Age (days) 0 3 10 17 24 31 38 45 55 65 100 130 180

Average 0 13.37 13.30 12.02 11.80 8.70 8.40 5.48 10.86 10.63 10.83 10.98 11.61

Interval 0 11-14 0-14 10-14 9-14 0-12 0-12 0-11 9-14 9-14 9-14 9-14 10-14

to be 10.83. The average antibody titer specific for PPV in the population of 130 days old fatlings was 10.98. Within the examined population of 180 days old fatlings, antibody titer specific for PPV was found to be 11.61 (Table 2). DISCUSSION Before the uptake of colostrum, antibodies specific for PPV were not diagnosed in the blood serum of any piglet from the vaccinated mothers (Table 1). This indicates no intrauterine infection (Dividich, 2007). The average antibody titer specific for PPV in blood serum of 3 days old piglets was 13.37 which is a very high value and shows the efficiency of the transfer of colostral antibodies from sow to piglet (Damm et al., 2002). Nearly all the identical average antibody titer specific for PPV was diagnosed in the blood serum of 10 days old piglets. Although it is a question of a relatively unexpected occurrence, it is possible that it is the case of a prolonged absorption of colostral immunoglobulins, which, in some

cases, can last for 5 days (Rooke et al., 2003). In this period, the first piglets without immunoglobulin appeared (Table 1), which could be connected to immunoglobulins M (IgM) which in a number of cases could be the colostral immune carriers. With 17 days old piglets, the decrease of the antibody titer specific for PPV was noted, compared to the antibody titre with the same piglets seven days before (from 13.30 to 12.02). The drop in antibody titer values of 10% is probably the consequence of the onset of the catabolism of colostral titre antibodies for about 10% (GagrÄ?in et al., 1989) due to the decreased plasma concentration in a growing piglet (Paul et al., 1981). Antibody titer specific for PPV in blood serum of 45 days old piglets has a tendency to drop, and with 31 days old piglets, an increased number of seronegative animals occurred. With the same examined 45 days old fatlings, the lowest antibody titer specific for PPV was found to be 5.48. The antibody titer specific for PPV progressively increased from 55 until the 180th day of fatling life. The antibody titer in 55 days old fatlings was 10.86, which is double the value compared to the one gained 10 days earlier. The reason for this abrupt raise of antibodies specific for PPV in the blood serum of fatlings should be sought in the fact that PPV infection of swine is widely spread with clinically healthy swine around the world. Also, PPV is an enzootic infection, permanently present on the territory of Serbia (DoĹĄen et al., 2002), especially in clinically healthy swine herds in intensive breeding, in a form of inapparent persistent infection. All this is a consequence that the infection of fatlings whose level of protection from PPV infection was very low when they were 45 days old initiated immunological response which manifested itself with elevation of antibody titer specific for PPV. The results show that up till 45 days of life, piglet catabolism of colostral antibodies occurred, and the passive immunity seized to exist, which is evidenced by the fact that the bearers of passive immunity are immunoglobulin G (IgG) (GagrÄ?in et al., 1989; Rooke et al., 2003). Half-life of this class of immunoglobulin is 15 days (Jerant-Patic, 2000; Tizard, 2000) which as a consequence has continuation of passive immunity for 3 to 40 days, regardless of their

Afr. J. Biotechnol.

Titre of antibody

7774

Days of age Figure 1. The dynamics of movement of antibody titer values specific for PPV in the blood serum of piglets.

concentration in the colostrum itself. Considering the data from many authors that colostrum immunity lasts up to 6 months (Gradil et al., 1990; Mengeling et al. 1999; Fenati et al. 2009), the question that arises is “what is the class of immunoglobulin of which the half life would be 3 to 6 months?” Because such an immunoglobulin class has not been determined, the reason for this statement should be sought in the activating of the self immunological response. In this study, a very high antibody titer specific for PPV in the blood serum of 130 and 180 days old fatlings was found (10.98 and 11.61). This high antibody titer specific for PPV has been confirmed in studies by Mengeling et al. (1999) and Fenati et al. (2009). They administered the findings of a high antibody titer with 3 to 6 months old piglets to passive immunity, that is, to colostral antibodies. The antibody titer specific for PPV in 40 days old piglets dropped to a low level since there was catabolism of colostral antibodies which Gagrčin et al. (1989) explained in their research and which meant termination of passive immunity, upon which the self immune response happened (active immunity) (Figure 1). REFERENCES Antonis FGA, Bruschke JMC, Rueda P, Maranga L, Casal JI, Vela C, Hilgers ATL, Belt BGMP, Weerdmeester K, Carrondo JTM, Langeveld PMJ (2006). A novel recombinant virus-like particle vaccine for prevention of porcine parvovirus-induced reproductive failure. Vaccine, 24: 5481-5490. Ašanin R, Krnjajić D, Milić N (2006). Priručnik sa praktičnim vežbama iz mikrobiologije sa imunologijom. Autorsko izdanje, Beograd. pp. 63-66 Clark LK (1996). Epidemiology and management of selected swine reproductive diseases. Anim. Reprod. Sci. 42:447-454. Damm IB, Friggens CN, Nielsen J, Ingvarsen LK, Pedersen JL (2002). Factors affecting the transfer of porcine parvovirus antibodies from sow to piglets. J.Vet. Med. Series A, 49(9): p. 487.

Dividich LJ (2007). The issue of colostrums in piglet survival: energy and immunity. Nutri. Biotech. Feed Food Ind. pp. 89-102. Došen R, Gagrčin M, Prodanov J, Orlić D (2002). Porcine parvovirus infection. Vet. Glasnik, 56(1-2): 13-19. Fenati M, Armaroli E, Corrain R, Guberti V (2009). Indirect estimation of porcine parvovirus maternal immunity decay in free-living wild boar (Sus scrofa) piglets by capture-recapture data. Vet. J. 180(2): 262264. Gagrčin M, Popović M, Ćirković D (1989). Some aspects of colostral immunity in piglets against porcine parvovirus infection. Vet. Glasnik 44(7): 587-590. Gradil CM, Joo HS, Molitor TW (1990). Persistence of porcine parvovirus in swine infected in utero and followed through maturity. J. Vet. Med. B 37: 309-316. Jerant-Patić V (2000). Viruses today and tomorrow. Med. Pregl. 53(1112): 547-558. Mengeling WL (2006). Porcine parvovirus. Diseases of swine, Iowa State University Press, Iowa, pp. 373-386. Mengeling WL (1999). Porcine parvovirus. Diseases of swine, Iowa State University Press, Iowa, pp. 187-200. Mengeling LW, Lager MK, Vorwald CA (2000). The effect of porcine parvovirus and porcine reproductive and respiratory syndrome virus on porcine reproductive performance. Anim. Reprod. Sci. 60-61: 199210. Oravainen J, Hakala M, Rautiainen E, Veijalainen P, Heinonen M, Tast A, Virolanen JV, Peltoniemi OAT (2006). Parvovirus antibodies in vaccinated gilts in field conditions-results with HI and ELISA tests. Reprod. Dom. Anim. 41: 91-93. Paul PS, Mengeling WL, Pirtle EC (1981). Duration and biological halflife of passively acquired colostral antibodies to porcine parvovirus. Am. J. Vet. Res. 43:8. Rogan D, Petrović T, Lazić S (2002). Novija saznanja o parvovirusnim infekcijama svinja, Zbornik referata i kratkih sadržaja, 14. savetovanje veterinara Srbije, Zlatibor, pp. 49-58. Rooke AJ, Carranca C, Bland MI, Sinclair GA, Ewen M, Bland CVI, Edwards AS (2003). Relationship between passive absorption of immunoglobulin G by the piglet and plasma concentrations of immunoglobulin G at weaning. Livestock Prod. Sci. 81: 223-234. th Tizard IR (2000). Veterinary Immunology. 6 Edition, London, WB Sauders, 89: p. 223.

African Journal of Biotechnology Vol. 11(30), pp. 7775-7780, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3448 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

The use of kefir as potential probiotic in Çoruh trout (Salmo coruhensis): Effects on growth performance and immunoglobulin (IgM) levels Erkan CAN1*, Filiz KUTLUYER1, Fatma DELİHASAN SONAY2 and Özay KÖSE2 1

Fisheries Faculty, Tunceli University, Tunceli, 62000, Turkey. 2 Fisheries Faculty, Rize University, Rize, 53000, Turkey. Accepted 18 January, 2012

The objective of this study was to evaluate the effects of three different rates of kefir on growth performance and immunoglobulin (IgM) levels of Çoruh trout (Salmo coruhensis). The experiment was carried out with the four following treatments: Control group (not supplemented kefir), D1, D2 and D3 (kefir supplemented diet 10, 20, 40 g kg-1 fish body mass, respectively). Condition factor (CF), food conversion ratio (FCR), survival rate, and specific growth rate (SGR) were monthly determined and IgM level was measured at the end of the 4 months. Survival ranged from 88.2 to 89.1%, and was independent of dietary treatments (P>0.05). The highest specific growth rate was found for the fish fed D2; although, there was no significant difference in growth parameters between the control, the fish fed D1, D2 and D3 (P>0.05). However, diets contained kefir (D1, D2) increased immunoglobulin level in S. coruhensis (P<0.05). It can also be concluded that kefir is crucial for fish production as a potential probiotic. Key words: Salmo coruhensis, kefir, probiotic, growth, immunoglobulin (IgM).

INTRODUCTION Using of functional foods have become a vital necessity to minimize the use of chemical drugs for treatment of some fish diseases and to reduce their effects on the fish and environment and also decrease the production costs and to obtain more environment-friendly aquaculture productions (Gatesoupe, 1999; Can, 2001; Suzer et al., 2008; Al-Dohail et al., 2009; Merrifield et al., 2010; Ekici et al., 2011). Kefir is an acidic and mildly alcoholic fermented milk with a complex mixture of bacteria, which are confined to a matrix of discrete kefir grains. The bacteria include various species of lactobacilli, lactococci, leuconostocs and aceterobacteria and yeasts (both lactose-fermenting and nonlactose-fermenting) (Marshall and, Cole, 1985;

*Corresponding author. E-mail: erkancan@tunceli.edu.tr, ecanengineer@gmail.com. Tel: +90-428-2131794. Fax: +90428-2131861. Abbreviations: IgM, Immunoglobulin; CF, condition factor; FCR, food conversion ratio; SGR, specific growth rate.

Koroleva, 1988; Thoreux and Schmucker, 2000). Kefir also exhibits antimicrobial activity in vitro against a wide variety of Gram-positive and Gram-negative bacteria and some fungi (Cevikbas et al., 1994; Zacconi et al., 1995). Recently, antibacterial, immunologic and antitumor effects of kefir were studied on human beings (Lin and Change, 2000; Hoolihan, 2001; Liu et al., 2005) and some other animals, rats etc. (Furukawa et al., 1990, 1991; Zacconi et al., 1995; Güven et al., 2003; Cenesiz et al., 2008; Ozcan et al., 2009) although there is lack of information in the literature on growth performances and immunoglobulin level of kefir on the fish species. IgM, which is an important immunoglobulin class, is important in phylogenetic research being the first immunoglobulin to appear in evolution and commonly the only immunoglobulin class described in fish (Magnadóttir, 1998). A lot of researchers have focused on this immunoglobulin class in their studies on immune system and growth performance of cultured species (Assem and El-Zaeem, 2005; Panigrahia et al., 2005; Salinas et al., 2008; Reyes-Becerril et al., 2008; Al-Dohail et al., 2009; Lim et al., 2010), and, recently, understanding of the

7776

Afr. J. Biotechnol.

structure and function of fish IgM has become all the more important due to the need of the fish farming industry for effective prevention and control of various fish diseases (Magnadóttir, 1998). Kefir have been reported to stimulate the immune system in both in vitro and in vivo studies (Furukawa et al., 1991; Osada et al., 1994). The immune system was stimulated in rainbow trout by several probiotics (Irianto and Austin, 2002; Raida et al., 2003; Panigrahi et al., 2005; Sharifuzzaman and Austin, 2009). The application of live probiotics may therefore result in elevated health status, improved disease resistance, growth performance, body composition, reduced malformations and improved gut morphology and microbial balance in aquaculture nowadays (Merrifield et al., 2010). As concerns, Coruh trout (Salmo coruhensis, described by Turan et al., 2009) is the new culture species in Black Sea region of Turkey known as Salmo trutta labrax (PALLAS, 1811) in previous literature; the knowledge lack information in the literature on the effect of kefir on the growth and immune system. In this framework, the main objective of this study was to examine the effect of dietary kefir on the growth, survival and immunoglobulin (IgM) levels of Çoruh trout (S. coruhensis).

MATERIALS AND METHODS Fish and experimental design The samples of S. coruhensis broodstocks used in the present study were obtained from Çoruh River (Rize) population of S. coruhensis. This study was carried out between December 02, 2010 and March 02, 2011 for 4 months at the facility Aquaculture Department Production, Rize, Turkey. Twelve tanks (50 L) were used and fish were equally allotted to four groups with three replicates for each treatment. Each tank contained 90 fish (9.7±0.2 g). The temperature of the incoming water was 8±2.53°C. Flow rate was 30 L min-1. Oxygen saturation was always higher than 88% (measured by HQ40D multi - Hach Lange). In the present study, fish were exposed to natural photoperiod. Four diets were prepared to investigate the effects of different levels of kefir on condition factor (CF), food conversion ratio (FCR), survival rate, specific growth rate (SGR) and IgM level in S. coruhensis. For this aim, one control and three experimental diets (D1, D2 and D3) were arranged. Kefir was not included to the control group; however, D1, D2 and D3 groups were supplemented with kefir at 10, 20 and 40 g kg-1 fish diet mass levels, respectively. The experimental diets were formulated to contain approximately 50% crude protein, 19% crude lipids, crude cellulose 3%, 12% moist and 13% ash. The experiment was carried out with three replicates for each dietary treatment. Daily tank feed was calculated as 3% of the group biomass. All groups were fed the same daily ration of commercial food (Bioaqua, standard extruder). All the fish in each tank received the same feed treatment. The amount fed to each tank was recorded. Each fish was anesthetized (Benzocaine, 50 ppm), and body weight (Wt; to 1 g), and total length (Lt; to 1 mm) were recorded at intervals of 30 days. Condition factor was calculated as (Wt Lt-3) * 100. Food conversion ratio per tank was calculated as (food fed)/(biomass gain). Specific growth rate was calculated as (LnW t-LnW 0 / t) * 100. Survival rate was calculated as

(Nt / N0) * 100 (Duston et al., 2007). Kefir and feed preparation Raw milk was obtained from a special milk production farm daily (Rize, Turkey), and heated to 90°C for minimum of 10 min, then cooled to inoculation temperature (25°C) and 5% active kefir grains added. The inoculated milk was incubated at 22°C for 20 h (Marshall and Cole, 1985). At the end of the incubation, the grains were separated from the kefir product by filtration through a plastic sieve, washed and maintained at +4°C in the sterile drinkable water until the next culture passage. Kefir product was maintained at +4°C for 24 h and then used for microbiological and chemical analyses before feeding the fish in treatment groups. Prepared kefir was not used as feed additive if it was stored for more than 3 days (Güven et al., 2003). Prepared feeds were stored under 4°C conditions. After the feed was prepared with kefir, all 4 groups’ feed was covered with fish oil at 32 ml to per kilo of feed.

Bacteriological analysis of kefir Twenty-five milliliters of kefir product was mixed with 225 ml peptone water (Oxoid Ltd., Hampshire, UK). Tenfold serial dilutions from this homogenate were prepared in the same solution and 0.1 ml from these dilution tubes spread-plated onto separate duplicate plates. Lactobacilli were investigated by using MRS agar (Oxoid, CM361) and lactic streptococci were counted by using M17 agar (Oxoid, CM785). Selective enumeration of yeasts was specified via potato dextrose agar (Oxoid, CM 139) (Harrigan and McCance, 1976).

Sampling and measurement of blood serum immunoglobulin M (IgM) Fish were sampled monthly for growth parameters and at the end of feeding period for enzymatic analyses. At each sampling for enzymatic analyses, three fish from each tank (nine per treatment) were taken at random. All specimens were anaesthetized by immersion in benzocaine solution (50 ppm) before blood drawing. Blood was drawn from the vena caudalis using an 18 G×1½ in syringe. Blood serum was obtained by blood centrifugation at 3000 rpm for 15 min. An ELISA kit (Fish Immunoglobulin M (IgM) ELISA Kit) from Cusabio Biotech (Cat. No. CSB-E12045Fh) were used following the manufacturer’s instructions to determine total IgM concentrations in serum. All tests were studied in Bilim Special Veterinary Diagnosis and Analysis Laboratory, Istanbul-Turkey. Statistical analysis One-way analysis of variance (ANOVA) was conducted to compare differences among dietary treatments. Overall differences were significant (P<0.05), Duncan's multiple range test was used to compare the mean values between individual treatment groups. All tests were performed in SPSS 15.0 software for Windows (SPSS Inc., Chicago, IL, USA).

RESULTS Survival and growth parameters Survival

ranged

from

88.2

to

89.1%, and was

Can et al.

7777

Table 1. Changes in mean SGR, FCR and CF of S. coruhensis in the control and fed D1, D2 and D3.

Month S G R

F C R

C F

a,b,c x,y,z

Control

Diet 1 a,x

Diet 2 a,x

Diet 3 a,x

a,x

1

1.61±0.15

1.73±0.13

1.82±0.12

1.76±0.08

2

1.68±0.52a,x

1.74±0.07a,x

1.82±0.09a,x

1.79±0.08b,x

3

1.14±0.06b,x

1.18±0.08b,x

1.17±0.06b,x

1.16±0.02c,x

4

1.12±0.21b,x

1.10±0.13b,x

1.21±0.16b,x

1.11±0.08a,x

1

4.47±0.13

2

3.14±0.35

3

2.60±0.18c

4

2.28±0.13

0

a,x

4.83±0.14

a,x

4.29±0.10

a,x

4.46±0.02

b,x

3.11±0.16

b,x

2.98±0.22

b,x

2.71±0.51

c,x

2.37±0.17

c,x

2.12±0.62

2.39±0.19

c,x

2.32±0.13

c,x

2.11±0.73

0.90±0.06a,x

0.91±0. 06a,x

0.91±0. 05a,x

0.90±0.05a,x

1

1.05±0.07ab,x

1.04±0.08a,x

1.03±0.08a,x

1.05±0.07ab,x

2

1.08±0.07b,x

1.07±0.08ab,x

1.09±0.08a,x

1.06±0.08b,x

3

1.03±0.07ab,x

1.03±0.08b,x

1.06±0.07a,x

1.03±0.07ab,x

4

1.03±0.07ab,x

1.04±0.06b,x

1.07±0.08a,x

1.04±0.08ab,x

a,x

c,x

2.52±0.20

a,x b,x c,x c,x

Indicate the differences among the same columns (P<0.05). Indicate the differences among the same rows (P>0.05).

independent of dietary treatments (P>0.05). Fish fed diet with 20 mg kg-1 kefir (D2) showed the highest growth rate although there were no significant differences between groups (P>0.05). SGR in the control group was lower compared to the kefir induced groups but these differences were not statistically different (P>0.05) (Table 1). FCR and CF in fish fed kefir supplemented diets and the control group are presented in Table 1. FCR and CF were higher in Diet 2 compared to the other groups but the differences between groups were not statistically significant (P>0.05) (Table 1). Nevertheless, there were also significant differences during the various cycle of the production on SGR, FCR and CF by time (P<0.05). Kefir analyses At the end of the microbiological analysis of kefir, lactic acid bacteria, lactic streptococci and yeasts were found 8 7 7 to be 1.0 * 10 , 2 * 10 and 3 * 10 CFU/ml, respectively. Blood serum immunoglobulin M (IgM) IgM level in fish fed kefir supplemented diets and the control group are presented in Figure 1. The findings of the present study showed that the concentration of 10 and 20 g kg-1 kefir addition to diets caused a significant increase in IgM level in S. coruhensis.

DISCUSSION There have been no comparative studies on the effect of kefir on growth and immune system of aquatic species. However, the significance of probiotic in fish production has been confirmed in several studies. The effect of dietary probiotic on growth and survival rate depended on many factors (Gomez-Gil et al., 2000) such as species composition, application level, frequency of application and environmental conditions. Zhou et al. (2009) and Liu et al. (2010) determined that Saccharomyce cerevisae and Bacillus subtilis which are two of the microorganisms constituting the kefir grains had beneficial effects on the survival rate. The higher survival rates in the probiotic-treated group could also be attributed to their increased potential to respond to and better tolerate the harmful conditions possibly encountered in the culture tanks, probably due to higher induced HSP70 levels, as reported earlier by Carnevali (2006) in sea bream (Sparus aurata). Tovar-Ramírez et al. (2010) found an increase of the final mean weight of sea bass larvae fed a yeast-supplemented diet as reported by Lara et al. (2003) who suggested that yeast (S. cerevisae) was an appropriate growth-stimulating additive in tilapia cultivation where higher survival, SGR, PER and FCR values were obtained in probiotic treatments with Streptococcus faecium and Lactobacillus acidophilus. Similarly, Al-Dohail et al. (2009) reported that significantly better (P<0.05) growth performance was

7778

Afr. J. Biotechnol.

Figure 1. Changes in mean IgM levels of S. coruhensis in the control and fed diet D1, D2 and D3.

observed in Clarias gariepinus fingerling maintained on the diet supplemented with L. acidophilus, Similar and Carnevali (2006) who reported that growth in sea bass juvenile was significantly (P<0.05) better in the treated groups than the control when Lactobacillus delbrueckii was used as a probiotic via rotifer carriers and Artemia nauplii for 70 days. Wang and Zirong (2006), Noh et al. (1994), Bogut et al. (1998) and Yanbo and Zirong (2006) all reported significantly better growth performance and FCR in common carp when fed diets enriched with probiotics. In contrast, WachĂŠ et al. (2006) reported that neither survival nor growth was significantly affected by the probiotic treatment with Saccharomyces cerevisiae in another study, in rainbow trout (Onchoryncus mykiss). Similarly, on the effectiveness of commercial probiotics in northern white shrimp Penaeus monodon ponds Shariff et al. (2001) reported that survival rate did not increase in probiotic-induced groups compared to the control group. In the present study, there was only a rise in growth performance in Coruh trout but not at significant level by feeding dietary kefir, for a period of 4 months. Our results which are similar to those reported by Shariff et al. (2001) and WachĂŠ et al. (2006) indicated that dietary kefir did not affect growth and survival of fish. It was not possible to discriminate the contribution of yeast among the effect on growth (Gatesoupe, 2007). The growth performance may be affected by the other environmental conditional, especially by the bacterial bloom on the culture environment (Can et al., 2010). This study was conducted in winter period when the bacterial activation is low. The pathogen effects may be possible to observe due to high activation of pathogenic bacteria if the study is conducted in summer period. Moreover, the findings

may change if the study repeated by enhancing microbiological challenge tests. IgM is the main immunoglobulin present in fish (Watts et al., 2001) and probiotics also modulate various immunological parameters in teleosts (Nayak, 2010). The effects of probiotics have been reported to stimulate the immune system in both in vitro and in vivo studies (Furukawa et al., 1991; Osada et al., 1994; Irianto and Austin, 2002; Raida et al., 2003; Panigrahi et al., 2005). Assem and El-Zaeem (2005) and Panigrahia et al. (2005) suggested that increased total immunoglobulin concentration could be due to an increased immune response in the probiotic group, induced by the presence of L. acidophilus. The authors reported higher immunoglobulin levels in the blood plasma of rainbow trout when lactic acid bacteria Lactobacillus rhamnosus JCM 1136 were supplemented in the diet of the fish. AlDohail et al. (2009) reported that total immunoglobulin in African catfish (Clarias gariepinus) (Burchell, 1822) with two probiotic bacteria additives to fish diet was significantly higher (P<0.05) in fish fed the probiotic supplemented diet than in the control diet over the 12week culture period. Reyes-Becerril et al. (2008) observed a significantly increase (P = 0.004) on immunoglobulin M level in recovered leopard groupers. In contrast, Balcazar et al. (2007) only found rise in immunoglobulin level in Salmo trutta but not at significant level by feeding LAB groups of probiotics, which are Lactococcus lactis ssp. lactis, Lactobacillus sakei and Leuconostoc mesenteroides, supplemented at106 CFU/g feed for a period of 2 weeks. Our results indicate that increased levels of serum IgM levels were detected with kefir supplemented diets (Diet 1 and 2) similarly to those

Can et al.

reported earlier in grouper (Mycteroperca rosacea) (Reyes-Becerril et al., 2008), African catfish (Clarias gariepinus) (Al-Dohail et al., 2009) and rainbow trout (Oncorhynchus mykiss) (Panigrahia et al., 2005), which were fed with basal control and probiotic supplemented diets. Previous study by Rea et al. (1996) indicated that kefir 9 8 grains contained (cfu/ml) 10 lactococci, 10 6 5 leuconostocs, 10 lactobacilli, 10 acetic acid bacteria and 106 yeasts. In another study, Güven et al. (2003) reported the averages of the total mesophilic aerobic colony counts, lactic acid bacteria, lactic streptococci, enterococci, and yeasts were found to be 1.04 × 109, 9.87 × 108, 4.38 ×108, 7.80 × 104 and 1.26 × 105 CFU/ml, respectively. Our findings in this study showed a bit difference. The microbial content of kefir grains depends primarily on their source. It has been reported that kefir grains contain lactobacilli, lactococci and yeast, and sometimes acetic acid bacteria, depending on the source or country of origin (Guzel-Seydim et al., 2005). In conclusion, diets contained different levels of kefir affected the immunoglobulin concentrations in S. coruhensis but not growth and survival rate. Therefore, our results indicate kefir has the potential to be a promising probiotic and kefir as a probiotic can be used an integral part of the culture practices for improving growth and disease resistance. Further studies are under way to elucidate kefir effects on growth and IgM activity on aquaculture production.. ACKNOWLEDGEMENT The authors wish to thank Dr. Ilker Zeki KURTOGLU for his efficient technical contribution towards conducting of the experiments. REFERENCES Al-Dohail MA, Hashim R, Aliyu-Paiko M (2009). Effects of the probiotic, Lactobacillus acidophilus, on the growth performance, haematology parameters and immunoglobulin concentration in African Catfish (Clarias gariepinus, Burchell 1822) fingerling. Aquac. Res. 40: 16421652. Assem SS, El-Zaeem SY (2005). Application of biotechnology in fish breeding II: production of highly immune genetically modified redbelly tilapia, Tilapia zillii. Afr. J. Biotechnol. 4: 449-459. Balcazar JL, de Blas I, Ruiz-Zarzuela I, Vendrell D, Calvo AC, Marquez I, Girones O, Muzquiz JL (2007). Changes in intestinal microbiota and humoral immune response following probiotic administration in brown trout (Salmo trutta). Brit. J. Nutr i. 97: 522-7. Bogut I, Milakovic Z, Bukvic Z, Brkicand S, Zimmer R (1998). Influence of probiotic Streptococcus faecium M74 on growth and content of intestinal microfllora in carp Cyprinus carpio. Czech J. Anim. Sci. 43: 231-235. Can E (2001). Effect of Probiotic Products on Growth of European Sea bass (Dicentrarchus Labrax). Ege University, Graduate School of Natural and Applied Science, Master of Science Thesis. Can E, Saka S, Firat K (2010). Disinfection of Gilthead Sea Bream (Sparus aurata), Red Porgy (Pagrus pagrus), and Common Dentex (Dentex dentex) Eggs from Sparidae with Different Disinfectants. Kafkas Univ. Vet. Fak. 16 (2): 299-306.

7779

Carnevali O, Vivo L, Sulpizio R, Gioacchini GI, Olivotto I, Silvi S, Cresci A (2006). Growth improvement by probiotic in European sea bass juveniles (Dicentrarchus labrax, L.), with particular attention to IGF-1, myostatin and cortisol gene expression. Aquaculture, 258: 430-438. Cenesiz SA, Devrim K, Kamber U, Sozmen M (2008). The effect of kefir on glutathione (GSH), malondialdehyde (MDA) and nitric oxide (NO) levels in mice with colonic abnormal crypt formation (ACF) induced by azoxy-methane (AOM). Deut. Tıerarztl. Woch. (DTW), 115: 15-19. Cevikbas A, Yemni E, Ezzedenn FW, Yardimici T (1994). Antitumoural, antibacterial and antifungal activities of kefir and kefir grain. Phytother. Res. 8: 78-82. Duston J, Astatkie T, Murray SB (2007). Effect of salinity at constant 10 °C on grow-out of anadromous Arctic charr from Labrador. Aquaculture, 273: 679-686. Ekici S, Diler Ö, Didinen BI, Kubilay A (2011). Balıklardan İzole Edilen Bakteriyel Patojenlere Karşı Bazı Bitkisel Uçucu Yağlarının Antibakteriyal Aktivitesi. Kafkas Univ. Vet. Fak. 17: (Suppl A),47-54. Furukawa N, Matsuoka A, Takahashi T, Yamanaka Y (1990). Effects of orally administered yogurt and kefir on tumor growth in mice. J. Jpn. Soc. Food Sci. Technol. 43: 450-453. Furukawa N, Matsuoka A, Takahashi T, Yamanaka Y (1991). Effects of fermented milk on the delayed-type hypersensitivity response and survival in mice bearing Meth- Anim. Sci. Tech. (Japan), 62: 579-585. Gatesoupe FJ (1999). The use of probiotics in aquaculture: Review. Aquaculture 180: 147-165. Gatesoupe FJ (2007). Live yeasts in the gut: natural occurrence, dietary introduction, and their effects on fish health and development. Aquaculture, 267: 20-30. Gomez-Gil B, Roque A, Turnbull JF (2000). The use and selection of probiotic bacteria for use in the culture of larval aquatic organisms. Aquaculture 191: 259-270. Güven A, Güven A, Gülmez M (2003). The Effect of Kefir on the Activities of GSH-Px, GST, CAT, GSH and LPO Levels in Carbon Tetrachloride-Induced Mice Tissues. J. Vet. Med. B 50: 412-416. Guzel-Seydim Z, Wyffels JT, Seydim AC, Greene AK (2005) Turkish kefir and kefir grains: microbial enumeration and electron microscopic observation. Int. J. Daıry Technol. 58: 25-29. Hoolihan LK (2001). Prophylactic and therapeutic use of probiotics: a review. J. Am. Diet. Assoc. 101: 220-238. Harrigan FW, McCance ME (1976). Laboratory Methods in Food and Dairy Microbiology. Academic Press, London. Irianto A, Austin B (2002). Use of probiotics to control furunculosis in rainbow trout, Oncorhynchus mykiss (Walbaum). J. Fish Dis. 25: 333342. Koroleva NS (1988). Starters for fermented milks. Section 4, Kefir and Kumys Starters. Bulletin of the IDF 227, Chapter 2. International Dairy Federation, Brussels, Belgium. Lara-Flores M, Olvera-Novoa MA, Guzmán-Méndez BE, López-Madrid W (2003). Use of the bacteria Streptococcus faecium and Lactobacillus acidophilus, and the yeast Saccharomyces cerevisiae as growth promoters in Nile tilapia (Oreochromis niloticus). Aquaculture, 216: 193-201. Lim C, Yildirim-Aksoy M, Welker T, Klesius PH, Li MH (2010). Growth Performance, Immune Response, and Resistance to Streptococcus iniae of Nile Tilapia, Oreochromis niloticus, Fed Diets Containing Various Levels of Vitamins C and E. J. World Aquac. Soc. 41: 35-48. Lin MY, Change FJ (2000). Antioxidative effect of intestinal bacteria Bifidobacterium longum ATCC 15708 and Lactobacillus acidophilus ATCC 4356. Digest. Dis. Sci. 45: 1617-1622. Liu JR, Chen MJ, Lin CW (2005). Antimutagenic and antioxidant properties of milk-kefir and soymilk-kefir. J. Agric. Food Chem. 53:2467-74. Liu K, Chiu C, Shiu Y, Cheng W, Liu C (2010). Effects of the probiotic, Bacillus subtilis E20, on the survival, development, stress tolerance, and immune status of white shrimp, Litopenaeus vannamei larvae. Fish Shellfish Immun. 28: 837-844. Magnadóttir B (1998). Comparison of immunoglobulin (IgM) from four fish species. Icelandic Agric. Sci. 12: 47-59. Marshall MV, Cole WM (1985). Methods for making kefir and fermented milks based on kefir. J. Dairy Res. 52: 451-456. Merrifield LD, Dimitroglou A, Foey A, Davies JS, Baker MTR, Bøgwald

7780

Afr. J. Biotechnol.

J, Castex M, Ringø E (2010). The Current Status And Future Focus Of Probiotic and Prebiotic Applications for Salmonids, Aquaculture, 302: 1-18. Nayak SK (2010). Probiotics and immunity: A fish perspective. Fish Shellfish Immun. 29: 2-14. Noh SH, Han K, Won TH, Choi YJ (1994). Effect of antibiotics, enzyme, yeast culture and probiotics on the growth performance of Israeli carp. Kor. J. Anim. Sci. 36:480-486. Ozcan A, Kaya N, Atakisi O, Karapehlivan M, Atakisi E, Cenesiz S (2009). Effect of kefir on the oxidative stress due to lead in rats. J. Appl. Anim. Res. 35: 91-93. Osada K, Nagira K, Teruya K, Tachibana H, Shirahata S, Murakami H(1994). Enhancement of interferon-b production with sphingomyelinimmune response in rainbow trout Oncorhynchus mykiss. Aquaculture, 243: 241-254. Panigrahi A, Kiron V, Kobayashi T, Puangkaew J, Satoh S, Sugita H (2005). The viability of probiotic bacteria as a factor influencing the immune response in rainbow trout Oncorhynchus mykiss. Aquaculture, 243: 241-254. Raida MK, Larsen JL, Nielsen ME, Buchmann K (2003). Enhanced resistance of rainbow trout, Oncorhynchus mykiss (Walbaum), against Yersinia ruckeri challenge following oral administration of Bacillus subtilis and B. licheniformis (BioPlus2B). J.Fish Dis. 26: 495498. Rea MC, Lennartsson T, Dilon P, Drinan FD, Reville WJ, Heapes M, Cogan TM (1996) Irish kefir like grains: their structure, microbial composition and fermentation kinetics. J. Appl. Bacteriol. 81: 83-94. Reyes-Becerril M, Tovar-Ramírez D, Ascencio-Valle F, CiveraCerecedo R, Gracia-López V, Barbosa-Solomieu V (2008). Effects of dietary live yeast Debaryomyces hansenii on the immune and antioxidant system in juvenile leopard grouper Mycteroperca rosacea exposed to stress. Aquaculture, 280: 39-44. Salinas I, Abelli L, Bertoni F, Picchietti S, Roque A, Furones D, Cuesta A, Meseguer J, Esteban MA (2008). Monospecies and multispecies probiotic formulations produce different systemic and local immunostimulatory effects in the gilthead seabream (Sparus aurata L.). Fish Shellfish Immun. 25:114-23. Sharifuzzaman SM, Austin B (2009). Influence of probiotic feeding duration on disease resistance and immune parameters in rainbow trout. Fish Shellfish Immun. 27:440-5. Shariff M, Yusoff FM, Devaraja TN, Srinivasa Rao SP (2001). The effectiveness of a commercial microbial product in poorly prepared tiger shrimp, Penaeus monodon (Fabricius), ponds. Aquac. Res. 32: 181–187.

Suzer C, Coban D, Kamaci HO, Saka S, Firat K, Otgucuoğlu Ö, Küçüksari H (2008). Lactobacillus spp. bacteria as probiotics in gilthead sea bream (Sparus aurata, L.) larvae: effects on growth performance and digestive enzyme activities. Aquaculture, 280: 140145. Tovar-Ramírez D, Mazurais D, Gatesoupe JF, Quazuguel P, Cahu CL, Zambonino-Infante JL (2010). Dietary probiotic live yeast modulates antioxidant enzyme activities and gene expression of sea bass (Dicentrarchus labrax) larvae. Aquaculture, 300: 142-147. Thoreux K, Schmucker DL (2000). Kefir Milk Enhances Intestinal Immunity in Young but Not Old Rats. J. Nutri. 807-812. Turan D, Kottelat M, Engin S (2009). Two new species of trouts, resident and migratory, sympatric in streams of northern Anatolia (Salmoniformes: Salmonidae), Ichthyol. Explor. Freshwaters, 20(4): 333-364. Wache Y, Auffray F, Gatesoupe FJ, Zambonino J, Gayet V, Labbe L, Quentel C (2006). Cross effects of the strain of dietary Saccharomyces cerevisiae and rearing conditions on the onset of intestinal microbiota and digestive enzymes in rainbow trout, Onchorhynchus mykiss, fry. Aquaculture, 258 (1-4): 470-478. Wang Y, Zirong X (2006). Effect of probiotics for common carp (Cyprinus carpio) based on growth performance and digestive enzyme activities. Anim. Feed Sci. Tech. 127: 283-292. Watts M, Munday BL, Burke CM (2001). cDNA sequences and organization of IgM heavy hain genes in two holostean fish. Dev. Comp. Immunol. 19: 153-164. Yanbo W, Zirong X (2006). Effect of probiotics for common carp (Cyprinus carpio) based on growth performance and digestive enzyme activities. Anim. Feed Sci. Tech. 127: 283-292. Zacconi C, Parisi MG, Sarra PG, Dallavalle P, Bottazzi V (1995). Competitive exclusion of Salmonella kedougou in kefir fed chicks. Microbiologie, Aliments, Nutrition, 12: 387-390. Zhou XX, Wang YB, Li WF (2009). Effect of probiotic on larvae shrimp (Penaeus vannamei) based on water quality, survival rate and digestive enzyme activities. Aquaculture, 287: 349-353.

African Journal of Biotechnology Vol. 11(30), pp. 7781-7788, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3719 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Molecular cloning and characterization of a novel Cys2/His2-type zinc finger protein gene from chrysanthemum Qing-Lin Liu1*, Jiao Wu1, Ke-Dong Xu2, Liang-Jun Zhao3 and Hai-Qing Zhang1 1

Department of Ornamental Horticulture, Sichuan Agricultural University, 211 Huimin Road, Wenjiang District, Chengdu, Sichuan 611130, P. R. China. 2 Key Laboratory of Plant Genetics and Molecular Breeding, Department of Life Science, Zhoukou Normal University, East Wenchang Street, Chuanhui District, Zhoukou, Henan 466001, P. R. China. 3 Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, 2 Yuanmingyuan West Road, Haidian District, Beijing 100193, P. R. China. Accepted 27 January, 2012

A novel member of the Cys2/His2-type zinc finger protein gene family, designated DgZFP3, was isolated from chrysanthemum by rapid amplification of cDNA ends (RACE). The DgZFP3 encodes a protein of 248 amino acids, including two conserved Cys2/His2-type zinc finger motifs with a plant-specific QALGGH motif in each zinc finger domain, a B-box (KXKRSKRXR) domain in the N-terminal region as a putative nuclear localization signal (NLS), a L-box (EXEXXAXCLXXL) and an EAR-box (DLNL) at C-terminus. Subcellular localization showed the presence of DgZFP3 in the nucleus. The transcript of DgZFP3 was enriched in roots and leaves than in stems and flowers of the adult chrysanthemum plants. Expression patterns revealed that DgZFP3 was strongly induced by NaCl, drought, cold and abscisic acid (ABA) treatment in the seedlings. We argued that DgZFP3 is a new member of the Cys2/His2-type zinc finger protein gene family, and it may be involved in the plant responses to various stresses. Key words: Chrysanthemum, DgZFP3, gene expression, Cys2/His2-type zinc finger protein. INTRODUCTION Drought, high salinity and temperature stress including low or high temperature are adverse environmental conditions that limit plant growth and development. In response to these adversities, plants can increase tolerance or adaptation to stress conditions via a series of physiological, cellular and molecular processes culminating in stress tolerance. Multiple signal pathways regulate the various abiotic stress responses of plants

*Corresponding author. E-mail: liuqinglin@126.com. Tel/Fax: +86-28-86290881. Abbreviations: ABA, Abscisic acid; CaMV, the cauliflower mosaic virus; NLS, nuclear localization signal; GFP, green fluorescent protein; RACE, rapid amplification of cDNA ends; qRT-PCR, quantitative real-time reverse transcriptasepolymerase chain reaction.

(Shinozaki and Yamaguchi-Shinozaki, 2007; Nakashima et al., 2009). Based on stress signal transduction, transcription factors such as AP2/EREBP, bZIP, NAC, MYB, MYC, WRKY and Cys2/His2-type zinc finger proteins, activate the expression of many stress-related downstream genes, and finally increase tolerance or adaptation to stress conditions in plants (Agarwal et al., 2006; Chinnusamy et al., 2006; Umezawa et al., 2006). Among them, the Cys2/His2-type zinc finger proteins received much attention in the past decade. Since ZPT21 was isolated from petunia(Petunia hybrida), the Cys2/His2-type zinc finger proteins genes have been isolated from a wide variety of plants such as Arabidopsis, rice (Oryza sativa), maize (Zea mays), soybean (Glycine max), wheat (Triticum aestivum), pepper (Capsicum annuum), etc (Baltz et al., 1992; Sakamoto et al., 2000; Kim et al., 2001, 2004; Huang et al., 2007; Kam et al., 2008). Several Cys2/His2-type zinc

7782

Afr. J. Biotechnol.

finger proteins genes such as STZ, SCOF-1, ZPT2-3, DgZFP, etc, have been implicated in the regulation of stress responses (Sakamoto et al., 2000; Kim et al., 2001; Sugano et al., 2003; Mittler et al., 2006, Liu et al., 2010a). However, the Cys2/His2-type zinc finger proteins genes have been studied in only a limited number of plant species. Therefore, it is necessary that more Cys2/His2-type zinc finger proteins genes be identified and characterized to assess more comprehensively, an overall picture of Cys2/His2-type zinc finger proteins genes regulation. Chrysanthemum is an important ornamental plant in the world. However, chrysanthemum-growing areas are subject to extreme drought, high salinity and low temperature, each of which can affect chrysanthemum growth and production. Now, isolation and characterization of novel stress-responsive Cys2/His2-type zinc finger protein genes in chrysanthemum is critical to further our understanding of the molecular mechanisms governing chrysanthemum stress response and tolerance, ultimately leading to enhancement of stress tolerance in chrysanthemum through genetic manipulation. To date, there are few reports on the characterization of the Cys2/His2type zinc finger protein genes from chrysanthemum (Liu et al., 2010a, b). In this study, we isolated a Cys2/His2type zinc finger protein gene from chrysanthemum, designated DgZFP3. Furthermore, the expression of DgZFP3 was induced by salt, drought, cold and abscisic acid (ABA) stresses.

sequenced (Invitrogen, Beijing).

RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR) assay Total RNA from various chrysanthemum tissues was extracted by Trizol reagent (Mylab, Beijing) underlying with the manufacturer’s instructions; putative genomic DNA contamination was removed by DNaseI. The first strand cDNA was synthesized with 1 µg total RNA and 1 µl superscript II enzyme (Invitrogen, USA) according to the manufacturer’s protocol. Quantitative real-time PCR assay was performed using SYBR Green I (TOYOBO, Japan) by a Bio-RAD iCycler iQ5 Machine. The primers were designed to amplify a 130 bp fragment of the DgZFP3 sequence (forward 5'-TTGTTACAGTAGTAAAGATCCGTTT-3' and reverse 5'-CTACACAAACGGATCTTTACTACTG-3'). The chrysanthemum actin gene (GenBank accession number: AB205087) was used as a reference (forward 5'-CCAGTGGTCGTACAACTGGCATT-3' and reverse 5'-CAGTCAGATCACGACCAGCAAGATC-3'.). A 25 μl PCR amplification mixture contained 10 μl SYBR Green PCR master mix, 0.2 μM of each primer and 12 ng cDNA. The PCR was performed as follows: an initial denaturation of 95°C for 3 min, followed by 40 cycles of 10 s at 94°C, 20 s at 58°C, 50 s at 72°C, followed by a final elongation of 10 min at 72°C. The resulting data were represented by means ± standard deviation (SD) of three replicates. Relative expression levels were calculated by the 2- CT method, where CT = (CT, target-CT, actin gene) the indicated time treatment-(CT, target－CT, actin gene ) 0 h treatment (Livak and Schmittgen, 2001). The data were scaled by setting the expression of DgZFP3 in untreated leaves at 0 h as 1.

Subcellular localization MATERIALS AND METHODS Plant materials and stress treatments Chrysanthemum (Dendronthema grandiform) cv. Jinba seedlings growing in greenhouse were exposed to air on filter paper for dehydration, or subjected to 4°C cold stress. For salt and ABA treatments, seedlings were put in 200 mM NaCl, and 0.1 mM ABA solution, respectively. Each experiment contained three biological replicate. All excised leaf samples of controlled and treated plants were taken out for treatment for 0, 1, 3, 6, 12 and 24 h, respectively, and then frozen immediately in liquid nitrogen, and stored at -80°C for RNA extraction.

The DgZFP3 ORF were cloned into the SacI and EcoRI sites of the pSAT6-GFP-N1 vector. This vector contains a modified red-shifted green fluorescent protein (GFP) at EcoRI-NcoI sites. The DgZFP3GFP construct was transformed into onion epidermal cells by particle bombardment as described earlier (Wang and Fang, 2002). The transient expression of the DgZFP3-GFP fusion protein was observed using confocal microscopy.

Sequence alignment and phylogenetic tree analysis The sequence alignment of DgZFP3 and other plant Cys2/His2-type zinc finger proteins amino acid sequences were compared by DNAMAN (ver 6.0) and the phylogenetic tree was constructed by neighbor-joining method with MEGA program (ver 4.1).

Isolation of the DgZFP3 gene For 3' rapid amplification of cDNA ends (RACE), one primer was designed GSP1 (5'-CA(A/G)GCI(T/C)TIGGIGGICA(C/T)-3') corresponding to conversed regions of the amino acid QALGGH. Primers for 5' RACE were: GSP2, 5'-CCGCTAGCTGATGAGGTCGTTGT-3' and GSP3, 5'-TACAAATTGTTGGTGTTGTAGTTGC-3'. The RACE reactions were performed according to the manufacturer’s protocol (Takara RACE cDNA amplification kit, Japan). A single full-length cDNA sequence by combining the 5'-RACE fragment and 3'-RACE fragment was obtained. Finally, a pair of primers (F1, 5'CTCTTAAATTAATAATAATACTCTTA-3' and F2, 5'-CATACAAATTAAATTCACGAAATAC-3') was then designed from the putative 5' and 3' untranslated region (UTR) of the full-length cDNA sequence. The resultant DNA fragments and RACE products were purified by agarose gel and cloned into pMD18-T Vector (Takara) and

RESULTS Isolation of the DgZFP3 gene from chrysanthemum Based on the conserved regions of Arabidopsis ZAT10 and chrysanthemum DgZFP, degenerate primers to conduct the 3'-RACE were proposed to obtain a 643 bp fragment from leaves of chrysanthemum. The full-length cDNAs was obtained by 5'-RACE, and were designated as DgZFP3 (Genbank accession no. JQ040514). Sequence analysis showed that the DgZFP3 cDNA was986 bp in length, including a complete open reading

Liu et al.

7783

Figure 1. Nucleotide and deduced amino acid sequences of DgZFP3 (GenBank accession no. JQ040514). The Cys2/His2-type zinc finger motifs are underlined.

frame of 747 bp flanking with a 5'-UTR of 42 bp and a 3'UTR of 197 bp (Figure 1). The predicted protein of DgZFP3 was composed of 248 amino acids with a calculated molecular mass of 26.36 kDa and its theoretical isoelectric point was 9.27. The predicted amino acid sequence of the DgZFP3 protein was compared with other plant Cys2/His2-type zinc finger proteins from rice, soybean, chrysanthemum, petunia, pepper and Arabidopsis by DNAMAN (Version 6.0) (Figure 2). DgZFP3 contains two conserved Cys2/His2-type zinc finger motifs with a plant-specific QALGGH motif in each zinc finger domain, a B-box (KXKRSKRXR) domain in the N-terminal region as a putative nuclear localization signal (NLS), a L-box (EXEXXAXCLXXL) and an EAR-box (DLNL) at C-

terminus. The plant Cys2/His2-type zinc finger proteins were then retrieved for construction of a neighbor-joining phylogenetic by MEGA 4.1 (Figure 3). Phylogenetic analysis revealed that DgZFP3 was clustered with ZAT10 and DgZFP, and more closely related to DgZFP.

Expression analysis of DgZFP3 The spatial-specific expression of DgZFP3 in different tissues at the adult stage was determined by real-time RT-PCR. The results show that DgZFP3 transcripts is more abundant in roots and leaves than in stems and flowers (Figure 4A). To investigate the expression patterns of DgZFP3 gene

7784

Afr. J. Biotechnol.

Figure 2. Comparison of the deduced amino acid sequence of DgZFP3 and other plant Cys2/His2-type zinc finger proteins. The comparison was conducted by DNAMAN (version 6.0). The Cys2/His2-type zinc finger motif, B-box, L-box and EAR-box are indicated. Arabidopsis thaliana (ZAT10, AF250336; ZAT12, CCA67232.1; AZF1, BBA85108.1; AZF2, AAG10143); Capsium annuunm (CAZFP1, AAQ10954); Glycine max (SCOF1, AAB39368) and Petunia hybrida (ZPT2-3, BAA05079); Oryza sativa (ZFP179, AAL76091.1); chrysanthemum (DgZFP, GQ392036; DgZFP2, JQ031154).

Liu et al.

7785

Figure 3. Phylogenetic tree analysis of DgZFP3 and other plant Cys2/His2-type zinc finger proteins. The tree was constructed by neighbor-joining method with MEGA program (ver 4.1). Branch numbers represent percentage of bootstrap values in 1000 sampling replicates and scale indicates branch lengths. The accession numbers were as follows: ZAT10 (AF250336), ZAT12 (CCA67232.1), AZF1 (BBA85108.1), AZF2 (AAG10143), CAZFP1 (AAQ10954), SCOF1 (AAB39368), ZPT2-3 (BAA05079), ZFP179 (AAL76091.1), DgZFP (GQ392036) and DgZFP2 (JQ031154).

under stress such as high salinity, drought, low temperature and exposure to ABA, the analysis with real-time RT-PCR was performed, respectively. The expression of DgZFP3 was kept at low affected level in normal conditions (Figures 4B to E). For salt stress, the concentration of DgZFP3 mRNA was up-regulated 1 h after 200 mM NaCl treatment and was maintained constant up to 12 h by 200 mM NaCl treatment (Figure 4B). By drought treatment, the expression level of DgZFP3 began to increase after 3 h and gradually accumulated up to 24 h (Figure 4C). The expression of DgZFP3 peaked within 6 h and gradually decreased in response to cold treatment (Figure 4D). The expression of DgZFP3 peaked within 3 h after the beginning of the ABA treatment and gradually decreased by 3 h post imposition of ABA treatment (Figure 4E). Real-time RTPCR analysis revealed that the expression of DgZFP3 could be induced by salt, drought, cold and ABA. Localization of DgZFP3 in the nucleus The deduced amino acid sequence contained a B-box (KXKRSKRXR) domain in the N-terminal region as a putative NLS, suggesting that DgZFP3 might interact with

the cell nuclear system. To examine the subcellular localization of DgZFP3 in living cells, a construct containing DgZFP3 fused in frame with the GFP (DgZFP3-GFP) driven by CaMV 35S promoter was transiently expressing in onion epidermal cells. As shown in Figure 5, confocal microscopic examination shows that the DgZFP3-GFP fusion protein was targeted into the nuclear 4',6-diamidino-2-phenylindole (DAPI) staining, whereas the control GFP alone was distributed in the entire cytoplasm. DISCUSSION Some Cys2/His2-type zinc finger protein genes in plants usually play critical roles in response to abiotic stresses (Ciftci-Yilmaz and Mittler, 2008). A plant Cys2/His2-type zinc finger protein gene termed DgZFP3 from chrysanthemum was isolated and characterized in the present work. Sequence analysis shows that it contained two conserved Cys2/His2-type zinc finger motifs with a plant-specific QALGGH motif in each zinc finger domain, a B-box (KXKRSKRXR) domain in the N-terminal region as a putative nuclear NLS, a L-box (EXEXXAXCLXXL) and an EAR-box (DLNL) at C-terminus. The DgZFP3 was

7786

Afr. J. Biotechnol.

Figure 4. Expression patterns of DgZFP3 in different organs and in response to various treatments. Mean values and standard deviation calculated from triplicated assays. The relative expression of DgZFP3 in untreated leaves was used as CK. (A) Expression patterns of DgZFP3 in roots, stems, leaves and flowers under normal conditions. (B) Salt treatment; (C) drought treatment; (D) cold treatment; (E) ABA treatment.

structurally similar to DgZFP which was isolated from chrysanthemum under high-salt, drought and cold stresses (Liu et al., 2010a). Phylogenetic analysis revealed that DgZFP3 was clustered with ZAT10 and DgZFP, and more closely related to the DgZFP. These results indicate that DgZFP3 is a novel member of the plant Cys2/His2-type zinc finger protein genes family. The subcellular localization of the DgZFP3-GFP fusion protein in the nuclear DAPI staining implied the role of DgZFP3 as a transcription factor. The mRNA expression analysis shows that DgZFP3 substantially induced by the treatment of NaCl, drought, cold, ABA and DgZFP3 may be involved in the abioticstress response via the ABA-dependent pathway. The expression patterns of DgZFP3 were similar to ZPT2-3, ZAT10, ThZF1 and ZFP179 during several different stresses (Sugano et al., 2003; Mittler et al., 2006; Xu et

al., 2007; Sun et al., 2010). Petunia ZPT2-3 and Arabidopsis STZ/ZAT10 containing an EAR-box (DLNL) have exhibited transcription repressive activities by transient analysis in plants (Sugano et al., 2003; Sakamoto et al., 2004). However, several zinc finger proteins containing the EAR-box (DLNL) have exhibited transcriptional activation activity in yeast cells, such as rice ZFP179 and Thellungiella halophila ThZF1 (Xu et al., 2007; Sun et al., 2010). Previous report showed that the EAR-box (DLNL) is directly involved in transcriptional regulatory networks in response to abiotic stresses in plants, and DgZFP3 also contains an EAR-box (DLNL) at its C-terminus. Thus, further experiments are required to identify the possible function of DgZFP3 as a transcription activator or repressor. To our knowledge, this work is the first report on the cloning and expression of a novel Cys2/His2-type zinc

Liu et al.

7787

Figure 5. Subcellular localization of DgZFP3. Transient expression in onion epidermal cells of 35S-GFP and 35S-DgZFP3-GFP translational product was visualized by fluorescence microscopy. The transient vector harboring 35S-GFP and 35S-DgZFP3-GFP cassettes were transformed into onion epidermal cells by particle bombardment. The photos were taken in bright light (A and D), in the dark for GFP images (B and E) and DAPI-stained images (C and F) after incubation for 20 h.

finger protein gene termed DgZFP3 from chrysanthemum. Clarifying the possible functions of DgZFP3 under various stresses will be helpful for the enhancement of stress tolerance in chrysanthemum through genetic manipulation. The important functions of DgZFP3 responding to environmental stimuli in chrysanthemum needs further investigation. ACKNOWLEDGEMENTS This research was supported by the Key Scientific Research Project of Education Department of Sichuan Province (10ZA051) and Sichuan Agricultural University Scientific Fund to Undergraduate Research and Innovation Projects (04050838). We thank Prof. Tao Wang (State Key Laboratories of AgroBiotechnology, China Agricultural University) for providing the pSAT6GFP-N1 vector. REFERENCES Agarwal PK, Agarwal P, Reddy MK, Sopory SK (2006). Roles of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 25: 1263-1274. Baltz R, Domon C, Pillay DTN, Steinmetz A (1992). Characterization of a pollen-specific cDNA from sunflower encoding a zinc finger protein. Plant J. 2: 713-721. Chinnusamy V, Zhu J, Zhu JK (2006). Gene regulation during cold acclimation in plants. Physiol Plant. 126: 52-61. Ciftci-Yilmaz S, Mittler R (2008). The zinc finger network of plants. Cell

Mol. Life Sci. 65: 1150-1160. Huang J, Yang X, Wang MM, Tang JH, Ding LY, Shen Y, Zhang HS (2007). A novel rice C2H2-type zinc finger protein lacking DLNbox/EAR-motif plays a role in salt tolerance. Biochimica et Biophysica Acta. 1769: 220-227. Kam J, Gresshoff P, Shorter R, Xue GP (2008). The Q-type C2H2 zinc finger subfamily of transcription factors in Triticum aestivum is predominantly expressed in roots and enriched with members containing an EAR repressor motif and responsive to drought stress. Plant Mol. Biol. 67: 305-322. Kim JC, Lee SH, Cheong YH, Yoo CM, Lee SI, Chun HJ, Yun DJ, Hong JC, Lee SY, Lim CO, Cho MJ (2001). A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants. Plant J. 25: 247-259. Kim SH, Hong KH, Lee SC, Sohn KH, Jung HW, Hwang BK (2004). CAZFP1, Cys2/His2-type zinc-finger transcription factor gene functions as a pathogen-induced early-defense gene in Capsicum annuum. Plant Mol. Biol. 55: 883-904. Liu QL, Xu KD, Ma, N, Zeng L, Zhao LJ (2010a). Isolation and functional characterization of DgZFP: a gene encoding a Cys2/His2type zinc finger protein in chrysanthemum. Mol. Biol. Rep. 37: 11371142. Liu QL, Xu KD, Zeng L, Ma N, Zhao LJ (2010b). Molecular characterization and expression of DgZFP1, a gene encoding a single zinc finger protein in chrysanthemum. Afr. J. Biotechnol. 9(15): 2210-2215. Livak K, Schmittgen T (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-(Delta Delta C(T)) method. Methods, 25: 402-408. Mittler R, Kim Y, Song L, Coutu J, Coutu A, Ciftci-Yilmaz S, Lee H, Stevenson B, Zhu JK (2006). Gain- and loss-of-function mutations in Zat10 enhance the tolerance of plants to abiotic stress. FEBS Lett. 580: 6537-6542. Nakashima K, Ito Y, Yamaguchi-Shinozaki K (2009). Transcriptional regulatory networks in response to abiotic stresses in Arabidopsis and grasses. Plant Physiol. 149: 88-95. Sakamoto H, Araki T, Meshi T, Iwabuchi M (2000). Expression of a

7788

Afr. J. Biotechnol.

subset of the Arabidopsis Cys2/His2-type zinc-finger protein gene family under water stress. Gene. 248: 23-32. Sakamoto H, Maruyama K, Sakuma Y, Meshi T, Iwabuchi M, Shinozaki K, Yamaguchi-Shinozaki K (2004). Arabidopsis Cys2/His2-type zincfinger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions. Plant Physiol.136: 27342746. Shinozaki K, Yamaguchi-Shinozaki K (2007). Gene networks involved in drought stress response and tolerance. J. Exp. Bot. 58: 221-227. Sugano S, Kaminaka H, Rybka Z, Catala R, Salinas J, Matsui K, OhmeTakagi M, Takatsuji H (2003). Stress-responsive zinc finger gene ZPT2-3 plays a role in drought tolerance in petunia. Plant J. 36: 830841. Sun SJ, Guo SQ, Yang X, Bao YM, Tang HJ, Sun H, Huang J, Zhang HS (2010). Functional analysis of a novel Cys2/His2-type zinc finger protein involved in salt tolerance in rice. J. Exp. Bot. 61: 2801-2818.

Umezawa T, Fujita M, Fujita Y, Yamaguchi-Shinozaki K, Shinozaki K (2006). Engineering drought tolerance in plants: discovering and tailoring genes to unlock the future. Curr. Opin. Biotechnol. 17: 113122. Wang GL, Fang HY (2002). Gene engineering in plant; 2nd edition. Press of Science, Beijing, pp. 734-736. Xu S, Wang X, Chen J (2007). Zinc finger protein 1 (ThZF1) from salt cress (Thellungiella halophila) is a Cys-2/His-2-type transcription factor involved in drought and salt stress. Plant Cell Rep. 26: 497506.

UPCOMING CONFERENCES 2012 International Conference on Biotechnology and Food Engineering ICBFE 2012 Dubai, UAE. August 4-5, 2012

15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012

Conferences and Advert August 2012 International Conference on Biotechnology and Food Engineering (ICBFE 2012) Dubai, UAE, 4 Aug 2012 September 2012 Agricultural Biotechnology International Conference (ABIC2012), Christchurch, New Zealand, 1 Sep 2012 15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012 October 2012 Biotechnology and Bioinformatics Symposium, Provo, USA, 25 Oct 2012

African Journal of

Biotechnology Related Journals Published by Academic Journals

■ ■ ■ ■ ■ ■

Journal of Evolutionary Biology Research Journal of Yeast and Fungal Research Journal of Brewing and Distilling African Journal of Biochemistry Research African Journal of Food Science African Journal of Plant Science

African Journal of Biotechnology Vol. 11(30), pp. 7684-7692, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.485 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Propagation physiology of Juniperus phoenicea L. from Jordan using seeds and in vitro culture techniques: Baseline information for a conservation perspective Ezz AL-Dein Al-Ramamneh1*, Susan Dura2 and Nidal Daradkeh2 1

Department of Agricultural Sciences, AL-Shouback University College, Al-Balqa Applied University, AL -Shouback, Maan, Jordan. 2 Department of Biotechnology, National Center for Agricultural Research and Extension, Baq'a 19381, Jordan. Accepted 22 March, 2012

Seeds of Juniperus phoenicea L. collected from Shouback city, south of Jordan, were cold-moist stratified at 5°C for 1 and 3 months. Non-stratified seeds were used as the control. The recalcitrant nature of J. phoenicea was clear as shown by low germinability of seeds. The highest germination percentage was recorded for seeds stratified for three months. Germination bioassay of wheat grains indicated that stratification is a prerequisite for the germination of J. phoenicea seeds and that reduction in inhibitors found in mature seeds occurred with longer stratification periods. In a separate set of experiments, in vitro culture of J. phoenicea, using shoot tips with axillary buds from young seedlings and mature seeds from adult trees as explants was attempted. Explants were established on Murashige and Skoog (MS), and Rugni Olive (OM) media. The effects of kinetin (kin), 6-benzyl amino purine (BAP) and thidiazuron (TDZ) on the differentiation of axillary buds were tested at 0.5 mg/L and compared with that using plane media without hormones. Mature seeds were completely contaminated one month after culture establishment. The grooves along the surface of the seeds may have increased the chance for latent microbes to grow with prolonged culture time. In contrast, shoot tips with axillary buds responded better than seeds in vitro. Key words: Germination, in vitro culture, recalcitrance, seed morphology, thidiazuron (TDZ).

INTRODUCTION The genus Juniperus consists of 67 species and 37 varieties. All the taxa grow in the northern hemispheres, except J. procera, which grows along the Rift Mountains in east Africa into the southern hemisphere (Adams, 2004). J. phoenicea is an evergreen monoecious or dioecious tree native to some regions of the Mediterranean basin from Portugal to Lebanon, Jordan and Western Saudi Arabia, and North Africa in Algiers, Morocco and Egypt, as well as the Canary Islands

*Corresponding author. E-mail: ezznew@hotmail.com. Tel: +962 775211825. Fax: +962 32165035. Abbreviations: MS, Murashige and Skoog; OM, Rugni Olive media; Kin, kinetin; BAP, 6-benzyl amino purine; TDZ, thidiazuron.

(Adams et al., 2002; Adams, 2004; El-Bana et al., 2010). J. phoenicea is a small tree, normally 6 to 8 m tall, or sometimes only a shrub with scaly leaves and brown to reddish 8 to 14 mm cones that usually contain on average five seeds (Adams, 2004; Mazur et al., 2003; Piotto et al., 2003). These plants grow in areas characterized by persistent drought and arid climate with high temperature ranges (El-Bana et al., 2010). A reproductive cycle of about 20 months, from cone differentiation to seed dispersal has been reported in J. phoenicea subsp. phoenicea, while in J. phoenicea subsp. turbinata it is two years (Arista et al., 1997). J. phoenicea occurs in the southern part of Jordan, usually at high altitudes, over 1000 m, on sandy rocks (Syouf and Duwayri, 1996; AlQura’n, 2005). Juniperus species are used for many purposes including landscaping, wood and medicinal purposes (Dale and Greenway, 1961; Lind and Morrison,

Al-Ramamneh et al.

1974; Loureiro et al., 2007). J. phoenicea is used largely in traditional medicine to treat diarrhea (Qnais et al., 2005). Leaves and berries of this plant are used to prepare mixtures that act as an oral hypoglycaemic agent (Amer et al., 1994). Oils isolated from leaves showed also inhibition effects against bacteria and fungi (Mazari et al., 2010). Lack of pollination, low pollen viability and / or embryo degeneration are important causes for reduced seed production in Juniperus (Ortiz et al., 1998). Furthermore, it is reported for the genus Juniperus like J. communis and J. sabina L. that seed quality tends to decrease in drier and or colder regions (Garcia et al., 2000; Wesche et al., 2005) and only very small percentage of the collected cones contain viable seeds (Wesche et al., 2005). J. phoenicea, similar to other Juniperus species, does not have a high rate of plant production through seed germination (Ortiz et al., 1998). Moreover, it is not efficiently propagated by traditional methods and results are extremely inconsistent and not reproducible (Brito, 2000). Piotto et al. (2003) reported that no completely effective pre-treatments are known that will improve germination for J. phoenicea from Mediterranean countries. However, they suggested cold treatments of naked seeds at 3 or 4°C for 30 to 90 days. Moreover, some nurseries in Sardinia sow seeds of J. phoenicea in October and transplanting of the seedlings usually occurs the following March (Piotto et al., 2003). Stratification was also recommended at 3 to 5°C for 6 to 8 weeks to get good germination in seeds of J. procera depending on the collection site and seed lot (Tigabu et al., 2007). Tissue culture had emerged as a tool to improve the propagation of many plants. Gomez and Segura (1995) reported the proliferation of J. oxycedrus by axillary shoots and later found some morphogenic capacity in calluses derived from single cell culture of the same species (Gomez and Segura, 1996). Harry et al. (1995), reported plantlet regeneration using embryogenic explants of J. cedrus. The induction of adventitious buds was achieved on excised cotyledon segments and embryo explants of J. excelsa (Negussie, 1997). Explants with axillary buds prepared from microcuttings of mature plants were used for the micropropagation of Portuguese J. phoenicea and J. narvicularis (Loureiro et al., 2007; Castro et al., 2011). The shoot branching process generally involves the formation of axillary meristems in leaf axils and the growth of axillary buds (Shimizo -Sato and Mori, 2001). The mechanisms of axillary bud growth depend on the ratio of the plant hormones auxin and cytokinin. Regulation of initiation and outgrowth of axillary meristems is important for controlling the overall plant growth and architecture (Shimizo-Sato and Mori, 2001). Due to the prevailing drought conditions in the southern part of Jordan and the difficulty of J. phoenicea plant regeneration through seeds, this plant is considered as an endangered plant species. This is true as Jordanian J. phoenicea trees were noticed to dry in the last few years

7685

in its natural habitats. Furthermore, the over-exploitation of forest trees timber as heat-generating source in winter, in light of the increasing prices of oil, has contributed to the gradual decline of this plant species. To the best of our knowledge, Juniperus species have not been investigated in relation to their level of physiological dormancy. Furthermore, only one study on the in vitro regeneration of J. phoenicea using explants with axillary buds from mature trees has been reported (Loureiro et al., 2007). In Jordan, no reports were published on the propagation of J. phoenicea. This research, therefore, was undertaken to understand the propagation physiology of J. phoenicea in order to develop methods for mass production through seeds and vegetative means. For this purpose the following objectives were investigated: the effects of stratification on the germination of seeds collected from Shouback south of Jordan, physiology of seed germination and dormancy in J. phoenicea utilizing wheat grains germination bioassay, and the effects of hormones and media on the in vitro regeneration of J. phoenicea using mature seeds and axillary buds of young seedlings. MATERIALS AND METHODS Study area and cones collection Mature reddish Cones of J. phoenicea were collected from its habitat (Al-Jhayer Mountains), approximately 1700 m above sea level, latitude 30° 31′ N, longitude 32° 35′ E, in Shouback region in the Southern part of Jordan. The soil of the seed collection site is silt loam with pH of 7.7 and EC of 0.47 (dS/m). The mean annual temperature, precipitation and relative humidity of shouback were 13.3°C, 176.5 mm and 59.9%, respectively (the data was obtained from the National Meteorological Department of Jordan). Cones were harvested from the periphery of infections- and insects- free trees based on visual inspection. Usually, cones were collected from the upper part of small to medium-sized trees. The height and diameter measured at breast height of J. phoenicea trees were variable and ranged from (2 to 10 m) and (30 to 80 cm), respectively. The cone and seed characteristics are given in Table 1. The cones served as the starting material for seed germination tests. Seed extraction Cones of J. phoenicea were soaked in distilled water for 24 h, which allowed for the softening of the hard pericarp of the fruits. The seeds were then manually extracted from cones and kept at room temperature for later experiments. Morphological features of the seeds The morphological features of seeds obtained from mature cones were observed and photographs were taken to identify seed coat morphology using Labomed 7GA9 microscope (USA, SN: 09010289) (Program Software::Progres Capture Pro 2.7.7). Cold-moist stratification and nursery experiments Seeds collected in 2008 were soaked in distilled water for 24 h.

7686

Afr. J. Biotechnol.

Then un-imbibed or damaged seeds were excluded. Seeds were placed in perforated plastic bags filled with moistened perlite and were placed in a refrigerator at 5°C for 1 and 3 months. Nonstratified seeds served as the control. Bags containing seeds were checked periodically for moisture availability and were moistened with the fungicide Seed Guard at 1g/L. The seeds stratified for 1 and 3 months as well as non-stratified seeds (control) were allowed to germinate in plastic trays filled with peat and perlite at (2:1) ratio, respectively. The seeds were placed in the greenhouse in National Center for Agricultural Research and Extension (NCARE) in Baqa´a city North of Jordan. The trays were irrigated when needed with tap water and every two weeks with 1g/L benomyl fungicide. The germination process was monitored every two days for 100 days and considered as the emergence of new seedlings. The following parameters were determined: germination capacity (GC) and mean germination time (MGT). GC is the proportion of total number of germinated seeds to that of sown seeds expressed in percentage. MGT was calculated as follows: MGT (days) = ∑(tini)/ ∑ni Where, ti is the number of days starting from the date of sowing and ni is the number of seeds germinated at each day (Bewley and Black, 1994). The total number of seeds per treatment was 216 seeds in four replicates (54 seeds per replicate) and the experiment had a completely randomized design. Biological determination of inhibitors to J. phoenicea seeds germination (wheat germination bioassay) To determine the promotion or inhibition in germination of wheat grains by extracts obtained from seeds of J. phoenicea stratified for 1 and 3 months as well as extracts of non-stratified seeds. The promotion in grains germination acted as an indicator for the change in seed inhibitors of J. phoenicea in response to increased stratification period. This, in turn, could explain the germination behavior of seeds of J. phoenicea stratified for the assigned durations. This procedure was based on several reports utilizing wheat coleoptiles bioassay, barley endosperm bioassay and bioassay utilizing Brassica camprestris L. seeds (Al-Ramamneh, 1998; Boucaud and Ungar, 1973; Zhou and Bau, 2011) Sensitivity of wheat grains to filtrates of J. phoenicea seeds This aimed at determining extract concentration of J. phoenicea seeds that can induce minimum germination of wheat grains. Extracts of J. phoenicea from seeds collected in 2010 were prepared using a modified procedure of Saxena et al. (1996). Seeds were ground in a blender to give a fine powder. The dry tissue was extracted with distilled water to prepare concentrations of 100, 33 and 20 g/L. The seed powder solutions were homogenized by stirring gently for 10 min. The extract was then filtered through Whatman no. 1 filter paper and the filtrate was collected. Wheat grains cv. Hourani were germinated on filter paper on 9-cm Petri dishes. Then 5 ml of each prepared extract (100, 33 and 20 g/L filtrates) was added to each Petri dish containing wheat grains. Distilled water was used as a positive control for the germination of wheat grains. The Petri dishes were kept at 23 to 25°C. Each treatment consisted of three replicates of 10 grains each in a completely randomized design (a total of 30 grains). At the end of a 5-day germination period, the following parameters were recorded for wheat grains: GC, coleoptiles length, number and length of seminal roots. In vitro culture Microcuttings from young seedlings of J. phoenicea (3-year old)

obtained from the Forestry Department in Shouback and mature seeds from adult plants provided explants for tissue culture techniques.

Preparation and sterilization of the plant material Cuttings from terminal branches of the young seedlings were first washed in tap water, and then treated with household detergent for five minutes. This was followed by washing cuttings with tap water to remove all the traces of the detergent. Cuttings were immersed in 2.5% active chlorine from sodium hypochlorite for 15 min and then washed three times with sterilized distilled water. Cuttings were then divided to provide explants that consisted of shoot tips 1.5 cm in length (containing three axillary buds). The mature seeds were sterilized using the same procedure employed for the cuttings.

Influence of medium composition and growth regulators The resulting explants were cultured in tubes (25 mm × 150 mm) on approximately 20 ml of either MS (Murashige and Skoog, 1962) or OM (Rugini, 1984) media supplemented with kinetin, thidiazuron (TDZ) and 6-benzyl amino purine (BAP) at 0.0 or 0.5 mg/L. All cultures were incubated in growth chamber at 25±2°C, with a 16-h photoperiod and illuminated by 40 W (watts) white fluorescent lights. The experiments were arranged in a completely randomized design with ten replicates. Each replicate was the average readings for three explants (total 30 explants for each treatment). Shoot survival and morphological characters as number of shoots per explant, shoot length, number of branches per explant and branch length were evaluated three weeks after culture establishment. In vitro cultures lasted for two months to collect more observations. The formation of callus on explants was also evaluated.

Statistical analysis All the described experiments were repeated twice. The data were analyzed with a general linear model using the Statistical Analysis System (SAS, 2001) and least significant difference (LSD) test at 5% probability level was applied to compare the treatment means.

RESULTS Morphological features of the seeds J. phoenicea trees produce small cones (mean cone weight equals 0.25 g), each containing 5 small seeds (Table 1). The cones are green-colored and become reddish when mature. The shape of seeds in J. phoenicea is ovoid. However, seeds tend sometimes to be tapered at both ends. They are wrinkled and characterized by the presence of protrusions and furrow-like grooves along their surface (Figure 1A to C). Seed germination stratification

in

response

to

cold-moist

Stratification had a significant effect (P<0.01) on GC and MGT for seeds collected from Shouback region (Table 2). Seeds stratified for three months had significantly higher

Al-Ramamneh et al.

7687

Table 1. Morphological characteristics of cones and seeds of J. phoenicea collected from Al-Jhayer in Shouback south of Jordan.

Cone and seed characters No. of seeds / cone Cone weight (g) Seed size (mm × mm × mm) 1000 seed weight (g)

Overall mean a 4.65 ± 0.24 b 0.25 ± 0.01 c (5.03 ± 0.17) × (3.18 ± 0.13) × (2.58 ± 0.08) d 16.27 ± 0.25 a

b

c

d

The values are the mean ± standard error of (n:20), (n:30), (n:20) and (n:3).

A

B

C

Figure 1. Morphology of J. phoenicea seeds (A) Ovoid seed shape, wrinkled surface of the seed (arrow) and furrow-like grooves (arrowhead). (B) Tapered ends of the seed (arrows). (C) furrow-like grooves (arrowheads). Scale bars: 1 mm.

Table 2. Germination capacity (GC) and mean germination time (MGT) of J. phoenicea seeds from Shouback stratified at 5°C for 0, 1 and 3 months.

Parameter Control 5°C × 1 month 5°C × 3 month LSD (P=0.05)

GC 0.0±0.0c 3.2±0.8b 9.3±1.3a 2.9

MGT 0.0±0.0b 74.9±2.1a 73.4±3.6a 7.7

Control: Non-stratified seeds of J. phoenicea. Means in each column followed by the same letter are not significantly different at P<0.05.

GC (9.3%) than seeds stratified for one month (3.2%). However, MGT was on the same level of significance for seeds stratified for one and three months (74.9 and 73.4, respectively). Meanwhile, the non-stratified seeds failed to germinate. Sensitivity of wheat grains to filtrates of J. phoenicea seeds The germination of wheat grains was highly sensitive to increase in filtrate concentration of J. phoenicea seeds (P<0.01) (Table 3). The filtrate concentration of 100 g/L resulted significantly in the least germination response of

wheat grains (GC=23%). This was also coupled with the least average length (0.5 cm) of the seminal roots of the germinated grains. Wheat grains germinated in distilled water free of J .phoenicea filtrate recorded significantly the highest GC (77%), coleoptiles length (2.1 cm), mean number and length of seminal roots (4.1 seminal roots and 2.7 cm, respectively). However, data from further experiments indicated that 110 g/L filtrate of J. phoenicea seeds resulted in 10 % GC of wheat grains (Table 4) and therefore, was used as the concentration of J. phoenicea filtrate required to induce the minimum accepted germination of wheat seeds. Biological determination of inhibitors to germination of J. phoenicea seeds It is shown in Table 4 that germination of wheat grains was significantly stimulated when moistened with seedfiltrates of J. phoenicea that received longer stratification periods. In this sense, germination percentages of 10, 53 and 77 were obtained when wheat grains were moistened with filtrates of J. phoenicea seeds that were nonstratified, stratified for 1 month and those stratified for 3 months in that order, respectively. Moreover, germination efficiency of wheat seeds as indicated by coleoptile length, number and length of seminal roots was also enhanced for wheat grains that were treated with seed-

7688

Afr. J. Biotechnol.

Table 3. Effects of seed filtrate of J. phoenicea on the germination of wheat grains cv. Hourani.

Filtrate concentration (g/L) 0 20 33 100 LSD (P=0.05)

GC (%) a 77 55b 57b c 23 14.1

Coleoptile length (cm) a 2.1 0.8b 0.4b b 0.8 0.6

Number of seminal root a 4.1 ab 3.2 2.5bc c 1.7 1.4

Length of seminal root (cm) a 2.7 1.8b 1.5b c 0.5 0.7

0: Distilled water used as positive control. Means in each column followed by the same letter are not significantly different at P<0.05.

Table 4. Effects of seed filtrates (110 g/L) of J. phoenicea stratified for 0, 1 and 3 months on the germination of wheat grains cv. Hourani.

Stratification period Control 5°C × 1 month 5°C × 3 month LSD (P=0.05)

GC 10.0c b 53.3 76.7a 14.8

Coleoptile length (cm) 0.9b b 1.1 2.6a 1.3

Number of seminal roots 0.6b ab 2.3 4.0a 2.2

Length of seminal roots (cm) 0.1b ab 0.5 0.7a 0.5

Control: Non-stratified seeds of J. phoenicea. Means in each column followed by the same letter are not significantly different at P<0.05.

Table 5. Effect of basal media and growth regulators on the growth parameters of J. phoenicea three weeks after culture establishment.

Medium

MS

Growth regulator (mg/L) 0.0 0.5 KIN 0.5 BAP 0.5 TDZ

Number of shoots per explant

0.0 0.5 KIN 0.5 BAP 0.5 TDZ

OM

Number of branches per explant

0e 2.6cd 0e 2.9c

Shoot length (cm) 0d 1.3c 0d 1.5c

4.6b b 5.3 d 1.6 6.6a

LSD (P=0.05)

Callus a

0d 3.6b 0d 4.4b

Branch length (cm) 0c 1.8b 0c 2.2b

2.1b ab 2.6 c 0.9 a 3

2.4bc a 7.0 cd 0.7 8.3a

1.4b a 3.3 c 0.3 a 3.6

+ +

0.6

2.1

1.0

1.2

+ +

a

Explants consisted of shoot tips 1.5±0.2 cm with three axillary buds. Qualitative characterization of callus production: -, absence; +, presence. Means in each column followed by the same letter are not significantly

filtrates of J. phoenicea that were stratified for up to three months (Table 4). In vitro culture - Mature seed explants Mature seed explants showed microbial contamination few days after culture irrespective of media and hormones used. The contamination developed gradually to cover all cultures one month after culture establishment. Contamination varied from creamy to green areas In vitro culture - Microcutting explants Microcuttings grown on MS medium without hormones or

with 0.5 mg/L BAP failed to show any morphogenic response. These explants showed progressively necrotic areas and were browned at the end of the culture. Explants growth on OM medium without hormones were significantly better than explants grown on the same medium containing 0.5 mg/L BAP (Table 5). The best response was for explants that were grown on OM medium supplemented with 0.5 mg/L TDZ (Table 5). This medium-hormone combination stimulated axillary bud differentiation and thus significantly produced the highest number of shoots per explant (6.6). However, shoot length, number of secondary branches per explant and secondary branch length were on the same level of significance for explants grown in the presence of 0.5 mg/L TDZ or 0.5 mg/L kinetin in both media with

Al-Ramamneh et al.

significantly higher response in OM compared to MS medium. Shoots and secondary branches developed in the presence of 0.5 mg/L TDZ were thick, swelled and dark green compared to shoots formed in media containing 0.5 mg/L Kinetin. However, irrespective of the media and hormones used, it was necessary to perform sub-culturing after three to four weeks from start of the experiment. After this, shoots began browning starting from the base of the explants which gradually spread to the whole shoots and secondary branches. Prolong exposure of shoots to TDZ (2 months) caused callusing of shoots (data not shown). Callus production in the present study formed in OM and MS media when containing 0.5 mg/L Kin or TDZ. DISCUSSION Seed germination stratification

in

response

to

cold-moist

Stratification of seeds in a cold-moist medium at 5°C is recommended to overcome dormancy in many plant species, especially those from temperate regions (Baskin and Baskin, 2004). In the present study, stratification for one and three months significantly raised the GC of J. phoenicea seeds collected from Shouback region compared to non-treated seeds. However, the GC was poor and did not exceed 9.3% for seeds that was stratified for three months. In agreement with the results of the present study, seeds of J. procera collected from five provenances in Ethiopia have shown significant differences in seed germinability in response to stratification at 5°C (Tigabu et al., 2007). Furthermore, seeds of J. procera collected from Gra-Kassu, Wolf-Washa and AribGebeya provenances in Ethiopia germinated poorly (< 8%) (Tigabu et al., 2007) which is similar to the germination response of J. phoenicea seeds collected from shouback region and cold-stratified for up to three months. However, Tigabu et al. (2007) recorded a GC between 60 and 80% for seeds stratified for 6 weeks and collected from Hirna and Yabelo provenances characterized by high temperature. High temperature that prevails during seed maturation can induce an afterripening effect, which in turn enhances the growth of the embryo necessary for seed germination (Tigabu et al., 2007). The collection site (Al-Jhayer) for J. phoenicea seeds in this study is characterized by the decrease in temperature during seed maturation (from October to December), which induces dormancy and poor germination response in seeds when they mature. Physiology of J. phoenicea seed germination Grains of wheat germinated poorly when moistened with filtrate of non-stratified J. phoenicea seeds. However,

7689

germination of wheat grains was enhanced when grains were moistened with filtrate obtained from J. phoenicea seeds stratified for one month and was significantly the highest (GC: 77%) for grains that were treated with filtrate of J. phoenicea seeds stratified for up to three months. These results indicate clearly that mature seeds of J. phoenicea contained high amounts of inhibitors and that stratification was associated with a reduction in the inhibitors found in the mature seeds. Consistence with this, dormancy release of seeds in many plants involves the decrease in sensitivity of seeds to inhibitors involved in the signal transduction pathway controlling germination (Chien et al., 1998; Goggin et al., 2009; Koornneef et al., 2002; Nonogaki et al., 2010). These results highlighted the fact that stratification is a prerequisite for the successful germination of J. phoenicea seeds. This is understood by the gradual significant increase in the germination of J. phoenicea seeds that received stratification for one and three months in that order. The length of the chilling moist treatment necessary to break seed dormancy varies among different plant species. The present study indicated that mature seeds of J. phoenicea possess deep physiological dormancy as indicated by slow germination (MGT; 73.4) and poor GC (9.3%) of J. phoenicea seeds that were stratified for up to three months. This, when compared to the enhanced germination of wheat grains that were moistened with filtrate of J. phoenicea seeds stratified for up to three month, indicated that the effect of changes in inhibitors in repressing/stimulating germination of J. phoenicea seeds is probably modulated by the inhibitor/promoter ratio alongside other minor factors, in response to stratification (Piotto et al., 2003). The role of promoters, in particular gibberellins (GA), in breaking seed dormancy is well documented in many plant species (Dissanayake et al., 2010; Fang et al., 2006; Güleryüz et al., 2011; Nadjafi et al., 2006; Penfield et al., 2005; Goggin et al., 2011). This principle of inhibitors/promoters ratio was supported in earlier studies by barley endosperm bioassay and wheat coleoptile bioassay that supported the presence of an inhibitor activity and the absence of gibberellin-like activity in dormant non-treated varieties of the genus Suaeda (Boucaud and Ungar, 1973). AlRamamneh (1998) reported an increase in the germination of Tilia argentea seeds with cold stratification for up to four months, and found by utilizing wheat germination bioassay, a significant decrease in free ABA with stratification of T. argentea seeds for up to four months. Moreover, Piotto et al. (2003), pointed out that after breaking dormancy of J. phoenicea seeds, germination may be encouraged by the temperature of about +15 °C, while higher temperatures (+20/25 °C) do not seem optimal. In this respect, the germination temperature that prevailed throughout the present study (22±2) may not be optimal to induce the required increase in seed germination of J. phoenicea. The recalcitrant nature of seeds of J. phoenicea as indicated in this study could

7690

Afr. J. Biotechnol.

result from the adaptation to the particular environment where these trees grow in Al-Jhayer Mountains (approximately 1700 m above Sea level) with both cold winters and summers.

In vitro culture The contamination noticed in mature seed cultures involved, although not identified, bacterial and fungal contaminant. The failure to establish seed cultures in vitro in the present study indicates that sterilization techniques employed needs fine tuning. The morphological features of seeds in J. phoenicea seem to play a role in the contamination of the established cultures. The grooves along the surface of seeds reduced the effectiveness of surface sterilization and thus latent microbes can have the chance to develop with prolonged culture time. This is further understood in light of the fact that Juniperus species can be attacked by pest insects (GarcĂ­a, 1998; Tigabu et al., 2007) and pest-damaged seeds, in turn, may harbor infective pathogens (El Atta, 1993). The results of the present study showed that MS medium without hormones was not suitable to establish axillary bud multiplication in vitro using shoot tips as explants from young seedling of J. phoenicea. For the two media tested in this investigation, growing explants on OM medium resulted in significantly highest response in terms of shoot number per explants, shoot length, number of secondary branches and average length of secondary branches. Loureiro et al. (2007) showed the favorable response of OM medium compared to MS medium on explants from microcuttings collected from old trees of J. phoenicea in Portugal. The browning of explants that extends to shoots and secondary branches made it necessary to do subculturing after three to four weeks from the start of the experiment in the present study. Adverse conditions were also reported for the in vitro cultures of J. excelsa (Negussie, 1997). Original explants, undifferentiated adventitious domes and well differentiated buds / shoots of J. excelsa showed gradual yellowing and subsequent death. This condition might be due to physiological and / or physical causes (Negussie, 1997). Axillary bud differentiation on explants in the present study was favored in the presence of TDZ and kinetin in the media. When BAP was included in OM media, it was noticed that number of shoots, number of secondary branches and shoot elongation were significantly less than in the presence of either TDZ or kinetin. This led us to conclude that the concentration of BAP (0.5 mg/L) used in the present study was too high and toxic to the explants especially when using MS medium. BAP at 0.09 mg/L produced a better response for the in vitro culture of J. phoenicea and J. navicularis on explants from adult trees (Castro et al., 2011; Loureiro et al., 2007). TDZ effects appeared to be promising on the

stimulation of axillary bud differentiation using microcuttings from young seedling of J. phoenicea. Although how TDZ functions as a cytokinin is not known, improved regeneration using TDZ rather than cytokinins like BA is well documented in many plants (Canli and Tian, 2008; Huetteman and Preece, 1993; Wojtania et al., 2004). Similar to the results of the present study, TDZ was also reported to induce thickened and swelled tissues in many plants (Mundhara and Rashid, 2006; Singh et al., 2003). Conclusion The results of the present study provide evidence that seeds of J. phoenicea have deep physiological dormancy. In this sense, cold-moist stratification of mature seeds for up to three months was not sufficient to produce efficient germination response. Therefore, further studies should be carried out to investigate the effects of longer stratification periods on germination of J. phoenicea seeds. These studies should also investigate the effects of using various temperature regimes throughout the germination process on subsequent GC. However, studies concerning treatment of seeds with plant growth promoters or other stimulants of seed germination should be of high priority to replace longer stratification periods. In vitro culture techniques provide a great potential for the conservation of J. phoenicea. The use of OM medium combined with TDZ was promising for the multiplication and elongation of shoots using shoot tips containing few axillary buds from young seedlings as explants. And in conclusion, the surface-sterilization of mature seeds of J. phoenicea should be further optimized to reduce contamination. ACKNOWLEDGEMENTS This project was supported by the Deanship of Scientific Research in Al Balqa Applied University. Additional requirements and instruments were also provided by NCARE. The authors would like to thank the employees in Al Shouback University College and the Department of Forestry in Al Shouback for the help they provided in the collection of the plant material. REFERENCES Adams RP (2004). Junipers of the world: The genus Juniperus. Trafford, Vancouver. Adams RP, Pandey N, Rezzi S, Casanova J (2002). Geographic variation in the random amplified polymorphic DNAs (RAPDs) of Juniperus phoenicea, J.p. var. canariensis, J.p. subsp. eumediterranea, and J.p. var. turbinata. Biochem. Syst. Ecol. 30: 223229. Al-Qura’n S (2005). Vegetation dynamics in the Tafilah woodlands of southern Jordan. Am. J. Environ. Sci. 1: 46-49. Al-Ramamneh E (1998). Influence of seed treatments on germination of Tilia argentea and its propagation by stem cuttings. Master Thesis,

Al-Ramamneh et al.

University of Jordan, Jordan. Amer MMA, Wasif MM, Abo-Aytta AM (1994). Chemical and biological evaluation of Juniperus phoenicea as a hypoglycaemic agent. J. Agric. Res. 21: 1077-1091. Arista M, Ortiz PL, Talavera S (1997). Reproductive isolation of two sympatric subspecies of Juniperus phoenicea (Cupressaceae) in southern Spain. Plant Syst. Evol. 208: 225-237. Baskin CC, Baskin JM (2004). Determining dormancy breaking and germination requirements from the fewest seeds. In: Guerrant EO, Havens K, Maunder M (Eds.), Ex situ Plant Conservation: Supporting Species Survival in the Wild. Island Press, Washington, DC. Bewley JD, Black M (1994). Seeds: physiology of development and germination. Plenum press, New York. Boucaud J, Ungar IA (1973). The role of hormones in controlling the mechanically induced dormancy of Suaeda spp. Plysiol. Plant. 29: 97-102. Brito G (2000). Micropropagação de duas espécies autóctones da Ilha de Porto Santo (Olea europaea L. ssp. maderensis Lowe e Juniperus phoenicea L.) e estudo da resposta de rebentos in vitro a stress osmótico. Master Thesis, University of Aveiro, Aveiro. Canli FA, Tian L (2008). In vitro shoot regeneration from stored mature cotyledons of sweet cherry (Prunus avium L.) cultivars. Sci. Hortic. 116: 34-40. Castro MR, Belo AF, Afonso A, Zavattieri MA (2011). Micropropagation of Juniperus navicularis, an endemic and rare species from Portugal SW coast. Plant Growth Regul. 65: 223-230. Chien CT, Kuo-Huang LL, Piaolin T (1998). Changes in ultrastructure and abscisic acid level, and response to applied gibberellins in Taxus mairei seeds treated with warm and cold stratification. Ann. Bot. 81: 41-47. Dale IR, Greenway PJ (1961). Kenya trees and shrubs. Buchanan's Kenya Estate limited, Nairobi. Dissanayake P, George DL, Gupta ML (2010). Effect of light, gibberellic acid and abscisic acid on germination of guayule (Parthenium argentatum Gray) seed. Ind. Crop. Prod. 32: 111-117. El-Atta HA (1993). The effect of Caryedon serratus Olivier (Col., Bruchidae) on viability and germination of seeds of Acacia nilotica (L. Willd. ex Del.) in the Sudan. Forest Ecol. Manage. 57: 169-177. El-Bana M, Shaltout K, Khalafallah A, Mosallam H (2010).Ecological status of the Mediterranean Juniperus phoenicea L. relicts in the desert mountains of north Sinai, Egypt. Flora, 205: 171-178. Fang S, Wang J, Wei Z, Zhu Z (2006). Methods to break seed dormancy in Cyclocasrya paliurus (Batal) Iljinskaja. Sci. Hortic. 110: 305-309. García D (1998). Interaction between juniper Juniperus communis L. and its fruit insects: Pest abundance, fruit characteristics and seed viability. Acta Oecol. 19: 517-525. Garcia D, Zamora R, Gomez JM, Jordano P, Hodar JA (2000). Geographical variation in seed production, predation and abortion in Juniperus communis throughout its range in Europe. J. Ecol. 88: 436446. Goggin DE, Powles SB, Toorop PE, Steadman K (2011). Darkmediated dormancy release in stratified Lolium rigidum seeds is associated with higher activities of cell wall-modifying enzymes and an apparent increase in gibberellin sensitivity. J. Plant Physiol. 168: 527-533. Goggin DE, Steadman KJ, Emery RJN, Farrow SC, Benech-Arnold RL, Powles SB (2009). ABA inhibits germination but not dormancy release in mature imbibed seeds of Lolium rigidum Gaud. J. Exp. Bot. 60: 3387-3396. Gomez MP, Segura J (1995). Axillary shoot proliferation in cultures of explants from mature Juniperus oxycedrus trees. Tree Physiol. 15: 625-628. Gomez MP, Segura J (1996). Morphogenesis in leaf and single-cell cultures of mature Juniperus oxycedrus. Tree Physiol. 16: 681-686. Güleryüz G, Kirmizi S, Arslan H, Sakar FS (2011). Dormancy and germination in Stachys germanica L. subsp. bithynica (Boiss) Bhattacharjee seeds: Effects of short-time moist chilling and plant growth regulators. Flora 206: 943-948. Harry IS, Pulido CM, Thorpe TA (1995). Plantlet regeneration from mature embryos of Juniperus cedrus. Plant Cell. Tissue Org. Cult. 41: 75-78.

7691

Huetteman CA, Preece JE (1993). Thidiazuron: a potent cyctokinin for woody plant tissue culture. Plant Cell. Tissue Org. Cult. 33: 105-119. Koornneef M, Bentsink L, Hilhorst H (2002). Seeds dormancy and germination. Curr. Opin. Plant Biol. 5: 33-36. Lind EM, Morrison MES (1974). East African vegetation. Longman Group, London. Loureiro J, Capelo A, Brito G, Rodriguez E, Silva S, Pinto G, Santos C (2007). Micropropagation of Juniperus phoenicea from adult plant explants and analysis of ploidy stability using flow cytometry. Biol. Plant. 51: 7-14. Mazari k, Bendimerad N, Bekhechi C, Fernandez X (2010). Chemical composition and antimicrobial activity of essential oils isolated from Algerian Juniperus phoenicea L. and Cupressus sempervirens L. J. Med. Plant Res. 4: 959-964. Mazur M, Boratyńska K, Marcysiak K, Gómez D, Tomaszewski D, Didukh J, Boratyński A (2003). Morphological variability of Juniperus phoenicea (Cupressaceae) from three distant locations on Iberian Peninsula. Acta Soc. Bot. Pol. 1: 71-78. Mundhara R, Rashid A (2006). TDZ-induced triple-response and shoot formation on intact seedlings of Linum, putative role of ethylene in regeneration. Plant Sci. 170: 185-190. Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15: 473-497. Nadjafi F, Bannayan M, Tabrizi L, Rastgoo M (2006). Seed germination and dormancy breaking techniques for Ferula gummosa and Teucrium polium. J. Arid Environ. 64: 542-547. Negussie A (1997). In vitro induction of multiple buds in tissue culture of Juniperus excelsa. For. Ecol. Manage. 98: 115-123. Nonogaki H, Bassel GW , Bewley JD (2010). Germination-Still a mystery. Plant Sci. 179: 574-581. Ortiz PL, Arista M, Talavera S (1998). Low reproductive success in two subspecies of Juniperus oxycedrus L. Int. J. Plant Sci. 159: 843-847. Penfield S, Josse EM, Kannangard R, Gilday AD, Halliday KJ, Graham IA (2005). Cold and light control seed germination through the bHLH transcription factor Spatula. Curr. Biol. 15: 1998-2006. Piotto B, Bartolini G, Bussotti F, García AA, Chessa I, Ciccarese C, Ciccarese L, Crosti R, Cullum FJ, Di Noi A, García-Fayos P, Lambardi M, Lisci M, Lucci S, Melini S, Reinoso JCM, Murranca S, Nieddu G, Pacini E, Patumi GPM, García FP, Piccini C, Rossetto M, Tranne G, Tylkowski T (2003). Fact sheets on the propagation of Mediterranean trees and shrubs from seeds. In: Piotto B, Di Noi A (Eds.), Seed propagation of Mediterranean trees and shrubs. Agency for the Protection of the Environment and for Technical Services (APAT), Roma, Italy. Qnais EY, Abdulla FA, Abu Ghalyun YY (2005). Antidiarrheal effects of Juniperus phoenicea L. leaves extract in rats. Pak. J. Biol. Sci. 8: 867-871. Rugini E (1984). In vitro propagation of some olive (Olea europaea L. var. sativa) cultivars with different root-ability, and medium development using analytical data from developing shoots and embryos. Sci. Hortic. 24: 123-134. SAS Institute Inc (2001). SAS/STAT, Statistical guide release. Cary, NC, USA. Saxena A, Singh DV, Joshi NL (1996). Autotoxic effects of pearl millet aqueous extracts on seed germination and seedling growth. J. Arid Environ. 33: 255-260. Shimizo-Sato S, Mori H (2001). Control of outgrowth and dormancy in axillary buds. Plant Physiol. 127: 1405-1413. Singh ND, Sahoo L, Sarin NB, Jaiwal PK (2003). The effects of TDZ on organogenesis and somatic embryogenesis in pigeonpea (Cajanus cajan L. Millsp). Plant Sci.164: 341-347. Syouf MQ, Duwayri MA (1996). Jordan: Country report to the FAO international technical conference on plant genetic resources. Leipzig. Tigabu M, Fjellström J, Odén PC, Teketay D (2007). Germination of Juniperus procera seeds in response to stratification and smoke treatments, and detection of insect-damaged seeds with VIS + NIR spectroscopy. New Forest. 33: 155-169. Wesche K, Ronnenberg K, Hensen I (2005). Lack of sexual reproduction within mountain steppe populations of the clonal shrub Juniperus sabina L. in semi-arid southern Mongolia. J. Arid Environ. 63: 390-405.

7692

Afr. J. Biotechnol.

Wojtania A, Gabryszewska E, Marasek A (2004). Regeneration of Pelargonium x hederaefolium ‘Bonete’ from petiol explants. Acta Physiol. Plant. 26: 255-262. Zhou Z, Bao W (2011). Levels of physiological dormancy and methods for improving seed germination of four rose species. Sci. Hortic. 129: 818-824.

African Journal of Biotechnology Vol. 11(30), pp. 7693-7700, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.3740 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Lactic acid fermentation from refectory waste: Factorial design analysis Didem OMAY1* and Yuksel GUVENILIR2 1

Yalova University, Faculty of Engineering, Chemical and Process Engineering, Yalova, Turkey Istanbul Technical University, Faculty of Chemical and Metallurgical Engineering, Department of Chemical Engineering, Istanbul, Turkey

2

Accepted 30 March, 2012

A factorial experimental design method was used to optimize the lactic acid production using Lactobacillus bulgaricus from refectory waste obtained from Istanbul Technical University mess hall, Turkey. Fermentation experiments were carried out in a batch type reactor system which contains refectory waste with Lactobacillus bulgaricus bacteria during an exposition time of 30 h. Factorial design of experiments was employed to study the effect of three factors namely temperature (30 and 45°C), substrate concentration (10 and 60 g/L) and pH (4.0 and 6.0) at two markedly different levels. The main effects and interaction effects of the three factors were analysed using statistical techniques. A regression model was recommended and it was found to fit the experimental data very well. The results were analysed statistically using Student’s t-test, and analysis of variance was used to define the most important process variables affecting the production of lactic acid by fermentation. In the present study, the most significant factor affecting lactic acid fermentation was found to be the initial substrate concentration. Key words: Refectory waste, lactic acid, factorial design, Lactobacillus bulgaricus. INTRODUCTION Lactic acid is an organic acid (α-hydroxy-propionic acid) used for a wide variety of industrial applications. In food industry, it is used as an acidulant, a preservative and an antimicrobial agent. For pharmaceutical applications, lactic acid can be used as electrolytes and mineral sources. For technical applications lactic acid can be used as neutralizers, solvents, cleaning agents, slow acid release agents and metal complexing agents. It has also been used in cosmetic industry as pH buffer, antimicrobial, skin rejuvenating and skin lightening. A large number of carbohydrate materials have been used, tested or proposed for the manufacture of lactic acid by fermentation (Vick Roy, 1985). There are two isomers of lactic acid, these are D(-) and L(+) forms, which differ only in their optical properties, but are identical in their physical and chemical characteristics. L(+)-Lactic acid is biodegradable and can be metabolized by the human

*Corresponding author. E-mail: didem.omay@yalova.edu.tr.

body and this property has resulted in the application of lactic acid in biomaterial and biomedical field (Hunger, 1984). Lactic acid is produced by chemical synthesis and by microbial fermentation. By chemical synthesis method, racemic mixture of lactic acid is produced, while by microbial fermentation method L(+) and D(-) lactic acids can be produced according to the type of microorganism which may be homofermentative or heterofermentative. This is an important advantage of the microbial fermentation method compared to the chemical synthesis method. At the end of the fermentation process, lactic acid exists in the complex medium of fermentation broth that contains whey proteins, biomass, salts and other impurities. Lactic acid is then recovered from this complex medium. Since the high cost of lactic acid purification process limits the utilization of this chemical, in a large scale application, a system with less raw material and fewer unit operations are needed (Narayanan et al., 2004). Sucrose from cane and beet sugar, whey containing

7694

Afr. J. Biotechnol.

lactose, and maltose and dextrose from hydrolysed starch are presently used commercially for lactic acid production. Over the years, authors have studied a large number of carbohydrates and nitrogenous materials for production of lactic acid. These have been investigated on the basis of high lactic acid yields, optimum biomass production, negligible by-product formation, fast fermentation rate, less pre-treatment, easy downstream processing, low cost, ease of availability etc. The choice of the raw material to be used depends on the microorganisms studied and also on the product desired. Sucrose, lactose, maltose, glucose, mannitol etc. have been commercially used (Narayanan et al., 2004). Batch fermentations are widely used method for the production of lactic acid. Fermentation conditions are different for each industrial producer but are typically in the range of 45 to 60°C with a pH of 5.0 to 6.5 for Lactobacillus delbrueckii; 43°C and a pH of 6.0 to 7.0 for Lactobacillus bulgaricus. The acid formed is neutralized by calcium hydroxide or calcium carbonate. The fermentation time is 1 to 2 days for 5% sugar sucrose such as whey and 2 to 6 days for a 15% sugar source such as glucose or sucrose. Under optimal laboratory conditions the fermentation takes 1 to 2 days. The yield of lactic acid after the fermentation stage is 90 to 95 wt% based on the initial sugar or starch concentration (John et al., 2006). The fermentation rate depends primarily on the temperature, pH, concentration of nitrogenous nutrients, and initial substrate concentration. The undissociated, electroneutral form of lactic acid rather than lactate appears to be the components which inhibits the fermentation (Vick Roy, 1985). In the present study, lactic acid was produced from refectory waste, which was collected from Istanbul Technical University mess hall, through fermentation process and convenient conditions were optimized for the production of the highest lactic acid yield via experimental design analysis. The most important factors for the production of lactic acid using fermentation process are the substrate concentration, pH and temperature. Factorial design of experiments was employed to study the effect of these three factors on the lactic acid production. Also, this work represents the first in the literature to follow the factorial experimental design of lactic acid production using Lactobacillus bulgaricus from refectory waste. MATERIALS AND METHODS Microorganism and culture conditions L. bulgaricus (DSMZ 20081) was used through the study. The microorganism was maintained on De Man, Rogosa and Sharpe (MRS) agar plates at 4°C and sub-cultured every 15 days. Cells for inoculation of the production medium at a level of 10% (v/v) were obtained from cultures grown on MRS broth (pH 7.0) at 37°C for 24 h in the incubator and kept at 4°C in the refrigerator. Twenty-four hour (24 h) old fresh cultures were used as the inoculum for the

fermentations. Composition of refectory waste Reducing sugar and total carbohydrates of refectory waste was estimated by dinitrosalicylic acid and phenol sulphuric acid methods, respectively. Physiochemical properties of refectory waste were determined using standard protocols. The pH of the sample was determined using a digital pH meter. Lactic acid fermentation Batch experiments were performed in a temperature-controlled incubator shaker operated at 160 rpm, at 37°C. The shake flasks were 250 ml Erlenmeyer flasks containing 100 ml of refectory waste as fermentation medium (initial pH 6). Unless otherwise indicated, refectory waste was dissolved to attain 58 g/L of initial sucrose concentration and supplemented with (g/L) yeast extract (10), K2HPO4 (0.5), KH2PO4 (0.5), MgSO4 (0.2) and MnSO4.H2 O (0.05). Refectory waste medium (pH 6.0) and all salt solutions were sterilized separately at 121°C for 15 min. Sterile CaCO3 (10% (w/v) of the initial sucrose concentration) was added to the medium to neutralize the acid. The shake flasks were inoculated aseptically with 30-h-old fresh culture propagated in medium at 30 and 45°C (Mel et al., 2008). Lactic acid determination Lactic acid concentrations were analysed by high performance liquid chromatography (HPLC). The HPLC system was composed of Agilent 1100 Series. The mobile phase was 5 mM H2 SO4 for Aminex HPX-87H column. Mobile phase was filtered through 45 µM cellulose acetate filter papers after solution preparation (Okano et al., 2009). Experimental design and statistical analysis In the optimization studies using factorial design analysis, initial substrate concentration, pH and temperature were varied as parameters, while the levels of other medium components were kept constant. The statistical analysis of the data was performed using Minitab Statistical Software (Release 14). In this design, there were two experimental levels (-1, +1) where –1 and +1 corresponded to low level and high level of each variable, respectively (Kotzamanidis et al., 2002).

RESULTS Composition of refectory waste Samples of waste collected from Istanbul Technical University mess hall were analysed for moisture, ash, protein, total reducing sugar and total carbohydrates, nitrogen and protein contents (Table 1). The refectory waste contained mainly carbohydrate components. Total carbohydrate (total reducing sugar + sucrose) and total reducing sugar content of the refectory waste were confirmed as 61.38 and 0.47% respectively. During the inversion of 1 mole of sucrose, it reacts with 1 mole of water and 95 g of sucrose to produce 100 g of reducing

Omay and Guvenilir

7695

Table 1. Composition of refectory waste.

Composition of medium Moisture content Total Ash Total reducing sugar Total carbohydrate Nitrogen Protein

Percentage (%) 7.50 5.68 0.47 61.38 2.85 10.41

Table 2. Levels of factors.

Factor pH Temperature, T (°C) Initial substrate concentration, S0 (g/L)

Low (-1) 4.0 30 10

High (+1) 6.0 45 60

Table 3. Experimental factorial design results for lactic acid.

T -1 +1 -1 +1 -1 +1 -1 +1

Factor S0 -1 -1 +1 +1 -1 -1 +1 +1

pH -1 -1 -1 -1 +1 +1 +1 +1

Produced lactic acid (g/L) SF1 SF2 SF3 8 6 6 13 10 17 20 18 22 29 32 30 15 12 13 24 18 23 27 25 29 43 47 40

T, Temperature; S0, ınitial substrate concentration.

sugar. From this principle, sucrose content of the refectory waste was calculated as difference between total carbohydrates and reducing sugar multiplied by 0.95 and sucrose content and was estimated at 58 g/L. The moisture content of refectory waste was found in the range of 5 to 10%, the nitrogen content in waste was 2.85% and ash content at range 5 to 6%. The lactic acid bacteria require substrates with high nitrogen content during fermentation. The nutrients were added in the form of malt sprout, corn steep liquor, and yeast extract. Lactic acid production increased with the concentration of the supplement especially yeast extract. The highest production rate was found with addition of 5 to 15 g/L yeast extract (Lund et al., 1992). Although the refectory waste contained very little nitrogen, this concentration was adequate for lactic acid bacteria growth in the present study. Experimental analysis

determined. The effect of a factor was in the change in response and production of lactic acid by a change in the level of a factor, pH, temperature and initial substrate concentration from lower to higher level (Table 2). Eight experiments were carried out and each of them was replicated three times. All possible combinations of factors were used and a matrix was established according to the high and low levels represented by +1 and -1 respectively (Table 3). The main effects represented deviations of the average between high and low levels for each one of them. When the effect of a factor was positive, production of lactic acid increased as the factor was changed from low to high levels. The results were analysed using the software for a 95% confidence level (α = 0.05) and main effects and interactions between factors were examined. The effects, regression coefficients, standard errors and p were shown in Table 4. The mathematical model 3 employed for the 2 factorial design was:

The results were analysed using Minitab 14 for windows. The main effects and interaction between factors were

SF = A0 + A1*T + A2*S0 + A3*pH + A4*T*S0 + A5*T*pH + A6*S0*pH + A7*T*S0*pH........................ (1)

7696

Afr. J. Biotechnol.

Table 4. Statistical parameters for 23 design.

Term Constant T S0 pH T*S0 T*pH S0*pH T*S0*pH

Effect 21.9583 10.4167 16.4167 8.7500 2.9167 1.9167 1.2500 1.0833

Coefficient 21.9583 5.2083 8.2083 4.3750 1.4583 0.9583 0.6250 0.5417

Standart error 0.5052 0.5052 0.5052 0.5052 0.5052 0.5052 0.5052 0.5052

t-statistic 43.47 10.31 16.25 8.66 2.89 1.90 1.24 1.07

p 0.000 0.000 0.000 0.000 0.011 0.076 0.234 0.300

Figure 1. Main effects plot for produced lactic acid. T, Temperature; S0, ınitial substrate concentration.

Where A0 represents the global mean and Ai represents the other regression coefficients. Substituting the coefficient Ai in Equation (1) by their values from Table 4 we got model equation: SF = 21.9583 + 5.2083T + 8.2083S0 + 4.3750pH + 1.4583T*S0 + 0.9583T*pH + 0.6250S0*pH + 0.5417T*S0*pH…………………………………………… (2) Equation (2) presented that effects of all factors were positive and results in an increase in the value of the produced lactic acid. The main effects of the control factors were presented in Figure 1. A horizontal line

(parallel to the x-axis) indicated that no main effect was present (the control factor does not influence the objective function). If the line was not horizontal, there could be a main effect present and in this case the control factors influence the objective function. The greater the slope of the line, the stronger the effect produced. Student’s t-test The Pareto chart (Figure 2) gave the relative importance of the individual and interactions effect. Student’s t-test

Omay and Guvenilir

7697

2.12

Figure 2. Pareto chart of standardized effects on the produced lactic acid concentration. T, Temperature; S0, ınitial substrate concentration.

Table 5. Analysis of variance.

Source Main effects 2-way interactions 3-way interactions Residual error Pure error Total 2

R = SSMODEL/SSTOTAL; R

Degrees of freedom 3 3 1 16 16 23 2

Sum of square 2727.46 82.46 7.04 98.00 98.00 2914.96

Mean square 909.153 27.486 7.042 6.125 6.125 2

adj

= 1 – [(SSERROR/DFERROR)/(SSTOTAL/DFTOTAL)]; R = % 96.64

was performed in order to determine whether the calculated effects were significantly different from zero and these values for each effect were shown in Pareto chart by horizontal columns. In our case, all control factors with a significant influence were located over the line marked at 2.12 (p = 0.05). The vertical line in the chart indicated the minimum statistically significant effect magnitude for 95% confidence level. Analysis of variance (ANOVA) In Table 5, the sum of squares used to estimate the factors’ effects and F ratios are shown. It can be said

R

2 (adj)

F 148.43 4.49 1.15

p 0.000 0.018 0.300

=% 95.17.

that R2 and R2(adj) values which were important due to test obtained mathematical model were close to each other 2 2 and approximately 1.0 (R = 96.64%, R (adj) =95.17%) that of expected result statistically. Another important aspect was the interaction among the control factors. The interaction between the control factors can be estimated from experimental design and the results were presented in Figure 3. If the lines were parallel to each other, there was no interaction present. With the increase of the deviation degree of line from being parallel, the interactions among control factors increase. The residues were also examined for normal distribution. Figure 4 shows the normal probability plot of residual values. It could be seen that the experimental points were

7698

Afr. J. Biotechnol.

Figure 3. Interaction effects for produced lactic acid. T, Temperature; S0, ınitial substrate concentration.

reasonably aligned, thus suggesting normal distribution. DISCUSSION Lactic acid starters are currently produced using pH controlled pure cultures (Beal et al., 1989), during which pH is generally regulated at an optimal value by continuously adding sodium hydroxide or ammonia in the bioreactor (Savoie et al., 2007). Various growth characteristics such as maximal biomass concentration, specific growth rate, fermentation time, substrate consumption and product yields are influenced by the pH value (Adamberg et al., 2003). Optimal pH ranges were therefore determined for several lactic acid bacteria, such as Streptococcus thermophilus (pH 6.5), Lactococcus lactis subsp. cremoris (pH 6.3 to 6.9) and L. bulgaricus (pH 5.8 to 6) (Beal et al., 1989). The effect of initial pH on the cell growth of L. bulgaricus during the fermentation of refectory waste was investigated and optimized in the present study. According to the experimental results, at the initial pH of 4.0, the bacteria exhibited a prolonged lag phase and bacteria did not grow as well as at higher initial pH value. Moreover, as the initial pH increased above 4.0, the cell

growth increased, however, until up to a certain limit. Beyond initial pH 6.5, its growth rate decreased again. Therefore, the optimal initial pH for the refectory waste fermentation of L. bulgaricus was 6.0, which is similar to those reported by Goksungur and Guvenc (1997) by using beet molasses as a substrate. Various researchers have studied the effect of pH on lactic acid production and found that the optimum pH for lactic acid production is in the range of 5.0 to 7.0 (Hofvendahl and Hagerdal, 2000; Goksungur and Guvenc, 1997). Goksungur and Guvenc (1997) showed that the effect of pH on lactic acid production was important and the optimal pH was 6.0 with the yield value 79%. That is why when the statistical analysis of the data was performed using Minitab, the levels of pH factors used in the experimental design were chosen as pH 4.0 and 6.0 (Table 2). Also, temperature is one of the most important environment factors that effect the lactic acid production. Various studies on the effect of temperatureon the lactic acid production have reported an optimal temperature between 40 to 45°C (Hofvendahl and Hagerdal, 2000). Goksungur and Guvenc (1997) reported that the optimal temperature was 45°C and this might be due to the different substrates used in the lactic acid fermentation. Maximum yield obtained with 53.61 g/L of lactic acid when the temperature was 45°C, and the

Omay and Guvenilir

7699

Figure 4. Normal probability plot of residual values for concentration of lactic acid vs. their expected values when the distribution is normal.

lactic acid production decreased rapidly to 25.14 g/L Lactobacillus helveticus used in a temperature range of 35°C. For similar reason the causes of choosing the pH levels, temperature levels were chosen as 30 and 45°C (RakĹn et al., 2004). In the present study, the Pareto chart showed that substrate concentration has a highly significant effect on the produced lactic acid concentration (Figure 2). Additionally, for initial substrate concentration at 60 g/L, concentration of lactic acid was estimated as 20 g/L. This value was considerably higher than the obtained value using initial substrate concentration as 10 g/L (Table 3); this situation was considered ideal in batch type fermentations. It was observed that as the initial substrate concentration increased to a very high point, production of lactic acid decreased clearly (results were not given), a phenomenon that can occur by substrate inhibition, product inhibition or exhaustion of one restricting nutrient or their combined effect. It was reported that in batch type, lactic fermentations have varying substrate concentrations from 20 to 100 g/L; the results for lactic acid concentrations and sucrose conversion obtained were similar to those reported in this study. It was also reported inhibition by substrate in fermentations occur using Lactobacillus casei NRRL B-441, and varying the glucose concentration between 80 and 160 g/L (Hujanen et al., 2001). According to these results, the effects of the high and low levels for the initial substrate concentration were chosen as 10 and 60 g/L in paralleling to the other variables. It was observed that initial substrate concentration (S0)

whose value was 16.4167, was the most significant effect on the production of lactic acid. After that respectively T and pH main effects and T*S0 binary interaction presented the statistical significance. Other binary and trio interactions were not statistically significant: T*pH, S0*pH and T*S0*pH. Similar results were obtained when p values were evaluated. From the p value which was defined as the smallest level of significance leading to rejection of the null hypothesis, it appears that the main effect of each factor and the interaction effects were statistically significant when p<0.05. So, it can be said that the main effects of T, S0, pH, and interaction effect T*S0 were statistically significant. On the other hand, p values of T*pH, S0*pH and T*S0*pH interaction effects were higher than 0.05, so these interaction effects were not statistically significant (Table 4). The effects of the all variables (pH, temperature and initial substrate concentration) and their interactions on the formation of the lactic acid production were illustrated with analysis of variance (Table 5). The goodness of fit of the analysis of variance model was checked by the 2 determination coefficient (R ). In this case, the value of 2 the R (0.9664) for ANOVA indicates that the sample variation of nearly 97% for lactic acid was attributed to the independent variables and only 3% of the total variation could not be explained by the model. The value of the adjusted determination co efficient (R2adj = 0.9517) was also high, which stressed the significance of the model. The high value of R (0.9664) demonstrated a high degree of agreement between the experimental observations and predicted values.

7700

Afr. J. Biotechnol.

Conclusion In this study, important process variable factors which affect fermentative lactic acid production were determined using a factorial experimental design technique. The results of statistical study clearly showed that initial substrate concentration was the most important parameter. Moreover the main effect of temperature, pH and interaction between temperature-initial substrate concentrations had a considerable effect on the amount of lactic acid produced. Other two-way and three-way interactions did not exhibit any statistical significance. REFERENCES Adamberg K, Kask S, Laht TM, Paalme T (2003). The effect of temperature and pH on the growth of lactic acid bacteria: a pHauxostat study. Int. J. Food Microbiol. 85: 171-183. Béal C, Louvet P, Corrieu G (1989). Influence of controlled pH and temperature on the growth and acidification of pure cultures of Streptococcus thermophilus 404 and Lactobacillus bulgaricus 398. Appl. Microbiol. Biotechnol. 32: 148-154. Goksungur Y, Guvenc U (1997). Continuous production of lactic acid from beet molasses by L. Delbrueckii IFO 3202. J. Chem Eng. Biotechnol. 69: 399-404. Hofvendahl K, Hagerdal BH (2000). Factors affecting the fermantative lactic acid production from renewable resources. J. Enzymes, Microbial Technol. 26: 87-107. Hujanen M, Linko S, Linko Y, Leisola M (2001). Optimization of media and cultivation conditions for L(+) (S)-lactic acid production by Lactobacillus casei NRRL B- 441. Appl. Microbiol. Biotechnol. 56(12): 126-130. Hunger W (1984). Dextro-rotatory and levo-rotatory lactic acid: Their significance and occurrence in sour milk products. Danish Dairy Food Industry Worldwide, 4: 39-42. John RP, Nampoothiri KM, Pandey A (2006). Simultaneous saccharification and L(+) lactic acid fermentation of protease-treated wheat bran using mixed culture of lactobacilli, Biotechnol. Lett. 28(2): 1823-1826. Kotzamanidis Ch, Roukas T, Skaracis G (2002). Optimization of lactic acid production from beet molasses by Lactobacillus delbrueckii NCIMB 8130. World J. Microb. Biot. 18(5): 441-448.

Lund B, Nordahl B, Ahring B (1992). Production of lactic acid from whey using hydrolysed whey protein as nitrogen source. Biotechnol. Lett. 14: 851-856. Mel M, Karim MIA, Salleh MRM, Amin NAM (2008). Optimizing media of Lactobacillus rhamnosus for lactic acid fermentation. J. Appl. Sci. 8(17): 3055-3059. Narayanan N, Roychoudhury PK, Srivastava A (2004). L(+) lactic acid fermentation and its product polymerization. Electron. J. Biotechnol. 7(2): 167-179. Okano K, Zhang Q, Shinkawa S, Yoshida S, Tanaka T, Fukuda H, Kondo A (2009). Efficient production of optically pure D-Lactic acid from raw corn starch by using a genetically modified L-Lactate dehydrogenase gene deficient and alpha amylase secreting Lactobacillus plantarum strain. Appl. Environ. Microbiol. 75(2): 462467. Rakın M, Baras J, Vukasinovic M, Maksimovic M (2004). The examination of parameters for lactic acid fermentation and nutritive value of fermented juice of beetroot, carrot and brewer’s yeast autolysate. J. Serb. Chem. Soc. 69(8-9): 625-634. Savoie S, Champagne CP, Chiasson S, Audet P (2007). Media and process parameters affecting the growth, strain ratios and specific acidifying activities of a mixed lactic starter containing aromaproducing and probiotic strains. J. Appl. Microbiol. 103: 163-174. Vick Roy TB (1985). Lactic acid. in Comprehensive biotechnology: the principles, applications, and regulations of biotechnology in industry, agriculture and medicine, ed Moo-Young M. (Pergamon Press, New York), 2: 761-776.

African Journal of Biotechnology Vol. 11(11), pp. 7701-7710, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.2874 ISSN 1684–5315 © 2011 Academic Journals

Full Length Research Paper

Optimization of growth parameters for increased yield of the edible mushroom Calocybe indica Gopinath Lakshmipathy*, Arunkumar Jayakumar, Meera abhilash and Shantha Prema Raj Department of Industrial Biotechnology, Dr. MGR Educational and Research University, Maduravoyal, Chennai - 600095, India. Accepted 25 November, 2011

This study was conducted to enhance the yield performance of Calocybe indica through optimization of the cultivation parameters by utilizing cheaper substrates that are available in Tamil Nadu, India. The total fresh mushroom yield obtained with a change in spawn substrate, spawn running bed substrate (SRBS), sterilization procedure and casing soil with different amendments were studied. Sorghum grains provided the highest yield of 1.58 ± 0.06 g fresh mycelia after 17 ± 0.75 days of incubation. The protein, fat, carbohydrate, dietary fiber, moisture and ash content of mushrooms were also analyzed. The maximum amount of nutritive value was obtained from the paddy straw and the lowest from sugarcane leaves as substrate. The fat, protein, carbohydrate, dietary fiber, moisture and ash (g/100 g dried matter) values of C. indica were 0.66 ± 0.02 g, 31.29 ± 1.56 g, 58.40 ± 1.75 g, 38.21 ± 1.91 g, 84.91% and 8.47 ± 0.25 g, respectively, when cultivated in paddy straw. Furthermore, the chemical sterilization yielded 1.16 kg of mushroom with a contamination rate of <8 of 30 bags. The different chemical compositions were used in the preparation of casing soil; however, it produced the highest yield of 1648 ± 49.44 g/kg (w/w) for paddy straw. Key words: Calocybe indica, chemical sterilization, growth parameters, physical sterilization, substrate. INTRODUCTION Mushrooms have been favored as food by mankind for a long time. Mushrooms supply a rich addition to the diet in the form of protein, carbohydrates, valuable salts, minerals and vitamins. As food, the nutritional value of mushrooms deceit in between meat and vegetables. Calocybe indica, commonly known as milky white mushroom, grows during the summer and it is a tropical mushroom known for its nutritive value. Its robust size, sustainable yield, attractive colour, delicacy, long shelflife and lucrative market value have attracted the attention of both mushroom consumers and prospective growers. C. indica is rich in protein, lipids, fiber, carbohydrates and vitamins and contains an abundant amount of essential amino acids and low fat product (Ruhul et al., 2010). These qualities make it suitable for food supplement in diet.

*Corresponding author. E-mail: snehamgp@gmail.com. Tel: +91 9003271819.

Commercial milky white mushroom growers are mostly confined to Tamil Nadu, India, particularly in Erode, Salem, Coimbatore, Trichy, Madurai and other districts (Krishnamoorthy, 2003). Among vital growth requirements, environmental factors play a major role in the growth and reproduction of edible fungi. Cultivation of C. indica is influenced by temperature and relative humidity for its yield. However, optimum conditions favorable for the growth of C. indica have not been clearly defined under controlled conditions. Growing edible mushrooms is the most efficient method of bioremediation of the large quantity of lignocellulosic wastes generated annually through agricultural and allied activities (Stamets, 2000). Considering these facts, this research work was committed towards the optimization of the growth parameters to increase yield and to bioremediate agricultural wastes. Synthetic substrates using different cellulosic waste formulations are used to study their effect on the yield of mushroom. The aim was to investigate the effect of various substrates, casing materials and other supplements that can be used to optimize the growth conditions

7702

Afr. J. Biotechnol.

Table 1. Design summary for optimizing the concentration of chemicals for sterilization of substrate.

Variable

Units

Formaldehyde (A) Carbendazim (B)

ml/L g/L

-1 100 30

-α -65.68 11.36

Level 0 500 75

+1 900 120

+-α 1065.69 138.64

Table 2. Experimendal design and of 22 factorial design.

No of Run

A: Formaldehyde (ppm)

B: Carbendazim (g)

1 2 3 4 5 6 7 8 9 10 11 12

500 500 500 1065.68 500 900 100 500 100 900 500 500

75 138.63 75 75 75 120 30 75 120 30 75 11.36

13

0

75

and enhance the yield of C. indica. Additionally, it was intended to compare the quality attributes of conventional methods of mushroom cultivation.

Substrates for cultivation of C. indica

MATERIALS AND METHODS

Coir pith, maize straw, paddy straw, sugarcane bagasse, sugarcane leaves and vettivera leaves were used as substrates for this study. All the substrates except coir pith were chopped into 2 to 3inch pieces and soaked in water. The substrates were sterilized by physical and chemical methods.

The commercial edible mushroom, C. indica, procured from Tamil Nadu Agricultural University, Coimbatore was used for this study.

Physical sterilization

Preparation of spawn Clean grains such as sorghum, wheat, bajra and rice husk were selected for spawn preparation. The grains were washed and soaked for 6 to 8 h in cold water and then boiled for 40 min. The boiled grains were drained and supplemented with 2% of calcium carbonate (CaCO3), and then the excess moisture was reduced through air drying to 60%. The treated grains (250 g) were packed in poly propylene bags (of size 200 × 300 mm in dimensions) with necks made from cut PVC pipes in place of the commercial plastic neck to hold the cotton plug and autoclaved at 121°C for about 45 min. The bags were taken out of the autoclave and allowed to cool for a day. After sterilization and cooling, the bags were inoculated with pure culture of C. indica from the potato dextrose agar (PDA) Petri plates. The culture and grains were mixed by shaking to uniformly distribute the mycelium. Inoculated bags were incubated at 27 ± 2°C for mycelial growth without light for 17 to 23 days until the mycelium fully covered the grains.

The chopped substrates were soaked in water for 3 to 4 h. Steam sterilization was done by autoclaving the substrates at 121°C for various durations such as 15, 30, 45, 60, 75 and 90 min. Substrates were air-dried so that a moisture content of about 65% was allowed in the wet substrate prior to spawning.

Chemical sterilization Statistical optimization of the concentration of chemicals by response surface methodology (RSM) The optimum concentration of chemicals required for sterilization of the substrate was analyzed by RSM using the central composite design. The experiments were carried out by using Design-Expert 7.1.6 software package (Tables 1 and 2). RSM is a collection of statistical and mathematical techniques useful for developing, improving and optimizing the process. RSM defines the effects of the independent variables alone or in combination, on the process. In addition to analyzing the effects of the independent variables, this experimental methodology generates a mathematical model

Lakshmipathy et al.

that accurately describes the overall process. It has been successfully applied to optimizing conditions in food, chemical and biological processes.

Experimental design of RSM for optimizing the concentration of chemicals for sterilization of substrate The levels of two variables like temperature and pH were optimized for chemical sterilization of substrates. For that purpose, the response surface approach by using a set of experimental design (central composite design with five coded levels) was performed. The factors were at the level of 0. The axial distance α, was chosen to be 1.68 to make this design orthogonal. A set of 13 experiments was done for two variables. The central values (0 level) chosen for experimental design were given as gram per liter (g/L). In developing the regression equation, the test factors were coded according to the following equation:

7703

Preparation of casing material The casing material was prepared with various combinations of farm-yard manure. Different supplements were tried for the increased yield. Different combinations of supplements such as CaCO3 and gypsum were mixed with the casing soil to promote growth of the mushroom. After mycelial colonization, the mouth of the spawn ran bed was cut into two equal parts. Casing layer of half an inch thickness was laid over the spawn ran open part of bed. After casing, the bags were transferred in to the cultivation sheds for fruiting at 32 to 37°C temperatures and 80 to 90% humidity. Controlled environment such as temperature light and ventilation were maintained during the cropping period in the cultivation chamber. Water was also sprayed regularly to keep the surface of the substrate to maintain moisture. Fruiting bodies once after maturation were harvested from two flushes by twisting them slightly near the base and fresh weights were recorded immediately. Bits and pieces of harvested sporophores were not allowed to remain in the substrate. Biological efficiency was calculated as the ratio between the fresh weight of mushrooms and the dry weight of substrate per bag and was expressed as percent.

(1)

(1) Proximate analysis

Where xi is the coded value of the ith independent variable, Xi the natural value of the ith independent variable, X0 the natural value of the ith independent variable at the center point, and ∆Xi the step change value of variables. For a two-factor system, the model equation is:

Estimation of the moisture content (Ranganna, 1977), crude fibre content (Maynard, 1970), total carbohydrates content (Anthrone method), ash content (Horsefall and Ayebaemi, 2004), protein content (Bradford method) and fat content (Soxhlet method), of the samples were done by the standard methods.

Experimental design (2) Where Y is the predicted response; b0 is the intercept; b1, b2, and b3 are linear coefficients; b11, b22, and b33 are squared coefficients; and b12, b13, and b23 are the interaction coefficients (Myers and Montgomery, 2002). Based on the concentrations of the chemicals, the chemical sterilization was carried on with the substrates. The substrates were soaked in the different concentration of the chemicals for 16 to 18 h. Excess moisture was removed. Moisture content of about 60% was allowed in the wet substrate prior to spawning.

Each experiment had three replicates. The following data were collected; mycelial growth in the different substrates, change in nutritive value while using different substrates, the number of contaminated bags after subjecting to different sterilization methods and variation, number of days required for the initiation of primordial in different substrates, the number of days required for total harvest, the number of effective fruiting bodies, economic yield, and biological efficiency and nutritional difference while using different combinations of casing soil.

Statistical analysis Preparation of cultivation bed Substrates (500 g) were added to polypropylene bags (7 × 10'' sizes) as different layers, spawns (100 g) were sowed over the six layers of substrate, and nearly 16.6 g of spawn was laid on each layer. The openings of the bags were plugged with cotton and secured with plastic rings. The spawned bags were incubated in dark under normal room temperature (25 to 35°C) for spawn run.

All values were expressed as means ± standard deviation. The results were analyzed using one-way analysis of variance (ANOVA) and the differences among the treatments means were analyzed using the Tukey-Kramer multiple comparison test. P value<0.05 was considered as least significant. The software GraphPad InStat was employed for the statistical analysis.

RESULTS AND DISCUSSION Cultivation chamber Once after the spawn run and casing, the beds were incubated in the dome shaped partially sunken chamber lined with blue coloured sylphalein sheet which was used as the roofing material. The chamber’s pit walls were built with hollow blocks from the bottom, with smooth flooring and convenient steps near the entrance with good cross ventilation. The skeleton structures of the chamber were made by waste polymer (Procured from Texnova, Chennai).

The effect of spawn grains on the rates of mycelial production of C. indica The differences in the means due to grain were highly significant (p<0.05) wet weight, and maximum mycelial growth was observed. The wet mycelial weight of C. indica was significantly increased in media containing sorghum. Wheat, rice husk and bajra induced lesser mean weights than sorghum. Sorghum was found to be

7704

Afr. J. Biotechnol.

Table 3. Optimization of spawn on different substrate.

Types of Substrate Wheat Bajara Rice husk Sorghum

Mycelial fresh weight (g) a 0.717 ± 0.035 0.761 ± 0.041a a 0.844 ± 0.036 b 1.583 ± 0.06

Mycelia formation (days) a 18 ± 0.8 20 ± 0.86ab b 23 ± 0.95 17 ± 0.75a

Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

Table 4. Nutritional analysis of C. indica grown on different substrates.

Substrates Coir pith Maize straw Paddy straw Sugarcane bagasse Sugarcane leaves vettivera leaves

Moisture (%) a 79.2 ± 3.96 c 83.4 ± 4.17 c 84.9 ± 4.24 a 78.6 ± 3.93 a 78 ± 3.9 81.3 ± 4.06b

Protein (g/100g) b 28.8 ± 1.44 c 30.5 ± 1.52 c 31.2 ± 1.56 a 27.4 ± 1.09 b 29.5 ± 1.18 28.2 ± 1.12b

Fat (g/100g) d 0.85 ± 0.034 c 0.77 ± 0.0308 a 0.66 ± 0.026 b 0.72 ± 0.021 bc 0.74 ± 0.02 0.8 ± 0.024d

Carbohydrate (g/100g) a 53.2 ± 1.59 ab 54.5 ± 1.63 c 58.4 ± 1.75 b 55 ± 2.2 a 53.2 ± 2.12 55.6 ± 2.22b

Fibre (g/100g) a 35.6 ± 1.78 bc 37.5 ± 1.87 c 38.2 ± 1.91 a 35.3 ± 1.05 a 35.1 ± 1.05 36.5 ± 1.09b

Ash (g/100g) b 8.17 ± 0.24 c 8.3 ± 0.24 c 8.47 ± 0.25 b 8.07 ± 0.32 a 7.87 ± 0.31 7.97 ± 0.31a

Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

most favorable to mycelial extension of C. indica. The result of the analysis of variance (Table 3) show that the mycelial weight was 1.58 ± 0.06 g for C. indica on the 17th day of incubation when sorghum was used as substrate. Rice husk was next to sorghum with mycelial weight of 0.844 ± 0.036 g, although it obtained the yield on 23rd day. The substrates wheat and bajra least supported the growth of mycelia with average mycelial weight of 0.717 ± 0.035 g and 0.761 ± 0.041 g on the 18th and 20th day, respectively, after incubation. Nwanze et al. (2005) observed that in the case of Lentinus squarrosulus, wheat (1.17 g) and corn spawn (1.37 g) were similar and induced mycelial wet weights (Jiskani et al. 2007).

paddy straw substrate. The biological yield for this study was 1.019 ± 5.1 kg for paddy substrate subsequently maize substrate with 0.979 ± 4.9 kg. The data is significantly more than the previous studies with substrates without supple-mentation. Work done by Pani (2010) revealed that paddy straw was the best among the substrates as it produced the maximum yield (0.712 kg) and biological efficiency (71.2% BE) of C. indica, and it took 30 days for pinhead appearance. Similarly Nuhu et al. (2010) observed 0.918 kg of biological yield per W/W of nutrient supplemented substrate. Nutritional analysis of C. indica

Effect of different substrates on yield and yieldcontributing characteristics The results reveal the yield, B.E. and nutrient content of the C. indica cultivated on different agro-wastes. The shortest time required to complete mycelial growth was observed in the paddy straw substrate (20 ± 2 days), followed by the Vettivera leaves (26 ± 2 days) and sugarcane bagasse (27 ± 2 days) substrates. The longest time (30 ± 2 days) required to complete mycelial growth was observed in the coconut coir substrate Pani 2010. The minimum time for first flush was observed in paddy straw substrate (8 ± 1 days), which was statistically similar to that of the coconut coir, maize straw, and rice straw substrates. The longest time was recorded in sugarcane leaf substrate (14 ± 1 day). Alam et al. (2010) observed that 19.3 days was required for the primordial initiation of C. indica in a previous study conducted on

The aim was to obtain the increased nutrient and yield of C. indica. The moisture content of the mushroom cultivated in paddy straw, maize straw, vettivera leaves and coir pith were found about 84.9, 83.4, 81.2 and 79.2%, respectively (Table 4). For the substrate paddy straw, 100 g of fresh C. indica contained 31.29 ± 1.56 g of proteins, 38.2 ± 1.91 g of fiber and 58.4 ± 1.75 g of carbohydrates. Least amount of protein was observed for the sugarcane bagasse with 27.4 ± 1.09 g. Moreover, 35.1 ± 1.05 g of fiber and 53.2 ± 2.12 g of carbohydrates was the least values found in sugarcane leaves. While comparing the fat content, mushrooms harvested from coir pith had elevated amount of 0.85 ± 0.03 g and the lowest was recorded in paddy straw with a value of 0.66 ± 0.02 g, which was a significant observation. According to Nuhu et al. (2008) C. indica contained 2.6 to 2.9 g of proteins, 0.6 to 0.7 g of lipids, 1.5 to 1.8 g of fiber and 6.3 to 7.3 g of carbohydrates. Based on the study results, it

Lakshmipathy et al.

7705

Table 5. Effect of physical sterilization.

Substrate

Paddy straw

Sterilization temperature

Autoclaved at 121 °C

Time of steaming (min) 15 30 45 60 75 90

Contamination (%) d 76 ± 3.2 60 ± 2.9c 30 ± 1.7b a 0.6 ± 0.025 a 0.5 ± 0.02 a 0.5 ± 0.019

pH 7.5 7.5 7.5 7.5 7.5 7.5

Temp °C ~35 ~35 ~35 ~35 ~35 ~35

RH % ~85 ~85 ~85 ~85 ~85 ~85

Total no. of flushes a 9.7 ± 0.38 c 15 ± 0.62 16.66 ± 0.94c d 20.33 ± 0.86 c 16.7 ± 0.74 b 13.65 ± 0.63

Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation. RH, Relative humidity.

Table 6. Optimizing the concentration of chemicals for sterilization of substrate.

No. of run 1 2 3 4 5 6 7 8 9 10 11 12 13

A: Formaldehyde [ppm] 500 500 500 1065.68 500 900 100 500 100 900 500 500 0

B: Carbendazim [ppm] 75 138.63 75 75 75 120 30 75 120 30 75 11.36 75

was concluded that paddy straw was the effective substrate for the cultivation of C. indica and it was used for further studies. Effects on sterilization methods on substrates for cultivation of C. indica Physical sterilization Current study explored that 6 h of soaking the substrate and steaming for 60 min yielded the maximum production with 0.6% contamination which was found to be economically viable (Table 5). The previous experiment done by Pathan (2009) revealed that the maximum percent yield was in case of soaking and boiling for 75 min (61.75%). Chemical sterilization The results of central composite design experiments for

Contamination % 5.5 3.3 6.6 6.6 6.6 3.3 70 13.3 40 36.6 10 43.3 50

Total yield % 1.11 0.67 1.16 0.66 1.02 0.45 0.45 1.05 0.65 0.56 0.9 0.35 0.25

Bio-efficiency % 111 67 116 66 102 45 45 105 65 56 90 35 25

studying the effects of chemical sterilization of substrate on the contamination percentage are presented in Table 6. The F-value of 24.01 showed the model as significant. There was only chance of 0.01% variation in "model-F value" due to noise (Table 7). The values of "Prob > F" and less than 0.05 indicated that the model terms were significant. In this case, A2 and B2 are significant model terms. However, values greater than 0.1 indicated that the model terms are not significant. The "lack of fit Fvalue" of 9.26 was exhibited as significant and there was only slight chance of 0.03% variation in "Lack of Fit Fvalue" due to noise. Moreover, the lack of fit value was not significant, so the model has to be change to fit as significant. The "Pred R-Squared" of 0.65 is in reasonable agreement with the "Adj R-Squared" of 0.905. "Adeq Precision" measures the signal to noise ratio and a ratio greater than 4 is desirable. The ratio of 13.486 indicates an adequate signal (Table 8). This model can be used to navigate the design space. The model coefficient was estimated by linear regression (Table 9). The following equations were used: Final Equation in terms of coded

7706

Afr. J. Biotechnol.

Table 7. F-test analysis ( ANOVA for response surface quadratic model).

Source Model A-Formaldehyde B-carbendazim AB A^2 B^2 Residual Lack of Fit Pure Error Cor Total

Sum of squares 5646.03 2160.77 1796.05 2.72 1152.03 747.90 329.24 287.78 41.46 5975.28

df 5 1 1 1 1 1 7 3 4 12

Mean square 1129.20 2160.77 1796.05 2.72 1152.03 747.90 47.03 95.92 10.36

F value 24.00 45.94 38.19 0.05 24.49 15.90

p-value Prob > F 0.0003 0.0003 0.0005 0.8168 0.0017 0.0053

9.25

0.0285

Table 8. Comparition of R2 predicted and estimated.

Parameter Std. Dev. Mean C.V. % PRESS

Value 6.9 22.7 30.21 2111.266

Parameter R-Squared Adj R-Squared Pred R-Squared Adeq Precision

Value 0.945 0.905 0.647 13.486

Table 9. Model coefficient estimated by linear regression.

Factor Intercept A-Formaldehyde B-carbendazim AB A^2 B^2

Coefficient estimate 8.4 -16.43 -14.98 -0.82 12.86 10.36

df 1 1 1 1 1 1

Standard error 3.06 2.42 2.42 3.42 2.60 2.60

95% CI Low 1.147479 -22.16 -20.71 -8.93 6.72 4.22

95% CI High 15.65 -10.70 -9.24 7.28 19.01 16.51

VIF 1 1 1 1.017 1.017

df, Degree of freedom;

factors: Contamination = +8.40-16.43 * A-14.98 * B-0.8 * A * B+12.87 * A2+10.37 * B2 Final equation in terms of actual factors: Contamination = +101.10663-0.11808 * Formaldehyde1.07811 * carbendazim-4.58333E-005 * Formaldehyde * carbendazim +8.04297E-005 * 2 2 Formaldehyde +5.12037E-003 * carbendazim

Effect of chemical sterilization on total yield The results of central composite design experiments for studying the effects of chemical sterilization of substrate on the contamination percentage are presented in Table

6. The F-value of 12.12 showed the model is significant. There is only a chance of 0.24% variation in "model-F value" due to noise (Table 10). The values of "Prob > F" and less than 0.05 indicated that the model terms are significant. In this case, A2 and B2 are significant model terms. However, values greater than 0.1 indicated that the model terms are not significant. The "Lack of Fit F-value" of 9.26 indicated significance and there is only slight chance of 0.08% variation in "Lack of Fit F-value" due to noise. The lack of fit value was not significant, so the model has to be change to fit as significant. The "Pred R-Squared" of 0.46 was in reasonable agreement with the "Adj R-Squared" of 0.82. "Adeq Precision" measures the signal to noise ratio and a ratio greater than 4 is desirable. The ratio of 8.58 indicated an adequate signal (Table 11). This model can be used to navigate the design space. The model coefficient was estimated by linear regression (Table 12) using the following equations: final equation in terms of coded

Lakshmipathy et al.

7707

Table 10. F-test analysis ( ANOVA for Response Surface Quadratic Model).

Source Model A-Formaldehyde B-carbendazim AB A^2 B^2 Residual Lack of Fit Pure Error Cor Total

Sum of squares 1.001 0.02 0.03 0.02 0.56 0.46 0.11 0.077 0.03 1.11

df 5 1 1 1 1 1 7 3 4 12

Mean square 0.2 0.02 0.03 0.024 0.56 0.46 0.01 0.025 0.009

F value 12.11 1.81 2.22 1.45 34.26 27.97

Prob > F 0.0024 0.2198 0.1792 0.2670 0.0006 0.0011

2.61

0.1882

Table 11. Comparition of R2 predicted and estimated.

Parameter Std. Dev. Mean C.V. % PRESS

Value 0.128 0.713 18.005 0.605

Parameter R-Squared Adj R-Squared Pred R-Squared Adeq Precision

Value 0.896 0.822 0.457 8.58

Table 12. Model coefficient estimated by linear regression.

Factor Intercept A-Formaldehyde B-carbendazim AB A^2 B^2

Coefficient estimate 1.04 0.061 0.067 -0.077 -0.285 -0.257

df 1 1 1 1 1 1

Standard error 0.057 0.045 0.045 0.064 0.0487 0.0487

factors;

95% CI low 0.912 -0.046 -0.039 -0.229 -0.400 -0.37298

95% CI high 1.183 0.168 0.175 0.074 -0.170 -0.142

VIF 1 1 1 1.017 1.017

Final equation in terms of actual factors;

improved total yield, when compared to single factor analysis. Physical and chemical sterilizations produced the best and similar results. Comparing the cost effectiveness and least usage of chemical sterilizers, the chemical sterilization could be considered as a method for sterilizing substrates.

R2 Total Yield in Kg = -0.46470+2.25880E003*Formaldehyde+0.02275* carbendazim-4.30556E006*Formaldehyde*carbendazim-1.78281E-006 *Formaldehyde2 1.27284E-004*carbendazim2

Effect of different casing materials along with supplements on yield and yield-contributing characteristics

The contour and three-dimensional response surface curves were plotted and presented in the Figures 1 and 2. Minimum contamination (2.03 %) and total yield of (1.04 Kg) was observed for formaldehyde (620 ppm) and carbendazim (82.79 ppm). Response surface methodology reduced the contamination and significantly

Farm-yard manure, red soil and sand were used as casing materials to evaluate the yield and yieldcontributing characteristics of C. indica. Maximum biological efficiency was recorded in farm-yard manure, red soil and sand at the proportion of (1:3:1) which yielded 145.1% and followed by the farm-yard manure

R2 Total Yield in Kg = +1.05 +0.06 * A +0.068 * B -0.078* A * B 0.29* A2 -0.26 * B2

7708

Afr. J. Biotechnol.

Design-Expert速 Software Factor Coding: Actual R1 Contamination Design points above predicted value Design points below predicted value 70 3.3 X1 = A: Formaldehyde X2 = B: carbendazim

R 1 C o n ta m in a tio n

80 60 40 20 0 -20

900.00 820.00 740.00

120.00 111.00 102.00 93.00 84.00 75.00 66.00 57.00 48.00 39.00 B: carbendazim 30.00

660.00 580.00 500.00 420.00 340.00

A: Formaldehyde

260.00 180.00 100.00

Figure 1. The contour and 3D response surface plot showing the effect of chemical sterilization on contamination.

Design-Expert速 Software Factor Coding: Actual R2 Total Yield in Kg Design points above predicted value Design points below predicted value 1.16 0.25 X1 = A: Formaldehyde X2 = B: carbendazim

R 2 T o ta l Y ie ld in K g

1.2

1

0.8

0.6

0.4

0.2 900.00 820.00 740.00 660.00 120.00 111.00 102.00

580.00 500.00 93.00

420.00

84.00 75.00

340.00

66.00 48.00

180.00

39.00

B: carbendazim

A: Formaldehyde

260.00

57.00 30.00

100.00

Figure 2. The contour and 3D response surface plot showing the effect of chemical sterilization on contamination.

and red soil (3:1) with yield 128% and farm-yard manure and sand (3:1) 104.1% casing materials (Figure 3). Previous studies conducted by Ruhul et al. (2010)

indicated that a maximum biological efficiency was recorded in cow dung and soil (62.94%) followed by the farm-yard manure (62.64%), spent mushroom substrate

Lakshmipathy et al.

1600 1400 1200 1000 800 600 400 200 0

c

25

b

20

7709

b a a

15

a

10 5 0 Farm yard manure Farm yard manure Red Soil & Farm and sand (3:1) and Red Soil (3:1) yard manure with sand (1:3:1) Total no of fushes

Casing soil with caco3

Total yield (g of mushroom / 1 Kg of substrate)

1800 1600 1400 1200 1000 800 600 400 200 0

b

25

a

a

20

b a

a

‌

15 10

No of flushes

Total yield

Figure 3. Effect of different composition of soils on the yield of C. indica. Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

5 0 1

2

3

caco3 concentration Economic yield (g of mushroom / 1 Kg of substrate)

Total no of fushes

Figure 4. Effect of different concentration of CaCO3 in casing soil on the yield of C .indica. Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

(61.66%), and soil and sand (61.46%) casing materials. Hence, farm-yard manure, red soil and sand at the proportion of (131) with 2% CaCO3 and 1.75% of gypsum brought a significant yield of 1.64 Âą 49.4 Kg (Figures 4 and 5) of mushroom per dry weight of substrate. Previous studies done by Kassim et al. (1990) stated that the

number and yield of mushrooms was increased when the supplements were added to the casing soil. The yield was significant when nutrient supplements were added to the casing material. Days of primordial formation, total cropping days gets reduced and BE increases as a result of amendment.

7710

Afr. J. Biotechnol. casing soil with gypsum 1800 b

b

a

1400

Total yield

1200

a

a

25

a b

b

20

c d

1000

e 15

800 600

No of flushes

1600

30

c

10

400 5 200 0

0 1

1.5

1.75

2

2.5

2.75

concentation of gypsum Economic yield (g of mushroom / 1 Kg of substrate)

Total no of fushes

Figure 5. Effect of different concentration of gypsum in casing soil on the yield of C. indica. Values followed by the same letter are not significantly different (P<0.05). Values represent the mean of triplicates with standard deviation.

Effect of casing soil on the nutritive value Casing soil amendments supported the yield significantly, porous loam texture coupled with farmyard manure, CaCO3 and gypsum contributed for the yield. 31.42 ± 1.57 g of proteins, 37.68 ± 1.50 g of fiber, 0.74 ± 0.03 g of fat, 8.75 ± 0.35 g and 56.73 ± 2.83 g of carbohydrates was observed. Studies conducted earlier described that the casing layer is an essential component for the artificial cultivation of C. indica. According to Sassine et al. (2010) the casing layer must be very loose; otherwise, the primordia cannot penetrate from the bottom to the top of the casing layer. ACKNOWLEDGEMENTS The authors are grateful to Dr. MGR Educational and Research Institute University for supporting this research. Thanks also to Tamil Nadu Agricultural University and Karunya University, for providing the facilities for carrying out the research work. REFERENCES Alam N, amin R, khan A, Ara I, Shim MJ, Lee Mw, Lee TS (2010). Nutritional analysis of cultivated mushrooms in bangladesh: pleurotus ostreatus, pleurotus sajor-caju, pleurotus florida and calocybe indica. Mycobiology, 36: 228-32.

Kassim MY, khaliel AS, Al-rahmah AN (1990). Effects of casing soil amendments and nutrient supplementation on mushroom cropping. J. King Saudi University, Agric. Sci. 2(2): 225-230. Jiskani MM, Bhatti ML, Wagan KH, Pathan MA, Bhatti AG (2007). Determination of sorghum grains for spawn growth of oyster mushroom, pleurotus ostreatus (jacq. Ex. Fr) kummer. Pak. J. Bot. 39(7): 2681-2684. Maynard AJ (1970). Methods in food analysis, academic press, New York, p. 176. Nuhu A, Ruhul A, Abul K, Tae SL (2010). Influence of different supplements on the commercial cultivation of milky white Mushroom. Mycobiology, 38(3): 184-188. Nuhu A, Ruhul A, Asaduzzaman K, Ismot A, Mi JS, Min WL, Tae SL (2008). Nutritional analysis of cultivated mushrooms in Bangladeshpleurotus ostreatus, pleurotus sajor-caju, pleurotus florida and calocybe indica. Mycobiol. 36(4): 228-232. Nwanze PI, Khan AU, Ameh JB, Umoh VJ (2005). The effect of spawn grains, culture media, oil types and rates on carpophore production of lentinus squarrosulus (mont.) Singer. Afr. J. Biotechnol. 4(6): 472477. Pathan AA, Pathan MA, Wagan KH, Nizamani ZA (2009). Effect of soaking and boiling of substrate on the growth and productivity of oyster mushroom. Pakistan J. Phytopathol. Pani BK (2010). Evaluation of some substrates for cultivation of white summer mushroom (calocybe indica). Res. J. Agric. Sci. 1(4): 357359. Pani BK (2010). Optimal in vitro environmental conditions for the growth of white summer mushroom (calocybe indica). Res. J. Agric. Sci. 1(3): 280-281. Ruhul A, Abul K, Nuhu A, Tae SL (2010). Effect of different substrates and casing materials on the growth and yield of calocybe indica. Mycobiol. 38(2): 97-101 Sassine YN, Cosette Karam, Dima Mounayar, Ghassan AbdelMenhem (2010). Prospective of local Oyster mushroom production in Lebanon. J. Appl. Sci. Res. 6(12): 2139-2142.

African Journal of Biotechnology Vol. 11(30), pp. 7711-7719, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.1331 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Isolation and characterization of toebicin 218, a bacteriocin, produced by Geobacillus toebii HBB-218 Gamze Başbülbül Özdemir* and Haci Halil Biyik Biology Department, Faculty of Arts and Science, Adnan Menderes University, 09010 Aydin, Turkey. Accepted 22 July, 2011

A novel bacteriocin Toebicin 218 was isolated from Geobacillus toebii HBB-218, a soil inhabiting Gram positive bacterium. The cell free culture supernatants of G. toebii HBB-218 showed antibacterial activity against many Gram positive bacteria including thermophilic strains. Purification of the bacteriocin was achieved after ammonium sulphate precipitation, gel filtration and ion exchange chromatography. Tricine-SDS-PAGE yielded a single protein band observed with a molecular mass of 5.5 kDa. The antibacterial compound was heat stable and sensitive to proteolytic enzymes. Bacteriocin production started at the early logarithmic phase and maximum production was observed at the end of the stationary phase. Bacteriocin was found to be effective especially against thermophilic bacteria and it may have a potential for use as a biopreservative in canned foods. This study provides the first data on bacteriocin produced by a strain of G. toebii. Key words: bacteriocin, Geobacillus toebii, toebicin 218, thermophilic, characterization. INTRODUCTİON Bacteriocins are a heterogeneous group of ribosomally synthesized antibacterial peptides that inhibit strains and species that are usually, but not always, closely related to producing bacteria (Tagg et al., 1976). Both Gram positive and Gram negative bacteria produce small, heatstable bacteriocins. Bacteriocins produced by Gram positive bacteria are often membrane permeabilizing cationic peptides with fewer than 60 amino acid residues (Jack et al., 1995). The bacteriocins produced by lactic acid bacteria offer several desirable properties that make them suitable for food preservation: (1) Are generally recognised as safe substances, (2) Are not active and nontoxic on eukaryotic cells, (3) Become inactivated by digestive proteases, having little influence on the gut microbiota, (4) Are usually pH and heat-tolerant, (5) Have a relatively broad antimicrobial spectrum, against many food-borne pathogenic and spoilage bacteria, (6) Show a bactericidal mode of action, usually acting on the bacterial cytoplasmic membrane: No cross resistance with antibiotics, and (7) Their genetic determinants are

*Corresponding author. E-mail: gbasbulbul@adu.edu.tr Tel: 0090 256 218 2000-1937. Fax: 0090 256 213 53 79.

usually plasmid-encoded, facilitating genetic manipulation (Galvez et al., 2007). According to the Klaenhammer classification scheme, bacteriocins produced by lactic acid bacteria are grouped into four main classes: Class I is the modified bacteriocins which are known as lantibiotics. Class II is the heat-stable, minimally modified bacteriocins. Class III is the larger heat labile bacteriocins and Class IV is complex bacteriocins, these are carrying lipid or carbohydrate moieties (Klaenhammer, 1993). Although, reported bacteriocins are generally isolated from food-grade, mesophilic microorganisms, there are a few examples of bacteriocins produced by thermophilic bacteria and archea (Shafia, 1966; Sharp et al., 1979; Becker et al., 1986; Novotny and Perry, 1992; Prangishvilli et al., 2000; Martirani et al., 2002; Pokusaeva et al., 2009). Thermophilic bacteria belonging to Bacillus genetic group 5 have been reclassified as members of Geobacillus gen. nov., with G. stearothermophilus as the type species (Nazina et al., 2001). Geobacillus species, literally named as earth or soil Bacillus, are widely distributed and readily isolated from natural or man made thermophilic biotopes (McMullan et al., 2004). Geobacillus toebii was firstly identified as a thermophilic, aerobic, spore forming Gram positive bacteria by Sung et al. (2002). The aim of this

7712

Afr. J. Biotechnol.

study was to evaluate the antibacterial activity of a bacteriocin produced by Geobacillus toebii HBB-218 isolated from soil collected from a the thermal spring in Denizli, Turkey. The antibacterial spectrum, characterization and purification of the bacteriocin are described in this report. MATERİALS AND METHODS Bacteria and media Strain HBB-218 was isolated from soil that was collected around thermal spring in Denizli,Turkey. Soil samples were inoculated into Thermus broth and then incubated aerobically at 65°C for 48 h. One mililiter of culture was mixed with Caso agar cooled at 45°C, and then poured onto the plates. Colonies grown after 24 h were purified two times and pure culture of isolate was obtained. Indicator strains used in this study were obtained from different sources and were maintaned in skim milk 20% (v/v) at -20°C. Thermophilic isolates used as indicator strain from our culture collection were identified by partial 16S rDNA analysis, enterococci were identified by API 20E (Biomerieux, France). All the indicator strains were propagated in appropriate media and at temperatures before conducting the experiments (Table 1).

Identification of strain HBB-218 Strain HBB-218 was identified with biochemical tests and 16S rDNA analysis. API 50 CH (BioMerieux, France) kit was used to determine the carbohydrate utilization pattern of the strain. Genomic DNA of strain was isolated as described by Ronimus et al. (1997), 16S rRNA gene was amplified via PCR and then amplicon was sequenced. The primers used for the amplification were: 20F (5'- AGA GTT TGA TCC TGG CTC AG-3') and 1390R (5'- GAC GGG CGG TGT GTA CAA-3') (Orphan et al., 2000). The partial 16S rRNA gene sequence of strain HBB-218 was submitted to GenBank Nucleotide Sequence Database and accession number GQ255948 has been assigned.

Antibacterial activity assays The antibacterial activity of cell free culture supernatants (CFS) were obtained from 24, 48, 72 and 96 h cultures of HBB-218 were detected by modified agar-well diffusion method (Hechard et al., 1992). For this purpose, HBB-218 was grown in BHI broth, and samples were centirifuged at 8 000 × g for 10 min. The supernatant was then sterilized through a milipore filter (Sartorius) with 0.45 µm pore size. 350 µl bacterial suspension (0.5 McFarland) was mixed with appropriate 35 ml agar media for each strain and then poured into plates. Wells with 6 mm diameter were cut into agar media by using cork borer and then 50 µl bacteriocin were placed into each well. The plates were kept at 4°C for 2 h for bacteriocin diffusion then incubated at the given temperatures for each bacterial strain and examined for zones of inhibition.

Effects of heat, enzymes, pH and chemicals on bacteriocin activity In order to obtain crude bacteriocin sample, HBB-218 was grown in BHI broth at 60°C which is the optimum temperature detected for bacteriocin production (data not shown) for 24 h and then cell-free culture supernatants were prepared by centrifuge at 8 000 × g for

10 min. Both CFSs and purified samples were used for characterization of antibacterial substance. To determine the thermal stability, bacteriocin samples were heated for 30 min and 2 h at 30, 45, 60 and 95°C, also autoclaved for 20 min at 121°C, cooled and assayed for activity. Aliquots were also maintained for one month at 4°C, and then activity was tested. Untreated samples served as control (Powell et al., 2007). The effects of various enzymes on bacteriocin activity were also tested. Aliquots were treated with pronase E, proteinase K, papain, RNase, Lipase, B-glucoronidase, lactase at final concentration of 1 and 10 mg/ml, catalase at final concentration of 300 IU/ml for 1 and 24 h. An untreated bacteriocin and the enzyme in the buffer were both served as controls (Riosen et al., 2005). In a separate experiment, the effect of the pH on bacteriocin activity was tested by adjusting each of the aliquots to between 3.0 and 11.0 with sterile 1 mol L-1 NaOH or 1 mol L-1 HCl. After 24 h of incubation at 4°C, the treated samples were adjusted to pH 7.0 with sterile 1 mol L-1 NaOH or 1 mol L-1 HCl and tested for activity (Deraz et al., 2005). Acetone, chloroform, dimethyl sulfoxide (DMSO), ethanol, methanol and xylol were added to 24 hold cell-free culture supernatants at final concentration of 10% (v/v) and then incubated for 1 h at 30°C. Trichloroacetic acid (TCA) was added at a final concentration of 100 mg/ml, incubated for 1 h at 30°C. After treatment with TCA, samples were centrifugated at 10 000 × g for 5 min and the supernatants were neutralized to pH 7.0 before testing for antibacterial activity. Tween 80 and urea were used at final concentration of 1 mg/ml, and ethylenediaminetetraacetic acid (EDTA) was used at 0.1 mmol l-1. Chemicals and bacteriocin aliquots diluted with sterile distilled water at same final concentration were used as control (Todorov and Dicks, 2005). After each treatment, the samples were tested for antibacterial activity against G. stearothemophilus DSMZ 22 using well diffusion method.

Growth and bacteriocin production A 24 h-old culture of strain HBB-218 was inoculated (2%, v/v, OD600 nm = 0.1) into BHI broth and incubated at 65°C without agitation. Samples were taken at 3 h intervals and absorbencies were recorded. To determine the bacteriocin titers, samples were centrifugated at 8 000 × g for 10 min and then put into wells. The titer was defined as the reciprocal of the highest dilution that exhibit inhibition of the sensitive strain and was expressed in arbitrary units (AU) per mililiter.

Purification of bacteriocin Purification of bacteriocin was achieved by ammonium sulphate precipitation, gel-filtration chromatography and ion-exchange chromatography, sequentially. All the purification steps were performed at 4°C. Strain HBB-218 was grown in 500 ml modified media (soja peptone 3%, galactose 0.1%, NaCl 5 g l-1; di-sodium phosphate 2.5 g l-1) at 60°C for 72 h, then cells were harvested by centrifugation at 8 000 × g for 10 min. 450 ml culture supernatant were autoclaved at 121°C for 20 min, precipitants were removed again via centrifugation at 8 000 × g for 10 min. Ammonium sulphate was added to the resulting culture supernatant at 80% saturation. The pelleted amonnium sulphate precipitate was dissolved in 20 mmol l-1 sodium phosphate buffer (pH 7.0), and dialyzed against the same buffer by using a 1000 Da dialysis membrane (ZelluTrans-Roth E887.1). The dialyzed sample was stirred for 24 h in 20 mmol l-1 sodium phosphate buffer (pH 7.0), then concentrated by using 5 000 MWCO ultrafiltration membrane (Sartorius). 3 ml concentrated sample was applied to a gel filtration column (100 cm length and 1-cm internal diameter), Sephadex G50, previously equilibrated with 20 mmol l-1 sodium phosphate buffer (pH 7.0) and eluted at a flow rate of 0.35 ml min-1 with the

Özdemir and Biyik.

7713

Table 1. Indicator strains used in the study

Strain Geobacillus stearothermophilus Bacillus sphaericus Bacillus sp. B. mycoides B. thrungiensis B. cereus B. subtilis Serratia marcescens Pseudomonas fluorescens Proteus sp. Pectobacterium carotovorum Enterococcus faecalis Listeria sp. Staphylococcus aureus Micrococcus luteus Streptococcus vestibularis Escherichia coli Listeria innocua Lactobacillus plantarum L. acidophilus L. sakei Leuconostoc mesenteroides Brochothrix thermosphacta Cellulomonas fimi Clostridium pasteurianum Geobacillus sp. Anoxybacillus sp. Anoxybacillus sp. Anoxybacillus sp. Anoxybacillus sp. Geobacillus sp. Geobacillus sp. Geobacillus sp. Geobacillus sp. Geobacillus sp. E. faecium E. faecium E. faecium Enterococcus gallinarium E. gallinarium E. faecalis E.faecalis Enterococcus avium Enterococcus durans E. durans

Strain number DSMZ 22 DSM 396 Soil isolate DSM 299 Soil isolate ATCC 11778 ATCC 6633 Soil isolate DSM 50090 Clinical isolate DSM 30168 ATCC 51299 Food isolate ATCC 25923 ATCC 9341 DSM 5636 ATCC 35218 DSM 20649 DSM 20174 DSM 20079 DSM 6333 DSM 20343 DSM 20171 DSM 20114 DSM 525 HBB-103 HBB-134 HBB-225 HBB-226 HBB-229 HBB-269 HBB-270 HBB-301 HBB-247 HBB-234 HBB-M-1 HBB-MS-1 HBB-KT-2 HBB-MÇ-3 HBB-LC-M1 HBB-NÇ HBB-AS-1 HBB-AS-3 HBB-KT-1 HBB-K-1

same buffer containing 0.15 mol l-1 NaCl. Fractions were pooled and their absorbancies at 280 nm were measured using spectrophotometer (Shimadzu UV-1601) and bacteriocin activities were detected. One of the fractions obtained by gel chromatography, fraction B, was concentrated and then applied to DEAE-

Media Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar Nutrient Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar MRS Agar MRS Agar MRS Agar MRS Agar Corynebacterium agar Trypticase soy yeast Agar Glucose yeast extract Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar Caso Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar BHI Agar

Temperature (ºC) 55 30 30 30 30 30 30 37 30 37 26 37 37 37 37 37 37 37 37 37 30 30 30 30 37 65 65 65 65 65 65 65 65 65 65 37 37 37 37 37 37 37 37 37 37

sepharose column (Sigma, C-3794), eluted with 20 mmol l-1 sodium phosphate buffer (pH 7.0) followed by a gradient from 0 to 1 mol l-1 NaCl at a flow rate of 0.6 ml min-1 . Protein concentrations were determined by Bradford method using bovine serum albumin as the standart (Bradford, 1967).

7714

Afr. J. Biotechnol.

Bacteriocin activities were tested against G. stearothermophilus DSMZ 22 as indicator strain.

SDS-PAGE The Tricine-SDS-PAGE method (4 and 16% acrylamide for the stacking and separating gel, respectively) was performed to control the purification steps and to determine the molecular weight of the bacteriocin (Schagger, 2006). Molecular weight standarts were from Sigma (M3546). One half of the gel was stained with Coomasie blue, and the other half was used for direct detection of bacteriocin activity. The gel, assayed for antibacterial activity was overlaid with soft (0.7%) BHI agar, inoculated with the indicator strain G. sterathermophilus DSMZ 22 (1 % v/v). Plate was incubated at 55°C for 14 h, and observed for the formation of inhibition zone.

RESULTS

bacteriocin activity was stable after incubation for 24 h with pH values ranging from 3 to 11, while partial inactivation was observed for purified bacteriocin at pH 3, 4 and 5. Among the tested chemicals, only TCA was able to fully inactivate both of the crude and pure bacteriocin. Tween 80 and chloroform treatment resulted with decrease in activity (20 and 13%, respectively) (Table 4). Bacteriocin production The production of bacteriocin was found to be starting at early logarithmic phase of growth and it reached to the maximum level (320 AU/ml) after 72 h of cultivation. Figure 1 represents the correlation between bacteriocin activity and growth of G. toebii HBB-218.

Identification of the strain HBB-218

Purification of the bacteriocin

The strain HBB-218 is a Gram-positive, aerobic, endospore forming thermophilic bacterium. According to the biochemical test results, HBB-218 was found to be catalase and oxidase positive, and produced acid from glucose, ribose and glycerol. The 16S rDNA sequence of the strain HBB-218 showed highest similarity (99.6%) with G. toebii according to BLAST results.

The bacteriocin was purified from cell free culture supernatants by a combination of ammonium sulphate precipitation, gel filtration and ion exchange chromatography. As a result of gel filtration chromatography, active fractions were collected at four different parts. Fraction B which is the mostly active one and has lower protein content applied to anion exchange column. On the anion exchange column, fractions with inhibitor activity were detected at initial samples without using NaCl gradient. The data for recovery and degree of purification are summarized in Table 5.

Antibacterial spectrum of bacteriocin The bacteriocin produced by G. toebii HBB-218 showed inhibition of a wide range of Gram positive bacteria whereas none of the tested Gram negative strains were inhibited. Bacteriocin inhibits some clinically important bacteria like Enterococcus faecalis and Micrococcus luteus and it is more active against thermophilic bacterial isolates. The cell-free supernatans obtained from 72 and 96 h-old culture were effective especially against enterococcal species. The antibacterial spectrum of bacteriocin produced by strain HBB-218 is compiled in Table 2. Effects of heat, pH, enzymes and chemicals on bacteriocin activity As a result of enzyme treatment, inhibitory agent was found to be sensitive to pronase E and proteinase K; the crude bacteriocin was found to be relatively resistant to proteolytic enzymes. Also, the activity was partially or completely lost by lipase and B-glucoronidase enzymes depending on the enzyme concentration and incubation time (Table 3). Inhibitory agent was found to be a very heat stable, a loss of activity (31%) of the purified bacteriocin was determined after testing at 121°C for 20 min. Storage of either crude or purified bacteriocins at 4°C did not affect the activity after one month. Crude

Molecular weight determination According to Tricine-SDS-PAGE analysis, the purified bacteriocin provided only one band which corresponds to a molecular mass of approximately 5.5 kDa. On the other, for half of the identical gel, this band was active against the indicator strain G. stearothermophilus DSMZ 22 (Figure 2). DİSCUSSİON In this study, a bacteriocin tentatively named as Toebicin 218 produced by G. toebii HBB-218 was isolated, characterized and purified. HBB-218 isolated from soil collected around the thermal spring (Denizli, Turkey) was identified as G. toebii according to 16S rDNA results. To our knowledge, this is the first description of a bacteriocin produced by a G. toebii strain. Bacteriocin produced by strain HBB-218 was active against many of the tested Gram positive bacteria, especially the thermophilic species. One of the most sensitive strains, G. stearothermophilus is a canned food spoilage bacterium and spores of this bacterium are extremely resistant to

Ă–zdemir and Biyik.

7715

Table 2. Antibacterial spectrum of toebicin 218.

Indicator strain G. stearothermophilus DSMZ 22 B. sphaericus DSM 396 M. luteus ATCC 934 Lact. plantarum DSM 20174 Listeria sp. E. faecalis ATCC 51299 E. gallinarium MÇ-3 E. gallinarium LC-M1 E.faecium MS-1 E. faecium KT-2 E. durans K-1 E.durans KT-1 E. avium AS-3 Brochothrix thermosphacta DSM 20171 Cellulomonas fimi DSM 20114 Clostridium pasteurianum DSM 525 Anoxybacillus sp. HBB-134 Geobacillus sp. HBB-234 Geobacillus sp.HBB-247 Geobacillus sp. HBB-269 Geobacillus sp. HBB-270 Anoxybacillus sp.HBB-229 Geobacillus sp. HBB-301 Bacillus sp. (soil isolate) B. mycoides DSM 299 B.cereus ATCC 11778 B. subtilis ATCC 6633 S. marcescens (soil isolate) Pseudomonoas fluorescence DSM 50090 Pectobacterium carotovorum DSM 30168 Staphylococcus aureus ATCC 25923 Streptococcus vestibularis DSM 5636 E.coli ATCC 35218 Listeria innocua DSM 20649 Lact. acidophilus DSM 20079 Lact. sakei DSM 6333 Leuconostoc mesenteroides DSM 20343 Geobacillus sp. HBB-103 Anoxybacillus sp. HBB-225 Anoxybacillus sp. HBB-226

24 h CFS 20 9 9 10 11 9 16 20 10 8 18 8 15 15 -

heat treatment. Low-acid foods such as meat and marine products, milk, vegetables, meat and vegetable mixtures (such as soups) can be spoiled by G. stearothermophilus under improper storage conditions (Ayres et al., 1980). Toebicin 218 is also heat stable and active over a wide range of pH values. Because of these properties, it can be very useful in canned food industry against some thermophilic, endospore former spoilage-causing bacteria.

Zone of inhibition (mm) 48 h CFS 72 h CFS 20 20 9 9 9 9 10 10 9 9 11 11 12 14 10 13 10 12 14 14 10 20 22 20 24 16 18 11 11 18 21 12 8 10 16 18 18 18 -

96 h CFS 20 9 9 10 9 11 13 14 10 13 13 14 13 8 24 25 18 11 21 12 15 20 18 -

The results obtained from the bacteriocin treatment with different enzymes revealed the proteinaceous nature of the analyzed antimicrobial substances. Inhibitory agent is sensitive to pronase E and proteinase K, which indicates that a bacteriocin is indeed responsible for the antibacterial activity observed. Both purified and crude bacteriocins were also inactivated by TCA treatment. Among tested enzymes, lipase and B-glucuronidase also

7716

Afr. J. Biotechnol.

Table 3. Effects of different enzymes on activity.

Residual activity (%) 1 h incubation CFS Pure CFS Pure 1 mg/ml 10 mg/ml 100 0 100 0 100 80 100 69 100 100 87,5 0 62,5 80 62,5 0 100 100 62,5 100 100 100 100 100 100 100 100 100 100 100 100 100

Enzyme

Proteinase K Pronase E Papain Lipase β-Glucuronidase Lactase RNAse Catalase (300IU/mL) a

a

24 h incubation CFS Pure CFS Pure 1 mg/ml 10 mg/ml 100 0 0 0 100 0 75 0 100 100 87,5 0 62,5 0 0 0 100 100 0 50 100 100 100 100 100 100 100 100 100 100 100 100

Residual activity was estimated according to formula “zone diameter of treated bacteriocin x100 / zone diameter of control”

Table 4. Effects of heat, pH and chemicals on toebicin 218 activity.

Treatment

Residual activitya Crude (%) Pure (%)

Organic solvent (10%) Acetone, xylol, DMSO, methanol, ethanol, Chloroform TCA (100 mg/ml)

100 100 0

100 87 0

Detergent EDTA (0.1 mM), urea (1 mg/ml) Tween 80 (1 mg/ml)

100 100

100 80

pH 3-5 6-11

100 100

86 100

Temperature (°C) 30, 45, 60, 95 for 30 min 30, 45, 60, 95 for 2 h 121 for 20 min +4 for 1 month

100 100 100 100

100 100 69 100

a

Residual activity was estimated according to formula “zone diameter of treated bacteriocin x100 / zone diameter of control

affected the antibacterial activity which may be indicating that carbohydrate and lipid moieties are essential for bacteriocin activity. Reduction in the activity can be related to longer incubation times or bacteriocin instability. Similar results on bacteriocin activity and carbohydrate or lipid related enyzmes were reported for other bacteriocins produced by Lactobacillus curvatus L422, Streptococcus thermophilus ST110, L. paracasei and L. rhamnosus, G. stearothermophilus 17 (Xiraphi et al., 2005; Gilbert and Somkuti, 2005; Gulahmadov et al., 2006; Pokusaeva et al., 2009).

Production of bacteriocin starts at logarithmic growth phase and it reaches maximum level at the end of the stationary phase. Our results are similar to those described for bacteriocins produced by Lactobacillus salivarius, Lactobacillus plantarum TF711, S. auerus AB188, E. faecium MMT21 (Ocana et al., 1999; Hernandez et al., 2005; Saeed et al., 2006; Ghrairi et al., 2007). The reduction observed at the end of the stationary phase may be due to the proteolytic degradation or other environmental factors such as pH level or adsorption to the producer cell. To understand the

Özdemir and Biyik.

7717

Figure 1. Kinetics of growth and bacteriocin production by G. toebii HBB-218 in BHI broth; (■) OD600, (●) bacteriocin activity (AU/mL) against G. stearothermophilus DSM22.

Table 5. Purification of the bacteriocin produced by G. toebii HBB-218.

Fraction CFS Autoclaved CFS Dyalisate Concentrated dyalisate Fraction B (gel chromatography) Fraction 1 (anion exchange)

Volume (ml)

Activity (AU/ml)

Protein (mg/ml)

450 400 21 3 12.5 3

160 160 2560 10240 640 320

0.234 0.154 2.03 11.35 0.240 0.029

correlation between lyses of cells and increasing bacteriocin activity, we also investigated the intracellular bacteriocin activity (data not shown). As a result of sonication of 24 h-old culture of strain, bacteriocin activities were detected in all three fractions including extracellular (80 AU/ml), intracellular (<40 AU/ml) and membrane-bound (<40 AU/ml) aliquots. These results are similar with some bacteriocins produced by B. linens ATCC 9171, Sulfolobus islandicus HEN2/2, and L. curvatus (Kato et al., 1991; Prangishvilli et al., 2000; Chung and Yousef, 2005). Toebicin 218 was purified by sequential precipitation, gel filtration, and ion exchange chromotography process with a purification fold of approximately 16. A single band of about 5.5 kDa was observed after purification corres-

Total activity (AU) 72000 64000 53760 30720 8000 960

Total protein (mg/ml) 105.3 61.6 42.63 34.05 3.00 0.087

Spesific activity (AU/mg)

Purification fold

Recovery (%)

6 84 1039 1261 902 2667 11035

1 1.52 1.84 1.32 3.90 16

100 89 75 43 11.1 1.33

ponded to the activity detected after incubation of the indicator strain with a gel slice containing bacteriocin. During anion exchange chromatography experiments, aliquots with antibacterial activity were obtained at first fractions. Bacteriocins produced by Gram positive bacteria are known as cationic molecules and our results are in agreement with this nature of bacteriocins. Pokusaeva et al. (2009) estimated the molecular weights of bacteriocins produced by some strains of G. stearothermophilus about 6.8, 5.6, 7.1 and 7.2 kDa (strain 17, 30, 31 and 32A, respectively) and indicated that these values differ from all bacteriocins produced by endospore-forming strains described previously. Toebicin 218 has some similarities to that produced by G. stearothermophilus strain 30 in terms of its molecular

7718

Afr. J. Biotechnol.

Figure 2. Tricine SDS-PAGE visualization of purified bacteriocin. M, Marker. Right line corresponds to zone of inhibition on the portion of the gel overlaid with the G. stearothermophilus DSM22.

wiehgt and antibacterial spectrum (Pokusaeva et al., 2009). Bacillocin 490 produced by a thermophilic strain of Bacillus licheniformis is also a small (2 kDa) and heat stable bacteriocin (Martirani et al., 2002). On the other hand, some examples of high molecular weight bacteriocins produced by thermophiles, such as thermoleovorine-S2 (42 kDa) and thermoleovorine-N9 (36 kDa), isolated from B. thermoleovorans and sulfolobicin purified from S. islandicus HEN2/2 had a molecular mass of about 20 kDa (Novotny and Perry, 1992; Prangishvilli et al., 2000). The bacteriocin, designated toebicin 218, is inhibitory to several food spoilage and pathogenic bacteria and shows a remarkable stability to heat treatment. In conclusion, toebicin 218 appears to be a potential biopreservative for food products subjected to pasteurization, sterilization and other heat processing treatments. Our study increases recent knowledge about bacteriocins produced by thermophilic bacteria, which were not previously investigated in depth. Further studies regarding the genetic determinants of bacteriocin production and its usefulnes in food systems are required to accumulate knowledge on bacteriocins produced by thermophilic bacteria. ACKNOWLEDGEMENTS This work is supported by projects granted by TUBİTAK (project no 106T581) and ADU-BAP (6009). The authors

would like to thank Dr. Bulent BOZDOGAN and Erman ORYASIN for their cooperation in the field and the sequencing studies and Dr. Kubilay METİN for purification of bacteriocin. REFERENCES Ayres JC, Mundt JO, Sandine WE (1980). Microbiology of Foods. Freeman, San Francisco, CA. Becker RJ, Becker DA, Starzyk MJ (1986). Bacteriocin like activity within the genus Thermus. Appl. Environ. Microbiol. 52: 1203-1205. Bradford MM (1967). Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of ProteinDye Binding. Anal. Biochem. 72: 248-254. Chung HJ, Yousef AE (2005). Lactobacillus curvatus produces a bacteriocin-like agent active against Gram negative pathogenic bacteria. J. Food Safety 25: 59-79. Deraz SF, Karlssoni EN, Hedstörm M, Andersson MM, Mattiasson B (2005). Purification and characterization of acidocin D20079, a bacteriocin produced by Lactobacillus acidophilus DSM 20079. J. Biotechnol. 117: 343-354. Galvez A, Abriouel H, Lopez RL, Omar NB (2007). Bacteriocin-based strategies for food biopreservation. Int. J. Food Microbiol. 120: 51-70. Ghrairi T, Frere J, Berjeaud JM, Manai M (2007). Purification and characterization of bacteriocins produced by Enterococcus faecium from Tunisian rigouta cheese. Food Control 19: 162-169. Gilbert SE, Somkuti GA (2005). Thermophilin 110: A bacteriocin of Streptococcus thermophilus ST 110. Curr Microbiol 51: 175-182. Gulahmadov SG, Batdorj B, Dalagalarrondo M, Chobert JM, Kuliev AA, Haertle T. (2006). Characterization of bacteriocin-like inhibitory substances (BLIS) from lactic acid bactera isolated from traditional Azerbaijani cheeses. Eur. Food Res. Technol. 224: 229-235. Hechard Y, Derijard B, Letellier F, Cenatiempo Y (1992). Characterization and purification of mesentericin Y105, an antilisteria bacteriocin from Leuconostoc mesenteroides. J. Gen. Microbiol. 138:

Ă–zdemir and Biyik.

2725-2731. Hernandez D, Cardell E, Zarate V (2005). Antimicrobial activity of lactic acid bacteria isolated from Tenerife cheese: initial characterization of plantaricin TF711, a bacteriocin-like substance produced by Lactobacillus plantarum TF711. J. Appl. Microbiol. 99: 77-84 Jack RW, Tagg JR, Ray B (1995). Bacteriocins of Gram positive bacteria. Microbiol Rev. 59: 171-200. Kato F, Eguchi Y, Nakano M, Oshima T, Murata A (1991). Purification and characterization of Linecin A, a bacteriocin of Brevibacterium linens. Agric. Biol. Chem. 55: 161-166 Klaenhammer TR (1993). Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol. Rev. 12: 39-85. Martirani L, Varcamonti M, Naclerio G, Felice MD (2002). Purification and partial characterization of bacillocin 490, a novel bacteriocin produced by a thermophilic strain of Bacillus licheniformis. Microbial Cell Factories, 1: 1-5 McMullan G, Christie JM, Rahman TJ, Banat IM, Ternan NG, Marchant R (2004). Habitat, applications and genomics of the aerobic, thermophilic genus Geobacillus. Biochem. Soc. Transistions, 32: 214217. Nazina TN, Tourova TP, Poltaraus AB, Novikova EV, Grigoryan AA, Ivanova AE, Lysenko AM, Petrunyaka VV, Osipov GA, Belyaev SS, Ivanov MV (2001). Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen. nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus thermoglucosidasius and B. thermodenitrificans. Int. J. Syst. Evol. Microbiol. 51: 433-446. Novotny JF, Perry JJ (1992). Characterization of bacteriocins from two strains of Bacillus thermoleovorans, a thermophilic hydrocarbonutilizing species. Appl. Environ. Microbiol. 58: 2393-2396. Ocana V, Ruiz Holdago A, Nader-Macias ME (1999). Characterization of a Bacteriocin-Like Substance Produced by a Vaginal Lactobacillus salivarius Strain. Appl. Environ. Microb. 65: 5631-5635. Orphan VJ, Taylor LT, Hafenbradl D, Delong EF (2000). Culture dependent and Culture-Ä°ndependent Characterization of Microbial Assemblages Asociated with High-Temperature Petroleum Reservoirs. Appl. Environ. Microbiol. 66(2): 700-711 Pokusaeva K, Kuisiene N, Jasinskyte D, Rutiene K, Saleikiene J, Chitavichius D (2009). Novel bacteriocins produced by Geobacillus stearothermophilus. Cent. Eur. J. Biol. 4: 196-203

7719

Powell JE, Witthun RC, Todorov SD, Dicks LMT (2007). Characterization of bacteriocin ST8KF produced by a kefir isolate Lactobacillus plantarum ST8KF. Int. Dairy J. 17: 190-198. Prangishvilli D, Holz I, Stieger E, Nickell S, Kristjansson JK, Zillig W (2000). Sulfolobicins, specific proteinaceous toxins produced by strains of the extremely thermophilic archaeal genus Sulfolobus. J. Bacteriol. 182: 2985-2988. Riosen PA, Ronning P, Hegna IK, Kolsto AB (2005). Characterization of a broad range antimicrobial substance from Bacillus cereus. J. Appl. Microbiol. 96: 648-655. Ronimus RS, Parker LE, Morgan HW (1997). The utilization of RAPDPCR for identifying thermophilic and mesophilic Bacillus species. FEMS Microbiol. Lett. 147: 75-79. Saeed S, Rasool SA, Ahmed S, Khanum T, Khan MB, Abbasi A, Ali SA (2006). New insight in staphylococcin research: bacteriocin and/or bacteriocin-like inhibitory substances produced by S. aureus AB188. World J. Microbiol. Biotechnol. 22: 713-732. Schagger H (2006). Tricine-SDS-PAGE. Nat Protocols, 1: 16-23. Shafia F (1966). Thermocins of Bacillus stearothermophilus. J. Bacteriol. 92: 524-525. Sharp RJ, Bingham AHA, Comer MJ, Atkinson A (1979). Partial characterization of bacteriocin (thermocin) from Bacillus stearothermophilus RS93. J. Gen. Microbiol. 111: 449-451 Sung MH, Kim H, Bae JW, Rhee SK, Jeon CO, Kim K, Kim KK, Hong SP, Lee SG, Yoon JH, Park YH, Baek DH (2002). Geobacillus toebii sp. nov., a novel thermophilic bacterium isolated from hay compost. Int. J. Syst. Evol. Microbiol. 52: 2251-2255. Tagg JR, Dajani AS, Wannamaker LW (1976). Bacteriocins of grampositive bacteria. Bacteriol. Rev. 40: 722-756. Todorov SD, Dicks LM (2005). Characterization of bacteriocins produced by lactic acid bacteria isolated from spoiled black olives. J . Basic Microbiol. 45: 312-322. Xiraphi N, Georgalaki M, Van Driessche G, Devreese B, Van Beeumen J, Ttsakalidou E, Metaxopoulos J, Drosinos E (2005). Purification and characterization of curvaticin L442, a bacteriocin produced by Lactobacillus curvatus L442. Antonie van Leuwenhook, 89: 19-26.

African Journal of Biotechnology Vol. 11(30), pp. 7720-7724, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.590 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Proximate and mineral analysis of some wild edible mushrooms I. O. Okoro* and F. I. Achuba Department of Biochemistry, Faculty of Science, Delta State University, Abraka, Delta state, Nigeria. Accepted 11 August, 2011

Proximate and mineral analysis of five species of mushroom, Lentinus squarrosulus, Volvariella volvacea, Coprinus micaceus, Lepiota procera, and Auricularia auricula were examined in this study to determine their nutritional value. These mushrooms were found to contain on the average, 3.24 to 8.70% of crude fibre; 4.12 to 11.12% of ash; 0.90 to 2.58% of fats and oil; 12.02 to 27.00% of protein; 13.01 to 92.02% of moisture and 21.11 to 68% of carbohydrate. The average mineral element content of the mushrooms was found to be 144 to 1321 mg/100 g of potassium; 122 to 364 mg/100 g of sodium; 164 to 549 mg/100 g of calcium; 26 to 53 mg/100 g of magnesium; 738 to 1537 mg/100 g of phosphorus and 120 to 432 mg/100 g of iron. The overall nutritional potential of the five mushroom species was quite good. These results show that these species of mushroom are highly nutritive. These findings were discussed in line with the importance and implications of the uses of edible mushrooms to man. Key words: Edible mushroom, mineral composition, proximate analysis.

INTRODUCTION The consumption of mushrooms is now assuming greater importance in human diet worldwide, but many people are apprehensive about mushrooms as a food source. Ignorance has led many to become sceptical about whether food of fungal origin can hold any great nutritional promise. It seems much education is needed before full advantage can be taken of this readily available, nutritionally rich food source (Chang and Mshigeni, 2001; Crisan and Sands, 1978). Mushroom eating is still not popular in some parts of Nigeria today. This is due to the fact that mushrooms and fungus in general grow on decaying organic matter and waste substrates, coupled with the fact that some mushrooms are poisonous. However, in other parts of Nigeria, mushrooms are regular source of food to them (Oso, 1975; Nwokolo, 1987). Mushrooms have assumed greater importance in the diets of both rural and urban dwellers, unlike previously when consumption was confined to rural dwellers. Mushrooms are now marketed along highways and urban centres (Aremu et al., 2008). Most of the mushrooms consumed in Nigeria are picked by rural dwellers from farmlands, forests and around waste dump sites when

*Corresponding author. E-mail: israelik@yahoo.com.

environmental conditions particularly humidity favour their sporocarp formation. They are relatively much cheaper than beef, pork and chicken that contain similar nutrients. Also, Africa is very rich in edible species of mushroom and many people in African countries still depend on collection of wild edible mushrooms (Peter, 1991; Masuka and Utete, 1996). Mushrooms represent one of the world's greatest untapped resources of nutritious food. Cultivation of saprophytic edible mushrooms may be the only currently economical biotechnology for lignocellulose organic waste recycling that combines the production of protein rich food with the reduction of environmental pollution (Obodai et al., 2003). Mushrooms are rich in protein, minerals, and vitamins, and they contain an abundance of essential amino acids (Sadler, 2003). Therefore, mushrooms can be a good supplement to cereals (Chang and Buswell, 1996). Mushrooms are saprophytes. They include members of the Basidiomycota and some members of the Ascomycota. They consist of two main parts, the mycelium and the fruity body (sporocarp). The mycelium consists of a treelike structure called hyphae hidden in the soil. The mycelium absorbs food nutrients while the hyphae form into mycelia which forms the fruit (sporocarp) structure on the surface when atmospheric conditions particularly

Okoro and Achuba

humidity is favourable. The spore producing tissue is called the hymenium (Etang et al., 2006). Mushrooms vary in sizes, colour, texture and structure that favour their spore formation. The cap is called the cuticle and varies among different mushroom species, being sticky or slimy in texture. The stalk is the stem-like structure on which the cap is mounted and this varies in length depending on the species (Gyar and Ogbonna, 2006). Many species of mushrooms are edible, for example, Plevritis sp., Agricus bisporus (J. Lange) Imbach and Volvariella volvaceae (Bulliard ex Fries) Singer. Some are medicinal like Tremella fuciformis Berk., for maintaining healthy lung tissue, while others are poisonous like Pholiota semarrasa and Amanta vaginata (Bull.: Fr.) Lam. (Chang and Buswell, 1996). Mushrooms have been a food supplement in various cultures and they are cultivated and eaten for their edibility and delicacy. They fall between the best vegetables and animal protein source. Mushrooms are considered as source of proteins, vitamins, fats, carbohydrates, amino acids and minerals (Jiskani, 2001). All essential amino acids are present as well as water soluble vitamins and all the essential minerals (Buigut, 2002). Mushrooms are good sources of vitamins like riboflavin, biotin and thiamine (Chang and Buswell, 1996). It has been indicated that mushroom is about 16.5% dry matter out of which 7.4% is crude fibre, 14.6% is crude protein and 4.48% is fat and oil. The protein value of mushrooms is twice as that of asparagus and potatoes, four times as that of tomatoes and carrots, and six times as that of oranges (Jiskani, 2001). Their energy value also varies according to species, which is about equal to that of an apple. A common species of mushroom found in southern part of Nigeria is Pleurotus tuber-regium. It is useful in some combinations to cure headache, stomach ailents, colds and fever (Oso, 1977), asthma, smallpox and high blood pressure (Oso, 1977; Fasidi and Olorunmaiye, 1994), while Lentinus tuber-regium and Lentinus tigrinus are used for treating dysentery and blood cleansing respectively. Auricularia specie has been traditionally used for treating hemorrhoids and various stomach ailments (Chang and Buswell, 1996). Chanterelles, Boletus edulis and Lactarius spp. are used for killing flies, while the puffballs are used for healing wounds (Harkonen, 1998; Delena, 1999). They are also recommended to diabetic and anaemic persons, owing to their low carbohydrate and high folic acid content. Some mushrooms are reputed to possess anti-allergic, anticholesterol, anti-tumor and anti-cancer properties (Jiskani, 2001). With the present high cost of meat and fish, many Nigerians are turning to mushrooms as an alternative source of protein. A limited amount of research has been carried out on the nutritive value of Nigerian mushrooms (Oke, 1966; Oso, 1977; Ogundana and Fagade, 1982). The objective of this study was to determine the

7721

biochemical composition of five different wild edible mushrooms species, in terms of moisture, protein, crude fat, carbohydrate, fibre, ash and micronutrient elements. It is hoped that the results may be valuable for chemotaxonomical and will encourage people to embark on their husbandry. MATERIALS AND METHODS Collection and treatment of samples Mushrooms grow abundantly in the wild during the rainy season in every part of Delta State, Nigeria. Fruiting of five mushroom species were harvested from decaying logs and oil palm stalks dump site inside a bush located at Abraka, Delta State, Nigeria. The mushroom species were identified by a mycologist in the Department of Botany, Faculty of Science, University of Benin, Benin City, Edo State, Nigeria as Lentinus squarrosulus, V. volvacea, Coprinus micaceus, Lepiota procera and Auricularia auricula. Sample preparation was done as follows: after harvest, the fruit bodies were cleaned by gentle wiping with a cloth to remove any debris. Except for moisture and ascorbic acid determination, which were performed immediately after harvesting, dried samples were used. Dried samples were ground using a laboratory mill to pass through 1 mm sieve. All ground samples were transferred to airtight plastic bottles with well fitting caps, labelled and then sealed in polythene bags to prevent any water intake and were stored in a refrigerator at 4째C until required for analysis. The cold stored samples were allowed to attain room temperature and mixed thoroughly with a spatula before withdrawing samples for further proximate constituent analysis. Proximate analysis was done on ground samples in triplicate for each sample to yield results from which mean compositions were computed. All reagents were of analytical grade and used as obtained.

Analytical methods Standard procedures of AOAC were used to determine the moisture content, crude fibre, crude fat, total nitrogen (Kjeldahl method) and ash (AOAC, 2002). In the fruit body of edible mushrooms, a large amount of nitrogen is actually contained in non-protein compounds; hence, the conversion factor of total nitrogen into crude protein is 3.45 to 4.38 (Braaksman and Schaap, 1996; Shah et al., 1997). In this study, crude protein was calculated using the conversion factor of (N x 4.38); a correlation factor adopted for mushrooms in food composition tables (Crisan and Sands, 1978). The content of ascorbic acid was determined by a titration method using the 2, 6 dichlorophenolindophenol Tillmans reagent (Tillman's method) (AOAC, 2002). The results were expressed in milligram of ascorbic acid per 100 g of sample. Mineral constituents (calcium, phosphorous, sodium, potassium, magnesium and iron) were determined by atomic absorption spectrophotometry (AOAC, 2002). The percentage of crude protein, crude fat, minerals and ash were combined and subtracted from 100 to obtain the total carbohydrate percentage for each sample.

Statistical analysis The data on nutritive content determined for the five edible wild mushrooms species were subjected to analyses of variance (one way ANOVA) significance was accepted at the 5% probability level using the Statistical Package for Social Sciences (SPSS) Program

7722

Afr. J. Biotechnol.

100 90

Concentration

80 70 60 50 40

Lentinus squarrosulus

30

Volvariella volvacea Coprinus micaceus

20

Lepiota procera

10

Auricularia auricula

0

Figure 1. Proximate nutrient compositions of the mushroom samples.

10.1 version (SPSS, 1999). Data for proximate nutrient composition and for mineral constituents were reported as the mean ± SD for three determinations per sample. The results were given as mean ± SD.

RESULTS The results of the proximate composition are presented in Figure 1. V. volvacea had the highest concentration of protein (27±1.02%) followed by L. procera and L. squarrosulus, while A. auricular had the least value of 12.02±2.1%. With respect to moisture content, V. volvacea had the highest value (92±0.12%) and L. procera the least value (13.01±0.2%). A. auricular had the highest carbohydrate value (61±0.32) and crude fibre was highest in V. volvacea (8.7±0.22). The ether extract (lipid) of V. volvacea gave the highest value of 2.80±0.21% and the least was C. micaceus (0.90±0.01%). Minimum and maximum ascorbic levels in the present study were 1.34±0.2 mg/100 g d.w. and 58±0.14 mg/100 g d.w. for A. auricular and L. squarrosulus, respectively. Results in Figure 2 showed values of the mineral compositions. Calcium content was 549±0.6 mg/100 g dry weight for L. squarrosulus and 164±2.01 mg/100 g d. w. for A. auricular. L. procera and C. micaceus had the highest sodium content of 364±0.12

and 289±3.1 mg/100 g dry weights respectively. V. volvacea had the highest potassium concentration (1321±1.05 mg/100 g) and A. auricular had the least content (151.26±1.3 mg/100 g). V. volvacea had the highest phosphorus content, followed by L. squarrosulus and C. micaceus. V. volvacea had the highest magnesium content (53±1.40 mg/100g). The iron content varied from L. procera with 119±2.1 mg/100 g d.w to V. volvacea with 432±1.40 mg/100 g. DISCUSSION Proximate analysis was carried out on five edible mushroom species: L. squarrosulus, V. volvacea, C. micaceus, L. procera and A. auricular. They were selected based on their availability at the time of analysis. The results of the proximate analysis of the five species of edible mushroom showed that the mushroom are richly endowed with protein, fibre, ash, moisture, fat, carbohydrates and mineral elements. This agrees with the finding of Moore and Chi (2005) that edible mushrooms have high nutritional attributes and potential applications in industries. The crude protein, ash and crude fibre values of most mushrooms compared favourably with and in some instances surpassed those reported for most legumes except groundnut and soybeans grown in West

Concentration (mg/100 g dry weight)

Okoro and Achuba

7723

1800 1600 1400 1200 1000 800 600

400 200 0

Lentinus squarrosulus Volvariella volvacea Coprinus micaceus Lepiota procera

Auricularia auricula

Figure 2. Concentrations of Na, K, Ca, Mg, P, Fe and ascorbic acid of analyzed mushroom samples (mg/100 g dry weight).

Africa (FAO, 1970; Aletor and Aladetimi, 1989). The mineral levels, mainly potassium, phosphorous, sodium and iron in these mushrooms were higher than those reported for several cowpea varieties (Aletor and Aladetimi, 1989), but lower than those reported for fish, snails and broiler meat (Imevbore, 1992). Using this proximate analysis, the mineral and analytical food value as approximate indices of nutritional quality, it would appear that some of these mushrooms fall between most legumes and meat. In earlier studies, Gruen and Wong (1982) indicated that edible mushrooms were highly nutritional and compared favourably with meat, egg and milk. Some of the mushrooms are known to possess antitumorigenic and hypocholesterolaemic agents, which implies that mushrooms could hold special attraction for and may be recommended for people with cholesterolrelated ailments (Chihara, 1993). The results of the study showed appreciable levels of fibre which is known as anti-tumorigenic and hypochlestrolaemic agent. This implies that mushrooms hold special attraction and may be recommended for people with cholesterol related ailment (Kadiri and Fasidi, 1990). The moisture contents of some of the mushrooms analyzed are high, indicating that mushrooms are highly perishable. High moisture contents promote susceptibility to microbial growth and enzyme activity. V. volvacea has the highest protein, moisture, ash and crude fibre content of the five species. The high moisture and protein content especially in V. volvacea suggests that great care must be taken in their handling and epresentation as high moisture contents promote susceptibility to microbial growth and enzyme activity. The results show that the five species of

mushrooms were rich in nitrogen and were found to contain reasonable levels of the minerals analysed. This is in agreement with results of the study of some cultivated mushrooms (Agaricus bisporus and Pleurotus osterotus) by Edeoga and Gomina (2000). In addition, it is also known that the moisture content of mushrooms depends on their harvesting time, maturation period and environmental conditions such as humidity and temperature in growing period, and storage conditions, Crisan and Sands (1978). The moisture content of all studied mushroom species ranged from 13.01Âą0.2 to 92Âą0.12. Mushrooms are consumed for low-calorie diet because of their low crude fat content. The major compounds of mushrooms are proteins and carbohydrates. It is reported that the protein contents of mushrooms are affected by a number of factors, namely the type of mushrooms, the stage of development, the part sampled, level of nitrogen available and the location, Flegg and Maw (1977). It can be understood from the data that the studied mushrooms are good protein source. Mushroom carbohydrates include glucans, mono- and disaccharides, sugar alcohol, glycogen and chitin (Kurztman, 1997). The trace metal content of mushrooms are related to species of mushroom, collecting site of the sample, age of fruiting bodies and mycelium, distance from sources of pollution (Kalac et al., 1991) and are mainly affected by acidic and organic matter content of the soil. Metal ion uptake of mushrooms is considerably higher than plants because of their effective take up mechanism (Lepsova and Mejstrik, 1988). The results of mineral values of the five edible species of mushrooms clearly indicate the potential for their use as sources of good quality food. Minerals in the

7724

Afr. J. Biotechnol.

diet are required for metabolic reactions, transmission of nerve impulses, rigid bone formation and regulation of water and salt balance among others. Conclusion The results of the proximate analysis of the five species showed that V. volvacea had the highest levels of crude protein, moisture and crude fibre. It can be said following the results of this study that these edible mushrooms hold tremendous promise in complementing the protein and minerals supply deficiencies prevalent in developing countries since mushrooms are highly nutritional and can compare favourably with egg, meat and milk. However, for the nutritional potential of mushrooms to be realized, sustained efforts must be geared towards the cultivation and popularization of these studied mushrooms (L. squarrosulus, V. volvacea, C. micaceus, L. procera and A. auricular). Edible mushrooms are grown with little efforts in their husbandry: they are grown on straw based compost, and sawdust supplemented with other nutrients. It can be conclude that the investigated wild edible mushrooms are good food sources in terms of protein, carbohydrate, crude fat, and crude fibre and may be cultivated. REFERENCES Aletor VA, Aladetimi OO (1989). Compositional evaluation of some cowpea varieties and some underutilized edible legumes in Nigeria. Die Nahrun 33: 99-1007. th AOAC (2002). Official Methods of Analysis -17 ed. Association of Official Analytical Chemist, Maryland. Aremu MO, Basu SK, Toma GA, Olowoniyi FD (2008). Evaluation of the nutritional value of three types of edible mushrooms found in Nasarawa State, Nigeria. Bangladesh J. Prog. Sci. Tech. 6(2): 305– 308. Braaksman A, Schaap DJ (1996). Protein analysis of the common mushrooms Agaricus bisporus. Post. Harv. Biol. Technol. 7: 119-127. Buigut SK (2002). Mushroom production in sustainable small-scale farming system-opportunities and constraints: a survey of Uasin Gishu district. In: Proceedings of the Holticulture seminar on Sustainable Horticultural Production in the Tropics at Jomo Kenyatta University of Agriculture & Technology, Juja, Kenya 3rd-6th October, 2001. Eds. Wesonga JM, Losenge T, Ndung’u CK, Fricke A, Hau B, Stützel H (2002). pp. 1-5. Chang ST, Buswell JA (1996). Mushroom neutraceuticals. World J. Microbiol Biotechnol. 12(5): 473 – 476. Chang ST, Mshigeni KE (2001).Mushroom and their human health: their growing significance as potent dietary supplements. The University of Namibia, Windhoek. pp. 1-79. Chihara G (1993). Medicinal aspects of Lentian Isolated from Lentinus edodes (Berk). Hong Kong, Chinese University Press. pp. 261-266. Crisan EV, Sands A (1978). Nutritional value. In: Chang ST and Hayes WA (Eds). The Biology and Cultivation of Edible Mushrooms. London, Academic Press Inc, pp 137-165. Delena T (1999). Edible and Useful Plants of Texas and the SouthWestA Practical Guide. 2003-5 University of Texas Press. p. 542. Edeoga HO, Gomina A (2000). Nutritional values of some nonconventional leaf vegetables of Nigeria .Journal of Economic Botany 24: 7-12

Etang BB , Essian JP, Odejimi RAO (2006). Nutritional and bacteriological quality of mushroom from Niger-Delta rainforest of Nigeria. Nig. J. Microbiol. 20(2): 965 – 975. FAO (1970). Food and agricultural Organization (No 12) FAO, Rome, Italy. Fasidi IA, Olorunmaiye KS (1994). Studies on the requirements for vegetative growth of Pleurotus tuber-regium (Fr.) Singer, a Nigerian mushroom. Food Chem. 50: 397-401. Flegg PB, Maw G (1977). Mushrooms and their possible contribution to world protein needs. Mushroom J. 48: 395-403. Gruen VEC, Wong HX (1982). Immunodulatory and Antitumour activities of a polysaccharide-peptide complex from a mycelial culture of Trichoderma sp. Sciences, 57: 269-281. Gyar SD, Ogbonna CIC (2006). Comparative study on nutrient and mineral profiles of mushroom species Macrolepiota procerus cultivated on two Mansonia altissima sawdust formulations. Adv. Food Sci. 28(4): 1 – 4. Harkonen M (1998). Uses of mushrooms by Finns and Karelians. Int. J. Circumpolar Health, 57 (1): 40-55. Imevbore EA (1992). Perspectives of snail farming in tropical Africa: the Nigerian situation. In: Proc. Invertebrates (Microlivestock) Farming Seminar, La Union, Philippines. Jiskani MM (2001). Energy potential of mushrooms. The DAWN Economic and Business Review, Oct. 15-21, 2001. p. IV. Kadiri M, Fasidi IC (1990). Studies on enzyme activities of Plerotus tuber regium Hein at various fruitbody stages. Nahrung, 34(8): 695999. Kalac P, Burda J, Staskova I (1991). Concentrations of lead, cadmium, mercury and Cooper in mushrooms in the vicinity of a lead smelter. Sci. Total Environ. 105: 109-119. Kurztman RH (1997). Nutrition from mushrooms, understanding and reconciling available data. Mycoscience, 38: 247-253. Lepsova A, Mejstrik V (1988). Accumulation of trace-elements in the fruiting bodies of macrofungi in the Krusnehory Mountains, Czechoslovakia. Sci. Total Environ. 76: 117-128. Masuka AJ, Utete D (1996). Overview of mushroom production in Africa: Constraints, opportunities and strategies. Paper presented at the regional workshop on mushroom production and mushroom germplasm collection and conservation. Harare, 23-27 September, 1996. Moore D, Chi SW (2005). Fungi products as food (eds) pointing, S.B and Hyde, K.O. In Bio-Explotation of filamentous fungi. Fungi Diversity Res. Lenis, 6: 223-251. Nwokolo E (1987). Composition of nutrients in the sclerotium of mushroom pleurotuus tuber-regium. Plant Foods Human Nutr. 37: 133-139. Obodai M, Cleland-Okine J, Vowotor KA (2003). Comparative study on the growth and yield of Pleurotus ostreatus mushroom on different lignocellulosic by-products. J. Ind. Microbiol. Biotechnol.; 30: 146149. Ogundana SK, Fagade OE (1982). Nutritive value of some Nigerian edible mushroom J. Food Chem. 8: 263-268. Oke OL (1966). Chemical studies on the more commonly used leaf vegetables in Nigeria.West Afr. Sci. Assoc. 2: 42-49. Oso BA (1975). Mushrooms and the Yoruba people of Nigeria, Mycolgia, 67: 311-319 Oso BA (1977). Pleurotus tuber-regium from Nigeria. Mycologia, 69: 271. Peter O (1991). Manual on mushroom cultivation. Tool publications sarphat Istraat 650, 1018 AV Amsterdam. The Netherlands pp 1725. Sadler M (2003). Nutritional properties of edible fungi. British Nutrition Foundation Nutrition Bulletin, 28: 305-308. Shah H, Khalil IA, Jabeen S (1997).Nutritional composition and protein quality of Pleurotus mushroom. Sarhad J. Agric. 13:621-627. SPSS. Statistical package for Social Sciences (1999) Computer Program, MS for Windows. SPSS 10 for Windows, Chicago, Illinois, USA.

African Journal of Biotechnology Vol. 11(30), pp. 7725-7730, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3231 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Stabilization and preservation of probiotic properties of the traditional starter of African opaque sorghum beers A. P. Polycarpe Kayodé1, Deloris C. Deh1, Lamine Baba-Moussa2, Simeon O. Kotchoni3 and Joseph D. Hounhouigan1 1

Département de Nutrition et Sciences Alimentaires, Faculté des Sciences Agronomiques, Université d’Abomey-Calavi, 01 BP 526 Cotonou, Bénin. 2 Laboratoire de Biologie et de Typage Moléculaire en Microbiologie; Faculté des Sciences et Techniques, Université d’Abomey-Calavi, 05 BP 1604 Cotonou, Bénin. 3 Department of biology and Center for Computational and Integrative Biology, Rutgers University, 315 Penn St., Camden, NJ 08102, USA. Accepted 28 February, 2012

This present study assessed the impact of drying process parameters, that is temperature and drying duration, on the dry matter content, pH, titratable acidity, yeasts and lactic acid bacteria content of granule starter of African opaque sorghum beer. Probiotic properties of the dry starter were tested. The aim was to establish levels of temperature and duration of drying that lead to a longer shelf life and optimum activity of the starter. Results show that the drying temperature has significant effects on the titratable acidity, yeasts and lactic acid bacteria contents of the granule starter while the level of dry matter was significantly affected by both temperature and duration of drying. The optimal drying conditions providing a stable granule starter with optimum viability of lactic acid bacteria and yeasts were established to 43°C and 24 h. Both wet and dried starters showed inhibitory effect on the meticillin resistant Staphylococcus aureus. Key words: sorghum, opaque beer, starter, yeats, probiotic, Response Surface Methodology.

INTRODUCTION Opaque sorghum beers are popular alcoholic beverages in Africa. They are known as tchoukoutou in Benin, dolo in Burkina-Faso, pito in Ghana, and burukutu or otika in Nigeria (Odunfa, 1985; Kayodé et al., 2005). The beers have a sour taste, a relatively high dry matter content and low alcohol content, which make them suitable beverages for adults (Agu and Palmer, 1998; Briggs et al., 2004). The nutritional attributes of eight commercial sorghum beers were reported by Novellie and De Schaepdrijver (1986) as follows: protein 5.4 g L-1, ash 1.13 g L-1, carbohydrate 47.6 g L-1, iron (Fe) 1.4 g L-1 and zinc (Zn) -1 1.4 g L . This suggests that such beer can be a significant source of dietary nutrients, considering the rather large quantity that is consumed daily in certain

*Corresponding author: E-mail: polykap@yahoo.fr. Tel +229 97870734.

locations (Briggs et al., 2004; Kayode et al., 2005). The sorghum beers are largely consumed by the poorest people and therefore contribute to their dietary needs. Tchoukoutou, the Benin opaque sorghum beer, is produced by women using various processes. In general, as in the conventional lager beer process, the manufacturing process consists of three phases: malting, mashing and fermentation. The grain is soaked in water overnight (9 to 12 h), germinated (72 to 85 h), sun dried (7 to 15 h), ground in a disc mill, mixed with water, decanted and divided into slurry and supernatant. The slurry is mashed under gradual heating until the boiling point is reached after 2 h, mixed with supernatant and allowed to ferment overnight, then filtered, boiled (6 to 9 h), cooled, and inoculated with a starter called kpetekpete, which is generally harvested from the bottom of a previous fermenting beer (resulting from 13 to 14 h overnight fermentation). The fermentation step is a critical step in the process, and its success depends on the

7726

Afr. J. Biotechnol.

accurate knowledge of the processor in terms of the starter handling. Several researches reported that the microorganisms contained in the traditional starters of African opaque beers mainly consist of yeasts and lactic acid bacteria (Van der Aa Kühle et al., 2001; Demuyakor and Ohta, 1991; Sefa-Deheh et al., 1999; Sanni and Lönner, 1993). The microorganisms are kept alive by replacing the supernatant on a daily basis. The preservation of such starter is a tedious and a risky business since it is common that the starter to loose its fermenting properties and therefore fail to make the beer effervescent, because the involved microorganisms would have died. Preliminary data demonstrated that rural and urban women’s groups in the processing chain of opaque sorghum beers derive a direct benefit from increased marketing opportunities (Kayodé et al., 2007). Thus, innovations in the traditional brewing technology and the product quality could significantly improve income and livelihood of rural households involved in this activity. This present study aims at improving the shelf life of the traditional starter used to ferment opaque African beers. More specifically, the objective was to evaluate the effect of temperature and duration of drying, on several quality determining factors such as the dry matter content; titratable acidity, as well as yeast and lactic acid bacteria content of granule starter. It is quite likely that these factors are interdependent. However, interactions between factors cannot be detected using the one-factorat-a-time approach (Giovani, 1983). Therefore, we decided to use a design methodology that is able to detect such interactions. The response surface methodology (RSM) was used applying a central composite design. Central composite designs are the basis for RSM and are used to estimate parameters of a full second-degree model. Such a quadratic model is usually sufficient for accuracy in product and process design (Giovani, 1983). In addition, the probiotic properties of the dry granules were evaluated by testing the anti-microbial effect of the starter extracts on methicillin resistant Staphylococcus aureus grown on agar plates. MATERIALS AND METHODS

Experimental design Response surface methodology is a statistical method that uses quantitative data derived from an appropriate experimental design with quantitative factors to estimate the relationship between a response and the factors in order to optimize processes or products (Giovani, 1983). In this study, an orthogonal rotatable central composite design (Montgomery, 2001) for K = 2 factors was used to estimate the simultaneous effect of two process variables on titratable acidity, lactic acid bacteria, yeasts, and total mesophilic aerobic bacteria in a quadratic function. The variables (factors) were the drying temperature (35 to 50°C), and duration of drying (5 to 24 h). The responses were titratable acidity, dry mater, yeasts, lactic acid bacteria, and total mesophilic aerobic bacteria counts. The design generated 14 observations which are distributed as follows: four kernel points, four star points and six replications at the central point. The design matrix and variable combinations are presented in Table 1.

Experimental processing 4 kg of cleaned sorghum grains were dehulled using a mini-PRL dehuller (Thiès, Sénégal) and then ground. The flour obtained is mixed with distilled water (45% w/w), inoculated with 10% (w/w ) of kpete-kpete, kneaded into dough and allowed to ferment in a plastic bucket with lid for 24 h. Fermented dough samples were oven dried for an indicated time and temperature as specified in the next experimental design (Table 1). Samples were withdrawn when the predefined time and temperature were reached and immediately analyzed for microbiological characteristics.

Counts of viable microorganisms Total counts of mesophilic aerobic bacteria, lactic acid bacteria (LAB), yeasts, moulds and Enterobacteriaceae were enumerated according to the method described by Nout et al. (1987). Duplicate samples of stabilized starter (10 g) were diluted in 90 ml sterile peptone physiological saline solution (5 g peptone, 8.5 g NaCl, and 1000 ml distilled water, pH = 7.0) and homogenised with a Stomacher lab-blender (type 400, London, UK). Decimal dilutions were plated. Total mesophilic aerobic bacteria counts were determined on plate count agar (PCA, oxoid, CM 325, Hampshire, England) after incubation at 30°C for 72 h. Viable counts of lactic acid bacteria were determined on de Man, Rogosa and Sharpe Agar (MRSA, CM 361, Oxoid, Hampshire, England) containing 0.1% (w/v) natamycin (Delvocid, DSM, The Netherlands) with incubation in anaerobic jar (Anaerocult A, Merck KGaA, Germany). Viable yeasts were determined on oxytetracyclin glucose yeast extract agar (OGYA, Oxoid CM 0545, Basingstoke, Hampshire, England) containing oxytetracycline. Enterobacteriaceae were enumerated on violet red bile agar (VRBA) after incubation at 37°C for 24 h.

Starter sampling Traditional starter, locally known as kpete-kpete, was harvested from one processing site in Abomey-Calavi. This consists of wet slurry from an actively fermenting sorghum beer. The samples were collected in sterile bottles, packed in ice cold box and transported to laboratory for microbiological and physicochemical analysis. To check for the variability in the starter, four samples were collected from the same processor on different days and analysed for pH, titratable acidity, total mesophilic aerobic bacteria, lactic acid bacteria, yeasts and enterobacteriaceae counts. The coefficients of variation for the measured parameters were consistently below 7% in the different samples. One batch of starter was sampled from this processor and use for the stabilization study.

Physico-chemical analysis Dry matter was determined according to the American Association of Cereal Chemists (AACC) approved methods (AACC, 1984). Titratable acidity and pH were determined as described by Nout et al. (1989).

Evaluation of probiotic properties The probiotic properties of the dry granules were evaluated by testing the anti-microbial effect of the starter extracts on methicillin

Kayodé et al.

7727

Table 1. Design matrix and variable combinations.

Treatment code 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Level code Temperature 0 0 0 0 0 0 +1 -1 -1 +1 +α 0 -α 0

resistant S. aureus grown on agar plates (Baba-Moussa et al., 2008). In order to confirm the preservation of the functional properties of the starter, we tested the starter before and after the drying under the optimum condition (43°C, 24 h). The dry starter was resuspended in water before use. The starters were centrifuged (13,000 rpm, at room temperature, for 5 min) and respective supernatants were used as probiotic extracts for the antimicrobial test. For the test, a drop (30 µl) of the supernatant was allowed to diffuse from a paper disk deposited at the center of S. aureus grown agar plate. The plate was incubated overnight at 37°C and the inhibition zone induced by the extract on the bacterial plate was recorded. A bacterial grown plate containing a paper disk with a drop (30 µl) of water was used as control.

Statistical analysis Data were analyzed using the Minitab 14 statistical program. A second order polynomial model was proposed to establish the relationship between the responses (Y) and the variables (X) as follows: Y = b0 + b1 x1 + b2 x2 + b 3 x12 + b4 x22 + b5 x1 x2 In which b0 is a constant, b1 and b2 are linear effect coefficients, b3 and b4 are quadratic effect coefficients, b5 is an interaction effect coefficient. The fitted polynomial equations were expressed in a 3D response surface in which the response is presented on the vertical axis and two factors at the two horizontal perpendicular axes.

RESULTS AND DISCUSSION Effect of drying parameters on dry matter The response values for the different treatments are presented in Table 2. The polynomial equation was fitted to the experimental data using the Minitab program, and the linear regression coefficients estimates are presented in Table 3. The water content of a food product is a good

Time 0 0 0 0 0 0 +1 +1 -1 -1 0 +α 0 -α

Variable level Temperature (°C) 42.5 42.5 42.5 42.5 42.5 42.5 47.0 38.0 38.0 47.0 50.0 42.5 35.0 42.5

Time (h) 14.5 14.5 14.5 14.5 14.5 14.5 20.2 20.2 8.79 8.79 14.5 24.0 14.5 5.0

indicator of its storage ability. After the drying treatments applied, the water content of the granules ranged between 6.19 and 49.36% (Table 2). The analysis of variance showed that the drying temperature (X1) as well as the drying duration (X2) significantly affected (P ≤ 0.05) the dry mater content of the granules. Particularly, the linear and the quadratic effects of these factors are significant on the product dry matter content (Table 3). Figure 1 shows the trends in dry matter content of the granules as function of temperature, the drying duration, and their mutual interaction. At drying duration < 12 h, the dry matter content of the product is quite stable for temperatures values between 35°C and 44°C. Between 12 h and 24 h of drying duration, there is a significant increase in the granule dry matter content which reaches 80% (Figure 1a). Such increase in the product dry matter content, due to water loss, is desirable since it could improve shelf life of the product. Previous research demonstrated that cereal products preserve well with water content < 12% (Cecil, 1992). From our experiment it is apparent from the response surface plot that such level of water content could be achieved at drying temperature between 42 and 44°C. Effect of drying parameters on viable yeast and lactic acid bacteria The number of viable microorganisms varied among treatments and the major variation in the microorganisms counts were explained by the model. The coefficient of variation (R2) was 0.75, 0.74, and 0.75 for total count of viable lactic acid bacteria, yeasts, and total mesophilic aerobic bacteria respectively. The analysis of variance showed that only the temperature exerted a significant effect on the viability of microorganisms contained in the granule starter. The number of viable microorganisms is

7728

Afr. J. Biotechnol.

Table 2. Response for pH, titratable acidity, dry matter, lactic acid bacteria, yeasts, and total count.

Code 1 2 3 4 5 6 7 8 9 10 11 12 13 14

pH 3.92 3.90 4.24 4.54 4.62 4.30 3.64 4.00 3.85 3.65 3.96 4.20 4.31 3.61

Titratable acidity (% lactic acid) 0.21 0.34 0.22 0.2 0.16 0.22 0.18 0.26 0.34 0.19 0.17 0.16 0.41 0.24

Lactic acid bacteria (log cfu/g) 7.86 7.84 8.02 7.82 7.89 7.9 7.19 7.46 7.52 7.50 6.90 7,82 7.76 8.60

Dry matter (%) 60.09 58.83 59.29 59.17 61.78 60.18 82.28 55.04 51.72 60.10 93.81 85.43 50.64 55.01

Yeasts (log cfu/g) 7.82 7.92 7.90 7.89 7.86 7.84 7.30 7.46 7.52 7.39 0.00 7.51 8.08 8.71

Total mesophilic aerobic bacteria count (log cfu/g) 7.91 8.13 7.90 7.95 7.83 7.92 7.37 7.74 7.82 7.62 0.00 7.90 8.41 8.83

Table 3. Coefficients of the variables in the model and their corresponding R 2.

Coefficient

pH

Titratable acidity

Dry matter

Lactic acid bacteria

Yeast

Total mesophilic aerobic bacteria count

b0

-4.031

0.225

398.549

-13.2092

-90.737

-86.63

b1

0.329

-0.109a

-15.844a

1.0371a

5.044a

4.873a

b2

0.232

-0.038

-9.099a

0.0119

-0.193

-0.195

b3

-0.004

0.066

0.184a

-0.0123b

-0.063a

-0.061a

b4 b5

-0.005 -0.002

-0.023 0.048

0.093a 0.184

0.0021 -0.0024

0.0058 -0.0003

0.008 -0.001

0.75

0.94

0.75

0.74

0.75

R2 c

0.46 2

2

Y = b0 + b1 x1 + b2 x2 + b 3 x1 + b4 x2 + b5 x1 x2 where, X1 = temperature (°C), X2 = time (h); a, significatif at 5 %; b, significatif at 1 %; c; 2 coefficient of determination R .

relatively constant at drying temperature between 36 and 44°C. At these temperatures, the level of viable yeasts, lactic acid bacteria and total mesophilic aerobic bacteria is in the range between 8.1 and 9.0 log cfu/g. These values are comparable to values reported for these microorganisms in the traditional starter of the African opaque sorghum beer (Hounhouigan, 2007). The effect of temperature on viability of the microorganisms is more pronounced between 44 and 50°C. At this temperature interval, viable yeasts decrease from 7.3 to 2.0 log cfu/g and the total mesophilic aerobic bacteria decreased from 7.19 to 6.6 log cfu/g. Similar to findings by Fields et al. (1981), our results confirm the relative susceptibility of yeasts to temperature compared to lactic acid bacteria which are able to survive at temperatures as high as 45°C (Giudici et al., 1998; Frazier, 1958). No significant effect of the drying duration was observed on the pH, while the titratable acidity of the granules was only affected by the temperature.

Optimization of the drying conditions In order to identify the drying conditions that lead to the optimum viability and functionality of the microorganisms of the granule starter, we used the desirability function to optimize the drying duration and temperature. The target characteristics of the granule starter, except the dry matter content, were selected on the basis of the properties of the traditional starter and were as follows: viable yeasts 7.6 to 8.64 log cfu/g, viable lactic acid bacteria 7.19 to 8.26 log cfu/g and pH 3.20 to 4.62. The level of the dry matter was set to 80 to 89%. The optimum drying conditions for the granule starter were found to be: drying temperature: 42.84°C and drying duration: 24 h with a desirability of 0.78. To check for the adequacy of the predicted model, we conducted additional independent experiments at the suggested optimal drying conditions. The predicted and the experiment values for viable yeast and lactic acid bacteria, pH

Kayodé et al.

7729

Figure 1. Response surfaces showing the effects of temperature and drying duration on (A) dry matter, (B) lactic acid bacteria, (C) yeast viability, and (D) titratable acidity of starter of opaque beer.

Table 4. Predicted and experimental value for pH, dry matter, lactic acid bacteria and yeasts.

Variable pH Dry matter (%) Lactic acid bacteria (Log cfu/g) Yeasts (Log cfu/g)

Limit 3.20- 4.62 80.0 – 89.0 7.19 – 8.26 7.62 – 8.64

Desirability (%) 0.88 0.95 0.65 0.69

and dry matter are presented in Table 4. The experimental and the predicted values are in close agreement with a desirability ranging between 0.65 and 0.95. A Chi-square test indicated that the observed values were statistically the same as the predicted values. Consequently the generated model adequately predicted the viability of the microorganisms as well as the pH and dry matter content of the granule starter. Probiotic properties of the dry granule The probiotic properties of the traditional starter have been here demonstrated (Figure 2). We hypothesized

Predicted value 3.94 82.00 7.72 8.00

Experimental value 4.15 ± 0.09 84.39 ± 0.99 7.95 ± 0.76 7.6 ± 0,10

that the starter represents a biologically stable probiotic matter that can inhibit opportunist and disease inducing microorganisms. We tested our hypothesis by assessing the inhibitory effect of the undried and the dried starters on disease inducing S. aureus (Baba-Moussa et al., 2008). Our results show that even when dried, the starter was able to inhibit the meticillin resistant S. aureus (Figures 2A, B and C) as expected. The diameter of the inhibition zone can easily be seen on the agar plates (Figures 2B and C) compared to the control plate (Figure 2A) indicating the potential benefits of the starter as a powerful health promoting matter. Our results demonstrate the stability and preservation of the probiotic properties of the traditional starter under the optimum

7730

Afr. J. Biotechnol.

Figure 2. Inhibitory effects of probiotic on methicillin resistant S. aureus. The undried starter (B) and dried starter (43°C, 24 h) (C) inhibits the bacterial growth as revealed by significant inhibitory zone (B, C) compared to control plate (A) where we observed no inhibitory zone but a uniform growth of the bacteria.

drying conditions established. Conclusion This present study shows that the temperature of drying has significant effects on tritratable acidity; yeasts and lactic acid contents of the starter granules while the level of dry matter was significantly affected by both temperature and duration of drying. The optimal drying conditions ensuring a stable granules starter with optimum viability of lactic acid bacteria and yeasts were established to 43°C and 24 h. These drying conditions have no effect on the probiotic properties of the starter. The response surface methodology could be used to establish prediction model that adequately describe the changes in viability of microorganisms, pH and dry matter content of the granule starter for the fermentation of African opaque beers. AKNOWLEDGEMENTS The authors thank the Projet Aires Sud Grant N° 7190, IRD, France, for financial support. REFERENCES AACC (1984). Approved methods of the American Association of cereal th chemists, 8 Edition, St. Paul, MN, USA. Agu RC, Palmer GH (1998). A reassessment of sorghum for lager-beer brewing. Bioresour. Technol. 66: 253-261. Baba-Moussa L, Anani L, Scheftel JM, Couturier M, Riegel P, Haıkou N, Hounsou F, Monteil H, Sanni A, Prevost G (2008). Virulence factors produced by strains of Staphylococcus aureus isolated from urinary tract infections. J. Hosp. Infect. 68: 32-38. Briggs DE, Boulton CA, Brookes PA, Stevens R (2004). Native African beers. In Brewing: Science and practice Woodhead publishing Ltd, Cambridge, UK. pp. 589-605. Demuyakor B, Ohta Y (1991). Characteristics of pito yeasts from Ghana. Food Microbiol. 8: 183-193.

Fields ML, Ahmed M, Hamad K, Duane KG (1981). Natural lactic acid fermentation of corn meal. J. Food Sci. 46: 900-902. Giovanni M (1983). Response Surface Methodology and product optimization. Food Technol. 11: 41-45. Giudici P, Caggia C, Pulvirenti A, Rainieri S (1998). Karyotyping of Saccharomyces strains with different temperature profiles. J. Appl. Microbiol. 84: 811-819. Hounhouigan H (2007). Evaluation et amélioration de la technologie traditionnelle de production de kpètè-kpètè, un ferment utilisé pour la fermentation du tchoukoutou. Thèse d’Ingénieur Agronome, FSA / UAC. Kayodé APP, Hounhouigan DJ, Nout MJR, Niehof A (2007). Household production of sorghum beer in Benin: technological and socioeconomical aspects. Int. J. Cons. Stud. 3: 258-264. Montogomery DC (2001). Design and analysis of experiments, 5 ed.; John Wiley and Sons: New York. Nout MJR, Beernink G, Bonants-Van Laarhoven TMG (1987). Growth of Bacillus cereus in soyabean tempeh. Int. J. Food Microbiol. 4: 293301. Nout MJR, Rombouts FM, Havelaar A (1989). Effect of accelerated natural lactic fermentation of infant food ingredients on some pathogenic micro-organisms. Int. J. Food Microbiol. 8: 351-361. Novellie L, De Schaepdrijver P (1986). Modern developments in traditional African beers. Progr. Ind. Microbiol. 23: 74-157. Odunfa SA (1985). African fermented foods. In Wood BJB (ed.) Microbiology of Fermented Foods Elsevier Applied Science, London, UK. pp. 167-195. Sanni AI, Lönner C (1993). Identification of yeast isolated from Nigerian traditional alcoholic beverages. Food Microbiol. 10: 517-523. Sefa-Dedeh S, Sanni AI, Tetteh G, Sakyi-Dawson E (1999). Yeasts in the traditional brewing of pito in Ghana. World J. Microbiol. Biotechnol. 15: 593-597. Van der Aa Kuhle A, Jesperen L, Glover RLK, Diawara B, Jakobsen M (2001). Identification and characterization of Saccharomyces cerevisiae strains isolated from West African Sorghum beer. Yeast, 18: 1069-1079.

African Journal of Biotechnology Vol. 11(30), pp. 7731-7737, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4112 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Qianliening capsule treats benign prostatic hyperplasia (BPH) by down-regulating the expression of PCNA, CyclinD1 and CDK4 Xiaoyong Zhong1, Jiumao Lin1,2, Jianheng Zhou3, Wei Xu4, Zhenfeng Hong1* and Jun Peng1,2 1

Academy of Integrative Medicine Biomedical Research Center, Fujian University of Traditional Chinese Medicine, 1 Huatuo Road, Minhou Shangjie, Fuzhou, Fujian 350108, China. 2 Fujian Key Laboratory of Integrative Medicine on Geriatrics, Fujian University of Traditional Chinese Medicine, 1 Huatuo Road, Minhou Shangjie, Fuzhou, Fujian 350108, China. 3 Department of Integrative Medicine, Fujian University of Traditional Chinese Medicine, 1 Huatuo Road, Minhou Shangjie, Fuzhou, Fujian 350108, China. 4 Department of Pharmacology, Fujian University of Traditional Chinese Medicine, 1 Huatuo Road, Minhou Shangjie, Fuzhou, Fujian 350108, China. Accepted 8 March, 2012

Benign prostatic hyperplasia (BPH) is characterized by abnormal proliferation of epithelial and stromal cells in prostatic tissue, which is closely correlated with increased expression of PCNA, CyclinD1 and CDK4. Therefore, inhibition of cell proliferation by suppressing the expression of the above genes is a promising strategy in the development of novel anti-BPH therapies. The aim of this study was to investigate the effect of Qianliening capsule (QC), a traditional Chinese formulation that has been shown to be clinically effective in the treatment of BPH, on the expression of PCNA, CyclinD1 and CDK4 in prostatic tissues of BPH rats. Male Sprage-Dawley (SD) rats were castrated and subcutaneously injected with testosterone propionate to generate BPH model. Meanwhile, BPH rats were orally treated with QC, or with finasteride that was used as a positive control drug. Treatment with QC or finasteride significantly reduced the PI (Prostate Index, PI = prostate wet weight / body weight × 100%) in BPH rats (P<0.05). In addition, QC or finasteride treatment significantly inhibited model construction-induced upregulation of expression of PCNA, CyclinD1 and CDK4 in prostatic tissues of BPH rats (P<0.05). Our findings for the first time demonstrated that QC can obviously reduce the PI, the expression of PCNA, CyclinD1 and CDK4 in the prostatic tissues of BPH rats, which may in part explain its anti-BPH activity. Key words: Qianliening capsule, benign prostatic hyperplasia, cell proliferation, PCNA, CyclinD1, CDK4.

INTRODUCTION Benign prostatic hyperplasia (BPH) is a pathological overgrowth of the human prostate that develops in a majority of aging men older than 50 years. BPH causes increased resistance to urine flow through the urethra and sometimes kidney damage, bladder stones and

*Corresponding author. E-mail: zfhong1953@163.com. Tel: (+86) 591-22861012. Fax: (+86) 591-22861012 Abbreviations: QC, Qianliening capsule; BPH, benign prostatic hyperplasia; PI, prostatic index; DHT, 5-dihihydrotestosterone; LUTS, lower urinary tract symptoms

urinary tract infections, and thereby affects the quality of life (Djavan, 2003). BPH is a proliferative process of both the stromal and epithelial elements of the prostate arising in the periurethral and transition zones of the gland, and is hormonally dependent on testosterone and dihydrotestosterone production (Berry et al., 1984). Despite the prevalence of BPH, its pathogenesis remains controversial. Multiple partially overlapping and complementary theories have been proposed, such as embryonic reawakening, stem cell defects, chronic inflammation, imbalance between androgen/estrogen signaling and increased TGF-β signaling, all of which seem to partly reveal the abnormal growth in BPH.

7732

Afr. J. Biotechnol.

However, recently, it was widely accepted that increase in the total number of stromal and epithelial cells, which resulted from excessive cell proliferation and/or reduction of cell apoptosis, plays a critical role in the development of BPH (Zhang et al., 2009; Kyprianou et al., 1996; Claus et al., 1997; Roehrborn, 2008). The cell cycle takes place in prostatic stromal and epithelial cells leading to their division and duplication. G1/S transition is one of the two main checkpoints used by cells to regulate the cell cycle progress and thus the cell proliferation. G1/S progression is highly regulated by Cyclin D1 and Cyclin-dependent kinase 4 (CDK4) (Chen et al., 1996; Grana and Redy, 1995). PCNA is an acidic nuclear protein that has been recognized as a histological marker for the G1/S phase in the cell cycle (Zhong et al., 2008). Therefore, the expression of PCNA, CDK4 and CyclinD1 can reflect the proliferation state of BPH cells to some extent. To date, there is no completely effective treatment for BPH. The mainstay of pharmacotherapy is the combination of 5α-reductase inhibitors, such as finasteride and dutasteride which regulate the levels of 5-dihhichydrotestosterone (DHT), and alpha adrenergic-blockers, including terazosin, doxazosin and tamsulosin which inhibit α-adrenergic receptors, relaxing smooth muscle in the prostate and the bladder neck, thus decreasing the blockage of urine flow. Moreover, in some patients, surgery, transurethral resection of the prostate, is the only effective intervention (Tiwari et al., 2005). However, all these therapies may have troubling side effects such as orthostatic hypotension, decreased libido and ejaculation or erectile dysfunction. Because of these adverse effects, natural products that appear to have limited adverse events are becoming more and more important in treatments of BPH, such as Saw palmetto, Pygeum africanum and Hypoxis rooperi (Boyle et al., 2000; Wilt et al., 2000, 2002) which have long been used to treat BPH successfully. Qianliening capsule (QC) is a traditional Chinese medicine formulation consisting of wine rhubarb, leech, Milkvetch root, Achyranthes aspera and dodders. These components together confer QC properties of heatclearing, detoxification, promotion of blood circulation, removal of blood stasis, tonifying the kidney and nourishing vitality (replenishing the kidney qi in Chinese). It has been shown that QC can obviously improve a series of lower urinary tract symptoms (LUTS) in BPH patients, such as frequency of urination, urinary urgency, thin urine flow, urinary endless and some other voiding disorders. In addition, QC can ameliorate the urodynamic evaluation indexes of BPH patients such as maximum free urinary flow rate and average urinary flow rate. Our preliminary study on BPH model rats showed that QC could significantly decrease the prostatic volume and weight, and inhibit enlargement of prostate (Lin et al.,2010; Zhou et al., 2008, 2010a, b, 2012), further confirming that QC has a good therapeutic effect on BPH.

However, the mechanism of its anti-BPH activity still remains largely unknown. Therefore, using a rat model of BPH which was generated by castration and subcutaneous injection with testosterone propionate, in this study, we evaluated the therapeutic effect of QC on BPH, and investigated the underlying molecular mechanism. MATERIALS AND METHODS Thirty-two SPF grade male adult Sprague-Dawley (SD) rats (200 to 220 g) were purchased from Shanghai Si-Lai-Ke Experimental Animal Ltd. (Shanghai, China). The rats were housed in clean pathogen-free rooms in an environment with controlled temperature (22°C), humidity and a 12 h light/dark cycle with free access to water and standard laboratory food. All animal treatments were strictly in accordance with international ethical guidelines and the National Institutes of Health Guide concerning the Care and Use of Laboratory Animals, and the experiments were approved by the Institutional Animal Care and Use Committee of Fujian University of Traditional Chinese Medicine. Except for the eight control group (Cont) rats, orchiectomy was carried out for the other 24 rats under napental anesthesia through the scrotal route in an asepsis condition. Seven days after castration, they were randomly assigned to three experimental groups with eight animals in each: the model group (Model), the finasteride group (Finast) and the QC group (QC). Testosterone propionate (Shanghai GM Pharmaceutical Co., Ltd. China) were given to the castrated rats by daily intraperitoneal injections at a does of 5 mg/kg for 4 weeks to generate BPH model. Following BPH induction, the finasteride group received finasteride (Hangzhou Merck. China) at a does of 0.5 mg/kg every day and QC group received the Qianliening capsules (QC, Fujian, China, FDA approval No.: Z09104065) at a dose of 4.5 mg/kg (equivalent to 6 times the dose for a human adult) for 4 weeks. After 4 weeks of treatment, the prostates from the rats in all groups were removed, weighed and subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) assays and immunohistochemistry examination.

Prostatic index (PI) An analytical balance was used to measure the prostate weight (PW) and the prostatic index (PI) was calculated as: PW / BW × 100%.

RNA extraction and RT-PCR analysis Total RNA was isolated from fresh prostate tissues with TriZol Reagent (Invitrogen, Carlsbad, CA, USA). Oligo(dT)-primed RNA (2 µg) was reverse-transcribed with SuperScript II reverse transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The obtained cDNA was used to determine the mRNA amount of PCNA, cyclinD1 and CDK4 by PCR with Taq DNA polymerase (Fermentas). β-Actin was used as an internal control. The sequences of the primers used for amplification of PCNA, cyclinD1 and CDK4 are as follows: PCNA forward 5 - GA CAC ATA CCG CTG CGA TCG -3 and reverse 5 - TCA CCA CAG CAT CTC CAA TAT -3 (Tm = 59°C, 307 bp); Cyclin D1 forward 5 GGA GCA GAA GTG CGA AGA-3 and reverse 5 - GGG TGG GTT GGA AAT GAA-3 (Tm = 57°C,394 bp); CDK 4 forward 5 -CTT CCC GTC AGC ACA GTT C-3 and reverse 5 - GGT CAG CAT TTC CAG TAG C (Tm = 55°C, 687 bp); -actin forward 5 -ACT GGC ATT GTG ATG GAC TC-3 and reverse 5 -CAG CAC TGT GTT GGC

Zhong et al.

7733

Table 1. Comparison of the prostate wet weight and PI among different groups ( ±s).

Group

N

PI (%)

Control group

8

0.13 ± 0.0225

Model group Finasteride group

8 8

0.25 ± 0.01356 * 0.20 ± 0.019272) **

QC group

8

0.21 ± 0.01885 **

1)

2)

PI = PW (prostate wet weight) / BW (body weight) ×100%. *P < 0.05 for the difference between PI in normal group and model group. **P<0.05 versus model group.

ATA GA-3 (Tm = 55°C, 453 bp). Samples were analyzed by gel electrophoresis (1.5% agarose). The DNA bands were examined using a Gel Documentation System (BioRad, Model Gel Doc 2000, USA).

Immunohistochemistry analysis A 0.5 × 0.5 × 0.1 cm block of tissue was collected from the lateral lobe of the prostate gland of each rat. The tissue blocks were rinsed with phosphate buffer solution (PBS), fixed with 10% formaldehyde for 12 to 24 h, and subsequently embedded in paraffin, archived, and finally, sliced. The paraffin sections were processed for PCNA, cyclinD1 and CDK4 immunohistochemistry using streptavidinperosidase (SP) method: endogenous peroxidase activity was blocked by 0.3% hydrogen peroxide for 10 min, followed by incubation with 10% serum for 30 min at room temperature. Sections were incubated with primary antibodies at room temperature for 2 h. Primary antiserum was detected after incubation with a biotinylated secondary antibody. The primary antibodies employed were polyclonal rabbit anti-rat PCNA, cyclinD1 and CDK4 (Bohai Biotechnology Development Co., Ltd. Hebei, China). Secondary antibody, SP was purchased from Bohai Biotechnology Development Co., Ltd. (Hebei, China). PBS was used to replace the primary antibody as a negative control. Color was developed using DAB chromogen (Bohai Biotechnology Development Co., Ltd. Hebei, China). After staining, five high-power fields (400x) were randomly selected in each slide and the immunohistochemistry slides were examined with the method of immunohistochemical score (IHS), which was calculated by combining an estimate of the percentage of immunoreactive cells (quantity score) with an estimate of the staining intensity (staining intensity score), as follows: no staining is scored as 0, 1 to 10% of cells stained scored as 1, 11 to 50% as 2, 51 to 80% as 3 and 81 to 100% as 4. Staining intensity is rated on a scale of 0 to 3, with 0 = negative; 1 = weak; 2 = moderate and 3 = strong. The raw data were converted to the IHS by multiplying the quantity and staining intensity scores: 0 as “-”, 1 to 4 as “+”, 5 to 8 as “++” and 9 to 12 as “+++” (Table 3).

Statistical analysis Data were expressed as means ± standard deviation (s.d). The comparisons between the four groups were performed using the one-way ANOVA (analysis of variance) with a post hoc test. For categorical variables, data were presented by number and percentage. The associations between categorical variables were tested using Fisher’s exact test. All statistical hypothesis tests were set with a significance level of 0.05. Statistical analyses were performed using SPSS 15.0 statistics software (SPSS Inc, Chicago, IL, USA).

RESULTS QC treatment reduced prostatic index (PI) in BPH rats To evaluate the efficacy of QC in treatment of BPH, we first examined the effect of QC on prostatic index (PI) in BPH rats by calculating the ratio of prostatic weight to body weight. As shown in Table 1, the mean PI in the model group was significantly elevated when compared with that in the control group (P<0.05). However, administration with either QC or finasteride significantly reduced PI in BPH rats (p < 0.05). QC treatment suppressed the mRNA expressions of PCNA, CyclinD1 and CDK4 in the prostatic tissue of BPH rats The mRNA expression was determined by RT-PCR assay. As shown in Figure 1 and Table 2, model construction obviously enhanced the mRNA expression of PCNA, CyclinD1 and CDK4 in rat prostatic tissues which however, was significantly neutralized by both QC and finasteride treatment. QC treatment inhibited the protein expressions of PCNA, CyclinD1 and CDK4 in the prostatic tissue of BPH rats and quantitative analysis Data from immunohistochemistry analysis (IHC) showed that the protein expression level of PCNA, CyclinD1 and CDK4 in prostatic tissues of model group was significantly higher than that of the control group (P<0.05) (Figures 2 to 4 and Table 3), whereas treatment with QC or finasteride profoundly inhibited the protein expression of PCNA, CyclinD1 and CDK4 in the prostatic tissues of BPH rats (P<0.05; Figures 2 to 4 and Table 3). DISCUSSION BPH, also known as benign prostatic hypertrophy, is a non-cancerous enlargement of the prostate that involves hyperplasia of prostatic stromal and epithelial cells. As

7734

Afr. J. Biotechnol.

Figure 1. Effects of QC on the mRNA expressions of PCNA, Cyclind1 and CDK4 in the prostate cells. QC treatment was able to downregulate the expression of PCNA, CyclinD1 and CDK4.

Table 2. Quantitative analysis of PCNA, CyclinD1, CDK4 mRNA expression in each group (

Group Control group Model group Finasteride group QC group

N 8 8 8 8

PCNA/β- actin 0.65±0.22 0.93±0.13* 0.56±0.15** 0.45±0.26**

CyclinD1/β- actin 0.29±0.18 0.61±0.11* 0.42±0.15** 0.28±0.21**

±s).

CDK4/β- actin 0.25±0.19 0.44±0.08* 0.25±0.18** 0.10±0.16**

* P<0.05 versus control group; ** P<0.05 versus model group.

Table 3. Expression of PCNA, CyclinD1, CDK4 in the prostate tissues of different groups of rats.

Group

N

Control group Model group Finasteride group QC group

8 8 8 8

0 0 1 2

PCNA + ++ 6 2 0 5 5 2 4 2

+++ 0 3* 0 ** 0 **

2 0 2 1

Cyclin D1 + ++ 6 0 3 3 4 1 3 4

CK4 +++ 0 2* 1 ** 0 **

3 0 2 1

+ 5 3 5 5

++ 0 3 1 2

+++ 0 2* 0 ** 0 **

* P<0.05 versus control group; ** P<0.05 versus model group.

the volume of the prostate sufficiently enlarges, the nodules compress the urethral canal to cause partial or sometimes virtually complete obstruction of the urethra, which interferes with the normal flow of urine. It leads to the symptoms of urinary hesitancy, frequent urination, dysuria (painful urination), increased risk of urinary tract infections and urinary retention. Treatment options for BPH include surgery and medications to reduce the amount of tissue and increase the flow of urine. Usually, medication treatments are the most common choice for BPH patients with slight or midrange symptoms. The two main medications for management of BPH are alpha blockers and 5α-reductase inhibitors. But both two of these medicines have their own side effects. So people

often seek herbal remedies for BPH since they usually generate less negative effects and display therapeutic efficacy (Lieber, 1998). As a traditional Chinese herbal formulation which has been used for a long time in clinical practice, QC has been shown to be effective in the treatment of BPH (Lin et al., 2010; Zhou et al., 2008, 2010a, b). In this study, we calculated the PI of each group to observe the general changes of prostate tissues. The result shows that both QC and finasteride significantly reduced PI in BPH rats, which validate the clinical effect of QC. However, the mechanism of QC action is still largely unknown. BPH is considered to be a proliferative process of both the stromal and epithelial elements. Cell proliferation is

Zhong et al.

Figure 2. Immunohistochemical staining of PCNA in the prostate tissues of different groups of rats (immunohistochemistry 400Ă—). There were more PCNA positive cells in model group than that in the control group prostates (P<0.05, Table 3). Few PCNA positive cells were found in the QC group and finasteride group prostates (P<0.05, Table 3).

Figure 3. Immunohistochemical staining of in the prostate tissues of different groups of rats (immunohistochemistry 400Ă—). There were more Cyclind1 positive cells in model group than that in the control group prostates (P<0.05, Table 3). Few CyclinD1 positive cells were found in the QC group and finasteride group prostates (P<0.05, Table 3).

7735

7736

Afr. J. Biotechnol.

Figure 4. Immunohistochemical staining of CDK4 in the prostate tissues of different groups of rats (immunohistochemistry 400Ă—). There were more CDK4 positive cells in model group than that in the control group prostates (P<0.05, Table 3). Few CDK4 positive cells were found in the QC group and finasteride group prostates (P<0.05, Table 3).

highly regulated by the cell cycle, which consists of four periods: S phase (DNA synthesis phase), M phase (mitosis), G1 and G2 phase. G1/S transition is one of the two main checkpoints of cell cycle (Nurse, 1994), which is responsible for initiation and completion of DNA replication. G1/S progression is precisely regulated by Cyclin D1 that exerts its function via forming an active complex with its CDK major catalytic partners (CDK4/6) (Morgan, 1995; Nurse, 2000). An unchecked or hyperactivated Cyclin D1/CDK4 complex may be responsible for enhanced cellular proliferation and the alteration of Cyclin D1/CDK4 complexes is becoming a possible target for the anti-proliferation therapies (Day et al., 2009; Sridhar et al., 2006; Dobashi, 2004; Nurse et al., 1998). PCNA is a 36 kD DNA polymerase delta auxiliary protein that involves proliferation and it is specifically expressed in proliferating cell nuclei. PCNA has been recognized as a histologic marker for the G1/S phase in the cell cycle (Bantis et al., 2004). Using immunohistochemistry and RT-PCR analyses, in this study, we found that the expression of PCNA, Cyclin D1 and CDK4 was significantly increased in the BPH model group which however, could be significantly inhibited by QC treatment. In conclusion, here, we reported for the first time that Qianliening capsule can inhibit cell proliferation by downregulating the expression of PCNA, Cyclin D1 and CDK4, which might be one of the mechanisms by which QC treats BPH.

ACKNOWLEDGEMENT This work was supported by the Nature Science Foundation of China (81072927 and 81173433), the Natural Science Foundation of Fujian Province of China (2010J01199 and 2009J01169). REFERENCES Bantis A, Giannopoulos A, Gonidi M (2004). Expression of P120, Ki –67 and PCNA as proliferation biomarkers in imprint smears of prostate carcinoma and their prognostic smears of prostate carcinoma and their prognostic value. Cytopathol. 15(1): 25-31. Berry SJ, Coffey DS, Walsh PC, Ewing LL (1984). The development of human benign prostatic hyperplasia with age. J. Urol. 132: 474-479. Boyle P, Robertson C, Lowe F, Roehrborn C (2000). Meta-analysis of clinical trials of Permixon in the treatment of symptomatic benign prostatic hyperplasia. Urology, 55(4): 533-539. Claus S, Berges R, Senge T, Schulze H (1997). Cell kinetic in epithelium and stroma of benign prostatic hyperplasia. J. Urol. 158(1): 217-221. Chen Y, Robles AI, Martinez LA, Liu F, Gimenez-Conti IB, Conti CJ (1996). Expression of G1 cyclins, cyclin-dependent kinases, and cyclin-dependent kinase inhibitors in androgen-induced prostate proliferation in castrated rats. Cell Growth Differ. 7(11): 1571-1578. Day PJ, Cleasby A, Tickle IJ, O'Reilly M, Coyle JE, Holding FP, McMenamin RL, Yon J, Chopra R, Lengauer C, Jhoti H (2009). Crystal structure of human CDK4 in complex with a D-type cyclin. Proc. Natl. Acad. Sci. USA. 106(11): 4166-4170. Djavan B (2003). Lower urinary tract symptoms/benign prostatic hyperplasia: fast control of the patient's quality of life. Urology, 62: 614.

Zhong et al.

Dobashi Y, Goto A, Fukayama M, Abe A, Ooi A (2004). Overexpression of cdk4/cyclin D1, a possible mediator of apoptosis and an indicator of prognosis in human primary lung carcinoma. Int. J. Cancer, 110(4): 532-541. Grana X, Redy EP (1995). Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CKIs). Oncogene, 11(2): 211219. Kyprianou N, Tu H, Jacobs SC (1996). Apoptotic versus proliferative activities in human benign prostatic hyperplasia. Hum. Pathol. 27(7): 668-675. Lieber MM (1998). Pharmacologic therapy for prostatism. Mayo Clin. Proc. 73(6): 590-596. Lin Jianheng, Zhong Xiaoyong, Pen Jun, Xu Wei, Zheng Yin, Zhao Yan, Hong Zhenfeng (2010). Effects of Qianliening capsule on the expression of EGF and EGFR in BPH Rats. Fujian J. Traditional Chinese Med. 41(6): 45-47. Morgan DO (1995). Principles of CDK regulation. Nature, 374(6518):131-134. Nurse P, Masui Y, Hartwell L (1998). Understanding the cell cycle. Nat. Med. 4(10): 1103-1106. Nurse P (1994). Ordering S phase and M phase in the cell cycle. Cell, 79: 947-550. Nurse P (2000). A long twentieth century of the cell cycle and beyond. Cell, 100(1): 71-78. Nurse P, Masui Y, Hartwell L (1998). Understanding the cell cycle. Nat. Med. 4(10): 1103-1106. Roehrborn CG (2008). Pathology of benign prostatic hyperplasia. Int. J. Impot. Res. 20(3): S11-18. Sridhar J, Akula N, Pattabiraman N (2006). Selectivity and potency of cyclin-dependent kinase inhibitors. AAPS J. 8: 204-221. Tiwari A, Krishna NS, Nanda K, Chugh A (2005). Benign prostatic hyperplasia: an insight into current investigational medical therapies. Expert Opin. Invest. Drugs, 14: 1359-1372.

7737

Wilt T, Ishani A, MacDonald R, Stark G, Mulrow C, Lau J (2000). Betasitosterols for benign prostatic hyperplasia. Cochrane DB. Syst. Rev. (2): CD001043. Wilt T, Ishani A, Mac Donald R, Rutks I, Stark G (2002). Pygeum africanum for benign prostatic hyperplasia. Cochrane DB. Syst. Rev. (1): CD001044. Zhang MD, Zhao YN, An LW (2009). B-cell lymphoma/leukemia-2 and benign prostatic hyperplasia. Zhonghua Nan Ke Xue. 15(5): 452-454. Zhong W, Peng J, He H, Wu D, Han Z, Bi X, Dai Q (2008). Ki-67 and PCNA expression in prostate cancer and benign prostatic hyperplasia. Clin. Invest. Med. 31(1): E8-E15. Zhou J, Lin J, Xu W, Zhong X, Xie J, Hong Z (2010a). Effects of Qianliening capsule on the expression of IL-10 and TNF-ι in benign prostatic hyperplasia. Chinese Arch. Tradit. Chin. Med. 28(12): 26572569. Zhou J, Hong Z, Lin J, Zhao J, Zhou H (2008). Effect of Qianliening Granule on Experimental Hyperplasia of Prostate. Fujian Coll. Tradit. Chin. Med. 18(5): 45-47. Zhou H, Lin J, Zhao J, Zhou J, Hong Z (2010b). Inhibition Effects of Qianliening Granule on IL-1β and its mRNA Expression in Model Rats. Fujian Coll. Traditional Chinese Med. 20(3): 21-24. Zhou J, Lin J, Xu W, Zhong X (2012). Qianliening capsule treats benign prostatic hyperplasia through regulating the expression of sex hormones, estrogen receptor and androgen receptor. Afr. J. Pharm. Pharmacol. 6(3): 173-180.

African Journal of Biotechnology Vol. 11(30), pp. 7738-7743, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3536 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Isolation, purification and effects of hypoglycemic functional polysaccharides from Inonotus obliquus Tao Hu, Ping Liu*, Yuanying Ni and Chuntao Lu College of Food Science and Nutritional Engineering, China Agricultural University, P. O. Box 398, 17 Qinghua Donglu, Haidian District, Beijing 100083, China. Accepted 12 March, 2012

Inonotus obliquus is generally used for the treatment of diseases such as cancers, angiocardiopathy and diabetes. However, few studies are available on its functional components. The objective of this study was to isolate and purify hypoglycemic functional polysaccharides from I. obliquus (HPIO) and study their hypoglycemic activities. I. obliquus powder was used to obtain crude polysaccharides at room temperature (HPIO-R) and at high temperature (HPIO-H) using diethylaminoethyl cellulose (DEAE) cellulose -52 column chromatography for purification. Streptozotocin (STZ)-induced hyperglycemic mice were used to evaluate the in vivo antihyperglycemic and antilipidperoxidative effects of HPIOs at each eluted level. The results show that HPIO was a uniform compound and HPIO (0.2 mol/L NaCl) had antihyperglycemic effects and regulated lipid metabolism. Key words: Hypoglycemic activity, polysaccharides, Inonotus obliquus, isolation, purification.

INTRODUCTION Obesity, high blood glucose and diabetes which are the significant chronic diseases and causes of death in modern society and they are largely caused by diet. Worldwide, scientists have focused on how to reduce blood glucose levels (Bjorntorp et al., 1999). The worldwide incidence of diabetes mellitus is expected to continue growing by 6% annually and to become a leading cause of human death (Kang et al., 2008). Therefore, new drugs to manage this condition are needed. Many drugs are available to manage diabetes; however, most are expensive and have side effects. To find new drugs and meet patient needs, scientists have studied herbs with no side effects. Studies have shown that fungi are highly edible and have medicinal value,

*Corresponding author. E-mail: liuping@cau.edu.cn. Tel: +86 10 62737131. Fax: +86 10 62737131. Abbreviations: HPIO, Hypoglycemic functional polysaccharides from I. obliquus; HPIO-R, hypoglycemic functional polysaccharides at room temperature; HPIO-H, hypoglycemic functional polysaccharides at high temperature; DEAE, diethylaminoethyl cellulose; STZ, streptozotocin.

especially Inonotus obliquus, a well-known medicinal plant traditionally used for antihyperglycemic effects.I. obliquus is a white rot fungus that grows under the bark of Betula (birch), Ulmus, Alnus and dry dead trees (Mao, 2000). It is a typical disease fungus of trees and is widely distributed over the latitude 45° N to 50° N area, such as in Northern Russia, Europe, China and Hokkaido, Japan. It has been used as a folk remedy to prevent digestive system diseases; cancers of the stomach, colon and liver; angiocardiopathy; diabetes; and viral diseases. Studies have shown that a glycoprotein and a water extraction of polysaccharides isolated from the fruiting bodies of I. obliquus have significant antihyperglycemic effects. In particular, an extract of I. obliquus can sustain antihyperglycemic effects for 48 h (Huang, 2002). Extracts from I. obliquus have protective and prosthetic effects on the pancreatic islands, and on hepatic and kidney injury in STZ-induced diabetic rats (Zhang et al., 2008). Studies have also shown that dry matter from the culture broth of I. obliquus and fruiting bodies, and sclerotia and polysaccharide extracts of I. obliquus have significant antihyperglycemic, antilipid-peroxidative, and antioxidant effects on diabetic mice (Sun and Ao 2008; Chen et al., 2006). Mizuno et al. 1999; Mizuno and Zhuang 2005) found that soluble or non-water-soluble

Hu et al.

polysaccharides isolated from the scleritis and mycelia of I. obliquus showed antihyperglycemic effects. This was confirmed by further studies that concluded that trametenolic acid in the water extract of I. obliquus has an effect on non-insulin-dependent diabetes mellitus. Most patients with diabetes have hypercholesterolemia and hyperglycemia and a higher risk of heart disease and dyslipidaemia. Diabetes is primarily characterized by fasting hyperglycemia and can lead to severe health problems (Tamrakar et al., 2008). While many drugs to prevent and treat diabetes are in trials, none are highly effective. Oral hypoglycemia agents can reduce blood sugar levels, but they have long-term toxic effects (Mitra et al., 1996). Many new agents and methods have been used to treat diabetes. In recent years, mushroom polysaccharides have received attention and shown to have antitumor effects (Borchers et al., 1999; Leung et al., 1997). Previous studies found that I. obliquus, a kind of mushroom has therapeutic effects but the active ingredients have not been clearly elucidated.I. obliquus polysaccharides that might defend against cancers and obesity are needed; however, little research is available on the isolation and purification of I. obliquus polysaccharides and their hypoglycemic activity. In this article, a preparation method was established for purification of room-temperature and high-temperature extracts of crude polysaccharides (HPIO-R and HPIO-H) from I. obliquus fruiting bodies by DEAE cellulose-52 column chromatography. The hypoglycemic activity of different fractions was studied in mice, providing a theoretical and experimental basis for the application of I. obiquus extracts in treatment and further research. MATERIALS AND METHODS Plant material I. obliquus harvested at Changbai Mountain, Jilin, China, were crushed and sieved by 40 mesh and stored in the laboratory.

7739

Experimental procedures Preparation of I. obliquus total crude polysaccharide extracts The powdered fruiting bodies of I. obliquus were extracted with water at 30 times volume at 90°C for 3 h, and centrifuged at 4000 rpm for 20 min. The precipitated fraction was dried at 50°C and total polysaccharide determined. This was used to compare the antihyperglycemic effects to fractionated polysaccharide.

Preparation of crude polysaccharide from I. obliquus fruiting bodies Polysaccharides at room temperature: For HPIO-R, I. obliquus powdered fruiting bodies were extracted with water at room temperature at 30 times volume for 48 h and centrifuged at 4000 rpm for 20 min. The aqueous phase was evaporated, reduced to an appropriate volume and mixed with absolute ethyl alcohol (1:4, v/v). The precipitated fraction was dried at 50°C and total polysaccharide was determined. Polysaccharide at high temperature: For HPIO-H, after polysaccharide extraction at room temperature, the powder was washed three times with water at room temperature, then extracted with water at 90°C at 30 times volume for 3 h and centrifuged at 4000 rpm for 20 min. The aqueous phase was evaporated, reduced to an appropriate volume and mixed with absolute ethyl alcohol (1:4, v/v). The precipitated fraction was dried at 50°C and total polysaccharide was determined.

Isolation and purification of polysaccharide HPIO-R and HPIO-H were dissolved in distilled water. And then they were loaded into an anion-exchange DEAE cellulose DEAE-52 column (2.6×25 cm), after that they were eluted stepwise with H 2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl at 120 ml/h to give rise to three fractions. Polysaccharide was determined at 495 nm by using phenol-sulfuric acid method (Li et al., 1997). Fractions were collected, concentrated, and centrifuged. Precipitated polysaccharides were dialyzed for 24 h in distilled water, and then they were obtained for the subsequent studies.

Measuring in vivo antihyperglycemic effects of polysaccharide fractions

Reagents

Establishment of the diabetes mice model

Metformin hydrochloride tablets were from Beijing Pharmaceutical Co., Ltd. (China; 0.25 g × 50 pieces/box). DEAE cellulose-52 column chromatography reagents were from Pharmacia Inc. (USA). Streptozotocin (STZ) was from Sigma-Aldrich Inc. (USA). All other chemicals were analytical grade. Assay kits for glucose oxidase, triglyceride (TG) and enzymatic determination of total cholesterol (TC) were purchased separately from Beijing Strong Biotechnologies, Inc. Beijing Kang Tai clinical reagent Co., Ltd. and BioSino Bio-technology and Science Inc.

ICR mice were acclimatized under controlled conditions for 1 week before experiments. Mice were given intraperitoneal injections of freshly prepared STZ (35 mg/kg in 0.01 mol/L citrate buffer) 4 times per day for 3 days while normal control groups were injected with buffer only. On the sixth day, only water was offered to the animals for 6 h, then blood was collected from the tail vein, and glucose level measured.

Antihyperglycemic effects analysis Animals Male ICR mice (20 ± 2 g) were from the Chinese Academy of Military Sciences Experimental Animal Center, license number SCXK (Army) 2002-001. All animal handling procedures were in strict accordance with the PR China legislation on the use and care of laboratory animals, with guidelines established by the Experimental Animal Center of Peking University.

Mice with blood glucose levels above 12 mmol/L were deemed to be hyperglycemic and randomly divided into 10 groups with 12 animals in each group. Both the normal and diabetic control groups were fed a basal diet and sodium chloride solution. Model animals were fed with crude total polysaccharide (100 or 300 mg/kg body weight), HPIO-R elution fractions, or HPIO-H elution fractions (4.5 mg/kg body weight, in H2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl). The positive control group was given metformin hydrochloride tablets

Afr. J. Biotechnol.

ofofpolysaccharide(mg/ml) concentration polysaccharide (mg/ml) Concentration

7740

0.18 0.16 0.14 0.12 0.10 0.08 0.06 0.04 0.02 0.00 -0.02

H2O Nacl 0.2mol/L Nacl 0.5mol/L

0

15

30

45

60

75

90 105 120

Tube number tube number

Figure 1. Elution profile of HPIO-R with the anion-exchange chromatography of DEAE-cellulose DEAE-52. Tubes (40 ml) of each fraction were assayed for polysaccharide at 495 nm by phenol-sulfuric acid method (Li et al., 1997).

(125 mg/kg body weight) for 21 days.During the experiments, fasting blood glucose levels and body weight were measured at weekly intervals for 21 days. Mice were sacrificed by cervical dislocation after the last administration, and then the blood was centrifuged to separate serum for measuring TG and TC levels. All of the fasting blood glucose, total cholesterol (TC) and triglyceride (TG) levels were measured following the instructions of commercial kits.

Statistical analysis In the experiment, all the data was expressed as means Âą standard deviation (Mean Âą SD) and the statistical software statistical package for social sciences 17.0 (SPSS 17.0) was used for performing the statistical methods. Values of P < 0.05 used were considered to be significant.

RESULTS HPIO was extracted from I. obliquus and isolated by DEAE cellulose-52 column chromatography. HPIO-R was isolated by DEAE cellulose-52 column chromatography Figure 1 shows the results of HPIO-R eluted with H2O, 0.2 mol/L NaCl and 0.5 mol/L NaCl. As shown in Figure 1, polysaccharide was isolated in several fractions, in which

water elution gave three peaks, with peak-I having a high polysaccharide content, and the others with a low content. NaCl (0.2 mol/L) isolated a complete and single fraction that might be a single compound. Multiple fractions were isolated by NaCl 0.5 mol/L; peak-II had the highest polysaccharide concentrations. However, the polysaccharide concentrations of all the peaks were little. And the eluted fractions for HPIO-R-H2O-peak-I NaClpeak-I, HPIO-R-0.2 mol/L NaCl and HPIO-R-0.5 mol/L NaCl-peak-II were collected and refrigerated respectively. HPIO-H isolated chromatography

by DEAE

cellulose-52

column

Figure 2 shows the results of HPIO-H isolation. As shown in Figure 2, polysaccharide was isolated in several fractions with many peaks and complex compounds with water solution, in which Peak-I had a high polysaccharide content. NaCl 0.2 mol/L isolated a complete single fraction that might be a single compound. Three fractions with small peaks were isolated with NaCl 0.5 mol/L. The main HPIO-H-H2O-peak-I and HPIOH-0.2 mol/L NaCl-peaks were collected and refrigerated respectively. Our results show that fractions could be purified by DEAE-52 anion-exchange chromatography, and fractions

(mg/ml) Concentration polysaccharide(mg/ml) concentration of polysaccharide

Hu et al.

7741

H2O NaCl 0.2mol/L NaCl 0.5mol/L

0.06

0.04

0.02

0.00

0

15 30 45 60 75 90 105 120 135 150 Tube tubenumber number

Figure 2. Elution profile of HPIO-H with the anion-exchange chromatography of DEAE-cellulose DEAE-52 Tubes (50 ml) of each fraction were assayed for polysaccharide at 495 nm by phenolsulfuric acid method (Li et al., 1997).

Table 1. Effect of I. obliquus crude total polysaccharide and fractions on fasting blood glucose levels of STZ-induced diabetic mice.

Group Normal control Diabetic control Metformin A B C D E F H1 H2

Number

Dose (mg/kg b.w.)

12 12 12 12 12 12 12 12 12 12 12

0 0 125 4.5 4.5 4.5 4.5 4.5 4.5 100 300

0 day 7.74±5.3 19.02±7.05* 19.95±6.23* 19.35±8.28* 18.7±7.26* 18.25±6.87* 18.24±7.49* 18.53±7.21* 18.26±7.76* 19.37±6.97* 19.39±6.58*

Blood glucose (mmol/L) 7 day 14 day 8.72±1.24 9.96±1.8 22.81±2.02 34.25±1.94 18.24±3.95** 25.92±5.98** 20.76±4.33 26.54±7.44 20.97±8.15 25.92±9.38 20.83±5.73 30.58±6.28 21.79±5.02 28.04±7.32 18.59±7.69 28.25±10.78 22.64±7.23 30.42±5.5 24.31±3.82 32.69±4.73 16.56±5.53** 23.57±5.85**

21 day 9.70±1.70 19.50±1.86 16.62±3.2** 17.92±3.70 17.82±3.64 17.73±4.04 18.35±3.02 14.9±5.26** 18.53±2.46 17.76±2.41 18.60±2.53

Mean ± S.D; b.w., body weight. *P < 0.05 vs. normal control group. **P < 0.05 vs. diabetic control group. A, B, C (HPIO-R elution fractions: H2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl); D, E, F (HPIO-H elution fractions: H 2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl); H1, H2 (Crude total polysaccharide).

might include a single compound isolated by 0.2 mol/L NaCl. Hypoglycemic activity of crude total polysaccharide and fractions Effect of I. obliquus crude total polysaccharide and fractions from fasting blood glucose in STZ-induced diabetic mice The antihyperglycemic effect of I. obliquus crude total polysaccharide and fractions on fasting blood glucose

levels of STZ-induced diabetic mice are shown in Table 1. Mice in the diabetic modeling groups initially had significantly (P < 0.05) increased blood glucose levels compared to the normal control group, and Table 1 showed the establishment of diabetes mice model was succeeded. Compared to diabetic control mice, the blood glucose level of the H2 diabetic groups significantly decreased (P < 0.05) after 7 and 14 days. However, a rebound occurred after 21 days, while the blood glucose level of the E diabetic groups was significantly decreased (P < 0.05) after 21 days. Moreover, the blood glucose levels of the other diabetic groups were not significantly

7742

Afr. J. Biotechnol.

Table 2. Effect of I. obliquus crude total polysaccharide and fractions on lipid profile of STZ-induced diabetic mice.

Number

Dose (mg/kg b.w.)

TC (mmol L−1)

TG (mmol L−1)

Normal control

12

0

4.2±0.74

1.74±0.62

Diabetic control

12

0

4.05±0.8

4.11±3.24

Metformin

12

125

4.48±0.76

3.53±2.65

A

12

4.5

3.83±0.57

3.04±1.31

B

12

4.5

4.18±1.94

1.82±0.91**

C

12

4.5

4.86±0.66

3.01±0.99

D

12

4.5

4.21±0.71

3.09±0.9

E

12

4.5

4.15±0.81

2.1±0.98

F

12

4.5

4.69±1.1

2.61±0.99

H1

12

100

4.73±1.14

3.05±1.01

H2

12

300

5.58±1.33

3.16±1.56

Group

Mean ±S.D; b.w., body weight; TC, total cholesterol; TG, triglyceride. *P < 0.05 vs. normal control group. **P < 0.05 vs. diabetic control group. A, B, C (HPIO-R elution fractions: H2O, 0.2 mol/L NaCl, 0.5 mol/L NaCl); D, E, F (HPIO-H elution fractions: H2O, 0.2 mol/L NaCl, 0.5 mol/LNaCl); H1, H2 (crude total polysaccharide).

Table 3. Effect of I. obliquus crude total polysaccharide and fractions on STZ-induced diabetic mice weight.

Group Normal control Diabetic control Metformin A B C D E F H1 H2

Number

Dose (mg/kg b.w.)

12 12 12 12 12 12 12 12 12 12 12

0 0 125 4.5 4.5 4.5 4.5 4.5 4.5 100 300

0 day 24.89±1.35 23.41±1.78 24.41±1.63 24.36±2.27 24.14±1.61 24.38±1.99 24.50±2.39 23.95±1.69 24.96±1.66 24.46±1.35 23.76±2.23

b.w./g 7 day 14 day 30.05±2.87 32.23±2.83 25.15±1.73 27.51±1.92 26.75±2.01 28.39±2.15 26.74±2.56 27.69±2.54 24.34±2.62 25.24±2.84 26.02±2.88 26.47±2.90 27.58±2.34 28.29±2.38 25.59±3.29 26.97±2.75 26.64±2.26 28.33±2.28 26.41±2.32 26.33±2.13 23.96±3.43 24.16±3.35

21 day 34.84±2.87 29.22±2.55 30.25±2.74 27.90±2.35 29.82±2.64 28.73±2.02 28.41±2.61 28.31±2.92 28.41±2.61 26.10±1.35 26.77±3.58

Mean ±S.D; b.w., body weight. *P < 0.05 vs. normal control group. **P < 0.05 vs. diabetic control group. A, B, C (HPIO-R elution fractions: 0 mol/L, 0.2 mol/L, 0.5 mol/l NaCl); D, E, F (HPIO-H elution fractions: 0 mol/L, 0.2 mol/L, 0.5 mol/L NaCl); H1, H2 (crude total polysaccharide).

decreased (P > 0.05) compared to diabetic control mice, except for the STZ+metformin group. Effect of I. obliquus crude total polysaccharide and fractions on lipid profile of STZ-induced diabetic mice TC and TG levels in serum were determined. Compared to diabetic control mice, the TG level of the STZ+ metformin group was not significantly decreased, while the TG level of the diabetic groups E and B decreased. The B diabetic groups significantly decreased (P < 0.05) the TG level compared with the diabetic control groups (Table 2). The results show that I. obliquus extracts had antihyperglycemic effects and regulated lipid metabolism.

Effect of I. obliquus crude total polysaccharide and fractions on body weight of STZ-induced diabetic mice As shown in Table 3, no obvious differences in body weight were seen between the different groups. The body weight of the diabetic groups was not significantly different than the diabetic control mice. Table 3 shows that I. obliquus extract had no side effects on the physiological condition of the mice. DISCUSSION In this study, the effects of DEAE-52 fractions of I.

Hu et al. obliquus in normal, diabetic normal and STZ-induced diabetic mice were evaluated. Traditionally, a small piece of I. obliquus (1 to 2 g) or one tablespoon of crushed extract in hot water was taken (Park et al., 2005). In this study, we showed that oral administration of 4.5 mg/kg HPIO isolated by NaCl 0.2 mol/L had a significant hypoglycemic or hypolipidemic effects in vivo. The body weight of the groups revealed no obvious differences. This meant that HPIO had no side effects on the physiological condition of the mice. This amount of HPIO 0.2 mol/L NaCl elution might be reasonable compared to the dose recommended in traditional medicinal use. In conclusion, our results found that DEAE-52 fractions of I. obliquus had significant antihyperglycemic effects in STZ-induced mice, as well as anti-TG effects, especially the fraction with a single peak isolated by NaCl 0.2 mol/L. Thus, I. obliquus extracts might have important prophylactic benefits to humans through their potential diabetes-preventing effects. However, more efforts are needed to characterize and evaluate the extract. ACKNOWLEDGEMENTS The authors thank the Chinese Academy of Military Sciences Experimental Animal Center for providing the experimental animals. This work was supported by the Lab of Fermentation Engineering, Institute of Food Science and Nutritional Engineering, China Agricultural University, Beijing, China and the Experimental Animal Center of Peking University, Beijing, China. REFERENCES Bjorntorp P, Holm G, Rosmond R (1999). Hypothalamic arousal, insulin resistance and type 2 diabetes mellitus. Diabetic Med. 16: 373-383. Borchers AT, Stern JS, Hackman RM, Keen CL, Gershwin ME (1999). Mushrooms, Tumors, and Immunity. P. Soc. Exp. Biol. Med. 221(4): 281-293. Cheng YQ, Zhou LJ, Li Y (2006). The comparative analysis of antihyperglycemic effect of submerge cultured mycelia, sclerotium and wild Fruit bodies of Inonotus obliquus. Edible Fungi, 3: 52-54. Huang NL (2002). Civilian medicinal fungi in Russia. Edible Fungi of China 21(4): 7-8.

7743

Kang SI, Jin Y, Ko HC, Choi SY, Hwang JH, Whang I, Kim MH, Shin HS, Jeong HB, Kim SJ(2008). Petalonia improves glucose homeostasis in streptozotocin-induced diabetic mice. Biochem. Bioph. Res. CO. 373: 265-269. Leung YM, Fung KP, Choy YM (1997). The isolation and characterization of an immunomodulatory and anti-tumor polysaccharide preparation from Flammulina velutipes. Immunopharmacol. 35: 255-263. Li XH, Li SP, He YQ, Li RZ, Cui SM (1997). On the determination of polysaccharides in Lingzhi (Ganoderma lucidum). Chin. Tradit. Herbal Drugs, 28(3): 530-531. Mao XL (2000). The Macrofungi in China. Henan Science and Technology Press, Zhengzhou, Henan, China. Mitra SK, Gopumadhavan S, Muralidhar TS, Anturlikar SD, Sujatha MB (1996). Effect of a herbomineral preparation D-400 in streptozotocininduced diabetic Rats. J. Ethnopharmacol. 54: 41-46. Mizuno T, Zhuang C, Abe K, Okamoto H, Kiho T, Ukai S, Leclerc S, Meijer L (1999). Antitumor and hypoglycaemic activities of polysaccharides from the scleritia and mycelia of Inonotus obliquus. Int. J. Med. Mushrooms 1(4): 301-316. Mizuno T, Zhuang C (2005). Antitumor and hypoglycemic activities of polysaccharides from the scleritia and mycelia of Inonotus obliquus. J. Ethnopharmacol. 101(3): 120-121. Park YM, Won JH, Kim YH, Choi JW, Park HJ, Lee KT (2005). In vivo and in vitro anti-inflammatory and anti-nociceptive effects of the methanol extract of Inonotus obliquus. J. Ethnopharmacol. 101: 120128. Sun JN, Ao ZH (2008). Antihyperglycemic and antilipidperoxidative effects of dry matter of culture broth of Inonotus obliquus in submerged culture on normal and alloxan-diabetes mice. J. Ethnopharmacol. 118: 7-13. Tamrakar AK, Yadav PP, Tiwari P, Maurya P, Srivastava AK (2008). Identification of pongamol and karanjin as lead compounds with antihyperglycemic activity from Pongamia pinnata fruits. J. Ethnopharmacol. 118: 435-439. Zhang XH, Sun DZ, Chen HY, Cui JC, Liu SS (2008). The protective effects of Inonotus obliquus on tissue injury in diabetic mice. Edible Fungi of China 27(2): 31-33.

African Journal of Biotechnology Vol. 11(30), pp. 7744-7750, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3511 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Morphological and chemical characteristics of tomato foliage as mechanisms of resistance to Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) larvae Muahmmad Ashfaq1,2*, Muhammad Sajjad1, Muhammad Noor ul Ane 1 and Noureen Rana3 1

Department of Agricultural Entomology, University of Agriculture, Faisalabad, Punjab, Pakistan. 2 Faculty of Agriculture, University of Agriculture, Faisalabad, Pakistan. 3 Department of Zoology and Fisheries, University of Agriculture, Faisalabad, Punjab, Pakistan. Accepted 1 February, 2012

Morphological characters and chemical composition of tomato (Lycopersicon esculentum Miller) leaves were measured and compared among nine tomato varieties (Roma VFN, NARC-1, Fs-8802, Tommy, Pant Babr, Rio Grande, Nova Mecb, Pakit and Sahil) exhibiting varying levels of host plant resistance to Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) as based on fruit infestation. The variety, Sahil, was resistant, whereas Roma VFN was the susceptible variety. Hair length and hair density on lower leaf surface, as well as thickness of leaf lamina significantly correlated with larval population and fruit infestation. Leaf hair density accounted for 92.0% of the variation in fruit infestation and 77.0% of the variation in larval population. Ferrous (Fe2+) and phosphorous content in the leaves were negatively correlated with fruit infestation and larval population; whereas, nitrogen, calcium, magnesium, manganese and zinc content were positively correlated with fruit infestation and larval population. The resistant variety, Sahil, produced the maximum yield as compared to susceptible variety, Roma VFN. Key words: Helicoverpa armigera, tomato fruit borer, host plant resistance, Lycopersicon esculentum. INTRODUCTION Tomato (Lycopersicon esculentum Miller) is an important solanaceous crop grown throughout the world, including Pakistan where total production was 468,146 MT on 46,200 ha in 2005 to 2006 (Agricultural Statistics of Pakistan, 2007). Yield of Pakistan-grown tomatoes is limited by arthropod pests including Helicoverpa sp., Spodoptera sp., and tomato russet mites [Aculops lycopersici (Massee)] (Hartz et al., 2008). Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) feeds primarily on the tomato fruit causing reported yield losses as high as 35% in Pakistan (Ahmad and Mohsin, 1969; Latif et al., 1997) and 38% in neighboring India (Selvanarayanan and Narayanasamy, 2006). Insecticides use to manage H. armigera poses health, safety, environmental and economic concerns. Host plant resistance

*Corresponding author. E-mail: drashfaqti@yahoo.com. Tel: +92-41-9200161-170. Fax: +92-41-9201083.

has proven to be a valuable tool for crop protection (Kennedy, 1984) and may provide a viable pest management tactic for managing H. armigera in Pakistan-grown tomatoes (Jallow et al., 1998), with reducing deleterious effects of uncontrolled use of pesticides. Cultivation of Helicoverpa-resistant tomato cultivars is limited due to a lack of data on potential genetic sources and plant mechanisms (antixenosis) of resistance. Laterinstar H. armigera larvae feed on developing tomato fruit, while neonates and early instars usually start feeding on tender leaves before moving to the fruit (Liu et al., 2004; Perkins et al., 2009) and are often impacted by leaf characteristics (Sheloni et al., 2010, Simmons et al., 2004). Role of physio-chemical factors is important to identify a source of resistance in plants against pests (Dhilllon et al., 2005). Based upon preliminary screening data (Sajjad and Ashfaq, unpublished data), Roma VFN, NARC-1, and Fs-8802 were found susceptible, Nova Mecb, Pakit and Sahil were resistant, and Tommy, Pant Babr, and Rio Grande exhibited intermediate levels of

Ashfaq et al.

resistance based on the fruit-infestation data. Therefore, the study reported herein was undertaken to: (1) determine the relative resistance of these nine commerciallyavailable tomato varieties to H. armigera, (2) correlate morphological and chemical characteristics of leaves with the observed resistance to H. armigera, and (3) compare marketable yield of resistant and susceptible varieties. MATERIALS AND METHODS

7745

leaves. The Kjeldahl method was used to determine % nitrogen in the leaves. Individual 0.5 g samples were removed from the dried and ground leaf tissue for digestion, distillation and titration. Magnesium and phosphorous content was determined using calorimetric methods, calcium and potassium content was determined using photometric analyses, while copper, manganese and zinc content were measured using spectrophotometric analyses. Percentage lipid content was determined using a soxhlet extractor. Carbohydrate content and fiber content were estimated using formulas based upon residuals remaining after measurement of other major components of the leaves.

Varietal infestation screening Based upon preliminary screening data (Sajjad and Ashfaq, unpublished data), nine varieties of tomato were planted in field trials to screen for possible H. armigera resistance. These were; Roma VFN, NARC-1, Fs-8802, Tommy, Pant Babr, Rio Grande, Nova Mecb, Pakit and Sahil (Ali Akbar Group, Pakistan). Nurserygrown seedlings of these varieties were transplanted on the 17th of March 2008 and 15th of March 2009, in a randomized complete block design with four replications per variety. Individual plots were 6.11 × 12.23 m with a row width of 102 cm and a distance of 26 cm between adjacent plants within a row. Standard cultivation practices were used throughout the study, and no plant protection measures were used. Plants were monitored weekly starting one week after transplanting. At each observation, the number of H. armigera larvae per plant from five randomly-selected plants in each plot was recorded. Once tomato fruit appeared on the plants, the numbers of damaged and undamaged fruits were recorded weekly from five randomlyselected plants in each plot to calculate percent of fruit infestation.

Leaf morphological factors Three leaves (top, middle and lower portions of the plant) from each of three randomly-selected plants per plot were excised and transported to the laboratory. Six areas on the upper surface of each leaf and six areas on the lower surface of each leaf were microscopically examined. The density of leaf hairs and length of the hairs was measured at each location. In addition, a crosssection of the leaf lamina was cut using a razor blade to measure the thickness of the lamina at six locations on each leaf. All measurements were made with a Carl Zeiss™ binocular microscope equipped with an ocular micrometer. Non glandular trichomes were recorded in the present study.

Leaf chemical factors To determine selected chemical content of the leaves, leaf samples weighing 500 g each were removed from the top and bottom portions of randomly-selected plants in each plot. These samples were transferred to the laboratory, washed with distilled water, air dried under shade for 3 h, and oven-dried at 70 ± 5°C for 12 h. The oven-dried material was cut, then ground and passed through a 1mm sieve. These ground samples were stored in dry polythene bags. Furthermore, for each of these samples, 2 g of dried and ground leaf tissue was placed in a boron-free, silica-fused crucible and then placed in a muffle furnace at 600°C for 5 h. The combusted material was weighed and returned to the furnace for an additional 5 h. This was repeated until the material was completely combusted yielding a grayish-white ash with a constant weight. The percentage of total minerals in the leaf tissue was determined by comparison of weight of combusted ash to weight of the dried

Statistical analyses Larval population and fruit damage as response to tomato varieties were subjected to analysis of variance using MSTAT statistical software. Where applicable, treatment means were separated by Tukey’s honestly significant difference (HSD) tests for paired comparisons (P = 0.05). SPSS software was used for data analysis (one-way ANOVA) of morphological and chemical leaf characters (O’Connor, 2000). Larval population and fruit damage data were also correlated with the various morphological and chemical leaf factors using correlation analysis and stepwise multiple regression analysis.

RESULTS AND DISCUSSION Varietal infestation screening There were significant differences (F = 45.7, 61.2; df = 8; P < 0.05) among the nine tomato varieties with respect to H. armigera larval population per 10 plants and % tomato fruit damaged by H. armigera larvae (Table 1). Both characteristics were similarly expressed across the nine varieties. Varieties ‘Sahil’, ‘Pakit’ and Nova Mecb, seem to be more resistant to H. armigera than other varieties. Less than one-half of the larvae were found on the most susceptible varieties ‘Roma VFN’ and NARC-1 followed by FS-8802, while less than one-third of the fruit damage incurred on Roma VFN, NARC-1 and FS-8802. This result is in accordance with the Khanam et al. (2003) and Mishra et al. (1988). Numerous studies have also shown variation among the varieties for their susceptible/ resistant response towards the pest infestation (Sarfraz et al., 2007; Ashfaq et al., 2010). Influence of physical leaf characteristics on larval population and fruit infestation Significant variations were recorded for some physiomorphic leaf characteristics among tomato varieties (Table 2). Hair density and hair length on lower surface, and thickness of leaf lamina ranged from 49.8 to 23.7 per ½ cm2, 32.5 to 19.4 micron, and 6.1 to 4.9 micron, respectively. These values were higher for ‘Sahil’, ‘Pakit’, and Nova Mecb than others varieties. However, there were no differences between tomato varieties in hair density and hair length on upper leaf surface.

7746

Afr. J. Biotechnol.

Table 1. Comparison of average means of the data for 2008 and 2009 regarding larval population per 10 plants and the fruit-infestation (%), caused by the fruit-borer in various varieties of tomato.

Variety Roma VFN NARC-1 FS-8802 Tommy Pant Bahr Rio Grande Nova Mecb Pakit Sahil

Fruit infestation (%) 36.0a ab 32.0 29.3b 22.7c 20.3c 19.1c d 11.7 10.8d 10.7d

No. of larvae per 10 plant 5.7a a 5.7 5.6a 3.5b 3.5b 3.5b c 1.4 1.3c 1.3c

Means sharing same letter are not significantly different (P = 0.05).

Table 2. A comparison of means for the data on physio-morphic characteristics of the leaves between selected varieties of tomato. 2

Variety Roma VFN NARC-1 FS-8802 Mommy Pant Babr Rio Grande Nova Mecb Pakit Sahil

Hair density (no. per ½ cm ) Upper leaf Lower leaf 22.6ns 23.7h 23.2 25.8g 23.7 27.4f 24.0 33.9e 24.1 36.3d 24.1 37.2d 24.4 43.7c 24.4 47.0b 24.5 49.8a

Length of hair (µM) Upper leaf Lower leaf 12.9ns 19.4f 12.8 21.9e 12.7 23.7d 12.7 25.3c 12.7 26.0c 12.6 27.8b 12.6 31.7a 12.3 32.1a 12.1 32.5a

Thickness of Leaf Lamina (µM) 4.9c 4.9c 4.9c 5.3b 5.3b 5.5b 5.9a 6.0a 6.1a

Ns, Non-significant; means sharing similar letter are not significantly different (P = 0.05).

Table 3. The correlation coefficient (r) for different physical leaf characteristics, on the larval population of fruit borer and fruits infestation in tomato.

correlation coefficient (r) Larval population HDus HDls HLup HLls Tlf

Fruit Infestation 0.89** -0.22ns -0.96** ns 0.42 -0.95** -0.91**

Larval population -0.31ns -0.88** ns 0.33 -0.86** -0.87**

**, Significant at P≤0.01; *, significant at P≤0.05; ns, non-significant. HDus, Hair density on upper surface; HLup, hair length on upper surface; HDls, hair density on lower surface; HLls, hair length on lower surface; Tlf, thickness of leaf lamina.

Furthermore, the correlation coefficient values between physical leaf characteristics and fruit infestation and larval population are presented in Table 3. The hair density and

length of hair on the lower surface showed a significant negative correlation with the fruit-infestation and larval population, showing r-value of -0.96**, -0.88**; -0.95**

Ashfaq et al.

7747

Table 4. Stepwise regression model showing effect of different physical leaf character on larval population and fruit infestation.

R2

Regression equation Larval population Y = 10.6 - 0.19X1

0.77

Percentage fruit infestation Y = 57.2 - 0.99X1

0.92

X1, Hair density.

Table 5. A comparison of means for the data on chemical characteristics of the leaves of various selected varieties of tomato.

Chemical trait Total Minerals (%) Nitrogen (%) Phosphorous (%) Potassium (%) Calcium (%) Magnesium (%) Ferrous (%) Manganese (%) Zinc (%) Fat (%) Crude Fiber (%) Carbohydrate (%)

Roma VFN 7.40h a 2.73 0.36d 2.73e 0.33a 0.29ns 0.14c 0.39a 0.13ns d 2.60 16.27b 48.76c

NARC-1 FS-8802 7.47h 7.70g b bc 2.66 2.61 d 0.36 0.36d 2.79d 2.79d ab 0.22 0.22ab 0.28 0.28 0.15c 0.15c 0.38ab 0.37bc 0.13 0.12 c c 2.62 2.62 ab 16.45 16.50ab c 48.64 49.37b

Tomato Variety Tom-my Pant Babr Rio Grande Nova Mecb Pakit 7.98f 8.26e 8.32d 8.34c 8.53b cd cd cde cde de 2.59 2.58 2.57 2.55 2.54 cd cd bc bc 0.37 0.37 0.38 0.38 0.40b 2.80cd 2.82bcd 2.83abc 2.84ab 2.84ab abc abc bc c 0.21 0.21 0.21 0.20 0.20c 0.28 0.28 0.27 0.27 0.27 0.16bc 0.16bc 0.17ab 0.18a 0.18a 0.36cd 0.35de 0.35de 0.35de 0.33ef 0.12 0.12 0.12 0.12 0.11 b b ab ab a 2.64 2.64 2.65 2.66 2.67 ab ab a a 16.60 16.64 16.67 16.71 16.74a ab ab ab ab 49.55 49.58 49.58 49.64 49.68a

Sahil 8.62a e 2.52 0.43a 2.86a 0.18d 0.27 0.18a 0.33f 0.11 a 2.67 16.76a 49.71a

Ns, Non-significant; means sharing similar letter are not significantly different (P = 0.05).

and -0.86** respectively. These findings are in lined with the findings of Juvik et al. (1982), Selvanarayanan and Narayanasamy (2006) and Peter (1995). This may be due to the reason that exudates of trichomes interfere in larval feeding (Dimoch et al., 1983; Kennedy and Sorenson, 1985) and reduced larval weight (Sunitha et al., 2008). Thickness of leaf lamina is negatively correlated with fruit infestation (r = 0.91**) and larval population (r = -0.87**). Similar findings were also reported by Coley (1983) and Morrow (1983). According to Larsson and Ohmart (1988), tough leaves prohibit feeding of early larval instars and reduce their development (Clissold et al., 2006). Moreover, stepwise regression analysis indicated that hair density on lower surface explained 92.0 and 77.0% variation in fruit infestation and larval population respectively (Table 4). These can be used as marker trait to develop resistant varieties against tomato fruit worm. Influence of chemical traits on larval population and fruit infestation Nitrogen, calcium and manganese ranged from 2.52 to

2.73%, 0.18 to 0.33% and 0.33 to 0.39%, respectively, with values significantly lower in resistant varieties and higher in susceptible varieties. Contrarily, phosphorous and ferrous ranged from 0.43 to 0.36% and 0.18 to 0.14%, respectively and were higher in resistant varieties than in susceptible varieties (Table 5). According to Table 6, fruit infestation and larval population were positively correlated with nitrogen (r = 0.74**, 0.65**), calcium (r = 0.59**, 0.59**), magnesium (r = 0.44*, 0.49**), manganese (r = 0.75**, 0.72**) and zinc content (r = 0.57**, 0.49**). In contrast, phosphorous and ferrous was negatively correlated with fruit infestation (r = -0.43**, 0.81** respectively) and larval population (r = -0.46**, 0.73** respectively). Stepwise regression analysis indicated that ferrous and calcium explained 74.0 and 65.0% variation in fruit infestation and larval population, respectively (Table 7). Therefore, these can be selected as marker traits to develop resistant varieties against H. armigera in tomato crop. There are no available data on relation between H. armigera and chemical leaf characteristics investigated in this study; therefore, it is discussed with reference to other systems. Our study showed that high concentration of nitrogen, manganese and calcium increases fruit

7748

Afr. J. Biotechnol.

Table 6. Effect of chemical plant characteristics (%) on the larval population and infestation (%) of fruit borer on tomato crop.

Chemical factor Total Minerals Nitrogen Phosphorus Potassium Calcium Magnesium Ferrous Manganese Zinc Fat Crude fiber Carbohydrate

Larval population -0.07ns 0.65** -0.46* ns -0.31 0.59** 0.49** -0.73** 0.72** 0.49** ns -0.22 ns 0.03 ns -0.30

Fruit infestation (%) -0.11ns 0.74** -0.43 * ns -0.20 0.59** 0.44 * -0.81** 0.75** 0.57** ns -0.07 -0.00ns ns -0.36

**, Significant at P≤0.01; *, significant at P≤0.05; ns, non-significant.

Table 7. Stepwise regression model showing effect of different chemical leaf characteristics on larval population and fruit infestation.

R2

Regression equation Larval population Y = 4.4 - 72.8X1 + 52.0X2

0.65

Percentage Fruit Infestation Y = 38.6 - 392.1X1 + 219.9X2

0.74

2+

X1, Ferrous (Fe ); X2, calcium.

infestation and larval population density. This is similar to findings of Grafton-Cardwell and Ouyang (1996) who stated that high concentration of nitrogen and manganese increases the reproduction of predaceous mite, and Khaliq et al. (2001) who reports the similar kind of relationship between calcium and Chilo partellus (Swinhoe) infestation. Moreover, the decrease of concentration of zinc (Phelan et al., 1995) and magnesium (McKinnon et al., 1999) decreases the pest’s oviposition. This supports the findings of our present study that fruit infestation and larval population can be decreased with the decrease in concentration of zinc and magnesium. Marketable fruit-yield of tomato An analysis of variance revealed a significant difference in the yield among the varieties at P>-0.01 (Figure 1). The variety, Sahil, which showed a resistant trend against the fruit-borer, showed a maximum fruit-yield of 99.56 kg/plot. The variety, Roma VFN, showing a susceptible trend, against the fruit-borer, had a minimum yield of 39.50 kg/plot. Generally, varieties Sahil, Pakit and Nova

Mecb provide higher fruit yield than others. These results are similar to findings of Heinrichs (1994) who reports that resistant varieties show high yield response. Effect of the larval population and infestation of the fruit borer on the yield of tomato Table 8 shows the results regarding the effect of larval population and infestation on the yield of tomato. The larval-population and fruits infestation exerted a significant and negative effect on the fruit-yield, with r-values of -0.81** and -0.86**, respectively, and this was in line with findings of Phillips et al. (1979). Our results clearly suggest that resistant varieties’, having less fruit infestation than susceptible varieties, is due to physical and chemical leaf characteristics. Conclusion The presented study indicates that morphological characteristics such as leaf hair density, and chemical traits

Ashfaq et al.

7749

Yield (kg/plot) 120

a

Yield (kg/plot)

100

a

a

80

60

c

c

bc

b

bc

bc

40

20

0 Roma VFN

NARC-1

FS-8802

Mommy

Pant Babr

Rio Grande Nova Mecb

Pakit

Sahil

Genotypes Figure 1. Marketable fruit-yield of different tomato varieties.

Table 8. Effect of the larval population and fruit infestation on the yield of tomato.

Independent factor Larval population Fruit infestation (%)

Yield (kg/plot) r = -0.81 ** r = -0.86 **

**, Significant at P ≤ 0.01.

like iron and calcium concentration, can be used as maker traits to develop insect resistant varieties of tomato through breeding programs. Further research is needed to study the physical and chemical characteristics of tomato fruit in relation to H. armigera and its natural enemies, so that combination of host plant resistance and biological control can be used to attain maximum yield. Acknowledgement We are grateful to the Chairman, Dr. Muhammad Inayat Khan, Department of Mathematics & Statistics for guiding the statistical analysis of this study. REFERENCES Ahmad F, Mohsin MD (1969). Control of cotton boll worm. Heliothis armigera_ (Hb.) by air in Multan District of West Pakistan. International Pest Control Nov. /Dec. Anonymous (2007). Agriculture statistics of Pakistan 2005-06. Government of Pakistan, Ministry of Food, Agriculture and Livestock. Food, Agri. and Livestock Div. (Economic Wing) Islamabad. pp. 84-

85. Ashfaq M, Noor ul Ane M, Zia K, Nasreen A, Mansoor-ul-Hasan (2010). The correlation of abiotic factors and physio-morphic characteristics of (Bacillus thuringiensis) BT transgenic cotton with whitefly, Bemisia tabaci (Homoptera: Aleyrodidae) and jassid, Amrasca devastans (Homoptera: Jassidae) populations. Afr. J. Agric. Res. 5: 3102-3107. Clissold F, Sanson GD, Read J (2006). The paradoxical effects of nutrient ratios and supply rates on an outbreaking insect herbivore, the Australian plague locust. J. Anim. Ecol. 75: 1000-1013. Coley PD (1983). Herbivory and defensive characteristics of tree species in a lowland tropical forest. Ecol. Monog. 53: 209-233. Dhillon MK, Singh R, Naresh JS, Sharma NK (2005). The influence of physico-chemical traits of bitter gourd, Momordica charantia L. on larval density and resistance to melon fruit fly, Bactrocera cucurbitae (Coquillett). J. Appl. Entomol. 129: 393-399. Dimoch MB, Kennedy GG (1983). The role of glandular trichomes in the resistance of Lycopersicum hirsutum f. glabratum to Heliothis zea. Entomol. Exp. Appl. 33: 263-268. Grafton-Cardwell E, Ouyang Y (1996). Influence of citrus leaf nutrition on survivorship, sex ratio, and reproduction of Euseius tularensis (Acari: Phytoseidae). Environ. Entomol. 25: 1020-1025. Hartz T, Miyao G, Mickler J, Lestrange M, Stoddard S, Nunez J (2008). Processing tomato production in California. University of California Repository, ANR Publication [Cited 10 Sept 2009.] Available from URL: http:// ucanr.org/freepubs/docs/7228.pdf. 7228: p. 5. Heinrichs EA (1994). Development of Multiple Pest Resistant Crop Cultivarsl. J. Agric. Entomol. 11(3): 225-253 Jallow MFA (1998). Host-plant selection and use by Helicoverpa

7750

Afr. J. Biotechnol.

armigera (Hübner) (Lepidoptera: Noctuidae): Individual variation within and among populations. Aust. J. Ecol. 23: 187-188. Jallow MFA, Cunningham JP, Zalucki MP (2004). Intra-specific variation for host plant use in Helicoverpa armigera (Hubner) (Lepidoptera: Noctuidae): implications for management. Crop Prot. 23: 955-964. Juvik JA, Berlinger MJ, Ben David T, Rudich J, David T (1982). Resistance among accessions of the genera Lycopersicon and Solanum to four of the main pests of tomato in Israel. Phytoparasitica, 10: 145-146. Kennedy GG (1984). 2-Tridecanone, tomatoes and Heliothis zea. Potential incompatibility of plant antibiosis with insecticidal control. Entomol. Exp. Appl. 35: 305-311. Kennedy GG, Sorenson CF (1985). Role of glandular trichomes in the resistance of Lycopersicon hirsutum f. glabratum to Colorado potato beetle (Coleoptera: Chrysomelidae). J. Econ. Entomol. 8: 547-551. Khaliq A, Ashfaq M, Akram, W, CHOI JK, Jong-Jin L (2001). Effect of Plant Factors, Sugar Contents, and Control Methods on the Top Borer (Scirpophaga nivella F.) Infestation in Selected Varieties of Sugarcane. Entomol. Res. 5: 153-160. Khanam UKS, Hossain M, Ahmad N, Uddin MM, Hussain MS (2003). Varietal screening of Tomato to Tomato Fruit Borer, Helicoverpa armigera (Hub.) and Associated Tomato Plant Characters. Pak. J. Biol. Sci. 6(4): 413-412. Larsson S, Ohmart CP (1988). Leaf age and larval performance of the leaf beetle Paropsis atomaria. Environ. Entomol. 13: 19-24. Latif M, Ahecr GM, Saeed M (1997). Quantitative losses in tomato fruits by Heliothis armigera Hb. Abstr. PM-9. Third Intern Congr Entomol Sci., by Pakistan Entomol. Society held during March 18-20, 1997 at NARC, Islamabad. Liu Z, Li D, Gong P, Wu K (2004). Life table studies of the cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae), on different host plants. Environ. Entomol. 33: 1570-1576. Shelomi M, Perkins LE, Cribb BW, Zalucki MP (2010). Effects of leaf surfaces on first-instar Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) behaviouraen_7. Aust J. Entomol. 49: 289-295. McKinnon ML, Quiring DT, Bauce E (1999). Influence of tree growth rate, shoot size and foliar chemistry on the abundance and performance of a galling adelgid. Funct. Ecol. 13: 859-867. Mishra PN, Singh YV, Nautiyal MC (1988). Screening of brinjal varieties for resistance to shoot and fruit borer, Leucinodes orbonalis Guen. (Lepidoptera: Pyralidae). South Ind. Hort. 36: 182-88. Morrow PA (1983). The role of sclerophyllous leaves in determining insect grazing damage. In Kruger FJ, Mitchell DT, Jarvis JUM [eds.], Mediterranean-type ecosystems-the role of nutrients. SpringerVerlag, Berlin, Germany, pp. 509-524.

O’Connor BP (2000). SPSS and SAS programs for determining the number of components using parallel analysis and Velicer’s MAP test, Behavior Res. Methods Instrum. Comput. 32: 396-402. Perkins LE, Cribb BW, Hanan J, Glaze E, Beveridge C, Zalucki MP (2009). Where to from here? The mechanisms enabling the movement of first instar caterpillars on whole plants using Helicoverpa armigera (Hübner). Arthropod-Plant Interactions, 2: 197207. Peter JA (1995). Pigeonpea trichomes a promising source for pod borer resistance. IPM and IRM News Letter for Legume Crops in Asia. 2: 45. Phelan PL, Mason JF, Stinner RF (1995). Soil-fertility management and host preference by European corn borer, Ostrinia nubilalis. Agric. Ecosyst. Environ. 56: 1-8. Phillips JR, Clower DF, Hopkins AR, Pfrimmer TR (1979). Economic thresholds of Heliothis species on indeterminate cottons, In Economic thresholds and sampling of Heliothis Species on cotton, corn, soybeans and other host crops. South. Coop. Ser. Bull. 231: 44-49. Sarfraz M, Dosdall LM, Keddie BA (2007). Resistance of some cultivated Brassicaceae to infestations by Plutella xylostella (Lepidoptera: Plutellidae). J. Econ. Entomol. 100: 215-224. Selvanarayanan V, Narayanasamy P (2006). Factors of resistance in tomato accessions against the fruit worm, Helicoverpa armigera (Hubner). Crop Prot. 25: 1075-1079. Simmons AT, Gurr GM, McGrath D, Martin PM, Nicol HI (2004). Entrapment of Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) on glandular trichomes of Lycopersicon species. Aust. J. Entomol. 43: 196-200. Sunitha V, Rao1 GVR, Lakshmi KV, Saxena KB, Rao VR, Reddy YVR (2008). Morphological and biochemical factors associated with resistance to Maruca vitrata (Lepidoptera: Pyralidae) in short-duration pigeonpea. Int. J. Trop. Insect Sci. 28: 45-52.

African Journal of Biotechnology Vol. 11(30), pp. 7751-7755, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.002 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Bacterial content in the intestine of frozen common carp Cyprinus carpio Ahmed H. Al-Harbi* and Md. Naim Uddin Natural Resources and Environment Research Institute, King Abdulaziz City for Science and Technology, Riyadh, Saudi Arabia. Accepted 23 February, 2012

The quantitative and qualitative analyses of bacterial flora associated with the intestine of common carp Cyprinus carpio in fresh and frozen storage conditions for 16 months was determined. Aerobic plate counts (APC) ranged from 1.8 ± 2.7 × 109 to 1.1 ± 2.9 x 104 colony forming unit (CFU) g-1, 2.0 ± 2.1 x 1010 to 6.1 ± 1.4 x 104 CFU g-1, and 1.3 ± 3.2 x 1010 to 4.3 ± 3.3 x 104 CFU g-1 each of 3 storage tank, respectively from the intestine of common carp in fresh and frozen storage. The APC decreased c. 3log cycles after 1 month storage and then counts declined more slowly during frozen storage over 16 months. In total, 14 bacterial genera with 18 species were identified. Gram-negative rods bacteria (77%) dominated the population. Aeromonas hydrophila, Aeromonas sp., Bacillus sp., Enterobacter sp., Micrococcus sp., Photobacterium damselae, Serratia liquefaciens, Shewanella putrefaciens, Staphylococcus sp., Streptococcus sp. and Vibrio sp. survived after prolonged freezing. Two bacterial species viz. Shewanella putrefaciens and Aeromonas hydrophila were dominant with a prevalence of > 10% both in fresh and frozen fish. S. putrefaciens was the dominant bacteria (19% of the total isolates) throughout the period of study. Key words: Bacterial enumeration, species composition, intestine, frozen common carp. INTRODUCTION Dense microbial populations occur within the intestinal content, with numbers of bacteria much higher than those in the surrounding water, indicating that the intestines provide favorable ecological niches for these organisms (Austin and Austin, 1999). For high quality fresh fish, the number of bacteria present on the surface varies from 3 to 4 log10 CFU g-1. Counts are normally one or two orders of magnitude higher in the gills and intestinal counts can reach 9 log10 CFU g-1 (Sikorski, 1990). Microbiological quality of fresh and frozen fish can be assessed using several criteria (Kramer and Liston, 1987). Some seafood processors specify a 2-class plan for the acceptance of frozen fish, where APC should not be higher than 5 log10 -1 CFU g (Elliot, 1987). For fish, ICMSF (1986) proposed microbiological lower

*Corresponding author. E-mail: aalharbi@kacst.edu.sa. Tel: +966 1 4813605. Fax: +966-1-481 3638.

(m) and maximum (M) limits of aerobic plate counts at 30°C as 5x105 (5.69 log) and 107 (7 log) CFU g-1 or cm-2 respectively. Aeromonas hydrophila, Shewanella putrefaciens, Vibrio spp., Corynebacterium urealyticum, Staphylococcus sp. and Streptococcus sp. were the major bacteria in the intestine of common carp (Al-Harbi and Uddin, 2008). Cahill (1990) reported the presence of A. hydrophila, Flavobacterium sp., Pseudomonas sp. and Vibrio sp. in common carp. Contamination of edible portions of fish may originate from gastrointestinal sources. The shelf-life of raw fish depends on the storage conditions, the intrinsic factors, and the qualitative and quantitative composition of the initial microflora, related to the environment where the fish live and are caught, the season, the fishing method and the early conditions of handling (Ward, 1988). Freezing is one method of preserving fish for long periods and frozen fish have become an important commodity both for domestic and export markets in a number of countries. The duration of bacterial viability in frozen fish tissues or the length of

7752

Afr. J. Biotechnol.

time tissues can remain frozen and still yield viable bacteria; upon partial thawing is an area warranting further study. In local markets, storage of frozen common carp without evisceration is most common. The quality of fish can be measured by bacterial numbers in fish organs, as these affect the storage life and fish product quality. Despite the number of surveys on the microbiology of fish, there have been few studies on frozen fish. Limited information on microbiological conditions of fish during frozen storage in Saudi Arabia led to this research. Scientific knowledge on quality changes in fish during freezing and subsequent frozen storage will provide a basis for supplying good quality fish. The objective of this research study was to evaluate quantitative and qualitative bacteriological results from the analysis of the intestine of both fresh and frozen common carp. MATERIALS AND METHODS Fish Four hundred and fifty of common carp Cyprinus carpio weighing between 700 to 1100 g were collected from three 10 m2 (3.8 x 2.64 x 1.2 m) outdoor aerated concrete tanks (150 fish from each tank). The tanks water level was 1 m, and about 20% of the tanks water was exchanged daily with fresh water (ground water) to maintain good water quality. The fish for all the three tanks were fed daily with a tilapia pelleted feed (34% crude protein) at the rate of 3% of body weight. The water temperature was 30°C.

whole intestines to standardize the sampling. Around 2 g of homogenate was suspended to a bottle containing 25 ml of sterile (121°C, 15 min) 0.85% (w/v) NaCl prepared in de-ionized water. One milliter (1 ml) of the suspension was serially diluted to 10-9. Volumes (0.1 ml) of the dilutions were spread onto tryptone soya agar plates (TSA, Oxoid, UK) in duplicate.

Total viable count (TVC) Total aerobic heterotrophic bacterial counts of common carp intestine were determined by incubation of all the inoculated plates at 25°C for 48 h and colony forming units (CFU) were counted with a Quebec Darkfield Colony Counter (Leica, Inc., Buffalo, New York) equipped with a guide plate ruled in square centimeters. The plates having ≥ 30 to 300 colonies were used to calculate bacterial population numbers, expressed as CFU.

Isolation of bacteria Bacterial isolates were recovered from the intestine of fresh and frozen common carp. To determine the percent composition of bacteria types in the samples, we divided the bacterial colonies into different groups according to colony characteristics (shape, size, elevation, structure, surface, age, color, and opacity), and counted the number of colonies of each recognizable type. With some exceptions, 3 to 5 representatives of each colony type were then streaked on TSA plate repeatedly until pure cultures were obtained. Around 2% of primary isolates failed to grow despite repeated attempts on subsequent sub-culturing. Purified cultures were inoculated onto TSA slants and kept at 4°C for stock; these were sub-cultured on slants every 6 weeks.

Identification of bacteria Bacteriological sampling and analyses Three samplings, one in each tank were done simultaneously to harvest the fish by hand net for microbial investigations of common carp intestine for fresh and frozen conditions. Immediately after catch, 16 sample bags of each of the 3 tanks, a total of 48 bags and each containing 9 representatives (size, condition, sex etc.) fish were preserved in a freezer at -20 ± 1°C for frozen sampling from May, 2005 to August, 2006. Samples were tested monthly for quantitative bacterial analyses and every four months for qualitative analyses. One bag of frozen fish was randomly taken from each unit and microbial quality determined.

To identify the selected bacterial isolates to genus or species level, the purified isolates were observed for cell shape, motility, flagellation, spores, encapsulation, and Gram staining. The isolates were then subjected to biochemical tests (oxidase, catalase, amylase, gelatinase, lipase, indole, H2S production and nitrate reduction) following the criteria described in the Bergey’s Manual of Determinative Bacteriology (Holt et al., 1994). The presumptive vibrio species were confirmed by their growth in different concentrations of NaCl, thiosulphate-citrate-bile sucrose (TCBS) agar (Oxoid) and by their sensitivity to the vibriostatic agent (0/129) (Oxoid). In parallel, the commercial API 20E, API 20 STREP, (bioMerieux, France) and Biolog (biolog, Hayward, CA, USA) methods were also used.

Common carp intestine Microbial examination of fresh fish was done initially at the beginning of the storage period (fresh) and at 4, 8, 12, and 16 months following storage at -20 ± 1°C. From each of the 3 tanks, 15 representative fish (three replicates, three x five sample times in each tank) were used. They were killed by physical destruction of the brain. At each sample time, 9 fish collected from each of 3 tanks (three fish in each replication) were used for bacteriological tests. Frozen fish were thawed at room temperature (c. 1 to 2 h) until it was soft enough to take out the intestine. The number of incidental organisms was reduced by washing the fish skin with 70% ethanol before opening the ventral surface with sterile scissors to expose the body cavity. Around 5 g of intestine from sampled fish was taken aseptically, mixed, and homogenized in a mortar. Intestines were taken from three (interior, mid and posterior) parts of the

RESULTS Quantitative bacterial flora Quantitative results of APC in common carp intestine at fresh and different storage conditions for 16 months are summarized in Table 1. APC decreased from 1.8 ± 2.7 x 109 to 1.1 ± 2.9 x 104 CFU g-1, 2.0 ± 2.1 x 1010 to 6.1 ± 4 -1 10 4 1.4 x 10 CFU g , and 1.3 ± 3.2 x 10 to 4.3 ± 3.3 x 10 -1 CFU g in the intestine of common carp collected from tank 1, tank 2, and tank 3 respectively during the period of study. For all groups of fish, APC decreased c. 3-log

Al-Harbi and Uddin

7753

Table 1. Counts of bacteria in the intestine of Cyprinus carpio in fresh and frozen storage conditions for 16 months.

Month frozen (CFU g-1) 7th 8th 9th 10th

Tank number

Fresh intestine CFU g-1

1

1.8x10 (2.7)

5.2x10 (3.4)

1.3x10 (2.8)

5.8x10 (3.8)

8.3x10 (1.4)

3.2x10 (2.4)

1.9x10 (3.6)

2.2x10 (4.0)

3.4x10 (3.1)

2.0x10 (1.7)

5.5x10 (3.1)

1.9x10 (2.2)

8.0x10 (2.9)

1.8x10 (2.5)

3.2x10 (3.7)

5.3x10 (3.1)

1.1x10 (2.9)

2

2.0x1010 (2.1)

1.0x107 (2.1)

4.8x106 (2.7)

2.1x106 (2.6)

2.7x106 (3.4)

1.0x106 (2.2)

4.2x106 (1.9)

1.4x106 (2.5)

8.9x105 (2.0)

1.5x105 (1.0)

6.1x104 (1.4)

1.1x105 (2.3)

1.2x105 (0.9)

7.9x104 (1.7)

8.1x104 (3.5)

6.4x104 (2.8)

2.3x105 (4.1)

3

1.3x1010 (3.2)

1.3x107 (2.9)

6.2x106 (3.3)

3.1x106 (3.0)

1.3x106 (2.0)

1.4x106 (2.8)

7.5x105 (2.7)

6.8x105 (1.6)

1.1x106 (1.8)

6.6x105 (2.3)

3.7x105 (3.5)

7.2x105 (3.8)

4.3x104 (3.3)

3.6x105 (2.4)

8.9x104 (4.2)

1.1x105 (3.9)

6.7x104 (2.5)

9

1st

3rd

2nd 6

6

4th 5

5th 5

6th 5

5

5

5

5

11th 4

12th 5

13th 4

14th 4

15th 4

16th 4

4

Parentheses indicate SD.

cycles after 1 month frozen storage; thereafter, counts slowly declined during frozen storage. Each count was the mean value of viable colonies that appeared in duplicate agar plates for each sample. Analysis of variance of the regressions showed no statistically signifi-cant difference between the tanks in the slopes with a common regression co-efficient of -0.129, but there was a significant difference in intercepts. The data for tanks 2 and 3 were not significantly different from each other with a mean value of 6.83, but that for tank 1 at 6.27 was significantly different from the other two. But the reasons were not clear. Qualitative bacterial flora Bacterial isolates recovered from the intestine of fresh and frozen common carp were identified to

genus or species level. Their percentage distribution (Table 2) is given as the mean bacterial flora of 3 tanks because in all the tanks and data obtained from each was very similar. Table 2 reports the isolation frequency of the recognized bacterial groups at fresh and different storage times. There were wide variations in the types of bacteria taken at different sampling times. Bacteria identified in this study were predominantly Gramnegative rods (77%). In total, 14 bacterial genera and 18 species were identified from the intestine of common carp. For fresh and frozen conditions, two bacterial species viz. S. putrefaciens, and A. hydrophila were the dominant bacteria with a prevalence of > 10% at all time. S. putrefaciens was the most dominant organisms (19% of the total isolates). Out of 18 species of bacteria 11 survived 16 months frozen storage. Pseudomonas fluorescens, Vibrio alginolyticus, and Vibrio

vulnificus were not recovered after 12 months frozen storage while after 16 months, Cellulomonus sp., Corynebacterium urealyticum, Escherichia coli, and Pseudomonas sp. were not found. DISCUSSION In this trial, bacterial load in common carp intestine varied in fresh and frozen conditions. The APC for all the groups of fish decreased c. 3log cycles after 1 month frozen storage and c. 5logs after 16 months. Al-Harbi and Uddin (2005) observed that the APC decreased c. 2-log cycles in frozen tilapia after 1 month storage and c. 3logs after 1 year. According to Suvanich et al. 7 5 -1 (2000), APC decreased from c. 10 to 10 CFU g after 2 months frozen storage of channel catfish

7754

Afr. J. Biotechnol.

Table 2. Composition and percentage distribution of bacteria in the intestine of Cyprinus carpio in fresh and frozen storage conditions at 4 month intervals for 16 months.

Bacteria Aeromonas hydrophila Aeromonas sp. Bacillus sp. Cellulomonus sp. Corynebacterium urealyticum Enterobacter sp. Escherichia coli Micrococcus sp. Photobacterium damselae Pseudomonas fluorescens Pseudomonas sp. Serratia liquefaciens Shewanella putrefaciens Staphylococcus sp. Streptococcus sp. Vibrio alginolyticus Vibrio sp. Vibrio vulnificus Unidentified Gram-negative rods

Fresh intestine Number % 38 18.18 12 5.74 4 1.91 0 0 7 3.35 8 3.83 9 4.31 6 2.87 4 1.91 3 1.44 10 4.79 4 1.91 39 18.66 5 2.39 9 4.31 12 5.74 17 8.13 15 7.18 7 3.35

frame mince and then remained nearly unchanged. The initial killing rate of microorganism during freezing is rapid then followed by a gradual reduction (Frazier and Westhoff 1990). This research appears closer to our work due to similar observation in the decrease of viable microorganisms with the frozen storage period of common carp. Throughout the period studied in this trial, Gram-negative rods in particular two bacterial species viz. S. putrefaciens, and A. hydrophila dominated the bacterial flora with a prevalence of > 10% as shown in Table 2. In

4 month frozen Number % 17 11.26 9 5.96 6 3.97 2 1.33 8 5.30 10 6.62 5 3.31 7 4.64 5 3.31 4 2.65 6 3.97 7 4.64 20 13.25 8 5.30 11 7.29 4 2.65 9 5.96 5 3.31 8 5.30

8 month frozen Number % 14 10.45 8 5.97 2 1.49 4 2.99 5 3.73 11 8.21 4 2.99 6 4.48 7 5.22 2 1.49 6 4.48 3 2.24 24 17.91 6 4.48 5 3.73 4 2.99 9 6.72 4 2.99 10 7.46

another study, S. putrefaciens, Coryne. urealyticum, A. hydrophila, and Flavobacterium sp. were the dominant bacteria with a prevalence of c. 10% in tilapia frozen for 1 year (Al-Harbi and Uddin, 2005). Streptococcus agalactiae was recovered from frozen tilapia after 6 months storage (Evans et al., 2004). Recovery and revival of different types of bacteria from frozen common carp after prolonged freezing in the present study supports the idea that frozen fish is a viable alternative to fresh fish for microbiological sampling in instances when fresh, healthy or moribund fish are unavailable or impractical

12 month frozen Number % 17 10.18 9 5.39 4 2.40 5 2.99 10 5.99 13 7.78 14 8.38 4 2.40 9 5.39 0 0 4 2.40 2 1.20 41 24.55 12 7.19 10 5.99 0 0 7 4.19 0 0 6 3.59

16 month frozen Number % 13 10.66 7 5.74 3 2.46 0 0 0 0 14 11.48 0 0 4 3.28 3 2.46 0 0 0 0 8 6.56 23 18.85 8 6.56 16 13.11 0 0 12 9.84 0 0 11 9.02

(Evans et al., 2004). Brady and Vinitnantharat (1990) found viable pathogenic Gram negative bacteria could be recovered from channel catfish Ictalurus punctatus frozen at -20°C for over 20 days. The high prevalence of S. putrefaciens, Aeromonas spp., Vibrio spp., Enterobacter sp., Streptococcus sp., and Staphylococcus sp. in this study suggests that these bacteria may be common in the intestine of carp. S. putrefaciens is considered as one of the main spoilage bacteria in fish (Gennary et al., 1999). Jørgensen and Huss (1989) characterized S. putrefaciens cultures in order to examine the spoilage activity and found a

Al-Harbi and Uddin

good correlation between bacterial counts, detection time in conductance measurements and production of trimethylamine and off-odour. López-Caballero et al. (2001) also reported a correlation between the highest microbial counts (>9 log cfu/ml) of S. putrefaciens and TMA concentrations (45 mg N- TMA/100 ml), and strong putrid off-odours. S. putrefaciens and Pseudomonas spp. are the specific spoilage bacteria of iced fresh fish regardless of the origin of the fish (Gram and Huss, 1996). P. fluorescens is an important odour producer and the most frequently isolated proteolytic species (Edwards et al., 1987). Although, S. putrefaciens counts alone are not a sufficient predictor of shelf-life, they can be used as a quality determinant of fish. Although the numbers of food-borne outbreaks caused by Aeromonas spp. are low (Altwegg et al., 1991; Krovacek et al., 1992), the presence of Aeromonas spp. in the food chain should not be ignored. A. hydrophila have been recovered in other studies on frozen fish (Figueras et al., 2000, CastroEscarpulli et al., 2003) and the significance of the bacteria isolated varies. The bacteria isolated included S. putrefaciens, A. hydrophila, Enterobacter sp., Streptococcus sp., Staphylococcus sp., E. coli, V. vulnificus, and P. fluorescens which are facultative pathogens or agents of food poisoning and spoilage. Shannon (1986) reported the presence of pathogenic Bacillus cereus, E. coli, Staphylococcus aureus and V. cholerae in catfish. The vibrios can cause different types of disease and are transmitted through foods and through cross-contamination during handling and processing of foods. Al-Harbi (2003) reported significant coliform bacteria including E. coli in fish ponds. Note that in the present study, E. coli could not be recovered after 16 months frozen storage. This research helps understand the quality of fish during frozen storage. During processing and handling of fish products, the presence of pathogenic bacteria is of concern to fish processors. ACKNOWLEDGMENT The authors are grateful to King Abdulaziz City for Science and Technology (KACST), KSA for research support. REFERENCES Al-Harbi AH (2003). Faecal coliforms in pond water, sediments and hybrid tilapia (Oreochromis niloticus x O. aureus) in Saudi Arabia. Aquacult. Res. (34): 517-524. Al-Harbi AH, Uddin MN (2005). Microbiological quality changes in the intestine of hybrid tilapia (Oreochromis niloticus x O. aureus) in fresh and frozen storage condition. Lett. Appl. Microbiol. (40): 486-490. Al-Harbi AH, Uddin MN (2008). Aerobic bacterial flora of common carp (Cyprinus carpio L) cultured in earthen ponds in Saudi Arabia. J. Appl. Aquacult. (20): 108-119.

7755

Altwegg M, Martinetti Lucchini G, Luthi-Hottenstein J, Rohrbach M (1991). Aeromonas associated gastroenteritis after consumption of contaminated shrimp. Eur. J. Clin. Microbiol. Infect. Dis. (10): 44-45. Austin B, Austin DA (1999). Bacterial fish pathogens: Disease of farmed and wild fish. 3rd edn. Springer –praxis, London, p. 457 Brady YL, Vinitnantharat S (1990). Viability of bacterial pathogens in frozen fish. J. Aquat. Anim. Health, (2): 149-150. Cahill MM (1990). Bacterial flora of fishes: a review. Microb. Ecol. (19): 21-41. Castro-Escarpulli G, Figueras MJ, Aguilera-Arreola G, Solar L, Fernandez-Rendon E, Aparicio GO, Guarro G, Chacon MR (2003). Characterization of Aeromonas spp. isolated from frozen fish intended for human consumption in Mexico. Int. J. Food Microbiol. (84): 41-49. Edwards RA, Dainty RH, Hibbard CM (1987). Volatile compounds produced by meat pseudomonads and related reference strains during growth on beef stored in air at chilled temperature. J. Appl. Bacteriol. (62): 403-412. Elliot EL (1987). Microbiological quality of Alaska pollack surumi. In Seafood quality determination ed. Kramar DE. and Liston, New York: Elsevier Science Publishing, J. pp. 269-281. Evans JJ, Wiedenmayer AA, Klesius PH, Shoemaker CA (2004). Survival of Streptococcus agalactiae from frozen fish following natural and experimental infections. Aquaculture, (233): 15-21. Figueras MJ, Soler L, Chacon MR, Guarro J, Martinez-Murcia AJ (2000). Extended method for discrimination of Aeromonas spp. By 16S rDNA-RFLP analysis. Int. J. Syst. Evol. Microbiol. (50): 20692073. rd Frazier WC, Westhoff DC (1990). Food Microbiology (3 ed. Tata McGraw Hill Publishing Co. Ltd. New Delhi.) p. 247. Gennary M, Tomaselli S, Cotrona V (1999). The microflora of fresh and spoiled sardines (Sardina pilchardus) caught in Adriatic (Mediterranean) Sea and stored in ice. Food Microbiol. (16): 15-28. Gram L, Huss HH (1996). Microbiological spoilage of fish and fish products. Int. J. Food Microbiol. (33): 121-137. Holt JG, Krieg NR, Sneath PHA, Williams ST (ed.) (1994). Bergey's th manual of determinative bacteriology, 9 edn. Williams and Wilkins, Baltimore. International Commission on Microbiological Specifications for Foods (ICMSF). (1986). Microorganisms in foods, 2: sampling for nd microbiological analysis: principles and specific applications, 2 ed. Black-well Scientific Publications, London. Jørgensen BR, Huss HH (1989). Growth and activity of Shewanella putrefaciens isolated from spoiling fish. Int. J. Food Microbiol. (9): 51-62. Kramer DE, Liston J (1987). Seafood quality determination. New York: Elsevier Science Publishing, p.677. Krovacek K, Faris A, Baloda SB, Peterz M, Lindberg T, Mansson I (1992). Prevalence and characterization of Aeromonas spp. isolated from foods in Uppsala, Sweden. Food Microbiol. (9): 29-36. López-Caballero ME, Sánchez-Fernández JA, Moral A (2001). Growth and metabolic activity of Shewanella putrefaciens maintained under different CO2 and O2 concentrations. Int. J. Food Microbiol. (3): 277287. Shannon CW (1986). Pathogenic microorganisms: a menace to the th food industry. In proceedings of the 15 annual catfish processing workshop Mississippi, USA, Mississippi State University. p. 13. Sikorski ZE (1990). Seafood: Resources, nutritional composition and preservation. Boca Raton, Fla.: CRC press Inc. p. 248 Suvanich V, Marshall DL, Jahncke ML (2000). Microbiological and color quality changes of channel catfish frame mince during chilled and frozen storage. J. Food Sci. (65): 151-154. Ward DR, Baj NJ (1988). Factors affecting microbiological quality of seafood. Food Technol. (3): 85-89.

African Journal of Biotechnology Vol. 11(30), pp. 7756-7765, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3273 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Generation and characterization of a stable red fluorescent transgenic Tanichthys albonubes line Qing Jian, Min Chen, Jun-jie Bai*, Peng Jiang, Jia-jia Fan, Xing Ye and Shi-ling Xia Key Laboratory of Tropical and Subtropical Fishery Resource Application and Cultivation, Ministry of Agriculture, Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, Guangdong 510380, China. Accepted 16 March, 2012

White cloud mountain minnow (Tanichthys albonubes) is a small cyprinid oviparous fresh-water fish in Southern China. For ornamental purpose, the red fluorescent protein (RFP) transgenic T. albonubes was generated by microinjection of a pMYLZ2-RFP gene construct containing zebrafish myosin light polypeptide 2 (mylz2) promoter into the fertilized eggs, and a transgenic line was established. For this line, segregation of RFP gene followed Mendelian single-gene inheritance, confirming transgene integration into the T. albonubes genome at a single locus. Results of reverse transcriptase-polymerase chain reaction (RT-PCR) analyses showed that RFP transgene was expressed in almost all body tissues, revealing an ectopic transgene expression. Based on ordinary and quantitative PCR analyses, integration pattern of RFP gene was determined to be three copies and head-to-tail multimers. An approximately 1.0 kb fragment amplified from 5'-flanking sequence of transgenes was identified in wildtype T. albonubes genome, and bears no homologous sequence in the GenBank database. In the 3'flanking region, an approximately 1.2 kb fragment with unidentified source was amplified which has 99% homology to enterobacteria phage P1. The above results well demonstrated the pMYLZ2-RFP constructs have being inserted as a stable DNA fragment in the T. albonubes genome and could be stably inherited and expressed in transgenic progenies. Key words: Transgenic fish, Tanichthys albonubes, RFP, expression, flanking sequence, copy number. INTRODUCTION Fluorescent proteins originally isolated from marine invertebrates are widely used as noninvasive probes for cell and molecular biology (Matz et al., 1999; Stewart, 2006). In recent years, researchers opened up their novel application for ornamental fish by transgenic technology, such as the fluorescent transgenic zebrafish (Danio rerio) and Japanese medaka (Oryzias latipes) (Gong et al., 2003; Kinoshita, 2004). This novel application benefits from the expression of fluorescent proteins in a wide range of cell types without apparent toxic effects and the vivid fluorescent colors that are readily visible to unaided eyes (Liu et al., 1999; Shaner et al., 2004).Tanichthys albonubes, “white cloud mountain minnow”, is a small cyprinid oviparous fresh-water fish in Southern China

*Corresponding author. E-mail: baijj2005@21cn.com. Tel: +86 20 81616129. Fax: +86 20 81616162.

(Liang et al., 2008), which have been cultured around the world as a popular aquarium fish (Yi et al., 2004). To develop new varieties of ornamental fish, our laboratory generated the red fluorescent protein (RFP) transgenic T. albonubes by microinjecting fertilized eggs with RFP gene under the control of zebrafish myosin light polypeptide 2 (mylz2) promoter. Germ-line transmitted transgenic T. albonubes was obtained, which displays a visible red fluorescent color instead of the original body color of wild-type fish. To date, microinjection is still the most common method used for gene transfer in fish (Zbikowska, 2003). However, this classical transgenic approach is linked to the random and uncontrolled integration of transgenes into the host genome (Sin, 1997). The integration behavior would inevitably disrupt the neighboring sequences and may be accompanied by some mutations (Tzfira et al., 2004; Wilson et al., 2006). In addition, the introduced foreign DNA can be modified in many ways

Jian et al.

7757

Figure 1. Plasmid map of pMYLZ2-RFP for generating the red fluorescent transgenic T. albonubes.

before, during, and even after the integration process (Würtele et al., 2003). As a result, transgenic organisms often have unexpected and unstable traits. For example, transgenic expression may vary across different sites of transgenic integration, a phenomenon called “positional effects” (Lin et al., 1994; Iyengar et al., 1996). Therefore, in establishing a transgenic line, integration of transgenes into host genome and their stable transmission and expression in offspring are the most important issues (Kinoshita et al., 1996). Nevertheless, to our knowledge there is little published information on the detailed characterization of integration site and expression pattern in the fluorescent transgenic ornamental fish. In the present study, we describe the generation of a germline RFP transgenic T. albonubes and attempt to investigate its characterization in terms of transgene inheritance, expression and integration pattern. Both upstream and downstream flanking regions of the insertion site were also examined. These obtained data provide a basis for analyzing whether the inserted foreign genes can be stably inherited and expressed in transgenic progenies. MATERIALS AND METHODS Fish maintenance and transgene constructs T. albonubes, purchased from a local ornamental fish market (Guangzhou, China), were maintained in well-aerated glass aquaria

containing dechlorinated tap water under fluorescent lighting on a 12L: 12D cycle. Fish were fed flake food to satiation daily, supplemented with live brine shrimp nauplius (Artemia salina). Fertilized eggs of T. albonubes were collected from pair spawning in tanks and subjected to gene transfer. An approximate of 6.0 kb gene construct pMYLZ2-RFP used in this study (Figure 1) was made by insertion of a 1.9 kb zebrafish mylz2 promoter into the multiple cloning site of pDsRed2-1 vector (BD Biosciences Clontech, USA). The zebrafish mylz2 promoter was isolated by PCR (Jian et al., 2004) and digested with EcoRI and BamHI. For microinjection, the recombinant vector was linearized by BglII and then purified by PCR Clean-Up Kit (Roche, USA). Generation and screening of transgenic T. albonubes The linear pMYLZ2-RFP expression vector was diluted in ddH2 O to a final concentration of 100 ng/μl for microinjection. The detailed procedure was carried out as previously described (Jian et al., 2004). Injected eggs were incubated at 25-26°C in pure water under laboratory conditions. Living embryos were screened under a fluorescence microscope (with 2,072 filter combination) and all the selected RFP-positive embryos were raised to sexual maturity. Transgenic founders (F0) were mated individually with wild-type fish to produce the F1 generation. The F1 transgenic individuals with red body color were again crossed to wild-type fish to produce the F2 generation. F3 were produced by crossing two F2 red transgenic siblings. In the present study, we chose transgenic F 3 generation and its progenies (self- or test-cross) from a germline transgenic T. albonubes as research objects. To confirm the inheritance pattern of RFP gene in this line, the randomly chosen five F 3 individuals (3 female and 2 male) were crossed with wild-type mates. The frequencies of pMYLZ2-RFP transgene transmission to F4 progeny were examined under the fluorescence microscope. In addition, dot

7758

Afr. J. Biotechnol.

Table 1. Primers used in this study.

Primer name

Sequence (5'-3')

Purpose

Expected size (bp)

Red-F Red-R

CAGGACGGCTGCTTCATCTA GGTGTAGTCCTCGTTGTGGG

RT-PCR

288

β-actin-F β-actin-R

GCTTTGTCACTCCAGCACCG GGGCATCATCTCCAGCGAAT

RT-PCR

220

AP1 AP2

GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT

Adaptor primers

—

szq1 szq2

AAATAAAGGGTGTAAACTGTCACTGGG CATTGTTTTGCTTCTCTTGATTTTTCCC

Upstream junction cloning

—

xzzt2 xzzt2

CCACCACTTCAAGAACTCTGTAGCACC CGACCTACACCGAACTGAGATACCTAC

Downstream junction cloning

—

Dsredf Dsredr

TCAGATTCATCCCATTCCAAGAC GACCGAGAGAGAAAGAGGAAAAACT

Quantitative PCR

127

Upstrf Upstrr

CACACACCCACACATAAAGATTCAG CATCCGCTGCATAAAAAATACACT

Quantitative PCR

143

SZYS-SY SZYS-XY

CTGGGATACATTGAGCCT GTATCCGCCAGAGTTAG

Sequence detection

722

xzxl-sy xzxl-xy

CGCCTGGCACACTGGATACG CAGTTGGCAGAATCAGTATC

Sequence detection

911

blot method was employed to determine whether there exists silent integration in the non-transgenic offspring.

Detection of transgene expression by RT-PCR Total RNA was extracted from muscle, liver, gonad, spleen, gill, intestine, swim bladder and heart of adult F3 transgenic T. albonubes and non-transgenic siblings using Trizol Reagent (Invitrogen, USA). Reverse transcription was performed according to the protocol of PrimeScript TM 1st strand cDNA Synthesis Kit (TaKaRa, Japan). The synthesized cDNA (2 μl) from each tissue was used as template in a 20 μl PCR mixture. The PCR primers for RFP mRNA were Red-F and Red-R shown in Table 1. A region of the endogenous β-actin mRNA as an internal control was amplified using primers β-actin-F and β-actin-R (Table 1). PCR was performed with an initial denaturation of 3 min at 94°C and then 30 s of denaturation at 94°C, 30 s of annealing at 64°C (55°C for βactin amplified), and 1 min of extension at 72°C for 34 (RFP gene) or 30 cycles (β-actin gene), followed by a final extension of 7 min at 72°C. The reacted products were electrophoresed on a 1.5% agarose gel.

PCR analysis of transgene arrangement Single-primer xzzt2, szq1 and their combination (Table 1) were

used to amplify the pMYLZ2-RFP construct-to-construct junctions in F3 transgenic and non-transgenic fish, respectively. An amount of 20 μl PCR reaction contained 0.2 μl template DNA, 0.4 μl each of forward and reverse primers, 0.3 μl dNTP (10 μmol/l), 2.0 μl 10 × PCR buffer (Mg2+ 25 mmol/l), 1.0 U Taq polymerase. The reaction was denatured for 3 min at 94°C and then cycled 30 times at 94°C for 30 s, 55°C for 30 s and 72°C for 1 min, followed by a final extension of 7 min at 72°C.

Cloning of flanking regions of the transgene by genomic walking A total of 100 μl blood sample was collected from the heart ventricle of five F3 transgenic siblings with a capillary tubule. Genomic DNA was isolated from the whole blood sample using Blood and Cell Culture DNA Kit (QIAGEN, Germany). Briefly, EcoR V and Dra I genome walker libraries were constructed including digestion, purification of genomic DNA, and ligation of genomic DNA to GenomeWalker Adaptors. To obtain the 5' flanking region of the transgene insertion locus, primers szq1 and szq2 (Table 1) were designed according to the known pMYLZ2-RFP sequence. The first-round PCR was performed using EcoR V library as template with Adaptor primer AP1 and primer szq2 (Table 1). An amount of 50 μl PCR reaction contained 1 μl template DNA, 1 μl each primer (20 μmol/l), 8 μl dNTP (10 μmol/l), 5.0 μl 10 × PCR buffer (Mg 2+ 25 mmol/l), 0.5 μl LA Taq polymerase and 33.5 μl ddH2O. Amplification

Jian et al.

conditions for the primary PCR were 25 s at 94°C; 3 min at 72°C for 7 cycles, 25 s at 94°C, 3 min at 67°C for 32 cycles, and 7 min at 67°C for the final extension. The second-round PCR with Adaptor primer AP2 and primer szq1 was performed using a 1 in 50 dilution of the primary amplification as template. Secondary PCR had the same reaction composition and parameters as described above except amplification was allowed to proceed for 5 and 20 cycles. Also, the 3'-flanking region of the transgene was isolated employing the genome walking techniques as described above. The two rounds of PCR were performed using Dra I library as template with Adaptor primers AP1/AP2 and specific primers xzzt1/xzzt2 (Table 1). The resulting PCR products were electrophoresed on a 0.8% agarose gel and then purified using a gel extraction kit (Omega, USA). The purified PCR products were subcloned into the pMD18-T Vector and sequenced. Determination of transgene copy number by quantitative PCR (qPCR) Genomic DNA templates were isolated from fin samples of one F 5 and one F6 transgenic hemizygotes, respectively. For the transgene amplification, primers Dsredf and Dsredr (Table 1) were used to amplify a 127-bp fragment from RFP gene. Based on the obtained 5'-integration junction sequence, primers Upstrf (locating at the 5'flanking genomic sequence) and Upstrr (locating at the upstream transgene sequence) (Table 1) were designed to amplify a 143-bp single copy fragment as a reference. Both primer pairs were tested to ensure amplification of single discrete bands with no primerdimers. PCR products were subcloned into the pMD18-T vector for sequencing. The purified plasmids were quantified by spectrophotometry using an Eppendorf BioPhotometer (Germany) and copy numbers were calculated by the formula: plasmid DNA (copies /ml) = [Concentration of plasmid DNA (g/ml) ×6.02×1023 (copies/mol)]/ Molecular weight of plasmid DNA (g/mol); Molecular weight of plasmid DNA (g/mol) = Length (bp) × 660 (g/mol/bp), where 6.02×1023 is the Avogadro constant, 660 is the average molecular weight of one base-pair (double strand DNA). Serial dilutions were performed to give final concentrations ranging from 104 to 109 copies. Standard curves were generated for both target and internal control based on six 10-fold dilutions. Quantitative PCR analysis was performed using Platinum ® SYBR® Green qPCR SuperMix-UDG kit (Invitrogen, USA) and monitored on an ABI PRISM® 7300 Sequence Detection System (Applied Biosystems). The qPCR reactions were carried out in 96well plates using a 25-μl volume per well that included 12.5 μl SYBR PCR Master Mix, 0.5 μl ROX Reference Dye, 0.25 μl each primer (20 μmol/l), 0.4 μl of plasmid or genomic DNA template and 11.1 μl ddH2 O. The qPCR reactions were performed under the following conditions: 2 min at 50°C, 2 min at 95°C and 42 cycles of 15 s at 95°C, 30 s at 60°C and 30 s at 72°C. Each reaction was repeated four times to ensure the reproducibility of the results. To prevent all possible false-positive results, including primer-dimerinduced positive results, all qPCR procedures were followed by melting curve analysis. According to each standard curve, the CT values were converted to the initial copy number in the samples. Transgene copy number was calculated using the double standard curves method, following the formula: Transgene copy number = initial copies of target RFP gene / initial copies of internal reference sequence. Data were expressed as means ± standard deviation (S.D.).

RESULTS Generation of transgenic T. albonubes In the spring-summer of 2003, the linear pMYLZ2-RFP

7759

expression vector was microinjected into wild-type T. albonubes fertilized eggs at 1-2 cell stage. Out of a total of 719 eggs microinjected, 321 embryos (45%) survived after injected, 265 embryos hatched out normally and 83 fry had RFP expression under the fluorescence microscope (31% RFP-positive rate). At 25 to 26°C, the survival T. albonubes embryos hatched out by 36 h post-fertilization (hpf), and no fluorescence signal was detected under the fluorescence microscope. RFP expression was initially observed at around 48 hpf. Subsequently, RFP expression gradually expanded to developing somite and skeletal muscles (Figure 2A, B). After 7 days post-hatching (dph), red fluorescent color was visible to unaided eyes under normal daylight (Figure 2C). Up to 30 dph, RFP expression increased continuously, and transgenic founders displayed the patched RFP expression in body muscles (Figure 2D, E). Germline transmission constructs

of

pMYLZ2-RFP

gene

The randomly chosen five F3 individuals from the germline transgenic T. albonubes were used to analyze the genetic character of RFP gene. When three F3 female and two F3 male were crossed with wild-type fish, 100, 45.2, 51.5, 51.1 and 52% of their F4 transgenic progeny showed uniform RFP expression (Figure 2F), respectively. Segregation studies indicated that the transgene follows Mendelian single-gene inheritance in this line (Table 2). Furthermore, dot blot analysis showed that no hybridization signal was observed in all the RFPnegative offspring (data not shown). These results reveal that the pMYLZ2-RFP transgene DNA is integrated into the T. albonubes genome and exists at a single locus. Expression levels of RFP in different tissues To examine the characteristic of transgene expression in different tissues of adult F3 transgenic individuals, the presence of RFP mRNA was determined by RT-PCR. An expected 288 bp band of RFP was specifically amplified from transgenic fish, while no band was observed in the non-transgenic siblings. As shown in Figure 3, relatively higher RFP expression levels were detected in muscle, liver and gonad, while a lower expression was detected in spleen, gill, intestine, swim bladder and heart. Furthermore, similar expression patterns were observed between male and female transgenic fish. The arrangement of pMYLZ2-RFP gene constructs in transgenic fish The quantitative PCR analysis revealed that multiple copies of the pMYLZ2-RFP construct were inserted into the host genome. To further characterize the arrangement

7760

Afr. J. Biotechnol.

Figure 2. Expression of RFP in T. albonubes injected with the linearized pMYLZ2-RFP vector. Red fluorescence in transgenic larva was observed under a fluorescence microscope (A) and an anatomical lens (B). RFP expression in 7 dph (C) and adult (D, E) transgenic founder fish was observed under normal daylight. The arrows indicate muscle-specific expression of RFP in transgenic fish. Wild-type fish as controls are also shown in (C), (D) and (E). (F) Adult transgenic F 4 progeny with uniform RFP expression photographed under normal daylight.

of the expression vector, single primer szq1 binds in the promoter region and extends in the upstream direction whereas single primer xzzt2 binds in the terminator region and extends in the downstream direction. If the constructs were arranged in a head-to-head fashion, single primer szq1 would be anticipated to amplify an 892 bp band. Likewise, single primer xzzt2 would be anticipated to amplify a 748 bp band if the constructed were arranged in a tail-to-tail fashion. However, as shown in Figure 4, no product was

amplified by either single primer while an approximate 800 bp band was amplified using their combination. These results indicated that the constructs were not organized in either a head-tohead or a tail-to-tail arrangement fashion but in a head-to-tail orientation (Figure 5). Flanking DNA sequence analysis Approximately 1.5 kb fragment was generated

from EcoR V library, which contained 1075 bp of 5'-flanking region of the transgene insertion locus and 442 bp of the transgene sequence. Compared to the corresponding 5'-end sequence of pMYLZ2-RFP vector, the 442-bp transgenic sequence was no major modification but the deletion of cohesive terminus of BglII at the upstream transgene-host genomic DNA junction. The 5'-flanking sequence analysis showed that there was no significant homology to sequences present in the GenBank database. In addition,

Jian et al.

Table 2. Segregation of pMYLZ2-RFP transgene from transgenic F3 generation to F4 progenies.

Trial

Sex

1 2 3 4 5

Female Female Female Male Male

Positive 96 28 34 24 39

Negative 0 34 32 23 36

Crosses with wild-type fish Total Transgene transmission / % 96 100.0 62 45.2 66 51.5 47 51.1 75 52.0

Figure 3. RT-PCR analysis of RFP expression in various tissues of male and female F 3 transgenic T. albonubes. The endogenous β-actin mRNA was used as an internal control.

Figure 4. The arrangement of pMYLZ2-RFP constructs in transgenic fish. Lane M: Marker III; lanes 1, 4: single-primer PCR with primer szq1 in transgenic individuals; lanes 2, 5: single-primer PCR with primer xzzt2 in transgenic individuals; lanes 3, 6: PCR with both szq1 and xzzt2 primers in transgenic individuals; lane N: PCR with both szq1 and xzzt2 primers in non-transgenic fish.

7761

7762

Afr. J. Biotechnol.

Figure 5. Genetic structure of transgenic T. albonubes. The boxes made up of dotted lines represent flanking regions of transgene insertion locus. Three complete copies of the 6.0 kb pMYLZ2-RFP construct were integrated into T. albonubes genome, and arranged in a head-to-tail fashion. The arrows represent the amplified direction and location of primers.

primers SZYS-SY and SZYS-XY (Table 1) were designed according to the obtained 5'-flanking sequence, and an expected size fragment was specifically amplified from wild-type genome (data not shown). This further demonstrated that the amplified 1075-bp fragment existed in the host genome DNA. Approximately 1.6 kb fragment was generated from Dra I library, which contained 374 bp of the transgene sequence and 1233 bp of 3'-flanking region of the transgene insertion locus. Compared to the corresponding 3'-end sequence of pMYLZ2-

RFP vector, the 374-bp transgenic sequence was not found the mutations including base substitution and insertion, and BglII restriction site was well preserved at the downstream junction. Sequence analysis showed that the 3'-flanking sequence was 99% identical to that of phage P1 partial genome. Furthermore, the same sequence was also amplified using PvuII genome walker library. It indicated that the amplified 1.6-kb fragment belonged to the 3'-flanking region of the insertion point. Nevertheless, PCR analysis revealed that no product was amplified from wild-

type T. albonubes genome DNA with primers xzxlsy and xzxl-xy (Table 1), which were designed according to the obtained 3'-flanking sequence. Transgene copy numbers estimated by qPCR In the qPCR assay, standard curves for target gene and internal reference sequence were produced by using ABI 7300 System SDS software. The correlation coefficient (R2) between CT value and log DNA concentration was 0.9992 for target gene and 0.9982 for internal reference sequence.

Jian et al.

7763

Table 3. Estimation of transgene copy number in F5 and F6 transgenic T. albonubes.

F5 generation Trial 1 2 3 4 Mean ± SD

Initial copy of internal reference 3.40E+5 3.34E+5 2.99E+5 3.44E+5 (3.29±0.21)E+5

Initial copy of target gene 8.96E+5 9.74E+5 9.26E+5 9.75E+5 (9.43±0.39)E+5

F6 generation Transgene copy number 2.64 2.92 3.10 2.83 2.87±0.19

The PCR reaction efficiencies were 95.29 and 100.39% for target gene and internal reference sequence PCR assay, respectively. Good linearity between DNA quantities and CT values indicated that the established assays were well suited for quantitative measurements. Copy number value for RFP gene is shown in Table 3. The initial copies for RFP gene and internal reference sequence were (9.43 ± 0.39) × 105 and (3.29 ± 0.21) × 105 in the F5 sample, and (2.72 ± 0.20) × 105 and (9.31 ± 0.51) × 104 in the F6 sample, respectively. From these data, transgene copy number value was determined to be three per haploid genome. DISCUSSION In this study, 45% of T. albonubes eggs survived after microinjection and 31% of the hatched fry tested RFPpositive which represents a relative high efficiency of transgenic fish production. Nonetheless, most transgenic founders displayed the patched RFP expression in body muscles. This mosaic phenomenon has been widely reported (Chou et al., 2001; Pan et al., 2008) and thought to result from delayed transgenic integration after the precleavage stage of embryonic development (Gross et al., 1992; Figueiredo et al., 2007). In fact, the stable transgenic T. albonubes line described in this paper, although mosaic, was able to transmit RFP gene to the offspring because the transgene was integrated into its germ cells. In addition, Mendelian transmission pattern suggested the transgene exists at a single locus in this line. Results of RT-PCR analysis revealed that RFP gene driven by zebrafish mylz2 promotor was expressed in most T. albonubes tissues, but previous studies reported that this muscle-specific promoter can drive reporter gene expression solely in the skeletal muscle (Gong et al., 2003; Ju et al., 2003; Zeng et al., 2005). Such ectopic expression may be due to lack of putative tissue-specific or repressor elements in our isolated zebrafish mylz2 promoter (Jian et al., 2004; Hobbs and Fletcher, 2008). On the other hand, the influence of integration site context also may result in ectopic expression (Clark et al., 1994). For example, expression patterns often differ

Initial copy of internal reference

Initial copy of target gene

9.14E+4 8.80E+4 1.00 9.32E+4 (9.31±0.51)E+4

2.71E+5 2.48E+5 2.97E+5 2.73E+5 (2.72±0.20)E+5

Transgene copy number 2.96 2.82 2.97 2.93 2.92±0.07

among transgenic lines carrying the same gene construct (Nam et al., 1999). Yet, the possible mechanism for ectopic transgene expression needs further study. Traditionally, Southern blot hybridization is the conventional method for transgene copy number determination (Rahman et al., 2000). But this method is time consuming, costly, and requires a large amount of DNA sample for each assay (Ballester et al., 2004; Yuan et al., 2007). To avoid these drawbacks, we adopted quantitative PCR to determine RFP gene copy number in transgenic T. albonubes, characterized by speediness, sensitivity and accurateness. For qualitative PCR assays, an endogenous reference gene of known copy number is always considered as necessity, but it is relatively difficult to screen a suitable gene in T. albonubes. Specifically, this study developed a 143-bp fragment from the 5' transgene-host junction region used as an internal control, which was validated to be present as a single copy per haploid transgenic T. albonubes genome. This novel design has also been applied to the detection of genetically modified foods (Hernández et al., 2003; Zhu et al., 2008). Meanwhile, the same result obtained for the different generations demonstrated the feasibility of qPCR method to estimate transgene copy number. Both flanking sequences were obtained from the transgene insertion locus using genome walking technology. BLAST analysis showed that the 5'-flanking sequence bore no significant homology to sequences present in the GenBank database, while the 3'-flanking sequence was 99% identical to that of phage P1 partial genome. A similar event was reported by Uh et al. (2006) that the downstream flanking sequences of an insertion site in transgenic coho salmon (Oncorhynchus kisutch) has high homology to the cercaria antigen (CA) membrane protein gene from Schistosoma japonicum. One explanation is that the P1 phage sequences had existed in the genome DNA of the wild-type T. albonubes receptor prior to injecting the pMYLZ2-RFP gene constructs. This phenomenon indicates the possible presence of “hot spot” for DNA integration. Indeed, a few studies reveal some interesting trends that integration of foreign DNA preferentially occurs near the repetitive regions, AT-rich regions, ends of chromosomes, etc (Hamada et al., 1993; Rijkers et al., 1994). Nevertheless,

7764

Afr. J. Biotechnol.

most transgene integration events are often viewed as a random process (Merrihew et al., 1996; Smith, 2001). Certainly, it is impossible to ignore an alternative possibility that the 3'-flanking sequence may be from the original sample for injection, which was inserted together with the pMYLZ2-RFP construct. The presumptive evidences are listed as follows: (1) No product was amplified from some other wild-type T. albonubes individuals with primers xzxl-sy and xzxl-xy, which were designed according to the obtained 3'flanking sequence. (2) P1 is a temperate phage which infects and lysogenizes Escherichia coli and other enteric bacteria (Łobocka et al., 2004). This provides the probability that phage P1 genomic DNA was blended into the purified recombinant vector because of the employment of E. coli DH5α competence cells in the experiment. (3) When the exogenous DNA sequences are integrated into the host genome, the deletion or modification of nucleotides always take place at the transgene-host DNA junction (Gheysen et al., 1991; Mayerhofer et al., 1991). However, sequence analysis showed that the downstream transgene region adjacent to the P1 phage homologous sequences was not found any kind of alteration at nucleotide level, and BglII restriction site was well preserved at the downstream junction. If this assumption is true, it not only puts a higher safety requirement for transgenic manipulation, but also shows the unpredictable nature of transgenesis. In summary, this germline transgenic T. albonubes is of some unique features such as ectopic expression and an unusual 3'-flanking sequence, however, Mendelian transmission, consistent expression, complete pMYLZ2RFP constructs and an appropriate genomic integration context well demonstrated the transgenes have been inserted as a stable DNA fragment in the T. albonubes genome and can be stably inherited and expressed in transgenic progenies. ACKNOWLEDGMENTS Research results reported in this paper were supported by grants from the National Facilities and Information Infrastructure for Science and Technology Program of China (Grant No. 2005DKA21103 and 2010B20308002), Science and Technology Plan Projects of Guangdong Province, China (Grant No. 2005B20301018), Fish Germplasm Improvement and Evaluation Research (Grant No. A200899F01) and National High-Tech Research and Development Program 863 of China (Grant No.2009AA10Z105). REFERENCES Ballester M, Castelló A, Ibáñez E, Sánchez A, Folch JM (2004). Realtime quantitative PCR-based system for determining transgene copy

number in transgenic animals. Biotechniques, 37: 610-613. Chou CY, Horng LS, Tsai HJ (2001). Uniform GFP-expression in transgenic medaka (Oryzias latipes) at the F0 generation. Transgenic Res. 10: 303-315. Clark AJ, Bissinger P, Bullock DW, Damak S, Wallace R, Whitelaw CB, Yull F (1994). Chromosomal position effects and the modulation of transgene expression. Reprod. Fertil. Dev. 6: 589-598. Figueiredo MA, Lanes CFC, Almeida DV, Marins LF (2007). Improving the production of transgenic fish germlines: in vivo evaluation of mosaicism in zebrafish (Danio rerio) using a green fluorescent protein (GFP) and growth hormone cDNA transgene co-injection strategy. Genet. Mol. Biol. 30: 31-36. Gheysen G, Villarroel R, Van Montagu M (1991). Illegitimate recombination in plants: a model for T-DNA integration. Genes Dev. 5: 287-297. Gong ZY, Wan HY, TayTL, Wang H,Chen M, Yan T (2003). Development of transgenic fish for ornamental and bioreactor by strong expression of fluorescent proteins in the skeletal muscle. Biochem. Biophys. Res. Commun. 308: 58-63. Gross ML, Schneider JF, Moav N, Moav B, Alvarez C, Myster SH, Liu Z, Hallerman EM, Hackett PB, Guise KS, Faras AJ, Kapuscinski AR (1992). Molecular analysis and growth evaluation of northern pike (Esox lucius) microinjected with growth hormone genes. Aquaculture, 103: 253-273. Hamada T, Sasak H, Seki R, Sakak Y (1993). Mechanism of chromosomal integration of transgenes in microinjected mouse eggs: sequence analysis of genome-transgene and transgene-transgene junctions at two loci. Gene, 128: 197-202. Hernández M, Pla M, Esteve T, Prat S, Puigdomènech P, Ferrando A (2003). A specific real-time quantitative PCR detection system for event MON810 in maize Yield Gard based on the 3'-transgene integration sequence. Transgenic Res. 12: 179-189. Hobbs RS, Fletcher GL (2008). Tissue specific expression of antifreeze protein and growth hormone transgenes driven by the ocean pout (Macrozoarces americanus) antifreeze protein OP5a gene promoter in Atlantic salmon (Salmo salar). Transgenic Res. 17: 33-45. Iyengar A, Müller F, Maclean N (1996). Regulation and expression of transgenes in fish–a review. Transgenic Res. 5: 147-166. Jian Q, Bai JJ, Ye X, Xia SL, Liang XF, Luo JR (2004). Cloning of Mylz2 promoter and generation of green fluorescence transgenic zebrafish. J. Fish. Sci. China, 11: 391-395. Ju B, Chong SW, He J, Wang X, Xu Y, Wan H, Tong Y, Yan T, Korzh V, Gong Z (2003). Recapitulation of fast skeletal muscle development in zebrafish by transgenic expression of GFP under the mylz2 promoter. Dev. Dyn. 227: 14-26. Kinoshita M, Toyohara H, Sakaguchi M, Inoue K, Yamashita S, Satake M, Wakamatsu Y, Ozato K (1996). A stable line of transgenic medaka (Oryzias latipes) carrying the CAT gene. Aquaculture, 143: 267-276. Kinoshita M (2004). Transgenic medaka with brilliant fluorescence in skeletal muscle under normal light. Fish. Sci. 70: 645-649. Liang XF, Chen GZ, Chen XL, Yue PQ (2008). Threatened fishes of the world: Tanichthys albonubes Lin 1932 (Cyprinidae). Environ. Biol. Fish. 82: 177–178. Lin S, Yang S, Hopkins N (1994). LacZ expression in germline transgenic zebrafish can be detected in living embryos. Dev. Biol. 161: 77-83. Liu H-S, Jan M-S, Chou C-K, Chen P-H, Ke H-J (1999). Is green fluorescent protein toxic to the living cells? Biochem. Biophys. Res. Commun. 260: 712-717. Łobocka MB, Rose DJ, Plunkett G, Rusin M, Samojedny A, Lehnherr H, Yarmolinsky MB, Blattner FR (2004). Genome of bacteriophage P1. J. Bacteriol. 186: 7032-7068. Matz MV, Fradkov AF, Labas YA, Savitsky AP, Zaraisky AG, Markelov ML, Lukyanov SA (1999). Fluorescent proteins from nonbioluminescent Anthozoa species. Nat. Biotechnol. 17: 969-973. Mayerhofer R, Koncz-Kalman Z, Nawrath C, Bakkeren G, Crameri A, Angelis K, Redei GP, Schell J, Hohn B, Koncz C (1991). T-DNA integration: a mode of illegitimate recombination in plants. EMBO J. 10: 697-704. Merrihew RV, Marburger K, Pennington SL, Roth DB, Wilson JH (1996). High-frequency illegitimate integration of transfected DNA at preintegrated target sites in a mammalian genome. Mol. Cell. Biol.

Jian et al.

16: 10-18. Nam YK, Noh CH, Kim DS (1999). Transmission and expression of an integrated reporter construct in three generations of transgenic mud loach (Misgurnus mizolepis). Aquaculture, 172: 229-245. Pan X, Zhan H, Gong Z (2008). Ornamental expression of red fluorescent protein in transgenic founders of white skirt tetra (Gymnocorymbus ternetzi). Mar. Biotechnol. 10: 497-501. Rahman MA, Hwang G-L, Razak SA, Sohm F, Maclean N (2000). Copy number related transgene expression and mosaic somatic expression in hemizygous and homozygous transgenic tilapia (Oreochromis niloticus). Transgenic Res. 9: 417-427. Rijkers T, Peetz A, Rüther U (1994). Insertional mutagenesis in transgenic mice. Transgenic Res. 3: 203-215. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol. 22: 1567-1572. Sin FYT (1997). Transgenic Fish. Rev. Fish Biol. Fish. 7: 417-441. Smith K (2001). Theoretical mechanisms in targeted and random integration of transgene DNA. Reprod. Nutr. Dev. 41: 465-485. Stewart CN Jr (2006). Go with the glow: fluorescent proteins to light transgenic organisms. Trends Biotechnol. 24: 155-162. Tzfira T, LiJ, Lacroix B, Citovsky V (2004). Agrobacterium T-DNA integration: molecules and models. Trends Genet. 20: 375-383. Uh M, Khattra J, Devlin RH (2006). Transgene constructs in coho salmon (Oncorhynchus kisutch) are repeated in a head-to-tail fashion and can be integrated adjacent to horizontally-transmitted parasite DNA. Transgenic Res. 15: 711-727. Wilson AK, LathamJR, Steinbrecher RA (2006). Transformation-induced mutations in transgenic plants: Analysis and biosafety implications. Biotechnol. Genet. Eng. Rev. 23: 209-237.

7765

Würtele H, Little KCE, Chartrand P (2003). Illegitimate DNA integration in mammalian cells. Gene Theor. 10: 1791-1799. Yi ZS, Chen XL, Wu JX, Yu SC, Huang CE (2004). Rediscovering the wild population of white cloud mountain minnows (Tanichthys albonubes Lin) on Guangdong province. Zool. Res. 25: 551-555. Yuan JS, Burris J, Stewart NR, Mentewab A, Stewart CN (2007). Statistical tools for transgene copy number estimation based on realtime PCR. BMC Bioinformatics, 8: S6. Zbikowska HM (2003). Fish can be first- advances in fish transgenesis for commercial applications. Transgenic Res. 12: 379-389. Zeng Z, Liu X, Seebah S, Gong Z (2005). Faithful expression of living color reporter genes in transgenic medaka under two tissue-specific zebrafish promoters. Dev. Dyn. 234: 387-392. Zhu H, Zhao X, Jia J, Sun J, Zhao K (2008). A specific qualitative and real-time PCR detection of MON863 maize based on the 5'-transgene integration sequence. J. Cereal Sci. 48: 592-597.

African Journal of Biotechnology Vol. 11(30), pp. 7766-7770, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.2400 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Soybean (Glycine max) as a versatile biocatalyst for organic synthesis Luciana M. Bertini, Telma L. G. Lemos*, Leonardo A. Alves, Francisco Jose Q. Monte, Marcos C. de Mattos and Maria da Conceição F. de Oliveira Departamento de Química Orgânica e Inorgânica- Laboratório de Biotransformações e Produtos Naturais- LBPN, Universidade Federal do Ceará, 60.451-970, Fortaleza - CE, Brazil. Accepted 8 March, 2012

A series of aliphatic and aromatic aldehydes and ketones were reduced using plant cell preparations of Glycine max seeds (soybean). The biotransformation of five aromatic aldehydes in water, at room temperature afforded the corresponding alcohols in excellent yields varying from 89 to 100%. Two prochiral aromatic ketones yielded the alcohol in very low conversion, 1% and to 4%; however with good enantiomeric excess (ee) of 99 and 79%, respectively. Additionally, three prochiral and one cyclic aliphatic ketones produced the corresponding alcohols in moderate yields varying from 10 to 58% and ee varying from 73 to 99%. Hydrolysis of two aromatic esters yielded the expected carboxylic acids in 49 and 66%. Most of the obtained alcohols have commercial value as cosmetic fragrances. Although, the enzymes present in soybean (reductase/lipase) has not been defined, the reaction is an important route for the preparation of pure alcohols and carboxylic acid, with low cost and environmental impact. Key words: Glycine max, biocatalysis, bioreduction, aldehydes and ketones, ester hydrolysis.

INTRODUCTION During the last decades chemical reactions using plant cell cultures, whole plants or microorganisms as biocatalysts have received a great deal of attention. The current interest in applying biocatalysis into organic chemistry is related to the preparation of optically active compounds with high stereoselectivity under environmentally friendly conditions. The chiral alcohols obtained by plant-mediated reductions of carbonyl groups, are in great demand by various industries, since they are precursors of drugs, agrochemicals (pheromones), specialty materials (for example, liquid crystals), flavors and fragrances (Yadav et al., 2002, 2007; Ishihara et al., 2003; Caron et al., 2005). The use of different plant species for biotransformation in particular is an increasing practice and it represents an interesting route for the synthesis of useful compounds (Giri et al., 2001; Longo and Sanromaín, 2006). General advantages of plants as reagents are their easy disposal

*Corresponding author. E-mail: tlemos@ufc.br. Tel: +55 8533669366. Fax +55 85-33669782.

after use, as they are biodegradable with mild reaction conditions, as well as their wide availability at low cost (Bohman et al., 2009). In order to determine the potential source of enzymes from Brazilian northeastern plants to be used as biocatalysts, an investigation of different tropical fruits and vegetables as bioreduction agents was carried out. Recently, plant parts and microorganisms have been used directly as biocatalysts in sources of reductase activity with alcohol dehydrogenase systems, such as Daucus carota (Yadav et al., 2002b, 2008), Manihot species (Machado et al., 2006), Saccharum officinarum (Assunção et al., 2008), Passiflora edulis (Machado et al., 2008), Cocos nucifera (Fonseca et al., 2009), Lentinus strigellus (Barros-Filho et al., 2009) and Candida tropicalis (Vieira et al., 2010). Seeds of Vigna unguiculata was recently investigated as biocatalyst and showed promising agent for the reduction of carbonyl and nitro group (Bizerra et al., 2010). Glycine max (Leguminosae) has been economically used as a source of proteins for an industrial purpose (Kumar et al., 2009). Therefore, the aim of this work was to study the biocatalytic properties of seeds from soybean

Bertini et al.

7767

Table 1. Glycine max seeds biocatalyzed reduction and hydrolysis of organic compound

Entry 1

2 3 4 5 6 7 8 9 10 11 12 13 a

Product 1a 1b 1c

c (%) 56 28 14

2a 3a 4a 5a 6a 7a 8a 9a 10a 11a 12a 13a

100 89 100 4 1 47 49 10 77 24 58 100

eeP (%)

a

Configuration alcohol

>99 79

S S

>99 73 76

S S S

Enantiomeric excesses (ee) were determined by GC using chiral column.

(Glycine max), as an alternative to produce important intermediates for organic synthesis. As far as we are concerned, this is the first report on the use of seeds as a biocatalyst in organic reactions. MATERIALS AND METHODS General All substrates were obtained from commercial suppliers. The products were obtained and the pure starting materials were analyzed by gas chromatography-mass spectroscopy (GC–MS) on a Hewlett–Packard Model 5971, using a (5%-phenyl)-methylpolysiloxane DB-5 capillary column (30 m x 0.25 mm) with film thickness 0.1 m; carrier gas helium, flow rate 1 mL/min with split mode. The injector temperature and a detector temperature was 250 and 200°C, respectively. The column temperature was programmed at 4°C /min from 35 to 180°C, and then at 10°C /min from 180 to 250°C. Enantiomeric excess (ee) was determined from chiral gas chromatography-flame ionization detector (GC-FID) analysis, as well as measuring of the optical rotations, being measured on a Perkin–Elmer 341 digital polarimeter, followed by a comparison with literature values. The products were analyzed by GC-FID on Thermo Electron GC-FID model Trace GC Ultra, using a Varian Chirasil-Dex CB capillary column (25 m x 0.25 mm x 0.25 µm). Column chromatography was run using silica gel 60 (70 to 230 mesh, Vetec), while thin layer chromatography (TLC) was conducted on precoated silica gel polyester sheets (Kieselgel 60 F254, 0.20 mm, Merck). Compounds were detected by spraying vanillin followed by heating at 120°C.

Reduction of substrates Seeds were rinsed with 5% of a sodium hypochlorite solution and distilled water. The seeds were tritured in blender until obtaining uniform not pieces approximately 0.5 cm and fats were removed by extraction with hexane for 24 h. Substrates 1 to 20 (200 mg) were added to the triturated seeds (23 g) in 150 mL of water, and the reaction mixtures were incubated in an orbital shaker (175 rpm) at room temperature for 72 h, according to the literature procedures (Machado et al., 2006). The mixture was then filtered off, and the seeds were washed with water. Filtrates were extracted with EtOAc (3 x 100 mL). Then, the organic phase was dried (Na2 SO4) and there after evaporated in a vacuum. The final products were purified by silica gel column using Hex:EtOAc (9:2, v/v) as eluent to afford reduced product: 1a, 1b and 1c (146 mg), 2a (123 mg), 3a (158 mg), 4a (142 mg), 5a (161 mg), 6a (154 mg), 7a (138 mg), 8a (164 mg), 9a (139 mg), 10a (149 mg), 11a (143 mg), 12a (158 mg), 13a (162 mg), 14a (165 mg), 15a (153 mg), 16a (144 mg), 17a (157 mg), 18a (163 mg), 19a (172 mg) and 20a (159 mg). Conversions were quantified by GC-MS, and its results are shown on Table 1.

Bioconversion versus time In the kinetics experiments, compounds 1 was submitted to the same procedure, as previously described in the reduction of substrates. Samples were analyzed by GC-MS after 12, 24, 36, 48, 60, 72, 84, 96, 108, 120, 132 and 144 h to compound 1. Experiments were performed in duplicate and the results are presented in Figure 1.

Plant material

Acylation of compounds 9a, 10a and 11a to determination of enantiomeric excess

Commercial seeds from Glycine max were purchase in a local market and were identified by botanist at the Federal University of Ceara, Fortaleza-Ceara-Brazil.

The enantiomeric excess of 9a, 10a and 11a were determined through the corresponding acylated derivative. The racemate alcohols were prepared by the reduction of the carbonylic

Figure 1. 7768

Afr. J. Biotechnol.

100

Bioconversion yield (%)

90 80 70

Hydrocinnamic alcohol (1b)

60

(1c)

50

Cinnamaldehyde (1) Cinnamyl alcohol (1a)

40 30

(1a)

20

(1b)

Cinnamic acid (1c)

10

(1) 0 0

12

24

36

48

60

72

84

96 108 120 132 144

Reaction time (h) Figure 1. Bioconversion of cinnamaldehyde (1) to the corresponding hydrocinnamic alcohol (1b), cinnamyl alcohol (1a) and cinnamic acid (1c), using Glycine max seeds at room temperature. Error bars represent the standard error of mean.

A series of simple aromatic and aliphatic, such as aldehydes, ketones and esters (Scheme 1) were treated with Glycine max seeds as biocatalyst.

or benzaldehyde containing a methoxy group in the para position (100%). The chemoselectivity was not observed with cinnamaldehyde (1), where the reduction reaction generated three products after 72 h; first (1a, 56%) resulting from selective reduction of the carbonyl group; second (1b, 28%) related to non-chemoselective reduction of the carbonyl and olefinic bonds, as well as one minor product (1c, 14%), resulted from oxidation of the carbonyl group or alcohols to carboxylic acids. The products 1a and 1b were previously observed with Saccharum officinarum bioreduction (Assunção et al., 2008).

Insert scheme 1

Insert Table 1

Crude reactions were analyzed by GC-MS and the results are presented in Table 1. All tested aldehydes (1 to 4) produced the corresponding alcohols in excellent yield, varying from 89 to 100% comparable to others previously published (Machado et al., 2008; Fonseca et al., 2009). Two aromatic ketones (acetophenone and mmethoxy-acephenone) 5 and 6 yielded the corresponding alcohols in very low conversion 1 and to 4%, however with good ee of 99 and 79%, respectively. Aliphatic ketones 9 to 12 produced the corresponding alcohols in moderate yield varying from 10 to 58% and ee varying from 73 to 99%. As expected, aldehydes were more reactive than ketones, and the presence of methoxy group in the meta position cause a decrease on the reaction yield (89%) when compared with unsubstituted benzaldehyde (100%)

A kinetic investigation of biotransformation of cinnamaldehyde (1) was performed during seven days. Aliquots were analyzed by GC-MS with reaction times varied from 12, 24, 36, 48, 60, 72, 84, 96, 108, 120, 132 and 144 h. The results show the production of cinnamic acid (1c), hydrocinnamic alcohol (1b) and cinnamyl alcohol (1a). The results show it was important to extended reaction time in order to observe oxidation reaction. The results of kinetic studies are shown in Figure 1.

compounds 9 to 11 with sodium borohydride in methanol. Racemate and the reaction product obtained by reduction were separately acylated with Ac 2O/ pyridine at room temperature (Almeida et al., 2010). Both acylated products were analyzed by Chiral GC and the ee of the bioreduction process was determined. GC conditions: 100°C, 2°C /min until 180°C.

RESULTS AND DISCUSSION

Insert Figure 1 For reduction of the aromatic ketone, 5 and 6, respectively the bioconversion afforded the corresponding

Bertini et al.

7769

Scheme 1. Reaction of Glycine max seeds with aromatic and aliphatic carbonyl compounds (aldehydes, ketones an esters).

secondary alcohols in low yields (4% of 5a and 1% of 6a). However, excellent and moderate enantioselectivity were obtained, with 99% ee for the (S)-isomer (5a) and

79% ee for the (S)-isomer (6a). Bioreduction of aliphatic ketones (9 and 11) were carried out producing the corresponding alcohols at low yields and excellent to

7770

Afr. J. Biotechnol.

moderate enantioselectivity [10% (ee 99%) and 24% (ee 76%), respectively]. A moderated bioconversion (58%) was obtained with cyclohexanone 12, but no reaction was observed for menthone (14), carvone (15) α,βunsaturated ketone and cyclopentanone (16). The reductase enzyme system present in soybean was also evaluated for effects on the β-keto-ester 10, having two different carbonyl groups. Complete chemio- and enantioselectivity were observed through the exclusive reduction of the keto group at C-3 yielding 3S(+)-hydroxy-ethylbutyrate 10a (77% yield), as a product showing an ee value of 73%. Finally, the enzymatic reaction was extended to other functionable compounds: esters (methyl benzoate, 7 and ethyl benzoate, 8), an acid carboxylic (benzoic acid, 17), one nitrile (benzonitrile, 18), an amide (benzamide, 19), and a nitro derivative (nitrobenzene, 20). The aromatic ester produced the corresponding carboxylic acid (47% for 7a and 49% for 8a). No reaction product was observed for the benzoic acid, benzamide, benzonitrile and nitrobenzene. Conclusion In summary, this work duly demonstrated that Glycine max seeds can act as a promising stereoselective biocatalyst to reduce carbonyl compounds to the corresponding alcohols with medium or high conversions suggesting that this vegetable may have interesting potential as a cheap sustainable alternative. It is encouraging to use the vast abundance of Brazilian biodiversity biocatalysts, calling an attention for selectivity and simplicity. ACKNOWLEDGMENTS The authors thank the Brazilian agencies CNPq, FUNCAP, PRONEX, and CAPES for fellowships and financial supports. REFERENCES Almeida MCS, Alves LA, Souza LGS, Matos MC, Oliveira MCF, Lemos TLG, Braz-Filho R (2010). Flavonoides e outras substâncias de Lippia sidoides e suas atividades antioxidantes. Quim. Nova. 33:1877-1881. Assunção JCC, Machado LL, Lemos TLG, Cordell GA, Monte FJQ (2008). Sugar cane juice for the bioreduction of carbonyl compounds. J. Mol. Cat. B: Enzyme, 52:194-198. Barros-Filho, BA, de Oliveira MCF, Lemos TLG, de Mattos MC, Gonzalo G, Gotor-Fernández V, Gotor V (2009). Lentinus strigellus: a new versatile stereoselective biocatalyst for the bioreduction of prochiral ketones. Tetrahedron. Assym. 20: 1057-1061. Bizerra AMC, Gonzalo G, Lavandera I, Gotor-Fernadez V, de Mattos MC, de Oliveira MCF, Lemos TLG, Gotor V (2010). Reduction processes biocatalyzed by Vigna unguiculata. Tetrahedron. Assym. 21: 566-570.

Bohman B, Cavonius LR, Unelius CR (2009). Vegetables as biocatalysts in stereoselective hydrolysis of labile organic compounds. Green Chem. 11:1900-1905. Caron D, Coughlan AP, Simard M, Bernier J, Piché Y, Chênevert R (2005). Stereoselective reduction of ketones by Daucus carota hairy root cultures. Biotechnol. Lett. 27: 713-716. Fonseca AM, Monte FJQ, de Oliveira MCF, de Mattos MC, Cordell GA, Braz-Filho R, Lemos TLG (2009). Coconut water (Cocos nucifera L.) - A new biocatalyst system for organic synthesis. J. Mol. Cat.. B: Enzyme, 57: 78-82. Giri A, Dhingra V, Giri CC, Singh A, Ward OP, Narasu ML (2001). Biotransformation Using Plant Cells, Organ Cultures and Enzyme Systems: Current Trends and Future Prospects. Biotechnol. Adv. 19: 175-199. Ishihara K, Hamada H, Hirata T, Nakajima N (2003). Biotransformation using plant cultured cells. J. Mol. Cat. B: Enzyme, 23: 145-170. Kumar S, Dwevedi A, Kayastha AM (2009). Immobilization of soybean (Glycine max) urease on alginate and chitosan beads showing improved stability: Analytical applications. J. Mol. Cat. B: Enzyme, 58: 138-145. Longo MA, Sanromaín MA (2006). Production of Food Aroma Compounds: Microbial and Enzymatic Methodol. Food Technol. Biotechnol. 44: 335-353. Machado LL (2004). Estudo Fitoquimico e Atividade Biológicaos dos Frutos de Passiflora edulis e Redução Seletiva de Aldeídos e Cetonas Aromáticas Utilizando a Casca da Passiflora como Biocatalisador. MS Thesis, Edições UFC, Fortaleza, Brazil, 2003. Machado LL, Monte FJQ, de Oliveira MCF, de Mattos MC, Lemos TLG, Gotor-Fernández V, Gonzalo G, Gotor V (2008). Bioreduction of aromatic aldehydes and ketones by fruits’ barks of Passiflora edulis. J. Mol. Cat. B: Enzyme, 54:130-133. Machado LL, Souza JSN, Mattos MC, Sakata SK, Cordell GA, Lemos TLG (2006). Bioreduction of aldehydes and ketones using Manihot species. Phytochemistry, 67: 1637-1643. Maciel CDG, Poletine JP, Pereira JP, Mondini ML (2005). Avaliação da qualidade de sementes de soja (Glycine max (l.) Merrill) cultivar IAC18.Revista Científica Eletrônica de Agronomia 7: 1-5. Vieira GAB, Araujo DMF, Lemos TLG, de Mattos MC, de Oliveira MCF, Melo VMM, De Gonzalo G, Gotor-Fernández V, Gotor V (2010). Candida tropicalis CE017: a new Brazilian enzymatic source for the bioreduction of aromatic prochiral ketones. J. Braz. Chem. Soc. 21: 1509-1516. Yadav JS, Reddy GSKK, Sabitha G, Krishna AD, Prasad AR, Rahaman HUR, Rao KV, Rao AB (2007). Daucus carota and baker’s yeast mediated bio-reduction of prochiral ketones. Tetrahedron. Asymm. 18: 717-723. Yadav JS, Nanda S, Thirupathi R, Bhaskar R (2002a). Efficient enantioselective reduction of ketones. J. Org. Chem. 67: 3900-3903. Yadav JS, Nanda S, Thirupathi R, Bhaskar R (2002b). Efficient enantioselective reduction of ketones. J. Org. Chem. 67: 3900-3903. Yadav JS, Reddy BVS, Sreelakshmi GC, Kumar GGKSN, Rao AB (2008). Enantioselective reduction of substituted tetrahydropyran-4ones using Daucus carota plant cells. Tetrahedron. Lett. 49: 27682771.

African Journal of Biotechnology Vol. 11(30), pp. 7771-7774, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4207 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

Passive and active immunity against parvovirus infection in piglets Nenad Stojanac*, Mladen Gagrčin, Ognjen Stevančević, Ivan Stančić and Aleksandar Potkonjak Faculty of Agriculture, Department of Veterinary Medicine, University of Novi Sad, Serbia. Accepted 23 March, 2012

The aim of this study was to come to a closer understanding of the origination, dynamics of movement and cessation of colostral immunity to parvovirus infection in swine (PPV) on the basis of an analysis of antibody titres in the blood serum of piglets in their first 6 months. On the third day of life in the blood serum of newborn piglets, an average antibody titer of 13.37 was recorded. An antibody level of 13.30 was maintained until the 10th day of life, when it started to decline to 12.02 on the seventeenth and to 11.80 on the twenty-fourth day of life. A seronegative result was ascertained on the 38th and 45th day of life (8.40 and 5.48). On the 55th day of life, the titer increased to 10.86 and slowly continued to rise to 11.61 on the 180th day of life. Because negative results are the sign of a complete catabolism of colostral antibodies whose absorption was completed in the first 2 to 3 days of life, the antibodies th recorded on the 55 day are to be considered as a result of active immunological reaction formed st between 31 and 55th day of life. The research was done on 60 piglets descending from vaccinated mothers and it was expected of the piglets to obtain enough immunity through colostrum which would protect them against PPV infection until they developed their own immunological response. On the basis of the given results, we conclude that colostral immunity to parvovirus infection in swine lasts for about one month and that antibodies found in the blood serum of piglets after the first month of life are a result of the activation of the immune system. Key words: Porcine parvovirus, colostral immunity, reproductive efficiency, antibody.

INTRODUCTION Porcine parvovirus (PPV) infection is widely spread in swine around the world and has an enzootic character. The virus attacks swine at all ages and the most endangered categories are gilts before insemination due to the disappearance of passive immunity and of inadequately developed active immunity (Mengeling, 2006). Parvovirus infection is constantly present in Serbia, especially in herds of clinically healthy swine in intensive breeding in the form of a persistent and in-apparent infection (Došen et al., 2000). Porcine parvovirus infection lowers reproductive efficiency which puts into question the continuity, amount, and feasibility of pig production in Serbia. Literature duly suggests the importance of the diagnosis of swine infection caused by

*Corresponding author. E-mail: stojanac.n@gmail.com. Tel: +381638526510.

parvovirus and the implementation of immunoprevention in order to inhibit its spread (Antonis et al., 2006; Oravainen et al., 2006). For these reasons, etiology, pathogenesis, and the route of the transmission of parvovirus infection in swine have been studied by many authors (Clark, 1996; Mengeling et al., 2000; Rogan et al., 2002), with special emphasis on the investigation of a protective character of immunity achieved with seropositive and persistently infected swine without the clinical manifestation of the symptoms of the disease after vaccination with inactive vaccine against parvovirus, and the persistency of specific maternal antibodies in their piglets. Newborn piglets are not protected against parvovirus infection because the specific maternal antibodies are only absorbed through colostrum in the first hours of life (Dividich, 2007). Colostrum is the only source of antibodies for piglets (Damm et al., 2002; Rooke et al., 2003), because many

7772

Afr. J. Biotechnol.

of the layered structures of the placenta do not allow transplacental transmission of antibodies against parvovirus from mother onto fetus, whereas pathogenic agents easily pass the placenta. The aim of this research was to follow immunity formation (active and passive) in piglets from the day they were born up until they were 6 months old. Having in mind the data given by many authors that colostral immunity with parvoviral infections may last up to 5 months (Mengeling et al., 1999; Fenati et al., 2009), the main postulate about this type of immunity is a natural passive immunity whose effectors are synthesized in another organism of the same species. The carriers of this immunity are immunoglobulins of class G (IgG). Half life of these immunoglobulins is 15 days, which results in colostral immunity lasting for about 30 days, regardless of their concentration in colostrum itself. Hence, we thought that the reasons for finding antibodies in blood serum of 5 months old piglets have to be searched for elsewhere. On the basis of this, it was decided to study the onset, dynamics of movement and ending of colostrum immunity in pigs. MATERIALS AND METHODS Experimental animals The experiment was performed on a pig farm, with a capacity of 2500 sows, with an intensive way of keeping the pigs infected with PPV enclosed. The experiment was performed on 60 piglets originating from mothers (5 gilts and 5 sows) of the breeds Swedish Landras hybrid (F1), Large Yorkshire, and Swedish Landrace. All experimental animals were clinically healthy and in good condition. From every mother, six piglets were randomly chosen for monitoring of the onset, development and length of passive and active immunity to parvovirus infection. During the experiment, a few piglets died, so the number of researched piglets dropped in time. All the piglets had tags on their ears and a tattooed number. Blood sampling was performed on day 0, 3, 10, 17, 24, 31, 38, 45, 55, 65, 100, 130 and 180 of life. Blood was taken by the puncture of the brachiocephalic plexus of the piglets.

Immunization of mothers A regular vaccination against PPV infection of all the mothers was performed on the farm. Sows were vaccinated with inactivated monovalent vaccine against swine parvovirus according to the manufacturer’s instructions (Intervet, Holland) two weeks before insemination, while gilts were vaccinated twice, 8 and 2 weeks prior to insemination. The vaccine had inactivated swine parvovirus, subtype 014, which was diluted in water adjuvance. The vaccine was applied in 2 ml dosages, deeply intramuscularly, behind the ear. Two milliliter dosage contained >2560 HA units.

Determination of the presence of antibodies Antibodies against parvovirus were detected with a HI test (Ašanin et al., 2006), with slight modifications: only guinea pig erythrocytes and V-bottom microplates were used and no bovine serum albumin was used for a clearer end-point. Animals were considered to have

low antibody levels when HI titres were ≤1:512. Titres >1:512 were considered high. The Scientific Veterinary Institute, Novi Sad diagnostic guidelines for PPV viruses, based on evaluations of vaccinated animals and field cases, are as follows: antibody titres ≤1:8 indicate that the animal has not seroconverted, 1:16 to 1:512 indicate intermediate seroconversion, and titres beyond this represent a high level of antibodies.

Statistical analyses During the processing of the results, antibody values characteristic of PPV were calculated on logarithm values - log2. After log2 results, titres ≤1:512, were considered negative and were given 0, log 2 titre 1:512 was 9, 1:1024 was 10, 1:2048 was 11, 1:4096 was 12, 1:8192 was 13 and 1:16384 was 14. After processing the results, and on the basis of referent values administered by accredited laboratories for testing, the obtained antibody titer results characteristic for PPV in blood serum of examined animals with the value less than 9, were considered as seronegative results. For the evaluation of the results, statistical methods were used: average and interval variation. Data handling was done in Excel 2007. The results were transformed to logarithmic values with the base logarithm 2 (log2).

RESULTS The obtained results showed titre values of characteristic antibodies for PPV and represent the diluting of the serum where antibodies were detected, so, there is no unit in which they could be measured. The obtained results of the diluting were transformed into logarithmic values (log2). Table 1 shows the levels of antibodies specific for PPV in blood serum of newborn piglets. Before the uptake of colostrum, antibodies were not found in any piglet. In the blood serum of three days old piglets, antibodies specific for PPV were found. A total of 60 blood serum samples were checked, and the defined titre values of specific antibodies ranged between 11 to 14 (Table 2). In three days old piglets, the antibody level was 13.37. With the same 10 days old piglets, an antibody level of 13.30 specific for PPV was diagnosed. In blood serum of 17 days old piglets, the average titer value of antibodies specific for PPV was 12.02, which is a lower level compared to an average level of antibodies specific to PPV in the blood serum of 10 days old piglets (13.30). From the results in Table 2, it can be concluded that an average antibody titer specific for PPV in the blood serum of 24 days old piglets was 11.80. With 31 days old piglets, the determined antibody titer values specific for PPV was 8.70. The antibody titer value characteristic of PPV in blood serum of examined 38 days old piglets was 8.40. In blood serum of 45 days old fatlings, the lowest antibody titre value characteristic of PPV was found, and it measured 5.48. The average value of antibody titer characteristic of PPV with 55 days old fatlings was 10.86. The average antibody titer specific for PPV in blood serum of 65 days old fatlings was 10.63. With 100 days old fatlings, the antibody titre specific for PPV was found

Stojanac et al.

7773

Table 1. Antibody titer specific for PPV in blood serum of piglets.

Titer value 14 13 12 11 10 9 0

*0 0 0 0 0 0 0 60

3 36 14 6 4 0 0 0

10 38 16 4 0 1 0 1

17 7 13 20 14 6 0 0

24 11 8 14 13 13 1 0

Number of piglets 31 38 45 0 0 0 0 0 0 2 6 0 9 7 10 21 22 10 21 15 12 7 10 26

55 4 6 5 13 21 8 0

65 2 2 8 15 21 9 0

100 2 4 7 15 9 10 0

130 12 2 1 8 12 15 0

180 3 10 14 9 13 0 0

* Age (days).

Table 2. The average antibody titer values specific for PPV in the blood serum of piglets.

Age (days) 0 3 10 17 24 31 38 45 55 65 100 130 180

Average 0 13.37 13.30 12.02 11.80 8.70 8.40 5.48 10.86 10.63 10.83 10.98 11.61

Interval 0 11-14 0-14 10-14 9-14 0-12 0-12 0-11 9-14 9-14 9-14 9-14 10-14

to be 10.83. The average antibody titer specific for PPV in the population of 130 days old fatlings was 10.98. Within the examined population of 180 days old fatlings, antibody titer specific for PPV was found to be 11.61 (Table 2). DISCUSSION Before the uptake of colostrum, antibodies specific for PPV were not diagnosed in the blood serum of any piglet from the vaccinated mothers (Table 1). This indicates no intrauterine infection (Dividich, 2007). The average antibody titer specific for PPV in blood serum of 3 days old piglets was 13.37 which is a very high value and shows the efficiency of the transfer of colostral antibodies from sow to piglet (Damm et al., 2002). Nearly all the identical average antibody titer specific for PPV was diagnosed in the blood serum of 10 days old piglets. Although it is a question of a relatively unexpected occurrence, it is possible that it is the case of a prolonged absorption of colostral immunoglobulins, which, in some

cases, can last for 5 days (Rooke et al., 2003). In this period, the first piglets without immunoglobulin appeared (Table 1), which could be connected to immunoglobulins M (IgM) which in a number of cases could be the colostral immune carriers. With 17 days old piglets, the decrease of the antibody titer specific for PPV was noted, compared to the antibody titre with the same piglets seven days before (from 13.30 to 12.02). The drop in antibody titer values of 10% is probably the consequence of the onset of the catabolism of colostral titre antibodies for about 10% (GagrÄ?in et al., 1989) due to the decreased plasma concentration in a growing piglet (Paul et al., 1981). Antibody titer specific for PPV in blood serum of 45 days old piglets has a tendency to drop, and with 31 days old piglets, an increased number of seronegative animals occurred. With the same examined 45 days old fatlings, the lowest antibody titer specific for PPV was found to be 5.48. The antibody titer specific for PPV progressively increased from 55 until the 180th day of fatling life. The antibody titer in 55 days old fatlings was 10.86, which is double the value compared to the one gained 10 days earlier. The reason for this abrupt raise of antibodies specific for PPV in the blood serum of fatlings should be sought in the fact that PPV infection of swine is widely spread with clinically healthy swine around the world. Also, PPV is an enzootic infection, permanently present on the territory of Serbia (DoĹĄen et al., 2002), especially in clinically healthy swine herds in intensive breeding, in a form of inapparent persistent infection. All this is a consequence that the infection of fatlings whose level of protection from PPV infection was very low when they were 45 days old initiated immunological response which manifested itself with elevation of antibody titer specific for PPV. The results show that up till 45 days of life, piglet catabolism of colostral antibodies occurred, and the passive immunity seized to exist, which is evidenced by the fact that the bearers of passive immunity are immunoglobulin G (IgG) (GagrÄ?in et al., 1989; Rooke et al., 2003). Half-life of this class of immunoglobulin is 15 days (Jerant-Patic, 2000; Tizard, 2000) which as a consequence has continuation of passive immunity for 3 to 40 days, regardless of their

Afr. J. Biotechnol.

Titre of antibody

7774

Days of age Figure 1. The dynamics of movement of antibody titer values specific for PPV in the blood serum of piglets.

concentration in the colostrum itself. Considering the data from many authors that colostrum immunity lasts up to 6 months (Gradil et al., 1990; Mengeling et al. 1999; Fenati et al. 2009), the question that arises is “what is the class of immunoglobulin of which the half life would be 3 to 6 months?” Because such an immunoglobulin class has not been determined, the reason for this statement should be sought in the activating of the self immunological response. In this study, a very high antibody titer specific for PPV in the blood serum of 130 and 180 days old fatlings was found (10.98 and 11.61). This high antibody titer specific for PPV has been confirmed in studies by Mengeling et al. (1999) and Fenati et al. (2009). They administered the findings of a high antibody titer with 3 to 6 months old piglets to passive immunity, that is, to colostral antibodies. The antibody titer specific for PPV in 40 days old piglets dropped to a low level since there was catabolism of colostral antibodies which Gagrčin et al. (1989) explained in their research and which meant termination of passive immunity, upon which the self immune response happened (active immunity) (Figure 1). REFERENCES Antonis FGA, Bruschke JMC, Rueda P, Maranga L, Casal JI, Vela C, Hilgers ATL, Belt BGMP, Weerdmeester K, Carrondo JTM, Langeveld PMJ (2006). A novel recombinant virus-like particle vaccine for prevention of porcine parvovirus-induced reproductive failure. Vaccine, 24: 5481-5490. Ašanin R, Krnjajić D, Milić N (2006). Priručnik sa praktičnim vežbama iz mikrobiologije sa imunologijom. Autorsko izdanje, Beograd. pp. 63-66 Clark LK (1996). Epidemiology and management of selected swine reproductive diseases. Anim. Reprod. Sci. 42:447-454. Damm IB, Friggens CN, Nielsen J, Ingvarsen LK, Pedersen JL (2002). Factors affecting the transfer of porcine parvovirus antibodies from sow to piglets. J.Vet. Med. Series A, 49(9): p. 487.

Dividich LJ (2007). The issue of colostrums in piglet survival: energy and immunity. Nutri. Biotech. Feed Food Ind. pp. 89-102. Došen R, Gagrčin M, Prodanov J, Orlić D (2002). Porcine parvovirus infection. Vet. Glasnik, 56(1-2): 13-19. Fenati M, Armaroli E, Corrain R, Guberti V (2009). Indirect estimation of porcine parvovirus maternal immunity decay in free-living wild boar (Sus scrofa) piglets by capture-recapture data. Vet. J. 180(2): 262264. Gagrčin M, Popović M, Ćirković D (1989). Some aspects of colostral immunity in piglets against porcine parvovirus infection. Vet. Glasnik 44(7): 587-590. Gradil CM, Joo HS, Molitor TW (1990). Persistence of porcine parvovirus in swine infected in utero and followed through maturity. J. Vet. Med. B 37: 309-316. Jerant-Patić V (2000). Viruses today and tomorrow. Med. Pregl. 53(1112): 547-558. Mengeling WL (2006). Porcine parvovirus. Diseases of swine, Iowa State University Press, Iowa, pp. 373-386. Mengeling WL (1999). Porcine parvovirus. Diseases of swine, Iowa State University Press, Iowa, pp. 187-200. Mengeling LW, Lager MK, Vorwald CA (2000). The effect of porcine parvovirus and porcine reproductive and respiratory syndrome virus on porcine reproductive performance. Anim. Reprod. Sci. 60-61: 199210. Oravainen J, Hakala M, Rautiainen E, Veijalainen P, Heinonen M, Tast A, Virolanen JV, Peltoniemi OAT (2006). Parvovirus antibodies in vaccinated gilts in field conditions-results with HI and ELISA tests. Reprod. Dom. Anim. 41: 91-93. Paul PS, Mengeling WL, Pirtle EC (1981). Duration and biological halflife of passively acquired colostral antibodies to porcine parvovirus. Am. J. Vet. Res. 43:8. Rogan D, Petrović T, Lazić S (2002). Novija saznanja o parvovirusnim infekcijama svinja, Zbornik referata i kratkih sadržaja, 14. savetovanje veterinara Srbije, Zlatibor, pp. 49-58. Rooke AJ, Carranca C, Bland MI, Sinclair GA, Ewen M, Bland CVI, Edwards AS (2003). Relationship between passive absorption of immunoglobulin G by the piglet and plasma concentrations of immunoglobulin G at weaning. Livestock Prod. Sci. 81: 223-234. th Tizard IR (2000). Veterinary Immunology. 6 Edition, London, WB Sauders, 89: p. 223.

African Journal of Biotechnology Vol. 11(30), pp. 7775-7780, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3448 ISSN 1684–5315 © 2012 Academic Journals

Full Length Research Paper

The use of kefir as potential probiotic in Çoruh trout (Salmo coruhensis): Effects on growth performance and immunoglobulin (IgM) levels Erkan CAN1*, Filiz KUTLUYER1, Fatma DELİHASAN SONAY2 and Özay KÖSE2 1

Fisheries Faculty, Tunceli University, Tunceli, 62000, Turkey. 2 Fisheries Faculty, Rize University, Rize, 53000, Turkey. Accepted 18 January, 2012

The objective of this study was to evaluate the effects of three different rates of kefir on growth performance and immunoglobulin (IgM) levels of Çoruh trout (Salmo coruhensis). The experiment was carried out with the four following treatments: Control group (not supplemented kefir), D1, D2 and D3 (kefir supplemented diet 10, 20, 40 g kg-1 fish body mass, respectively). Condition factor (CF), food conversion ratio (FCR), survival rate, and specific growth rate (SGR) were monthly determined and IgM level was measured at the end of the 4 months. Survival ranged from 88.2 to 89.1%, and was independent of dietary treatments (P>0.05). The highest specific growth rate was found for the fish fed D2; although, there was no significant difference in growth parameters between the control, the fish fed D1, D2 and D3 (P>0.05). However, diets contained kefir (D1, D2) increased immunoglobulin level in S. coruhensis (P<0.05). It can also be concluded that kefir is crucial for fish production as a potential probiotic. Key words: Salmo coruhensis, kefir, probiotic, growth, immunoglobulin (IgM).

INTRODUCTION Using of functional foods have become a vital necessity to minimize the use of chemical drugs for treatment of some fish diseases and to reduce their effects on the fish and environment and also decrease the production costs and to obtain more environment-friendly aquaculture productions (Gatesoupe, 1999; Can, 2001; Suzer et al., 2008; Al-Dohail et al., 2009; Merrifield et al., 2010; Ekici et al., 2011). Kefir is an acidic and mildly alcoholic fermented milk with a complex mixture of bacteria, which are confined to a matrix of discrete kefir grains. The bacteria include various species of lactobacilli, lactococci, leuconostocs and aceterobacteria and yeasts (both lactose-fermenting and nonlactose-fermenting) (Marshall and, Cole, 1985;

*Corresponding author. E-mail: erkancan@tunceli.edu.tr, ecanengineer@gmail.com. Tel: +90-428-2131794. Fax: +90428-2131861. Abbreviations: IgM, Immunoglobulin; CF, condition factor; FCR, food conversion ratio; SGR, specific growth rate.

Koroleva, 1988; Thoreux and Schmucker, 2000). Kefir also exhibits antimicrobial activity in vitro against a wide variety of Gram-positive and Gram-negative bacteria and some fungi (Cevikbas et al., 1994; Zacconi et al., 1995). Recently, antibacterial, immunologic and antitumor effects of kefir were studied on human beings (Lin and Change, 2000; Hoolihan, 2001; Liu et al., 2005) and some other animals, rats etc. (Furukawa et al., 1990, 1991; Zacconi et al., 1995; Güven et al., 2003; Cenesiz et al., 2008; Ozcan et al., 2009) although there is lack of information in the literature on growth performances and immunoglobulin level of kefir on the fish species. IgM, which is an important immunoglobulin class, is important in phylogenetic research being the first immunoglobulin to appear in evolution and commonly the only immunoglobulin class described in fish (Magnadóttir, 1998). A lot of researchers have focused on this immunoglobulin class in their studies on immune system and growth performance of cultured species (Assem and El-Zaeem, 2005; Panigrahia et al., 2005; Salinas et al., 2008; Reyes-Becerril et al., 2008; Al-Dohail et al., 2009; Lim et al., 2010), and, recently, understanding of the

7776

Afr. J. Biotechnol.

structure and function of fish IgM has become all the more important due to the need of the fish farming industry for effective prevention and control of various fish diseases (Magnadóttir, 1998). Kefir have been reported to stimulate the immune system in both in vitro and in vivo studies (Furukawa et al., 1991; Osada et al., 1994). The immune system was stimulated in rainbow trout by several probiotics (Irianto and Austin, 2002; Raida et al., 2003; Panigrahi et al., 2005; Sharifuzzaman and Austin, 2009). The application of live probiotics may therefore result in elevated health status, improved disease resistance, growth performance, body composition, reduced malformations and improved gut morphology and microbial balance in aquaculture nowadays (Merrifield et al., 2010). As concerns, Coruh trout (Salmo coruhensis, described by Turan et al., 2009) is the new culture species in Black Sea region of Turkey known as Salmo trutta labrax (PALLAS, 1811) in previous literature; the knowledge lack information in the literature on the effect of kefir on the growth and immune system. In this framework, the main objective of this study was to examine the effect of dietary kefir on the growth, survival and immunoglobulin (IgM) levels of Çoruh trout (S. coruhensis).

MATERIALS AND METHODS Fish and experimental design The samples of S. coruhensis broodstocks used in the present study were obtained from Çoruh River (Rize) population of S. coruhensis. This study was carried out between December 02, 2010 and March 02, 2011 for 4 months at the facility Aquaculture Department Production, Rize, Turkey. Twelve tanks (50 L) were used and fish were equally allotted to four groups with three replicates for each treatment. Each tank contained 90 fish (9.7±0.2 g). The temperature of the incoming water was 8±2.53°C. Flow rate was 30 L min-1. Oxygen saturation was always higher than 88% (measured by HQ40D multi - Hach Lange). In the present study, fish were exposed to natural photoperiod. Four diets were prepared to investigate the effects of different levels of kefir on condition factor (CF), food conversion ratio (FCR), survival rate, specific growth rate (SGR) and IgM level in S. coruhensis. For this aim, one control and three experimental diets (D1, D2 and D3) were arranged. Kefir was not included to the control group; however, D1, D2 and D3 groups were supplemented with kefir at 10, 20 and 40 g kg-1 fish diet mass levels, respectively. The experimental diets were formulated to contain approximately 50% crude protein, 19% crude lipids, crude cellulose 3%, 12% moist and 13% ash. The experiment was carried out with three replicates for each dietary treatment. Daily tank feed was calculated as 3% of the group biomass. All groups were fed the same daily ration of commercial food (Bioaqua, standard extruder). All the fish in each tank received the same feed treatment. The amount fed to each tank was recorded. Each fish was anesthetized (Benzocaine, 50 ppm), and body weight (Wt; to 1 g), and total length (Lt; to 1 mm) were recorded at intervals of 30 days. Condition factor was calculated as (Wt Lt-3) * 100. Food conversion ratio per tank was calculated as (food fed)/(biomass gain). Specific growth rate was calculated as (LnW t-LnW 0 / t) * 100. Survival rate was calculated as

(Nt / N0) * 100 (Duston et al., 2007). Kefir and feed preparation Raw milk was obtained from a special milk production farm daily (Rize, Turkey), and heated to 90°C for minimum of 10 min, then cooled to inoculation temperature (25°C) and 5% active kefir grains added. The inoculated milk was incubated at 22°C for 20 h (Marshall and Cole, 1985). At the end of the incubation, the grains were separated from the kefir product by filtration through a plastic sieve, washed and maintained at +4°C in the sterile drinkable water until the next culture passage. Kefir product was maintained at +4°C for 24 h and then used for microbiological and chemical analyses before feeding the fish in treatment groups. Prepared kefir was not used as feed additive if it was stored for more than 3 days (Güven et al., 2003). Prepared feeds were stored under 4°C conditions. After the feed was prepared with kefir, all 4 groups’ feed was covered with fish oil at 32 ml to per kilo of feed.

Bacteriological analysis of kefir Twenty-five milliliters of kefir product was mixed with 225 ml peptone water (Oxoid Ltd., Hampshire, UK). Tenfold serial dilutions from this homogenate were prepared in the same solution and 0.1 ml from these dilution tubes spread-plated onto separate duplicate plates. Lactobacilli were investigated by using MRS agar (Oxoid, CM361) and lactic streptococci were counted by using M17 agar (Oxoid, CM785). Selective enumeration of yeasts was specified via potato dextrose agar (Oxoid, CM 139) (Harrigan and McCance, 1976).

Sampling and measurement of blood serum immunoglobulin M (IgM) Fish were sampled monthly for growth parameters and at the end of feeding period for enzymatic analyses. At each sampling for enzymatic analyses, three fish from each tank (nine per treatment) were taken at random. All specimens were anaesthetized by immersion in benzocaine solution (50 ppm) before blood drawing. Blood was drawn from the vena caudalis using an 18 G×1½ in syringe. Blood serum was obtained by blood centrifugation at 3000 rpm for 15 min. An ELISA kit (Fish Immunoglobulin M (IgM) ELISA Kit) from Cusabio Biotech (Cat. No. CSB-E12045Fh) were used following the manufacturer’s instructions to determine total IgM concentrations in serum. All tests were studied in Bilim Special Veterinary Diagnosis and Analysis Laboratory, Istanbul-Turkey. Statistical analysis One-way analysis of variance (ANOVA) was conducted to compare differences among dietary treatments. Overall differences were significant (P<0.05), Duncan's multiple range test was used to compare the mean values between individual treatment groups. All tests were performed in SPSS 15.0 software for Windows (SPSS Inc., Chicago, IL, USA).

RESULTS Survival and growth parameters Survival

ranged

from

88.2

to

89.1%, and was

Can et al.

7777

Table 1. Changes in mean SGR, FCR and CF of S. coruhensis in the control and fed D1, D2 and D3.

Month S G R

F C R

C F

a,b,c x,y,z

Control

Diet 1 a,x

Diet 2 a,x

Diet 3 a,x

a,x

1

1.61±0.15

1.73±0.13

1.82±0.12

1.76±0.08

2

1.68±0.52a,x

1.74±0.07a,x

1.82±0.09a,x

1.79±0.08b,x

3

1.14±0.06b,x

1.18±0.08b,x

1.17±0.06b,x

1.16±0.02c,x

4

1.12±0.21b,x

1.10±0.13b,x

1.21±0.16b,x

1.11±0.08a,x

1

4.47±0.13

2

3.14±0.35

3

2.60±0.18c

4

2.28±0.13

0

a,x

4.83±0.14

a,x

4.29±0.10

a,x

4.46±0.02

b,x

3.11±0.16

b,x

2.98±0.22

b,x

2.71±0.51

c,x

2.37±0.17

c,x

2.12±0.62

2.39±0.19

c,x

2.32±0.13

c,x

2.11±0.73

0.90±0.06a,x

0.91±0. 06a,x

0.91±0. 05a,x

0.90±0.05a,x

1

1.05±0.07ab,x

1.04±0.08a,x

1.03±0.08a,x

1.05±0.07ab,x

2

1.08±0.07b,x

1.07±0.08ab,x

1.09±0.08a,x

1.06±0.08b,x

3

1.03±0.07ab,x

1.03±0.08b,x

1.06±0.07a,x

1.03±0.07ab,x

4

1.03±0.07ab,x

1.04±0.06b,x

1.07±0.08a,x

1.04±0.08ab,x

a,x

c,x

2.52±0.20

a,x b,x c,x c,x

Indicate the differences among the same columns (P<0.05). Indicate the differences among the same rows (P>0.05).

independent of dietary treatments (P>0.05). Fish fed diet with 20 mg kg-1 kefir (D2) showed the highest growth rate although there were no significant differences between groups (P>0.05). SGR in the control group was lower compared to the kefir induced groups but these differences were not statistically different (P>0.05) (Table 1). FCR and CF in fish fed kefir supplemented diets and the control group are presented in Table 1. FCR and CF were higher in Diet 2 compared to the other groups but the differences between groups were not statistically significant (P>0.05) (Table 1). Nevertheless, there were also significant differences during the various cycle of the production on SGR, FCR and CF by time (P<0.05). Kefir analyses At the end of the microbiological analysis of kefir, lactic acid bacteria, lactic streptococci and yeasts were found 8 7 7 to be 1.0 * 10 , 2 * 10 and 3 * 10 CFU/ml, respectively. Blood serum immunoglobulin M (IgM) IgM level in fish fed kefir supplemented diets and the control group are presented in Figure 1. The findings of the present study showed that the concentration of 10 and 20 g kg-1 kefir addition to diets caused a significant increase in IgM level in S. coruhensis.

DISCUSSION There have been no comparative studies on the effect of kefir on growth and immune system of aquatic species. However, the significance of probiotic in fish production has been confirmed in several studies. The effect of dietary probiotic on growth and survival rate depended on many factors (Gomez-Gil et al., 2000) such as species composition, application level, frequency of application and environmental conditions. Zhou et al. (2009) and Liu et al. (2010) determined that Saccharomyce cerevisae and Bacillus subtilis which are two of the microorganisms constituting the kefir grains had beneficial effects on the survival rate. The higher survival rates in the probiotic-treated group could also be attributed to their increased potential to respond to and better tolerate the harmful conditions possibly encountered in the culture tanks, probably due to higher induced HSP70 levels, as reported earlier by Carnevali (2006) in sea bream (Sparus aurata). Tovar-Ramírez et al. (2010) found an increase of the final mean weight of sea bass larvae fed a yeast-supplemented diet as reported by Lara et al. (2003) who suggested that yeast (S. cerevisae) was an appropriate growth-stimulating additive in tilapia cultivation where higher survival, SGR, PER and FCR values were obtained in probiotic treatments with Streptococcus faecium and Lactobacillus acidophilus. Similarly, Al-Dohail et al. (2009) reported that significantly better (P<0.05) growth performance was

7778

Afr. J. Biotechnol.

Figure 1. Changes in mean IgM levels of S. coruhensis in the control and fed diet D1, D2 and D3.

observed in Clarias gariepinus fingerling maintained on the diet supplemented with L. acidophilus, Similar and Carnevali (2006) who reported that growth in sea bass juvenile was significantly (P<0.05) better in the treated groups than the control when Lactobacillus delbrueckii was used as a probiotic via rotifer carriers and Artemia nauplii for 70 days. Wang and Zirong (2006), Noh et al. (1994), Bogut et al. (1998) and Yanbo and Zirong (2006) all reported significantly better growth performance and FCR in common carp when fed diets enriched with probiotics. In contrast, WachĂŠ et al. (2006) reported that neither survival nor growth was significantly affected by the probiotic treatment with Saccharomyces cerevisiae in another study, in rainbow trout (Onchoryncus mykiss). Similarly, on the effectiveness of commercial probiotics in northern white shrimp Penaeus monodon ponds Shariff et al. (2001) reported that survival rate did not increase in probiotic-induced groups compared to the control group. In the present study, there was only a rise in growth performance in Coruh trout but not at significant level by feeding dietary kefir, for a period of 4 months. Our results which are similar to those reported by Shariff et al. (2001) and WachĂŠ et al. (2006) indicated that dietary kefir did not affect growth and survival of fish. It was not possible to discriminate the contribution of yeast among the effect on growth (Gatesoupe, 2007). The growth performance may be affected by the other environmental conditional, especially by the bacterial bloom on the culture environment (Can et al., 2010). This study was conducted in winter period when the bacterial activation is low. The pathogen effects may be possible to observe due to high activation of pathogenic bacteria if the study is conducted in summer period. Moreover, the findings

may change if the study repeated by enhancing microbiological challenge tests. IgM is the main immunoglobulin present in fish (Watts et al., 2001) and probiotics also modulate various immunological parameters in teleosts (Nayak, 2010). The effects of probiotics have been reported to stimulate the immune system in both in vitro and in vivo studies (Furukawa et al., 1991; Osada et al., 1994; Irianto and Austin, 2002; Raida et al., 2003; Panigrahi et al., 2005). Assem and El-Zaeem (2005) and Panigrahia et al. (2005) suggested that increased total immunoglobulin concentration could be due to an increased immune response in the probiotic group, induced by the presence of L. acidophilus. The authors reported higher immunoglobulin levels in the blood plasma of rainbow trout when lactic acid bacteria Lactobacillus rhamnosus JCM 1136 were supplemented in the diet of the fish. AlDohail et al. (2009) reported that total immunoglobulin in African catfish (Clarias gariepinus) (Burchell, 1822) with two probiotic bacteria additives to fish diet was significantly higher (P<0.05) in fish fed the probiotic supplemented diet than in the control diet over the 12week culture period. Reyes-Becerril et al. (2008) observed a significantly increase (P = 0.004) on immunoglobulin M level in recovered leopard groupers. In contrast, Balcazar et al. (2007) only found rise in immunoglobulin level in Salmo trutta but not at significant level by feeding LAB groups of probiotics, which are Lactococcus lactis ssp. lactis, Lactobacillus sakei and Leuconostoc mesenteroides, supplemented at106 CFU/g feed for a period of 2 weeks. Our results indicate that increased levels of serum IgM levels were detected with kefir supplemented diets (Diet 1 and 2) similarly to those

Can et al.

reported earlier in grouper (Mycteroperca rosacea) (Reyes-Becerril et al., 2008), African catfish (Clarias gariepinus) (Al-Dohail et al., 2009) and rainbow trout (Oncorhynchus mykiss) (Panigrahia et al., 2005), which were fed with basal control and probiotic supplemented diets. Previous study by Rea et al. (1996) indicated that kefir 9 8 grains contained (cfu/ml) 10 lactococci, 10 6 5 leuconostocs, 10 lactobacilli, 10 acetic acid bacteria and 106 yeasts. In another study, Güven et al. (2003) reported the averages of the total mesophilic aerobic colony counts, lactic acid bacteria, lactic streptococci, enterococci, and yeasts were found to be 1.04 × 109, 9.87 × 108, 4.38 ×108, 7.80 × 104 and 1.26 × 105 CFU/ml, respectively. Our findings in this study showed a bit difference. The microbial content of kefir grains depends primarily on their source. It has been reported that kefir grains contain lactobacilli, lactococci and yeast, and sometimes acetic acid bacteria, depending on the source or country of origin (Guzel-Seydim et al., 2005). In conclusion, diets contained different levels of kefir affected the immunoglobulin concentrations in S. coruhensis but not growth and survival rate. Therefore, our results indicate kefir has the potential to be a promising probiotic and kefir as a probiotic can be used an integral part of the culture practices for improving growth and disease resistance. Further studies are under way to elucidate kefir effects on growth and IgM activity on aquaculture production.. ACKNOWLEDGEMENT The authors wish to thank Dr. Ilker Zeki KURTOGLU for his efficient technical contribution towards conducting of the experiments. REFERENCES Al-Dohail MA, Hashim R, Aliyu-Paiko M (2009). Effects of the probiotic, Lactobacillus acidophilus, on the growth performance, haematology parameters and immunoglobulin concentration in African Catfish (Clarias gariepinus, Burchell 1822) fingerling. Aquac. Res. 40: 16421652. Assem SS, El-Zaeem SY (2005). Application of biotechnology in fish breeding II: production of highly immune genetically modified redbelly tilapia, Tilapia zillii. Afr. J. Biotechnol. 4: 449-459. Balcazar JL, de Blas I, Ruiz-Zarzuela I, Vendrell D, Calvo AC, Marquez I, Girones O, Muzquiz JL (2007). Changes in intestinal microbiota and humoral immune response following probiotic administration in brown trout (Salmo trutta). Brit. J. Nutr i. 97: 522-7. Bogut I, Milakovic Z, Bukvic Z, Brkicand S, Zimmer R (1998). Influence of probiotic Streptococcus faecium M74 on growth and content of intestinal microfllora in carp Cyprinus carpio. Czech J. Anim. Sci. 43: 231-235. Can E (2001). Effect of Probiotic Products on Growth of European Sea bass (Dicentrarchus Labrax). Ege University, Graduate School of Natural and Applied Science, Master of Science Thesis. Can E, Saka S, Firat K (2010). Disinfection of Gilthead Sea Bream (Sparus aurata), Red Porgy (Pagrus pagrus), and Common Dentex (Dentex dentex) Eggs from Sparidae with Different Disinfectants. Kafkas Univ. Vet. Fak. 16 (2): 299-306.

7779

Carnevali O, Vivo L, Sulpizio R, Gioacchini GI, Olivotto I, Silvi S, Cresci A (2006). Growth improvement by probiotic in European sea bass juveniles (Dicentrarchus labrax, L.), with particular attention to IGF-1, myostatin and cortisol gene expression. Aquaculture, 258: 430-438. Cenesiz SA, Devrim K, Kamber U, Sozmen M (2008). The effect of kefir on glutathione (GSH), malondialdehyde (MDA) and nitric oxide (NO) levels in mice with colonic abnormal crypt formation (ACF) induced by azoxy-methane (AOM). Deut. Tıerarztl. Woch. (DTW), 115: 15-19. Cevikbas A, Yemni E, Ezzedenn FW, Yardimici T (1994). Antitumoural, antibacterial and antifungal activities of kefir and kefir grain. Phytother. Res. 8: 78-82. Duston J, Astatkie T, Murray SB (2007). Effect of salinity at constant 10 °C on grow-out of anadromous Arctic charr from Labrador. Aquaculture, 273: 679-686. Ekici S, Diler Ö, Didinen BI, Kubilay A (2011). Balıklardan İzole Edilen Bakteriyel Patojenlere Karşı Bazı Bitkisel Uçucu Yağlarının Antibakteriyal Aktivitesi. Kafkas Univ. Vet. Fak. 17: (Suppl A),47-54. Furukawa N, Matsuoka A, Takahashi T, Yamanaka Y (1990). Effects of orally administered yogurt and kefir on tumor growth in mice. J. Jpn. Soc. Food Sci. Technol. 43: 450-453. Furukawa N, Matsuoka A, Takahashi T, Yamanaka Y (1991). Effects of fermented milk on the delayed-type hypersensitivity response and survival in mice bearing Meth- Anim. Sci. Tech. (Japan), 62: 579-585. Gatesoupe FJ (1999). The use of probiotics in aquaculture: Review. Aquaculture 180: 147-165. Gatesoupe FJ (2007). Live yeasts in the gut: natural occurrence, dietary introduction, and their effects on fish health and development. Aquaculture, 267: 20-30. Gomez-Gil B, Roque A, Turnbull JF (2000). The use and selection of probiotic bacteria for use in the culture of larval aquatic organisms. Aquaculture 191: 259-270. Güven A, Güven A, Gülmez M (2003). The Effect of Kefir on the Activities of GSH-Px, GST, CAT, GSH and LPO Levels in Carbon Tetrachloride-Induced Mice Tissues. J. Vet. Med. B 50: 412-416. Guzel-Seydim Z, Wyffels JT, Seydim AC, Greene AK (2005) Turkish kefir and kefir grains: microbial enumeration and electron microscopic observation. Int. J. Daıry Technol. 58: 25-29. Hoolihan LK (2001). Prophylactic and therapeutic use of probiotics: a review. J. Am. Diet. Assoc. 101: 220-238. Harrigan FW, McCance ME (1976). Laboratory Methods in Food and Dairy Microbiology. Academic Press, London. Irianto A, Austin B (2002). Use of probiotics to control furunculosis in rainbow trout, Oncorhynchus mykiss (Walbaum). J. Fish Dis. 25: 333342. Koroleva NS (1988). Starters for fermented milks. Section 4, Kefir and Kumys Starters. Bulletin of the IDF 227, Chapter 2. International Dairy Federation, Brussels, Belgium. Lara-Flores M, Olvera-Novoa MA, Guzmán-Méndez BE, López-Madrid W (2003). Use of the bacteria Streptococcus faecium and Lactobacillus acidophilus, and the yeast Saccharomyces cerevisiae as growth promoters in Nile tilapia (Oreochromis niloticus). Aquaculture, 216: 193-201. Lim C, Yildirim-Aksoy M, Welker T, Klesius PH, Li MH (2010). Growth Performance, Immune Response, and Resistance to Streptococcus iniae of Nile Tilapia, Oreochromis niloticus, Fed Diets Containing Various Levels of Vitamins C and E. J. World Aquac. Soc. 41: 35-48. Lin MY, Change FJ (2000). Antioxidative effect of intestinal bacteria Bifidobacterium longum ATCC 15708 and Lactobacillus acidophilus ATCC 4356. Digest. Dis. Sci. 45: 1617-1622. Liu JR, Chen MJ, Lin CW (2005). Antimutagenic and antioxidant properties of milk-kefir and soymilk-kefir. J. Agric. Food Chem. 53:2467-74. Liu K, Chiu C, Shiu Y, Cheng W, Liu C (2010). Effects of the probiotic, Bacillus subtilis E20, on the survival, development, stress tolerance, and immune status of white shrimp, Litopenaeus vannamei larvae. Fish Shellfish Immun. 28: 837-844. Magnadóttir B (1998). Comparison of immunoglobulin (IgM) from four fish species. Icelandic Agric. Sci. 12: 47-59. Marshall MV, Cole WM (1985). Methods for making kefir and fermented milks based on kefir. J. Dairy Res. 52: 451-456. Merrifield LD, Dimitroglou A, Foey A, Davies JS, Baker MTR, Bøgwald

7780

Afr. J. Biotechnol.

J, Castex M, Ringø E (2010). The Current Status And Future Focus Of Probiotic and Prebiotic Applications for Salmonids, Aquaculture, 302: 1-18. Nayak SK (2010). Probiotics and immunity: A fish perspective. Fish Shellfish Immun. 29: 2-14. Noh SH, Han K, Won TH, Choi YJ (1994). Effect of antibiotics, enzyme, yeast culture and probiotics on the growth performance of Israeli carp. Kor. J. Anim. Sci. 36:480-486. Ozcan A, Kaya N, Atakisi O, Karapehlivan M, Atakisi E, Cenesiz S (2009). Effect of kefir on the oxidative stress due to lead in rats. J. Appl. Anim. Res. 35: 91-93. Osada K, Nagira K, Teruya K, Tachibana H, Shirahata S, Murakami H(1994). Enhancement of interferon-b production with sphingomyelinimmune response in rainbow trout Oncorhynchus mykiss. Aquaculture, 243: 241-254. Panigrahi A, Kiron V, Kobayashi T, Puangkaew J, Satoh S, Sugita H (2005). The viability of probiotic bacteria as a factor influencing the immune response in rainbow trout Oncorhynchus mykiss. Aquaculture, 243: 241-254. Raida MK, Larsen JL, Nielsen ME, Buchmann K (2003). Enhanced resistance of rainbow trout, Oncorhynchus mykiss (Walbaum), against Yersinia ruckeri challenge following oral administration of Bacillus subtilis and B. licheniformis (BioPlus2B). J.Fish Dis. 26: 495498. Rea MC, Lennartsson T, Dilon P, Drinan FD, Reville WJ, Heapes M, Cogan TM (1996) Irish kefir like grains: their structure, microbial composition and fermentation kinetics. J. Appl. Bacteriol. 81: 83-94. Reyes-Becerril M, Tovar-Ramírez D, Ascencio-Valle F, CiveraCerecedo R, Gracia-López V, Barbosa-Solomieu V (2008). Effects of dietary live yeast Debaryomyces hansenii on the immune and antioxidant system in juvenile leopard grouper Mycteroperca rosacea exposed to stress. Aquaculture, 280: 39-44. Salinas I, Abelli L, Bertoni F, Picchietti S, Roque A, Furones D, Cuesta A, Meseguer J, Esteban MA (2008). Monospecies and multispecies probiotic formulations produce different systemic and local immunostimulatory effects in the gilthead seabream (Sparus aurata L.). Fish Shellfish Immun. 25:114-23. Sharifuzzaman SM, Austin B (2009). Influence of probiotic feeding duration on disease resistance and immune parameters in rainbow trout. Fish Shellfish Immun. 27:440-5. Shariff M, Yusoff FM, Devaraja TN, Srinivasa Rao SP (2001). The effectiveness of a commercial microbial product in poorly prepared tiger shrimp, Penaeus monodon (Fabricius), ponds. Aquac. Res. 32: 181–187.

Suzer C, Coban D, Kamaci HO, Saka S, Firat K, Otgucuoğlu Ö, Küçüksari H (2008). Lactobacillus spp. bacteria as probiotics in gilthead sea bream (Sparus aurata, L.) larvae: effects on growth performance and digestive enzyme activities. Aquaculture, 280: 140145. Tovar-Ramírez D, Mazurais D, Gatesoupe JF, Quazuguel P, Cahu CL, Zambonino-Infante JL (2010). Dietary probiotic live yeast modulates antioxidant enzyme activities and gene expression of sea bass (Dicentrarchus labrax) larvae. Aquaculture, 300: 142-147. Thoreux K, Schmucker DL (2000). Kefir Milk Enhances Intestinal Immunity in Young but Not Old Rats. J. Nutri. 807-812. Turan D, Kottelat M, Engin S (2009). Two new species of trouts, resident and migratory, sympatric in streams of northern Anatolia (Salmoniformes: Salmonidae), Ichthyol. Explor. Freshwaters, 20(4): 333-364. Wache Y, Auffray F, Gatesoupe FJ, Zambonino J, Gayet V, Labbe L, Quentel C (2006). Cross effects of the strain of dietary Saccharomyces cerevisiae and rearing conditions on the onset of intestinal microbiota and digestive enzymes in rainbow trout, Onchorhynchus mykiss, fry. Aquaculture, 258 (1-4): 470-478. Wang Y, Zirong X (2006). Effect of probiotics for common carp (Cyprinus carpio) based on growth performance and digestive enzyme activities. Anim. Feed Sci. Tech. 127: 283-292. Watts M, Munday BL, Burke CM (2001). cDNA sequences and organization of IgM heavy hain genes in two holostean fish. Dev. Comp. Immunol. 19: 153-164. Yanbo W, Zirong X (2006). Effect of probiotics for common carp (Cyprinus carpio) based on growth performance and digestive enzyme activities. Anim. Feed Sci. Tech. 127: 283-292. Zacconi C, Parisi MG, Sarra PG, Dallavalle P, Bottazzi V (1995). Competitive exclusion of Salmonella kedougou in kefir fed chicks. Microbiologie, Aliments, Nutrition, 12: 387-390. Zhou XX, Wang YB, Li WF (2009). Effect of probiotic on larvae shrimp (Penaeus vannamei) based on water quality, survival rate and digestive enzyme activities. Aquaculture, 287: 349-353.

African Journal of Biotechnology Vol. 11(30), pp. 7781-7788, 12 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3719 ISSN 1684–5315 Š 2012 Academic Journals

Full Length Research Paper

Molecular cloning and characterization of a novel Cys2/His2-type zinc finger protein gene from chrysanthemum Qing-Lin Liu1*, Jiao Wu1, Ke-Dong Xu2, Liang-Jun Zhao3 and Hai-Qing Zhang1 1

Department of Ornamental Horticulture, Sichuan Agricultural University, 211 Huimin Road, Wenjiang District, Chengdu, Sichuan 611130, P. R. China. 2 Key Laboratory of Plant Genetics and Molecular Breeding, Department of Life Science, Zhoukou Normal University, East Wenchang Street, Chuanhui District, Zhoukou, Henan 466001, P. R. China. 3 Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, 2 Yuanmingyuan West Road, Haidian District, Beijing 100193, P. R. China. Accepted 27 January, 2012

A novel member of the Cys2/His2-type zinc finger protein gene family, designated DgZFP3, was isolated from chrysanthemum by rapid amplification of cDNA ends (RACE). The DgZFP3 encodes a protein of 248 amino acids, including two conserved Cys2/His2-type zinc finger motifs with a plant-specific QALGGH motif in each zinc finger domain, a B-box (KXKRSKRXR) domain in the N-terminal region as a putative nuclear localization signal (NLS), a L-box (EXEXXAXCLXXL) and an EAR-box (DLNL) at C-terminus. Subcellular localization showed the presence of DgZFP3 in the nucleus. The transcript of DgZFP3 was enriched in roots and leaves than in stems and flowers of the adult chrysanthemum plants. Expression patterns revealed that DgZFP3 was strongly induced by NaCl, drought, cold and abscisic acid (ABA) treatment in the seedlings. We argued that DgZFP3 is a new member of the Cys2/His2-type zinc finger protein gene family, and it may be involved in the plant responses to various stresses. Key words: Chrysanthemum, DgZFP3, gene expression, Cys2/His2-type zinc finger protein. INTRODUCTION Drought, high salinity and temperature stress including low or high temperature are adverse environmental conditions that limit plant growth and development. In response to these adversities, plants can increase tolerance or adaptation to stress conditions via a series of physiological, cellular and molecular processes culminating in stress tolerance. Multiple signal pathways regulate the various abiotic stress responses of plants

*Corresponding author. E-mail: liuqinglin@126.com. Tel/Fax: +86-28-86290881. Abbreviations: ABA, Abscisic acid; CaMV, the cauliflower mosaic virus; NLS, nuclear localization signal; GFP, green fluorescent protein; RACE, rapid amplification of cDNA ends; qRT-PCR, quantitative real-time reverse transcriptasepolymerase chain reaction.

(Shinozaki and Yamaguchi-Shinozaki, 2007; Nakashima et al., 2009). Based on stress signal transduction, transcription factors such as AP2/EREBP, bZIP, NAC, MYB, MYC, WRKY and Cys2/His2-type zinc finger proteins, activate the expression of many stress-related downstream genes, and finally increase tolerance or adaptation to stress conditions in plants (Agarwal et al., 2006; Chinnusamy et al., 2006; Umezawa et al., 2006). Among them, the Cys2/His2-type zinc finger proteins received much attention in the past decade. Since ZPT21 was isolated from petunia(Petunia hybrida), the Cys2/His2-type zinc finger proteins genes have been isolated from a wide variety of plants such as Arabidopsis, rice (Oryza sativa), maize (Zea mays), soybean (Glycine max), wheat (Triticum aestivum), pepper (Capsicum annuum), etc (Baltz et al., 1992; Sakamoto et al., 2000; Kim et al., 2001, 2004; Huang et al., 2007; Kam et al., 2008). Several Cys2/His2-type zinc

7782

Afr. J. Biotechnol.

finger proteins genes such as STZ, SCOF-1, ZPT2-3, DgZFP, etc, have been implicated in the regulation of stress responses (Sakamoto et al., 2000; Kim et al., 2001; Sugano et al., 2003; Mittler et al., 2006, Liu et al., 2010a). However, the Cys2/His2-type zinc finger proteins genes have been studied in only a limited number of plant species. Therefore, it is necessary that more Cys2/His2-type zinc finger proteins genes be identified and characterized to assess more comprehensively, an overall picture of Cys2/His2-type zinc finger proteins genes regulation. Chrysanthemum is an important ornamental plant in the world. However, chrysanthemum-growing areas are subject to extreme drought, high salinity and low temperature, each of which can affect chrysanthemum growth and production. Now, isolation and characterization of novel stress-responsive Cys2/His2-type zinc finger protein genes in chrysanthemum is critical to further our understanding of the molecular mechanisms governing chrysanthemum stress response and tolerance, ultimately leading to enhancement of stress tolerance in chrysanthemum through genetic manipulation. To date, there are few reports on the characterization of the Cys2/His2type zinc finger protein genes from chrysanthemum (Liu et al., 2010a, b). In this study, we isolated a Cys2/His2type zinc finger protein gene from chrysanthemum, designated DgZFP3. Furthermore, the expression of DgZFP3 was induced by salt, drought, cold and abscisic acid (ABA) stresses.

sequenced (Invitrogen, Beijing).

RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR) assay Total RNA from various chrysanthemum tissues was extracted by Trizol reagent (Mylab, Beijing) underlying with the manufacturer’s instructions; putative genomic DNA contamination was removed by DNaseI. The first strand cDNA was synthesized with 1 µg total RNA and 1 µl superscript II enzyme (Invitrogen, USA) according to the manufacturer’s protocol. Quantitative real-time PCR assay was performed using SYBR Green I (TOYOBO, Japan) by a Bio-RAD iCycler iQ5 Machine. The primers were designed to amplify a 130 bp fragment of the DgZFP3 sequence (forward 5'-TTGTTACAGTAGTAAAGATCCGTTT-3' and reverse 5'-CTACACAAACGGATCTTTACTACTG-3'). The chrysanthemum actin gene (GenBank accession number: AB205087) was used as a reference (forward 5'-CCAGTGGTCGTACAACTGGCATT-3' and reverse 5'-CAGTCAGATCACGACCAGCAAGATC-3'.). A 25 μl PCR amplification mixture contained 10 μl SYBR Green PCR master mix, 0.2 μM of each primer and 12 ng cDNA. The PCR was performed as follows: an initial denaturation of 95°C for 3 min, followed by 40 cycles of 10 s at 94°C, 20 s at 58°C, 50 s at 72°C, followed by a final elongation of 10 min at 72°C. The resulting data were represented by means ± standard deviation (SD) of three replicates. Relative expression levels were calculated by the 2- CT method, where CT = (CT, target-CT, actin gene) the indicated time treatment-(CT, target－CT, actin gene ) 0 h treatment (Livak and Schmittgen, 2001). The data were scaled by setting the expression of DgZFP3 in untreated leaves at 0 h as 1.

Subcellular localization MATERIALS AND METHODS Plant materials and stress treatments Chrysanthemum (Dendronthema grandiform) cv. Jinba seedlings growing in greenhouse were exposed to air on filter paper for dehydration, or subjected to 4°C cold stress. For salt and ABA treatments, seedlings were put in 200 mM NaCl, and 0.1 mM ABA solution, respectively. Each experiment contained three biological replicate. All excised leaf samples of controlled and treated plants were taken out for treatment for 0, 1, 3, 6, 12 and 24 h, respectively, and then frozen immediately in liquid nitrogen, and stored at -80°C for RNA extraction.

The DgZFP3 ORF were cloned into the SacI and EcoRI sites of the pSAT6-GFP-N1 vector. This vector contains a modified red-shifted green fluorescent protein (GFP) at EcoRI-NcoI sites. The DgZFP3GFP construct was transformed into onion epidermal cells by particle bombardment as described earlier (Wang and Fang, 2002). The transient expression of the DgZFP3-GFP fusion protein was observed using confocal microscopy.

Sequence alignment and phylogenetic tree analysis The sequence alignment of DgZFP3 and other plant Cys2/His2-type zinc finger proteins amino acid sequences were compared by DNAMAN (ver 6.0) and the phylogenetic tree was constructed by neighbor-joining method with MEGA program (ver 4.1).

Isolation of the DgZFP3 gene For 3' rapid amplification of cDNA ends (RACE), one primer was designed GSP1 (5'-CA(A/G)GCI(T/C)TIGGIGGICA(C/T)-3') corresponding to conversed regions of the amino acid QALGGH. Primers for 5' RACE were: GSP2, 5'-CCGCTAGCTGATGAGGTCGTTGT-3' and GSP3, 5'-TACAAATTGTTGGTGTTGTAGTTGC-3'. The RACE reactions were performed according to the manufacturer’s protocol (Takara RACE cDNA amplification kit, Japan). A single full-length cDNA sequence by combining the 5'-RACE fragment and 3'-RACE fragment was obtained. Finally, a pair of primers (F1, 5'CTCTTAAATTAATAATAATACTCTTA-3' and F2, 5'-CATACAAATTAAATTCACGAAATAC-3') was then designed from the putative 5' and 3' untranslated region (UTR) of the full-length cDNA sequence. The resultant DNA fragments and RACE products were purified by agarose gel and cloned into pMD18-T Vector (Takara) and

RESULTS Isolation of the DgZFP3 gene from chrysanthemum Based on the conserved regions of Arabidopsis ZAT10 and chrysanthemum DgZFP, degenerate primers to conduct the 3'-RACE were proposed to obtain a 643 bp fragment from leaves of chrysanthemum. The full-length cDNAs was obtained by 5'-RACE, and were designated as DgZFP3 (Genbank accession no. JQ040514). Sequence analysis showed that the DgZFP3 cDNA was986 bp in length, including a complete open reading

Liu et al.

7783

Figure 1. Nucleotide and deduced amino acid sequences of DgZFP3 (GenBank accession no. JQ040514). The Cys2/His2-type zinc finger motifs are underlined.

frame of 747 bp flanking with a 5'-UTR of 42 bp and a 3'UTR of 197 bp (Figure 1). The predicted protein of DgZFP3 was composed of 248 amino acids with a calculated molecular mass of 26.36 kDa and its theoretical isoelectric point was 9.27. The predicted amino acid sequence of the DgZFP3 protein was compared with other plant Cys2/His2-type zinc finger proteins from rice, soybean, chrysanthemum, petunia, pepper and Arabidopsis by DNAMAN (Version 6.0) (Figure 2). DgZFP3 contains two conserved Cys2/His2-type zinc finger motifs with a plant-specific QALGGH motif in each zinc finger domain, a B-box (KXKRSKRXR) domain in the N-terminal region as a putative nuclear localization signal (NLS), a L-box (EXEXXAXCLXXL) and an EAR-box (DLNL) at C-

terminus. The plant Cys2/His2-type zinc finger proteins were then retrieved for construction of a neighbor-joining phylogenetic by MEGA 4.1 (Figure 3). Phylogenetic analysis revealed that DgZFP3 was clustered with ZAT10 and DgZFP, and more closely related to DgZFP.

Expression analysis of DgZFP3 The spatial-specific expression of DgZFP3 in different tissues at the adult stage was determined by real-time RT-PCR. The results show that DgZFP3 transcripts is more abundant in roots and leaves than in stems and flowers (Figure 4A). To investigate the expression patterns of DgZFP3 gene

7784

Afr. J. Biotechnol.

Figure 2. Comparison of the deduced amino acid sequence of DgZFP3 and other plant Cys2/His2-type zinc finger proteins. The comparison was conducted by DNAMAN (version 6.0). The Cys2/His2-type zinc finger motif, B-box, L-box and EAR-box are indicated. Arabidopsis thaliana (ZAT10, AF250336; ZAT12, CCA67232.1; AZF1, BBA85108.1; AZF2, AAG10143); Capsium annuunm (CAZFP1, AAQ10954); Glycine max (SCOF1, AAB39368) and Petunia hybrida (ZPT2-3, BAA05079); Oryza sativa (ZFP179, AAL76091.1); chrysanthemum (DgZFP, GQ392036; DgZFP2, JQ031154).

Liu et al.

7785

Figure 3. Phylogenetic tree analysis of DgZFP3 and other plant Cys2/His2-type zinc finger proteins. The tree was constructed by neighbor-joining method with MEGA program (ver 4.1). Branch numbers represent percentage of bootstrap values in 1000 sampling replicates and scale indicates branch lengths. The accession numbers were as follows: ZAT10 (AF250336), ZAT12 (CCA67232.1), AZF1 (BBA85108.1), AZF2 (AAG10143), CAZFP1 (AAQ10954), SCOF1 (AAB39368), ZPT2-3 (BAA05079), ZFP179 (AAL76091.1), DgZFP (GQ392036) and DgZFP2 (JQ031154).

under stress such as high salinity, drought, low temperature and exposure to ABA, the analysis with real-time RT-PCR was performed, respectively. The expression of DgZFP3 was kept at low affected level in normal conditions (Figures 4B to E). For salt stress, the concentration of DgZFP3 mRNA was up-regulated 1 h after 200 mM NaCl treatment and was maintained constant up to 12 h by 200 mM NaCl treatment (Figure 4B). By drought treatment, the expression level of DgZFP3 began to increase after 3 h and gradually accumulated up to 24 h (Figure 4C). The expression of DgZFP3 peaked within 6 h and gradually decreased in response to cold treatment (Figure 4D). The expression of DgZFP3 peaked within 3 h after the beginning of the ABA treatment and gradually decreased by 3 h post imposition of ABA treatment (Figure 4E). Real-time RTPCR analysis revealed that the expression of DgZFP3 could be induced by salt, drought, cold and ABA. Localization of DgZFP3 in the nucleus The deduced amino acid sequence contained a B-box (KXKRSKRXR) domain in the N-terminal region as a putative NLS, suggesting that DgZFP3 might interact with

the cell nuclear system. To examine the subcellular localization of DgZFP3 in living cells, a construct containing DgZFP3 fused in frame with the GFP (DgZFP3-GFP) driven by CaMV 35S promoter was transiently expressing in onion epidermal cells. As shown in Figure 5, confocal microscopic examination shows that the DgZFP3-GFP fusion protein was targeted into the nuclear 4',6-diamidino-2-phenylindole (DAPI) staining, whereas the control GFP alone was distributed in the entire cytoplasm. DISCUSSION Some Cys2/His2-type zinc finger protein genes in plants usually play critical roles in response to abiotic stresses (Ciftci-Yilmaz and Mittler, 2008). A plant Cys2/His2-type zinc finger protein gene termed DgZFP3 from chrysanthemum was isolated and characterized in the present work. Sequence analysis shows that it contained two conserved Cys2/His2-type zinc finger motifs with a plant-specific QALGGH motif in each zinc finger domain, a B-box (KXKRSKRXR) domain in the N-terminal region as a putative nuclear NLS, a L-box (EXEXXAXCLXXL) and an EAR-box (DLNL) at C-terminus. The DgZFP3 was

7786

Afr. J. Biotechnol.

Figure 4. Expression patterns of DgZFP3 in different organs and in response to various treatments. Mean values and standard deviation calculated from triplicated assays. The relative expression of DgZFP3 in untreated leaves was used as CK. (A) Expression patterns of DgZFP3 in roots, stems, leaves and flowers under normal conditions. (B) Salt treatment; (C) drought treatment; (D) cold treatment; (E) ABA treatment.

structurally similar to DgZFP which was isolated from chrysanthemum under high-salt, drought and cold stresses (Liu et al., 2010a). Phylogenetic analysis revealed that DgZFP3 was clustered with ZAT10 and DgZFP, and more closely related to the DgZFP. These results indicate that DgZFP3 is a novel member of the plant Cys2/His2-type zinc finger protein genes family. The subcellular localization of the DgZFP3-GFP fusion protein in the nuclear DAPI staining implied the role of DgZFP3 as a transcription factor. The mRNA expression analysis shows that DgZFP3 substantially induced by the treatment of NaCl, drought, cold, ABA and DgZFP3 may be involved in the abioticstress response via the ABA-dependent pathway. The expression patterns of DgZFP3 were similar to ZPT2-3, ZAT10, ThZF1 and ZFP179 during several different stresses (Sugano et al., 2003; Mittler et al., 2006; Xu et

al., 2007; Sun et al., 2010). Petunia ZPT2-3 and Arabidopsis STZ/ZAT10 containing an EAR-box (DLNL) have exhibited transcription repressive activities by transient analysis in plants (Sugano et al., 2003; Sakamoto et al., 2004). However, several zinc finger proteins containing the EAR-box (DLNL) have exhibited transcriptional activation activity in yeast cells, such as rice ZFP179 and Thellungiella halophila ThZF1 (Xu et al., 2007; Sun et al., 2010). Previous report showed that the EAR-box (DLNL) is directly involved in transcriptional regulatory networks in response to abiotic stresses in plants, and DgZFP3 also contains an EAR-box (DLNL) at its C-terminus. Thus, further experiments are required to identify the possible function of DgZFP3 as a transcription activator or repressor. To our knowledge, this work is the first report on the cloning and expression of a novel Cys2/His2-type zinc

Liu et al.

7787

Figure 5. Subcellular localization of DgZFP3. Transient expression in onion epidermal cells of 35S-GFP and 35S-DgZFP3-GFP translational product was visualized by fluorescence microscopy. The transient vector harboring 35S-GFP and 35S-DgZFP3-GFP cassettes were transformed into onion epidermal cells by particle bombardment. The photos were taken in bright light (A and D), in the dark for GFP images (B and E) and DAPI-stained images (C and F) after incubation for 20 h.

finger protein gene termed DgZFP3 from chrysanthemum. Clarifying the possible functions of DgZFP3 under various stresses will be helpful for the enhancement of stress tolerance in chrysanthemum through genetic manipulation. The important functions of DgZFP3 responding to environmental stimuli in chrysanthemum needs further investigation. ACKNOWLEDGEMENTS This research was supported by the Key Scientific Research Project of Education Department of Sichuan Province (10ZA051) and Sichuan Agricultural University Scientific Fund to Undergraduate Research and Innovation Projects (04050838). We thank Prof. Tao Wang (State Key Laboratories of AgroBiotechnology, China Agricultural University) for providing the pSAT6GFP-N1 vector. REFERENCES Agarwal PK, Agarwal P, Reddy MK, Sopory SK (2006). Roles of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 25: 1263-1274. Baltz R, Domon C, Pillay DTN, Steinmetz A (1992). Characterization of a pollen-specific cDNA from sunflower encoding a zinc finger protein. Plant J. 2: 713-721. Chinnusamy V, Zhu J, Zhu JK (2006). Gene regulation during cold acclimation in plants. Physiol Plant. 126: 52-61. Ciftci-Yilmaz S, Mittler R (2008). The zinc finger network of plants. Cell

Mol. Life Sci. 65: 1150-1160. Huang J, Yang X, Wang MM, Tang JH, Ding LY, Shen Y, Zhang HS (2007). A novel rice C2H2-type zinc finger protein lacking DLNbox/EAR-motif plays a role in salt tolerance. Biochimica et Biophysica Acta. 1769: 220-227. Kam J, Gresshoff P, Shorter R, Xue GP (2008). The Q-type C2H2 zinc finger subfamily of transcription factors in Triticum aestivum is predominantly expressed in roots and enriched with members containing an EAR repressor motif and responsive to drought stress. Plant Mol. Biol. 67: 305-322. Kim JC, Lee SH, Cheong YH, Yoo CM, Lee SI, Chun HJ, Yun DJ, Hong JC, Lee SY, Lim CO, Cho MJ (2001). A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants. Plant J. 25: 247-259. Kim SH, Hong KH, Lee SC, Sohn KH, Jung HW, Hwang BK (2004). CAZFP1, Cys2/His2-type zinc-finger transcription factor gene functions as a pathogen-induced early-defense gene in Capsicum annuum. Plant Mol. Biol. 55: 883-904. Liu QL, Xu KD, Ma, N, Zeng L, Zhao LJ (2010a). Isolation and functional characterization of DgZFP: a gene encoding a Cys2/His2type zinc finger protein in chrysanthemum. Mol. Biol. Rep. 37: 11371142. Liu QL, Xu KD, Zeng L, Ma N, Zhao LJ (2010b). Molecular characterization and expression of DgZFP1, a gene encoding a single zinc finger protein in chrysanthemum. Afr. J. Biotechnol. 9(15): 2210-2215. Livak K, Schmittgen T (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-(Delta Delta C(T)) method. Methods, 25: 402-408. Mittler R, Kim Y, Song L, Coutu J, Coutu A, Ciftci-Yilmaz S, Lee H, Stevenson B, Zhu JK (2006). Gain- and loss-of-function mutations in Zat10 enhance the tolerance of plants to abiotic stress. FEBS Lett. 580: 6537-6542. Nakashima K, Ito Y, Yamaguchi-Shinozaki K (2009). Transcriptional regulatory networks in response to abiotic stresses in Arabidopsis and grasses. Plant Physiol. 149: 88-95. Sakamoto H, Araki T, Meshi T, Iwabuchi M (2000). Expression of a

7788

Afr. J. Biotechnol.

subset of the Arabidopsis Cys2/His2-type zinc-finger protein gene family under water stress. Gene. 248: 23-32. Sakamoto H, Maruyama K, Sakuma Y, Meshi T, Iwabuchi M, Shinozaki K, Yamaguchi-Shinozaki K (2004). Arabidopsis Cys2/His2-type zincfinger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions. Plant Physiol.136: 27342746. Shinozaki K, Yamaguchi-Shinozaki K (2007). Gene networks involved in drought stress response and tolerance. J. Exp. Bot. 58: 221-227. Sugano S, Kaminaka H, Rybka Z, Catala R, Salinas J, Matsui K, OhmeTakagi M, Takatsuji H (2003). Stress-responsive zinc finger gene ZPT2-3 plays a role in drought tolerance in petunia. Plant J. 36: 830841. Sun SJ, Guo SQ, Yang X, Bao YM, Tang HJ, Sun H, Huang J, Zhang HS (2010). Functional analysis of a novel Cys2/His2-type zinc finger protein involved in salt tolerance in rice. J. Exp. Bot. 61: 2801-2818.

Umezawa T, Fujita M, Fujita Y, Yamaguchi-Shinozaki K, Shinozaki K (2006). Engineering drought tolerance in plants: discovering and tailoring genes to unlock the future. Curr. Opin. Biotechnol. 17: 113122. Wang GL, Fang HY (2002). Gene engineering in plant; 2nd edition. Press of Science, Beijing, pp. 734-736. Xu S, Wang X, Chen J (2007). Zinc finger protein 1 (ThZF1) from salt cress (Thellungiella halophila) is a Cys-2/His-2-type transcription factor involved in drought and salt stress. Plant Cell Rep. 26: 497506.

UPCOMING CONFERENCES 2012 International Conference on Biotechnology and Food Engineering ICBFE 2012 Dubai, UAE. August 4-5, 2012

15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012

Conferences and Advert August 2012 International Conference on Biotechnology and Food Engineering (ICBFE 2012) Dubai, UAE, 4 Aug 2012 September 2012 Agricultural Biotechnology International Conference (ABIC2012), Christchurch, New Zealand, 1 Sep 2012 15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012 October 2012 Biotechnology and Bioinformatics Symposium, Provo, USA, 25 Oct 2012

African Journal of

Biotechnology Related Journals Published by Academic Journals ■ ■ ■ ■ ■ ■

Journal of Evolutionary Biology Research Journal of Yeast and Fungal Research Journal of Brewing and Distilling African Journal of Biochemistry Research African Journal of Food Science African Journal of Plant Science