African Journal of Biotechnology - 17 April, 2012 Issue by Academic Journals

African Journal of

Biotechnology Volume 11 Number 31 ISSN 1684-5315

17 April, 2012

ABOUT AJB The African Journal of Biotechnology (AJB) is published bi-weekly (one volume per year) by Academic Journals. African Journal of Biotechnology (AJB) a new broad-based journal, is an open access journal that was founded on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed.

Submission of Manuscript Submit manuscripts as e-mail attachment to the Editorial Office at: ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com. A manuscript number will be mailed to the corresponding author shortly after submission. For all other correspondence that cannot be sent by e-mail, please contact the editorial office (at ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com). The African Journal of Biotechnology will only accept manuscripts submitted as e-mail attachments. Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given the last name of the first author.

Editors George Nkem Ude, Ph.D Plant Breeder & Molecular Biologist Department of Natural Sciences Crawford Building, Rm 003A Bowie State University 14000 Jericho Park Road Bowie, MD 20715, USA N. John Tonukari, Ph.D Department of Biochemistry Delta State University PMB 1 Abraka, Nigeria Prof. Dr. AE Aboulata Plant Path. Res. Inst., ARC, POBox 12619, Giza, Egypt 30 D, El-Karama St., Alf Maskan, P.O. Box 1567, Ain Shams, Cairo, Egypt Dr. S.K Das Department of Applied Chemistry and Biotechnology, University of Fukui, Japan Prof. Okoh, A. I Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and Microbiology, University of Fort Hare. P/Bag X1314 Alice 5700, South Africa Dr. Ismail TURKOGLU Department of Biology Education, Education Faculty, Fırat University, Elazığ, Turkey Prof T.K.Raja, PhD FRSC (UK) Department of Biotechnology PSG COLLEGE OF TECHNOLOGY (Autonomous) (Affiliated to Anna University) Coimbatore-641004, Tamilnadu, INDIA. Dr. George Edward Mamati Horticulture Department, Jomo Kenyatta University of Agriculture and Technology, P. O. Box 62000-00200, Nairobi, Kenya.

Dr Helal Ragab Moussa Bahnay, Al-bagour, Menoufia, Egypt. Dr VIPUL GOHEL Flat No. 403, Alankar Apartment, Sector 56, Gurgaon122 002, India. Dr. Sang-Han Lee Department of Food Science & Biotechnology, Kyungpook National University Daegu 702-701, Korea. Dr. Bhaskar Dutta DoD Biotechnology High Performance Computing Software Applications Institute (BHSAI) U.S. Army Medical Research and Materiel Command 2405 Whittier Drive Frederick, MD 21702 Dr. Muhammad Akram Faculty of Eastern Medicine and Surgery, Hamdard Al-Majeed College of Eastern Medicine, Hamdard University, Karachi. Dr. M.MURUGANANDAM Departtment of Biotechnology St. Michael College of Engineering & Technology, Kalayarkoil, India. Dr. Gökhan Aydin Suleyman Demirel University, Atabey Vocational School, Isparta-Türkiye, Dr. Rajib Roychowdhury Centre for Biotechnology (CBT), Visva Bharati, West-Bengal, India. Dr.YU JUNG KIM Department of Chemistry and Biochemistry California State University, San Bernardino 5500 University Parkway San Bernardino, CA 92407

Editorial Board Dr. Takuji Ohyama Faculty of Agriculture, Niigata University

Dr. Mehdi Vasfi Marandi University of Tehran

Dr. FÜgen DURLU-ÖZKAYA Gazi Üniversity, Tourism Faculty, Dept. of Gastronomy and Culinary Art

Dr. Reza Yari Islamic Azad University, Boroujerd Branch

Dr. Zahra Tahmasebi Fard Roudehen branche, Islamic Azad University

Dr. Tarnawski Sonia University of Neuchâtel – Laboratory of Microbiology

Dr. Albert Magrí Giro Technological Centre

Dr. Ping ZHENG Zhejiang University, Hangzhou, China. Prof. Pilar Morata University of Malaga

Dr. Greg Spear Rush University Medical Center

Dr. Mousavi Khaneghah College of Applied Science and Technology-Applied Food Science, Tehran, Iran.

Prof. Pavel KALAC University of South Bohemia, Czech Republic.

Dr. Kürsat KORKMAZ Ordu University, Faculty of Agriculture, Department of Soil Science and Plant nutrition

Dr. Tugay AYAŞAN Çukurova Agricultural Research Institute, PK:01321, ADANA-TURKEY.

Dr. Shuyang Yu Asistant research scientist, Department of Microbiology, University of Iowa Address: 51 newton road, 3-730B BSB bldg.Tel：+319-3357982, Iowa City, IA, 52246, USA.

Dr. Binxing Li E-mail: Binxing.Li@hsc.utah.edu

Dr Hsiu-Chi Cheng National Cheng Kung University and Hospital.

Dr. Kgomotso P. Sibeko University of Pretoria, South Africa.

Dr. Jian Wu Harbin medical university , China.

Instructions for Author Electronic submission of manuscripts is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Arial font). The cover letter should include the corresponding author's full address and telephone/fax numbers and should be in an e-mail message sent to the Editor, with the file, whose name should begin with the first author's surname, as an attachment. Article Types Three types of manuscripts may be submitted: Regular articles: These should describe new and carefully confirmed findings, and experimental procedures should be given in sufficient detail for others to verify the work. The length of a full paper should be the minimum required to describe and interpret the work clearly. Short Communications: A Short Communication is suitable for recording the results of complete small investigations or giving details of new models or hypotheses, innovative methods, techniques or apparatus. The style of main sections need not conform to that of full-length papers. Short communications are 2 to 4 printed pages (about 6 to 12 manuscript pages) in length. Minireview: Submissions of mini-reviews and perspectives covering topics of current interest are welcome and encouraged. Mini-reviews should be concise and no longer than 4-6 printed pages (about 12 to 18 manuscript pages). Mini-reviews are also peer-reviewed.

Regular articles All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title page. The Title should be a brief phrase describing the contents of the paper. The Title Page should include the authors' full names and affiliations, the name of the corresponding author along with phone, fax and E-mail information. Present addresses of authors should appear as a footnote. The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. The Abstract should be 100 to 200 words in length.. Complete sentences, active verbs, and the third person should be used, and the abstract should be written in the past tense. Standard nomenclature should be used and abbreviations should be avoided. No literature should be cited. Following the abstract, about 3 to 10 key words that will provide indexing references should be listed. A list of non-standard Abbreviations should be added. In general, non-standard abbreviations should be used only when the full term is very long and used often. Each abbreviation should be spelled out and introduced in parentheses the first time it is used in the text. Only recommended SI units should be used. Authors should use the solidus presentation (mg/ml). Standard abbreviations (such as ATP and DNA) need not be defined.

Review Process All manuscripts are reviewed by an editor and members of the Editorial Board or qualified outside reviewers. Authors cannot nominate reviewers. Only reviewers randomly selected from our database with specialization in the subject area will be contacted to evaluate the manuscripts. The process will be blind review. Decisions will be made as rapidly as possible, and the journal strives to return reviewersâ&#x20AC;&#x2122; comments to authors as fast as possible. The editorial board will re-review manuscripts that are accepted pending revision. It is the goal of the AJB to publish manuscripts within weeks after submission.

The Introduction should provide a clear statement of the problem, the relevant literature on the subject, and the proposed approach or solution. It should be understandable to colleagues from a broad range of scientific disciplines.

Materials and methods should be complete enough to allow experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. Capitalize trade names and include the manufacturer's name and address. Subheadings should be used. Methods in general use need not be described in detail.

Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the authors' experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. Discussion, speculation and detailed interpretation of data should not be included in the Results but should be put into the Discussion section. The Discussion should interpret the findings in view of the results obtained in this and in past studies on this topic. State the conclusions in a few sentences at the end of the paper. The Results and Discussion sections can include subheadings, and when appropriate, both sections can be combined. The Acknowledgments of people, grants, funds, etc should be brief. Tables should be kept to a minimum and be designed to be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes. Each table should be on a separate page, numbered consecutively in Arabic numerals and supplied with a heading and a legend. Tables should be self-explanatory without reference to the text. The details of the methods used in the experiments should preferably be described in the legend instead of in the text. The same data should not be presented in both table and graph form or repeated in the text. Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, TIFF, JPEG or Powerpoint before pasting in the Microsoft Word manuscript file. Tables should be prepared in Microsoft Word. Use Arabic numerals to designate figures and upper case letters for their parts (Figure 1). Begin each legend with a title and include sufficient description so that the figure is understandable without reading the text of the manuscript. Information given in legends should not be repeated in the text. References: In the text, a reference identified by means of an author‘s name should be followed by the date of the reference in parentheses. When there are more than two authors, only the first author‘s name should be mentioned, followed by ’et al‘. In the event that an author cited has had two or more works published during the same year, the reference, both in the text and in the reference list, should be identified by a lower case letter like ’a‘ and ’b‘ after the date to distinguish the works. Examples: Smith (2000), Blake et al. (2003), (Kelebeni, 1983), (Chandra and Singh,1992),(Chege, 1998; Steddy, 1987a,b;

Gold, 1993,1995), (Kumasi et al., 2001) References should be listed at the end of the paper in alphabetical order. Articles in preparation or articles submitted for publication, unpublished observations, personal communications, etc. should not be included in the reference list but should only be mentioned in the article text (e.g., A. Kingori, University of Nairobi, Kenya, personal communication). Journal names are abbreviated according to Chemical Abstracts. Authors are fully responsible for the accuracy of the references. Examples: Diaz E, Prieto MA (2000). Bacterial promoters triggering biodegradation of aromatic pollutants. Curr. Opin. Biotech. 11: 467-475. Dorn E, Knackmuss HJ (1978). Chemical structure and biodegradability of halogenated aromatic compounds. Two catechol 1, 2 dioxygenases from a 3chlorobenzoate-grown Pseudomonad. Biochem. J. 174: 73-84. Pitter P, Chudoba J (1990). Biodegradability of Organic Substances in the Aquatic Environment. CRC press, Boca Raton, Florida, USA. Alexander M (1965). Biodegradation: Problems of Molecular Recalcitrance and Microbial Fallibility. Adv. Appl. Microbiol. 7: 35-80. Boder ET, Wittrup KD (1997). Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotechnol. 15: 537-553.

Short Communications Short Communications are limited to a maximum of two figures and one table. They should present a complete study that is more limited in scope than is found in full-length papers. The items of manuscript preparation listed above apply to Short Communications with the following differences: (1) Abstracts are limited to 100 words; (2) instead of a separate Materials and Methods section, experimental procedures may be incorporated into Figure Legends and Table footnotes; (3) Results and Discussion should be combined into a single section. Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF file. Page proofs are considered to be the final version of the manuscript. With the exception of typographical or minor clerical errors, no changes will be made in the manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that the editorial office waive some of the handling fee under special circumstances. Copyright: ÂŠ 2012, Academic Journals. All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary bibliographic citation, including author attribution, date and article title. Submission of a manuscript implies: that the work described has not been published before (except in the form of an abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the publisher. Disclaimer of Warranties In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or not advised of the possibility of damage, and on any theory of liability. This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or information in this publication or of any other publication to which it may be linked.

African Journal of Biotechnology Table of Contents:

Volume 11

Number 31 17 April, 2012,

International Journal of Medicine and Medical Sciences ences ARTICLES

. Research Articles GENETICS AND MOLECULAR BIOLOGY Polyploidy levels of Chinese large-flower chrysanthemum determined by flow cytometry Xinwei Guo, Chang Luo, Zhongyi Wu, Xiuhai Zhang, Xi Cheng, Conglin Huang

7789

Characterization of the fertilization independent endosperm (FIE) gene from soybean Yingkao Hu, Ya Gao, Hongliang Xu, Jinyue Sun, Yaxuan Li and Yueming Yan

7795

Molecular cloning and characterization of a putative OGG_N domain from the camel, Camelus dromedarius Farid Shokry Ataya, Mohammad Saud Alanazi, Dalia Fouad, Hesham Mahmoud Saeed, and Mohammad Bazzi

7803

Segregation and expression of transgenes in the progenies of Bttransgenic rice crossed to conventional rice varieties Zhonghua Wang, Chao Yu and Leyu Jiang

7812

The characterization of cytoplasmic ribosomal protein genes in microsporidian Nosema bombycis Genome Handeng Liu, Guoqing Pan, Tian Li, Wei Huang and Zeyang Zhou

7819

PLANT AND AGRICULTURAL TECHNOLOGY Impact of crop residues on seed germination of native desert plants grown as weeds Ali El Keblawy

7836

Table of Contents:

Volume 11

Number 31

17 April, 2012

ences ARTICLES Efficient callus induction and indirect plant regeneration from various tissues of Jatropha curcas Zhong-Guang Li, Ming Gong, Shi-Zhong Yang and Wei-Biao Long

7843

Allelopathic activities of Jasminum officinale f. var. grandiflorum (Linn.) Kob.: Inhibition effects on germination, seed imbibition, and α-amylase activity induction of Echinochloa crus-galli (L.) Beauv. Montinee Teerarak, Chamroon Laosinwattana, Patchanee Charoenying and Hisashi Kato-Noguchi

7850

Light-sensitive features of seed germination in the invasive species Ageratina adenophora (syn. Eupatorium adenophorum) in China Huimei Wang, Yong Jiang, Yanhong Li, Wenjie Wang and Zu Yuangang

7855

7864

Genetic map construction and quantitative trait locus (QTL) analysis on growth-related traits in common carp (Cyprinus carpio L.) Jun Wang, Anyuan He, Yuqing Ma, Chenghui Wang

7875

In planta transformation of rice (Oryza sativa) using thaumatin-like protein gene for enhancing resistance to sheath blight Gita Naseri, Mohammad Mehdi Sohani, Andisheh Pourmassalehgou and Somayeh Allahi

Copper and manganese content of the leaves of pepper (Capsicum annuum L.) grown on different soil types Milena Djurić, Senad Murtić, Gordana Šekularac, Nura Rešidović, Vesna Milić, Jasmina Zdravković and Ljiljana Bošković-Rakočević

7885

7894

Table of Contents:

Volume 11

Number 31

17 April, 2012

ences ARTICLES Selection of alfalfa (Medicago sativa L.) cultivars for salt stress tolerance using germination indices Asieh Soltani, Zahra Khodarahmpour, Ali Ashraf Jafari and Shahram Nakhjavan

Plant regeneration and stimulation of in vitro flowering in Eruca sativa Mill. Madan Mohan Sharma, Mukta Dhingra, Anju Dave and Amla Batra

7899

7906

ENVIRONMENTAL BIOTECHNOLOGY Estimation of coliform contamination rate and impact of environmental factor on bacterial quality of tube well water supplies in Khorramdarreh County, Iran Amini Bahram, Baghchesaraei Hamid and Nasiri Akram

Purification and characterization of three laccase isozymes from the white rot fungus Trametes sp. HS-03 Weiyun Guo, Zhaoyang Yao, Chenyan Zhou, Duan Li, Hongli Chen, Qiang Shao, Zongyi Li and Huigen Feng

Salinity effect and seed priming treatments on the germination of Suaeda salsa in the tidal marsh of the Yellow River estuary H.L. Song, Z.G. Sun, X. J. Mou and J.Y. Zhao

7912

7916

7923

INDUSTRIAL MICROBIOLOGY Screening of root nodule bacteria for the production of polyhydroxyalkanoate (PHA) and the study of parameters influencing the PHA accumulation Sreya Kumbhakar, Prabhat Kumar Singh and Ambarish S Vidyarthi

7934

Isolation of polyvinyl chloride degrading bacterial strains from environmental samples using enrichment culture technique Rajashree Patil and U. S. Bagde

7947

Table of Contents:

ences

Volume 11

Number 31

17 April, 2012

ARTICLES

Rapid biosynthesis of cadmium sulfide (CdS) nanoparticles using culture supernatants of Escherichia coli ATCC 8739, Bacillus subtilis ATCC 6633 and Lactobacillus acidophilus DSMZ 20079T Abd El-Raheem R. El-Shanshoury, Sobhy E. Elsilk and Mohamed E. Ebeid

7957

FOOD TECHNOLOGY Effect of X-ray irradiation on the physical and chemical quality of America red globe grape Fenfen Kang, Guy J. Hallman, Yadong Wei, Fanhua Zhang and Zhihong Li

7966

MEDICAL AND PHARMACEUTICAL BIOTECHNOLOGY Effective extraction of cephalosporin C from whole fermentation broth of Acremonium chrysogenum utilizing aqueous two phase systems Amina Wajid, Farnaz Malik, Shazia Shafaat, Shahzad Hussain, Ghazala Parveen, Sabeeha Roohi, Rashid Mahmood, Rafiq A. Channa, Fahadiya Yasin Raja, Humayun Riaz, and Muhammad Ismail

Role of Notch-1 signaling in ethanol induced PC12 apoptosis Yong-qiang Li, Zhen-yu Shi, Bin Liu, Chao-shen Huangfu and Wei-juan Zhang

Study of anti-inflammatory, anti-diabetic, and analgesic activity of Oscillatoria annae extract in rats and mice Perumal Varalakshmi, Rajendran Arunkumar, Loganathan Chanthramohan, Murugan Nagarajan, Thangavelu Vinoth Babu and Nagarajan Pratheeba

7973

7980

7986

Phytochemicals, antioxidant and antibacterial properties of a lichen species Cladonia digitata P. Dzomba, E. Togarepi and C. Musekiwa

7995

Clinical significance of RECK and MMP-9 expression in cutaneous squamous cell carcinoma Qian Wu, Li-jun Hao, Jian-yu Han and Li-jun Wang.

8000

Table of Contents:

Volume 11

Number 31

17 April, 2012

ences ARTICLES FISHERY SCIENCE In Silico characterization of growth hormone from freshwater ornamental fishes: Sequence analysis, molecular modelling and phylogeny Chittaranjan Baruah, Umesh C. Goswami and Dhirendra K. Sharma

8005

BIOTECHNIQUES Plant regeneration studies of Jatropha curcas using induced embryogenic callus from cotyledon explants Tee Chong Siang, Siow Then Soong and Adeline Ting Su Yien

8022

Enhancement of the enzymatic hydrolysis of wheat straw by pretreatment with 1-allyl-3-methylimidazolium chloride ([Amim]Cl) Zhang Zhi-guo and Chen Hong-zhang

8032

ANIMAL SCIENCE Oral vaccination with attenuated Salmonella choleraesuis C500 expressing recombinant UreB and CagA antigens protects mice against Helicobacter pylori J. G. Chen, A. X. Liang, L. Han, J. J. Xiong, A. Z. Guo and L. G. Yang

8038

WOOD TECHNOLOGY Utilization of bio-waste cotton (Gossypium hirsutum L.) stalks and underutilized paulownia (paulownia fortunie) in wood-based composite particleboard Hossein Khanjanzadeh, Ali Akbar Bahmani , Ali Rafighi and Taghi Tabarsa

8045

Full Length Research Paper

Polyploidy levels of Chinese large-flower chrysanthemum determined by flow cytometry Xinwei Guo, Chang Luo, Zhongyi Wu, Xiuhai Zhang, Xi Cheng, Conglin Huang* Beijing Agro-Biotechnology Research Center, Beijing Academy of Agriculture and Forestry Science, Beijing 100097, China. Accepted 22 March, 2012

Flow cytometry was used to determine the ploidy level of 405 Chinese large-flower chrysanthemum (Chrysanthemum morifolium Ramat.) cultivars. Sixty-three cultivars are triploid, 175 cultivars tetraploid, 32 cultivars pentaploid, 46 cultivars hexaploid and 1 cultivar heptaploid. Forty-eight cultivars were then randomly selected for confirmation by chromosome-counting; the results are in agreement with the classification of ploidy level by flow cytometry. Most cultivars are aneuploid. The high percentage of tetraploid and triploid, instead of hexaploid in previous studies, represents the first evidence of low ploidy in large-flower chrysanthemum, which indicated a wider range of ploidy variation in this population. The results also offer further insights to the possible evolution and the regulation of flower size of this large-flower population. Additionally, the combination of flow cytometry and chromosomecounting is proved to be efficient and necessary for large-scale ploidy screening of chrysanthemum. Key words: Chrysanthemum, ploidy level, flow cytometry.

INTRODUCTION The chrysanthemum (Chrysanthemum morifolium Ramat.) originates in China, and is one of the most important flowers in the world. Cultivated chrysanthemum is one the group of chrysanthemum genus, comprising more than 3,000 China native cultivars. Cultivated chrysanthemum is divided into large- and small-flower system, the former refers to cultivars with inflorescence diameter larger than 60 mm (Li and Shao, 1990). Largeflower chrysanthemum is superior to most ornamental flower in terms of abundant diversity in flower type and color, and is regarded as one of two flower spectacle in the world (Chen, 2001). However, their genetic backgrounds as well as genetic relationships are lack of knowledge. Large-flower chrysanthemum has been cultivated for more than 1, 600 years (Zhao et al., 2009). It experienced long-term artificial and natural cross, and folk breeding work consisted of a considerable part of artificial breeding. Thus, few

*Corresponding author. E-mail: conglinhuang@hotmail.com. Tel: +86 10 51503801. Fax: +86 10 51503882.

records were left for us to investigate into its complex genetic backgrounds. Lack of fundamental information has largely limited large-flower chrysanthemum’s further research. Ploidy level of cultivars is thought to be one aspect. The incompatibility within different ploidy background is proved to heavily restrict breeding work (Dai and Chen, 1996) and germplasm evaluation. The basic chromosome number within the genus is x=9 (Dowrick, 1953). Previous findings showed that the chromosome number of largeflower chrysanthemum varies from 45 to about 71, hexaploid and hexaploid-based aneuploid are the most commonly found cytotype (Li et al., 1983; Li and Shao, 1990; Liu and Yang, 2009; Zhu et al., 2011). Aneuploidy variation widely exists and large difference on chromosome number could be generally observed in different root-tip cells of the same individual. Until now, there is still lack of knowledge of ploidy level for most cultivars, which is due to these inherent difficulties with C. morifolium cytogenetic, as well as the lack of powerful high throughput determining means. Ploidy determination of Chinese large-flower chrysanthemum is traditionally performed by chromosome-

7790

Afr. J. Biotechnol.

counting. However, concerning its high level of ploidy, numerous chromosomes and aneuploidy variation, counting is laborious and fraught with inaccuracies. Measurement of the nuclear DNA content by flow cytometry is suggested as an alternative (Dolezel, 1998). The method has been increasingly used for large-scale ploidy screening (Dolezel et al., 2007), and has been proved to have a close relationship with chromosome counting on results (Yagi et al., 2009; Roux et al., 2003; Gamiette et al., 1999). In this study, we aimed to determine the ploidy level of Chinese large-flower chrysanthemum cultivars systematically by flow cytometry, and to develop an efficient system for large-scale ploidy screening of chrysanthemum. The study on ploidy level and high throughput determining means will lead to a better understanding of chrysanthemum’s genetic background and a more efficient work of breeding and germplasm evaluation. MATERIALS AND METHODS Plant materials Four hundred and five Chinese traditional large-flower chrysanthemum cultivars (Chrysanthemum morifolium Ramat) collected from northern China are preserved in the chrysanthemum nursery garden of Beijing academy of agriculture and forestry sciences, Beijing, China. Their source and genetic background is unknown. Young and healthy leaves of stem tips were collected.

Flow cytometric analysis Diploidy Chrysanthemum lavandulifolium was used as reference standard. It was proved by chromosome counting and showed 2n=2x=18 as expected (Figure 1a) (Wang et al., 2010), assuring the reliability of consequent experiments. Samples were prepared according to Dolezel, (1997). About 1 g fresh leaf was chopped with a sharp razor blade in a Petri dish containing 2 ml pre-chilled lysis buffer (Dolezel et al., 2007). The sample was filtered through a 50 μm nylon mesh and centrifuged for 5 min at 800 rpm at 4°C. The supernatant was removed, and nuclei were re-suspended in 200 μL propidium iodide (PI) (50 μg/mL). The sample was then briefly vortexed and stored in the dark at 4°C for 30 min. Flow cytometry analysis on 15,000 cells of each sample was carried out using a FACS-Vantage (Becton-Dicknson, USA) flow cytometry. The standard peak was programmed to appear at about channel 50 at 488 nm. The ploidy level was estimated by comparing the mean fluorescence intensity of nuclei of sample material with that of the reference standard. The measurements are triplicate and results with coefficient of variation (CV, %) lower than 5% are finally accepted.

Chromosome-counts were performed under a phase contrast microscopy (Olympus BH2). At least 30 cells were observed. The most frequent number was finally accepted.

RESULTS Flow cytometric analysis Variation of the ratio of sample and reference largely existed in identical ploidy level (partially showed in Table 1). Based on the obtained results, we conducted the deviation of each ploidy level, and defined triploid as the value (sample/reference ratio) between 1.35 to 1.65; tetraploid as 1.80 to 2.20; pentaploid as 2.30 to 2.70; hexaploid as 2.80 to 3.20; heptaploid as 3.30 to 3.70, and others out of range are classified as uncertainty. According to the above standard, 317 cultivars were preliminarily certained; other eighty-eight were out of range and were classified as uncertainty. With flow cytometric method, 317 cultivars were classified in five clusters corresponding to 3x, 4x, 5x, 6x and 7x ploidy levels (Figure 1). In spite of general variation, the value (sample/reference ratio) for triploid, tetraploid, pentaploid, hexaploid and heptaploid cultivars was basically approximated 1.5:2:2.5:3:3.5, which gave no doubt on the deviation we defined. Sixty-three triploids, one hundred and seventy-five tetraploids, thirty-two pentaploids, fortysix hexaploids and one heptaploid were preliminarily identified. Tetraploid clearly predominated and accounted for 55.21% of all certain cultivars, while the percentage of hexaploid was only 14.51% (Figure 2). Chromosome-counting Forty-eight cultivars were randomly selected for confirmation by chromosome-counting. According to the results of flow cytometric, this random population comprised five triploids, thirty-one tetraploids, six pentaploids, and six hexaploids (Table 1). The chromosomecounting results of forty-eight cultivars are in agreement with the classification of ploidy level by flow cytometry. Most cultivars are aneuploid. The chromosome number of ‘Fengongge’ is 28, that of ‘Fuguifengliu’ is 36, that of ‘Baisongzhen’ is 44 and that of ‘Jinefeitian’ is 53 (Figure 3). The chromosome number ranges from 26 to 29 on triploid level, 33 to 40 on tetraploid level, 44 to 47 on pentaploid level and 50 to 58 on hexaploid level. Therefore, it was demonstrated that the deviation applied in flow cytometric is appropriate.

Chromosome counting In order to verify the results of flow cytometry, 48 cultivars were randomly selected for further determination by chromosomecounting. Young root tips were excised from cuttings, held in ice water for 48 h and then fixed in Carnoy’s solution (3:1 ethanol: glacial acetic acid) at 4°C for 48 h. The fixed root tips were squashed under a glass slide in a drop of 45% glacial acetic acid.

DISCUSSION The reliability and feasibility of ploidy determination of Chinese large-flower chrysanthemum cultivars was carried out with flow cytometry.

Guo et al.

7791

Figure 1. Flow cytometric histogram patterns of nuclei isolated from C. lavandulifolium and typical cultivars of different ploidy. Peak 1 corresponds to nuclei at the G0/G1 phase, while peak 2 corresponds to nuclei at the G 2 phase. Coefficient of variation value (CV, %) of the G0/G1 peaks are also given.

In large-flower chrysanthemum, we found that variation of DNA content within identical ploidy level brought some difficulties to distinguish the two contiguous ploidy levels by flow cytometric. Abundant aneuploidy variation was thought to be one of the reasons; another was the highly complex genetic background. The flow cytometric detection of ploidy is based on a simplified assumption that all the chromosomes have the same DNA content (Roux et al., 2001), which may not be the case in chrysanthemum (Dowrick et al., 1969). Therefore, defining an appropriate deviation on DNA content of each ploidy level which was expressed as ploidy index in this study is important in ploidy determination. In Dioscorea alata L., Obidiegwu et al. (2010) accepted 10% deviation on fluorescence and successfully detected tetraploid, hexaploid and octaploid. But when applied to large-flower chrysanthemum that comprised a series of continuous ploidy, 10% deviation led to an overlap of one high ploidy level by another. So we conducted the deviations of each ploidy level and demonstrated its reliability. Although the ploidy level of 88 cultivars remained a further estimation, we have rapidly locked their distribution and have known they are aneuploids.

It is also suggested that the combination of flow cytometric and chromosome-counting is highly efficient in large-scale ploidy screening for large-flower chrysanthemum. The use of flow cytometric as preliminary screening, and, if need be, chromosome-counting is useful as further estimation. The possible origination of low ploidy large-flower chrysanthemum Through the survey on cytometry of Chinese large-flower chrysanthemum, lower ploidy such as triploid has not been reported so far. Zhu et al. (2011) analyzed the karyotype parameter of 38 Chinese large-flower chrysanthemum cultivars and showed the fewest chromosome number found in ’Mojianrong’ is 46. Even in small-flower chrysanthemum, the fewest chromosome number was reported in Japanese small-flower ‘YS’ with 2n=2x=36 (Endo et al., 2004). The occurrence of triploids and tetraploids indicates a lower ploidy level which exist in large-flower population. What are the evolutionary status of these low ploidy cultivars? Whether they occur before hexaploid; these

7792

Afr. J. Biotechnol.

Table 1. Ploidy level of 48 random selected cultivars of Chinese large-flower chrysanthemum using flow cytometric analysis.

Cultivar name C. morifolium ‘Yudiechi’ C. morifolium ‘Baoxingtangjin’ C. morifolium ‘Lechengchunxue’ C. morifolium ‘Tianxiayipin’ C. morifolium ‘Fengongge’ C. morifolium ‘Pengzeziyan’ C. morifolium ‘Jinhongjiaohui’ C. morifolium ‘Changanyanhuo’ C. morifolium ‘Tangyulongyun’ C. morifolium ‘Laomoju’ C. morifolium ‘Fensongzhen’ C. morifolium ‘Qiufengshuiyue’ C. morifolium ‘Huangjinzhuangshi’ C. morifolium ‘Longshe’ C. morifolium ‘Daidaizhaoxia’ C. morifolium ‘Huanglongge’ C. morifolium ‘Bolinqing’ C. morifolium ‘Xiahui’ C. morifolium ‘Xueyan’ C. morifolium ‘Xishiqiaozhuang’ C. morifolium ‘Mokui’ C. morifolium ‘Feiliuzhixia’ C. morifolium ‘Yunxiahuancai’ C. morifolium ‘Xuridongsheng’ C. morifolium ‘Tangyulongyun’ C. morifolium ‘Tangyushouweng’ C. morifolium ‘Dahongmaoju’ C. morifolium ‘Bihaiyinlong’ C. morifolium ‘Changheluori’ C. morifolium ‘Xintaoranzui’ C. morifolium ‘Chuchishifei’ C. morifolium ‘Taohuahong’ C. morifolium ‘Huangjingyishou’ C. morifolium ‘Yulanhe’ C. morifolium ‘Fuguifengliu’ C. morifolium ‘Feiniaomeiren’ C. morifolium ‘Baisongzhen’ C. morifolium ‘Qingshanbaozhu’ C. morifolium ‘Jinguanling’ C. morifolium ‘Huanshuimingzhu’ C. morifolium ‘Tangyuaoshi’ C. morifolium ‘Qingshangusha’ C. morifolium ‘Hualouyufeng’ C. morifolium ‘Ziyun’ C. morifolium ‘Ziruyi’ C. morifolium ‘Caoanqingdan’ C. morifolium ‘Tangyuhewu’ C. morifolium ‘Jinefeitian’

Ploidy level

Mean value of ploidy index ± SE

CV range

3x 3x 3x 3x 3x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 4x 5x 5x 5x 5x 5x 5x 6x 6x 6x 6x 6x 6x

1.48±0.05 1.52±0.01 1.61±0.03 1.51±0.02 1.50±0.02 2.14±0.02 1.95±0.02 1.94±0.03 1.97±0.03 1.97±0.04 2.13±0.06 2.00±0.04 2.01±0.04 1.84±0.04 2.12±0.01 1.84±0.02 2.01±0.05 1.96±0.03 1.87±0.04 1.99±0.02 2.00±0.03 2.13±0.03 1.98±0.04 1.86±0.04 1.88±0.01 2.14±0.02 1.83±0.02 2.09±0.03 2.11±0.03 1.85±0.05 1.82±0.01 1.87±0.04 2.02±0.03 1.96±0.02 1.91±0.03 1.86±0.02 2.51±0.02 2.45±0.02 2.38±0.06 2.45±0.03 2.44±0.02 2.43±0.03 2.98±0.01 3.03±0.04 2.99±0.02 2.98±0.03 2.82±0.04 2.88±0.02

4.21-4.27 4.36-4.96 4.19-4.27 3.77-3.90 3.49-3.57 3.99-4.04 3.15-3.45 3.35-3.40 3.67-3.81 3.29-4.01 3.49-3.88 3.62-3.72 4.08-4.34 3.86-4.10 3.26-3.50 3.59-3.77 3.70-4.18 3.75-4.00 4.03-4.17 3.67-3.92 3.19-3.25 2.91-3.05 3.33-3.41 4.24-4.37 4.01-4.25 3.22-3.31 3.36-3.84 3.91-4.15 4.38-4.72 3.12-3.24 3.89-4.01 3.65-3.83 3.76-4.01 4.30-4.76 3.75-3.93 3.84-4.01 3.42-3.57 3.46-3.61 3.47-3.64 3.29-3.35 4.14-4.36 3.31-3.82 3.78-4.01 3.60-3.79 4.35-4.63 4.74-4.87 4.54-4.90 3.15-3.33

Guo et al.

60.00%

55.21%

% of total

50.00%

7793

Flow cytometric confirmed by choromosome-counting

40.00% 30.00% 20.00%

19.87% 14.51% 10.09%

10.00%

0.32%

0.00% 3x

5x Ploidy

Figure 2. Ploidy distributions of 317 C. morifolium Ramat cultivars by flow cytometry and chromosome-counting.

Fig.3 Chromosome-counting of C. lavandulifolium and partial cultivars. a C. lavandulifolium (2n=2x=18). b ‘Fengongge’ (2n=28). c ‘Fuguifengliu’ (2n=36). d ‘Baisongzhen’ (2n=44). e ‘Jinefeitian’ (2n=53). Bars=3μm.

are valuable to be studied. It is generally considered that evolution in the genus Chrysanthemum has several rounds of allopolyploidization from low ploidy to high ploidy (Fedorov, 1969). In large-flower chrysanthemum, most previous data of morphological characteristic investigation seem to support the view of evolving from simple to complex. For

petal type, flat petal type is the most popular type (Wang et al., 2010) and is generally considered to be the basic type. Spoon and quilled type are advanced, and they further evolve to other types (Miao et al., 2007). For color, yellow color is primitive. White, purple and red are thought to evolve from yellow sequentially. Orange, pink and complex color form at last (Wang et al., 2010).

7794

Afr. J. Biotechnol.

The origin of cultivated chrysanthemum is still a matter of debate but it is generally accepted that it might be originated by long-term natural and artificial hybridizations within several wild species, which comprised a series of polyploidy namely diploidy, tetraploidy, hexaploidy and others (Kondo et al., 2003). Accordingly, the triploidy and tetraploidy large-flower chrysanthemum may generate from hybridizations within diploid, tetraploid and hexaploid wild species and occur before hexaploidy cultivar. They might act as a transitional population from wild species to hexaploidy cultivar and have a closer relationship with wild species. If so, these new evidence should be of considerable significance to studying the evolution and genetic background of large-flower chrysanthemum. On the other hand, it is also possible that they occur after hexaploidy cultivars. One way may be crossing between hexaploidy cultivar and diploidy wild species. It is suggested that in the genus Chrysanthemum and closely related genus, there are many wild species that are able to cross successfully with modern chrysanthemum (Yang et al., 2010). Another way might be regulated by self-mechanism. In the analysis of karyotype of both traditional and modern large-flower chrysanthemum, Zhu et al. (2011) found that increasing and decreasing of symmetry coexist in modern cultivars. Then they issued the view of multi-direction evolution of karyotype in modern population. It is still unknown whether if the multi-direction mode also exist in ploidy evolution of traditional cultivar. Further evidence needs the support of both cellular and molecular analysis. We preliminarily developed flow cytometric in Chinese large-flower chrysanthemum and detected a low ploidy population predominant with tetraploid for the first time, which provides new insight to the evolution and genetic background of chrysanthemum. Flow cytometry has been suggested to combine with chromosome counting for large ploidy screening in chrysanthemum. REFERENCES Chen JY (2001). Classification system for Chinese flower cultivars. China Forestry Press, Beijing, China. Dai SL, Chen JY (1996). Artificial interspecific cross among seven species of Dendranthema in China. J. Beijing For. Univ. 18: 16-22. Dolezel J, Greilhuber J, Suda J (2007). Estimation of nuclear DNA content in plants using flow cytometry. Nat. Protoc. 2: 2233-2244. Dolezel J (1998). Flow cytometry, its application and potential for plant breeding, in: Lelley T (EDs), Current topics in plant cytogenetics related to plant improvement. Universitätsverlag, Vienna, pp. 80-90. Dolezel J (1997). Application of flow cytometry for the study of plant genomes. J. Appl. Genet. 38: 285-302. Dowrick GJ, El Bayoumi AS (1969). Nucleic acid content and chromosome morphology in Chrysanthemum. Genet. Res. 13: 241250.

Dowrick GJ (1953). The chromosomes of Chrysanthemum, Ⅱ: Garden varieties. Heredity, 7: 59-72. Endo N, Hashimoto H, Yang J, Inada I (2004). Characteristics of F1 progenies obtained by crossing a small-flowered tetraploid garden chrysanthemum, ‘YS’ (2n=36), with hexaploid chrysanthemum cultivars (2n=54). J. Jpn. Soc. Hortic. Sci. 73: 42-50. Fedorov AA (1969). Chromosome numbers of flowering plants. Academu of Scinces of the USSR, V.L. Komarov Botanical Institute, Moscow. Gamiette F, Bakry F, Ano G (1999). Ploidy determination of some yam species (Dioscorea spp.) by flow cytometry and conventional chromosomes counting. Genet. Resour. Crop Evol. 46: 19-27. Kondo K, Abd El-Twab MH, Idesawa R (2003). Genome phylogenetics in Chrysanthemum sensulato, in: Sharma AK, Sharma A (EDs), Plant genome biodiversity and evolution, Vol. 1, Part A. Science Publishers, Enfield, pp. 117-200. Li HJ, Shao JW (1990). Investigation, collection and classification of Chrysanthemum cultivars in China. J. Nanjing Agric. Univ. 13: 30-36. Li MX, Zhang XF, Chen JY (1983). Cytological studies on some Chinese wild Dendranthema species and chrysanthemum cultivars. Acta Hortic. Sinica, 10: 199-206. Liu R, Yang JS (2009). Genetic relationship among 11 wild species and 12 cultivated varieties of Chrysanthemum revealed by ISSR analysis. Genomics Appl. Biol. 28: 874-882. Miao HB, Chen FD, Zhao HB (2007). Genetic relationship of 85 chrysanthemum (Dendranthema × Grandiflora (Ramat.) Kitamura) cultivars revealed by ISSR analysis. Acta Hortic. Sinica, 34: 12431248. Obidiegwu J, Rodriguez E, Ene-Obong E, Loureiro J, Muoneke C, Santos C, Kolesnikova-Allen M, Asiedu R (2010). Ploidy levels of Dioscorea alata L. germplasm determined by flow cytometry. Genet. Resour. Crop Evol. 57: 351-356. Roux N, Toloza A, Radecki Z, Zapata-Arias FJ, Dolezel J (2003). Rapid detection of aneuploidy in Musa using flow cytometry. Plant Cell Rep. 21: 483-490. Wang HB, Chen FD, Chen SM, Fang WM, Zhu XR, Li FT (2010). Investigation of standard chrysanthemum cultivars in six cities of China. J. Plant Genet. Resour. 12: 570-574. Wang RB, Zhang XH, Wu ZY, Huang CL (2010). Common methods of cell chromosome ploidy identification for Chrysanthemum and its application in breeding. J. Anhui Agric. Sci. 38: 12778-12780, 12789. Yagi M, Kimura T, Yamamoto T, Onozaki T (2009). Estimation of ploidy levels and breeding backgrounds in pot camation cultivars using flow cytometry and SSR markers. J. Jpn. Soc. Hortic. Sci. 78: 335-343. Yang DY, Hu X, Liu ZH, Zhao HE (2010). Intergeneric hybridizations between Opisthopappus taihangensis and Chrysanthemum lavandulifolium. Sci. Hortic. 125: 718-723. Zhao HE, Liu ZH, Hu X, Yin JL, Li W, Rao GY, Zhang XH, Huang CL, Anderson N, Zhang QX, Chen JY (2009). Chrysanthemum genetic resources and related genera of chrysanthemum collected in China. Genet. Resour. Crop Evol. 56: 937-946. Zhu ML, Liu QQ, Dai SL (2011). Karyotype analysis of 38 large-flowered chrysanthemum cultivars from China. Chinese Bull. Bot. 46: 447-455.

Full Length Research Paper

Characterization of the fertilization independent endosperm (FIE) gene from soybean Yingkao Hu1*, Ya Gao1, Hongliang Xu1, Jinyue Sun2, Yaxuan Li1 and Yueming Yan1 1

College of Life Sciences, Capital Normal University, Beijing, 100048, China. Plant Biotechnology Institute, National Research Council, Saskatoon, SK, S7N 0W9, Canada.

Accepted 24 January, 2012

Reproduction of angiosperm plants initiates from two fertilization events: an egg fusing with a sperm to form an embryo and a second sperm fusing with the central cell to generate an endosperm. The tryptophan-aspartate (WD) domain polycomb protein encoded by fertilization independent endosperm (FIE) gene, has been known as a repressor of hemeotic genes by interacting with other polycomb proteins, and suppresses endosperm development until fertilization. In this study, one Glycine max FIE (GmFIE) gene was cloned and its expression in different tissues, under cold and drought treatments, was analyzed using both bioinformatics and experimental methods. GmFIE showed high expression in reproductive tissues and was responsive to stress treatments, especially induced by cold. GmFIE overexpression lines of transgenic Arabidopsis were generated and analyzed. Delayed flowering was observed from most transgenic lines compared to that of wild type. Overexpression of GmFIE in Arabidopsis also leads to semi-fertile of the plants. Key words: Polycomb proteins, fertilization independent endosperm (FIE), Glycine max, Arabidopsis thaliana.

INTRODUCTION Dramatic gene expression pattern shifts happen during angiosperm plant reproduction, especially at fertilization when the zygotic process is initiated. Arabidopsis ovule, which generates the female gametophyte, consists of an egg cell, two synergid cells, three antipodal cells, and a central cell (Drews et al., 1998). Double fertilization is initiated when an entering pollen tube discharges two genetically identical sperm cells. Along with this process, four distinct developmental programs are activated and lead to the formation of the embryo, endosperm, seed coat, and mature fruit. The two products of fertilization, embryo and endosperm are formed through distinct developmental patterns. The embryo is the result of fertilization of the egg cell as it passes through five stages: globular, heart, torpedo, walking stick, early maturation, and maturation (Goldberg et al., 1994). The

*Corresponding author. E-mail: yingkaohu@yahoo.com. Tel: +86-10-68901842. Fax: +86-10-68901857. Abbreviations: WD, Tryptophan-aspartate; FIE, fertilization independent endosperm.

endosperm is generated by fertilization of the central cell, which then divides mitotically without cytokinesis to form a syncytium of nuclei that fills the expanding central cell. Subsequently, the endosperm cellularizes to produce large amounts of protein, starch, and lipid to support the development of the embryo (Lopes and Larkins, 1993). However, the balance between embryo and endosperm development can be disturbed by mutation of the fertilization independent endosperm (FIE) gene. FIE encodes a tryptophan-aspartate (WD)-type protein, which has seven WD motifs (Ng et al., 1997) and is homologous to the Drosophila polycomb group (PcG) protein, extra sex comb (ESC) (Ohad et al., 1999), and mammal’s embryonic ectoderm development (EED) (Korf et al., 1998). Both ESC and EED promote their interactions with other polycomb proteins and repress homeotic target gene expression (Simon and Tamkun, 2002). Similarly, Arabidopsis PcG protein MEDEA (MEA) and FIE interact with each other through the aminoterminal region of MEA, regulating endosperm and embryo development (Luo et al., 1999; Spillane et al. 2000; Yadegari et al., 2000; Kohler et al., 2003a, b). Mutations of FIE genes allow diploid endosperm

7796

Afr. J. Biotechnol.

development, seed coat formation, fruit elongation, and even partial embryo development in the absence of fertilization (Ohad et al., 1996, 1999; Chaudhury et al., 1997). These facts indicate that the wild-type FIE gene is essential to suppress endosperm development until fertilization. Down regulation of FIE in Hieracium can lead to seed abortion or inhibit autonomous embryo and endosperm initiation (Katz et al., 2004; Rodrigues et al., 2008). Despite the aberration phenotypes caused by low expression levels of FIE, the plants can still reach maturity. In addition to its previously described roles in seed development, FIE has also been reported to repress the expression of MADS-box gene family members: Minichromosome maintenance 1 (MCM1) genes in yeast, Agamous (AG) in Arabidopsis, deficiens (DEF) in Antirrhinum and serum response factor (SRF) in humans (Riechmann and Meyerowitz, 1997). As in flowering plants, FIE PcG complex plays a central role in regulating the transition of female gametophyte to sporophyte (Goodrich et al., 1997; Guitton et al., 2004; Kohler et al., 2003a; Ohad et al., 1996, 1999). Low expression levels of FIE lead to dramatic morphological aberrations such as loss of apical dominance, curled leaves, early flowering and homeotic conversion of leaves in Arabidopsis. It has been shown that the FIE PcG protein interacts with curly leaf (CLF), a SET domain PcG protein, which functions in the regulation of leaf and flower differentiation (Goodrich et al., 1997). Therefore, it is quite possible that FIE controls the gametophytic and sorophytic developmental programs by associating with different SET-domain proteins (Katz et al., 2004). Much work has been done on the study of the mutants of FIE and interactions of FIE PcG proteins with other PcG proteins. Given the conservation of FIE among species, we focused our present study on the potential effects of overexpression of extraneous FIE from soybean in Arabidopsis to provide more insights into the function of FIE PcG. As one of the most important crops in the world, studying the mechanism of seed development in soybeans has significant scientific and economic value. In this study, a soybean FIE gene was cloned and over expressed in Arabidopsis to further illustrate its function. The expression of soybean FIE among different tissues and under different stress treatments was also explored. MATERIAL AND METHODS Plant growth and treatments Soybean seeds (Cultiva Zhonghuang 13) were germinated in pots containing 1.5 kg soil collected from an experimental field of the Chinese Academy of Agricultural Sciences (Beijing, China). The five-leaf stage seedlings were transferred to natural conditions to grow from April 4th, 2010 until harvesting. Soybean cotyledons, epicotyls, and hypocotyls were collected from five-day old seedlings. Vegetative tissues such as leaves, stems, and roots were collected from four-week old seedlings. Flowers were

collected when they were in full bloom. Developmental seeds were collected two weeks after flowering (Xu et al., 2010). For drought treatment, four-week old seedlings were stressed in culture solution with 20% polyethylene glycol (PEG) 6000. Leaves of the stress-treated seedlings were collected at time intervals of 0, 2, 5, 8 and 12 h. For cold treatment, four-week old seedlings were put in a chamber at 4°C for 48 h. Leaf samples were collected at time interval of 0, 5, 8, 12, 24 and 48 h. All samples were immediately frozen with liquid nitrogen and stored at -80°C for later use. Arabidopsis thaliana ecotype Columbia (Col-0) was used in this study. Seeds were surface-sterilized and germinated on MacConkey agar (MA) plates. After germination plants were transferred to pots of soil and grown in a chamber at 23°C under long day conditions (16/8 h light/dark cycle). Cloning of GmFIE Arabidopsis FIE (Genbank accession no: AAD23584) was used to search the soybean EST database using the TBLASTN program (http://blast.ncbi.nlm.nih.gov/Blast.cgi.) to retrieve similar ESTs. These segments were assembled into one contig by SeqMan program of DNAStar software. ORF finder (http:// www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to analyze the open reading frame of the contig sequence. Specific primers 5’AGATGGTGGGTGAAACGGC-3’ and 5’- CATTAACTTAGCTTGAGGACGCAC-3’ were designed according to the sequence of the contig. Bioinformatics analysis of GmFIE Soybean genome database phytozom v6.0 (http:// www.phytozome.net/soybean) was searched to determine the location and number of copies of GmFIE, and retrieve corresponding genomic sequences as well as promoter region sequences. Software GSDS (http://gsds.cbi.pku.edu.cn/) was employed to analyze the structure of GmFIE. The online software compute pI/Mw tool (http://au.expasy.org/tools/pi_tool.html) was used to predict the molecular weight and pI for GmFIE. The online protein database prosite (http://npsa-pbil.ibcp.fr/cgibin/npsa_automat.pl?page=npsa_prosite.html) was used to analyze the amino acids composition features of GmFIE. Meanwhile, online database PLACE (http://www.dna.affrc.go.jp/PLACE/index.html; (Higo et al., 1999)) was used to analyze the potential cis-elements of the GmFIE promoter. In silico expression analysis of GmFIE was carried out in the UniGene database (http://www.ncbi.nlm.nih.gov/ unigene/) with GmFIE Genbank number: EU169385. Lastly, Bioedit was used for mulit-alignment of GmFIE with FIEs from tobacco, Arabidopsis, potato, rice, Physcomitrella patens and Micromonas pusilla. RNA extraction, first-strand cDNA synthesis and quantitative real-time polymerase chain reaction (qRT-PCR) analysis RNA extraction, first–strand cDNA synthesis, as well as qRT-PCR were carried out according to the methods described by Xu et al. (2010). Constitutively expressed soybean CYP2 (cyclophilin) gene was used as internal reference for normalization with a pair of primers: 5’-CGGGACCAGTGTGCTTCTTCA-3’ and 5’CCCCTCCACTACAAAGGCTCG-3’ (Jian et al., 2008). Specific primers for qRT-PCR analysis of GmFIE were used as follows: forward primer 5’- AAATACCCTGTTCCTGAGTGTG-3’ and reverse primer 5’- CCCTTCCCTGTTACCCACT-3’. The PCR was performed on a CFX96 real-time PCR detection system (Bio-Rad) and the conditions were as follows: 95°C for 3 min, 45 cycles of 15

Hu et al.

s at 95°C, 58°C for 15 s and 72°C for 20 s. Three replicates were used for each sample. Data were analyzed by using CFX Manager Software (Bio-Rad).

Generation of transgenic plants overexpressing GmFIE GmFIE open reading frame was amplified by PCR with the following primers: Forward 5’- GGGTCTAGACGGGAATTCGATAAGATG-3’ (added XbaⅠ site underlined) and reverse 5’ACACCCGGGCGCGAATTCACTAGTGATTC-3’ (added XmaⅠ site underlined). PCR products were digested with XbaⅠ and XmaⅠ, and inserted into the XbaⅠ/SmaⅠ (share the same site with XmaⅠ) sites of the pBI121 vector under the control of the CaMV 35S promoter. The recombinant plasmid pBI121-GmFIE was used to transform Agrobacterium tumefaciens (strain GV3101) by freezethaw methods (Weigel and Glazebrook, 2006). Arabidopsis plants were transformed by the floral dip method described by Clough and Bent (1998). Transformed plants were grown under the long day condition described previously. T1 generation seeds were harvested and screened on MS medium containing 50 mg/L kanamycin. 60 independent transgenic plants were obtained and transferred to pots of soil. Two leaves of 20-day old plants were used for DNA extraction with plant genomic extraction kit (TIANGEN). Specific primers (forward 5’AAACCTCCTCGGATTCCATTGCC-3’ and reverse 5’CCCATTGATTCCTCCAGCCACA-3’) were designed to identify the transgenic plants. Primers were designed across the border of target gene FIE and the vector pBI121. Two transgenic lines F5-3 and F8-4 were selected in the T2 generation for subsequent experiments.

Characterization of GmFIE overexpression lines Seeds of T2 generation and WT were germinated and grown under the long day conditions described previously. The flowering date for transgenic and WT lines were noted. Pods collected from the transgenic lines and WT were dissected under stereomicroscope (Stemi SV11, ZEISS). Seeds of transgenic lines were calculated and results were chi-square tested with SPSS16.0.

RESULTS Cloning and bioinformatics analysis of GmFIE and its promoter region Protein sequence of Arabidopsis FIE (AF129516) was used to search the soybean EST database and four ESTs were retrieved, namely: EV281299, BI424788, GR841855, and BW656508. After assembly by the SeqMan program of DNAStar software, one contig was generated. With specific primers, a full-length cDNA fragment was amplified from first-strand cDNA by RTPCR. The amplified fragment was purified and cloned into the pMD18-T vector for sequencing. The full-length soybean GmFIE was 1487 bp which is exactly the same size as the in silico cloning result. The GmFIE cDNA encodes a protein (ABW23440) which contains 381 amino acid residues with an estimated molecular weight of 42.4992 kDa and pI 5.56. Right at 5’ of the initiation codon, there was a termination codon. The UTR at the 3’

7797

had one typical tailing signal. This sequence was stored at GenBank with an accession number EU169385. Multiple alignment of GmFIE with six other FIEs from species tobacco, Arabidopsis, potato, rice, P. patens, and M. pusilla species showed that they have high similarity, being 95, 87, 93, 89, 85 and 62%, respectively. The aforementioned evidence clearly indicated that the cloned GmFIE cDNA sequence was complete. Genome search results showed that GmFIE has two copies, one is located on soybean chromosome 10 with locus number Glyma10g02690, and another is located on chromosome 2 with locus number Glyma02g17110. The copy on chromosome 10 is exactly as cloned in our experiments and has a 99% similarity to the copy on chromosome 2. Comparison of the coding sequence (CDS) and genomic sequences showed that GmFIE has 11 introns and 12 exons. Prosite database analysis showed that GmFIE has seven WD motifs which are conserved among plants. Cis-element analysis of GmFIE promoter region (2000 bp upstream of initiation condon) showed that a wide variety of elements existed in this region (Table 1). More significantly, many potential regulatory elements associated with stress-related responses were found, including 12 MYB transcription factor binding sites (all 12 are MYB core) and 16 MYC transcription binding sites. Expression analysis of GmFIE in different tissues and under different treatments In silico expression analysis showed that GmFIE was highly expressed in seed coats and somatic embryos with 93 transcripts per million and 153 transcripts per million respectively (Table 2). In roots, only 20 transcripts per million were detected. No expression in cotyledons, epicotyls, hypocotyls, flowers, leaves, stem, meristems nor pods was detected. Tissue specific analysis with qRT-PCR showed that GmFIE was highly expressed in epicotyl, hypocotyl, cotyledon and seeds, and highest in cotyledon. Its expression in the other four chosen tissues, root, stem, leaf, and flower was significantly low (Figure 1). Analysis of drought treatment showed that the pattern of GmFIE was slightly down-regulated in the first 8 h then sharply up-regulated in the next 4 h (Figure 2). The expression level for 12 h treatment was more than three times that for 0 h. For cold treatment, the expression patterns of GmFIE were first up-regulated then downregulated, and the highest with the 5 h treatment -almost 50 times of that of the 0 h (Figure 2). Features of Arabidopsis GmFIE overexpression lines Among the 60 seedlings of six T2 transgenic lines, 49 showed delayed flowering averaged two days compared to that of WT. Arabidopsis pods from 13 plants of two randomly chosen transgenic lines: F5-3 and F8-4, as well

7798

Afr. J. Biotechnol.

Table 1. Primary cis-regulatory elements and functions of GmFIE.

Elements type

Shared sequence

Element name

Basic element

TATA

TATA box

GCCAATCT TCTCTCTCT

CAAT box CaMV35S

25 7

GATA

CNGTTR (R = A/G)

MYBCORE

Binding site for all animal MYB and at least two plant MYB

CANNTG TGAC

MYC WRKY710S

16 15

Binding site of ATMYC2, ICE1 Core of TGAC-containing W-box

Upstream elements

Stress responsive elements

Element number

Function of element Critical for accurate initiation of gene transcription Influence initiation rates of transcription Enhance gene expression Core of a CuRE (copper-response element)

Table 2. Expression profile of GmFIE in different tissues and stages by in silico analysis.

Organ Cotyledon Epicotyl Hypocotyl Flower Leaf Root Stem Meristem Pod Seed coat Somatic embryo

Transcripts per million (TPM) 0 0 0 0 0 22 0 0 0 93 153

as WT were collected and dissected under stereomicroscope. In the pods of most transgenic lines unfertilized ovules were observed (Figure 3). Unfertilized ovule rates of transgenic lines were significantly higher than that of WT (Table 3). The chi-square test results for unfertilized ovules rates of transgenic line for F5-3 is X2=74.186, df=1, p=0.000<0.01 and for F8-4, X2=70.485, df=1, p=0.000<0.01.

Gene EST/ total EST in pool 0/30082 0/2692 0/22641 0/16569 0/45127 1/45166 0/20640 0/5891 0/8637 1/10690 2/13053

eight for qRT-PCR analysis. In silico results showed that GmFIE in somatic embryo and seed coat have the highest expression level, while qRT-PCR showed that epicotyl, hypocotyl, cotyledon and seed have the highest expression of GmFIE. They both showed that GmFIE was highly expressed in tissues closely related with soybean reproduction. So, it seems that despite its possible roles in the control of the development of vegetative tissue, FIE mainly functions in plants reproduction process.

DISCUSSION Expression analysis of GmFIE in different tissues

Bioinformatics and qRT-PCR analysis of GmFIE revealing its new function in stress response

It has been reported that FIE widely expresses in different tissues such as stem, cauline leaves and roots (Luo et al., 2000; Ohad et al., 1999). Interaction with different SET domain PcG proteins FIE is essential for the development control of plant shoot and leaf development (Katz et al., 2004). In this study, 11 different tissues or organs were chosen for in silico expression analysis, and

Thanks to the genome sequencing of soybeans and powerful online bioinformatics analysis tools, a relatively comprehensive analysis of GmFIE was carried out in this study. Located on chromosome 10 with 12 exons, the complex structure indicated complex and important roles of GmFIE. Promoter region analysis showed 12 MYB transcription factor binding sites and 16 MYC

Hu et al.

7799

Figure 1. Transcript level of GmFIE in 8 different tissues and organs. The x-axis is for different tissues or organs. The bars above gene name indicate different tissues or organs. The order from left to right is: root, stem, leaves, flower, epicotyl, hypocotyl, cotyledon, and seed. The y-axis indicates the expression level after normalization to reference gene CYP2.

transcription binding sites (Chinnusamy et al., 2003; Hartmann et al., 2005; Urao et al., 1993) distributed in this area. Then high density of cis-elements indicated that GmFIE could be a highly stress responsive gene. This was confirmed by the qRT-PCR results of soybean drought and cold treatments. No such reports concerning FIE have been reported before. However, since a dynamic change happens during fertilization and seeds development, it is no surprise to find that GmFIE is stress responsive (Xu et al., 2010). Overexpression of GmFIE in Arabidopsis confers evolution conservation and significant functions of FIE polycomb proteins Introduction of an extraneous FIE gene to different plant species has been used in lots of research works in order to illustrate its function. It has been reported that the defects caused by FIE mutants can be rescued or partially rescued by the FIE gene from other species. One example in case is the target deletion of FIE in P. patens, which causes gametophore meristems over proliferation resulting in the moss not reaching the reproductive phase. This defect can be partially rescued by the FIE gene of A. thaliana. Meanwhile, the A. thaliana FIE

mutantâ&#x20AC;&#x2122;s gametophytic lesion can also be partially complemented by introduction of PpFIE (Mosquna et al., 2009). This fact indicates that the function of FIE proteins have been highly conserved during evolution and that the FIE protein from one species can function well in another species. According to previous reports, loss-of-function mutations of FIE allowed endosperm development in the absence of fertilization (Ohad et al., 1996, 1999; Chaudhury et al., 1997), and reduced level of FIE protein in Arabidopsis caused pleiotropic aberrant phenotypes (Katz et al., 2004), indicating that the FIE polycomb complex is an essential component to suppress the floral program in the early stages of plant development (Kinoshita et al., 2001). Also, PcG proteins, especially FIE plays a major role in maintaining the repression of homeobox gene beyond their appropriate and temporal and spatial expression boundaries (Simon and Tamkun, 2002). Though not only that, an extraneous FIE proteins can function as well as endogenesis ones. Here we hope to know what will happen if extraneous FIE protein is overexpressed in Arabidopsis. In the current work, GmFIE was introduced into Arabidopsis and the transgenic lines and two significant phenotype changes were observed. First, over half of the transgenic lines have observed flowering date delay compared to that of

7800

Afr. J. Biotechnol.

Time (h)

Time (h) Figure 2. Expression profile of GmFIE under drought and cold treatments. The xaxis shows time courses of drought (A) and cold (B) treatments. The bars from left to right indicate time courses of drought treatment 0, 2, 5, 8 and 12-h intervals (A) and cold treatment 0, 5, 8, 12, 24 and 48-h intervals (B). The y-axis shows expression levels after normalization to internal control gene CYP2.

WT. While low level expression of FIE in Arabidopsis can lead to early flowering (Katz et al., 2004), the delayed flowering in the study provide another evidence that FIE PcG protein functioned in suppressing of critical aspect of early plant reproduction.

Secondly, unfertilized ovules rates of transgenic lines were significantly higher than WT. Many possible reasons may contribute to the phenomenon. Possibly, the overexpressed protein may act in a dominant-negative manner to interfere with the function of the endogenous

Hu et al.

7801

Table 3. Quantity statistics of Arabidopsis seeds for transgenic lines and WT.

Plant WT F5-3 F8-4

Normal seed number 553 424 428

Unfertilized ovule 22 111 108

Total number 575 535 536

Figure 3. Morphological character of seeds of transgenic GmFIE plant of T3 generation and WT (Ă&#x2014;1.6). A, WT; B, transgenic GmFIE plant of T2 generation.

Arabidopsis FIE protein, by forming inactive PcG complexes or competing for the other components of the complex and thus reducing the number of complete complexes present. There is also the possibility that the over expressed protein suppressed the expression of endogenous Arabidopsis FIE gene. The actual mechanism behind the phenomenon needs more evidence from further studies. Acknowledgements Authors would like to thank the National Natural Science Foundation of China (30971783) for financial support. REFERENCES Chaudhury AM, Luo M, Miller C, Craig S, Dennis ES, Peacock WJ (1997). Fertilization independent seed development in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA, 94: 4223-4228.

Chinnusamy V, Ohta M, Kanrar S, Lee BH, Hong X, Agarwal M, Zhu JK (2003). ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis. Gene Dev. 17: 1043-1054. Clough SJ, Bent AF (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16: 735-743. Drews GN, Lee D, Chistensen CA (1998). Genetic analysis of female gametophyte development and function. Plant Cell, 10: 5-17. Goldberg RB, De Paiva G, Yadegari R (1994). Plant embryogenesis: zygote to seed. Science, 266: 605-614. Goodrich J, Puangsomlee P, Martin M, Long D, Megerowitz EM, Coupland G (1997). A polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature, 386: 44-51. Guitton AE, Page DR, Chambrier P, Lionnet C, Faure JE, Grossniklaus U, Berger F (2004). Identification of new members of Fertilization Independent Seed Polycomb Group pathway involved in the control of seed development in Arabidopsis thaliana. Development, 131: 2971-2981. Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar B (2005). Defferential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control lightresponsive and tissue-specific activation of phenylpropanoid biosynthesis genes. Plant Mol. Biol. 57: 155-171. Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999). Plant cis-acting regulatory DNA elements (PLACE) database: Nucleic Acids Res. 27:

7802

Afr. J. Biotechnol.

297-300. Jian B, Liu B, Bi Y, Hou W, Wu C, Han T (2008). Validation of internal control for gene expression study in soybean by quantitative real-time PCR. BMC Mol. Biol. 9: p. 59. Katz A, Oliva M, Mosquna A, Hakim O, Ohad N (2004). FIE and CURLY LEAF polycomb proteins interact in the regulation of homeobox gene expression during sporophyte development. Plant J. 37: 707-719. Kinoshita T, Harada JJ, Goldberg RB, Fischer RL (2001). Polycomb repression of flowering during early plant development. Proc. Natl. Acad. Sci. USA. 98: 14156-14161. Kohler C, Hennig L, Bouveret R, Gheyselinck J, Grossniklaus U, Gruissem W (2003a). Arabidopsis MSI1 is a component of the MEA/FIE Polycomb group complex and required for seed development. EMBO J. 22: 4804-4814. Kohler C, Hennig L, Spillane C, Pien S, Gruissem W, Grossniklaus U (2003b). The Polycomb-group protein MEDEA regulates seed development by controlling expression of the MADS-box gene PHERES1. Gene Dev. 17: 1540-1553. Korf I, Fan Y, Strome S (1998). The polycomb group in Caenorhabditis elegans and maternal control of germline development. Development, 125: 2469-2478. Lopes MA, Larkins BA (1993). Endosperm origin, development, and function. Plant Cell, 5: 1383-1399. Luo M, Bilodeau P, Dennis ES, Peacock WJ, Chaudhury A (2000). Expression and parent-of-origin effects for FIS2, MEA, and FIE in the endosperm and embryo of developing Arabidopsis seeds. Proc. Natl. Acad. Sci. USA. 97: 10637-10642. Luo M, Bilodeau P, Koltunow A, Dennis ES, Peacock WJ, Chaudhury AM (1999). Genes controlling fertilization-independent seed development in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 96:296-301. Mosquna A, Katz A, Decker EL, Rensing SA, Reski R, Ohad N (2009). Regulation of stem cell maintenance by the Polycomb protein FIE has been conserved during land plant evolution. Development, 136: 2433-2444. Ng J, Li R, Morgan K, Simon J (1997). Evolutionary conservation and predicted structure of the Drosophila extra sex combs repressor protein. Mol. Cell Biol. 17: 6663-6672. Ohad N, Margossian L, Hsu YC, Williams C, Repetti P, Fischer RL (1996). A mutation that allows endosperm development without fertilization. Proc. Natl. Acad. Sci. USA. 93: 5319-5324.

Ohad N, Yadegari R, Margossian L, Hannon M, Michaeli D, Harada JJ, Goldberg RB, Fischer RL (1999). Mutations in FIE, a WD polycomb group gene, allow endosperm development without fertilization. Plant Cell, 11: 407-416. Riechmann JL, Meyerowitz EM (1997) MADS domain proteins in plant development. Biol. Chem. 378: 1079-1101. Rodrigues JCM, Tucker MR, Johnson SD, Hrmora M, Koltunow AM (2008). Sexual and Apomictic Seed Formation in Hieracium Requires the Plant Polycomb-group Gene Fertilization Independent Endosperm. Plant Cell, 20: 2372-2386. Simon JA, Tamkun JW (2002). Programming off and on states in chromatin: mechanisms of Polycomb and trithorax group complexes. Curr. Opin. Genet. Dev. 12: 210-218. Spillane C, MacDougall C, Stock C, Kohler C, Vielle-Calzada JP, Nunes SM, Grossniklaus U, Goodrich J (2000). Interaction of the Arabidopsis polycomb group proteins FIE and MEA mediates their common phenotypes. Curr. Biol. 10: 1535-1538. Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K (1993). An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell, 5: 1529-1539. Weigel D, Glazebrook J (2006). Transformation of Agrobacterium using the freeze-thaw method. Cold Spring Harb. Protoc. doi:10.1101/pdb.prot4666. Xu H, Li Y, Yan Y, Wang K, Gao Y, Hu Y (2010). Genome-scale identification of Soybean BURP domain-containing genes and their expression under stress treatments. BMC Plant Biol. 10: 197. Yadegari R, Kinoshita T, Lotan O, Cohen G, Katz A, Choi Y, Nakashima K, Harada JJ, Goldberg RB, Fisher RL, Ohad N (2000). Mutations in the FIE and MEA genes that encode interacting polycomb proteins cause parent-of-origin effects on seed development by distinct mechanisms. Plant Cell 12: 2367-2382.

African Journal of Biotechnology Vol. 11(31), pp. 7803-7811, 17 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3915 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Molecular cloning and characterization of a putative OGG_N domain from the camel, Camelus dromedarius Farid Shokry Ataya1,2*, Mohammad Saud Alanazi1, Dalia Fouad3, Hehsam Mahmoud Saeed1,4 and Mohammad Bazzi1 1

Department of Biochemistry, College of Science, King Saud University, Riyadh, Saudi Arabia. Department of Molecular Biology, Genetic Engineering Division, National Research Center, Dokki, Cairo, Egypt. 3 Department of Zoology, College of Science, King Saud University, Riyadh, Saudi Arabia. 4 Department of Biotechnology, Institute of Graduate Studies and Research, Alexandria University, 163 El-Horreya Avenue El-Chatby, Alexandria, Egypt. 2

Accepted 9 March, 2012

Reactive oxygen species (ROS) oxidize the guanine base in the DNA to 8-oxoguanine (8-oxoG). This lesion, if left unrepaired, causes the transversion of G:C pair to T:A following replication. 8-oxoG is targeted by one of the DNA glycosylases, namely OGG1. Arabian camel (one humped camel, Camelus dromedarius) is adapted to live in desert climate conditions under direct exposure to endogenous and exogenous ROS-producing conditions, among of them the sunlight. In the recent study, partial sequence of camel OGG-1 gene was cloned and analyzed for the first time. A DNA fragment of 567 bases was amplified by reverse transcription PCR. It is equivalent to about 55% from the coding region of the known transcript of many organisms. The level of expression of OGG-1 in different camel tissues (liver, kidney, spleen, lung and testis) was examined using real time-PCR. The highest level of OGG-1 transcript was found in the camel liver (represented as 100%) followed by testis (85%), spleen (78%), kidney (37%) and lung (3%) using 18S ribosomal subunit as endogenous control. The obtained cDNA sequence of OGG-1 showed high similarity with Ailuropoda melanoleuca (86%), Sus scrofa (86%), Canis familiaris (85%), Bos taurus (85%), Macaca mulatta (85%), Homo sapiens (84%), Pan troglodytes (84%) and Pongo abelii (82%). Key words: Camelus dromedarius, cloning, OGG1, gene expression,DNA glycosylase.

INTRODUCTION Domesticated Arabian camel (one-humped camel, Camelus dromedarius) is the most important animal in the Arabian desert, as it represents the main source of meat and milk, and for its high cultural and economical values. This animal, like other living organisms, is continuously exposed to deleterious endogenous and exogenous factors that if not treated properly, may result in mutations and cell death. The most life-threatening compounds are the damaging reactive oxygen species (ROS). They affect mainly the DNA causing the

*Corresponding author. E-mail: fataya@ksu.edu.sa. Abbreviations: ROS, Reactive oxygen species; 8-oxoG, 8oxoguanine.

generation of oxidized bases with high frequency. The presence of such abnormal bases makes gross DNA alterations, for example, single- and double-strand breaks and DNA base modifications. Under normal physiological conditions the mammalian DNA is damaged between 104 and 105 times per cell daily and this number can be increased substantially by stress (Mullart et al., 1999; Lindahl 1993). If these DNA lesions are not repaired correctly, the cell may die or be subjected to genomic instability, which may lead to aging and initiation or acceleration of the carcinogenic process through mutations in genes controlling these biological processes (Slupphaug et al., 1995; Jaiswal et al.,1998; Pearl, (2000). ROS induce the production of various kinds of oxidative DNA damage. The most affected is the guanine base

7804

Afr. J. Biotechnol.

which is oxidized to 8-oxoguanine (8-oxoG). This lesion is a potent mutagen and can generates transversions of G:C pair to T:A, since 8oxoG in DNA allows the incurporation of adenine as well as cytosine opposite the lesion (Moriya et al., 1991; Shibutani et al., 1991). It can be formed spontaneously in the genomic DNA of aerobic organisms since ROS are constantly generated in vivo as byproducts of respiration and normal metabolism and/or by the action of ionizing radiation, chemical pollutions, heavy metals, etc. (Marnett, 2000; Floyd et al., 1986). The damaged DNA is repaired by a number of enzymes that act sequentially to remove damaged bases and replace them with regular ones through the base excision repair (BER) pathway which involves the catalytic activity of DNA glycosylase enzymes (Krokan et al., 2000). DNA glycosylases fall into two major classes, which differ with respect to catalytic mechanism; monofunctional and bifunctional glycosylases. The first one removes the damaged base, generating an abasic site which can be converted to a single-strand break by apurinic/apyrimidinic (AP)–endonuclease, while the second has lyase activity besides its glycosylase activity; hence the name bifunctional glycosylases (Ide and Kotera, 2004). Despite the obvious structural similarity of 8-oxoG to the vastly more abundant G, 8-oxoG is recognized specifically and efficiently by 8-oxoG DNA glycosylases (OGG1). It or its analogue has been proposed to be implicated in repair of ultraviolet A (UVA)-induced DNA lesions (Dahle et al., 2008). It catalyses the removal of 8oxoG through its glycosylase activity and cleaves the DNA sugar backbone through its lyase activity. This incision generates a normal 3'-hydroxyl group and an abasic deoxyribose-5-phosphate, which is processed subsequently by β-polymerase and DNA ligase and several accessory proteins (Roldan-Arjona et al., 1997; Rosenquist et al., 1997). OGG1 genetic polymorphisms and altered gene expressions and/or enzyme activities are associated with oxidative DNA damage (Jensen et al., 2012). Many contradictory results are published regarding the association between OGG1 Ser326Cys polymorphism and the increased risk of breast, colorectal and lung cancer (Gu et al., 2010; Yuan et al., 2010; Li et al., 2011; Zhang et al., 2011). The sequence of OGG-1 gene and the predicted amino acid sequence are highly conserved from Saccharomyces cerevisiae to humans (Demple and Harrisson, 1994; Hoeijmakers, 1993; Aspinwall et al., 1997). We have used sequence homology of the highly conserved regions as a criterion to identify potential human homolog of the camel OGG-1 gene through the preparation of primers from such conserved regions. Generally, the study of DNA repair genes has facilitated the understanding of carcinogenicity and cancer susceptibility in man (Kolodner, 1995). Therefore, the identification of OGG-1 homolog in camel may provide valuable information on the etiologies of degenerative

diseases in higher organisms exposed to ROS produced by exposure to natural sunlight for long time. The Arabian camel spends most of its life in direct exposure to sunlight, and to many other factors which end to the production of ROS. So, it is proposed that camel could have robust mechanisms for repairing oxidized DNA lesions. To date, no researches have been done on camel to show how it can resist the direct sun exposure and how it can manipulate supposed UVAinduced DNA lesions. In this recent study, we sequenced and cloned a partial coding region of OGG-1 and we studied its expression on the level of the transcript by qPCR in order to identify the tissue of highest OGG-1 expression which reflects the tissue most affected by DNA damaging agents. MATERIALS AND METHODS Unless otherwise stated, all Escherichia coli strains were grown in Luria Bertani (LB) medium supplemented with 100 μg/ml ampicillin. Camel tissues were obtained from three different two-year old male adult camel, immediately after killing the animal in Southern Riyadh Main Slaughterhouse. Tissue samples were immediately submerged in RNAlater® solution (Qiagen, Ambion, Courtabeuf, France) to avoid RNA degradation, stored at -20°C till use.

Oligonucleotide design Two primers were designed from the highly conserved regions of known OGG-1 genes available in the gene bank. These primers are named OGF (forward, 5′- CATCCCGTGCCCTCGCTCTGA-3′) and OGR (reverse, 5′- ATGGCTCGGGCACTGGCACTCA-3′), respectively. These primers were used in RT-PCR for amplification of OGG-1 cDNA fragment. On the other hand, two new primers were designed to amplify 194 bp for qPCR namely OG1qF 5'CAACATTGTCCGTATCACTGG-3' and OG1qR 5'-GCTCGGGCACTGGCACTCACG-3', for the forward and reverse respectively.

DNA/RNA extraction and cDNA synthesis Fifty mg of liver, kidney, spleen, lung or testis in RNAlater were homogenized in radial transmission line (RTL) lysis buffer (Qiagen, Ambion, Courtabeuf, France) supplemented with 1% 2-mercaptoethanol. Genomic DNA and total RNA was extracted using AllPrep DNA/RNA Mini kit (Qiagen, Ambion, Courtabeuf, France) according to the manufacturer's instruction. Elution was performed with 50 µl nuclease free water. Concentrations and integrity of RNA samples were assessed using NanoDrop-8000 and formaldehyde agarose gel (1%) electrophoresis. Two micrograms of the total RNAs were retrotranscribed in single stranded cDNA using ImProm-II Reverse Transcription System (Promega Corporation, Madison, Wisconsin, USA) as recommended by the manufacturer, with the following cycling conditions: 96°C for 1 min, then 40 cycles at 94°C for 30 s, 65°C for 30 s, and 72°C for 1 min.

PCR and cloning Gradient PCR was carried out at annealing temperatures ranged from 50 to 60°C in a final volume of 50 µl as follow: 25 µl of FideliTaqTM master mix (USB Corporation, Cleveland, Ohio, USA) 5

Ataya et al.

7805

µl of either genomic DNA or c-DNA, 3 µl of each forward and reverse primers (30 pmoles) then the final volume was adjusted to 50 µl with nuclease free water. The PCR condition was 1 cycle at 95°C for 45 s followed by 40 cycles at 94°C for 30 s, 50 to 60°C for 45 s and 68°C for 1 min. Final extension was carried out at 72°C for 5 min. The PCR products were analyzed using 1.5% agarose gel by electrophoresis in Tris-acetate-EDTA (TAE) buffer. The selected PCR fragment of the expected size was cut from the agarose gel after electrophoretic separation and purified using QiAquick gel extraction (Qiagen, Ambion, Courtabeuf, France) then cloned into the pGEM®-T Easy vector (Promega Corporation, Madison, Wisconsin, USA). To ligate the purified PCR products onto pGEM-T vector, 2 µl of each purified PCR products were taken in a clean 0.5 ml tube to which 1 µl pGEM-T- Easy vector (50 ng) and 5 µl of 2X rapid ligation buffer were added followed by the addition of 3 units of T4 DNA ligase enzyme. The final volume of the ligation reaction was adjusted to 10 µl by the addition of nuclease free water. The ligation mixture was incubated at 15°C for 16 h. Transformation of E. coli JM 109 competent cells was carried out according to Sambrook et al. (1989). The recombinant E. coli harboring the recombinant plasmid was screened in selective LB/IPTG/X-gal/Ampicillin/agar plates. Moreover, colonies PCR was conducted to screen recombinant bacteria for ligated DNA insert using T7/SP6 primers.

Studying gene expression by qPCR The expression of OGG-1 transcripts was studied by real-time quantitative PCR (qPCR). The reaction was performed three times, each contained 10 times diluted cDNA from camel liver, kidney, spleen, lung or testis, 5 pmoles each OG1qF and OG1qR primers and 10 μl Fast-SYBR Green qPCR Master Mix (Applied Biosystems, Foster city, California, USA) in a final 20 μl reaction volume as recommended by the manufacturer. The qPCR was performed using Applied Biosystems 7500 Fast real-time PCR system. The following standard conditions was used, initial denaturation at 95°C for 3 min, amplification over 40 cycles of serial heating at 95°C for 30 s and 60°C for 30 s. The amplified product from these amplification parameters was subjected to SYBR Green I melting analysis by increasing the temperature to 95°C for 15 s followed by 60°C for 1 min and ramping the temperature of the reaction samples from 60 to 95°C.

Sequencing of the PCR products and sequence analyses Sequencing of the PCR product cloned onto pGEM-T- Easy vector was carried out according to Sanger et al. (1977) using MegaBACE 1000 DNA Sequencing System (Amersham Pharmacia Biotech, Inc., New Jersey, USA). The chain termination sequencing reaction was conducted utilizing the DYEnamic ET terminator kit mix (USB Corporation, Cleveland, Ohio, USA) as an integral part of the MegaBACE 1000 DNA sequencing system. The reaction mixture contained 8 µl DYEnamic ET terminator sequencing premix, 3 µl T7 or SP6 primers and 500-700 ng plasmid and the final volume was adjusted to 20 µl by DNAse-free water. The chain termination PCR condition was as follow; 1 cycle at 95°C for 30 s followed by 30 cycles at 94°C for 30 s, 50°C for 30 s and 60°C for 1 min. The chain termination PCR products were purified using DyeEx 2.0 Spin Kit (GE Healthcare UK Limited. UK), dried by speed vacuum centrifuge and dissolved in 10 µl MegaBACE loading buffer, then applied to MegaBace 1000 Sequencing machine. The nucleotide sequences were determined in both directions and analyzed using the Genetics Computer Group (GCG, Madison, WI, USA), BioEdit and DNASTAR programs. The prediction

Figure 1. Agarose gel (1.2%) electrophoresis of RT– PCR products of OGG-1 gene using OGF/OGR primers + cDNA (lane 1) or genomic DNA (lane 2), respectively.

of the secondary structure was done using the PSIPRED protein structure prediction server. The deduced amino acid sequence was compared with sequences obtained from searches in the NCBI Protein Database using the basic local alignment search tool program (BLASTP) algorithm (Altschul et al., 1990). The amino acid sequences were aligned and converted to a phylogenetic tree using MegAlign of the DNASTAR package.

RESULTS A cDNA fragment of 567 bp was amplified by reverse transcription PCR (Figure 1) using OGF and OGR primers designed from the highly conserved regions of OGG-1 sequences as previously explained. The optimum annealing temperature was at 58°C. This fragment represents about 55% of the coding region comparing with the corresponding regions from different organisms (~1035 bp). Our sequence was submitted in the gene bank with the accession number HM369806 http:// www.ncbi.nlm.nih.gov/nuccore/HM369806.1. This cDNA fragment encodes part of the OGG1 enzyme of 188 amino acids (Figure 2) which forms the OGG_N domain (accession number ADK35367.1).

7806

Afr. J. Biotechnol.

Figure 2. The nucleotide sequence and the deduced amino acids of the cloned fragment of camel OGG-1. The sequence was submitted to NCBI GeneBank (accession number HM369806.1 and ADK35367.1).

The comparison between the predicted amino acid sequence of OGG1 and the sequences of OGG1 from different organisms indicated the percentage of similarity with C. dromedarius was 86% for panda (Ailuropoda melanoleuca), 86% for pig (Sus scrofa), 85% for dog (Canis lopus familiaris), 85% for cow (Bos taurus), 85%

for Rhesus monkey (Macaca mulatta), 84% for human (Homo sapiens), 84% for chimpanzee (Pan troglodytes) and 82% for orangutan (Pongo abelii) (Table 1). The alignment of amino acid sequences from different organisms is shown in Figure 3. The amino acid sequences of camel OGG-1 and other

Ataya et al.

Table 1. Homology of the translated OGG1 gene of 9 species with the deduced amino acid sequence of C. dromedarius OGG1.

Animal Panda Pig Dog Cow Rhesus monkey Human Chimpanzee Orangutan

Scientific name Ailuropoda melanoleuca Sus scrofa Canis lopus familiaris Bos taurus Macaca mulatta Homo sapiens Pan troglodytes Pongo abelii

Accession # EFB29741.1 XP_001928227.3 XP_541781.2 NP_001073754.2 XP_001096322.1 1N3C_A XP_003309654.1 XP_002813520.1

Percentage identity 86 86 85 85 85 84 84 82

Figure 3. Multiple sequence alignment of the deduced amino acid sequence of C. dromedarius OGG_N domain (accession number ADK35367.1) with other similar species from the NCBI database. The alignment was generated with the MegAlign program. The three conserved amino acids which form part of the pocket are marked ( ) and the NNN motif labeled ( ).

7807

7808

Afr. J. Biotechnol.

Figure 4. The phylogenetic tree of C. dromedarius OGG_N domain region (accession number ADK35367.1) and potentially related proteins. The deduced amino acid sequence of Camel OGG-1 was compared with other sequences of the GenBankTM data base. The alignment was generated with the MegAlign program.

Table 2. Predicted structure analysis of the cloned fragment of OGG-1 camel liver using Protean Program.

Parameter Molecular weight Length I microgram = Molar extinction coefficient 1 A (280 nm) Charged amino acids (RKHYCDE) Acidic amino acids (DE) Basic amino acids (KR) Polar amino acids (NCQSTY) Hydrophobic amino acids (AILFWV)

Value 21.244 188 47.07 27910 Âą 5% 0.76 mg/ml 52 18 17 53 68

tissues (liver, kidney, spleen, lung and testis) is examined using qPCR. The primers were designed to amplify 192 base pairs and the experiment condition was adjusted to give only one band and to eliminate the primer dimer, self dimer or hairpin form. The expression of OGG-1 in liver was taken as reference sample (calibrator) and the expression of camel 18S ribosomal subunit as housekeeping gene (endogenous control). The relative expressions of OGG-1 in kidney, spleen, lung and testis were compared with that of the liver. The highest expression level was found in liver (represented as 100%) followed by testis (85%), spleen (78%), kidney (37%) and lung (3%) (Figure 6). DISCUSSION

eight mammalian OGG-1 enzymes were used to construct phylogenetic tree using MegAlign of the DNASTAR package (Figure 4). We found that OGG-1 from human, chimpanzee, orangutan and Rhesus monkey are grouped together, while panda and dog, pig and cow are grouped in form other two branches, respectively. Surprisingly, camel OGG-1 takes a different evolutionary line from all the above examined species. The molecular analysis of the 188-amino acid sequence of camel OGG-1 using the program Protean showed that this protein contains 52 charged amino acid (27.66%), 68 hydrophobic (36.17%), 18 acidic (9.6%), 17 basis (9%) and 53 polar amino acids (28.25%) (Table 2). This fragment is composed of eight alpha helices and five beta sheets in the same manner of the human OGG1 (Figure 5). The level of OGG-1 expression The

level of expression of OGG-1 in different camel

Arabian camel is the most important animal in the Middle East. Despite its economic and cultural importance, very little biochemical researches are done to elucidate how it can survive in the desert's harsh conditions. Studying the DNA repair genes of C. dromedarius is essential for understanding the impact of exposure to direct sunlight and desert life on the health status of such mammal. 8oxoG is a premutagenic lesion produced by exposure to ROS. It is targeted by OGG1, a bifunctional DNA glycosylase belonging to base excision repair enzymes. OGG1 catalyses the removal of 8-oxoG through its glycosylase activity (EC: 3.2.2.23) and cleaves the DNA sugar backbone through its lyase activity (EC:4.2.99.18) (Roldan-Arjona et al., 1997; Rosenquist et al., 1997). The structure and function of OGG1 is studied in many eukaryotic and prokaryotic organisms. It is composed of two domains; the OGG_N in the N terminal and the ENDO3c domain. The OGG_N domain contributes to the 8-oxoguanine binding pocket in the enzyme. The ENDO3c domain exists in many DNA repair enzymes

Ataya et al.

7809

Figure 5. The secondary structure annotation sites of the partial OGG-1 sequence of C. dromedarius.

including endonuclease III (DNA-apurinic or apyrimidinic site lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases (reviewed Bruner et al., 2000). This present study is the first work to clone and study the chemical composition of the OGG_N domain of the one-humped camel OGG-1 gene. Our results show amplification of a cDNA fragment of 567 bp using a primer set spanning this DNA fragment (Figure 1). The sequencing indicated that this part covers the highly conserved N-terminal domain belonging to OGG-N super family [cl06806] and part of the ENDO3c domain of the known DNA glycosylases. The comparison between the predicted amino acid sequence of the obtained OGG1 fragment and the sequences of OGG1 from different organisms indicated that the largest identity was found with OGG1 of A. melanoleuca (86%), S. scrofa (86%), C. familiaris (85%), B. taurus (85%), M. mulatta (85%), H. sapiens (84%), P. troglodytes (84%) and Pongo abelii (82%). The alignment

of amino acid sequences from different organisms is shown in Figure 3. To date, the three dimensional structure of human OGG1 is the only resolved structure among the previously listed enzymes. Hence we compared the camel OGG_N domain with the human one. The mechanism by which the OGG1 localizes the oxidized guanine (8-oxoG) in the midst of the vast genome containing a huge excess of undamaged guanine bases is an area of interest of many scientists. OGG_N domain contributes to a 8-OxoG pocket on the OGG1 enzyme. The cloned part of the camel OGG1 has three amino acids of the six residues that form that pocket of human OGG1. These residues are Gly42, Gln43, Phe45, which form with Cys253, Gln315 and Phe319 the pocket of 8-oxoG binding on the human OGG1. Gly 42, Gln43 and Phe45 interact with the major groove edge recognizing the protonated N7 of the 8oxoG, whilst the Phe319 and Cys253 pack against oppos te faces of o oG ( r‫ه‬set al., 2002). Camel OGG1

7810

Afr. J. Biotechnol.

Figure 6. Expression of OGG-1 using Real time PCR and cDNA from different camel tissues. The results are expressed relative to liver as calibrator and using 18S ribosomal subunit as housekeeping gene

has the HNN motif in positions 149 to 151. This motif differs from hOGG1 that has asparagine in position 149, not histidine. The codon that produces H in camel is CAC while the corresponding codon in human and other compared species is AAC. It seems that this very important codon had changed in the early evolution of camel and it could affect the activity and the structure of the pocket of 8-oxoG binding on the OGG1 enzyme. The function of this motif is to fill the space in the duplex by forming a hydrogen bond through the protruded sidechain amide carbonyl of N149 with the exocyclic N4 amino group of the estranged cytosine base on the distal strand (Bruner et al., 2000; Norman et al., 2003). The Asn residues 150 and 151 form hydrogen bonds back to the protein in the DNA complex and stabilize the cytosinerecognition motif. These two Asn are directed away from the body of the protein. The position occupied around residues 149 and 150 overlaps the site occupied by the phosphodiester backbone on the 5' side of 8oxoG in the -bound structure ( r‫ه‬set al., 2002). The predicted secondary structure of the OGG1 fragment from C. dromedarius gave a profile similar to the corresponding region from H. sapiens. The only difference is the possibility of formation of a small helix in camel OGG1 by the amino acids 9 to 14. The expression of camel OGG-1 is studied in different tissues using qPCR technique. Our findings suggest that OGG-1 is highly expressed in liver and testis. The high level of expression in liver is expected where most of the metabolic processes are performed with the possibility of high ROS production. Also it is important to be present in

the testis and other tissues of active cell division to repair any possible base lesion in the produced germ cells. The activity of OGG-1 might reflect a link between OGG-1 and maintenance of cellular integrity in such tissues. Conclusion The cloned partial coding region of OGG-1 represents the first trial of cloning camel OGG-1. The expression is higher in the liver and testis where most of the metabolic processes and active cell division are performed with the possibility of high ROS production. ACKNOWLEDGEMENTS We are grateful to Dr Mohamed Hussain and the veterinarians at the Southern Riyadh Main Slaughterhouse for collecting camel tissue samples. This work was supported by funding from the King Abdulaziz City for Science and Technology (KACST), Riyadh, Saudi Arabia, project # LGP 14-52.

REFERENCES Altschul, SF, Gish A, Miller W, Myers EW, Lipman DJ (1990). Basic local alignment search tool, J. Mol. Biol. 215(3): 403-410. Aspinwall R, Rothwell DG, Roldan-Arjona T, Anselmino C, Ward CJ, Cheadles JP, Sampson JR, Lindahl T, Harris PC, Hickson I (1997). Cloning and characterization of a functional human homolog of

Ataya et al.

Escherichia coli endonuclease III. Proc. Natl. Acad. Sci. USA. 94(1): 109-114. r‫ه‬s M, Seeberg E, Luna L, Pearl LH, Barrett TE (2002). Reciprocal "flipping" underlies substrate recognition and catalytic activation by the human 8-oxo-guanine DNA glycosylase, J. Mol. Biol. 317(2): 171177. Bruner SD, Norman DPG, Verdine GL (2000). Structural basis for recognition and repair of the endogenous mutagen 8-oxoguanine in DNA, Nature, 403(6772): 859-866 Dahle J, Brunborg G, Svendsrud DH, Stokke T, Kvam E (2008). Overexpression of human OGG1 in mammalian cells decreases ultraviolet A induced mutagenesis, Cancer Lett. 267(1): 18-25. Demple B, Harrisson L (1994). Repair of oxidative damage to DNA: enzymology and biology . Annu. Rev. Biochem. 63: 915-948. Floyd RA, Watson JJ, Wong PK, Altmiller DH, Rickard RC (1986). Hydroxyl free radical adduct of deoxyguanosine: sensitive detection and mechanisms of formation, Free Radica.l Res. Commun. 1(3): 163-172. Gu D, Wang M, Zhang Z, Chen J (2010). Lack of association between the hOGG1 Ser326Cys polymorphism and breast cancer risk: evidence from 11 case-control studies. Breast Cancer. Res. Treat. 122(2): 527-531. Hoeijmakers JHJ (1993). Nucleotide excision repair. II: From yeast to mammals. Trends Genet. 9(6): 211-217. Ide H, Kotera M (2004). Human DNA glycosylases involved in the repair of oxidatively damaged DNA. Biol. Pharm. Bull. 27(4): 480-485. Jaiswal M, Lipinski LJ, Bohr VA, Mazur SJ (1998). Efficient in vitro repair of 7-hydro-8-oxodeoxyguanosine by human cell extracts: Involvement of multiple Pathways. Nucleic Acids Res. 26(9): 2184-2191. ensen , r , r sen , Gr nb‫و‬ , orry , oft , ller P (2012). Influence of the OGG1 Ser326Cys polymorphism on oxidatively damaged DNA and repair activity, Free Radic. Biol. Med. 52(1): 118125. Kolodner RD (1995). Mismatch repair: mechanisms and relationship to cancer susceptibility. Trends Biochem. Sci., 10: 397-401. Krokan HE, Nilsen H, Skorpen F, Otterlei M, Slupphaug G (2000). Base excision repair of DNA in mammalian cells. FEBS Lett. 476(1-2): 7377. Li Z, Guan W, Li MX, Zhong ZY, Qian CY, Yang XQ, Liao L, Li ZP, Wang D. (2011). Genetic polymorphism of DNA base-excision repair genes (APE1, OGG1 and XRCC1) and their correlation with risk of lung cancer in a Chinese population. Arch. Med. Res. 42(3): 226-234. Lindahl T. (1993). Instability and decay of the primary structure of DNA. Nature, 362(6422): 709-715. Marnett LJ (2000). Oxyradicals and DNA damage. Carcinogenesis, 21(3): 361-370.

7811

Moriya M, Ou C, Bodepudi V, Johnson F, Takeshita M, Grollman AP (1991). Site-specific mutagenesis using a gapped duplex vector: a study of translesion synthesis past 8-oxodeoxyguanosine in E. coli, Mutat. Res., 254(3): 281-288. Mullart E, Lohman PHM, Berends F, Vijg J (1990). DNA damage metabolism and aging, Mutat. Res. 237(5-6): 189-210. Norman DP, Chung SJ, Verdine GL (2003). Structural and biochemical exploration of a critical amino acid in human 8-oxoguanine glycosylase, Biochemistry. 42(6): 1564-1572. Pearl LH (2000). Structure and function in the uracil–DNA glycosylase superfamily. Mutat. Res. 460(3-4): 165-181. Rolda-Arjona T, Wei YF, Carter KC, Klungland A, Anselmino C, Wang RP, Augustus M, Lindahl T (1997). Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8hydroxyguanine-DNA glycosylase, Proc. Natl. Acad. Sci. USA, 94(15): 8016-8020. Rosenquist TA, Zharkov DO, Grollman AP (1997). Cloning and characterization of a mammalian 8-oxoguanine DNA glycosylase.,Proc. Natl. Acad. Sci. USA, 94(14): 7429-7434. Sambrook J, Fritsch E, Manaiatis T (1989). Molecular cloning: a laboratory manual 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Sanger F, Nicklen S, Coulson AR (1977). DNA sequencing with chainterminating inhibitors, Proc. Natl. Acad. Sci. USA, 74(12): 5463-5467. Shibutani S, Takeshita M, Grollman AP (1991). Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG. Nature, 349(6308): 431-434. Slupphaug G, Eftedal I, Kavli B, Bharati S, Helle NM, Haug T, Levine DW, Krokan HE (1995). Properties of a recombinant human uracilDNA glycosylase from the UNG gene and evidence that UNG encodes the major uracil-DNA glycosylase, Biochemistry, 34(1): 128138. Yuan W, Xu L, Feng Y, Yang Y, Chen W, Wang J, Pang D, Li D. (2010). The hOGG1 Ser326Cys polymorphism and breast cancer risk: a meta-analysis, Breast Cancer Res. Treat. 122(3): 835-842. Zhang Y, He BS, Pan YQ, Xu YQ, Wang SK (2011). Association of OGG1 Ser326Cys polymorphism with colorectal cancer risk: a metaanalysis, Int. J. Colorectal Dis. 26(12): 1525-1530.

Full Length Research Paper

Segregation and expression of transgenes in the progenies of Bt transgenic rice crossed to conventional rice varieties Zhonghua Wang*, Chao Yu and Leyu Jiang Institute of Biotechnology, Zhejiang Wanli University, Ningbo 315100, People’s Republic of China. Accepted 20 February, 2012

-Glucuronidase (GUS) activity bioassay, western blotting and polymerase chain reaction (PCR) analysis demonstrated that the cry1Ab gene was closely inherited and expressed with reporter gene gus in the progenies of Bacillus thuringiensis (Bt) transgenic rice (Oryza sativa L.) crossed to conventional rice varieties. Therefore, it is feasible using GUS-assisted-selection to preliminarily identify the Bt gene and study the inheritance of transgenes in breeding program. Mendelian segregation was observed in BC1F1, BC1F2 and F2 populations derived from Bt rice crossed to japonica rice respectively which indicated that the cry1Ab gene was inherited as a single dominant locus. PCR, Southern blotting and Western dot blotting analysis confirmed that cry1Ab gene was transferred to the genome of conventional rice varieties and it was highly expressed in the different progenies of Bt rice crossed to conventional rice varieties. Among these lines, the highest Bt toxin protein content reached 2.88% of total soluble proteins, even though the amount of Bt toxin protein in leaves of some GUS positive plants was higher than that detected in the original Bt rice. Meanwhile, the variances in Bt toxin protein between crosses and its parents were significant at 0.05 or 0.01 levels, respectively. Therefore, foreign cry1Ab gene with native insect resistant trait can be easily transferred to other rice varieties with higher yield potential and good quality through classical breeding. Key words: Oryza sativa L., transgenes, inheritance, expression. INTRODUCTION Rice (Oryza sativa L.) is one of the most important crop plants worldwide, especially in Asia (IRRI, 1989). Currently, more than 200 million tons of rice is lost per year due to insect pests. The most destructive insects are the lepidopterous stem borers, which cause annual losses of an estimated 10 million tons (Herdt, 1991). An attractive method for protection is the production of proteins with insecticidal activity by the rice plant itself. The entomocidal spore-forming soil bacterium Bacillus thuringiensis (Bt) offers a promising variety of so-called cry genes that encode insect-specific -endotoxins. Since

*Corresponding author. E-mail: wang1972@zwu.edu.cn. Abbreviations: Bt, Bacillus thuringiensis; glucuronidase; PCR, polymerase chain reaction.

GUS,

-

late 1980s, these cry genes have been transferred to higher plants including tobacco, tomato and cotton (Vaeck et al., 1987; Fischhoff et al., 1987; Perlak et al., 1990), resulting in insect-resistant plants. In addition, monocotyledonous plants such as maize (Koziel et al., 1993; Armstrong et al., 1995) and rice (Fujimoto et al., 1993; Wunn et al., 1996; Ghareyazie et al., 1997; Nayak et al., 1997; Wu et al., 1997; Cheng et al., 1998; Tu et al., 1998, 2000; Maqbool and Christou, 1999; Zhu et al., 1999) have also been successfully transformed with these genes. The former Zhejiang Agricultural University has suc-ceeded in obtaining many transgenic rice plants via Agrobacterium-mediated transformation through close co-operation with the University of Ottawa, Canada in 1994. Biological assays by polymerase chain reaction (PCR) and Southern hybridization confirmed that cry1Ab gene is successfully integrated into the rice genome (Xiang et al., 1999;

Wang et al.

Shu et al., 2000). Insect bioassays in both laboratory and field conditions showed that the transgenic plants were highly resistant to eight lepido-pteran rice pest species (Shu et al., 1998, 2000). The introduction and expression of foreign genes in plants by genetic transformation is now routine for many species, including rice, cotton, maize, wheat and soybean (Christou, et al., 1989), but the segregation and expression of transgenes in rice hybrid plants have rarely been reported. Here, we report the inheritance and expression of transgenes in the progenies of Bt transgenic rice crossed to conventional rice varieties. MATERIALS AND METHODS Two homozygous transgenic lines, KMD1 and KMD2, derived from a commercial Chinese japonica rice variety (Xiushui 11) transformed by Agrobacterium infection (Cheng et al., 1998; Xiang et al., 1999) were provided by Dr. Dianxing Wu from Zhejiang University. They contained a synthetic cry1Ab gene from Bt under the control of a maize ubiquitin promoter, and linked in tandem with gusA and hpt genes (Xiang et al., 1999). KMD1 comes from primary R0 transformant TR30 and KMD2 from GS5, which is independent on TR30 (Shu et al., 1998; 2000). Although KMD1 and KMD2 were only at R3 and R2 generation, respectivel when the crosses were made with conventional varieties, they were already homozygous for cry1Ab according to the results of PCR analysis (Shu et al., 1998, 2000). Representative commercial rice materials susceptible to lepidopteran were selected for this research. The first group comprises 3 conventional indica rice varieties: Zhe 733, Yongxian 57 and Jiayu 293, which are cultivated as early season crop varieties in Zhejiang and neighboring provinces of China. The second group includes 3 conventional japonica varieties: Zhejing 22, Yongjing 18 and Ning 04-81; these are widely planted as single or late season crop varieties in Zhejiang and Jiangsu Province of China. While the third group is represented by one indica cytoplasmic male sterility (CMS) restorer lines, Miyang 46, and one indica CMS maintainer lines, Longtefu B. Miyang 46 was developed by breeders of Republic of Korea and has been widely used as a commercial indica restorer line in hybrid rice production in China since late 1980s, while Longtefu B has been used as a commercial maintainer line in southern China since the early 1990s. Seeds of the above mentioned rice varieties were kindly provided by Ms. Juanying Han at the Seeds Administration Station of Yuyao County, Zhejiang Province, China. In the autumn of 2009, KMD1 and KMD2 lines were crossed to the above non-transgenic susceptible rice varieties or lines in the paddy field of Zhejiang Wanli University. In all the crosses, transgenic parents were used as pollen donor. A part of the F1 seeds were sent to Hainnan Province, China, and true F1 seedlings identified by -glucuronidase (GUS) assay were transplanted to rice fields together with non-transgenic parents in our winter breeding nursery in the winter of 2009. In the spring of 2010, back-crosses were made by using non-transgenic parents as pollen donor. Meanwhile, F2 seeds were obtained from F1 plants. GUS staining assay Histochemical GUS assays were performed as described by Rueb and Hensgens (1989) with some modifications. Leaf tissue of rice plants were incubated in X-Gluc staining solution containing 1 mg/ml 5-bromo-4-chloro-3-indolyl--D-glucuronide, 0.5% Triton X-

7813

100, 20% methanol and 100 mM phosphate buffer (pH 7.0). The leaves were pretreated in 100 mM phosphate buffer (pH 7.0) at 37°C for 1 to 2 h, and then incubated in X-Gluc staining solution at 37°C for more than 6 h or overnight. Finally, the leaves were washed with ddH2O and put in 95% ethanol for 2 to 3 h. The leaf with GUS expression displays blue color.

PCR analysis Genomic DNAs were mini-prepared following the method of Steiner et al. (1995). For identifying cry1Ab gene in the progenies of Bt rice crossed to conventional rice varieties, one pair of specific primers were designed and synthesized. The sequences of the primers were as follows: forward primer 5′-TTCCTTGGACGAAATCCCACC3′, reverse primer 5’-GCCAGAATTGAACACATGAGCGC-3′. The putative PCR product for cry1Ab gene was 559 base pairs (bp). First, DNA was subjected to 1 cycle with 94°C for 4 min (initial denaturation), then 35 cycles of three steps each (94°C, 30 s; 54°C, 1 min; 72°C, 90 s ) in 25 µL of PCR buffer (10 mM Tris-HCl, pH 8.4, 50 mM KCl, 2.0 mM MgCl2) containing 0.1 mM of each dNTPs, 50 to 100 ng primers and 1 U of Taq polymerase, and finally to 1 cycle with 72°C for 7 min (maintaining temperature). PCR products were then analyzed by agarose gel electrophoresis.

Southern blot Leaves of 8 rice plants from KMD1, F2 GUS positive plants of KMD1 crossed to Zhefu 504, together with Zhefu 504 control, were randomly chosen at the tillering stage respectively and were ground to fine powder using liquid nitrogen. DNA isolation was performed as described by Lu and Zheng (1992). About 15 μg of rice genomic DNAs was digested with Hind III, the DNA fragments were subsequently separated overnight on a 0.8% agarose gel and transferred to Hybond N + nylon membrane following the method described by Sambrook et al. (1989). The 559 bp DNA fragment amplified with one pair of primers specific for the cry1Ab gene was used as hybridization probe. Probe labeling, membrane prehybridization and hybridization were carried out according to the hybridization kit instruction supplied by Amersham Pharmacia Biotech Company. After hybridization, the membrane was seal with a plastic sheet and exposed to X-ray film.

Assay for Cry1Ab protein Leaves of GUS positive plants at tillering stage were collected and ground in liquid nitrogen. About 0.4 g of above powder was transferred to 1.5 ml Eppendorf tubes with 400 to 600 µL extraction buffer (50 mM Na2 CO3, 10 mM DTT). After homogenizing, the tubes were kept at 4°C for 2 to 3 h and then 1 µL crude extract was applied to nitrocellulose membrane and subjected to Western dot blotting by using a polyclonal goat antibody specific for Cry1Ab essentially as described by Sardana et al. (1996). Total protein concentration was measured by using bicinchoninic acid (BCA) protein assay reagents.

RESULTS Linkage analysis of reporter gene (gus) and cry1Ab gene Previous studies have proved that the reporter gene (gus) was linked closely with cry1Ab gene in T-DNA of Bt

7814

Afr. J. Biotechnol.

Table 1. cry1Ab expression in GUS positive plants in the progenies of Bt transgenic rice crossed to conventional rice varieties.

Generation F1 F2 BC1F1 BC2 Total

Number of combination 4 7 10 7 28

Number of GUS positive plant 74 166 86 68 394

Number of cry1Ab gene expressing 74 (100%) 164 (98.8%) 86 (100%) 68 (100%) 392 (99.5%)

Figure 1. Identification of the cry1Ab gene in F2 GUS positive plants derived from Bt transgenic line KMD1 crossed to indica rice variety Zhe 733. The DNA templates for PCR were the parental lines Zhe 733 (Lane 1), KMD1 (Lane 2) and F2 plants (Lanes 3 to 13). The size of fragment is shown at the right.

transgenic rice (Shu et al., 1998; Xiang et al., 1999; Wu et al., 2000). After Bt transgenic rice was crossed or backcrossed to conventional rice varieties, it was found that this relationship still stayed (Table 1). The result demonstrates that the cry1Ab gene was closely inherited and co-expressed with the reporter gene gus. To identify the presence of cry1Ab gene in the GUS positive plants of the progenies of Bt transgenic rice crossed to conventional rice varieties, PCR analysis was conducted with specific DNA primers. The expected 559 bp size fragment was amplified from all random F2 positive plants derived from Zhe 733×KMD1 (Figure 1). Southern blot of Hind III digested DNA randomly chosen from F2 GUS positive plants of KMD1 crossed to Zhe 733 were performed. The expected 4.1 kb DNA fragment consisting of the ubiquitin promoter, the cry1Ab gene and the nos terminator was detected. The result demonstrates that the cry1Ab gene was indeed transferred to the progenies via sexual reproduction and the expression unit was kept intact in the successive generations (Figure 2). The results obtained herein confirmed that cry1Ab gene was evidently presented in the GUS-positive progenies of Bt transgenic rice crossed to conventional rice varieties. Meanwhile, any issue related with the ecological risks and food bio-safety of gus gene and its expression product in transgenic modified plants were not found (Wang and Xia, 2000). Therefore, it is practicable using GUS-assisted-selection to preliminarily identify the Bt gene and study the inheritance of transgenes in backcross breeding program. Segregation of transgenes Segregation ratio of GUS positive and negative plants in the progenies of Bt transgenic rice crossed to

conventional rice varieties was investigated by GUS histochemical assay. Results indicate that the segregation ratio of reporter gene gus also showed the inheritance pattern of cry1Ab gene. Mendelian segregation of transgenes was observed in BC1F1 and BC1F2 populations of Bt transgenic rice backcrossed to conventional rice varieties respectively (Table 2). The result suggested that the cry1Ab gene of Bt transgenic rice was inherited as a single, dominant locus. However, it was found that segregation ratio in the F2 population of Bt transgenic rice crossed to early season indica rice 2 varieties deviated from the expected 3:1 ratio ( >3.84) (Table 2). Cry1Ab protein assay Cry1Ab insecticidal protein expression level in the different progenies of Bt transgenic rice crosses to conventional rice varieties was analyzed by Western dot blotting. The samples derived from GUS positive plants of Bt transgenic rice crossed to conventional rice varieties were found to produce a higher level of toxin protein, but with greater range of variation. The maximum level is up to 2.88% SP (Table 3). As seen in Table 3, Cry1Ab toxin protein in all hybrid lines was expressed higher than in Bt transgenic rice lines KMD1 and KMD2. In addition, it was also found that the variation of Bt toxin protein between F1 plants derived Zhe 733×KMD1 or Zhejing 22×KMD1 and Bt transgenic rice control is highly significant at 0.01 level. DISCUSSION Typically, transgenes with a single copy usually segregate

Wang et al.

7815

Figure 2. Southern blot of Hind III-digested DNA from Bt transgenic rice line KMD1 and F2 GUS positive plants of KMD1 crossed to indica rice variety Zhe 733. Zhe 733 (Lane 8); Bt transgenic rice KMD1 (Lane 9); F2 plants (Lanes 1 to 7). The size of fragment was estimated using marker ladder as shown on the left.

Table 2. Segregation ratio of GUS positive and negative plants in the progenies of Bt transgenic rice crossed to conventional rice varieties.

BC1F1 F2 BC1F2

Tested Plant 116 85 105

GUS positive plant 57 53 79

GUS negative plant 59 32 26

YX57/KMD1

BC1F1 F2

6 176

3 105

JY293/KMD1

BC1F1 F2 BC1F2

23 133 63

LTH/KMD1 MY46/KMD1 ZJ22/KMD1

BC1F1 BC1F1 F2

Z733/KMD2

Combination

Generation

Z733/KMD1

GUS /GUS

ď Ł

0.97:1 1.66:1 3.04:1

0.008 (1:1) 6.251 (3:1) 0.003 (3:1)

3 71

1:1 1.48:1

0.166 (1:1) 17.212 (3:1)

11 67 47

12 66 16

0.92:1 1.01:1 2.71:1

0.000 (1:1) 42.040 (3:1) 0.005 (3:1)

41 43 190

21 21 135

20 22 55

1.05:1 0.95:1 2.45:1

0.000 (1:1) 0.000 (1:1) 1.718 (3:1)

BC1F1 F2 BC1F2

112 125 80

56 77 59

56 48 21

1:1 1.60:1 2.81:1

0.009 (1:1) 8.838 (3:1) 0.067 (3:1)

JY293/KMD2

146

1.61:1

13.891 (3:1)

YJ18/KMD2

BC1F1 F2

17 140

8 94

9 46

0.89:1 2.04:1

0.000 (1:1) 4.609 (3:1)

N0481/KMD2

185

139

3.02:1

0.001 (3:1)

Z733, Zhe 733; YX57, Yongxian 57; JY293, Jiayu 293; LTH, Lontefu B; MY46, Miyang 46; ZJ22, Zhejing 22; YJ18, Yongjing 18; N0481, Ning 2 04-81; *ď Ł (0.05) =3.84

with 3:1 ratio in the self- population (Christous et al., 1989; Datta et al., 1990; Ulian et al., 1994; Peng et al., 1995), and 1:1 in the backcross population (Hiei et al., 1994; Casas et al., 1995; Peng et al., 1995; Dillen et al., 1997). In the present study, Mendelian segregation of reporter gene was also observed in F2, BC1F1 and BC1F2 populations derived from Bt transgenic rice lines KMD1 and KMD2 crossed to conventional rice varieties, which indicates that the cry1Ab gene was inherited as a single, dominant trait. On the other hand, it also shows that T-

DNA was integrated as a single locus into rice genome. However, non-Mendelian segregation of transgenes has been reported in previous studies on transgenic rice (Datta et al., 1990; Peng et al., 1995) and other transgenic crops such as soybean (Christou et al., 1989), wheat (Srivastava et al., 1996) and cotton (Sachs et al., 1998). Some mechanisms responsible for this phenolmenon, including the lower viability of transgenic pollen, lower fertilization ability (Zhang et al., 1996), transgene inactivation (Spencer et al., 1992; Walters et al., 1992),

7816

Afr. J. Biotechnol.

Table 3. Cry1Ab insecticidal protein concentration [as percent of total soluble protein (%SP)] in young terminal leaves of different hybrid lines derived from Bt transgenic rice crossed or backcrossed to conventional rice varieties at tillering stage.

Combination

Generation

Plant tested

Bt protein (%SP)*

The difference between hybrid lines and Bt rice

Z733/KMD1

F1 F2 BC1F1

30 12 10

1.04 ± 0.54 (0.48-2.52) 1.29 ± 0.55 (0.41-2.05) 0.98 ± 0.31 (0.51-1.57)

0.53*** 0.78*** 0.47***

YX57/KMD1

F2 BC1F1

50 3

0.64 ± 0.60 (0.12-2.88) 1.07 ± 0.08 (1.02-1.17)

0.13 0.56***

JY293/KMD1 LTH/KMD1 MY46/KMD1 ZJ22/KMD1

BC1F1 BC1F1 BC1F1 F1

4 11 21 24

0.70 ± 0.24 (0.52-1.04) 0.90 ± 0.27 (0.52-1.37) 0.99 ± 0.45 (0.20-1.80) 0.85 ± 0.40 (0.34-1.48)

0.19 0.39** 0.48*** 0.34**

Z733/KMD2

F2 BC1F1

10 9

1.32 ± 0.30 (0.69-1.85) 0.64 ± 0.20 (0.36-0.99)

0.91*** 0.23

JY293/KMD2 N0481/KMD2 KMD1 KMD2 Z733 YX57 JY293 LTH MY46 ZJ22 YJ18 N0481

BC1F1 F2 R3 R2 -

5 46 30 10 10 10 10 10 10 10 10 10

1.38 ± 0.44 (1.02-2.04) 0.80 ± 0.38 (0.15-2.35) 0.51 ± 0.29 (0.20-1.48) 0.41 ± 0.19 (0.11-1.09) 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

0.97*** 0.39** -

Z733, Zhe 733; YX57, Yongxian 57; JY293, Jiayu 293; LTH, Lontefu B; MY46, Miyang 46; ZJ22, Zhejing 22; YJ18, Yongjing 18; N0481, Ning 04-81. *Percentage of Bt protein to total soluble protein, Mean ± SE (change range); ***significant at 0.05 level; *****significant at the 0.01 level

or the recessive lethal (Scott et al., 1998) were proposed in recent years. Christou et al. (1989) and Srivastava et al. (1996) proposed that the failure of passing the transgene to the next generation through pollen (pollen lethality) is the reason for abnormal segregation. Moreover, Sachs et al. (1998) attributed abnormal phenotypic ratios in F2 progeny derived from MON 249 to poor germination and survival rate resultant from foreign gene insertion and/or somaclonal effects. In this experiment, it was found that the segregation ratio of F2 population derived from Bt transgenic rice crossed to early season indica rice varieties deviated from Mendelian law (Table 2). The irregular ratios in F2 population of indica/japonica crosses may result from pollen sterility of F1 hybrid plants. High pollen sterility of F1 plants is a common phenomenon in interspecies crosses between indica and japonica rice, and abnormal segregation has been observed for molecular markers in resultant F2 populations

(Xu et al., 1995, 1997; Zhuang et al., 1999). This was also supported by Zhuang et al. (1999) who indicated that the high sterility of pollens is the main factor leading to the distortion of molecular markers in F2 population of indica-japonica crosses. Previous reports on the expression of Bt gene in rice only showed original transgenic plants (Fujimoto et al., 1993; Wunn et al., 1996; Ghareyazie et al., 1997; Nayak et al., 1997; Cheng et al., 1998; Tu et al., 1998, 2000; Maqbool and Christou, 1999; Xiang et al., 1999; Wu et al., 2002). In this study, it was found that Bt gene can also be highly expressed in hybrid rice plants derived from transgenic rice crossed to conventional rice varieties. It was also found that Cry1Ab toxin protein concentration (%SP) in F1 populations derived from Bt transgenic rice crossed to early season indica variety or japonica variety was higher significantly than in original Bt transgenic rice (P< 0.01) (Table 3). This might be related to hybrid vigor

Wang et al.

of plants. Previous studies showed genetic background affected the expression of transgenes. Sachs et al. (1998) reported that genetic background greatly impacted the content of Cry1Ab toxin protein in F2 population derived from Bt transgenic cotton crossed to conventional insect-resistant cotton isoline. The Cry1Ab protein concentration (%SP) was 19% lower in the C312×ST213 background than that in the C312×CAMD-E and C312×DP61 background. In the present experiment, it was found that the Cry1Ab protein concentration (%SP) was 22.3% higher in the Zhe 733×KMD1 than in the Zhejing 22×KMD1 background. In addition, our results indicated that the average Cry1Ab content of F1, GUS positive BC1F1 and F2 plants is higher than that of KMD1 and KMD2 in most crosses, although difference among crosses exists. Plant heterosis and genotypic effects may in part explain the Cry1Ab content increase and difference among crosses; other mechanisms for this phenomenon may also exist. Based on these results, it is reasonable to conclude that KMD1 and KMD2 could be used as an exploitable source of striped stem borer (SSB) resistance in various rice breeding programs, including japonica, indica and hybrid rice. When establishing a breeding program using KMD1 or KMD2 as SSB resistance donor, one should consider the segregation difference of cry1Ab gene. Genetic engineering is a powerful tool for crops improvement, and enables plant breeders to utilize genes from other species, which otherwise is impossible. Once a gene is introduced into rice plants, conventional breeding techniques should be as effective as for other rice own genes. Therefore, genetic transformation is not always necessary, and sometimes not always capable or available in developing countries to introduce genes into each variety of crops. Plant breeders should be able to develop new varieties by using transgenic plants as donors. In this case, studies on phenotypic performance of progenies from crosses between transgenic and nontransgenic plants are of importance in breeding programs. A previous study showed that no significant differences in main agronomic traits, such as plant height, panicle length, the number of tillers per plant, days to heading and 1000-grain weight, were found between the two classes of the GUS-positive plant and the GUSnegative plant in the progenies of Bt transgenic rice lines KMD1 and KMD2 crossed to conventional rice varieties (Cui et al., 2001). In conclusion, therefore, the foreign cry1Ab gene with native insect resistant trait in a single genetic background can be successfully accomplished by a traditional cross or backcross breeding program. ACKNOWLEDGEMENTS A part of this research was financially supported by grants from Ministry of Science and Technology, China, and the Science and Technology Department, Zhejiang Province,

7817

China. For critical reading we thank Dr. Yulin Jia of Dale Bumpers National Rice Research Center, USDA-ARS, United States of America. REFERENCES Armstrong CA, Parker GB, Pershing JC, Brown SM, Sanders PR, Duncan DR, Stone T, Dean DA, DeBoer DL, Hart J, Howe AR, Morrish FM, Pajeau ME, Petersen WL, Reich BJ, Rodriguez R, Santino CG, Sato SJ, Schuler W, Sims SR, Stehling S, Tarochione LJ, Fromm ME (1995). Field evaluation of European Corn Borer control in the progeny of 173 transgenic corn events expressing an insecticidal protein from Bacillus thuringensis. Crop Sci. 35: 550-557. Casas AM, Kononowicz AK, Bressan RA, Hasegawa PM (1995). Cereal transformation through particle bomardment. Plant Breed. Rev. 13: 235-264. Cheng X, Sardana R, Kaplan H, Altosaar I (1998). Agrobacteriumtransformed rice plants expressing synthetic cryIA(b) and cryIA(c) genes are highly toxic to striped stem borer and yellow stem borer. Proc. Natl. Acad. Sci. USA, 95: 2767-2772. Christou P, Swain WF, Yang NS, McCabe DE (1989). Inheritance and expression of foreign genes in transgeic soybean plants. Proc. Natl. Acad. Sci. USA, 86: 7500-7504. Cui H, Wang Z, Shu Q, Wu D, Xia Y, Gao M (2001). Agronomic traits of hybrid progenies between Bt transgenic rice and conventional rice varieties. Chinese J. Rice Sci. 15: 101-106. Datta SK, Peterhas A, Datta K, Potrykus I (1990). Genetically engineered fertile indica-rice recovered from protoplasts. Biotechnology, 8: 736-740. Dillen W, Clercq JD, Goosens A, Van Montagu M, Sngenon G (1997). Agrobacterium mediated transformation of Phaseolus acuti-folius A. Gray. Theor. Appl. Genet. 94: 151-158. Fischhoff DA, Bowdish KS, Perlak FJ, Marrone PG, McCormick SM, Niedermeyer JG, Dean DA, Kusano-Krezmer K, Mayer EJ, Rochester DE, Rogers SG, Fraley RT (1987). Insect tolerant transgenic tomato plants. Biotechnology, 5: 807-813. Fujimoto H, Itoh K, Yamamoto M, Kyozuka J, Shimamoto K (1993). Insect resistant rice generated by introduction of a modified endotoxin geng from Bacillus thuringiensis. Biotechnology, 11: 1151-1155. Ghareyazie B, Alinia F, Menguito CA, Rubia LG, Palma JM, Liwanag EA, Cohen MB, Khush GS, Bennett J (1997). Enhanced resistance to two stem borers in an aromatic rice containing a synthetic cryIA(b) gene. Mol. Breed. 3: 401-414. Herdt RW (1991). Research priorities for rice biotechnology. In: Khush GS and Toenniessen GH (Eds), Rice Biotechnology, CAB Inter. Wallingford. pp. 19-54. Hiei Y, Ohta S, Komari T, Kumashiro T (1994). Efficient transformation of rice mediated by agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 6: 271-282. International Rice Research Institute (1989). IRRI toward 2000 and beyond. IRRI, Los Banos, Philippines, pp. 34-47. Koziel MG, Beland GL, Bowman C, Carozzi NB, Crenshaw R, Crossland L, Dawson J, Desal N, Hill M, Kadwell K, Launis K, Maddox D, Mepherson K, Meghji MR, Merlin E, Rhodes R, Warren GW, Wright M, Evola SV (1993). Field performance of elite transgenic maize plants expressing an insecticidal protein derived from Bacillus thuringiensis. Biotechnology, 11: 194-200. Lu YJ, Zheng KL (1992). A simple method to extract DNA from rice. Chinese J. Rice Sci. 6: 47-48. Maqbool SB, Christou P (1999). Multiple trait of agronomic importance in transgenic indica rice plants: analysis of transgene integration patterns, expression levels and stability. Mol. Breed. 5: 471-480. Nayak KP, Basu D, Das S, Basu A, Ghosh D, Ramakrishna NA, Ghosh M, Sen SK (1997). Transgenic elite indica rice plants expressing CryIAcδ-endotoxin of Bacillus thuringiensis are resistant against yellow stem borer (Scirpophaga incertulas). Proc. Natl. Acad. Sci. USA, 94: 2111-2116. Perlak FJ, Deaton RW, Armstrong TA, Fuchs RL, Sims SR, Greenplate JT, Fishoff DA (1990). Insect resistant cotton plants. Biotechnology, 8: 939-943.

7818

Afr. J. Biotechnol.

Peng J, Wen F, Lister RL, Hodges TK (1995). Inheritance of gusA and neo genes in transgenic rice. Plant Mol. Biol. 27: 91-104. Rueb S, Hensgens LAM (1989). Improved histochemical staining for GUS activity in monocotyledonous plants. Rice Genet. Newsl. 6: 168169. Sachs ES, Benedict JH, Stelly DM, Taylor JF, Altman DW, Berberich SA, Davis SK (1998). Expression and segregation of genes encoding Cry1A insecticidal proteins in cotton. Crop Sci. 38: 1-11. Sambrook J, Fritsch EF, Maniatis T (1989). Molecular cloning: a laboratory manual. Cold Spring Harbor Press, New York. pp. 106134. Sardana R, Dukiandjiev S, Giband M, Cheng XY, Cowan K, Sauder C, Altosaar I (1996). The construction of modified cry1Ab and cry1Ac toxin genes. Plant Cell Rep. 15: 677-681. Scott A, Woodfield D, White DWR (1998). Allelic composition and genetic background effects on transgene expression and inheritance in white clover. Mol. Breed. 4: 479-490. Shu Q, Ye G, Cui H, Xiang Y, Wu D, Gao M (1998). Development of transgenic Bacillus thuringensis rice resistant to rice stem borers and leaf folders. J. Zhejiang Agric. University, 24: 579-580. (in Chinese with English abstract) Shu Q, Ye G, Cui H, Cheng X, Xiang Y, Wu D, Gao M, Xia Y, Hu C, Sardana R, Altosaar I (2000). Transgenic rice plants with a synthetic cry1Ab gene from Bacillus thuringensis were highly resistant to eight lepidopteran rice pest species. Mol. Breed. 6: 433-439. Spencer TM, Oâ&#x20AC;&#x2122;Brien JV, Start WG, Adams TR (1992). Segregation of transgene in maize. Plant Mol. Biol. 18: 201-210. Srivastava V, Vasil V, Vasil IK (1996). Molecular characterization of the fate of transgenes in transformed wheat (triticum aestivum L.). Theor. Appl. Genet. 92: 1031-1037. Steiner JJ, Poklemba CJ, Fjellstrom RG, Ellictt LF (1995). A rapid onetube genomic DNA extraction process for PCR and RAPD analysis. Nucleic Acids Res. 23: 2569-2570. Tu J, Datta K, Alam MF, Fan Y, Khush GS, Datta SK (1998). Expression and function of a hybrid Bt toxin gene in transgenic rice conferring resistance to insect pest. Plant Biotechnol. 15: 195-203. Tu J, Zhang G, Datta K, Xu C, He Y, Zhang Q, Khush GS, Datta SK (2000). Field performance of transgenic elite commercial hybrid rice expressing Bacillus thuringiensis d-endotoxin. Nat. Biotechnol. 18: 1101-1104. Ulian EC, Magill JM, Smith RH (1994). Expression and inheritance pattern of two foreign genes in petunia. Theor. Appl. Genet. 88: 433440. Vaeck M, Reynaerts A, Hofte H, Jansens S, De Beuckeleer M, Dean C, Zabeau M, Van Montagu M, Leemans J (1987). Transgenic plants protected from insect attack. Nature, 327: 239-247. Walters DA, Vetsch CS, Potts DE, Lundquist RC (1992). Transformation and inheritance of a hygromycin phosphotransferase gene in maize plants. Plant Mol. Biol. 18: 189-200. Wang Z, Xia Y (2000). Bio-safety and expression of reporter gene gus in transgenic plants. Chinese Bull. Life Sci. 12: 198-209.

Wu C, Fan Y, Zhang C, Oliva N, Datta SK (1997). Transgenic fertile japonica rice expressing a modified cry1Ab gene resistant to yellow stem borer. Plant Cell Rep. 17: 129-132. Wu G, Cui H, Shu Q, Xia Y, Xiang Y, Gao M, Cheng X, Altosaar I (2000). Striped Stem Borer (chilo suppressalis) Resistant Transgenic Rice with a cry1Ab Gene from Bt (Bacillus thuringiensis) and its Rapid Screening. J. Zhejiang University, 19:15-18. Wu G, Cui H, Ye G, Xia Y, Sardana R, Cheng X, Li Y, Altosaar I, Shu Q (2002). Inheritance and expression of the cry1Ab gene in Bt (Bacillus thuringiensis) transgenic rice. Theor. Appl. Genet. 104: 727-734. Wunn J, Kloti A, Burkhardt PK, Ghosh GCB, Launis K, Iglesias K, Potrykus I (1996). Transgenic indica rice breeding line IR58 expressing a synthetic cry1Ab gene from Bacillus thuringiensis provides effective insect pest control. Biotechnology, 14: 171-176. Xiang Y, Liang Z, Gao M, Shu Q, Ye G, Cheng X, Altosaar I (1999). Agrobacterium-mediated transformation of insecticidal Bacillus thuringensis cry1Ab and cry1Ac genes and their expression in rice. Chinese J. Biotechnol. 15: 494-500. Xu Y, Shen Z, Zhu L (1995). Abnormal segregation of RLFPs and their chromosome distribution in F2 populations between indica and japonica crosses. Acta Botanica Sinica, 37: 91-96. Xu Y, Zhu L, Xiao J, Huang N, McCouch SR (1997). Chromosomal regions associated with segregation distortion of molecular markers in F2, backcross, doubled haploid, and recombinant inbred populations in rice (Oryza sativa L.). Mol. Gen. Genet. 253: 535-545. Zhang S, Warkentin D, Sun B, Zhong H, Sticklen M (1996). Variation in the inheritance of expression among subclones for unselected (uidA) and selected (bar) transgenes in maize (Zea mays L.). Theor. Appl. Genet. 92: 752-761. Zhu C, Hu Q, Weng F, Zheng Z, Zhang J (1999). Production of insectresistant rice plants transformed with cry1Ab and pinII genes. Chinese J. Agric. Biotechnol. 7: 259-266. Zhuang C, Zhang G, Mei M, Lu Y (1999). Molecular mapping of the S-a locus for F1 pollen sterility in cultivated rice (Oryza sativa L.). Acta. Genet. Sinica, 26: 213-218.

Full Length Research Paper

The characterization of cytoplasmic ribosomal protein genes in microsporidian Nosema bombycis Genome Handeng Liu1,2, Guoqing Pan1*, Tian Li1, Wei Huang1 and Zeyang Zhou1,3 1

Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, P.R. China. 2 Experimental Teaching Center, Chongqing Medical University, Chongqing 400016, P.R. China. 3 Laboratory of Animal Biology, Chongqing Normal University, Chongqing 400047, P.R. China. Accepted 31 August, 2011

Microsporidia are obligate intracellular, eukaryotic parasites of medical and commercial importance, which can infect almost all animals including humans. However, their ribosomes are not of the 80S type as other eukaryotes, but like the prokaryotic 70S ribosome. In order to get the global composition of ribosomal protein genes of Nosema bombycis, the pathogen of Pébrine, and their comparative genomics’ characteristics, a genome-wide survey in N. bombycis genome was performed. From the results, we identified 130 CDSs corresponding to 73 ribosomal protein genes. Among them, three ribosomal protein genes (RPL19, RPS4 and RPS18) with short introns (23 or 24 bps) were verified by N. bombycis ESTs, and they have the same structure among microsporidia. The novel arrangements of ‘AAATTT-like signal – CCC/GGG-like motif – transcription start site’ are present in the upstream sequences of ribosomal protein genes, and several regulatory elements that may have synergy with introns of ribosomal protein genes for its high transcriptional frequency were detected too. 76.7% ribosomal protein genes of N. bombycis were located in syntenic blocks, indicating that their gene order was conserved among microsporidian species. And phylogenic trees show its ancient eukaryotic position too. The characterization of the total ribosomal proteins contributes a first step to ribosomal proteins’ transcription regulation, evolution of microsporidia. Key words: Microsporidian, ribosomal protein, Nosema bombycis, transcription regulation, evolution.

INTRODUCTION Ribosome is a ribonucleoprotein complex that is composed of rRNAs and proteins, and is responsible for the synthesis of polypeptide chains in all living cells. The 70S ribosome belongs to prokaryote, while eukaryotes harbor 80S ribosome. Atomic resolution crystal structures of prokaryotic ribosome suggest that the two fundamental activities of ribosome (peptidyl transfer at the P site and decoding activity at the A site) are carried out by the RNA (Ban et al., 2000; Nissen et al., 2000; Ogle et al., 2001). The structure and function of both prokaryotic and eukaryotic ribosome have been investigated. The cytosolic ribosome is composed of a large number of ribosomal proteins (RPs) and distinct rRNAs (three

*Corresponding author. E-mail: gqpan@swu.edu.cn. +86-23-68251088. Fax: +86-23-68251128.

Tel:

distinct rRNAs in prokaryotes and four in eukaryotes). Prokaryotic ribosome and ribosomal proteins have provided knowledge of ribosome structure and composition. Three dimensional structures of small and large ribosomal subunits of thermophilic eubacteria have been earlier described at 5.5- and 2.5-Å resolution from crystallographic data (Ban et al., 1999, 2000; Clemons et al., 1999), respectively. In total, 55 ribosomal proteins have been identified in Escherichia coli and their amino acid sequences have been determined (Wittmann, 1982; Wittmann-Liebold et al., 1990). The ordered assembly process of eubacterial ribosome was also documented too (Nomura et al., 1984; Culver et al., 1999). As well known, ribosomes of an archaebacterial ancestor gave rise to the cytosolic ribosomes of eukaryotes (Matheson et al., 1990; Wittmann-Liebold et al., 1990; Wool et al., 1995). However, the ribosomal proteins of plastids and mitochondria indicate evolutionary similarity to those of

7820

Afr. J. Biotechnol.

eubacteria and include organelle-specific proteins (Graack and Wittmann-Liebold, 1998; Koc et al., 2000; Yamaguchi and Subramanian, 2000; Yamaguchi et al., 2000). In eukaryotes, the ribosomal protein component of Rattus norvegicus was determined by direct protein sequencing followed by gene cloning and a presumed complete set of 79 ribosomal proteins was compiled (Wool et al., 1995). In addition, genes corresponding to 78 ribosomal proteins of Saccharomyces cerevisiae were also identified through genome sequencing efforts (Goffeau et al., 1996; Planta and Mager, 1998). The evolutionary conservation of ribosomal proteins is not surprising given the constraints of rRNA-protein interactions, coordinated ribosome assembly, and ribosome function. Actually, phylogenetic relationships between animal, fungi, and plant kingdoms have been obtained by comparison of orthologous ribosomal proteins (Veuthey and Bittar, 1998). Also, the distribution of ribosomal protein genes of both prokaryotes and eukaryotes has been examined. In eubacteria, lots of the ribosomal protein genes are clustered in a few operons, which allows for coordinated regulation (Nomura et al., 1984). For humans, 75 ribosomal protein genes have been located and they are distributed on all chromosomes, with a bias toward chromosome 19 (Kenmochi et al., 1998b). Synthesis of ribosomal proteins in eukaryotes requires coordination of now unlinked genes. It is conspicuous that the regulation of ribosomal protein gene expression appears to occur at the transcriptional level in S. cerevisiae (Planta and Mager, 1998) and predominantly at the translational level in animals (Meyuhas, 2000; Meyuhas and Hornstein, 2000). For the ribosome of microsporidia, which is same as the other two amitochondriate groups of unicellular eukaryotes, diplomonads and parabasalids; they exhibit certain distinct features when compared with ribosomes of ‘typical’ eukaryotes such as S. cerevisiae or R. norvegicus. These features are that the 70S sedimentation coefficient of microsporidian (N. bombycis) (Ishihara and Hayashi, 1968) and trichomonad (Champney et al., 1992) ribosomes have shorter small and large subunit ribosomal RNAs (Vossbrinck et al., 1987; Sogin et al., 1989; Chakrabarti et al., 1992; Healey et al., 1990; Philippe and Germot, 2000; Peyretaillade et al., 1998) than those found in ‘typical’ eukaryotes, and the presence of fewer proteins (40 to 56) in trichomonad ribosomes (Champney et al., 1992), which is absent in microsporidia of the internal transcribed spacer 2 present in the LSU rRNA region of all other eukaryotes (Weiss and Vossbrinck, 1999). Moreover, a covalent link joins the 5.8S region with the LSU as seen in prokaryotes. Previously, these features were regarded as one part of evidence that made them ‘prokaryotic’ or ‘primitive eukaryotic’, although, more recent work indicates that none of these provide a compelling argument for such status (Roger, 1999). In addition, recent phylogenetic studies have consistently

supported a placement of these organisms as a basal lineage of the fungi (Franzen et al., 2006; Germot et al., 1997; Hirt et al., 1997; Peyretaillade et al., 1998). These parasites are characterized by small genomes ranging from only 2.3 Mb to 23 Mb (Peyretaillade et al., 1998; Belkorchia et al., 2008), a trait reflected in the short length of most putative proteins compared to eukaryote orthologues and compact gene organization. To date, over 1300 species of Microsporidia (in 160 genera) have been formally described in the literature, based on their cellular structure, life cycle, and host specificity (Corradi and Keeling, 2009). Unfortunately, the characterization of ribosome does not encompass these features for all three groups, and thus, it remains to be established whether the protein components really separate these groups from the ‘typical’ eukaryotes. Till date, there are a few reports about the ribosomal proteins of microsporidia. Using a genome-wide investigation of synteny between a broader range of fungi and three microsporidia, the only conserved gene pair was RPL21 and RPS9 (Lee et al., 2008), which is intriguingly conserved across all fungi, but not in species outside the fungal kingdom, suggesting an ancient functional role for this gene pair within the fungi. After a small spliceosomaltype intron had been discovered in a ribosomal protein gene of Encephalitozoon cuniculi (Biderre et al., 1998), 11 ribosomal protein genes which harbor a short intron sequence have been found (Katinka et al., 2001). In Nosema ceranae genome, six ribosomal protein genes with predicted short introns have been identified, only five of them are orthologs to ribosomal protein genes of E. cuniculi (Cornman et al., 2009). However, no spliceosomal intron has been found in ribosomal protein genes in the Enterocytozoon bieneusi genome data (Akiyoshi et al., 2009). And RPL5 gene, which contains an intron in E. cuniculi, does not contain an intron in Edhazardia aedis (Gill et al., 2008). As the first discovered microsporidia, N. bombycis has been studied since the middle of the nineteenth century. N. bombycis is an obligate intracellular parasite of the domesticated silkworm, and as the causative agent of pebrine disease, is still prevalent in sericulture. Through pulse-field gel electrophoresis (PFGE), the number of chromosomes in N. bombycis was estimated at 18, ranging from approximately 380 to 1500 kbp, with a total size of approximately 15,330 kb (Kawakami et al., 1994). Recently, the genome project of N. bombycis had been performed in our laboratory. To date, a whole genome shotgun database with 7.8-fold coverage of the whole genome and a cDNA library with 11,155 expressed sequence tags were constructed successfully. For ribosomal RNA, we performed a genome-wide analysis and find that the ribosomal RNA of N. bombycis is multiple and distributed on all chromosomes (Liu et al., 2008), but the characteristics of ribosomal proteins are still unknown. In this study, a genome-wide analysis was performed to the cytoplasmic ribosomal protein genes (RPGs) of N.

Liu et al.

bombycis and the total ribosomal protein genes have been identified. At the same time, the characteristics and genome distribution of all RPGs have been displayed and there are three ribosomal protein genes containing short intron sequences verified by ESTs. Also, the core promoter and regulatory elements corresponding to ribosomal protein genes are predicted in the upstream sequence. In order to get more information among different microsporidian, syntenic maps and phylogenic trees are constructed for all ribosomal protein genes. MATERIALS AND METHODS Based on the N. bombycis genome, in total, we perform a genome-wide survey to search the genome annotation table using the key words “ribosomal protein”. Also, using the annotation ribosomal protein gene sequences in other organisms (including E. cuniculi, Antonospora locustae, E. bieneusi, N. ceranae and S. cerevisiae) as query, a BLAST searching was conducted on N. bombycis genome in order to find more ribosomal protein gene orthologues. In order to display the distribution of ribosomal proteins on N. bombycis genome, pictures of ribosomal protein genes located on genome have been plotted using a script of Perl programmer (drawContigStructure). Some ribosomal protein genes which clustered on one scaffold have been exhibited too. In other microsporidian, such as E. cuniculi, N. ceranae and A. locustae, ribosomal protein genes which harbor intron have been documented before (Katinka et al., 2001; Cornman et al., 2009; Peyretaillade et al., 2009). However, we haven’t found intron in another microsporidian E. bieneusi. So, using the same method, we searched introns in ribosomal protein genes of N. bombycis. The core promoter regions of ribosomal protein genes were predicted by a promoter-finding program, which was designed on the basis of time-delay neural network, Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html). The parameter of minimum promoter score of each gene was set at 0.8 (Reese, 2001). After predicting the promoter of the ribosomal protein genes and aligning their sequences by ClustalX software, we treated the core promoters using Weblogo (http://weblogo.berkeley.edu/logo.cgi). The position of the nucleotide sequences was calculated based on the distance from the initiation site of the predicted transcription start site (TSS, +1). The regions 500 bps upstream from the transcription initiation site were used for analyzing the potential binding sites for the transcription regulatory motifs by NSITE program (http://www.softberry.com/ berry.phtml). As a class of very conservative gene, ribosomal protein genes have some conserved characteristics on gene order among the five sequenced microsporidia. To compare the locations of different microsporidian RPGs, syntenic maps of RPGs containing regions among E. cuniculi, A. locustae, N. ceranae, E. bieneusi and N. bombycis were plotted with a Perl script based on the genome data of N. bombycis, E. cuniculi (http://www.ncbi.nlm.nih.gov), A. locustae (http: //jbpc.mbl.edu/Nosema), N. ceranae (http://www.ncbi.nlm.nih. gov) and E. bieneusi (http://www.ncbi.nlm.nih.gov). Othologous genes were identified using BLASTP program (Altschul et al., 1997). We retrieved almost all ribosomal protein-related sequences by searching NCBI database (http:// www.ncbi.nlm.nih.gov/) using BLASTP (Altschul et al., 1990). Multiple sequence alignments were initially made using the program ClustalX version 1.83. These alignments were then reconciled and further adjusted by eye to minimize insertion/deletion events. A completed ribosomal protein sequence region of each RPGs was used in the subsequent phylogenetic analyses, which included the RPGs signature motif. Phylogenetic trees were reconstructed using the neighbor-joining method (Saitou and Nei, 1987) implemented in MEGA 4.0 program

7821

(Tamura et al., 2007). Bootstrap support was evaluated based on 1000 replicates.

RESULTS Characteristics of ribosomal protein genes in N. bombycis As other organisms, N. bombycis also has lots of ribosomal proteins which combine with rRNA to form a complete ribosome. In N. bombycis genome, we identified a total of 130 ribosomal protein (RP) gene hits (including both complete and incomplete sequences) corresponding to 73 putative cytoplasmic ribosomal protein types, which include 30 putative small-subunit proteins encoded by 51 RP gene hits and 43 putative large-subunit proteins encoded by 79 RP gene hits. There are 72 ribosomal protein genes in E. cuniculi genome and the identity of all ribosomal proteins between N. bombycis and E. cuniculi is around 33 to 77% at amino acid level, and RPL10, RPL23, RPS23 and RPS26 are 70, 77, 75 and 72%, respectively. This indicates that these housekeeping genes are conserved in microsporidian species. Furthermore, there were only six multiple copy genes in E. cuniculi. However, more than half of RPGs are multiple in N. bombycis in spite of containing some incomplete sequences and it is mainly the length difference among different copies of RPGs. Among all RPGs, we only found 29 ribosomal protein genes which have EST proofs (about 368 EST hits) in NbBmEST database. Domain of each ribosomal protein sequence was predicted on http://smart.embl-heidelberg.de/. Molecular weight and theoretical pI also were predicted by the BioXM software. All basic characteristics of each ribosomal protein have been displayed in Table 1. Ribosomal protein genes’ distribution on N. bombycis genome In N. bombycis genome, 130 ribosomal protein genes were distributed on 92 superscaffolds. Among them, there are 26 superscaffolds harbor at least two RP genes. Among them, there are four superscaffolds (nbo2, nbo6, nbo10 and nbo13), which contain more than four RP genes on each superscaffold (Figure 1). In addition, we found some RP genes are multiple in N. bombycis genome. Four pairs of RP genes were found not only multiple, but also in a tandem order distributed on different superscaffolds (Figure 2). RPL8-A gene and RPS17 gene were located on superscaffold nbo2, nbo18 and nbo1552 (Figure 2a); RPL10 gene and RPS19 gene were located on superscaffold nbo12 and nbo419 (Figure 2b); RPL13 gene and RPS16 gene were located on superscaffold nbo16 and nbo386 (Figure 2c); RPL17 and ubiquibitin/L40 were located on superscaffold nbo67 and nbo98 (Figure 2d). And the transcriptive directions of tandem RP genes are conserved among its corresponded superscaffolds,

7822

Afr. J. Biotechnol.

Table 1. Identification and characteristics of ribosomal protein genes of N. bombycis. Annotation of ribosomal protein RPSA

RPS2 RPS3 RPS3aE RPS4 RPS5 RPS6 RPS7

RPS8-B

RPS9 RPS11 RPS12 RPS13 RPS14 RPS15 RPS15a RPS16 RPS17 RPS18

Location on genome

Domain (SMART predicted)

GenBank Accession No.

Number of amino acids (Aa)

NBO_554 g 0006 NBO_64 g 0055 NBO_81 g 0008 NBO_1209 g 0001 NBO_1208 g i001 NBO_41 g 0036 NBO_76 g 0005 NBO_13 g 0033 NBO_70 g 0002 NBO_53 g 0020 NBO_53 g 0021 NBO_20 g 0021 NBO_1210 g 0002

HQ291394 HQ291395 HQ291367

260 99(NC) 116(NC)

Ribosomal_S2 NO

HQ291366

197(NC)

Ribosomal_S5

HQ291365 HQ291390 HQ291405 HQ291370 HQ291404 HQ291392 HQ291393

240 214 235 172 205 218 218

HQ291369 HQ291368

NBO_10 g 0072 NBO_996 g 0002 NBO_1167 g 0001

HQ291357 HQ291359

NBO_72 g 0004 NBO_594 g i001 NBO_64 g 0024 NBO_29 g 0033 NBO_13 g 0045 NBO_445 g i001 NBO_54 g 0017 NBO_1061 g 0002 NBO_56 g 0004 NBO_59 g i001 NBO_6 g 0022 NBO_16 g 0058 NBO_386 g 0016 NBO_2 g 0034 NBO_18 g 0032 NBO_66 g 0017 NBO_1315 g 0002

HQ291399 HQ291398 HQ291403 HQ291382 HQ291372 HQ291373

187 50(NC) 122 149 1145 149

HQ291362 HQ291361

Ribosomal_S3 Ribosomal_S3Ae Ribosomal_S4e Ribosomal_S7

GC content (%)

Copy number in genome

Molecular weight (kDa)

Theoretical pI

EST proof

NF NF

34.36 32.33 38.46

1 1

29.39 11.50 12.67

5.22 4.52 5.84

N N N

39.06

21.37

9.15

1 1 1 1

26.46 23.60 26.41 19.82 23.10

9.38 9.52 9.96 5.11 10.01

N N N Y Y

24.85

9.8

8.28

6.71

18.85

6.33

19.00

10.27

1 1

19.00 19.03 21.56 6.06 13.96 17.03

10.27 10.27 9.99 10.28 10.26 8.35

Y Y N N N N

132.25

5.32

14.48

10.49

11.84

10.94

16.84 16.87 14.55 16.67 16.65 14.06 14.06 13.16

9.59 9.62 9.59 9.65 9.60 9.52 9.52 10.72

N N Y Y Y Y Y Y

13.16

10.72

intron

NF NF YES NF

Ribosomal_S6e

74 163

170

Ribosomal_S8e

Ribosomal_S4

Ribosomal_S17 Ribosomal_L7Ae

NF NF

Ribosomal_S13; Ribosomal_S15

135 111

Ribosomal_S11

148

Ribosomal_S19

127

Ribosomal_S8

146

Ribosomal_S9

120

Ribosomal_S17e

115

Ribosomal_S13

YES

HQ291358

HQ291396 HQ291397 HQ291400 HQ291376 HQ291377 HQ291379 HQ291378 HQ291375 HQ291374

37.81 32.71 33.47 32.76 34.63 35.01 35.01 32 30.28 35.87 35.67 35.28 35.64 34.00 36.59 29.56 31.27 34.44 41.18 42.26 33.11 33.11 34.38 41.72 41.5 37.19 36.64 37.93 37.36

2 2 1 2 2 2

Liu et al.

7823

Table 1. Continues.

RPS19 RPS20 RPS21e RPS23 RPS24-A RPS25 RPS26-3 RPS28e RPS30 RPS31

RP S1 + IF2 RPL3

RPL4 RPL5 RPL5-B RPL6 RPL7 RPL8 RPL8-A RPL9 RPL9-B RPL10

NBO_419 g 0009 NBO_12 g 0023 NBO_1009 g 0002

HQ291364 HQ291363

101

Ribosomal_S19

24.42 23.76

11.90 11.86

9.59 9.59

N N

HQ291360

119

Ribosomal_S10

34.17

13.75

5.38

NBO_32 g 0001 NBO_86 g 0004 NBO_3 g 0051 NBO_6 g 0054 NBO_13 g 0044 NBO_37 g 0009 NBO_44 g 0012 NBO_641 g 0001 NBO_41 g 0041 NBO_6 g 0036 NBO_367 g 0007 NBO_366 NBO_198 NBO_304 g 0003 NBO_20 g 0032 NBO_11 g 0008 NBO_85 g 0009 NBO_13 g 0061 NBO_1546 g 0001 NBO_73 g 0002 NBO_66 g 0043 NBO_941 g 0003 NBO_3 g 0006 NBO_919 g 0001 NBO_28 g 0076 NBO_30 g 0007 NBO_2 g 0031 NBO_18 g 0035 NBO_914 g i001 NBO_10 g 0064 NBO_419 g 0008 NBO_12 g 0022 NBO_9 g 0005

HQ291384 HQ291385 HQ291383 HQ291402 HQ291371 HQ291387 HQ291388 HQ291389 HQ291391 HQ291401

Ribosomal_S21e

389 131 67

Ribosomal_S12 Ribosomal_S24e NO

NF NF NF

1 1 1

7.50 7.50 45.25 15.13 7.86

6.14 6.14 9.73 10.16 9.80

Y Y N N Y

103

Ribosomal_S26e

11.90

10.17

67 60

Ribosomal_S28e Ribosomal_S30

NF NF

1 1

138

Ubiquitin; Ribosomal_S27

286

S1; EIF_2_alpha

Ribosomal_L3

Ribosomal_L4

33.82 34.3 30.76 37.12 34.8 33.97 33.65 34.62 35.29 39.89 32.13 32.13 31.4 30.66 30.31 36.36 33.79 35.92

7.56 7.10 15.82 15.81 15.80 32.33 32.36 43.31 76.43 37.84

9.25 11.31 9.13 8.83 9.13 7.97 8.26 10.06 9.04 9.74

N N Y Y Y N N N N Y

Ribosomal_L4

36.79

21.44

10.14

36.38 32.51 32.63 35.5 33.62 38.38 38.52 35.46 36.27 37.06 34.76 37.04 36.75 33.91

34.68 33.17 33.14 91.81 27.25 25.81 25.84 23.03 23.00 6.41 21.04 13.27 13.27 57.45

5.10 9.75 9.76 8.93 9.54 9.91 9.91 9.71 9.71 8.66 9.68 10.13 10.13 8.10

N N N N N N N N N N N Y Y Y

HQ291386 HQ291381 HQ291380 HQ291421 HQ291422 HQ291439

384 664 334

HQ291440

192(NC)

HQ291479 HQ291472 HQ291473 HQ291457 HQ291484 HQ291455 HQ291456 HQ291452 HQ291451 HQ291483 HQ291406 HQ291426 HQ291425 HQ291427

317

284

Ribosomal_L18p

801 232

Ribosomal_L6e Ribosomal_L30

NF NF

237

Ribosomal_L2

203

Ribosomal_L7Ae

56 186 116 116 520

NO Ribosomal_L6 Ribosomal_L16 Ribosomal_L16 NO

NF NF NF

2 2

2 1 1 2 2 1 1 3

7824

Afr. J. Biotechnol.

Table 1. Continues.

RPL10A

RPL11

RPL12

RPL13

RPL13a RPL15

NBO_53 g 0009 NBO_53 g 0010 NBO_770 g 0001 NBO_1221 g 0001 NBO_2 g 0013 NBO_1288 g 0002 NBO_32 g 0010 NBO_1214 g 0001 NBO_16 g 0057 NBO_386 g 0017 NBO_6 g 0082 NBO_1020 g 0003 NBO_4 g 0015

HQ291431 HQ291432 HQ291433 HQ291430

69(NC) 123(NC) 89(NC)

Ribosomal_L1

217

31.9 31.99 31.85

31.8

HQ291435 HQ291434

174

Ribosomal_L5

35.43 35.43

HQ291429 HQ291428

164

RL11

36.36 36.16

HQ291447 HQ291448

162

Ribosomal_L13e

36.4 36.2

HQ291412 HQ291411

197 147(NC)

Ribosomal_L13

32.49 30.18

HQ291459

204

Ribosomal_L15e

38.37

1 2

8.02

5.22

14.42

9.86

10.21

5.05

25.25

9.28

19.51

9.94

19.51

9.94

17.73

9.56

17.72

9.56

18.99

10.67

19.00

10.67

22.88

9.74

17.53

9.79

24.07

10.77

19.62

9.77

9.77 9.84

N N N

RPL17

NBO_67 g 0006 NBO_98 g 0001

HQ291476 HQ291477

171

Ribosomal_L22

31.78 31.4

RPL18

NBO_508 g 0011

HQ291468

194

Ribosomal_L18e

34.87

19.62 21.99

RPL18a

NBO_199 g 0002

HQ291453

180

Ribosomal_L18ae

32.78

21.08

9.78

RPL19

NBO_66 g 0010

HQ291471

154

Ribosomal_L19e

YES

37.63

18.02

10.65

RPL21

NBO_72 g 0006 NBO_594 g 0004

HQ291470 HQ291469

198 160

35.18 35.61

23.39

10.07

18.68

10.33

12.72 12.64

9.49 9.35

N N

13.11

9.46

16.09

10.06

16.03

10.13

16.03

10.13

17.28

10.24

10.28

11.09

10.28

11.09

7.35

11.39

7.91

10.31

RPL22

RPL23

NBO_19 g 0024 NBO_1303 g 0001 NBO_1305 g 0001 NBO_13 g 0023 NBO_1436 g 0002 NBO_1440 g 0001

HQ291420 HQ291418 HQ291419

109 109 113

HQ291436 HQ291437 HQ291438

146

RPL23a2

NBO_69 g 0008

HQ291478

151

RPL24

NBO_18 g 0010 NBO_34 g 0042 NBO_998 g i001 NBO_1033 g i001

HQ291449 HQ291450 HQ291417 HQ291416

92 92 66(NC) 64(NC)

Ribosomal_L21e

Ribosomal_L22e

Ribosomal_L14

Ribosomal_L23

Ribosomal_L24e

33.03 32.42 30.41

42.18 42.4 42.4

29.61

36.56 36.56 35 37.44

Liu et al.

7825

Table 1. Continues.

RPL24P

NBO_417 g 0005 NBO_418 g 0002

HQ291462 HQ291463

139

KOW

33.57 33.1

RPL27

NBO_64 g 0036 NBO_401 g 0009

HQ291461 HQ291460

125

Ribosomal_L27e

35.45 34.92

RPL27a

NBO_10 g 0092 NBO_1278 g 0002

HQ291407 HQ291408

107 147

L15

35.49 38.51

RPL30

NBO_15 g 0009 NBO_55 g 0011

HQ291441 HQ291442

108

Ribosomal_L7Ae

35.17 35.17

RPL31

NBO_73 g 0024

HQ291480

111

Ribosomal_L31e

30.65

RPL32

NBO_6 g 0084 NBO_1021 g 0002 NBO_1022 g i001

HQ291414 HQ291413 HQ291415

139 139 80(NC)

Ribosomal_L32e

RPL34

NBO_15 g 0024 NBO_54 g 0010

HQ291443 HQ291444

106 193

Ribosomal_L34e

RPL35

NBO_16 g 0038 NBO_1116 g 0001

HQ291424 HQ291423

122

RPL35A

NBO_2 g 0091 NBO_10 g 0112

HQ291410 HQ291409

73(NC) 113

RPL36e

NBO_792 g 0001

HQ291481

RPL37a

NBO_462 g 0004 NBO_6 g i002

HQ291466 HQ291467

86 92

RPL39e

NBO_443 g 0003 NBO_733 g 0001

HQ291464 HQ291465

UBIQUITIN/L40 ribosomal protein FUSION

NBO_67 g 0005 NBO_98 g 0003

HQ291474 HQ291475

RPL44

NBO_80 g 0021

RPP0

NBO_514 g 0008 NBO_1574 g 0002

RPP1 RPP2

36.43 35.95 37.45

31.78 31.27

Ribosomal_L29

33.88 34.15

Ribosomal_L35Ae

35.14 34.21

Ribosomal_L36e

31.25

37.98 37.63

Ribosomal_L39

37.11 36.48

131

UBQ; Ribosomal_L40e

29.8 29.29

HQ291482

103

Ribosomal_L44

35.58

HQ291446 HQ291445

263 139(NC)

NBO_375 g 0004

HQ291458

NBO_27 g i004

HQ291454

Ribosomal_L37ae

16.06

9.68

16.06

9.75

14.48

9.93

12.40

9.70

16.76

10.38

11.87

9.66

11.90

9.66

12.80

10.25

16.02

10.32

16.02

10.32

8.82

9.78

12.44

10.56

22.59

10.49

14.60

9.88

14.60

9.88

8.12

10.20

12.57

10.48

11.12

10.71

9.45

10.53

10.16

10.53

6.39

11.60

14.94

9.87

15.00

9.87

11.80

10.45

29.90

9.01

15.68

4.83

Ribosomal_L10

29.67 29.52

106

Ribosomal_60s

38.63

11.43

4.55

136

36.5

14.95

4.21

NC, The ribosomal protein sequence is not complete; NO, domain not found by SMART predicted; NF, intron not found in this sequence; YES, there is one intron in this sequence; Y, found EST proof; N, EST proof not found.

7826

Afr. J. Biotechnol.

Figure 1. Distribution of RP genes on four superscaffolds. The superscaffold name is labeled at the left, and the number of the scale labeled on the top of each superscaffold. RP genes are signed with the arrow (red represents forward direction, and blue represents backward direction).

respectively. Introns located in three ribosomal protein genes of N. bombycis In N. bombycis genome, three ribosomal protein genes have been found harboring predicted short introns, which have the same sequence structure to the documented result on E. cuniculi, N. ceranae and Octosporea bayeri (Corradi et al., 2009). While Katinka et al. (2001) inferred eleven ribosomal protein genes with introns in E. cuniculi, Cornman et al. (2009) documented that five of the N. ceranae orthologues to E. cuniculi also contained an intron and the sixth N. ceranae gene containing an intron encodes the S4 ribosomal protein, which lacks an intron in E. cuniculi. Except for the L19 and S4 ribosomal proteins

of N. bombycis, another ribosomal protein, S18, contains a short intron (24 bp). These introns harbor consensus spliceosomal boundaries (5â&#x20AC;˛-GT...AG-3â&#x20AC;˛) with a 5â&#x20AC;˛ region identical to the consensus of higher eukaryotes (GTAAGT). In addition, the intronic sequences also show fairly robust conservation within and among species (Figure 3), indicating selection for efficient recognition by the spliceosomal machinery. Recently, one intron has been detected in A. locustae ribosomal protein genes (Peyretaillade et al., 2009). However, no intron has been detected in ribosomal protein genes in E. bieneusi (Akiyoshi et al., 2009) to date. Fortunately, using the NbBmEST database in our lab, EST proofs of these three RP genes have been found, but only the EST corresponding to S18 gene is complete. Figure 4 shows the aligned result which the intron sequence has been spliced in the EST sequence.

Liu et al.

7827

Figure 2. Tandem ribosomal protein genes in N. bombycis genome. a, b, c and d stand for the four groups of tandem RP genes in N. bombycis, respectively. The superscaffold number is labeled on the left of each superscaffold, and the red (forward) and blue (backward) arrows represent the RP genes located on the superscaffold. The tandem RP genes are connected by green lines between its corresponding genes.

Promoter and regulatory sequences prediction of ribosomal protein genes Further analysis of the ribosomal protein genes showed that each encoding protein of these genes is located on one coding sequence, and core promoter sequences of partial (about 29.2%) of them are structurally characteristic of TATAA (Figure 5). Moreover, like other microsporidian such as E. cuniculi, A. locustae, E. bieneusi, N. ceranae and A. algerae (Peyretaillade et al., 2009), the genes coding for ribosomal proteins of N. bombycis were also identified with the AAATTT-like signal; and the CCC motif (three RPGs - RPL4, RPL10A, RPS21, harbour GGG-like motif) was identified between the AAATTT sequence and the translational transcription start (TSS) codon. In addition, the regions 500 bps upstream of all genes were searched for its potential regulation motifs with NSITE programs (Figure 6), and it was found that all the ribosomal protein genes have at least one SP1 and one GATA-1 factor binding site. SP1, a ubiquitous transcription factor binding GC-boxes in the regulating promoter elements, is required for the constitutive and

inducible expression of a variety of genes, such as in cell cycle or mammalian development. GATA-1, which is expressed predominantly in hematopoietic cells, regulates differentiation and gene expression in T-lymphocytes, erythroids and megakaryocytes. RPL22 have one transcription factor, NF-ÎşB, which is involved in the regulation of many genes encoding mediators of the immune, acute phase and inflammatory responses. Genes of RPS6, RPS7 and RPS14 have one Oct-1 motif each. Each member of the Oct family is a factor involved in the first step of differentiation during embryogenesis and its functions were to keep an undifferentiated cell stable. The other three regulatory elements, Rap1, GAGA and HNF-3 motifs were also found in these ribosomal protein genes. Syntenic analysis of ribosomal protein genes among five microsporidian To compare the locations of different microsporidian RPGs, syntenic maps of RPGs containing regions among

7828

Afr. J. Biotechnol.

Figure 3. Alignment of the 5â&#x20AC;&#x2122; region of three ribosomal protein genes in N. bombycis that contained predicted introns, together with the three orthologues of these genes in N. ceranae, one orthologue in E. cuniculi and one orthologue in O. bayeri. Alignment begins with the start codon, which is interrupted by an intron in the ribosomal protein L19. Introns were manually aligned to illustrate regions of sequence conservation. Nbo = N. bombycis, Nce = N. ceranae, Ecu = E. cuniculi, Oba = O. bayeri.

E. cuniculi, A. locustae, N. ceranae, E. bieneusi and N. bombycis were plotted with a Perl script based on the genome data of N. bombycis, E. cuniculi (http: //www.ncbi.nlm.nih.gov), A. locustae (http: //jbpc.mbl.edu/ Nosema), N. ceranae (http: //www.ncbi.nlm.nih.gov) and E. bieneusi (http: //www.ncbi.nlm.nih.gov). Othologous genes were identified using BLASTP program (Altschul et al., 1997). A syntenic map of each ribosomal protein gene has been drawn based on the five microsporidian genome sequences. All syntenic blocks flanking RP genes were observed among N. bombycis, E. cuniculi, A. locustae, N. ceranae and E. bieneusi, for example, RPL3 located on syntenic block among the five microsporidians (Figure 7). In total, about 56 ribosomal protein genes have been detected belonging to syntenic blocks among more than three microsporidian species, which is about 76.7% to the RPGs total number 73. Phylogenetic trees of ribosomal protein genes of N. bombycis The phylogenetic trees of all ribosomal protein genes were constructed from multiple alignments of RP genes (for example RPL3 showed on Figure 8). In all trees,

microsporidia lies on almost the same location as that of tree constructed by ribosomal RNA. According to this phylogenetic tree, it also indicated that microsporidia is a primitive eukaryote. DISCUSSION For the first time, we got the information of whole ribosomal protein genes of N. bombycis. Also, this is the first species that all ribosomal protein genes have been analyzed in microsporidia. N. bombycis has 130 ribosomal protein gene hits corresponding to 73 putative ribosomal protein genes, which is one more than ribosomal protein gene in E. cuniculi, and is close to the ribosomal proteins number of typical eukaryotes. In N. bombycis, more RPGs are multiple than that in E. cuniculi. This is consistent to the redundant characteristic of N. bombycis genome. In addition, the 130 ribosomal protein gene sequences of N. bombycis scatter on 92 superscaffolds randomly. Comparing with other microsporidian, we found the phenomenon that gene orders of some RP genes are conserved among microsporidia (data not shown). And the RP genes which include in conserved gene orders are multiple in N. bombycis genome (such

Liu et al.

7829

Figure 4. Alignment of S18 gene and its NbBmEST sequence. The start codon and stop codon have been labeled with green color. And spliceosomal boundaries (5â&#x20AC;˛-GT...AG-3â&#x20AC;˛) have been labeled with red color. The intron has been indicated on the top of its corresponding sequence.

as RPL8-A and RPS17, RPS16 and RPL13, et al.). Inspection of genes in the vicinity of ribosomal protein genes suggests maybe extensive duplication of large

chromosome fragments has happened before in the N. bombycis genome. Among all the ribosomal protein genes, three of them

7830

Afr. J. Biotechnol.

Figure 5. TATA-box of the core promoters treated on Weblogo (http://weblogo.berkeley.edu/logo.cgi). The bits show the frequency of the base of the sites .

Figure 6. Some putative regulation elements of ribosomal protein genes in N. bombycis. The NSITE programs were used to identify the regulatory elements in the upstream regions from the genes available in N. bombycis database. The upstream (500 bps) regions were drawn by scale. Arc arrows indicate the transcription start sites. The position of the nucleotide sequences is calculated based on the distance from the predicted transcription initiation site. The open read frame is marked with a green box, and the numbers mean the distances to the transcription initiation sites. The binding sites of the SP1 factor and the GATA-1 factor are shown with black circles and red crux stars, respectively. The blank crux stars stand for Rap1 motifs and the blank pentangular stars refer to Oct-1 motifs. The yellow pentangular star and the blank and green triangles mean NF-ÎşB, GAGA and HNF-3 motifs, respectively.

Liu et al.

7831

Figure 7. Syntenic maps of RPL3 flanking regions on chromosomes/superscaffolds in five microsporidians. Syntenic maps of RPL3 containing regions were plotted among N. bombycis (superscaffold NBO_11 and NBO_85), A. locustae (contig ALO_483), E. bieneusi (contig EBI_15), E. cuniculi (chromosome ECU_3 and ECU_9) and N. ceranae (contig NCE_8). Orthologulous genes were detected with BLSATP (Altschul et al., 1997) and linked with transparent yellow lines. The green (RPL3), red and yellow blocks represent syntenic genes.

contained short introns, which have the same sequence structure to the documented result on E. cuniculi, N. ceranae (Cornman et al., 2009) and O. bayeri (Corradi et al., 2009). And the intronic structures showed fairly robust conservation within and among species (Figure 3), which indicate election for efficient recognition by the spliceosomal machinery. Recently, one intron has been found in the ribosomal protein gene S6 of A. locustae (Peyretaillade et al., 2009). However, no intron has been detected in ribosomal protein genes of E. bieneusi to date. We have not found any rules of the distribution of intron in ribosomal protein genes till now. In S. cerevisiae, however, more than 70% of the RPGs contain introns in contrast to only 5% intron-containing genes in its total genes. And recently, the law of combinational regulation between upstream regions and introns has been characterized and the synergy between them may result in the high transcriptional frequency of yeast RPGs (Hu et al., 2010). As a type of species related to fungi, Microsporidia have the same intron structure (5’-end of RPGs) to S. cerevisiae. In order to satisfy the quantity requirement of protein synthesis in period of microsporidian spore proliferation, the synergy between upstream regions and introns may play important role. These structures of genes in N. bombycis and S. cerevisiae are not same to that of Rattus norvegicus, which has more introns in each ribosomal protein gene. As one type of parasite, maybe this event is either a new obtained or a degraded thing in

the ribosomal protein genes evolution. In order to get more information of the upstream sequences of ribosomal protein genes, we cut the 500 bps sequences for analysis. A structural characteristic of TATA-like motif has been found in the ribosomal protein genes. In N. ceranae, TATA-like promoters are important components of its gene regulation (Cornman et al., 2009), which is same to that of yeast genes (Basehoar et al., 2004). But there are still some ribosomal protein genes of N. bombycis of which the classic promoter structure cannot be found, maybe because the length 500 bps was not sufficiently long, or those ribosomal protein genes do not have this structure at all. In addition, the majority of ribosomal protein genes presented the CCC-like motif immediately upstream from the transcription start site, except for three ribosomal protein genes (RPL4, RPL10A, RPS21), which contained GGG-like motif. At the same time, an AAATTT-like signal was identified upstream from the CCC-like motif. These characteristics are same to other microsporidian species, such as E. cuniculi, A. locustae, E. bieneusi, N. ceranae and A. algerae for ribosomal protein genes (Peyretaillade et al., 2009). Maybe these characteristics are widespread among microsporidia. Like S. cerevisiae, we have not found the characteristic “terminal oligopyrimidine tract” in the 5’ end of RPGs in N. bombycis. Certainly, lots of regulatory motifs have been detected in the upstream sequences, which can facilitate the transcription of ribosomal protein

7832

Afr. J. Biotechnol.

Figure 8. Phylogenetic tree of ribosomal protein L3 gene. The neighbor-joining trees were generated with the MEGA4.0 software and sequences aligned without gaps. The bootstrap values given at the nodes were from 1,000 replicates.

genes. From the syntenic maps of RP-containing regions among the five microsporidian, E. cuniculi, A. locustae, N.

ceranae, E. bieneusi and N. bombycis, we can see more ribosomal protein genes belonging to syntenic blocks. That is; to the house-keeping genes, they follow a

Liu et al.

conserved gene order evolution mechanism. Recently, a novel approach has been applied, which is based on the conservation of gene order (Lee et al., 2008). It has been known for some time that while microsporidian gene sequences are evolving very quickly, the order of genes within the genome is highly conserved (Corradi et al., 2007; Slamovits et al., 2004). This observation was recently extended by the demonstration that microsporidian genomes share higher frequency of gene order conservation with zygomycetes than they do with any other group of fungi for which genome data are available (Dyer, 2008; Lee et al., 2008). From the syntenic blocks, similar genomic structures are shown among these five microsporidian, in spite of some inner transversion occurring in its syntenic regions. In addition, among these five microsporidian, if there is one or more ancestral organization of RPGs, the genome structures of other microsporidian which have gene transversion must have been greatly rearranged. This may be caused by homologous recombination, segmental duplication, whole genome duplication or transposition. Causally, the TEs harbored in N. bombycis, which had been documented (Xu et al., 2006) before and discovered in other microsporidian lately (Williams et al., 2008; Gill et al., 2008), to some extent may change these variations. Perhaps, the analysis of syntenic blocks of ribosomal protein gene flanking regions can give more information of microsporidian genome evolution. The trees of ribosomal protein genes showed almost the same result to that of ribosomal RNA. According to this result of phylogenetic tree (Figure 8), it also indicated that microsporidia may be a primitive eukaryote. This however, is the long-branch artifacts due to increased evolutionary rates of their ribosomal RNAs (Palmer and Delwiche, 1996; Embley and Hirt, 1998; Keeling and McFadden, 1998). As we all know, the ribosome of plant is smaller than that of mammals (Cammarano et al., 1972; Verschoor et al., 1996). Despite an overall similarity in ribosomal architecture, the length of highly variable loop regions of the 23S-like rRNA is difference. The size ranges from approximately 3,300 bp (25 to 26S) in plants to approximately 4,700 bp (28S) in mammals (Schnare et al., 1996). According to this information, we compared the rRNA length and structure of N. bombycis to those of other eukaryotes and bacterium, and found that the rRNA length of N. bombycis and some nuclear acids are different. However, this is mainly because the rRNA sequence is a highly degenerated sequence (Van de Peer et al., 2000). To ribosomal proteins, the same condition may occur. This still need to be clarified in the future. The number of ribosomal protein genes of N. bombycis is slightly smaller than that of typical eukaryote, but the phylogenetic location of these genes show that it belongs to primitive eukaryote. Combination with the length of rDNA sequence of microsporidia, maybe the 70S ribosome of Microsporidia, resulted from the shorter sequence length of rDNA and the smaller number of

7833

ribosomal protein genes. We may give a further hypothesis that the sedimentation coefficient (70S or 80S) of ribosome not only depend on phylogenetic position of species, but also depend on its environment. In short, the identification of the total ribosomal protein genes and the determination of their sequence organization and distribution constitute a first step to determine their biological role, modeling of ribosome structure and function, and genome evolution. Nucleotide sequences reported in this study have been submitted to the GenBankTM, EMBL and DDBJ databases under the accession numbers: HQ291357-HQ291484. ACKNOWLEDGEMENTS We are grateful to all the authors for their free-charged software cited and used in this article. The authors appreciate the assistance of Dr. Hongjuan Cui in improving the manuscript. This work is supported by the National Natural Science Foundation of China under Grant No. 30930067, the Program of Introducing Talents of Discipline to Universities (No. B07045) and the Research Fund of the Doctoral Program of Southwest University under Grant No. swu109039. REFERENCES Akiyoshi DE, Morrison HG, Lei S, Feng X, Zhang Q, Corradi N, Mayanja H, Tumwine JK, Keeling PJ, Weiss LM, Tzipori S (2009). Genomic survey of the non-cultivatable opportunistic human pathogen, Enterocytozoon bieneusi. PLoS Pathog. 5(1): e1000261. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990). Basic local alignment search tool. J. Mol. Biol. 215(3): 403-410. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997). Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402. Ban N, Nissen P, Hansen J, Capel M, Moore PB, Steitz TA (1999). Placement of protein and RNA structures into a 5 Å-resolution map of the 50S ribosomal subunit. Nature, 400: 841–846. Ban N, Nissen P, Hansen J, Moore PB, Steitz TA (2000). The complete atomic structure of the large ribosomal subunit at 2.4 Å resolution. Science, 289: 905-920. Basehoar AD, Zanton SJ, Pugh BF (2004). Identification and distinct regulation of yeast TATA box-containing genes. Cell, 116: 699–709. Belkorchia A, Biderre C, Militon C, Polonais V, Wincker P, Jubin C, Delbac F, Peyretaillade E, Peyret P (2008). In vitro propagation of the microsporidian pathogen Brachiola algerae and studies of its chromosome and ribosomal DNA organization in the context of the complete genome sequencing project. Parasitol. Int. 57(1): 62-71. Biderre C, Metenier G, Vivares CP (1998). A small spliceosomal-type intron occurs in a ribosomal protein gene of the microsporidian Encephalitozoon cuniculi. Mol. Biochem. Parasitol. 94(2): 283-286. Cammarano P, Pons S, Romeo A, Galdieri M, Gualerzi C (1972). Characterization of unfolded and compact ribosomal subunits from plants and their relationship to those of lower and higher animals: evidence for physiochemical heterogeneity among eukaryotic ribosomes. Biochim. Biophys. Acta. 28: 571-596. Chakrabarti D, Dame JB, Gutell RR, Yowell CA (1992). Characterization of the rDNA unit and sequence analysis of the small subunit rRNA and 5.8S rRNA genes from Tritrichomonas foetus. Mol. Biochem. Parasitol. 52: 75-84. Champney WS, Chittum HS, Samuels R (1992). Ribosomes from

7834

Afr. J. Biotechnol.

trichomonad protozoa have prokaryotic characteristics. Int. J. Biochem. 24: 1125-1133. Clemons WM, May Jr. JL, Wimberly BT, McCutcheon JP, Capel MS, Ramakrishnan V (1999). Structure of a bacterial 30S ribosomal subunit at 5.5 Å resolution. Nature, 400: 833–840. Cornman RS, Chen YP, Schatz MC, Street C, Zhao Y, Desany B, Egholm M, Hutchison S, Pettis JS, Ian Lipkin W, Evans JD (2009). Genomic analyses of the microsporidian Nosema ceranae, an emergent pathogen of honey bees. PLoS Pathog. 5(6): e1000466. Corradi N, Akiyoshi DE, Morrison HG, Feng X, Weiss LM, Tzipori S, Keeling PJ (2007). Patterns of genome evolution among the microsporidian parasites Encephalitozoon cuniculi, Antonospora locustae and Enterocytozoon bieneusi. PLoS ONE, 2: e1277. Corradi N, Haag KL, Pombert JF, Ebert D, Keeling PJ (2009). Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host parasite interactions. Geno. Biol. 10: R106. Corradi N, Keeling PJ (2009). Microsopridia: a journey through radical taxonomical revisions. Fungal Bio. Rev. 23: 1-8. Culver GM, Cate JH, Yusupova GZ, Yusupov MM, Noller HF (1999). Identification of an RNA-protein bridge spanning the ribosomal subunit interface. Science. 285: 2133-2136. Dyer PS (2008). Evolutionary biology: microsporidia sex a missing link to fungi. Curr. Biol. 18: 1012-1014. Embley TM, Hirt RP (1998). Early branching eukaryotes. Curr. Opin. Genet. Dev. 8: 624-629. Franzen C, Nassonova ES, Scholmerich J, Issi IV (2006). Transfer of the members of the genus Brachiola (microsporidia) to the genus Anncaliia based on ultrastructural and molecular data. J. Eukaryot. Microbiol. 53(1): 26-35. Germot A, Philippe H, Le Guyader H (1997). Evidence for loss of mitochondria in Microsporidia from a mitochondrial-type HSP70 in Nosema locustae. Mol. Biochem. Parasit. 87(2): 159-168. Gill EE, Becnel JJ, Fast NM (2008). ESTs from the microsporidian Edhazardia aedis. BMC Genomics. 9: 296. Goffeau A, Barrell BG, Bussey H, Davis RW, Dujon B, Feldmann H, Galibert F, Hoheisel JD, Jacq C, Johnston M, Louis EJ, Mewes HW, Murakami Y, Philippsen P, Tettelin H, Oliver SG (1996). Life with 6000 genes. Science. 274: 546–567. Graack HR, Wittmann-Liebold B (1998). Mitochondrial ribosomal proteins (MRPs) of yeast. Biochem. J. 329: 433-448. Healey A, Mitchell R, Upcroft JA, Boreham PFL, Upcroft P (1990). Complete nucleotide sequence of the ribosomal RNA tandem repeat unit from Giardia intestinalis. Nucleic Acids Res. 18: 4006. Hirt RP, Healy B, Vossbrinck CR, Canning EU, Embley TM (1997). A mitochondrial Hsp70 orthologue in Vairimorpha necatrix: molecular evidence that microsporidia once contained mitochondria. Curr. Biol. 7(12): 995-998. Hu J, Li H, Zhang J (2010). Analysis of transcriptional synergy between upstream regions and introns in ribosomal protein genes of yeast. Comput. Biol. Chem. 34: 106-114. Ishihara R, Hayashi Y (1968). Some properties of ribosomes from the sporoplasm of Nosema bombycis. J. Invertebr. Pathol. 11: 377-385. Katinka MD, Duprat S, Cornillot E, Méténier G, Thomarat F, Prensier G, Barbe V, Peyretaillade E, Brottier P, Wincker P, Delbac F, EI Alaoui H, Peyret P, Saurin W, Gouy M, Weissenbach J, Vivarès CP (2001). Genome sequence and gene compaction of the eukaryote parasite Encephalitozoon cuniculi. Nature. 414(6862): 450-453. Kawakami Y, Inoue T, Ito K, Kitamizu K, Hanawa C, Ando T, Iwano H, Ishihara R (1994). Identification of a chromosome harboring the small subunit ribosome RNA gene of Nosema bombycis. J. Invertebr. Pathol. 64: 147-148. Keeling PJ, McFadden GI (1998). Origins of microsporidia. Trends Microbiol. 19: 19-23. Kenmochi N, Ashworth LK, Lennon G, Higa S, Tanaka T (1998 b). High-resolution mapping of ribosomal protein genes to human chromosome 19. DNA Res. 5: 229-233. Koc EC, Burkhart W, Blackburn K, Moseley A, Koc H, Spremulli LL (2000). A proteomics approach to the identification of mammalian mitochondrial small subunit ribosomal proteins. J. Biol. Chem. 275: 32585-32591. Lee SC, Corradi N, Byrnes EJ 3rd, Torres-Martinez S, Dietrich FS,

Keeling PJ, Heitman J (2008). Microsporidia evolved from ancestral sexual fungi. Curr. Biol. 18(21): 1675-1679. Liu H, Pan G, Song S, Xu J, Li T, Deng Y, Zhou Z (2008). Multiple rDNA units distributed on all chromosomes of Nosema bombycis. J. Invertebr. Pathol. 99(2): 235-238. Matheson AT, Auer J, Ramíerez C, Böck A (1990). Structure and evolution of archaebacterial ribosomal proteins. In Hill WE, Dahlberg A, Garrett RE, Moore PB., D. Schlessinger, J.R. Warner, eds, The Ribosome, Structure, Function and Evolution. American Society of Microbiologists, Washington, DC. USA. pp. 617-633. Meyuhas O (2000). Synthesis of the translational apparatus is regulated at the translational level. Eur. J. Biochem. 267: 6321-6330. Meyuhas O, Hornstein E (2000). Translational control of TOP mRNAs. In Sonenberg N, Hershey JWB, Mathews MB, eds, Translational Control of Gene Expression. Cold Spring Harbor Press, eds, Cold Spring Harbor, NY. USA. pp. 671-693, Nissen P, Hansen J, Ban N, Moore PB, Steitz TA (2000). The structural basis of ribosome activity in peptide bond synthesis. Science, 289: 920-930. Nomura M, Gourse R, Banghman G (1984). Regulation of the synthesis of ribosomes and ribosomal components. Annu. Rev. Biochem. 53: 75-117. Ogle JM, Brodersen DE, Clemons .Jr. WM, Tarry MJ, Carter AP, Ramakrishnan V (2001). Recognition of cognate transfer RNA by the 30S ribosomal subunit. Science, 292: 897-902. Palmer JD, Delwiche CF (1996). Second-hand chloroplasts and the case of the disappearing nucleus. Proc. Natl. Acad. Sci. USA. 93: 7432-7435. Peyretaillade E, Biderre C, Peyret P, Duffieux F, Metenier G, Gouy M, Michot B, Vivares CP (1998). Microsporidian Encephalitozoon cuniculi, a unicellular eukaryote with an unusual chromosomal dispersion of ribosomal genes and a LSU rRNA reduced to the universal core. Nucleic Acids Res. 26(15): 3513-3520. Peyretaillade E, Broussolle V, Peyret P, Metenier G, Gouy M, Vivares CP (1998). Microsporidia, amitochondrial protists, possess a 70-kDa heat shock protein gene of mitochondrial evolutionary origin. Mol. Biol. Evol. 15(6): 683-689. Peyretaillade E, Gonçalves O, Terrat S, Dugat-Bony E, Wincker P, Cornman RS, Evans JD, Delbac F, Peyret P (2009). Identification of transcriptional signals in Encephalitozoon cuniculi widespread among Microsporidia phylum: support for accurate structural genome annotation. BMC Genomics, 10: 607. Philippe H, Germot A (2000). Phylogeny of eukaryotes based on ribosomal RNA: long- branch attraction and models of sequence evolution. Mol. Biol. Evol. 17: 830-834. Planta RJ, Mager WH (1998). The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast, 14: 471-477. Reese MG (2001). Application of a time delay neural network to promoter annotation in the Drosophila melanogaster genome. Comput. Chem. 26: 51-56. Roger JA (1999). Reconstructing early events in eukaryotic evolution. Am. Nat. 154: 146-163. Saitou N, Nei M (1987). The neighbor joining method: A new 331 method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425. Schnare MN, Damberger SH, Gray MW, Gutell RR (1996). Comprehensive comparison of structural characteristics in eukaryotic cytoplasmic large subunit (23S-like) ribosomal RNA. J. Mol. Biol. 256: 701-719. Slamovits CH, Fast NM, Law JS, Keeling PJ (2004). Genome compaction and stability in microsporidian intracellular parasites. Curr. Bilo. 14: 891-896. Sogin ML, Gunderson JH, Elwood HJ, Alonso RA, Peattie DA (1989). Phylogenetic meaning of the kingdom concept: an unusual ribosomal RNA from Giardia lamblia. Science, 243: 75-77. Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599. Van de Peer Y, Ben Ali A, Meyer A (2000). Microsporidia: accumulating molecular evidence that a group of amitochondriate and suspectedly primitive eukaryotes are just curious fungi. Gene, 246: 1-8. Verschoor A, Srivastava S, Grassucci R, Frank J (1996). Native 3D structure of eukaryotic 80S ribosome: morphological homology with E.

Liu et al.

coli 70S ribosome. J. Cell Biol. 133: 495-505. Veuthey AL, Bittar G (1998). Phylogenetic relationships of fungi Plantae and Animalia inferred from homologous comparison of ribosomal proteins. J. Mol. Evol. 47: 81-92. Vossbrinck CR, Maddox JV, Friedman S, Debrunner-Vossbrinck BA, Woese CR (1987). Ribosomal RNA sequence suggests microsporidia are extremely ancient eukaryotes. Nature, 326: 411-414. Weiss LM, Vossbrinck CR (1999). Molecular biology, molecular phylogeny, and molecular diagnostic approaches to the microsporidia. In: Wittner M, Weiss LM, eds. The Microsporidia and Microsporidosis. Washington, DC: ASM Press. USA. pp. 129-171, Williams BA, Lee RC, Becnel JJ, Weiss LM, Fast NM, Keeling PJ (2008). Genome sequence surveys of Brachiola algerae and Edhazardia aedis reveal microsporidia with low gene densities. BMC Genomics, 9: p. 200. Wittmann HG (1982). Components of bacterial ribosomes. Ann. Rev. Biochem. 51: 155-183. Wittmann-Leibold B, Kopke AKE, Arndt E, Kromer W, Hatakeyama T, Wittmann HG (1990). Sequence comparison and evolution of ribosomal proteins and their genes. In WE Hill, A Dahlberg, RE Garrett, PB Moore, D Schlessinger, JR Warner, eds, The Ribosome, Structure, Function and Evolution. Am. Soc. Microbiologists, Washington, DC. USA. pp. 598-616.

7835

Wool IG, Chan YL, Gluck A (1995). Structure and evolution of mammalian ribosomal proteins. Biochem. Cell. Biol. 73: 933â&#x20AC;&#x201C;947. Xu J, Pan G, Fang L, Li J, Tian X, Li T, Zhou Z, Xiang Z (2006). The varying microsporidian genome: Existence of long terminal repeat retrotransposon in domesticated silkworm parasite Nosema bombycis. Int. J. Parasitol. 36: 1049-1056. Yamaguchi K, Subramanian AR (2000). The plastid ribosomal proteins: identification of all the proteins in the 50S subunit of an organelle ribosome (chloroplast). J. Biol. Chem. 275: 28466-28482. Yamaguchi K, Von Knoblauch K, Subramanian AR (2000). The plastid ribosomal proteins: identification of all the proteins in the 30S subunit of an organelle ribosome (chloroplast). J. Biol. Chem. 275: 28455-28465.

Full Length Research Paper

Impact of crop residues on seed germination of native desert plants grown as weeds Ali El Keblawy Applied Biology Department, Faculty of Science, Sharjah University and Sharjah Research Academy, P.O. Box: 27272, Sharjah, United Arab Emirates. E-mail: akeblawy@sharjah.ac.ac. Tel: +971-6-5053833 or +971-50-5432065. Fax: +9716-5053820. Accepted 22 March, 2012

Allelopathy refers to an ecological phenomenon where there is plant-plant interference through release of organic chemicals (allelochemicals) in the surrounding soil environment as water leachates or root exudates. Crop residues produce allelochemicals that may inhibit seed germination of many weeds. In this study, I assessed the effect of aqueous extracts of three crop residues (radish, rocket and rhodes) on final germination percentage and germination rate of four desert plants recorded as weeds in the United Arab Emirates farms (Coelachyrum piercei (Benth.) Bor, Plantago ovata Forssk., Sporobolus arabicus Boiss. and Tephrosia apollinea (Delile) DC.). Residues of the two crucifers (radish and rocket) were more effective in inhibiting seed germination of the four species. Up to 4% of rhodes grass extracts showed insignificant effects on the seed germination. Both C. piercei and P. ovate were more sensitive to allelopathic effect (their germination was greatly inhibited), but S. arabicus and T. apollinea were more resistant to the extracts. The suppressive ability of the two crucifers’ residues would be of environmental importance if integrated in weed management programmes. Key words: Crop residues, radish, rhodes, rocket, seed germination, weeds. INTRODUCTION Allelopathy is an ecological phenomenon which refers to any direct or indirect positive or negative effect of one plant on the other through the release of chemicals into the environment (Rice, 1984). These organic chemicals (allelochemicals) can be directly and continuously released by the donor plants in their immediate environment as water leachates, volatiles in the air or root exudates in soil, or they can be the microbial degradation products of plant residues (Weston, 1996). Allelochemicals may interfere with survival and growth of neighboring plants, and may also discourage insects and pathogens infestation (Zeng et al., 2008). Non-herbicidal innovations to manage weed populations are increasingly needed because of public concern about herbicide use, increased agricultural costs and the emergence of herbicide-resistant weed species (Wu et al., 1999). Allelopathy has been considered a natural and environment-friendly technique for weed control and thereby increases crop yields (Purvis et al., 1985). The

application of allelopathy could be incur-porated into an integrated weed management package, thereby reducing the dependence on herbicides (Wu et al., 1999). Putnam and Duke (1974) indicated the possibility of utilizing allelopathic crops to suppress weed growth in agricultural sites. In addition, many investi-gations documented the feasibility of using cover crops and their residues for weed suppression (Weston, 2005). Many cereals have shown allelopathic effects (Wu et al., 1998; Baghestani et al., 1999; Fujii, 2001; Zhao et al., 2005). For example, Wu et al. (1998) indicated that both germination and radicle growth of ryegrass were significantly inhibited by the aqueous shoot extracts of wheat cultivars. The inhibition for radicle elongation ranged from 19.2 to 98.7% and for seed germination from 4.2 to 73.2% (Wu et al., 1998). In addition, sorghum (Sorghum bicolor) is well recognized for its allelopathic effects on other crops (Putnam and DeFrank, 1983). Similarly, Brassicaceae family has received great attention with

El Keblawy

respect to its allelopathic effects and is known to contain glucosinolates, which suppress several weed species. Radish is the most popular allelopathic crop of this family (Uygur et al., 1990; Weston and Duke, 2003). Uygur et al. (1990) examined the effect of radish extracts on germination of 25 weed and 32 crop species and found that garden radish extracts totally inhibit the germination of 11 weeds and four crop species. Resistance in plants evolves rapidly in response to particular chemical composition of neighboring plants (Ehlers and Thompson, 2004). Callaway et al. (2005) found that the survival of native grass speceis from North American communities that have experienced extensive invasion by Centaurea maculosa have higher tolerances to allelochemical exudates than individuals from communities that did not experience invasion. Similarly, weeds might evolve resistance to the natural allelopathic herbicides released or leached by some crop residues (Bewick, 1994). However, newly introduced weeds to the reclaimed farms in the deserts might have lower tolerance to allelochemicals of the crop residues, as compared to traditional old weeds that coevolved with the crops. Although, most of the studies were concerned with the traditional weeds associated with crop, none examined the impact of allelochemicals on the germination response of desert plants growing as weeds in farmlands reclaimed in the deserts. The aim of the present study was to determine the effects of leaf extracts of radish (Raphanus sativus), rocket (Eruca sativa) and rhodes grass (Chlons gayana) on the final seed germination and germination rate of four desert plants reported as weeds in many farms of the desert lands of United Arab Emirates (UAE): Tephrosia apollinea, Coelachyrum piercei, Sporobolus arabicus and Plantago ovata. MATERIALS AND METHODS Collections of plant materials and extract preparation Fresh leaf samples of three crops were collected in October 2008 from mature plants of a farm around Al Fujairah, on the coast of the Gulf of Oman in the eastern region of UAE. Two of the crops are from crucifer family (Radish or Raphanus sativus and Rocket or Eruca sativa), and one is a forage grass (rhodes grass or Chlons gayana). All samples were oven dried at 50°C for five days and subsamples were ground to pass through a 3-mm sieve. As crop residues are usually used dry for suppressing the emergence of weeds, the dried plant materials were used in this experiment. Dried materials of each crop were extracted in distilled water at 25 g100 ml−1 for 24 h at 25°C. Following extraction, coarse plant materials were removed with a 2-mm sieve; extracts were passed through a Whatman filter paper and centrifuged at 12,000 rpm for 20 min. These 25% (w/v) extracts of dried materials were further diluted to obtain 1, 2, 3, 4 and 5% solutions.

Petri dishes bioassay Seeds of four weedy plants (Tephrosia apollinea, Coelachyrum

7837

piercei, Sporobolus arabicus and Plantago ovata) were collected during May 2007 from a farm near Fujairah. Seeds were separated from the litters and stored dry in brown paper pages until their use in germination experiments in October 2008. The germination was conducted in 9-cm Petri-dishes containing one disk of Whatman No. 1 filter paper, with 10 ml of test solution. Each dish was wrapped with parafilm as an added precaution against loss of water by evaporation. For each species, dishes were arranged in an incubator set at 15/25°C in 12 h dark/12 h light, with light coinciding with 25°C in a completely randomized design with three crop extracts (radish, rocket and rhodes) and five concentrations of each extract. Four replicate dishes were used for each treatment, each with 25 seeds. Sterile distilled water was used as a control. Radicle emergence was the criterion for germination. Germinated seedlings were counted and removed every second day for 20 days following seeds sowing.

Calculation and statistical analysis The rate of germination was estimated using a modified Timson’s index of germination velocity = G/t, where, G is the percentage of seed germination at two days intervals and t is the total germination period (Khan and Ungar, 1984). The possible maximum value using this index with these data was 700/14 = 50. The higher the value, the more rapid the germination. Two-way ANOVA was performed to evaluate the effects of extracted crop and extract concentration on final germination percentage and germination rate, seedling emergence and seedling dry weight. Tukey test (honestly significant differences, HSD) was used to estimate least significant range between means. The germination rate was log-transformed and germination percentages were arcsine-transformed to meet the assumptions of ANOVA. This transformation improved normality of the distribution of the data. All statistical methods were performed using SYSTAT, version 11.0.

RESULTS Effects of crop extracts on seed germination of T. apollinea Two-way ANOVA showed significant effects of the extracted crops (P<0.05) and extract concentration (P< 0.001) on the final germination of T. apollinea seeds. Regardless of the crop extract, there was no significant difference in final germination of T. apollinea seeds between control (non-treated seeds) and both 1 and 2%; all attained significantly greater values than the higher concentrations (3 to 5%). There was no significant difference between 4 and 5%. The extracts of both radish and rocket, but not that of rhodes, resulted in a significant decrease in final germination of T. apollinea seeds. About 21% of T. apollinea seeds germinated in distilled water (control). There was no significant difference between 1% extract of the different crops and the control. The 2% of radish and rhodes extracts did not affect the final germination, but the same concentration of rocket extract significantly reduced it. All higher concentrations (4 to 5%) of the different extracts resulted in significant reductions in the final germination; so, the effect was

7838

Afr. J. Biotechnol.

Table 1. Effects of different concentrations of different crop extracts on final germination and germination rate of T. apollinea seeds.

Extracted crop

Concentration (%)

Final germination (%) Mean SE 21.3 2.7

Germination rate Mean SE 43.4 2.3

Control

Radish

1 2 3 4 5

20.0 16.0 10.7 1.3 2.7

2.3 2.3 1.3 1.3 1.3

39.1 34.4 27.8 30.0 18.7

2.1 3.1 2.8 0.0 6.2

Rhodes

1 2 3 4 5

21.3 18.7 10.7 8.0 12.0

1.3 3.5 2.7 2.3 2.3

40.6 43.5 33.3 35.2 35.4

2.9 3.1 7.5 2.8 7.5

2 3 4 5

21.3 13.3 12.0 6.7 1.3

3.5 1.3 4.0 1.3 1.3

34.5 37.5 37.5 37.5 25.0

4.9 2.4 0.0 0.0 0.0

Rocket

more pronounced in radish and rocket extracts. This result indicates that the suppression effect of the two crucifer species on the germination of T. apollinea was more obvious, as compared to the extracts of rhodes grass (Table 1). The concentration of the extract had significant effect (P<0.05) on germination rate of T. apollinea seeds. However, the extract type had no significant effect (P>0.05). There was no significant difference between control and 1% extracts of radish, rocket and rhodes on the germination rate. In higher concentrations (2 to 5%), rhodes extracts did not affect the germination rate, but radish extracts significantly inhibited it. The effect of radish extracted was significantly greater than that of rocket at 3 and 5% (Table 1). Effects of crop extracts on seed germination of C. piercei Two-way ANOVA showed significant effects of the extracted crops and extract concentration (P<0.001) on the final germination of C. piercei seeds. Seed germination of C. piercei was very sensitive to the extracts of the different crops, as compared to those of T. apollinea. The non-treated seeds germinated to about 30%. However, the lowest concentration (1%) of both

radish and rocket extracts resulted in significant reduction in final germination of C. piercei seeds. All higher concentrations of the extracts of these crops resulted in complete inhibition of the final germination. Seeds of C. piercei germinated in all concentrations of rhodes, so the germination level was significantly lower than that of the control. The reductions in final germination, as compared to the control, were 69% for both 1 and 2%, 86% for 3% and 82% for both 4 and 5%, respectively (Table 2). The effects of extract type and concentration were significant on germination rate of C. piercei (P<0.001). The 1% concentration of both rhodes and rocket did not affect significantly the final germination rate of C. piercei seeds, but the same concentration of radish did. All higher concentrations of both radish and rocket (2 to 5%) inhibited the germination. There was no significant difference between germination rate of non-treated seeds, and those treated with 1 and 2% of rhodes extract. Higher levels of rhodes extracts (3 to 5%) significantly reduced germination rate of C. piercei (Table 2). Effects of crop extracts on seed germination of P. ovata The effects of the crop extract and extract concentration

El Keblawy

7839

Table 2. Effects of different concentrations of different crop extracts on final germination and germination rate of C. piercei seeds.

Extracted crop

Concentration (%)

Final germination (%) Mean SE 36.00 2.31

Germination rate Mean SE 38.28 2.45

Control

Radish

1 2 3 4 5

1.33 0.00 0.00 0.00 0.00

25.00 0.00 0.00 0.00 0.00

0.00 0.00 0.00 0.00 0.00

Rhodes

1 2 3 4 5

9.33 9.33 4.00 5.33 5.33

1.33 1.33 2.31 1.33 1.33

38.19 37.50 21.88 16.67 16.67

3.03 0.00 3.13 4.17 4.17

Rocket

1 2 3 4 5

5.33 0.00 0.00 0.00 0.00

1.33 0.00 0.00 0.00 0.00

41.67 0.00 0.00 0.00 0.00

4.17 0.00 0.00 0.00 0.00

on the final germination of P. ovata were significant (P<0.001). Both radish and rocket extracts were more effective in germination inhibition of both P. ovata seeds. The lowest concentration (1%) of all crop extracts resulted in a significant increase in final germination of P. ovata seeds, as compared to the control. Seeds of P. ovata treated with 1% extracts of radish, rhodes and rocket germinated more than that of control by 47, 43.6 and 30%, respectively. All higher concentrations of radish and rocket resulted in significant reduction of the P. ovata germination. For rhodes extract, however, 2 and 3% resulted in significant increases, but 4 and 5% resulted in significant decreases in the final germination (Table 3). The effect of extract type and concentration had significant effects on germination rate of P. ovata (P<0.01). The difference between control and 1% extracts of radish, rocket and rhodes with respect to the germination rate was insignificant. In the higher concentrations (2 to 5%), rhodes extracts did not affect the germination rate, but radish extracts significantly inhibited it. For rocket extracts, 2% did not affect the germination rate, but higher concentrations (3 to 5%) significantly inhibited it (Table 3).

centration on the final germination of S. arabicus seeds were significant (P< 0.001). Seed germination of S. arabicus was more tolerant to the extracts of the different crops, as compared to those of the other weedy plants. There was insignificant difference between control and all concentrations of rhodes and rocket, except 5% of rocket extract, with respect to the final germination. The final germination was reduced by about 35% with the application of 5% of rocket extract, as compared to the control. Radish extracts, however, did not affect germination rate at 1 and 2% levels, but significantly reduced it at 3% or higher levels. Concentrations of 4 and 5% almost inhibited the germination of S. arabicus seeds (Table 4). Two way ANOVA showed that the effect of extract concentration, but not the extracted crop, was significant on germination rate of S. arabicus (P<0.05). The 4 and 5% concentrations of both radish and rocket resulted in a significant reduction in germination rate of S. arabicus, but lower concentrations (1 to 3%) did not affect it. All concentrations of rhodes grass, however, did not affect the germination rate of S. arabicus seeds (Table 4). DISCUSSION

Effects of crop extracts on seed germination of S. arabicus The effects of the extracted crops and extract con-

Crucifer family (Brassicaceae) is known to produce allelochemicals (Boydston and Hang, 1995; Eberlein et al., 1998; Kiemnec and McInnis, 2002). For example, the

7840

Afr. J. Biotechnol.

Table 3. Effects of different concentrations of different crop extracts on final germination and germination rate of P. ovata seeds.

Extracted crop

Concentration (%)

Final germination (%) Mean SE 37.3 1.3

Germination rate Mean SE 43.9 2.1

Control

Radish

1 2 3 4 5

57.3 1.3 1.3 2.7 0.0

2.7 1.3 1.3 1.3 0.0

37.0 12.5 16.0 12.5 0.0

1.8 0.0 0.0 0.0 0.0

Rhodes

1 2 3 4 5

56.0 52.0 52.0 21.3 10.7

4.6 4.0 4.0 2.7 1.3

39.0 37.5 35.6 37.5 29.9

0.4 0.0 0.4 3.2 2.5

Rocket

1 2 3 4 5

50.7 12.0 0.0 0.0 0.0

3.5 2.3 0.0 0.0 0.0

37.2 38.5 0.0 0.0 0.0

0.3 1.0 0.0 0.0 0.0

incorporation of Brassica green manures into soil reduced weed emergence and biomass production without reducing yields of tolerant crops (Krishnan et al., 1998). In Nebraska, incorporating mustard species into soil reduced weed biomass in soybean by 49% at six weeks after emergence (Krishnan et al., 1998). Our results show significant inhibition for the aqueous extracts of the two members of the family Brassicaceae (radish and rocket), as compared to rhodes grass. A similar result was reported for the aqueous extract of wild radish; it significantly reduced germination and radicle growth of several weeds and crops (Norsworthy, 2003). In addition, the aqueous extract of leaves of Parthenium hysterophorus (Brassicaceae) suppressed seed germination and seedling growth of three cereal crops, three cultivated crucifers and two wild species of the family Asteraceae (Maharjan et al., 2007). The inhibitory effect of the aqueous extract of radish and rocket on seed germination of the different plants in the present study could be attributed to the presence of some allelochemicals in the extracts. For example, other members of Brassicaceae, such as Brassica sp., contain high amounts of glucosinolates (Fenwick et al., 1983). Although, the biological activity of these secondary plant metabolites is very low, they play a key role in weed suppression (Fenwick et al., 1983). In addition, Vaughn and Berhow (1999) isolated several phytotoxic chemicals, mainly allyl isothiocyanate and benzyl isothiocyanate

from garlic mustard, another member of Brassicaceae. Several studies have reported the allelopathic effects of grasses family. Wheat, oat, corn and sorghum residues, for example, contain water-soluble materials that are toxic to the growth of wheat seedlings (Guenzi et al., 1967; Li et al., 2005; Zuo et al., 2005). In addition, the aqueous shoot extracts of wheat cultivars significantly inhibited both germination and radicle growth of ryegrass (Wu et al., 1998). Phytotoxicity was found to correlate with the total phenolic contents in the extract (Wu et al., 1998). Our results show little or no allelopathic inhibition for the rhodes grass extract on the germination of the different studied species. Caswell et al. (1991) examined the allelopathic effect of rhodes grass on the Hawaiian populations of Rotylenchulus reniformis, the reniform nematode, and found no effect. Similarly, rhodes grass hydrophobic root exudates did not reduce the rate of hatching of Rotylenchulus renqonnis. However, no other studies are available on the impact of rhodes grass on the germination of weedy species. The results show that seeds of S. arabicus were the most resistant to the extract of the three crops: only 4% of radish extract was effective in inhibiting their germination. Seeds of P. ovata were less tolerant than those of S. arabicus, but more resistant, as compared to T. apollinea and C. piercei extracts. Despite the fact that all four weeds were native desert plants, both T. apollinea and C. piercei had higher frequency around the farms, as

El Keblawy

7841

Table 4. Effects of different concentrations of different crop extracts on final germination and germination rate of S. arabicus seeds.

Extracted crop

Concentration (%)

Final germination (%) Mean SE 77.33 5.33

Germination rate Mean SE 43.75 0.40

Control

Radish

1 2 3 4 5

70.67 66.67 45.33 5.33 1.33

3.53 2.67 2.67 1.33 1.33

41.29 47.28 41.53 37.50 37.50

0.26 0.38 0.14 0.00 0.00

Rhodes

1 2 3 4 5

58.67 66.67 66.67 62.67 69.33

1.33 2.67 3.53 2.67 4.81

44.01 42.77 40.24 42.30 42.79

0.62 0.20 0.13 0.20 0.94

Rocket

1 2 3 4 5

90.67 85.33 77.33 77.33 50.67

5.33 1.33 3.53 2.67 3.53

44.03 43.98 42.32 39.49 40.56

0.85 1.29 0.93 1.31 2.04

compared to P. ovata and S. arabicus (Ali El-Keblawy, personal observation). The lack of coevolved tolerance of P. ovata and S. arabicus to allelopathic chemicals of the crop residues would explain their resistance, as compared to the other two species. It has been documented that plants can evolve resistance to chemical substances produced by their neighbor plants (Ehlers and Thompson, 2004; Callaway et al., 2005). Callaway et al. (2005) found that the survival of the native grass species from North American communities that have experienced extensive invasion by Centaurea maculosa have higher tolerances to allelochemical exudates than individuals from communities that did not experience invasion. Weed management systems often seek biological solutions to minimize the environmental impacts related to the use of herbicides in agricultural systems (Tesio and Ferrero, 2011). In recent years, allelochemicals are considered as an important tool for sustainable weed and pest management (Singha et al., 2001). The plant residues that are left in the fields after the harvest of crops represent a waste problem. However, if properly managed, these residues could be used for controlling weeds and pests. The results of the present study show the incorporation of the two crucifersâ&#x20AC;&#x2122; residues into soil for reducing emergence of the desert plants that are growing as weeds in the desert agroecosystems.

REFERENCES Baghestani MA, Lemieux C, Leroux GD, Baziramakenga R, Simard RR (1999). Determination of allelochemicals in spring cereal cultivars of different competitiveness. Weed Sci. 47: 498-504. Bewick TA, Shilling DG, Dusky JA, Williams D (1994). Effects of celery (Apium graveolens) root residues on growth of various crops and weeds. Weed Technol. 8:625-629. Boydston RA, Hang A (1995). Rapeseed (Brassica napus) green manure crop suppresses weeds in potato (Solanum tuberosum). Weed Technol. 9: 669-675. Callaway RM, Ridenour WM, Weir TLT, Vivanco JM (2005). Natural selection for resistance to the allelopathic effects of invasive plants. J. Ecol. 93: 576-583. Caswell EP, Defrank J, Api WJ, Tang CS (1991). Influence of Nonhost Plants on Population Decline of Rotylenchulus reniformis. J. Nematol. 23: 91-98. Eberlein CV, Morra MJ, Guttieri MJ, Brown PD, Brown J (1998). Glucosinolate production by five field-grown Brassica napus cultivars used as green manures. Weed Technol. 12: 712-718. Ehlers BK, Thompson J (2004). Do co-occurring plant species adapt to one another? The response of Bromus erectus to the presence of different Thymus vulgaris chemotypes. Oecologia, 141: 511-518. Fenwick GR, Heaney RK, Mullin WJ (1983). Glucosinolates and their breakdown products in food and food plants. Crit. Rev. Food Sci. 18: 123-301 Fujii Y (2001). Screening and future exploitation of allelopathic plants as alternative herbicides with special reference to hairy vetch. Crop Prot. 4: 257-275. Guenzi WD, McCalla TM, Norstadt FA (1967). Presence and Persistence of Phytotoxic Substances in Wheat, Oat, Corn. and Sorghum Residues. Agron. J. 59: 163-165 Khan MA, Ungar IA (1984). The effect of salinity and temperature on the germination of polymorphic seeds and growth of Atriplex

7842

Afr. J. Biotechnol.

triangularis Willd. Am. J. Bot. 71: 481-489. Kiemnec GL, McInnis ML (2002). Hoary cress (Cardaria draba) root extract reduces germination and root growth of five plant species. Weed Technol. 16: 231-234 Krishnan G, Holshouser DL, Nissen SJ (1998). Weed control in soybean (Glycine max) with green manure crops. Weed Technol. 12: 97-102. Li XJ, Wang GQ, Li BH, Blackshaw RE (2005). Allelopathic effects of winter wheat residues on germination and growth of crabgrass (Digitaria ciliaris) and corn yield. Allelopath. J. 15: 41-48. Maharjan S, Shrestha BB. Jha PK (2007). Allelopathic effects of aqueous extract of leaves of Parthenium hysterophorus L. on seed germination and seedling growth of some cultivated and wild herbaceous species. Sci. World, 5: 33-39 Norsworthy JK (2003). Allelopathic Potential of Wild Radish (Raphanus raphanistrum). Weed Technol. 17: 307-313. Purvis CE, Jessop RS, Lovett JV (1985). Selective regulation of germination and growth of annual weeds by crop residues Weed Res. 25: 415-421. Putnam AR, DeFrank J (1983). Use of phytotoxic plant residues for selective weed control. Crop Prot. 2: 173-181. Putnam AR, Duke WO (1974). Biological suppression of weeds: Evidence for allelopathy in accessions of cucumber. Sci. 185: 370372. Rice EL (1984). Allelopathy, 2nd edition. Academic Press, Orlando, FL, USA. Singha HP, Batisha DR, Kohlia RK (2001). Allelopathy in agroecosystems: an overview. J. Crop Prod. 4: 1-41 Tesio LA, Ferrero A (2011). Allelochemicals identified from Jerusalem artichoke (Helianthus tuberosus L.) residues and their potential inhibitory activity in the field and laboratory. Sci. Hortic. Amsterdam, 129: 361-368. Uygur FN, Kรถseli F, ร inar A, Koch W (1990). Die allelopathische Wirkung von Raphanus sativus L. Z. Pfl. Krankh. Pflaschutz, Sonderh, 12: 259-264.

Vaughn SF, Berhow MA (1999). Allelochemicals isolated from tissues of the invasive weed garlic mustard (Alliara petiolata). J. Chem. Ecol. 25: 2495-2504. Weston LA (1996). Utilization of allelopathy for weed management in agroecosystems. Agron. J. 88: 860- 866. Weston LA (2005). History and Current Trends in the Use of Allelopathy for Weed Management. In: Proceedings of the 4th World Congress on Allelopathy, Charles Sturt Univ. Wagga Wagga, pp. 15-21. Weston LA, Duke SO (2003). Weed and crop allelopathy. Crit. Rev. plant Sci. 22: 367-389 Wu H, Pratley J, Lemerle D, Haig T (1999). Crop cultivars with allelopathic capability. Weed Res. 39: 171-180 Wu H, Pratley J, Lemerle D, Haig T, Verbeek B (1998). Differential allelopathic potential among wheat accessions to annual ryegrass, In: Proceedings of the 9th Australian Agronomy Conference (Eds. by Michalk DL and Pratley JE). Charles Sturt Univ. Wagga Wagga, pp. 567-571. Zeng RS, Mallik AU, Luo SM (2008). Allelopathy in Sustainable Agriculture and Forestry, Springer, New York, USA. Zhao H, Li HB, Kong CH, Xu XH, Liang WJ (2005). Chemical response of allelopathic rice seedling under varying environmental conditions. Allelopath. J. 15: 105-110. Zuo SP, Ma YQ, Deng XP, Li XW (2005). Allelopathy in wheat genotypes during the germination and seedling stages. Allelopath. J. 15: 21-30.

Full Length Research Paper

Efficient callus induction and indirect plant regeneration from various tissues of Jatropha curcas Zhong-Guang Li*, Ming Gong, Shi-Zhong Yang and Wei-Biao Long School of Life Sciences, Engineering Research Center of Sustainable Development and Utilization of Biomass Energy, Ministry of Education, Key Laboratory of Biomass Energy and Environmental Biotechnology, Yunnan Province, Yunnan Normal University, Kunming 650092, People’s Republic of China. Accepted 2 April, 2012

The Jatropha curcas is considered as an important energy plant due to the fact that its seed contains high oil content. Nowadays focus is being placed on J. curcas callus induction and plant regeneration. In this study, explants epicotyl, hypocotyl, petiole and cotyledon of 8-day-old seedlings of J. curcas were utilized for callus induction on media supplied with 1 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D), naphthyl acetic acid (NAA) or indolebutyric acid (IBA) and 0.1 mg/L kinetin (Kin), and the results demonstrated that the combination of 1 mg/L NAA and 0.1 mg/L Kin was the best medium for callus induction and growth. In addition, induced calli were transferred to regeneration medium containing different combination of auxins and cytokinins, and the data showed that the medium containing 1 mg/L thidiazuron (TDZ) and 1 mg/L Kin combined with 0.1 mg/L IBA was propitious to plant regeneration compared with other combinations. Key words: Callus induction, indolebutyric acid, Jatropha curcas, kinetin, naphthyl acetic acid, plant regeneration, thidiazuron. INTRODUCTION Jatropha curcas belonging to the tribe Jatropheae in the Euphorbiaceae family is considered as an important energy plant because its seed contains high oil content. J. curcas has spread beyond its original distribution due to its hardiness, drought endurance, short gestation period, rapid growth, adoption to wide agro-climatic conditions and multiple uses of different plant parts, which is well adapted to arid and semi-arid climates. It also grows on a large range of soils provided they are well drained and aerated, does not compete arable land with other oleaginous plants or crop plants (Carels, 2009; King et al., 2009; Mukherjee et al., 2011). The seed of J. curcas contains 30 to 40% oil with 21% saturated fatty acids and 79% unsaturated fatty acids, and recognition

*Corresponding author. E-mail: zhongguang_li@163.com,gongming@163.com. Tel: +86-8715517394. Fax: +86-871-5516759. Abbreviations: BA, Benzylaminopurine; 2,4-D, 2,4dichlorophenoxyacetic acid; GA, gibberellin; IAA, indole-3acetic acid; IBA, indolebutyric acid; Kin, kinetin; MS, Murashige and Skoog; NAA, naphthyl acetic acid; TDZ, thidiazuron.

that J. curcas oil can yield a high quality biodiesel has led to a surge of interest in J. curcas across the globe (Carels, 2009; King et al., 2009). The J. curcas oil has a good oxidation stability compared to soybean oil, low viscosity compared to castor oil and a low pour point (the temperature where it starts to become solid) compared to palm oil. The fuel properties of J. curcas biodiesel are close to those of fossil diesel and match the American and European standards (Yang et al., 2012). In addition, J. curcas is also widely used as folk medicine, fertilizer, manufacturing of soap and candles, illumination, ﬁsh poison, inhibitor of watermelon mosaic virus, and nuts collected from a non-toxic Mexican variety are roasted and consumed (Modi et al., 2006; Carels, 2009; Bisen et al., 2010; Mukherjee et al., 2011). Callus induction and plant regeneration are one of the key tools in plant biotechnology that exploits the totipotent nature of plant cells. Systems of plant regeneration can be categorized as direct and indirect (Mukherjee et al., 2011). Almost all types of explant tissues are now used as regeneration systems through direct (direct generation from explants) and indirect methods (callus-mediated shoot regeneration) (Sujatha and Mukta, 1996; Rajore and Batra, 2005; Varshney and Johnson, 2010; Kumar et

7844

Afr. J. Biotechnol.

al., 2010a, b). Shoots can be derived either through differentiation of non-meristematic tissues known as adventitious shoot formation or through pre-existing meristematic tissues known as axillary shoot formation. A successful plant regeneration protocol requires appropriate choice of explant, age of the explant, deﬁnite media formulations, speciﬁc growth regulators, genotype, source of carbohydrate, gelling agent and other physical factors including light regime, temperature, humidity, etc (Sujatha and Mukta, 1996; Sujatha et al., 2005; Deore and Johnson, 2008). Plant hormones play a crucial role in controlling the way in which plants grow and develop. They regulate the speed of growth of the individual parts and integrate these parts to produce the plants. Both auxins and cytokinins are synergistically required to induce cell division, differentiation and growth in plant tissue cultures (Shrivastava and Banerjee, 2008; Purkayastha et al., 2010; Jha et al., 2007). Many groups have reported that the different combinations of cytokinins such as benzylaminopurine (BA), kinetin (Kin) and auxins like naphthyl acetic acid (NAA), indolebutyric acid (IBA) as well as indole-3-acetic acid (IAA) control direct adventitious multiple shoot bud generation from epicotyl, hypocotyl, petiole and cotyledon of J. curcas (Cho et al., 2007; Sujatha and Mukta, 1996; Sujatha et al., 2005; Deore and Johnson, 2008). In direct regeneration system, thidiazuron (TDZ), one of the several substituted ureas that have been investigated recently for their cytokinin-like activity, is known to be more active than zeatin for stimulating the growth, differentiation and organogenesis, especially in direct shoot regeneration, when added to a tissue culture medium at a low concentration (Sujatha et al., 2005; Deore and Johnson, 2008; Kumar and Reddy, 2010; Kumar et al., 2010a, b). In addition to these, Soomro and Memon (2007) used leaf and hypocotyls of J. curcas as explants, and found that excellent growth of callus was obtained in medium supplemented with 0.5mg/L 2,4-dichlorophenoxyacetic acid (2,4-D) alone and with 2% (v/v) coconut milk in hypocotyl explants, as well as suspension culture was primarily established. In J. curcas, however, there are few reports available on better induction system of callus and regeneration through an intermediary callus phase. In this study, callus induction and plant regeneration were investigated and the results showed that callus could be excellently induced on appropriate medium from different tissues such as epicotyl, hypocotyl, petiole and cotyledon. The adventitious shoots were efficiently generated from induced callus. MATERIALS AND METHODS

surface-sterilized in 1% CuSO4 for 15 min and rinsed thoroughly with sterile distilled water, and then pre-soaked for imbibition in distilled water for 24 h. The soaked seeds were sowed on six layers of wetted filter papers in trays with covers and germinated in climate chamber at 26°C in the dark for 8 days.

Callus induction Explants epicotyl, hypocotyl, petiole and cotyledon were isolated from 8-day-old seedlings, and were then sectioned into segments with length 0.5 cm or cm2 (cotyledon). These segments were disinfected with 75% (v/v) ethyl alcohol for 7 s and then transferred to 0.1% HgCl2 (w/v) solution to sterilize sequentially for 10 min. At the end of sterilization, the segments were rinsed thoroughly with bacteria free water four times, and then transferred to MS (Murashige and Skoog, 1962) medium supplied with the following plant hormones for callus induction, respectively: (1) 1 mg/L 2,4dichlorophenoxyacetic acid (2,4-D) + 0.1 mg/L kinetin (Kin), (2) 1 mg/L naphthaleneacetic acid (NAA) + 0.1 mg/L Kin, (3) 1 mg/L indolebutyric acid (IBA) + 0.1 mg/L Kin, (4) 0.5 mg/L NAA + 0.1 mg/L Kin, (5) 1.5 mg/L NAA + 0.1 mg/L Kin. Each conical flask contained three segments and cultured in climate chamber at 26°C in the dark for 35 days. The rate of callus induction (%) and fresh weight (g) per callus were counted the 35th day of induction.

Plant regeneration and shoot elongation from callus The inducted calli by 1 mg/L NAA + 0.1 mg/L Kin from epicotyl were transferred to the following MS medium containing the combination of different plant hormones for plant regeneration, respectively: 0.5, 1 or 2 mg/L thidiazuron (TDZ) + 0.5, 1 or 2 mg/L Kin + 0.05, 0.1 or 0.2 IBA (Table 1). Each conical flask was inoculated three pieces of calli and cultured in climate chamber at 26°C for 45 days, with 150 µmol.m-2.s-1 and 16 h photoperiod. The number of adventitious shoots per callus and the rate of adventitious shoot induction (%) were counted the 45th day of regeneration (Table 1). Regenerated shoots were transferred to MS medium containing 1 mg/L IAA + 0.5 mg/L gibberellin (GA) to elongate shoots for 30 days.

Rooting and acclimation The healthy elongated shoots were transferred to 1/2 MS medium containing 0.1 mg/L IBA to root for 20 days, and then the rooting rate was counted. Acclimation of plantlets was carried out according to the methods of Sharma et al. (2011) with a few modifications: Rooted shoots were isolated from medium and washed gently with distilled water several times to remove attached medium, and then transferred to polythene bags containing sterilized soil with perlite, peat and sand (1:2:1) as well as wetted with 0.02% (w/v) carbendazole in greenhouse with 150 µmol.m-2.s-1 and 16 h photoperiod. The polythene bags were covered with transparent plastic bags to maintain humidity. After 1 week polythene bags were punched, thus decreasing the humidity gradually. After 3 weeks, the established plantlets were transplanted to polybags containing garden soil and farmyard manure, and then transferred to a greenhouse for further growth. The numbers of surviving plants were recorded after 7 weeks.

Statistical analysis

Seed germination Seeds of J. curcas were collected from Yuanmou, Yunnan Province, China, and stored at room temperature for a year. Seeds were

All data were taken from at least three independent experiments. The results were processed statistically using analysis of variance (ANOVA). Figures were drawn by SigmaPlot 11.0, error bars in

Zhongguang and Ming

7845

Table 1. Effect of the combination of different plant hormones on the formation of shoot buds.

TDZ

Kin

IBA

Number of adventitious shoot per callus

Rate of adventitious shoot induction (%)

0.5

0.05

2.3 ± 0.15 d

15.2 ± 2.0 d

1 2 0.5 1 2 0.5 1 2 -

1 2 0.5 1 2 0.5 1 2

0.1 0.2 0.05 0.1 0.2 0.05 0.1 0.2

15.4 ± 0.45 b 8.2 ± 0.35 b 7.2 ± 0.25 b 6.4 ± 0.21 6.5 ± 0.25 b b 6.3 ± 0.17 c 5.1 ± 0.20 4.7 ± 0.18 c 0 0 0

80.5 ± 3.5 c 25.3 ± 1.5 c 32.1 ± 2.2 22.4 ± 1.6 c 21.1 ± 2.0 c b 40.4 ± 2.3 b 38.5 ± 2.6 27.2 ± 1.8 c 0 0 0

Induced calli from epicotyls were transferred to shoot induction medium supplied with the combination of different plant hormones for 45 days. The average values designated different letter express statistically significant differences at the 0.05 level and the same letter are statistically insignificant. TDZ, Thidiazuron; kin, kinetin; IBA, indole-3-butyric acid.

figure represent standard error and each data in figure or table represents the mean ± SE of at least three experiments.

RESULTS Explants epicotyl, hypocotyl, petiole and cotyledon from 8-day-old seedlings of J. curcas were transferred to callus induction medium and cultured in climate chamber at 26°C in the dark for 35 days. The results show that different combinations of plant hormones could induce callus information, and the medium supplied with 1 mg/L NAA and 0.1 mg/L Kin was the most significant among the other mediums; the rate of callus induction reached 100% (Figure 2). Furthermore, appropriate combination of concentration of plant hormone for callus induction, sterilized explants were transferred to the medium with the combination of different concentration of 2,4-D, NAA and IBA, respectively. As shown in Figure 2, different combination of plant hormones could induce the formation of callus and stimulate callus growth, especially in the combination of 1 mg/L NAA and 0.1 mg/L Kin, which was the most significant compared with the other combinations. The fresh weight of this combination was up to 10 g per callus, but another two combinations were 6 and 7 g per callus, respectively. These data implied that different combination of plant hormone could induce the formation of callus in epicotyl, hypocotyl, petiole and cotyledon of J. curcas seedlings, and the combination of 1 mg/L NAA and 0.1 mg/L Kin was an appropriate medium for inducing the formation of callus and promoting its growth. Callus-mediated shoot regeneration is an indirect method for plant regeneration (Datta et al. 2007;

Mukherjee et al. 2011). To probe into the formation of adventitious shoot from callus, 35-day-old calli were transferred to plant regeneration medium. The results show that calli from different explants were not different for plant regeneration (data not shown), and calli from epicotyl were used to further plant regeneration experiments due to their rapid growth (Figure 2). At 45 days of plant regeneration, the number of adventitious shoots per callus and the rate of adventitious shoot induction were counted as shown in Table 1. The media containing TDZ could induce the formation of adventitious shoots, but other combinations without TDZ could not, and the number of adventitious shoot per callus and the rate of adventitious shoot induction showed that a trend declined with the increased concentration of TDZ. In addition, the medium supplied with 1 mg/L TDZ, 1 mg/L Kin and 0.1 mg/L IBA not only increased the number of adventitious shoots per callus, but also improved the rate of adventtious shoot induction among the eleven regeneration medium. These results suggested that plant regeneration media containing TDZ in combination with other plant hormones could stimulate the formation of adventitious shoots and the combination of 1 mg/L TDZ, 1 mg/L Kin and 0.1 mg/L IBA was a suitable medium for adventitious shoots from callus. After shoot elongated, the healthy regenerated shoots were rooted on 1/2 MS medium supplied with 0.1 mg/L IBA and rooting rate reached above 90%. Regenerated plants with well developed shoots and roots were successfully acclimated in soil, and then transferred to greenhouse for further growth. Moreover, there were no visible detectable variations during the process of growth (Figure 1).

7846

Afr. J. Biotechnol.

(B)

(A)

(D)

(C)

(E) Figure 1. Callus induction and plant regeneration. (A) Callus induction of epicotyl in MS supplied with 1 mg/L 2,4-D,NAA or IBA and 0.1 mg/L Kin for 35 days. (B) Formation of shoot buds from callus in MS supplied with 1 mg/L TDZ, 1 mg/L BA and 0.1 mg/L Kin for 45 days. (C) Propagation and elongation of shoots. (D) Rooting of shoots. (E) Rooted plants transplanted to pot for 4 months.

Zhongguang and Ming

7847

Figure 2. Effect of the combination of different plant hormones on induction and growth of callus. Explants epicotyl, hypocotyl, petiole and cotyledon were transferred to callus induction medium supplied with 1 mg/L 2,4-D,NAA or IBA and 0.1 mg/L Kin for 35 days. Error bars represent standard error and each data in figure represents the mean Âą SE of three experiments. The bars designated with different letter express statistically significant differences at the 0.05 level and the same letter are statistically insignificant.

DISCUSSION Interaction of auxins and cytokinins plays vital role in cell division, growth, development, differentiation and the formation of plant organs (Shrivastava and Banerjee, 2008; Purkayastha et al., 2010; Jha et al., 2007). The present results showed that different combination of plant hormone could induce the formation of callus in epicotyl, hypocotyl, petiole and cotyledon of J. curcas seedlings, and the combination of 1 mg/L NAA and 0.1 mg/L Kin was an appropriate medium for inducing the formation of callus and promoting its growth (Figures 2 and 3). At the same time, plant regeneration media supplied with TDZ in combination with other plant hormones could stimulate the formation of adventitious shoots and the combination of 1 mg/L TDZ, 1 mg/L Kin and 0.1 mg/L IBA was a suitable medium for adventitious shoots from callus. A number of studies have showed that auxin, such as 2,4-D, IBA and NAA play an important role in callus induction (Soomro and Memon, 2007; Lu et al., 2003; Qin et al., 2006; Wei et al., 2004). In J. curcas, Soomro and Memon (2007) have found that excellent growth of callus was obtained in medium supplemented with 0.5 mg/L 2, 4-D alone and with 2% (v/v) coconut milk in hypocotyl

explants; the callus produced from hypocotyl explants grew faster during 7 to 30 days of culture then stabilized at a low growth rate, and calli cultured on this medium showed an 8-fold increase in fresh weight by the fourth week of incubation. In a work carried out by Lu et al. (2003), it was found that MS medium supplied with 0.5 mg/L BA and 1 mg/L IBA is the best medium for callus induction from hypocotyl and petiole of J. curcas. In addition, Wei et al. (2004) used plumules, cotyledons, hypocotyls, leaf blades, petioles and stalks of J. curcas as explants, and found that the MS medium with 5 mg/L BA and 1 mg/L NAA was the best for callus induction. In this experiment, the combination of 1 mg/L NAA and 0.1 mg/L Kin was an appropriate medium for inducing the formation of callus and promoting its rapid growth in epicotyl, hypocotyl, petiole and cotyledon of J. curcas seedlings (Figures 2 and 3). These data implied that growth hormone, especially NAA, plays a key role in excellent induction and growth of callus in J. curcas, which may be involved in that NAA is easy to enter into the cell (Oono et al., 2003). TDZ is one of the several substituted ureas that have been investigated recently for their cytokinin-like activity, which is known to be more active than zeatin for

7848

Afr. J. Biotechnol.

Figure 3. Effect of the combination of different concentration of auxins on induction and growth of callus. Explants epicotyl, hypocotyl, petiole and cotyledon were transferred to callus induction medium supplied with 0.5, 1 or 1.5 mg/L NAA and 0.1 mg/L Kin for 35 days. Error bars represent standard error and each data in figure represents the mean ± SE of three experiments. The bars designated different letter express statistically significant differences at the 0.05 level and the same letter are statistically insignificant.

stimulating the growth when added to a tissue culture medium at a low concentration (Kim et al., 2001; Sujatha et al., 2005; Deore and Johnson, 2008; Kumar and Reddy, 2010; Kumar et al., 2010a, b). Deore and Johnson (2008) found that adventitious shoot buds were induced from very young leaf explants of in vitro germinated seedlings as well as mature ﬁeld-grown plants cultured on MS medium supplemented with 2.27 µM TDZ, 2.22 µM BA and 0.49 µM IBA, and the presence of TDZ in the induction medium has greater inﬂuence on the induction of adventitious shoot buds. In addition, Sharma et al. (2011) also reported that the best results irrespective of genotype were obtained on the medium containing 0.5 mg/L TDZ and in vitro hypocotyl explants were observed to have higher regeneration efficiency as compared to ex vitro explant in both toxic and non-toxic genotypes. In addition to these, the study of Kumar et al. (2011) indicated that maximum regeneration efficiency (81.07%) and the number of shoot buds per explants was observed on 9.08 μM TDZ containing MS medium from in vitro cotyledonary leaf explants. Our present results also showed that plant regeneration media supplied with TDZ in combination with Kin or IBA could stimulate the formation of adventitious shoots, and the combination of 1 mg/L TDZ, 1 mg/L Kin and 0.1 mg/L IBA was a best

medium for adventitious shoot formation (Table 1). These results suggest that TDZ plays a very important role in the formation of adventitious shoot buds of J. curcas, and these effects may be involved in stimulating de novo synthesis of auxins by increasing the levels of IAA and its precursor, tryptophan, as well as increase in contents of endogenous cytokinin and ethylene (Murthy et al., 1995; Murthy and Saxena, 1998). The other possibilities include the modification in cell membranes, energy levels, nutrient uptake, or nutrient assimilation (Murthy et al., 1995,Murthy and Saxena; 1998). In conclusion, it is clearly shown that the system of excellent induction and growth of callus in epicotyl, hypocotyl, petiole and cotyledon of J. curcas seedlings is the medium supplied with 1 mg/L NAA and 0.1 mg/L Kin, and the combination of 1 mg/L TDZ, 1 mg/L Kin and 0.1 mg/L IBA is the best plant regeneration system. Regenerated shoots could induced root formation on 1/2 MS medium with 0.1 mg/L IBA, and survival percentage reached above 90% through acclimating in polythene bags. ACKNOWLEDGEMENT This research is supported by Key Grant of Education

Zhongguang and Ming

Department of Yunnan Province of China (ZD 2010004), Natural Science Foundation of Yunnan Province of China (2010ZC066). REFERENCES Bisen PS, Sanodiya BS, Thakur GS, Baghel RK, Prasad GBKS (2010). Biodiesel production with special emphasis on lipase-catalyzed transesteriﬁcation. Bioltechol. Lett. 32: 1019-1030. Carels N (2009). Jatropha curcas: A review. Adv. Bot. Res. 50: 39-86. Cho M, Lee OR, Ganguly A, Cho HT (2007). Auxin-signaling: short and long. J. Plant Biol. 50: 79-89. Datta MM, Mukherjee P, Ghosh B, Jha TB (2007). In vitro clonal propagation of biodiesel plant (Jatropha curcas L.). Curr. Sci. 93: 1438-1442. Deore AC, Johnson TS (2008). High-frequency plant regeneration from leaf-disc cultures of Jatropha curcas L.: an important biodiesel plant. Plant Biotechnol. Rep. 2: 7-11. Jha TB, Mukherjee P, Datta MM (2007). Somatic embryogenesis in Jatropha curcas L., an important biofuel plant. Plant Biotech. Rep. 1: 135-140. Kim CJ, Chang MY, Son SI, Heo SJ (2001). Thidiazuron required for efficient somatic embryogenesis from suspension-cultured cells of pimpinella brachycarpa. J. Plant Biol. 44: 224-230. King AJ, He W, Cuevas JA, Freudenberger M, Ramiaramanana D, Graham IA (2009). Potential of Jatropha curcas as a source of renewable oil and animal feed. J. Exp. Bot. 60: 2897-2905. Kumar N, Reddy MP (2010). Plant regeneration through the direct induction of shoot buds from petiole explants of Jatropha curcas: a biofuel plant. Ann. Appl. Biol. 156: 367-375. Kumar N, Vijay Anand KG, Reddy MP (2010). A shoot regeneration from cotyledonary leaf explants of Jatropha curcas: a biodiesel plant. Acta Physiol. Plant. 32: 917-924. Kumar N, Vijay Anand KG, Reddy MP (2011). Plant regeneration of nontoxic Jatropha curcas-impacts of plant growth regulators, source and type of explants. J. Plant Biochem. Biotechnol. 20: 125-133. Kumar N, Vijay Anand KG, Sudheer Pamidimarri DVN, Sarkar T, Reddy MP, Radhakrishnan T, Kaul T, Reddy MK, Sopori SK (2010b). Stable genetic transformation of Jatropha curcas via Agrobacterium tumefaciens-mediated gene transfer using leaf explants. Ind. Crop Prod. 32: 41-47. Lu WD, Wei Q, Tang L, Yan F, Chen F (2003). Induction of callus from Jatropha curcas and rapid propagation. Chin. J. Appl. Environ. Biol. 9:127-130. Modi MK, Reddy JRC, Rao BVSK, Prasad RBN (2006). Lipasemediated transformation of vegetable oils into biodiesel using propan2-ol as acyl acceptor. Biotechnol. Lett. 28: 637-640. Mukherjee P, Varshney A, Johnson TS, Jha TB (2011). Jatropha curcas: a review on biotechnological status and challenges. Plant Biotechnol. Rep. 5: 197-215.

7849

Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol. Plant 5: 473-479. Murthy BNS, Murch SJ, Saxena PK (1995). TDZ-induced somatic embryogenesis in geranium cotyledonary cultures. Plant Cell Rep. 15: 423-426. Murthy BNS, Saxena PK (1998). Somatic embryogenesis and plant regeneration of Neem (Azadirachta indica A. Juss). Plant Cell Rep. 17: 469-475. Oono Y, Ooura C, Rahman A, Aspuria ET, Hayashi K, Tanaka A, Uchimiya H (2003). p-Chlorophenoxyisobutyric Acid Impairs Auxin Response in Arabidopsis Root. Plant Physiol. 133: 1135-1147. Purkayastha J, Sugla T, Paul A, Solleti SK, Mazumdar P, Basu A, Mohommad A, Ahmed Z, Sahoo L (2010). Efficient in vitro plant regeneration from shoot apices and gene transfer by particle bombardment in Jatropha curcas. Biol. Planta. 54: 13-20. Qin H, Song SQ, Long CL, Chen HY (2006). Tissue culture and plant regeneration of Jatropha curcas (Euphorbiaceae). Acta Bot. Yunnan 28: 649-652. Rajore S, Batra A (2005). Efficient plant regeneration via shoot tip explant in Jatropha curcas. J. Plant Biochem. Biotech. 14: 73-75. Sharma S, Kumar N, Reddy MP (2011). Regeneration in Jatropha curcas: Factors affecting the efficiency of in vitro regeneration. Ind. Crop Prod. (In press). Shrivastava S, Banerjee M (2008). In vitro clonal propagation of physic nut (Jatropha curcas L): Influence of additives. Int. J. Integrative Biol. 3: 73-79. Soomro R, Memon RA (2007). Establishment of callus and suspension culture in Jatropha curcas. Pak. J. Bot. 39: 2431-2441. Sujatha M, Mukta N (1996). Morphogenesis and plant regeneration from tissue cultures of Jatropha curcas. Plant Cell Tissue Organ Cult. 44: 135-141. Sujatha M, Makkar HPS, Becker K (2005). Shoot bud proliferation from axillary nodes and leaf sections of non-toxic Jatropha curcas L. Plant Growth Regul. 47: 83-90. Varshney A, Johnson TS (2010). Efficient plant regeneration from immature embryo cultures of Jatropha curcas, a biodiesel plant. Plant Biotech. Rep. 4: 139-148. Wei Q, Lu WD, Liao Y, Pan SL, Xu Y, Tang L, Chen F (2004). Plant regeneration from epicotyl explants of Jatropha curcas. J. Plant Physiol. Mol. Biol. 30: 475-478. Yang CY, Fang Z, Li Bo, Long YF (2012). Review and prospects of Jatropha biodiesel industry in China. Renew. Sustain. Energy Rev. 16: 2178-2190.

Full Length Research Paper

Allelopathic activities of Jasminum officinale f. var. grandiflorum (Linn.) Kob.: Inhibition effects on germination, seed imbibition, and α-amylase activity induction of Echinochloa crus-galli (L.) Beauv. Montinee Teerarak1, Chamroon Laosinwattana1*, Patchanee Charoenying2 and Hisashi Kato-Noguchi3 1

Department of Plant Production Technology, Faculty of Agricultural Technology, King Mongkut’s Institute of Technology Ladkrabang Bangkok 10520, Thailand. 2 Department of Chemistry, Faculty of Science, King Mongkut’s Institute of Technology Ladkrabang Bangkok 10520, Thailand. 3 Department of Applied Biological Science, Faculty of Agriculture, Kagawa University, Miki, Kagawa761-0795, Japan. Accepted 9 March, 2012

A methanolic extract in wettable powder from the leaves of Jasminum officinale f. var. grandiflorum (Linn.) Kob. (JWP) was inhibitory to germination and seedling growth of Echinochloa crus-galli (L.) Beauv. weeds. The inhibition percentages on E. crus-galli seed germination treated with 500 to 8,000 ppm for 7 days was about 0 to 70%, respectively, whereas shoot length was inhibited from 19.04 to 71.82% and root length was 76.31 to 100% inhibition, respectively. The imbibition and α-amylase activities in the treated E. crus-galli seeds were progressively depressed with increasing JWP concentrations. The obtained results suggest that JWP inhibited imbibition and α-amylase activity in E. crus-galli seeds during germination. Key words: Allelopathy, α-amylase, Echinochloa crus-galli, Jasminum officinale, seed imbibition.

INTRODUCTION Higher plants are a rich source of valuable allelopathic compounds used for weed control technologies based on natural products. Allelopathic potential present in the extraction of many higher plants and in many plant organs can be accomplished with bioassays under laboratory conditions. The initial laboratory assays of allelochemicals have focused on seed germination and seedling growth (Vyvyan, 2002). The bioassay chosen for studying the mode of action of these natural compounds is an important consideration. Gibberellin synthesis, seed imbibition and activity of α-amylase enzyme (EC 3.2.1.1) are consistently linked with the seed germination

*Corresponding author. E-mail: laosinwattana@yahoo.com. Tel: +66817330554. Fax: +6623298515.

process. Seeds begin to germinate after imbibition of an adequate moisture level and become metabolically active. These hydrolytic enzymes are involved in the hydrolysis and transformation of the endosperm starch into soluble sugars to provide nutrition or energy during early seed germination and seedling growth. Principal among these is α-amylase which catalyzes endohydrolysis of α-1-4 glucosidic linkages in starch and any related oligosaccharides to make oligosaccharides and glucose (Taiz and Zeiger, 2006). The measurement of seed imbibition and α- amylase activity can be used to assess changes in germination efficiency of the seeds treated with allelochemical substances. In our previous report, the leaves of Jasminum officinale f. var. grandiflorum (L.) Kob. had allelopathic activity. The main active compound was isolated and determined by spectral data as a secoiridoid glucoside named oleuropein. However,

Teerarak et al.

bioassay results from different fractions during the isolation process indicated that methanolic extract is responsible for inhibitory growth effects on Echinochloa crus-galli (L.) Beauv., with a vast number of chemical constituents as mixtures, and the observed activities could be related to synergistic effects (Teerarak et al., 2010). To explore the potential of allelo-chemicals from a crude methanolic extract in wettable powder (JWP) for use as a natural herbicide, the present study was designed to examine allelopathic activities on germination of E. crus-galli seeds.

7851

Seed imbibition Measurement of seed imbibition was done by following the method of Turk and Tawaha (2003). Four replicates of 100 E. crus-galli seeds were weighed and recorded as the original seed weight (W 1). These seeds were separately germinated in 7 ml of JWP (500 to 8000 ppm), with distilled water as the control. Seed weights were recorded as the final seed weight (W 2) for each concentration and exposure time. The imbibition percentage was calculated from the following equation: Seed imbibition (%) = [(W 2 - W 1) / W 1] × 100 Extract and assay -amylase activity

MATERIALS AND METHODS Plant materials One-year-old J. officinale plants growing around an experimental field at King Mongkut’s Institute of Technology Ladkrabang, Bangkok, Thailand were collected. Mature and healthy leaves were harvested, immediately cleaned of soil with running tap water, dried in a hot-air oven at 45°C for 3 days, and ground to powder (100 mesh) in an electric blender. The E. crus-galli was selected for bioassay plant because it is a major weed in paddy rice field. The seeds of E. crus-galli were collected from paddy fields in the Ladkrabang district, Thailand. E. crus-galli seeds were placed in the shade at room temperature for three months, and then incubated at 60°C in a hot-air oven for 48 h to break their dormancy.

Preparation of wettable powder formulation and bioassay 1 kg of 100 mesh J. officinale leaf powder was extracted (1 kg: 10 L), with methanol at 25°C constant temperature. After 24 h of extraction, the brown supernatants were filtered through four layers of cheesecloth and re-filtered through Whatman no. 1 filter paper (Whatman Inc. Clifton, NI, USA.). After that, the residue was reextracted two times with the same extraction solvent at the same conditions as the first extraction procedure; a crude extract of extraction number 1, 2 and 3 were pooled. Following filtration, the brown supernatants were dried by evaporation of the solvent using a rotary evaporator (BUCHI Rotavapor R255), BUCHI, Lausanne, Switzerland), under a partial vacuum at 45°C until a constant crude extract weight was reached. Wettable powder formulation of crude extract (JWP) was prepared by dissolving sticky crude extract with acetone in a mortar jar and then wettable powder [kaolinite:anionic surfactant; 97:3 (w/w)] was added into the mortar jar in a 3:7 ratio (crude extract:wettable powder). The mixture was slowly pulverized until completely dry. Acetone was added three times and kept in the dark at a low temperature until used. The JWP was dissolved in distilled water to contain five concentrations of 500, 1000, 2000, 4000 and 8000 ppm. 5 ml of each treatment was added to germination paper placed in each 9 cm diameter glass Petri dish. 20 healthy seeds of E. cruss-galli were placed in each Petri dish. Four replicates were maintained per treatment in a completely randomized manner in a growth chamber with a temperature of 25 to 32°C, a 14 h photoperiod with light intensity (Cool White 840) of 100 mol m-2 s-1 and relative humidity of around 80%. Treatments with distilled water were used as the control. Germination was deemed to have occurred only after the radicle had protruded beyond the seed coat by at least the dimension of the seed at seven days after treatment. Seedling growth was measured as the root and shoot lengths at seven days after treatment. The value of the germination expresses the percentage of germinating seeds related to number of planted seeds.

Extraction and measurement of activity of α-amylase was done by following the method of Bernfield (1955) and Sadasivam and Manickam (1996). After measuring imbibition, seeds (100 seeds for one determination) were homogenized with a 4 ml ice-cold solution of 0.1 M CaCl2 and centrifuged at 9600 × g for 10 min. Supernatant was used as the enzyme extract. The -amylase was then assayed by measuring the rate of generation of reducing sugars from soluble starch. The reaction medium (3 ml) contained 1 ml of 1% soluble starch in acetate buffer solution at pH 5.5 and 1 ml of the enzyme. The assay medium was incubated for 15 min at 37°C. The reaction was terminated by addition of 1 ml dinitrosalicylic acid (DNS reagent ; 40 mM 3,5 dinitrosalicylic acid, 0.4 N NaOH and 1M K-Na tartrate), and immediately heated in a boiling water bath for 5 min. The mixture was cooled under running tap water. A total volume was made up to 7 ml with distilled water. The intensity of color was measured as absorption at 560 nm in a spectronic GENESYS 20 spectrophotometer (Thermo Electron Corporation, USA). A standard graph was prepared using maltose, and the amount of amylase present in the sample was calculated from the standard curve and expressed as mol maltose min-1 g-1(FW).

Statistical analysis Each treatment consists of four replications in completely randomized design. Analysis of variance was calculated for all data and comparisons between treatments were made at probability level p ≤ 0.05 using Tukey’s test.

RESULTS The results show that JWP had significant allelopathic effects against E. crus-galli (Figure 1). At 2000 ppm dose, germination of E. crus-galli was inhibited by 12.5%. By increasing the dose of application at 4000 and 8000 ppm, the inhibition magnitude was increased to 40 and 70%, respectively. Shoot and root length of E. crus-galli was significantly reduced in response to JWP and the effect was concentration dependent. In general, the inhibitory effect was more on root length than on shoot length. At the highest concentration of 8000 ppm, root length was completely inhibited, whereas shoot length decreased by 71.82%. However, at the lowest concentration of 500 ppm, there were a promotory effects on shoot and root length. These results indicate that JWP contains some inhibitory principles upon inhibited germination and seedling growth. However, the nature of inhibitory

7852

Afr. J. Biotechnol.

Germination

80 Inhibition (% of control)

100

Shoot length

Root length

b 40

b bc

20 c c cd c

Control -20

500 d

1000

2000

4000

8000

Concentration (ppm) Figure 1. Effects of crude methanolic extract from J. officinale in wettable powder form (JWP) on seed germination and seedling growth of E. crus-galli seeds. The values represent the means. Different letters indicate significance differences ( p<0.05) between treatments.

principles contained in JWP is unknown. Thus, further studies were extended to explore the impact of JWP on imbibition and α-amylase activities of E. crus-galli seeds. Data that further shows the differences in the percentage of imbibition between control and treated E. cruss-galli seeds with concentration application of JWP at different imbibition periods are presented in Figure 2. The percentages of imbibition in the control seeds exhibited a marked increase by prolonging the imbibition periods. The time required for 32.84, 45.11 and 79.54% of imbibition was about 12, 24 and 48 h, respectively. Under the same concentration of JWP, the percentage of imbibition in treated seeds increased by prolonging the imbibition period. For all treatment concentrations, no significant differences in imbibition after the 12 and 24 h imbibiton time were observed. After the 48 h imbibition period, the percentage of imbibition caused marked changes for all concentrations used. The activities of αamylase in E. cruss-galli seeds were also investigated and the results are shown in Figure 3. Under the same extract concentration, α-amylase activity increased by prolonging the imbibition period. Application of 500 ppm JWP had a stimulatory activity of α-amylase on E. crussgalli. An increased concentration of JWP inhibited αamylase activity. However, the activity of α-amylase was not significantly inhibited at concentrations of 1000 and 2000 ppm crude metanolic extract in wettable powder during the whole experiment. It was significantly inhibited when imbibing the seeds in JWP at concentrations of

4000 and 8000 ppm for a period of 12, 24 and 48 h. DISCUSSION In the present study, it is clearly shown that JWP inhibited E. crus-galli seed germination. Exposure of dry E. crusgalli seeds to JWP, in general, inhibited the imbibition of E. crus-galli seeds, compared to control seeds. Other studies have also shown inhibition of seed imbibition by the presence of allelochemicals. Aqueous extracts of ginger, especially stem and leaf, inhibited imbibition for chive and soybean seeds (Han et al., 2008), and leaf aqueous extract of Brassica nigra L. inhibited imbibition of Avena fatua L. seeds (Turk and Tawaha, 2003). Most seeds require an adequate moisture level for activation of metabolism within seed (Chong et al., 2002). On the other hand, seed which inhibited imbibition may be limited in specific enzymes required for metabolism of reserved food and hence have poor seed germination. In this study, the activity of α-amylase tended to decrease as the JWP concentration increase. The α-amylase enzyme catalyze endosperm starch hydrolysis and transformation into soluble sugars and hence its utilization for providing energy during seed germination (Chong et al., 2002). Inversely, the decrease in amylase activity as a result of exposure to JWP could suggest the retardation of substrate production for respiration and consequently limited energy production.

Seed imbibition (%)

Teerarak et al.

100

7853

a a

c a

0 12

Time (h)

control

500 ppm

1000 ppm

2000 ppm

4000 ppm

8000 ppm

(mol maltose min g (FW))

(µmol maltose min g -1FW)-1

-Amylase-1activity -1

α- Amylase activity

Figure 2. Effects of crude metanolic extract from J. officinale in wettable powder form (JWP) on imbibition of E. crus-galli seeds at different imbibition periods. The values represent the means. Different letters indicate significance differences (p<0.05) between treatments.

a a

ab abc

bcd 6 4

a a a

a ab ab

cd b

Time (h)

control

500 ppm

1000 ppm

2000 ppm

4000 ppm

8000 ppm

Figure 3. Effects of crude metanolic extract from J. officinale in wettable powder form (JWP) on α-amylase activity of E. crus-galli seeds at different imbibition periods. The values represent the means. Different letters indicate significance differences (p<0.05) between treatments.

For this reason, JWP may adversely affect seed germination. It was shown that the activity of α-amylase was inhibited by the presence of allelochemicals. Kato-

Noguchi and Macίas (2005) previously reported that lettuce (Lactuca sativa L. cv. Grand Rapids) seeds treated with 6-methoxy-2- benzoxazolinone (MBOA)

7854

Afr. J. Biotechnol.

inhibited seed germination by impeding induction of αamylase activity. A different sensitivity of the roots and shoot to the presence of JWP was evident in our experiments. E. crus-galli root length was found to be more sensitive to the allelochemicals than that observed for shoot growth. These results are similar to that observed in several reports that noted that roots are more sensitive to allelochemicals than shoots (Laosinwattana et al., 2010; Meksawat and Pornprom, 2010). The obtained data resulted from the over accumulation of JWP in tissue which effectively was toxic. E. crus-galli root length was found to be more sensitive to the allelochemicals than that observed for shoot growth. The accumulation of allelochemicals in the JWP may be higher in root than in shoot. Conclusion Phytotoxic substances present in J. officinale adversely affected seed germination and seedling growth of E. crus-galli seeds treated with JWP inhibited seed germination by impeding seed imbibition and induction of α-amylase activity. ACKNOWLEDGEMENTS The authors want to thank the Thailand Research Fund (TRF; Grant number IUG5280011) for financial support.

REFERENCES Bernfeld P (1955). Amylases α and β. In: Method in Enzymology. (eds. By Colowick SP and Kaplan NO). Academic Press, New York, pp. 149-158. Chong C, Bible BB, Ju HY (2002). Germination and Emergence..In: Handbook of Plant and Crop Physiology, Second edition. (ed. by Pessarakli M). Marcel Deckker, Inc. New York, pp. 57-115. Han CM, Pan KW, Wu N, Wang JC, Li W (2008). Allelopathic effect of ginger on seed germination and seedling growth of soybean and chive. Sci. Hortic. 116: 330-336. Kato-Noguchi H, Macías FA (2005) Effects of 6-methoxy-2benzoxazolinone on the germination and -amylase activity in lettuce seeds. J. Plant Physiol. 162: 1304-1307. Laosinwattana C, Boonleom C, Teerarak M, Thitavasanta S, Charoenying P (2010). Potential allelopathic effects of Suregada multiflorum and the influence of soil type on its residue’s efficacy. Weed Biol. Manage. 10: 153-159. Meksawat S, Pornprom T (2010). Allelopathic effect of itchgrass (Rottboellia cochinchinensis) on seed germination and plant growth. Weed Biol. Manage. 10: 16-24. Sadasivam S, Manickam A (1996). Biochemical Mmethods. New Age International (P) Ltdimited., New Delhi. Taiz L, Zeiger E (2006). Plant Physiology, fourth edition. Sinauer Associates, Massachusetts. Teerarak M, Laosinwattana C, Charoenying P (2010). Evaluation of allelopathic, decomposition and cytogenetic activities of Jasminum officinale L. f. var. grandiflorum (L.) Kob. on bioassay plants. Bioresour. Technol. 101: 5677-5684. Turk MA, Tawaha AM (2003). Allelopathic effect of black mustard (Brassica nigra L.) on germination and growth of wild oat (Avena fatua L.). Crop Prot. 22: 673-677. Vyvyan JR (2002). Allelochemicals as leads for new herbicides and agrochemicals. Tetrahedron, 58: 1631-1646.

Full Length Research Paper

Light-sensitive features of seed germination in the invasive species Ageratina adenophora (syn. Eupatorium adenophorum) in China Huimei Wang, Yong Jiang, Yanhong Li, Wenjie Wang* and Zu Yuangang Key Laboratory of Forest Plant Ecology, Northeast Forestry University, Harbin 150040, People’s Republic of China. Accepted 30 March, 2012

Ageratina adenophora (Crofton weed) is a noxious invasive plant in several countries and its germination features favor its invasiveness. The aim of this study was to characterize the light-sensitive seed germination of this weed. Two to five-fold higher germination was observed under light conditions than under dark conditions. Dormancy-breaking methods of low temperature pre-treatment, pre-soaking with KNO3 solution, polyethylene glycol, and salicylic acid did not influence germination under either light or dark conditions. Very low light (39 μmol·m-2·s-1, 25% light transmittance) tripled seed germination from 22.3 to 66.7%, when compared to no light. Germination under violet, blue and green glass papers was significantly lower than that under yellow, orange, and red ones. Significant correlations between red-light intensity, red/far-red ratio and germination indicated that these 2 types of light may be responsible for the germination differences. Experiments under narrow band filters also proved this; red light at 630 nm could induce germination, while far-red light 740 nm could prevent germination. Thus, red/far-red light was effective in the photoblastic germination of Crofton weed, while other treatments could not replace light during germination. This photoblastic germination could favor the fast colonization of this weed when the seeds in deep soil approach the surface. Key words: Crofton weed, plant invasiveness, light quality, light quantity, red/far-red ratio, biological control. INTRODUCTION At present, there are approximately 170 species (41 families) of invasive terrestrial plants in China (Sang et al., 2010) and similarly, many invasive species have been reported in Africa (Olckers, 2004). Ageratina adenophora (Spreng.) R. M. King & H. Rob. (syn. Eupatorium adenophorum Spreng), commonly called Crofton weed, is a representative of the Asteraceae family (49 invasive species) and is a noxious weed found in many countries, including the United States of America, New Zealand, Australia and many African and Asian countries (Cronk and Fuller, 1995; Dong et al., 2011). Crofton weed is a perennial herb, with a woody rootstock and many stems reaching up to 1.5 m in height (Wang et al., 1994). Originally from Mexico, it first appeared in China in the Yunnan Province in 1935 (possibly from Burma), and its

*Corresponding author. E-mail: wjwang225@hotmail.com.

dispersal continued northwards and eastwards at an average speed of 20 km·year−1 (Sang et al., 2010). In this paper, we discussed the effect of light on seed germination and its possible role in the invasiveness of Crofton weed. Crofton weed is highly effective in invading heavily disturbed areas along streams, roadsides, large tracts of pasture and horticultural land in both South Asia and Africa (Wang et al., 1994; Dong et al., 2011; Buccellato et al., 2012). The successful invasion of this species has been attributed to a number of mechanisms, including plasticity in photosynthesis and nitrogen utilization (Wang and Feng, 2005), a lack of natural predators (Raj Mohan and Ramaswamy, 2007), allelopathy for other native plants (Yu et al., 2004), large amounts of seed production and variable methods of dispersal (Wang et al, 1994; Yang et al., 2007). Like other seed traits, germination (the first step in colonizing a new habitat), can also evolve in response to the selective pressures of different habitats,

7856

Afr. J. Biotechnol.

thereby producing genetic differentiation (Li and Feng, 2009). Light can affect the germination process of Crofton weed; however, there is wide variation in the results of published studies (Lu et al., 2006; Wang et al., 2006; Xu et al., 2011; Niu et al., 2011). Liu et al. (1985) found that stable light, together with a hot and moist environment, is necessary for successful germination of Crofton weed seeds. Lu et al. (2006) also found that the major invasion of Crofton weed should be limited to parts of Southwest China, while germination failure is likely in other regions. Wang et al. (2006) found that the peak germination rate of Crofton weed was below 28% of full sunlight, and additional light could decrease the germination rate. Moreover, Niu et al. (2011) found that low light (<6%) improved germination and seedling survival, and Lu et al. (2006) reported that germination increased to over 90% under light, while germination in the dark was 17%. Plasticity in the germination of seeds in variable elevations and different soil-depths may also favor invasiveness of Crofton weed in variable environments (Li and Feng, 2009; Shen et al., 2011). These data suggest that environmental factors, together with light, may influence the germination of this weed, although large differences exist in the results of the studies conducted to date. On the basis of the data from the literature, it is difficult to define the amount and type of light required to break photodormancy. In addition, it is not clear from the studies undertaken so far if other traditional dormancybreaking methods can replace light and initiate germination. Hence, a systematic study is required to investigate these areas. In this study, we aimed to define the light-sensitive features of seed germination of Crofton weed and to answer the following questions: (1) Is the germination of Crofton weed light sensitive? (2) Can traditional dormancy-breaking methods [low temperature, polyethylene glycol (PEG) treatment, salicylic acid treatment and KNO3 treatment] stimulate germination equally as well as light? (3) Does radiation intensity affect the germination of this weed? (4) What effect do radiation wavelengths (color) have on germination? (5) Can red/far-red light inhibit germination? MATERIALS AND METHODS Seed origin

Light quality experiment To test the effect of different colors of light on germination, 6 colors of glass paper (the color of the filters perceived by the eye: red, green, orange, yellow, blue and violet) (Hongtu film and TV appliances Inc., Beijing, China) were used to cover the Petri dishes during germination in growth chambers. The control was not covered with glass paper (white). The light transmittance of the glass papers was measured using an AvaSpec dual-channel fiberoptic spectrometer (Avaspec-2048-2, Aventes, Netherlands) (Table 3). For each treatment, 30 seeds were evenly placed on wet filter papers (2 layers) in Petri dishes (diameter, 9 cm), and one layer of glass paper was wrapped over the dish and kept in place until the germinated seeds were counted (7 days). For each treatment, at least 3 replicates were conducted.

Light quantity experiment To expose the seeds to variable amounts of incident light, variable layers of medical gauze were used to cover the Petri dishes. Five light intensities were used: 100% (11640 lux, 158 μmol·m -2·s-1), 75% (8730 lux, 118 μmol·m-2·s-1), 50% (5820 lux, 71 μmol·m-2·s-1), 25% (2910 lux, 39 μmol·m-2·s-1), and <0.5% (30 lux, 0.4 μmol·m-2·s1 ). An illuminometer (TES-1330A, Tes Electrical Electronic Corp., Taiwan) was used to measure light transmittance. A full dark treatment was performed in a growth chamber without a lamp (light transmittance, 0%, 0 lux). For each treatment, 40 seeds were evenly placed on wet filter papers (2 layers) in Petri dishes (diameter, 9 cm), and at least 3 replicates were performed for each treatment.

Red/far-red induction experiment

All seeds were harvested in March 2010 close to the World Horticulture Exposition Garden in Kunming, China (102.76°N, 25.08°E). Fully matured seeds were naturally dried in the laboratory, and even-sized good seeds were selected for this experiment. The weight of the seeds was 48 mg/1000 seeds. The seeds were stored in the laboratory for less than 1 month prior to the germination experiment. Combined experiments methods and light

temperature (LT) treatment, salicylic acid (SA) treatment, PEG treatment and KNO3 treatment. Prior to germination in growth chambers, the following treatments were conducted. For LT treatment, the seeds were placed in a refrigerator (5°C) for 7 days. For SA treatment, the seeds were pre-soaked in 3 concentrations of SA (0.01, 0.05 and 0.1 mmol·L-1) and 1 control of distilled water for 20 to 21 h. For PEG treatment, the seeds were pre-soaked in 3 concentrations of PEG (5, 10 and 15%) for 20 to 21 h and the control of distilled water. For KNO3 treatment, the seeds were presoaked in 10, 25 and 50 mmol·L-1 of KNO3 solution for 22 to 23 h, and the control seeds were pre-soaked in distilled water for the same duration. For each treatment, 40 seeds were evenly placed on wet filter papers (2 layers) in Petri dishes (diameter, 9 cm) and then cultivated in growth chambers (Dongtuo, ZPW-400, Harbin, China) under the following conditions: 25°C for 16 h·day-1 in complete light by using 24 fluorescent lamps (ca. 11640 lux, 158 μmol·m -2·s-1), and 15°C for 8 h·day-1 in complete darkness. For each treatment, at least 3 replicates were performed.

traditional

dormancy-breaking

The traditional dormancy-breaking methods used included low-

The red/far-red light experiment was performed in growth chambers with narrow band glass filters (Changchun Fuchun Photoelectrical Inc., Changchun, China). A halogen bulb (20 W, 220 V) fitted in front of a polished aluminum reflector was used as a source for both red and far-red light. The Avaspec spectrometer was used to measure the central wavelength and half-band width of the red and far-red light. Central wavelengths for red light and far-red light were 630 and 740 nm, respectively and the half-band widths were 30 and 20 nm, respectively. The distance from the light source to the seed dishes was 90 cm. Three test inductions and a dark control were used in this experiment. The first test was red light for 9 h (red9hour) and red light for 9 h plus far-red for 0.25 h (red9hour/far-

Wang et al.

red0.25hour). The second test was red light for 36 h (red36hour) and red light for 36 h plus far-red for 4 h (red36hour/far-red4hour). The third test was red light for 66 h (red66hour) and red light for 66 h plus far-red for 8 h (red66hour/far-red8hour). For each treatment, 40 seeds were evenly placed on wet filter papers (2 layers) in a Petri dish (diameter, 9 cm), and at least 3 replicates were performed for each treatment.

Germination recording and data analysis Cotyledon expansion was used as a criterion for seed germination. No new germination within 3 days was recorded as the end of seed germination. Germination percentage was calculated as the percentage of germinated seeds to the total number of seeds tested. Furthermore, germination differences between light and dark conditions under variable treatments of temperature, PEG, SA, and KNO3 were analyzed using analysis of variance (ANOVA). The effects of light color, light quantity and red/far-red light on germination were tested using ANOVA, followed by multiple comparisons with the Duncanâ&#x20AC;&#x2122;s test. All statistical analyses were performed using SPSS15.0.

RESULTS Effects of traditional dormancy-breaking methods and light on seed germination Germination of both plants that underwent LT and the control plants was significantly higher under light conditions than under dark conditions (Tables 1 and 2). However, the LT treatment did not diminish the difference between light and dark (46.3%) compared with the control (34%) (Tables 1 and 2). In all 3 concentrations of KNO3, germination percentages under light conditions were significantly higher than those under dark conditions (p < 0.05). Similarly, germination in the control (distilled water) showed the same result (Tables 1 and 2), and statistical analysis showed no significant influence of the KNO3 treatment on seed germination under both dark and light conditions (Table 2). The various PEG pre-treatments did not affect seed germination under both light and dark conditions (Tables 1 and 2). Statistical analysis showed significant differences between light and dark treatments in all PEG treatments (p < 0.05); however, the PEG concentrations did not significantly influence seed germination (p > 0.05). Similar to the KNO3 treatments, germination in all SA treatments under light conditions was significantly higher than that under dark conditions (Table 1). However, the SA treatment did not have any significant influence on seed germination, both in dark and light conditions (p > 0.05) (Table 2). Effect of light quantity on seed germination Light intensity was shown to strongly affect seed germination (Figure 1). Compared to no light, very low light (30 lux, <0.5% light transmittance) increased seed

7857

germination 1.5 times, from 22.3 to 35.7%, and 25% light transmittance (2910 lux) tripled the germination rate (66.7%) (p < 0.05). With further increases in light intensity from 50 to 100%, little increase in germination was observed (Figure 1). Regression analysis showed that germination percentage increased exponentially with light transmittance (r2 = 0.960, p < 0.05) and light intensity (r2 = 0.958, p < 0.05) (Figure 1).

Effects of light wavelength/color on seed germination Radiation under different glass papers was markedly different (Table 3). In comparison with the white control, red glass paper transmitted most of the red light from 621 to 750 nm (>97%). Orange glass paper transmitted a slightly lower percentage of red lights but a 2-fold higher percentage of orange light than red glass paper from 591 to 620 nm (73%). High transmittance for blue glass paper was observed for blue (77%) and violet (60%) light from 380 to 490 nm. The transmitting wavelength for violet glass paper was similar to that of blue glass paper, but much lower than the percentage transmitted (ca. 44% for blue light and 59% for violet light). Green glass paper transmitted the least light, and peak transmittance (41%) was observed from 491 to 570 nm in green light. Yellow glass paper transmitted almost all the light in the range of yellow, orange, red, and green from 491 to 750 nm (Table 3). No significant differences were observed among the glass papers in the far-red (750 to 1100 nm) and ultraviolet (200 to 379 nm) wavelengths (Table 3). Light wavelength markedly affected the seed germination of Crofton weed (Figure 2). Coverage by violet, blue and green glass papers induced similar seed germination, ranging from 59 to 64% (p > 0.05). These germination rates were significantly lower than those under yellow, orange and red glass papers (p < 0.05), which ranged from 80 to 83%. White light incidence produced interme-diate seed germination (72%), which did not significantly differ from either of the above-mentioned groups (p > 0.05). Regression analysis showed that germination was significantly correlated with red (621 to 750 nm) light intensity (p < 0.01) and orange (591 to 621 nm) light intensity (p < 0.05), while all other light intensities were not correlated with germination (Table 3). The most robust correlation (r2 = 0.91) was observed between red/far-red ratio and germination (Figure 2).

Effects of red and far-red light on seed germination Exposure to red light in excess of 36 h induced seed germination, while far-red light inhibited germination (Figure 3). Very short exposures of light did not induce seed germination, example, 9 h of red light exposure (Figure 3). With an increase in red light exposure from 36 to 66 h, germination increased from 27 to 41%, while a

7858

Afr. J. Biotechnol.

Table 1. Different traditional dormancy treatments and their influence on the light-dependent germination of Ageratina adenophora.

Treatment Temperature treatment

Light or dark

Germination (%)

Standard deviation

Light Dark

5°C

73.8 a 27.5

8.1 7.5

Light Dark

Room Temperature

62.3 a 28.3

1.2 8

Light Dark

74.6b a 19.2

4.0 2.9

Light Dark

75.4b a 20.8

2.6 1.4

Light Dark

77.9 22.5a

1.9 10.9

Light Dark

81.7b 19.2a

1.4 2.9

.0%/0 MPa

Light Dark

68.8a 28.3b

3.8 1.4

5%/-0.05 MPa

Light Dark

74.2a 30.0b

2.6 4.3

10%/-0.15 MPa

Light Dark

75.8a 30.8b

6.3 8.0

15%/-0.30MPa

Light Dark

69.6a 28..3b

7.5 2.0

0.00

Light Dark

72.5b a 15.0

7.0 2.5

0.01

Light Dark

75.4 a 20.8

5.6 10.4

0.05

Light Dark

70.8b a 15.8

5.6 3.8

0.1

Light Dark

72.5b 18.3a

5.7 12.8

-1

KNO3 treatment (mmol L )

PEG treatment (%) / Osmotic pressure (MPa)

SA treatment(mmol/L)

In the same treatment, different letter indicates significant differences, while the same letter indicates no significant dif ferences between light and dark.

far-red light exposure of 4 to 8 h following red light exposure terminated germination; no significant difference was observed in the dark control (p > 0.05) (Figure 3). The observed increase in germination was linearly correlated with red-light exposure time (y =

0.3621x - 1.6225, r² = 0.9759). The observed decrease in germination after exposure to far-red light was linearly correlated with far-red light exposure time (y = 3.0432x 1.3623, r² = 0.9161). By using the slope gradient as rate of germination changes owing to red or far-red light

Wang et al.

7859

Table 2. Analysis of variance of the impact of traditional treatments and light treatment on seed germination in Ageratina adenophora.

Source Temperature and light treatment Temperature Light Temperature * light

Significance

1 1 1

0.109 30.584 2.460

0.750 0.001 0.155

KNO3 and light treatment KNO3 light KNO3*light

3 1 3

0.839 937.959 0.990

0.492 0.000 0.423

Polyethylene glycol (PEG) and light treatment PEG Light PEG*Light

3 1 3

0.267 111.161 0.259

0.848 0.000 0.854

Salicylic acid (SA) and Light treatment SA treatment Light SA * Light

3 1 3

0.517 334.871 0.061

0.676 0.000 0.979

Figure 1. Relationship between seed germination and incident light intensity in Ageratina adenophora. Different letters indicate significant differences between different light intensity (p<0.05), while the same letter indicates no significant differences was found (p>0.05). The vertical bars showed the standard deviation of the raw data.

incidence, we observed that far-red light induced a decrease in the germination rate by 3.432%路h-1, which is almost 10-fold higher than the increased germination rate -1 observed under red light (0.3621%路h ).

DISCUSSION Owing to the destructive nature of Crofton weed on the local ecosystem in China and other parts of the world,

7860

Afr. J. Biotechnol.

Table 3. Differences in light intensity at variable wavelengths under different glass papers and their correlations with the germinati on rate in A. adenophora.

Intensity at nm range (μWatt cm -2 s-1 nm -1) Ultraviolet 200 - 379 nm Violet 380 - 450 nm Blue 451 - 490 nm Green 491 - 470 nm Yellow 571 - 590 nm Orange 591 - 620 nm Red 621 - 750 nm Far-red 750 - 1100 nm

Color of glass paper Violet 0.98(0.24)ab 16.8(4.4)bc 22.9(6.4)b 5.7(1.65)ab a 0.19(0.06) 0.16(0.05)a a 11.88(4.11) 18.52(6.79)a

Blue 2.45(0.78)ab 23.2(6.25)c 29.5(6.47)bc 19.5(7.12)c ab 10.11(5.13) a 8.37(4.37) ab 19.81(7.86) 15.05(5.03)a

Green 0.18(0.05)a 0.26(0.08)a 1.63(0.45)a 16.1(4.4)bc ab 5.85(1.69) 2.87(0.84)a a 8.32(2.49) 19.71(6.01)a

Yellow 1.05(0.26)ab 1.82(0.46)ab 6.82(1.74)a 32.06(6.12)d c 32.85(5.98) 40.68(8.68)c b 47.09(11.43) a 21.92(6.17)

Orange 1.35(0.43)ab 6.25(2.46)ab 0.97(0.40)a 1.75(0.80)a b 16.63(7.39) bc 27.46(9.09) ab 37.49(9.51) 16.11(5.00) a

Red 0.65(0.15)ab 1.23(0.30)ab 0.22(0.06)a 0.19(0.05)a a 1.47(0.43) 14.02(4.03)ab b 43.64(11.60) a 21.03(6.54)

White 5.19(1.32)c 38.3 (10.3)d 38.5(5.99)c 33.85(4.16)d c 32.88(4.28) 37.79(7.15)c b 44.85(12.69) a 23.73(8.91)

Regression with germination rate (y,%) Equations R2 p-level y=0.1638x + 71.612 0.0007 >0.05 y=-0.1877x+74.244 0.0699 >0.05 y=-0.2427x+75.374 0.141 >0.05 y=-0.0098x+72.041 0.0002 >0.05 y=0.3623x+66.715 0.2432 >0.05 y=0.4684x+63.099 0.5835 <0.05 y=0.556x+54.964 0.8268 <0.01 y=0.799x+56.359 0.0603 >0.05

In the same column, different letter indicates significant differences were observed in different wavelength ( p<0.05), while the same letter indicates no significant differences were observed (p>0.05).Data in the parenthesis are the standard deviation of the data.

the dark to 90% in full light, while Li and Feng (2009) found that germination traits may differ at different elevations. Niu et al. (2011) found that disturbance, such as footprints of cows and horses, together with 6% sunlight could greatly influence germination and seedling survival. In a comparison of 10 species, laboratory tests demonstrated that light can significantly increase the germination of invasive species (4 invasive species, including Crofton weed), in comparison with that of non-invasive species (6 species) (Xu et al., 2011). Thus, germination of Crofton weed requires light incidence in addition to other environmental factors, such as temperature and moisture (Liu et al., 1985). These previous studies have advanced our understanding of this invasive weed and are the basis of this study. Nevertheless, previous studies have not fully answered the questions regarding the amount and type of light necessary for breaking seed dormancy. Our findings in this investigation could answer these questions. The germination of Crofton weed is light-sensitive, and all traditional dormancy-breaking methods tested (low

temperature, SA treatment, PEG treatment, and KNO3 treatment) cannot replace light (Tables 1 and 2). Exponential increase in seed germination with light transmittance (~100%) and intensity (~160 μmol·m-2·y-1) were observed (r2 > 0.95) (Figure 1). Red light and red/far-red ratio were responsible for differences in germination under different glass papers (Figure 2). Further experiments on red and far-red light demonstrated that red light could break the dormancy of Crofton weed seeds, while far-red light could terminate the germination process (Figure 3). Thus, the lightsensitive germination of Crofton weed is a typical phytochrome-related germination (Wu et al., 2004), and the reactive lights are red light and farred light. All phytochromes have 2 mutually photoconvertible forms: Pfr (considered the active form), with maximum absorption at 730 nm and Pr, with maximum absorption at 660 nm. Seed germination requires Pfr function during a certain lapse (called the escape time). When Pfr is stable enough to remain longer than the escape time, just 1 light pulse is sufficient for germination, whereas if Pfr is reduced to ineffective levels

before the end of the escape time, more than 1 pulse or a longer exposure to light is necessary for germination (Yang et al., 2003). In the case of Crofton weed, a 66-h exposure to red light can double seed germination from 20 to 40% (Figure 3), while relatively short exposures to far-red light (4 to 8 h) can reverse Pfr back to Pr and maintain seed dormancy (Figure 3). The significance of this light-sensitive germination may be related to the seed bank in soil and the invasiveness of Crofton weed in disturbed soils. There is a large seed bank in soil (2,202 seeds·m-2), which serves as a source of regeneration for new plants in the event of disturbance (Shen and Liu, 2004). Seeds at the soil surface can remain viable for up to 5 months, while 40% of the seeds at depths of 5 and 10 cm are viable after 2 years and 20% of the seeds could still germinate after 3 years (Shen et al., 2011). Thus, a potential advantage of these photoblastic seeds is that they will not germinate when deeply buried in the soil (Lu et al., 2006) and can germinate following surface-soil disturbance, surviving much better than the seedlings from new seeds (Shen

Wang et al.

7861

(a)

(b)

Figure 2. (a) Seed germination under different glass papers (upper) and (b) its correlation with the ratio between red and far-red light intensity (down) in Ageratina adenophora. In the upper figure, different letters indicate significant differences between different light (p<0.05), while the same letter indicates no significant differences was found (p>0.05). The vertical bars show the standard deviation of the raw data.

et al., 2011). High-intensity environmental disturbances (road and building con-struction, agricultural reclamation, and forest harvest) are still common in Southwest China

(invasive area of this weed) because of high economic growth and high population density. Light-sensitive germination could be partially responsible for the

7862

Afr. J. Biotechnol.

Figure 3. The influence of red light and far-red light exposure on the seed germination of Ageratina adenophora. Different letters indicate significant differences between different light (p<0.05), while the same letter indicates no significant differences was found (p>0.05). The vertical bars showed the standard deviation of the raw data.

rampant spread of Crofton weeds in these disturbed environments. Thus, a decrease in the disturbance of surface soil may be a method for controlling this weed. As a common attribute of many seeds, other types of dormancy (physiological dormancy, thermodormancy and morphological dormancy, etc.) may be combined with photodormancy, and combined experiments of traditional dormancy-breaking methods and light may be used to discriminate different types of dormancy (Benech-Arnold et al., 2000). For example, fluctuating temperature treatments can stimulate or terminate light requirements, but this differs among species (Yang et al., 2003; Chen et al., 2008). PEG treatments can strengthen the effect of gibberellins (GA) on seed germination (Brocklehurst et al., 1982), and the effect of GA is generally accompanied by physiological dormancy and photodormancy (Yamaguchi and Kamiya, 2002). Nitrate may function somewhere in the membrane to break morphological dormancy (Benech-Arnold et al., 2000), and interactions between nitrate (KNO3) and light have been detected in some species, such as Sisymbrium officinale (Hilhorst and Karssen, 1988) and Arabidopsis thaliana (Derkx and Karssen, 1994). SA pre-soaking treatment (0.01 mmol路L1 ) can stimulate seed germination in Iva xanthifolia in the dark, similar to that under light (Xu et al., 2011). In this study, no traditional methods (LT, SA, KNO3, and PEG) interacted with the light-sensitive germination of this weed (Tables 1 and 2). Our findings suggest that the seed dormancy of Crofton weed requires light for its germination, and no other types of dormancy exist. By strict definition, seed dormancy is a condition of plant

seeds that prevents germination under ideal conditions of temperature, moisture, and light. Thus, the lack of light (buried too deep for successful germination and growth) may just not be an ideal condition for Crofton weed. Usually, dormancy causes seeds to germinate at staggered rates, even when under naturally ideal conditions, to help ensure survival. For example, A. adenophora seeds will all germinate simultaneously when the germination conditions of light, temperature and moisture are met. In conclusion, seeds of Crofton weed are dependent on light for germination. Very low light intensity (30 lux, <0.5% transmittance) resulted in germination rates that were 1.5 times higher than that in seeds exposed to darkness alone. Red light can break dormancy and induce germination, while far-red light was shown to terminate germination. This light-sensitive feature of seed germination may facilitate the fast germination of this weed from soil seed banks in disturbed soils of infrastructure construction, land reclamation and over-grazing pastures in China, and may finally favor its colonization in newly invaded habitats. ACKNOWLEDGEMENTS This study was financially supported by the national Natural Science Foundation of China (31100457, 31170575), and Basic Research Fund for National Universities from Ministry of Education of China (DL12DA03).

Wang et al.

REFERENCES Benech-Arnold RL, Saanchez RA, Forcella F, Kruk BC, Ghersa CM (2000). Environmental control of dormancy in weed seed banks in soil. Field Crops Res. 67: 105-122. Brocklehurst PA, Rankin WEF, Thomas TH (1982). Stimulation of celery seed germination and seedling growth with combined ethephon, gibberellin and polyethylene glycol seed treatments. Plant Growth Regul. 1: 195-202. Buccellato L, Byrne MJ, Witkowski ETF (2012). Interactions between a stem gall fly and a leaf-spot pathogen in the biological control of Ageratina adenophora. Biological control, DOI: 10.1016/j.biocontrol. 2012.02.004 Chen H, Zhang S, Cao M (2008). Effects of light and temperature on seed germination of Ficus hispida in Xishuangbanna, southwest China. Acta Pytoecol. Sin. 32: 1084-1090. Cronk Q, Fuller J (1995). Plant invaders: the threat to natural ecosystems. Chapman & Hall. New York. Derkx MPM, Karssen CM (1994). Are seasonal dormancy patterns in A. thaliana regulated by changes in seed sensitivity to light, nitrate and gibberellin? Ann. Bot. 73: 129-136 Dong SK, Li JP, Li XY, Liu SL, Zhao QH (2011). Impacts of geophysical factors and human disturbance on composition and diversity of roadside vegetation: A case study from Xishuangbanna National Nature Reserve of Southwest China. Afr. J. Biotechnol. 10(72): 16228-16235. Hilhorst HWM, Karssen CM (1988). Dual effect of light on the gibberellin- and nitrate-stimulated seed germination of Sisymbrium officinale and A. thaliana. Plant Physiol. 86: 591-597. Li YP, Feng YL (2009). Differences in seed morphometric and germination traits of Crofton weed (Eupatorium adenophorum) from different elevations. Weed Sci. 57(1): 26-30. Liu LH, Xie SC, Zhang JH(1985). Studies on the distribution, harmfulness and control of Eupatorium adenophorum. Acta Ecologica Sinica, 5(1): 1-6. Lu P, Sang WG, Ma KP (2006). Effects of environmental factors on germination and emergence of Crofton weed (Eupatorium adenophorum).Weed Sci. 54(3): 452-457. Niu YF, Feng YL, Xie JL, Luo FC (2011). Effects of disturbance intensity on seed germination, seedling establishment and growth of Ageratina adenophor. Guihaia, 31(6): 795-800. Olckers T (2004).Targeting emerging weeds for biological control in South Africa: the benefits of halting the spread of alien plants at an early stage of their invasion. South Afr. J. Sci. 100: 66-68.

7863

Raj Mohan D, Ramaswamy M (2007). Evaluation of larvicidal activity of the leaf extract of a weed plant, Ageratina adenophora, against two important species of mosquitoes, Aedes aegypti and Culex quinquefasciatus. Afr. J. Biotechnol. 6(5): 631-638. Sang WG, Zhu L, Axmacher JC (2010). Invasion pattern of Eupatorium adenophorum in southern China. Biol. Invasions, 12: 1721-1730. Shen YX, Liu WY (2004). Persistent soil seed bank of Eupatorium adenophorum. Acta Phytoecol. Sin. 28(6): 768-772. Shen YX, Zhao CY, Liu WY (2011). Seed vigor and plant competitiveness resulting from seeds of Eupatorium adenophorum in a persistent soil seed bank. Flora, 206: 935-942. Wang HJ, He P, Ma JL (1994). An investigation and research report on the dissemination of Ageratina adenophora on rangeland areas in Liangshan District of Sichuan Province. Grassland China, 1: 62â&#x20AC;&#x201C;64 Wang ML, Feng YL (2005). Effects of soil nitrogen levels on morphology, biomass allocation and photosynthesis in Ageratina adenophora and Chromoleana odorata. Chin. J. Plant Ecol. 29(5): 697-705. Wang WQ,Wang JJ, Zhao Z (2006). Seed population dynamics and germination characteristics of Eupatorium adenophorum. Chinese J. Appl. Ecol. 17(6): 982-986 Wu WH (2002). Plant Physiology. Science Press of China, Beijing. P3: 48-349. Xu HN, Wang WJ, Yu XY, He HS, Guan Y, Zu YG (2010).The differences in light-demanding germination features of seeds between invasive and noninvasive alien plants within Compositae. Acta Ecol. Sin. 30(13): 3433-3440. Yamaguchi S, Kamiya Y (2002). Gibberellins and light-stimulated seed germination. J. Plant Growth Regul. 20: 369-376. Yang FJ, Zhang ZH, Wang WJ, Zu YG, Chen HF, Jia J, Guan Y, Zhang NJ (2005). Anatomical and physiological differences of eight exotic species from Asteraceae. Acta Ecol. Sin. 29(5): 697-705. Yang QH, Song SQ, Ye WH, Yin SH (2003). Mechanism of seed photosensitivity and factors influencing seed photosensitivity. Chin. Bull. Bot. 20(2): 238-247 Yu XJ, Yu D, Ma KP (2004). Relationships between allelopathy and invasiveness by Eupatorium adenophorum at different sites. Chin. J. Plant Ecol. 28(6): 773-780.

Full Length Research Paper

Cloning and expression analysis of glutathione reductase gene from cucumber (Cucumis sativus L.) treated by exogenous nitric oxide under low temperature stress Xingwang Liu, Xiaolan Zhang, Yan Zhang, Lei Wang, Yangdong Guo and Huazhong Ren* College of Agriculture and Biotechnology, China Agricultural University, Yuanmingyuan West Road No 2, HaiDian District, Beijing, 100193, P.R. China. Accepted 28 October, 2011

Nitric oxide (NO) is a bioactive and multifunctional gaseous molecule signal that plays a crucial role in stress responses and mediates a variety of physiological processes in plant. Previous studies indicate that NO can reduce stress damage via regulating the activities of antioxidant enzymes including glutathione reductase (GR). In order to analyze the potential effect of cucumber GR activity on NO application prior to cold treatment, full length of GR sequence was obtained by rapid amplification of cDNA ends (RACE), and its expression was characterized by northern blot. The GR gene in cucumber is 1995 bp (accession number: GU248528) in length, including one open reading frame encoding 496 amino acids. The GR sequence in cucumber shares a high similarity with those from other plant species at the polypeptide level. Northern blot analysis indicates that the GR expression is up-regulated under NO treatments before chilling stress in cucumber leaves. Key words: Cucumber, gene expression, glutathione reductase, low temperature stress, nitric oxide. INTRODUCTION Low temperature stress, such as chilling (<20°C) or freezing (<0°C) temperature, is one of the most important abiotic stresses that adversely affects plant growth and development, and significantly constrains the crop yield as well as the spatial distribution of plant productivity (levitt, 1980; Chinnusamy et al., 2007; Hua et al., 2008; Xia and Zhao, 2009). In the past decades, due to the increasing demand of plant cold tolerance, the mechanism of low temperature response in higher plants has gained extensive attention, especially in temperate plants; as such, many adaptive mechanisms have been identified to accommodate the continuous low temperature environment (Sakamoto and Murata, 2002).

*Corresponding author. E-mail: renhuazhong@cau.edu.cn. Tel: +86 10 62732825. Abbreviations: GSH, glutathione; GSSG, oxidized glutathione; NO, nitric oxide; RACE, rapid amplification of cDNA ends.

Plant cold acclimation involves the remodeling of cell and tissue structures, reprogramming of cell metabolism as well as regulating of gene expressions (Chinnusamy et al., 2002; Wu et al., 2009). Moreover, plants have developed a complex antioxidant system to scavenge the reactive oxygen species (ROS) that have been produced during abiotic and biotic stresses, and can cause significant damage to DNA, protein, chlorophyll and membrane functions without immediate removal (Tsai and Yang, 2005). Glutathione reductase (GR; EC.1.6.4.2) is one of the most important components in the plant antioxidant system (Loprasert and Whangsuk, 2005). GR belongs to the flavoprotein oxidoreductase family that was widely identified both in eukaryotes and prokaryotes. This antioxidant catalyzes the oxidized glutathione (GSSG) into glutathione (GSH) using NADPH. The GSH pool maintained by GR is necessary for proper functioning of the active proteins, and the millimolar concentrations of GSH act as a key redox buffer that maintains the

Liu et al.

7865

Table 1. Primer sequences used in this study.

Primer name 5LP 5SP 3P P1 P2 P3 P4 P5 P6

Sequence 5’-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG-3’; 5’-AAGCAGTGGTATCAACGCAGAGT-3’; 5’-ATTCTAGAGGCCGAGGCGGCCGACATGTTTTTTTTTTTT-3’; 5’-AAAATGTATGAAGGAGAGGGAAAGA-3’; 5’-GGAGTTTCCTAAGCGTGTTGTGGTG-3’; 5’-TAAAAACAGAGAACGGAATAAAAGT-3’; 5’-AGATGCTGTGTTGTTTGCGACTGGT-3’; 5’-TTATTCCGTTCTCTGTTTTTATCAA-3’; 5’-ATACTCATTAACCTTCACAGCACCA-3’

delicate balance between protein Cys groups and ROS (Gustavo et al., 2007). GR is a member of the subgroup of flavoprotein enzymes comprising the disulfide oxidoreductases that contain two active-site electron acceptors: a redox-active disulfide and the flavin adenine dinucleotide (FAD). The GR-mediated redox cycles are so important in maintaining the anti-oxidative capacity of cells and GR has been considered to be a crucial enzyme for plant oxidative responses (Loprasert and Whangsuk, 2005). In particular, it has been universally advocated by numerous existing reports based on high activities of GR in stress-tolerant plants and intransgenic plants with over expression of GR (Aono et al., 1993). Besides, Aono et al. (1999), Ding et al. (2009) and Martret et al. (2011) documented that the suppression of chloroplast GR activity enhanced the sensitivity to paraquat, methyl viologen (MV), cadmium and UV-B stress, respectively, in transgenic tobacco. NO is a bioactive and multifunctional gaseous signal involved in various biological processes during plant growth and development, including germination, flowering, fruit ripening, programmed cell death, stress responses to pathogen attack, herbicide, salt, drought, temperature and heavy metal (Bethke et al., 2006; Arasimowicz and Wieczorek, 2007; Singh et al., 2008; Zheng et al., 2009). Recent studies revealed that NO plays an important role in cold acclimation in Arabidopsis (Zhao et al., 2009). Moreover, strong evidence showed that NO is a potent antioxidant in plants and its action may, at least in part, be explained by its ability to directly scavenge ROS (Beligni and Lamattina, 2002). NO has also been identified to greatly induce the antioxidative enzymes and protect sunflower leaves against Cd-induced oxidative damages (Laspina et al., 2005). In addition, NO can function as a signaling molecule that regulates a cascade of gene expression (Leshem, 1996). The dual functions of NO, either as a potent oxidant or as an effective antioxidant, depend on the NO concentration in plant and the specific environmental conditions (Beligni and Lamattina, 1999). Recent evidences in cucumber reveal that exogenous NO treatment can reduce the oxidation damage by

enhancing the activities of H2O2-scavenging enzymes and by promoting GR activities under salt stress (Shi et al., 2007). However, little is known about the influences of exogenous NO treatment on the GR activities under cold stress in cucumber, and the cucumber GR gene cloned. To this end, we cloned the full-length of GR gene in cucumber and analyzed its expression upon exogenous NO treatment prior to low temperature exposure. MATERIALS AND METHODS Plant materials and treatments Seeds of Cucumber ZND407 were obtained from the Department of Vegetable Science, China Agricultural University. ZND407 is a cold tolerant cultivar. Healthy seeds with similar size were selected for all the experiments. Seeds were first surface sterilized and allowed to germinate on filter papers under the dark at 27°C for 24 h. Germinated seeds were transferred to plots with saw dust and vermiculite (2:1) and grown in a growth chamber with a photoperiod of 14 h (light intensity of 520 μmol m-2 s-1) at 28°C and 70% humidity Healthy and vigorous seedlings at their leaf stage were used for treatments. Sodium nitorprusside (SNP; Sigma, USA) were used as NO donor. Different doses of SNP (0, 0.5, 1.0, 2.0 mM) were sprayed to cucumber seedling leaves before exposing them to 3days cold treatment at 4 (±0.5)°C under continuous light (520 μmolm-2 s-1). Every treatment has at least three replicates with ten seedlings each. After treatment, the leaves were collected into liquid N 2 and stored at -80°C until further use.

RNA isolation and cloning of GR cDNA Fresh leaves (0.2 g) were ground in liquid nitrogen. Total RNA was extracted and served as the template for first-strand cDNA synthesis using the Takara RNA polymerase chain reaction (PCR) kit (AMV was replaced by superscript II, TaKaRa/Invitrogen, Japan). The resulted cDNA was used for GR rapid amplification of cDNA ends (RACE) using primers designed from Cucumis sativus GR partial CDS sequence (accession number EF530128.1) (Table 1). The PCR program was set as: 95°C for 5 min, followed by 30 cycles of 45 s denaturation at 95°C, 1 min annealing at 56.7°C and 2 min extension at 72°C; then followed by 72°C for 5 min. PCR products were gel purified and cloned into pEGM-T (Tiangen) plasmid vector and sequenced.

7866

Afr. J. Biotechnol.

ml crude enzyme extract. After 5 min, the absorbance at 340 nm was measured and the amount of GR unit was calculated based on the NADPH oxidation; after which the results are given in U g-1FW -1.

Sequence analysis DNA sequence data were analyzed using the National Centre of Biotechnology (NCBI) website (http://www.ncbi.nlm.nih.gov). The DNAMAN software was used for phylogenetic analysis of GR genes from cucumber and from other plant species. The nucleotide sequences reported in this paper have been submitted to NCBI and the accession number is GU248528.

Figure 1. 5’RACE of the GR gene. M: mark; from top to bottom: 2000, 1000, 750, 500, 250, 100 bp; lanes 1 and 2 indicate the same sample.

RESULTS Molecular cloning of GR cDNA and comparative sequence analysis Two GR cDNA fragments of approximately 800 and 1100 bp were amplified by real time (RT)-PCR using 5’RACE and 3’RACE (Figures 1 and 2). The polyadenylation signal AATAAA at 270 bp downstream of the translational stop point (Figure 3) suggests that the 3’RACE product is the 3’ terminal of the GR gene. The full-length of GR cDNA sequence is 1995 bp, with one open reading frame (ORF) encoding 496 amino acids and a predicted molecular mass of 54 KD. The putative GR protein is rich in hydrophobic amino acids such as L-argnine, Ltryptophane, L-isoleucine and L-leucine, implying its hydrophobic character. The isoelectric point of GR protein is estimated to be 6.00, which is relatively acidic. The predicted protein evolutional analysis

Figure 2. 3’RACE of the GR gene. M: mark, from top to bottom: 2000, 1000, 750, 500, 250, 100 bp; lanes 1 to 4 indicate the1200 bp.

Northern bolt Denatured total RNA (9 µg) samples were separated on 1.2% (w/v) agarose-formaldehyde gels, and were then transferred into a Hydond-N membrane (Amersham) and cross-linked at 80°C for 2 h. To measure the loading variation, membranes were stained with 0.03% methylene blue in 0.3 M sodium acetate (pH 5.2). The stained rRNA bands were used as an internal control for each sample (Gosalbes et al., 2004). Probe synthesis and hybridization were performed according to the manufacturer’s manual from the Mylab Company (China).

Assay of GR activities The GR activities were determined by the oxidation of NADPH at 340 nm according to classic method (Foyer and Halliwell, 1976). The 2 ml reaction mixture was composed of 25 mM HEPES buffer (pH 7.0), 0.5 mM GSSG, 0.12 mM NADPH, 0.1 mM EDTA and 0.2

Different GR protein sequences of representative plant species gained from Genebank, together with the predicted cucumber GR protein sequence in this study were sent to evolutional analysis using DNAMAN software (Table 2). Table 1 and Figure 4 show the cucumber GR protein sequence alignment with those of other plant species. Cucumber GR showed the highest similarity to that of Vitisvinifera (81%), and the similarity to Arabidopsis thaliana GR was 74%. The phylogenetic tree generated from this analysis (Figure 5) placed the cucumber GR sequence in a cluster with other plant GR genes that are distinct from those of Zinniaviloacea.

GR gene expression with NO treatment under low temperature Northern hybridization analysis was carried out to examine the GR expression at different time points upon 1.0 mM NO treatment (Figure 6a). GR expression showed a dynamic change over the 72 h period. The transcripts initially increased, and then reached its maximum level at 48 h point, after which it then decreased at

Liu et al.

Figure 3. GR cDNA sequence and its deduced amino acid sequence. The polyadenylation signal AATAAA is boxed.

7867

7868

Afr. J. Biotechnol.

Figure 3. Contd.

Table 2. Comparison of Cucumis staivus GR amino sequences with those from other plant species.

Source Spinaciaole leracea Vignaunguiculata Pisum sativum Vitisvinifera Populustrichocarpa Ricinuscommunis Arabidopsis thaliana Brassicarapasubsp .pekinensis

Amino similarity (%) 78 7 77 81 81 80 74 74

Accession number Q43154 ABB89042 Q43621 XP-002285672 XP-002299276 XP-002518118 AAK25938 004955

Liu et al.

7869

Figure 4. The sequences of cucumber GR protein and those of other plant species aligned using DNAMAN software. Black boxes indicate fully conserved residues in all sequences, whereas pink boxes represent partial conserved residues.

7870

Afr. J. Biotechnol.

Figure 4. Contd.

Liu et al.

7871

Figure 5. Phylogenetic tree based on the amino acid sequences of GRs from different plant species. The length of the horizontal line is proportional to the estimated evolutionary distance. Values in the branches indicate bootstrap percentage.

72 h treatment. Meanwhile, GR expressions under different concentrations of NO applications were investigated by Northern blot analysis as well. As shown in Figure 6b, the GR gene responds differently to different concentrations of NO treatments. The GR transcript level increased remarkably at 1.0 mM NO and then decreased at 2.0 mM NO, suggesting that there was a correlation between the expression of GR gene and the concentrations of NO treatments. GR activities in cucumber leaves treated with NO prior to cold exposure GR activities were measured at 48 h upon SNP addition. The activities of GR increased significantly than those without SNP treatments (Figure 7). Specifically, the GR activities increased progressively with more concentrated SNP treatments, for example, the GR activities were 37.5% more in the 0.5 mM SNP addition, while it was 68.7% more in the 1 mM SNP treatment. However, the activities of GR started to reduce upon 2.0 mM SNP treatment, but were still higher than those without SNP treatment. DISCUSSION This is the first report on the cloning of GR gene in cucumber (Cucumis staivus L.) and the analyses of its expression were under NO treatments and low tempe-

rature stress. GR has been purified and characterized from a variety of plants, and it has been reported that GR isozymes are located in various subcellular compartments such as chloroplast, cytosol, mitochondrion and peroxisome. So far, the GR genes from many plant species have been cloned and they can be divided into two groups: (1) encoding chloroplastic/ mitochondrial GRs and (2) cytosolic GRs (Lee et al., 2002). Amino acid sequence alignment of GRs suggested that GR is highly conserved in common agricultural crops, such as the similarity of GR in cucumber with that of cowpea (77%), spinach (78%), pea (78%), poplar (81%), castorbean (80%), grape (81%), thalecress (74%), Chinese cabbage (74%) and zinnia (74%) (Table 1), and all these sequences were from cytosol, so we speculate that cucumber GR is a cytosolic gene as well. Recently, it was documented that changes in the GR isoform population may account for the higher enzyme activity upon different oxidative stresses (Wingsle and Karpinski, 1996). In our work, northern hybridization analysis showed that the GR expression increased to its maximum level with 1 mM NO treatment and cold stress (Figure 7), implying that NO may regulate the GR gene expression directly. Therefore, the various physiological and developmental effects of NO application in plants may result from the control of a cascade of gene expressions by NO (Kopyra and Gwozdz, 2004). GR plays a key role in the oxidative stress responses by maintaining the intracellular glutathione pool primarily in the reduced state (Stevens et al., 1997). In our studies, GR activities increased in leaves with exogenous SNP

7872

Afr. J. Biotechnol.

Figure 6a. Northern blot analysis of GR gene expression in Cucumber leaves with 1 mM NO treatments for different time periods prior to 4째C stress.

Figure 6b. Northern blot analysis of GR gene transcripts in cucumber leaves treated with different concentrations of NO for 12 h before chilling stress (4째C).

application, with the highest level at 1.0 mM SNP treatment (Figure 7), suggesting that GR may be activated to regulate the oxidant-reduction status of GSH

upon low temperature stress. This result is similar to that of Shi et al. (2007) who reported that exogenous NO can enhance cucumber GR activities in response to salt

Liu et al.

7873

3.5 407

GR activities (U.g -1 .FW -1)

3.0

2.5

2.0

1.5

1.0

0.0 0.0

1.0

1.5

2.0

2.5

Concentration of NO (mM) Figure 7. Activities of GR antioxidant enzyme in Cucumber leaves upon different concentrations of NO treatments prior to chilling stress.

stress. Different isoforms of GR have been shown to be involved in different stress conditions in plants (Edwards et al., 1994). However, the GR gene we cloned may respond to low temperature stress, and is positively regulated by exogenous NO application. In conclusion, the GR gene we cloned was highly conserved at the amino acid level, and we speculate that this GR is a cytosolic gene based on the similarities observed with those of other plant species. The activities of GR have been observed to increase in cucumber leaves when subjected to NO treatments prior to low temperature stress. Different concentrations of NO applications can stimulate the transcription of GR, with the highest accumulation of 1 mM NO treatment for 48 h. It is possible that the cold stress induced GR expression via a signal transduction pathway that was mediated by NO; however, the specific mechanism underlining the oxidative stresses needs further research in the future. ACKNOWLEDGEMENTS This work was supported by the National Basic Research Program of China (2009CB119000) and the National Key Research Program of China (2009BADB8B02 and 2011BAD12B03).

REFERENCES Aono M, Kubo A, Saji H, Tanak KK, Kondo N(1993). Enhanced tolerance to photooxidative stress of transgenic Nicotiana tabacum with chloroplastic glutathione reductase activity. Plant Cell Physiol. 34: 129-135. Aono M, Saji H, Fujiyama K, Sugita M, Kondo N, Tanaka K (1995). Decrease in activity of glutathione reductase enhances paraquat sensitivity in transgenic Nicotiana tabacum. Plant Physiol.107: 645648. Arasimowicz M, Wieczorek JF (2007). Nitric oxide as a bioactive signaling molecule in plant stress reponses. Plant Sci. 172: 876-887. Beligni MV, Lamattina L (1999). Nitric oxide counteracts cytotoxic processes mediated by reactive oxygen species in plant tissues. Planta, 208: 337-344. Beligni MV, Lamattina L (2002). Nitric oxide interferes with plant photooxidative stress by detoxifying reactive oxygen species. Plant Cell Environ. 25: 737-748. Chinnusamy V, Zhu J, Zhu JK (2002). Cold stress regulation of gene expression in plants. Trends Plant Sci. 12(10): 444-451. Ding SH, Lu QT, Zhang Y, Yang ZP, Wen XG, Zhang LX, Lu CM (2009). Enhanced sensitivity to oxidative stress in transgenic tobacco plants with decreased glutathione reductase activity leads to a decrease in ascorbate pool and ascorbate redox state. Plant Mol. Biol. 69: 577592. Edwards EA, Enard C, Creissen GP, Mullineaux PM (1994). Synthesis and properties of glutathione reductase in stressed peas. Planta, 192: 137-143. Foyer CH, Halliwell B (1976). Presence of glutathione and glutathione reductase in chloroplasts: a proposed role on ascorbic acid metabolism. Planta. 133:21-25. Gosalbes MJ, Zacarias L, Lafuente MT (2004). Characterization of the

7874

Afr. J. Biotechnol.

expression of an oxygenase involved in chilling-induced damage in citrus fruit. Postharvest Biol. Tech. 33: 219-228. Gustavo G, Yannarelli AJ, Alvarez F,Santa-Cruz DM, Tomaro ML (2007). Glutathione reductase activity and isoforms in leaves and roots of wheat plants subjected to cadmium stress. Phytochemistry, 68: 505512. Hua YJ, Yuan G, Li YM, Qi XH, Zhang MF (2008). Salicylic acid-induced enhancement of cold tolerancethrough activation of antioxidative capacity in watermelon. Sci. Hortic. 118:200-205. Kopyra M, Gwozdz EA (2004). The role of nitric oxide in plant growth regulation and responses to abiotic stresses. Acta Physio Plant. 26(4):459-472. Laspina NV, Groppa MD (2005). Nitric oxide protects sunflower leaves against Cd-induced oxidative stress. Plant Sci. 169: 323-330. Lee H, Won SH, Lee BH, Park HD, Chung W, and Jo J (2002). Genomic cloning and caharacterization of glutathione reductase gene from Brassica campestris var.Pekinensis. Mol Cells, 13(2): 245-251. Leshem YY (1996). Nitric oxide in biological systems. Plant Growth Regul. 18: 155-159. Levitt J (1980). Responses of plants to environmental stress: chilling, freezing, and high temperature stress. Academic press, New York, pp. 166-248. Loprasert S, Whangsuk W (2005). The unique glutathione reducatase from Xanthononas campestris: gene expression and enzyme characterization. Bioch. Biophl. Res. Co. 331: 1324-1330. Martret BL, Poage M, Shiel K, Nugent GD, Dix PJ (2011).Tobacco choroplast transformants expressing genes encoding dehydroascorbate reductase, glutathione reductase, and glutathioneS-transferase, exibit altered anti-oxidant metabolism and improved abiotic stress. Plant Biotechnol. J. 6: 1-13. Bethke PC, Libourel IGL, Jones RL (2006). Nitric oxide reduces seed dormancy in Arabidopsis. J .Exp. Bot. 57: 517-526. Sakamoto T, Murata N (2002). Regulation of the desaturation of fatty acids and its role in tolerance to cold and salt stress. Curr. Opin. Microbiol. 5: 206-210.

Shi Q, Ding F, Wang X, Wei M (2007). Exogenous nitric oxide protect cucumber roots against oxidative stress induced by salt stress. Plant Physiol. Bioch. 45: 542-550. Singh HP, Batish DR, Kaur G, Arora K, Kohli RK (2008). Nitric oxide (as sodium nitroprusside) supplementation ameliorates Cd toxicity in hydroponically grown wheat roots. Environ. Exp .Bot. 63: 158-167. Stevens RG, Creissen GP, Mullineaux PM (1997). Cloning and characterization of a cytosolic glutathione reductase cDNA from pea (Pisum sativum L.) and its expression in response to stress. Plant Mol. Biol. 35: 641-654. Tsai YC, Yang CW (2005). Expression of ascorbat peroxidase and glutathione reductase in roots of rice seedlings in response to NaCl and H2O2. J Plant Physiol. 162: 291-299. Wingsle G, Karpinski S (1996). Differential redox regulation by glutathione of glutathione reductase and cu/zn-superoxide dismutase gene expression in Pinus sylvestrisL.needles. Planta, 198: 151-157. Wu Y, Deng Z, Lai J, Zhang Y, Yang C, Yin B, Zhao Q, Zhang L, Li Y, Yang C, Xie Q (2009). Dual function of Arabidopsis ATAF1 in abioitc and biotic stress responses. Cell Res. pp. 1-12. Xia J, Zhao HZY (2009). Role of ytokinin and salicylic acid in plant growth at low temperatures. Plant Growth Regul. 57: 211-221. Zhao MG, Chen L, Zhang LL, Zhang WH (2009). Nitric redutasedependent nitric oxide production is involved in cold acclimation and frezzing tolerance in arabidopsis. Plant Physiol. 151: 755-67. Zheng C, Jiang D, Liu F, Dai T, Liu W, Jing Q, Cao W (2009). Exogenous nitric oxide improves seed germination in wheat against mitochondrial oxidative damage induced by high salinity. Environ. Exp. Bot. 67: 222-227.

African Journal of Biotechnology Vol. 11(31), pp. 7874-7884, 17 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3268 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Genetic map construction and quantitative trait locus (QTL) analysis on growth-related traits in common carp (Cyprinus carpio L.) Jun Wang, Anyuan He, Yuqing Ma, Chenghui Wang* Key Laboratory of Aquatic Genetic Resources and Utilization, Ministry of Agriculture, Shanghai Ocean University, Shanghai, 201306, China. Accepted 27 January, 2012

Common carp (Cyprinus carpio L.) is one of the most widely distributed freshwater species in the world with important values in aquaculture, however, its quantitative trait loci (QTLs) associated to growthrelated traits have been rarely identified. In this study, using F 2 populations derived from a cross between Purse red common carp (C. carpio var. wuyuanensis) and Xingguo red common carp (C. carpio var. singuonensis), a genetic linkage map of common carp based on amplified fragment length polymorphisms (AFLP) and microsatellite (SSR) markers was constructed, meanwhile QTL analysis were conducted for growth-related traits. A total of 347 AFLP and 22 SSR markers were assembled on the map, which comprised 50 linkage groups and covered 5608.1cM Kosambi. A total of 25 QTLs were identified for growth-related traits, including four QTLs for body weight, one QTL for total length, four QTLs for standard length, six QTLs for body height, eight QTLs for caudal peduncle length and two QTLs for caudal peduncle height, which explained 0.05 to 61.40% of phenotypic variation. Meanwhile, comparison of linkage maps between common carp and zebrafish was also conducted, providing a new insight into the genetic base of the QTL affecting the growth-related traits. This study will be useful for conducting marker-assisted selection (MAS) breeding programs in common carp. Key words: Cyprinus carpio, F2 populations, amplified fragment length polymorphisms, microsatellite, quantitative traits locus. INTRODUCTION A major challenge in current biology is to understand the genetic basis of variation for quantitative traits (Mackay et al., 2009). The quantitative traits are determined by the combined forces of genetic, environmental factors and interaction between them (Poormohammad Kiani et al., 2009). Understanding the relationship between variation in DNA sequences and variation in phenotypes for these quantitative traits will yield insights that are important for increasing the speed of selective breeding programs in agriculturally important plants and animals and for predicting adaptive evolution (Mackay et al., 2009).

*Corresponding author. E-mail: wangch@shou.edu.cn. Tel: +8621-61900439. Fax:+86-21-61900439.

Common carp (Cyprinus carpio L.) is the longest cultured and the most domesticated freshwater species in the world with approximately 4000 years of cultured history (Wohlfarth, 1993; Balon, 1995). During its long history of domestication, numerous strains and breeds of common carp have been developed from the wild ancestor and significant genetic improvements have also been achieved under selective breeding and hybridization of different strains (Wang et al., 2010; Bakos and Gorda, 1995). Alternatively, the common carp is one of the freshwater fishes with the most extensive selective breeding practices in the world. Growth-related traits (for example, body weight and body shape), which are economically important complex traits, have been widely studied in the genetic improvement researches (Gideon, 1995; Marc, 2003). Understanding the genetic basis of

Wang et al.

these complex traits is important for better conducting the genetic improvement programs. The construction of genetic map and identification of quantitative traits locus (QTL) is one efficient approach to determine candidate genes controlling quantitative traits variation, and to conduct maker-assisted selection (MAS). To date, two genetic maps for common carp have been constructed by using gynogenetic individual as the resource populations (Sun and Liang, 2004 ; Cheng et al., 2010). However, no precise QTLs associated to growth-related traits have been identified based on common carp linkage maps. Conducting genetic map construction and QTL analysis are very useful in improving the speed of genetic improvement and employing marker-assisted selection in common carp. Xingguo red common carp (C. carpio var. singuonensis) and Purse red common carp (C. carpio var. wuyuanensis) are the most well-known varieties of common carp in Chinese aquaculture industry. They have been widely used as breeding parents for cross breeding or hybridization in producing many hybrids with obvious heterosis (Li, 1996 ; Lou and Sun, 2001). Furthermore, Xingguo red common carp and Purse red common carp are the excellent materials for genetic map construction and QTL analysis as the following attributions: (1) significant morphological differences between them, Xingguo red common carp is the spindle shape, while Purse red common carp is the purse-like shape with short standard length and caudal peduncle length, and high pre-dorsal height, (2) high genetic homozygosity derived from about 20 generations of artificial selection, respectively. Amplified fragment length polymorphisms (AFLP) markers was reported to show a greater level of polymorphism and informativeness than any other markers (Liu et al., 2003), and has been widely used in linkage mapping of many fish species (Perez et al., 2004; Felip et al., 2005; Li et al., 2006; Wang et al., 2010). Microsatellite markers has been increasingly used in the construction of linkage map in the recent years for aquatic species (Chistiakov et al., 2005; Bouza et al., 2007; Sekino and Hara, 2007; Wang et al., 2007; Xia et al., 2010). In the present study, using the F2 population derived from a cross of Purse red common carp (♀) × Xingguo red common carp (♂), we constructed the genetic map and identified 25 QTLs associated with growth-related traits in common carp. The aim was to determine the loci that are responsible for variation in growth-related quantitative traits and provide insight into the genetic architecture of the traits that are interesting for breeding practices in common carp. MATERIALS AND METHODS Mapping panel Five female Purse red common carp (abbreviated as PR) and five

7875

male Xingguo red common carp (abbreviated as XG) were used as grandparents to produce intermediate F2 full-sib population. Randomly selected 43 F2 specimens at commercial harvest size were used for map construction. Six growth-related phenotype traits that were measured according to Wu (Wu, 1964) including body weight (BW), total length (TL), standard length (SL), pre-dorsal height (PDH), caudal peduncle length (CPL) and caudal peduncle height (CPH), were measured for QTLs identification.

Genotyping DNA was isolated from the partial tail fin using a standard phenol– chloroform method (Sambrook and Russell, 2001). AFLP reaction were carried out according to the protocols described by Vos (Vos et al., 1995) with small modification. 14 AFLP primers were chosen from 64 combination pairs based on EcoRI and MseI enzyme. Polymerase chain reaction (PCR) products were visualized by the CEQ 8000 genetic analysis system (Beckman Coulter, Germany) which uses the fluorescence technology and capillary electrophoresis technology to detect the PCR products. The AFLP results were transformed into “0” and “1” data type by using the software implemented in the CEQ 8000. A total of 171 microsatellite loci developed from common carp by our laboratory (unpublished data) were also screened for map construction, of which 67 microsatellite (SSR) markers were polymorphic. The PCR reaction mixture was 10 µL volume containing 1 µL genomic DNA (20 ng/µL), 5 µL buffer (0.2 µM dNTPs, 1.5 µM MgCl2, 0.5 µM Taq DNA polymerase), 1 µL primers (0.5 µM each), and 3 µL distilled water. PCR reactions were conducted as follows: initial denaturation for 5 min at 94°C, followed by 35 cycles for 30 s at 94°C, 30 s at optimal annealing temperature, and 30 s at 72°C, last followed by 10 min at 72°C. The PCR products were separated by 8% acrylamide gel and visualized by silver staining.

Data analysis and map construction The AFLP markers were named in accordance to the selective nucleotides of the EcoRI primer followed by those of the MseI primer and the product size in base pairs, and the microsatellite markers were named according to the primer names in this study. Genotype data were recorded in a TXT file and imported to the Mapmanager QTXb20 software (Manly et al., 2001). A Chi-squared test was used to evaluate the Mendelian segregation distortion of all the polymorphic loci data in the F2 population before linkage analysis. The data set was designated as “intercross” and linkage groups were assigned with P-value of 1.0E-4 by using the “Make linkage groups” command and then the linkage groups were accordingly adjusted by the “Distribute” and “Ripple” command. The consensus linkage map from AFLP and SSR markers was graphically represented using the MapChart software (Voorrips, 2002) based on the calculated map distances between markers.

QTL analysis First, the normality of the growth-related quantitative data was assessed using a one-sample Kolmogorov-Smirnov test implemented in SPSS 17.0 software (www.spss.com), no deviation from a standard normal distribution were found for the studied traits. QTL analysis was performed by means of composite interval mapping (CIM) (Zeng, 1994) implemented in Windows QTL Cartographer 2.5 software (Wang et al., 2007) using 1000 permutations with the significance as 0.05. A LOD threshold of 3.0 was used for considering a significant QTL, and the percentage of

7876

Afr. J. Biotechnol.

Table 1. Descriptive statistics of 14 pairs of AFLP primers used for genetic linkage map construction in common carp.

EcoR I E-AAC E-AAC E-AAC E-AAG E-AAG E-AAG E-AAG E-ACA E-ACA E-ACA E-ACA E-ACT E-ACT E-ACT Total

Mse I M-CAC M-CTG M-CTT M-CAA M-CAC M-CTA M-CTT M-CAG M-CAT M-CTA M-CTG M-CAC M-CTC M-CTG

Total number of segment 255 176 199 192 167 172 227 173 177 254 230 155 165 255 2797

phenotypic variance explained by each QTL was estimated using Windows QTL Cartographer 2.5.

Comparative mapping Comparative genomics can provide valuable information about the architecture and functional organization of the species genome (Du et al., 2010). A total of 24 microsatellite loci placed on the linkage map were used to conduct comparative mapping analysis with zebrafish (Danio rerio), as the flanking regions of microsatellite markers have ability to identify chromosomal regions that are homologous across species (Woram et al., 2003).The total genome of zebrafish has been sequenced and is closely related to common carp on phylogenetics. The flanking sequences of 24 common carp microsatellite loci were used as queries to blast against the zebrafish whole genome data through NCBI (http://www.ncbi. nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=7955).

RESULTS Marker genotyping A total of 64 AFLP primer combinations were screened in the F2 population, in which, 14 pairs combinations with high polymorphism and rich fragments were selected to construct a genetic map. A total of 605 clearly and informatively amplified bands were detected in the F2 population, of which 378 bands were fitted to the expected 3:1 ratio after Chi-square test (Table 1). A total of 67 SSR primer pairs were tested with parents and progeny of the tested primers, of which 24 loci were informative and did not deviate from the expected 1:2:1 ratio used for map construction (Table 2).

Polymorphic loci 30 42 61 56 42 32 62 20 43 58 37 30 36 56 605

Loci according with 3:1 ratio 19 24 34 35 33 28 45 14 21 27 31 11 16 40 378

markers, 347 AFLP markers and 22 SSR markers were linked in 50 linkage groups (LG1 to LG50), the same numbers with haploid chromosome groups of common carp. However, 31 AFLP and two SSR markers remained unlinked. The total length of the linkage map was 5608.1cM with coverage of 73.9% and an average genetic distance of 15.24 cM between adjacent markers (Figure 1). The longest linkage group was LG3 with 472.6 cM while the smallest was LG16 with 2.1 cM. QTL analysis The profiles and characteristics of QTLs associated with the six traits are presented in Table 3 and Figure 2. A total of 25 significant QTLs were detected on 13 linkage groups. Four QTLs (BW-1 to BW-4) were identified for body weight on four different LGs, each of these QTLs explained 2.33 to 15.99% of the phenotypic variation individually. One QTL (TL-1) was identified for total length, which explained 45.93% of the phenotypic variation. Four QTLs (SL-1 to SL-4), explaining 4.41 to 14.71% of the phenotypic variation, were identified for standard length. Six QTLs (PDH-1 to PDH-6) were identified for body height. Interestingly, eight QTLs (CPL1 to CPL-8) were detected for caudal peduncle length and accounted for 0.05 to 32.00% of the phenotypic variation. Two QTLs (CPH-1, CPH-2), accounting for 3.86-38.71% of the phenotypic variation, were identified for caudal peduncle height. However, 11 QTLs (44% of 25 QTLs) were found with positive additive effects. Seven QTLs (TL-1, PDH-3, CPL-3, CPL-4, CPL-5, CPL-7 and CPH-2) explained more than 20% of the phenotypic variation individually.

Linkage mapping A total of 378 AFLP markers and 24 SSR markers were employed to construct the linkage map. Of these

Comparative mapping The 24 flanking sequences of microsatellite loci placed

Wang et al.

7877

Table 2. Characterization of 24 microsatellite loci used for genetic linkage map construction in common carp.

Locus CL001 CL009 CL018 CL021 CL024 CL029 CL043 CL051 CL052 CL078 CL081 CL092 CL096 CL098 CL103 CL105 CL115 CL123 CL134 CL139 CL140 CL158 CL162

Primer sequences (5′ - 3′) Forward GAAGCTGGCGTGCATATT TGGCTTGTGTGAGTGTCTGT TGCAGCATCTGTCTCACTCA. CTCTTCTAAGTCCTGAGCAGGT GCAGACCTACAGAAGCTTGAG GCCAAGAGACAACAATTCTGA AGCCTGTGTGCTGAACAGTT CGGTGAGTGAGTGAGTGTGTT TAGTGCTGTTGTGCTGAAGC TTAGAGTGGCCCACTTCAAC GGTCGTGCTTGAAAGCAT CAGCTAAATGGTCGCTCTTC CGATAAGTCAGAAACAGCCA CTGAACTGCCTTCACACCTT CACAGCACTGAGGTCCAATT TGGAAGTGAATGCTCAAATG AGCGTTTGCTCTGTCTGTCT GTTCTTCACATACTCGCCGT CTGGAAAGGACATGACATGTG ACCGCTGGTTCACATCAA CTTTGCTACGACAATCTGCC ACGATGTCATGGCAGGAA ACTAGAGCTGCTGGGAACAT

Reverse CCTCCAAGGAACCAGCATAT GAGTCATGCATGTTACCGTG TAGCTGGTCCTTCCTTCTCA CTGGTTTTGTGGTCTCTCACTC GAGTCTGTCCATCACTGGAAG GCCACTGGAATTTCTATCACG TGCTCTGAAGTCATTCTCCC CGAGACTCACCTTCAGTCTGA TTGGAGTGTAGTCAGGCAGA ATGGAAATCGGTCCCAAC GGTTTGTAAGCTGTGTGTGG GATTGACTGACGAGCACAAG CAATCAGACCTAGCAAAGCA TGTAGAGTCGACAGTACTGCG GAAGCTTGTGTGCTCATAGC GCATGACAGCCACATGTATT AAAACGCCGGCTCACTTA CCAGTGTTGCAGAGAGTGATT CATCTGAAGACAACAGTGCTG AAGCCTGTTTATGCGTGTG CGAATGTGTTTGCAGTACGC GAATTACTCACACCAGCACG GTGGGGTTGTGTTGTGTTTG

on the map were used to compare with genomic DNA sequences of zebrafish. Of which, nine were significantly conserved between common carp and zebrafish (Evalue<1.0×10-4). The nine hits were distributed on eight of the 24 chromosomes in zebrafsih (Table 4). Unique correspondences were detected in five chromosome pairs (LG17-CH3, LG21-CH5, LG23-CH7, LG31-CH22, LG45-CH8). Two SSR loci (CL106, CL139) were conserved in the chromosome 11 and 17 of zebrafish, respectively. However, they were not mapped on the linkage group of common carp. Two SSR loci (CL052, CL163) mapped on LG14 and LG40 in this study were both homologous with the chromosome 18 of zebrafish. DISCUSSION Linkage map Compared with the linkage map constructed by the previous reports (Sun and Liang, 2004 ; Cheng et al., 2010), our linkage map was based on F2 families (HB♀×XG♂) while Sun’s map based on haploid gynogenesis population from a hybrid F1 female (Common carp♀×Boshi carp♂) and Cheng’s map was also based on a haploid gynogenesis population from a

Allele range

Ta (°C)

GeneBank Number

116 162 154 149 165 160 215 148 186 210 275 292 190 294 195 200 202 165 178 223 211 157 217

54 54 62 60 54 53 60 56 54 60 53.6 62 62 60 56 56 61 56 56 53.7 62 56 62

JQ267676 JQ267677 JF825148 JQ267678 JQ267679 JF825150 JF825152 JQ267680 JQ267681 JQ267682 JQ267683 JQ267684 JQ267685 JQ267686 JQ267687 JQ267688 JQ267689 JQ267690 JQ267691 JQ267692 JQ267693 JQ267694 JQ267695

female common carp. Diploid F2 population is more advantageous than haploid gynogenesis population in linkage mapping. First, F2 population has the largest genetic information on genetic mapping and have all the allele combination between the parents (Li and Guo, 2003). Second, an advantage of the diploid protocol is that diploid survive to adulthood, providing much more genomic DNA for mapping than haploids which survive for only a few days after fertilization (Kelly et al., 2000). Third, phenotypic traits data cannot be exactly measured for haploid individuals as they can survive only few hours or days (Kocher et al., 1998). The linkage map covering 5608.1cM in the present study was the largest map among the three linkage maps in common carp, comparing with the first map covering 4111cM (Sun and Liang, 2004) and the second map covering 5506.9cM (Cheng et al., 2010). However, the marker density in this map was relatively lower than the previously reported second map. Adding more markers in the map is requested in future study. QTL analysis Genetic linkage maps are essential in the localization of QTL for marker-assisted selection (Dekkers and Hospital,

7878

Afr. J. Biotechnol.

Figure 1. Genetic linkage map of common carp based on AFLP and SSR markers. AFLP, Amplified fragment length polymorphisms; SSR, microsatellites

2002). In this study, we reported the QTL analysis of the growth-related traits in common carp. A total of 25 QTLs were identified, including four QTLs for BW, one QTL for TL, four QTLs for SL, six QTLs for PDH, eight QTLs for CPL and two QTLs for CPH. For the PDH trait, the most dominant QTL (PDH-3) was located on linkage group 12, which explained 32% of

phenotypic variation and indicated high additive effect (0.72), implying this locus should be a major genomic position controlling the PDH trait. For the CPL trait, four major QTLs (CPL-3, CPL-4, CPL-6 and CPL-7) explained phenotypic variation ranging from 42.50 to 61.40% and showed all negative additive effect values, demonstrating that these four loci have great negative ffect on caudal

Wang et al.

7879

Figure 1. Contd.

peduncle length. Thus, it can be expected that the high PDH trait and the short CPL trait could be well inherited in the progeny if the Purse red common carp was used as

female parent in breeding programs. This expectation was confirmed by the reported results from quantitative traits analysis (Wang et al., 2006; Wang and Li, 2007).

7880

Afr. J. Biotechnol.

Table 3. Putative QTLs and their genetic effects for growth-related traits in common carp.

Trait

QTL BW-1 BW-2 BW-3 BW-4

Linkage group 7 24 30 30

Adjacent marker CL096 AGT/CCC-78 ATT/CCC-147 CL051

LOD value 3.86 4.88 3.47 3.13

Additive effect 71.28 -74.18 28.90 30.28

Variance (%) 15.99% 7.70% 2.33% 2.50%

TL-1

ATT/CCC-69

3.99

2.70

45.93%

SL-1 SL-2 SL-3 SL-4

3 3 4 21

ATT/CCC-161 AGG/AAT-59 ACG/AAG-242 CL021

3.21 4.14 3.16 3.43

1.62 1.19 -0.91 1.11

13.73% 10.93% 4.41% 14.71%

PDH

PDH-1 PDH-2 PDH-3 PDH-4 PDH-5 PDH-6

2 5 12 31 38 38

AGT/CGA-246 AGG/CGA-229 ACG/AAT-163 AGG/AAG-137 AGT/AAT-67 ACG/AAT-72

4.16 6.22 4.24 4.36 6.81 6.53

-0.20 -0.26 0.72 0.03 -0.33 -0.28

2.50% 4.22% 32.00% 0.05% 10.49% 7.55%

CPL

CPL-1 CPL-2 CPL-3 CPL-4 CPL-5 CPL-6 CPL-7 CPL-8

3 5 5 5 30 31 32 43

AGG/AAT-59 AGG/CGA-109 AGG/CGA-120 AGG/CGA-82 ACG/AAT-92 AGG/AAG-137 ACG/CCC-263 CL105

4.60 4.70 4.15 4.22 4.43 4.17 4.48 4.34

0.15 0.04 -0.50 -0.50 -0.23 -0.43 -0.48 -0.19

5.41% 0.43% 56.03% 56.17% 12.88% 42.50% 61.40% 8.27%

CPH

CPH-1 CPH-2

2 32

AGT/CGA-201 ACG/CCC-263

3.67 4.51

-0.09 -0.26

3.86% 38.71%

In the present study, several QTLs controlling different traits were clustered in very close interval of the same linkage group, for instance, the QTL SL-2 and CPL-1 were identified in the 130.8-163.5cM interval on the LG3, the QTL CPL-6 and PDH-4 were identified in the 131.0183.6cM interval on the LG31. The clustering of QTLs indicated the tight linkage of different genetic positions or the same chromosome region shared by several different QTLs. Identification of QTLs influencing several traits could increase the efficiency of MAS and enhance genetic progress (Upadyayula et al., 2006). Meanwhile, the clustering of several QTLs affecting several traits correspondingly provides an explanation for the positive correlation among different traits.

aquatic species. In the present study, the locus CL052 was mapped on the LG14 and the locus CL163 was mapped on the LG40, however, they were both conserved with the same chromosome 18 of zebrafish. It is speculated that the LG14 and LG40 probably correspond to a single orthologous chromosome in zebrafish. Interestingly, the locus CL021, which was linked with a QTL affecting standard length trait, was conserved with growth hormone gene of grass carp (Ctenopharyngodon idella) (GenBank number: X60419). Which provide a new insight into the genetic base of the QTL affecting the standard length. Prospective

Comparative mapping Comparative mapping between common carp and zebrafish can give us new insights into the evolution of

Although the coverage and density of our genetic map of common carp needs further improvement, and the QTLs needs further precise location, it will still be very useful tools for common carp genetic study and selection

Wang et al.

7881

Figure 2. Putative QTLs for growth-related traits in common carp. QTLs, Quantitative trait loci.

breeding programs in the future. Combining nextgeneration sequencing and genotyping technologies, more markers could be added to the genetic map of common carp to improve the quality of genetic map. A saturated genetic map will provide more valuable information and promote the development of common carp aquaculture industry.

ACKNOWLEDGEMENTS The authors would like to thank Mr. Songping Xiang and Jian Wang (the Oujiang Color Common Carp Farm in Longquan of Zhejiang Province, China) for their kind help in collecting samples. This work was supported by the National Natural Science Foundation of China (No.

7882

Afr. J. Biotechnol.

Figure 2. Contd.

Table 4. The comparative chromosome of microsatellite marker in the linkage map of common carp and Zebrafish.

Microsatellite locus CL018 CL021 CL052 CL092 CL103 CL106 CL123 CL139 CL163

LG in common carp LG17 LG21 LG14 LG31 LG23 / LG45 / LG40

30700622), the Program for New Century Excellent Talents in University (No. NCET-08-0896) and the Special Fund for Agro-scientific Research in the Public Interest (No. 200903045). REFERENCES Bakos J, Gorda S (1995). Genetic-improvement of common carp strains using intraspecific hybridization. Aquaculture, 129: 183-186. Balon EK (1995). Origin and domestication of the wild carp, Cyprinus carpio: from Roman gourmets to the swimming flowers. Aquaculture,

Chromosome in zebrafish CH3 CH5 CH18 CH22 CH7 CH11 CH8 CH17 CH18

129: 3-48. Bouza C, Hermida M, Pardo BG, FernaÂ´ndez C, Fortes GG, Castro J, Sanchez L, Presa P, PeÂ´rez M, Sanjuan As, Carlos Ad (2007). A Microsatellite Genetic Map of the Turbot (Scophthalmus maximus). Genetics, 177: 2457-2467. Cheng L, Liu L, Yu X, Wang D, Tong J (2010). A linkage map of common carp (Cyprinus carpio) based on AFLP and microsatellite markers. Anim. Genet. 41: 191-198. Chistiakov DA, Hellemans B, Haley CS, Law AS, Tsigenopoulos CS, Kotoulas G, Bertotto D, Libertini A, Volckaert FAM (2005). A Microsatellite Linkage Map of the European Sea Bass Dicentrarchus labrax L. Genetics, 170: 1821-1826. Dekkers JCM, Hospital F (2002). The use of molecular genetics in the

Wang et al.

improvement of agricultural populations. Nat. Rev. Genet. 3: 22-32. Du ZQ, Ciobanu DC, Onteru SK, Gorbach D, Mileham AJ, Jaramillo G, Rothschild MF (2010). A gene-based SNP linkage map for pacific white shrimp, Litopenaeus vannamei. Anim. Genet. 41: 286-294. Felip A, Young WP, Wheeler PA, Thorgaard GH (2005). An AFLP-based approach for the identification of sex-linked markers in rainbow trout (Oncorhynchus mykiss). Aquaculture, 247: 35-43. Gideon H (1995). A review of genetic improvement of the common carp (Cyprinus carpio L.) and other cyprinids by crossbreeding, hybridization and selection. Aquaculture, 129: 143-155. Kelly PD, Chu F, Woods IG, Ngo-Hazelett P, Cardozo T, Huang H, Kimm F, Liao L, Yan Y-L, Zhou Y, Johnson SL, Abagyan R, Schier AF, Postlethwait JH, Talbot WS (2000). Genetic Linkage Mapping of Zebrafish Genes and ESTs. Genome Res. 10: 558-567. Kocher TD, Lee W-J, Sobolewska H, Penman D, McAndrew B (1998). A Genetic Linkage Map of a Cichlid Fish, the Tilapia (Oreochromis niloticus). Genetics, 148: 1225-1232. Li L, Guo XM (2003). New approaches to the genetic pattern study on some animals in aquaculture (in Chinese). Marine. Seience. 27: 1419. Li SF (1996). Germplasm resources and conservation of freshwater fishes in China. China Agriculture Press. Li Y, Dierens L, Byrne K, Miggiano E, Lehnert S, Preston N, Lyons R (2006). QTL detection of production traits for the Kuruma prawn Penaeus japonicus (Bate) using AFLP markers. Aquaculture, 258: 198-210. Liu Z, Karsi A, Li P, Cao D, Dunham R (2003). An AFLP-Based Genetic Linkage Map of Channel Catfish (Ictalurus punctatus) Constructed by Using an Interspecific Hybrid Resource Family. Genetics, 165: 687694. Lou YD, Sun JC (2001). Progress on studies of origin and genetic diversity of three breeds of red carp in JiangXi Province (in Chinese). J. Fish. China. 25: 570-575. Mackay TFC, Stone EA, Ayroles JF (2009). The genetics of quantitative traits: challenges and prospects. Nat. Rev. Genet. 10: 565-577. Manly KF, Cudmore JRH, Meer JM (2001). Map Manager QTX, crossplatform software for genetic mapping. Mamm. Genome, 12: 930932. Marc V (2003). Selective breeding of quantitative traits in the common carp (Cyprinus carpio): a review. Aquat. Living Resour. 16: 399-407. Perez F, Erazo C, Zhinaula M, Volckaert F, CalderoÂ´n J (2004). A sexspecific linkage map of the white shrimp Penaeus (Litopenaeus) vannamei based on AFLP markers. Aquaculture, 242: 105-118. Poormohammad Kiani S, Maury P, Nouri L, Ykhlef N, Grieu P, Sarrafi A (2009). QTL analysis of yield-related traits in sunflower under different water treatments. Plant Breed. 128: 363-373. Sambrook J, Russell DW (2001). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. Sekino M, Hara M (2007). Linkage Maps for the Pacific Abalone (Genus Haliotis) Based on Microsatellite DNA Markers. Genetics, 175: 945958.

7883

Sun XW, Liang LQ (2004). A genetic linkage map of common carp (Cyprinus carpio L.) And mapping of a locus associated with cold tolerance. Aquaculture, 238: 165-172. Upadyayula N, da Silva HS, Bohn MO, Rocheford TR (2006). Genetic and QTL analysis of maize tassel and ear inflorescence architecture. Theor. Appl. Genet. 112: 592-606. Voorrips RE (2002). MapChart: Software for the Graphical Presentation of Linkage Maps and QTLs. J. Hered. 93: 77-78. Vos P, Hogers R, Bleeker M, Reijans M, Lee Tvd (1995). AFLP: a newtechnique for DNA fingerprinting. Nucleic Acids Res. 23: 44074414. Wang CH, Li SF (2007). Genetic effects and genotype Ă&#x2014; environment interactions for growth-related traits in common carp. Aquaculture, 272: 267-272. Wang CH, Li SF, Nagy ZT, Lehoczky I, Huang L, Zhao Y, Song X, Jeney Z (2010). Molecular genetic structure and relationship of Chinese and Hungarian common carp (Cyprinus carpio L.) strains based on mitochondrial sequence. Aquacult. Res. 41: 1339-1447. Wang CH, Li SF, Xiang SP, Wang J, Liu ZG, Pang ZY, Duan JP, Xu ZB (2006). Additive, dominance genetic effects for growth-related traits in common carp, Cyprinus carpio L. Aquact. Res. 37: 1481-1486. Wang CM, Zhu ZY, Lo LC, Feng F, Lin G, Yang WT, Li J, Yue GH (2007). A Microsatellite Linkage Map of Barramundi, Lates calcarifer. Genetics, 175: 907-915. Wang SC, Basten J, Zeng ZB (2007). Windows QTL Cartographer 2.5. Deparment of Statistics, North Carolina State University, Raleigh,NC. http://statgen.ncsu.edu/qtlcart/WQTLCart.htm. Wang WJ, Wang HP, Yao H, Wallat G, Tiu L, Wang QY (2010). A first genetic linkage map of bluegill sunfish (Lepomis macrochirus) using AFLP markers. Aquacult. Int. Wohlfarth GW (1993). Heterosis for growth rate in common carp. Aquaculture, 113: 31-46. Woram RA, Gharbi K, Sakamoto T, Hoyheim B, Holm LE, Naish K, McGowan C, Ferguson MM, B.Phillips R, Stein J, Guyomard R, Cairney M, Taggart JB, Powell R, Davidson W, Danzmann RG (2003). Comparative Genome Analysis of the Primary SexDetermining Locus in Salmonid Fishes. Genome Res. 13: 272-280. Wu X (1964). Cyprinoid Fish of China. Shanghai Science and Technology Press, Shanghai. Xia JH, Liu F, Zhu ZY, Fu J, Feng J, Li J, Yue GH (2010). A consensus linkage map of the grass carp (Ctenopharyngodon idella) based on microsatellites and SNPs. BMC. Genomics, 11: p. 135. Zeng ZB (1994). Precision mapping of quantitative trait loci. Genetics, 136: 1457-1468.

Full Length Research Paper

In planta transformation of rice (Oryza sativa) using thaumatin-like protein gene for enhancing resistance to sheath blight Gita Naseri*, Mohammad Mehdi Sohani, Andisheh Pourmassalehgou and Somayeh Allahi Department of Plant Biotechnology, Faculty of Agriculture, University of Guilan, Rasht, Iran. Accepted 1 February, 2012

Among the fungal diseases, sheath blight caused by Rhizoctonia solani Kuhn is one of the most important wide spread diseases found in all the rice plants (Oryza sativa) growing countries. The control of the disease with agricultural alternation and traditional breeding has not been successful so far. Application of fungicide is not recommended. Resistant genes which can cause immunity to the disease have not been found. D34 is a thaumatin-like protein (TLP) belonging to the group 5 of pathogen-related proteins (PRs). These proteins can probably change permeability of fungal membrane. In this research, an attempt was made to enhance the resistance to the sheath blight fungus on rice plant through the expression of TLP gene under the control of a CaMV35 promoter. To achieve this goal, rice plants (O. sativa) were transformed by the pAJ21-CaMV35S-tlpD34 construct via in planta method using Agrobacterium tumefaciens EHA101. The transformed plants were confirmed using polymerase chain reaction (PCR) amplifying a 710 bp fragment of the cloned gene. Key words: In planta, pathogenesis-related protein, Rhizoctonia solani, rice, sheath blight, thaumatin-like protein, transformation. INTRODUCTION In plants, host disease resistance is an active phenomenon involving many biochemical components. Plant resistance mechanisms include the hypersensitive response (HR) and systemic acquired resistance (SAR) (Ross, 1961b). HR and SAR are involved in the upregulation of the pathogen-related proteins (Bowles, 1990; Song and Goodman, 2001). On the basis of the amino acid sequences, serological relationship, and/or enzymatic or biological activity, there are 17 recognized groups of pathogen related (PR)-proteins, designated PR-1 through PR-17 in various plant species (Okushima et al., 2000; Christensen et al., 2002; Kostoff, 2005; Liu et al., 2010). Many PR-5 proteins have been found to have an antifungal activity (Koiwa et al., 1997, 1999; Wang and Ng, 2002; Van loon et al., 2006; O’Leary et al., 2007;

*Corresponding author. E-mail: gita_naseri@yahoo.com. Abbreviations: TLP, Thaumatin-like protein; PRs, pathogenrelated proteins; PCR, polymerase chain reaction.

Wang et al., 2010; Dhekney et al., 2010). The antifungal activity is presumably attributed to PR-5 induced membrane leakage and hyphal rupture of fungal pathogen (Robert and Selitrennikoff, 1990; Vigres et al., 1992; Daolin et al., 2005). Then, PR5 proteins generally exert their antifungal activity through a very fast and dramatic increase in the permeability of the pathogen's plasma membrane, by disrupting the lipid bi-layer and creating trans-membrane pores, though the exact molecular mechanism underlying the PR-5 antifungal activity is not known (Liu et al., 2010; Wang et al., 2010; El-Kereamy et al., 2011). PR-5 proteins may also indirectly contribute to other defense regulatory mechanisms such as phenylpropanoid and phytoalexin pathways (El-Kereamy et al., 2011). Initially, a thaumatin-like protein (TLP) cDNA clone has been isolated and characterized from rice leaves infiltrated with Pseudomonas syringae pv syringae, a non– pathogen of rice (Reimmann and Dudler, 1993). In rice plants infected with Rhizoctonia solani, two TLPs, C22 and D34, have been identified which were entirely different from the TLP described previously (Velazhahan

7886

Afr. J. Biotechnol.

et al., 1998). The rice TLPD34 was detected two to six days after inoculation, with a peak on the fourth day (Velazhahan et al., 1998). pGL2-CaMV35S-tlpD34, harboring TLPD34 gene was used to transform protoplasts of indica rice cultivars by polyethylene glycol (PEG)-mediated direct gene and immature embryos by biolistic transformation (Datta et al., 1999). A rice thaumatin-like protein gene (tlp-D34) and a rice chitinase gene (chi11) were introduced into the spring wheat cultivar 'Bobwhite' by co-transformation of the plasmids pGL2-CaMV35S-tlpD34 and pAHG11-CaMV35S-chi11. The transformation was by biolistic bombardment (Chen et al., 1999). A cDNA encoding TLP from rice was cloned into the binary vector pMON410 under the control of the CaMV35S promoter for Agrobacterium-mediated transformation of tomato (Radhajeyalakshmi et al., 2004). Transgenic rice which led to an enhanced resistance to sheath blight pGL2-ubi-tlpD34, harboring TLPD34 gene, and pMKU-RF2-chill, harboring chitinase gene, were used to transform mature and immature embryos of indicia rice cultivars by biolistic transformation (Kalpana et al., 2006). Furthermore, constitutive overexpression of TLPD34 in transgenic wheat plants by biolistic transformation delayed the onset of infection by Fusarium graminearum (Caroline et al., 2007). The purified rice TLP also inhibited the mycelial and germ tube growth of some other fungi in vitro (Jayaraj et al., 2004). Since the breakthrough of Hiei and colleagues in the early 1990s, Agrobacterium tumefaciens-mediated transformation methods for rice have advanced and become the routine methods first inoculated onto immature embryos and calli, in a tissue culture system. However, they require sterile conditions and are time窶田onsuming. Also, somatic mutation or somaclonal variation frequently occurs in plant cells during in vitro culture, especially in the monocotyledon plants, because of lack of special inducer and inability in entering to the nuclear and integration to plant genome, and some plants are recalcitrant to regeneration (Hiei and Koman, 2008). On the other hand, in planta transformation involves no in vitro culture and eliminates the chances of somaclonal variation induced through in vitro culture (Supartana et al., 2005). In planta transformation has been demonstrated in other species like Arabidopsis thaliana, buckwheat, kenaf, rice, cotton, Brassica napus and wheat previously (Feldmann and Marks, 1987; Kojima et al., 2000; Kojima et al., 2004; Supartana et al., 2005; Keshamma et al., 2008; Li et al., 2010 and Razzaq et al., 2010). In this report, we carried out some modification of this method to increase the efficiency of integration of the recombinant vector harboring the TLPD34 gene. MATERIALS AND METHODS

(LB), super optimal broth (SOB), yeast extract peptone (YEP), super optimal broth with catabolite repression (SOC), Yoshida and other solutions were all from Merck (Frankfurt, Germany). Escherichia coli JM101, pAJ21, all the enzymes and various size markers were prepared from Fermentas (St. Leon-Rot, Germany). Ampicillin, rifampicin and cefotaxime were prepared from CoAlhavi (Tehran, Iran). Primers were purchased from GeneWorkCo (Thebarton, Australia). dNTPs were from Roche (Mannheim, Germany) and other reagents used for polymerase chain reaction (PCR) were from Sinagen (Tehran, Iran). 2-[4-morpholino]-ethane sulfonic acid (MES) for preparation of induction medium and acetosyringone were from Sigma (Deisenhofen, Germany). Rice (Oryza sativa var Hashemi) seeds were obtained from Rice Research Institute (Rasht, Iran). Instrument used in this investigation were as follows: gradient thermal cycler for polymerase chain reaction; spectra photometer (Eppendorf) for quantification of nucleic acid; electroporation for transformation of bacteria; gel documentation system for image acquisitions. Full-length cDNA preparation for TLPD34 gene pFLCI harboring full-length cDNA of TLPD34 gene, sequence producing significant alignment, was purchased from NIAS (Ibaraki, Japan). Introduction pFLCI to E. coli Rice pFLCI harboring TLP gene was delivered to the E. coli JM101 by electroporation, after preparation of E. coli competent cell by calcium chloride procedure. The LB medium supplemented with ampicillin sulfate (50 ﾂｵg/ml) was used for selection of the transformed colonies. Extraction of plasmid DNA for PCR analysis Plasmid extraction of E. coli JM101 with pFLCI plasmid containing TLPD34 gene and A. tumefaciens EHA101 with pAJ21 plasmid containing TLPD34 gene was carried out according to the Quick gel QIA extraction kit instruction. Construction of TLPD34 gene delivery vector A 1.1 kb DNA fragment was obtained by digestion of pFLCI with BamHI and XhoI. Digestion of pAJ21, a binary vector with CaMV35S promoter fragment excised for A. tumefaciens over expression with the same enzymes was carried too. pAJ21CaMV35S and the 1.1 kb BamHI-XhoI fragment of the TLPD34 gene were mixed together and ligated to yield pAJ21-CaMV35StlpD34 by Fermentas protocol. pAJ21-CaMV35S-tlpD34 construct was delivered to the E. coli JM101 by electroporation method. Transformed colonies were selected in LB medium. After plasmid extraction, sequence analysis was carried out (Macrogene, Tokyo, Japan). Introduction of construct to the A. tumefaciens Introduction of construct to the A. tumefaciens EHA101 was carried out by virtue of electroporation method, and then the transformed colonies were spread on LB medium containing rifampicin sulfate (75 ﾂｵg/ml) and ampicillin (50 ﾂｵg/ml). This approach led to an appropriate primary selection of Agrobacterium strain harboring pAJ21-CaMV35S-tlpD34. Several selected colonies were subjected to PCR based on the amplification of TLPD34 gene (710 bp) using TLP primers.

Materials and instruments PCR test Sodium hypochloride, tryptone, yeast extract, agar and salts for preparation of Agrobacterium induction media (AB), Luria-Bertani

PCR was used for amplification of a 710 bp of the full-length cDNA

Naseri et al.

of tlpD34 using specific primers: tlp forward ACCAAAGCCATGGCGCCTTCCCT-3′) and tlp reverse TTCGATCATGGGCAGAAGACGAC-3′).

(5′(5′-

In planta transformation We carried out the transformation by the Gelvin method (2006). A. tumefaciens was cultured on LB medium containing rifampicin (75 µg/ml) and ampicillin (50 µg/ml) at 28°C for 16 h. Afterward, 0.5 ml bacterial suspension was cultured on AB medium containing glucose (0.5%) at 28°C and 230 rpm for 16 h. Bacterial plate at OD600 was assembled and cultured on inducing medium contained acetosyringone (100 µM) at 25°C and 50 rpm for 14 to 24 h. Bacterial plate was solved in 1.2 Murashige and Skoog (MS) medium. Rice (O. sativa var Hashemi) seeds were sterilized by soaking in 90% ethanol (1 min) and washed with water three times. Sterile seeds were placed on wet cotton at 22°C for two days. At this stage, A. tumefaciens was inoculated into embryonic apical meristem of the soaked seeds, a region on the seed surface where a shoot would later emerge and was pierced twice up to depth of about 1 to 1.5 mm with a needle (Φ 0.70 mm) dipped in the A. tumefaciens inoculums. The inoculated seeds were then placed on filter papers on wet perlite in flasks covered with aluminum foil and incubated at 23°C in dark for nine days, during which 70 to 75% of inoculated seeds germinated to seedlings. In order to eliminate A. tumefaciens, the seedlings were immersed, at room temperature, in an aqueous solution (1000 ppm) of cefotaxime for 1 h. Subsequently, seedlings were transformed to basins containing Yoshida solution for rooting. Finally, seedlings were planted in pots and grown to maturation (T0) under non-sterile conditions and allowed to pollinate naturally to set seeds (T1). Inoculation of rice plants by R. solani The T0 and T1 generation of transformants were infected with R. solani, 40 days after planting. All the R. solani inoculations were carried out with mycelial disc of 5 mm diameter, obtained from three-day-old culture of R. solani grown on potato dextrose agar at 28°C. Each selected leaf sheath was inoculated with a single mycelial disc. The mycelial disc placed on leaf sheath, was covered with absorbent cotton and secured with parafilm. The cotton was moistened periodically with sterile distilled water, to maintain high humidity (Anuratha et al., 1996).

Extraction of genomic DNA from leaves Genomic DNA for PCR was isolated from young leaves at the shoot apices of rice plants of transformed plants according to cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1990).

RESULTS AND DISCUSSION Full-length cDNA (clone ID: 301152 and 98% homology with TLPD34 gene) was selected in KOME site. PCR with specific primers for amplification of a 710 bp of full-length cDNA was used as a method for the confirmation of existing full-length cDNA in pFLCI. Cloning of pFLCI in E. coli JM101 was performed for more reproduction for further uses. As shown in Figure 1, cloning was confirmed by PCR reaction and results showed that all of

7887

the selective colonies had a 710 bp band in gel electrophoresis. The result (710 bp) was subjected to series of excision and sub-cloning processes towards production of pAJ21-CaMV35S-tlpD34 construct. The insertion of TLPD34 gene in pAJ21 showed a 6000 bp band in gel electrophoresis (Figure 2). For selection of transformed A. tumefaciens, very low amount of the bacteria was used to ensure the colony selection process confirmed by PCR (Figure 3) and insertion of TLPD34 gene in pAJ21 confirmed by sequence analysis too (data not shown). Regeneration of inoculated seeds The seeds were sterilized and inoculated. Regeneration percentage was 59% (Table 1). Piercing the seeds might have damaged mother line germ cells. Therefore, 39% treated seeds could not regenerate into seedling. Piercing meristematic cells with needles is very critical for the determination of inoculating mother line germ cells and attention should be taken to avoid the mother line cells from damage. It is necessary bacteria infect mother line cells. The embryo was visible when inoculated and choosing the best position of embryo for inoculation was possible. Induction of thaumatin-like protein in R. solaniinfected rice plants Rice plants were infected with R. solani at maximum tillering stage. In transgenic lines, the disease lesions were relatively smaller and surrounded by a conspicuous defensive browning, while in the non-transgenic controls, the disease lesions were larger (Figure 4), leading to morbid yellowing of leaves. Moreover, in the leaf sheaths of transgenic line, the spread of lesion was slower and the lesions were surrounded by zone of extensive browning. However, in non-transformed controls, blanched lesion appeared, the faster spread of which led to complete drying of infected leaf sheaths. Molecular evolution of putative transformants Transformed status of the putative transformants was evaluated by the presence of TLPD34 transgene in the genomic DNA by PCR analysis. PCR analysis for some samples is presented in Figure 5. PCR results showed that 24% plants inoculated with Agrobacterium integrated transgene (Table 1). In planta transformed rice plants have been obtained recently by Supartana et al. (2005). Therefore, TLP gene can be delivered successfully into growing meristem cells of rice as is evident from this experiment. The transformed plants were confirmed using PCR amplifying a 710 bp fragment of TLPD34 gene.

7888

Afr. J. Biotechnol.

1500 bp 710 bp 500 bp

Figure 1. PCR product of the cloned full-length cDNA of TLP gene on the 1% agarose gel. PCR for confirmation of E. coli transformation, M, 100 bp marker; T, amplified TLPD34 gene; P, positive control; N, negative control. PCR, Polymerase chain reaction.

5000 bp 1000 bp 710 bp 500 bp

Figure 2. pAJ21-CaMV35-tlp on 1% agarose gel. M, 1 k bp marker; lane 1, pAJ21 before insertion of TLPD34 gene; lane 2, pAJ21 after insertion of tlpD34.

Figure 3. PCR product of transformed A. tumefaciens. M, 100 bp marker; lane 1, colony with a 710 bp band; P, positive control; N, negative control. PCR, Polymerase chain reaction.

Naseri et al.

7889

Table 1. Percentage of PCR positive plants after inoculation of apical meristem with Agrobacterium.

Detail of material No. of treated seeds No. of inoculated seeds No. of regenerated seeds Regeneration percentage Number of PCR positive Percentage of PCR positive plants

Inoculation 800 550 327 59%* 80 24%**

Percentage calculated based on number of seeds inoculated; **percentage calculated based on number of regenerated seeds.

(A)

(B)

Figure 4. Assessment of sheath blight development in transformed rice plants expressing TLP (A) and non-transformed rice plants (B). TLP, Thaumatin-like protein.

Sequencing analysis of putative transformants A search of DNA sequence data base in National Center for Biotechnology Information (NCBI) revealed that sequenced DNA shared sequence similarity to the TLP34 gene deposited with Genebank under accession number U77657 by Velazhahan et al. (1998) (Figure 7). The results of this experiment reveal the success of delivery and stable integration of foreign gene into meristem cells of rice. The results also provide a positive evidence for success of in planta. This indicates a good efficiency of this method compared with particle bombardment and Agrobacterium-mediated transformation involving tissue culture. This prevents essential tissue culture requirement that needs a good skill, expense and labor to

produce handful of transformed plants. Moreover, this method removes the probabilities of somaclonal variation induced through in vitro culture. In planta method is a potentially useful approach for cereals where regeneration of transformed plantlets is insufficient. In planta developed for transformation of rice through apical meristem can renew the genetic progress of it to cope with its fast increasing demand and has the potential for effective genetic transformation of other crops through growing meristems. In the present study, we were able to produce transgenic lines of Iranian rice cultivar by in planta method and inheritance of TLP gene was confirmed into the genome of T1 plants. Until now, considerable efforts have been made for optimization of Agrobacterium-mediated

7890

Afr. J. Biotechnol.

(B)

(A)

1500 bp

710 bp 710 bp

500 bp

Figure 5. Detection of transgene in transformants. A) PCR reaction of T 0 transformants. M, 100 bp marker; lane 1, PCR product of T0 transformants. B) PCR of T1 transformants. M, 100 bp marker, lanes 1 to 3, PCR products of T1 transformants; P, positive control; N, negative control.

(A)

(B)

Figure 6. The position of inoculation of rice seeds. A) The position of plumule and embryonic apical meristem (Lin et al., 2009). B) The side of apical meristem of soaked seeds inoculated by A. tumefaciens.

Naseri et al.

7891

Figure 7. BLAST of the sequence of insertion fragment in T1 plants in NCBI. NCBI, National Center for Biotechnology Information.

transformation of mature embryos and development of direct Agrobacterium-mediated transformation of germline cells in seeds, shoot meristem and immature embryos (Dai et al., 2001; Urushibara et al., 2001; Hiei and Koman, 2008; Azria and Bhalla, 2011). Modification of different genetic and environmental aspects of transformation method may lead to better understanding

of the system and result in high efficiency (Alimohammadi and Bagherieh-Najjar, 2009). Efforts have also been devoted to deliver exogenous DNA to the cells of cereals meristems via electrophoresis, p article bombardment and microinjection (Razzaq et al., 2011). Meristem cells of cereals can be targeted successfully for delivery of DNA (Iglesias, 1994) and are competent

7892

Afr. J. Biotechnol.

for stable transformation (Potrykus, 1990). Therefore, imagining the importance of tissue culture free genetic transformation, a study was done for in planta apical meristem transformation of rice through Agrobacterium to study an easy, cheap and efficient method. A. tumefaciens was inoculated on to the embryonic apical meristems of soaked seeds, in which various organs and primordial had already been formed. Conceivably, A. tumefaciens could transfer its T-DNA not only to the cells of apical meristems, but also to the cells of various organs and primordia of the soaked seeds. Consequently, it is likely that transformants at the T0 stage were chimeras and at the T1, A. tumefaciens transfer was only to the genomes of the cells. The best position for inoculation is side of apical meristem of soaked seeds in which plumule will form later (Chang and Bardenase, 1965). Plumule may be destroyed later, if needle pierce into it directly (Lin et al., 2009; Figure 6). To put it differently, in planta transformation method mimicked the infection process of A. tumefaciens of plants in nature. This might leads to the high transformation efficiency of in planta method. We used acetosyringone (100 ÎźL), A. tumefaciens EHA101 and glucose, as another inducing substance; according to optimal protocol, introduced acetosyringone enhances expression of vir genes (Hiei and Koman, 2008). Acetosyringone was included in this experiment as an essential factor required for the transcriptional activation of Agrobacterium virulence machinery (Seo et al., 2002; He et al., 2010). Nevertheless, some of the researchers think this is not an absolute requirement (Bartlett et al., 2008). It seems likely that the other inducing substance, monosaccharide, plant hormone, vacuum and other strains of Agrobacterium can increase the efficiency of in planta method. Of importance is that their effectiveness can be probed in the molecular level and transcription of inducer gene like virG and virD. TLP transgenic lines produced in this study could be used as a source of resistance to other fungal diseases.

ACKNOWLEDGEMENTS This work was sponsored by the Rice Centers of Excellence, University of Guilan, Rasht, Iran. We are grateful to the Rice Research Institute, Rasht, Iran, for providing the rice seeds used in this work. REFERENCES Alimohammadi M, Bagherieh-Najjar MB (2009). Agrobacteriummediated transformation of plants: Basic principles and influencing factors. Afr. J. Biotechnol. 8: 5142-5148. Anuratha, CS, Zen KC, Cole KC, Mew T, Muthukrishnan S (1996). Induction of chitinases and Ă&#x;-1,3-glucanases in Rhizoctonia solaniinfected rice plants: isolation of an infection related chitinase cDNA clone. Physiol. Plant, 97: 39-46. Azria D, Bhalla P (2011). Agrobacterium-mediated transformation of

Australian rice varieties and promoter analysis of major pollen allergen gene, Ory s 1. Plant. Cell. Rep. 30: 1673-1681. Bartlett JG, Alves SC, Smedley M, Snape JW, Harwood WA (2008). High-throughput Agrobacterium-mediated barley transformation. Plant Methods, 4: 1-12. Bowles DJ (1990). Defense-related proteins in higher plants. Annu. Rev. biochem. 59: 873-907. Caroline AM, Lewise J, Lewise l, Radmer LE, Shin S, Heinen SJ, Smith LA, Wyckoff MN, Macky RD, Evans CK, Kravchenko S, Baldridge GD, Zeyen RJ, Muehlbaur GJ (2007). Overexpression of defense response genes in transgenic wheat enhances resistance to Fusarium head blight. Plant Cell. Rep. 4: 476-488. Chang TT, Bardenas E (1965). The morphology and varietal characteristics of rice plant. IRRI. Tech. Bull. 4: p. 40. Chen WP, Chen PD, Liu DJ, Kynast R, Friebe B , Velazhahan R, Muthukrishnan S, Gill BS (1999). Development of wheat scab symptoms is delayed in transgenic wheat plants that constitutively express a rice thaumatin-like protein gene. Theor. Appl. Genet. 99: 755-760. Christensen AB, Cho BH, Naesby M, Gregersen PL, Brandt J, Madrizordenana K, Colling DB, Thordal-Christensen H (2002). The molecular characterization of two barley proteins establishes the novel PR-17 family of pathogenesis-related proteins. Mol. Plant. Pathol. 3: 135-144. Dai SH, Zheng P, Marmey P, Zhang SP, Tian WZ, Chen SY, Beachy RN, Fauquet C (2001). Comparative analysis of transgenic rice plants obtained by Agrobacterium-mediated transformation and particle bombardment. Mol. Breed. 7: 25-33. Datta K, Velazhahan R, Oliva N, Ona I, Mew T, Khush GS, Muthukrishnan S, Datta SK (1999). Over-expression of the cloned rice thaumatin-like protein (PR-5) gene in transgenic rice plants enhances environmental friendly resistance to Rhizoctonia solani causing sheath blight disease. Theor. Appl. Genet. 98: 1138-1145. Daolin F, Tisserat NA, Xiao Y, Settle D, Muthukrishnan S, Liang GH (2005). Overexpression of rice TLPD34 enhances dollar-spot resistance in transgenic bentgrass. Plant Sci. 168: 671-680. Dhekney SA, Li ZT, Gray DJ (2010). Genetically engineered grapevines expressing a cisgenic Vitis vinifera thaumatin-like protein exhibit fungal resistance and improved post-harvest characteristics. 12th World congress of the International Association for Plant th th Biotechnology, St. Louis, June 6 -11 . Doyle JJ, Doyle JI (1990). Isolation of plant DNA from fresh tissues. Focus, 12: 13-15. El-kereamy A, El-sharkawy I, Ramamoorthy R, Taheri A, Errampalli D, Kumar P, Jayasankar S (2011). Prunus domestica PathogenesisRelated Protein-5 Activates the Defense Response Pathway and Enhances the Resistance to Fungal Infection. PLoS ONE. 6 doi: 10.1371/journal.pone.0017973. Feldmann KA, Marks MD (1987). Agrobacterium-mediated transformation of germinating seeds of Arabidopsis thaliana: a nontissue culture approach. Mol. Gen. Genet. 208: 1-9. Gelvin SB (2006). Agrobacterium virulence gene induction. Method. Mol. Boil. 343: 77-84. He Y, Jones HD, Chen S, Chen XM, Wang DW, Li KX, Wang DS, Xia LQ (2010). Agrobacterium-mediated transformation of durum wheat (Triticum turgidum L. var. durum cv Stewart) with improved efficiency. J. Exp. Bot. 61: 1567-1581 Hiei Y, Koman T (2008). Agrobacterium-mediated transformation of rice using immature embryo or cali induced from mature seed. Nature, 3: 824-834. Iglesias VA, Gisel A, Bilang R, Potrykus I, Sauter C (1994). Transient expression of visible marker genes in meristem cells of wheat embryos after biloistic micro-targeting. Planta, 192: 84-91. Jayaraj J, Velazhahan R, Fu D, Liang GH, Muthukrishnan S (2004). Bacterially produced rice thaumatin-like protein shows in vitro antifungal activity. J. Plant. Dis. Prot. 111: 334-344. Kalpana K,Maruthasalam S,Rajesh T,Poovannan K,Kumar KK, Kokiladevi E,Raja JAJ,Sudhakar D,Velazhahan R,Samiyappan R,Balasubramanian P (2005).Engineering sheath blight resistance in elite indica rice cultivars using genes encoding defense proteins.plant sci.170:203-215. Keshamma E, Rohini S, Rao KS, Madhusudhan B, Udaya KM (2008).

Naseri et al.

Tissue culture-independent in planta transformation strategy: an Agrobacterium tumefaciens-mediated gene transfer method to overcome recalcitrance in cotton (Gossypium hirsutum L.). J. Cotton. Sci. 12: 264-272. Koiwa H, Kato H, Nakatsu T, Oda J, Yamada Y (1997). Purification and characterization of tobacco pathogenesis-related protein PR-5d, an antifungal thaumatin-like protein. Plant Cell Physiol. 38: 783-791. Koiwa H, Kato H, Nakatsu T, Oda J, Yamada Y, Sato F (1999). Crystal structure of tobacco PR-5d protein at 1.8 A resolation reveals a conserved acidic cleft structure in antifungal thaumatin- like proteins. J. Mol. Boil. 286: 1137-1145. Kojima M, Arai Y, Iwase N, Shiratori K, Shioiri H, Nozue M (2000). Development of a simple and efficient method for transformation of buckwheat plant (Fagopyrum esculentum) using Agrobacterium tumefaciens. Biosci. Biotechnol. Biochem. 64: 845-847. Kojima M, Shioiri H, Nogawa M, Nozue M, Matsumoto D, Wada A, Saiki Y, Kiguchi K (2004). In planta transformation of kenaf plants (Hibiscus cannabinus var. aokawa no. 3) by Agrobacterium tumefaciens. J. Biosci. Bioeng. 98: 136-139. Kostoff D (2005). Pathogenesis-related proteins: research progress in the last 15 years. Gen. Appl. Plant Physiol. 31: 105-124. Li J, Tan X, Zhu F, Guo J (2010). A Rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. Int. J. Biol. 2: 127-131. Lin J, Zhou B, Yang Y, Mei J, Zhao X, Guo X, Hang X, Tang D, Lin X (2009). Piercing and vaccum in filation of mature embryo: a simplified method for Agrobacterium-mediated transformation of indica rice. Plant. Cell. Rep. 28: 1065-1074. Liu JJ, Sturrock R, Ekramoddoullah AKM (2010). The superfamily of thaumatin-like proteins: its origin, evolution, and expression towards biological function. Plant Cell, Rep. 29: 419-436. Okushima Y, Koizumi N, Kusano T, Sano H (2000). Secreted proteins of tobacco cultured BY2 cells: identification of a new member of pathogenesis-related proteins. Plant Mol. Biol. 42: 479-488. O'Leary SJB, Poulis BAD, Von Aderkas P (2007). Identification of two thaumatin-like proteins (TLPs) in the pollination drop of hybrid yew that may play a role in pathogen defense during pollen collection. Tree Physiol. 27: 1649-1659. Potrykus I (1990). Gene transfer to cereals: an assessment. Biotechnology, 8: 535-542. Radhajeyalakshmi R, Velazhahan R Balasubramanian P, Doraiswamy S (2005). Overexpression of thaumatin-like protein in transgenic tomato plants confers enhanced resistance to Alternaria solani. Arch. Phytopathol. Plant Prot. 38: 257-265. Razzaq A, Ishfaq AH, Imran M, Azhar H (2010). Development of in planta transformation protocol for wheat. Afr. J. Biotechnol. 5: 740750. Reimmann C, Dudler R (1993). cDNA cloning and sequence analysis of a pathogen-induced thaumatin-like protein from rice (Oryza sativa). Plant. Physiol. 101: 1113-1114.

7893

Robert WK, Selitrennikoff CP (1990). Zeamatin, an antifungal protein from maize with membrane-permealizing activity. J. Gen. Microbiol. 136: 1771-1778. Ross AF (1961b). Systemic acquired resistance induced by localized virus infection in plants. Virology, 14: 340-358. Seo MS, Bae CH, Choi DO, Rhim SL, Seo SC, Song PS, Lee HY (2002). Investigation of transformation efficiency of rice using Agrobacterium tumefaciens and high transformation of GPAT (glycerol-3-phosphate acyltransferase) gene relative to chilling tolerance. Plant. Biotech. 29: 85-92. Song F, Goodman RM (2001). Molecular biology of disease resistance in rice. Physiol. Mol. Plant. Pathol. 59: 1-11. Supartana P, Shimizu T, Shioiri H, Nogawa M, Nozue M, Kojima M (2005). Development of simple and efficient in planta transformation method for rice (Oryza sativa L.) using Agrobacterium tumefaciens. J. Biosci. Bioeng. 4: 391-397. Urushibara S, Tozawa Y, Kawagishi-Kobayashi M, Wakasa K (2001). Efficient transformation of suspension-cultured rice cells mediated by Agrobacterium tumefaciens. Breed. Sci. 51: 33-38. Van Loon LC, Rep M, Pieterse CMJ (2006). Significance of inducible defense related proteins in infected plants. Annu. Rev. Phytopathol. 44: 135-162. Velazhahan R, Chen- Cole K, Anuratha CS, Muthukrishnan S (1998). Induction of thaumatin- like proteins (TLPs) in Rhizoctonia solaniinfected rice and characterization of two new cDNA clones. Physiol. Plant. 102: 21-28. Vigers AJ, Wiedemann S, Roberts WK, Legrand M, Selitrennikoff CP, Fritig B (1992). Thaumatin-like pathogenesis-related proteins are antifungal. Plant Sci. 83: 155-161. Wang H, Ng TB (2002) Isolation of an antifungal thaumatin-like protein from kiwi fruits. Phytochem. 61: 1-6. Wang X, Tang C, Deng L, Cai G, Liu X, Han Q, Buchenauer H, Wei G, Han D, Huang L, Kang Z (2010). Characterization of a pathogenesisrelated thaumatin-like protein gene TaPR5 from wheat induced by stripe rust fungus. Physiol. Plant, 139: 27-38.

Full Length Research Paper

Copper and manganese content of the leaves of pepper (Capsicum annuum L.) grown on different soil types Milena Djurić 1, Senad Murtić2, Gordana Šekularac1, Nura Rešidović3, Vesna Milić4, Jasmina Zdravković5 and Ljiljana Bošković-Rakočević1 1

Department of Organic Chemistry and Plant Physiology, University of Kragujevac, Faculty of agriculture Čačak, Republic of Serbia 2 Mr. Sci. Senad Murtić, Department of Botany and Plant Physiology, Faculty of agriculture and food science, University Of Sarajevo, Zmaja od Bosne 8, 71000 Sarajevo, Bosnia and Herzegovina 3 Federal Institute for Agropedology, Sarajevo, Bosnia and Herzegovina 4 Faculty of Agriculture, East Sarajevo, Republic of Srpska, Bosnia and Herzegovina 5 Institut for vegetable crops, Smederevska Palanka, Republic of Serbia Accepted 28 March, 2012

The aim of this study was to determine the degree of copper (Cu) and manganese (Mn) uptake by pepper plants (Capsicum annuum L.) grown on four different soil types. The study was conducted in 2009 and 2010 under controlled conditions in a greenhouse. The experiment was set up according to a randomized block design with four treatments (soil types) in five replications. The results showed that the degree of Cu and Mn uptake by pepper plants was statistically significantly dependent upon the soil type used for pepper cultivation regardless of plant phenostage and year of the study. The degree of Cu uptake by pepper plants was highest in the treatment on chernozem, lower on fluvisol and pseudogley, and lowest on vertisol, while the degree of Mn uptake by pepper plants was highest on chernozem and lowest on pseudogley. The Cu content of pepper leaves in all the treatments was low as compared to related literature data irrespective of plant phenostage. Considering the potential antagonistic relationship between Cu and Mn in the soil solution, we can conclude that one of the reasons for the low copper uptake by pepper plants was the high concentration of Mn in all soil types tested. Key words: Pepper, soil types, manganese, copper. INTRODUCTION Peppers are vegetable crop traditionally grown in Serbia, particularly in the southern Serbian regions that offer exceptionally favorable conditions for their cultivation. The statistical data for the period of 2008 to 2011 showed that peppers in Serbia are cultivated on about 20,000 ha of land, being among the most common vegetable crops in Serbia. In terms of pepper cultivars, there has been an increasing use of cv. Dora in the last two years in Serbia. This cultivar is distinguished by its very long, large, finelycoloured bright yellow peppers primarily intended for

*Corresponding author. E-mail: murticsenad@hotmail.com. Tel: +387 33 225 72. Fax: +387 33 667 429.

fresh consumption (Cvikić et al., 2010). Apart from having fine appearance, the peppers of cv. Dora are fleshy, tasty easily thermally processed and exhibit early crop maturity. These are additional advantages that encourage producers to grow this pepper cultivar. Despite the long tradition of vegetable cultivation and favorable conditions for the development of vegetable production, pepper yields per unit area in Serbia are rather low as compared to the European average. This is partly due to high temperatures and insufficient rainfall amounts during the summer period when the water requirements of peppers are quite high, and partly due to the inadequate use of agro-technical measures, notably irrigation and fertilization, which have a substantial effect on pepper yield and quality. Apart from the above factors,

Duric et al.

successful pepper production also depends upon the type of soil used for the crop cultivation. Only soils that have a stable structure, show high biological activity, good aeration, water infiltration and retention capacity and contain a high level of available nutrients have the potential to become a medium for the cultivation of both vegetables and other agricultural crops (Resulović et al., 2008). In terms of its suitability for use in agriculture, the soil potential of Serbia is grouped into eight quality classes; the first four including soils suitable for agricultural production, and the latter four classes cover mostly uncultivable soils (Hadžić et al., 2002). The most common soil types in Serbia include chernozems, pseudogleys, vertisols and alluvial soils or fluvisols (Antonović et al., 2010). Chernozems are characterized by a stable structure, favorable water and air relationships, good thermal properties, high biological activity and a high content of available nutrients (Živković and Đorđević, 2003), which classifies these soils as class I soils. In terms of soil suitability for agricultural production, vertisols are classified among class III soils. These soils are formed on substrates containing over 30% of clay, with the clay content largely defining the soil characteristics (Milivojević, 2003). In a soil saturated with water, clay swells and consequently, the soil has a very low drainage capacity. In contrast, dry soils result in clay contraction and hence the formation of deep cracks into which the soils from the horizon A surface fall. This type of soils was named vertisols (lat. Verto-turn) due to the so-called turnover of soils. Regardless of their markedly unfavorable physical characteristics, vertisols have exceptionally favorable chemical properties, neutral to slightly alkaline pH, a high adsorption capacity and a good nitrogen and potassium supply. If physically improved through the use of adequate cultural operations (tillage combined with irrigation and fertilization), these soils can become highly suitable media for the cultivation of agricultural crops (Finck and Venkateswarlu, 1982). Along with vertisols, alluvial soils (fluvisols) are classified as class III soils according to their suitability for crop cultivation. Alluvial soils are formed as the result of fluvial deposits, and are quite diversified in terms of texture (Galić, 2006), being primarily dependent upon type of deposits, the power and amount of flood waters, and the human effect (Resulović, 2008). The specific process of formation and the environmental conditions occurring during the process induce considerable differences in both chemical and physical properties of fluvisols. Specifically, most fluvisols occurring in Serbia show both moisture excess during certain parts of the year and moisture deficiency during certain periods. In order to turn these fluvisol subtypes into suitable media for the successful cultivation of agricultural crops, irrigation should be used during dry periods and soil drainage during humid weather (Hadžić et al., 2002). Only if these conditions are satisfied and if

7895

the other cultural operations essential for plant development are performed can satisfactory yields and quality of agricultural crops be realistically expected. Pseudogley soils commonly occur in Serbia, but in terms of their suitability for crop cultivation they are classified as class IV soils. These soils have unfavorable water/air relationships and thermal properties (Rakočević-Bošković, et al., 2004), as induced by profile structure; the characteristic sequence of horizons. The top horizons on pseudogleys are composed of loam and clay, whereas lower horizons are highly colloidal and clayey and hence of low porosity. Consequently, under excessive moisture conditions, water stagnates in certain horizons, adversely affecting the soil water/air relationship. Unfortunately, the chemical properties of pseudogleys are likewise unfavorable. These soils are mostly acidic in reaction (pH 5 to 5.5), exhibit a low adsorption capacity and have a low supply of plant nutrients (Đurić et al., 2010). Pepper cultivation in Serbia is mostly practiced on chernozems, vertisols, fluvisols and pseudogleys, hence the use of these soils in the present study. The aim of this study was to determine the content of Cu and Mn in the leaves of pepper (Capsicum annuum L. cv. Dora) grown on four different soil types, in order to evaluate the effect of soil type on the uptake of these nutrients. Copper and manganese are dealt with in this study due to their vital role during photosynthesis. The intensity and efficiency of the photosynthetic process have a direct effect on crop yield and quality. The role of Mn is closely associated with water photolysis and electron transport to photosystem II (Nešković et al., 2003), whereas Cu is a component or activator of many enzymes taking part in the electron transport from photosystem II to photosystem I (Kralova et al., 1994; Lombardi and Maldonado, 2011). Moreover, copper has the ability to increase chlorophyll stability (Vukadinović and Lončarić, 1997). These reasons serve as an indication of the high importance of this element during photosynthesis. MATERIALS AND METHODS This study was conducted in 2009 and 2010 under controlled greenhouse conditions at the Faculty of Agronomy in Čačak. The material used in the study included pepper plants cv. Dora and 9.5 L pots filled separately with one of the following soil types: chernozem, vertisol, fluvisol and pseudogley. Soil samples were collected from plots located in a wider region of the Moravica district. The soil was sampled from different plot zones at a depth of up to 40 cm and mixed thereafter to obtain uniformity of each soil type tested. Immediately upon soil delivery to the greenhouse, the pots were filled with adequate soil types for pepper plants to be transplanted. The pepper plants (Capsicum annuum cv. Dora) used in the experiment were produced at a certified nursery located near the Faculty, and showed no substantial difference in terms of size and appearance. The study also involved chemical analysis of the test soil types to evaluate soil pH and Cu and Mn content. Soil pH was determined

7896

Afr. J. Biotechnol.

Table 1. pH value and average Cu and Mn content of the test soil types.

Soil type Chernozem Vertisol Fluvisol Pseudogley

Element content (ppm) Cu

37.0 58.0 35.2 34.1

400.1 490.1 447.0 512.0

pH value 6.3 7.1 6.0 5.3

Table 2. Average Cu content of pepper (Capsicum annuum L. cv. Dora) leaves.

Average Cu content of pepper leaves (µg/g dry matter) Soil type

Chernozem Vertisol Fluvisol Pseudogley F - test LSD0.05 = 0.383

Stage of development Flowering 2009 2010 2009 4.208ab 4.378a 2.960d 3.954b 4.049ab 2.976cd cd c 3.204 3.345 2.983cd cd e 3.053 2.544 2.946d Significant

by a digital pH meter (ISO 10390, 1994), and Cu and Mn levels in the soil samples were assessed by the AAS- method (ISO 11047,1998). The objective of this part of the analysis was to measure the Cu and Mn content in the soil prior to the experiment. The experiment on the effect of soil type on Cu and Mn content in pepper leaves was set up in a randomized block design in four treatments (soil types) and five replications. Each treatment included ten pepper plants, making up a total of 200 plants. The trial design was identical in both years. Throughout the experiment, all pepper plants received identical care, irrigation, fertilization, and other cultural operations vital for successful plant growth. Fertilization involved soil mineral fertilization depending on the plot treated, as follows: the fertilizers applied had an increased content of nitrogen at the beginning of the pepper growing season, an identical content of nitrogen, phosphorus and potassium (20-20-20) in the middle of the growing season, and a high content of potassium and calcium (5-20-30 + Ca) at the end of the season. The Cu and Mn content of pepper leaves was determined at both the flowering and full maturity phenostage using the AAS method (Hanlon, 1998). The data obtained were subjected to standard methods of the analysis of variance (ANOVA) and multiple test (LSD test) using Microsoft Excel 2003 and Statistica 5.0 programs. The data analysed were used to interpret the results of the study and draw

corresponding conclusions. RESULTS AND DISCUSSION The results of the chemical analysis of the test soil types are presented in Table 1. The average Cu content of pepper leaves at different plant development stages as dependent upon the type of soil used for pepper cultivation is outlined in Table 2. The results presented in Table 2 show that the Cu content in pepper leaves during

Full maturity 2010 3.015cd 2.990cd 2.919d 2.944d

both stages of plant development was significantly affected by the type of soil used for pepper cultivation. The highest Cu content in pepper leaves in both years was found in the treatment involving pepper cultivation on chernozem, regardless of the fact that the copper amount was not highest in this type of soil. Obviously, the degree of Cu uptake from this soil was highest as compared to the other types of soil, being primarily due to favorable physical and chemical properties of chernozem. Chernozem soils are characterized by favorable water/air relationships and thermal properties, as well as by a high content of available nutrients (Škorić et al., 1985), which eventually lead to an increased uptake of Cu by the plant. The results presented in Table 2 also show that pepper plants grown on vertisol had the highest leaf Cu content after plants cultivated on chernozem. However, given the fact that this type of soil was found to contain at least 30% more copper prior to the experiment as compared to the other soil types, the analysis suggests that the high leaf Cu content in pepper plants cultivated on vertisol was, in fact, negatively correlated with Cu uptake. The lower Cu uptake by the plant in this case cannot be attributed to a low vertisol supply with copper, but rather to unfavorable soil pH. The soil tested had a pH of 7, which made it unsuitable for copper uptake. Copper availability is higher in slightly acidic soils (Chaignon et al., 2009; Aref, 2011), as confirmed by the results of this study. In addition, Table 2 reveals that no statistically significant difference was observed in leaf copper content between pepper plants grown on fluvisol and those cultivated on pseudogley, irrespective of the plant pheno-

Duric et al.

7897

Table 3. Average Mn content of pepper (Capsicum annuum L. cv. Dora) leaves.

Soil type

Chernozem Vertisol Fluvisol Pseudogley F - test LSD0.05 = 0.843

Average Mn content of pepper leaves (µg/g dry matter) Stage of development Flowering Full maturity 2009 2010 2009 2010 24.061a 23.993a 20.008cd 19.960d a a d d 23.719 24.036 19.518 19.201 a a e ef 23.261 23.956 18.216 17.666 bc b fg g 20.521 20.951 16.988 16.591 Significant

stage and year of the study. The soil chemical analysis showed no significant difference between the two soil types in terms of the Cu content in the soil, suggesting a similar degree of copper uptake by pepper plants grown on fluvisol and those on pseudogley under the present trial conditions. Overall, the results outlined in Table 2 indicate that copper uptake by pepper plants is largely affected by soil type. With the data on soil Cu content considered, the results show that the highest degree of Cu uptake was observed in pepper grown on chernozem, somewhat lower on fluvisol and pseudogley, and the lowest on vertisol. Another important fact suggested by the results is that pepper leaves were found to have very low copper levels, regardless of the soil type used for pepper cultivation. The average copper values found in the plant dry matter as reported by many researchers range from 2 to 20 ppm, whereas the Cu content in the present study did not exceed 4 ppm in any treatment. This is due to the competitive relationship between Cu uptake by the root system and manganese (Nautival and Chatteriee, 2002). Accordingly, the decrease in Cu uptake in all soil types was most likely induced by high Mn levels. Antagonistic relationships between Cu and Mn were also reported by other authors in a similar research (Haldar and Mandal, 1982; Padua et al., 2010). The average content of Mn in pepper leaves in different plant development stages, as dependent upon soil type used for pepper cultivation, is presented in Table 3. The results presented in Table 3 suggest that as in the case with copper, the Mn content of pepper leaves was significantly affected by the type of soil used for pepper cultivation, regardless of plant phenostage and year of the study. The highest leaf Mn content was found in the treatment using chernozem soil for pepper cultivation, although this soil exhibited the lowest Mn content before the start of the experiment. This finding is sufficient to confirm the qualitative characteristics of this soil type and, hence, the justifiable classification of chernozem among class I soils according to its suitability for use in agriculture. As regards the effect of vertisol and fluvisol on the Mn content of pepper leaves, the results given in

Table 3 show no statistically significant difference in leaf Mn content between the pepper plants grown on the two soil types. However, as Mn levels were more than 20% higher in vertisol than in fluvisol prior to the experiment, it is clear that under the trial conditions fluvisol is much more favorable as a pepper growing medium in terms of Mn uptake. The disadvantage of vertisol used in this study is its unfavorable pH (pH 7.1), a major reason for the very low degree of Mn uptake by the plants in this type of soil. In general, manganese availability markedly declines in neutral and alkaline environments, but increases with increasing soil acidity (Millaleo et al., 2010). A low degree of Mn uptake by pepper plants was also determined in the treatment using pseudogley for pepper cultivation. The disadvantageous properties of pseudogley as a medium for pepper cultivation are further enhanced by the fact that Mn content in this soil type was significantly higher as compared to the other soil types tested. In terms of the effect of soil pH on Mn uptake, the above results are relatively unexpected, since the low pH of pseudogley should favor Mn uptake. However, apart from being largely dependent upon pH, Mn availability is also strongly governed by the soil oxido-reduction potential (Vukadinović and Lončarević, 1997), with the percentage of reduced readily absorbable forms of Mn 2+ 2+ (water soluble Mn and exchangeable sorbed Mn ) in the pseudogley tested being most likely very low. Conclusion The study on the effect of soil type on the copper and manganese content of pepper leaves suggests the following: the Cu and Mn content of pepper leaves was statistically significantly dependent upon the type of soil used for pepper cultivation, regardless of the plant phenostage and year of the study. Under the trial conditions, the degree of Cu uptake by pepper plants was highest on chernozem, somewhat lower on fluvisol and pseudogley, and lowest on vertisol. A similar trend was observed for Mn uptake, with the degree of uptake being, however, lowest on pseudogley. The comparison of the leaf Cu content in pepper plants

7898

Afr. J. Biotechnol.

in the present study with those reported in the related literature suggests that a very low copper concentration in pepper leaves was found in the present experiment, regardless of both plant phenostage and the type of soil used for pepper cultivation. Given the antagonism between Cu and Mn levels in the soil solution, one of the reasons for the low degree of copper uptake by the plant was most likely the high molybdenum concentration in all soil types. ACKNOWLEDGEMENT This study is part of the project Ref. No. 31059 titled ‘A Novel Breeding Concept for Vegetable Cultivars and Hybrids Intended for Sustainable Growing Systems involving the use of biotechnological methods’ financially supported by the Ministry of Science of the Republic of Serbia. REFERENCES Antonović G, Mrvić V, Saljnikov E, Perović V, Kravljanac-Kostić Lj, Nikoloski M, Jaramaz D (2010). Pedological catographie and soil classification in Serbia. Acta Biologica Iugoslavica-series A: Zemljište i biljka, 59(3): 139-157. Aref F (2011). Iron, copper and manganese concentration in maize leaves influenced by soil and foliar application of zinc sulfate and boric acid. Internat. J. Acad. Res. 3(4): 1080-1087. Bošković-Rakočević LJ, Ubavić M, Jakovljević M, Milivojević J (2004). Effects of pseudogley chemical amelioration of the changes in soil and plant phosphorus and potassium contents. J. Agric. Sci. 49(2): 149-158. Chaignon V, Quesnoit M, Hinsinger P (2009). Copper availability and bioavailability are controlled by rhizosphere pH in rape grown in an acidic Cu-contaminated soil. Environ. Pollut. 157(12): 3363-3369. Cvikić D, Pavlović N, Zdravković M, Zdravković J (2010). Dora-new pepper (Capsicum annuum L.) variety from Institut for vegetable crops, Smederevska Palanka. Book of abstracts of the Sixth Scientific-Research Symposium on Breeding and Seed Production of the Serbian Association of Plant Breeding and Seed Producers, Vršac. Đurić M, Pavlović R., Čivić H, Bošković-Rakočević LJ (2010). The effect of liming on element contents of pseudogley. Proceedings of Research papers, Institut PBK Agroekonomik, 16(1-2): 223-230. Finck A, Venkateswarlu J (1982). Chemical properties and fertility th management of Vertisols. Transactions of 12 Int. Cong. Soil Sci. 3: 61-79.

Galić Z, Ivanišević P, Orlović S, Klasnja B, Vasić V (2006). The main soil characteristics for poplar growing in Alluvial zones of lowland rivers. Ann. Faculty Eng. Hunedoara, 2: 97-102. Hadžić V, Nešić Lj, Belić M, Furman T, Savin L (2002). Potencial of soils in Serbia. Traktori Pogonske Mašine, 7(5): 43-51. Haldar M, Mandal LN (1982). Cu x Mn interaction and the availability of Zn, Cu, Fe, Mn, and P in the waterlogged rice soils. Plant Soil, 69 (1): 131-134. Hanlon E (1998). Elemental determination by AAS. Handbook of Reference Methods for Plant Analysis, Yash P. Kaira, CRS Press, USA, pp. 157-165. ISO 10390 (1994). Soil Quality - Determination of pH. International Organization for Standardization, Geneve, Switzerland, p. 5. ISO 11047 (1998). Soil Quality - Determination of cadmium, chromium, cobalt, copper, lead, manganese, nickel and zinc. Flame and Electrothermal AAS. International Organization for Standardization, Geneve, Switzerland, p. 6. Kralova K, Sersen F, Blahova M (1994). Effects of Cu(II) complexes on photosynthesis in spinach chloroplasts; Aqua (aryloxyacetato) copper(II) plexes. Gen. Physiol. Biophys. 13(6): 483-491. Lombardi AT, Maldonado MT (2011). The effects of copper on the photosynthetic response of Phaeocystis cordata. Photosynth. Res. 108(1): 77-87. Milivojević ŽJ (2003). Sadržaj i mobilnost mikroelemenata (Fe, Mn i Zn) u smonicama Srbije. PhD thesis, Faculty, Agricult. Univ. Belgrade, pp. 8-12. Millaleo R, Reyes-Diaz M., Ivanov AG, Mora ML, Alberdi M (2010). Manganese asessential and toxic element for plants: transport, accumulation and resistance mechanisms. J. Soil Sci. Plant, Nutr. 10(4): 470-481. Nautival N, Chatteriee C (2002). Copper - Manganese interaction in cauliflower. J. Plant Nutr. 25(8): 1701-1707. Nešković M, Konjević R, Ćulafić Lj (2003). Fiziologija biljaka. NNKInternational, Beograd. Padua M, Cavaco AM, Aubert S, Bligny R, Casimiro A (2010). Effects of copper on the photosynthesis of intact chloroplasts: interaction with manganese. Physiol. Plant, 138(3): 301-311. Resulović H, Čustović H, Čengić I (2008). Sistematika tla/zemljišta. Faculty, Agricult. Food Sci. Univ. Sarajevo, pp. 171-175. Škorić A., Filipovski G, Ćirić M (1985). Classification of Yugoslav Soils. Academy of sciences and arts of Bosnia and Herzegovina. Special publications. Tome LXXVIII, Sarajevo. Vukadinović V, Lončarić Z (1997). Ishrana bilja. Faculty of agriculture in Osijek. Živković M, Đorđević A (2003). Pedologija. Faculty, Agricult. Univ. Belgrade. 41: p. 2

African Journal of Biotechnology Vol. 11(31), pp. 7899-7905, 17 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3977 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Selection of alfalfa (Medicago sativa L.) cultivars for salt stress tolerance using germination indices Asieh Soltani1, Zahra Khodarahmpour2, Ali Ashraf Jafari3 and Shahram Nakhjavan4 1

MSc of Plant Breeding, Boroujerd Branch, Islamic Azad University, Boroujerd, Iran Department of Agronomy & Plant Breeding, Shoushtar Branch, Islamic Azad University, Shoushtar, Iran. 3 Associate Professor of Research Institute of Forests and Reglandds, Tehran, Iran 4 Department of Plant Breeding, Boroujerd Branch, Islamic Azad University, Boroujerd, Iran

Accepted 14 March, 2012

To select the most tolerant alfalfa genotypes to salinity stress, an experiment was performed in a factorial scheme having a completely randomized design (CRD) with three replications. The cultivar and salinity stress factors comprised 20 cultivars and four levels of salinity stress (control, 75, 150 and 225 mM) with NaCl, respectively. Results indicate that a significant decrease was observed in all traits except for mean germination time in stress conditions. The Bami Garmsiri cultivar showed the highest germination percentage, germination rate, radicle length, plumule length, seedling length, radicle length/plumule length ratio and seed vigour traits in salinity conditions. Results of the cluster analysis using the data for all measured traits and salinity levels clustered cultivars into two groups. Cultivars KFA1, KFA5, KFA12, KFA16, Yazdii Garmsiri, KFA2, KFA4, KFA11, Nikshahri Garmsiri and Bami Garmsiri as well as KFA3, KFA6, KFA7, KFA9, KFA17, KFA8, KFA13, KFA10, KFA14 and KFA15 were placed in the first and second clusters, respectively. Cultivars in the first cluster were found to be tolerant, while those in the second cluster were sensitive to salt. Bami Garmsiri was the most tolerant cultivar to salt. However, all the cultivars were used in large field trials to confirm their tolerance to salt waiting creation of new hybrid varieties. Key words: Cluster analysis, Nacl stress factorial scheme, completely randomized design, analysis, new hybrid varieties, Iran. INTRODUCTION Medicago sativa L. is a perennial, forage and diploid legume of the Fabaceae family (http://en.wikipedia.org/ wiki/Alfalfa, on the 18th February 2012). Salinity of soil and rarity of water resources is a serious threat to human lives and worldwide peace (Amer, 2010). Soil salinity may affect the germination of seeds either by creating low osmotic potential to the seeds preventing water uptake or through the toxic effects of Na+ and Cl- ions on germinating seed (Khajeh-Hosseini et al., 2003; Atak et al., 2006; Kaya et al., 2006; Golbashy et al., 2010). Likewise, the rarity of water triggers conflicts among waterside countries.

*Corresponding author. E-mail: Zahra_khodarahm@yahoo.com.

Seed sowing is generally considered as a stage that is both critical and sensitive in the life cycle of plants. Seeds are frequently exposed to unfavorable environmental conditions that may compromise the establishment of seedling (Figueiredo-e-Albuquerque and Carvalho, 2003). Alfalfa is moderately tolerant to salinity (Al-Khatib et al., 1992; Rumbaugh and Pendery, 1990) but there are high morphological variations between and within cultivars. Such morphological variations noted in center of diversity among the germplasms led to the selection of the most tolerant cultivars to salinity. It has also been reported that under saline conditions, germination ability of seeds differs from crop to crop and even a significant variation is observed amongst the different varieties of the same crop (Asana and Kale, 1965; Maas and Hoffman, 1977). Water stress acts by

7900

Afr. J. Biotechnol.

decreasing the percentage and rate of germination and seedling growth (Rahimi et al., 2006; Bhardwaj et al., 2010; Hamidi and Safarnejad, 2010). Several investigations of seed germination under salinity stress have indicated that seeds of most species achieve their maximum germination in distilled water and are very sensitive to elevated salinity at the germination and seedling phases of development (Monirifar, 2008; Bhardwaj et al., 2010; Yarnia, 2011; Torabi et al., 2011). Monirifar (2008) studying Syah-Roud, Gara-Yonjeh, Hasht-Roud, Khor-Khor and Bash-Kand cultivars indicated that the response was significantly different among cultivars and within the NaCl levels. The NaCl effect was significant in reducing all measured traits of all the five ecotypes. Bash-Kand had recorded the highest yield reduction percentage, whereas Syah-Roud and Gara-Yonjeh cultivars had the lowest one, in general, Syah-Roud and Gara-Yonjeh expressed the highest tolerant to salinity. Sodium chloride (NaCl) salinity is one of the major environmental factors that limit plant growth, productivity and distribution (Wang et al., 2003). Many tools are now available to study relationships among cultivars, including various types of molecular markers; however, morphological characterization is the first step in the description and classification of germplasm (Smith and Smith, 1989). The availability of genetic variation, both at intra or inter-specific level, is a prerequisite for the success of breeding programs (Ashraf et al., 1987; Maas 1986). Genetic variability for salt tolerance was reported in alfalfa (Mckimmie and Dobrenz, 1991; Yarnia et al., 2001; Peel et al., 2004; Torabi et al., 2011). Alfalfa is being increasingly cultivated in Iran; therefore, it is important to develop new alfalfa hybrids with a high genetic capacity to tolerate salt stress. The first important step in breeding new varieties with high salt tolerance is to lay out useful and substantial genetic variation in tolerance to salinity stress. The tolerance level to salinity of cultivars KFA1, KFA2, KFA3, KFA4, KFA5, KFA6, KFA7, KFA8, KFA9, KFA10, KFA11, KFA12, KFA13, KFA14, KFA15, KFA16, KFA17, Bami Garmsiri, Nikshahri Garmsiri and Yazdii Garmsiri is still not observed; this is a problem that needs urgent consideration. Among the cultivars, some might be tolerant and so they adapt to saline soils from Iran, though this is as an assumption. The objective of this research was to select the most tolerant genotypes to salinity stress in further hybridization purposes. MATERIALS AND METHODS Plant material and culture conditions Twenty alfalfa cultivars (KFA1, KFA2, KFA3, KFA4, KFA5, KFA6, KFA7, KFA8, KFA9, KFA10, KFA11, KFA12, KFA13, KFA14, KFA15, KFA16, KFA17, Bami Garmsiri, Nikshahri Garmsiri and Yazdii Garmsiri) were provided by the Department of Plant and Seed Research Institute of Karaj, Iran. These cultivars were used in four

levels of salinity treatment (distilled water as control, 75, 150 and 225 mM) of sodium chloride (NaCl) solution. This experiment was carried out at Seed Laboratory, Islamic Azad University - Shoushtar Branch in Iran in 2011. At each level of stress, 25 seeds of each genotype were selected and sterilized in sodium hypochlorite (1%) and then washed in distilled water twice. The seeds of cultivars were germinated in Petri-dishes (11 cm) on two layers of filter paper (90 mm) in an incubator (40% relative humidity) maintained at 25°C. Experimental design and measured variables 20 x 4 factorial scheme having a completely randomized design with three replications was used. In all, 240 treatments were tested. Two factors comprising cultivar and salinity with 20 (KFA1, KFA2, KFA3, KFA4, KFA5, KFA6, KFA7, KFA8, KFA9, KFA10, KFA11, KFA12, KFA13, KFA14, KFA15, KFA16, KFA17, Bami Garmsiri, Nikshahri Garmsiri and Yazdii Garmsiri) and 4 levels (control, 75, 150 and 225 mM) of sodium chloride (NaCl) for each were used, respectively. Treatment consisted of one cultivar associated with one level of salinity laid out in one Petri-dish. Daily, germination rate was calculated and the filter papers were replaced. NaCl soluble was added to the treatment. Seeds were considered germinated when the emergent radicle reached 2 mm length. After 10 days, germination percentage was calculated by ISTA (1996) standard method. On the 10th day, the germination percentage (Formula 1), mean germination time (MGT) (Ellis and Robert, 1981), germination rate (Formula 2), radicle length, plumule length, seedling length, radicle length/plumule length ratio and seed vigour (Formula 3) were calculated. Formula 1:

GP 

SNG  100 SN 0

GP is the germination percentage, SNG is the number of germinated seeds, and SNO is the number of experimental seeds with viability (Scott et al., 1984).

Formula 2:

GR 

N  (n  g )

Where, GR is the germination rate; n is the number of germinated seed on gth day and g is the number of total germinated seeds (Ellis and Robert, 1981). Formula 3: Seed vigour = germination percentage × seedling length Statistical analyses For statistical analysis, the data of germinating percentage were transformed to arcsin X . Analyses were done using the Minitab 100 software. Differences among means were determined by Duncan’s Multiple Range Tests (DMRT) at 1% probability level. Cluster analysis is a convenient method for organizing a large data set so information can be retrieved more efficiently and it can be easily understood without the need for complicated mathematical techniques. All investigated traits were subjected to hierarchical cluster analysis using the procedure of Ward’s minimum variance method as a clustering algorithm. Ward’s minimum method is a hierarchical clustering procedure in which similarity is used to join clusters and is calculated as the sum of squares between the two clusters summed over all variables (Hair et al., 1998). It minimizes them within cluster sums of squares

Soltani and Khodarahmpour

7901

Table 1. Cultivar and salinity level effects and their interaction on the recorded germination indices.

Source of variance

Germinatio n (%)

Mean germination time (day)

Salinity levels Cultivar Salinity levelsĂ&#x2014;Cultivar Error CV%

3 19 57 160 -

674.367** 7328.086** 133.549** 66.367 9.7

0.090 ns 77.670** 0.086 ns 0.067 9.4

Germination rate (number in day) 0.002* 0.0852** 0.001ns 0.001 8.1

Radicle length (cm)

Plumule length (cm)

Seedling length (cm)

Radicle length/Plumule length ratio

Seed vigour

1.050** 123.907** 0.410 ns 0.397 24.3

0.324** 70.729** 0.193 ns 0.150 16.1

2.467** 363.695** 0.690 ns 0.795 17.9

0.064 ns 6.137** 0.055 ns 0.063 24.2

3.697** 364.200** 0.952 ns 0.801 20.3

ns and **, non significant and significant at 1% probability level respectively.

Table 2. Classification of means simple effect of salinity stress levels on germination and seedling growth.

Salinity stress (mM)

Germination (%)

0 75 150 225 Percentage of decrease

92.033a 90.467a 86.067b 68.000c -26

Mean germination time (day) 2.15917 c 2.07650 c 2.36217 b 4.47610 a -

Germination rate (number in day) 0.464167 a 0.480500 a 0.424500 b 0.221356 c -54

Radicle length (cm) 3.9232 a 3.5983 a 2.0030 c 0.8391 d -79

Plumule length (cm)

Seedling length (cm)

Radicle length/Plumule length ratio

Seed vigour

3.73117 a 2.81950 b 1.78850 c 1.28190 d -66

7.2657 a 6.8057 b 3.8082 c 2.0693d -72

1.05457c 1.27950a 1.12983 b 0.66362 d -54

669.90 a 616.53 b 330.60 c 144.98 d -78

Means with similar letter(s) in each trait is not significantly different at 1% probability level according to Duncanâ&#x20AC;&#x2122;s Multiple Range Test.

across all partitions.

RESULTS AND DISCUSSION Results show that, there were significant differences between salinity stress levels except for mean germination time and radicle length/ plumule length ratio. For cultivars, there were significant differences for all traits which demonstrated existence of high diversity among cultivars studied for salinity tolerance. Also, analysis of variance showed that interaction effects were significant only for germination percentage (Table 1).

Germination percentage and germination rate It was observed that in all cultivars, there was a decrease in germination percentage because increment salinity stress and maximum germination percentage was delayed. In this experiment, different cultivars had different response to the salinity stress. Among the alfalfa cultivars, Bami Garmsiri had the highest germination percentage and germination rate, while KFA15 had the lowest germination percentage and germination rate (Table 3). However, maximum reduction in germination percentage and germination rate was observed at the highest level at 225 mM of NaCl

level (Table 2). Results show that germination percentage (26%) and germination rate (54%) decreased with a decrease in osmotic potential, while the maximum germination percentage and germination rate were obtained at the control treatment and 75 mM of NaCl (Table 2). Similar results were also reported by Rahimi et al. (2006), Bhardwaj et al. (2010) and Hamidi and Safarnejad (2010) on alfalfa at drought stress condition. Some studies showed that stress can contribute to improve germination rate and seedling emergence in different plant species by increasing the expression of aquaporins (Gao et al., 1999), enhancement of ATPase activity, RNA and acid

7902

Afr. J. Biotechnol.

Table 3. Classification of means simple effect of cultivar on germination and seedling growth.

Cultivar

Germination (%)

KFA1 KFA2 KFA3 KFA4 KFA5 KFA6 KFA7 KFA8 KFA9 KFA10 KFA11 KFA12 KFA13 KFA14 KFA15 KFA16 KFA17 Bami Garmsiri Nikshahri Garmsiri Yazdii Garmsiri

86.833 a-g 85.000 a-g 77.091 g 78.000fg 94.000 ab 80.333efg 86.8333 a-g 88.667 a-e 84.667 b-g 92.667 abc 87.000 a-g 83.667 c-g 83.167 c-g 88.000 a-f 61.3333 h 91.000 abcd 82.333 defg 95.000 a 77.500 g 81.000 defg

Mean germination time (day) 2.8233 ab 2.9175 a 2.7082 ab 2.6950 ab 2.8017 ab 2.8092 ab 2.8708 a 2.7100 ab 2.8225 ab 2.7840 ab 2.7058 ab 2.7508 ab 2.7992 ab 2.7042 ab 2.8708 a 2.6683 ab 2.7667 ab 2.5283 b 2.7208 ab 2.7650 ab

Germination rate (number in day) 0.40000 abc 0.39167 abc 0.39727 abc 0.40250 abc 0.39250 abc 0.39667 abc 0.39583 abc 0.40250 abc 0.38833 cb 0.40000abc 0.41167 ab 0.39750 abc 0.38750 bc 0.39667 abc 0.36833 c 0.41250 ab 0.39083 abc 0.43167 a 0.40000 abc 0.40333 abc

Radicle length (cm)

Plumule length (cm)

Seedling length (cm)

2.5908 abc 2.9558 abc 2.4773 abc 2.8167 abc 2.7417 abc 2.2800 bc 2.4108 abc 2.4758 abc 2.4333 abc 2.1958 c 3.1417 a 2.7125 abc 2.5650 abc 2.1608 c 2.3055 bc 2.5683 abc 2.5383abc 3.1475 a 3.0658 ab 2.4950 abc

2.4358 ab 2.3842 ab 2.3764 ab 2.5075ab 2.6708 a 2.3892 ab 2.2592 ab 2.3225 ab 2.2400 ab 2.1550 b 2.6150 ab 2.5667 ab 2.3292 ab 2.2067 ab 2.3618 ab 2.3067 ab 2.2575 ab 2.6817 a 2.6158 ab 2.6050 ab

4.9433 a-e 5.3400a-e 4.3945 a-e 5.4425 abcd 5.4100 abcd 4.5858 cde 4.5867 cde 4.7983 a-e 4.6733 bcde 4.2675 e 5.7567 ab 5.2792 a-e 4.8942 a-e 4.3675 de 4.6673 bcde 4.8750 a-e 4.7958 a-e 5.8167 a 5.7017 abc 5.1000 a-e

Radicle length/Plumule length ratio 1.0242 a 1.2150 a 1.0309 a 1.1017a 1.0075 a 0.9342 a 1.0633 a 1.0383 a 1.0417 a 1.0442 a 1.1317a 1.0317a 1.0833a 0.9317a 0.9936a 1.0567a 1.0658a 1.0908a 1.1150a 0.8975a

Seed vigour 445.67 bcd 589.42 abcd 391.45 de 446.67 bcd 510.17 abc 385.83 de 413.00 cde 445.92 bcd 410.67 cde 405.75 cde 531.42 ab 455.17 bcd 442.00 bcd 404.83 cde 315.45 e 460.00 abcd 397.67 cde 564.08 a 480.92 abcd 448.75 bcd

Means with similar letter(s) in each trait are not significantly different at 1% probability level according to Duncanâ&#x20AC;&#x2122;s Multiple Range Test.

phosphathase synthesis (Fu et al., 1988), also by increase of amylases, proteases or lipases activity (Ashraf and Foolad, 2005).

The maximum mean germination time was obtained at 225 mM of NaCl (Table 2). The results are in agreement with Rahimi et al. (2006) and Hamidi and Safarnejad (2010) on alfalfa.

Mean germination time Among the alfalfa cultivars, KFA2, KFA7 and KFA15 had the highest mean germination time and Bami Garmsiri had the lowest mean germination time (Table 3). Mean germination time was delayed by decreasing water potential (Table 2).

Radicle, plumule, seedling length and radicle length/plumule length ratio The radicle length provides an important clue to the response of plants to salinity stress. A special reduction in the radicle length, the plumule length

and the seedling length of all cultivars of alfalfa was observed because of salt stress. Among the alfalfa cultivars, KFA11 and Bami Garmsiri had the longest radicle length, KFA5 and Bami Garmsiri had the longest plumule length and Bami Garmsiri had the longest seedling length, but between cultivars, there was no significant difference for radicle length/plumule length ratio (Table 3). Results of this study show that radicle length (79%), plumule length (66%) and seedling length (72%) decreased with increasing salinity levels in all cultivars. The most effective level in reducing

Soltani and Khodarahmpour

7903

Dendrogram in Germinator Ward Linkage; Euclidean Distance

Distance

17.88

11.92

5.96

0.00

16 20

19 18

13 10

14 15

Observations Figure 1. Cluster analysis of alfalfa cultivars under different levels of salinity stress using Wardâ&#x20AC;&#x2122;s minimum variance method. 1, KFA1; 2, KFA2; 3, KFA3; 4, KFA4; 5, KFA5; 6, KFA6; 7, KFA7; 8, KFA8; 9, KFA9; 10, KFA10; 11, KFA11; 12, KFA12; 13, KFA13; 14, KFA14; 15, KFA15; 16, KFA16; 17, KFA17; 18, Bami Garmsiri; 19, Nikshahri Garmsiri; 20, Yazdii Garmsiri.

these attributes was 225 mM of NaCl (Table 2). The best level of NaCl concentration in radicle length was the control treatment and 75 mM of NaCl, and for plumule length and seedling length, it was the control treatment and for radicle length/Plumule length ratio, it was 75 mM NaCl (Table 2). Water stress acts by decreasing the percentage rate of germination and seedling growth (Rahimi et al., 2006; Bhardwaj et al., 2010; Hamidi and Safarnejad, 2010). Bhardwaj et al. (2010) and Monirifar (2008) reported that with increasing salinity concentration, radicle, plumule and seedling length decreases. Seed vigour Among the cultivars, Bami Garmsiri was affected the least by salinity stress because it gave the lowest reduction rate for seed vigour (Table 3). Seed vigour (78%) decreased with increased concentration of NaCl solution. The best level in seed vigour was the control treatment (Table 2). Of all the cultivars, Bami Garmsiri produced the highest seed vigour at all salt regimes while KFA15 cultivar produced the lowest seed vigour at all salt regimes. Hamidi and Safarnejad (2010) studied alfalfa cultivars in drought stress conditions and reported that seed vigour decreased with a decrease in osmotic potential. Classification of alfalfa cultivars Results of cluster analysis (Wardâ&#x20AC;&#x2122;s minimum variance

method) arranged cultivars at interval 11.92 into two groups (Figure 1). The results of the first cluster which included ten of the cultivars (KFA1, KFA5, KFA12, KFA16, Yazdii Garmsiri, KFA2, KFA4, KFA11, Nikshahri Garmsiri and Bami Garmsiri) for the following traits: germination percentage, germination rate, radicle length, plumule length, seedling length, radicle length/plumule length ratio and seed vigour, were higher than the total mean, while for the mean germination time trait, they were lower than the total mean (Table 4). The results of the second cluster which included ten cultivars (KFA3, KFA6, KFA7, KFA9, KFA17, KFA8, KFA13, KFA10, KFA14 and KFA15) for all desirable traits: germination percentage, germination rate, radicle length, plumule length, seedling length, radicle length/plumule length ratio and seed vigour, were lower than the total mean, while for the undesirable trait mean germination time, they were higher than the total mean. Therefore, cultivars KFA1, KFA5, KFA12, KFA16, Yazdii Garmsiri, KFA2, KFA4, KFA11, Nikshahri Garmsiri and Bami Garmsiri in the first cluster are tolerant to salinity stress and cultivars KFA3, KFA6, KFA7, KFA9, KFA17, KFA8, KFA13, KFA10, KFA14 and KFA15 in second cluster are sensitive to salinity stress. Yarnia et al. (2001) reported that Golestan (20313) and Fao (2526) were the most tolerant and sensitive respectively to salinity stress. Lines Hamadani Ahar and Sistan and Baluchestan lines were selected as semisensitive and semitolerant respectively. Torabi et al. (2011) reported that the ecotypes Bami, Galehbani, Nik-Shahri, Rehnani and Gharegozloo were superior to others in terms of salt tolerance at germination stage. Rezaei et al. (2010) assessed genetic diversity in alfalfa ecotypes from central and eastern regions of Iran using SSR markers and reported that

7904

Afr. J. Biotechnol.

Table 4. Means and deviation precentage from total mean for alfalfa difference traits of groups in cluster analysis in salinity condition.

Traits

Germination percentage Mean germination time (day) Germination rate (number in day) Radicle length (cm) Plumule length (cm) Seedling length (cm) Radicle/Plumule length ratio Seed vigour

Cluster 1 KFA1, KFA5, KFA12, KFA16, Yazdii Garmsiri, KFA2, KFA4, KFA11, Nikshahri Garmsiri and Bami Garmsiri 85.87, +2.06 2.74, -1.08 0.40, +1.58 2.76, +6.4 2.51, +4.38 5.37, +7.55 1.07, +3.61 493.2, +11.97

despite the similarities of genetic structures between the ecotypes from two regions, high variation was observedamong individual plants possibly due to the high allogamy 90%), insects activity (particularly bees) and pollen transmission among ecotypes. Conclusion In this study, we tested the hypothesis assuming the existence of some cultivars tolerant to salinity. We observed that there exist some cultivars tolerant to saline stress. Indeed, KFA1, KFA5, KFA12, KFA16, Yazdii Garmsiri, KFA2, KFA4, KFA11, Nikshahri Garmsiri and Bami Garmsiri expressed a good tolerance to salt stress. Afterward, the most important result was presented among others. Salt stress adversely affected the germination percentage, germination rate, mean germination time, radicle length, plumule length, seedling length and seed vigour of 20 cultivars of alfalfa, and a significant variation in salt tolerance was observed among all the cultivars. In conclusion, the germination and early seedling growth stages of the investigated cultivars showed different responses to salt stress. Furthermore, germination failure due to NaCl resulted from an osmotic barrier induced by NaCl. Redmann (1974) found that the osmotic effect of NaCl on germination of alfalfa was more important than the toxic effect. However, seedling growth was more sensitive to salt stress than was germination; this is because germination percentage (26%) and seedling length (72%) decreased. Obviously, acceptable growth of plants in arid and semiarid lands which are under exposure of salinity stress is related to the ability of seeds to undergo the best germination under unfavorable conditions, hence evaluation of salinity tolerant genotypes is important at the primary growth stage. Ranking of the genotypes was done using the data of all measured traits at all levels of salt. Results show that

Cluster 2 KFA3, KFA6, KFA7, KFA9, KFA17, KFA8, KFA13, KFA10, KFA14 and KFA15 82.49, -1.96 2.80, +1.08 0.39, -1.41 2.42, -6.56 2.3, -4.37 4.6, -7.82 0.99, -3.88 387.8, -14.01

Total mean

84.14 2.77 0.398 2.59 2.405 4.99 1.03 440.50

the cultivars KFA1, KFA5, KFA12, KFA16, Yazdii Garmsiri, KFA2, KFA4, KFA11, Nikshahri Garmsiri and Bami Garmsiri were in the first cluster and for the traits of germination percentage, germination rate, radicle length, plumule length, seedling length, radicle length/plumule length ratio and seed vigour results were higher than the total mean. For mean germination time, trait was lower than the total mean. Therefore, cultivars of the first cluster are tolerant to salinity stress. The second cluster included cultivars KFA3, KFA6, KFA7, KFA9, KFA17, KFA8, KFA13, KFA10, KFA14 and KFA15 and for all desirable traits; germination percentage, germination rate, radicle length, plumule length, seedling length, radicle length/plumule length ratio and seed vigour results were lower than the total mean; for undesirable trait, mean germination time was higher than the total mean. Therefore, cultivars of the second cluster are sensitive to salinity stress. In this research, Bami Garmsiri cultivar had the highest germination percentage, radicle length, plumule length, seedling length and seed vigour traits, and therefore was found to be the most tolerant to salt stress. These results can be related to some earlier studies in which cultivars identified as salt tolerant at the earlier growth stages showed tolerance when tested at the later growth stages. Although, a considerable magnitude of variation for salt tolerance was observed in the 20 cultivars of alfalfa while screening them at germination stages, further studies need to be carried out to assess whether the genotypes marked as salt tolerant at the initial growth stages maintain their degree of salt tolerance when tested as adult plants. REFERENCES Al-Khatib M, McNeilly T, Collins J (1992). The potential of selection and breeding for improved salt tolerance in lucerne (Medicago sativa L.). Euphytica, 65: 43-51. Amer KH (2010). Corn crop response under managing different irrigation and salinity levels. Agric. Water Manage. 97: 1553-1563.

Soltani and Khodarahmpour

Asana RD, Kale VR (1965). A study on salt tolerance of four wheat varieties. Ind. J. Plant physiol. 8: 5-22. Ashraf M, Foolad MR (2005). Pre – sowing seed treatment – a shotgun approach to improve germination growth and crop yield under saline and none – saline conditions. Adv. Agron. 88: 223-271. Ashraf M, McNelly T, Bradshaw, AD (1987). A developmental window for salt adaptation in Sorghum bicolor. J. Expe. Bot. 44: 645-652. Atak M, Kaya MD, Kaya G, Çıkılı Y, Çiftçi CY (2006). Effects of NaCl on the germination, seedling growth and water uptake of triticale. Turk. J. Agric. For. 30: 39-47. Bhardwaj, SH, Sharma, NK, Srivastava PK, Shukla G (2010). Salt tolerance assessment in alfalfa (Medicago sativa L.) ecotypes. Bot. Res. J. 3(1-4): 1-6. Ellis RA, Roberts EH (1981). The quantification of ageing and survival in orthodox seeds. Seed Sci. Technol. 9: 373-409. Figueiredo e Albuquerque MC, De Carvalho NM (2003). Effect of type of environmental stress on the emergence of sunflower (Helianthus annuus L.), Soybean (Glycine max (L.) Merril) and maize (Zea mays L.) seeds with different levels of vigour. Seed. Sci. Techno. 31: 465469. Fu JR, Lu XH, Chen RZ, Zhang BZ, Liu ZS, Li ZS, Cai DY (1988). Osmoconditioning of peanut Arachis hypogaea L. seeds with PEG to improve vigour and some biochemical activities. Seed Sci. Tech. 16: 197-212. Gao YP, Young L, Bonham-smith P, Gusta LV (1999). Characterization and expression of plasma and tonoplast membrane aquaporins in primed seed of Brassica napus during germination under stress conditions. Plant Mol. Biol. 40: 444-635. Golbashy M, Khavari Khorasani S, Ebrahimi M, Choukan R (2010). th Study of response of corn hybrids to limited irrigation. 11 Iranian Crop Science Congress Tehran, 24-26 July. University of Shahid Beheshti. p. 218. Hair FF, Anderson RE, Tatham RL, Black WC (1998). Multivariate data analysis, 5th Ed. Prentice-Hall Inc, Upple Saddle River, NJ, USA. pp. 239-325. Hamidi H, Safarnejad A (2010). Effect of drought stress on alfalfa cultivars (Medicago sativa L.) in germination stage. AmericanEurasian J. Agric. Environ. Sci. 8(6): 705-709. http://en.wikipedia.org/wiki/Alfalfa ISTA (International Seed Testing Association) (1996). International rules for seed testing rules. Seed Sci. Techno. Supplement 24: 155-202. Kaya MD, Okçu G, Atak M, Çıkılı Y, Kolsarıcı O (2006). Seed treatments to overcome salt and drought stress during germination in sunflower (Helianthus annuus L.). Eur. J. Agron. 24: 291-295. Khaje-hosseini M, Powell AA, Bingham IJ (2003). The interaction between salinity stress and seed vigour during germination of soybean seeds. Seed Sci. Technol. 31: 715-725. Maas EV, Hoffman GJ (1977). Crop salt tolerance current assessment. J. Irrig. Drain Div. ASCE. 103:115-134. Mass EV (1986). Salt tolerance in plants. Appl. Agric. Res. 1: 12-25.

7905

Mckimmie T, Dobrenz AK (1991). Ionic concentrations and water relations of alfalfa seedlings differing in salt tolerance. Agron J. 83: 363-367. Monirifar H (2008). Tolerance of Five Azarbaijan Alfalfa Ecotypes to Salinity. Int. Meeting on Soil Fertility Land Manage. Agroclimatol. Turkey. pp. 709-713. Peel M, Waldron B, Jensen K, Chatterton N, Horton H, Dudley L (2004). Screening for salinity tolerance in alfalfa: A repeatable method. Crop Sci. 44: 2049. Rahimi A, Jahansoz MR, Rahimian Mashhadi HR, Poustini K, Sharifzade F (2006). Effect of iso-osmotic salt and water stress on germination and seedling growth of two Plantago species. Pak. J. Biol. Sci. 9: 2812-2817. Redmann RE (1974). Osmotic and specific ion effect on the germination of alfalfa. Can. J. Bot. 52: 803-808. Rezaie M, Naghavi MR, Maali-Amiri R (2010). Assessment of genetic diversity in alfalfa (Medicago sativa L.) ecotypes from central and eastern regions of Iran using SSR markers. Iran. J. Crop Sci. 12(4): 520-532. Rumbaugh M, Pendery B (1990). Germination salt resistance of alfalfa (Medicago sativa L.) germplasm in relation to subspecies and centers of diversity. Plant. Soil. 124: 47-51. Scott SJ, Jones RA, Williams WA (1984). Review of data analysis methods for seed germination. Crop Sci. 24: 1192-1199. Smith JSC, Smith OS (1989). The description and assessment of distances between inbred lines of maize: The utility of morphological, biochemical, and genetic descriptors and a scheme for the testing of distinctiveness between inbred lines. Maydica, 34: 151-161. Torabi M, Halim RA, Sinniah UR, Choukan R (2011). Influence of salinity on the germination of Iranian alfalfa ecotypes. Afr. J. Agric. Res. 6(19): 4624-4630. Wang W, Vinocur B, Altman A (2003). Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta, 218: 1-14. Yarnia M, Heidari Sharif Abad H, hashemi Dezfuli SA, Rahimzade Khoei F, Ghalavand A (2001). Evaluation of alfalfa (Medicago sativa L.) lines to salinity tolerance. Iran. J. Crop Sci. 3(2): 12-26.

Full Length Research Paper

Plant regeneration and stimulation of in vitro flowering in Eruca sativa Mill. Madan Mohan Sharma*, Mukta Dhingra, Anju Dave and Amla Batra Department of Botany, University of Rajasthan, Jaipur, India. Accepted 27 February, 2012

Explants such as apical buds, axillary buds, cotyledons, cotyledonary nodes, leaves, hypocotyls and immature embryonal axes from in vitro-grown plantlets were inoculated on the Murashige and Skoog (MS) medium supplemented with 4.44 µM 6-benzylaminopurine in combination with 2.85 µM indole-3acetic acid. Best multiple shoots formation was obtained with cotyledonary nodes. Each inoculated explant produced 18.10 ± 0.66 shoots within 2 to 3 weeks. These shoots were separated carefully and were transferred to the fresh half strength MS solid medium with indole-3-butyric acid (4.90 µM) for the development of the roots. These in vitro-developed plantlets produced flowers on the same medium with supplementation of 6-furfuril kinetin (0.23 µM). These plantlets were successfully transferred to the soil where they grew well for 8 to 10 weeks with 80% survivability. Key words: Eruca sativa, cotyledonary nodes, in vitro regeneration, in vitro flowering, shoot multiplication.

INTRODUCTION Eruca sativa Mill. belonging to the family Brassicaceae attain a height of 2 to 4 feet, it is branched, erect, hairy, and leaves are borne on the stem in an alternate fashion. Flowers are self sterile bright yellow in colour. Fruit is siliqua, one inch in length. Seeds are small, light reddish brown in colour. Flowering occurs in the month of January to April. Effect of high temperature of Rajasthan is very much pronounced on flowering and consequently on seeds. A high temperature during vegetative growth produces the highest seed yield. High temperature during early seed formation affects the seed oil content and quality adversely. The plant is able to withstand temperature up to 40°C. It has photoperiod ranges of 10 h. Maturity of the plant takes place from 60 to 340 days. Brassicaceae family contributes fifth major portion amongst the oil seed crops. It also has diversified medicinal and therapeutic properties like astringent,

*Corresponding author. E-mail: drmadansharma@gmail.com Abbreviations: BAP, 6-Benzylaminopurine; Kn, 6-furfuryl amino purine; IAA, indole-3- acetic acid; IBA, indole-3-butyric acid; NAA, α-naphthalene acetic acid.

diuretic, digestive, emollient, tonic, depurative, laxative, rubefacient, stimulant, anti-tumor, anti-ulcer and hepatoprotective activities (Yaniv et al., 1998; Modlinger et al., 2004). It is mainly used for the production of oil, which is being used for domestic lighting. It is also used in industries. Industrial uses of high erueic oil content could be expanded since long chain fatty acids involved have considerable advantages. Oil seeds constitute important group of crops as they are an easily available source of energy and nutrition. Inspite of the recalcitrant nature of certain oil seed crops like cumin, sesamum, arachin, Jatropha, Ricinus, Brassica, etc., reports are available on their in vitro regeneration (Batra and Dhingra, 1991; Khan et al., 2009). Plant regeneration of E. sativa via shoot tip culture, somatic embryogenesis, mesophyll protoplasts, zygotic embryos and isolated microspore culture has previously been reported (Ahloowalia, 1987; Sikdar et al., 1987; John and Batra, 1994; Zhang et al., 2005; Leskovsek et al., 2008), but the regeneration frequencies were low and the protocols were complicated. This paper presents the findings of an experiment to work out a suitable protocol on efficient and reliable regeneration system via cotyledonary nodes in E. sativa

Sharma et al.

and the role of phytohormones in in vitro flowering in this plant species. Thus, the protocol developed during the present investigation may contribute towards improvement of this crop quality in Brassicaceae family. MATERIALS AND METHODS

7907

taken after 3 weeks of culture. The mean number of shoots per explant was determined after 14 and 21 days of culture. All experiments were repeated at least thrice and consisted of 28 replicates. Data were analyzed statistically.

RESULTS AND DISCUSSION

Procurement of plant materials

Multiple shoot induction

Mature dried seeds of E. sativa were procured from Durgapura Agriculture Research Station, Jaipur (Rajasthan) India. Seeds were washed three to four times with distilled water. Seeds were then treated with 0.1% (v/v) Tween-20 solution for 10 min, rinsed with distilled water at least thrice. Further surface-sterilization treatment was conducted in laminar air flow chamber. Seeds were dipped in 0.1% (w/v) freshly prepared aqueous mercuric chloride (HgCl2) solution for 3 to 5 min, followed by 30 s in 70% (v/v) ethanol, and then washed three to four times with sterile distilled water. Surface sterilized seeds were inoculated on half strength MS medium supplemented with 1.0% sucrose and 0.8% agar.

During the present studies, micropropagation was obtained by in vitro grown explants. Two weeks old germinated seedlings were used for the excision of explants (Figure 1A). However, for these explants, surface sterilization was not required since they were already grown under aseptic conditions. Explants like apical bud, axillary bud, cotyledons, cotyledonary nodes, leaves, hypocotyls, immature embryonal axes, etc. were inoculated on nutrient MS medium along with 0.8% agar, 3.0% sucrose and pH 5.8 under aseptic conditions. Protocol for optimum regeneration was developed via the culture of cotyledonary nodes. However, reports are available on regeneration of plantlets via cotyledonary node in a variety of plants like Psoralea corylifolia L., Aegle marmelos (L.) Corr., Vigna mungo (L.) Hepper, Vigna radiata L., Pterocarpus marsupium Roxb. (Jeyakumar and Jayabalan, 2002; Anis et al., 2005; Muruganantham et al., 2005; Sita Mahalakshmi et al., 2006; Nayak et al., 2007). Cotyledonary node segments inoculated on MS medium augmented with BAP (1.1 µM) gave elongated shoots but it did not multiply the number of shoots till two weeks (Figure 1B and Table 1). Further, multiple shoot proliferation was obtained after 15 days of cotyledonary nodes subcultured on MS medium supplemented with BAP (4.44 µM) and IAA (2.85 µM). Cytokinin alone did not show significant results. However, IAA in combination with BAP produced the optimal number of shoots (18.10 ± 0.66) (Table 2). Horizontally inoculated explants showed callusing at the cut ends and gave only 2- to 3 shoots, while vertically placed explants gave rise to shoot clusters and callus from the base of the explants which was embedded inside the medium (Figure 1C). Except IAA, none of the auxins was found to accelerate the rate of multiplication (data not shown). These shoots further increased in number and length (5.5 to 7.5 cm.) within 4 weeks, when they were separated carefully and subcultured onto MS medium with same hormonal regimes (Figures 1D, 2A and Table 2).

Culture conditions All the culture were incubated at 25 ± 2°C with 55 to 65% relative humidity under a 16 h light/8 h dark cycle at the light intensity of 40 µ mol m-2 s-1 provided by cool and white fluorescent tubes. The in vitro germinated seedlings were used as stock mother plant. Cotyledonary node segments excised from two weeks old seedlings served as explants and cultured on MS medium (Murashige and Skoog 1962), supplemented with BAP (1.1 to 22.19 µM) and Kn (1.16 to 23.23 µM) alone or in combination with different concentrations of IAA (0.57 to 14.27 µM), IBA (0.49 to 12.26 µM), NAA (0.54 to 13.43 µM) and 2,4-D (0.45 to 11.31 µM). MS medium was supplemented with 3% sucrose. The pH of the medium was adjusted to 5.8 with 0.1 N NaOH or 0.1 N HCl before adding 0.8% agar (bacteriological grade, Himedia) and autoclaved. The effects of orientation of the explant were also studied. Cotyledonary nodes were placed horizontally as well as vertically on MS medium. The cultures were transferred to fresh medium at three weeks intervals.

In vitro rooting and flowering Well developed elongated shoots (5.5 to 7.5 cm) with four to five leaves regenerated on MS medium supplemented with BAP and IAA were excised and transferred to solidified half-strength MS medium containing 3% sucrose and different concentrations of NAA (0.54 to 13.43 µM), IAA (0.57 to 14.27 µM) and IBA (0.49 to 12.26 µM) alone or in combination with cytokinin (BAP and kinetin) for root and flower induction. In vitro separated shoots were also sub cultured on hormone free MS medium as control for the root induction. The number of flowers per shoot was counted.

Hardening and acclimatization of plants Rooted plantlets were taken out from culture vials and washed with distilled water delicately to remove adhered agar and transferred to earthen pots containing autoclaved soil and vermicompost (3:1). The pots were covered with inverted glass beakers to maintain high humidity. Plants were provided with MS salts as few drops gradually on alternate day along with distilled water. The percentage of explants forming shoots was regularly recorded and readings were

In vitro rooting These in vitro developed shoots were subjected to rooting media regimes. Rooting was scanned by incorporating each auxin such as IAA (0.57 to 14.27 µM), IBA (0.49 to 12.26 µM) and NAA (0.54 to 13.43 µM)

7908

Afr. J. Biotechnol.

Figure 1. In vitro seed germination and further multiplication of shoots through cotyledonary node culture. A, Two weeks old sterile seedlings of E. sativa on ½ MS medium; B, Elongation of a single shoot at two weeks on MS + BAP (1.1 µM); C, Shoot multiplication at two weeks on MS + BAP (4.44 µM) + IAA (2.85 µM); a, Horizontally placed explant; b, vertically placed explant; D, Shoot clusters at four weeks on the same medium. Table 1. Effect of cytokinin on shoot proliferation from the cotyledonary node explant of Eruca sativa Mill. on the MS medium.

Plant growth regulator and concentration (µM) BAP (1.1) BAP (2.22) BAP (4.44) BAP (8.87) BAP (17.74) BAP (22.19) Kn (1.16) Kn (2.32) Kn (4.65) Kn (9.29) Kn (18.58) Kn (23.23) z

Percentage explants showing shoot proliferation 40z 70 85 60 50 30 35 50 40 30 25 25 y

Mean number of shoots produced/explant 1.25±0.88y 6.55±0.25 9.60 ± 4.50 4.66 ± 0.21 3.70± 0.60 0.66 ± 0.21 1.00 ± 0.25 1.33 ± 0.21 1.16 ± 0.17 0.50 ± 0.22 0.33 ± 0.21 0.20 ± 0.16

Values represent mean ± SE of eight replicates per treatment. Mean values within the column followed by the same letter are not significantly different by the Tukey’s test at 0.05% probability level.

Sharma et al.

7909

Table 2. Effect of IAA with optimal concentration of BAP on shoot proliferation from cotyledonary nodes of Eruca sativa Mill. in MS medium.

Growth regulator BAP (4.44 µM) + IAA (0.57 µM) BAP (4.44 µM) + IAA (1.425 µM) BAP (4.44 µM) + IAA (2.85 µM) BAP (4.44 µM) + IAA (5.71 µM) BAP (4.44 µM) + IAA (11.42 µM) BAP (4.44 µM) + IAA (14.27 µM)

Percentage explants showing shoot proliferation 60 70 80 50 30 30

Mean number of shoots produced/explant 12.81±1.80 13.93±0.91 18.10±0.66 11.22±0.44 7.4 ± 0.03 7.25±0.478

separately and in combination with BAP (1.1 to 22.19 µM) and Kn (1.16 to 23.23 µM) in half strength MS medium. On hormone free MS basal medium, no rhizogenesis response was observed, leaves turned yellow and the shoots became necrotic (Figure 2B). IAA did not induce rooting (data not shown). NAA at concentration as low as 2.69 µM produced profuse fibrous roots, while slightly higher concentration (5.37 µM) induced root formation accompanied by callusing (Figure 2C). Best response at 4.90 µM of IBA and Kn (0.23 µM) was 60 to 80% rooting which was obtained (Figure 2D). Effect of phytohormones on flower induction In vitro rooting preceded flowering in all the responding shoots. Shoots without roots did not produce flowers. Flowers were initiated in the media containing auxin (IBA) and cytokinin (BAP and kinetin) in combination. Thus, it is evident that the presence of auxin and cytokinin is essentially required for the induction of flowering in E. sativa in vitro, as no inflorescences were observed in the control explants devoid of cytokinins. The number of flowers was influenced by both the type of cytokinin (BAP and Kn) added to the media and the concentration thereof (Figure 2E, Grapg-1 and 2). Among the auxins tested, IBA (4.90 µM) was more efficient than NAA and IAA in induction and maturation of in vitro flowers in combination with Kn. Cytokinins are constituents of the floral stimulus transported in phloem sap to the apex in response to a photoperiodic treatment inducing flowering (Bernier et al., 1993). The role of cytokinin in floral morphogenesis was also reported by various scientists (Taylor et al., 2005; Verma and Singh, 2007; Sudarshana et al., 2008). However, Sharma et al. (2011) also reported the in vitro flowering in Portulaca oleracea L. on Kn along with gibberellic acid, which was also in favour of the present results. In contrast to the above results, BAP (13.3 mM) in combination with Kn (9.3 mM) stimulated flowering in

Rosa hybrida cv. ‘Heirloom under photoperiod of 12/12 (light/dark cycle) (Kanchanapoom et al., 2010). Effect of sucrose and ammonium nitrate on flower induction Different concentrations of sucrose (0.0 to 6.0%) were tested, out of all, 3% sucrose induced rooting and flowering. Maximum number of flowers were induced on half strength ammonium nitrate (NH4NO3) (0.825 g l-1), when compared with full strength (1.65 g l -l) ammonium nitrate in the medium. Similarly, Franklin et al. (2000) also reported in vitro flowering in Pisum sativum L. using half strength ammonium nitrate in the medium. In contrast with the present results, Chen and Li (1993) reported successful in vitro flower induction in tobacco using free amino acids. Effect of age of cultures on flower induction The initiation of flowering in vitro depends on the age of the cultures derived in vitro. Plantlets derived from in vitro primary cultures showed maximum number of flowers as compared to the cultures with increased age. However, Wang et al. (2002) reported the induction of in vitro flower buds in rose after 15 days of subculturing of the shoots. Hardening and acclimatization These rooted plantlets were carefully taken out from the agar media without causing damage to the delicate root system. Roots were then thoroughly washed with sterile distilled water to remove even the traces of adhering agar of the media. These recreated plantlets were then transferred to plastic pots having a mixture of vermicompost and autoclaved soil (1:3). These were kept in mist chamber for first two weeks with high humidity,

7910

Afr. J. Biotechnol.

Figure 2. Platelet formation in E. sativa. A, Shoot proliferation on MS + BAP (4.44 µM) + IAA (2.85 µM); B, Separated shoots on hormone free MS medium; C, Rooting from isolated shoots on MS + NAA (2.69 µM); D, Rooting and shoot elongation in single shoot on ½ MS + IBA (4.90 µM); E, Flower and bud induction on MS + Kn (0.23 µM) + IBA (4.90 µM); f, Flower bud; r, roots.

controlled temperature and light. After two weeks, the plants were gradually exposed to natural conditions for a few hours and then this duration of exposure was increased every day from 21st till 28th days, respectively. Similar procedure of hardening was also reported by many earlier scientist in different plant species such as Curculigo orchioides Gaertn. (Bhavisha and Jasrai, 2003) and Phoenix dactylifera (Bekheet et al., 2007). In contrast

to this, other scientists adopted different method and potting mixture (cocopeat and soilrite) for hardening of the plantlets (Kavyashree, 2007; Girijashankar, 2011). Conclusions In conclusion, we reported an in vitro regeneration and

Sharma et al.

flowering in aseptic conditions of E. sativa. The flowers were bisexual and looked like general flowers. In view of these, the present protocol provides a useful system in plant breeding and crop improvement. It can also be used for the study of physiological signals that induce in vitro flowering. REFERENCES Ahloowalia BS (1987). Somatic embryogenesis and plant regeneration in Eruca sativa. Crop Sci. 27: 813-814. Anis M, Mohd KH, Shahzad A (2005). In vitro plantlet regeneration of Pterocarpus marsupium Roxb., an endangered leguminous tree. Curr. Sci. 88(6): 861-863. Batra A, Dhingra M (1991). Production of plantlets of Eruca sativa in vitro. J. Phytol. Res. 4(1): 73-77. Bekheet SA, Taha HS, Saker MM, Solliman ME (2007). Application of Cryopreservation technique for in vitro grown Date Plam (Phoenix dactylifera L.) cultures. J. Appl. Sci. Res. 3(9): 859-866. Bernier G, Havelange A, Houssa C, Petitjean A, Lejeune P (1993). Physiological signals that induce flowering. Plant Cell, 5: 1147-1155. Bhavisha BW, Jasrai YT (2003). Micropropagation of an Endangered Medicinal Plant: Curculigo orchioides Gaertn. Plant Tissue Cult. 13(1): 13-19. Chen Y, Li W (1993). Floral gradient in flowering tobacco in relation to free amino acids. Cell Res. 3: 85-92. Franklin G, Pius PK, Ignacimuthu S (2000). Factors affecting in vitro flowering and fruiting of green pea (Pisum sativum L.). Euphytica, 115: 65-73. Girijashankar V (2011). Micropropagation of multipurpose medicinal tree Acacia auriculiformis. J. Med. Plants Res. 5(3): 462-466. Jeyakumar M, Jayabalan N (2002). In vitro plant regeneration from cotyledonary node of Psoralea corylifolia L. Plant Tissue Cult. 12(2): 125-129. John N, Batra A (1994). Plantlet formation from shoot tip culture of Eruca sativa Mill. J. Ind. Bot. Soc. 73(3-4): 367-368. Kanchanapooma K, Sakpetha P, Kanchanapoomb K (2010). In vitro flowering of shoots regenerated from cultured nodal explants of Rosa hybrida cv. â&#x20AC;&#x2DC;Heirloomâ&#x20AC;&#x2122;. Sci. Asia, 36: 161-164. Kavyashree R (2007). A repeatable protocol for in vitro micropropagation of mulberry variety S54. Ind. J. Biotech. 6: 385-388. Khan MMA, Hassan l, Ahmad SD, Shah SH, Batool F (2009). In vitro regeneration potentiality of oil seed Brassica genotypes with differential BAP concentration. Pak. J. Bot. 41(3): 1233-1239. Leskovsek L, Jakse M, Bohanec B (2008). Doubled haploid production in rocket (Eruca sativa Mill.) through isolated microspore culture. Plant Cell Tissue Organ Cult. 93:181-189.

7911

Modlinger PS, Wilcox CS, Aslam S (2004). Nitric oxide, oxidative stress, and progression of chronic renal failure. Semin. Nephrol. 24: 354-365 Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassay with tobacco tissue culture. Physiol. Plant 15: 473-497. Muruganantham M, Ganapathi A, Amutha S, Vengadesan G, Selvaraj N (2005). Shoot regeneration from immature cotyledonary nodes in black gram [Vigna mungo (L.) Hepper]. Ind. J. Biotech. 4: 551-555. Nayak P, Behera PR, Manikkannan, T (2007). High frequency plantlet regeneration from cotyledonary node cultures of Aegle marmelos (L.) Corr. In Vitro Cell. Dev. Biol. Plant, 43: 231-236. Sharma MM, Singh A, Verma RN, Ali DZ, Batra A (2011). Influence of PGRS for the in vitro plant regeneration and flowering in Portulaca oleracia l.: A medicinal and ornamental plant. Int. J. Bot. 7(1): 103107. Sikdar SR, Chatterjee G, Das S, Sen SK (1987). Regeneration of plants from mesophyll protoplasts of the wild crucifer Eruca sativa Lam. Plant Cell Rep. 6: 486-489. Sita Mahalakshmi L, Leela T, Kiran B, Naresh B, Devi P (2006). In vitro plant regeneration from the petioles of primary leaves of Mungbean Vigna radiata L. Plant Biotech. 23: 409-411. Sudarshana MS, Niranjan MH, Girisha ST (2008). In vitro flowering, somatic embryogenesis and regeneration in Boerhaavia diffusa Linn. A medicinal plant. Global J. Biotech. Biochem. 3(2): 83-86. Taylor NJ, Light ME, Van Staden J (2005). In vitro flowering of Kniphofia leucocephala:influence of cytokinins. Plant Cell Tissue Org. Cult. 83: 327-333. Verma R, Singh RR (2007). Regeneration and in vitro flowering in Brassica campestris (L.) Var. Bhavani. Our Nature, 5: 21-24. Wang GY, Yuan MF, Hong Y (2002). In vitro flower induction in roses. In Vitro Cell. Dev. Biol. Plant 38: 513-518. Yaniv Z, Schafferman D, Amar Z (1998). Tradition, Uses, and Biodiversity of Rocket (Eruca sativa) in Israel. Econ. Bot. 52: 394400. Zhang T, Cao ZY, Wang XY (2005). Induction of somatic embryogenesis and plant regeneration from cotyledon and hypocotyl explants of Eruca sativa Mill. In Vitro Cell. Dev. Biol. Plant, 41: 655657.

African Journal of Biotechnology Vol. 11(31), pp. 7912-7915, 17 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3424 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Estimation of coliform contamination rate and impact of environmental factor on bacterial quality of tube well water supplies in Khorramdarreh County, Iran Amini Bahram1, Baghchesaraei Hamid1* and Nasiri Akram2 1

Department of Microbiology, Zanjan University of Medical Sciences, Skahrak Karmandan, Zanjan, Iran. 2 Faculty of Basic Science, Azad University of Zanjan, Etemadieh, Zanjan, Iran. Accepted 5 March, 2012

In this study, the presence of fecal coliforms in tube wells of Khorramdarreh County, Iran, and impact of environmental factors on quantity and quality of these organisms were evaluated. In a cross-sectional survey, 76 tube well water samples from March to September 2010 were tested to determine presence of fecal coliforms, by measuring the most probable number (MPN), and identification of three enteric bacteria namely, Escherichia coli, Klebsiella sp. and Salmonella sp. Out of 76 wells, 24 (31.57%) and 25 (32.89%) wells showed presence of fecal coliforms, during rainy and dry seasons, respectively. In contrast to seasonal changes, depth of the wells showed significant correlation with type of isolated bacterial indices (P = 0.0005). On the other hand, depth of the well and seasonal variations did not show any significant correlation with fecal coliform contamination rate. The level of bacterial contamination of tube wells, in terms of presence of fecal coliforms is alarming. This was only an indicative study, and therefore, appropriate studies are required to determine the extent, risk factors and nature of the problem. Key words: Fecal coliforms, tube well, E.coli, Klebsiella sp., Salmonella sp. INTRODUCTION Water is an increasingly scarce resource worldwide. One of the most significant changes has been the growth of cities to unprecedented sizes and rising demand for water (Mazari-Hiriart et al., 2008). Moreover, due to rapid increase of population, rapid industrialization, flow of pollution from upland to lowland, and too much use of fertilizers and pesticides in agriculture, there is a growing concern over the safety and fate of this valuable source of water (Jothivenkatachalam et al., 2010). Globally, Iran is situated in a relatively dry zone and only 10% of the country receives enough rainfall and remaining part rely heavily on groundwater to meet its need (Ravilious, 2008). Ground water is usually defined as water found underground in the saturated zone of rocks and exploited

*Corresponding author. E-mail: hsaraei@zums.ac.ir. Tel: 0098241-4240301-3 or 0098-09121412523. Fax: 0098-2414249553. P.O. Box: 45147.

by means of tube well and depending on geological constitution of the soil in different region, the depth usually varies from 50 to 500 m (Reshma and Prakasma, 2007). Water used for drinking should be of potable nature which means it could be consumed in desired amount without adverse effect on health (Jiban et al., 2009). Vast varieties of microorganisms are water borne and due to this fact, conformation with microbiological standard is of special interest because of the capacity of water to spread diseases within a large population (Omezuruike et al., 2008). For more efficient hygienic supply of water the World Health Organization (WHO) proposed a scheduled program of water assessment, including microbial assay (WHO, 2008). When water is submitted to an accredited laboratory, for testing, it will also be analyzed for the bacteriological property, particularly fecal coliforms status. While coliforms are themselves not normally causes of serious illness, their presence can be used as an indication for other pathogenic organisms of fecal origin. Microbial character

Amini et al.

of well water can be influenced by certain factors like seasonal variations and depth of the well, which should be considered while assessing these water sources (Egwari and Aboaba, 2002). Ground water is one of the main sources of water supply in Iran and since it is used for human consumption, it should meet required microbial standards. Regular microbial analysis of water at source must be carried out to monitor the effectiveness of treatment process. In present study, our aim was to determine the presence of fecal coliforms contamination in tube well water of Khorramdarreh County, Iran, and investigate the impact of environmental factors, namely seasonal variations and depth of the well, on quantity and quality of these organisms. MATERIALS AND METHODS

7913

was confirmed by concomitant incubation of non inoculated tubes, as a control. The presumptive test was followed by the confirmative test. In confirmative test, positive tubes (gas production) were sub cultured on eosin methylene blue (EMB) agar, for selective isolation of E. coli. At the same time, selective isolation of two other enteric bacteria namely, Klebsiella sp. and Salmonella sp., as model organisms of enteric pathogen, was attempted. In present study the Hicrome Coliform Agar w/SLS-M1300 from Himedia Company, India was used as selective and differential media for identification of Klebsiella sp. and Salmonella sp. On this media, Klebsiella sp. appears pink and Salmonella sp. as colorless colonies. The pure cultures of the bacterial isolates on EMB and Hicrome Coliform Agar were subjected to conventional morphological and biochemical test methods for identification of the above mentioned organisms, with reference to Bergeyâ&#x20AC;&#x2122;s Manual of Determinative Bacteriology (Buchanan and Gibbons, 1974). With the help of Statistical Package for Social Sciences (SPSS, Version 11) software package, the data was analyzed, using X2 tests, to test the significance of associations between categorical variables.

Site description

RESULTS This descriptive study was performed between March and September 2010 in Khoramdarreh. Khorramdarreh County, with an area of 407 kmÂ˛ and population of 60499 (2006), is situated in Zanjan province, which is in North West part of Iran. This county has a mostly rural population which mostly rely on ground water supply for domestic and agriculture purposes. According to water resource management organization of Iran, on the bases of depth, the tube wells are classified in to three category of deep (> 50 m), semi deep (30 to 50 m) and shallow (less than 30 m). All wells in study area were equipped with electric motor for water draining.

Sampling strategy Sample size was calculated (precision 5%, confidence interval 95%) and out of 190 available well, 76 locations were randomly selected for this study, out of which it was comprised of 32 deep and semi deep wells each, and remaining 12 were shallow wells. Samples were collected twice, one in rainy and the other in dry season from selected wells at different locations. The rainy season in Khoramdare region starts from March to middle of June and from then onward up to September, it is relatively dry. In order to reduce microbial contamination during sample collection, the water was pumped continuously for 3 min first of all and then exiting mouth of the well was flame-sterilized with a portable gas flame and finally midstream flow was collected in a 300 ml sterile plastic bottle. About 3 to 4 ml of the bottle was left empty to prevent any probable contamination of sample with external periphery, while tightening the screw cap. In order to avoid any error between collection and analysis, well number, location, time and date of sampling were labeled on each bottle. Water samples were placed in ice containing cool box and dispatched within 30 to 45 min to microbiology diagnostic laboratory for analysis. Laboratory evaluation Determination of fecal coliforms contamination rate was based on most probable number (MPN) method, (Sutton 2010) which estimates the concentration of total coliforms (TC) and thermophilic coliform (Escherichia coli) per 100 ml of water sample. It is based upon the application of the theory of probability to the numbers of observed positive growth responses to a standard dilution series of sample inoculums placed into a set number of culture media tubes. A serial dilution was prepared with sample inoculums for detection of total fecal coliforms. The sterility of each batch of test medium

Following bacterial analysis of collected water samples out of 76 wells of different depth, 24 (31.57%) and 25 (32.89%) locations showed fecal coliforms contamination during rainy and dry seasons, respectively (Table 1). The MPN for the presumptive TC of water samples ranges from 3.6 to 460 and 3.6 to 1100 MPN/100 ml during rainy and dry seasons, respectively (Table 2). As it is evident in Table 2, E. coli comprises the dominant genes of isolated bacteria in water samples, and incidence of Klebsiella sp. and Salmonella sp. are only evident in shallow wells. Among the contaminated wells, well no. 73 showed concomitant isolation of Salmonella sp. and Klebsiella sp. In contrast to seasonal changes, depth of the wells showed significant correlation with type of isolated bacterial indices (P = 0.0005). On the other hand, depth of the well and seasonal variations did not show any significant correlation with TC contamination rate. DISCUSSION Coliforms are normal inhabitants of digestive tracts of animals, including human, and are found in their wastes, besides soil material (Jiban et al., 2009). They are also considered as indicator organisms of water pollution caused by fecal contamination which is a serious problem due to the potential for contracting diseases from pathogens (disease causing organisms). Although the concentrations of pathogens from fecal contamination are small, the possible occurrence of a number of different pathogens is large. On the other hand, coliforms are not specific indicators of fecal pollution and the presence of E. coli (thermophilic coliforms) is proved to be the most appropriate group of coliforms to indicate fecal pollution from warm-blooded animals (Ashbolt et al., 2001). According to WHO standard, potable water should be free of coliform organisms (WHO, 2008), hence, some of the water samples, in our study, did not comply with the

7914

Afr. J. Biotechnol.

Table 1. Frequency distribution of contaminated wells of different depth in rainy and dry season.

Depth of well Deep Semi deep Shallow Total

Contaminated well Rainy season Dry season 8 7 10 11 6 7 24 25

Table 2. Frequency distribution of MPN/100 ml and isolated bacterial sp. in rainy and dry seasons.

Contaminated well number

Depth of the well

5 8 13 14 18 19 20 25 34 37 44 46 47 49 50 53 54 56 65 67 68 69 70 73 67

D D D D D D D SD SD SD SD SD SD SD SD SD SD SD S S S S S S S

Total coliform MPN/100 ml In rainy season In dry season 15 43 43 43 15 43 3.6 3.6 23 23 15 43 15 23 15 3.6 15 9.1 240 460 3.6 3.6 9.1 6.1 9.1 3.6 23 9.1 9.1 15 43 43 15 23 0 9.1 210 210 21 7.3 120 120 15 43 120 120 460 1100 9 02

Isolated bacterial sp. In rainy season E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli Klebsiella Klebsiella Klebsiella E. coli Klebsiella Klebsiella Salmonella E. coli

In dry season E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli E. coli Klebsiella Klebsiella Klebsiella E. coli Klebsiella Klebsiella Salmonella E. coli

D, Deep; SD, semi deep; S, shallow; MPN, most probable number.

recommended value. In comparison with other similar findings, the results from this study are considered to show slightly lower but also, in some cases, higher contamination rate. Bacteriological analysis of the ground water of District Nainital (Uttarakhand, India) did not show any sign of bacterial contamination in tube-well water samples (Jain et al., 2010) whereas assessment of groundwater in Bangalore, India, showed 50% bacterial contamination in the groundwater (Shankar et al., 2008). In our study, no significant correlation could be established between TC contamination rate and seasonal

variation, which contradict the similar findings in a Niger (Egwari and Aboaba, 2002) India (Jiban et al., 2009) and Mexico City (Mazari-Hiriart et al., 2008). The water quality index (WQI) value, as a function of various physicchemical and bacteriological parameters, was determined for groundwater obtained from a total of 21 locations in Bhandara District of central India. The WQI during premonsoon season varied from 68 to 83, while for postmonsoon, it was between 56 and 76. Significantly (Pâ&#x20AC;&#x2030;<â&#x20AC;&#x2030;0.01) lower WQI for the post-monsoon season was observed, indicating deterioration of the groundwater

Amini et al.

overall in corresponding season (Rajankar et al, 2011). In a study on rural drinking water at supply and household levels, 61% of tube-well water samples met the Bangladesh and WHO standards of fecal coliforms and the rate of water contamination was highest during the February to May period (Hoque et al., 2006). Study in Karnataka state of India revealed that the level of contamination is beyond the permissible limit for indicator organisms in groundwater during rainy season which can render the consumer more vulnerable to health risks (Jiban et al., 2009). Recently Iran is experiencing a relatively low rain fall level as per the official reports released by Iranian Meteorological organization, which can be a probable explanation for non significant correlation between contamination rate and seasonal variations. In contrast to seasonal changes, depth of the wells showed significant correlation with type of isolated bacterial indices (P = 0.0005). At the same time no significant correlation could be found between contamination rate and depth of the well. Following deep article review, we could not find any related article; hence we do not pass any comment on this issue. The isolated bacterial species in this study were matching with some of those commonly encountered in water and aquatic environments reported by other researchers (Omezuruike et al., 2008). The identified isolates include E. coli, Salmonella sp. and Klebsiella sp. These data confirm what other studies have noted that tube wells are commonly contaminated with fecal organisms (Luby et al., 2008; Omezuruike et al., 2008). There are certain index and model organism which their presence in water sample is of great concern, for example evidence of E. coli as an index for Salmonella sp. and F-RNA coliphages as models of human enteric viruses (Ashbolt et al., 2001). Hence presence of coliforms group in these water samples suggests that there are chances of mixed contamination with more dangerous microorganisms. Upon bacterial analysis we could isolate Salmonella sp. from shallow well no. 73, which might be due to the presence of a dairy farm in vicinity of this specific well region. Conclusion In this study, the coliform contamination of tube well in Khoramdarreh was studied. The bacterial analysis showed that out of 76 wells, 24 (31.57%) and 25 (32.89%) locations are contaminated with coliform during rainy and dry seasons, respectively. In adition to E. coli, Klebsiella sp. and Salmonella sp. were also isolated. There was a significant correlation between depth of the wells and type of isolated bacterial indices (P = 0.0005). It is recommended that the government and other relevant actors in Khoramdarreh establish a comprehensive drinking water system that integrates water supply, quality, handling and related educational programs in

7915

order to ensure the safety of drinking water supplies. Conflict of interest No conflict of interest to declare. REFERENCES Ashbolt NJ, Willie OK, Grabow OK, Snozzi M (2001). Indicators of microbial water quality. W.H.O. pp. 290-291. Buchanan RE, Gibbons NE (1974). Bergey’s Manual of Determinative Bacteriology 8th edition. The Williams and Wilkins company, Baltimore. Egwari L, Aboaba OO (2002). Environmental impact on the bacteriological quality of domestic water supplies in Lagos,Nigeria. Rev. Saúde. Pública. 36: 513-20. Hoque BA, Hallman K, Levy J, Bouis H, Ali N, Khan F, Khanam S, Kabir M, Hossain S, Shah Alam M (2006). Rural drinking water at supply and household levels: quality and management. Int. J. Hyg. Environ. Health, 209: 451-60. Jain CK, Bandyopadhyay A, Bhadra A (2010). Assessment of ground water quality for drinking purpose, District Nainital, Uttarakhand, India. Environ. Monit. Assess. 166: 663-676. Jiban SM, Somashekar RK, Prakash KL, Shivanna K (2009). Bacteriological assessment of groundwater in Arkavathi and Vrishabhavathi basins, Bangalore, Karnataka. J. Ecol. Nat. Environ. 1: 156-159. Jothivenkatachalam K, Nithya A, Chandra MS (2010). Coralation analysis of drinking water quality in and around Perur block of Oimbatroe district, Tamil nadu, India. Rasayan J. Cham. 3: 649-654. Luby SP, Gupta SK, Sheikh MA, Johnston RB, Ram PK, Islam MS (2008). Tubewell water quality and predictors of contamination in three flood-prone areas in Bangladesh. J. Appl. Microbiol. 105: 10021008. Mazari-Hiriart M, Ponce-de-Leon S, Lopez-Vidal Y, Islas-Macıas P, Amieva- Fernandez R, Quinones-Falconi F (2008). Microbiological Implications of Periurban Agriculture and Water Reuse in Mexico City. P.Lo.S. 3: e2305. Omezuruike OI, Damilolan AO, Adeola OT, Enobong A, Olufunke B (2008). Microbiological and physicochemical analysis of different water samples used for domestic purposes in Abeokuta and Ojota, Lagos State, Nigeria. Afr. J. Biotechnol. 7: 617-621. Rajankar PN, Tambekar DH, Wate SR (2011). Groundwater quality and water quality index at Bhandara District. Environ. Monit. Assess. 179: 619-625. Ravilious K (2008). Iran Sinking as Groundwater Resources Disappear. National Geographic News. September 22. Reshma S, Prakasma VB (2007). Potability of tube wells of Mayyanad Panchayat of Kerala. Ind. J. Environ. Prot. 27: 1015-1018. Shankar BS, Balasubramanya N, Reddy MT (2008). Hydrochemical assessment of the pollutants in groundwaters of Vrishabhavathi Valley Basin in Bangalore (India). J. Environ. Sci. Eng. 50: 97-102. Sutton S (2010). The Most Probable Number method and its uses in enumeration, qualification, and validation. J. Valid. Technol. 3: 35-38. World Health Organization (2008). Water Guidelines for drinking-water quality. Recommendation of the World Health Organization. WHO, 3rd ed. p. 29.

Full Length Research Paper

Purification and characterization of three laccase isozymes from the white rot fungus Trametes sp. HS-03 Weiyun Guo1, Zhaoyang Yao2, Chenyan Zhou1, Duan Li1, Hongli Chen1, Qiang Shao3, Zongyi Li3 and Huigen Feng1* 1

Department of Life Science and Technology, Xinxiang Medical University, Xinxiang 453003, People’s Republic of China. 2 School of Basic Medicine, Xinxiang Medical University, Xinxiang 453003, People’s Republic of China. 3 College of Life Science, Henan Normal University, Xinxiang 453007, People’s Republic of China. Accepted 2 April, 2012

Three laccase isozymes (LacI, LacII and LacIII) were isolated from the culture supernatant solution of Trametes sp. HS-03. Diethylaminoethyl (DEAE)-sepharose fast flow anion exchange chromatography and Sephadex G-100 size-exclusion chromatography was performed to achieve electrophoretic homogeneity. The molecular masses (64.2, 60.7 and 38.9 kDa), isoelectric points [pIs (7.3, 4.7 and 3.5), and N-terminal amino acid sequences (G-I-G-P-V, A-I-G-P-T and S-I-G-P-V) were found to be different for the three laccase isozymes. LacI and II have similar thermostability, while LacIII showed better thermostability. LacIII also showed optimal activity at 80°C, with a half-life of 125 min at 70°C. The pI-value of LacI and the molecular mass of LacIII differ significantly from previously described fungal laccases. Key words: Trametes sp. HS-03, laccase isozymes, purification, characterization.

INTRODUCTION Laccases (benzenediol: oxygen oxidoreductases, EC 1.10.3.2) form part of a larger group of multicopper oxidases that oxidize a wide variety of substrates with concomitant reduction of molecular oxygen to water (Thurston, 1994). Laccases are distributed widely in nature and found in higher plants, fungi, insects and bacteria (Montazer et al., 2009). However, laccases of fungal origin are the most well studied, particularly those found in white-rot fungi. Due to their interesting catalytic properties, laccases have broad potential in many industrial and environmental applications, including paper processing and the biotransformation of environmental pollutants such as pesticides, industrial dyes and effluents

*Corresponding author. E-mail: xinmigwy@163.com or fenghuigen@xxmu.edu.cn. Tel: +86 373 3029889. Fax: +86 373 3029887. Abbreviations: ABTS, 2,2’-Azino-bis-(3-ethylbenzthiazoline6-sulfonic acid); SDS-PAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis; IEF–PAGE, isoelectric focusing gel; pIs, isoelectric points.

(Champagne and Ramsay, 2010; Hadibarata et al., 2012). They are used in the food industry, particularly in tea and coffee fermentation, and in vinification processes to improve wine quality by removing fermentation inhibitors so as to increase yield of ethanol (Baldrian, 2006). They have also been used in drug analysis, and even as a tool for medical diagnostics (Rodriguez and Toca, 2006). It is well known that white-rot fungi secrete a variety of oxidative enzymes, including lignin peroxidase (LiP), manganese peroxidase (MnP) and laccase (Isikhuemhen and Mikiashvili, 2009; Kim et al., 2012). These enzymes are polymorphic, and different isoforms with different properties are produced depending on environmental conditions and the fungal species (Baldrian, 2006). Although there have been many papers dealing with laccase-producing fungi, Trametes sp. is one of the best studied white-rot fungi, and is known to secrete several laccase isoforms. In this study, three laccase isozymes generated from Trametes sp. HS-03 were purified and characterized. These isozymes showed a number of different properties from previously reported laccases. The study therefore may be helpful to exploit the capabilities of laccases.

Guo et al.

MATERIALS AND METHODS 2,2’-Azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) was purchased from Sigma. The chromatography media used [diethylaminoethyl (DEAE)-Sepharose fast flow and Sephadex G-100] were from Amersham Pharmacia Biotech. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and isoelectric focusing (IEF) calibration proteins were from New England Biolabs and Bio-Rad. All other chemicals used were of analytical grade.

Microorganism and culture condition Trametes sp. HS-03 isolated from a pulp mill wastewater effluent in Xinxiang ,Henan, China was inoculated on potato dextrose agar plates for 5 days at 28°C. Five mycelial agar blocks of 0.5 cm diameter taken from the growing fungal colonies were used as the inoculum in liquid cultures medium. The liquid culture medium contained: 1% (w/v) glucose, 0.7% (w/v) yeast extract, 0.2% (w/v) KH2 PO4, 0.5% (w/v) MgSO4·7H2O, 0.1% (w/v) CaCl2·2H2O and trace elements solution containing N-hydroxyacetanilide and thiamine-HCl. The cultures were incubated in 500 ml Erlenmeyer flask containing 100 ml liquid culture medium with constant shaking (150 rpm) at 28°C. The 5-day-old cultures was filtered and centrifuged at 20,000 g for 20 min, and then the supernatant solutions were collected as the crude enzyme.

Enzyme assays and protein analysis Laccase activity was detected by measuring the absorbance increase at 420 nm ( 420=36,000 M-1 cm-1) during the oxidation of 0.5 mM ABTS in 100 mM citrate-phosphate buffer, (pH) 5.0 at 25°C. One unit (U) of laccase activity was defined as the amount of enzyme that catalyzed the oxidation of 1 µmol ABTS per minute under the assay conditions. Protein concentrations were determined by the method of Bradford using bovine serum albumin as standard. All of the measurements were performed in triplicate. Purified proteins were submitted to Shanghai GeneCore BioTechnologies Co. Ltd. for N-terminal sequence analysis using automated Edman degradation and subjected for wavelength scan (300 to 700 nm) on TU-1900 UV/Vis spectrophotometer (Beijing, China). The copper content was determined by a Z-5000 Atomic absorption spectrometer (Hitachi Ltd., Tokyo, Japan).

Laccase purification All operations described below were performed at 4°C. The crude enzyme was concentrated by ultrafiltration on an Amicon PM-10 membrane, dialyzed (10 kDa cut off) overnight against 10 mM sodium phosphate buffer (pH 6.0) and applied to a DEAESepharose Fast Flow anion exchange chromatography column (2.5 cm × 20 cm), equilibrated with the dialyzed buffer. The column was washed with the equilibration buffer until the A280 reading was less than 0.02, and the bound proteins were subsequently eluted from the column using an increasing linear gradient of 0 to 0.6 M NaCl (400 ml) at a flow rate of 0.5 ml/min. Each fraction containing laccase activity was further purified by loading onto a Sephadex G-100 size-exclusion chromatography column (1.2 cm × 100 cm) equilibrated with 10 mM sodium phosphate buffer (pH 6.0) at a flow rate of 0.4 ml/min. Each enzyme was pooled and stored at 4°C. Biochemical characterization of purified laccases SDS-PAGE was used to determine protein purity and the molecular

7917

mass of the purified enzymes under denaturing conditions using a 10% (w/v) acrylamide gel. Protein was stained with Coomassie Brilliant Blue R-250. The isoelectric points of the laccase isozymes were determined using a Bio-Rad Model 111 Mini IEF cell with a 5% polyacrylamide gel and ampholyte (pH 3 to 10). The isoelectric points of the isozymes were determined by comparison with protein standard markers between pH 4.45 and 9.6 by silver staining. The optimal pHs of the laccase isozymes were studied from pH 2.0 to 9.0. To determine the pH stability, isozymes were kept at 25°C for 4 h in different buffers and the residual laccase activity was determined under standard assay conditions using ABTS as substrate. The optimal temperature for the laccase reaction was assayed from 25 to 100°C at 5°C intervals. Thermostability of the laccase isozymes was investigated by incubating laccase isozymes from 25 to 100°C. All experiments were performed three times, and the measurements were highly reproducible.

RESULTS Purification of laccase isozymes DEAE-Sepharose fast flow anion-exchange chromatography successfully separated the supernatant solutions of 5 days’ cultures of Trametes sp. HS-03 into three distinct peaks with laccase activity, and the resulting fractions were named LacI, LacII and LacIII (Figure 1). The first peak (LacI) was partially eluted during washing of the column with the equilibration buffer, which suggested that LacI was poorly adsorbed on DEAE-Sepharose Fast Flow. A salt gradient resolved two peaks further (LacII and LacIII) that featured laccase activity. These were eluted at NaCl concentrations of approximately 0.09 and 0.28 M, respectively. The three active fractions were collected separately and further purified to homogeneity by means of Sephadex G-100 size-exclusion chromatography. At the end of the purification process, the LacI, LacII and LacIII laccase fractions had been purified 31.7-, 192- and 9.6-fold, with an overall yield of 11.8, 39 and 1.2%, respectively (Table. 1). The apparent homogeneity of the three laccase isozymes was monitored on SDS-PAGE (Figure 2). The relative molecular masses of LacI, LacII and LacIII were approximately 64.2, 60.7 and 38.9 kDa. Analytical isoelectric focusing established pI values of 7.3, 4.7 and 3.5 for LacI, LacII and LacIII, respectively (Figure 3). The three laccase isozymes were observed as single bands by both SDS-PAGE and IEF-PAGE, suggesting that the purified laccase isozymes were present as monomeric proteins. The N-terminal amino acid sequences were found to be G-I-G-P-V for LacI, A-I-G-P-T for LacII and S-I-G-P-V for LacIII, which were similar to that of other fungal laccases (D’Souza-Ticlo et al., 2009; Schmidt et al., 2011). LacI, LacII and LacIII contained 4.0, 3.9 and 2.5 mol of copper per mol of protein, respectively. The UV–visible spectra of LacI and LacII showed typical characteristics of blue multicopper oxidases, including a peak at around 600 nm and a shoulder at 330 nm (Uthandi et al., 2010), while no absorbance of Lac was detected near 600 nm. These confirmed the authenticity

7918

Afr. J. Biotechnol.

Figure 1. DEAE-sepharose fast flow elution profile of proteins secreted by Trametes sp. HS-03, showing three distinct fractions (LacI, LacII and LacIII)

Table 1. Summary of purification of laccase isozymes from Trametes sp. HS-03a.

Purification step

Fraction

Crude enzyme ultrafiltration

Total activity (U) 1285 1157

Total protein (mg) 530 351

Specific activity (U/mg) 2.4 3.3

Yield (%) 100 90

Purification factor (fold) 1 1.4

DEAE-sepharose fast flow chromatography

LacI LacII LacIII

154 765 71

18 35 30

8.6 22 2.4

12 60 5.5

3.6 9.2 1

Sephadex G-100 chromatography

LacI LacII LacIII

151 507 16

2 1.1 0.7

76 461 23

11.8 39 1.2

31.7 192 9.6

All purification procedures were performed at 4°C in sodium phosphate buffer (10 mM, pH 6.0) (buffer A). The crude enzyme was dialyzed overnight and applied to a DEAE-sepharose fast flow anion exchange chromatography column equilibrated with buffer A. LacI was poorly adsorbed on DEAE-Sepharose eluted during washing of the column with buffer A. The column was subsequently eluted using an increasing gradient of 0 to 0.6 M NaCl at a flow rate of 0.5 ml/min. LacII and LacIII were eluted at NaCl concentrations of approximately 0.09 and 0.28 M, respectively. LacI, LacII and LacIII were collected separately and further purified to homogeneity by loading onto a Sephadex G-100 size-exclusion chromatography column (1.2 cm × 100 cm) equilibrated with buffer A at a flow rate of 0.4 ml/min.

of the enzyme preparation and allowed confident identification. Biochemical characterization of purified laccases The optimal pHs for most fungal laccases are 2.0 to 5.5 for ABTS substrate. Figure 4a shows that the optimal pHs with ABTS were 3.5 for LacI, 4.0 to 4.5 for LacII and 2.5 to 3.0 for LacIII. These enzymes therefore fell within the normal range of fungal laccases for this property. LacI, LacII, and LacIII had good stability at pHs of 2.5 to 4.5, 3.5 to 5.5 and 2.0 to 4.5, respectively (Figure 4b), after incubation for 4 h. However, at pH values higher than 7.0,

all the laccase isozymes lost their activity very rapidly. The optimal temperatures with ABTS were 40, 50 and 80°C, respectively (Figure 5a). The activities of LacI and LacII were stable below 50°C, decreased rapidly at approaching 60°C, and over 70°C they lost virtually all activity. However, LacIII retained 80% of its initial activity after incubation at 80°C for 30 min (Figure 5b). The thermostability of LacIII was investigated further by measuring the residual enzyme activity after incubation between 40 and 90°C at 10°C intervals. As shown in Figure 6, LacIII retained high levels of activity at high temperatures, with 80 and 60% of the initial activity remaining after incubation at 60 and 70°C for 2 h, respectively, although LacIII became rapidly less stable at

Guo et al.

Figure 2. SDS-PAGE (10% polyacrylamide gel) of purified laccase isozymes from Trametes sp. HS-03. Lane 1, Molecular weight markers with indicated molecular masses in kDa on the left; lane 2, purified LacI; lane 3, purified LacII; lane 4, purified LacIII.

Figure 3. IEF of purified laccases. A: Lane 1, standard protein markers of different pI value; lane 2, purified LacI. B: Lane 1: standard protein markers of different pI value; lane 2, purified LacII. C: Lane 1: standard protein markers of different pI value; lane 2, purified LacIII.

7919

7920

Afr. J. Biotechnol.

Figure 4. Effect of pH on the activities of the laccase isozymes from Trametes sp. HS-03. (a) Optimal pH for LacI (100% = 73.78 U/mg), LacII (100% = 457.48 U/mg) and LacIII (100% = 21.72 U/mg); b, pH stability for LacI, LacII and LacIII. The initial act ivities were determined at each pH value and defined as 100% (LacI: 100% = 74.37 U/mg, LacII: 100% = 459.6 5 U/mg, LacIII: 100% = 21.96 U/mg).

Figure 5. Effect of temperature on the activities of laccase isozymes. (a) Optimal temperature for LacI (100% = 73.84 U/mg), LacII (100% = 458.69 U/mg) and LacIII (100% = 22.38 U/mg). b, thermal stability of LacI, LacII and LacIII. The initial activities were defined as 100% (LacI: 100% = 74.62 U/mg, LacII: 100% = 459.18 U/mg, LacIII: 100% = 22.67 U/mg).

90°C. Moreover, the half-life (t 1/2) of LacⅢ was 125 min at 70°C. DISCUSSION In our study, three laccase isozymes of LacI, LacII and LacIII are excreted into the extracellular space by T. versicolor HS-03. These three isozymes were obtained in purified form by two-step chromatography using DEAESepharose Fast Flow anion exchange chromatography

followed by Sephadex G-100 size-exclusion chromatography. This two-step procedure allows effective and easy purification of large volumes of this culture, and should therefore allow the ready preparation of laccases on scales appropriate for industrial application. The overall yield of LacIII was only 1.2%, however, and this would need to be improved for industrial applications. Some of the physicochemical characteristics of these three laccases are somewhat different to those of most laccases reported previously. The pIs of fungal laccases vary widely, from 2.9 to 6.9 (Li et al., 2010).Though the

Guo et al.

7921

Figure 6. Effect of temperature on the thermal stability of LacIII. The initial activity was defined as 100% (LacI: 100% = 74.82 U/mg, LacII: 100% = 460.85 U/mg, LacIII: 100% = 21.76 U/mg).

pIs of LacII and LacIII were found to be 4.7 and 3.5 and these enzymes are more similar to other reported fungal laccases, the pI of LacI was found to be 7.3, which is therefore unusually high for fungal laccases. It is, however, lower than the pI of a laccase isolated from the white-rot fungus Coriolus hirsutus, which displayed a pI of 7.4 (Shin and Lee, 2000). In addition, LacIII has an apparent molecular mass of only 38.9 kDa. This is much lower than the molecular mass of typical fungal laccase, which generally have molecular masses of 60 to 90 kDa (Baldrian, 2006; Rogalski and Janusz, 2010). The molecular masses of LacI and LacII observed were similar to those of most other fungal laccases. The typical optimal temperature range of catalytic activity for laccases is 30 to 55°C. Unexpectedly, LacIII maintained its activity up to 80°C. This optimal temperature is significantly higher than those of other thermostable fungal laccases (Wu et al., 2010). However, the unique oxidative thermostable laccase isolated from Trametes hirsuta was thermostable at 85°C (Zhang et al., 2009), and a laccase isolated from the thermophile Thermus thermophilus HB27 was thermostable at over 92°C (Miyazaki, 2005). The activity of fungal laccases usually drops suddenly above 60°C (Baldrian, 2006) whereas LacIII retains the majority of its activity in thermostability assays, with 80 and 60% initial activity remaining after incubation at 60 and 70°C for 2 h, respectively. The typical half-life of a fungal laccase is less than 1 h at 70°C and below 10 min at 80°C

(Sadhasivam et al., 2008). More significantly, LacIII has a half-life of 125 min at 70°C, which is higher than the thermostable metal-tolerant laccase from a marinederived fungus with the half-life of 90 min at 70°C (D’Souza-Ticlo et al., 2009), but less than laccases from Pycnoporus sanguineus (SCC 108), which have a half-life of 170 min at 75°C (Litthauer et al., 2007). The thermostability of LacIII suggests that it may have potential use of high process temperatures including the biotransformation of various industrial effluents such as treatment of textile mill wastewater and black liquor from paper and pulp industry, and further research is required. In summary, three laccase isozymes were obtained by a straight-forward two-step chromatography procedure from the extracellular fluid of Trametes sp. HS-03. These three laccases featured some significantly different physicochemical characteristics to those of most other laccases reported previously. The results provide evidence for the important variety of laccases produced by Trametes sp. HS-03, and these isozymes are likely to have specialized niches of application. The molecular origin of these differences, however, remains to be determined. Furthermore, because of the high levels of laccase produced by Trametes versicolor HS-03 grown on very simple media and the ease of its induction, the laccase preparations obtained from this organism are expected to have broad utility in various biotechnological applications. Thus, this is the preliminary step towards investigation of the role of these enzymes from Trametes sp. HS-03.

7922

Afr. J. Biotechnol.

ACKNOWLEDGEMENTS The authors are thankful to Dr. Juntang Lin at Friedrich Schiller University for his valuable comments. This work was supported by a research grant (No. 201003071 to WY-G) from the Medical Science and Technology Research Foundation of Henan. REFERENCES Baldrian P (2006). Fungal laccases-occurrence and properties. FEMS Microbiol. Rev. 30(2): 215-242. Champagne PP, Ramsay JA (2010). Dye decolorization and detoxification by laccase immobilized on porous glass beads. Bioresour. Technol. 101(7): 2230-2235. D'Souza-Ticlo D, Sharma D, Raghukumar C (2009). A thermostable metal-tolerant laccase with bioremediation potential from a marine-derived fungus. Mar. Biotechnol. (NY). 11(6): 725-737. Hadibarata T, Yusoff ARM, Aris A, Salmiati, Hidayat T, Kristanti RA (2012). Decolorization of azo, triphenylmethane and anthraquinone dyes by laccase of a newly isolated Armillaria sp. F022. Water Air Soil. Pollut. 223: 1045-1054. Isikhuemhen OS, Mikiashvili NA (2009). Lignocellulolytic enzyme activity, substrate utilization, and mushroom yield by Pleurotus ostreatus cultivated on substrate containing anaerobic digester solids. J. Ind. Microbiol. Biotechnol. 36(11): 1353-1362. Kim H, Lee S, Ryu S, Choi HT (2012). Decolorization of remazol brilliant blue R by a purified laccase of polyporus brumalis. Appl. Biochem. Biotechnol. 166(1): 159-164. Li M, Zhang G, Wang H, Ng T (2010). Purification and characterization of a laccase from the edible wild mushroom Tricholoma mongolicum. J. Microbiol. Biotechnol. 20(7): 1069-1076. Litthauer D, Vuuren MJV, Tonder AV, Wolfaardt FW (2007). Purification and kinetics of a thermostable laccase from Pycnoporus sanguineus (SCC 108). Enzyme Microb. Technol. 40: 563-568.

Miyazaki K (2005). A hyperthermophilic laccase from Thermus thermophilus HB27. Extremophiles, 9(6): 415-425. Montazer M, Dadashian F, Hemmatinejad N, Farhoudi K (2009). Treatment of wool with laccase and dyeing with madder. Appl. Biochem. Biotechnol. 58(3): 685-693. Rodriguez CS, Toca HJL (2006). Industrial and biotechnological applications of laccases: a review. Biotechnol. Adv. 24(5): 500-513. Rogalski J, Janusz G (2010). Purification of extracellular laccase from Cerrena unicolor. Prep. Biochem. Biotechnol. 40(4): 242-255. Sadhasivam S, Savitha S, Swaminathan K, Lin FH (2008). Production, purification and characterization of mid-redox potential laccase from a newly isolated Trichoderma harzianum WL1. Proc. Biochem. 43: 736-742. Schmidt G, Krings U, Nimtz M, Berger RG (2011). A surfactant tolerant laccase of Meripilus giganteus. World J. Microbiol. Biotechnol. DOI: 10.1007/s11274-011-0968-z Shin KS, Lee YJ (2000). Purification and characterization of a new member of the laccase family from the white-rot basidiomycete Coriolus hirsutus. Arch. Biochem. Biophys. 384(1): 109-115. Thurston CF (1994). The structure and function of fungal laccases. Microbiology, 140: 19-26. Uthandi S, Saad B, Humbard MA, Maupin-Furlow JA (2010). LccA, an archaeal laccase secreted as a highly stable glycoprotein into the extracellular medium by Haloferax volcanii. Appl. Environ. Microbiol. 76(3): 733-743. Wu YR, Luo ZH, Kwok-Kei Chow R, Vrijmoed LL (2010). Purification and characterization of an extracellular laccase from the anthracene-degrading fungus Fusarium solani MAS2. Bioresour. Technol. 101(24): 9772-9777. Zhang HB, Zhang YL, Huang F, Gao PJ, Chen JC (2009) Purification and characterization of a thermostable laccase with unique oxidative characteristics from Trametes hirsute. Biotechnol. Lett. 31(6): 837-843.

Full Length Research Paper

Salinity effect and seed priming treatments on the germination of Suaeda salsa in the tidal marsh of the Yellow River estuary H.L. Song1,2, Z.G. Sun1, X. J. Mou1,3 and J.Y. Zhao4 1

Key Laboratory of Coastal Zone Environmental Processes, Yantai Institute of Coastal Zone Research(YIC), Chinese Academy of Sciences (CAS); Shandong Provincial Key Laboratory of Coastal Zone Environmental Processes, YICCAS, Yantai Shandong 264003, P. R. China. 2 Graduate University of Chinese Academy of Sciences, Beijing 100049, China. 3 Key Laboratory for Wetland Ecology and Environment, Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Changchun 130012, P. R. China 4 China Institute of Water Resources and Hydropower Research, Beijing 00038, China Accepted 2 March, 2012

The effects of salinity and seed priming treatments (hydropriming, water, KNO3 and KH2PO3) on the germination of the euhalophyte Suaeda salsa in intertidal zone of the Yellow River estuary were investigated. Results show that the seed germination percentage decreased with increasing NaCl concentration, and at the high NaCl level (800 mM), the lowest germination percentage was recorded. At the low NaCl levels, the highest germination rate was observed on day two and the seedling length was promoted slightly. In contrast, the germination delayed and the seedling length decreased at the high salinity. According to the survival functions, we also found that, at the low salinity, the seeds germinated quickly at the initial days and then the germination rate decreased, while few seeds germinated at the initial days at the high salinity. From the results of germination percentage and seedling length, we found that the effect of Yellow river water on germination was similar to the 400 mM NaCl. For priming treatments, the hydropriming has no promotion to the seeds germination, but it promoted the seedling growth at the river water and 400 mM NaCl. Seeds primed with KNO 3 could improve the germination at the low salinity, while priming with KH2PO4 could improve the seedling growth at the high salinity, indicating that seed priming with proper nutrient (N, P) solutions could improve the germination or seedling growth as the nutrient (N, P) availability in the soil of S. salsa marsh was very limited. Key words: Suaeda salsa, germination, salinity, priming, Yellow River estuary.

INTRODUCTION About 9.5 hundred million hectares of the world’s soil are saline soil, not including large area of secondarily salinized soil in cultivated land (Zhao et al., 2002). Soil salinization results from salt water intrusion, run off from salt used during road deicing, brine contamination associated with the extraction of oil and gas products, or a buildup of inorganic ions in irrigated regions (Keiffer and Ungar, 2001). Plant germination and growth (especially

*Corresponding author. E-mail: zhigaos2012@163.com.

germination) is detrimentally impacted by salinity because germination is a key stage in the life cycle of plants in saline environment and it determines whether or not the plants can establish successfully in certain areas. One important effect of salts on the initial growth of + plants is toxicity. High intracellular concentrations of Na and/or Cl are toxic, since they inhibit the activity of many enzymatic systems and some cellular processes, such as protein synthesis or mRNA processing (Serrano, 1996; Yeo, 1998; Zhu, 2001; Forment et al., 2002). Another inhibitory effect of salinity is mainly due to osmotic effect. The osmotic component results from dehydration and

7924

Afr. J. Biotechnol.

loss of turgor induced by external solutes (Greenway and Munns, 1980; Serrano and Gaxiola, 1994). Some studies have shown that the inhibitory effect of NaCl on seed germination was more severe than that of isoosmotic polyethyleneglycol (PEG). Katembe et al., (1998) found that higher concentrations of NaCl (~1.0 MPa) more inhibitory to the germination and seedling root elongation of Atriplex prostrate and Atriplex patula than iso-osmotic PEG solutions. Duan et al.., (2004) also found that at the ~1.8 MPa and ~2.7 MPa PEG-6000 solution, there was no Glaucum L. seed germination, while at the ~1.8 MPa NaCl solution, there was also 2.5% seeds germination. However, some studies also found that the inhibition in germination at equivalent water potential of NaCl and PEG was mainly due to an osmotic effect rather than salt toxicity. Demir and Mavi (2008) discovered that both NaCl and PEG inhibited germination and seedling growth in both the varieties, but the effects of NaCI compared to PEG was less on germination and seedling growth. Similar results were reported by Kaya et al., (2006), Yagmur and Kaydan (2008), and Gunjan (2010) when they studied Phaseolus mungo, sunflower and triticale. The effects of salinity on seed germination were mainly attributed to osmotic effect and/or ion toxicity, and these different mechanisms might be related to the plant species (Song et al., 2005). There are many strategies to overcome the negative effects of salinity. An alternative strategy for the possibilities to overcome salt stress is by seed treatments with hydropriming or other treatments (Yagmur and Kaydan, 2008). Seed priming has been successfully demonstrated to improve germination and emergence in seeds of many plants. Korkmaz and Pill (2003) found that among all the priming agents (K3PO4, KH2PO4 or NH4H2PO4 and PEG 8000), only priming with KH2PO4 improved the germination synchrony of low vigor cultivar 'Greenlakes'. Kaya et al. (2006) applied 500 ppm KNO3 and distilled water to immerse the sunﬂower (Helianthus annuus L.) seeds, and showed that both seed treatments gave better performance than control under salt and drought stresses with clear effectiveness of hydropriming in improving the germination percentage at low water potential. Some other studies also indicated that priming with deionized water (Casenave and Toselli, 2007; Toselli and Casenave, 2005; Ghassemi-Golezani et al., 2008), KNO3 (Amjad et al., 2007; Demir and Mavi, 2004) and KH2PO3 (Nerson and Govers, 1986) are effective to the germination of seeds. The Yellow River is well known as a sediment-laden river. Every year, approximately 1.05 × 107 tons of sediment is carried to the estuary (Cui et al., 2009) and deposited in the delta where the flow rate slows down resulting in vast area of floodplain and special wetland landscape (Xu et al., 2002; Wang et al., 2004). Yellow River delta is the important back-up land resource of China; however, about half of the area (44.3 × 104 hm2) distributes salinized soil (Zhang et al., 2002). Suaeda

salsa (L.) Pall. (Chenopodiaceae) is the most important succulent halophytic herb, which can grow in both saline soils and intertidal zone, and has strong adaptations to the environmental stresses, such as high salinity, flooding, and sediment burial. In the growing season, the leaves and stems of S. salsa are generally red-violet due + to the accumulation of Na , Cl and betacyanin (Zhang and Zhao, 1998), and compartmentalization of these ions in the vacuole to their lower osmotic potential under high saline conditions (Zhao et al., 2003). Due to the ratio of evaporation and rainfall being 3.5 in this region and the freshwater supply from the Yellow River was significantly decreased in recent years, the salinity of marsh soil is -1 very high (>8g kg ) and approximately 70% area of salt marsh is differently salinizated (Guan et al., 2001). Therefore, exploring an effective seed priming technique, to a great extent, directly determined the restoration effect of the degraded S. salsa marsh. In this study, the distilled water, (hydropriming) KNO3 and KH2PO3 are selected to treat S. salsa seeds due to two main reasons. Firstly, many current studies have proved that KNO3 and KH2PO3 had significant effects on seed germination (Korkmaz and Pill, 2003; Kaya et al., 2006; Yagmur and Kaydan, 2008). Secondly, the nutrient status of S. salsa marsh is also an important factor. In general, N and P are the essential nutrients to the growth of marsh plants (Mistch and Gosselin, 2000), and the N/P ratio is an effective indicator to estimate nutrient limitation and N saturation (Tessier and Raynal, 2003). Koerselman and Meuleman (1996) found that marsh plant growth was limited by N if N/P ratio was less than 14. If N/P ratio was between 14 and 16, growth was limited by both N and P. If N/P ratio was more than 16, growth was limited by P. Mou (2010) applied the relationships to study the nutrient limitation of S. salsa, and found that the plant was limited by N in the low salinity status, while in high salinity status, the plant was limited by both N and P, and the limitation degree of P was very high, but the P limitation was more significant. The purposes of this paper were: (i) to investigate the germination of S. salsa seeds at different salinity levels, and identify the actual effect of Yellow River water to the germination of S. salsa seeds; (ii) to assess the various treatments (hydropriming, KNO3 and KH2PO3) as a presowing seed treatment; (iii) to examine the effects of salinity levels on the inhibition of germination and seedling damage. MATERIALS AND METHODS Study region and seeds sampling Seeds of S. salsa were collected in October 2009 from multiple individuals at an experimental plot in S. salsa marsh wetland (37°45′57.0″N, 119°09′40.7″E) in intertidal zone of the Yellow River estuary, located in the Nature Reserve of Yellow River Delta (37°35′N to 38°12′N and 118°33′E to 119°20′E) in Dongying City, Shandong Province, China. Seeds were cleaned, dried at room

Song et al.

temperature for two to three weeks, then stored at 8°C under dry and dark conditions. The nature reserve is of typical continental monsoon climate with distinctive seasons; summer is warm and rainy while winter is cold. The annual average temperature is 12.1°C, the frost-free period is 196 days, and the effective accumulative temperature is about 4300°C. Annual evaporation is 1962 mm and annual precipitation is 551.6 mm, with about 70% of precipitation occurring between June and August. The soils in the study area are dominated by intrazonal tide soil and salt soil (Tian et al., 2005). Compared with the intrazonal tide soil, the dissolubility salt content in the upper layer (0 to 20 cm) of salt soil is much higher (>8g kg-1), and its grain composition is dominated by sand and silt (50 to 80%). The main vegetations include Phragmites australis, S. salsa, Triarrhena sacchariflora, Myriophyllum spicatum, Tamarix chinensis and Limoninum sinense. S. salsa, an annual C3 plant, is one of the most important halophytes in the Yellow River estuary and can tolerate coastal seawater salinity and salinity fluctuations resulting from water evaporation and tidal inundation (Han et al., 2005). It generally germinates in late April, blooms in July, matures in late September and completely dies in late November (Gu, 1998).

Determination of seed germination and seedling growth The experiment was carried out at the Laboratory of Coastal Wetland Ecology in Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences in October 2010. The experimental design was two factors factorial (4 × 7) arranged in a completely randomized design; with three replications and 50 seeds per replicate. The ﬁrst factor was seed treatments (control, hydropriming, KNO3 and KH2 PO3), the second factor was osmotic potential levels (deionized water (control), river water (sampling date: 31 September 2010), and 100, 200, 400, 600 and 800 mM NaCl solutions). The treated and untreated seeds were then transferred to Petri dishes (50 seeds per Petri dish with three replications) containing one filter paper moistened with 4 ml of control solution or the same solution added with NaCl. In order to avoid water losses, Petri dishes were sealed with an impermeable colourless parafilm. Germination was carried out in a germination chamber with a regime of 12 h light at 25°C and 12 h darkness at 20°C. The number of germinated seeds was counted every day during 10 days from the start of the test. Seeds were considered to have germinated when the emerging radicle was at least 1 mm. At the end of the experiment, the length of seedlings in each petri dish was measured. Mean value of length in each Petri dish was used as one replicate. Three replicates were used for each treatment.

Priming techniques Three priming medium were used such as deionized water, 500 ppm KNO3 and KH2PO3 solutions. For hydropriming, S. salsa seeds were immersed in deionized water at room temperature for 6 h. For KNO3 and KH2 PO3 treatments, the seeds were immersed in 500 ppm KNO3 and KH2PO3 solution at room temperature for 2 h. Since the KNO3 and KH2PO3 solutions have the same concentration, we can compare their effects on germination. The treated seeds were removed from priming media at the same time, and dried back to their original moisture content. The control treatment consisted of untreated seed.

Germination rate The germination rate for S. salsa seed was estimated using a modiﬁed Timson Index:

 G 1   G 2   Gt ...   Germination rate=       t  t   t 

7925

  , 

Where, G is the percentage of seed germination at two-day intervals, and t is the days of the germination period. A greater value of G indicates a faster germination rate.

Germination function Due to their peculiar characteristics, seed germination and emergence assays may pose problems for data analysis, due to non-normal error distribution and serial correlation between the numbers of seeds counted on different dates from the same experimental unit (Petri dish, pot, and plot). Furthermore, it is necessary to consider viable seeds that have not germinated/emerged at the end of an experiment (censored observations), as well as late germination/emergence ﬂushes, that relate to genotypic differences within natural occurring seed populations. Traditional methods of data analysis may not be optimal for dealing with these problems. Therefore, survival analysis may represent an appropriate alternative. In this analysis, the time course of germination/emergence is described by using a nonparametric step function (‘germination function’) (Onofri et al., 2010). Like survival probability, the ‘germination/emergence probability’ can be estimated non-parametrically by using the Kaplan–Meyer method (Venables and Ripley, 2003): s

j 1

S (t )   (1  Where,

) ,

d j is the number of seeds that germinate in a given interval

of time j,

n j is

the number of seeds ‘at risk’ (this term stems from

the epidemiological ﬁeld) of germination in the same interval (number of non-germinated seeds entering the interval, minus one half of the number of lost seeds during the same interval).

Statistical analysis Analysis of variance (ANOVA) was conducted between different treatments. Significant differences between treatments were evaluated by one-way ANOVA, and the data are expressed as the mean values ± S.E. of at least three replicates.

RESULTS Germination Seed germination percentage generally decreased with increasing NaCl concentration, but the low salinity levels (control, 100 and 200 mM) had no significant influence on it (p>0.05) (Figure 1). As NaCl concentration increased over 600 mM, the germination time delayed and the germination percentage drastically declined. The lowest germination percentage was observed at the highest NaCl concentration (800 mM). Considering seed treatments, KNO3 gave the highest germination percentage at

7926

Afr. J. Biotechnol.

100 90

Control Hydropriming KNO3

Germination Percentage (％)

80 70

KH2PO4

60 50 40 30 20 10 0 Control

River water

100 mM

200 mM

400 mM

600 mM

800 mM

Salinity levels Figure 1. Germination percentage of seeds treated with water, KNO 3, KH2 PO3 and control at different NaCl concentrations. Values are means (±S.E, n = 3). Fig1. Germination percentage of seeds treated with water, KNO3, KH2PO3 and

Control at different NaCl concentrations. Values are means (±S.E, n=3) different NaCl levels (except 200 mM), indicating that the KNO3 had improved germination, and the promotion became more significant at the high salinity. Compared with untreated seeds, seeds primed with KH2PO3 and deionized water generally had lower germination percentage (Figure 1). Germination rates Germination rates were calculated by a modified Timson Index at days two, four, six and eight per salinity level. For all treatments, the highest germination rate was observed on day two at the low salinity levels (control: River water, 100 and 200 mM) (Figure 2), while at the high salinity levels (400 and 600 mM), the value was occurred on day four except for the water priming treatment (Figure 2b), indicating that high salinity generally delayed germination. As the salinity reached 800Mm, there were still few seeds germinated. Considering seed treatments, seeds treated with KNO3 gave the highest germination rate at the high salinity levels, and the germination rate generally decreased in the order of KNO3 > Control> KH2PO3> Hydropriming.

Seedling growth The length of S. salsa was not significantly affected by salinity (Figure 3), and the low NaCl concentrations (100 and 200 mM) slightly promoted the seedling growth. Comparatively, the seedling length of the three seed treatments was different. At the low NaCl concentrations (control and 100 mM), seeds primed with KNO3 promoted the seedling growth, while at the high concentrations (200, 600 and 800 mM), the promotion effect of KH2PO3 was more significant (Figure 3). For hydropriming, the seedlings had the longest length at the treatments of river water and 400 mM NaCl concentration. Germination function Survival functions provide the information on the salinity of the seed emergence trends over time (Figure 4). The emergence trends were generally different between the low salinity and high salinity as the seeds primed with KNO3 and KH2PO3, and the survival function of seeds primed with water differed from other priming techniques. At the low salinity status (Control, River water, 100 and

Song et al.

(a)

Timson's index

20 15

2 days 4 days 6 days 8 days

(b) 8 6

0mM River Water100mM 200mM 400mM 600mM 800mM

(c)

Timson's index

7927

(d)

0mM River Water100mM 200mM 400mM 600mM 800mM

Salinity levels

0mM River Water100mM 200mM 400mM 600mM 800mM

Salinity levels

Figure 2. Germination rates of seeds treated with control (a), water (hydropriming) (b), KNO3 (c) and KH2 PO3 (d) at different NaCl concentrations.

Figure 2. Germination rates of seeds treated with control (a), water (hydropriming) (b), KNO3 (c) and KH2PO3 (d) at different NaCl concentrations. 200 mM), the seeds germinated quickly at the initial days and then the germination rate declined, while at the high salinity status (600 and 800 mM), few seeds germinated at the initial days. The survival function of 400 mM was different at the different priming techniques. The survival function tended to the low salinity status as the seeds primed with KNO3, while primed with KH2PO3 and control, the survival function tended to the high salinity status, which indicated that the seeds primed with KNO3 increased the tolerance of salinity. DISCUSSION Effects salinity on seed germination This study showed that the germination of S. salsa seeds was significantly affected by salinity, and the germination percentage and germination rate generally decreased with increasing salinity. There were several probable reasons. Firstly, NaCl had inhibitory effects on the water uptake of S. salsa seed. Water generally plays the most

important role in the process of seed germination, but high salinity prevents the seeds from absorbing enough water. Secondly, the increase of salinity in medium resulted in the decrease of Îą-amylase and protease activities, decrease in concentration of reducing and nonreducing sugars, and slower mobilization of reserve protein and reduced amino acids levels during seeds germination (Yasin Ashraf et al., 2002). Thirdly, with + + increasing salinity, K content decreased while Na content increasedďź&#x2C6;Khan et al., 2000). The current study has showed that more than 50 enzymes were activated + + by K , and Na could not substitute in this role (Bhandal and Malik, 1998). Owing to the K+ requirement for the binding of tRNA to ribosome, protein synthesis requires high concentrations of K+ (Blanha et al., 2000). However, the disruption of protein synthesis by high concentrations + of Na appears to be an important cause of damage (Tester and Davenport, 2003). Different species have dissimilar ability to tolerant salinity. Halophytes such as Salicornia stricta and Salicornia ramosissima could germinate in as high as

7928

Afr. J. Biotechnol.

Control Hydropriming KNO3

7 6

Seedling length(cm)

KH2PO3 5 4 3 2 1 0

Control river water 100mM 200mM 400mM 600mM 800mM Salinity levels Figure 3. Seedling length of seeds treated with water, KNO3, KH2 PO3 and control at different NaCl concentrations. Values arelength means (ÂąS.E, n=3). Fig3. Seedling of seeds treated with water, KNO3, KH2PO3 and

control at different NaCl concentrations. Values are means (ÂąS.E. n=3) 4.0% NaCI, while other halophytes (including Triglochin maritima, Plantago maritima, Aster tripolium, Spergularia marginata, Puccinellia distans, Atriplex littorale, and Anubias hastatum) could not germinate in salinities above 1.5% NaCl (Ungar, 1978). In this study, we found that there were still few seeds which germinated at 800 mM (~4.47%), indicating that S. salsa could tolerate high salinity, which might be related to its physiological characteristic. S. salsa is a succulent halophytic herb, and succulence is an anatomical adaptation which, by increasing the vacuolar volume, permits the accumulation of large amounts of water (and dissolved ions) in the leaves (Vicente et al., 2004). One of the important attributes of halophyte seeds and possibly the principal characteristic distinguishing them from glycophytes could be their seeds' ability to remain viable for long periods under extremely high salinity stress and then germinate at a later time when soil water potentials were raisedďź&#x2C6;Ungar, 1978. This study also showed that the highest germination rate of S. salsa was occurred on day two at the low salinity levels, while at the high salinity levels (400 and 600 mM), the value was observed on day 4, but there

were no seeds which germinated at the initial day at the high salinity (800 mM), indicating that the S. salsa seemingly developed a strategy to delay germination at the high salinity. This result is similar to the report by Song et al., (2005) who found that the seeds of Haloxylon ammodendron and Suaeda physophora germinated rapidly at low NaCl concentration but remained ungerminated at high NaCl concentration during the initial stage. Easton and Kleindorfer (2009) indicated that the germination rates of Frankenia cordata decreased as salinity levels increased. The highest germination rate was recorded on day four at 0% salinity, on day six at 10% salinity, and on day eight at 20 and 30% salinity. The special strategy taken by the halophytic species might produce a persistent seed bank of viable seeds in salt habitat that would maintain the populations over time. One of the most critical stages in the life cycle of halophytes is the period of germination and establishment. Once the bottleneck of seed germination is overcome, the salt tolerance of S. salsa increases progressively with the growth of plants. In this paper, we found that the effects of salinity on germination were more significant than those on seedling length (Figures 1

Song et al.

7929

Time (Day)

B Time (Day) Figure 4. A, Survival function of seeds treated with control at different NaCl concentrations; B, survival function of seeds treated with water at different NaCl concentrations; C, survival function of seeds treated with KH2PO3 at different NaCl concentrations; D, survival function of seeds treated with KNO3 at different NaCl concentrations.

Time (Day)

and 3). Similar result was reported by Vicente et al. (2004) who found that seedlings of Plantago crassifolia

survived NaCl concentrations of 200 to 300 mM, which completely inhibited germination, showing little or no

7930

Afr. J. Biotechnol.

C C

Time (Day)

D D

Time (Day)

Fig4. Survival of seeds treated with Control (A), Water (B), KH2PO3 (C) and KNO3 (D) at dif Figure 4. Contdfunction . Fig4. Survival function of seeds treated with Control (A), Water (B), KH2PO3 NaCl concentrations. (C) and KNO3 (D) at different NaCl concentrations. Fig4. Survival function of seeds treated with Control (A), Water (B), KH2PO3 (C) and KNO3 (D) at di Fig4. Survival function of seeds treated with Control (A), towards Water (B), damage, although growth was slower than in non-treated metabolic precursors) theKH defense 2PO3 reactions KNO3adaptive (D) at different NaCl concentrations. controls. Slow growth (C) is aand general feature for against stress (Zhu, 2001). In this study, the seedling plants survival under different environmental stresses, allowing redirection of cell resources (such as energy and

length of S. salsa decreased as the NaCl concentrations were high (400, 600 and 800 mM), which was mainly due

Song et al.

to the shoot growth. Hsiao and Xu (2000), Munns and Sharp (1993) reported that shoot growth was often more reduced than root growth by salinity. There are two probable causes for growth reduction under stress. One cause is inadequate photosynthesis owing to stomatal closure and consequently limited carbon dioxide uptake. Another one is that the stress might inhibit cell division and expansion directly (Zhu, 2001). This study also showed that the low NaCl concentrations (100 and 200 mM) slightly promoted the seedling growth, which might be related to the reason why S. salsa was not responsive enough and run the risk of dying by continuous growth as stress is already serious. Fine-tuning the response could potentially increase the productivity of some plants under salt stress, while other plants might show response to stress that they ‘panic’ and almost cease growing as only stress occurs (Zhu, 2001). According to the studies of germination percentage and seedling length, we found that the effects of Yellow river water were similar to the 400 mM NaCl solution when the seeds were primed with deionized water, indicating that the actual salinity of Yellow water might approximate 400 mM. In addition, since the river water sampled from the Yellow river reflected the actual salinity of water in S. salsa marsh, and at the salinity of river water, the hydropriming had the most promotion to the seedling growth compared with the other treatments (Figure 3), indicating that the combination of hydropriming technique and appropriate amount of Yellow River water imported into the degraded S. salsa marsh in seed germination period might be an advantage to the restoration of S. salsa. Effects of seeds priming This study showed that hydropriming generally had no significant effects on seeds germination and seedling growth (Figures 1 and 3), which was not related to two reasons: (1) priming time; time is very important for seeds priming, and it generally varies from species. If time is not well controlled, it will have adverse effect on germination. In this paper, the priming time was set as 6 h, which was probably the perfect priming time for S. salsa seeds according to the analysis of seeds germination and seedling growth. (2) Environmental factors; environmental factors also influence the priming effect greatly. Subedi and Ma (2005) found that seeds soaking with water for 16 h significantly reduced percentage emergence and final plant stand; seeds soaking with 2.5% KCl and 20 ppm gibberellic acid (GA3) solution for 16 h significantly reduced plant stand and grain yield −1 under the 150 kg N ha treatment, and the possible causes were due to more wet and cool conditions during seedling establishment stage and higher soil nitrate nitrogen availability. They also concluded that in a humid growing environment such as eastern Ontario, seed priming in corn had limited or no benefits on crop development, N response, and grain yield (Subedi and

7931

Ma, 2005). Some studies also showed that there were no or limited benefits of seeds priming. For example, Giri and Schillinger (2003) indicated that none of the seedpriming media used (water, KCl, and polyethylene glycol) improved field emergence and subsequent grain yield in deep-planted winter wheat. Under soil conditions of low nutrient availability, seed dressing or coating with the limiting nutrient element has been shown to be more economical and more convenient than either soil or foliar applications (Savithri et al., 1999; Ajouri et al., 2004). Under conditions of P and Zn deficiency, Ajouri et al. (2004) used the solutions containing 5 to 500 mM P, Zn and P + Zn to soak the seeds of traditional barley cultivar Arabi aswad, and found that the priming of barley seeds for 12 h in 10 mM Zn and 50 mM P solution increased the content of these nutrients in the seeds and on the seed coat by up to 200 and 300 mg P (kg seed-1). In this paper, we found that seeds primed with KNO3 promoted the seedling growth at the low salinity, while at the high salinity; the promotion effect of KH2PO3 was more significant (Figure 3), which was probably related to the nutrient status of S. salsa wetland. In intertidal zone of the Yellow River estuary, the salinity generally increased from high tidal marsh to bare flat. Mou (2010) found that the N/P ratio (9.87 ± 1.23) of S. salsa in the middle tidal marsh was less than 14, indicating that plant growth was limited by N. Comparatively, the N/P ratio (15.73 ± 1.77) of S. salsa in the low tidal marsh was less than 16, indicating that the growth was limited by both N and P, but the P limitation was more significant. Therefore, at the low salinity, N is the limited nutrient, and seeds primed with KNO3 had prominent effect. Differently, at the high salinity, P was the most limited nutrient, and seeds primed with KH2PO3 had prominent influence. Presently, the nutrient (N, P) import amount of the Yellow River estuary is increasing due to frequent human activities, and approximately 4650 tons of nutrient is carried to the estuary every year (Bulletin of Shandong Environmental Status, 2009). Therefore, appropriate amount of Yellow River water imported into the degraded S. salsa marsh in seed germination period can improve the nutrient and salinity status of S. salsa marsh, which might be propitious to the seeds germination and seedling growth of S. salsa. However, the definite import amount of the Yellow River water is still needed to be determined in the following studies. ACKNOWLEDGEMENTS The authors would like to acknowledge the financial support of the National Nature Science Foundation of China (No. 41171424), the Key Program of Natural Science Foundation of Shandong Province (No. ZR2010DZ001), the Strategy Guidance Program of the Chinese Academy of Sciences (No. XD05030404), and the Talents Program of the Youth Innovation Promotion

7932

Afr. J. Biotechnol.

Association, Chinese Y129091041).

Academy

Sciences

(No.

REFERENCES Ajouri A, Asgedom H, Becker M (2004). Seed priming enhances germination and seedling growth of barley under conditions of P and Zn deficiency. J. Plant Nutr. 167: 630-636. Amjad M, Ziaf K, Iqbal Q, Ahnad L, Riaz MA, Saqib Z A (2007). Effect of Seed Priming on Seed Vigour and Salt Tolerance in Hot Pepper. Pak. J. Agri. Sci. 44(3):408-416. Bhandal IS, Malik CP (1998). Potassium estimation, uptake, and its role in the physiology and metabolism of flowering plants. Int. Rev. Cytol. 110: 205-254. Blanha G, Stelzl U, Spahn CMT, Agrawal RK, Frank J, Nierhaus KH (2000). Preparation of functional ribosomal complexes and effect of buffer conditions on tRNA positions observed by cryoelectron microscopy. Methods in Enzymology 317:292-309.. Bulletin of Shan dong Environment Status (2009). (http://www.sdein.gov.cn /attach/0/100817151 421859. pdf). Casenave EC, Toselli ME (2007). Hydropriming as a pre-treatment for cotton germination under thermal and water stress conditions. Seed Sci. Technol. 35: 88-98. Cui BS, Yang QC, Yang ZF, Zhang KJ (2009). Evaluating the ecological performance of wetland restoration in the Yellow River Delta, China. Ecol. Eng. 35: 1090-1103. Demir I, Mavi K (2004). The effect of priming on seedling emergence of differentially matured watermelon (Citrullus lanatus (Thunb.) Matsum and Nakai) seeds. Sci. Horticult. 102: 467–473. Demir I, Mavi K (2008). Effect of Salt and Osmotic Stresses on the Germination of Pepper Seeds of Different Maturation Stages. Brazil Archiv. Biol. Technol. 51(5): 897-902. Duan DY, Liu XJ, Feng FL, Li CZ (2004). Effects of salt and water stress on seed germination of halophyte Chenopodium glaucum L. J. Plant Resour. Environ. 13(1): 7-11. Easton LC, Kleindorfer C (2009). Effects of salinity levels and seed mass on germination in Australian species of Frankenia L. (Frankeniaceae). Environ. Exp. Bot. 65: 345-352. Forment J, Naranjo MΑ, Roldan M, Serrano R, Vicente O (2002). Expression of Arabidopsis SR-like splicing proteins confers salt tolerance to yeast and transgenic plants. Plant J. 30: 511-519. + Han N, Sha Q, Lu M, Wang BS (2005). The leaf tonoplast V-H -ATPase activity of a C3 halophyte Suaeda salsa is enhanced by salt stress n a Ca-dependent mode. J. Plant Physiol. 162: 267-274. Hsiao TC, Xu LK (2000). Sensitivity of growth of roots versus leaves to water stress: biophysical analysis and relation to water transport. J . Exp. Bot. 51: 1595-1616. Ghassemi-Golezani K, Aliloo AA, Valizadeh M, Moghaddam M (2008). Effects of different priming techniques on seed invigoration and seedling establishment of lentil (Lens culinaris Medik). Int. J. Food. Agric. Environ. 6: 222-226. Giri GS, Schillinger WF (2003). Seed priming winter wheat for germination, emergence and yield. Crop Sci. 43: 2135-2141. Greenway H, Munns R (1980). Mechanisms of salt tolerance in nonhalophytes. Ann. Rev. Plant Physiol. 31: 149-190. Gu FT (1998). Research in exploiting the green series of ediblesSuaeda salsa. J. Binzhou Education College, 5: 43-48. Guan YX, Liu GH, Wang JF (2001). Regionalization of salt-affected land for amelioration in the Yellow River delta based on GIS. Acta Geogrephica Sinica, 56: 198-205. Gunjan G (2010). Response in germination and seedling growth in Phaseolus mungo under salt and drought stress. J. Environ. Biol. 31(3): 261-264. Katembe WJ, Ungar IA, Mitchell JP (1998). Effect of salinity on germination and seedling growth of two Atriplex species (Chenopodiaceae). Ann. Bot. 82: 167-175. Kaya MD, Okcu G, Atak M, Cıkılı Y, Kolsarıcı ö (2006). Seed treatments to overcome salt and drought stress during germination in sunflower (Helianthus annuus L.) Eur. J. Agron. 24: 291-295. Keiffer CH, Ungar IA (2001). The effect of competition and edaphic

conditions on the establishment of halophytes on brine effected soils. Wetlands Ecol. Manage. 9: 469-481. Khan MA, Ungar IA, Showalter AM (2000). The effect of salinityon the growth, water status, and ion content of a leaf of a succulent perennial halophyte, suaeda fruticosa (L.) Forssk. J. Arid Environ. 45: 73-84. Koerselman W, Meuleman AFM (1996). Vegetation N: P ratio: a new tool to detect the nature of nutrient limitation. J. Appl. Ecol. 33: 14411450. Korkmaz A, Pill WG (2003). The effect of different priming treatments and storage conditions on germination performance of lettuce seeds. Eur. J. Horticult. Sci. 68: 260-265. Mistch WJ, Gosselin JG (2000). Wetlands. Van Nostrand Reinhold Company Inc, New York. Mou XJ (2010). Study on the Nitrogen Biological Cycling Characteristics and Cycling Model of Tidal Wetland Ecosystem in Yellow River Estuary. Master degree dissertation. Yantai Institute of Coastal Zone Research, Chinese Acad. Sci. Yantai. Munns R, Sharp RE (1993). Involvement of abscisic acid in controlling plant growth in soils of low water potential. Aust. J. Plant Physiol. 20: 425-437. Nerson H, Govers A (1986). Salt priming of muskmelon seeds for lowtemperature germination. Sci. Hortic. 28: 85-91. Onofri A, Gresta F, Tei F (2010). A new method for the analysis of germination and emergence data of weed species. Weed Res. 50: 187-198. Savithri P, Perumal R, Nagarajan R (1999). Soil and crop management technologies for enhancing rice production under micronutrient constraints. Nutrient Cycling Agroecosyst. 53: 83-92. Serrano R (1996). Salt tolerance in plants and microorganisms: toxicity targets and defence responses. Int. Rev. Cytol. 165: 1-52. Serrano R, Gaxiola R (1994). Microbial models and salt stress tolerance in plants. Crit. Rev. Plant Sci. 13: 121-138. Song J, Feng G, TIAN CY, Zhang FS (2005). Strategies for Adaptation of Suaeda physophora, Haloxylon ammodendron and Haloxylon persicum to a Saline Environment During Seed-Germination Stage. Ann. Bot. 96: 399-405. Subedi KD, Ma BL (2005). Seed Priming Does Not Improve Corn Yield in a Humid Temperate Environment. Agron. J. 97: 211-218. Tessier JT, Raynal DJ (2003). Use of nitrogen to phosphorus ratios in plant tissue as an indicator of nutrient limitation and nitrogen saturation. J. Appl. Ecol. 40: 523-534. + + Tester M, Davenport R (2003). Na tolerance and Na transport in higherplants. Ann. Bot. 91: 503-527. Tian JY, Wang XF, Cai XJ (2005). Protection and restoration technique of wetland ecosystem in Yellow River Delta. China Ocean University Press, Qingdao. Toselli ME, Casenave EC (2005). Hydropriming and cottonseed germination under unfavourable conditions: modifications in hydrotime model parameters. Seed Sci. Technol. 33: 87-96. Ungar IA (1978). Halophyte seed germination. Bot. Rev. 44: 233-264. Venables W, Ripley B (2003). Modern Applied Statistics with S. Statistics and Computing. Springer-Verlag, New York, NY, USA. Vicente O, Boscaiub M, Naranjo MA, Estrelles E, Belles JM, Soriano P (2004). Responses to salt stress in the halophyte Plantago crassifolia (Plantaginaceae) J. Arid Environ. 58: 463-481. Wang FY, Liu RJ, Lin XG, Zhou JM (2004). Arbuscular mycorrhizal status of wild plants in saline-alkaline soils of the Yellow River Delta. Mycorrhiza, 14: 133-137. Xu XG, Guo HH, Chen XL, Lin HP, Du QL (2002). A multi-scale study on land use and land cover quality change: the case of the Yellow River Delta in China. Geo. J. 3: 177-183. Yagmur M, Kaydan D (2008). Alleviation of osmotic stress of water and salt in germination and seedling growth of triticale with seed priming treatments. Afr. J. Biotechnol. 7(13): 2156-2162. Yasin Ashraf M, Afaf R, Saleem Qureshi M, Sarwar S, Naqvi MH (2002). Salinity induced changes in s-amylase and protease activities and associated metabolism in cotton varieties during germination and early seedling growth stages. ACca Physiol. Planta. 24: 37-44. Yeo A (1998). Molecular biology of salt tolerance in the context of wholeplant physiology. J. Exp. Bot. 49: 915-929. Zhao KF, Fan H, Ungar IA (2002). Survey of halophyte species in China.

Song et al.

Plant Sci. 163: 491-498. Zhang HY, Zhao KF (1998). Effects of salinity and water stresses on osmotic adjustment of Suaeda salsa seedlings. Acta Bot. Sinica. 40: 56-61. Zhang JF, Xing SJ, Xi JB, Song YM, Ma BY (2002). Forestry Strategy for Coping with Environmental Problems on Yellow River Delta Sustainable Development. J. Northeast For. Univ. 30(6): 115-119.

7933

Zhao KF, Fan H, Zhou S, Song J (2003). Study on the salt and drought tolerance of Suaeda salsa and Kalanchoe daigremontiana under isoosmotic salt and water stress. Plant Sci. 165: 837-844. Zhu JK (2001). Plant salt tolerance. Trends Plant Sci. 6: 66-71.

Full Length Research Paper

Screening of root nodule bacteria for the production of polyhydroxyalkanoate (PHA) and the study of parameters influencing the PHA accumulation Sreya Kumbhakar, Prabhat Kumar Singh and Ambarish S Vidyarthi* Department of Biotechnology, Birla Institute of Technology, Mesra, Ranchi-835215, India. Accepted 14 March, 2012

Twelve polyhydroxyalkanoate (PHA) producing microbes were isolated from root nodules of 8 leguminous plants belonging to two phyla: Proteobacteria and Firmicutes. One of the isolate VK-12 of genus Burkholderia showed the highest PHA accumulation (42% wt/wt) as compared to other isolates in mineral medium. The effect of different cultural and growth conditions were studied on isolate VK-12 in shake flasks for highest PHA accumulation. VK-12 showed highest PHA accumulation in sucrose and ammonium sulphate amongst other carbon and nitrogen sources tested in the medium. The medium containing sucrose and ammonium sulphate having C: N ratio of 39.72 gave the highest PHA accumulation. The optimum pH, temperature, inoculum concentration and incubation time for highest PHA accumulation were 7.0, 30°C, 10% and 48 h respectively. An overall increase in PHA accumulation from 42 to 63% wt/wt was obtained under optimised conditions. The PHA was characterised using gas chromatography-mass spectrometry (GC-MS). All the isolates produced poly (3-hydroxybutyrate) (PHB) except VK-9, which produced polymer poly (3-hydroxybutyrate-co-3-hydroxyvalerate). Key words: Polyhydroxyalkanoate (PHA), PHB-co-HV, root nodule bacteria, carbon sources, C: N ratio, characterization of PHA. INTRODUCTION Decades have been invested on extensive research to develop biodegradable polymers as a substitute for petrochemical based polymers due to their eco-friendly nature. Polyhydroxyalkonoates (PHA) are polyesters of various R-hydroxyalkanoates and are considered as a good alternative amongst other biodegradable polymers developed, due to their biodegradability, biocompatibility, use of renewable resources as raw material, plastic and elastomeric material properties similar to petrochemical based polymers (Lee, 1996a; Ojumu et al., 2004). PHA’s are accumulated as intracellular inclusion bodies by many Gram-positive and Gram-negative bacteria to

*Corresponding author. E-mail: asvidyarthi@bitmesra.ac.in. Tel: +91-651-2276223. Fax: +91-651-2275401. Abbreviations: PHA, Polyhydroxyalkanoate; GC-MS, gas chromatography-mass spectrometry; PHB, poly (3hydroxybutyrate).

levels as high as 90% of dry cell weight when carbon source is in excess but other nutrient supply (O, P, N and S) are in limiting condition (Anderson and Dawes, 1990; Lee, 1996b). A large number of PHA’s and its copolymers have been exploited as bioplastics, biomedical applications such as drug delivery (Gursel et al., 2002; Sendil et al., 1999) and tissue engineering (Chen and Wu, 2005; Misra et al., 2006). Various researchers have isolated the promising microorganisms from different environment such as municipal sewage sludge (Reddy et al., 2008), marine microbial mats (López-Cortés et al., 2008) and marine environments (Arun et al., 2009). The root nodules of leguminous plants can be regarded as a good ecosystem for the isolation of potential PHA producing isolates as plants interact with abundant and diverse range of bacteria present in the soil. In the present work, isolation and screening of PHA producing bacteria has been carried out from the root nodules of leguminous plants. The major problem associated with the industrial poly β-

Kumbhakar et al.

hydroxybutyrate (PHB) production is its cost of production that could be minimised by cultural optimization studies. Hence, different cultural and environmental conditions were tested to analyze their effect on PHA production by the higher PHA producing isolate. MATERIALS AND METHODS Isolation and identification of PHA producing bacteria Plants of Glycine max, Vigna sinensis, Vigna umbellate, Arachis hypogaea, and Vigna mungo, grown and maintained in the fields of Birsa Agricultural University, Ranchi, India, and Acacia catechu, Mimosa pudica and Trifolium repens grown in the campus of Birla Institute of Technology (BIT), Mesra, Ranchi, during the winter (November to December) of 2009 were uprooted, root nodules (4 to 6 per plant) were collected and stored in air tight plastic containers. Bacterial isolation was carried from nodules according to the method of Zakhia et al. (2006). The bacterial isolates were further evaluated for PHA accumulation by incubating them for sufficient time (72 h) at 28°C on YEMA plates. PHA accumulation of the bacteria was first checked by Sudan Black B staining (Burdon, 1946) and then confirmed with Nile Blue A staining (Ostle and Holt, 1982). PHA producing isolates were subsequently identified based on 16S rRNA sequencing. Genomic DNA was extracted and purified according to standard protocols (Sambrook and Russell, 2001) and its purity was assessed by measuring the absorbance at 260 and 280 nm (A260/A280). The 16S rRNA was PCR amplified using the following universal primers: 8F (5’-AGAGTTTGATCCTGGCTCAG3’) and 1492R (5’ ACGGCTACCTTGTTACGACTT-3’). The amplified samples were sent to Xcelris laboratories, Ahmadabad, India, for sequencing service. Chromatograms, thus received were analyzed while contigs were assembled manually using Chromas Pro version 1.5 (Technelysium Ptv, Ltd, Tewantin, Australia). The 16S rRNA gene sequences were compared with other known rRNA gene sequences from Ribosome Database Project (RDP) (http://rdp.cme.msu.edu/). Seq match programme of RDP was used to search the most similar sequences in the databases (Cole et al., 2007, 2009).

PHA production Growth medium and culture conditions Pre inoculum of all the selected cultures was prepared in mineral medium (Borah et al., 2002) with glucose (2% w/v) as carbon source. PHA production was carried out in 100 ml mineral medium in a 500 ml Erlenmeyer flask. A 5% pre-inoculum culture was inoculated into the 100 ml production medium described earlier and incubated in an orbital shaker at 150 rpm and 30°C for 48 h. Using the same method, all 12 isolates were incubated for 48 h (30°C). After incubation, the broth was centrifuged at 8,000 rpm for 10 min; cells collected were washed with distilled water to remove the remaining media constituents and cells were lyophilized for the extraction of PHA. To estimate dry cell weight, 10 ml of the broth was centrifuged separately and cells were dried to a constant weight at 60°C for 48 h.

7935

Effect of different carbon and nitrogen sources and C: N ratio Glucose and ammonium sulphate of the mineral medium was replaced with different carbon sources (sucrose, mannitol, glucose, lactose, xylose, maltose and starch) and nitrogen sources (ammonium chloride, ammonium nitrate, ammonium sulfate, tryptone, yeast extract, peptone, beef extract, malt extract). The amount of carbon and nitrogen compound added was calculated to give the same concentration as the original source. The C:N ratio varied from 9.93 to 79.44 by keeping sucrose concentration at 20 gL-1 and varying ammonium sulphate concentration from 2.0 to 0.5 gL-1 in the mineral medium. Other cultural conditions were kept constant. Samples were analysed for cell growth and PHA accumulation.

Effect of different pH, temperature, inoculum concentration and incubation time The effect of different pH, temperature, inoculum concentration and incubation time was determined by growing the isolate in mineral media having sucrose and ammonium sulphate with C: N ratio of 39.72. The pH of the medium varied in the range 6 to 9, temperature in the range of 25 to 50°C, cell concentration of 12 h old inoculum in the range of 1 × 104 to 1x 105 cells in 100ml medium, incubation time varied from 0 to 60 h and the fermentation was carried as stated before. Samples were analysed for cell growth and PHA accumulation.

Quantification and characterization of PHA The PHA content of the isolates was quantified using UVspectrophotometer at 208 nm according to the method of Karr et al. (1983). Standard curve was prepared with poly β-hydroxybutyrate (PHB) (Sigma-Aldrich Co. Ltd). For the extraction of PHA, the lyophilized cells were treated with hypochlorite solution (4 to 6% w/v active chlorine). At this concentration, the cell will lyses without degradation of PHA. Then the cells were subjected to homogenisation by ultrasonic treatment for 5 min for complete cell lyses. The homogenate was further kept at 37°C for 30 min in orbital shaker. The lysed cell mass was centrifuged at 10,000 rpm for 15 min, the pellet obtained was washed with sterile distilled water and then with cold diethyl ether. The residue obtained was finally dried and subjected to chloroform extraction at 50°C for 24 h. PHA present was concentrated by rotary vacuum evaporation and precipitation using 10 volumes of ice-cold methanol. The precipitate obtained was centrifuged and air-dried.

GC-MS analysis Methyl esters of the extracted PHA were prepared (Braunegg et al., 1978). The analysis was performed using Perkin Elmer Clarus 500 GC/MS. Elite 17 MS column (30 m-length, 0.25 mm-internal diameter, and 0.25 µm-film thickness) was used. The sample (1 µl) in chloroform was injected with helium (1ml/ min) as the carrier gas. The injector temperature was 230°C and the column temperature was increased from 80 to 150°C at 10°C min-1.

RESULTS Optimization studies VK-12 isolate was further used for the optimization studies in shake flask. The media used for these experiments were the same as earlier described.

Isolation and identification of PHA producing bacteria Dilution of root nodule extract on YEMA plate gave rise to a large number of colonies with a great variation in colony

7936

Afr. J. Biotechnol.

Table 1. List of root nodule bacteria isolated and screened for PHA production.

Host plant Acacia catechu Trifolium repens Mimosa pudica Glycine max Vigna sinensis Vigna umbellata Arachis hypogaea Vigna mungo

Number of colony screened for PHA production a 8 5 7 7 4 9 5 9

No of colonies picked from second plate for screening; confirmation with Nile blue A staining.

Number of PHA producing isolates b 6 1 1 2 1 1 b

based on Sudan black B and

Table 2. PHA yield and its monomeric composition obtained from isolates.

Isolate Vk-4 VK-5 VK-6 VK-7 VK-8 VK-9 VK-10 VK-11 VK-12 VK-13 VK-14 VK-15

Dry cell mass (g L-1) * 2.43±0.04 1.73±0.03 2.03±0.31 2.53±0.17 6.24±0.21 6.66±0.071 2.11±0.05 6.22±0.12 6.35±0.11 6.61±0.03 4.08±0.11 3.70± 0.02

PHA (g L-1) *a 0.51±0.02 0.42±0.03 0.45±0.03 0.62±0.03 2.07± 0.12 2.60± 0.03 0.39±0.04 1.85±0.08 2.83±0.03 2.41±0.05 1.42±0.03 1.48±0.04

%PHA* b 21±0.17 24±0.23 22±0.09 25±0.03 33±0.21 39±0.15 18±0.11 30±0.18 42±0.06 36±0.06 30±0.13 40±0.19 a

PHA content PHB PHB PHB PHB PHB P3HBco HV PHB PHB PHB PHB PHB PHB b

*Values are the means of triplicate measurements with standard deviations; PHA content in the medium; PHA accumulation based on cell dry weight.

morphology, colour and size. Out of these, a total of 54 bacterial isolates were screened for PHA producing potentials. Twelve PHA producing isolate were obtained from the root nodules (Table 1). These isolates, named VK-4 through VK-15, were screened on the basis of results of staining with Sudan black B and Nile blue-A stains. The 16S rRNA sequence analysis of the isolates showed that they belonged to seven genera (Bacillus (VK-4 through VK-7), Ensifer (VK-8), Rhizobium (VK-9), Pseudomonas (VK-10), Burkholderia (VK-11 through VK13), Delftia (VK-14) and Cupriavidus (VK-15)). The 16S rDNA sequences of various isolates have been deposited in EMBL database under accession numbers FR853803 through FR853814 for isolates VK4-VK-15. PHA production In shake flask experiment, the production of PHA by the

12 isolates ranged between 0.4 and 2.8 gL-1 when incubated for 48 h at 30°C. The percentage PHA productivity was highest for VK-12 (42% wt/wt) based on dry cell mass (Table 2). Optimization studies Effect of different carbon and nitrogen sources and C: N ratio The isolate was able to utilize all seven carbon sources for growth and PHA accumulation; it produced maximum PHA with sucrose followed by mannitol, glucose, lactose, xylose, maltose and starch. The amount of PHA produced using sucrose as sole carbon source was 3.56 -1 g L , corresponding to 50% of cell dry weight (Figure 1). However, starch was least suitable for the growth and PHA production. The influence of different nitrogen sources on the growth and PHB production by the isolate

Kumbhakar et al.

7937

Figure 1. Effect of different carbon sources on growth and PHB production of isolate VK-12.CDW gl-1= cell dry weight, PHB gl-1= PHB content in the medium, %PHB (wt/wt) = PHB accumulation based on cell dry weight.

in media containing sucrose as a carbon sources have shown that yeast extract and ammonium sulphate gave the highest biomass yield though percentage PHA accumulation was found to be highest for ammonium sulphate as compared to yeast extract. The maximum PHA accumulation was obtained in case of ammonium sulphate followed by tryptone, yeast extract, peptone, beef extract, malt extract, ammonium chloride and ammonium nitrate (Figure 2). Maximum PHA concentrations were obtained with sucrose and ammonium sulphate; hence, both have been used in all subsequent work. Optimisation studies with varying C: N ratio show that highest biomass yield was obtained at C:N ratio of 13.24 while highest PHA accumulation was obtained at C:N ratio of 39.72 (Figure 3). Effect of different pH, temperature, concentration and incubation time

It is known that temperature is one of the most critical parameters that have to be controlled in the bioprocess. It is obvious from the results (Figure 5) that 30°C was generally more favourable for PHA production. However, the temperature above 30°C resulted in a sharp decrease in PHA accumulation. The results indicate that the use of 4 5×10 cells in 100 ml medium as inoculation gave the highest PHA accumulation (Figure 6). Higher or lower inoculum concentration resulted in a significant decrease in PHA accumulation. Studies on effect of incubation time show that the PHB production increased by increasing its time up to 48 h. Accumulation of the polymer begins in the late log phase of growth and becomes maximum during the stationary phase of growth after PHA decreased in time dependent manner, thus, 48 h was selected as the optimum incubation time (Figure 7).

inoculum PHA characterisation

The optimum growth of isolate VK-12 was observed at pH 7.0 and also at this pH, the maximum accumulation of PHB by this isolate was obtained (Figure 4). Although the culture grew at lower and higher pH values, a significant decrease in PHB accumulation was observed.

GC-MS analysis The polymers extracted from 12 isolates were analyzed by GC-MS. Eleven isolates produced PHB as observed

7938

Afr. J. Biotechnol.

Figure 2. Effect of different nitrogen sources on growth and PHB production of isolate VK-12 CDW gl-1= cell dry weight, PHB gl-1= PHB content in the medium, %PHB (wt/wt) = PHB accumulation based on cell dry weight.

Figure 3. Effect of different C: N ratio on growth and PHB production of isolate VK-12. CDW gl-1= cell dry weight, PHB gl-1= PHB content in the medium, %PHB (wt/wt)= PHB accumulation based on cell dry weight.

Kumbhakar et al.

Figure 4. Effect of different pH on PHB production by isolate VK-12. CDW gl-1= Cell dry weight, PHB gl-1= PHB content in the medium, %PHB (wt/wt)= PHB accumulation based on cell dry weight.

Temperature (째C) Figure 5. Effect of different temperature on PHB production by isolate VK-12. CDW gl-1= cell dry weight, PHB gl-1= PHB content in the medium, %PHB (wt/wt) = PHB accumulation based on cell dry weight.

7939

7940

Afr. J. Biotechnol.

Figure 6. Effect of different inoculum concentration/100 ml medium on PHB production by isolate VK-12. CDW gl-1= cell dry weight, PHB gl-1= PHB content in the medium, %PHB (wt/wt) = PHB accumulation based on cell dry weight.

Figure 7. Effect of incubation time on biomass yield and PHB production by isolate VK-12. CDW gl-1= cell dry weight, PHB gl-1= PHB content in the medium, %PHB (wt/wt) = PHB accumulation based on cell dry weight.

Kumbhakar et al.

7941

Figure 8. The total ion current chromatogram (TIC) of the methanolysis product of the polymer isolated. STD1= standard methyl ester of 3hydroxybutyrate, STD2= standard methyl ester of 3-hydroxy valerate, sample1= polymer extracted from VK-8 and Sample2= polymer extracted from VK-9. Peak was magnified 5 times.

by a peak of methyl ester of 3-hydroxybutyrate (3.99) and only VK-9 gave an additional peak at 5.27 which corresponds to methyl ester of 3-hydroxyvalerate. The mass spectrum and retention time of these peaks also matched that of the standard sample of the methyl ester of 3-hydroxybutyrate (Sigmaâ&#x20AC;&#x201C;Aldrich) and methyl ester of 3-hydroxyvalerate (Sigma-Aldrich) (Figures 8 and 9). The chromatogram peak with retention time of 3.99 min also matched the mass spectrum from the MS library (NIST 2005), for the methyl ester of 3-hydroxybutyrate. DISCUSSION Bacteria are diverse and abundant in soils. Therefore, plants are constantly involved in interactions with a wide

range of bacteria, and a number of plant-associated bacteria colonize the rhizosphere (rhizobacteria), the phyllosphere (epiphytes), and inside of the plant tissues endophytes. Our research goals include the isolation of PHA producing microbes from root nodules of leguminous plants, identifying the PHA producing ability, quantifying and characterising the PHA produced by these isolates. In this study, we isolated 12 potential PHA producing strains from root nodules of A. catechu, T. repens, M. pudica, V. sinensis, V. umbellate and V. mungo (Table 2). Considering 16S rRNA gene sequencing results, these strains commonly belong to two phyla: Proteobacteria and Firmicutes with seven genera (Bacillus, Ensifer, Rhizobium, Pseudomonas, Burkholderia, Delftia and Cupriavidus). Half of the PHA producing isolates were obtained from A. catechu and

7942

Afr. J. Biotechnol.

Figure 9. Mass spectra of (a) standard methyl ester of 3-hydroxy butyrate (3HB), (b) methyl ester of polymer extracted from VK-8, (c) standard methyl ester of 3-hydroxy valerate (3HV) and (d) methyl ester of polymer extracted from VK-9.

belonged to genus Bacillus, Ensifer, Rhizobium, Pseudomonas and Burkholderia. Among all the isolates, VK-12 emerged as the highest PHA producer (42% wt/wt) based on dry cell weight (Table 2) and it belonged to genus Burkholderia. Burkholderia sp. is known for one of the most metabolically versatile bacterium (Stanier et al., 1966), therefore, it was able to utilise all tested carbon source for growth and PHA production; however, the PHA accumulation was found to be highest with sucrose as carbon source as compared to other carbon sources tested. Lee and Yim (1995) have reported similar

kind of results in their study on Pseudomonas cepacia KYG-505 (KCCM 10004) that sucrose as a carbon source gave the highest cell growth and PHA accumulation as compared to fructose, glucose and maltose. In this study, it was observed that the highest biomass yield and PHA accumulation was obtained using ammonium sulphate as nitrogen source compared to other nitrogen sources tested. However, Borah et al. (2002) reported that organic nitrogen sources increased the PHB accumulation rather than inorganic nitrogen sources based on the study on Bacillus mycoides. In contrast to this, El-

Kumbhakar et al.

7943

Figure 9. Contd.

Sayed et al. (2009) have reported higher growth of R. eutropha ATCC 17697 and A. latus ATCC 29712 using organic nitrogen compared to inorganic nitrogen, while there was high PHB production by the strains in media supplemented with ammonium sulphate as nitrogen source. There are many reports to establish the effect of different nitrogen sources on Bacillus sp. (Borah et al., 2002, YĂźksekdaÄ&#x; et al., 2004), Streptomyces sp. (Aysel et al., 2002), Rhizobium sp. (Mercan et al 2002), A. latus, and R. eutropha (El-Sayed et al., 2009), but none have reported the effect of different nitrogen sources on Burkholderia sp.

Results on optimisation of C:N ratio show that the optimal C:N ratio yields of the highest cell dry weight did not correspond to the highest PHA production. The cell dry weight of the strain decreased with increase in C:N ratio and the highest cell dry weight (8.15 g/l) was observed at C:N ratio of 13.24. However, the PHA accumulation in cell increased with increasing C:N ratio, till reaching the optimum values at C:N ratio of 39.72, and subsequently decreased up to C:N ratio of 79.44. At C:N -1 ratio of 39.72, the PHA accumulation was 3.6 gL of the medium corresponding to PHB content of 59 % (wt/wt) based on dry cell weight. Similar results in PHA study

7944

Afr. J. Biotechnol.

Figure 9. Contd.

were reported by El-Sayed et al. (2009) with both R. eutropha ATCC 17697 and A. latus ATCC 29712 and found maximum PHB accumulation values at C: N ratio of 12.57. Based on the experiments in this study, the optimum pH, temperature, and incubation time for highest PHA accumulation were 7.0, 30Â°C, and 48 h respectively. The optimum inoculum concentration was found to be 5Ă&#x2014;104 cells in 100 ml medium for highest PHA accumulation. Lower inoculum concentration resulted in decreased PHA production due to delay in cell mass production. Further increase of inoculum size resulted in lower PHA accumulation. Similar results of influence of inoculum size on PHB production were also reported by Ramadas et al. (2010). An overall increase in PHA accumulation from 42 to 63% (wt/wt) was obtained under these optimised conditions.

GC-MS spectra of the PHA accumulated by various isolates as well as PHA standards confirmed that the polymer produced is mainly PHB except in case of VK-9 in which an additional peak at 5.27 min was recorded. The additional peak represents for P (3HB co HV) when compared with standard. Similar results were reported by Lakshman and Shamala (2003) for PHA produced by R. meliloti MTCC 100.

ACKNOWLEDGEMENTS This research was financially supported by the Department of Biotechnology, BIT, Mesra. The authors thankfully acknowledge them for their assistance in creating the infrastructure used in this research. The

Kumbhakar et al.

7945

Figure 9. Contd.

authors would also like to thank Dr. Manish Kumar, Mr. Shankaracharya and Dr Ashoke Sharone for their help during GC-MS, phylogenetic analysis and for critical reviews of this manuscript respectively. S. Kumbhakar acknowledges the Council of Scientific and Industrial Research (CSIR), New Delhi, India, for the award of research fellowship. REFERENCES Anderson AJ, Dawes EA (1990). Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates. Microbiol. Rev. 54: 450-472. Arun A, Arthi R, Shanmugabalaji V, Eyini M (2009). Microbial production of poly-Î˛- hydroxybutyrate by marine microbes isolated from various marine environments. Bioresour. Technol. 100: 2320-2323.

Aysel U, Sahin N, Beyatli Y (2002). Accumulation of Poly-Î˛Hydroxybutyrate in Streptomyces Species during Growth with Different Nitrogen Sources. Turk. J. Biol. 26: 171-174. Borah B, Thakur PS, Nigam JN (2002).The influence of nutritional and environmental conditions on the accumulation of poly-betahydroxybutyrate in Bacillus mycoides RLJ B-017. J. Appl. Microbiol. 92: 776-783. Braunegg G, Sonnleitner B, Lafferty RM (1978). A rapid gas chromatographic method for the poly-b-hydroxybutyric acid in microbial biomass. Eur. J. Microbiol. Biotechnol. 6: 29-37. Burdon KL (1946). Fatty acid material in bacteria and fungi revealed by staining dried, fixed, slide preparation. J. Bacteriol. 52: 665-678. Chen GQ, Wu Q (2005). The application of polyhydroxyalkanoates as tissue engineering materials. Biomaterials. 26: 6565-6578. Cole JR, Wang Q, Cardenas E, Fish J, Chai B, Farris RJ, Kulam-SyedMohideen AS, McGarrell DM, Marsh T, Garrity GM, Tiedje JM (2009). The ribosomal database project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 37: D141-D145. Cole JR, Chai B, Farris RJ, Wang Q, Kulam-Syed-Mohideen AS,

7946

Afr. J. Biotechnol.

McGarrell DM, Bandela AM, Cardenas E, Garrity GM, Tiedje JM (2007). The ribosomal database project (RDP-II): introducing my RDP space and quality controlled public data. Nucleic Acids Res. 35: D169-D172. El-Sayed, Azhar A, Abdelhady HM, Hafez AMA, Khodair TA (2009). Production of Polyhydroxybutyrate (PHB) using batch and two stage batch culture strategies. Aust. J. Basic Appl. Sci. 3(2): 617-627. Gursel I, Yagmurlu F, Korkusuz F, Hasirci V (2002). In vitro antibiotic release from poly (3-hydroxybutyrate-co-3-hydroxyvalerate) rods. J. Microencapsulation, 19: 153-164. Karr DB, Waters JK, Emerich DW (1983). Analysis of poly β hydroxybutyrate in Rhizobium japonicum bacteroids by ion-exclusion highpressure liquid chromatography and UV detection. Appl. Environ. Microbiol. 46: 1339-1344. Lakshman K, Shamala TR (2003). Enhanced biosynthesis of polyhydroxyalkanoates in a mutant strain of Rhizobium meliloti. Biotechnol. Lett. 25: 115-119. Lee SY (1996a). Plastic bacteria? Progress and prospects for polyhydroxyalkanoate production in bacteria. Trends. Biotechnol. 14(11): 431-438. Lee SY (1996b). Bacterial polyhydroxyalkanoates. Biotechnol. Bioeng. 49: 1-14. Lee YG, Yim GB (1995). Poly-.beta.-hydroxy alkanoate (PHA) copolymer, method of its production, the microbe which produces it, and PHA copolymer blend U.S Patent 5,395,919, Filed Nov. 18, 1993 and issued: Mar 7, 1995. López-Cortés A, Lanz LA, García MJQ (2008). Screening and isolation of PHB-producing bacteria in a polluted marine microbial mat. Microb. Ecol. 56: 112-120. Mercan N, Aslım B, Yüksekdağ ZN, Beyatlı Y (2002). Production of poly- β-hydroxybutyrate (PHB) by some Rhizobium bacteria. Turk. J. Biol. 26: 215-219. Misra SK, Valappil SP, Roy I, Boccaccini AR (2006). Polyhydroxyalkanoate (PHA)/ inorganic phase composites for tissue engineering applications. Biomacromolecules, 7: 2249-2258.

Ojumu TV, Yu J, Solomon BO (2004). Production of polyhydroxyalkanoates, a bacterial biodegradable polymer. Afr. J. Biotechnol. 3: 18-24. Ostle AG, Holt JG (1982). Nile blue as a fluorescent stain for PHB. Appl. Environ. Microbiol. 44: 238-241. Ramadas NV, Soccol CR, Pandey A (2010). A Statistical Approach for Optimization of Polyhydroxybutyrate Production by Bacillus sphaericus NCIM 5149 under Submerged Fermentation Using Central Composite Design. Appl. Biochem. Biotechnol. 162: 9961007. Reddy SV, Thirumala M, Mahmood SK (2008). Isolation of bacteria producing polyhydroxyalkanoates (PHA) from municipal sewage sludge. World J. Microbiol. Biotechnol. 24: 2949-2955. Sambrook J, Russell RW (2001). Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring. Sendil D, Gürsel I, Wise DL, Hasirci V (1999). Antibiotic release from biodegradable PHBV microparticles. J. Control. Release, 59:207-210. Stanier RY, Palleroni NJ, Doudoroff M (1966). The aerobic pseudomonads: A taxonomic study. J. Gen. Microbiol. 43: 159-271. Yüksekdağ ZN, Aslim B, Beyatli Y, Mercan N (2004). Effect of carbon and nitrogen sources and incubation times on poly-betahydroxybutyrate (PHB) synthesis by Bacillus subtilis 25 and Bacillus megaterium 12. Afr. J. Biotechnol. 3(1): 63-66. Zakhia F, Jeder H, Willems A, Gillis M, Dreyfus B, de Lajudie P (2006). Diverse bacteria associated with root nodules of spontaneous legumes in Tunisia and first report for nifH like gene within the genera Microbacterium and Starkeya. Microbial. Ecol. 51: 375-393.

African Journal of Biotechnology Vol. 11(31), pp. 7947-7956, 17 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3630 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Isolation of polyvinyl chloride degrading bacterial strains from environmental samples using enrichment culture technique Rajashree Patil and U. S. Bagde* Microbiology Laboratory, Department of Life Sciences, University of Mumbai, Vidyanagari, Mumbai, 400078, India. Accepted 12 March, 2012

Plastic causes serious damage to the environment, both during its production and disposal. Biodegradation of plastic waste using microbial strain could offer a solution to the problem. Microorganisms have been a good resource for solution to this problem due to their diverse metabolic capability, adaptability to different environment and possibility of isolation using artificial growth media for utilization in situ. In the present investigation, potent microbial strains degrading plastic constituting polymer polyvinyl chloride (PVC) were isolated using enrichment culture technique. To increase the chances of isolating such strain which could have adapted to metabolize plastic constituting polymers, samples were collected from different environmental sites that were rich in plastic waste. These samples were used as a source of microbial culture for enrichment of potential PVC degraders. After then, some bacterial species were subsequently isolated on solid agar medium containing emulsified PVC polymer. The strain PVC 4 characterized as Micrococcus species was found to be more efficient among the other isolates and was chosen for further studies. The biodegradability of PVC by Micrococcus species with PVC as a sole carbon source was determined by their ability to release chloride from PVC polymer, increase their cell density in test media, carbon dioxide production and growth on the surface of PVC film in plate assay. The Micrococcus species showed 0.36% release of chloride and 8.87% mineralization measured in terms of carbon dioxide evolution respectively over a period of 70 days in PVC containing media. The increase in cell density in liquid growth media constituting PVC polymer as a sole source of carbon and growth of cells on the surface of PVC film further substantiate the potential of isolated strain for PVC utilization. Key words: Polyvinyl chloride, biodegradation, Micrococcus species, enrichment culture.

INTRODUCTION The issue of plastic waste management is a complex process and there is no simple solution for reducing this waste. Incineration, recycling, and land filling are some of the traditional methods for handling plastic waste. However, these methods are costly and often create new environmental difficulties (Mody, 2000; Mario, 2008). The best solution according to many scientists in the world is a combination of solutions that includes use of biodegradable plastic, plastic recycling, and bioremediation of plastic waste. Nowadays, bioremediation of plastic waste is gaining increased attention in environmental manage-

*Corresponding author. E-mail: bagdeu@yahoo.com.

ment of plastic waste as biological degradation is necessary for plastics that eventually enter the waste streams and can therefore neither be recycled nor incinerated (Cacciari et al.,1993; Shah et al., 2008). In view of this, the diverse metabolic capability of microorganisms could be exploited for bioremediation of plastic waste that use microbial strains developed through selection, strain improvement, or genetic modification. The most effective microbial strain can then be produced in large scale for field application. The degradation of most synthetic plastics is a very slow process that involves environmental factors and action of wild microorganisms (Shah et al., 2009). In nature, complete mineralization of plastics to carbon dioxide and water involves succession of syntrophic association,

7948

Afr. J. Biotechnol.

between various groups of microorganisms. However systematic and reproducible study on biodegradation process necessitates isolation of microorganisms in the form of pure culture. In addition, isolation is appropriate for the identification and detailed study of microorganisms that are added with compound in the environment. However, practically, microorganisms with plastic degrading abilities are rare in environmental samples and hence their number needs to be amplified prior to isolation. Subsequently, the most potent organisms could be isolated on solid agar medium. Enrichment culture technique is used for isolating the desired target organisms from various kinds of organisms that coexisted in nature, and is generally designed to achieve an increase in the relative numbers of particular organism by favoring growth, survival (that is, physiological competition), or its spatial separation from other members of population (Tomita et al., 2004). The aim of this study was to isolate potent polyvinyl chloride (PVC) degrading microbial strains using enrichment culture technique from samples collected from different sites rich in plastic waste, and subsequently its isolation on solid mineral agar media incorporated with emulsified polyvinyl chloride. The work also involved preliminary characterization and study of degradation potential of selected isolated strain using different test methods. MATERIALS AND METHODS Collection of microbial environmental sites

source

samples

from

different

Samples from various sites were collected to be used as a microbial source for the enrichment of plastic degrading microorganisms. The sites, where plastic materials were found polluting the sites either openly or partially buried in the soil, were initially identified. Soil samples were collected from the garden area near the campus of University of Mumbai, India. In this area, it was observed that plastic was buried under the soil, and from dumping ground used to dump municipal solid waste, along with lots of plastic waste, near Kalyan city, India. Industrial effluent samples were collected from effluent drainage near Gharda Chemicals Ltd., Dombivili, India, and from sea creak, near Century Rayon Ltd., Shahad, India, where the drainage also showed large amounts of plastic bags clogging the flow of water. The sea sediments and sea water samples were collected from sites highly polluted with plastic waste from one of the beaches in Mumbai, India.

Soil burial technique for stimulation of PVC degrading microbial strains In addition to the aforementioned sites, soil burial technique was used for obtaining samples of microbial population stimulated to PVC degradation. The method was as per the procedure used by Goheen and Wool (1991). The soil was obtained from the garden area near the University campus, Mumbai, India. It was then screened to remove large clumps, plant debris, and macro organisms, and then placed in plastic container. Soil was kept wet by frequent water spraying throughout the experiment. The container was stored in laboratory at room temperature. Commercially obtained plastic films were cut into long strips of

approximately 15 × 3 cm and buried at a depth of four inches. After two months, strips were removed and washing of the strips was used as inoculums for enrichment culture.

Polymer sample Polyvinyl chloride in a powdered form provided by Reliance Product Application and Research Centre, Mumbai, India, was used for degradation study. The molecular weight of PVC was between 31000 and 94000. Molecular weight of repeating unit of vinyl monomer was 62.5 which contains 56% by weight of chlorine

Enrichment and isolation of polyvinyl chloride (PVC) degrading microbial strains Environmental samples collected from different sites rich in plastic waste as well as washings of the plastic strips buried in soil were used as inoculants for enrichment culture. Each solid sample of 1 to 2 g and liquid sample 1 ml was diluted to 10 and 9 ml using normal saline and used as inoculums for enrichment culture in the ratio of 1 to 100 ml of mineral salt vitamin media (MSV). The mineral salt vitamin medium (MSV) was the same as the one previously used by Pantke (1977) but with slight modification by supplementing biotin (20 mg) and vitamin B12 (10 mg). Mineral salt vitamin medium (MSV) prepared in 1000 ml distilled water contained; NH4NO3, 1 g; KH2 PO4, 0.7 g; K2HPO4, 0.7 g; MgSO4.7H2O, 0.7 g; NaCl, 0.005 g; FeSO4.H2O, 0.002 g; ZnSO4.7H2O, 0.002 g; MnSO4.4H2 O, 0.001 g; Biotin, 20 mg; Vitamin B12, 10 mg; and PVC in the form of powder, 1 g; pH-7. Flasks were then incubated in shaker incubator (Neolab, India) for at least 4 weeks. After 4 weeks, 1 ml of supernatant was transferred to the same fresh medium. Same procedure was repeated thrice. Concentration of PVC in the medium increased gradually at each repeated enrichment culture from 0.1 to 0.5%. The growth was monitored by visual assessment as increase in turbidity of the culture broth.

Isolation of PVC degrading microbial strains A portion of enrichment culture was diluted adequately with sterile saline and spread on the nutrient agar plates. Incubation was carried out at 30°C for 48 h. Individual colonies formed on nutrient agar were picked and tested for their ability to grow on solid MSV medium containing emulsified PVC, where the medium was fortified with supplement and without any supplement such as 0.1% yeast extract and 0.1% glucose. The solid MSV medium containing emulsified PVC was prepared by modifying the procedure previously used by Ishigaki et al. (2000). The agar plates were prepared by dissolving 0.1 g of polyvinyl chloride in 25 ml of tetrahydrofuran. The solution was then added to molten MSV agar medium at 50 to 60°C with gentle shaking and plates were poured immediately. The lids of the plate were kept partially opened for at least 30 min to allow complete evaporation of solvent. The lids of the plates were then replaced. Pure cultures of the PVC degrading bacteria were obtained by repeated sub-culturing of the isolated colonies on the same medium. The selected isolates were assigned with codes, for example, PVC 1, PVC 2 and so on, for further study. The selected isolates were characterized using Bergey’s manual of determinative bacteriology (Krieg and Holt, 1984).

Optimization of media used for degradation study For isolation and degradation studies, various compositions of mineral salt vitamin media (MSV) containing polyvinyl chloride

Patil and Bagde

(PVC) as a primary source of carbon and energy were supplemented with additional carbon source as a co-substrate such as yeast extract and glucose at a final concentration of 0.1%.

Preparation of microbial degradation studies

cell

suspension

for

various

The suspension of microbial cells used in various degradation studies was grown in nutrient broth for 18 h at 30°C. The cells were harvested from culture by centrifugation at 4500 rpm for 15 min (Sorvall RC 5B Plus, Kendro, Newtown, USA). After discarding supernatant, the cell pellet was suspended in normal saline and centrifuge at 4500 rpm. The same procedure was repeated twice. The washed cell pellet was re-suspended in the medium used for degradation experiment.

7949

14, 21, 28, 35, 42, 49, 56, 63 and 70 days), Ba(OH) 2 from the side arm was removed for analysis of residual Ba(OH)2. The amount of un-reacted Ba(OH)2 in the sample was treated with 0.05 N HCI control, containing inoculated medium without any test compounds, was evaluated for CO2 evolution to determine endogenous metabolism of test culture. A control, containing an un-inoculated medium with test substance was also used for determining carbon dioxide evolved due to non-biological degradation. The amount of carbon dioxide evolved from control flask was subtracted from the corresponding experimental flask.The percentage biodegradation was calculated from the cumulative amount of carbon dioxide released during the entire test period. Three identical sets of experiment had been set and the result was given as an average of the three experimental sets. Testing PVC film degradation with the selected isolated strain

Determination of polyvinyl chloride (PVC) degradation by monitoring chloride release Polyvinyl chloride (PVC) degradation by isolated strains was determined by using the method based on chloride release as previously used by Yabannvar and Bartha (1993, 1994). The experiment was performed in 500 ml Erlenmeyer flask containing 250 ml of mineral salt vitamin medium (MSV) with 0.1% PVC and supplemented with 0.1% yeast extract (Hi media, India ), 5% of washed microbial cell suspension, approximately 108 colony forming unit (CFU)/ml was used as inoculums for the test. The test flasks were incubated at 30°C on shaker incubator (Neolab, India) at 180 rpm along with the control flasks. Two controls were kept; one with MSV-PVC medium without test culture and the other with MSV medium without PVC inoculated with test culture. At each test intervals, 10 ml of sample was taken from each flask for analysis of chloride concentration. Samples were centrifuged at 4500 rpm for 15 min (Sorvall RC %B, Kendro, Newtown USA) for separation of cells. The resulting supernatants were filter sterilized through Sartorius filter and the filtrates were used for analysis of chloride concentrations. Two controls were kept, and were treated in the same manner. Absence of microbial contamination was checked by optical microscopy before any determination. After appropriate dilution of filtrate, chloride concentration was quantitatively determined by spectrophotometric analysis according to Bergmann and Sanik (1957). Three identical set of experiment were set and the result was given as an average of the three experimental sets.

Polyvinyl chloride (PVC) film was prepared in the laboratory by conventional solvent casting method as previously used by Nishida and Tokiwa (1992). PVC powder 1% (W/V) was dissolved in tetrahydrofuran. A film was cast from tetrahydrofuran by pouring a tetrahydofuran solution onto a clean glass plate. After evaporation of tetrahydrofuran, the film was left out from glass surface and kept overnight at room temperature to achieve equilibrium in crystallinity. The afore prepared PVC film was cut into strips and layered onto Whatman No. 1 filter paper covered with aluminum foil and autoclaved at 121°C for 15 min, and sterilized as per procedure given by Roberts and Davidson (1986). The PVC film degradation study was carried out as was described by Cornell et al. (1984). Pour plate technique was used for inoculation of cell suspension into the medium. Cell suspension of culture (1 ml) was added to sterile Petri plate followed by addition of warm MSV medium maintained at 45°C in the plate. The plate was swirled and the added culture was homogeneously mixed. The PVC film was then aseptically placed on the surface of the inoculated hardened agar. The plates were sealed in polythene bag to avoid desiccation and incubated at 30°C. The plate was periodically removed and the film was observed for sign of microbial growth.

RESULTS AND DISCUSSION Isolation of polyvinyl chloride degrading microbial strains

Assessment of PVC mineralization by CO2 evolution method Polyvinyl chloride (PVC) biodegradation was determined as per the general guidelines of ISO 14855 (1999) and ASTM D 5338 (1998). The medium used for assay of CO2 evolution was the same as that given in OECD (2001) guidelines for testing of chemicals. The apparatus - Biometer flask - used in the present study was as described by Reich and Bartha (1977) and Yabannavar and Bartha (1993, 1994). For measurement of CO2, evolution the main compartment of the Biometer flask was amended with 100 ml of mineral medium with 0.1% of PVC in the form of powder along with 5% washed cell suspension of selected isolated strain. The carbon dioxide produced during metabolic activity was absorbed in a solution of barium hydroxide and subsequently determined by titration using 0.05 N HCl, where the amount of CO2 produced was calculated from the amount of residual base remaining in the absorption tube. The mineralization was expressed as a percentage of the theoretical CO2 (ThCO2) produced, computed from the total carbon content of the samples. During the test period, flasks were incubated at room temperature in the dark. The stopcock was periodically opened for exchange of air. At each test interval (1, 7,

The samples collected from different natural environment were used as a microbial source for the enrichment of PVC degrading microorganisms. In addition to the natural environments, soil burial technique (Figure 1) in which commercially obtained PVC strips were buried in soil under laboratory condition was used for obtaining samples of microbial population, possibly stimulated to PVC degradation. Allsopp and Seal (1986) referred to this technique as a mini technique and suggested high possibility for isolating potential biodegrading agents with the use of this method. In the present study, in order to overcome the problem of low biomass formation, that is, minute colonies on the mineral agar medium, the potential PVC degrading microbial strains from enriched samples were first cultivated on nutrient agar, which led to high cell densities, and large, as well as cultivable, colonies. From enrichment cultures

7950

Afr. J. Biotechnol.

Figure 1. Soil burial technique; commercially obtained PVC films of size 3 × 15 buried in soil and incubated at room temperature under laboratory condition.

Table 1. Number of microbial strains isolated on emulsified PVC agar medium from different samples.

Microbial source Garden soil Dumping ground Industrial effluent Sea sediments Soil burial technique

Number of microorganisms isolated on emulsified PVC MSV agar medium supplemented with Total number of isolated strain Number supplement Yeast extract Glucose 1 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 5 1 3 1

incorporated with PVC and incubated for 16 weeks at 30°C with different microbial sources, 20 morphologically different bacterial isolates were obtained on nutrient agar. Individual colonies were then tested for their ability to grow on emulsified polyvinyl chloride (PVC) in mineral salt vitamin agar media incorporated with and without any supplement. Among these 20 isolates, only seven strains were able to grow on emulsified PVC-MSV agar medium. Table 1 shows the number of organisms isolated on emulsified PVC-MSV agar medium with and without supplement. As seen in Table 1, the number of PVC degrading microbial strains inhabiting in different environments is very low. However, PVC strips buried in soil harbored more strains as compared to samples collected from natural environment, possibly due to close contact of plastic material during incubation. Results also showed that co-substrates were necessary for PVC utilization by most of the strains. It was observed that only one strain

showed growth on emulsified PVC agar medium without any supplements, whereas, the remaining isolates could grow either in the presence of yeast extract or glucose. The seven isolates thus obtained were designated as strain PVC 1, 2, 3, 4, 5, 6 and 7. These isolates were further screened for their ability to release chloride in mineral salt medium incorporated with polyvinyl chloride powder. Table 2 shows the chloride releasing activity of isolates expressed in terms of µg/ml. The cell growth measured as optical density (OD600 nm) of culture broth was also determined. As seen in Table 2, the strain PVC 3, PVC 4, PVC 6 and PVC 7 showed the ability to release chloride from PVC. Strain PVC 4 showed considerable amount of chloride release and cell growth in MSV-PVC medium and therefore was selected for further identification and CO2 evolution study. Figure 2 shows strain PVC 4 on emulsified PVC agar plates after incubation of 15 days at 30°C. The colonies were very minute, circular and white in color.

Patil and Bagde

7951

Table 2. Chloride releasing activity of microbial strains isolated from enrichment culture.

Isolated strains PVC 1 PVC 2 PVC 3 PVC 4 PVC 5 PVC 6 PVC 7

MSV PVC medium supplemented with 0.1% yeast extract Chloride release (µg/ml) Optical density 0 0.12 0 0.72 46 0.98 115 0.92 0 0.22 65 0.66 31 0.49

Figure 2. Isolated colonies of strain PVC 4 on MSV PVC agar plate (plates incubated at 30°C for 15 days).

Identification of strain PVC 4 In this study, among the seven isolates, the bacterial strain PVC 4 showed the highest activity for polyvinyl chloride degradation which was measured as chloride was released. This strain was characterized as Micrococcus luteus on the basis of the 8th edition of Bergey’s manual of Determinative Bacteriology, after studying morphological, cultural, and biochemical characteristics, and comparing it with standard strain of M. luteus. Cultural characteristics of strain PVC 4 were studied by following standard technique in microbiology. A pure culture of strain streaked on the nutrient agar from 1 to 2 mm. The circularly smooth, convex, mucoid, opaque and yellow pigment produced colonies on

nutrient agar. Figure 3 shows isolated colonies of strain PVC -4 on nutrient agar. Table 3 shows morphological and cultural characteristics of strain PVC 4. The biochemical characteristics of the strain PVC 4 are summarized in Table 4. Strain PVC 4 was observed to be an aerobic organism and showed good growth between 28 and 37°C. The strain showed oxidative metabolism in Hugh and Leifson’s media. It did not ferment lactose, galactose, mannose, arabinose, mannitol and maltose. Hydrolysis of starch and tween 80 was not observed. Hydrolysis of gelatin was observed. Urease test showed negative result. Strain was found sensitive to novobiocin and showed growth on 7.5% sodium chloride (NaCl). Not much information was available in the literature about the ability of M. luteus to utilize polyvinyl chloride

7952

Afr. J. Biotechnol.

Figure 3. Isolated colonies of strain PVC 4 on nutrient agar plate (plates incubated at 30°C for 48 h).

Table 3. Morphological and cultural characteristic of strain PVC 4.

Characteristic

Morphological characteristic

Gram staining Size Form Arrangement Capsule Spores Motility

Strain PVC 4 Gram positive 1 to 2 µm Cocci Singles, in pairs and in tetrads Absent Absent Non motile

Colony characteristic on nutrient agar (30°C/48 h)

Size Shape Surface Elevation Edge Consistency Opacity color

1 to 2 mm Circular Smooth Convex Entire Mucoid Opaque Yellow

Growth in nutrient broth (30°C/48 h)

Surface growth Clouding Cell Sediment Type of sediment

None slight Abundant Viscid on agitation

as a sole source of carbon and energy. However, the isolation of Micrococcus roseus as one of the strains which could degrade crude oil from hydrocarbon polluted streams in Lagos, Nigeria, was reported by Niranjan and

Chandra (2011). Similarly, Sielicki et al. (1978) reported oxidative degradation of 1, 3,-diaphenyl butane, a compound structurally representing the smallest repeating unit of styrene by Micrococcus species. Ability of this

Patil and Bagde

7953

Table 4. Biochemical characteristic of strain PVC 4.

Biochemical test Oxidation/fermentation Acid from lactose Acid from galactose Acid from mannose Acid from arabinose Acid from mannitol Acid from maltose Starch hydrolysis Tween-80 hydrolysis Gelatin hydrolysis Oxidase Catalase Urease Sensitivity to novobiocine Growth on nutrient agar with 7.5% NaCl

Observation for strain PVC 4 Oxidative Negative Negative Negative Negative Negative Negative Negative Negative Positive Positive Positive Negative Positive Positive

Chloride release (ug/ml) OD at 600 nm

250

0.5

200

0.4 0.35

150

0.3 0.25

100

0.2

OD at 600 nm

Chloride release

(Âľg/ml)

0.45

0.15 50

0.1 0.05

0 7

Time (days) Figure 4. Cumulative release of chloride by Micrococcus luteus in test media inoculated with polyvinyl chloride (time course degradation study of PVC).

common soil bacterium to utilize polyvinyl chloride as a sole source of carbon and energy indicates that it might have placed a strong selection pressure on the evolution to develop an efficient catabolic enzyme for utilization of this polymer. Time course of polyvinyl chloride degradation by strain PVC 4 The polyvinyl chloride (PVC) degradation potential of

strain PVC 4 which has been characterized as M. luteus was evaluated by measuring increase in concentration of chloride ions release in mineral salt medium incorporated with PVC in the form of virgin PVC powder, as a measure of PVC biodegradation. The time course of PVC degradation by strain PVC 4 in MSV-PVC medium containing 0.1% PVC and 0.1% yeast extract is shown in Figure 4. The degradation of PVC resulted in release of inorganic chloride ion in the medium. Increase in chloride ion concentration during test period was quantitatively investigated spectrophotometrically. In addition to the

7954

Afr. J. Biotechnol.

7.5 7

6.5 6 5.5 5

Test 4.5

Control

4 0

Time Time(Days) (days) Figure 5. Change in pH of growth media inoculated with cumulative release of chloride by Micrococcus luteus in test media inoculated with PVC polymer.

release of chloride as a measure of PVC utilization, bacterial growth was also monitored at the same time intervals in an attempt to obtain biological measure for PVC degradation. Bacterial growth was quantitatively determined by measuring optical density of the culture media at 600 nm (OD 600 nm). As seen in Figure 4, concentration of chloride released and cell growth were directly proportional to each other during test period. The graph of cell growth is divided into three phases; first, a lag phase of 14 days at which chloride concentration increased steadily at a value of 46 µg/ml. The lag phase was followed by an exponential phase, which ended on the 56th day during which chloride concentration increased consistently. At the end of the th test period (70 day), a total of 205 µg/ml chloride released in the medium was detected. This release corresponds to 0.36% of total release of chloride from 100 mg of PVC. Figure 5 shows change in the pH of the test medium during PVC degradation. The drop in pH of culture medium may be due to formation of acidic component during biodegradation of polyvinyl chloride (PVC). Method based on chloride release has been previously used by Yabannavar and Bartha (1993) to detect degradation of plasticized polyvinyl chloride film. Since halo substitution often has an effect on delaying or preventing biodegradation, release of chloride ion from PVC was a sure sign of biodegradation (Bartha, 1990). However, this group of scientists uses soil as a test medium, as well as a source of microorganism, and reported only marginal release of chloride which corresponds to less

than 0.1% w/w of the added polyvinyl chloride (PVC). In the present investigation, degradation of polyvinyl chloride by M. luteus showed a release of 205 µg/ml in mineral salt vitamin medium which corresponds to 0.36% of PVC degradation, which is comparatively higher than that of earlier reported data. The good correlation between chloride release value and increase in cell growth further supports degradation of polyvinyl chloride. Mineralization of polyvinyl chloride (PVC) by strain PVC 4 Mineralization of polyvinyl chloride (PVC) to its elemental constituent viz. CO2 and H2O was evaluated during 70 days of exposure with Micrococcus species. The complete conversion of 100 mg of PVC with 38.4 mg percent of total organic carbon (TOC) could have yielded 14.08 mg of carbon dioxide (ThCO2). The net CO2 evolution from PVC was found to be 1.25 mg in 70 days. During these 70 days of exposure, PVC underwent extensive biodegradation and up to 8.87% of their carbon was converted to carbon dioxide. Figure 6 shows cumulative CO2 evolution during mineralization of PVC by Micrococcus species in the Biometer flask over a period of 70 day.In the present study, 8.87% of mineralization (ultimate biodegradation) of polyvinyl chloride was obtained during 70 days in mineral media inoculated with M. luteus. Yabannavar and Bartha (1993) reported 27.3% conversion of carbon from plasticized polyvinyl polymer during three months of exposure in soil. However, the

Patil and Bagde

7955

Net CO2 evolution (mg)

1.4 1.2 1 0.8 0.6 0.4 0.2 0 7

Time Time(days) (Days) Figure 6. Cumulative CO2 evolution during mineralization of PVC by Micrococcus species in the Barometer flask over a period of 70 days.

Figure 7. Growth of Micrococcus luteus on polyvinyl chloride film placed on mineral salt vitamin media.

polyvinyl polymer used by them was heavily plasticized with dioctyl adipate (DOA) and epoxidized soyabean oil (ESO). Later on, analysis using gas chromatography residual weight determination indicated that only the plasticizer and not the polyvinyl chloride resin were mineralized (Yabannavar and Bartha, 1993). Thus, the significance of the result obtained in the present investigation cannot be ruled out, as pure polyvinyl chloride

resin was used for degradation study. Growth of Micrococcus species on PVC film Figure 7 shows growth of strain PVC 4 identified as Micrococcus species on polyvinyl chloride (PVC) film placed on mineral salt vitamin (MSV) agar inoculated with

7956

Afr. J. Biotechnol.

Micrococcus species. The agar plate was incubated for a period of 8 weeks at 30°C. During the test period, microbial growth started appearing after one week of incubation from the edges of the film and covered the entire surface of the film within eight weeks of incubation. However, due to dehydration of culture medium, it was not possible to continue the test after that. The photographs of plates as shown in Figure 6 were taken after 8 weeks of incubation. The results obtained showed that the isolated strain of M. luteus can survive on plastic film surface. Similar work was carried out by Roberts and Davidson (1986) where growth of Aspergillus fischeri and Paecilomyces species on plasticized polyvinyl film in liquid medium was reported. The growth of isolated strain on the surface of polyvinyl chloride (PVC) film gives positive intimation that the isolate can be used as potent biodegrading agent for in situ application during plastic waste remediation. The study shows that the most recalcitrant plastic polymer polyvinyl chloride can be degraded to some extent in the appropriate environment. Isolation and screening of organisms which degrade polymers, or produce enzymes or enzyme systems that degrade polymers may prove as environmentally profitable for forthcoming research. Conclusion In conclusion, we successfully isolated polyvinyl chloride degrading microbial strain utilizing polyvinyl chloride using enrichment culture technique. The findings have valuable application in solving plastic waste problem through bioremediation where modern approach developed for remediation can be combined and applied with this organism. Future research will focus on various experiments to find the optimum conditions for PVC degradation process, for example, effect of varying pH of growth media, effect of different concentration of PVC on degradation, synergistic effect of different group of organism on PVC degradation, effect of different co substrate on rate of degradation, etc. Future work may also be focused on identification and isolation of enzymes involved in polyvinyl chloride degradation by the isolated strain and designing and development of small prototypic field study by applying selected isolated consortia of microbial strain for bioremediation of plastic waste. REFERENCES Allsopp D, Seal KJ (Eds) (1986). Practical biodeterioration. In introduction to biodeterioration. Edward Arnold Ltd. London: p .95112.

American Society for Testing and Materials (1998). Standard test method for determining aerobic biodegradation of plastic materials under for determining aerobic biodegradation of plastic materials under controlled composting conditions. Annual book of ASTM standards, Philadelphia, USA. ASTM DZ5338-98: 1-6. Bartha R (1990). Isolation of microorganisms that metabolize xenobiotic compounds. Isolation of biotechnological organisms from nature. By Labeda DP (Ed). McGraw Hill, New York, pp. 284-307. Bergmann JG, Sanik J (1957). Determination of trace amount of chlorine in naphta. Anal. Chem. 29: 241-243. Cacciari I, Quatrini P, Zirletta G, Mincione E, Vinciguerra V, Lupattelli P, Sermanni GG (1993). Isotactic polypropylene biodegradation by a microbial community: Physicochemical characterization of metabolites produced. Appl. Environ Microbiol. 58: 3695-3700. Cornell JH, Kaplan AM, Rogers MR (1984). Biodegradabilty of photooxidized polyalkylenes. J. Appl. Polym. Sci. 29: 2581-2597. International Standard ISO 14855. (1999). Determination of the ultimate aerobic biodegradability and disintegration of plastic materials under controlled composting condition– Method by analysis of evolved carbon dioxide. International Organization for Standardization. Goheen SM, Wool RP (1991). Degradation of polyethylene-starch blends in soil. J. Appl. Polym. Sci. 42: 2691-2701. Krieg NR, Holt JG (Eds) (1984). Bergey’s Manual of Systematic Bacteriology. Williams, Wilkins Co, Baltimore, London. Mario C (2008). Plastic Materials and Environmental Externalities: Structural Causes and Corrective Policy. J. Lethbridge Undergraduate Res. 3: p. 2. Mody AS (2000). Biodegradable plastics. Plast. Packaging, 45: 89-91. Nilanjana D, Chandran P (2011). Microbial degradation of petroleum hydrocarbon contaminants: an overview. Biotechnol. Res. Int. p. 13. Nishida H, Tokiwa (1992). Effects of higher order structure of poly (3hydroxybutyrate) on its Biodegradation. I. Effects of heat treatment on microbial degradation. J. Appl. Polym. Sci. 46: 1467-1476. OECD (2001). OECD Guidelines for the Testing of Chemical: Ready Biodegradability-CO2 evolution in sealed vessels (Headspace test). Organization for Economic Co-operation and Development, France: pp. 1-16. Pantke M (1977). Test methods for evaluation of susceptibility of plasticized PVC and its components to microbial attack. In Biodeterioration Investigation technique by AH Walters (ed). Applied Science Publisher Ltd. London, pp. 51-75. Reich M, Bartha R (1977). Degradation and mineralization of a polybutene film-mulch by the synergistic action of sunlight and soil microbes. Soil Sci. 124: 177-180. Roberts WT, Davidson PM (1986). Growth characteristics of selected fungi on polyvinyl chloride film. Appl. Environ Microbiol. 51: 673-676. Shah AA, Hasan H, Hameed A, Iqbal JA (2009). Isolation of Fusarium sp. AF4 from sewage sludge, with the ability to adhere the surface of polyethylene. Afr. J. Microbiol. Res. 3: 658-663. Shah AA, Hasan F, Hameed A, Ahmed S (2008). Biological degradation of plastics: A comprehensive review. Biotechnol. Adv. 26: 246-265. 14 Sielicki MD, Focht D, Martin JP (1978). Microbial degradation of [ C] polystyrene and 1, 3 diphenylbutane. Canadian J. Microbiol. 24: 798803. Tomita K, Nakajima T, Kikuchi Y, Miwa N (2004). Degradation of poly (L-lactic acid) by a newly isolated thermophile. Polymer Degradation and Stability. 84: 433-438. Yabannavar AV, Bartha R (1994). Methods for assessment of Biodegradability of plastic films in soil. Appl. Environ. Microbiol. 60: 3608-3614. Yabannavar AV, Bartha R (1993). Biodegradability of some food packaging materials in soil. Soil Biol. Biochem. 25: 1469-1475.

Full Length Research Paper

Department of Botany, Bacteriology Unit, Faculty of Science, Tanta University, Tanta 31527, Egypt. Department of Biological Sciences, College of Science and Art, King Abdulaziz University, P.O. Box: 344 Rabigh 21911, Kingdom of Saudi Arabia. 3 Department of Biotechnology, Faculty of Science, Taif University, Taif P.O. Box21974, Kingdom of Saudi Arabia. 2

Accepted 2 March, 2012

Cell-associated biosynthesis of cadmium sulfide (CdS) nanoparticles has been reported to be rather slow and costly. In this study, we report on a rapid and low cost biosynthesis of CdS using culture supernatants of Escherichia coli ATCC 8739, Bacillus subtilis ATCC 6633 and Lactobacillus acidophilus DSMZ 20079T. The synthesis was performed at room temperature in the laboratory ambience and CdS nanoparticles were formed within 24 h. Ultraviolet (UV)–visible spectroscopy study revealed the buildup of absorption bands at 419.5, 381.5 and 362.5 nm for E. coli ATCC 8739, B. subtilis ATCC 6633 and L. acidophilus DSMZ 20079T, respectively for assisted synthesis of CdS nanoparticles. X-ray diffraction (XRD), transmission electron microscopy (TEM) and fluorescence spectral analyses were performed to ascertain the formation of CdS nanoparticles. Individual nanoparticles as well as few aggregates having the size of 2.5 to 5.5 nm were found. The process of extracellular and fast biosynthesis may help in the development of an easy and eco-friendly route for the synthesis of CdS nanoparticles. Key words: Nano-cadmium sulfide (CdS), nanomaterials, nanobiotechnology, biosynthesis, Escherichia coli, Bacillus subtilis, Lactobacillus acidophilus.

INTRODUCTION Nanometer-sized binary chalcogenides have attracted considerable attention due to their unique properties compared to their bulk counterparts on account of the size quantization effects (Fukuoka et al., 200; Maleki et al., 2007). Among these, cadmium sulfide (CdS) has been extensively studied due to its potential technological applications in field effect transistors, solar cells, photovoltaics, light emitting diodes, photocatalysis, photoluminescence, infrared photodetectors, environmental and biological sensors (Ionov et al., 2006; David and Michael., 2006; Nag et al., 2008; Yang et al., 2009). The preparation of CdS nanoparticles was carried out using

*Corresponding author. E-mail: selsilk@yahoo.de.

various methods such as microwave heating (Wada et al., 2001), microemulsion synthesis (Talapin et al., 2002; Ohde et al., 2002), chemical synthesis (Monte et al., 2006;Yang et al., 2009), photoetching (Torimoto et al., 2003) and ultrasonic irradiation (Wang et al., 2001). It is well established that many organisms can produce inorganic materials either on intra- or extra-cellular level (Williams et al., 1996; Ahamed et al., 2002; Kowshik et al., 2002). In order to meet the requirements and exponentially growing technological demand, there is a need to develop an eco-friendly approach for nanomaterial synthesis that is devoid of using toxic chemicals in the synthesis protocols. Recently, microorganisms have been explored as potential bio-factories for the synthesis of both semiconductor and metallic nanoparticles including sulphides, gold and silver nanoparticles (Prasad and Jha,

7958

Afr. J. Biotechnol.

2010). CdS nanoparticles. CdS nanoparticles belong to semiconductor nanoparticles when their diameter is less than a certain value known as the exciton Bohr radius, their spectral properties become size-dependent and CdS nanoparticles are then termed quantum dots (QDs). For CdS, the exciton Bohr radius is 2.8 nm (Titova et al., 2006). There is a growing interest in QDs because of their unique luminscence properties. QDs are extensively applied as fluorescent labels of biological compounds because they have unique advantages over convensional organic fluorophores including photostability and multifluorescence maxima (Pinaud et al., 2006). QDs also have the distinguished property that the position of their spectral flourescence maxima depend on the particle size. This allows their application as multiemitting species using the same excitation wavelength. In the present work, Escherichia coli ATCC 8739, Bacillus subtilis ATCC 6633 and Lactobacillus acidophilus DSMZ 20079T were used in order to assess their potential as putative candidate bacteria for the synthesis of CdS nanoparticles.CdS nanoparticles obtained were characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM) and Ultraviolet (UV)–visible and fluorescence spectra. An effort has also been made to understand the mechanism of nano transformation of accomplishing biosynthesis at the extracellular level. MATERIALS AND METHODS

nutrients for 36 h and this was diluted as source culture. This diluted culture solution was again allowed to grow for another 24 h and the supernatant was obtained by separating cells by centrifugation at 6000 rpm. Twenty milliliter of 0.25 M cadmium chloride (CdCl2) solution was taken and 5 ml of 0.5 M aqueous solution of Na2 S giving an orange-yellow color of cadmium sulphide suspension. The suspension was added to the culture supernatant and heated on steam bath up to 60°C for 10 to 20 min until fluffy orange-yellow deposition starts to appear at the bottom of the flask, indicating the initiation of transformation into nanoparticles. Then, the culture solution was cooled and allowed to incubate at room temperature in the laboratory ambience overnight. Next day, the mixture solution was observed to have distinctly remarkable coalescent orange-yellow clusters deposited at the bottom of the flask leaving the colloidal supernatant at the top. It was filtered for further studies. UV-visible and fluorescence spectroscopy The formation of CdS nanoparticles was characterized by UVvisible spectroscopy using a Shimadzu UV-160A Spectrophotometer. Steady-state emission spectra were measured using a Shimadzu RF 510 spectrofluorophotometer. The fluorescence spectra were not corrected for machine response. Transmission electron microscopy (TEM) The CdS nanoparticles formed by the culture supernatants of the test bacteria were imaged using TEM; Joel, 100SX, Japan with AMT digital camera. Each specimen was dispersed ultrasonically to separate individual particles, and one or two drops of the suspension was deposited onto holey-carbon coated copper grids and dried under infrared lamp. The nanoparticles film was observed and photographed.

Bacteria used for the synthesis of CdS nanoparticles X-ray diffraction The test strains E. coli ATCC 8739 and B. subtilis ATCC 6633 were obtained from our culture collection (Bacteriology Unit at Botany Department, Faculty of Science, Tanta University) and cultivated in Luria and Bertani (LB) broth containing tryptone 10.0; yeast extract 5.0; sodium chloride 10.0 g/l of distilled water according to Luria and Burrous (1957). L. acidophilus DSMZ 20079T was isolated from yoghurt and cultivated on ST broth containing g/l casein enzymic hydrolysate, 10.0; yeast extract 5.0; sucrose 10.0; dipotassium hydrogen phosphate 2.0 and 1000 ml distilled water according to Lee et al. (1974).

The formation of CdS nanoparticles was checked by XRD technique using an X-ray diffractometer (Phillips PW 1729/40 generator, diffractometer, one line detector) with Cu Kα radiation λ = 1.5405 Å over a wide range of Bragg angles (20 to 80°). Glass slides coated with of CdS nanoparticles were tested. For more efficient XRD studies, slides were primarily coated with silica gel then loaded with CdS nanoparticles solution prior to drying.

RESULTS Preparation of supernatants LB broth and ST broths were prepared, sterilized and inoculated with freshly grown inoculums of the test strains E. coli ATCC 8739, B. subtilis ATCC6633 and L. acidophilus DSMZ 20079T. The culture flasks were incubated for 24 h at 35°C. At the end of the incubation period, the cultures were centrifuged at 6000 rpm and their supernatants were used for further experiments.

Synthesis of CdS nanoparticles Synthesis of CdS nanoparticles using E. coli ATCC 8739, B. subtilis ATCC 6633 and L. acidophilus DSMZ 20079T was undertaken by allowing these bacteria to grow in sterile distilled water containing

Figure 1 shows the XRD profiles of CdS nanoparticles synthesized using E. coli ATCC 8739, B. subtilis ATCC 6633 and L. acidophilus DSMZ 20079T. The XRD patterns showed the diffraction peaks at 2θ values of 25, 30, 35, 37, 44.5, 48, 52.9, 55, 58 and 69° which match earlier reported values for CdS nanoparticles (Prasad and Jha, 2010). The TEM micrographs of the CdS nanoparticles formed by E. coli ATCC 8739, B. subtilis ATCC 6633 and L. acidophilus DSMZ 20079T is shown in Figure 2. The micrographs clearly illustrate individual nanoparticles as well as some aggregates. The nanoparticles are almost spherical in shape. The difference in size may possibly

El-Shanshoury et al.

7959

Figure 1. X-ray diffraction patterns of CdS nanoparticles prepared by E. coli, L. acidophilus and B. Subtilis at room temperature.

A Figure 2. TEM photograph of CdS nanoparticles synthesized using (A), E. coli; (B), B. Subtilis; (C), L. bacillus.

be due to the fact that the nanoparticles are being formed at different times.UVâ&#x20AC;&#x201C;vis absorption spectra of CdS nanoparticles formed by E. coli ATCC 8739, B. subtilis ATCC 6633 and L. acidophilus DSMZ 20079T is shown in Figure 3. Absorbance maxima were observed at

419.5, 381.5 and 362.5 nm for the CdS nanoparticles formed by E. Coli ATCC 8739, B. subtilis ATCC 6633 and L. acidophilus DSMZ 20079T, respectively. The absorption tail is broadened to longer wavelengths which may be due to the size distribution of the particles

7960

Afr. J. Biotechnol.

C Figure 2. Contd.

El-Shanshoury et al.

7961

+1.80A

A 0.200 (A/DIV.)

+0.00A

50.0 (NM/DIV.) 600.0 NM

peak λ 381.5

0.007A

E. coli

+1.80A

B 0.200 (A/DIV.)

+0.00A 419.5 50.0 NM

0.002A

B. subtilis

+1.80A

0.200 (A/DIV.)

+0.00A

peak λ 362.5

50.0 (NM/DIV.) 600.0 NM

0.007A

L. acidophilus Figure 3. UV-Vis spectra of CdS nanoparticles produced by (A) E. coli, (B) B. Subtilis and (C) L. acidophilus.

(Mulvaney, 1996). It is considered that the nanosized CdS particles should have a wider band gap than the

bulk material owing to the quantum confinement of the electron–hole pair that forms due to the absorption of a

7962

Afr. J. Biotechnol.

Figure 4. The build-up of absorbance for CdS nanoparticles formed (at increasing absorbances above 400 nm) at 10 min time intervals using B. subtilis supernatant.

sufficiently energetic photon. The larger energy difference causes a shift in the UV-visible absorption spectrum. Optical excitation of electrons across the band gap is strongly allowed, pro-ducing an abrupt increase in absorbance at the wave-length corresponding to the gap energy. This feature in the optical spectrum is known as the optical absorption edge which can be determined by diffuse reflectance spectroscopy (Kumar et al., 1999). The build-up of absorbance is shown in Figure 4 in which a change was observed in absorption spectra of CdS nanoparticles formed at a 10 min time interval using B. subtilis bacteria supernatant. The flourescence emission of CdS nanocrystals is shown in Figure 5. An intense flourescence peak is obtained at 440 nm (λex. = 365) for CdS synthesied by E. coli and L. acidophilus. CdS nanoparticles prepared by B. subtilis gave rise to fluorescence maximum at 450 nm (λex. = 365 nm). The shift of 10 nm in fluorescence maximum is attributed to larger size CdS particles produced by B. subtilis. Intense fluorescence peaks were obtained for CdS nanoparticles synthesied by B. subtilus and L. acidophilus. CdS nanoparticles were prepared by E. coli. Figure 6 shows the build-up of fluorescence intensity (λex.= 340 nm) for CdS nanoparticles prepared culture supernatent of B. subtilis. The fluorescence maxima at 470, 462 and 452 nm were recorded, respectively (at increasing intensities) after 1, 1.5 and 2 h of mixing with culture supernatant of B. subtilis bacteria. A shift to shorter wavelengths occurs as the synthesis time

increases reflecting more quantum confinement due to nanoparticle decrease in size.

DISCUSSION The underlying action of bacteria is to transform microsize particles into nanosize ones. CdS possesses a low solubility product value of 1x 10-27 (mol/l)2. The bacterial culture clearly shuttles this particle size transformation in a dynamic process including precipitation of nano2+ 2particles and replenishment of depleted Cd and S ions at the expense of micro-size CdS particles. The chemical reactions which proceed in the culture medium is as follows: C6H12O6 →CH3-CO-COOH↔CH3-CHOH -COOH CdCl2 +Na2S → CdS +2NaCl 2+

It is known that E. coli usually accumulates Cd via a zinc transport system which is less efficient than the manganese transport system (Dar, 1999) and is used to explain Cd2+ uptake in Gram-negative bacteria (Dar, 2+ 1999; Park, 1998; Yoon, 1998). The high uptake of Cd 2+ showed that Cd could be more efficiently transported by the expression of the manganese transport gene in E. coli.

Fluorescence intensity (arbitrary units)

El-Shanshoury et al.

7963

F i g u r e 5 . F l u o r e s c e n c e

s p e c t λex. = 340 nm) of CdS prepared in cultur e prepared in culture Figure ra 5. (Fluorescence spectra ( λex.nanoparticles = 340 nm) of CdS nanoparticles supernatant of B. (——) B. subtilis, (-.-.-.-.) E. and coli (and (------) L. acidophilus. supernatant of (——) subtilis, ( ) E. coli ) L. acidophilus.

In case of B. subtilis, Cd2+ accumulation is performed after inducing the cells growth. The decrease in cell growth upon induction might be due to the metabolic burden in the induced cells. This indicates that the transport system has a high selectivity to Cd2+ and can be applied to the selective recovery of Cd2+ from a mixture of other metals. The Cd2+ accumulation culture showed a similar accumulation under neutral and basic conditions (Volesky and Holan, 1993). B. subtilis was resistant to ambient conditions, such as pH, ionic strength and the presence of metal chelators or complexing agents. Once Cd2+ was transported into the cytoplasm, it formed a complex with the metallothionein (MT) protein. In the induction at the early and late logarithmic phases, Cd2+ was accumulated. It was speculated that this was due to the incorporation based on the polysaccharide composition of each particular organism, and is highly variable among distinct genera and even strains from the same species. Grampositive cells has teichoic acids and acids associated to the cell wall, whose phosphate groups are key components for the uptake of metals (Beveridge, 1989).

Gram-positive cells accumulate a much higher amount of heavy metals than Gram-negative cells. Carboxyl groups are the main agents in the uptake of heavy metals. The sources of these carboxyl groups are the teichoic acids, associated to the peptidoglycan layers of the cell wall (Da Costa and De França, 1996; Da Costa, 1999). The capacity of Lactobacilli to grow even in the presence of oxygen makes it metabolically more capable. Addition of reducing agents like glucose tends to lower the value of oxidation-reduction potential. The oxidationreduction potential expresses the quantitative character of degree of aerobiosis having a designated unit expressed as rH2 (the negative logarithm of the partial pressure of gaseous hydrogen). In this connection, monosaccharide and plant extracts were used as reducing agents for rapid chemical synthesis of nanoparticles (Shankar et al., 2004). Energy yielding material – glucose (which controls the value of rH2), the ionic status of the medium pH and overall oxidation-reduction potential (rH2) which is partially controlled by the bicarbonate, all these factors cumulatively negotiate the synthesis of CdS nanoparticles in the presence of E. coli,

Afr. J. Biotechnol.

Fluorescence intensity (arbitrary units)

7964

Figure 6. The build- up of fluorescence intensity ( 位ex. = 340 nm) for CdS nanoparticles prepared by culture supernatent of B. subtilis. The fluorescence maxima at 470, 462 and 452 nm are recorded, respectively (at increasing intensities) after 1, 1.5 and 2 h of mixing with culture supernatant.

B. subitlis and L. acidophilus strain. Lactobacillus, being a prokaryote has comparatively less developed detoxification machinery in the cytosol and circumvents any chemical challenge at the membrane level itself, a mildly acidic pH and lowered rH2 activates the membrane bound oxidoreductase and makes the requisite ambience for an oxide nanoparticle synthesis.

ACKNOWLEDGMENTS The authors We would like to express our gratitude to Dr. ElZeiny, M. Ebied Prof. physical chemistry, Chemistry Department, Faculty of Science, Tanta University, Egypt for help with facilities he offered in photochemistry laboratory. Thanks are also extended to Prof. M. ElSaadany, Alexandria University for help and support in this study

REFERENCES Ahmad A, Mukherjee P, Mandal D, Senapati S, Khan MI, Kumar R, Sastry M (2002). Enzyme mediated extracellular synthesis of CdS nanoparticles by the fungus, Fusarium oxysporum. J. Am. Chem. Soc. 124: 12108-121099. Beveridge TJ (1989). Role of cellular design in bacterial metal accumulation and mineralization. Ann. Rev. Microbiol. 43: 147-171. Da Costa ACA (1999). Chemical interactions between mercurial species and surface biomolecules from structural components of some biological systems. In: Ebinghaus, W.; Lacerda, L.D. and Salomons, W. (eds). Mercury Contaminated Sites: Risk Assessment and Solutions, Environmental Science Series, Springer-Verlag, Heildelberg. 1(8): 159-178. Da Costa ACA, De Fran莽a FP (1996). Cadmium uptake by biosorbent seaweeds: adsorption isotherms and process conditions. Sep. Sci. Technol. 31: 2373-2393. Dar N (1999). Chromium tolerant yeast strains isolated from industrial effluents and their possible use in environmental clean-up. Bull. Environ. Contamin. Toxicol. 63: 744-750. David C, Michael C (2006). Infrared Phys. Technol. 48: p. 227. Fukuoka A, Sakamoto Y, Guan S, Inagaki S, Sugimoto N, Fukushima Y, Hirahara K, Iijima S, Ichikawa M (2001). Novel templating synthesis

El-Shanshoury et al.

of necklace-shaped mono- and bimetallic nanowires in hybrid organic-inorganic mesoporous materials. J. Am. Chem. Soc. 123: 3373-3374. Ionov L, Sapra S A, Synytska A, Rogach L, Stamm M, Diez S (2006). Fluorescent stimuli-responsive grafted composite layers of polymers and semiconductor nanocrystals as environmental sensors. Adv. Mater. 18: p. 1453. Kowshik M, Deshmukh N, Vogel W, Urban J, Kulkarni SK, Paknikar KM (2002). Microbial synthesis of semiconductor CdS nanoparticles; their characterization, and their use in the fabrication of an ideal diode. Biotechnol. Bioeng. 78: 583-588. Kumar V, Sharma S, Sharma T, Singh V (1999). Band gap determination in thick films from reflectance measurements. Opt. Mater. 12: 115-119. Lee SY, Vedamuthu ER, Washam CJ, Reinbold GW (1974). An agar medium for the differential enumeration of yoghurt starter bacteria. J. Milk Food Technol. 37: 272. Luria SE, Burrous JW (1957). Hybridization between Escherichia coli and Shigella. J. Bacteriol. 74(4): 461-476. Maleki M, Ghamsari MS, Ghasemzadeh SR (2007) Semicond. Phys. Quantum Electron. Optoelectron Mirdamadi. 10: 30-32. Monte AFG, Dantas NO, Morais PC, Rabelo D (2006). Synthesis and characterization of CdS nanoparticles in mesoporous copolymer template. Braz. J. Phys. 36: 427-429. Mulvaney P (1996). Surface plasmon spectroscopy of nanosized metal particles. Langmuir. 12: 788-800. Nag A, Sapra S, Sengupta S, Prakash A, Ghangrekar A, Periasamy N D, Sarma D (2008). Luminescence in Mn- doped CdS nanocrystals. Bull. Mater. Sci. 31-561. Ohde H, Ohde M, Bailey F, Kim H, Wai CM (2002). Water-in-CO2 microemulsions as nanoreactors for synthesizing CdS and ZnS nanoparticles in supercritical CO 2. Nano Lett. 2: 721-724. 2+ Park KM (1998). Cd removal by Azomonas agilis PY101; a cadmium accumulating strain in continuous aerobic culture, Biotechnol. Lett. 20: 1157-1159. Pinaud F, Xavier M, Laurent AB, James MT, Soren D, Jack JL, Gopal I, Shimon W (2006). Advances in fluorescence imaging with quantum dot bio-probes", Biomaterials, 27: 1679-1687. Prasad K, Jha KA (2010). Biosynthesis of metal and oxide nanoparticles using Lactobacilli from yoghurt and probiotic spore tablets. Anal. J. Biotechnol. 5: 285-291.

7965

Shankar SS, Rai A, Ahmad A, Sastry MJ (2004). Rapid synthesis of Au, Ag and bimetallic Au shell nanoparticles using Neem. J. Colloid Interf. Sci. 275: 496-502. Talapin DV, Poznyak SK, Gaponik NP, Rogach AL, EychmĂźller A (2002). Synthesis of surface- modified colloidal semiconductor nanocrystals and study of photoinduced charge separation and transport in nanocrystal-polymer composites Physica. E 14: 237-241. Titova LV, Hoang Thang BA, Jackson HE, Smith LM, Yarrison-Rice JM, Lensch JL, Lauhon LJ (2006). Low-temperature photoluminescence imaging and time-resolved spectroscopy of single CdS nanowires. Appl. Phys. Lett. 89: 53119-53122. Torimoto T, Reyes JP, Iwasaki KB, Pal Shibayama T, Sugawara K, Takahashi H, Ohtani BJ (2003). Preparation of novel silica- cadmium sulfide composite nanoparticles having adjustable void space by sizeselective photo-etching. Am. Chem. Soc. 125: 316-317. Volesky B, Holan ZR (1993). Cadmium biosorption by saccharomyces cerevisiae, Biotechnol. Bioeng. 41: 826-829. Wada Y, Kuramoto H, Anand J, Tikamura T, Sakata T, Mori H, Yanagida S (2001). Microwave-assisted size control of CdS nanocrystallites. J. Mater. Chem. 11: 1936-1940. Wang GZ, Chen W, Liang CH, Wang YW , Meng GW, Zhang LD (2001). Preparation and characterization of CdS nanoparticles by ultrasonic irradiation. Inorg. Chem. Commun. 4: 208-210. Williams P, Keshavarz-Moore E, Dunnill P (1996). Production of cadmium sulphide microcrystallites in batch cultivation by Schizosaccharomyces pombe. J. Biotechnol. 48: 259-267. Yang C, Zhou X, Wang L, Tian X, Wang Y, Pi Z (2009). Preparation and tunable photoluminescence of alloyed CdSxSe1â&#x2C6;&#x2019;x nanorods J. Mater. Sci. 44: 3015-3019. Yoon KP (1998). Isolation and characterization of Pseudomonas sp. KM10; a cadmium- and mercury-resistant, and phenol-degrading bacterium. J. Microbiol. Biotechnol. 8: 388-398.

African Journal of Biotechnology Vol. 11(31), pp. 7966-7972, 17 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4291 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ2012 Academic Journals

Full Length Research Paper

Effect of X-ray irradiation on the physical and chemical quality of America red globe grape Fenfen Kang1,2, Guy J. Hallman3, Yadong Wei2, Fanhua Zhang4 and Zhihong Li1* 1

China Agricultural University, Beijing 100193, China. Tianjin Entry-Exit Inspection and Quarantine Bureau, Tianjin 300461, China. 3 Subtropical Agricultural Research Center, 2413 E. Business Highway 83, Weslaco, Texas 78596, USA. 4 Chinese Academy of Inspection and Quarantine, Beijing 100029, China. 2

Accepted 17 February, 2012

The use of irradiation as a phytosanitary treatment has expanded in recent years. It plays important roles in developed and developing countries, facilitating international trade in irradiated fresh fruit. To evaluate the potential of X-ray irradiation as a quarantine treatment for America red globe grapes, we investigated the effect of X-ray irradiation by 0.2, 0.4, 0.6 and 1.0 kGy on the physical and chemical quality of fresh grape. Irradiation by 0.2 and 0.4 kGy could reduce the respiration rate of fresh grape and extend the shelf life of fruit. There was no significant effect of irradiation on other physical and chemical quality of grapes (weight loss, total soluble solids, titratable acidity, protein, mineral, sweet and taste). The irradiation treatments also had a better appearance than the control grapes after 14 days. Therefore, irradiation as a quarantine treatment for fresh grapes is possible. Key words: X-ray irradiation, quarantine treatment, physical-chemical, grape.

INTRODUCTION World trade in horticultural food products has become increasingly liberalized following the World Trade Organization. The importation of fresh fruits often needs phytosanitary treatments to meet quarantine requirements of importing countries (Heather and Hallman, 2008). Since 1997, America red globe grapes from California without quarantine pest that China inhibited could be transported to China through Tianjin, Haikou, Guangzhou, Dalian, Shanghai and Nanjing port. But once quarantine pest like live fruit flies, thrips and mites were intercepted from America Red Globe grapes, an appropriate quarantine treatment would be enforced. Although methyl bromide can be used to control pests of concern to China, for fruits especially and fresh commodities in general, ionizing irradiation is a superior treatment to methyl bromide fumigation or any other treatment from the standpoint of preserving commodity quality. At present, irradiation (including gamma ray, X-ray,

*Corresponding author. E-mail: lizh@cau.edu.cn. Tel: 86-1062731299. Fax: 86-10-62733404.

electron beam) is an approved phytosanitary treatment with the potential to disinfect a wide variety of fresh commodities of many quarantine pests. In 2003, the International Plant Protection Convention (IPPC) approved the International Standard for Phytosanitary Measures (ISPM) No.18-Guidelines for the use of irradiation as a phytosanitary treatment, which facilitated international trade in irradiated fresh fruit (FAO, 2003). In 2009, the IPPC adopted eight irradiation treatments for various insect pests, including a generic dose of 0.15 kGy for fruit flies of the family Tephritidae, for inclusion in ISPM No.28 on phytosanitary treatments for regulated pests (FAO, 2009a). Until 2011, fourteen irradiation treatments were approved (FAO, 2011). Recently, Food and Agriculture Organization (FAO) and International Atomic Energy Agency (IAEA) initiated a coordinated research on the development of generic irradiation doses for quarantine treatments (IAEA, 2009). The U.S. Department of Agriculture (USDA) suggested the IPPC to take 0.4 kGy as a generic dose for insect irradiation treatment, excluding lepidopteran pupae and adults. But when applied in a commercial scale, this target dose can increase to 2 to 3 times (Heather and

Kang et al.

Hallman, 2008). So it also places an added responsibility on researchers to ensure that the maximum absorbed dose approved for each quarantine pest has an adequate tolerance by fruits. Among different phytosanitary measures, irradiation is the most tolerated treatment by the fresh commodities (Heather and Hallman, 2008). Low dose irradiation has been recommended to prolong shelf life and delay ripening of fruits. In the literatures, few studies were done for irradiation as a phytosanitary treatment of grapes. The main insects that attack grapes are fruit flies, moths, thrips and mites. Irradiation treatment for fruit flies of the family Tephritidae (generic) was 150 Gy (FAO, 2009b). For moths, USDA approved 0.4 kGy as a generic dose, excluding lepidopteran pupae and adults (APHIS, 2007). For thrips and mites, there is no generic irradiation dose (International Database on Insect Disinfestation and Sterilization), but 150 to 250 Gy to thrips and 200 to 350 Gy to mites can prevent reproduction of actively reproducing adult (Heather and Hallman, 2008). For irradiation effect on quality of grapes, Al-Bachir (1999) evaluated the effect of gamma irradiation on weight loss, spoilage and total loss of two local table grape varieties (Baladi and Helwani), and found that the storage periods can be extended by 50% using the optimal doses, 0.5 to 1.0 kGy for Helwani and 1.5 to 2.0 kGy for Baladi. However, information is not available on the physiological responses of fresh grapes to different dose levels of irradiation. Under these considerations, our work researched the effect of X-ray irradiation on the quality of America red globe grapes from California. The purpose was to investigate the effect of X-ray irradiation on the physical and chemical quality of grape to get the optimal dose for quarantine treatment of fresh grapes.

MATERIALS AND METHODS

7967

X-ray irradiation The fruits of each group were exposed to X-rays from a source with electron beam energy of 6 MeV (Tsinghua University, China). The dose rate was 8.76 Gy/min. For each irradiation treatment, the actual doses were measured using PTW-UNIDOs (Freiburg, German) at three different heights among each group. Mean and standard error (SE) were 0.200 ± 0.012, 0.400 ± 0.020, 0.600 ± 0.017 and 1.000 ± 0.021 kGy, respectively.

Physical-chemical analysis Weight loss Each group was weighed (Precisa 4000C, Swiss) after physical and chemical measurement, quantified each group fruits before the next physical and chemical measurement. Weight loss was calculated as percentage loss of initial weight.

Respiration measurement Respiration rates of control and irradiated grapes were measured by gas chromatography (Agilent 6890, TCD detector, Santa Clara, California, USA) according to the method of Liu et al. (2010) as follows: Each replicate fruits were placed in a given volume of container, sealed and incubated for 2 h at 21°C. Briefly, 0.5 ml syringe was used to collect the gas produced by fruits, then a GC instrument was used to carry detection three times, and finally the mean data was use to obtained the actual respiration rate. The respiration rate was expressed in ml CO2kg-1h-1. Total soluble solids The juice of grapes was extracted, and then the content of total soluble solids was measured using a hand digital fruit refractometer (GMK-701R, Korea). The SSC was expressed in percentage.

Titratable acidity Titratable acidity was measured by titrating 5 ml of juice with 0.1 N NaOH to a pH of 8.1, and it was expressed as g tartaric acid 100 ml-1 juice.

Fruits Protein Post harvested America Red Globe grapes without any quarantine treatment were packaged according to the requirements of APHIS, and then transported from California to Tianjin Port less than 15 days by ventilated containers with 0 to 1.5°C. The air change rate of ventilated container was 15 m3/h. The total quantity of grape used in this experiment was randomized and divided into five groups of 5 kg fruits each. Four groups were irradiated respectively with 0.2, 0.4, 0.6 and 1.0 kGy, one group, as control and three replications for each treatment including the control. The grapes were packed in polyethylene film (there were 6 mm diameter holes on the film, the space between holes was 13 mm) and kept at room temperature for 1 day before irradiation. After treatments, the fresh grapes were stored at 1.5°C ± 0.5 (the temperature precision display of storage chamber is ± 0.5°C. In order to avoid damaging the grapes below zero, we set the storage temperature as 1.5°C) and 75% ± 5 RH in a temperature and humidity chamber (Binder 720, Neckarsulm, Germany) for 22 days, and were kept at room temperature for 1 h before physical-chemical analysis.

The content of crude protein (N × 6.25) in grapes was measured with Kjeltec 2300 Protein Analyzer after irradiation according to AOAC (2005). The result was expressed in g/100 g.

Mineral content Minerals were extracted from the samples by dry ashing method as described by Szentmihályi et al. (2009). The mineral content was determined using Agilent 7500 ICP-MS (USA).

Sensory evaluation The sensory evaluation was performed through 10 semi trained panelists, age from 25 to 50 including female and male. They tested the control and irradiated grapes randomly at interval for several days, and evaluated the sweetness, taste and overall appearance,

Afr. J. Biotechnol.

Weight loss (%)

7968

CK 0.2 KGy 0.4 KGy 0.6 KGy 1.0 KGy

Storage (days) Figure 1. Weight loss of grapes during storage.

judging on a 10-score scale where 1 = extremely unpleasant, 5 = fair and 10 = excellent (Alonso et al., 2007).

Statistical analysis The results were treated with analysis of variance (ANOVA) and multiple comparisons for quantitative (continuous) treatments (irradiation doses) at interval for several days and was tested based on Tukey’s test at 5% significance using SPSS 13.0 (Statistical Program for Social Sciences, 2004).

RESULTS AND DISCUSSION Weight loss Weight loss of grapes during storage at 2, 7 and 14 days was observed (Figure 1). The results demonstrate that the five treatments had similar behavior during storage. There was no significant difference between the control and irradiated (p>0.05). On day 2, the weight loss of grapes from control irradiated at 0.2, 0.4, 0.6 and 1.0 kGy presented 1.6, 1.2, 2.0, 1.7 and 1.7%, respectively. On days 7 and 14, the weight loss increased to 3.3% to 4.1%. From the whole distribution of weight loss during storage, grapes irradiated at 0.2 kGy showed a slightly lower result from others (except grapes irradiated at 0.4 kGy on day 7), but there was no statistical difference. This result is in agreement with Zaman et al. (2007) who found that there were no remarkable changes in the moisture contents of gamma irradiated bananas during the storage period. Whereas Al-Bachir (1999) reported

that ‘Baladi’ grape irradiated at 0.5 kGy had weight loss higher than the control fruit after 4 weeks in storage period, but there was no difference in weight loss between control and irradiated ‘Helwani’ grape.

Respiration The respiration rates of grapes during storage are shown in Figure 2. It was observed that the respiration rates of grapes irradiated at 0.2 and 0.4 kGy on 3 h-14 days storage period were lower than the control, 0.6 and 1.0 kGy treatment. With increasing storage days, the difference rate between 0.2/0.4 kGy and the control ascended gradually. It demonstrated that irradiation at 0.2 and 0.4 kGy X-rays reduced the respiration of fresh grapes. At 0.6 and 1.0 kGy treatment, the respiration rates were higher than at 3h and 1 d', but after 1 day, it was reversed. It was probable that X-rays can stimulate the respiration rate with 0.6 and 1.0 kGy during a short time. This research found that there were statistical differences among the five treatments (p<0.05) during different storage days, indicating that X-ray could influence the respiration rates of fresh grapes at different doses, which is in agreement with Aina et al. (1999) and Singh and Pal (2009). Singh and Pal (2009) reported that positive influence of irradiation on the respiratory behavior of fresh guava fruit declined during long-term storage at low temperature. While respiration of fruits plays a dominant role in fruits postharvest activity, it has a practical importance in physical and chemical change of

Kang et al.

7969

CK ml CO2 Kg-1 h-1

0.2 KGy 0.4 KGy 0.6 KGy 1.0 KGy

Storage (days) Figure 2. Respiration rate of grapes during storage.

CK 0.2 KGy

SSC (%)

0.4 KGy 0.6 KGy 1.0 KGy

Storage (days) Figure 3. SSC of fresh grapes during storage.

fruits, shelf life extension and ripening delay (Pan and Xie, 2009). Total soluble solids Irradiated fresh grapes showed lower values in total soluble solids content on days 2 and 7 (Figure 3), which was significantly different from the control (p<0.05). Sreenivasan et al. (1971) also reported that irradiation of guava fruit at 0.3 kGy dose resulted in slower rate of sugar accumulation during storage. The changes in SSC

of bananas, mangoes and papaya were also prevented in response to ionizing radiation treatment (Sreenivasan et al., 1971; Singh and Pal, 2009). But on day 14, the difference between irradiated grapes and the control was not significant (p>0.05), and the total soluble solids content of the control decreased gradually. Titratable acidity The obtained values of titratable acidity of all fruits are shown in Figure 4. The values varied from 1.0% to 1.3%.

7970

Afr. J. Biotechnol.

CK 0.2 KGy

Acidity (%)

0.4 KGy 0.6 KGy 1.0 KGy

Storage (days) Figure 4. Titratable acidity of fresh grapes during storage.

CK 0.2 KGy g/100 g

0.4 KGy 0.6 KGy 1.0 KGy

Storage (days) Figure 5. Protein of fresh grapes during storage.

On days 2 and 7, the acidity of four irradiated had a significant difference (p<0.05) with the control. The value of the control is always above irradiated treatments. Baghel et al. (2005) also reported the retention of titratable acid in fruit treated with 0.1 kGy dose of ionizing radiation. On day 14, the difference between irradiated and the control was not remarkable, although the value of the control was higher than irradiated fruits. Sabato et al. (2009) observed that the changes of acidity of the irradiated mangoes could be associated with the metabolism of the grapes.

Protein The total content of grapes protein during storage is presented in Figure 5. Only on day 3, that there were significant differences between 0.2 and 0.4 kGy, 0.4 and 0.6 kGy, 0.4 and 1.0 kGy (p<0.05). The value of 0.4 kGy was higher than others. But on days 12 and 22, significant differences among different doses had disappeared. This result is in agreement with Marriott (1980). And with the storage days, the gap among different treatments

Kang et al.

7971

Table 1. Mineral content (mg/kg) of grapes during storage.

Mineral

Storage (day)

Dose (kGy) 0.40 51.4 ± 2.67a 58 ± 2.5a a 56 ± 1.83

3 12 22

0 63.4 ± 2.05a 56 ± 2.3a a 64 ± 1.25

0.20 45.3 ± 2.24a 58 ± 3.0a a 58 ± 2.16

0.60 50.7 ± 1.69a 56 ± 2.1a a 79 ± 2.67

1.0 53.5 ± 1.93a 57 ± 2.1a a 66 ± 3.02

3 12 22

1391 ± 23.4 1631 ± 27.3a a 1507 ± 37.2

1099 ± 20.6 1617 ± 30.1a a 1590 ± 20.7

1211 ± 18.9 1397 ± 25.7a a 1465 ± 28.3

1409 ± 27.1 1471 ± 26.1a a 1663 ± 33.8

1247 ± 22.5 1574 ± 24.4a a 1538 ± 37.4

3 12 22

72 ± 4.2a a 70 ± 3.4 a 48 ± 2.7

52 ± 2.9a a 80 ± 3.6 a 45 ± 2.5

57 ± 4.0a a 84 ± 3.7 a 46 ± 2.6

48 ± 3.6a a 69 ± 4.2 a 57 ± 2.7

56 ± 3.1a a 77 ± 2.3 a 50 ± 1.8

7.5 ± 0.4 a 3.9 ± 0.3 a 3.9 ± 0.4

3 12 22

8.1 ± 0.6 a 4.1 ± 0.4 a 3.7 ± 0.2

8.8 ± 0.6 a 3.8 ± 0.3 a 3.7 ± 0.3

6.4 ± 0.2 a 4.2 ± 0.3 a 3.4 ± 0.2

8.2 ± 0.5 a 4.0 ± 0.2 a 3.8 ± 0.2

3 12 22

0.35 ± 0.02a 0.33 ± 0.03a 0.17 ± 0.02a

0.34 ± 0.03a 0.33 ± 0.03a 0.19 ± 0.01a

0.33 ± 0.02a 0.29 ± 0.01a 0.19 ± 0.01a

0.32 ± 0.02a 0.18 ± 0.02a 0.11 ± 0.00a

0.33 ± 0.01a 0.24 ± 0.02a 0.12 ± 0.01a

3 12 22

0.78 ± 0.03 0.45 ± 0.02a 0.40 ± 0.01a

0.43 ± 0.01 0.52 ± 0.02a 0.45 ± 0.02a

0.54 ± 0.03 0.55 ± 0.03a 0.43 ± 0.02a

0.39 ± 0.01 0.52 ± 0.04a 0.66 ± 0.05a

0.47 ± 0.02 0.50 ± 0.03a 0.45 ± 0.03a

3 12 22

1.05 ± 0.04a 1.46 ± 0.05a a 0.87 ± 0.04

1.09 ± 0.01a 1.18 ± 0.04a a 1.02 ± 0.03

0.88 ± 0.01a 1.15 ± 0.02a a 1.17 ± 0.02

1.01 ± 0.02a 1.40 ± 0.03a a 0.97 ± 0.02

1.05 ± 0.07a 1.29 ± 0.04a a 0.92 ± 0.02

3 12 22

0.32 ± 0.01a 0.17 ± 0.01a 0.21 ± 0.00a

0.20 ± 0.01a 0.17 ± 0.00a 0.21 ± 0.00a

0.20 ± 0.02a 0.16 ± 0.01a 0.21 ± 0.01a

0.19 ± 0.02a 0.13 ± 0.00a 0.28 ± 0.01a

0.21 ± 0.01a 0.16 ± 0.00a 0.25 ± 0.02a

Mean ± SE; b, On same day, means with the same letter are not significantly different at the level of 5% (p<0.05).

went down gradually. Mineral content The results of mineral composition of grapes are shown in Table 1. There were no significant differences between irradiated grapes and the control (p>0.05). This indicates that irradiation with doses less than 1.0 kGy do not result in decreasing mineral content of fresh grapes. Sensory evaluation The effect of irradiation on the sensory of fresh grapes is shown in Table 2. With a multiple comparison on the level of 5%, on days 3 and 7, sweetness, taste and appearance had no remarkable changes among the four

treatments, which was in agreement with the research on sensorial analysis of kiwi fruit (Harder et al., 2009). After 14 days, the appearance scores of the control was the lowest, and also had a significant difference with the irradiated treatments (p<0.05). This may indicate that irradiation up to 1.0 kGy can increase the shelf life of grapes. Conclusion The history of research on ionizing irradiation as a phytosanitary treatment is almost as long as the history of any other phytosanitary treatment. It is used for modest interstate shipments among the US states, mangoes and papaya from Australia to New Zealand and for a few shipments of mangoes from India to the USA. Other countries are considering to begin using it.

7972

Afr. J. Biotechnol.

Table 2. Results of sensory evaluation for grapes during storage days.

Storage (day)

Dose (kGy) Control 0.2 0.4 0.6 1.0

Sweetness a 7.8 ± 0.42 7.9 ± 0.57a a 7.8 ± 0.42 7.8 ± 0.42a 7.9 ± 0.52a

Taste a 8.5 ± 0.53 8.3 ± 0.48a a 8.2 ± 0.42 8.2 ± 0.63a 8.3 ± 0.57a

Appearance a 8.8 ± 0.42 8.9 ± 0.32a a 8.8 ± 0.42 8.6 ± 0.52a 8.7 ± 0.62a

Control 0.2 0.4 0.6 1.0 Control 0.2 0.4 0.6 1.0

7.8 ± 0.42a a 8.0 ± 0.47 7.9 ± 0.32a 7.8 ± 0.42a 7.8 ± 0.42a a 8.0 ± 0.47 a 8.1 ± 0.32 a 8.2 ± 0.42 a 7.7 ± 0.48 a 8.0 ± 0.47

8.3 ± 0.48a a 8.1 ± 0.57 8.1 ± 0.31a 8.1 ± 0.57a 8.1 ± 0.31a a 8.0 ± 0.67 a 8.1 ± 0.57 a 8.0 ± 0.47 a 8.0 ± 0.67 a 8.0 ± 0.47

8.2 ± 0.42a a 8.5 ± 0.53 8.6 ± 0.52a 8.3 ± 0.48a 8.2 ± 0.42a b 6.6 ± 0.52 a 7.5 ± 0.53 a 7.5 ± 0.71 a 7.4 ± 0.70 a 7.5 ± 0.53

a,b

Mean ± SE; on same day, means with the same letter are not significantly different at the level of 5% (p<0.05).

Irradiation has the potential to solve many phytosanitary problems and is the most tolerated treatment for fresh commodities in general (Heather and Hallman, 2008). This work showed that irradiation can reduce the respiration rate of fresh grapes. The irradiated grapes had a better appearance than the control on day 14. In addition, there was no remarkable difference found in weight loss, the soluble solids, titratable acidity after 14 days, and protein and mineral content between the irradiated and the control after 22 days of storage. From the current results, X-ray irradiation up to 1.0 kGy had no negative effect on the physical and chemical quality of fresh grape. It is therefore possible to consider irradiation as a quarantine treatment for fresh grapes. REFERENCES Aina JO, Adesiji OF, Ferris SR (1999). Effect of γ-irradiation on postharvest ripening of plantain fruit (Musa paradisiaca) cultivars. J. Sci. Food Agric. 79: 653-656. Al-Bachir M (1999). Effect of gamma irradiation on storability of two cultivars of Syrian grapes (Vitis vinifera). Radiat. Phys. Chem. 55: 8185. Alonso M, Palou L, Rio MA, Jacas JA (2007). Effect of X-ray irradiation on fruit quality of Clementine mandarin cv.‘Clemenules’. Radiat. Phys. Chem. 76: 1631-1635. AOAC (2005). Official method of analysis of AOAC international. AOAC, USA. APHIS (US Department of Agriculture Animal and Plant Health Inspection Service) (2007). Treatment Manual. http://www. aphis.usda.gov/ppq/manuals/port/Treatment Chapters.htm. Baghel BS, Gupta N, Khare A, Tiwari R (2005). Effect of different doses of gamma radiation on shelf life of guava. Indian J. Hort. 62: 129-132. FAO, IPPC (2003). ISPM 18: Guidelines for the use of irradiation as a phytosanitary measure. https://www.ippc.int/file_uploaded/ 1249306780422_ISPM_18_E.doc FAO, IPPC (2009a). ISPM 28: Phytosanitary treatments for regulated pests.

https://www.ippc.int/file_uploaded/1323949527_ISPM_28_2007_En_ 2011-11-29_Refor.pdf FAO, IPPC (2009b). ISPM 28, Annex 07: Irradiation treatment for fruit flies of the family Tephritidae (generic). https://www.ippc.int/file_uploaded/1323950176_PT_07_2009_En_201 1-12-01_Reforma.pdf FAO, IPPC (2011). Adopted Standards. https://www.ippc.int/index .php?id=ispms&no_cache=1&L=0 Harder MNC, Toledo TCF, Ferreira ACP, Arthur V (2009). Determination of changes induced by gamma radiation in nectar of kiwi fruit (Actinidia deliciosa). Radiat. Phys. Chem. 78: 579-582. Heather NW, Hallman GJ (2008). Pest management and phytosanitary trade barriers. Wallingford, UK: CAB International. IAEA (2009). Report of the first research coordination meeting on the development of generic irradiation doses for quarantine treatments. Vienna, Austria, 5-9 October. International Database on Insect Disinfestation and Sterilization http://nucleus.iaea.org/sso/NUCLEUS.html?exturl=http://wwwididas.iaea.org/IDIDAS/default.htm Liu B, Zhang FH, Wang YJ (2010). Toxicity of phosphine to Carposina sasakii Matsumura (Lepidoptera: Carposinadae) at low temperature. J. Econ. Entomol. 103(6): 1988-1993. Marriott J (1980). Bananas: Physiology and biochemistry of storage and ripening for optimum quality. Crit. Rev. Food Sci. Nutr. 13: 41-88. Pan YG, Xie JH (2009). Postharvest physiology of fruits and vegetables. Beijing: Chemistry and Industry Press. Sabato SF, Silva JM, Cruz N, Salmieri S, Rela PR, Lacroix M (2009). Study of physical-chemical and sensorial properties of irradiated Tommy Atkins mangoes (Mangifera indica L.) in an international consignment. Food Control. 20: 284-288. Singh SP, Pal RK (2009). Ionizing radiation treatment to improve postharvest life and maintain quality of fresh guava fruit. Radiat. Phys. Chem. 78: 135-140. Sreenivasan A, Thomas P, Dharkar SD (1971). Physiological effects of gamma radiation on some tropical fruits. Disinfestation of Fruit by Irradiation, International Atomic Energy Agency, Vienna, pp. 65-91. Szentmihályi K, Héthelyi É, Virág V, Then M (2009). Mineral elements in muscat sage plant (Salvia sclarea L.) and essential oil. Acta Biol. Szegediensis. 53: 35-38. Zaman W, Paul D, Alarm K, Ibrahim M, Hassan P (2007). Shelf life extension of banana (Musa sapientum) by gamma radiation. J. Biol. Sci. 15: 47-53.

African Journal of Biotechnology Vol. 11(31), pp. 7973-7979, 17 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3443 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Effective extraction of cephalosporin C from whole fermentation broth of Acremonium chrysogenum utilizing aqueous two phase systems Amina Wajid1, Farnaz Malik1, Shazia Shafaat1, Shahzad Hussain1*, Ghazala Parveen1, Sabeeha Roohi1, Rashid Mahmood1, Rafiq A. Channa 1, Fahadiya Yasin Raja1, Humayun Riaz2, and Muhammad Ismail3 1

National Institute of Health, Islamabad-45500, Pakistan. Department of Pharmacy, University of Sargodha, Sargodha, Pakistan. 3 Department of Pharmacy, University of Peshawar, KPK, Pakistan.

Accepted 30 January, 2012

The downstream processing of biotechnological products from fermentation broth is an important step of production and development of cost effective, efficient downstream processing of many biotechnological products. The present study was conducted by employing aqueous two phase systems (ATPSs) for the extraction of cephalosporin C (CPC) from whole fermentation broth of Acremonium chrysogenum. The biphasic system was prepared by mixing equal aliquots of 15% w/w polyethylene glycol (PEG) 3350 with 15% (NH4)2SO 4. The effects of pH, neutral salts, temperature and centrifugal force on partitioning in ATPS to develop efficient extraction system for recovery of CPC from fermentation broth were also examined. The extraction efficiency was improved by enhancing the centrifugal force. Similarly centrifugation for 12.5 min also gave the maximum extraction. Improvement in the recovery yield was also observed by the addition of 0.1% NaCl. The concentration of CPC was determined by high performance liquid chromatography (HPLC). Slight modifications in the mobile phase from 10 to 5% MeOH improved CPC resolution. Further development of more inexpensive systems for extraction can be the future target of research. Key words: Cephalosporin C, Acremonium chrysogenum, fermentation, aqueous two phase system (ATPS).

INTRODUCTION The development of cost effective and efficient downstream process for production of a purified biomolecule is the key concern of pharmaceutical industry due to the increased demand of pure biochemicals in the last decades. However, the technology for separating biological products from the fermentation broth in which they are produced has not reserved rapidity with the

*Corresponding author. E-mail: shshaikh2001@yahoo.com. Abbreviations: ATPSs, Aqueous two phase systems; PEG, polyethylene glycol; HPLC, high performance liquid chromatography; CPC, cephalosporin C.

advances in synthesis and production of these naturally produced metabolites (Ratnapongleka, 2010; Naganagouda and Mulimani, 2008). Commercially, significant antibiotics are produced naturally by several microorganisms like bacilli and species of fungi like Cephalosporium and Penicillium. Fermentation broth contains many metabolites and by-products. Product recovery from a mixed broth is usually done with multistep purification techniques. Antibiotics thus obtained are modified chemically or enzymatically and used for either commercial purposes or basic studies (Fayerman, 1986). The industrial separation of cephalosporin C (CPC), a bata-lactam antibiotic from fermentation broths, is usually achieved by liquid chromatography, adsorption on active carbon or more frequently a combination of these.

7974

Afr. J. Biotechnol.

Unfortunately, the efficiency is low. Moreover, the application of organic solvent whole broth extraction toward recovery of CPC is inadequate for hydrophilic compounds such as CPC due to its amphoteric nature (Hano et al., 1992; Yang et al., 1993) besides deleterious effects of organic solvents (Yan et al., 2001). Neither CPC nor desacetyl CPC (DAC, the major contaminant in the fermentation broth) is soluble in organic solvents. The application of aqueous two-phase system (ATPS) for recovery of CPC has recently been projected and gained considerable attention since the last decade (Yang et al., 1994). ATPS after its introduction in 1954 by Albertsson for the recovery of chloroplasts from plant extracts (Albertsson and Leyon, 1954), is widely used for purification of proteins (Shinomiya et al., 2003; Balasubramaniam et al., 2003; Waziri et al., 2004), enzymes (Pan et al., 2001; Bim and Franco, 2000; Xu et al., 2005), amino acids (Li et al., 2002), antibiotics (Yang et al., 1994) and aroma compounds (Macro et al., 2000). The eminent advantages of ATPS include reduced volume, high capacity, fast separations, easy scale-up (Yan, 2001; Xu et al., 2005). In addition, it constitutes gentle environmental conditions containing high water content in both liquid phases (Ratnapongleka, 2010). Beside other advantages, It is also considered to be an attractive and economically workable technology for downstream processing (Naganagouda and Mulimani, 2008). These systems are formed when water soluble polymers and certain inorganic salts are mixed together at specific concentrations. In a bio-separation process, it is significant to elevate the differences of partition coefficient (K) between target molecule and contaminants. This can be done by changing physical and chemical parameters of the separation system resulting in better separation (Drouin and Cooper, 1992). Aqueous two-phase extraction system was investigated as a powerful technique for separation, concentration and purification of biomolecules and pharmaceutical by studying the partitioning of ciprofloxacin in aqueous twophase system of polyethylene glycol (PEG)–Na2SO4– water. The results of the model show that the ciprofloxacin partitioning is highly dependent on salt concentration. However, temperature and PEG concentration were shown to have moderate effects on partitioning but PEG molecular weight has no significant effect on the antibiotic partitioning (Mokhtarani et al., 2008). The application of aqueous two-phase systems in the purification, characterization and study of biomaterials was reviewed by Xu et al. (2001). The applications of aqueous two-phase systems in the separation and study of various pharmaceuticals, including recombinant proteins, antibodies and antigens, antibiotics, amino acids and oligopeptides, lactic acid, enzymes were conversed. New developments of the aqueous two-phase systems and the prospects of this technology were also discussed. The addition of salts, a change in pH or the addition of

affinity ligands are often used to alter the partitioning of the biomolecules and improve the selectivity of the two phase concentration. Although such interactions in ATPS are not well understood yet, it has been suggested to involve molecular forces (Huddleston et al., 1991). The present study was undertaken for effective extraction of CPC from whole fermentation broth of Acremonium chrysogenum utilizing aqueous two phase systems. The effects of pH, neutral salts, temperature, and centrifugal force on partitioning in ATPS to develop efficient extraction system for recovery of CPC from the fermentation broth were also examined. MATERIALS AND METHODS Microorganism, media and culture conditions A. chrysogenum IM-1.1 strain was used in the study. The strain was cultured and maintained on potato dextrose agar slants. Potato dextrose broth containing 2% dextrose in 100 ml potato extract was used for inoculum’s development.

Antibiotic production medium Fermentation was carried out in a defined media developed with slight modifications (Zanaca and Martin, 1983). It contained 2.7% glucose, 3.6% sucrose, 0.7% DL-methionine, 13.5% salt solution A (composed of 115 g KH2PO4, 156 g K2HPO4, 1.6 g Na2 SO4, 1.3 g MgSO4.7H2O, 0.22 g ZnSo4.7H2O, 0.22 g MnSO4.H2O and 0.055 g CuSO4 per liter of distilled water) and 0.75% salt solution B made up of 2% ferrous ammonium sulfate. Batch culturing in shaker incubator Batch fermentations were performed in 250 ml Erlenmeyer flasks with 100 ml production media, initially at 25°C. Parameters such as pH, agitation and time of incubation were optimized for maximum antibiotic production in another experiment. Finally, optimum fermentation conditions considered for maximum antibiotic yield were pH 6.5, 200 rpm and incubation of culture for 72 h, as determined in our previous experiment.

Assay of cephalosporin C CPC concentration in broth was determined by a spectrophotometric method utilizing hydroxylamine-nickel reagent as described by Mays et al. (1975). After extraction in PEG-rich phase, CPC concentration was determined by high performance liquid chromatography (HPLC) (9A-Shimazzu, Japan). A reversed phase micro-Bondapak C18 (3.9 × 300 mm, Waters, USA) column was used. Mobile phase consisted of 0.02 M phosphate buffer containing 5% methanol and pH 3.5 at flow rate of 0.8 ml/min. CPC was detected at 254 nm.

Extraction of CPC from whole broth Different organic solvents were used to extract CPC from whole broth. It was observed from quantitative analysis using HPLC that none of the organic solvents including ethyl acetate, methyl-Isobutyl ketone, isopropyle alcohol and acetone. ATPS was developed by

Wajid et al.

7975

Figure 1. Effect of centrifugal force on extraction efficiency of cephalosporin C.

mixing 15% PEG 3350 and 15% ammonium sulfate and placed on magnetic stirrer for 5 min. Subsequently, 0.5 ml of broth was mixed with 10 ml of PEG-ammonium sulfate system and was then centrifuged at different speeds, for different time periods (Beckman, USA). Different neutral salts were also added in concentration of 0.1% in different systems to improve the recovery yield. All the operations were conducted at room temperature (25째C). The pH of stock solutions was adjusted to desired pH during those experiments, which explored the effect of pH. Otherwise pH was not adjusted and final pH was between the ranges of 2.8 to 6.2. Temperature pretreatment for 15 min was also done in order to study the effect of temperature on extraction of CPC.

RESULTS AND DISCUSSION The effect of (NH4)2SO4 concentration, time, speed of centrifugation and neutral salt addition were investigated to find a suitable extraction system for recovery of CPC antibiotic from whole fermentation broth. As earlier reported, changing the system properties like pH value, addition of salt and concentration of phase forming salt interfere with the surface properties of the partitioning molecules. Although these interactions are not well understood, it is suggested that certain molecular forces must be involved (Huddleston et al., 1991). Moreover, slight modification of mobile phase from 10% MeOH in 0.02 M buffer to 5% MeOH in 0.02 M improved HPLC resolution such that retention time of CPC increased. This made the CPC separation from its impurities easy. pH effects It is observed from results (Figure 5) that maximum

extraction was achieved at neutral pH 7. The change in the yield was not pronounced between pH 6 to 7. However, extraction efficiency dropped by further increases in pH (pH 8). Similar results were obtained by Yang et al. (1994) in their experiments where partition coefficient remained ineffective by changing pH from 4.5 to 7. Lee and Sandler (1990) also studied pH effects on vancomycin partitioning in ATPS. They explained that since pH determines net electric charge on a biomolecule, it can play an important role in determining its partitioning behavior. As reported in their experiment, partitioning co-efficient (K) was much higher at pH 4.0 and 7.0 than at 9.3. Newton and Abraham (1955) stated that CPC is rapidly inactivated at pH 12, while it is stable at pH 3.5. Similar pH induced changes are also observed in whole broth extraction of antibiotics using organic solvents. pH increase resulted in emulsion formation in such cases, hence causing reduced degree of extraction (Chaung et al., 1989). The effect of centrifugal force on extraction Several centrifugal forces were tried for different time periods and their effects on extraction were measured. As shown in Figure 1, the degree of extraction increases with increase in centrifugal force. This is in line with findings reported by Yang et al. (1994) that the recovery yield of CPC in whole broth extraction is observed to be a function of centrifugal forces used in phase separation. Similarly, it was reported that for whole broth extraction, higher centrifugation speeds are applied than for diluted or filtered broths.

7976

Afr. J. Biotechnol.

Figure 2. Effect of time of centrifugation on extraction of cephalosporin C.

Time of centrifugation

Effect of (NH4)2SO4 concentration

This was also optimized in our study to find suitable extraction condition for the antibiotic, and it was observed that centrifugation for 12.5 min gave best results (Figure 2). Beside all other advantages of PEG-ATPS, the system has a reasonable phase separation characteristics and can even be used with traditional solvent extraction equipment (Walter et al., 1985).

At 15% PEG 3350, the effects of (NH4)2SO4 concentration are illustrated in Figure 4. Out of different concentrations tested, a system containing 17% (NH4)2SO4 as phase forming salt was found to be the best for maximum CPC extraction. (NH4)2SO4 are more familiar systems and it was reported earlier that bivalent and multivalent salts are better for salting out PEG than monovalents. Yang et al. (1994) used 15% PEG and tried different salt concentration e.g. 12, 17 and 25%. In their case 20% PEG and 20% salt system+ 1% KSCN was found to be most suitable. Similarly Lin and Chu (1995) used 15% PEG and 17.5% (NH4)2SO4 along with 1.45% KSCN for CPC extraction in ATPS. The distribution ratio for different solutes increases with phase forming salt concentration to a certain limit, beyond which no further improvement in resolution takes place (Rogers et al., 1998).

Salt addition Enhancement of separation factor by addition of neutral salts into ATPS was also investigated. Results show that additions of salts that may disrupt water structure were found to be effective, and the effectiveness of salts were in the following sequence NaCl = KCl >KSCN > Na2SO4 = KI as shown in Figure 3. The addition of neutral salts in PEG-salts systems was reported to change both phase composition and differences of hydrophobicities between the two phases, which consequently changed the partition co-efficient (K) of target compound (Kuboi et al., 1991). Moreover, different salts had been found to produce different potential differences according to type and concentration. Therefore, in most commonly used PEG-salt ATPS, solute partitioning is the most significantly effected by type and concentration of biphasic forming anions.

Effect of temperature Temperature has been found to have role in promoting extraction as shown in Figure 6. Maximum extraction was achieved when the system was heated at 30째C for 15 min in a water bath. No further increase in the recovery yield was observed by increasing or decreasing the temperature. Temperature like pH is an important

Wajid et al.

7977

Figure 3. Effect of the addition neutral salts on partitioning of cephalosporin C.

14.15

9.95

13.2 9.3

8.95

(ug.ml)

CPC conc. (ug.ml)

5 0

Amonium sulphate concentration (%) Figure 4. Effect of ammonium sulphate concentration on CPC partitioning.

variable which effects partitioning of solutes in ATPS, as such variables modify the partitioning character (Rogers et al., 1996). Experimental observations by Johansson (1986) also shows the influence of different water structuring factors such as temperature change, additives

of urea and different inorganic salts on phase separation in ATPS. Temperature is also found to be an important factor in whole broth extractions of antibiotics involving organic solvents. Broth temperature pre-treatment had successfully been applied in such cases to reduce the

Afr. J. Biotechnol.

Figure 5. Effect of pH value on recovery yield of cephalosporin C.

Temperature

7978

Figure 6. Temperature pre-treatment effect on extraction of cephalosporin C.

Wajid et al.

emulsion formation, which results in improved extraction (Chaung et al., 1989). Conclusion In the pharmaceutical sector, demand of pure biochemicals has increased largely since the last few decades. In the present study, ATPS was applied for the recovery of CPC antibiotic from crude fermentation broth. Parameters like pH, temperature, concentration of ammonium sulphate, time and speed of centrifugation were optimized to find a suitable extraction system. The isolation of purified final product usually requires complicated steps that result in high manufacturing cost (Aragon, 2008). It is only very recent that new inexpensive systems utilizing ATPS have been developed for extraction of CPC from whole broth. Each phase in the biphasic systems is over 80% water. ATPS have been studied widely as gentle, non-denaturing systems for the separation of biomolecules, proteins and other cell matters (Albertsson, 1986; Rogers et al., 1996). Further development of more inexpensive bio-separation systems with improved downstream processing procedures can be the future target of research. REFERENCES Albertsson PA, Leyon H (1954). The structure of chloroplasts. V. Chlorella pyrenoidosa Pringsheim studied by means of electron microscopy. Exp. Cell Res. 7, 288-290. Aragon MM (2008). In Extraction of Immunoglobulin G. Study of HostGuest mechanisms. Printed by Gilderprint, Enschede, the Netherlands.ISBN: 978-90-386-1284-3 (A catalogue record is available from the Eindhoven University of Technology Library) Albertsson PA (1986). Partitioning of cell particals and macromolecules. rd 3 Ed. Wiley N.Y. Chaung TZ, Clarke AE, Paul E (1989). Isolation and purification of an antibiotic by solvent extraction of a whole fermentation broth. J. Chin. I. Ch. E. 20(3): 155-161. Drouin CM, Cooper DG (1992). Biosurdactants and aqueous two phase fermentation. Biotechnol. Bioeng. 40: 86-90. Fayerman JT (1986). New developments in gene clonning in antibiotic producing microorganisms. Biotechnology, 4: 786-788. Huddleston JG, Ottomar KW, Ngonyani DM, Lyddiatt A (1991). Influence of system and molecular parameters upon fractionation of intracellular proteins from Saccharomyces by ATPS Enzyme. Microb.Technol. 13(1): 24-32. Huddleston J, Vieda A, Kohler K, Flanagan J, Enfors SO, Lyddiatt A (1991). The molecular basis of partitioning in aqueous two-phase systems.TIBTECH. 9: 381-388. Johansson G (1986). In partitioning in aqueous two-phase systems. Walter H, Brooks DE, Fisher D. (Ed). Academic press Orlando. FL. pp.161-266. Kuboi R, Tanaka H (1991). Effect of salt addition on the hydrobhobicities of the system and proteins in aqueous two-phase extraction systems. Kagaco Kagaco Ronbunshou. 17: 67-74.

7979

Lee CK, Sandler SI (1990). Vanomycine partitioning in aqueous twophase systems: Effects of pH, salt and affinity ligand. Biotechnol. Bioeng. 35: 408-416. Lin Po-Chun, Chu I-Ming (1995). Separation of cephalosporin-C and deacetyl cephalosporin-C by High speed counter-current chromatography in aqueous two-phase systems. Biotechnol. Tech. 9(8): 549-552 Meritxell Martinez i Aragon (2008). Extraction of Immunoglobulin G. Study of host guest mechanisms. ISBN: 978-90-386-12843.Gilderprint, Enscede, the Netherlands. Mokhtarani B, Ramin Karimzadeh, Mohammad Hassan Amini , Siavash Darvish Manesh (2008).Partitioning of Ciprofloxacin in aqueous twophase system of poly(ethylene glycol) and sodium sulphate. Biochem. Eng. J. 38: 241-247. Naganagouda K and Mulimani AH (2008). Aqueous two-phase extraction (ATPE): An attractive and economically viable technology for downstream processing of Aspergillus oryzae [alpha]galactosidase, Process Biochem. 43: 1293-1299. Newton GF, Abraham EP (1955). Cephlosporin C, a new antibiotic containing sulphur and D-alpha-aminoadipic acid. Nature, p. 175. Rogers RD, Bond AH, Bauer CB, Zhang J, Griffin ST (1996). Metal ion separations in PEG based ATPS: correlation of partitioning behaviour with available thermodynamic hydration data. J. Chromatogr. Biomed. Appl. 680: 221-229. Rogers RD, Griffin ST (1998). Partitioning of mercury in ATPS and on ABECTM resins. J. Chromatogr. B. 711: 277-288-300. Rogers RD, Willauer HD, Griffin ST, Huddleston JG (1998). Partitioning of small molecules in ATPS. J. Chromatogr B. 711: 255-263. Ratnapongleka K (2010). Int. J. Chem. Eng. Appl. 1(2) August Walter H, Brooks DE, Fisher D (ed) (1985). Partitioning in ATPS, Theory, Methods, Uses and Applications to Biotechnology. Academic Press, Orlando, Florida. Shinomiya K, Kabasawa Y, Yanagidaira K, Sasaki H, Muto M, Okada T, Ito Y (2003). Protein separation by nonsynchronous coil planet centrifuge with aqueous-aqueous polymer phase systems. J Chromatogr A. 1005 (1-2): 103-112. Waziri SM, Abu-Sharkh BF, Ali SA (2004). Protein Partitioning in Aqueous Two-Phase Systems Composed of a pH-Responsive Copolymer and Poly (ethylene glycol). Biotechnol. Prog. Mar-Apr, 20(2): 526-532. Ying XU, Guo-qing HE, Li Jing-jun (2005). Effective extraction of elastase from Bacillus sp. fermentation broth using aqueous twophase system. J. Zhejiang Univ. Sci 6B(11): 1087-1094. Yang WY, Lin CD, I-Ming Chu, Lee CJ (1994). Extraction of cephalosporin C from whole broth and separation of desacetyl cephalosporin C by ATPS partition. Biotechnol. Bioeng. 43: 439-445. Yang ZF, Yu SQ, Yong JC (1992). The extraction of penicilline G with aliphatic amines in organic solvents of different polarities. J. Chem. Tech. Biotechnol. 53: 97-103. Zanaca DM, Martin JF (1983). Carbon catabolite regulation of conversion of penicillin N into cephalosporin C. J. Antibiotics. 36(6): 700-707.

Full Length Research Paper

Role of Notch-1 signaling in ethanol induced PC12 apoptosis Yong-qiang Li1, Zhen-yu Shi2, Bin Liu1, Chao-shen Huangfu1 and Wei-juan Zhang1* 1

College of Medicine, Henan University, Kaifeng 475004, China. College of Nursing, Henan University, Kaifeng 475004, China.

Accepted 9 March, 2012

Chronic alcoholic dementia has crucial role in progress of neurodegenerative disease and affects a large portion of our aging population. Neuronal cell apoptosis may be a contributing factor of neurodegenerative disease (ND) and Alzheimer's disease (AD). Previous researches have indicated that Notch-1 signaling pathway is related with learning and memory ability. Mutations of Notch-1 are reported to accelerate the onset of AD and PD. Despite much investigation, very little is known about the exact role of Notch-1 in ND. In our present study, we used neuronal PC12 cell line to study the regulation role of Notch-1 in ethanol-induced cell apoptosis. 3-(4,5-Dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay was used for detection of the proliferation of PC12 cells upon ethanol treatment. Changes in PC12 cell nuclear morphology was detected with Hoechst 33258/propidium iodide (PI) double-staining. Western blot was used for detecting the level of cell apoptosis-related protein. At the same time, Notch-1 signaling activity was detected through enzymatic assay and Western blot. Our results demonstrate that PC12 cell apoptosis was induced by ethanol modulated by Notch-1 signaling pathway. Key words: Neuronal PC12 cell, neurodegenerative disease, ethanol, Notch-1. INTRODUCTION Neurodegenerative disorders (ND) such as Alzheimer’s disease (AD) and Parkinson’s disease (PD) are progressive, age-dependent neurodegenerative disorder affecting the cortex and hippocampus, and eventually leading to cognitive impairment (Calabrese et al., 2003, 2004). Although much evidence demonstrated that ND belong to the family of the ‘‘protein conformational diseases’’, a large amount of experimental evidence implicates oxidative stress as one of the crucial factors in the pathogenesis of ND (Przedborski and Ischiropoulos, 2005; Hald and Lotharius, 2005; Tabner et al., 2001; Sun et al., 2008). It is known that chronic alcohol abuse not only causes the symptoms of dementia, such as memory loss, difficulty performing routine tasks and impaired judgment, but there is also a marked inability to learn new information or to develop new skills (Harman and Maxwell,

*Corresponding author. E-mail: zwjuan1965@yahoo.com.cn.

1995). Previous researches have demonstrated that ethanol can participate in free radical reaction to form ethoxyl radical (Oldfield et al., 1991). Subsequent studies further demonstrated that ethanol could induce cell death through oxidative mechanism (Sun et al., 1997). Recent studies support the hypothesis that chronic alcohol intake can cause oxidative stress and induce neurotoxicity due to its participation in free radical reaction (Loeber et al., 2009; Moselhy et al., 2001). Indeed, the increase in oxidative and nitrosative stress associated with the concomitant decline in cognitive deficit and motor performance through aging reveals a definite link between aging and neurodegenerative processes. A series of cell signaling pathway, IP3R1, IP3-kinase, and COX-2 take part in ethanol-induced oxidative stress (Simonyi et al., 1996) and ethanol-related neuro-degeneration (Simonyi et al., 2002). Notch signaling affects most aspects of development, and the determination of neural stem cell fate. The prospect that Notch is the substrate of γ-secretase/ presenilin and plays a role in learning and memory

Li et al.

implicates a potential link between Notch signaling and the pathogenesis of Alzheimer’s disease. Notch is expressed in the adult brain, particularly high levels in the hippocampus, where it is involved in regulation of learning and memory (Berezovska et al., 1998; Costa et al., 2003; Wang Yet al., 2004). In post-mitotic neurons, Notch proteins interact with PSs and with APP (Berezovska et al., 1998; Ray et al., 1999; Roncarati et al., 2002), which have roles in the memory deficits associated with Alzheimer’s disease. In some cases, mutations in the genes encoding the APP and PS1 and PS2 are responsible for early-onset Alzheimer’s disease (Saura et al., 2004; Donoviel et al., 1999; Costa et al., 2003). The importance of the Notch pathway in neuronal dysfunction was demonstrated by Notch mutant mice. Long-term spatial memory deficits were observed in Notch mutant mice that had normal acquisition and shortterm spatial memory (Li et al., 1997). A chronic decrease in Notch signaling can result in specific learning and memory deficits, which suggests that Notch-dependent transcription is critical for spatial learning. Mutations of molecules related to the Notch pathway have been implicated in several syndromes. Alagille syndrome, which is associated with mental retardation, is caused by mutations in the Notch ligand Jagged 1 (Harris and Filley, 2001). Indeed, previous researches have indicated that Notch-1 pathway and its downstream targets are involved in regulating learning and memory function. However, little is known about whether Notch-1 pathway modulates the ethanol-induced neuronal cells apoptosis. In our present study, we used neuronal-like PC12 cells as cell model, to study the molecular mechanism of ethanol-induced PC12 cell apoptosis. Our results indicate that Notch-1 activity is involved in PC12 cell apoptosis. This will therefore help in understanding the mechanism of ND and hopefully lead to a cure for Alzheimer’s disease. MATERIALS AND METHODS Cell culture and reagents PC12 cells were grown at 37°C in a humidified CO2 (5%) incubator with completed RPMI-1640 medium (Gibco, USA) supplemented with 12% (v/v) fresh fetal bovine serum (Hyclone laboratory), 100 units/ml penicillin, and 100 µg/ml streptomycin, (Life Technologies, Inc.). Cells were passaged and cultured for 24 h followed by treatment with different concentrations of ethanol (0, 100, 200 and 300 mM) for an indicated time. All reagents were obtained from Sigma Corporation, unless otherwise indicated. Antibodies to Notch-1 intercellular domain, caspase-3, caspase-8, caspase-9 and β-actin, were obtained from Santa Cruz Biotechnology.

Notch-1 ICD constructs and transfection assay Notch-1 ICD constructs was designed based on human sequence and generated by polymerase chain reaction (PCR)-based methods with the Notch1-Flag-Myc expression vector as template. The

7981

transient transfection was performed following manufacturer’s instructions of Lipofectamine 2000 (Invitrogen, USA). Briefly, PC12 cells were seeded in 24-well plate with the concentration of 2×105cells/ml and cultured overnight (to about 95% confluence). For each well, transient transfection PC12 cells expression Notch-1 Intercellular domain were generated by transfection with 2 µg plasmids and 4 µL Lipofectamine 2000. After transfection for 24 h, the cells were treated with the same procedure described above.

MTT assay PC12 cells were seeded at a density of 1×104 cells/ml in 96-well culture plates, and 24 h later, they were treated with the indicated concentrations of ethanol for 12, 24, 36 and 48 h. Control wells consisted of cells incubated with medium only. After treatment, cells were incubated with 20 μL 5 mg/ml 3-[4,5-dimethylthiazol-2-yl]-2,5diphenyltetrazolium bromide (MTT; Sigma, St Louis, MO, USA). After 4 h at 37°C, the supernatant was removed, and 150 μL dimethyl sulfoxide (DMSO) was added. When the blue crystal was dissolved, the optical density (OD) was detected at a 570 nm wavelength using a 96-well multiscanner autoreader (Bio-Rad, USA).

Hoechst 33258 / PI staining PC12 cells were seeded at a density of 1×104 cells/ml on the cover glass slides of a 35-mm chamber. After being treated with ethanol for 24 h, the cells were washed with cold phosphate buffered saline (PBS) two times and incubated with 5 μg/ml Hoechst 33258 and 1 μg/ml propidium iodide (PI; Sigma, St Louis, MO, USA) for 10 min at 37°C in the dark. The cells were then washed and fixed with 4% paraformaldehyde in PBS for 5 min at 4°C. Nuclear morphology was then examined under a fluorescent microscope (BX51, Olympus, Japan). γ-Secretase activity assay The γ-secretase activity kit (R&D Systems, USA) was used to measure the γ-secretase activity, following the manufacturer’s instructions. PC12 cells were treated with different concentrations of ethanol for 24 h. Cells were then washed twice with ice-cold PBS, harvested in the cell extraction buffer, and incubated on ice for 30 min. Whole cell lysates were centrifuged at 16000 × g for 10 min and supernatants were collected. The protein concentration was determined with bicinchoninic acid (BCA) protein assay (Pierce, USA) in each sample. Total protein (50 µg) was incubated with the γ-secretase fluorescent substrate for 2 h at 37°C and fluorescence intensity was measured at 355 / 460 nm.

Western blotting Cells were lysed by incubating in RIPA lysis buffer [50 mmol/L Tris (pH 7.5), 100 mmol/L NaCl, 1 mmol/L ethylenediaminetetraacetic acid (EDTA), 0.5% NP40, 0.5% Triton X-100, 2.5 mmol/L sodium orthovanadate, 10 μL/ml protease inhibitor cocktail, 1 mmol/L phenylmethylsulfonyl fluoride] for 20 min at 4°C. Protein concentrations were determined with the Bio-Rad assay system (Bio-Rad, Hercules, CA). Total proteins were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels (6% for Notch-1; 10% for caspase-3, caspase-8, caspase-9 and β-actin) and transferred onto immobilon-P transfer membranes (Millipore Corp.). The membranes were blocked for 1 h with 5% non-fat milk or bovine serum albumin (BSA) in PBS with 0.1% Tween-20. Blots were incubated with primary antibodies specific for

7982

Afr. J. Biotechnol.

Figure 1. Effects of ethanol on the viability of PC12 growth. PC12 cells were grown in a complete culture medium containing 12% bovine serum. After cell passage in 96-well plate for 24 h, all the cells were treated with different doses of ethanol for different times. As indicated, cell viability was detected by MTT assay. Data represent means ± SD of the three independent experiments.

the interesting proteins overnight at 4°C, followed by secondary antibodies for 1 h each at room temperature. Immuno-reactive bands were visualized using enhanced chemiluminescence (Pierce). The membranes were then incubated with stripping buffer (1 mM glycine, 1% SDS) for 30 min at 37°C, re-blocked, and reprobed with β-actin as a loading control.

Morphological change of PC12 cells upon ethanol treatment

Data are shown as Mean ± S.E. ANOVA was used to analyze the multi-factors comparison, followed by Dunnett’s test. For single comparison, the significance between control and treatment groups was determined by t-test. A value of P< 0.05 was considered as statistically significant.

Multi-factors are involved in cell viability, such as cell cytotoxicity, necrosis or apoptosis. To explore the exact disaster of PC12 upon ethanol treatment, Hoechst 33258 and PI double staining assay was used for detecting the change in nucleus morphology. PC12 cells induced to death by ethanol treatment exhibited cell shrinkage, classical chromatin condensation and membrane blebbing, a morphological marker of cell apoptosis (Figure 2). This indicates that apoptosis was induced upon PC12 treatment with ethanol.

RESULTS

Effect of ethanol on the activity of Notch-1 pathway

Effect of ethanol-induced PC12 cell apoptosis

To explore the molecular mechanism of ethanol induced pc12 apoptosis, the activity of γ-secretase was detected by enzymatic assay. As was expected, the activity of γsecretase decreased due to ethanol treatment of PC12 cells (Figure 3). We also detected the expression of Notch-1 intercellular domain (NICD) and found that the level of NICD decreased also in accordance with γ-

Statistical analysis

After PC12 cells were treated with different concentrations for 0, 12, 24, 36 and 48 h, the viability of PC12 cells were detected by MTT assay. PC12 cells viability decreased significantly upon 100, 200 and 300 mM ethanol treatment for 24, 36 and 48 h (Figure 1).

Li et al.

7983

Figure 2. Morphological changes of PC12 cells upon ethanol treatment. PC12 cells were plated on coverslips for 24 h, followed by treatment with ethanol at 0 mM (A), 100 mM (B) and 300 mM (C) for 24 h. All the cells were stained with nucleus strainer Hoechst 33258 and PI for 15 min at room temperature, then fired with 4% paraformaldehyde for 5 min. Nuclear morphology was then examined under a fluorescent microscope. Representative images were shown from three independent experiments. The cells with nuclear condencent or with nuclear fragmentation were selected as apoptosis cells. For the statistical analysis of apoptosis rate shown as (D), data is the mean from nine random visual fields (n = 9; Mean ÂąSD). *P<0.05 vs. A; **P <0.05 vs. A.

secretase activity. Effect of Notch-1 activity on the regulation of PC12 apoptosis induced by ethanol To further explore whether the activity of Notch-1 is involved in PC12 apoptosis, PC12 cells were overexpressed on NICD, followed by the detection of cell apoptosis. The results (Figure 4) show that cell apoptosis-related protein caspase-3, caspase-8 and caspase-9 increased upon ethanol treated. However, the effects reduced in NICD overexpressed cells. The results suggest that Notch-1 play a role in inversion of PC 12 cell apoptosis induced by ethanol. DISCUSSION Aging is a multi-factorial, complex process. Understanding the pathophysiological of aging and neuro-

degenerative diseases provides insightful knowledge for future treatment. In the present study, neuronal-like PC12 cell was used for exploring the mechanism of neurodegenerative disease. We first detected the PC12 cell viability with MTT assay. We found that PC12 cells viability decreased significantly upon ethanol treatment in concentration and time dependent manners. To explore the factors that caused decrease in PC12 cell viability, we first detected the type of cell death. Morphological change of PC12 cells were detected with nucleus staining. Hoechst 33258/PI staining assay showed that PC12 cells exhibited blebbing, chromatin condensation and nuclear shrinkage, which are features of apoptosis. These results indicate that apoptosis occurred when PC 12 cells were treated with ethanol. Apoptosis occurs in the developing brain to allow the removal of improperly wired neurons and it participates in the proper organization of the neuronal network. Apoptosis also occurs and may actually play an active role in the development of neurodegenerative diseases such as Alzheimer or Parkinson diseases (Dickson, 2004;

7984

Afr. J. Biotechnol.

Figure 3. Effect of ethanol on the activity of Notch-1 signaling pathway. PC12 cells were treated as previously mentioned, and all the cells were collected and lysed in RIPA buffer. Equal quantity of cell protein was incubated with γ–secretase and the activity of γ–secretase was measured according to the manufacturer’s instructions (A), n = 3. Data are represented as mean SD; *P< 0.05 vs. control; **p <0.01 vs. control. The expression of Notch-1 was detected by Western blot (B). For loading control, the membranes were stripped and re-probed with anti-β actin (1: 5000).

Figure 4. Effects of Notch-1 on the regulation of PC12 cell apoptosis. PC12 cells were transfected with NCID constructs and vector control followed by treatments with 200 mM ethanol incubation for 24 h. Total lysates were prepared and immunoblotted for caspase-3, caspase-8, caspase-9 and Notch-1 as described earlier. Loading control is indicated as β- actin blotting.

Yuan and Yankner, 2000), but the exact molecular mechanism of neurons apoptosis is still unknown. To find the participator molecule in ethanol inducing PC12 apoptosis, we first detected the activity of Notch-1 pathway. Notch proteins have long been known to influence cell fate in the developing nervous system with expression occurring primarily during embryogenesis and development. Notch is also expressed in the adult brain, in regions with high synaptic plasticity, particularly thehippocampus. Notch 1 is increased in AD, and the Notch receptor depends on γ-secretase for its functional proteolysis. So, we first detected the activity of γsecretase upon PC12 treated with ethanol. When PC12 cells were treated with low concentration of ethanol for 12 h, the activity of γ-secretase decreased evidently, and at the same time, the protein level of Notch-1 also decreased. The results therefore indicate that Notch-1 signaling pathway was down-regulated by ethanol. To verify whether the Notch-1 pathway is involved in ethanol-induced PC12 apoptosis, we overexpressed the constitutively active form of Notch-1 intercellular domain (NICD), followed with PC12 apoptosis detection. As was expected, NICD overexpression decreased the expression of caspase-3, caspase-8 and caspase-9, which function as cell apoptosis executioner. This indicates that Notch-1 activation rescued the effect of ethanol on the induced-PC12 apoptosis, thus indicating that Notch-1 is involved in ethanol-related neurodegeneration. Notch is a critical component of evolutionarily conserved signaling and is important for cell fate specification and differentiation in various systems. Notch pathway may

Li et al.

also function in neurogenesis (Hitoshi et al., 2002; Poirazi and Mel, 2001), as well as long-term memory and cognitive function (Shors et al., 2001; Costa et al., 2003). Analysis of Notch function will help to clarify how pathological events are regulated by cellular response in ethanol related neurodegenerative disease. Previous research has demonstrated that a chronic decrease in Notch signaling can result in specific learning and memory defection (Li et al., 1997). This study shows that ethanol incubation decreased the activity of γ-secretase and the expression of Notch-1. This indicates that Notch1 may be critical in neuronal apoptosis and neurodegeneration of chronic alcoholic dementia. ACKNOWLEDGEMENTS This work was supported by a grant (2010B310002) from Province Natural Science Foundation of Henan and grants from Basic Research program of Henan University (07YBZR013, 07YBZR028) and Research Office program of Henan province (102300410096). REFERENCES Berezovska O, Xia MQ, Hyman BT (1998). Notch is expressed in adult brain is coexpressed with presenilin-1, and is altered in Alzheimer disease, J. Neuropathol. Exp. Neurol. 57: 738-745. Calabrese V, Giuffrida Stella AM, Butterfield DA, Scapagnini G (2004). Redox regulation in neurodegeneration and longevity: role of the heme oxygenase and HSP70 systems in brain stress tolerance. Antioxid Redox. Signal, 6: 895-913. Calabrese V, Scapagnini G, Colombrita C, Ravagna A, Pennisi G, Giuffrida Stella AM, Galli F, Butterfield DA (2003). Redox regulation of heat shock protein expression in aging and neurodegenerative disorders associated with oxidative stress: a nutritional approach. Amino Acids, 25: 437-444. Costa RM, Honjo T, Silva AJ (2003). Learning and memory deficits in Notch mutant mice, Curr. Biol. 13: 1348-1354. Dickson DW (2004). Apoptotic mechanisms in Alzheimer neurofibrillary degeneration: cause or effect? J. Clin. Invest. 114: 23-27. Donoviel DB, Hadjantonakis AK, Ikeda M, Zheng H, Hyslop PS, Bernstein A (1999). Mice lacking both presenilin genes exhibit early embryonic patterning defects, Genes Dev. 13: 2801-2810. Hald A, Lotharius J (2005). Oxidative stress and inflammation in Parkinson’s disease: is there a causal link? Exp. Neurol. 193: 279290. Harman AW, Maxwell MJ (1995). An evaluation of the role of calcium in cell injury. Annu. Rev. Pharmacol. Toxicol. 35: 129-144. Harris JG, Filley CM (2001). CADASIL: neuropsychological findings in three generations of an affected family, J. Int. Neuropsychol. Soc. 7: 768-774. Hitoshi S, Alexson T, Tropepe V, Donoviel D, Elia AJ, Nye JS, Conlon RA, van der Kooy D (2002). Notch pathway molecules are essential for the maintenance, but not the generation of mammalian neural stem cells, Genes Dev. 16: 846-858. Li L, Krantz ID, Deng Y, Genin A, Banta AB, Collins CC, Qi M, Trask BJ, Kuo WL, Cochran J, Spinner NB (1997). Alagille syndrome is caused by mutations in human Jagged 1, which encodes a ligand for Notch1, Nat. Genet. 16: 2443-2451.

7985

Loeber S, Duka T, Welzel H, Nakovics H, Heinz A, Flor H, Mann K (2009). Impairment of cognitive abilities and decision making after chronic use of alcohol: the impact of multiple detoxifications. Alcohol. Alcohol. 44: 372-381. Moselhy HF, Georgiou G, Kahn A (2001). Frontal lobe changes in alcoholism: a review of the literature. Alcohol Alcohol. 36: 357-368. Oldfield FF, Cowan DL, Sun AY (1991). The involvement ofethanolin the free radical reaction of 6-hydroxydopamine. Neurochem. Res.16:8387. Poirazi P, Mel BW (2001). Impact of active dendrites and structural plasticity on the memory capacity of neural tissue, Neuron. 29: 779796. Przedborski S, Ischiropoulos H (2005). Reactive oxygen and nitrogen species: weapons of neuronal destruction in models of Parkinson’s disease. Antioxid Redox. Signal, 7: 685-693. Ray WJ, Yao M, Nowotny P, Mumm J, Zhang W, Wu JY, Kopan R, Goate AM (1999). Evidence for a physical interaction between presenilin and Notch, Proc. Natl. Acad. Sci. 96: 3263-3268. Roncarati R, Sestan N, Scheinfeld MH, Berechid BE, Lopez PA, Meucci, McGlade JC (2002), The gamma-secretase-generated intracellular domain of beta-amyloid precursor protein binds Numb and inhibits Notch signaling, Proc. Natl. Acad. Sci. 99: 7102-7107. Saura CA, Choi SY, Beglopoulos V, Malkani S, Zhang D, Rao BS, Chattarji S, Kandel RJ, Duff K, Kirkwood A, Shen J (2004). Loss of presenilin function causes impairments of memory and synaptic plasticity followed by age-dependent neurodegeneration, Neuron. 42: 23-36. Shors TJ, Miesegaes G, Beylin A, Zhao M, Rydel T, Gould E (2001). Neurogenesis in the adult is involved in the formation of trace memories, Nature, 410: 372-376. Simonyi A, Woods D, Sun AY, Sun GY (2002). Grape polyphenols inhibit chronic ethanol-induced COX-2 mRNA expression in rat brain. Alcohol. Clin. Exp. Res. 26: 352-357. Simonyi A, Zhang JP, Sun AY, Sun GY (1996). Chronicethanolon mRNA levels of IP3R1, IP3 3-kinase and mGluR1 in mouse Purkinje neurons. NeuroReport, 7: 2115-2118. Sun AY, Chen YM, James-Kracke M, Wixom P, Cheng Y (1997). Ethanol-induced cell death by lipid peroxidation in PC12 cells. Neurochem. Res. 22: 1187-1192. Sun AY, Wang Q, Simonyi A, Sun GY(2008). Botanical phenolics and brain health. Neuromol. Med. 10(4): 259-274. Tabner BJ, Turnbull S, El-Agnaf O, Allsop D (2001). Production of reactive oxygen species from aggregating proteins implicated in Alzheimer’s disease, Parkinson’s disease and other neurodegenerative diseases. Curr. Top Med. Chem. 1: 507-551. Wang Y, Chan SL, Miele L, Yao PJ, Mackes K, Ingram PJ, Mattson MP (2004). Involvement of Notch signaling in hippocampal synaptic plasticity, Proc. Natl. Acad. Sci. 10: 19458-9462. Yuan J, Yankner BA (2000). Apoptosis in the nervous system, Nature, 407: 802-809.

Full Length Research Paper

Study of anti-inflammatory, anti-diabetic, and analgesic activity of Oscillatoria annae extract in rats and mice Perumal Varalakshmi1,* Rajendran Arunkumar2, Loganathan Chanthramohan2, Murugan Nagarajan2, Thangavelu Vinoth Babu2 and Nagarajan Pratheeba2 1

Department of Molecular Microbiology, School of Biotechnology, Madurai Kamaraj University, Madurai – 625021, Tamil Nadu, India. 2 Department of Biotechnology, Kalasalingam University, Krishnan Koil-626 190, Tamil Nadu, India. Accepted 12 March, 2012

The aqueous extract of the cyanobacterium Oscillatoria annae was investigated for its antiinflammatory, anti-diabetic,analgesic and cholesterol regulating properties in different experimental standard animal models. The non-steroidal anti-inflammatory drug, indomethacin (10 mg/kg/body weight) was used as standard in the anti-inflammatory, and analgesic studies, while glibenclamide (600 µg/kg/b.wt.) was used as standard drug in the anti-diabetic study. The results reveal that O. annae possesses significant ameliorating effects in the studied animal models, including rats and mice. These effects were comparable to those obtained after treatment with the standard drugs used in this study. The results indicate that the cyanobacterial extract can act as natural remedy and also open a new avenue to identify the active ingredients behind these effects. Key words: Oscillatoria annae, anti-inflammatory, anti-diabetic, analgesic, cholesterol.

INTRODUCTION Natural products have been isolated from wide variety of taxa and tested for various biological activities. These active principles from plant origin have provided numerous crucial molecules in the search of new drug. The search of natural products has revolutionized the drug discovery programs. Many plant-derived molecules have shown a promising effect in therapeutics. Among these taxa, cyanobacteria are considered as good candidates for applications in agriculture, food industry and in pharmaceuticals. Although, cyanobacteria are still primarily viewed as an environmental nuisance or a source of toxins hazardous to man and aquatic livestock, there are many potential benefits to research on chemicals produced by these organisms. Antibacterial, antiviral, antifungal, algaecides and cytotoxic activities

*Corresponding author. E-mail: vara5277@gmail.com. Tel: 0452-2458208. Fax: 0452-2459105.

have been reported (Senthilkumar and John, 2008). Research on biological active compounds produced by cyanobacteria has been focused on freshwater species such as Microcystis, Anabaena, Aphanizomenon and Spirulina lonar. Studies on marine cyanobacterial species are related to filamentous forms in tropical regions. Oscillatoria is a genus of filamentous cyanobacteria which is named for the oscillation in its movement. Filaments in the colonies can slide back and forth against each other until the whole mass is reoriented to its light source. It is commonly found in watering-troughs and is mainly blue-green or brown-green. Oscillatoria reproduces by fragmentation, forming long cells which can break into fragments called hormogonia. Thehormogonia can grow into a new, longer filament. Oscillatoria uses photosynthesis to survive and reproduce. The use of plant medicines in the treatment of various ailments, including central nervous system disorders is an age long practice. It is important to note that plant medicines are also gaining popularity in developed

Varalakshmi et al.

countries. Herbal medicine is currently enjoying a revival in popularity in the west and in fact it is the primary form of medicine in many parts of the world (Williamson et al., 1996). With the great reliance on this type of medicine, it becomes pertinent to search for potent, effective and relatively safe plant medicines, as well as scientific validation of the success claims about plants already in use by traditional medicine practitioners in order to enhance their safety and efficacy. These are some of the problems making this alternative healthcare system less acceptable, especially by orthodox medicine practitioners. For instance, inflammation is a coordinated response that protects and heals the host after infection or tissue damage and it involves several molecular cues generated from either host or disease agent (Nathan, 2002). The modern drugs, including both steroidal and non-steroidal anti-inflammatory drugs (NSAIDs), are available for the treatment of various inflammatory disorders. These drugs however, offer only temporary relief and often elicit undesirable side effects. Hence, the investigations of the efficacy of plant-based drugs used in the traditional medicine have been paid great attention because they are cheap and have little side effects. Currently, for the first time we have reported hematological alterations and tissue defense activities of Oscillatoria annae on induced rats. Since analgesic and antipyretic properties associated with gastric damage are the most important features of anti-inflammatory drugs, the present study was undertaken to identify the analgesic and anti-inflammatory properties of O. annae extract. Cardiovascular diseases and diabetes are major health issues in India; the percentage of deaths is approximately 52% in South East Asia Region (Shah and Mathur, 2010). Diabetes mellitus is a complex endocrine disorder characterized by hyperglycemia and predisposes to affecting the eyes, blood vessels, nerves and kidneys. Several drugs such as biguanides and sulfonylureas are currently existing medicine to reduce hyperglycemia in diabetes mellitus. These drugs, however, have side effects and searching for a novel class of compounds is essential to conquer these problems. Moreover, some cyanobacterial strains have been well characterized with some anti-inflammatory and anti oxidant properties (Nagasathya and Thajuddin, 2003; Rajavel et al., 2009). Hence, this present study aimed to analyze the various pharmacological properties of O. annae in rats and mice. Further studies are needed to identify and purify the compound present in the extract of O. annae. MATERIALS AND METHODS Algae and culture conditions O. annae culture was collected from the National Facility for Marine Cyanobacteria, Bharathidasan University, Tiruchirappalli, India. The

7987

culture was transferred to 500 ml conical flasks containing 300 ml of NPK medium for the production of mass culture. The culture was grown under ambient temperature at pH 7.1 Âą 0.2. The culture media (Nitrogen - Phosphorus Potassium (NPK)) contains NaNO3 (1.54 g/L) and K2HPO4.3H2 O (0.04 g/L).

Preparation of ethanolic (80%) extract from cyanobacteria The cyanobacterium O. annae was harvested after 15 days using clean nylon cloth filter and washed thoroughly with tap water quickly to remove salts and other adhering substances, followed by washing with distilled water. The biomass was placed in a filter paper to remove excess moisture and weighed. The wet biomass was ground with 80% ethanol and the slurry was kept at 4Â°C for 12 h. Next, the supernatant was collected after centrifugation at 10000 rpm for 10 min. The process was repeated till the biomass become grey in color. The pooled supernatant was dried. The dried extract of exactly 200 mg was re-suspended with 0.2 ml of Tween 80 (1%) and then ground well with 5 ml distilled water. This extract was used for the animal studies.

Experimental animals Experimental animals included healthy female Swiss albino mice having weight around 20 to 40 g and healthy female rats of Wistar strain with weight around 100 to 200 g. They were maintained under appropriate laboratory conditions. The animals were maintained on a standard feed and water ad libitum throughout the experiment. The experiments were carried out between 08:00 and 16:00 h in a quiet laboratory with an ambient temperature. This study was conducted at the Department of Biotechnology and Arulmigu Kalasalingam College of Pharmacy, Kalasalingam University, Tamil Nadu, India during January to April 2009.

Drugs and chemicals Indomethacin was used in the analgesic and anti-inflammatory studies. Carrageenan was used in the anti-inflammatory study which is the standard anti-inflammatory drug. Diazepam was used for the study of muscle relaxation property and central nervous system (CNS) depressant/stimulant activity study. Simvastatin was used as the cholesterol-regulating drug, while alloxan monohydrate, glibenclamide were used for the anti-diabetic study. The chemicals used are Tween 80 (1%), ethanol, ether, chloroform, acetic anhydride, sodium bisulphate and concentrated sulfuric acid (H2SO4).

Assessment of analgesic activity by hot-plate test In this method, heat was used as a source to induce the pain. Animals were individually placed on a hot plate maintained at a constant temperature of 55Â°C. The reaction of animals to the heat such as paw licking or the jump response is taken as the end point as described previously (Eddy and Leimback, 1953; Williamson et al., 1996). Analgesic was used to increase the reaction time. To study the effect of the extracts, animals were tested before the administration of the control and conventional drugs. Then they were tested again after 15, 30, 45, 60 and 90 min of the intraperitoneal administration of saline (as negative control), conventional drug (as positive control) and the tested extract. Animals were placed individually in 21 glass beakers placed on a

7988

Afr. J. Biotechnol.

Figure 1. Carrageenan-induced paw edema.

thermostatically controlled hot plate, model HC 500 (Bibby Sterlin Ltd, England), maintained at 50 to 55째C. The pain threshold is considered to be reached when the animals lift and lick their paws or attempt to jump out of the beaker. The time taken for the mice to exhibit these characteristics (time reaction) was noted by means of a stopwatch. The animals were first tested for the paw-licking or jump response and only those that reacted after 4 s were used for the experiment. The ability of the plant extract to delay the reaction time was taken as the analgesic response. Assessment of anti-inflammatory activity by carrageenan induced paw edema Anti-inflammatory activity of O. annae on carrageenan-induced paw edema (Figure 1) was evaluated as previously described by Winter et al. (1962). The rats were divided into three groups, each group consisting of three animals as follows: Group 1: rats (treated with saline); Group 2: rats treated with O. annae extract (200 mg/kg) as a single dose intraperitoneally; Group 3: rats treated with the standard drug indomethacin (10 mg/kg). Carrageenan (0.1 ml of a 1% solution in saline) was injected into the left rear plantar region of the left hind paw of the experimental rats using a glass syringe (2 ml). The measurement of foot volume was carried out initially, that is before carrageenan injection, and then again the foot volume was measured at 30, 60, 90, 120 and 180 min after carrageenan injection by using the screw gauge.

Assessment of CNS depressant activity by spontaneous locomotor activity The photocell activity cage was utilized to determine the degree of

depression. The actions of cyanobacterial extract on spontaneous locomotor activity were measured automatically by using Actophotometer (Medicraft Actophotometer, Mode No. 600-40, India). The units of the activity counts were arbitrary and based on the beam breaks by movement of the mice. Selected animals were divided into three groups: the first group was with saline as control; the second group was injected with the standard drug diazepam (5 mg/kg), and the third group was treated with the extract from O. annae (200 mg/kg) as single dose intraperitoneally. The spontaneous locomotor activity was measured at 0 and 30 min interval by placing animals in a novel cage. The treatments were randomized throughout the day, between 09:00 and 17:00 h,to control for diurnal variations in activity.

Assessment of muscle relaxation activity by rota rod test This test is useful for analyzing the muscle relaxation activity by measuring the loss of muscle grip as indication to the muscle relaxation. This effect can thus be easily studied in animals using inclined plane or rotating rods. The difference in the fall-off time from the rotating rods between the control and diazepam treated animal is taken as an index of muscle relaxation. Fresh mice were placed on a horizontal rod of 32 mm diameter, rotating at a speed of 20 rpm. The mice capable of remaining on the top for 3 to 5 min in three successive trials were selected for the study. The selected animals were divided into three groups: the first group was with saline as the control; the second group was injected with the standard drug diazepam (5 mg/kg), and the third group was treated with the extract from O. annae (200 mg/kg) as single dose intraperitoneally. Then the capability of the animals to remain on top of the rod without falling (falling time) was recorded as previously described (Dunham and Miya, 1957).

Varalakshmi et al.

7989

Table 1. Analgesic activity of Oscillatoria annae on mice.

Treatment Control (Untreated)

Before drug administration 6±0.58

15 min 6.34 ± 0.33

Basal reaction time (s) After drug administration 30 min 45 min 60 min 5.34 ± 0.33 6.34 ± 0.33 6.34 ± 0.66

90 min 5.67 ± 0.66

Standard (Indomethacin)

7.67 ± 0.33

11.67 ± 0.88** (52.6%)

10.34 ± 0.88** (35.08%)

9.67 ± 0.33** (26.07%)

9.67 ± 0.33* (26.07%)

9.34 ± 0.33** (21.77%)

Test (Oscillatoria annae)

7 ± 0.58

11 ± 0.99* (57.14%)

11.67 ± 0.33*** (66.71%)

11 ± 0.58** (57.14%)

9.67 ± 1.20 (38.14%)

9.34 ± 0.33** (33.42%)

2.4 >0.05

12.5 <0.05

28.28 <0.05

25.75 <0.05

5.23 <0.05

15.66 <0.05

F Probability (P)

N = 3 in each group; df= 2, 6. The values are expressed in terms of Mean ± SEM. Percentage protection by the Oscillatoria annae Extract and reference drug (Indomethacin) are indicated as (%). P value was calculated from the comparison of Control versus Standard and Control versus Test.*P<0.05, **P<0.01, ***P<0.001 compared to control.

Assessment of anti-diabetic activity Diabetes was induced in female albino rats of Wistar strain by treating them with intraperitoneal injection of 150 mg/kg body weight alloxan after fasting for 24 h (Ajabno and Tilmisany, 1988). Blood glucose was assessed in all the animal groups by using a drop of the blood from paw. The blood glucose level was estimated after 1 day and those rats having blood glucose level 240 to 280 mg/100 ml of blood were included in the study. The rats were randomly divided into three groups (n = 3): group 1 was injected with saline as the diabetic control; group 2 was treated daily with oral administration of 5 mg/kg body weight O. annae ethanolic extract orally until the experimental period; group 3 served as a standard group. The blood glucose level was analyzed using glucometer (One touch horizon, Johnson & Johnson, U.S).

Anti-bacterial screening assay Four bacterial cultures were used, including Staphylococcus sp., Proteus sp., Pseudomonas sp., and Bacillus species. These cultures were grown in nutrient broth overnight. This culture was used for well diffusion antibacterial assay. Fresh culture was spread over the surface of Mueller-Hinton (Merck) agar plates. Four sterilized paper disks impregnated with the ethanolic extract of O. annae were placed on the surface of the inoculated medium. Plates were incubated for 24 h at the correspondent appropriate growth temperature. As controls, four sterilized blank paper disks impregnated only with solvent (ethanol) used for extractions were tested for each microorganism. The disks were kept overnight in a laminar flow bench sterilized by ultraviolet (UV) light, to evaporate the solvent. After incubation, each plate was examined and the diameter of the zones with complete inhibition of growth was measured to the nearest millimeter using a ruler and expressed in millimeter (mm). The minimum inhibitory concentration (MIC) values were determined with those bacterial strains that showed significant inhibitory zones. The bacterial strains selected for this study were Staphylococcus sp., Proteus sp., Pseudomonas sp. and Bacillus sp. The concentrations of 5, 10, 15 and 20 mg/L were prepared and the MIC values were determined as the lowest concentration of the constituent that completely inhibited the growth (Lokhande et al.,

2007).

Statistical analysis All the data obtained were analyzed using the “Unpaired student’s ttest”. The analyzed data were expressed as mean (± S.E.M).

RESULTS AND DISCUSSION Analgesic activity of O. annae on mice The treatment of animals with O. annae (200 mg/kg) produced significant (p<0.05 to p<0.001) analgesic effects against thermally induced pain in the plate (Table 1). Experimental evidence obtained in the present study indicates that O. annae extract can significantly induce analgesic effect. The hot plate test has been found to be suitable for evaluation of centrally acting analgesics (Ojewole, 2006). In the hot plate test, O. annae extract showed a significant analgesic action after 15 min of its administration and showed a maximum of 66.71% analgesic activity at 30 min. Similar effects in Spirulina extract with Swiss albino mice was also recorded. Anti-inflammatory activity of O. annae extract on rat Treatment with the O. annae extract induced antiinflammatory effect with the highest effect at 200 mg/kg as compared to the effect of the conventional drug indomethacin. The extract showed maximum inhibition of 28.69% at dose of 200 mg/kg body weight after 180 min of drug treatment in carrageenan induced paw edema as compared to 23.69% inhibition after 180 min of

7990

Afr. J. Biotechnol.

Table 2. Anti-inflammatory activity of Oscillatoria annae extract on rat.

Treatment

Diameter of right paw (mm)

Diameter of left paw (mm) 30 min 60 min 120 min 37 ± 0.578 36.67 ± 0.334 36.33 ± 0.334

Control (Untreated)

25.33 ± 0.877

0 min 39 ± 1

Standard (Indomethacin)

23.67 ± 0.334

37.33 ± 0.663

34.67 ± 0.878 (7.12%)

33.67 ± 1.483 (9.80%)

31.3 ± 1.76* (16.04%)

28.67 ± 1.327* (23.19%)

Test (Oscillatoria annae)

23.67 ± 0.334

38.33 ± 2.725

34.67 ± 3.377 (9.54%)

31.67 ± 3.52 (17.37%)

29.34 ± 2.332* (23.45%)

27.33 ± 1.76* (28.69%)

2.15

0.22

0.43

1.247

4.36

1.838

180 min 35 ± 0.57

The values are expressed in terms of Mean ± SEM. Percentage inhibition of the carrageenan -induced inflammation by the Oscillatoria annae extract and the reference drug used [Indomethacin] are indicated as (%).P value is calculated from the comparison of Control versus S tandard and Control versus Test. *P<0.05 compared to control. N = 3 in each group; df=2, 6.

indomethacin treatment (Table 2). The results indicate also that the ethanolic extract of O. annae had a significant anti-inflammatory effect against carrageenaninduced paw edema. Interestingly, the anti-inflammatory effect of O. annae extract was more potent than those induced by the conventional drug indomethacin. Indomethacin, a non-steroidal anti-inflammatory drug (NSAID) is commonly used for the treatment of inflammation. Indomethacin reduces inflammation and swelling by inhibiting prostaglandin synthesis or production (Ojewole, 2006). The extract caused a marked inhibition (28.69%) at a dose of 200 mg/kg after 180 min of drug treatment in the carrageenan induced paw edema model. The results of the present study suggest that the O. annae used probably produced its anti-inflammatory effect by inhibiting the release, synthesis and/or production of inflammatory mediators, including polypeptide (kinins), prostaglandin and so forth, like indomethacin. CNS depressant activity of O. annae extract on mice The effect of extract on the loco motor activity was measured after 1 h of drug administration. The extract significantly decreased the spontaneous loco motor activity in mice as compared to the effect of the conventional drug diazepam (4 mg/kg) treated rats as shown in the (Table 3). The effect of the ethanolic extract of O. annae on the CNS showed a significant increase in the hypnotic effect induced by the diazepam, indicating its sedative activity. The method employed for this assay is considered as a very sensitive way and denote agent with depressor activity on the CNS. The reduction of awareness and depressant action may be due to the action of the extract on CNS. The reduction in the exploratory behavior in animals treated with ethanol extract of O. annae is similar to those of the action of

other CNS depressant agents. The sedative effect recorded here may be related to an interaction with benzodiazepines and related compounds that bind to receptors in the CNS (Sundaram et al., 2008). Muscle relaxant activity of O. annae extract on mice The results obtained from the rota-rod test showed that treatment with the ethanolic extract of O. annae at 200 mg/kg significantly reduced the motor coordination of the tested animals as compared to the effect of conventional drug diazepam (4 mg/kg) treated rats (Table 4 ). The result obtained from rota-rod test showed that ethanolic extract of O. annae can significantly reduce the motor coordination as indicated by the increase in the number of falls and the decrease in the time on the bar. The rotarod method (Dunham and Miya, 1957) was used to determine the forced coordinated motor ability of the animals. The intensity of reduction in exploratory behaviors in treated animal rats resembled those obtained after treatment with the standard reference drug diazepam. These results indicated that the extract can be used to relax the basal tone of the muscle. Our current data showed that extract is also capable of inhibiting response to a wide range of contractile stimuli, such as neurotransmitters acetyl choline and histamine (Rosa martha et al., 2009). Anti-diabetic activity of O. annae extract The diabetic rats showed a significant increase in the blood glucose level. Oral administration of O. annae extract to diabetic rats at a dose of 5 mg/kg showed a significant decrease in the blood glucose level as compared to treatment with the conventional drug glibenclamide (600 µg/kg) treated diabetic rats (Table 5).

Varalakshmi et al.

7991

Table 3. CNS depressant Activity of Oscillatoria annae extract on mice.

Treatment Control (Untreated) Standard (Diazepam) Test (Oscillatoria annae) Probability (P)

Locomotor activity (scores) in 1 min Before drug administration After drug administration Percentage change in activity (%) 98.67 ± 2.332 98.33 ± 1.449 0.34 94.33 ± 1.853 23.33 ± 0.883* 75.26 101 ± 5.565 25.67 ± 1.2* 74.58 >0.05 <0.05 -

The values are expressed in terms of Mean ± SEM. P value was calculated from the comparison of Control versus Standard and Control versus Test. *P<0.001 compared to control.

Table 4. Muscle relaxant activity of Oscillatoria annae extract on mice.

Treatment Control (Untreated)

Fall off time (s) After drug administration Before drug administration 120 min 240 min 220.33 ± 5.77 211.67 ± 6.11 205.67 ± 7.881

Standard (Diazepam)

Test (Oscillatoria annae) Probability (P)

210.33 ± 10.64

24 ± 1.15* (88.58%)

22.67 ± 0.877* (89.22%)

234 ± 13.45

56.57 ± 2.40* (75.78%)

36.33 ± 1.454* (84.47%)

> 0.05

< 0.05

The values are expressed in terms of Mean ± SEM. P value was calculated from the comparison of Control versus Standard and Control versus Test. *P<0.001 compared to control.

Table 5. Anti-diabetic activity of Oscillatoria annae extract on rat.

Control (Untreated)

88 ± 1.15

Blood glucose level (mg/dl) Diabetes induced rat rd 0 day 3 day 277.33 ± 4.37 304.67 ± 3.17

Standard (Glibenclamide)

90 ± 2.07

278.67 ± 6.87

72 ± 1.73* (74.16%)

69 ± 1.52* (75.23%)

Test (Oscillatoria annae)

88.67 ± 2.33

274.33 ± 7.88

105.33 ± 2.96* (61.60%)

109.67 ± 3.75* (60.02%)

> 0.05

< 0.05

Treatment

Probability (P)

Normal rat

6 day 307.33 ± 2.96

The values are expressed in terms of Mean ± SEM. Percentage inhibition of the blood glucose level for reference drug (glibenclamide) and test (Oscillatoria annae) were indicated as %. P value was calculated from the comparison of Control versus Standard and Control versus Test. *P<0.001 compared to control.

Treatment of diabetic rats with ethanolic extract of O. annae or glibenclamide reduced the blood glucose level significantly as compared to the untreated diabetic rats. The effect of the extract was less significant than that of the standard drug glibenclamide. In the prolonged study (six days), the extract produced a sustained significant

reduction in the blood glucose levels of the diabetic rats, indicating to the long-lasting anti-diabetic effect of the extract. Similar results were reported for the extract derived from Spirullina plantensis (Layam and Reddy, 2006). The possible mechanism by which Oscillatoria extract brought about its antihyperglycemic action may be

7992

Afr. J. Biotechnol.

Table 6. Anti-bacterial activity of Oscillatoria annae extract on some common pathogens.

Absorbance at 600 nm

Bacterial strains Bacillus sp. Proteus sp. Pseudomonas sp. Staphylococcus sp.

Control

5 mg/L

10 mg/L

15 mg/L

20 mg/L

1.152 1.361 0.831 0.675

0.901 1.340 0.825 0.659

0.819 1.348 0.822 0.660

0.673 1.352 0.814 0.668

0.510 1.354 0.811 0.666

Result Table (Uncal-d:\dnps\kalasalingamuniversity-bitech-chanthramohan-oscillatoria) S/N Retention time (min) Area (mV.s) Height (mV) Area (%) Height (%) 1 3.767 197.818 10.080 39.7 41.3 2 4.037 58.913 3.968 11.8 16.3 3 4.743 236.737 9.967 47.5 40.9 4 8.550 5.213 0.385 1.0 1.6 Total 498.681 24.400 100.0 100.1

W05 0.13 0.23 0.30 0.18

Figure 2. HPLC chromatogram of Oscillatoria annae extract.

through potentiating the pancreatic secretion of from islet Î˛-cell or the enhanced transport of glucose to the peripheral tissue, or due to the regulation of NADPH and NADH, a cofactor metabolism (Layam et al., 2006).

insulin blood downin fat

Anti-bacterial activity of O. annae extract on some common pathogens In vitro treatment with the ethanolic extract of O. annae showed significant antibacterial activity against Bacillus sp. (Gram positive), slight activity against Pseudomonas sp. and poor anti-bacterial effect against the other bacterial strains (Table 6). The lack of activity against cyanobacteria is consistent with the fact that most Gram-

negative bacteria such as cyanobacteria are resistant to toxic agents in the environment due to the barrier of lipopolysaccharides of their outer membrane (Priya et al., 2007). Identification of compounds by high performance liquid chromatography (HPLC) High performance liquid chromatography (HPLC), Column: C-18, mobile phase was injected with 0.02 ml of acetonitrile and the ethanolic extract. The O. annae extract showed comparable retention times to the standard drug, indicating to the presence of bioactive compounds that might be responsible for the pharmacological properties of O. annae extract (Figures 2 to 4).

Varalakshmi et al.

Result Table (Uncal-d:\dnps\kalasalingamuniversity-bitech-chanthramohan-oscillatoria) S/N Retention time (min) Area (mV.s) Height (mV) Area (%) Height (%) 1 3.743 588.089 67.333 99.6 99.5 2 5.193 2.658 0.324 0.4 0.5 Total 590.747 67.657 100.0 100.0

W05 0.14 0.14

Figure 3. HPLC chromatogram of the standard drug, indomethacin.

Result Table (Uncal-d:\dnps\kalasalingamuniversity-bitech-chanthramohan-oscillatoria) S/N Retention time (min) Area (mV.s) Height (mV) Area (%) Height (%) 1 3.450 64.341 0.236 57.7 4.0 2 3.823 42.756 5.107 38.4 87.3 3 5.183 4.354 0.508 3.9 8.7 Total 111.451 5.851 100.0 100.0

Figure 4. HPLC chromatogram of the standard drug, glibenclamide.

W05 0.29 0.13 0.14

7993

7994

Afr. J. Biotechnol.

Conclusion Taken together, our results suggest that the crude extract from O. annae has anti-inflammatory, anti-diabetic, antipyretic, and analgesic activities indicating its beneficial pharmacological effects in different diseases settings. Further investigation is underway to determine the exact phytoconstituents that are responsible for the above reported pharmacological effects of the ethanolic extract of O. annae.

REFERENCES Dunham NW, Miya TS (1957). A note on a simple apparatus for detecting neurological deficit in rats & mice, J. Am. Pharmaceut. Assoc 46: 208-209. Gutierrez RMP, Diaz SL, Reyes IC, Gonzalez AMN (2010). Antiglycation effect of spices and chilies uses in traditional Mexican cuisine. J. Natural Prod. 3: 95-102. Layam A, Reddy CLK. (2006). Anti diabetic property of Spirulina, Diabetologia Croatica, 35(2): 29-33. Lokhande PD, Gawai KR, Kodam KM, Kuchekar BS, Chabukswar AR, Jagdale SC. (2007) Antibacterial activity of extracts of Piper longum. J. Pharmacol. Toxicol. 2: 574-579. Nagasathya A, Thajuddin. (2003). Antioxidant property of hypersaline cyanobacteria, Phormidium tnue (KMD 33). Int. J. Pharmacol. pp. 15. Nathan C (2002). Points of control in inflammation. Nature (Lond), 420: 846-852. Ojewole JAO. (2006). Analgesic anti inflammatory and hypo glycaemic effects of Ethanol extracts of Zingiber officinale (Roscoe) Rhizomes (Zingiberaceae) in Mice and Rats, Phytother. Res. 20: 764-772.

Priya K, Ganjewala D. (2007). Anti bacterial activities and phytochemical analysis of different plant part of Nyctanthes arbourtristis (Linn.). Res. J. Phytochem. 1(2): 61-67. Rajavel R, Sivakumar T, Jagadeeswaran M, Malliga P. (2009). Evaluation of analgesic and anti-inflammatory activities of Oscillatoria willei in experimental animal models. J. Medicinal Plants Res. 3: 533537. Senthilkumar R, Ahmed John S (2008). Hypoglycemic activity of marine cyanobacteria in alloxan-induced diabetic rats. Pharmacol. Online, 2: 704-714. Shah B, Mathur P (2010). Surveillance of cardiovascular disease risk factors in India: The need & scope. Indian J. Med. Res. 132: 634-642. Sharma VK, Kumar S, Patel HJ (2010). Hypoglycemic activity of Ficus Glomerata in alloxan induced diabetic rats. Int. J. Pharmaceut. Sci. Rev. Res. 1: 18-22. Sundaram SR, Sampathumar R, Sivakumar P, Nethaji R, Senthil V, Murthy VN, Kanagasabi R. (2008). CNS activity of the methanol extracts of Careya arborea in experimental animal model, J. Bangladesh Pharmacol. Soc. (BDPS), 3: 36-43. Williamson EM, Okpako DT, Evans FJ. (1996). Pharmacological methods in phytotherapy research: selection, preparation and pharmacological evaluation of plant material, Wiley, Chichester, pp. 131-154. Winter CA, Risley EA, Nuss GW (1962). Carrageenan-induced oedema in the hind paw of rat as an assay or anti-inflammatory activity. Proc. Soc. Exp. Biol. Ther. 111: 544-547.

Full Length Research Paper

Phytochemicals, antioxidant and antibacterial properties of a lichen species Cladonia digitata P. Dzomba, E. Togarepi and C. Musekiwa Faculty of Science Education, Chemistry Department; P Bag 1020 Bindura, Zimbabwe. Accepted 22 March, 2012

Antioxidant activity assessment was performed using the free radical scavenging activity of 1,1diphenyl-2-picrylhydrazyl radical (DPPH) and reducing power assay. Phytochemical screening was done using chemical tests. Antibacterial activities of Cladonia digitata were determined by a disk diffusion method at concentrations of 0, 10, 50 and 100% (v/v) against pathogenic bacteria, Eschericia coli, Clostridium perfringens and Staphylococcus aureus. Standard cotrimoxazole (10 µg/ml) was used as a positive control. C. digitata revealed the presence of alkaloids, tannins, saponins, cardiac glycosides, flavonoids, anthraquinones and steroidal terpenes. The results of antioxidant activity indicate a concentration dependent activity. C. digitata extract showed better free radical scavenging activity than ascorbic acid and quercetin. There was no significant difference (T-test, p = 0.05) in the antioxidant activity between the extract and those of ascorbic acid and quercetin as assessed by the reducing power assay. The highest antibacterial activity was 16.1 mm diameter of zone inhibition observed against Clostridium perfringens followed by 15.5 mm against Staphylococcus aureus at the concentration of 100 and 50%, respectively. The results reveal that the tested extract consisted of several bioactive compounds, significant antioxidant and antimicrobial activity. The present results scientifically authenticate the use of C. digitata in folk medicine. Key words: Phytochemicals, antioxidant, antibacterial, Cladonia digitata. INTRODUCTION Lichens are well known symbiotic species consisting of one alga or a cyanobacteria and a fungi partner. The belief is that they consist of medicinal properties against various diseases and are often used in folk medicines (Rankovic et al., 2007). In Zimbabwe, traditional healers use them as alternative medicine for various diseases including treatment of severe burns. Lichens synthesize many useful secondary metabolites which are antiviral, anti-microbacterial, antitumor, anti-allergic and have an inhibitory effect on the growth of plants (Halama and van Haluwin, 2004; Huneck, 1999; Rankovic et al., 2007). This makes them an interesting object of research. Previously a lot of attention has been paid to lichens as a source of natural antioxidants (Behera et al., 2006; Gulcin et al., 2002). This is because the use of synthetic

*Corresponding author. E-mail: pdzomba@gmail.com or pdzomba@buse.ac.zw. Tel: +263773474525. Fax: +263 7536.

antioxidants in food to prevent rancidity and diets to reduce occurrence of diseases due to reactive oxygen and nitrogen species is diminishing rapidly as these are said to be mutagenic and genotoxic (Bergfeld et al., 2005; Maestri et al., 2006). Natural antioxidants consist of antifungal, antibacterial, antiviral, anti-inflammatory and anti allergic properties (François Muanda et al., 2010). They are also believed to lower chances of developing diseases such as cancers, coronary diseases, cerebral malaria and anthritis (Aliyu et al., 2008). Growing resistance of pathogenic micro-organisms on current existing antibiotics is a major public concern and several researches have focused on lichens as a source of antimicrobial therapeutics or lead compounds to synthesis of new drugs (Gulluce et al., 2006; Halama and van Haluwin, 2004; Rankovic et al., 2008). In Zimbabwe, there are no researches focusing on antioxidant activity and antibacterial activity of lichens species despite their wide use in traditional medicine. Therefore, in the present study we investigated phytochemical composition,

7996

Afr. J. Biotechnol.

antioxidant and antibacterial activity of a lichen species growing in the Mavhuradonha range bordering the Zambezi escarpment. MATERIALS AND METHODS Samples of the lichens Cladonia digitata were collected from Mavhuradonha Mountains near St Alberts, Mashonaland central, Zimbabwe in May 2011 and validated by a taxonomist at Harare botanical garden. Voucher specimen (No. 2010/5) was deposited at Bindura university in the chemistry department (natural product section), for reference. Ethanol, 2,2-diphenyl-1-picrylhydrazyl radical (DPPH), quercetin, ascorbic acid, potassium fericyanide, trichloroacetic acid, ferric chloride, sulphuric acid, sodium hydroxide, agar nutrient (Mueller- Hinton - agar), cotrimoxazole, paper discs were obtained from Skylabs South Africa. Bacterial strains used in this research were Escherichia coli, Clostridium perfringens and Staphylococcus aureus. All other chemicals were of analytical grade.

Solvent extraction Dried lichens were ground twice into powder using a wooden mortar and pestle, followed by sieving through a laboratory king test sieve 75 microns. The fine material which passed through the sieve was collected. The remaining residues were then discarded. Ground material, 10 g was extracted with cold ethanol (absolute) on a shaker at room temperature followed by filtration through Whatman no. 1 filter paper. The residues were re-extracted under the same treatment and the filtrates combined. The filtrates were then evaporated in a rotary evaporator at 40°C and stored in a deep freeze in the dark before use.

fericyanide [K3Fe(CN)6] (1%). The mixture was then kept in a 50°C water bath for 20 min. The resulting solution was then cooled rapidly, spiked with 2.5 mL of 10% trichloroacetic acid and centrifuged at 3000 rpm for 10 min. The supernatant (5 mL) was then mixed with 5 mL of distilled water and 1 mL of 0.1% ferric chloride (FeCl3). The absorbance at 700 nm was then detected after reaction for 10 min. The higher the absorbance the stronger the reducing power. The assays were carried out in triplicate.

Antibacterial screening Antibacterial screening is often performed by disc diffusion method (Khan et al., 2007; Wei et al., 2006). Twenty millimeter quantities of nutrient agar (Mueller Hinton Agar) were placed in Petri dishes with 0.1 ml of diluted bacterial culture. Filter paper discs (Whatman) (6 mm in diameter) impregnated with various concentrations of C. digitata extracts were placed on the organism seeded plates. Blank disc impregnated with ethanol was used as negative control and cotrimoxazole (10 µg/ml) was used as a positive control. The activity was determined after 18 h of incubation at 37°C. The diameters of zone of inhibition produced by the extract were then compared with the standard antibiotic cotrimoxazole. Each assay was done in triplicate for the determination of antibacterial activity.

Statistical analysis Statistic analysis to compare antioxidant reducing power of extract and standard antioxidants were determined at the significance level of p = 0.05, student t test.

RESULTS Phytochemical screening

Phytochemical screening Phytochemical screening of the extract was carried out to identify the secondary metabolites, resins, alkaloids (Mayer’s and Draggendorff’s test), tannins (ferric chloride test), saponins (Frothing test), flavonoids (Shinoda test), anthraquinones (Borntrager’s test), cardiac glycosides (Keller-Killiani and Kedde tests), steroids and terpenes(Salkowski test), basing standard methods as reported by Sofowora (1994).

The phytochemicals present in the dried powdered extract of C. digitata include alkaloids, tannins, saponins, cardiac glycosides, flavonoids, anthraquinones and steroidal terpenes (Table 1). Antioxidant activity assay

Antioxidant activity assay

DPPH assay

Determination of DPPH radical scavenging activity

Free radicals are implicated in the pathology of diseases such as coronary heart diseases and cancer. DPPH• is considered to be a model of a stable lipophilic radical. Antioxidants react with DPPH• by either addition of an electron or a hydrogen atom. This reduces the number of DPPH• free radicals. Therefore, the absorption at 517 nm is proportional to the amount of residual DPPH•. It is observed by a discolouration from purple to yellow. The results of the free radical scavenging activity of the 1,1diphenyl-2-picryl-hydrazyl radical (DPPH) assay showed that absorbance decreased with increasing concentration of extract (10 µg/ml to 200 µg/ml) (Figure 1). C. digitata extract proved to be a better free radical scavenger than quercetin and ascorbic acid. C. digitata line is below that of quercetin and ascorbic acid (Figure 1).

Free radical scavenging activity of C. digitata extract was assessed following a slightly modified previous reported procedure using the stable 2,2-diphenyl-1-picrylhydrazyl radical (DPPH●) (Masuda et al., 2007). One milliter (1 ml) of 100 µM DPPH solution in ethanol was mixed with 1 ml of ethanolic extract/ascorbic acid/quercetin. The reaction mixture was incubated in the dark for 30 min and thereafter the absorbance was recorded at 517 nm against the blank. The solutions were prepared daily before measurements.

Reducing power assay The total reducing power of lichen extract was determined according to the method of Oyaizu (1986). One milliter (1 ml) of the ethanolic lichen extract/quercetin/ascorbic acid were mixed with 2.5 mL of phosphate buffer (0.2 M, pH 6.6) and 2.5 mL of potassium

Dzomba et al.

7997

Table 1. Phytochemical screenings of Cladonia digitata extract (chemical tests results).

Phytochemical Resins Alkaloids Tannins Saponins Glycosides Flavonoids Anthraquinones Cardiac glycosides steroidal terpenes

Result ++ + ++ + ++ ++ ++

+, Trace; ++, present in appreciable quantities base on the colour intensity of the chemical test; -, absent.

Figure 1. Free radical scavenging activity of Cladonia digitata.

Reducing power assay In the reducing power assay, presence of antioxidants in the extract reduced iron (III) ferricyanide complex to the ferrous form. The reducing power of compounds can serve as an indicator of potent antioxidant properties (Aliyu et al., 2008) and increasing absorbance usually indicate an increase in reducing power. The reducing power of the extract (0.379 ± 0.018 nm) was comparable to those of standards quercetin and ascorbic acid (0.374 ± 0.012 and 0.372 ± 0.012, respectively) showing that there was no marked difference between antioxidant reducing power of extract and that of standards (Table 2). This suggests that the extract is an electron donor and

could neutralize free radicals (Aliyu et al., 2008). Antibacterial screening assay Antibacterial activities of ethanol extract of C. digitata were determined at the concentrations of 0, 10, 50, and 100% against three pathogenic bacteria. The positive control was cotrimoxazole at a concentration of 10 µg/ml (Table 3). The highest activity was 16.1 mm diameter of zone inhibition observed against Clostridium perfringens followed by 15.5 mm diameter of zone inhibition against Staphylococcus aureus at the concentration of 100 and 50%, respectively. Antibacterial activity was comparable

7998

Afr. J. Biotechnol.

Table 2. Antioxidant reducing power of Cladonia digitata.

Concentration(μg/ml) of extract 10 50 100 200 200(μg/ml) Quercetin 200(μg/ml) Ascorbic acid

Reducing power n = 3 (Abs. 700 nm) 0.188 ± 0.022 0.285 ± 0.028 0.314 ± 0.007 0.379 ± 0.018* 0.374 ± 0.012* 0.372 ± 0.012*

*(P = 0.05) student t test, no significant difference in antioxidant reducing power of extract and that of quercetin and ascorbic acid.

Table 3. Antibacterial activity of Cladonia digitata for extract concentration 0, 10, 50, and 100% (v/v).

Test organism

0% (- control)

Escherichia coli Clostridium perfringens Staphylococcus aureus

0 0 0

Diameter of zone of inhibition (mm) n = 3 cotrimoxazole (10 µg/ml) 10% 50% 100% (+ control) 7.0 ± 0.1 11.1± 0.2 15.0± 0.1 16.2± 0.2 14.3± 0.3 15.0± 0.1 16.1± 0.5 17.2± 0.1 12.1± 0.4 12.5± 0.3 12.7± 0.1 17.9± 0.7

to that of 10 µg/ml cotrimoxazole. DISCUSSION Phytochemicals are specialized plant metabolic compounds that act as antioxidants (Oktay et al., 2003; Wangensteen et al., 2004). They participate in redox systems which allow them to act as electron donors, hydrogen donors and singlet oxygen quenchers (Kahkonen et al., 1999). The DPPH model has been widely used as a quick, reliable and reproducible parameter to search for the in vitro general antioxidant activity of pure compounds as well as plant extracts (Kähkonen et al., 1999; Maestri et al., 2006). The decrease in absorbance in the DPPH assay with increase in concentration of the extract (Figure 1) which was accompanied with a rapid colour change of the purple DPPH, suggest that the ethanol extract of C. digitata has antiradical activity. Antioxidant activity may be due to the presence of terpenes, tannins and flavonoids (El-Massy et al., 2009; Maestri et al., 2006). Base on the present results of phytochemical screening, DPPH antiradical activity, ferric antioxidant reducing ability and antibacterial activity, it is possible to affirm that C. digitata can be used as a source of natural antioxidants and alternative method for treatment of diseases caused by bacteria and prevention of diseases due to free radicals. According to Ebana et al. (1991), alkaloids inhibit pathogenic bacteria, and tannins are important in herbal medicine in treating wounds which includes severe burns and to arrests bleeding (Nguyi, 1988). This confirms the use of C.

digitata for wounds treatment in traditional medicine in Zimbabwe. The reason for different sensitivity of the extracts towards the selected bacteria can be rationalized as due to morphological differences between the organisms, for example differences in the porosity of the cell walls (Rankovic et al., 2008). Conclusion The present study showed that C. digitata consists of appreciable quantities of phytochemicals, significant antioxidant and antibacterial activity thereby supporting its use in traditional medicines by herbalists in Zimbabwe. It can be used as a source of antioxidant to prevent food rancidity and prevention of diseases. It is suggested that future studies should focus on the use of other models of in vitro antioxidant assessment, separation of active components from the extracts, structural elucidation, synthesis and antifungal screening as well as their possible use in the reduction of food rancidity in actual food samples. ACKNOWLEDGEMENTS We thank Mr. Makahamadze and Mr. Mapfaka for excellent technical assistance. REFERENCES Aliyu AB, Musa, AM, Abdullahi MS, Oyewale AO (2008). Phytochemical and antibacterial properties of Ludwigia suffruticosa (Willd.) Oliv. ex.

Dzomba et al.

O. Ktze (Onagraceae). Int. J. Appl. Sci. 2(4): 1-5. (IJPAS Online). Behera BC, Verma N, Sonone A, Makhija U (2006). Determination of Antioxidative Potential of Lichen Usnea ghattensis in vitro. LWT. 39: 80-85. Bergfeld WF, Belsito DV, Marks JGJ, Andersen FA (2005). Safety of ingredients used in cosmetics. J. Am. Acad. Dermatol. 52: 125-132. Ebana RUB, Madunagu BE, Ekpe ED, Otung IN (1991). Microbiological exploitation of cardiac glycosides and alkaloids from Garcinia kola, Borreria ocymoides, Kola nitida and Citrus aurantifoli. J. Appl. Biotechnol. 71: 398 - 401. El-Massy KF, El-Ghorab AH, Shaaban HA, Shibamoto T (2009). Chemical compositions and antioxidant/ antimicrobial activities of various samples prepared from Schinus terebinthifolius cultivated in Egypt. J. Agric. Food Chem. 57: 5265-5270. François Muanda N, Amadou D, Rachid S (2010). Chemical composition and biological activities of Ficus capensis leaves extracts. J. Natural Prod. 3: 147-160. Gulcin I, Oktay M, Kufrevioglu IO, Asian A (2002). Determination of Antioxidant Activity of Lichen Cetraria islandica (L.) Arch. J. Ethnopharmacol. 79(3): 325-329. Gulluce M, Asian A, Sokmen M, Sahin F, Adigu_ zel A, Agar G, Sokmen A (2006). Screening the Antioxidant and Antimicrobial Properties of the Lichens Parmelia saxatilis, Parmelia glauca, Ramalina pollinaria, Ramalina polymorpha and Umbilicaria nylanderina. Phytomedicine, 13(7): 515-521. Halama P, van Haluwin C (2004). Antifungal Activity of Lichen Extracts and Lichenic Acids. BioControl, 49(1): 95-107. Huneck S (1999). The Significance of Lichens and Their Metabolites. Naturwissenschaften. 86: 559-570. Kähkonen MP, Hopia AI, Vuorela HJ, Rauha JP, Pihlaja K, Kujala TS (1999). Antioxidant activity of plant extracts containing phenolic compounds. J. Agric. Food Chem. 47: 3954-3962. Khan A, Rahman M, Islam S (2007). Antibacterial, antifungal and cytotoxic activities of tuberous roots of Amorphophallus campanulatus. Turk. J. Biol. 31: 167-172.

7999

Maestri DM, Nepote V, Lamarque AL, Zygadlo JA (2006). Natural products as antioxidants. Res. Signpost. 1: 105-135. Masuda T, Yonemori S, Oyama Y, Takeda Y, Tanaka T, Andoh T (2007). Evaluation of the antioxidant activity of environmental plants: activity of leaf extracts from seashore plants. J. Agric. Food Chem. 47: 1749 -1754. Nguyi A (1988). Tannins of some Nigerian flora. J. Biotechnol. 6: 221226. Oktay M, Gülçin I, Küfrevioglu OI (2003). Determination of in vitro antioxidant activity of fennel (Foeniculum vulgare) seed extracts. LWT. 36: 263-271. Oyaizu M (1986). Studies on product of browning reaction prepared from glucose amine. Jpn. J. Nutr. 44(3): 307-315. Rankovic B, Mišic M, Sukdolak, S (2008). The Antimicrobial Activity of Substances Derived from the Lichen Physcia aipolia, Umbilicaria polyphylla, Parmelia caperata and Hypogymnia physodes. World J. Microbiol. Biotechnol. 24(7): l239-1242. Rankovic B, Mišic, M, Sukdolak S, (2007). Evaluation of Antimicrobial Activity of the Lichens Lasallia pustulata, Parmelia sulcata, Umbilicaria crustulosa, and Umbilicaria cylindrica. Microbiology, 70(6): 723-727. Sofowora EA (1994). Medical Plant and Traditional Medicine in Africa. University of Ife Press. Nigeria.1: 1-23. Wangensteen H, Samuelsen AB, Malterud KE (2004). Antioxidant activity in extracts from coriander. Food Chem. 88: 293-297. Wei WZ, Xue-Ke W, Nan F, Yu-jie, Yuan gang Z (2006). Antimicrobial activities of essential oil from Artemisiae argyi leaves. J. Forest. Res. 17(4): 332-334.

Full Length Research Paper

Clinical significance of RECK and MMP-9 expression in cutaneous squamous cell carcinoma Qian Wu, Li-jun Hao*, Jian-yu Han and Li-jun Wang. Plastic Surgery Center, the First Affiliated Hospital of Harbin Medical University, Harbin 150001, Heilongjiang Province, People’s Republic of China. Accepted 19 March, 2012

Matrix metalloproteinase 9 (MMP-9) is recognized for its ability to promote tumor invasion and metastasis. However, its role and that of a novel regulator of MMP-9, reversion-inducing-cysteine-rich protein with kazal motifs (RECK), have not been explored in cutaneous squamous cell carcinoma (SCC). We investigated expression of MMP-9 and RECK in SCC to determine the clinical significance of their expression and potential uses for diagnostic, prognostic and therapeutic approaches. Immunohistochemistry was used to analyze expression in 36 SCC and 13 healthy skin samples collected at our hospital. RECK expression was detected in 33.3% of SCC samples, significantly fewer than for control samples (84.6%, P<0.05). In contrast, MMP-9 was expressed in 77.8% of SCC samples, significantly more than in control samples (30.8%, P<0.05). RECK and MMP-9 expression in SCC samples were negatively correlated (r = -0.406, P<0.05). Furthermore, negative RECK and positive MMP9 expression in SCC tissues were correlated with differentiation degree and lymph node metastasis (P<0.05) but not with gender or age. Thus, low/absent expression of RECK and increased expression of MMP-9 correspond to increased disease severity. These proteins may play opposing roles in pathogenesis of SCC and may serve as future diagnostic or prognostic markers. Therefore RECK should be further investigated for therapeutic potential as an MMP-9 inhibitor. Key words: Cutaneous squamous cell carcinoma, RECK, MMP-9, immunohistochemistry, clinicopathological parameter. INTRODUCTION

Skin squamous cell carcinoma (SCC), a malignant tumor derived from keratinocytes in epithelial tissues, accounts for 20% of skin tumors (Bradford, 2009). Invasion and metastasis of SCC result in poor prognosis and even death. For any tumor, invasion and metastasis begin with destruction of the basement membrane and degradation of extracellular matrix (ECM). These actions require (MMP-9) (Ivaska and Heino, 2000; Loukopoulos et al., 2003). MMP-9 and related proteins are required for skin cell proliferation and wound healing (Philips et al., 2011).

*Corresponding author. E-mail: haoljharbin@126.com. Abbreviations: MMP-9, Matrix metalloproteinase 9; SCC, squamous cell carcinoma; RECK, reversion-inducing-cysteinerich protein with kazal motifs.

However, overexpression of MMP-9 has been shown to promote aging and carcinogenesis by destabilizing ECM (Philips et al., 2011). Interestingly, a recently discovered protein, reversioninducing-cysteine-rich protein with kazal motifs (RECK) has been reported to act as a regulator of MMPs and appears to inhibit expression of MMP-9, preventing tumor invasion and metastasis (Namwat et al., 2011; Chang et al., 2008). RECK expression has been detected in skin cells (Zibert et al., 2010). Thus, this protein may possess a therapeutic potential for preventing invasion and metastasis of SCC by inhibiting MMP-9 activity. To determine the roles of both MMP-9 and RECK in SCC, we used immunohistochemistry to detect their expression in 36 SCC tissue samples and 13 normal skin samples. We sought to establish the relationship between RECK and MMP-9 expression as well as the correlation

Wu et al.

8001

Figure 1. Positive expression of RECK and MMP-9 in SCC tissues (×400). MMP-9, Matrix metalloproteinase 9; SCC, squamous cell carcinoma; RECK, reversion-inducing-cysteine-rich protein with kazal motifs.

of their expression with clinicopathological parameters of SCC to provide novel insight into SCC diagnosis, prognosis and treatment. MATERIALS AND METHODS Sample collection Skin specimens were collected from 36 patients who had been pathologically diagnosed with SCC at the First Affiliated Hospital of Harbin Medical University. Each case had detailed clinical data and did not receive preoperative chemotherapy or radiotherapy. Study population included 15 males and 21 females ranging in age from 42 to 71 years (mean age = 58.1±7.6 years). Cases were classified according to World Health Organization (WHO) pathological criteria, as follows: highly differentiated in 15 cases, moderately differentiated in 12 cases, and poorly differentiated in nine cases; and no lymph node metastasis in 22 cases and metastasis in 14 cases. In addition, 13 normal skin samples were obtained from cutting edge during out-patient surgery for controls.

Sections were counterstained with haematoxylin, dehydrated through an ethanol gradient, and sealed with neutral gum. Known positive tissues were used as a positive control, and PBS was used in place of primary antibodies as a negative control. RECK and MMP-9 are visualized as brownish-yellow granules in cytoplasm. To score staining, 10 high-power fields were analyzed per sample and samples were classified by intensity as follows: samples with no visible staining received a 0, pale yellow staining received a 1, yellow staining received a 2, and brownish-yellow received a 3. Additionally, the percentage of positively-staining cells was determined from the total number of tumor cells, and samples were assigned scores as follows: ≤5% of tumor cells positive was assigned a 0, 6 to 25% positive was assigned a 1, 26 to 50% positive was assigned a 2, 51 to 75% was assigned a 3, and ≥76% positive was assigned a 4. Total scores for each case represent the sum of scores from staining intensity and from the percentage of positively-stained cancer cells, with total scores of 0 represented as (-), total scores of one to two represented as (+), total scores of three to five represented as (++), and total scores of six to seven represented as (+++).

Statistical methods Immunohistochemistry Tissues were fixed in neutral formalin, dehydrated and embedded in paraffin by conventional methods. Samples were sectioned (4 μM thickness) and collected on glass slides. Sections were then dewaxed for 5 min with dimethylbenzene, rehydrated through an alcohol gradient, rinsed in distilled water, soaked for 5 min in phosphate buffered saline (PBS) and heated for antigen retrieval. Upon cooling, 3% hydrogen peroxide solution was used to block endogenous peroxidase activity. Slides were sealed with nonspecific serum and then placed in a wet box and incubated for 10 min at room temperature. Primary antibodies against MMP-9 or RECK [mouse anti-human monoclonal (MMP-9) or rabbit antihuman polyclonal (RECK) antibodies, Santa Cruz Biotechnology] were added to the wet box prior to overnight incubation at 4°C. Slides were washed with PBS three times before the addition of biotinylated secondary antibodies and incubated for 30 min at room temperature. Finally, the slides were washed with PBS three times prior to addition of streptococcus avidin-peroxidase (SP kit, Fuzhou Maixim Bio-technology Development Co., Ltd) and incubated at 37°C for 30 min. Diaminobenzidine (DAB; Fuzhou Maixim Biotechnology Development Co., Ltd) was used to develop staining.

SPSS17.0 statistical software was used for statistical analysis. χ2 test was used to compare expression of RECK and MMP-9 among groups and Spearman rank correlation was used to analyze correlation between RECK and MMP-9 expression. Analyses were two-sided, with alpha level of 0.05 and P<0.05 considered statistically significant.

RESULTS RECK and MMP-9 expression in SCC RECK and MMP-9 were both detected in normal and SCC skin samples as brownish-yellow granules in the cytoplasm (Figure 1). RECK protein was detected in 12/36 cases (33.3%; Table 1) of SCC, a significantly lower proportion than for normal skin samples (11/13, 2 84.6%; χ =10.172, P<0.05). In contrast, MMP-9 was expressed in 28/36 cases (77.8%; Table 2) of SCC, compared to just 4/13 (30.8%) normal skin samples. This

8002

Afr. J. Biotechnol.

Table 1. Expression of RECK in SCC and normal skin samples [n (%)].

Skin sample SCC Normal Total

n 36 13 49

24 (66.7) 2 (15.4) 26 (53.1)

+ 3 (8.3) 3 (23.1) 6 (12.2)

++ 5 (13.9) 4 (30.8) 9 (18.4)

+++ 4 (11.1) 4 (30.8) 8 (16.3)

++ 11 (30.6) 0 11 (22.4)

+++ 7 (19.4) 0 7 (14.3)

χ =10.172, p=0.017. SCC, squamous cell carcinoma.

Table 2. Expression of MMP-9 in SCC and normal skin samples [n (%)].

Skin sample SCC Normal Total

n 36 13 49

8 (22.2) 9 (69.2) 17 (34.7)

+ 10 (27.8) 4 (30.8) 14 (28.6)

χ =12.613, p=0.006. SCC, squamous cell carcinoma; n, number of samples.

Table 3. Correlation between RECK and MMP-9 expression in SCC samples.

RECK

+ ++ +++ Total

24 3 5 4 36

3 (12.5) 3 (100.0) 1 (20.0) 1 (25.0) 8 (22.2)

MMP-9 [n (%)] + ++ 5 (20.8) 10 (41.7) 0 0 2 (40.0) 1 (20.0) 3 (75.0) 0 10 (27.8) 11 (30.6)

+++ 6 (25.0) 0 1 (20.0) 0 7 (19.4)

r = -0.406, p=0.014. MMP-9, Matrix metalloproteinase 9; RECK, reversion-inducing-cysteine-rich protein with kazal motifs. n, number of samples.

difference in MMP-9 expression was also statistically significant (χ2=12.613, P<0.05). Further, RECK expression and MMP-9 expression in SCC tissues were negatively correlated (r = -0.406, P<0.05; Table 3). RECK and MMP-9 expression and clinicopathological parameters To determine whether the altered expression of RECK and MMP-9 in SCC samples are associated with disease severity, we assessed expression in comparison with various clinicopathological parameters. RECK (Table 4) and MMP-9 (Table 5) expression in SCC tissues was correlated with degree of differentiation and lymph node metastasis (both P<0.05), but not with gender or age. For RECK, samples with low or absent expression tended to have higher differentiation degree and/or metastasis. In contrast, for MMP-9, samples with higher expression had higher differentiation degree and/or metastasis. DISCUSSION The

RECK

gene was initially isolated as a novel

transforming and suppressor gene from a cDNA expression library transfected into v-Ki-ras-transformed NIH3T3 cells by Takahashi et al. (1998). Highly conserved in Drosophila, mice, and humans, RECK mRNAs were detected in many normal human tissues and cell lines (Eisenberg et al., 2002). However, Takahashi et al. (1998) reported that RECK was not expressed in cancer cell lines or transformed cell lines. Thus, RECK is typically expressed only in normal cells, not tumor cells (Mori et al., 2007); this feature may allow RECK to be used as a novel diagnostic indicator with high sensitivity and specificity. Indeed, RECK has been explored as a diagnostic marker in cancers other than SCC. Moreover, RECK expression is lower in human breast (Span et al., 2003) and gastric (Song et al., 2006) cancers than in normal tissues. Our findings of reduced RECK expression in SCC samples support this previous work. Additionally, the apparent tumor-suppressing activity of RECK holds some promise as a potential therapy for cancer. Studies have shown that invasion and metastasis capabilities are inhibited in cell lines transfected with RECK (Petruzzelli et al., 1998). Restoring RECK expression in cells otherwise not expressing the protein results in inhibition of tumor progression. Human studies

Wu et al.

8003

Table 4. Correlation between expression of RECK and clinicopathological parameters in SCC samples [n (%)]. 2

Parameter Gender Male Female

+++

15 21

10 (66.7) 14 (66.7)

2 (13.3) 1 (4.8)

3 (20.0) 2 (9.5)

0 4 (19.0)

4.320

0.229

Age (years) <60 ≥60

16 20

11 (68.8) 13 (65.0)

2 (12.5) 1 (5.0)

3 (18.8) 2 (10.0)

0 4 (20.0)

4.309

0.230

Pathological grade High Middle Low

15 12 9

5 (33.3) 11 (91.7) 8 (88.9)

2 (20.0) 0 0

3 (20.0) 1 (8.3) 1 (11.1)

4 (26.7) 0 0

14.8112

0.022

Lymph node metastasis No Yes

22 14

11 (50.0) 13 (92.9)

2 (9.1) 1 (7.1)

5 (22.7) 0

4 (18.2) 0

8.123

0.044

RECK, reversion-inducing-cysteine-rich protein with kazal motifs; SCC, squamous cell carcinoma.

Table 5. Correlation between expression of MMP-9 and clinicopathological parameters in SCC samples [n (%)]. 2

Parameter Gender Male Female

+++

15 21

5 (33.3) 3 (14.3)

2 (20.0) 7 (33.3)

4 (26.7) 7 (33.3)

3 (20.0) 4 (19.0)

2.120

0.548

Age (years) <60 ≥60

16 20

3 (18.8) 5 (25.0)

3 (18.8) 7 (35.0)

6 (37.5) 5 (25.0)

4 (25.0) 3 (15.0)

1.913

0.591

Pathological grade High Middle Low

15 12 9

8 (53.3) 0 0

7 (46.7) 3 (25.0) 0

0 8 (66.7) 3 (33.3)

0 1 (8.3) 6 (66.7)

39.387

0.001

Lymph node metastasis No Yes

22 14

6 (27.3) 2 (14.3)

10 (45.5) 0

5 (22.7) 6 (42.9)

1 (4.5) 6 (42.9)

14.887

0.002

MMP-9, Matrix metalloproteinase 9; SCC, squamous cell carcinoma.

corroborate these findings. Van der Jaqt et al. (2006) in a study of 63 surgically-resected colorectal cancer specimens, reported reduced RECK mRNA expression in tumors compared to normal tissues. In addition, expression was not correlated with tumor size, lymph node metastasis, or distant metastasis. Masui et al. (2003) while studying 50 surgically-resected pancreatic cancer specimens, reported that RECK protein expression was lower than in adjacent normal tissues. Additionally, the invasiveness of tumors with positive

expression was weaker compared to those not expressing RECK. In fact, patients with high RECK expression in their tumor samples had significantly better prognosis and long-term survival compared to those without RECK expression. Our results reveal that RECK expression in skin SCC samples correlate with tissue differentiation and lymph node metastasis, specifically, as in pancreatic cancer, those samples with low or absent RECK expression had increased disease severity. These findings indicate that RECK is suppressed during the

8004

Afr. J. Biotechnol.

development and progression of skin SCC. MMP-9 has been recognized as a tumor promoter (thanks to its ability to degrade type IV collagen-a critical component of ECM and basement membranes (Newby, 2005)) to promote endothelial cell migration and tumor angiogenesis, and to regulate cell adhesion during tumor cell metastasis (Sato et al., 1993; O'Grady et al., 2007). Consistent with findings in other tumor types, we found that MMP-9 expression is significantly higher in skin SCC than in normal skin samples. To our knowledge, this is the first report of MMP-9 expression in skin SCC. Additionally, MMP-9 expression in skin SCC correlates with tumor differentiation and lymph node metastasis. Thus, the overexpression of MMP-9 in skin SCC appears to promote the development and progression of SCC. This information may allow MMP-9 to be developed into a diagnostic and prognostic marker of SCC. Importantly, research has shown that RECK negatively regulates MMP-9, both in vitro and in vivo, inhibiting MMP-9 secretion and activation and subsequently, reducing lung cancer cell metastasis (Takagi et al., 2009; Chang et al., 2008, Buhmeida et al., 2009). Indeed, our results show that RECK and MMP-9 expressions are negatively correlated in skin SCC, consistent with results observed in nasopharyngeal carcinoma studies (Li and Deng, 2010). These results suggest that reduced RECK expression allows MMP-9 to be overexpressed, leading to disease progression. Therefore, developing RECK as a therapeutic molecule to inhibit MMP-9 and reduce tumor differentiation and metastasis represents an important avenue for future research. In summary, reduced RECK expression and increased MMP-9 expression in skin SCC promotes the progression and metastasis of SCC. Thus, RECK and MMP-9 should be explored for use as diagnostic and prognostic markers of skin SCC. RECK also warrants investigation as a potential therapeutic molecule targeting MMP-9. REFERENCES Bradford PT (2009). Skin cancer in skin of color. Dermatol. Nurs. 21(4):170-177. Buhmeida A, Bendardaf R, Hilska M, Collan Y, Laato M, Syrjänen S, Syrjänen K, Pyrhönen S (2009). Prognostic significance of matrix metalloproteinase-9 (MMP-9) in stage II colorectal carcinoma. J. Gastrointest. Cancer, 40(3-4): 91-97. Chang CK, Hung WC, Chang HC (2008). The Kazal motifs of RECK protein inhibit MMP-9 secretion and activity and reduce metastasis of lung cancer cells in vitro and in vivo. J. Cell. Mol. Med. 12(6B): 27812789. Eisenberg I, Hochner H, Sadeh M, Argov Z, Mitrani-Rosenbaum S (2002). Establishment of the genomic structure and identification of thirteen single-nucleotide polymorphisms in the human RECK gene. Cytogenet. Genome Res. 97(1-2): 58-61. Ivaska J, Heino J (2000). Adhesion receptors and cell invasion: mechanisms of integrin-guided degradation of extracellular matrix. Cell. Mol. Life. Sci. 57(1): 16-24.

Li R, Deng Y (2010). Expression of RECK, RAGE and MMP-9 in nasopharyngeal carcinoma and its significance. Lin Chung, Er Bi Yan, Hou Tou, Jing Wai Ke, Za Zhi, 24(18): 823-827. Loukopoulos P, Mungall BA, Straw RC, Thornton JR, Robinson WF (2003). Matrix metalloproteinase-2 and -9 involvement in canine tumors. Vet. Pathol. 40(4): 382-394. Masui T, Doi R, Koshiba T, Fujimoto K, Tsuji S, Nakajima S, Koizumi M, Toyoda E, Tulachan S, Ito D, Kami K, Mori T, Wada M, Noda M, Imamura M (2003). RECK expression in pancreatic cancer: its correlation with lower invasiveness and better prognosis. Clin. Cancer Res. 9(5): 1779-1784. Mori T, Moriuchi R, Okazaki E, Yamada K, Katamine S (2007). Tgat oncoprotein functions as a inhibitor of RECK by association of the unique C-terminal region. Biochem. Biophys. Res. Commun. 355(4): 937-943. Namwat N, Puetkasichonpasutha J, Loilome W, Yongvanit P, Techasen A, Puapairoj A, Sripa B, Tassaneeyakul W, Khuntikeo N, Wongkham S (2011). Downregulation of reversion-inducing-cysteine-rich protein with Kazal motifs (RECK) is associated with enhanced expression of matrix metalloproteinases and cholangiocarcinoma metastases. J. Gastroenterol. 46(5): 664-675 Newby AC (2005). Dual role of matrix metalloproteinases (matrixins) in intimal thickening and atherosclerotic plaque rupture. Physiol. Rev. 85(1): 1-31. O'Grady A, Dunne C, O'Kelly P, Murphy GM, Leader M, Kay E (2007). Differential expression of matrix metalloproteinase (MMP)-2, MMP-9 and tissue inhibitor of metalloproteinase (TIMP)-1 and TIMP-2 in nonmelanoma skin cancer: implications for tumour progression. Histopathology, 51(6): 793-804. Philips N, Auler S, Hugo R, Gonzalez S (2011). Beneficial regulation of matrix metalloproteinases for skin health. Enzyme Res. 2011: 427285. Takahashi C, Sheng Z, Horan TP, Kitayama H, Maki M, Hitomi K, Kitaura Y, Takai S, Sasahara RM, Horimoto A, Ikawa Y, Ratzkin BJ, Arakawa T, Noda M (1998). Regulation of matrix metalloproteinase-9 and inhibition of tumor invasion by the membrane-anchored glycoprotein RECK. Proc. Natl. Acad. Sci. USA. 95(22): 1322113226. Petruzzelli GJ, Benefield J, Yong S (1998). Mechanism of lymph node metastases: current concepts. Otolaryngol. Clin. North Am. 31(4): 585-599. Sato H, Kita M, Seiki M (1993). v-Src activates the expression of 92-kDa type IV collagenase gene through the AP-1 site and the GT box homologous to retinoblastoma control elements. A mechanism regulating gene expression independent of that by inflammatory cytokines. J. Biol. Chem. 268(31): 23460-23468. Song SY, Son HJ, Nam E, Rhee JC, Park C (2006). Expression of reversion-inducing-cysteine-rich protein with Kazal motifs (RECK) as a prognostic indicator in gastric cancer. Eur. J. Cancer, 42(1): 101108. Span PN, Sweep CG, Manders P, Beex LV, Leppert D, Lindberg RL (2003). Matrix metalloproteinase inhibitor reversion-inducing cysteine-rich protein with Kazal motifs: a prognostic marker for good clinical outcome in human breast carcinoma. Cancer, 97(11): 27102715. Takagi S, Simizu S, Osada H (2009). RECK negatively regulates matrix metalloproteinase-9 transcription. Cancer Res. 69(4): 1502-1508. van der Jagt MF, Sweep FC, Waas ET, Hendriks T, Ruers TJ, Merry AH, Wobbes T, Span PN (2006). Correlation of reversion-inducing cysteine-rich protein with kazal motifs (RECK) and extracellular matrix metalloproteinase inducer (EMMPRIN), with MMP-2, MMP-9, and survival in colorectal cancer. Cancer Lett. 237(2): 289-297. Zibert JR, Løvendorf MB, Litman T, Olsen J, Kaczkowski B, Skov L (2010). MicroRNAs and potential target interactions in psoriasis. J. Dermatol. Sci. 58(3): 177-185.

Full Length Research Paper

In Silico characterization of growth hormone from freshwater ornamental fishes: Sequence analysis, molecular modelling and phylogeny Chittaranjan Baruah1, Umesh C. Goswami2* and Dhirendra K. Sharma1 1

Department of Zoology, Bioinformatics Centre, Gauhati University, Guwahati – 781 014, Assam, India. Department of Zoology, Fish Biology and Fishery Sciences Laboratory, Gauhati University, Guwahati – 781 014, Assam, India.

Accepted 12 March, 2012

The present investigation includes in Silico sequence analysis, three-dimensional (3D) structure prediction and evolutionary profile of growth hormone (GH) from 14 ornamental freshwater fishes. The analyses were performed using the sequence data of growth hormone gene (gh) and its encoded GH protein. The evolutionary analyses were performed using maximum likelihood (ML) estimate and maximum parsimony (MP) methods. Bootstrap test (1000 replicates) was performed to validate the phylogenetic tree. The tertiary structures of GH were predicted using the comparative modelling method. The suitable template for comparative modeling protein databank (PDB IDs: 1HWG A) has been selected on the basis of basic local alignment search tool (BLASTp) and fast analysis (FASTA) results. The target-template alignment, model building, loop modelling and evaluation have been performed in Modeller 9.10. The tertiary structure of GH is α-helix structure connected by loops, which forms a compressed complex maintained by two disulfide bridges. The resultant 3D models are verified by ERRAT and ProCheck programmes. After fruitful verification, the tertiary structures of GH have been deposited to protein model database (PMDB). Sequence analyses and RNA secondary structure prediction was performed by CLC genomics workbench version 4.0. The computational models of GH could be of use for further evaluation of molecular mechanism of function. Key words: Growth hormone, in Silico, somatotropin, growth hormone gene (gh) mRNA, freshwater ornamental fish. INTRODUCTION The growth hormone (GH), which is a single chain polypeptide, synthesized, stored and secreted by the somatotroph cells within the lateral wings of the anterior

*Corresponding author. E-mail: gauhatiuniv.btisnet@nic.in, ucgoswami@rediffmail.com. Tel: 0091 0361 2700294 or 0091 98640 24121. Abbreviations: 3D, Three dimensional; BLAST, Basic Local Alignment Search Tool; EBI, European Bioinformatics Institute; FASTA, fast analysis; PDB, protein databank; PMDB, protein model database; RMSD, root mean square deviation; GH, growth hormone; gh, growth hormone gene; ML, maximum likelihood; MP, maximum parsimony.

pituitary gland, plays an essential role in the regulation of growth and development, by promoting the division, differentiation and enlargement of cells (Moore et al., 1982; Copelandet and Nair, 1994; Corin et al., 1990) as well as osmoregulation in fishes (Sakamoto et al., 1997) and many physiological activities of fish (Stacey et al., 1984; Peter et al., 1986; Sumpter et al., 1991; Trudeau, 1997; Degani et al., 2003). GH is phenotypically associated with characteristics of interest to animal breeding, such as growth, reproduction and osmoregulation (Duan, 1998; Gomez et al., 1998; Mccormik, 2001). Genomic GH sequences and cDNAs have been used as a phylogenetic marker for different taxonomic groups including fishes (Koren et al., 1989; Chang et al., 1992; 2004).

8006

Afr. J. Biotechnol.

Table 1. Nucleotide sequence statistics of the gh cDNA sequence.

Taxon C. lalia O. goramy Channa marulius C. striata Channa gachua C. punctata Channa diplogramme T. trichopterus Trichogaster leerii M. albus Oreochromis niloticus O. mossambica O. urolepis hornorum T. tinca

GenBank accession numbers AY873788 JF310708 GQ214245 EF447030 GQ214244 GQ214243 GQ214246 AF157633 AY873789 AY265351 HM565014 AF033805 EF371465 GU205401

Length (bp) 846 828 846 863 848 848 845 881 840 825 904 615 839 1040

In addition, GH may be the most promising growthpromoting agent in aquaculture (Zohar, 1989), since it is essential for somatic growth and reproduction in bony fishes and osmoregulation in euryhaline fishes (Sciara et al., 2006). Among vertebrates, GH is essential for normal growth and is involved in the regulation of several anabolic processes (Xu et al., 2001). The teleost growth hormone gene (gh) can be grouped into two types: on one hand are genes of the siluriforms and cypriniforms, which consist of five exons and four introns (5-exon type), and on the other hand are those of the salmoniforms, perciforms and tetradontiforms, which consist of six exons and five introns (6-exon type). Structurally, the latter differs from the former by the presence of an intron inserted at the 5th exon (Moriyama et al., 2006). The gh has been shown to serve as a natural marker for studies of evolutionary genetics of various fishes because of its sequence conservation, sufficient length and minimal amount of homoplasy (Marins et al., 2003; Chen et al., 2004; Pinheiro et al., 2008). The aim of the present study was to annotate the coding sequence of the gh and perform a gh-based phylogenetic analysis among ornamental fish species. This study, for the first time focuses on prediction of gh mRNA structure, sequence comparison and comparative modelling for characterization of GH. Like other native Indian freshwater fish species of economic importance, ornamental fish genetics needs greater attention for animal breeding programs. The gh is known to be linked to a number of molecular markers and quantitative trait loci. In this study, we have performed in Silico analysis with an attempt to characterize the gh (cDNA and mRNA) from 14 ornamental fish species and its encoded GH protein. Our results provide meaningful information for further studies on the ornamental fish breeding and fish phylogeny. On the other hand, the

MW (kDa) 272.169 266.763 272.302 277.985 273.088 272.936 271.897 283.163 269.892 265.577 291.385 198.197 270.553 335.307

Melting temperature (째C) (salt)= 0.1 M 83.70 84.90 84.09 84.09 84.24 84.38 84.45 83.28 83.64 84.88 83.90 86.03 84.50 81.65

Frequency of A + T 0.541 0.512 0.532 0.532 0.528 0.525 0.523 0.552 0.543 0.513 0.537 0.485 0.522 0.591

Frequency Of C + G 0.459 0.488 0.468 0.468 0.472 0.475 0.477 0.448 0.457 0.487 0.463 0.515 0.478 0.409

secondary RNA structures, which are often conserved, are essential in understanding the biological processes (Wuyts et al., 2002; Zwieb et al., 2003). Many computational methods have been developed for predicting RNA structures (Bachellerie et al., 2002; Perriquet et al., 2003; Hofacker et al., 2004). Although, there has been availability of sequence information for GH from different fish groups, yet speciesspecific structural information are lacking. Therefore, the biochemistry and molecular mechanism of their functions in fishes are still not very well understood due to lack of their structural information. Thus, an attempt has been made to predict the three-dimensional (3D) folding pattern (Zemla et al., 1999) of GH from 14 ornamental fish species and their sequence analysis. MATERIALS AND METHODS Acquisition and alignment of sequences The study was extended to data mining and sequence analyses of gh and GH protein from the sequence information extracted from GenBank (NCBI) and protein knowledgebase (UniProtKB), respectively (Boeckmann, 2003; Apweiler et al., 2004) (Tables 1 and 2). The sequences were simultaneously aligned using CLUSTAL-W (Higgins et al., 1994) and Modeller version 9v10 (Fiser et al., 2000) programs.

Sequence analysis and RNA structure prediction The gh nucleotide and GH protein sequence analyses and GH mRNA structure prediction were performed in the CLC Genomics Workbench 4.0 (CLC Bio, Hyderabad). The physicochemical parameters of GH were computed using CLC Genomics Workbench and ProtParam (Gasteiger et al., 2005). The important calculations for the amino acid composition, atomic composition, theoretical pI, molecular weight, formula, extinction coefficients,

Baruah et al.

8007

Table 2. Ornamental fish GH protein statistics.

UniProtKB accession number

Number of amino acid

MW (Da)

Q5FYZ3 F1JZV8 D6MLR5 C0SKH7 D6MLR4 D6MLR3 D6MLR6 Q98UF6 Q5FYZ2 Q7T231 Q53WZ5 Q6LAL0 A3FEU9 D7RPP4

204 204 204 204 204 204 204 204 204 204 204 204 204 210

23303.6 23283.6 23216.6 23172.5 23143.5 23172.5 23120.4 23411.8 23397.8 22964.3 23110.2 23110.2 23105.2 23699.2

6.43 6.43 6.90 6.08 6.42 6.08 6.90 6.43 6.43 6.51 5.95 5.95 5.95 6.32

Negative charged residues 23 23 22 23 22 23 22 23 23 22 22 22 22 25

Positive charged residues 22 22 22 21 21 21 22 22 22 21 19 19 19 24

Formula

GRAVY

C1041H1651N281O311S7 C1037H1643N279O313S8 C1032H1658N282O311S7 C1032H1654N278O312S7 C1030H1651N279O311S7 C1032H1654N278O312S7 C1026H1646N280O312S7 C1049H1659N279O311S8 C1048H1657N279O311S8 C1022H1642N276O311S6 C1019H1624N280O318S7 C1019H1624N280O318S7 C1021H1625N279O317S7 C1042H1684N290O317S11

99.85 96.03 105.15 106.08 104.66 106.08 101.81 98.92 98.92 105.64 97.94 97.94 97.45 97.00

-0.180 -0.215 -0.168 -0.129 -0.151 -0.129 -0.204 -0.175 -0.175 -0.117 -0.250 -0.250 -0.257 -0.175

MW, Molecular weight; pI, isoelectric point; AI, aliphatic index; GRAVY, grand average of hydropathicity.

half-life,instability index, aliphatic index, hydrophobicity and charge versus pH were carried out under sequence analysis.

Molecular phylogenetic analysis The sequences for the gh were separately aligned using ClustalW 1.6 (Thompson et al., 1994) integrated in software MEGA5 (Tamura et al., 2011), using default parameters. gh sequences were translated into amino acids (aa) of GH protein prior to analysis. Both gh and GH datasets were subjected to phylogenetic analyses. Evolutionary analyses were conducted in MEGA5 (Tamura et al., 2011). The evolutionary history was inferred by using two different methods namely the maximum parsimony (MP) (Eck and Dayhoff, 1966) and maximum likelihood (ML) estimate (Jones et al., 1992). Nucleotide substitution model that best fits each dataset and the model parameters were estimated using Akaike information criterion implemented in the program MODELTEST version 3.7 (Posada and Crandall, 1998) (Table 4).

Three-dimensional structure prediction Basic local alignment search tool (BLASTp) (Altschul et al., 1997) and fast analysis (FASTA) (Pearson and Lipman, 1988, 1990; Pearson, 1991) searches were performed independently with protein databank (PDB) (Kauranov et al., 2006; Berman et al., 2007) for obtaining a suitable template. The significance of the BLAST results was assessed by expect values (e-value) generated by BLAST family of search algorithm (Altschul et al., 1991). The target-template alignment (Lassmann and Sonnhammer, 2005) was carried out using ClustalW version 2.1 (Higgins et al., 1994) and Modeller 9.10 (Fiser et al., 2000) programmes. Comparative (Homology) modelling was conducted by the Modeller version 9.10 (Marti-Renom et al., 2000; Fiser and Sali, 2003). The final 3D structures with all the coordinates for GH were obtained by optimization of a molecular probability density function (pdf) of Modeller (Eswar et al., 2006). The molecular pdf for homology modelling was optimized with the variable target function procedure in Cartesian space that employed the method of conjugate gradients and molecular dynamics

with simulated annealing (Sali and Blundell, 1993). The 3D structures for GH were evaluated (Giorgetti et al., 2005) by ERRAT (Colovos and Yeates, 1993) and ProCheck (Laskowski et al., 2003) programmes. After fruitful verification, the coordinate files were successfully deposited to protein model database (PMDB) (Tiziana et al., 2006). All the graphic presentations of the 3D structures were prepared using Chimera (Peterson et al., 2004) and RasMol programs (Sayle and Milner-White, 1995).

RESULTS Data mining and sequence analysis In ornamental fishes, the gh ranged from 615 to 1040 nucleotide long and with molecular weights of 198.197 to 335.307 kDa. The melting temperature ranged from 81.65 to 86.03 at 0.1 M salt concentration (Table 1). The nucleotide sequence

8008

Afr. J. Biotechnol.

Figure 1A. Nucleotide composition (% in average) in the gh cDNA sequence in the ornamental fishes based on 14 gh sequences.

Figure 1B. Distribution of amino acids for GH protein in the ornamental fishes.

analysis based on the homologous gh mRNA (cDNA) sequence showed the domination of A:T in the gh (Figure 1A). The frequency of AT in different ornamental fish ranged from 0.485 (in Oreochromis mossambica) to 0.591 (in Tinca tinca). On the other hand, frequency of GC ranged from 0.409 (in T. tinca) to 0.515 (in O. mossambica) (Table 1). The sequence alignment of gh mRNA (cDNA) sequence detected insertions of ‘GTGTT’ and ‘TTCTA’ th th from 105 to 109 position in O. mossambica and T. tinca, respectively. Another insertion of ‘AG’ has been observed from 87 to 88th positions in both the species. Again, insertion (TTTTTTC) has been observed in the genus Oreochromis from 800 to 806 positions in the alignment. Deletion of ‘GTTT’ is detected from 42 to 45 position in all the Channa species. There is a deletion of

‘CGA’ (667 to 668 positions) in all the Channa species. T. tinca has a deletion of ‘CT’ at 34 to 35 positions in the alignment. Trichogaster sp., Colisa lalia and Monopterus rd albus has deletion of ‘A’ at 33 position. Deletion of ‘CTTGC’ has been observed in the genus Oreochromis from 773 to 777 positions. Deletion of ‘ACCCCTAT’ (685 to 692 position) has been observed in T. tinca and Oreochromis sp. (supplementary file). The primary structures of GH are shown to be comprised of 204 to 210 amino acid residues. The amino acid leucine (L=16%) and serine (S=12.3%) has been found predominantly rich in the GH of these 14 ornamental fish species (Figure 1B). Sequence analysis of GH revealed negative hydropathy on the average (0.117 to -02.57) (Table 2 and Figure 1C). The molecular weight of GH in the ornamental fishes of the present

Baruah et al.

8009

Figure 1C. Plot of local Hydropathy for GH (Kyte-Doolittle scale, Kyte and Doolittle, 1982).

Figure 1D. Electrical charge as a function of pH for GH in the ornamental fishes.

study ranged from 22964.3 Da (in M. albus) to 23699.2 Da (in T. tinca). The isoelectric point of the GH ranged from 5.95 (in Oreochromis sp.) to 6.90 (in Channa sp.) (Table 2 and Figure 1D). Extinction coefficients for GH are 17670 [Abs 0.1% (=1 g/l) 0.758] and 317420 [Abs

0.1% (=1 g/l) 0.748]. The instability index (II) of GH was computed to be 59.46. There were 22 to 25 negatively charged and 19 to 24 positively charged amino acid resides in the GH sequence. The aliphatic index for GH was computed in the range of 96.03 to 106.08 (Table 2).

8010

Afr. J. Biotechnol.

Figure 2. Multiple amino acid sequence alignment of GH protein among the 14 ornamental fish species. (-) represent sequence not conserved. The sizes of the letter in the sequence logo represent the degree of conservation of respective amino acid in each alignment position.

Multiple sequence alignment of the GH protein showed that T. tinca has an insertion of ‘LV’ and ‘LTVGNP’ in the 12 th to 13th and 119th to 124th positions, respectively. th Similarly, deletion has been observed in T. tinca at 161

and 272nd positions. The genus Oreochromis differed from Channa in the position19th, 34th, 99th, 156th and 157th in the alignment (Figure 2). The homology searching demonstrated that the T. tinca GH shares a high

Baruah et al.

8011

Table 3. Summary of gh mRNA structure.

Taxon C. striata T. trichopterus O. goramy T. tinca Trichogaster leerii C. lalia Oreochromis niloticus Channa diplogramme Channa marulius Channa gachua C. punctata M. albus O. mossambica Oreochromis urolepis

Minimum folding energy (kcal/mol) -260.8 -272 -277.2 -290 -254.1 -241.5 -282.5 -264.2 -265.5 -262.7 -259.2 -267.3 -215.4 -255.7

Bulge

Hairpin loop

Interior loop

Multiloop

Stem

9 14 13 16 12 7 6 14 9 6 8 20 6 11

15 18 16 17 16 17 17 15 16 14 15 13 16 14

18 16 13 28 19 23 23 16 19 20 17 18 11 19

12 15 13 13 12 14 11 12 13 12 13 11 11 11

27 33 29 29 28 31 28 27 29 26 28 24 27 25

Table 4. Maximum likelihood model parameters for data sets as estimated in model test (Posada and Crandall, 1998).

Parameter Model Bayesian information criterion (BIC) scores Akaike information criterion, corrected (AICc) value Maximum likelihood value (lnL) Gamma distribution (G) invariable (I) Transition/transversion bias (R) Total positions in the final dataset

homology at the nucleotide and amino acid levels with those of grass carp (92% nt, 98% aa), of silver carp (91% nt, 98% aa) and common carp (88% nt, 98% aa). Secondary structure gh mRNA The minimum folding energy ( ) of the gh mRNA structure ranged from -215.4 kcal/mol (O. mossambica) to -290 kcal/mol (T. tinca) (Tables 3). The number of bulges ranged from 6 (O. mossambica) to 20 (M. albus), while hairpin loops ranged from 13 (M. albus) to 18 (Trichogaster trichopterus) and stems ranged from 24 (M. albus) to 33 (T. trichopterus) (Tables 3). The sequence analysis indicated that a minor variation in bulge, hairpin loop, interior loop and in stem (Table 3) exists in the gh secondary mRNA structure. Minor structural changes have been observed in some parts of the mRNA secondary structure with variation in the minimum folding energy (Table 3 and Figure 3).

gh T92+G 9596.7 9394.5 -4669.2 0.98125 n/a 1.5677 727

GH protein JTT+I 3120.7 2966.6 -1457 n/a 0.220026 n/a 202

Molecular evolution of GH The evolutionary tree of both gh and GH protein in ornamental fishes supports the fact that the families Channidae (Channa spp.) and Belontidae (C. lalia, Trichogaster spp.) along with Osphronemidae (Osphronemus goramy) are sister groups, while family Cichlidae (Oreochromis sp.) is their successive sister group. Family Synbranchidae (M. albus) was represented as an intermediate clade between Belontidae and Cichlidae. Family Cyprinidae (T. tinca) is represented as out group in the phylogenetic tree. Evolution of gh Pairwise distances of gh are shown in Table 5. The bootstrap consensus tree inferred from 1000 replicates was taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). There were a total of

8012

Afr. J. Biotechnol.

Figure 3. Lowest energy secondary structure of growth hormone (GH) mRNA (C. marulius). The numbers represent nucleotide positions of gh mRNA sequence.

727 positions in the final dataset. The pairwise distance of gh sequences among the 14 ornamental fish species of the present study revealed shortest genetic distance (0.007) between Channa striata and Channa punctata. The longest genetic distance (0.597) exists between O. mossambica and T. tinca (Table 5).

with search level 1 in which the initial trees were obtained with the random addition of sequences (10 replicates). The tree was drawn to scale; with branch lengths calculated using the average pathway method (Nei and Kumar, 2000) and are in the units of the number of changes over the whole sequence (Figure 4A).

1) The evolutionary history was inferred using the MP method. The MP tree was obtained using the CloseNeighbor-Interchange algorithm (Nei and Kumar, 2000)

2) The evolutionary history was inferred by using the ML method based on the Tamura 3-parameter model (Tamura, 1992). The ML tree with the highest log

Baruah et al.

8013

Table 5. Pairwise distance gh.

1 0.193 0.146 0.557 0.190 0.205 0.257 0.100 0.063 0.045 0.007 0.179 0.326 0.267

0.109 0.569 0.022 0.096 0.259 0.179 0.172 0.180 0.187 0.206 0.323 0.261

0.558 0.102 0.131 0.226 0.146 0.140 0.143 0.140 0.179 0.301 0.228

0.561 0.578 0.583 0.549 0.539 0.538 0.553 0.571 0.597 0.582

0.098 0.257 0.179 0.169 0.177 0.184 0.201 0.323 0.260

0.282 0.190 0.193 0.193 0.199 0.227 0.345 0.283

0.268 0.248 0.253 0.254 0.219 0.110 0.014

0.084 0.094 0.096 0.186 0.327 0.274

0.021 0.056 0.161 0.318 0.253

0.039 0.166 0.322 0.260

0.175 0.323 0.264

0.293 0.223

0.118

likelihood (-4725.1438) is shown. A discrete gamma distribution was used to model evolutionary rate differences among sites [(5 categories (+G, parameter = 3.5077)]. The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 0.0000% sites) (Figure 4B). In the gh (cDNA) phylogeny, the families Channidae (Channa spp.) formed a clade with bootstrap support 92 and 100% in the MP and ML trees, respectively. Family Belontidae (C. lalia, Trichogaster spp.) and Osphronemidae (O. goramy) are clustered together at the bootstrap support 99 and 100% for MP and ML trees. In another cluster, family Cichlidae (Oreochromis sp.) formed a separate clade with bootstrap value 100%. The family Synbranchidae (M. albus) represented in an intermediate clade and along with Channidae, Belontidae and Osphronemidae is separated from Cichlidae at a bootstap percentage 73 and 97% in the MP and ML trees, respectively. Family Cyprinidae (T. tinca) is represented as out group in the phylogenetic tree (Figure 4). Evolution of GH protein Pairwise distance of GH protein is shown in Table 6. The analysis involved 14 protein sequences. All positions containing gaps and missing data were eliminated. There were a total of 202 positions in the final dataset. The pairwise distance of GH sequences among the 14 ornamental fish species of the present study revealed significant distance (0.654) between M. albus and T. tinca (Table 6). 1) The evolutionary history was inferred using the MP method. Tree #1 out of 6 most parsimonious trees (length =169) is shown. The consistency index is (0.857143), the

retention index is (0.900000) and the composite index is 0.825444 (0.771429) for all sites and parsimonyinformative sites (in parentheses). The MP tree was obtained using the Close-Neighbor-Interchange algorithm (Nei and Kumar, 2000) with search level 1 in which the initial trees were obtained with the random addition of sequences (Figure 5A). 2) The evolutionary history was inferred by using the ML method based on the JTT matrix-based model (Jones et al., 1992). The tree with the highest log likelihood (1461.4701) is shown in Figure 5B. In the evolutionary tree GH protein, Belontidae (C. lalia, Trichogaster spp.) and Osphronemidae (O. goramy) formed a clade with bootstap support 98% in MP an ML trees. This clade is separated from the clade formed by Channidae (Channa spp.), with bootstap value 75 and 82% for the MP and ML trees, respectively. Further, family Cichlidae (Oreochromis sp.) is separated from family Synbranchidae (M. albus) with bootstrap probability 67 and 83% for MP and ML trees. All the Oreochromis spp. have been clubbed together with a bootstrap support of 99 and 97% for MP and ML phylogeny. The predicted 3D structure of GH Based on BLASTp and FASTA results, 1HWG (Chain A, Complex of Human GH; Identities 34%) was considered to be the best template for homology modelling. The model of GH has 7 to 11 helices, 10 to 17 helix-helix interactions, 5 to 13 beta turns, 0 to 5 gamma turns and 2 disulphide linkages (Table 8 and Figure 6). The overall quality factors predicted by ERRAT verification programme for the 3D structures of GH are around 95 (Figure 7). Procheck verification proved that the models

8014

Afr. J. Biotechnol.

A 100

Channa striata Channa punctata

100

Channa marulius

100

Channa gachua

79 92

Channa diplogramme Osphronemus goramy

Colisa lalia

100

Trichogaster trichopterus

100 100

Trichogaster leerii

Monopterus albus Oreochromis mossambica

100 100

Oreochromis niloticus Oreochromis urolepis Tinca tinca

0.05

B Figure 4. Molecular phylogenetic anaylsis of ornamental fish gh. A, MP tree; B, ML tree based on the Tamura 3-parameter model (Tamura, 1992). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches (Felsenstein, 1985). The scale bars represent the branch lengths measured in the number of changes (substitutions per site) over the whole sequence.

are of good quality (88.8 to 96.3%) as judged by Ramachandran plot (Ramachandran and Sasisekharan,

1968). The number of glycine and proline resides in the plot ranged from 7 to 9 and 6 to 8, respectively as

Baruah et al.

8015

Table 6. Pairwise distance GH protein.

Taxon C. lalia O. goramy Trichogaster_leerii Channa gachua C. striata Channa diplogramme Channa marulius M. albus O. urolepis hornorum C. punctata T. trichopterus Oreochromis niloticus T. tinca O. mossambicus

1 0.040 0.030 0.143 0.138 0.126 0.132 0.155 0.208 0.138 0.030 0.196 0.635 0.196

0.025 0.126 0.121 0.099 0.115 0.138 0.184 0.121 0.025 0.172 0.626 0.172

0.132 0.126 0.115 0.121 0.155 0.202 0.126 0.000 0.190 0.617 0.190

0.015 0.056 0.020 0.149 0.221 0.015 0.132 0.208 0.635 0.208

0.056 0.035 0.143 0.215 0.000 0.126 0.202 0.635 0.202

0.046 0.132 0.184 0.056 0.115 0.172 0.626 0.172

0.132 0.196 0.035 0.121 0.184 0.626 0.184

0.167 0.143 0.155 0.155 0.654 0.155

0.215 0.202 0.015 0.617 0.015

0.126 0.202 0.635 0.202

0.190 0.617 0.190

0.626 0.000

0.626

observed in the Ramachandran plot statistics (Table 7). After fruitful verification, the tertiary structures of GH have been deposited to PMDB (Tiziana et al., 2006) (Table 8). InterPro scan for sequence motifs matched in scan against PROSITE, PRINTS, PFam-A, TIGRFAM and PRODOM motifs reveled that GH belongs to the somatotropin/prolactin family. Search of GH sequence versus superfamily HMM library revealed 11 motifs with superfamily name 4-helical cytokines (Motif 47266; residue ranges 19 to 146 and 150 to 202). Sequence search against existing PDB entries revealed that GH in the ornamental fish has 38.6% sequence identity with the structure of human GH (Hgh) (PDB ID 3 hh and 1 hwg). DISCUSSION GH in ornamental fishes in the present study has 204 to 210 amino acid residues with molecular weight of 22.96 th to 23.7 kDa. There are four cysteine residues (at 69 , th th nd 177 , 194 and 202 positions) in the GH sequence containing 204 aa (Table 2). However, there are 210 amino acid residue in T. tinca and the five cysteine residues (at 71st, 145th, 183rd, 100th and 108th positions) establishes itself as an out-group. The high Leucine content (Figure 1B) of the amino acid sequence of the GH is responsible for increased kinetics of the protein synthesis and controlling protein breakdown rates (Garlick, 2005). Sequence analysis of GH protein revealed negative hydropathy on average (Figure 1C), which signifies the polar and hydrophilic in nature of the GH. The instability index (II) of GH in the present study (59.46) classifies GH as unstable. The formation of cysteine disulfide bonds assumes highly conservative nature of GH and all known vertebrate GH contains two disulfide bonds between

cysteine-57 and cysteine-165 and between cysteine-182 and cysteine-189 (Scanes and Campbell, 1995). The present findings demonstrated two isoforms of GH and the out-group species T. tinca belongs to the first isoform with 210 amino acid residues, while the other 13 species could be included in the second isoform with 204 amino acid residues, where the residues 12 to 13 and 119 to 124 are missing, compared to T. tinca (Figure 2). Similarly, the gh cDNA (mRNA sequence) of T. tinca contains an open reading frame of 1040 nucleotides (Table 1) encoding a pre-protein of 210 amino acid residues, while the all other species of the families Channidae (Channa spp.), Belontidae (C. lalia, Trichogaster spp.), Osphronemidae (O. goramy), Cichlidae (Oreochromis sp.) and Synbranchidae (M. albus), the GH cDNA retains an open reading frame of 615 to 904 nucleotides encoding a pre-protein of 204 amino acid residues. The GH isoform(s) and their physiological significance in different fish remains unclear, but emerging data provide suitable evidence for season and nutrition related changes in the somatototropic axis activity (PeÂ´rez-SaÂ´nchez et al., 2002). Hong and Schart (1993) analyzed the silver carp (Hypophthalmichthys molitrix) gh with the suggestion that the arrangement of exons and introns are identical to the GH genes of common carp, grass carp and very similar to mammals and birds, but quite different from the GH genes of tilapia and salmonids. The sequence predicts a polypeptide of 210 aa including a putative signal peptide of 22 hydrophobic aa residues. Comparison of the gh sequence in the present study indicates that there is a high degree of homology, both at the nucleotide and amino acid level, among the fish species. AT-rich elements (Figure 1A) involved in homeotic protein regulation of the gh (Rhodes and Yamada, 1995). The minimum folding energy ( ) of the gh mRNA

8016

Afr. J. Biotechnol.

B Figure 5. Molecular phylogenetic anaylsis of ornamental fish GH protein. A, MP tree; B, ML tree. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches (Felsenstein, 1985). The scale bars represent the branch lengths measured in the number of changes (substitutions per site) over the whole sequence.

structure (-215.4 kcal/mol to -290 kcal/mol) is suggestive of highly stable structure (Table 3 and Figure 3). Timothy et al. (2004) suggested a relationship between the richness of AT/AU and mRNA stability for the regulation of the gene expression. Many of the known regulatory

pathways for mRNA stability involve proteins that interact with specific AU-rich elements in the 3â&#x20AC;˛-untranslated region (3â&#x20AC;˛ UTR) of the transcript. In particular, rapid context-specific regulation of the stability of mRNA transcripts encoding highly active proteins, such as GH,

Baruah et al.

Table 7. Ramachandran plot statistics.

Taxon C. lalia O. goramy Channa marulius C. striata Channa gachua C. punctata Channa diplogramme T. trichopterus Trichogaster leerii M.albus Oreochromis niloticus O.mossambica O. urolepis hornorum T. tinca

Most favoured regions [A,B,L] (%) 96.3 91.4 92.6 89.9 88.8 89.3 91.4 90.9 92.0 91.0 90.4 90.4 89.2 90.6

Additional allowed regions [a,b,l,p] (%) 3.2 8.1 6.9 9.0 11.2 9.6 7.5 8.0 6.4 8.5 8.0 8.0 9.7 6.2

Generously allowed regions [~a,~b,~l,~p] (%) 0.5 0.5 0.5 1.1 0.0 0.5 1.1 0.5 1.6 0.0 0.5 0.5 1.1 1.0

Disallowed regions [XX] (%) 0.0 0.0 0.0 0.0 0.0 0.5 0.0 0.5 0.0 0.5 1.1 1.1 0.0 2.1

End-residues (excl. Gly and Pro)

Glycine residues

Proline residues

2 2 2 2 2 2 2 2 2 2 2 2 2 2

9 8 8 7 8 7 8 8 7 6 8 8 7 8

6 7 6 7 7 7 7 7 7 7 6 6 7 8

Table 8. The PMDB ID assigned to the submitted structures.

Number of helices 8 7 11 11 8 11 8 11 7 10 11 11 7 9

Helix-helix interaction 10 10 16 14 12 17 14 17 11 17 15 15 11 15

Number of beta turns 6 8 5 4 11 5 11 5 12 13 5 5 10 9

Number of gamma turns 1 5 3 2 4 2 4 5 5 1 3

PMDB ID PM0077770 PM0077775 PM0077767 PM0077769 PM0077766 PM0077768 PM0077765 PM0077777 PM0077778 PM0077771 PM0077772 PM0077773 PM0077774 PM0077776

8017

8018

Afr. J. Biotechnol.

Figure 6. The predicted homology model of ornamental fish GH structure, as displayed by UCSF Chimera.

appears to play a key role in the control of these molecules and the processes they mediate (Timothy et al., 2004). Somvanshi et al. (2008) suggested that the genetic algorithm (GA) simulates natural folding pathway during RNA synthesis, which in fact enables the addition of new stems to growing RNA chain as well as allows the removal of unfavourable pairings. Their in Silico analysis GA on the evolutionary stability of the Influenza virus allows the prediction of tertiary interactions including RNA pseudoknots and the MFE is obtained from the secondary RNA structure. Secondary structure prediction of gh mRNA finds very clear evidence that the GH in 14

ornamental fish species has an evolutionary relationship, although it is not completely clear whether this was a relationship of homology or complementarities between the 5 prime and 3 prime directions of mRNA, demands further characterization. Though the number of amino acid residues has been obtained 171 to 217 in human, bovine and in some fishes, yet the ornamental fish group of the present study presented 204 to 210 amino acid residues. However, the present in Silico analysis has been failed to explain the discrepancy in the amino acid residues. The structural relationship of GH is consistent with phylogeny. In a

Baruah et al.

8019

Figure 7. Structure validation results showing overall quality of 3D structure of GH (ERRAT2 Verification). The two lines at 95 and 99% represent error axis, to indicate the confidence with which it is possible to reject regions that exceed that error value. The dark grey bars indicate residues under the 95% confidence limit.

recent study, Kocour and Kohlmann (2011) studied gh polymorphisms in T. tinca, comprising 1758 to 1763 bp in length. Polymorphisms in the T. tinca gh, a representative of the five-exon type and are not as extensive as in fishes with the six-exon GH gene. Both the tree building methods (MP and ML) used in the present study revealed almost similar tree topology in the final gh and GH protein phylogeny. However, M. albus (family Synbranchidae) was found to be the successive sister taxa of family Belontidae (C. lalia, Trichogaster spp.), Osphronemidae (O. goramy) and Channidae (Channa spp.), but an intermediate of family Cichlidae (Oreochromis sp.) in the ML and MP tree of gh and ML tree of GH protein. On the other hand, in the MP tree of GH protein, M. albus (family Synbranchidae) has formed a direct clade with Cichlidae (Oreochromis sp.). T. tinca (family Cyprinidae) is a distinct out-group of all the other taxa, as depicted by ML and MP trees of gh and GH protein phylogeny. The present study revealed independent evolution of GH at nucleotide and protein level in the ornamental fish families that is, one in Belontidae, Osphronemidae and Channidae group and the other Cichlidae and Synbranchidae, where Cyprinidae is a out group (Figures 4 and 5). Pairwise genetic distance analysis of this investigation demonstrated close relationship between C. striata and C. punctata (Table 5) and T. tinca is definite outgroup. Also, major distance has been putforwarded between T. tinca and O. mossambica (Tables 5 and 6). GH is structurally and apparently evolutionarily homologous to prolactin and chorionic somatomammotropin. Putative conserved domains of somatrophin-like GH superfamily were also detected in the BLAST result of the

present study. Growth rates of many fish species used in aquaculture are naturally slow, but are currently being enhanced by traditional methods of domestication and selection (Hershberger et al., 1990). The efficiency of growth and feed-conversion can also be increased in finfish by creating transgenic fish that incorporate a gene construct encoding GH, giving 3â&#x20AC;&#x201C;11-fold gains in weight (Rahman et al., 1998). The number of residues varies slightly with GH from different fish species. Chen et al. (1995) studied the growth rates in transgenic mice and demonstrated that aa residues in the third alpha-helix of GH involved in growth promoting activity. GH has two disulfide bridges which are conserved in fish species (Harvey et al., 1995). In hGH, four major isoforms were identified with the number of aa residues 217 (MW 24,847 Da), 202 (MW 22,992 Da), 179 (MW 20,561 Da) and 171 (MW 19,802 Da), respectively (Zhan et al., 2005). The largest isoform (217 aa, 24.85 kDa) is typically referred to hGH, and is most predominant. However, further wet lab analysis is required in order to study the GH isoforms in fish. The models presented here were deposited in the public domain database and could serve as a guide for the allocation of aa residues in each fold which is important for further investigations on molecular mechanism of functions. The study was performed for sequence analyses and prediction of 3D structure of GH using the homology modeling. A series of molecular modeling and computational methods were combined in order to gain insight into the 3D structure. Further study, investigating the role of other factors in GH biosynthesis in wet lab is in progress. Much is still to be learned about how the GH can manipulate a sequence of base pairs in such a

8020

Afr. J. Biotechnol.

peculiar way that results in a fully functional organism. REFERENCES Altschul SF (1991). Amino acid substitution matrices from an information theoretic perspective. J. Mol. Biol. 219(3): 555-565. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acid Res. 25(17): 3389-3402. Apweiler R, Bairoch A, Wu CH, Barker WC, Boeckmann B, Ferro S, Gasteiger E, Huang H, Lopez R, Magrane M, Martin MJ, Natale DA, O'Donovan C, Redaschi N, Yeh LS (2004). UniProt: the Universal Protein knowledgebase. Nucleic Acid Res. 32: D115-119. Bachellerie JP, Cavaille J, Huttenhofer A (2002). The expanding snoRNA world. Biochimie, 84: 775-790. Berman H, Henrick K, Nakamura H, Markley JL (2007). The worldwide Protein Data Bank (wwPDB): ensuring a single, uniform archive of PDB data. Nucleic Acid Res. 35(Database issue): D301-303. Boeckmann B, Bairoch A, Apweiler R, Blatter MC, Estreicher A, Gasteiger E, Martin MJ, Michoud K, O'Donovan C, Phan I, Pilbout S, Schneider M (2003). The SWISS-PROT protein knowledgebase and its supplement TrEMBL in 2003. Nucleic Acid Res. 31:365-370. Chang Y, Liu C, Huang F, Lo T (1992). The primary structures of growth hormones of three cyprinid species: Bighead carp, silver carp, and grass carp. Gen. Comp. Endocrinol. 87: 385- 393. Chen Y, Wang Y, He S, Zhu Z (2004). Cloning and sequencing of the growth hormone gene of large yellow croaker and its phylogenetic signiicance. Biochem. Genet. 42: 365-375. Chen WY, Chen NY, Yun J, Wight DC, Wang XZ, Wagner TE, Kopchick JJ (1995). Amino acid residues in the third alpha-helix of growth hormone involved in growth promoting activity. Mol. Endocrinol. 9(3): 292-302. Colovos C, Yeates TO (1993). Verification of protein structures: Patterns of nonbounded atomic interections. Prot. Sci. 2: 1511-1519. Copelandet KC, Nair KS (1994). Acute growth hormone effects on amino acid and lipid metabolism. J. Clin. Endocrinol. Metabol. 78: 1040-1047. Corin RE, Guller S, Wu KY, Sonenberg M (1990). Growth hormoneinduced antimitogenic state in 3T3-F442A preadipose cells. Proc. Natl. Acad. Sci. USA. 87: 7507-7511. Degani G, Tzhori I, Yom-Din S, Goldberg D, Jackson K (2003). Growth differences and growth hormone expression in male and female European eels (Anguilla anguilla (L.) Gen. Comp. Endocrinol. 134: 88-93. Duan C (1998). Nutritional and developmental regulation of insulin-like growth factors in fish. J. Nutr. 128: 306S-314S. Eck RV, Dayhoff MO (1966). Atlas of protein sequence and structure. National Biomedical Research Foundation, Silver Spring, Maryland, USA. Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen MY, Pieper U, Sali A (2006). Comparative Protein Structure Modelling Using MODELLER. Ed: Coligan JE, Dunn BM, Speicher DW, Wingfield PT. Curr. Protocols Protein Sci. Unit, 2(9): 1-31. Felsenstein J (1985). Confidence limits on phytogenies: An approach using the bootstrap. Evolution, 39: 783-791. Fiser A, Do RK, Sali A (2000). Modelling of loops in protein structures. Prot. Sci. 9: 1753-1773. Fiser A, Sali A (2003). ModLoop: automated modelling of loops in protein structures. Bioinformatics, 18: 2500-01. Garlick PJ (2005).The role of leucine in the regulation of protein metabolism. J. Nutr. 135: 1553S-156S. Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, Bairoch A (2005). Protein Identification and Analysis Tools on the ExPASy Server; (In) John M. Walker (ed). The Proteomics Protocols Handbook, Humana Press, pp. 571-607. Giorgetti A, Raimondo D, Miele AE, Tramontano A (2005). Evaluating the usefulness of protein structure models for molecular replacement. Bioinformatics, 21(2): 72-76 Gomez JM, Loir M, Le Gac F (1998). Growth hormone receptors in

testis and liver during the spermatogenetic cycle in rainbow trout (Oncorhynchus mykiss). Biol. Reprod. 58: 483-491. Harvey S, Scanes CG. Daughaday WH (1995). Growth Hormone. CRC Press, Boca Raton, FL. Hershberger WK, Myers JM, Lwamto RN, Mcaulley WC, Saxton AM (1990). Genetic changes in the growth of coho salmon (Oncorhynchus kisutch) in marine net-pens, produced by ten years of selection. Aquaculture, 85(4): 187-197. Higgins D, Thompson J, Gibson T, Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acid Res. 22:4673-4680. Hofacker IL, Bernhart SH, Stadler PF (2004). Alignment of RNA base pairing probability matrices. Bioinformatics, 20(14): 2222-2227. Hong Y, Schart M (1993) Sequence of the growth hormone ( GH) gene from the silver carp (Hypophthalmichthys molitrix) and evolution of GH genes in vertebrates. Biochimica et Biophysica Acta, 1174: 285-288. Jones DT, Taylor WR, Thornton JM (1992). The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 8: 275-282. Kocour M, Kohlmann K (2011). Growth hormone gene polymorphisms in tench, Tinca tinca L. Aquaculture, 310: 298-304. Koren Y, Sarid S, Ber R, Daniel V (1989). Carp growth hormone: Molecular cloning and sequencing of cDNA. Gene, 77: 309-315. Kouranov A, Xie L, de la Cruz J, Chen L, Westbrook J, Bourne PE, Berman HM (2006). The RCSB PDB information portal for structural genomics. Nucleic Acid Res. Jan. 1; 34(Database issue): D302-305. Kyte J, Doolittle R (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105-132. Laskowski RA, Watson JD, Thornton JM (2003). From protein structure to biochemical function. J. Struct. Funct. Genomics, 4: 167-177. Lassmann T, Sonnhammer EL (2005). Automatic assessment of alignment quality. Nucleic Acid Res. 33(22): 7120-7128. Marins L, Levy J, Folch J, Sanchez A (2003). A growth hormone-based phylogenetic analysis of euteleostean ishes including a representative species of the Atheriniformes Order, Odontesthes argentinensis. Genet. Mol. Biol. 26: 295-300. Marti-Renom MA, Stuart A, Fiser A, Sánchez R, Melo F, Sali A (2000). Comparative protein structure modelling of genes and genomes. Annu. Rev. Biophys. Biomol. Struct. 29: 291-325. Martí-Renom MA, Yerkovich B, Sali A (2002). Comparative protein structure prediction. John Wiley & Sons, Inc. Curr. Protocol. Prot. Sci. 1: 291-2922. McCormick SD (2001). Endocrine control of osmoregulation in teleost fish. Am. Zool. 41: 781-794. Moore D, Walter M, Diamond D, Conkling M, Goodman H (1982). Structure, expression and evolution of growth hormone genes. Rec. Prog. Horm. Res. 38: 197-225. Moriyama S, Oda M, Takahashi A, Sower SA (2006). Genomic structure of the sea lamprey growth hormone encoding gene. Gen. Comp. Endocrinol. 148: 33-40. Nei M, Kumar S (2000). Molecular evolution and phylogenetics. Oxford Univ. Press, Oxford. Pearson WR (1990). Rapid and Sensitive Sequence Comparison with FASTP and FASTA. Method Enzymol. 183: 63-98. Pearson WR (1991). Searching protein sequence libraries: comparison of the sensitivity and selectivity of the Smith-Waterman and FASTA algorithms. Genomics, 11(3): 635-50. Pearson WR, Lipman DJ (1988). Improved Tools for Biological Sequence Comparison. Proc. Natl. Acad. Sci. 85: 2444-2448. Pe´rez-Sa´nchez J, Calduch-Giner JA, Mingarro M, Vega-Rubı´n de Celis S, Go´mez-Requeni P, Saera-Vila A, Astola A, Valdivia MM (2002). Overview of fish growth hormone family. New insights in genomic organization and heterogeneity of growth hormone receptors. Fish Physiol. Biochem. 27: 243-258. Perriquet O, Touzet H, Dauchet M (2003). Finding the common structure shared by two homologous RNAs. Bioinformatics, 19: 108116. Peter RE, Chang JP, Nahorniak CS, Omeljaniuk RJ, Sokolowska M, Shih SH, Billard R (1986). Interactions of catecholamines and GnRH.

Baruah et al.

in regulation of gonadotropin secretion in teleost fish. Recent. Prog. Horm. Res. 42: 513-548 Pinheiro JS, Wolff J, AraĂşjo R, Hilsdorf A (2008). Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus). Genet. Mol. Biol. 31: 381-384. Peterson EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin, TE (2004). UCSF Chimera - A Visualization System for Exploratory Research and Analysis. J. Comput. Chem. 25: 16051612. Posada D, Crandall KA (1998). MODELTEST: testing the model of DNA substitution. Bioinformatics, 14: 817-818. Rahman MA, Mak R, Ayad H, Smith A, Maclean N (1998). Expression of a novel piscine growth hormone gene results in growth enhancement in transgenic tilapia (Orechromis niloticus). Transgen. Res. 7: 357-369. Ramachandran GN, Sasisekharan V (1968). Conformation of Polypeptides and Proteins. Adv. Protein. Chem. 23: 283-437. Rhodes C, Yamada Y (1995). Characterization of a glucocorticoid responsive element and identification of an AT-rich element that regulate the link protein gene. Nucleic Acids Res. 23(12): 2305-2313. Sakamoto T, Shepherd BS, Madsen SS, Nishioka RS, Siharath K, Richman NH, Grau EG (1997). Osmoregulatory actions of growth hormone and prolactin in an advanced teleost. Gen. Comp. Endocrinol. 106: 95-101. Sali A, Blundell TL (1993).Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234: 779-815. Sayle R, Milner-White EJ (1995). Rasmol: biomilecular graphics for all. Trends Biochem. Sci. 20: p. 374. Scanes CG, Campbell (1995). (In) Growth Hormone (Ed. Harvey S, Scanes CG, Daughaday WH). CRC Press, Boca Raton, FL. pp. 2537. Sciara AA, Rubiolo JA, Somoza GM, Arranz SE (2006). Molecular cloning, expression and immunological characterization of pejerrey (Odontesthes bonariensis) growth hormone. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 142: 284-292. Somvanshi P, Singh V, Seth PK (2008). Phylogenetic and computational proteomes analysis of Influenza A virus subtype H5N1. Int. J. Genomics Proteomics, 3(2): p. 15. Stacey NE, Mackenzie DS, Marchant TA, Kyle AL, Peter RE (1984) Endocrine changes during natural spawning in the white sucker, Catostomus commersoni. I. Gonadotropin, growth hormone, and thyroid hormones. Gen. Comp. Endocrinol. 56(3): 333-348. Sumpter JP, Lincoln RF, Bye VJ, Carragher JF, Bail Le PY (1991). Plasma growth hormone levels during sexual maturation in diploid and triploid rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 83(1): 103-10. Tamura K (1992). Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C content biases. Mol. Biol. Evol. 9(4): 678-687.

8021

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol. doi: 10.1093/ molbev/msr121. Thompson JD, Higgins DG, Gibson TJ, (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acid Res. 22: 4673-4680. Timothy JG, Jean-Jacques F, Jonathan LM (2004). AU-rich elements and the control of gene expression through regulated mRNA stability. Anim. Health Res. Rev. 5: 49-63. Tiziana C, Paolo D'Onorio DM, Domenico C, Talamo IG, Tramontano A (2006). The PMDB Protein Model Database CASPUR, Nucleic Acid Res. 2006 34(Database Issue): D306-D309. Trudeau VL (1997). Neuroendocrine regulation of gonadotropin II release and gonadal growth in the goldfish Carassius auratus. Rev. Reprod. 2: 55-68. Wuyts J, Van de PY, Winkelmans T, De Wachter R (2002). The European database on small subunit ribosomal RNA. Nucleic Acid Res. 30: 183-185. Xu B, Moriyama S, Zhang PJ, Miao HZ (2001). The complete amino acid sequence of growth hormone and partial amino acid sequence of prolactin and somatolactin from sea perch (Lateolabrax japonicus). Aquaculture, 201: 117-136. Zemla A, Venclovas C, Moult J, Fidelis K (1999). Processing and analysis of CASP3 protein structure predictions Proteins, Suppl. 3: 22-29. Zhan X, Giorgianni F, Desiderio DM (2005). Proteomics analysis of growth hormone isoforms in the human pituitary. Proteomics, 5(5): 1228-1241. Zohar Y (1989). Endocrinology and fish farming: Aspects in reproduction, growth, and smoltification. Fish Physiol. Biochem. 7: 395-405. Zwieb C, Gorodkin J, Knudsen B, Burks J, Wower J (2003). tmRDB (tmRNA database). Nucleic Acid Res. 31: 446-447.

African Journal of Biotechnology Vol. 11(31), pp. 8022-8031, 17 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3407 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Plant regeneration studies of Jatropha curcas using induced embryogenic callus from cotyledon explants Tee Chong Siang1*, Siow Then Soong1 and Adeline Ting Su Yien2 1

Department of Biological Science, Faculty of Science, University Tunku Abdul Rahman, Jalan University, Bandar Barat, 31900 Kampar, Perak, Malaysia. 2 School of Science, Monash University, Jalan Lagoon Selatan, Bandar Sunway, 46150, Selangor Darul Ehsan, Malaysia. Accepted 30 January, 2012

A plant regeneration system for Jatropha curcas, a biofuel- producing plant, was established from the induced embryogenic callus. Cotyledon explants cultured on single auxin media were able to form callus. However, only the callus induced from cotyledon explants using Murashige and Skoog (MS) medium containing 0.8 mg l-1 dicamba was embryogenic. The somatic embryos were suitable to be proliferated using phytohormone- free woody plant medium (WPM). Two somatic embryo regeneration methods were studied and the direct somatic embryos plant regeneration method using the media containing 0.3 mg l-1 6-benzylaminopurine (BAP) and 0.4 mg l-1 gibberellic acid (GA3) was more effective, 83.3 and 73.33% plant regeneration, respectively. The other method that needed to mature the somatic embryos prior to plant regeneration from the phytohormone- free MS medium was not preferred, less than 40% plant regeneration. In conclusion, an efficient plant regeneration system for J. curcas was established through somatic embryogenesis. Keywords: Jatropha curcas , cotyledons, callus , somatic embryogenesis , plant regeneration.

INTRODUCTION Jatropha curcas, belonging to Euphorbiaceae family, is a perennial, deciduous and oil-bearing shrub. It is originated from South America and can now be found in subtropical and tropical regions of African countries and Asia including Malaysia. Traditionally, J. curcas is mainly grown for making soaps, fencing live animals and reclaiming wasteland (Openshaw, 2000). J. curcas is now popularly grown for high content of non-edible oil in the seeds that is suitable for biofuel production (Chhetri et al., 2008). Attributed to its incredible value which is profusely acknowledged, large cultivation of J. curcas is inevitable at large marginal plantations in worldwide. However, conventional propagation is often limited to be used to mass propagate the desired elite plants to meet the high

*Corresponding author. E-mail: teecs@utar.edu.my. Fax: + (605)466 1676. Abbreviations: MS, Murashige and Skoog; WPM, woody plant medium; BAP, N-6-benzylaminopurine; GA3, gibberellic acid; ABA, abscisic acid; PEG 6000, polyethylene glycol 6000.

demand of planting materials. Hence, micropropagation could provide an alternative way for mass propagation. Somatic embryogenesis, a powerful micropropagation tool, has been widely applied to many plant species for mass propagation of planting materials. It had been applied to many important economical crops, such as rice (Sahrawat and Chand, 2001), wheat (Filippov et al., 2006), potato (JayaSree et al., 2001), oil palm (Rajesh et al., 2003), sesame (Mary and Jayabalan, 1997), to ensure the continuous supply of plants for plantations. For J. curcas, reported somatic embryogenesis studies are still limited although plant regeneration through organogenesis using different explants such as leafdiscs (Deore and Johnson 2008), axillary nodes (Sujatha et al. 2005) and shoot tips (Rajore and Batra 2005) were reported. Hence, it is important to study and develop an efficient somatic embryo regeneration protocol for efficient propagation and genetic manipulation programmes in future. Different plant species require different in vitro cultural conditions for initiation of somatic embryogenesis. Studies of auxins and cytokinins separately or in their

Siang et al.

combinations to initiate somatic embryogenesis such as in wheat (Filippov et al., 2006), cassava (Ma, 1998) and sesame (Mary and Jayabalan, 1997) were reported. As for J. curcas, the leaf explants were used to induce somatic embryos using the medium containing cytokinin (Jha et al., 2007). Despite this, it is still necessary to investigate plant regeneration system of J. curcas to improve the somatic embryo plant regeneration efficiency. In addition, plant tissue culture is genotype dependent and the effect of phytohormones on somatic embryogenesis varies depending on the type of explants investigated. Low frequency of plant regeneration from somatic embryos is a concern in somatic embryogenesis (Maruyama et al., 2005). In most of the studies, plant recovery from somatic embryos faced problems such as abnormal embryo formation (Singh and Hazra, 2009), low embryo maturation (Sunderlikova and Wilhelm, 2002) and precocious germination of somatic embryos (GarciaMartin et al., 2001). Different improvement strategies were attempted by researches in order to enhance the recovery of plants from somatic embryos by using exogenous phytohormones (Sunderlikova and Wilhelm, 2002) or osmoticums (Stasolla and Yeung, 2003; Yildirim et al.; 2006; Rai et al., 2007). In this study, we reported the induction of embryogenic callus, multiplication of somatic embryos on the suitable medium and approaches to enhance somatic embryo regeneration system. MATERIALS AND METHODS Plant materials and seed sterilisation Mature seeds were dehulled and used. Seeds were dehulled and washed with 30% (v/v) Clorox® for 15 min and followed by another washing with 20% (v/v) Clorox® for 10 min. Two drops of Tween 20 were added during each washing and the tissues were rinsed twice with sterile distilled- water for 2 min after each washing. After washing, the dehulled seeds were immersed in absolute ethanol for 1 min and then rinsed twice with sterile distilled- water for 2 min. Cotyledon tissues were cut into 3 x 3 mm in size and cultured on the medium.

8023

indolebutyric acid (IBA), 2,4-dichlorophenoxyacetic acid (2,4-D), 4amino-3,5,6-trichloropicolinic acid (picloram) and 3,6-dichloroanisic acid (dicamba) at various concentrations (0.4, 0.8, 1.2 and 1.6 mg l1 ). The pyhtohormone- free MS medium was used as control. Triplicate with 15 explants for each treatment were used and this study was repeated twice. The percentage of callus induction was recorded after four weeks.

Proliferation of somatic embryos Calli induced from cotyledon explants in the MS medium containing 0.8 mg l-1 dicamba turned embryogenic after subculturing the newly-emerged callus into the same medium. These embryogenic calli were used in this study. Approximately 0.2 g of embryogenic calli were weighed and cultured on the phytohormone-free halfstrength and full- strength MS and woody plant medium (WMP). Triplicate with a total of nine clumps of the weighed embryogenic calli were used for each treatment. The induction medium (MS containing 0.8 mg l-1 dicamba) was used as control. Somatic embryos at different developmental stages were grouped, quantified and recorded based on their morphologies after two weeks of culture and the study was repeated twice.

Plant regeneration from somatic embryos Two approaches were used in this study. For the first approach, somatic embryos at late cotyledonary stage were cultured on the MS medium supplemented with polyethylene glycol 6000 (PEG 6000) at different concentrations, 2, 4, 6 and 8% (w/v). Besides, ABA at various concentrations, 0.6, 1.2, 1.8 and 2.4 mg l-1, were also investigated. The percentage of embryo maturation (leaflets greening) was recorded after two weeks and the matured somatic embryos were transferred to phytohormone- free MS medium for plant regeneration. Percentage of plant regeneration (somatic embryos with elongated shoots and root formation) was recorded after two weeks. Triplicate with a total of fifteen somatic embryos were used for each treatment and the study was repeated twice. Somatic embryos without treated with ABA and PEG 6000 were used as control. For second approach, 6-benzylaminopurine (BAP) and GA3 were used to investigate somatic embryo regeneration. Somatic embryos at late cotyledonary stage were cultured on MS medium containing BAP at various concentrations, 0.1, 0.2, 0.3 and 0.4 mg l-1. For GA3, the concentrations investigated were 0.2, 0.4, 0.6 and 0.8 mg l-1. The percentage of plant regeneration (somatic embryos with elongated shoots and root formation) was recorded after two weeks. Triplicate with 15 embryos for each replicate were used and the study was repeated twice.

Medium preparation and culture conditions Murashige and Skoog medium (Murashige and Skoog, 1962) and woody plant medium (Lloyd and McCown 1980) were used in this study. All media were added with 3% (w/v) sucrose and 0.28% (w/v) gelrite. The pH of the medium was adjusted to 5.8 prior to autoclaving at 121°C and 15 psi for 15 min. Abscisic acid (ABA) and gibberillic acid (GA3) were filter-sterilised prior to use. All cultures were kept at 25 ± 1°C with 16 h photoperiod (1000 lux) and 8 h darkness.

Histological analyses Embryogenic calli and different stages of somatic embryos were fixed in fixative solution, formalin-acetic acid-alcohol (FAA) in ratio of 1:1:18, for 24 h. The tissues were then dehydrated in a gradual series of tertiary-butyl alcohol (TBA) solutions. After that, specimens were embedded in paraffin wax and sectioned to 8 to 10 µm thicknesses using a microtome (Leica RM 2235, Germany), mounted on the slides and stained with 0.5% (w/v) of haematoxylin and eosin. The stained samples were observed under light microscope (Leica CME, Germany).

Initiation of callus for somatic embryo induction Sterilised cotyledon explants were cultured on MS medium supplemented with single auxin. Auxins investigated in this study were 1-naphthylacetic acid (NAA), 3-indoleacetic acid (IAA), 3-

Statistical analyses Data recorded were analyzed using one-way analysis of variance

Afr. J. Biotechnol.

Callus induction (%)

8024

45 40 35 30 25 20 15 10 5 0

a a

ab ab ab

bb bc c

NAA

IAA

b bcbc

c c IBA

2,4-D

c c

picloram

dicamba

Auxin 0 mg/l

0.4 mg/l

0.8 mg/l

1.2 mg/l

1.6 mg/l

Figure 1. Effects of single auxins on callus induction using cotyledon explants. Mean values followed by same letters are not significantly different according to Tukey’s HSD test at P = 0.05. Bars indicate standard errors. HSD, Honestly significant difference.

Figure 1. Effects of single auxins on callus induction using cotyledon explants.

values followed by same letters are not significantly different according to Tukey’s (ANOVA) in SPSS 15.0 software (SPSS Inc. USA). Significant differences between groups were compared using Tukey’s honestly significant difference (HSD) test at significance level of 0.05.

test at P = 0.05. Bars

RESULTS Induction of callus and somatic embryos The response of cotyledon explants to various auxins on callus formation was different. Results showed that single auxin, IBA, 2, 4- D, picloram and dicamba, were suitable for callus induction from cotyledon explants. The highest callus induction, 31.1%, was obtained from the MS -1 medium containing 0.8 mg l dicamba and followed by -1 28.9% from the MS medium containing 0.8 mg l 2,4- D (Figure 1). Significant decrement of callus induction was -1 observed when higher concentration (1.6 mg l ) of -1 dicamba and lower concentration (0.4 mg l ) of 2,4-D were used. Besides, no callus was induced when MS media containing NAA and IAA and the control medium were used. Among all callus induction media investigated, the MS -1 medium containing 0.8 mg l dicamba was embryogenic. The embryogenic callus was obtained from the newlyformed callus (Figure 2A) emerged from the old callus cultures on the MS medium containing 0.8 mg l-1 dicamba

after subculturing. The embryogenic callus was friable, creamy and pale yellow in colour (Figure 2B) and able to be multiplied by subculturing at one month interval. Somatic embryos (Figure 2C) were formed and observed from the embryogenic calli. From histological examinations, proembryogenic mass (PEM) was observed on the embryogenic tissues (Figure 2D) indicating the differentiation of callus tissues forming somatic embryos. Proliferation of somatic embryos The somatic embryo induction medium was not suitable for proliferation of somatic embryos as shown in Figure 3 in which the number of somatic embryos for each stage obtained was significantly lower than all other media investigated. In contrast, media without addition of dicamba were found to be suitable for proliferation of somatic embryos. However, the number of somatic embryos (at different developmental stages) obtained varied when cultured on different media (Figure 3). Among all proliferation media investigated, full-strength WPM was more suitable for proliferation of somatic embryos. The most abundant globular embryos (331.12 per gram of embryogenic callus), heart-shape (268.33 per gram of embryogenic callus), torpedo (198.13 per gram of embryogenic callus) and cotyledonary embryos

Siang et al.

Figure 2. Induction of somatic embryos from cotyledon explants. A, The newly-formed embryogenic-like calli (arrow) from old callus culture; B, embryogenic-like calli; C, somatic embryos (arrow) obtained from the embryogenic calli; D, histological observation on cross-sectioned embryogenic calli shows the proembryogenic mass (PEM) (arrow). Scale bars = 5 mm.

Figure 3. Effects of different media formulations on the proliferation and deveopment of somatic embryos. Mean values followed by same letters are not significantly different according to Tukeyâ&#x20AC;&#x2122;s HSD test at P = 0.05. Bars indicate standard errors. HSD, Honestly significant difference.

8025

8026

Afr. J. Biotechnol.

Figure 4. Different stages of somatic embryo plant regeneration. A, Somatic embryos; B, different developmental stages (a = globular, b = heart-shaped, c = torpedo, d = cotyledonary stage) of somatic embryos; C, cross-section of a globular embryo; D, longitudinal-sectioned of a torpedo embryo show the formation of shoot meristerm (sm), root meristem (rm) and procambium tissue (pt); E, leaf primidia (lp) and root cap (rc) derive from root meristerm (rm) are later observed on the longitudinal-sectioned cotyledonary embryo; F, the longitudinalsectioned cotyledonary embryo also shows the shoot apex (sa) protoderms (p) and vascular strands (vs); G, a matured embryo; H, germination of a somatic embryo; I, a regenerated plantlet.

(118.90 per gram of embryogenic callus) were obtained using full-strength WPM. Globular embryos were the most abundant stage of embryos obtained and followed by heart-shape, torpedo embryos and cotyledonary

embryos. On all the proliferation media investigated, repetitive embryogenesis was observed (Figure 4A) and it was a feature of spontaneous proliferation of somatic embryos.

Siang et al.

Various developmental stages of somatic embryos (Figure 4B) were obtained and they were distinguished based on morphologies after two weeks on proliferation media. Histological analysis showed the intense actively dividing cells appeared during the globular stage (Figure 4C). For the torpedo embryos, differentiated tissues such as shoot and root meristerms and procambium tissues were observed (Figure 4D). At late cotyledonary stage (Figures 4E to F), structures such as root cap, leaf primodia, shoot apex, vascular strand and protoderms were observed. Plant regeneration study Due to low frequency of somatic embryos which were regenerated into plantlets on all the proliferation media investigated, somatic embryos were matured in the medium containing either ABA or PEG 6000 prior to plant regeneration. Our study found that matured somatic embryos (Figure 4G) were obtained after treated with ABA and PEG 6000. In general, matured somatic embryos obtained from different maturation media were able to germinate into plantlets (Figure 4I) on the phytohormone- free MS medium after two weeks. High embryo maturation, 77.8 and 62.2%, were obtained on the MS medium containing 0.6 mg l-1 ABA (Figure 5A) and 4% PEG 6000 (Figure 5B), respectively. In contrast, embryo maturation was found to be significantly low in the control medium. However, efficacy of obtaining matured somatic embryos was not significantly different among the concentrations investigated in this study for both ABA and PEG 6000. For plant regeneration, our results showed that the highest plant regeneration, 35.6% (Figure 5A), was obtained from the MS medium containing 0.6 mg l-1 ABA. On the other hand, the medium containing PEG 6000 achieved the highest plant regeneration (28.9%) at the concentration of 6% (Figure 5B). No significant different in plant regeneration was observed among the concentrations investigated for both ABA and PEG 6000 treated somatic embryos. However, plant regeneration frequency was significantly higher than that of the untreated somatic embryos from the control medium. In general, the matured somatic embryos obtained from different maturation media were able to germinate into plantlets after transferring to phytohormone- free MS medium. Besides, the induced somatic embryos (at cotyledonary stage) were able to directly regenerate into plantlets after two weeks cultured on the MS media containing BAP and GA3. The results show that the highest plant regeneration, 83.3%, was obtained from the MS medium containing 0.3 -1 mg l BAP while 73.3% plant regeneration was obtained from the MS medium containing 0.4 mg l-1 GA3 (Figure 6). No significant different on the plant regeneration frequency among the concentrations investigated for both

8027

BAP and GA3 was observed. Somatic embryo plant regeneration was significantly low in the control medium. In general, more than 60% plant regeneration was achieved from the medium containing BAP and GA3 regardless of the concentration used. After four weeks, the regenerated somatic embryos with newly developed leaves were observed on the MS medium containing BAP or GA3. Plant regeneration was more efficient when the somatic embryos were directly cultured on the MS medium containing BAP or GA3 than the somatic embryos that were treated with ABA or PEG 6000. The duration for obtaining regenerated plantlets was also shortened, two weeks was required instead of four weeks by using embryo maturation approach. DISCUSSION Induction and proliferation of somatic embryos A number of approaches had been used to achieve plant regeneration via somatic embryogenesis in many plant species. Jha et al. (2007) reported somatic embryogenesis of J. curcas from leaf tissues using single cytokinin, kinetin. In our study, somatic embryos of J. curcas were obtained from cotyledon-derived calli in the medium containing dicamba. In general, young tissues such as cotyledon tissues possess higher regeneration ability (Hoque and Mansfield, 2004; Prakash and Gurumurthi, 2010) and are suitable to be used as explants for initiation of embryogenic callus. Cotyledon tissues had also been successfully used for induction of somatic embryogenesis for many woody plant species such as Dalbergia sissoo Roxb (Singh and Chand, 2003), Azadirachta indica (Gairi and Rashid, 2005) and Protea cynaroides (Wu et al., 2007). In this study, embryogenic callus was initiated after subculturing the induced calli on the induction medium containing dicamba. According to Michaux-Ferriere and Carron (1989), a suitable subculturing time is important to initiate somatic embryogenesis from the callus. Dicamba was also used to induce somatic embryogenesis of several Triticum sp. (Filippov et al., 2006). Other than dicamba, single auxins such as NAA, IAA, IBA, 2, 4- D and picloram were also able to induce somatic embryogenesis of Myrtus communis (Canhoto et al., 1999) and Sesamum indicum (Mary and Jayabalan, 1997). In contrast to our study, Kalimuthu et al. (2007) reported a direct embryogenesis of J. curcas using cotyledon tissues in the medium containing BAP; however, plantlet regeneration and somatic embryo multiplication were not reported in their studies. The role of auxin is subjected to change after embryogenesis is induced. Less auxin is required as somatic embryos begin to synthesize their own auxins for proliferation (Zimmerman, 1993). Hence, the media without phytohormones were used for proliferation of

8028

Afr. J. Biotechnol.

Percentage (%)

60 50

a a

30 B

10 0 0 mg/l

0.6 mg/l

1.2 mg/l

1.8 mg/l

2.4 mg/l

Abscisic acid (mg/l) Plant regeneration Maturation

B Figure 5. Effects of (A) abscisic acid and (B) polyethylene glycol 6000 on embryo maturation and plant regeneration. Mean values between groups followed by same letters are not significantly different according to Tukeyâ&#x20AC;&#x2122;s HSD test at P = 0.05. Bars indicate standard errors. HSD, Honestly significant difference.

somatic embryos while reducing the chance of obtaining somaclonal variation of somatic embryos (Pinto et al., 2008). Similarly, the phytohormone- free medium was used in proliferation of somatic embryos in this study. In our study, proliferation of embryos was more efficient on the full-strength WPM. This probably attributed to the salt content of WPM used was suitable for proliferation and development of different stages of somatic embryos. Similar studies from Fisichella et al. (2000) and Kintzios et al. (2001) also showed that different salt contents supplemented into the medium would influence the

development and proliferation of somatic embryos. Plant regeneration from somatic embryos Embryo maturation is an essential phase during embryogenesis in which the synthesis of storage reserves such as starch, lipids, and proteins occurred (Sunderlikova and Wilhelm, 2002). Jha et al. (2007) used the medium containing combinations of adenine sulphate, kinetin and IBA to mature J. curcas somatic embryos. However, less

Siang et al.

8029

100 ab

Plant regeneration (%)

70 60 50 40 30 20

10 0 GA3

-10

Plant growth regulator 0 mg/l

0.2 mg/l

0.4 mg/l

0.6 mg/l

0.8 mg/l

A 100

Plant regeneration (%)

60 50 40 30 20

10 0 BAP Plant growth regulator 0 mg/l

0.1 mg/l

0.2 mg/l

0.3 mg/l

0.4 mg/l

B Figure 6. Effects of (A) GA3 and (B) BAP on direct plant regeneration from somatic embryos. Mean values between groups followed by same letters are not significantly different according to Tukeyâ&#x20AC;&#x2122;s HSD test at P = 0.05. Bars indicate standard errors. HSD, Honestly significant difference; BAP, N-6benzylaminopurine; GA3, gibberellic acid.

than 50% matured somatic embryos were obtained, the plantlets recovery from the matured somatic embryos was low (20%) and the duration required for plant regeneration was about six weeks in their study. In contrast, a higher percentage of matured somatic embryos was obtained in this study, 77.8% from the -1 medium containing 0.6 mg l ABA. Plant regeneration from somatic embryos was also higher after pre-culturing them on the MS medium containing 0.6 mg l-1 ABA (35.6%). The duration required for the cotyledonary stage

somatic embryos regenerated into plantlets was about four weeks. Besides, plant regeneration was improved by directly culturing the somatic embryos on the MS medium containing 0.3 mg l-1 BAP (83.3%) and 0.4 mg l-1 GA3 (73.3%). The beneficial effect of BAP was further evident when somatic embryogenesis of J. curcas was able to directly achieve (Kalimuthu et al. 2007). The plant regeneration duration required was shortened to two weeks by excluding maturation phase using ABA or PEG in this study.

8030

Afr. J. Biotechnol.

Thus, BAP and GA3 were more suitable for direct plant regeneration from somatic embryos in our study. In contrast, Yildirim et al. (2006) and Zhang et al. (2007) reported plant regeneration from somatic embryos was enhanced by adding ABA or PEG or combination of ABA and PEG. Efficiency of somatic embryos regeneration could be due to the effects of different genotypes used as J. curcas might be very genotype dependent and somatic embryos were originated from different types of explants. In other studies, BAP and GA3 were able to directly regenerate somatic embryos by either supplementing individually or in combination into the medium for somatic embryo germination of Centella asiatica (Paramageetham et al., 2004), Catharanthus roseus (Junaid et al., 2006) and Protea cynaroides (Wu et al., 2007). In brief, this study described the complete regeneration process of J. curcas via somatic embryogenesis. Our results suggest that somatic embryo maturation phase was not necesssary if somatic embryo regeneration was carried out using the media containing BAP and GA3.

ACKNOWLEDGEMENTS Authors are thankful to University Tunku Abdul Rahman for providing the research fund and facilities. REFERENCES Canhoto JM, Lopes ML, Cruz GS (1999). Somatic embryogenesis and plant regeneration in myrtle (Myrtaceae). Plant Cell Tissue Organ Cult. 57: 13-21. Chhetri AB, Tango MS, Budge SM, Watts KC, Islam MR (2008). Nonedible plant oils as new sources for biodiesel production. Int. J. Mol. Sci. 9: 169-180. Deore AC, Johnson TS (2008). High-frequency plant regeneration from leaf-disc cultures of Jatropha curcas L.: an important biodiesel plant. Plant Biotechnol. Rep. 2(1): 7-11. Filippov M, Miroshnichenko D, Vernikovskaya D, Dolgov S (2006). The effect of auxins, time exposure to auxin and genotypes on somatic embryogenesis from mature embryos of wheat. Plant Cell Tissue Organ Cult. 84: 213-222. Fisichella M, Silvi E, Morini S (2000). Regeneration of somatic embryos and roots from quince leaves cultured on media with different macroelement composition. Plant Cell Tissue Organ Cult. 63: 101107. Garcia-Martin G, Gonzalez-Benito M, Manzanera J (2001). Quercus suber L. somatic embryo germination and plant conversion: pretreatments and germination conditions. In Vitro Cell Dev. Biol. Plant 37: 190-198. Gairi A, Rashid A (2005). Direct differentiation of somatic embryos on cotyledons of Azadirachta indica. Biol. Plant. 49(2): 169-173. Hoque ME, Mansfield JW (2004). Effect of genotype and explant age on callus induction and subsequent plant regeneration from root-derived callus of Indica rice genotypes. Plant Cell, Tissue Organ Cult. 78: 217-223. JayaSree T, Pavan U, Ramesh M, Rao AV, Reddy KJM, Sadanandam A (2001). Somatic embryogenesis from leaf cultures of potato. Plant Cell Tissue Organ Cult. 64: 13- 17. Jha TB, Mukherjee P, Datta MM (2007). Somatic embryogenesis in Jatropha curcas Linn., an important biofuel plant. Plant Biotechnol. Rep. 1: 135-140.

Junaid A, Mujib A, Bhat MA, Sharma MP (2006). Somatic embryo proliferation, maturation and germination in Catharanthus roseus. Plant Cell Tissue Organ Cult. 84: 325-332. Kintzios S, Drossopoulos JB, Lymperopoulos CH (2001). Effect of vitamins and inorganic micronutrients on callus growth and somatic embryogenesis from leaves of chilli pepper. Plant Cell, Tissue Organ Cult. 67: 55-62. Kalimuthu K, Paulsamy S, Senthilkumar R, Sathya M (2007). In vitro Propagation of the Biodiesel Plant JatrophacurcasL. Plant Tissue Cult. Biotech.17(2): 137-147. Lloyd GB, McCown BH (1980). Commercially feasible micropropagation of mountain laurel (Kalmia latifolia) by use of shoot tip culture. Proc. Int. Plant Prop. Soc. 30: 421-427. Ma GH (1998). Effects of cytokinins and auxins on cassava shoot organogenesis and somatic embryogenesis from somatic embryo explants. Plant Cell Tissue Organ Cult. 54: 1-7. Maruyama E, Hosoi Y, Ishii K (2005). Somatic embryo production and plant regeneration of Japanese black pine (Pinus thunbergii). J. Forest Res. 10: 403-407. Mary RJ, Jayabalan N (1997). Influence of growth regulators on somatic embryogenesis in sesame. Plant Cell Tissue Organ Cult. 49: 67-70. Michaux-Ferriere N, Carron MP (1989). Histology of early somatic embryogenesis in Hevea brasiliensis: The importance of the timing of subculturing. Plant Cell Tissue Organ Cult. 19: 243-256. Murashige T, Skoog F (1962). A revised medium for growth and bioassay with tobacco tissue cultures. Plant Physiol. 15: 473-497. Openshaw K (2000). A review of Jatropha curcas: an oil plant of unfulfilled promise. Biomass Bioenergy, 19: 1-15. Paramageetham C, Babu GP, Rao JVS (2004). Somatic embryogenesis in Centella asiatica L. an important medicinal and neutraceutical plant of India. Plant Cell Tissue Organ Cult. 79: 19-24. Pinto G, Park YS, Silva S, Neves L, Araujo C, Santos C (2008). Factors affecting maintenance, proliferation, and germination of secondary somatic embryos of Eucalyptus globulus Labill. Plant Cell Tissue Organ Cult. 95: 69-78. Prakash MG, Gurumurthi K (2010). Effects of type of explant and age, plant growth regulators and medium strength on somatic embryogenesis and plant regeneration in Eucalyptus camaldulensis. Plant Cell Tissue Organ Cult. 100: 13-20. Rai MK, Akhtar N, Jaiswal VS (2007). Somatic embryogenesis and plant regeneration in Psidium guajava L. cv. Banarasi local. Sci. Hort. 113: 129-133. Rajesh MK, Radha E, Karun A, Parthasarathy VA (2003). Plant regeneration from embryo-derived callus of oil palm - the effect of exogenous polyamines. Plant Cell Tissue Organ Cult. 75: 41-47. Rajore S, Batra A (2005). Efficient plant regeneration via shoot tip explant in Jatropha curcas L. J. Plant Biochem. Biotechnol. 14: 73-75. Sahrawat AK, Chand S (2001). High-frequnecy plant regeneration from coleoptiles tissue of Indica rice (Oryza sativa L.). In Vitro Cell Dev. Biol. Plant, 37: 55-61. Singh AK, Chand S (2003). Somatic embryogenesis and plant regeneration from cotyledon explants of a timber-yielding leguminous tree, Dalbergia sissoo Roxb. J. Plant Physiol. 160: 415-421. Singh S, Hazra S (2009). Somatic embryogenesis from the axillary meristems of peanut (Arachis hypogaea L.). Plant Biotech. Rep. 3: 333-340. Stasolla C, Yeung EC (2003). Recent advances in conifer somatic embryogenesis: improving somatic embryo quality. Plant Cell Tissue Organ Cult. 74: 15-35. Sujatha M, Makkar HPS, Becker K (2005). Shoot bud proliferation from axillary nodes and leaf sections of non-toxic Jatropha curcas L. Plant Growth Regul. 47: 83-90. Sunderlikova V, Wilhelm E (2002). High accumulation of legumin and Lea-like mRNAs during maturation is associated with increased conversion frequency of somatic embryos from pedunculate oak (Quercus robur L.). Protoplasma, 220: 97-103. Wu HC, du Toit ES, Reinhardt CF (2007). A protocol for direct somatic embryogenesis of Protea cynaroides L. using zygotic embryos and cotyledon tissues. Plant Cell Tissue Organ Cult. 89: 217-224. Yildirim T, Kaya Z, Isik K (2006). Induction of embryogenic tissue and maturation of somatic embryos in Pinus brutia TEN. Plant Cell Tissue Organ Cult. 87: 67-76.

Siang et al.

Yildirim T, Kaya Z, Isik K (2006). Induction of embryogenic tissue and maturation of somatic embryos in Pinus brutia TEN. Plant Cell Tissue Organ Cult. 87: 67-76. Zhang CX, Li Q, Kong LS (2007). Induction, development and maturation of somatic embryos in Bungeâ&#x20AC;&#x2122;s pine (Pinus bungeana Zucc. ex Endl.). Plant Cell Tissue Organ Cult. 91: 273-280.

8031

Zimmerman JL (1993). Somatic embryogenesis: a model for early development in higher plants. Plant Cell. 5: 1411-1423.

Full Length Research Paper

Enhancement of the enzymatic hydrolysis of wheat straw by pretreatment with 1-allyl-3-methylimidazolium chloride ([Amim]Cl) Zhang Zhi-guo1,2 and Chen Hong-zhang2* 1

College of Chemistry and Chemical Engineering, Graduate University of the Chinese Academy of Sciences, Beijing, China. 2 National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, Beijing, China. Accepted 12 March, 2012

The enhancement of the enzymatic hydrolysis of lignocellulose by pretreatment is a key difficulty in biomass utilization. Wheat straw was treated with 1-allyl-3-methylimidazolium chloride ([Amim]Cl), and the morphology, enzymatic hydrolysis, recovery and the content of the composition of the treated wheat straw were investigated. Significant morphological change was observed when the wheat straw was heated at 150°C. When the temperature increased from 125 to 150°C, the glucose yield after enzymatic hydrolysis increased from 0.13 to 0.23 g/g (within 2 h). When the wheat straw was treated at 150°C for 6 h, the recovery of solid was only 23.9%, and the contents of cellulose, hemicellulose and lignin were 46.7, 10.8 and 24.2% respectively. It was concluded that heating with [Amim]Cl is an efficient pretreatment method; too intense treatment condition would induce degradation of wheat straw and the suitable condition of pretreatment is 150°C and 2 h. Key word: Ionic liquid, [Amim]Cl, wheat straw, pretreatment, cellulose, cellulase, enzymatic hydrolysis. INTRODUCTION Lignocellulose is the most abundant renewable biomass on earth. The utilization of lignocellulosic feedstocks such as forest and agricultural residues in environmental friendly way has been a highly active research area. For example, wheat straw has been seen as an important feedstock of cellulosic ethanol and other potential products (Chen and Qiu, 2010; Li and Chen, 2007; Taherzadeh and Karimi, 2008; Howard et al., 2003). Since the digestibility of native cellulose is hindered by some structural and compositional factors, pretreatment is necessary to achieve enzymatic degradation in production of ethanol and some other products with lingocellulose (Alvira et al., 2010).Many methods, including milling, steam explosion, irradiation and treatment with

*Corresponding author. E-mail: hzchen@home.ipe.ac.cn. Tel: +86-10-82627067. Fax: +86-10-82627071.

acid, have been introduced for pretreatment of lignocellulosic materials (Taherzadeh and Karimi, 2008). Ionic liquids (IL) are compounds composed entirely of ions, which are liquids at room temperature. Because of the negligible vapor pressure and high thermal stability (Li et al., 2010; Pârvulescu and Hardacre, 2007), it can be used as the reaction media for many processes (Castner et al., 2010; Dreyer and Kragl, 2008; Ma et al., 2010). Recently, some scientists and engineers have found that some ILs are valued solvent of cellulose, and they have attempted to treat the lignocellulose material with these liquids (Tadesse and Luque, 2011). For example, Liu and Chen (2006) found that the hydrolysis rate of wheat treated with [Bmim]Cl and microwave could reach 70.37%; Rogers et al. (2007) reported that not only cellulose, but also, wood can be dissolved in some ILs. Fort et al. (2007), Swatloski et al. (2002) and Dadi et al. (2006) reported that the initial enzymatic hydrolysis rates

Zhi-guo and Hong-zhang

were approximately 50-fold higher for regenerated cellulose (from [C4mim]Cl) as compared to untreated cellulose. Li et al. (2009) reported that the yield of reducing sugars from wheat straw pretreated with 1-ethyl3-methyl imidazolium diethyl phosphate ([Emim]DEP) reached 54.8% after being enzymatically hydrolyzed. 1Allyl-3-methylimidazolium chloride ([Amim]Cl) is IL designed and synthesized by Ren et al. (2003) and Zhang et al. (2005). They found that the [Amim]Cl is a good solvent for cellulose (Zhang et al., 2005). When cellulose is dissolved and regenerated from IL solution, the native structure would breakdown (Li et al., 2009), and [Amim]Cl might be used to treat the wheat straw and other lignocellulosic materials to enhance enzymatic hydrolysis. In this study, wheat straw was heated in [Amim]Cl. The morphology, enzymatic hydrolysis, recovery and the content of the composition of the treated wheat straw were investigated. MATERIALS AND METHODS Wheat straw was harvested from a local farmer in the suburb of Xinle, Hebei Province, China. The straw was comminuted to about 40 meshes with a plant disintegrator and extracted with ethanol/benzene (1/2, v/v) for 8 h in a Soxhlet apparatus. The extracted wheat straw flour was dried for 4 h at 105°C immediately before use. [Amim]Cl was synthesized using the method described by Ren et al. (2003) and Zhang et al. (2005). 1-Methylimidazole and allyl chloride (molar ratio 1:1.25) were added to a round-bottomed flask, heated at 55°C, and stirred for 8 h. The product was vacuum distilled to remove un-reacted chemicals reagent and water. Penicillium decumbens cellulase was provided by the Ningxia Cellulase Preparation Plant. Filter paper activity (FPA) was determined to be 110.0 IU/ml (Miller, 1959).

Treatment with [Amim]Cl Ten grams of [Amim]Cl and 0.5 g of wheat straw was heated in a round-bottomed flask at 100, 125 and 150°C and gently stirred with a magnetic stirrer. Then, 20 ml deionized water was added. The mixture was filtrated by millipore filtration (0.22 μm), and the obtained solid was washed with deionized water for three times.

Enzymatic hydrolysis The obtained solid after treatment with [Amim]Cl was dried at 105°C for 4 h. The dried solid was mixed with a sodium acetate buffer of pH 4.8 (20 ml buffer per g solid) and the P. decumbens cellulase (30 IU per g solid). Then, the mixture was incubated in a rotary shaker at 50°C and 170 rpm for 48 h. After the enzymatic hydrolysis, the glucose and xylose concentrations were assayed by high performance liquid chromatography (HPLC).

Compositional analysis Cellulose and hemicellulose of all samples were determined based

8033

on the standard NREL procedure No. 002 (NREL, 1996; Zhang et al., 2010). The sample was treated with 72% (v/v) sulphuric acid at 30°C for 1 h, followed by 4% dilute acid (w/w) at 121°C for 45 min. The glucose and xylose in the hydrolysate were determined by HPLC (Agilent, US) equipped with a refractive index detector (RID agilent, US) and an Aminex HPX-87H column (Bio-Rad). 5 mmol/L H2SO4 was used as the mobile phase. The flow rate of the mobile phase and the column temperature were maintained at 0.6 ml/min and 65°C. The cellulose and hemicellulose contents were calculated from glucose and xylose contents multiplied by conversion factors of 0.90 and 0.88, respectively (Zhang et al., 2010). The residual solid of hydrolysis was filtrate with a sand core filter (G 3) washed three times with deionized water. The washed solid was dried at 105°C for 4 h and then, burned at 575°C for 4 h with a muffle furnace. The content of lignin was calculated from the difference of the weight between before and after burning.

RESULTS AND DISCUSSION Morphology of the wheat straw treated with [Amim]Cl The wheat straw was heated in [Amim]Cl at 100 and 150°C. The morphology was observed with a microscope. Figure 1 shows that when the treatment time was 2 h at 100°C (Figure 1b), no significant change was found; when the heating time was 6 h (Figure 1c), the outline of the particles became blurred. At 150°C, the morphological change of the straw particles was more obvious after heating. When the treatment time was only 1 h (Figure 1d), the straw became curved, and when the heating time was extended to 6 h (Figure 1f), most of the particles disappeared. [Amim]Cl, a good solvent of cellulose, was designed by Zhang et al. (2005). They found that 14.5 weight % cellulose (dissolved pulp) or 8.0 wt % cotton linter can be dissolved in [Amim]Cl). When compared with the pure cellulose, it was difficult for the native lignocellulose to be dissolved by [Amim]Cl. However, Figure 1 shows that the straw can not be dissolved within 6 h, though the temperature was higher than 100°C. The reason might be that compact structure of wheat straw hinders the penetration of the IL. The figures suggested that temperature is a critical factor of the pre-treatment with [Amim]Cl. High temperature (≥150°C) induces significant changes in the morphology of wheat straw. Influence of treatment temperature on sugar yield of the enzymatic hydrolysis of wheat straw Wheat straw was treated with [Amim]Cl at 100, 125 and 150°C, and then regenerated with water. The recovered solid was hydrolysed with cellulase. The glucose and xylose yields were calculated and are shown in Figure 2. Figure 2 shows that the glucose yield of recovered solid increased with the treatment time at any temperature, and the yield on 150°C was much higher than those on

8034

Afr. J. Biotechnol.

Figure 1. Morphological changes of wheat straw during the treatment with [Amim]Cl. a, 100°C for 1 h; b, 100°C for 2 h; c, 100°C for 6 h; d, 150°C for 1 h; e, 150°C for 2 h; f, 150°C for 6 h.

100 and 125°C (Figure 2a). The xylose yield showed similar trend (Figure 2b). Li et al. (2009) investigated the pretreatment of wheat straw with [Emim]DEP. They found that when the temperature increased from 70 to 100°C, the hydrolytic effect increased considerably. In our study, the substantial increase stopped between 125 and 150°C. The difference might lie in the different solubility of the compounds of wheat straw in [Emim]DEP and [Amim]Cl. Since the content of cellulose in the treated wheat straw (heated for 2 h) was 38% (Figure 4), the maximum hydrolysis rate was 55.2%. Based on our findings, the effect was similar to the treatment of steam explosion at 1.5 MPa for about 10 min. The yields of glucose and xylose in Figure 2 suggest that when [Amim]Cl was used to treat wheat straw, high temperature (≥150°C) was more effective than low temperature. Influence of treatment temperature on recovery rate of wheat straw When wheat straw was heated in [Amim]Cl, high temperature resulted in not only the dissolution of cellulose but also the degradation of some compounds (Zhang et al., 2005). To study the influence of treatment temperature on the degradation of wheat straw, we heated the wheat straw at 100, 120 and 150°C in [Amim]Cl, and then regenerated it with deionized water. The recovery was calculated and is shown in Figure 3. It is found that when the treatment temperature was lower than 125°C, there was only little difference between

before and after 6 h treatment, while when the temperature was increased to 150°C, the recovery decreased to 23.9%. The data of the recovery in Figure 3 suggested that too intense condition would induce the degradation of wheat straw, though the treatment with [Amim]Cl can enhance enzymatic hydrolysis. The appropriate condition was at 150°C for 2 h. Since high temperature induced the decrease of the recovery of the wheat straw, it composition which is easy to be degraded should be investigated. In this study, wheat straw was treated with [Amim]Cl at 150°C. The contents of the compositions of the recovered solid were analysed. Figure 4 shows that when the wheat straw was treated with [Amim]Cl for 2 h at 150°C, all the content of the three compounds (cellulose, hemicellulose and lignin) increased slightly. The untreated wheat straw contained 35.1% cellulose, 22.7% hemicellulose and 16.1% lignin, while when the wheat straw was heated for 2 h, the contents of cellulose, hemicellulose and lignin were 38.4, 24.2 and 18.3%, respectively. Figure 3 shows that the straw was not significantly degraded when the straw was heated for 2 h, the reason for the increase in the contents of the three compounds might be that some other compounds such as pectin were degraded. When the wheat straw was treated for 6 h, the contents of cellulose, hemicellulose and lignin were 46.7, 10.8 and 24.2%. Because the recovery was only 23.9% when wheat straw was treated at 150°C for 6 h, all the three components in wheat straw were partly degraded in the condition. Since only the content of hemicellulose reduced, it was the most easily degradable component. The data in Figure 4 indicate that too intense condition

Zhi-guo and Hong-zhang

8035

Figure 2. Influence of treatment temperature on the enzymatic hydrolysis of straw. a, Glucose yield; b, xylose yield.

would result in the degradation of the compounds of straw (cellulose, hemicellulose and lignin), though enzymatic hydrolysis can be enhanced by treatment with [Amim]Cl, and the most easily degradable compound was the hemicellulose. Conclusions Wheat straw was heated in [Amim]Cl to enhance the enzymatic hydrolysis of cellulose. The morphology, enzymatic hydrolysis rate, the recovery and the content of the composition of the recovered solid were investigated. Significant morphological change was observed when the wheat straw was heated at 150째C. When the temperature increased from 125 to 150째C, the glucose yield of enzymatic hydrolysis was increased from

0.13 to 0.23 g/g. When the wheat straw was treated at 150째C for 6 h, the recovery of solid was only 23.9% because all the three main components of wheat straw (cellulose, hemicellulose and lignin) were partly degraded. It was concluded that treatment with [Amim]Cl is an efficient pretreatment method to enhance the enzymatic hydrolysis of wheat straw; too intense treatment condition would induce degradation of wheat straw and the most easily degradable component is hemicellulose. Heating at 150째C for 2 h is a suitable condition for the pretreatment. ACKNOWLEDGEMENTS This work was supported in part by the National Basic Research Program of China (973 Project, No.2011CB

8036

Afr. J. Biotechnol.

Figure 3. Recovery of wheat straw after treatment with [Amim]Cl and regeneration with water.

Figure 4. Content of cellulose, hemicellulose and lignin in wheat straw treated with [Amim]Cl at 150°C.

707401), the National Key Project of Scientific and Technical Supporting Program of China (No. 2011BAD22B02) and the President Fund of GUCAS (No. Y15101CYOO). REFERENCES Alvira P, Tomás-Pejó E, Ballesteros M, Negro MJ (2010). Pretreatment technologies for an efficient bioethanol production process based on enzymatic hydrolysis: A review. Bioresour. Technol. 101: 4851-4861. Castner JEW, Margulis CJ, Maroncelli M, Wishart JF (2010). Ionic liquids: structure and photochemical reactions. Annu. Rev. Phys. Chem. 62: 85-105. Chen HZ, Qiu WH (2010). Key technologies for bioethanol production from lignocellulose. Biotechnol. Adv. 28: 556-562.

Dadi AP, Varanasi S, Schall CA (2006). Enhancement of cellulose saccharification kinetics using an ionic liquid pretreatment step. Biotechnol. Bioeng. 95: 904-910. Dreyer S, Kragl U (2008). Ionic liquids for aqueous two phase extraction and stabilization of enzymes. Biotechnol. Bioeng. 99: 1416-1424. Fort DA, Remsing RC, Swatloski RP, Moyna P, Moyna G, Rogers RD (2007). Can ionic liquids dissolve wood? Processing and analysis of lignocellulosic materials with 1-n-butyl-3-methylimidazolium chloride. Green Chem. 9: 63-69. Li B, Filpponen I, Argyropoulos DS (2010). Dissolution of wood in ionic liquids. J. Agric. Food. Chem. 49: 3126-3136. Li DM, Chen HZ (2007). Biological hydrogen production from steamexploded straw by simultaneous saccharification and fermentation. Int. J. Hydrogen Energy, 32: 1742-1748. Li Q, He YC, Xian M, Jun G, Xu X, Yang JM, Li LZ (2009). Improving enzymatic hydrolysis of wheat straw using ionic liquid 1-ethyl-3methyl imidazolium diethyl phosphate pretreatment. Bioresource,

Zhi-guo and Hong-zhang

100: 3570-3575. Liu LY, Chen HZ (2006). Enzymatic hydrolysis of cellulose materials treated with ionic liquid [BMIM]Cl. Chin. Sci. Bull. 51: 2432-2436. Ma Z, Yu J, Dai S (2010). Preparation of inorganic materials using ionic liquids. Adv. Mater. 22: 261-285. Miller GL (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31: 426-428. NREL (1996). Technical report. Biomass analysis technology team laboratory analytical procedure. Golden. National Renewable Energy Laboratory. Howard RL, Abotsi E, Jansen van Rensburg EL, Howard S (2003). Lignocellulose biotechnology: issues of bioconversion and enzyme production. Afr. J. Biotechnol. 2: 602-619 P창rvulescu VI, Hardacre C (2007). Catalysis in Ionic Liquids. Chem. Rev. 107: 2615-2665. Ren Q, Wu J, Zhang J, He JS, Guo ML (2003). Synthesis of 1-allyl,3methylimidazolium-based room-temperature ionic liquid and preliminary study of its dissolving cellulose. Acta Polym. Sinica, 3: 448-451.

8037

Swatloski RP, Spear SK, Holbrey JD, Rogers RD (2002). Dissolution of cellose with ionic liquids. J. Am. Chem. Soc. 124: 4974-4975. Tadesse H, Luque R (2011). Advances on biomass pretreatment using ionic liquids: An overview. Energy Environ. Sci. 4: 3913-3929. Taherzadeh MJ, Karimi K (2008). Pretreatment of lignocellulosic wastes to improve ethanol and biogas production: a review. Int. J. Mol. Sci. 9: 1621-1651. Zhang H, Wu J, Zhang J, He J (2005). 1-Allyl-3-methylimidazolium chloride room temperature ionic liquid: a new and powerful nonderivatizing solvent for cellulose. Macromol.38: 8272-8277. Zhang H, Zheng R, Chen J, Huang H (2010). Investigation on the determination of lignocellulosices components by NREL method. Chin. J. Anal. Lab. 29: 15-18.

African Journal of Biotechnology Vol. 11(31), pp. 8038-8044, 17 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.051 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Oral vaccination with attenuated Salmonella choleraesuis C500 expressing recombinant UreB and CagA antigens protects mice against Helicobacter pylori J. G. Chen1, A. X. Liang1, L. Han1,2, J. J. Xiong1, A. Z. Guo2 and L. G. Yang1* 1

Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, P. R. China. 2 State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, P. R. China. Accepted 8 March, 2012

Helicobacter pylori are well known as the major gastro-duodenal pathogen of peptic ulcer disease and gastric cancer. Recombinant H. pylori vaccine comprising a single subunit antigen can only induce immune response with limited protection efficiency. Development of oral vaccine would be a new effective strategy for the prevention of H. pylori infection. In this study, the protective effect of H. pylori multicomponent vaccine consisting of UreB and CagA subunit antigens was constructed and investigated in mice. The UreB and CagA gene of H. pylori were inserted into the plasmid pYA3493 and expressed in attenuated Salmonella choleraesuis C500. The UreB and CagA producing strains were then administered orally to mice, contracting to Whole-cell vaccine against H. pylori SS1 infection, and the immune response was assessed by mice immunity IgG ELISA and H. pylori SS1 attack. Noticeable IgG response was induced in the sera of mice orally immunized with S. choleraesuis C500 strain consisting of UreB and CagA subunit antigens. Mice vaccinated orally were significantly protected against gastric Helicobacter infection following a challenge with H. pylori strain SS1. Orally vaccination with the expression of UreB-CagA could prevent gastric infection with H. pylori. Key words: Helicobacter pylor, orally vaccination, UreB and CagA subunit antigens, mice.

INTRODUCTION Helicobacter pylori is a Gram-negative bacterium, specialized in the colonization of the stomach (Warren and Marshall, 1983), and well known as the major gastroduodenal pathogen of peptic ulcer disease, mucosaassociated lymphoid tissue lymphoma, and gastric cancer (Blaser, 1995; Asaka, 1994; Graham, 1992; Michetti, 1997). Adhesion to the gastric epithelium and the host responses take the crucial role in the pathogenesis of H. pylori infections. Several H. pylori virulence factors have been identified,

*Corresponding author. E-mail: yangliguo2006@yahoo.com.cn. Tel: 86-27-87281813. Fax: 86-27-87281813.

including the urease, the vacuolating cytotoxin (VacA), and the cytotoxin-associated gene A antigen (CagA) (Covacci, 1993; Cover, 1996, Cover and Blaser, 1992; Hirai, 1994; Tee, 1995). Urease activity of H. pylori could produces ammonia, which buffers the pH of its immediate surroundings within the stomach and facilitates the organism's nitrogen metabolism at neutral pH as well as protecting it from acid damage at low pH (Williams, 1996). Urease might also help to recruit neutrophils and monocytes in the inflamed mucosa and to activate production of proinflammatory cytokines (Harris, 1996). Moreover, urease (including subunit proteins UreA and UreB) is one of the main antigens recognized by the human immune response to H. pylori, and UreB seems to be more

Chen et al.

protective than UreA (Ferrero, 1994). Thus, the UreB has been used in vaccination trials to prevent infection with H. pylori in mice (Del Giudice, 2001). Vaccine has been applied successfully as a potential therapeutic strategy for prevention and treatment. Recently, human H. pylori oral subunit vaccine (UreB LTB) has been approved for use in China, its anti-H. pylori infection protective time is one year and protective rate is 72.1%. However, the establishment of long-term oral immunity for protection against H. pylori infection has not yet been reported. The CagA is encoded in a pathogenicity island known as ‘Cag PAI’ and is deeply correlated with the severity of H. pylori-related diseases. The CagA is frequently associated with cytotoxin production. CagA-positive H. pylori infection elicits large amounts of IL-8 production from epithelial cells and IL-8 induces cellular inﬁltration into themucosa and consequently leads to the activation of anti-bacterial immune responses (Brandt, 2005; Sharma, 1998). Several studies have suggested that CagA is a useful marker for the most virulent strains that are associated with peptic ulcer, atrophic gastritis and adenocarcinoma (Figura, 1989; Crabtree, 1992; Blaser, 1995). They also found that CagA+ H. pylori (with CagA gene) caused more severely damage to CagA－ H. pylori and knockout of its CagA gene could prevent damage to the cell junctions of gastric epithelial cells (Keates S, 1999). In 90% of H. pylori-infected patients treated with antibiotics and strong acid suppressor drug, such as proton pump inhibitors, its eradication is successful (Rappuoli, 1999). However, failure of H. pylori eradication treatment has recently increased due to the proliferation of antibiotic-resistant strains (Murakami, 2002; Kotloff, 2001; Nystrom and Svennerholm, 2007). Vaccination against H. pylori is therefore one of the most effective ways to control H. pylori infection and, indeed, administration of oral bacterial antigens can protect mice against H. pylori infection (Marchetti, 1998). Recently, attenuated and nonpathogenic bacteria have been developed as mucosal vaccine delivery vehicles (Thole, 2000; Seegers, 2002; Nouaille, 2003; Wells and Mercenier, 2008). The risk of nonpathogenic bacteria is low and advantageous, particularly for the children, the elderly and immunocompromised individuals. In addition, as mucosal delivery vehicles, recombinant bacterial vaccine vectors offer several practical advantages, including avoidance of culturing large quantities of pathogens, no need to purify antigenic components or subunits. The use of oral routes for immunization against infective diseases is desirable due to easy administration and high compliance rates, and mucosal surfaces are the portals of entry for H. pylori. In generally, plasmids can be stably maintained in bacteria through the use of antibiotic selection genes encoded on the plasmid. However, antibiotics and their resistance genes are not desirable due to biosafety and regulatory concerns. Recent studies have demonstrated that the asd based host-plasmid balanced lethal system

8039

could overcome the problem of the use of antibiotic resistance gene. Zhao (2008) used △crp and △asd double deleted strain C500/pYA3493 balanced lethal system to express filamentous hemagglutinin and pertactin antigens gene and obtain the ideal efficacy. Previous studies have shown that animals can be protected from H. pylori infection by immunization. In this study, we expressed UreB and CagA in the C500. The recombinant attenuated S. choleraesuis were used for oral immunization of mice, contracting to Whole-cell vaccine against H. pylori SS1. MATERIALS AND METHODS Bacterial strain, plasmid and culture H. pylori Sydney strain 1 (SS1) was kindly provided by Professor Yong Xie (Nanchang University, Jiangxi, China). The H. pylori strain was cultured at 37°C under microaerophilic conditions on Columbia agar plates containing 10% sheep blood. This strain was grown in Brucella Broth containing 10% fetal bovine serum with gentle shaking at 37°C for 72 h under microaerophilic conditions. After cultivation for three days, the live bacteria were centrifuged at 5000×g for 15 min and washed three times with phosphate-buffered saline (PBS, pH 7.4). pYA3493 plasmid and strain of χ6097 were kindly provided by Curtiss R 3rd(2002) at Department of Biology, Washington University. S. enterica sv. Choleraesuis C500 strain with △crp △asd double deletion was obtained from Dr. Guo Aizhen (2006).

Construction of UreB/CagA DNA vaccine A pair of primers termed FP and RP were designed according to UreB gene and CagA gene of H. pylori SS1 in GenBank AF508016 and AF247651 as follows: UreB: FP:5-gAA TTC ATg AAA AAg ATT AgC AgA AAA gA-3’; RP:5’-gTC gAC TTg CCA AgT TCT AgT gAT AA TTC-3’. CagA: FP：5’ -ACg CgT CgA CAT gAC TAA CgA AAC CgT CgA -3’; RP: 5’-AAg CTT TCT TAC AAg gAT TCA TCA AAC ACg-3’. UreB: EcoRI and SalI; CagA: SalI and HindIII recognition sites were introduced into the 5,-terminal of FP (underlined) and RP (underlined), respectively, to facilitate cloning. The polymerase chain reaction (PCR) was done under the following conditions: preheating at 95°C for 5 min, followed by 35 cycles of denaturation at 94°C for 50 s, annealing at 55°C for 40 s, and extension at 72°C for 1 min (CagA genes) or 1.5 min (UreB gene). The PCR products were analyzed by agarose gel electrophoresis and recovered using a TaKaRa agarose gel DNA purification kit (China). The fragments were then ligated into the TaKaRa pMD18-T simple vector and sequenced at the Nucleic Acids Facility (Sangon, Shanghai, China). The obtained plasmids was named pMD18-T-CagA and pMD18-TUreB and both plasmids were transformed into Competent cells DH5a. Preparation of UreB/CagA DNA vaccine The plasmid pMD18-T-UreB was digested with EcoRI and SalI to obtain the UreB fragment. The purified UreB fragment was ligated into the EcoRI-SalI digested pYA3493 expression vector, resulting in pYA3493-UreB and then transformed into Competent cells E. coli x6097. The plasmid pMD18-T-CagA was digested with SalI and HindIII to release the CagA fragment. The purified CagA fragment

8040

Afr. J. Biotechnol.

OD value of the tested samples and negative control samples, respectively (Yang, 1998; Ebel, 2002). The ratio of the OD of known positive and known negative sera is termed as positive/negative (P/N) ratios. A P/N value higher than 2.0 and OD value over 0.3 was determined as comprehensive positive standard for the ELISA, otherwise, negative (Han, 2008).

Challenge of vaccinated mice The cultured H. pylori SS1 were harvested and resuspended in phosphate-buffered saline (PBS) to yield a concentration of 1×10 10 CFUmL-1. Vaccinated mice were challenged with 0.2 mL (2×10 9) H. pylori SS1 instilled into stomach once every day for three days. Food and water were given 2 h after the challenge.

Assessment of H. pylori colonization of the mouse

Figure 1. The target fragment of UreB and CagA gene amplified from H. pylori strain SS1 DNA. Lane 5, 1 kb DNA marker; lanes 6-9, the target amplification fragment of UreB gene (1134bp) from genomic DNA of H. pylori strain SS1; lane 4: blank control; lanes1-3, the target amplification fragment of CagA gene(480bp) from genomic DNA of H. pylori strain SS1.

was ligated into the SalI-HindIII digested pYA3493-UreB, resulting in pYA3493-UreB-CagA and then transformed into Competent cells χ6097. Thus the plasmid pYA3493-UreB-CagA was puriﬁed and transformed into Salmonella choleraesuis C500 strain by electroporation, and SDS-PAGE and western blot analysis were then carried out (Because the ligated production was more easily transformed into Competent cells χ6097 by heat shock than Salmonella choleraesuis C500 strain by electroporation).

Four weeks after receiving the challenge, mice were sacrificed by spinal dislocation. The stomachs and duodenum were washed twice in sterile 0.9% NaCl, and the pylorus, liver, lung, duodenum and spleen from mice were assessed by the hematoxylin-eosin (H.E.) staining. For H. pylori SS1 quantitative culturing, the stomach samples were weighed, and homogenized in PBS, serially diluted in PBS and plated onto Columbia agar plates containing 10% sheep blood with antibiotics.

Statistics All analyses were performed using SAS system 8.1 Software. The OD value and the data of bacterium were compared by a Student’s T-test, expressed as mean ± SD. P values of <0.05 were considered to be significant.

RESULTS

Immunization and sample collection

Amplification of UreB gene and CagA gene by PCR

Female Kunming mice aged 7 weeks were used in this experiment. One-week acclimatization period was given before immunization. Before immunization, feed and water were withheld for 8 h, and blood samples were taken from the cutting-down tails. 50 mice were randomly divided into 5 groups: inoculated orally into 0.2 mL of C500 expressing pYA3493-UreB-CagA; C500 with pYA3493; C500; PBS and injection into 0.2 mL (2×109) of H. pylori SS1 with adjuvant. Oral doses of 1×1010 CFUmL-1 were administered via an intragastric gavage. Before immunization, the 0.2 mL NaHCO 3 (7.5%) were administered via an intragastric gavage to the mice. Immunizations were performed on days 0, 7, 14, 21 and 28, and serum samples were taken at intervals of 7 days or 14 days and then centrifugalizated and stored at -20°C until use. Food and water were given 2 h after immunization.

The target fragment of UreB gene and partial CagA gene with the expected size amplified from DNA template of H. pylori stain SS1 is shown in Figure 1. The nucleotide sequences of UreB gene and partial CagA gene were completely similar to UreB and CagA gene of H. pylori SS1 in GenBank AF508016 and AF247651. Proteins were extracted and assayed by Western blotting after SDS-PAGE, using monoclonal antiserum to UreB and CagA (Santa Cruz Biotechnology). The results indicated that rUreB was produced in the supernatant of pYA3493ureB-CagA (Figures 2 and 3).

Detection of UreB-specific serum IgG

Antibodies assay

ELISA plates were coated overnight at 4°C with 1 mg/mL recombinant puriﬁed UreB. Three-fold serially diluted serum samples starting from 1: 400 were applied onto the plates and incubated for 1 h at 37°C. Serum IgG were detected by peroxidaselabeled goat anti-mouse IgG. Endpoint titers were determined as the reciprocal of the dilution factor of sample yielding background levels of OD450 nm. The ELISA results were evaluated using positive/negative (P/N) OD ratios. Symbols of P and N indicated the

Groups of mice were immunized orally with C500, which expresses the UreB-CagA protein. Control mice were vaccinated in the same way with pYA3493 strains of C500, C500, PBS and injection H. pylori SS1. The level of IgG in the serum was significantly higher (P<0.001) in mice immunized with C500 that expresses the UreBCagA protein and injection H. pylori SS1 (Figure 4).

from genomic DNA of H. pylori strain SS1; lane 4: blank lanes1-3, Chencontrol; et al. 8041

amplification fragment of CagA gene(480bp) from genomic DNA of H. pylori strain SS1 1

59kD

Figure 2. Analysis of recombinant UreB-CagA expression with SDS-PAGE. Lane 1, Protein Fig. Analysis recombinant UreB-CagA expression with SDS-PAGE. Lane marker;2 Lanes 2- 4, C500 of with pYA3493; Lane 5, C500; Lane 6, C500 with pYA3493-UreB-CagA (59kD).

marker; Lane 2- 4, C500 with pYA3493; Lane 5, C500; Lane 6, C500 with pYA3493-U 1

(59kD).

Figure 3. Western blot analysis of UreB and CagA in transgenic bacterium. Lane 1, Western blotting of C500 with pYA3493UreB-CagA; Lane 2, western blotting band of C500; Lane 3, western blotting band of C500 with pYA3493.

orally inoculated C500 with pYA3493, C500 and PBS (Table 1). The negative immunized mice had a range of H. pylori colonization from 5.4×104 to 7.3×104 bacteria g–1 stomach. The immunized mice with vaccine inoculated orally with C500 expressing pYA3493-UreB-CagA and by injected whole-cell of H. pylori SS1, were signiﬁcantly different in protection between the groups of mice immunized with the negative control groups (aP<0.01). DISCUSSION

Fig. 3. Western blot analysis of The UreB and ofCagA in istransgenic bacterium. infection H. pylori deeply associated with the Lane

development of peptic ulcer disease and cancer in the host stomach. In developing countries, the high incidence of gastric cancer, high H. pylori reinfection rates, antiblotting analysis of C500 with pYA3493-UreB-CagA; Lane western band of Immunohistochemical biotic resistance and2,high cost of blotting antibiotic treatment make vaccination a special attractive intervention Compared with the control group, histological analysis (Ramirez, 1997; Lahaie, 2002). One alternative to induce pointed that the liver, lung, spleen, duodenum and immune responses in the mucosal surfaces is by western blotting band of C500 with pYA3493. pylorus had no lesions. But the immunohistochemical introducing the vaccine antigen orally, where the antigen analysis showed that the anti-UreB antibody was is recognized and processed by specialized immune cells positively expressed in both the duodenum and pylorus situated at the gastrointestinal tract surfaces (Backert, immunized orally with C500 that expresses the UreB2000). S. choleraesuis C500 can be a tool in the CagA protein. On the contrary, there was no positive construction of oral subunit vaccines. C500 is an avirulent reaction in the control groups (Figure 5). vaccine strain attenuated by chemical methods, which is highly immunogenic and safe and has been used widely (Qiao, 2005; Zhao, 2008; Man, 2009). In this study, all H. pylori SS1 colony counts in different tissues mice immunized with C500 survived, and no clinical signs Four weeks after inoculation, all of the Kunming mice were observed in the immunized mice during the entire were immunized positively by colony counts. The positive experimental period. immunized group includes orally inoculated C500 with This report shows that oral vaccination with recompYA3493-UreB-CagA and injection of H. pylori SS1 binant C500 UreB-CagA producer strains prevented vaccine, which was whole-cell vaccine of H. pylori SS1 gastric infection with H. pylori. The aim of this study is to with adjuvant. The negative immunized group includes modulate the immune responses to UreB- CagA as

C50

8042

Afr. J. Biotechnol.

Weeks

Figure 4. Dynamics of anti-UreB antibodies levels detected in mice. ELISA titers of sera from mice on days 0, 7, 14, 21, 28, 35, 49 and 63 (*P<0.01).

Figure 5. Paraffin section of duodenum(a), pylorus(b), lung(c), liver(d) and spleen(e) by the hematoxylin-eosin staining. Immunohistochemical investigation of the pylorus (f:positive, g:negative) and duodenum(h:positive,i:negative).

Chen et al.

8043

Table 1. H. pylori SS1 colony counts in different tissues (Means ± SD) ( a P0.01, b P0.05).

Tissue Pylorus Duodenum Total

C500 with pYA3493UreB-CagA (×102/g) 9±4 2±0.66 11

C500 with pYA3493 (×102/g) a 354±104.1 a 191±38.1 540

the protein model and recombinant C500 strains as the vehicle. The rUreB/CagA-producing C500 strain was constructed to produce rUreB-CagA in an extracellular location and rUreB/CagA could be detected in the supernatant of C500 by Western blotting experiments. 9 Injection whole-cell vaccine and Oral inocula of 2×10 recombinant C500 expressing UreB-CagA were given on days 0, 7, 14，21 and 28 to mice elicited anti-UreB serum antibody responses that were significantly different from those observed in the control groups (inoculated orally C500 with pYA3493, C500 and PBS). Following oral immunization, a rapid increase in anti-UreB was detected in sera, but it declined on day 35. The IgG levels of whole-cell vaccine injection of H. pylori SS1 with adjuvant was lower than the oral vaccine. At the same time, the number of SS1 of tissues in the group which received injection was less than that of the group which received oral immunization (P0.05). Our results indicate that oral vaccination could elicit mucosal immune responses in the intestine and duodenum, and the H. pylori SS1 colony counts were significantly lower in the negative control group (P0.01), but similar in amount with the positive control group (P0.05). However, we can conclude that immunization with live recombinant C500-expressing UreB-CagA subunits reduced H. pylori colonization compared to the negative control mice, suggesting that a protective immune response had been induced in the mice. These results suggest that oral administrations of H. pylori-antigen with rCTB are safe and do not cause an anaphylactic reaction. This result was compatible with previous reports (Eiji Kubota et al., 2007). From our assessments, mucosal immunization by oral administration may be a better way of suppressing proliferation of H. pylori. Furthermore, the results obtained from the work of Lee et al. (2001) showed that there was no protective effect against H. pylori after H. pylori strain SS1 challenge, although the antigen-specific serum IgG titers were detected in mice immunized with recombinant L. lactis constitutive expression of the H. pylori UreB gene. Our results suggest that UreB-specific IgG was both necessary and sufficient to prevent gastric infection with H. pylori and this is because the H. pylori SS1 colony counts were significantly lower than the negative control group (P0.01) In conclusion, we have shown that the recombinant

C500 (×102/g) a

338±105.8 a 230±38.1 570

PBS (×102/g) a

576±131.1 a 252±102.1 730

H. pylori SS1 injection (×102/g) b 4±2.3 b 2±0.9 6

pYA3493-UreB-CagA is effective as a vaccination for immunization against H. pylori infection since mucosal immunization induced by oral administration of rCTB recombinant cholera toxin B-subunit suppressed proliferation of H. pylori. Oral vaccination may be a new strategy additively supportive of conventional antibiotic eradication therapy against H. pylori infection. But IgG levels antibody of Oral vaccination declined quicker than the IgG of injection whole-cell H. pylori vaccine. REFERENCES Asaka M, Kimura T, Kato M, Kudo M, Miki K, Ogoshi K, Kato T, Tatsuta M, Graham DY (1994). Possible role of Helicobacter pylori infection in early gastric cancer development. Cancer, 73: 2691-2694. Backert S, Ziska E, Brinkmann V, Zimny-Arndt U, Fauconnier A, ungblut PR, Naumann M, Meyer TF (2000). Translocation of the Helicobacter pylori CagA protein in gastric epithelial cells by a type IV secretion apparatus.Cell Microbiol. 2: 155-164. Blaser MJ, Chyou PH, Nomura A (1995). Age at establishment of Helicobacter pylori infection and gastric carcinoma, gastric ulcer and duodenal ulcer risk. Cancer Res. 55: 562-565. Blaser MJ, Perez-Perez GI, Cover TL (1995). Infection with Helicobacter pylori strains possessing CagA is associated with an increased risk of developing adenocarcinoma of stomach. Cancer Res. 55: 2111-2115. Brandt S, Kwok T, Hartig R, König W, Backert S (2005). NF-kappaB activation and potentiation of proinfammatory responses by the Helicobacter pylori CagA protein. Proc. Natl. Acad. Sci. USA. 102: 9300-9305. Covacci A, Censini S, Bugnoli M, Petracca R, Burronid D, Macchia G, Massone A, Papinit E, Xiang ZY, Figurat N, Rappuolit R (1993). Molecular characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer. Proc. Natl. Acad. Sci. USA. 90: 5791-5795. Cover TL (1996). The vacuolating cytotoxin of Helicobacter pylori. Mol. Microbiol. 20: 241-246. Cover TL, Blaser MJ (1992). Purication and characterization of the vacuolating toxin from Helicobacter pylori. J. Biol. Chem. 267: 1057010575. Crabtree JE, Figurer N, Taylor JD (1992). Expression of 120 kilodalton protein and cytotoxicity in Helicobacter pylori. J Clin Pathol. 45: 733734. rd Curtiss 3 R, Kang HY, Srinivasan J (2002). Immune responses to recombinant host/plasmid system that is pneumococcal PspA antigen delivered by live attenuated Salmonella enterica serovar typhimurium vaccine. Infect Immun. 70: 1739-49. Del Giudice G, Covacci A, Telford JL, Montecucco C, Rappuoli R (2001). The design of vaccines against Helicobacter pylori and their development. Annu. Rev. Immunol. 19: 523-563. nd Ebel GD, Dupuis AP 2 , Nicholas D, Young D, Maffei J, Kramer LD (2002). Detection by enzyme-linked immunosorbent assay of antibodies to West Nile virus in birds. Emerg Infect Dis. 8: 979-82. Ferrero RL, Thiberge JM, Huerre M, Labigne A (1994). Recombinant antigens prepared from the urease subunits of Helicobacter pylori spp.: Evidence of protection in a mouse model of gastric infection. Infect. Immun. 62: 4981-4989.

8044

Afr. J. Biotechnol.

Figura N, Guglielmetti P, Rossolini A (1989). Cytotoxin production by Campylobacter pylori strains isolated from patients with peptic ulcers and from patients with chronic gastritis only. J. Clin. Microbiol. 27: 225-226. Graham DY, Lew GM, Klein PD, Evans DG, Evans DJ Jr, Saeed ZA, Malaty HM (1992). Effect of treatment of Helicobacter pylori infection on the long-term recurrence of gastric or duodenal ulcer: A randomized, controlled study. Ann. Int. Med. 116: 705-708. Han L, Mao DG, Zhang DK, Liang AX, Fang M, Moaeen-ud-Din M, Yang LG (2008). Development and evaluation of a novel DNA vaccine expressing inhibin alpha (1-32) fragment for improving the fertility in rats and sheep. Anim. Reprod. Sci. 109: 251-65. Harris PR, Mobley HL, Perez-Perez GI, Blaser MJ, Smith PD (1996). Helicobacter pylori urease is a potent stimulus of mononuclear phagocyte activation and inﬂammatory cytokine production. Gastroenterology, 111: 419-425. Hirai M, Azuma T, Ito S, Kato T, Kohli Y and Fujiki N (1994). High prevalence of neutralizing activity to Helicobacter pylori cytotoxin in serum of gastric carcinoma patients. Int. J. Cancer, 56: 56-60. Keates S, Keates AC, Warny M, Peek RM Jr, Murray PG, Kelly CP (1999). Differential activation of mitogen-activated protein kinases in AGS gastric epithelial cells by cag+ and cag- Helicobacter pylori. J. Immunol. 163(10):5552-5559. Kotloff KL, Sztein MB, Wasserman SS, Losonsky GA, DiLorenzo SC, Walker RI (2001). Safety and immunogenicity of oral inactivated whole-cell Helicobacter pylori vaccine with adjuvant among volunteers with or without subclinical infection. Infect. Immun. 69: 3581-3590. Kubota E, Joh T, Tanida S, Sasaki M, Kataoka H, Watanabe K, Itoh K, Oshima T, Ogasawara N, Togawa S, Wada T, Yamada T, Mori Y, Fujita F, Shimura T, Ohara H, Isaka M, Yasuda Y, Itoh M (2005). Oral Vaccination against Helicobacter pylori with Recombinant Cholera Toxin B-Subunit. Helicobacter. 10(4): 345-352. Lahaie RG, Gaudreau C (2000). Helicobacter pylori antibiotic resistance: trends over time, Can. J. Gastroenterol. 14: 895-899. Lee MH, Roussel Y, Wilks M & Tabaqchali S (2001). Expression of Helicobacter pylori urease subunit B gene in Lactococcus lactis MG1363 and its use as a vaccine delivery system against H. pylori infection in mice. Vaccine. 19: 3927-3935. Man X, Wu B, Luo Y, Yu T, Zhao Z, Xu Y, Guo A, Chen H (2009). Construction of attenuated Salmonella choleraesuis vaccine strain expressing recombinant antigen of Shiga-like toxin Escherichia coli. Wei Sheng Wu Xue Bao. 49(4): 518-523. Marchetti M, Rossi M, Giannelli V, Giuliani MM, Pizza M, Censini S, Covacci A, Massari P, Pagliaccia C, Manetti R, Telford JL, Douce G, Dougan G, Rappuoli R,Ghiara P (1998). Protection against Helicobacter pylori infection in mice by intragastric vaccination with H. pylori antigens is achieved using a non-toxic mutant of E. coli heatlabile enterotoxin (LT) as adjuvant. Vaccine.16: 33-37. Michetti P (1997). Vaccine against Helicobacter pylori: Fact or ﬁction? Gut. 41: 728-730. Murakami K, Sato R, Okimoto T, Nasu M, Fujioka T, Kodama M, Kagawa J, Sato S, Abe H, Arita T (2002). Eradication rates of clarithromycin-resistant Helicobacter pylori using either rabeprazole or lansoprazole plus amoxicillin and clarithromycin. Aliment. Pharmacol. Ther. 16: 1933-1938.

Nouaille S, Ribeiro LA, Miyoshi A, Pontes D, Loir YL, Oliveira SC, Langella P and Azevedo V (2003). Heterologous protein production and delivery systems for Lactococcus lactis. Genet. Mol. Res. 2: 102111. Nystrom J, Svennerholm AM (2007). Oral immunization with HpaA affords therapeutic protective immunity against H. pylori that is reflected by specific mucosal immune responses. Vaccine, 25: 25912598. Qiao HW, Sun JF, Han WY, Li ZS, Yu XL, Tu CC (2005). Salmonella choleraesuis C500 delivering DNA immunization against classical swine fever virus. Chin. J. Biotech. 21(6): 865-870. Ramirez C, Nacher J, Molowny A, Sanchez-Sanchez F, Irurzun A, Lopez-Garcia C (1997). Photoperiod-temperature and neuroblast proliferation–migration in the adult lizard cortex, Neuroreport. 8: 2337-2342. Rappuoli R, Pizza M, Douce G, Dougan G (1999). Structure and mucosal adjuvanticity of cholera and Escherichia coli heat-labile enterotoxins. Immunol. Today. 20: 493-500. Seegers JF (2002). Lactobacilli as live vaccine delivery vectors: progress and prospects. Trends Biotechnol. 20: 508-515. Tee W, Lambert JR, Dwyer B (1995). Cytotoxin production by Helicobacter pylori from patients with upper gastrointestinal tract diseases. J. Clin. Microbiol. 33: 1203-1205. Thole JE, van Dalen PJ, Havenith CE, Pouwels PH, Seegers JF, Tielen FD, van der Zee MD, Zegers ND, Shaw M (2000). Live bacterial delivery systems for development of mucosal vaccines. Curr. Opin. Mol. Ther. 2: 94-99. Warren JR, Marshall BJ (1983). Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet, 6: 1273-1275. Wells JM, Mercenier A (2008). Mucosal delivery of therapeutic and prophylactic molecules using lactic acid bacteria. Nat. Rev. Microbiol. 6: 349-362. Williams CL, Preston T, HossackM, Slater C, McColl KE (1996). Helicobacter pylorus utilizes urea for amino acid synthesis. FEMS Immunol. Med. Mic. 13: 87-94. Xu YD, Guo AZ, Liu WH, Jia AQ, Chen HC (2006). Construction and characterization of delta crp delta asd mutant host-vector balanced lethalsystem of Salmonella choleraesuis C500 strain. Chin. J. Biotech. 22: 366-372. Yang LG, Hu SC, Wei PH, Guo AZ (1998). Enzyme Immunoassay Technology. Nanjing University Press. Nanjing (in Chinese). Zhao ZQ, Xue Y, Wu B, Tang XB, Hu RM, Xu YD, Guo AZ, Chen HC (2008). Subcutaneous Vaccination with Attenuated Salmonella enteric Serovar Choleraesuis C500 Expressing Recombinant Filamentous Hemagglutinin and Pertactin Antigens Protects Mice against Fatal Infections with both S. enterica Serovar Choleraesuis and Bordetella bronchiseptica. Infect. Immun. 6: 2157-2163.

Full Length Research Paper

Utilization of bio-waste cotton (Gossypium hirsutum L.) stalks and underutilized paulownia (paulownia fortunie) in wood-based composite particleboard Hossein Khanjanzadeh*, Ali Akbar Bahmani , Ali Rafighi and Taghi Tabarsa Department of Wood and Paper Technology, Gorgan University of Agricultural Sciences and Natural Resources (GUASNR), Gorgan, Iran. Accepted 2 March, 2012

The objective of this study was to investigate some mechanical (modulus of rupture, modulus of elasticity and internal bond) and physical (thickness swelling and water absorption) properties of woodbased three-layer particleboard containing different cotton (Gossypium hirsutum L.) stalks and underutilized paulownia (paulownia fortunie) wood particle ratios (30, 50 and 70%) using urea formaldehyde resin. Addition of cotton stalk and paulownia wood in particleboard improved mechanical properties of resulting composites boards significantly. However, the water resistance decreased with increasing cotton stalk and paulownia wood particle contents. The highest mechanical properties were obtained at cotton stalk and paulownia wood particle loading of 50 and 70%, respectively. Conclusively, valuable underutilized natural resources, cotton stalk and paulownia wood can be used with the mixture of industrial wood particles in the production of particleboards with high mechanical properties. Key words: Wood, resin, urea-formaldehyde, mechanical properties, physical properties.

INTRODUCTION Particleboard is an engineered wood composite manufactured from wood particles, such as saw mill shavings, chips, or even sawdust, and a synthetic binder or other suitable resin, which is pressed (Akyüz et al., 2010). It used widely as component of furniture, doors and cabinets. Serious shortage of wood resources in developing countries, including Iran, have increased the importance of particleboard manufacturing from agricultural fibers and wood residues as an alternative for solid wood. Alternative raw materials such as agricultural residues, underutilized species and fast-growing species can play an important role in the particleboard industry in the future. Recently, some researchers have focused on the use of various agricultural residues and wastes for particleboard manufacturing. Some low-cost lignocellulosic materials (LCM) used as raw material to produce composite panels from agricultural wastes had been as

*Corresponding author. E-mail: H_Khanjanzadeh@yahoo.com. Tel/fax: +98 171 2245964.

follows: Eggplant stalk (Guntekin and Karakus, 2008), grass clipping (Nemli et al., 2009), kiwi pruning (Nemli et al., 2003), pepper stalk (Guntekin et al., 2008), almond shell (Pirayesh and Khazaeian, 2011) and sunflower stalk (Bektas et al., 2005). Cotton (Gossypium hirsutum L.) is a major crop popularly known as ‘White Gold’ grown primarily for fiber and oil seed all over the world (Dong et al., 2010). The cultivation of cotton generates plant residue equivalent to three to five times the weight of the fiber produced (Reddy and Yang, 2009). After harvesting the cotton balls, the entire plant, consisting stalk and leaves, is a residue which remains in the field and the farmers usually destroy it by burning (Binod et al., 2011). Burning agricultural residues causes environmental problems such as air pollution, soil erosion and decreases soil biological activity (Copur et al., 2007). Paulownia is a fast-growing shade tree indigenous to China and South-East Asia (Bergmann, 1998). It has been highly valued for more than 2000 years in East Asia (Kalaycioglu et al., 2005). Paulownia trees have been used for different purposes such as to produce leaves useful as fodder or fertilizer, flower for honey production

8046

Afr. J. Biotechnol.

Table 1. Properties of the UF adhesive.

Property Solid content (%) Density (g/cm3) pH Viscosity (cps) Gel time (s) a

UF 60 1.27 7 63 45

, Urea-formaldehyde.

Table 2. Experimental design.

Panel typea A B C D E F G a

Particleboard composition (by weight %) Industrial wood (%) Paulownia wood (%) Cotton stalk (%) 100 0 0 70 0 30 50 0 50 30 0 70 70 30 0 50 50 0 30 70 0 3

, The density of all panels was 0.70 g/cm .

(Yorgun et al., 2009), and wood for the production of hardwood timber (Bergmann, 1998) over the years. Paulownia wood has also been investigated as a promising raw material for the production of wood based composites (that is, particleboard) (Kalaycioglu et al., 2005) and chemical pulp (Jiménez et al., 2005). It is soft, lightweight, ring porous, straight-grained, and mostly knot-free with a satiny luster. Its average density is about 0.35 g/cm3 (Kalaycioglu et al., 2005). In recent years, Paulownia is receiving increasing attention as a genus suitable resource for use as a short-rotation woody species in Iran. Under the appropriate conditions, a 5- to 7-year-old tree can reach about 15 to 20 m high and the annual production is as much as 150 tons/ha (Jiménez et al., 2005). Bio-based composites will become materials to replace polymer based composites and wood in terms of their attractive specific properties, lower cost, simple process technologies, eco-friendliness, and recyclability (Ndazi et al., 2006). Guler and Ozen (2004) studied properties of particleboards made from neat cotton stalk. There is no information on using cotton stalk and paulownia wood with the presence of industrial wood particles in particleboard production.The main objective of this study was to use cotton stalk and paulownia wood as raw materials in the production of three-layer particleboard, and to evaluate physical and mechanical properties of the boards to determine if they have the required levels of properties for general uses. MATERIALS AND METHODS The raw material of this study included Cotton (G. hirsutum L.)

stalk, paulownia (Paulownia fortunie) wood and industrial wood particles (consisting of mixed hardwood species such as beech, oak and hornbeam). Cotton stalks were harvested in an experimental field of the Iranian Cotton Research Institute located at Hashem Abad, Gorgan (Iran) and paulownia wood was harvested from a Shastcolateh experimental forest, Gorgan (Iran) and industrial wood particles were obtained from a commercial particleboard plant in Gorgan (Iran). The cotton stalks and paulownia wood were chipped using industrial-scale drum-chipper. The chips were then reduced into smaller particles by a knife-ring flaker. After that the particles were dried to 3% moisture content and then classified in a laboratory shaker. Industrial wood particles and particles produced from the cotton stalks and paulownia wood remained between 3 and 1.5 and 1.5 and 0.8 mm sieve were utilized in the core and outer layers, respectively.Urea-formaldehyde (UF) resin at 8 and 12% adhesive level was used for the core and outer layers based on oven-dry weight. The properties of UF resin is given in Table 1. One percent of ammonium chloride (NH4Cl) was added to the resin as a hardener. The particles were introduced in a drum blender and sprayed with UF and NH4Cl for 5 min to obtain a homogenized mixture. Panels were designed consisting 35% face and 65% core layers. The target density of boards was 0.70 g/cm3. Three panels were produced for each design. The experimental design is given in Table 2. Panel production parameters are also displayed in Table 3. The panels after conditioning (at 65% relative humidity and 20°C) to reach moisture content of about 12% were tested for modulus of rapture (MOR) and modulus of elasticity (MOE) (EN 310, 1993), internal bond strength (IB) (EN 319, 1993), thickness swelling (TS) and water absorption (WA) after 2 and 24-h immersion (EN 317, 1993). The average of 10 and 20 measurements were reported for mechanical and physical properties respectively.Data for each test were statistically analyzed using analysis of variance (ANOVA). When the ANOVA indicated a significant difference among factors and levels, a comparison of the means was done employing Duncan test to identify which groups were significantly different

Khanjanzadeh et al.

8047

Table 3. Production parameters of particleboards.

Parameter Press temperature (°C) Pressing time (min) 2 Peak pressure (kg/cm ) Thickness (mm) 33% NH4Cl (%) Outer layer (whole of board, %) Core layer (whole of board, %) Number of board for each type

Value 170 8 30 16 1 35 65 3

Table 4. Comparison of chemical composition of paulownia, cotton stalk and hardwoods.

Lignocellulosic material Cotton stalk Paulownia Hardwoods

Hemicellulose (%) 77.50 78.80 70-78

Cellulose (%) 47.80 48.30 45-50

from other groups at 99% confidence level.

RESULTS AND DISCUSSION Mechanical properties Table 5 shows the results of mechanical properties of the experimental panels. As seen, particleboards containing 70% paulownia wood, had the highest MOR (26.78 N/mm2) and MOE (2976 N/mm2) values. Besides, the lowest MOR (11.47 N/mm2) and MOE (1576 N/mm2) values were measured for panel type G, containing 70% cotton stalk in the mixture. The result indicates that addition of cotton stalk up to 50% and paulownia wood up to 70% improves MOR and MOE values of the boards in comparison to the reference ones, panel type A (particleboard produced using 100% industrial wood particles). Statistical analysis found some significant difference (p<0.01) between some groups means for MOR and MOE values. Significant differences between groups were determined individually for these tests by Duncan’s multiple comparison tests. The result of Duncan’s multiple range tests are shown in Table 5 by letters. Based on EN Standards, the minimum requirements for MOR and MOE of particleboards for interior grade type (including furniture) are 14 and 1800 MPa (EN 312-3). All the panels produced in this study provide MOR and MOE values with outstanding margin exceeding EN standard requirements for interior grade type (including furniture) except for panel type G, containing 70% cotton stalk. IB values of the experimental panels ranged from 0.36 2 to 0.70 N/mm . The highest IB value was observed for panel type D, while the lowest was observed for G type

Lignin (%) 21.20 22.10 30-35

Reference Ertas et al., 2010 Kalaycioglu et al., 2005 Pirayesh and khazaeian, 2011

panel. IB value of the panels also decreased with increasing cotton stalk percentage in the mixture but increased with increasing paulownia wood particle ratio. The minimal requirement of internal bond strength for general purposes (EN 312-2) interior usage (EN 312-3) and load-bearing board (EN 312-4) are 0.24, 0.35 and 0.50 MPa, respectively. In general, all the boards except for panel type G met the IB requirements of EN standard for different usage. The strength properties of bio-based composites depend on many factors such as physical and mechanical properties of individual particles, their interfacial adhesion, the orientation, density (or compact ratio) and aspect ratio of particles (Ayrilmis et al., 2009; Nourbakhsh and Ashori, 2010). Besides, cellulose, lignin and hemicelluloses contents that were different for all three raw material of this study (Table 4) had strong influences on the mechanical properties (Habibi et al., 3 2008). Cotton stalk density (0.28 to 0.31 g/cm ) is lower 3 than paulownia wood (0.35 g/cm ) and woody raw material density (0.40 to 0.75 g/cm3) (Guler and Ozen, 2004; Kalaycioglu et al., 2005). Lower density or higher compact ratio and bulky characteristics of cotton stalk and paulownia wood particles in comparison to industrial wood particles can be one of the main reasons of the mechanical properties improvements. However, regarding cotton stalk at high loading (70%), in the gluing stage they did not glue well, relatively forming lumps resulting in an interrupted glue line between the particles and consequently lower mechanical properties. Physical properties The results of ANOVA and Duncan’s mean separation test for TS and WA of particleboards containing cotton

8048

Afr. J. Biotechnol.

Table 5. The mechanical properties of particleboards made from cotton stalk, paulownia wood and industrial wood particles and the test results of ANOVA and Duncanâ&#x20AC;&#x2122;s mean separation tests.

Mechanical property

Standard error 0.015 0.858 0.499 0.390 0.409 0.221 0.233

XMinb

XMaxc

16.02s u 19.50 20.03u t 26.78 s 16.92 17.19s p 11.47

Standard deviation 0.049 2.714 1.581 1.235 1.296 0.698 0.737

15.98 14.89 16.99 24.73 14.97 16.26 10.19

16.12 23.79 22.00 28.39 18.45 18.10 12.37

* * * * * * *

MOE (N/mm )

A B C D E F G

2254.30s su 2345.20 2536.30ut v 2976.60 su 2357.30 2608.00t 1576.00p

36.435 215.886 185.677 195.191 166.146 80.209 153.511

11.522 68.269 58.716 61.725 52.540 25.364 48.544

2300.00 1971.00 2284.00 2637.00 2128.00 2505.00 1360.00

2399.00 2571.00 2890.00 3296.00 2610.00 2733.00 1890.00

* * * * * *

IB (N/mm2)

A B C D E F G

0.57su 0.65su 0.67u 0.70u 0.61su 0.62su 0.36p

0.032 0.108 0.064 0.101 0.123 0.128 0.139

0.010 0.034 0.020 0.032 0.038 0.040 0.043

0.53 0.53 0.55 0.54 0.44 0.35 0.10

0.62 0.85 0.75 0.87 0.78 0.70 0.55

* * * * * * *

MOR (N/mm )

Board type

Meana

A B C D E F G

, Mean values are the average of 10 specimens; , minimum value; , maximum value; significance level of 0.01 (for ANOVA); , values having the same letter are not significantly different (Duncan test). MOR, Modulus of rapture; MOE, modulus of elasticity; IB, internal bond strength. p,s,u,t,v

stalk and paulownia wood particles for 2 and 24-h water immersion times are given in Table 6. With the addition of cotton stalk and paulownia wood particle to the particleboard TS and WA values increased from 11.81 to 29.42% and 59.87 to 104.34% for 2-h water immersion time in comparison to the panel type A (particleboard produced using 100% industrial wood particles). Likewise, for 24-h water immersion time, these figures were 18.03 to 32.35% and 67.82 to 116.88%. Contrary to the mechanical properties, TS and WA values deteriorated with increasing cotton stalk and paulownia wood loading in the panels that can be related to lower density, higher porosity, of these materials in comparison to industrial wood particles than mean more voids and pores for water uptake. Besides, variation in the TS and WA values of the experimental boards can be attributed to differences in chemical composition of the raw material (Table 4) and differences in their pH value with the bindersâ&#x20AC;&#x2122; one. Difference in hemicelluloses, cellulose and lignin ratio of raw material can result in different dimensional stability of the resulting panels (Pirayesh and Khazaeian, 2011). One of the most important chemical properties of bio-based fibers that have an important role

in developing good bonding between resin and particles as well as hardening of resin is pH (Nemli et al., 2008). Inequity of pH value of raw material and binder can lead to different water absorption properties of resulting boards (Nemli et al., 2008). Level of pH of the raw material of this study, cotton stalk 4.74 (Kargarfard and Latibari, 2011), paulownia wood 5.38 (Kalaycioglu et al., 2005), hard woods 5.96 (Nemli et al., 2008) and the resin, 7, was relatively different. Also, lack of good glue line between bulky cotton stalk and paulownia wood particles can be another reason of the lower TS and WA In general, all boards did not satisfy the TS and WA requirement of EN standard for general purpose usage. Chemical modification of agricultural fibers as well as coating particleboard surfaces with melamine-resin impregnated papers or laminates can results in more dimensionally stable panels (Azizi et al., 2011 ; Ndazi et al., 2006). Adding wax to coat the lignocellulosic fibers can improve their water resistance (Ayrilmis et al., 2009). Especially, MDI resin can perfectly bond agricultural wastes to wood fibers (Yang and Zhang, 2004). Similarly, lower physical properties have been reported for particleboards made using agricultural

Khanjanzadeh et al.

8049

Table 6. Thickness swelling (TS) and water absorption (WA) test results of ANOVA and Duncanâ&#x20AC;&#x2122;s mean separation tests of particleboards produced from cotton stalk, paulownia and industrial wood particles.

Physical property

Thickness swelling (TS)

Water absorption (WA)

Board type A B C D E F G A B C D E F G

Soaking time (h) 2 2 2 2 2 2 2 24 24 24 24 24 24 24

Mean (%)a 11.81p s 15.73 22.14u ut 23.25 24.47tv 24.67v w 29.42 p 18.03 s 21.81 u 24.36 28.01t t 28.57 v 30.96 32.35w

Standard deviation 0.338 0.419 0.773 0.530 1.725 0.889 1.702 0.316 1.521 0.702 0.413 1.458 1.650 0.721

Standard error 0.107 0.132 0.244 0.167 1.545 0.281 1.538 0.100 0.481 0.222 0.130 0.461 0.521 0.228

XMin b

XMax c

11.20 15.10 21.30 22.31 21.48 23.17 27.68 17.40 19.14 23.15 27.43 26.02 28.55 31.02

12.28 16.40 23.37 23.91 26.30 25.81 32.21 18.40 23.61 25.20 28.50 30.19 33.23 33.19

* * * * * * * * * * * * * *

A B C D E F G A B C D E F G

2 2 2 2 2 2 2 24 24 24 24 24 24 24

59.87p 64.94s 69.72u 74.03t 75.70t 76.69t 104.34v 67.82p s 80.04 86.26u 94.19t 92.30t 93.83t v 116.88

3.181 4.933 3.578 3.454 1.035 0.979 1.827 0.470 4.920 5.259 4.043 1.427 2.676 3.532

1.005 1.560 1.131 1.092 0.327 0.309 0.577 0.148 1.556 1.663 1.278 0.451 0.846 1.116

57.50 59.57 63.43 70.31 74.41 75.22 102.17 66.90 70.41 77.93 86.55 90.09 90.70 110.95

68.50 74.52 73.26 79.76 77.47 78.06 107.38 68.40 87.73 92.39 98.66 93.84 97.31 121.05

* * * * * * * * * * * * * *

, Mean values are the average of 20 specimens; , minimum value; , maximum value; , significance level of 0.01 (for ANOVA); , values having the same letter are not significantly different (Duncan test).

p,s,u,t,v,w

wastes and residues (Copur et al., 2007; Bektas et al., 2005; Nemli et al., 2009; Guntekin and Karakus, 2008). Conclusion In this study, the potential of two underutilized fibrous materials for particleboard manufacturing was studied. Kinds of fibrous material and their ratios significantly influenced the mechanical properties of the panels. Addition of cotton stalk up to 50% and paulownia wood particles up to 70% improved the mechanical properties of the resulting boards; however, physical properties decreased with increasing cotton stalk and paulownia wood particles ratios in the mixture. This problem may be easily solved by the addition of paraffin to the boards. Based on initial findings of this study, it can be concluded that cotton stalk and underutilized paulownia wood could

be utilized in particleboard production. Finding this type of new application area for cotton stalk and underutilized paulownia wood can lead to decreasing pressure on the forests, alleviation of raw material shortage of wood industry in developing countries and providing second income from the plantation along with environmental benefits. REFERENCES AkyĂźz KC, Nemli G, Baharoglu M, Zekovic E (2010). Effects of acidity of the particles and amount of hardener on the physical and mechanical properties of particleboard composite bonded with urea formaldehyde. Int. J. Adhesion, Adhesives, 30: 166-169. Ayrilmis N, Buyuksari U, Avci E, Koc E (2009). Utilization of pine (Pinuspinea L.) cone in manufacture of wood based composite. Forest Ecol. Manage. 259: 65-70. Azizi K, Tabarsa T, Ashori A (2011). Performance characterizations of particleboards made with wheat straw and waste veneer splinters.

8050

Afr. J. Biotechnol.

Composites Part B, 42: 2085-2089. Bektas I, Guler C, Kalaycioglu H, Mengeloglu F, Nacar M (2005). The manufacture of particleboards using sunflower stalks (Helianthus annuus) and poplar wood (Populus alba L.). J. Compos. Mater. 39 (5): 467-473. Bergmann BA (1998). Propagation method influences first year field survival and growth of Paulownia. New Forests 16: 251-264. Binod P, Kuttiraja M, Archana M, Janu KU, Sindhu R, Sukumaran RK, Pandey A (2011). High temperature pretreatment and hydrolysis of cotton stalk for producing sugars for bioethanol production. doi:10.1016/j.fuel.2011.07.044. Copur Y, Guler C, Akgul M, Tascioglu C (2007). Some chemical properties of hazelnut husk and its suitability for particleboard production. Build. Environ. 42: 2568-2572. Dong H, Kong X, Li W, Tang W, Zhang D (2010). Effects of plant density and nitrogen and potassium fertilization on cotton yield and uptake of major nutrients in two fields with varying fertility. Field Crops Res. 119: 106-113 EN 310 (1993). Wood-based panels, determination of modulus of elasticity in bending and bending strength. Brussels (Belgium); European Committee for Standardization. EN 317 (1993). Particleboards and fiberboards, determination of swelling in thickness after immersion. Brussels (Belgium): European Committee for Standardization. EN 319 (1993). Particleboards and fiberboards, determination of tensile strength perpendicular to plane of the board. Brussels (Belgium): European Committee for Standardization. EN 312-2 (1996). Particleboards-specifications-part 2: requirements for general purpose boards for use in dry conditions. Brussels: European Standardization Committee. EN 312-3 (1996). Particleboards-specifications-part 3: requirements for boards for interior fitments (including furniture) for use in dry conditions. Brussels: European Standardization Committee. EN 312-4 (1993). Particleboards-specifications-part 4: requirements for load bearing boards for use in dry conditions. Brussels: European Standardization Committee. Ertas M, Acemioglub B, Alma MH, Usta M (2010). Removal of methylene blue from aqueous solution using cotton stalk, cotton waste and cotton dust. J. Hazardous Mater. 183: 421-427. Guler C, Ozen R (2004). Some properties of particleboards made from cotton stalks (Gossypium hirsitum L.). Holz als Roh – und Werkstoff . 62: 40-43. Guntekin E, Karakus B (2008). Feasibility of using eggplant stalks (Solanum melongena) in the production of experimental particleboard. Ind. Crops Prod. 27: 354-358. Guntekin E, Uner B, Sahin HT, Karakus B (2008). Pepper stalks (Capsicum annuum) as raw material for particleboard manufacturing. J. Appl. Sci. 8(12): 2333-2336.

Habibi Y, El Zawawy WK, Ibrahim MM, Dufresne A (2008). Processing and characterization of reinforced polyethylene composites made with lignocellulosic fibers from Egyptian agro-industrial residues. Compost. Sci. Technol. 68 (7-8): p. 1877. Jiménez L, Rodriguez A, Ferrer JL, Pérez A, Angulo V (2005). Paulownia, a fastgrowing plant, as a rawmaterial for paper manufacturing. Afinidad, 62: 100-105. Kalaycıoglu H, Deniz I, Hiziroglu S (2005). Some of the properties of particleboard made from paulownia. J. Wood Sci. 51(4): 410-414. Kargarfard A, Jahan-latibari A (2011). The performance of corn and cotton stalks for medium density fiberboard production. Bioresources, 6(2): 1147-1157. Ndazi B, Tesha JV, Nisanda ETN (2006). Some opportunities and challenges of producing bio-composites from non-wood residues. J. Mater. Sci. 41: 6984-6990. Nemli G, Yildiz S, Gezer ED (2008). The Potential for using the needle litter of Scotch pine (Pinussylvestris L.) as a raw material for particleboard manufacturing. Bioresour. Technol. 99: 6054-6058. Nemli G, Kırcı H, Serdar B, Ay N (2003). Suitability of kiwi pruning for particleboard manufacturing. Ind. Crops Prod. 17: 39-46. Nemli G, Demirel S, Gümüokaya E, Aslan M, Acar C (2009). Feasibility of incorporating waste grass clippings (Lolium perenne L.) in particleboard composites. Waste Manage. 29: 1129-1131 Nourbakhsh A, Ashori A (2010). Wood plastic composites from agrowaste materials: Analysis of mechanical properties. Bioresour. Technol. 101: 2525-2528. Pirayesh H, Khazaeian A (2011). Using almond (Prunus amygdalus L.) shell as a bio-waste resource in wood based composite. doi:10.1016/j.compositesb.2011.06.008 Reddy N, Yang Y (2009). Properties and potential applications of natural cellulose fibers from the bark of cotton stalks. Bioresour. Technol. 100: 3563-3569. Yang P, Zhang F (2004). Study on cure conditions of PMDI-based binder in use of wheat straw particleboard. China Adhesives, 14: 3739. Yorgun S, Vural N, Demiral H (2009). Preparation of high-surface area activated carbons from Paulownia wood by ZnCl2 activation. Microporous and Mesoporous Materials, 122: 189-194.

UPCOMING CONFERENCES 2012 International Conference on Biotechnology and Food Engineering ICBFE 2012 Dubai, UAE. August 4-5, 2012

15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012

Conferences and Advert August 2012 International Conference on Biotechnology and Food Engineering (ICBFE 2012) Dubai, UAE, 4 Aug 2012 September 2012 Agricultural Biotechnology International Conference (ABIC2012), Christchurch, New Zealand, 1 Sep 2012 15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012 October 2012 Biotechnology and Bioinformatics Symposium, Provo, USA, 25 Oct 2012

African Journal of

Biotechnology Related Journals Published by Academic Journals African Journal of Microbiology Research African Journal of Biochemistry Research African Journal of Plant Science Journal of Entomology and Nematology Journal of Bacteriology Research Journal of General and Molecular Virology