African Journal of Biotechnology - 24 April, 2012 Issue by Academic Journals

African Journal of

Biotechnology Volume 11 Number 33 ISSN 1684-5315

24 April, 2012

ABOUT AJB The African Journal of Biotechnology (AJB) is published bi-weekly (one volume per year) by Academic Journals. African Journal of Biotechnology (AJB) a new broad-based journal, is an open access journal that was founded on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed.

Submission of Manuscript Submit manuscripts as e-mail attachment to the Editorial Office at: ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com. A manuscript number will be mailed to the corresponding author shortly after submission. For all other correspondence that cannot be sent by e-mail, please contact the editorial office (at ajb_acadjourn@yahoo.com, ajb.submit@gmail.com, ajbreview@gmail.com). The African Journal of Biotechnology will only accept manuscripts submitted as e-mail attachments. Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given the last name of the first author.

Editors George Nkem Ude, Ph.D Plant Breeder & Molecular Biologist Department of Natural Sciences Crawford Building, Rm 003A Bowie State University 14000 Jericho Park Road Bowie, MD 20715, USA N. John Tonukari, Ph.D Department of Biochemistry Delta State University PMB 1 Abraka, Nigeria Prof. Dr. AE Aboulata Plant Path. Res. Inst., ARC, POBox 12619, Giza, Egypt 30 D, El-Karama St., Alf Maskan, P.O. Box 1567, Ain Shams, Cairo, Egypt Dr. S.K Das Department of Applied Chemistry and Biotechnology, University of Fukui, Japan Prof. Okoh, A. I Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and Microbiology, University of Fort Hare. P/Bag X1314 Alice 5700, South Africa Dr. Ismail TURKOGLU Department of Biology Education, Education Faculty, Fırat University, Elazığ, Turkey Prof T.K.Raja, PhD FRSC (UK) Department of Biotechnology PSG COLLEGE OF TECHNOLOGY (Autonomous) (Affiliated to Anna University) Coimbatore-641004, Tamilnadu, INDIA. Dr. George Edward Mamati Horticulture Department, Jomo Kenyatta University of Agriculture and Technology, P. O. Box 62000-00200, Nairobi, Kenya.

Dr Helal Ragab Moussa Bahnay, Al-bagour, Menoufia, Egypt. Dr VIPUL GOHEL Flat No. 403, Alankar Apartment, Sector 56, Gurgaon122 002, India. Dr. Sang-Han Lee Department of Food Science & Biotechnology, Kyungpook National University Daegu 702-701, Korea. Dr. Bhaskar Dutta DoD Biotechnology High Performance Computing Software Applications Institute (BHSAI) U.S. Army Medical Research and Materiel Command 2405 Whittier Drive Frederick, MD 21702 Dr. Muhammad Akram Faculty of Eastern Medicine and Surgery, Hamdard Al-Majeed College of Eastern Medicine, Hamdard University, Karachi. Dr. M.MURUGANANDAM Departtment of Biotechnology St. Michael College of Engineering & Technology, Kalayarkoil, India. Dr. Gökhan Aydin Suleyman Demirel University, Atabey Vocational School, Isparta-Türkiye, Dr. Rajib Roychowdhury Centre for Biotechnology (CBT), Visva Bharati, West-Bengal, India. Dr.YU JUNG KIM Department of Chemistry and Biochemistry California State University, San Bernardino 5500 University Parkway San Bernardino, CA 92407

Editorial Board Dr. Takuji Ohyama Faculty of Agriculture, Niigata University

Dr. Mehdi Vasfi Marandi University of Tehran

Dr. FÜgen DURLU-ÖZKAYA Gazi Üniversity, Tourism Faculty, Dept. of Gastronomy and Culinary Art

Dr. Reza Yari Islamic Azad University, Boroujerd Branch

Dr. Zahra Tahmasebi Fard Roudehen branche, Islamic Azad University

Dr. Tarnawski Sonia University of Neuchâtel – Laboratory of Microbiology

Dr. Albert Magrí Giro Technological Centre

Dr. Ping ZHENG Zhejiang University, Hangzhou, China. Prof. Pilar Morata University of Malaga

Dr. Greg Spear Rush University Medical Center

Dr. Mousavi Khaneghah College of Applied Science and Technology-Applied Food Science, Tehran, Iran.

Prof. Pavel KALAC University of South Bohemia, Czech Republic.

Dr. Kürsat KORKMAZ Ordu University, Faculty of Agriculture, Department of Soil Science and Plant nutrition

Dr. Tugay AYAŞAN Çukurova Agricultural Research Institute, PK:01321, ADANA-TURKEY.

Dr. Shuyang Yu Asistant research scientist, Department of Microbiology, University of Iowa Address: 51 newton road, 3-730B BSB bldg.Tel：+319-3357982, Iowa City, IA, 52246, USA.

Dr. Binxing Li E-mail: Binxing.Li@hsc.utah.edu

Dr Hsiu-Chi Cheng National Cheng Kung University and Hospital.

Dr. Kgomotso P. Sibeko University of Pretoria, South Africa.

Dr. Jian Wu Harbin medical university , China.

Instructions for Author Electronic submission of manuscripts is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Arial font). The cover letter should include the corresponding author's full address and telephone/fax numbers and should be in an e-mail message sent to the Editor, with the file, whose name should begin with the first author's surname, as an attachment. Article Types Three types of manuscripts may be submitted: Regular articles: These should describe new and carefully confirmed findings, and experimental procedures should be given in sufficient detail for others to verify the work. The length of a full paper should be the minimum required to describe and interpret the work clearly. Short Communications: A Short Communication is suitable for recording the results of complete small investigations or giving details of new models or hypotheses, innovative methods, techniques or apparatus. The style of main sections need not conform to that of full-length papers. Short communications are 2 to 4 printed pages (about 6 to 12 manuscript pages) in length. Minireview: Submissions of mini-reviews and perspectives covering topics of current interest are welcome and encouraged. Mini-reviews should be concise and no longer than 4-6 printed pages (about 12 to 18 manuscript pages). Mini-reviews are also peer-reviewed.

Regular articles All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title page. The Title should be a brief phrase describing the contents of the paper. The Title Page should include the authors' full names and affiliations, the name of the corresponding author along with phone, fax and E-mail information. Present addresses of authors should appear as a footnote. The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. The Abstract should be 100 to 200 words in length.. Complete sentences, active verbs, and the third person should be used, and the abstract should be written in the past tense. Standard nomenclature should be used and abbreviations should be avoided. No literature should be cited. Following the abstract, about 3 to 10 key words that will provide indexing references should be listed. A list of non-standard Abbreviations should be added. In general, non-standard abbreviations should be used only when the full term is very long and used often. Each abbreviation should be spelled out and introduced in parentheses the first time it is used in the text. Only recommended SI units should be used. Authors should use the solidus presentation (mg/ml). Standard abbreviations (such as ATP and DNA) need not be defined.

Review Process All manuscripts are reviewed by an editor and members of the Editorial Board or qualified outside reviewers. Authors cannot nominate reviewers. Only reviewers randomly selected from our database with specialization in the subject area will be contacted to evaluate the manuscripts. The process will be blind review. Decisions will be made as rapidly as possible, and the journal strives to return reviewersâ&#x20AC;&#x2122; comments to authors as fast as possible. The editorial board will re-review manuscripts that are accepted pending revision. It is the goal of the AJB to publish manuscripts within weeks after submission.

The Introduction should provide a clear statement of the problem, the relevant literature on the subject, and the proposed approach or solution. It should be understandable to colleagues from a broad range of scientific disciplines.

Materials and methods should be complete enough to allow experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. Capitalize trade names and include the manufacturer's name and address. Subheadings should be used. Methods in general use need not be described in detail.

Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the authors' experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. Discussion, speculation and detailed interpretation of data should not be included in the Results but should be put into the Discussion section. The Discussion should interpret the findings in view of the results obtained in this and in past studies on this topic. State the conclusions in a few sentences at the end of the paper. The Results and Discussion sections can include subheadings, and when appropriate, both sections can be combined. The Acknowledgments of people, grants, funds, etc should be brief. Tables should be kept to a minimum and be designed to be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes. Each table should be on a separate page, numbered consecutively in Arabic numerals and supplied with a heading and a legend. Tables should be self-explanatory without reference to the text. The details of the methods used in the experiments should preferably be described in the legend instead of in the text. The same data should not be presented in both table and graph form or repeated in the text. Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, TIFF, JPEG or Powerpoint before pasting in the Microsoft Word manuscript file. Tables should be prepared in Microsoft Word. Use Arabic numerals to designate figures and upper case letters for their parts (Figure 1). Begin each legend with a title and include sufficient description so that the figure is understandable without reading the text of the manuscript. Information given in legends should not be repeated in the text. References: In the text, a reference identified by means of an author‘s name should be followed by the date of the reference in parentheses. When there are more than two authors, only the first author‘s name should be mentioned, followed by ’et al‘. In the event that an author cited has had two or more works published during the same year, the reference, both in the text and in the reference list, should be identified by a lower case letter like ’a‘ and ’b‘ after the date to distinguish the works. Examples: Smith (2000), Blake et al. (2003), (Kelebeni, 1983), (Chandra and Singh,1992),(Chege, 1998; Steddy, 1987a,b;

Gold, 1993,1995), (Kumasi et al., 2001) References should be listed at the end of the paper in alphabetical order. Articles in preparation or articles submitted for publication, unpublished observations, personal communications, etc. should not be included in the reference list but should only be mentioned in the article text (e.g., A. Kingori, University of Nairobi, Kenya, personal communication). Journal names are abbreviated according to Chemical Abstracts. Authors are fully responsible for the accuracy of the references. Examples: Diaz E, Prieto MA (2000). Bacterial promoters triggering biodegradation of aromatic pollutants. Curr. Opin. Biotech. 11: 467-475. Dorn E, Knackmuss HJ (1978). Chemical structure and biodegradability of halogenated aromatic compounds. Two catechol 1, 2 dioxygenases from a 3chlorobenzoate-grown Pseudomonad. Biochem. J. 174: 73-84. Pitter P, Chudoba J (1990). Biodegradability of Organic Substances in the Aquatic Environment. CRC press, Boca Raton, Florida, USA. Alexander M (1965). Biodegradation: Problems of Molecular Recalcitrance and Microbial Fallibility. Adv. Appl. Microbiol. 7: 35-80. Boder ET, Wittrup KD (1997). Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotechnol. 15: 537-553.

Short Communications Short Communications are limited to a maximum of two figures and one table. They should present a complete study that is more limited in scope than is found in full-length papers. The items of manuscript preparation listed above apply to Short Communications with the following differences: (1) Abstracts are limited to 100 words; (2) instead of a separate Materials and Methods section, experimental procedures may be incorporated into Figure Legends and Table footnotes; (3) Results and Discussion should be combined into a single section. Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF file. Page proofs are considered to be the final version of the manuscript. With the exception of typographical or minor clerical errors, no changes will be made in the manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that the editorial office waive some of the handling fee under special circumstances. Copyright: ÂŠ 2012, Academic Journals. All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary bibliographic citation, including author attribution, date and article title. Submission of a manuscript implies: that the work described has not been published before (except in the form of an abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the publisher. Disclaimer of Warranties In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or not advised of the possibility of damage, and on any theory of liability. This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or information in this publication or of any other publication to which it may be linked.

African Journal of Biotechnology Table of Contents:

Volume 11

Number 33 24 April, 2012,

International Journal of Medicine and Medical Sciences

ences

ARTICLES

Review Procalcitonin, C-reactive protein and prognosis in septic patients Yoshan Moodley

8167

Research Articles GENETICS AND MOLECULAR BIOLOGY Direct colony polymerase chain reaction (PCR): An efficient technique to rapidly identify and distinguish Mycosphaerella fijiensis and Mycosphaerella musicola Roberto Vázquez-Euán, Rosa Grijalva-Arango, Bartolomé Chi-Manzanero, Miguel Tzec-Simá, Ignacio Islas-Flores, Cecilia Rodríguez-García, Leticia Peraza-Echeverría, Andrew C. James, Gilberto Manzo-Sánchez and Blondy Canto-Canché

8172

8181

Genetic diversity of Colletotrichum gloeosporioides in Nigeria using amplified fragment length polymorphism (AFLP) markers Aduramigba-Modupe A. O, Asiedu R, Odebode A. C and Owolade O. F

8189

Identification of a male-specific amplified fragment length polymorphism (AFLP) marker in Broussonetia papyrifera Wang Lianjun, Dai Changbo, Liu Degao and Liu Qingchang

8196

Table of Contents:

Volume 11

Number 33 24 April, 2012

ences ARTICLES Simple sequence repeat (SSR) markers analysis of genetic diversity among Brassica napus inbred lines based on correlation between seed quality traits and seed pigments content Cunmin Qu, Fuyou Fu, Liezhao Liu, Kun Lu, Jieheng Huang, Xiaolan Liu, Jingmei Xie, Li Chen, Rui Wang, Zhanglin Tang and Jiana Li

The effects of activation time on the production of fructose and bioethanol from date extract Gaily M. H, Sulieman A. K, Zeinelabdeen M. A, Al-Zahrani S. M, Atiyeh, H. K and Abasaeed A. E

8202

8212

PLANT AND AGRICULTURAL TECHNOLOGY In vitro regeneration from internodal explants of bitter melon (Momordica charantia L.) via indirect organogenesis Muthu Thiruvengadam, Nagella Praveen and Ill-Min Chung

Introgression of bacterial blight (BB) resistance genes Xa7 and Xa21 into popular restorer line and their hybrids by molecular marker-assisted backcross (MABC) selection scheme Junying Xu, Jiefeng Jiang, Xiaofei Dong, Jauhar Ali and Tongmin Mou

8218

8225

ENVIRONMENTAL BIOTECHNOLOGY Concentration of selected heavy metals in water of the Juru River, Penang, Malaysia IDRISS A. A and AHMAD A. K

8234

INDUSTRIAL MICROBIOLOGY Influence of two inocula levels of Saccharomyces bayanus, BV 818 on fermentation and physico-chemical properties of fermented tomato (Lycopersicon esculentum Mill.) juice John Owusu, Haile Ma, Ernest Ekow Abano and Felix Narku Engmann

8241

Table of Contents:

Volume 11

Number 33 24 April, 2012

ences ARTICLES High-yield production of Streptavidin with native C-terminal in Escherichia coli Xuelan Chen, Feng Xu, Fuzhong Peng, Hong Xu, Wei Luo, Hengyi Xu and Yonghua Xiong

Effect of garlic’s mode of administration on erythrocytes and plasma parameters in Wistar rat Sonia Hamlaoui-Gasmi, Meherzia Mokni, Nadia Limam, Ferid Limam, Mohamed Amri, Ezzedine Aouani and Lamjed Marzouki

8250

8259

APPLIED BIOCHEMISTRY Chemical modification of β-endoglucanase from Trichoderma viridin by methanol and determination of the catalytic functional groups Feng Cai, Yangang Xie, Xiaochun He and Tiejun Li

8264

Effects of dietary intake of red palm oil on fatty acid composition and lipid profiles in male Wistar rats A. O. Ayeleso, O. O. Oguntibeju and N. L. Brooks

8275

Effect of terrains on the volatiles of Cabernet Sauvignon wines grown in Loess Plateau region of China Bao Jiang, Zhen-Wen Zhang and Jun-Xian Zhang

8280

Purification and characterization of α-amylase from Ganoderma tsuage growing in waste bread medium Muhammad Irshad, Zahid Anwar, Muhammad Gulfraz, Hamama Islam Butt, Amir Ejaz and Haq Nawaz

Extraordinary mullet growth through direct injection of foreign DNA Samy Yehya El-Zaeem

8288

8295

Table of Contents:

Volume 11

Number 33

24 April, 2012

ences ARTICLES Comparison of liquid culture methods and effect of temporary immersion bioreactor on growth and multiplication of banana (Musa, cv. Dwarf Cavendish) Farah Farahani and Ahmad Majd

8302

Effects of an ethanolic extract of Garcinia kola on glucose and lipid levels in streptozotocin induced diabetic rats B. N. Duze, C. R. Sewani-Rusike and B. N. Nkeh-Chungag

8309

Optimization of cholesterol oxidase production by Brevibacterium sp. employing response surface methodology Shengli Yang and Hui Zhang

8316

MEDICAL AND PHARMACEUTICAL BIOTECHNOLOGY Salvia miltiorrhiza inhibits the expressions of transcription factor T-bet (T-bet) and tumor necrosis factor Îą (TNFÎą) in the experimental colitis in mice Xu Dekui, Wu Simeng, Yu Hongbo, Zheng Changqing, Liu Dongmei and Lin Yan

Antimicrobial and antiviral activities against Newcastle disease virus (NDV) from marine algae isolated from Qusier and Marsa-Alam Seashore (Red Sea), Egypt Ibraheem Borie Mohammad Ibraheem, Neveen Abdel-Raouf, Mohamed Sayed Abdel-Hameed and Khaled El-yamany

Chemical composition of essential oil of Psidium cattleianum var. lucidum (Myrtaceae) Raju K. Chalannavar, Venugopala K. Narayanaswamy, Himansu Baijnath and Bharti Odhav

8323

8332

8341

Table of Contents:

Volume 11

Number 33

24 April, 2012

ences ARTICLES ENTOMOLOGY Regulatory effects of Tenebrio molitor Linnaeus on immunological function in mice Qingfeng Tang, Yin Dai and Benguo Zhou

8348

FISHERY SCIENCE Effect of dietary protein, lipid and carbohydrate contents on the carcass composition of Cyprinus carpio communis fingerlings Muzaffar Ahmad, Qureshi T. A and Singh A. B

8353

Effect of dietary protein, lipid and carbohydrate contents on the viscera composition and organ Indices of Cyprinus carpio communis fingerlings Muzaffar Ahmad, T. A. Qureshi and A. B. Singh

8361

Effect of dietary protein, lipid and carbohydrate contents on the nutrient and energy utilization and digestibility of Cyprinus carpio communis fingerlings Muzaffar Ahmad, T. A. Qureshi and Singh A. B

8367

BIOTECHNIQUES Preparation of immunoaffinity column for rapid purification of human DNA polymerase delta and its subassemblies Xiao Li, Huiqing Chen, Lei Zhang, Liu Liu, Yujue Wang, Qian Zhang, Xiaoyong Liu, Yuanqing He, Yan Chen, Keping Chen and Yajing Zhou

Variation in quantitative characters of faba bean after seed irradiation and associated molecular changes Sonia MEJRI, Yassine MABROUK, Marie VOISIN, Philippe DELAVAULT, Philippe SIMIER, Mouldi SAIDI and Omrane BELHADJ

8375

8383

Table of Contents:

Volume 11

Number 33

24 April, 2012

ences ARTICLES Decolorization of azo dyes by Pycnoporus sanguineus and Trametes Membranacea Da Paz E. S. L, Paz JĂşnior F. B, Neto B. B and Cavalcanti M. A. Q

Effect of cadmium chloride and ascorbic acid exposure on the vital organs of freshwater Cyprinid, Labeo rohita Abdul Latif, Muhammad Ali, Rahila Kaoser, Rehana Iqbal, Kashif Umer, Muhammad Latif, Shazia Qadir and Furhan Iqbal

8391

8398

PHARMACEUTICAL SCIENCES Antibacterial spectrum of traditionally used medicinal plants of Hazara, Pakistan Ihtisham Bukhari, Mukhtiar Hassan, Fida M Abassi, Yasmeen Shakir, Asfandyar Khan, Sohail Ahmed, Rabia Masood, Zeba G Burki, Muhammad Afzal, Uzma Khan, Faisal Shahzad and Sajjad Hussain

8404

ANIMAL SCIENCE Supplementation of broiler feed with leaves of Vernonia amygdalina and Azadirachta indica protected birds naturally infected with Eimeria sp. Oyagbemi T. O and Adejinmi J. O

8407

African Journal of Biotechnology Vol. 11(33), pp. 8167-8171, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJBX11.075 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Review

Procalcitonin, C-reactive protein and prognosis in septic patients Yoshan Moodley Department of Anaesthetics, University of Kwazulu-Natal, South Africa. E-mail: moodleyyo@ukzn.ac.za. Tel: +27 31 240 1729. Accepted 3 February, 2012

Sepsis is of major importance worldwide, placing economic burden on healthcare systems and often resulting in morbidity and mortality in affected patients. The use of rapid, effective prognostic laboratory tests will no doubt improve decision-making on the part of the physician. We describe prospective observational studies of two commonly used biomarkers when monitoring the clinical course of sepsis, procalcitonin and C-reactive protein, herein. Key words: Procalcitonin, C-reactive protein, sepsis.

INTRODUCTION Infection by microorganisms may develop into systemic manifestations, namely sepsis (Figure 1). Sepsis may place significant economic burden on the healthcare systems of some countries and accounts for a substantial proportion of morbidity and mortality in affected patients (Martin et al., 2003). There remains a need for rapid, effective methods to predict outcomes in septic patients. Advances in medical biotechnology have yielded a number of biological markers (biomarkers), such as procalcitonin (PCT) and C-reactive protein (CRP), which address this need. PCT is a 116 amino acid prohormone encoded for by the CALC-1 gene on chromosome 11 (Figure 2). In healthy individuals, PCT is produced by C-cells in the thyroid (Carrol et al., 2002; Maruna et al., 2000; Michael, 2002). During sepsis/infection, parenchymal cells produce PCT in large quantities (up to 100,000 times normal physiological levels) following the onset of sepsis/infection (Niederman, 2008). The cytokines interleukin-1 and tumor necrosis factor- , as well as bacterial cell wall components such as lipopolysaccharide, are known inducers of PCT synthesis (Maruna et al., 2000). The role played by PCT during infection remains unknown; however its application as a biomarker is well established. PCT levels may be used to differentiate between Systemic Inflammatory Response Syndrome (SIRS) and sepsis, as well as differentiate between different degrees of sepsis (Carrol et al., 2002). CRP belongs to a group of phyllogenetically ancient

proteins known as pentraxins(Black et al., 2004). CRP is encoded by a gene CRP mapped to chromosome 1, and is produced by the liver during the acute phase (following trauma/infection) (Volanakis, 2001). Serum concentrations of CRP may increase 1000-fold within 2 days following induction by the pro-inflammatory cytokine interleukin-6 (Ablij and Meinders, 2002). Structurally, CRP consists of 206 amino acids arranged as five noncovalently linked protomers (Figure 3). CRP was first described in 1930, following its observed reaction with cell wall components of the bacterium Streptococcus pneumoniae. In addition to phosphocholine on bacterial cell walls, which it binds in a calcium-dependant manner, chromatin and nuclear proteins have also been identified as ligands for CRP (Black et al., 2004). CRP plays an important role during the innate immune response to infection. It activates the complement system via the classical pathway through direct interactions with complement proteins. CRP may also activate phagocytic cells by interacting with receptors on the cell surface. Other functions of CRP include its roles in the removal of apoptotic cells, atherosclerosis, and the mediation of tissue damage during myocardial infarction (Ablij and Meinders, 2002). PROSPECTIVE STUDIES COMPARING PCT AND CRP Zhang and colleagues evaluated the prognostic potential

8168

Afr. J. Biotechnol.

Infection or Trauma

SIRS

Sepsis

A clinical response resulting from a non-specific insult including 2 of the following: • Temperature >38oC or <36oC • Pulse > 90/min • Respiratory rate > 20/min • White cell count >12000 cells/ L or <4000 cells/ L

Severe Sepsis

SIRS with a presumed or confirmed infectious process

Figure 1. Definitions of SIRS and Sepsis (Qureshi and Rajah, 2008).

Signal sequence Aminoprocalcitonin

Calcitonin

NH2

Katacalcin COOH

PROCALCITONIN Figure 2. Schematic illustration of PCT (Carrol et al., 2002).

of serum soluble proteins such as: Triggering receptor expressed on myeloid cells-1 (sTREM-1), CRP and PCT in 52 patients with varying degrees of sepsis. It was found that within 7 days of admission to an intensive care unit (ICU), there was no significant difference in CRP and PCT levels between survivors and non-survivors. However, CRP and PCT levels were found to be significantly different between the two groups at days 10 and 14 post-ICU admission. Patients with higher serum levels of PCT and CRP had poorer prognoses, with CRP levels tending to be higher than PCT levels in patients diagnosed with sepsis based on 28-day survival. Correlation co-efficients between the physiological sequential organ failure assessment (SOFA) score and PCT levels was higher than that between SOFA scores

and CRP levels (r = 0.257 vs. r = 0.406) (Zhang et al., 2011). A similar study showed that baseline CRP did not differ significantly between survivors and non-survivors. PCT levels in non-survivors were almost 4 times higher than PCT levels in survivors (Gibot et al., 2005). The prognostic value of pro-atrial natriuretic peptide, proadrenomedullin, CRP and PCT was evaluated in 51 critically ill patients (Wang and Kang, 2010). In concurrence with the findings of Zhang et al. (2011), CRP and PCT levels were not significantly different between survivors and non-survivors on the day of admission to ICU (p = 0.75 and p = 0.08, respectively). Receiver operating characteristic (ROC) curve analysis showed that PCT was of more prognostic value than CRP. The area under curve (AUC) for PCT and CRP were

Moodley

8169

Fivefold symmetry axis Calciumdependant binding site for ligand

2Ca2+ 2Ca2+

2Ca2+

Binding sites for polycations, FcÎłRI, FCÎłRIIa and C1q

Protomer

Figure 3. Schematic illustration of CRP (Ablij and Meinders, 2002)

calculated as 0.81 and 0.53, respectively. In a smaller study of 20 patients with sepsis and severe sepsis, both PCT and CRP were higher in non-survivors with sepsis versus survivors (Piechota et al., 2007). In another study, PCT and CRP levels were elevated on day 1 of sepsis, and decreased steadily by day 7 in both survivors and non-survivors. Following day 7 of sepsis, an increase in circulating PCT was associated with a lethal outcome. Similar increases in CRP levels were observed in non-survivors after 7 days. However, serial CRP measurements did not adequately reflect sepsis severity or outcomes in septic patients. Also, CRP measurements in this study were not able to differentiate between sepsis and uneventful post-operative course (Tschaikowsky et al., 2002). In a study of 281 patients with community-acquired pneumonia (Schuetz et al., 2008), CRP levels measured at baseline where higher than PCT levels measured at the corresponding point in time. ROC analysis suggested that the ability of PCT to predict death was better when compared to CRP (AUC = 0.59 vs. 0.51). ROC analysis also showed that the ability of PCT to predict adverse outcomes tended to be better than that of CRP (AUC = 0.65 vs. 0.58). When combined with clinical severity scores, both CRP and PCT could not reliably predict death/adverse outcomes. The authors concluded that PCT was more of a diagnostic tool rather than a prognostic tool. In another two studies of communityacquired pneumonia, PCT showed improved performance at predicting death/organ failure than CRP (ChristCrain et al., 2006, 2007). Brunkhorst et al. (2002)

demonstrated that elevated CRP levels in patients with severe pneumonia were not prognostic, while PCT had a slight prognostic value. It was also found that in the latter stages of disease, non-survivors had higher PCT levels than survivors. Rau et al. (2007a) found that elevated PCT in patients with peritonitis was more likely to be associated with multi-organ dysfunction syndrome (MODS). Persistent PCT elevation was observed after 7 days in nonsurvivors. These findings were in contrast to CRP levels, which was not significantly different between survivors and non-survivors. A PCT level of >1 ng/ml was established as a suitable predictor of mortality in the week following the onset of symptomatic peritonitis. In a similar study, PCT was again shown to be a better prognostic tool than CRP in patients with severe acute pancreatitis (Rau et al., 2007b). Pettila et al. (2002) conducted a prospective cohort study to establish the predictive value of PCT and interleukin-6 in critically ill patients with suspected sepsis. CRP was also included for comparison. PCT was higher in non-survivors on days 1 and 2 post-admission (p = 0.007 and 0.003, respectively). For CRP, there was no significant difference observed in non-survivors and survivors on days 1 and 2 post-admission (p = 0.15 and 0.52, respectively). For PCT, reasonable discriminative power related to hospital mortality was observed on day 2 post admission (AUC > 0.75). AUC analysis for CRP did not yield similar results (AUC = 0.533). It should be noted that both PCT and CRP were not independently associated with mortality in this study.

8170

Afr. J. Biotechnol.

In a study of 101 critically ill patients admitted to an ICU, there was no significant difference between PCT levels in survivors (p = 0.38) and non-survivors (p = 0.05) on the day following ICU admission. The authors also stated that there was also a significant difference in CRP levels between survivors and non-survivors on the day following ICU admission, although this data was not presented. ROC/AUC plot analysis suggested PCT was better at predicting mortality than CRP (AUC = 0.67 vs. 0.51) (Morgenthaler et al., 2005). Between May 1998 and April 2000, Meisner et al. (2006) studied the kinetics of CRP and PCT in 90 adult trauma patients. Forty of these patients had proven infection, with PCT levels of days 1 and 2 post-trauma significantly higher in those who subsequently developed infection or those with suspected infection. CRP measurements at the same time points did not differ significantly amongst those developing a proven infection or in patients with suspected infection. Maruna et al. (2011) compared PCT with other inflammatory markers (including CRP) to determine its prognostic value following pulmonary artery endarterectomy. ROC/AUC analysis for PCT to predict post-operative infection was 0.83. No ROC/AUC analysis for CRP was presented. The discriminatory ability of PCT, CRP and physiological scores (MEDS) to predict mortality was evaluated by Lee and colleagues. The physiological scoring system was better than the two biomarkers at predicting early/late mortality. ROC analysis showed that there was a larger AUC for PCT in predicting early mortality than CRP (AUC = 0.76 vs. 0.68, respectively). C-statistics were also significantly different between CRP and PCT (P = 0.031). For late mortality, AUC obtained for PCT and CRP were 0.73 and 0.674, respectively. Cstatistics were once again significantly different between CRP and PCT (P = 0.030). Overall, there was a recommendation that PCT/CRP should be combined with physiological scoring systems for improved predictive accuracy (Lee et al., 2008). In a pilot study, comparing macrophage migration inhibitory factor (MIF), CRP and PCT in cardiac surgery patients with sepsis, PCT levels in non-survivors were significantly higher than those measured in survivors (P = 0.007). An AUC of 0.656 was obtained for PCT. No significant association between CRP and mortality/organ dysfunction was observed. Unfortunately, no ROC/AUC data for CRP was presented (de Mendonca-Filho et al., 2005). Clecâ&#x20AC;&#x2122;h et al. (2004) conducted a prospective controlled trial to determine whether PCT is a reliable diagnostic/ prognostic marker in septic shock versus non-septic shock. In patients with septic shock, non-survivors had higher levels of PCT that survivors measured on days 1, 3, 7 and 10 of septic shock (P = 0.045; 0.03; 0.003; and 0.02, respectively). PCT was shown to be of little value in predicting outcomes in cardiogenic shock. CRP levels were not correlated with outcomes on days 1, 3, 7, and 10 of septic shock. On day 1 of septic shock, a PCT level of

6 ng/ml predicted death (sensitivity = 87.5%, specificity = 45%). The authors stated that caution should be exercised when interpreting high PCT levels, as these may be associated with reduced specificity In a study by Claeys et al. (2002), both CRP and PCT proved to be poor predictors of outcome in terms of survival. PCT levels showed a decreasing trend in survivors versus non-survivors within 2 days of acute septic shock (P = 0.047). CRP levels in survivors also showed a decreasing trend, however after a longer time period of 120 h (P = 0.037). Christ-Crain and colleagues showed that there was no significant difference in PCT and CRP levels between survivors and non-survivors on admission to ICU. In those patients with diagnosed sepsis, PCT showed better prognostic ability than CRP (AUC = 0.68 vs. 0.60, respectively) (Christ-Crain et al., 2005). Similarly, PCT levels on day 3 of sepsis were superior to CRP in predicting mortality in critically ill patients (AUC = 0.81 vs. 0.63, respectively) (Chopin et al., 2006).Castelli et al. (2009) established that a PCT level of 1 to 1.5 ng/ml admission was the optimal cutt-off value for prognosis of sepsis versus SIRS. PCT, but not CRP at admission correlated with SOFA scores (p < 0.001). PCT was a superior maker for identifying patients at risk of organ dysfunction. A study of meningococcal septic shock in children showed that PC and CRP levels on admission were not significantly different between survivors and nonsurvivors. The AUC for prediction of septic shock for PCT and CRP were 0.85 and 0.428, respectively. The AUC for PCT in predicting the need for ventilation was 0.72, whilst CRP was not able to discriminate between children requiring ventilation and those who did not. PCT was also able to discriminate children requiring prolonged ICU stay exceeding 10 days (AUC = 0.97), whereas CRP could not (Carrol et al., 2005). CONCLUSION Biomarkers have proven to be a suitable method for predicting clinical outcomes in septic patients. Both CRP and PCT levels are commonly measured in septic patients, however, PCT is shown in many studies to have superior prognostic value when compared with CRP. Although there is a trend to a better prognostic value of PCT, many of the studies described in this paper are limited by small sample size. Further research with larger cohort sizes is required. REFERENCES Ablij H, Meinders A (2002). C-reactive protein: history and revival. Eur. J. Int. Med. 13: 412. Black S, Kushner I, Samols D (2004). C-reactive Protein. J. Biol. Chem. 279: 48487-48490. Brunkhorst FM, Al-Nawas B, Krummenauer F, Forycki ZF, Shah PM (2002). Procalcitonin, C-reactive protein and APACHE II score for risk evaluation in patients with severe pneumonia. Clin. Microbiol. Infect.

Moodley

8: 93-100. Carrol ED, Newland P, Thomson AP, Hart CA (2005). Prognostic value of procalcitonin in children with meningococcal sepsis. Crit. Care Med. 33: 224-225. Carrol ED, Thomson APJ, Hart CA (2002). Procalcitonin as a marker of sepsis. Int. J. Antimicrob. Agents, 20: 1-9. Castelli GP, Pognani C, Cita M, Paladini R (2009). Procalcitonin as a prognostic and diagnostic tool for septic complications after major trauma. Crit. Care. Med. 37: 1845-1849. Chopin N, Floccard B, Sobas F, Illinger J, Boselli E, Benatir F, Levrat A, Guillaume C, Crozon J, Negrier C, Allaouchiche B (2006). Activated partial thromboplastin time waveform analysis: a new tool to detect infection? Crit. Care Med. 34: 1654-1660. Christ-Crain M, Morgenthaler NG, Stolz D, Muller C, Bingisser R, Harbarth S, Tamm M, Struck J, Bergmann A, Muller B (2006). Proadrenomedullin to predict severity and outcome in communityacquired pneumonia [ISRCTN04176397]. Crit. Care, 10: R96. Christ-Crain M, Morgenthaler NG, Struck J, Harbarth S, Bergmann A, Muller B (2005). Mid-regional pro-adrenomedullin as a prognostic marker in sepsis: an observational study. Crit. Care, 9: R816-824. Christ-Crain M, Stolz D, Jutla S, Couppis O, Muller C, Bingisser R, Schuetz P, Tamm M, Edwards R, Muller B, Grossman AB (2007). Free and total cortisol levels as predictors of severity and outcome in community-acquired pneumonia. Am. J. Respir. Crit. Care. Med. 176: 913-920. Claeys R, Vinken S, Spapen H, ver Elst K, Decochez K, Huyghens L, Gorus FK (2002). Plasma procalcitonin and C-reactive protein in acute septic shock: clinical and biological correlates. Crit. Care. Med. 30: 757-762. Clec'h C, Ferriere F, Karoubi P, Fosse JP, Cupa M, Hoang P, Cohen Y (2004). Diagnostic and prognostic value of procalcitonin in patients with septic shock. Crit. Care. Med. 32: 1166-1169. De Mendonca-Filho HT, Gomes GS, Nogueira PM, Fernandes MA, Tura BR, Santos M, Castro-Faria-Neto HC (2005). Macrophage migration inhibitory factor is associated with positive cultures in patients with sepsis after cardiac surgery. Shock, 24: 313-317. Gibot S, Cravoisy A, Kolopp-Sarda MN, Bene MC, Faure G, Bollaert PE, Levy B (2005). Time-course of sTREM (soluble triggering receptor expressed on myeloid cells)-1, procalcitonin, and C-reactive protein plasma concentrations during sepsis. Crit. Care Med. 33: 792796. Lee CC, Chen SY, Tsai CL, Wu SC, Chiang WC, Wang JL, Sun HY, Chen SC, Chen WJ, Hsueh PR (2008). Prognostic value of mortality in emergency department sepsis score, procalcitonin, and C-reactive protein in patients with sepsis at the emergency department. Shock, 29: 322-327. Martin GS, Mannino DM, Eaton S, Moss M (2003). The epidemiology of sepsis in the United States from 1979 through 2000. N. Engl. J. Med. 348: 1546-1554. Maruna P, Kunstyr J, Plocova KM, Mlejnsky F, Hubacek J, Klein AA, Lindner J (2011). Predictors of infection after pulmonary endarterectomy for chronic thrombo-embolic pulmonary hypertension. Eur. J. Cardiothorac. Surg. 39: 195-200. Maruna P, Nedelnikova K, Gurlich R (2000). Physiology and genetics of procalcitonin. Physiol. Res. 49(1): S57-61. Meisner M, Adina H, Schmidt J (2006). Correlation of procalcitonin and C-reactive protein to inflammation, complications, and outcome during the intensive care unit course of multiple-trauma patients. Crit. Care, 10: R1. Michael M (2002). Pathobiochemistry and clinical use of procalcitonin. Clin. Chimica Acta. 323: 17-29.

8171

Morgenthaler NG, Struck J, Christ-Crain M, Bergmann A, Muller B (2005). Pro-atrial natriuretic peptide is a prognostic marker in sepsis, similar to the APACHE II score: an observational study. Crit. Care, 9: R37-45. Niederman MS (2008). Biological markers to determine eligibility in trials for community-acquired pneumonia: a focus on procalcitonin. Clin. Infect. Dis. 47(3): S127-132. Pettila V, Hynninen M, Takkunen O, Kuusela P, Valtonen M (2002). Predictive value of procalcitonin and interleukin 6 in critically ill patients with suspected sepsis. Intensive Care Med. 28: 1220-1225. Piechota M, Banach M, Irzmanski R, Misztal M, Rysz J, Barylski M, Piechota-Urbanska M, Kowalski J, Pawlicki L (2007). N-terminal brain natriuretic propeptide levels correlate with procalcitonin and Creactive protein levels in septic patients. Cell. Mol. Biol. Lett. 12: 162175. Qureshi K, Rajah A (2008). Septic shock: A review article. BJMP. 1: 712. Rau BM, Frigerio I, Buchler MW, Wegscheider K, Bassi C, Puolakkainen PA, Beger HG, Schilling MK (2007a). Evaluation of procalcitonin for predicting septic multiorgan failure and overall prognosis in secondary peritonitis: a prospective, international multicenter study. Arch. Surg. 142: 134-142. Rau BM, Kemppainen EA, Gumbs AA, Buchler MW, Wegscheider K, Bassi C, Puolakkainen PA, Beger HG (2007b). Early assessment of pancreatic infections and overall prognosis in severe acute pancreatitis by procalcitonin (PCT): a prospective international multicenter study. Ann. Surg. 245: 745-754. Schuetz P, Stolz D, Mueller B, Morgenthaler NG, Struck J, Mueller C, Bingisser R, Tamm M, Christ-Crain M (2008). Endothelin-1 precursor peptides correlate with severity of disease and outcome in patients with community acquired pneumonia. BMC Infect. Dis. 8: 22. Tschaikowsky K, Hedwig-Geissing M, Schiele A, Bremer F, Schywalsky M, Schuttler J (2002). Coincidence of pro- and anti-inflammatory responses in the early phase of severe sepsis: Longitudinal study of mononuclear histocompatibility leukocyte antigen-DR expression, procalcitonin, C-reactive protein, and changes in T-cell subsets in septic and postoperative patients. Crit. Care Med. 30: 1015-1023. Volanakis JE (2001). Human C-reactive protein: expression, structure, and function. Mol. Immunol. 38: 189-197. Wang RL, Kang FX (2010). Prediction about severity and outcome of sepsis by pro-atrial natriuretic peptide and pro-adrenomedullin. Chin. J. Traumatol. 13: 152-157. Zhang J, She D, Feng D, Jia Y, Xie L (2011). Dynamic changes of serum soluble triggering receptor expressed on myeloid cells-1 (sTREM-1) reflect sepsis severity and can predict prognosis: a prospective study. BMC Infect. Dis. 11: p. 53.

Full Length Research Paper

Direct colony polymerase chain reaction (PCR): An efficient technique to rapidly identify and distinguish Mycosphaerella fijiensis and Mycosphaerella musicola Roberto Vázquez-Euán1, Rosa Grijalva-Arango1, Bartolomé Chi-Manzanero1, Miguel TzecSimá1, Ignacio Islas-Flores2, Cecilia Rodríguez-García1, Leticia Peraza-Echeverría1, Andrew C. James1, Gilberto Manzo-Sánchez3 and Blondy Canto-Canché1* 1

Unidad de Biotecnología, Centro de Investigación Científica de Yucatán, Calle 43 No. 130, Col. Churburná de Hidalgo, Mérida, C.P. 97200, Yucatán, México. 2 Unidad de Bioquímica y Biología Molecular de Plantas, Centro de Investigación Científica de Yucatán, Calle 43 No. 130, Col. Chuburná de Hidalgo, Mérida, C.P. 97200, Yucatán, México. 3Laboratorio de Biotecnología, Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colima, Ap. Postal 36, Autopista Colima-Manzanillo km 40, C.P. 28100, Colima, México. Accepted 8 March, 2012

Sigatoka disease is the most important threat for banana production worldwide. Many species of Mycosphaerella have been described from banana but, to date, the three species Mycosphaerella fijiensis, M. musicola and M. eumusae are the only species found to be pathogenic to banana. Reliable identification by classical methods requires expertise because these fungi produce similar symptoms and they are morphologically similar. For studies of ecology, genetic diversity and epidemiology their differentiation is crucial. Several laboratories have developed molecular protocols to differentiate these fungi. Currently, a number of primers targeting ribosomal sequences, actin, tubulin and histone 3 genes are available for diagnosis of the Sigatoka complex. In the present work, we report a direct colonypolymerase chain reaction (DC-PCR) approach to rapidly distinguish M. fijiensis and M. musicola strains in multiplex PCR reactions. This is the most economical and the fastest procedure reported so far for diagnosis of these two Mycosphaerella species, which are distributed in banana-growing regions in the world; the DC-PCR technique was also found to be amenable for the identification of mating type of M. fijiensis isolates. This DC-PCR may also be applicable to prepare DNA templates for basic PCRbased analyses in other fungi. Key words: Sigatoka diseases, Banana’s Mycosphaerella, molecular diagnosis, direct colony PCR.

INTRODUCTION The causal agents of the most important fungal leaf diseases of banana worldwide, comprise Mycosphaerella fijiensis which causes the black Sigatoka disease,

*Corresponding author. E-mail: cantocanche@cicy.mx. Tel: 52+( 999)9428330 ext. 265. Fax: 52+ (999) 981 39 00. Abbreviations: ITS, Internal transcribed spacer; PCR, polymerase chain reaction; DC-PCR, direct colony PCR; dNTPs, deoxynucleotide triphosphates; bp, base pairs.

Mycosphaerella musicola (yellow Sigatoka disease) and Mycosphaerella eumusae (leaf spot disease) (Carlier et al., 2000; Arzanlou et al., 2007, 2008, Churchill, 2010). M. fijiensis and M. musicola are distributed worldwide in banana-growing regions (Jones, 2000), while M. eumusae has been so far described in South-East Asia, some Indian Ocean Islands and Nigeria (Arzanlou et al., 2010; Churchill, 2010). In addition to these three fungi, recently Arzanlou et al. (2008) reported three additional Mycosphaerella species occurring in banana, although there are no reports that these are pathogenic.

Vázquez-Euán et al.

8173

Table 1. List of Mycosphaerella isolates used in this study.

Isolate Sa-1 Ma-2 Pb-7 Ya-8 C1233 Veracruz 19H2 19H6

Fungi M. fijiensis M. fijiensis M. fijiensis M. fijiensis M. fijiensis M. fijiensis M. musicola M. musicola

Specialists are able to distinguish different Mycosphaerella species based on disease symptoms and small differences in ascospore sizes and shapes; however, these structures are difficult to produce in culture. In addition, these fungi produce similar symptoms and are morphologically highly similar, which makes identification extremely difficult (Jones, 2000). Furthermore, these fungi can co-exist in the same lesion (Crous, 1998; Arzanlou et al., 2008) and because of their morphological and epidemiological similarities, Mycosphaerella species can be misidentified (Maxwell et al., 2005; Arzanlou et al., 2008). However, molecular identification of fungi overcomes these problems aforementioned. Numerous DNA-based methods have shown to be useful in diagnosis, identification and for taxonomy studies of pathogenic fungi given their simplicity, specificity and sensitivity (Luo and Mitchell, 2002; Schaad and Frederick, 2002; Atkins and Clarck, 2004). The molecular techniques include the sequencing of the internal transcribed sequence (ITS) region (Turenne et al., 1999; Landeweert et al., 2003; Martin and Rygiewicz, 2005), molecular fingerprinting (Plaza et al., 2004; Gente et al., 2006) and the use of polymerase chain reaction (PCR) amplification technique with speciespecific primers (Bindslev et al., 2002; Luo and Mitchell, 2002; Maxwell et al., 2005). Isolation and purification of DNA is a key step in molecular protocols (Mirhendi et al., 2007; Deepak et al., 2007; Alshahni et al., 2009), and usually requires a number of laborious steps. There are some reports of protocols for extraction of DNA from Mycosphaerella fungi (Dellaporta et al., 1983; Johanson et al., 1994; Carlier et al., 2000; Rivas et al., 2004; Conde-Ferráez et al., 2008), but the isolation and purification of DNA is laborious and time consuming. Direct colony PCR (DCPCR) of fungal strains is an ideal alternative, being simpler, quicker and more efficient when compared to standard methodologies. Fungal pathogens can be directly identified from primary isolation plates (Luo and Michell, 2002; Calmin et al., 2007; Mirhendi et al., 2007). Its main characteristic is the omission of the DNA extraction procedure which significantly decreases time and cost; moreover, it avoids the risk of contamination

Geographical origin Uxmal, Yucatan, México Uxmal, Yucatan, México Uxmal, Yucatan, México Uxmal, Yucatan, México Uxmal, Yucatan, México Martínez de la Torre, Veracruz, México Tapachula, Chiapas, México Tapachula, Chiapas, México

during the DNA extraction process (Calmin et al., 2007; Mirhendi et al., 2007; Lau et al., 2008; Alshahni et al., 2009). For population studies (population genetics, fungicide resistance, and epidemiological studies), rapid isolation and identification of a large number of strains are necessary. For these purposes the speeding up of conventional DNA extraction methods is a requisite. Recently, Arzanlou et al. (2007) developed a molecular diagnostic approach for reliably distinguishing between M. fijiensis, M. musicola and M. eumusae. These authors extracted fungal genomic DNA by using the PureGene DNA isolation kit. To achieve this identification faster and cheaper, we used the specie-specific actin primers developed by these authors, but combined them with a simple in-house method for DC-PCR. This direct protocol is suitable for multiplex analysis, enabling rapid classification of Mycosphaerella strains isolated from banana with Sigatoka disease symptoms. In addition, the protocol is also applicable to other fungi. MATERIALS AND METHODS Biological material For the development of this PCR assay, previously identified Mexican Mycosphaerella strains were selected. The “Veracruz” strain was identified by sequencing the ITS region; the other strains were identified by molecular diagnosis using primers from Johanson and Jaeger (1993) and Arzanlou et al. (2007). The strains used here are listed in Table 1. All Mycosphaerella strains were grown on sterile solid medium containing 200 ml/L V8 juice added with 2 g/L CaCO3 and 2% agar–agar. Individual plates were inoculated with 16 mm2 mycelium and growth conditions were according to IslasFlores et al. (2006). For testing the technique with other fungi, the following species and lines were used: Trichoderma reesei CDBBH-353, Phanerochaete chrysosporium ATCC34540, Pleurotus ostreatus CDBB-H-686 and Trametes versicolor PUJ3, obtained from the microbial collection of CINVESTAV, Mexico, and Fusarium sp. isolated in our laboratory from banana lignocellulosic waste collected in the field. These fungal strains were cultured on potatodextrose-agar medium (PDA) for 7 days.

Template preparation A small amount of mycelium (approximately 2 mm2) was picked

8174

Afr. J. Biotechnol.

Table 2. List of primers used in this study.

ITS1 ITS4

Sequence (5′→3′) TCC GTA GGT GAA CCT GCG G TCC TCC GCT TAT TGA TAT GC

MFactF ACTR

CTCATGAAGATCTTGGCTGAG GCAATGATCTTGACCTTCAT

M. fijiensis. Actin (fragment)

500

Arzanlou et al. (2007)

MMactF2 MMactRb

ACGGCCAGGTCATCACT GCGCATGGAAACATGA

M. musicola. Actin (fragment)

200

Arzanlou et al. (2007)

ACTF MEactR

TCCAACCGTGAGAAGATGAC GAGTGCGCATGCGAG

M. eumusae. Actin (fragment)

630

Arzanlou et al. (2007)

ACTF ACTR

TCCAACCGTGAGAAGATGAC GCAATGATCTTGACCTTCAT

Mycosphaerella genus (general). Actin (fragment)

820

Arzanlou et al. (2007)

2723Mt1-F 3137Mt1-R

AGCACCTGGCATGGCTGTGTCACC GCGCAGATGGCGAAGAACTCG

M. fijiensis. Idiomorph mat1-1 (fragment)

414

Conde-Ferráez et al. (2010)

4327Mt2-F 5027Mt2-R

ATGTCGTCAACCAGCAGAAGAACG GGTCATGCGCTTCTTCTTCTCG

M. fijiensis. Idiomorph mat1-2 (fragment)

700

Conde-Ferráez et al. (2010)

flan4739-F inver5656-R

GCGGTTTTGGAGCGGTCAGG AAGCTCTGGGTATCTCAGCACAGG

M. fijiensis. Idiomorph mat1-2 (fragment)

917

Conde-Ferráez et al. (2007)

Primer

with a micropipette tip and suspended in 25 µL of ultrapure water in a 1.5 ml Eppendorf tube. The mycelium was manually ground with a plastic pestle tip, vortexed thoroughly and then spun in a minicentrifuge. Mycelium suspension was used as template in PCR reactions. As a positive control template, genomic DNA from M. fijiensis Veracruz strain was prepared according to Johanson (1995).

PCR reactions For PCR reactions, the mixture contained 3 µL of fungal

Target and location

Expected size product (bp)

References

General in fungi. ITS1-5.8S- ITS2 region of the ribosomal operon.

Highly variable (380-900)

White et al. (1990); Korabecna (2007)

suspension, 3 μL of 5X PCR buffer, 0.6 U of Taq DNA polymerase (BioLine), 2 mM MgCl2, 0.2 mM dNTPs and ultra purified water for a final reaction volume of 15 μL. For amplification of intergenic spacer region 0.8 µM each of the primers ITS1 and ITS2 were used. PCR amplification conditions were 5 min of denaturation at 95°C, followed by 30 cycles of 94°C for 20 s, 55°C for 25 s, 72°C for 50 s and a final extension step of 72°C for 10 min. Independent identification of M. fijienis and M. musicola was performed by amplifying the actin gene (0.4 μM each primer). For M. fijiensis, the primer pair was MFactF and ACTR; for M. musicola, MMactF2 and MMactRb. For simultaneous screening of M. fijiensis and M. musicola by multiplex PCR,

0.4 µM of each MFactF, ACTR, MMactF2 and MMactRb primers were mixed in a single reaction. PCR amplification conditions was 5 min of denaturation at 95°C, followed by 36 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 60 s and an extension step of 72°C for 10 min. Assignment of mating type for M. fijiensis (idiomorphs mat1-1 or mat1-2) was done by multiplex, using 0.8 µM each of the primers 2723Mt1-F and 3137Mt1-R (mat1-1) and 1 µM each of flan4739-F and inver5656-R (mat1-2). The cycling conditions were: 94°C denaturation 4 min, 94°C 40 s, 55°C annealing temperature 40 s, 72°C extension 50 s, 40 cycles; final extension 72°C, 7 min. The primer sequences are shown in Table 2. In all cases, water

Vázquez-Euán et al.

8175

Figure 1. DC-PCR amplification of ITS region from different strains of M. fijiensis and M. musicola. Lanes 1 to 6, M. fijiensis: Sa-1; Ma-2; Pb-7;Ya-8; C1233 and Veracruz respectively. Lanes 7 and 8; M. musicola: 19H2 and 19H6 respectively. Lane 9, Positive control, genomic DNA from M. fijiensis Veracruz strain prepared according to Johanson (1995). Lane 10, Negative control (water). Lane M, Marker HyperLadder I (BioLine)

Figure 2. DC-PCR for diagnostic molecular identification of M. fijiensis and M. musicola in multiplex reactions. Lanes 1 to 6, M. fijiensis strains Sa-1, Ma-2, Pb-7, Ya-8, C1233 and Veracruz, respectively. Lanes 7 and 8, M. musicola strains 19H2 and 19H6 respectively. Lane M, Marker HyperLadder I (BioLine). Amplification was conducted using Arzanlou et al. (2007) primers targeting the actin gene in these fungi

was used as negative control (no template DNA).

Agarose gel electrophoresis Detection of PCR-amplified products were performed by electrophoresis on a 1% (wt/vol) agarose gel stained with ethidium bromide. A volume of 5 µL of PCR product was loaded per lane.

RESULTS Quick test for application of DC-PCR on M. fijiensis and M. musicola fungi - Amplification of ITS The first PCR reactions were conducted using the ITS1 and ITS4 primers which amplify the ITS1-5.8S-ITS region of the ribosomal operon. Six strains of M. fijiensis and two of M. musicola were included. All of them produced an amplicon of approximately 500 bp (Figure 1), showing

that no inhibitor of PCR amplification was evident. Although DNA was not purified, the direct PCR resulted in a single band with the expected size. Diagnosis of M. fijiensis and M. musicola by DC-PCR using specific primers To distinguish M. fijiensis and M. musicola using PCR, we used the primers pairs ACTR/MFactF and MMactF2/ MMactRb reported by Arzanlou et al. (2007) which amplify fragments of the actin gene specifically in M. fijiensis and M. musicola templates. Amplifications were in both cases successful, observing in the gel the expected size-diagnostic bands,500 bp for M. fijiensis and 200 bp for M. musicola. As above, no unspecific bands were observed. To investigate whether this methodology is suitable for high throughput, a multiplex assay was tried. Figure 2 shows the result of multiplex.

8176

Afr. J. Biotechnol.

Figure 3. DC-PCR amplification for mating type determination in Mycosphaerella fijiensis. Lanes 1 and 2, idiomorph mat1-2 (strains Sa-1 and Ma-2); lanes 3 to 6 idiomorph mat1-1 (strains Pb-7, Ya-8, C1233 and Veracruz, respectively). Lane M, 100 bp DNA ladder (Gibco). Reactions were by multiplex as based on CondeFerrรกez et al. (2007, 2010)

Figure 4. DC-PCR amplification of ITS region in different fungi. Lanes 1 and 2, Ascomycetes ( Trichoderma reesei and Fusarium sp., respectively); lanes 3 to 5, Basidiomycetes: Phanerochaete chrysosporium, Pleurotus ostreatus and Trametes versicolor. Lane M, 100 bp DNA ladder (Gibco).s

The results were identical when both pairs of primers were pooled in a single PCR reaction, in comparison with reactions with separate pairs of primers (data not shown). DC-PCR based assay for mating type of M. fijiensis Suitability of this DC-PCR for rapid assignment of mating type in M. fjiensis strains was explored with the multiplex PCR assay developed by Conde et al. (2010). Attempts with this assay were unsuccessful; only mat1-1 strains were positively amplified (data not shown). Modifications in mat1-2 primer concentration in the mixture, and/or changes in the annealing temperature in the cycling were also negative for mat1-2 strains. Primers 4327Mt2-F and 5027Mt2-R (Conde et al., 2010) were changed for flan4739-F and inver5656-R (Conde et al., 2007). These primers were selected because they are specific for the M. fijiensis mat1-2 idiomorph and could also be suitable

for multiplex with the mat1-1 primers 2723Mt1-F and 3137Mt1-R. This new combination of primers works with the DC-PCR screening (Figure 3), producing the expected products (414 bp for mat1-1 and 917 bp for mat12). Mating type of Sa-1 and Ma-2 is mat1-2 and the other strains evaluated here are mat1-1. Application of DC-PCR on other fungi To explore if this quick and simple protocol can be extrapolated to other fungi, we tested the direct colony PCR-based ITS amplification on T. reesei and Fusarium sp. (Ascomycetes) and P. chrysosporium, P. ostreatus and T. versicolor (Basidiomycetes). Amplification of the ITS1-5.8S-ITS2 genomic region was successful with these fungi (Figure 4). The amplicons vary in size from approximately 400 to 700 bp, but were congruent with the expected range (Table 1). Mycelia suspensions were

Vázquez-Euán et al.

stored at -20°C and used six months later for PCR reactions with ITS primers. Amplifications were positive in all cases (data not shown). DISCUSSION PCR-based screening of many samples requires rapid and simple protocols to obtain the DNA templates. In the literature, there are a number of protocols available to extract DNA from Mycosphaerella species (Johanson et al., 1994; Carlier et al., 1994; Guo et al., 2005; Maxwell et al., 2005; Conde-Ferráez et al., 2008; Motteram et al., 2009). Supplementary Table 1 summarizes the shorter protocols available to obtain DNA in these fungi. These are rapid protocols amenable for PCR approaches. However the procedure presented here is faster. The technical modification is extremely simple (substitution of extracting buffers and multi-step extraction procedures by mechanical mycelium maceration in water), but the value is precisely in the simplicity and avoidance of special equipment, kits or reagents (for example special columns for DNA purification), and it requires only a few seconds to prepare the template. Therefore, the protocol is not only fast and simple, but also cheap. The procedure starts from a tiny piece of fungal tissue harvested from solid cultures. This overcomes the necessity of subculturing in liquid medium to obtain fungal biomass, and it is suitable for applying directly on primary cultures. Its simplicity makes it convenient to apply to a large number of samples. Lack of expertise in Mycosphaerella taxonomy is not a limitation to conduct this molecular identification since production and analysis of conidia is not necessary. Diverse protocols for distinguishing M. fijiensis and M. musicola have been published, based on molecular techniques or microscopic observations, as shown in the supplementary Table 2. Aguirre-Gaviria et al. (1999) were able to improve microscopic diagnosis with respect to other similar approaches [example that published by Jacome and Schuch (1993)], but diagnosis still requires experience to prevent misidentification of these fungi. Molecular approaches are more reliable since they are based on specific sequences in each species. Johanson et al. (1994) and Carlier et al. (1994) developed molecular diagnostic methods based on Southern blot and hybridization, but these techniques are laborious and require large amounts of DNA. In addition, purification of the DNA was necessary using CsCl to prevent inhibition of restriction enzyme digestions. The easiest protocols are based on the use of specific primers and analysis in gels of the PCR products or real time PCR diagnosis (Henderson et al., 2006). We chose the primers recently published by Arzanlou et al. (2007) because they developed species-specific primers after alignment of the actin gene for 17 Mycosphaerella spp. found in banana leaves and because they produced different amplicon

8177

sizes in PCR products which make them of potential use in multiplex analysis. The first attempt was a triple multiplex, combining primers targeting actin in M. fijiensis, M. musicola and M. eumusae, but the results were unsatisfactory. Arzanlou et al; 2007 diagnosis used the primer ACTF in combination with one specific primer of M. eumusae to amplify the actin in this fungus, and ACTR with one specific primer to amplify actin in M. fijiensis. However, both ACTF and ACTR together amplify actin in the Mycosphaerella genus, producing an expected amplicon of 820 bp. Therefore, the expected result for the multiplex is the 820 bp (general) band plus the specific band expected in each case. However, the M. fijiensis DNA template resulted in five bands instead of two, whilst in M. musicola there were three bands; the specific 200 bp band expected in M. musicola was the poorest amplified with M. musicola isolates. We obtained similar results when using pure DNA isolated from M. fijiensis and M. musicola and modifications in the preparation of the PCR mixture or cycling conditions were unsuccessful (data not shown). On these grounds the triple multiplex assay was discarded. So far, there is no report about M. eumusae in Mexico. Therefore, the majority of Mycosphaerella species in Mexican banana samples with Sigatoka symptoms are assumed to be M. fijiensis and M. musicola. Double multiplex reactions combining primers for M. fijiensis and M. musicola were conducted. In this case, the assay worked well between these two fungi for distinguishing the two species in a single reaction; results for separate or multiplex reactions were identical. This multiplex has enabled us to rapidly screen a fungal collection obtained from diseased banana leaves. If M. eumusae is suspected to be present, it can be identified in separate PCR reactions after negative results for the M. fijiesis/M. musicola complex. Other primers should be further developed for the triple multiplex. Recently, JaufeerallyFakim et al. (2009) developed two primer pairs based on the ITS of Mycosphaerella species from Musa. One pair amplifies one band (800 bp) in M. eumusae and two bands (1200 and 1600 bp) in M. musicola. The other pair produces one band (900 bp) in M. eumusae and one (1500 bp) in M. musicola but neither pairs of primers amplify the ITS from M. fijiensis. Evaluation of the protocol for rapid assignment of mating type in M. fijiensis strains was conducted. The first multiplex assay published by Conde-Ferrárez et al. (2010) was evaluated but only mat1-1 strains were identified, although modifications in the PCR mixture and cycling conditions were tried. Probably, the mat1-2 primers require purer templates to achieve annealing since the authors reported lower efficiency of the mat1-2 primers in comparison with the mat1-1 primers. Other primers for specific amplification of M. fijiensis mat1-1 or mat1-2 idiomorphs are available in the literature. We chose two mat1-2-specific primer pairs from CondeFerráez et al. (2007), f lan4739F and inver5656R, and

8178

Afr. J. Biotechnol.

inver8486F and flan9352R, and tested in single reactions with the DC-PCR. Best results were observed with the former pair and these primers were then mixed with the mat1-1 primers. In this case the mating type multiplex assay worked with the DC-PCR. Recently, Arzanlou et al. (2010) reported the sequences of M. eumusae and M. musicola mat1-1 and mat1-2 idiomorphs; therefore, the development of primers for quick PCR mating type assignment in these fungi is possible. With regard to the efficiency of the resulting primers, this DC-PCR approach could be probably applied for rapid idiomorphic classifications. The success of DC-PCR with M. fijiensis, a difficult fungus for molecular manipulations, may indicate that the technique will probably work with other fungi. The protocol was tested on two other Ascomycete and three Basidiomycete fungi. The amplification of the ITS region with the universal primers ITS1-ITS4 demonstrated this to is a simple and fast procedure, which could be applicable to amplify the ITS1-5.8S-ITS2 in other Ascomycete and Basidiomycete fungi. Since the DC-PCR established here works with different primer-based assays, this procedure may also be suitable for other PCR-based applications, example quick confirmation of fungal transformation. For example, Suzuki et al. (2006) used one approach of “colony direct PCR” for the screening of Aspergillus oryzae mutants. In that report, the mutants were picked from the Petri dish, extracted by microwave oven and applied and dried on FTA cards. Their procedure was fast and simple, but still more expensive than that presented here. The DC-PCR established here may also be advisable for further screening of M. fijiensis mutants and other fungal mutants. The DC-PCR reduces sampling handling to the minimum, eliminating the use of mortar and pestle. This prevents contamination and enables the protocol to be amenable for environmental and population studies. Currently, this procedure is being employed to identify M. fijiensis and M. musicola and other fungal isolates in our laboratory. ACKNOWLEDGEMENTS This work was funded by “Fondo Institucional de Fomento Regional para el Desarrollo Científico, Tecnológico y de Innovación (FORDECyT-CONACyT)” contract No. 116886. The authors thank X. Mena-Espino, G.M. Castillo-Avila, M. Canseco-Pérez and Y. BurgosCanul (Centro de Investigación Científica de Yucatán, A.C., México) for providing the fungal strains.

REFERENCES Aguirre-Gaviria MC, Castaño-Zapata J, Zuluaga-Arias LE (1999). A rapid method for the diagnosis of Mycosphaerella musicola Leach and M. fijiensis Morelet, the causal agents of yellow Sigatoka and

black Sigatoka. Infomusa, 8: 7-9. Alshahni MM, Makimura K, Yamada T, Satoh K, Ishihara Y, Takatori K, Sawada T (2009). Direct colony PCR of several medically important fungi using Ampdirect (a) Plus. Jpn. J. Infect. Dis. 62:164-167. Arzanlou M, Abeln E, Kema G, Waalwijk C, Carlier J, de Vries I, Guzmán M, Crous P (2007). Molecular diagnostics for the Sigatoka disease complex of banana. Phytopathology, 97: 1112-1118. Arzanlou M, Groenewarld JZ, Fullerton RA, Abeln ECA, Carlier J, Zapater MF, Buddenhagen IW, Viljoen A, Crous PW (2008). Multiple gene genealogies and phenotypic characters differentiate several novel species of Mycosphaerella and related anamophs on banana. Persoonia, 20: 19-37. Arzanlou M, Crous PW, Zwiers LH (2010). Evolutionary dynamics of mating-type loci of Mycosphaerella spp. occurring on banana. Euk. Cell, 9: 164-172. Atkins S, Clarck I (2004) Fungal molecular diagnostics: a mini review. J. Appl. Genet. 45: 3-15. Bindslev L, Oliver R, Johansen B (2002). In situ PCR for detection and identification of fungal species. Mycol. Res. 106: 27-279. Calmin G, Belbahri L, Lefort F (2007). Direct PCR for DNA Barcoding in the genera Phytopthora and Pythium. Biotechnol. Biotechnol. Equip. 1: 40-42. Carlier J, Mourichom X, Gonzales de León D, Zapater MF, Lebrun MH (1994). DNA restriction fragment length polymorphisms in Mycosphaerella sp. causing banana leaf spot diseases. Mol. Plant Pathol. 84: 751-756. Carlier J, Zapater MF, Lapeyre F, Jones DR, Mourichon X (2000). Septoria leaf spot of banana: a newly discovered disease caused by Mycosphaerella eumusae (anamorph Septoria eumusae). Phytopathology, 90: 884-890. Churchill ACL (2010). Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control. Mol. Plant Pathol. 12: 307-328. Conde-Ferráez L, Waalwijk C, Canto-Canché BB, Kema GHJ, Crous PW, James AC , Abeln E (2007). Isolation and characterization of the mating type locus of Mycosphaerella fijiensis, the causal agent of black leaf streak disease of banana. Mol. Plant Pathol. 8: 111-120. Conde-Ferráez L, Grijalva-Arango R, James AC (2008). A rapid DNA extraction method from mycelium which is suitable for PCR. Rev. Lat. Microbiol. 50: 86-88. Conde-Ferráez L, Grijalva-Arango R, Canto-Canché BB, ManzoSánchez G, Canul-Salazar MI, James AC (2010). The development of mating type-specific primers for Mycosphaerella fijiensis, the causal agent of black Sigatoka of banana, and analysis of the frequency of idiomorph types in Mexican populations. Australas Plant Pathol. 39: 217-225. Crous PW (1998). Mycosphaerella spp. and their anamorphs associated with leaf spot diseases of Eucalyptus. Mycol. Mem. 21: 1170. Deepak S, Kottapalli K, Rakwal R, Oros G, Rangappa K, Iwahashi H, Masuo Y, Agrawal G (2007). Real Time PCR: Revolutionizing detection and expression analysis of genes. Curr. Genomics, 8: 234251. Dellaporta S, Wood J, Hicks J (1983). A plant DNA minipreparation: version II. Plant Mol. Biol. Rep. 1: 19-21. Gente S, Sohier D, Coton E, Duhamel C, Guéguen M (2006). Identification of Geotrichum candidum at the species and strain level: proposal for a standardized protocol. J. Ind. Microbiol. Biotechnol. 33: 1019-1031. Guo JR, Schnieder F, Abd-Elsalam KA, Verreet JA (2005). Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent. Biotechnol. Lett. 27: 3-6. Henderson J, Pattemore J A, Porchun S C, Hayden HL, Van Brunschot S, Grice KRE, Peterson RA, Thomas-Hall SR, Aitken EAB (2006). Black Sigatoka disease: new technologies to strengthen eradication strategies in Australia. Australas Plant Pathol. 35: 181-193. Jacome LH, Schuh W (1993). Effect of temperature on growth and conidial production in vitro, and comparison of infection and aggressiveness in vivo among isolates of Mycosphaerella fijiensis var. difformis. Trop. Agric. 70: 51-59. Islas-Flores I, Peraza-Echeverría L, Canto-Canché B, Rodríguez-García

Vázquez-Euán et al.

C (2006). Extraction of High-Quality, Melanin-Free RNA From Mycosphaerella fijiensis for cDNA Preparation. Mol. Biotechnol. 34: 45-50. Jaufeerally-Fakim Y, Dheema-Sookun D, Benimadhu S (2009). Molecular differentiation of Mycosphaerella species from Musa. Australas Plant Pathol. 38: 461-466. Johanson A, Jeger M (1993). Use of PCR for detection of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka leaf spot in banana and plantain. Mycol. Res. 97: 670-674. Johanson A, Crowhurst RN, Rikkerink EHA, Fullerton RA, Templeton MD (1994). The use of species-specific DNA probes for the identification of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka disease. Plant Pathol. 43: 701-707. Johanson A (1995). Detection of banana leaf spot pathogens by PCR. OEP/EPPO Bull. 25: 99-107. Jones DR (2000). Diseases of banana, abaca and enset. CAB International, Wallingford, Oxon, UK. Korabecna M (2007). The Variability in the Fungal Ribosomal DNA (ITS1, ITS2, and 5.8 S rRNA Gene): Its Biological Meaning and Application in Medical Mycology. In Méndez-Vilas A (Ed). Commun. Curr. Res. Educ. Topics Trends Appl. Microbiol. 2: 783-787. Landeweert R, Leeflang P, Kuyper TW, Hoffland E, Rosling A, Wernars K, Smit E (2003). Molecular identification of ectomycorrhizal mycelium in soil horizons. Appl. Environ. Microbiol. 69: 327-333. Lau A, Sorrell T, Lee O, Stanley K, Halliday C (2008). Colony MultiplexTandem PCR for Rapid, Accurate Identification of Fungal Cultures. J. Clin. Microbiol. 46: 4058-4060. Luo G, Mitchell T (2002). Rapid identification of pathogenic fungi directly from cultures by using multiplex PCR. J. Clin. Microbiol. 40: 28602865. Martin KJ, Rygiewicz PT (2005). Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC Microbiol. 5: p. 28. Maxwell A, Jackson S, Dell B, Hardy GEJ (2005). PCR-identification of Mycosphaerella species associated with leaf diseases of Eucalyptus. Mycol. Res. 109: 992-1004. Mirhendi H, Diba K, Rezaei A, Jalalizand N, Hosseinpur L, Khodadadi H (2007). Colony-PCR Is a Rapid and Sensitive Method for DNA Amplification in Yeasts. Iran. J. Public. Health, 36: 40-44.

8179

Motteram J, Kufner I, Deller S, Brunner F, Hammond-Kosack KE, Nurnberger T, Rudd JJ (2009). Molecular characterization and functional analysis of MgNLP, the sole NPP1 domain-containing protein, from the fungal wheat leaf pathogen Mycosphaerella graminicola. Mol. Plant-Microbe Int. 22: 790-799. Plaza GA, Upchurch R, Brigmon RL, Whitman WB, Ulfig K (2004). Rapid DNA extraction for screening soil filamentous fungi using PCR amplification. Pol. J. Environ. Stud. 13: 315-318. Rivas GG, Zapater MF, Abadie C, Carlier J (2004). Founder effects and stochastic dispersal at the continental scale of the fungal pathogen of bananas Mycosphaerella fijiensis. Mol. Ecol. 13: 471-482. Schaad N, Frederick R (2002). Real-time PCR and its application for rapid plant disease diagnostics. Can. J. Plant Pathol. 24: 250-258. Suzuki S, Taketani H, Kusumoto K, Kashiwagi Y (2006). Highthroughput genotyping of filamentous fungus Aspergillus oryzae based on colony direct polymerase chain reaction. J. Biosci. Bioeng. 102: 572-574. Turenne CY, Sanche SE, Hoban DJ, Karlowsky JA, Kabani AM (1999). Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J. Clin. Microbiol. 37: 1846-1851. White T, Bruns T, Lee S, Taylor J (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis M, Gerfand D, Sninsky J, White T (Eds). PCR Protocols, pp. 315- 322.

8180

Afr. J. Biotechnol.

Supplementary Table 1. Selected protocols from the literature for quick preparation of Mycosphaerella DNA suitable for PCR approaches. Brief description

Time for preparation of template (before PCR)*

Used liquid-cultured mycelium (50 mg), ground in liquid nitrogen and lysis in 1 ml DNAzol reagent. After washing with chloroform, the DNA is precipitated with ethanol.

DNA extraction using TENS buffer** followed by DNA purification using the silica binding kit from Mo Bio.

Not specified. Estimation is less than 30 min,

Extraction of liquid-cultured mycelium (100 mg fresh weight) grinding in the presence of TENS buffer** and using a manual homogenizer with plastic pestle tips and quartz sand. After purification by phenol: chloroform: isoamyl alcohol, the DNA is precipitated with one volume of cold isopropanol.

Conde-FerrĂĄez et al. (2008)

Ground by Fastprep FP120, 5 to10 mg of freeze-dried mycelium in presence of TENS buffer**, followed by 30 min incubation at 65Â°C. Subsequent step is 20 min incubation after adding ice-cold ammonium acetate. DNA is further precipitated from supernatant by adding one volume of cold isopropanol.

Not specified. Estimation is 1.5 to 2 h

Motteram et al. (2009)

Uses primary solid-cultured mycelium (tiny sampling by pipette tip). Ground manually (in water) inside an Eppendorf tube by using a plastic pestle tip.

Seconds

Reference Guo et al. (2005)

Maxwell et al. (2005)

This study

*Time for growing the fungal culture was not considered. ** TENS buffer: Tris-HCl, EDTA, pH 8.0, NaCl, SDS. Concentration of the components could vary.

Supplementary Table 2. Methods for rapid diagnosis of M. fijiensis and M. musicola. Brief description

Observation

Reference

Development of specific M. fijiensis and M. musicola. Forward primers designed on a variable region on ITS1. Use of same reverse primer on 25S rDNA.

Both pairs of primers amplify 1000 bp. Therefore not suitable for multiplex.

Johanson and Jaeger (1993)

Developing species-specific probes based on RAPD-PCR

Identification requires Southern blot and hybridization (laborious). After extraction, the DNA is purified on CsCl gradients to be suitable for restriction enzyme digestions.

Johanson et al. (1994)

Development of cosmid libraries and selection of clones corresponding to single or low-copy nuclear DNA to use as probes,

Identification requires Southern blot and hybridization. After extraction, the DNA is purified on CsCl gradients.

Carlier et al. (1994)

Use of needle-free disposable plastic syringe full with agar-crystal violet, streptomycin and benomyl. Two millimeters is exposed and pressed onto necrotic areas to collect conidia. The disc is removed with a scalpel, mounted on slide, placed in a humid chamber and observed with X40 lens.

These authors improved other microscopy-based identification of these fungi, which was fast in sampling but time-consuming at microscopy level. It also requires experience to distinguish the relative intensities of staining and morphological differences in the conidia (presence/absence of hilum).

AguirreGaviria et al. (1999)

Development of specific primers targeting respectively M. fijiensis, M. musicola and M. eumusae. These authors conducted diagnosis and quantification of fungal biomass in field samples by qPCR*.

Fungal DNA extracted by using the PureGene kit (Gentra Systems Inc., Minneapolis, MN).

Arzanlou et al. (2007)

Use of species-specific primers developed by Arzanlou et al. (2007) on direct PCR and multiplex-direct PCR reactions, but preparation of template is simpler.

The cheapest and fastest procedure reported so far for molecular identification of M. fijiensis and M. musicola isolates.

This study

*qPCR, Quantitative PCR or real time PCR.

Full Length Research Paper

Rapid establishment of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) system for chloroplast DNA in tea [Camellia sinensis (L.) O. Kuntze] Chen, S. X., Qi, G. N*., Li, H., Shan, H. L and Zou, Y. Department of Tea Science, College of Horticulture, Sichuan Agricultural University, Ya’an 625014, China. Accepted 30 march,2012.

A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, 3U Taq DNA polymerase, and ddH2O to the total volume of 25 μl; the optimal digestion system was 6 μl amplification product, 2 U endonuclease, 1×endonuclease buffer in digestion solution, and ddH2O to the total volume of 15 μl; digestion time was 6 h at 37°C. With the optimized system, genetic diversity among 30 tea cultivars was investigated. Seven sets of chloroplast primers could produce one or more distinct bands. After the amplified products were digested by 10 restriction enzymes, a total of 135 bands were detected, among which 98 bands (72.59%) were polymorphic. The cpDNA PCR-RFLP based genetic distance (GD) among 30 tea accessions ranged from 0 to 0.071, with the mean of 0.049. This study suggests that the optimization system was suitable for PCR-RFLP analysis of cpDNA in tea. Key words: Camellia sinensis, PCR-RFLP, chloroplast DNA, establishment. INTRODUCTION A great number of genetic resources, including tea and its allied species and varieties in the genus Camellia, have been collected and preserved in China. However, selection of cultivated tea is largely based on selection of yield, quality, biotic, and abiotic stress resistance among the existing materials. As a consequence, the widespread cultivation of clonal tea can diminish genetic diversity if care is not taken in the use of clones of disperse origin. So, it appears necessary to estimate the extent of genetic variation among tea cultivars, which may provide important information as to phylogenetic relationships. Having an understanding of genetic diversity may also provide insights as to proper conservation and management of its genetic resources. Several preliminary

*Corresponding author. E-mail: guinian5612@sina.com. Tel: 86-835-288-2584.

investigations have shown a great deal of interspecific variation at the nuclear genome level (Chen and Yamaguchi, 2005; Chen et al., 2005; Hung et al., 2007). However, the extent of variation among the organellar genome of tea plants is not yet known. The availability of universal primers capable of amplifying specific regions of the chloroplast (Badens and Parfitt, 1995; Tsumura et al., 1996; Heinze, 2001) genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal source of genetic information in phylogenetic and population genetic studies. Currently, sequence comparison or restriction analysis of fragments amplified with universal primers for organellar DNA has been widely used in species identification, genetic diversity and phylogenetic studies in many different plant

8182

Afr. J. Biotechnol.

Table 1. The name and source of tea cultivars.

Number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

Cultivar name Mengshan 9 Mengshan 23 Mengshan11 Longjing 43 Yingshuang Fuxuan 9 Anjibaicha Chunbolv Meizhan Zhuyeqi Fudingdahaocha Juhuachun Longjingchangye Zhe’nong 113 Pingyangtezao Fuding Yuanxiaocha Wuniuzao Zhe’nong117 Donghuzao Zhehedabaicha Fujiangshuixian Huangyeshuixian Shuyong 307 Jingfeng Yinghong 1 Yinghong 2 Qianmei 303 Qianmei 419 Hainandaye

species (Huang and Sun, 2000; Parani et al., 2001; Xu et al., 2001; Panda et al., 2003; Su, et al., 2005; Wei et al., 2005; Gan et al., 2006; Cui et al., 2006). The objective of this study was to perform optimization of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) system by orthogonal experiments and rapidly establish a PCR-RFLP reaction system for the analysis of cpDNA in tea. The study is to evaluate the genetic diversity of chloroplast genomes in cultivated tea, and provides some more molecular data for phylogenetic relationships in Camellia sinensis. MATERIALS AND METHODS Plant material and DNA extraction The whole plant of 30 tea cultivars were collected from Sichuan, Zhejiang, Fujiang, Hunan, Guangdong and Hainan provinces in China and transferred to the Tea Plant Garden of Sichuan Agricultural University, Ya’an, Sichuan province, China. The cultivar names and origins are presented in Table 1. Total genomic DNA

Species C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis C. sinensis

Source Sichuan Sichuan Sichuan Zhejiang Zhejiang Fujiang Zhejiang Fujiang Fujiang Hunan Fujiang Zhejiang Zhejiang Zhejiang Zhejiang Fujiang Fujiang Zhejiang Zhejiang Hunan Fujiang Fujiang Guangdong Sichuan Fujian Guangdong Guangdong Guizhong Guizhong Hannan

was extracted from young leaves following the CTAB procedure described by Huang (2003) with minor modifications.

Establishment and optimization of RFLP-PCR reaction system Optimization of PCR reaction system 25 reaction systems were performed by the orthogonal experiment designed by L25(53) (Table 2). Template DNA and primer used in 25 reactions were from sample (Fuding) and primer trnL-trnF. All reaction volumes were 25 μl including 100 ng template DNA, 1.5 mmol L-1 MgCl2, and 1×PCR buffer, covered with a drop of mineral oil. Amplification was performed in a PTC-220 Thermalcycler. Initial denaturation was for 3 min at 94°C, followed by 40 cycles of 1 min at 94°C, 1 min at 55°C, 3 min at 72°C and a 10 min final extension step at 72°C. Amplification products were verified by electrophoresis of 2μl of the reaction products on 2% agarose gels in 1×TAE buffer and stained with ethidium bromide for visualization.

Optimization of digestion system 16 digestion systems were performed by the orthogonal experiment

Chen et al.

8183

Figure 1. The results of L 25 (53 ) orthogonal test (1-25 are orders listed in Table 2 and M is DL2000 marker).

designed by L16（43) (Table 3). The PCR-amplified DNA fragments of Fuding with optimized PCR reaction system were digested with the restriction endonuclease Taq Ⅰ. All reaction volumes were 15 μl including 1×endonuclease buffer in digestion solution, and sufficient quantum deionized H2O, respectively. Digestion reactions were carried out at 37°C for 2, 6, or 8 h. RCR-RFLP analysis Seven sets of chloroplast primers were chosen for this investigation. Primer sequences are listed in Table 4. All the primers were synthesized by Shanghai Bioengineering Company. PCR amplification was performed with the aforementioned optimized PCR system. The PCR-amplified DNA fragments were digested by the restriction endonucleases Hinf I, Hae III, Hind III, Taq I, Msp I, EcoR I, Ssp I, Rsa I, Xba I or EcoR V at 37°C with the afore stated optimized digestion system. The digested DNA fragments were separated by electrophoresis on 2% agarose gels in 1×TAE and stained with ethidium bromide. Images were photographed using ImageMaster VDS (Amersham PharmaciaBiotech).

for RFLP-PCR analysis on tea cultivars, that is, the optimization PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, 3U Taq DNA polymerase, and ddH2O to the total volume of 25 μl. 16 digestion systems were performed by the orthogonal experiment designed by L16 (43) (Table 3). The PCR-amplified DNA fragments of Fuding with optimized PCR reaction system were digested with the restriction endonucleases Taq I (Figure 2). Results show that reaction system 8 could amplify clear, stable bands. So, we believed that system 8 was a suitable digestion reaction system for RFLP-PCR analysis on tea cultivars, that is, the optimization digestion reaction system was 6 μl amplification product, 2U endonuclease, 1×endonuclease buffer in digestion solution, and ddH2O to the total volume of 15 ul; digestion time was 6 h. PCR-RFLP polymorphisms and distances between tea cultivars

Data analysis The digested DNA fragments were scored by presence (1) or absence (0) for each C. sinensis accession. Genetic similarities (GS) between each pair of accessions were estimated using the method of Nei and Li (1979): GS=2NXY/ (NX+NY), GD=1-GS, where NX and NY are the numbers of DNA fragments observed in accession X and Y, respectively, and N XY is the number of fragments shared by both accessions. All procedures were computed with the computer package NTSYS (Rohlf, 1993).

RESULTS AND DISCUSSION Establishment and optimization of PCR - RFLP reaction system 3

With orthogonal experiments by L25 (5 ), all amplification products were analyzed by 2.0% agarose gel electrophoresis (Figure 1). Results show reaction system 12, 13, 17, 18 and 19 could amplify clear, stable bands. However, reaction system 12 cost the least in terms of amounts of reagents (Table 2). So, we believed that system 12 was a suitable, economic PCR reaction system

With the optimized system, all seven primers used in the present study successfully amplified the corresponding cpDNA regions in all the tea cultivars investigated. Digestion of the amplified products with Hinf I, Hae III, Hind III, Taq I, Msp I, EcoR I, Ssp I, Rsa I, Xba I or EcoR totally detected 135 fragments (Table 5), of which, 98 fragments (72.59%) were polymorphic. Figure 3a illustrates the example of amplified products with primer trnL-trnF. Figure 3b shows the digested products of trnL-trnF/TaqⅠ combinations. The genetic distance (GD) values between 30 tea accessions are presented in Table 6. The GD values among tea accessions varied from 0 to 0.071, with the mean of 0.049. Fujiangshuixian and Huangyeshuixian have height GD of 0.071, while the GD value between Zhe’nong113 and Zhe’nong117, Yingshuang and Jingfeng, Yinghong1 and Yinghong2, Mengshan 9 and Mengshan11 and Mengshan23, was found to be the lowest (0). Zhe’nong113 and Zhe’nong117, Yingshuang and Jingfeng had the lowest distances (0). This is

8184

Afr. J. Biotechnol.

Table 2. Orthogonal design L25 (53) for PCR reaction system.

1 2 3 4 5

Taq (U) 1 1 1 1 1

Factor and level -1 dNTP (ÎźmolL ) 100 200 300 400 500

primer (ng) 25 50 75 100 125

6 7

2 2

100 200

25 50

8 9

2 2

300 400

75 100

10 11 12 13 14

2 3 3 3 3

500 100 200 300 400

125 25 50 75 100

15 16

3 4

500 100

125 25

17 18 19

4 4 4

200 300 400

50 75 100

20 21

4 5

500 100

125 25

22 23

5 5

200 300

50 75

24 25

5 5

400 500

100 125

Order

Table 3. Orthogonal design L16 (43) or digestion system.

Order 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Factor Amplification product (ÎźL) 5 5 5 5 6 6 6 6 7 7 7 7 8 8 8 8

Restriction endonuclease (U) 0.5 1 1.5 2 0.5 1 1.5 2 0.5 1 1.5 2 0.5 1 1.5 2

Digestion time(h) 2 4 6 8 4 2 8 6 6 8 2 4 8 6 4 2

Chen et al.

8185

Figure 2. The results of L 16 (43 ) orthogonal test (1-16) are orders listed in Table 3 and M is the DL2000 marker).

Table 4. DNA sequence and cpDNA primer pairs used in the present study.

Primer pair trnL-trnF

Sequence 5´-CGAAATCGGTAGACGCTACG-3´ 5´-ATTTGAACTGGTGACACGAG-3´

Reference Taberlet et al., 1991

trnT-trnL

5´-CATTACAAATGCGATGCTCT-3´ 5´-TCTACCGATTTCGCCATATC-3´

Taberlet et al., 1991

trnD-trnT

5´-ACCAATTGAACTACAATCCC-3´ 5´-CTACCACTGAGTTAAAAGGG-3´

Demesure et al., 1995

trnH-trnK

5´-ACGGGAATTGAACCCGCGCA-3´ 5´-CCGACTAGTTCCGGGTTCGA-3´

Demesure et al., 1995

trnS-trnfM

5´-GAGAGAGAGGGATTCGAACC-3´ 5’-CATAACCTTGAGGTCACGGG-3’

Demesure et al., 1995

rbcL

5´-TGTCACCAAAAACAGAGACT-3´ 5´-TTCCATACTTCACAAGCAGC-3´

Parani et al., 2000

trnS-psbC

5´-GGTTCGAATCCCTCTCTCTC-3´ 5´-GGTCGTGACCAAGAAACCAC-3´

Parani et al., 2000

because the earlier two cultivars were the offspring of the same parents whereas the later two had a common ancestral origin (Bai, 2001); while Yinghong1 and Yinghong2, Mengshan 9 and Mengshan11 and Mengshan23, have lowest distances (0).This may be due to the reason that both the cultivars originated from a single seed lot (Bai, 2001). Interspecific variation could be detected through restriction analysis of fragments amplified with cpDNA universal primers (Ziegenhagen et al., 1995; Parani et al.,

2001). This study shows that under the optimized system, the amplification of cpDNA with universal primers followed by electrophoresis of restricted amplified fragments could reveal interspecific polymorphism, which was 72.59% among 30 tea cultivars in this study. An investigation on 15 Chinese elite tea genetic resources showed that the diversity was 94.2% (Chen et al., 2005). The diversity of 36 clonal tea cultivars in China was reported as 99.17% (Yao et al., 2007), 91.59% for 40 tea cultivars (Huang et al., 2006), and 91.89% for 43 tea cultivars (Tan et al.,

8186

Afr. J. Biotechnol.

Table 5. Amplified and digested DNA fragments of the 30 tea accessions based on PCR-RFLP technology.

Enzyme Primer trnL-trnF trnT-trnL trnD-trnT trnH-trnK trnS-trnfM rbcL trnS-psbC

Hinf I TF PF 4 4 3 5 3 6 4

2 3 3 5 4

Hae III TF PF 2 1 1 2 2 3 2

1 2 2 2 2

Hind III TF PF 1 1 2 1 1 1 1 1 1 1 1 1 2 2

Taq I TF PF 5 5 1 1 1 2

0 0 1 1

Msp I TF PF 1 0 2 1

1 3 2

0 1 1

EcoR I TF PF 2 1 1 1 1 1

Ssp I TF PF 5 4

0 0 0 1

2 2 6 4

1 2 3 4

Rsa I TF PF 4 4

1 1 5 1

Xba I TF PF 4 3

1 1 5 0

4 5 7

EcoR V TF PF 3 3 1 0

3 4 4

1 6 2

0 4 1

TF, total fragments; PF, polymorphic fragments.

Figure 3. A-B. (A) Amplified products of primer pairs trnL-trnF of genomic DNA from 30 tea cultivars. 1-30 indicate the number in Table 1. (B) Amplified and digested products of primer/enzyme combination trnL-trnF/Taqâ&#x2026; of genomic DNA from 30 tea accessions. 1-30 indicate the number in Table 1, M indicates DL2000 marker.

Table 6. The genetic distances (GD) of 30 tea cultivars based on PCR-RFLP technology.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

1 0.000 0.000 0.000 0.046 0.058 0.053 0.057 0.045 0.041 0.055 0.058 0.042 0.043 0.060 0.049 0.044 0.047

0.000 0.000 0.046 0.058 0.053 0.057 0.045 0.041 0.055 0.058 0.042 0.043 0.060 0.049 0.044 0.047

0.000 0.046 0.058 0.053 0.057 0.045 0.041 0.055 0.058 0.042 0.043 0.060 0.049 0.044 0.047

0.000 0.064 0.053 0.044 0.043 0.047 0.065 0.046 0.053 0.026 0.049 0.042 0.047 0.046

0.000 0.047 0.051 0.039 0.051 0.060 0.050 0.048 0.060 0.040 0.052 0.041 0.050

0.000 0.044 0.040 0.036 0.057 0.041 0.040 0.047 0.046 0.047 0.037 0.047

0.000 0.047 0.046 0.058 0.050 0.050 0.040 0.052 0.051 0.046 0.042

0.000 0.041 0.068 0.037 0.046 0.045 0.031 0.040 0.032 0.038

0.000 0.052 0.038 0.049 0.044 0.048 0.042 0.038 0.032

0.000 0.066 0.048 0.064 0.065 0.062 0.064 0.062

0.000 0.056 0.041 0.042 0.048 0.033 0.032

0.000 0.048 0.054 0.051 0.045 0.053

0.000 0.042 0.038 0.043 0.041

0.000 0.043 0.033 0.067

0.000 0.038 0.052

Chen et al.

18 19 20 21 22 23 24 25 26 27 28 29 30

0.056 0.060 0.054 0.045 0.066 0.056 0.037 0.058 0.055 0.055 0.049 0.037 0.051

8187

0.056 0.060 0.054 0.045 0.066 0.056 0.037 0.058 0.055 0.055 0.049 0.037 0.051

0.045 0.049 0.061 0.042 0.064 0.065 0.051 0.064 0.058 0.058 0.060 0.051 0.061

0.053 0.040 0.054 0.048 0.065 0.063 0.057 0.000 0.062 0.062 0.059 0.055 0.064

0.040 0.046 0.048 0.034 0.052 0.058 0.050 0.047 0.057 0.057 0.056 0.048 0.059

0.039 0.052 0.055 0.041 0.059 0.062 0.063 0.051 0.061 0.061 0.058 0.043 0.062

0.046 0.031 0.053 0.032 0.059 0.054 0.057 0.039 0.062 0.062 0.067 0.058 0.064

0.047 0.048 0.052 0.030 0.068 0.063 0.058 0.051 0.052 0.052 0.055 0.051 0.062

0.059 0.065 0.038 0.060 0.069 0.049 0.054 0.060 0.039 0.039 0.035 0.054 0.035

0.045 0.042 0.061 0.035 0.056 0.062 0.067 0.050 0.063 0.063 0.066 0.068 0.063

0.048 0.054 0.052 0.051 0.055 0.054 0.043 0.048 0.049 0.049 0.049 0.045 0.055

0.039 0.042 0.059 0.038 0.063 0.064 0.057 0.060 0.054 0.054 0.065 0.051 0.062

0.054 0.000 0.053 0.047 0.061 0.056 0.063 0.040 0.060 0.060 0.067 0.057 0.060

0.042 0.043 0.054 0.043 0.056 0.057 0.056 0.052 0.061 0.061 0.064 0.050 0.060

0.000 0.035 0.048 0.033 0.051 0.034 0.060 0.058 0.056 0.041 0.059 0.059 0.062 0.054 0.061

0.000 0.045 0.038 0.056 0.029 0.063 0.065 0.059 0.050 0.060 0.060 0.065 0.053 0.064

0.000 0.054 0.057 0.042 0.058 0.058 0.058 0.053 0.059 0.059 0.056 0.048 0.058

0.000 0.053 0.047 0.061 0.056 0.063 0.040 0.060 0.060 0.067 0.057 0.060

0.000 0.051 0.068 0.046 0.057 0.054 0.034 0.034 0.042 0.050 0.045

0.000 0.063 0.055 0.055 0.048 0.058 0.058 0.058 0.049 0.062

0.000 0.066 0.071 0.064 0.066 0.066 0.068 0.070 0.062

0.000 0.064 0.063 0.051 0.051 0.052 0.050 0.037

0.000 0.058 0.050 0.050 0.052 0.025 0.058

0.000 0.062 0.062 0.062 0.055 0.064

0.000 0.000 0.041 0.048 0.033

0.000 0.041 0.048 0.033

0.000 0.054 0.035

0.000 0.052

0.000

Table 6. Contd.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

2009). The genetic distances (GD) of the 30 tea cultivars ranged from 0 to 0.071, and averaged at 0.049. The genetic distance of 15 Chinese elite tea genetic resources

ranged from 0.16 to 0.62, and averaged at 0.37 (Chen et al., 2005). These suggest that relatively higher levels of genetic polymorphism in tea cultivars could be detected at

8188

Afr. J. Biotechnol.

the nuclear genome level, whereas relatively lower levels of genetic polymorphism could be estimated by cpDNA PCR-RFLP markers. This is in agreement with the results of investigations on Cym bidium (Gan et al., 2007). Genetic diversity within the chloroplast genome may be lower than the nuclear genome because chloroplast DNA (cpDNA) is uniparentally inherited and has a lower mutation rate relative to the nuclear genome in most plants. REFERENCES Badens ML, Parfitt DE (1995). Phylogenetic relationships of cultivated Prunus species from an analysis of chloroplast DNA variation. Theor. Appl. Genet. 90: 1035-1041. Bai FY (2001). China tea varieties. Shanghai: Shanghai science & technical publishers. Chen L, Gao QK, Chen DM, Chen DM, Xu CJ (2005). The use of RAPD markers for detecting genetic diversity, relationship and molecular identification of Chinese elite tea genetic resources (Camellia sinensis (L.) O. Kuntze) preserved in tea germplasm repository. Biodiver. Conserv.14: 1433-1444. Chen L, Yamaguchi S (2005). RAPD markers for discriminating tea germplasms at the inter-specific level in China. Plant Breed. 124: 404-409. Cui BB, Li Y, Jin XJ, Feng H (2006). Genetic characters and polymorphism of chloroplastand mitochondrial DNA in white poplar. J. Beijing Forestry Univ. 28(6): 9-14. Demesure B, Sodzi N, Petit RJ (1995). A set of universal primers for amplication of polymorphic noncoding regions of mitochondrial and chloroplast DNA in plants. Mol. Ecol. 4: 129-131. Gan N, Tan XH, Chen QB, Wei YM, Zheng YL (2006). Genetic Diversity in Cymbidium Based on RAPD Markers and PCR-RFLP Analyses of Organellar DNAs. Acta Horticulturae Sinica, 33(2): 349-355. HEINZE B (2001). A data base for PCR primers in the chloroplast genome[DB]. http://bfw.ac.at/200/1859.html. Huang JC, Sun M (2000). Genetic diversity and relationships of sweet potato and its wild relatives in Ipomoea series Batatas (Convolvulaceae) as revealed by intersimple sequence repeat (ISSR) and restriction analysis of chloroplast DNA. Theor. Appl. Genet. 100: 1050-1060. Huang JA, Huang YH, Luo JW, Wang KB, Zhou LH ( 2003).Efficient methods for genomic DNA extraction from tea plant. J. Hunan Agric. Univ. 29(5): 403-407 Hung CY, Wang KH, Huang CC, Gong X, Ge XJ, Chiang TY( 2008).Isolation and characterization of 11 microsatellite loci from Camellia sinensis in Taiwan using PCR-based isolation of microsatellite arrays (PIMA). Conserv. Genet. 9(3): 779-781. Nei M, Li W (1979). Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl Acad. Sci. USA. 76: 5269-5273.

Panda S, Martin JP, Aguinagalde I (2003). Chloroplast DNA study in sweet cherry cultivars (Prunus avium L.) using PCR-RFLP method. Genet. Res. Crop Evol. 50: 489-495. Parani M, Lakshmi M, Ziegenhagen B (2000). Molecular phylogeny of mangroves VII. PCR-RFLP of trnS-psbC and rbcL gene regions in 24 mangrove and mangrove-associate species. Theor. Appl. Genet. 100: 454-460. Parani M, Rajesh K, Lakshmi M, Parducci L, Szmidt AE, Parida A (2001). Species identification in seven small millet species using polymerase chain reaction restrition fragment length polymorphism of trnS-psbC gene region. Genome, 44(3): 495-499. Rohlf, FJ (1993). NTSYS-pc version 1.80. -/ Exeter Software, Setauket, NY. Su YJ, Wang T, Zheng B, Jiang Y, Chen GP, Ouyang PY (2005). Genetic differentiation of relictual populations of Alsophila spinulosa in southenr China inferred from cpDNA trnL-F noncoding sequences. Mol. Phylogenet. Evol. 34: 323-333. Taberlet P, Gielly L, Pauto G, Bouvet J (1991). Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17(5): 1105-1109. Tsumura Y, Kawahara T, Wickneswari R, Yoshimura K (1996). Molecular phylogeny of Dipterocarpaceae in southeast Asia using RFLP of PCR-amplified chloroplast genes. Theor. Appl. Genet. 93: 22-29. Xu DH, Abe J, Kanazawa A, Gai Y, Shimamoto (2001). Identification of sequence variations by PCR-RFLP and its application to the evaluation of cpDNA diversity in wild and cultivated soybeans. Theor. Appl. Genet. 102: 683-688. Ziegenhagen B, Schauerte M, Scholz F, Kormutak A (1995). Restriction site polymorphism in chloroplast DNA of silver fir (Abies alba Mill.). For. Genet. 2: 99-107. Yao MZ, Chen L, Wang XC, Zhao LP, Yang YJ(2007). Genetic diversity and relationship of clonal tea cultivars in China revealed by ISSR markers. Acta Agronomica Sinica, 33(4): 598-604. Huang JP, Li JX, Huang YH, Luo JW, Gong ZH, Liu ZH(2006). Genetic Diversity of Tea (Cam ellia sinensis ( L.) O.Kuntze) cultivars revealed by AFLP Ana lysis. Acta Horticulturae Sinica. 33(2): 317-322. Tan YP, Li J, Liu SQ, Yan CY, Chen JH (2009). Genetic diversity of 43 tea cultivars (Camellia sinensis(L.) O. Kuntze) by SSR markers. J. Tea Sci. 29(4): 271-274.

Full Length Research Paper

Genetic diversity of Colletotrichum gloeosporioides in Nigeria using amplified fragment length polymorphism (AFLP) markers Aduramigba-Modupe, A. O.1*, Asiedu, R.2, Odebode, A. C.3 and Owolade, O. F.4 1

Department of Biological Sciences, Redeemer’s University, PMB 3005, Redemption City, Ogun State, Nigeria. 2 International Institute of Tropical Agriculture, PMB 5320, Ibadan, Oyo State, Nigeria. 3 Department of Botany and Microbiology, University of Ibadan, Oyo State, Nigeria. 4 Institute of Agricultural Research and Training, Obafemi Awolowo University, Ibadan, Oyo State, Nigeria. Accepted 1 June, 2011

Colletotrichum gloeosporioides is the causal agent of yam anthracnose disease in Nigeria. Differential cultivars and amplified fragment length polymorphic DNA markers were used to assess the extent of genetic diversity among 39 isolates of the pathogen. Fourteen (14) pathotypes of the pathogen were identified based on inoculation of a differential set of Dioscorea alata genotypes of which pathotype P11 was the most virulent attacking all differential D. alata host genotypes, while pathotype P8 was the least virulent. 52% of the isolates were avirulent, 23% were slightly virulent and 25% were virulent. Amplified fragment length polymorphism (AFLP) analysis confirmed genetic variation among the C. gloeosporioides isolates and was effective in establishing genetic relationships between them. However, the grouping of the isolates based on AFLP analysis was not directly related to virulence groups or geographical origin of the isolates. The genetic variation in C. gloeosporioides is important in choosing strategies to develop durable resistance Key words: Anthracnose disease, pathotypes, genetic diversity, amplified fragment length polymorphism (AFLP) markers, yam. INTRODUCTION Anthracnose disease is a major constraint to the production of Dioscorea alata (Abang et al., 2002; Egesi et al., 2009; Aduramigba et al., 2010), causing about 90% loss in yield. The disease is caused by the pathogen Colletotrichum gloeosporioides Penz. (Nwankiti and Ene, 1984; Abang et al., 2002; Aduramigba et al., 2010). Colletotrichum is one of the most important plant pathogenic fungi worldwide (Holliday, 1980). Species differentiation in the genus has been based primarily on conidia size and shape, and presence or absence of setae (Sutton, 1992). Colletotrichum species are ubiquitous and have been isolated from a variety of environments. They are best known, however, as the

*Corresponding author. E-mail: aduramigbaa@run.edu.ng.

causal agent of the disease symptoms commonly known as anthracnose. C. gloeosporioides has been reported as a pathogen on a wide range of host species throughout the world (Bailey and Jeger, 1992; Cannon et al., 2008). Anthracnose affects the leaves, petioles, stems and veins of the plant, causing leaf spots, leaf blotches, petiole blights, premature abscission, dieback and eventual death of the entire plant. The disease usually has a dramatic effect on infected plants, converting a field of initially healthy yam plants from ‘green’ to ‘black’ within a few weeks (Green and Simons, 1994). Phytopathogenic fungi are usually classified as species and races based on morphology, host specialization, cultivar specificity and mode of parasitism (O’Nell et al., 1998). The application of methods in molecular analysis has helped to clarify the genetic relationships of fungal taxa which are not clearly distinguished by their

8190

Afr. J. Biotechnol.

morphology. Restriction fragment length polymorphism (RFLP), PCR-based random amplified polymorphic DNA (RAPD) and rDNA sequence analyses have been reported to give a significant improvement in the identification and classification of phytopathogenic fungi (O’Nell et al., 1998). However, limitations in using these techniques include difficulty in standardization, time and effort required, the relatively small numbers of polymorphisms generated, small and variable selective sampling of the genome and reproducibility. RAPD markers which are based on the amplification of discrete DNA fragments in the genome by the use of oligonucleotide primers with random sequences have been largely used to identify physiological races of different Colletotrichum species (Guthrice et al., 1992). Amplified fragment length polymorphism (AFLP) is a PCR-based fingerprinting technique that has been used in plants, bacteria, nematodes and fungi (O’Nell et al., 1998). AFLP markers assay the presence/absence of restriction enzyme sites in combination with sequence polymorphisms adjacent to these sites. Production of AFLP is based on selective amplification of restriction enzyme digested DNA fragments. Multiple bands are generated in each amplified reaction that contains DNA markers of random origin (Zabeau and Vos, 1993; Vos et al., 1995). AFLP have significant advantage over other procedures because variability can be assessed at a large number of independent loci and data are obtained more quickly and are reproducible (Zabeau and Vos, 1993). It represents a practical advance in fungal DNA finger-printing because of the greater resolution and the collection of more information than is possible by RADP and RFLP techniques. AFLP analysis is useful in identifying genetic diversity and analysis of population structure within complex genera of fungi (O’Nell et al., 1998). This study was conducted to determine the variation among isolates of C. gloeosporioides in terms of virulence and DNA polymorphism using AFLP molecular markers. MATERIALS AND METHODS Thirty-eight (38) isolates of C. gloeosporioides obtained from infected yam leaves and one reference isolate (Cg 33) from IITA were studied. The isolates were purified by single spore isolation. A dilute spore suspension of each isolate was prepared by picking conidia from sporulating acervuli and placing them in sterile vials containing 1 ml of sterile distilled water. These suspensions were shaken thoroughly and streaked onto thin plates of tap water agar using a sterile wire loop. Single-spore isolations for all the isolates were done on tap water agar using two plates per isolate. Streaked plates were labelled and incubated at 28°C for 12 to 24 h. After incubation, a Swann Morton No. 11 blade fitted onto a holder was used to transfer four single germinated spores of each C. gloeosporioides isolate to Petri dishes containing 1/4 potato dextrose agar. Single germinating conidia were identified with the aid of a binocular dissecting microscope used at high power (x40).

Plates were sealed, labelled and incubated at 28°C for 3 to 5 days. The isolates were maintained on potato dextrose agar with periodic sub-culturing. The isolates were characterized based on morphological and cultural criteria (Baxter et al., 1983; Hawskworth et al., 1995) as well as virulence characteristics on both local and improved yam genotypes.

Determination of C. gloeosporioides pathotypes The reactions of four differential D. alata genotypes (TDa 289, TDa 85/00250, TDa 94-126 and TDa 94-72) were used to differentiate isolates of C. gloeosporioides into pathotypes. These genotypes were selected based on their differential reactions to anthracnose on the field (Aduramigba-Modupe et al., 2008). This was carried out using a rapid bioassay method developed by Green et al. (2000) for screening yam for the response to anthracnose disease. Spore suspensions of the isolates were prepared by washing the surface of 7 to 10-day old pure cultures of C. gloeosporioides isolated from infected yam leaves with sterile distilled water. The suspension was then passed through four layers of muslin cloth to remove fungal mycelia and other debris and then adjusted to 1 x 106 spores ml-1 using a haemocytometer. The leaves were inoculated with spore suspensions of individual isolates of C. gloeosporioides using an artist’s paint brush. Leaves used as control were inoculated with sterile distilled water (SDW). Two sterile filter papers were placed inside a 9 cm glass Petri dish and moistened with SDW. An inoculated whole leaf was placed in each dish, covered and sealed with parafilm. The experiment was set up in a randomized complete design with three replications. Incubation was done at 28°C under 12 h/day fluorescent light and lasted for 4 days. Leaves were rated for disease reaction using the scale of Sweetmore et al. (1994).

DNA extraction from mycelia DNA extraction was done according to Reeder and Broda (1987) with some modifications. Approximately, 0.3 g of washed mycelia was suspended in 200 ml of 2x CTAB buffer (50 mM Tris, pH 8.0; 10 mM EDTA; 2% hexadecyltri-methylammonium bromide; 0.1% 2mercaptoethanol), followed by 100 ml of 20% solution of sodium dodecyl sulphate (SDS) in double distilled water and was incubated at 65°C for 10 min. DNA was isolated by two extractions of chloroform isoamyl alcohol (24:1) and precipitated with absolute ethanol at -20°C. DNA was washed with 70% ethanol, dried and re-suspended in 100 l of sterile distilled water. DNA samples were subjected to electrophoresis to check their integrity in 1% agarose gels along with undigested Lambda DNA standards using 3 l of DNA sample loaded unto agarose gel 0.5x TBE (45 mM Tris- acetate, 1M EDTA, pH 8) as running buffer.

Polymerase chain reaction (PCR) amplification The modified method of Vos et al. (1995) was employed in the AFLP analysis. Three primers: EAA/MO, EAC/MA and EAA/MG were used for amplification. Amplification products were separated by electrophoresis in 2% agarose gels.

Data analysis Bands from lanes of the gel plates were scored visually for their presence or absence. A band was considered polymorphic if it was

Aduramigba-Modupe et al.

8191

Table 1. Pathotype designation of C. gloeosporioides in the D. alata differential set differential host D. alata.

Pathotype P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13

TDa 289 + + + + + + -

TDa 85/00520 + + + + + + -

TDa 94-126 + + + + + + + -

TDa 94-72 + + + + + + +

+: Susceptible host reaction; -: resistant host reaction.

present in one or more of the isolates used in this study. Positions of unequivocally scorable AFLP bands were transformed into a binary character matrix for the presence (“1”) or the absence (“O”) of a band at a particular position. Pair-wise distance matrices were compiled using the Jaccard coefficient of similarity (Jaccard, 1908) present in NTSYS-PC 2 software packages (Rohlf, 1993). Dendrograms were created by unweighted pair-group method with arithmetic averages (UPGMA) cluster analysis (Sneath and Sokal, 1973).

RESULTS Determination of C. gloeosporioides pathotypes Classification of the isolates was done according to the disease reactions of four differential D. alata cultivars. Thirteen (13) possible pathotypes were identified from the 39 isolates used in this study (Table 1). The four D. alata cultivars varied in their reactions to the isolates. P11 was the most aggressive and accounted for about 8% of the isolates, while P8 was not virulent on any genotype in the differential set, and accounted for about 18% of the isolates. P2 and P5 were the most common and they accounted for 13 and 16%, respectively. Different virulence patterns were found for some of the field isolates (Table 1).

dendrogram generated by complete cluster analysis showed 4 main clusters at 55% similarity level (Figure 1). All the isolates were distinct at 100% similarity level. The 4 main clusters could not be related to pathotype, host origin or geographical location where the isolates were obtained (Table 2). The isolates within the clusters were as follows: Cluster I: It contained 5 isolates, 53, 48, 40, 27 and 10 in two subgroups, ‘a’ and ‘b’. Subgroup ‘a’ consists of 53, 48 and 40 from Ebonyi, Cross river and Akwa-Ibom States in the humid forest area of Nigeria, while subgroup ‘b’ consists of 27 and 10 from Benue State in the guinea savannah. Cluster II: This comprises two isolates, 26 from Ebonyi State and 34 from Cross river State, Nigeria. Cluster III: Twenty-two (22) isolates, divided into three subgroups, ‘a’, ‘b’ and ‘c’. Subgroup ‘a’ has isolates 39, 31, 33, 30 and 22 from Ebonyi State. Subgroup ‘b’ consists of isolates 38, M33, 45, 42, 41, 43 and 35. Subgroup ‘c’, has isolates 4, 7, 9, 25, 27, 36, 49, 52, 55 and reference isolate F37 from cassava. Cluster 1V: There were 2 subgroups ‘a’ and ‘b’. ‘a’ has 2 isolates, 29 and 24 and ‘b’ has 8 isolates 1, 2, 15, 16, 17, 18, 20 and 8.

Molecular variation

The most closely related isolates were 7 and 49, as well as 52 and 56 at 62 and 98% similarity coefficient, respectively.

Fifty eight (58) polymorphic bands were observed. The similarity matrices were generated by each of the three primer pairs and were combined to determine the genetic relationships among C. gloeosporioides isolates. AFLP analysis was effective in establishing genetic relationships between different isolates of C. gloeosporioides. The

The principal component analysis of polymorphic bands The binary data generated from the 39 isolates were

8192

Afr. J. Biotechnol.

1F 2F 15GS F16 17F 18F 20GS 8GS 24F 29GS 4F 7F 49F 52GS 56DS 9GS 27GSb 25GS F35 36GS 35GS 43F 41F 42GS 45GS 38F M33 22GS 30F 33GS 31F 39F 26GS 34F 10GS 27GS 40F 48GS 53F

0.00

0.25

0.50

0.75

1.00

Coefficient Figure 1. Dendrogram showing the genetic similarity of 39 C. gloeosporioides isolates based on UPGMA using NTSYS v.2.02j.

Table 2. Variability in colour of mycelium, pathotype and molecular group of C. gloeosporioides isolates from different agroecological zones.

Isolate number 30 38 40 43 4

Agroecological zone Forest Forest Forest Forest Forest

Colour Grey Grey Grey Grey Grey

Pathotype P12 P13 P13 P2 P3

Molecular group 3 3 1 3 3

Aduramigba-Modupe et al.

8193

Table 2. continues

17 31 `41 18 1 39 34 2 49 7 24 16 53 8 27a 27b 45 52 42 26 35 22 33 20 29 10 25 36 15 48

Forest Forest Forest Forest Forest Forest Forest Forest Forest Forest Forest Forest Forest Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah Guinea savannah

subjected to principal component analysis using SAS. It made use of the matrix data to produce six Eigen vectors. The first six principal components were associated with 20.24, 13.76 and 7.55, 6.92, 6.07 and 4.71%, respectively, of the variance of the genetic distance and contributed about 59.25% of the total variation found among the 39 isolates (Table 2). The plot of the first principal component scores generated a scatter graph of the isolates (Figure 2). DISCUSSION The genetic studies of C. gloeosporioides isolates in this study contributed to our understanding of the genetic structure of C. gloeosporioides population in yam growing zones of Nigeria and will help in selecting strains of the pathogen for screening yam germplasm for resistance to anthracnose disease in Nigeria.

Grey Orange Orange Orange Salmon Salmon Salmon Salmon Salmon Salmon Salmon Salmon Salmon Grey Grey Grey Grey Grey Orange Orange Salmon Salmon Salmon Salmon Salmon Salmon Salmon Salmon Salmon Salmon

P8 P12 P8 P9 P1 P1 P11 P2 P2 P4 P5 P7 P9 P5 P11 P11 P2 P2 P11 P6 P1 P10 P10 P2 P2 P3 P5 P5 P6 P5

4 3 3 4 4 3 2 4 3 3 4 4 1 4 1 3 3 3 3 2 3 3 3 4 4 1 3 3 4 1

Breeding and effective deployment of durable plant resistance require an understanding of genetic diversity among C. gloeosporioides from yam-based cropping systems, and the geographical distribution of the pathotypes. A differential host series is based on vertical resistance of lines, such as host genotypes that are differentially resistant to some physiological races but not others, and which do not show a significant genotype x environment (G x E) interaction with respect to disease response. The use of molecular tools has provided pathologists with numerous markers for analysing populations of C. gloeosporioides from different host plants. The results of this study indicated that the populations of C. gloeosporioides are highly heterogenous for both virulence and DNA pattern. Four cultivars of D. alata selected on the basis of their performances in field screening, varied in their reaction (resistant to susceptible) to inoculations with C. gloeosporioides isolates in the laboratory. The disease

8194

Afr. J. Biotechnol.

Figure 2. Scatter diagram of the first two principal components for 39 isolates of C. gloeosporioides.

severity of the host genotypes varied according to which isolate was used, suggesting the occurrence of vertical resistance within the cultivars (Van der Plank, 1984). This finding supports the work of Mignouna et al. (2001), who described the presence of a single dominant resistance gene in one cultivar of D. alata (TDa 95/00328). Thirteen(13) pathotypes identified from the 39 isolates used in this study confirms the high variability observed by Kelemu et al. (1996) and Thottappilly et al. (1999). The extreme pathogenic variation among isolates of C. gloeosporioides should be considered when selecting isolates to use in an anthracnose resistance screening program. This implies that response may change depending on which isolate is used, and different combinations of isolates should be used when screening for resistance. Isolates within the group of the pathotype 11 would be appropriate for use in initial screening as they exhibited susceptibility reaction on all the host series. Progress in identifying and monitoring variability in C.

gloeosporioides is possible with the use of molecular markers that are isolate specific or pathotype specific. Molecular markers are used extensively to characterise plant pathogens (Guthrice et al., 1992; Michelmore et al., 1987; Thottappily et al., 1999). When combined with data on virulence, these markers often can elucidate the population genetic structure and evolutionary relationship of plant pathogens (McDonald and McDermott, 1993; Screenivasaprasad et al., 1992). This information can suggest novel strategies for the control of plant pathogens. Results reported here, however, showed there were no clear relationships between results of AFLP analysis, virulence tests and geographical origin. In conclusions, high variability exists within the population of C. gloeosporioides isolates from infected leaf samples. The extreme pathogenic variation among isolates of C. gloeosporioides should be considered when selecting isolates to be used in an anthracnose resistance screening program. DNA-based molecular markers represent a potent tool for the identification of

Aduramigba-Modupe et al.

distinct populations of C. gloeosporioides and thus, the development of D. alata genotypes with stable genetic resistance to anthracnose. REFERENCES Abang MM, Winter S, Green KR, Hoffmann P, Mignouna HD, Wolf GA (2002). Molecular identification of Colletotrichum gloeosporioides strains causing anthracnose of yam in Nigeria. Plant Pathol. 51: 6371. Aduramigba-Modupe AO, Asiedu R, Odebode AC (2008). Reaction of Dioscorea alata (water yam) to anthracnose disease in Nigeria. J. Food Agric. Environ. 6(3-4): 248-252. Aduramigba-Modupe AO, Odebode AC, Asiedu R (2010). Distribution of yam anthracnose disease in Nigeria. Afr. J. Root Tuber Crops, 8(1): 51-55. Bailey JA, Jeger MJ (1992). Colletotrichum: Biology, Pathology and Control CAB International, Wallingford, UK. p. 398 Cannon PF, Buddie AG, Bridge PD (2008). The typification of Colletotrichumgloeosporioides. Mycotaxon, 104: 189-204. Egesi CN, Onyeka TJ, Asiedu R (2009). Environmental stability of resistance to anthracnose and virus diseases of water yam (Dioscorea alata). Afr. J. Agric. Res. 4(2): 113-118. Green KR, Abang MM, Iloba C (2000). A rapid bioassay for screening yam germplasm for response to anthracnose. Trop. Sci. 40: 132-138. Green KR, Simons SA (1994). ‘Dead Skin’ on Yams (Dioscorea alata) caused by Colletotrichum gloeosporioides. Plant Pathol. 43: 10621065. Guthrice PAI, Magill CW, Frederiksen RA, Odoody GN (1992). Random Amplified polymorphic DNA markers: A system for identifying and differentiating isolates of C. graminicola. Phytopathology, 82: 832835. Holliday P (1980). Colletotrichum In: Fungus diseases of Tropical Crops. Cambridge Univ. Press, Cambridge, UK. pp. 91-109. Jaccard P (1908). Nouvelles recharges sur la distribution florate. Bulletin de la Societe Vandoise de Sciences naturelles, 44: 223-270. Kelemu S, Skinner DZ, Badel JL, Moreno CX, Rodríguez MX, Fernandes CD, Charchar MJ, Chakraborty S (1996). Genetic diversity in South American Colletotrichum gloeosporioides isolates from Stylosanthes guianensis, a tropical forage legume. Eur. J. Plant Pathol. 105: 261-272. McDonald BA, McDermott JM (1993). The population genetics of plant pathogenic fungi. BioSci. 43: 311-319.

8195

Michelmore RW, Dianese JC (1987). Race characterization of Brisilian isolates of C. Lindemuthianum and detection of resistance to anthracnose in Phaseolus Vulgaris. Phytopathology, 78: 650-655. Mignouna HD, Abang MM, Green KR, Asiedu R (2001). Inheritance of resistance in water yam (Dioscorea alata) to anthracnose (Colletotrichum gloeosporioides). Theor. Appl. Genet., 103: 52-55. Nwankiti AO, Ene LSO (1984). Advances in the study of th anthracnose/blotch disease of D. alata in Nigeria. In: Proc 6 Symposium of the Int. Soc. Trop. Root Crops, Shidler FS and Rincon H (eds). Lima Peru, 1983. pp. 633-640. O’Nell NR, Bailey BA, Brekum PB van (1998). AFLP, A novel PCRbased DNA Analysis Technique, reveals levels of genomic variation within species of Colletotrichum, Fusarium and Dendryphion. http:// www.bspp.org.uk/icpp98/2.2/87.html Reeder V, Broda P (1987). Rapid preparation of DNA from filamentous fungi, Appl. Microbiol. 1: 17-20. Rohlf FJ (1993). NTSYS-PC. Numerical Taxonomy and Multivariate Analysis System. Exerter, New York. Screenivasaprasad S, Brown AE, Mills PR (1992). DNA sequence variation and interrelationships among Colletotrichum species causing strawberry anthracnose. Physiol. Mol. Plant Pathol. 41: 265281. Sneath PHA, Sokal R (1973). Numerical Taxonomy. Freeman, San Francisco. Sutton BC (1992). The genus Glomerella and its anamorph Colletotrichum In: Colletotrichum: biology, pathology and control. (Eds. Bailey JA and Jeger MJ). Wallingford: C.A.B. International, U.K. pp. 1-26. Sweetmore A, Simons SA, Kenward M (1994). Comparison of disease progress curves for yam anthracnose. (Colletotrichum gloeosporioides). Plant Pathol. 43: 206-215. Thottappilly G, Mignouna HD, Onasanya A, Abang MM (1999). Identification and differentiation of isolates of Colletotrichum gloeosporioides from yam by Random Amplified Polymorphic DNA markers. Afr. Crop Sci. J. 7(2). 195-205. nd Van der Plank JE (1984). Disease Resistance in Plants. 2 Edition. Academic Press Orlando, Florida. USA: p. 194. Vos PR, Hogers M, Blecker M, Reijans TVD, Lee M, Hornes A, Frijter J, Pot J, Peleman M, Kuiper M, Zabeaus M (1995). AFLP a new technique for DNA fingerprinting. Nucleic Acid Res. 23: 4407-4414. Zabeau M, Vos P (1993). Selective restriction fragment amplification: a general method for DNA fingerprints. European patent application.

Full Length Research Paper

Identification of a male-specific amplified fragment length polymorphism (AFLP) marker in Broussonetia papyrifera Wang Lianjun1, Dai Changbo2, Liu Degao1 and Liu Qingchang1* 1

Key Laboratory of Crop Genomics and Genetic Improvement, Ministry of Agriculture; Beijing Key Laboratory of Crop Genetic Improvement, China Agricultural University, No. 2 Yuanmingyuan West Road, Beijing 100193, PR China. 2 Department of Medical Biotechnology, College of Biomedical Science, Kangwon National University, Chuncheon, Gangwon-do 200-071, Korea. Accepted 2 April, 2012

The present study exhibits amplified fragment length polymorphism (AFLP) molecular marker for sex identification in Broussonetia papyrifera. Based on nine selective amplification primer combinations, 230 bands were produced and the E-AGG/M-CAA combination was found to be a male-specific AFLP marker. Subsequently, this male-specific AFLP fragment was sequenced and converted into a sequence tagged site (STS) marker. Based on STS sequence, two primers, MADB-1 and MADB-2 (Male-Associated DNA from B. papyrifera), were designed to verify the specificity of the fragment. The results indicate that common homology sequence is existed in both male and female plants while one of the bands amplified via MADB-2 primer was solely present in male individuals at high annealing temperature up to 66°C. Finally, MADB-2 primer was introduced to amplify another 16 plants and it revealed that this primer could be used as a convenient, efficient, reliable, and low-cost molecular marker for sex identification in B. papyrifera. Key words: Broussonetia papyrifera, AFLP, STS, male-specific marker. INTRODUCTION Broussonetia papyrifera (Moraceae) is a dioecious plant and its fruits have been widely used in traditional medicine for the treatment of impotence, age-related disorders, ophthalmic disorders, and so on (Lee et al., 2001; Mei et al., 2009; Zheng et al., 2008). The bark is composed of very strong fibers, and has been used for manufacturing high-quality papers, clothes, and ropes while the leave can be eaten and used for animal fodder (Whistler and Elevitch, 2006). However, B. papyrifera is considered to be an invasive pest when introduced into new areas. The plant is known to quickly disrupt native

*Corresponding author. E-mail: liuqc@cau.edu.cn. Tel/Fax: +86 10 62733710. Abbreviations: AFLP, Amplified fragment length polymorphism; STS, sequence tagged site.

habitats, become highly invasive and upset natural ecosystems (Malik and Husain 2007; Nagpal et al., 2011). To avoid the species invasion, only male B.papyrifera were introduced into the pacific islands, subsequently, the invasion was blocked owing to absence of female viable seeds in the Pacific (Whistler and Elevitch 2006). By now, no recorded evidence of any monoecious genotypes was found to be existed in B. papyrifera species (Coder, 2008). Moreover, both male and female species are morphologically alike and hare to distinguish in sterile state (Whistler and Elevitch, 2006). It has been reported that female flowers possess a two- to four-lobed perianth and a superior ovary with a filiform style, which are remarkably different from male flowers. Unfortunately, the flowering process of most B. papyrifera species is unknown and of infrequent occurrence (Whistler and Elevitch, 2006). Thus, it is urgent and important to develop an approach for identification of the sex of B. papyrifera at the seedling stage.

Lianjun et al.

8197

Table 1. The sequence of amplified fragment length polymorphism (AFLP) and STS primers.

Primer name

Primer sequence (5’-3’)

EcoRI-pre

gac tgc gta cca att ca

MseI-pre E-ACG E-ACT

gat gag tcc tga gta ac gac tgc gta cca att cac g gac tgc gta cca att cac t

E-AGG M-CTT M-CAA

gac tgc gta cca att cag g gat gag tcc tga gta act t gat gag tcc tga gta a caa

M-CTG MADB-1forward MADB-1reverse

gat gag tcc tga gta a ctg tca gtt cca gtg acg acg ac cca act ttg aat ccg gaa aa

MADB-2forward MADB-2reverse

gaa ttc act caa gcc ctt tgg a tta act gta atc aag aac aaa gac tgg a

EcoRI-pre and MseI-pre indicate the primers for pre-amplification. E-ACG, E-ACT and E-AGG reveal three different EcoRI-adapter selective amplification primers. M-CTT, M-CAA and M-CTG show diverse MseIadapter selective amplification primers. MADB-1 forward/MADB-1 reverse and MADB-2 forward /MADB-2 reverse are two pairs of STS primers.

Amplified fragment length polymorphism (AFLP), based on the selective PCR amplification technology was firstly developed by Vos et al. (1995). After the initial finding, this efficient, high-thought technology has been thought to be an important molecular marker, and was widely applied in a variety of organisms from bacteria and fungi to plants and animals (Bensch and Akesson, 2005; Hua et al., 2009; Meudt and Clarke, 2007). Consideration of laborious, time-consuming during its utilization for routine sex identification and mapping, AFLP markers were frequently converted into easy-operation approaches, that is, sequence tagged site (STS) and sequencecharacterized amplified region (SCAR) markers (Hua et al., 2009). It reported that some AFLP-derived STS markers have been used for fine mapping of the sex gene in asparagus (Reamon-Büttner and Jung, 2000). Moreover, one of AFLP markers, termed as k2 fragment, was identified and converted into SCAR sequence, which could be used for marker-assisted breeding in Brassica napus (Ke et al., 2004). Since there are no available methods to identify the sex of B. papyrifera at the seedling stage, we consider developing a molecular approach to distinguish the sexes in B. papyrifera. In the present study, an AFLP molecular marker was screened, cloned and converted into STS sequence, which was introduced to the process of identification of gene sex in B. papyrifera during seedling stage. MATERIALS AND METHODS Collection of plant Young leaves of male and female plants of B. papyrifera were

harvested based on the presence of male flowers or development of fruits from National Baiwang Forest Park, Beijing, China.

DNA extraction and AFLP analysis Total genomic DNA was extracted separately from 3 g fresh leaves from four male and four female individuals with the modified sodium dodecyl sulphate (SDS) standard method (Danilova and Karlov ., 2006), and its quality and quantity were analyzed using 1% agarose gel electrophoresis and an ND-1000 spectrophotometer (NanoDrop Technologies, USA). AFLP analysis was conducted as described by Ma et al. (2010) with minor modifications. In brief, 100 ng of genomic DNA was digested with 1 μl mixture of EcoRI and MseI (1.25 μ/μl , TAKARA, Japan) for 7 h at 37°C, then heated for 15 min at 70°C to inactivate the enzymes. Ligation of specific adapters to restriction fragments was performed by adding 12 μl adapter mixture and incubated for 12 h at 20°C, and then the ligation reaction products was diluted for 10 times. Pre-amplification PCR was performed in a 50 μl volume with 2 μl 10×EasyTaq buffer, 4 μl 2.5 mM dNTPs, 0.5 μl EasyTaq DNA polymerase, 2 μl EcoRI-pre primer (Table 1), 2 μl MseI-pre primer (Table 1) and 3 μl diluted ligation mixture; sterilized water was added to make a final volume of 50 μl. The PCR reaction involved an initial 5 min denaturation at 94°C; followed by 20 cycles of 94°C, 30 s; 56°C, 1 min; 72°C, 1 min; and a final 7 min of extension. Aliquots of individual PCR products were separated on 1% agarose gel and stained with ethidium bromide. The preamplified PCR products were diluted to 30 times. Nine primer combinations were used for selective amplification (Table 1). The PCR amplification was performed using a ‘touchdown’ program: one cycle of denaturation at 94°C for 30 s, annealing at 65°C for 30 s, and extension at 72°C for 1 min; 12 cycles of subsequently lowering the annealing temperature (65°C) by 0.7℃ per cycle while keeping at 94°C for 30 s (denaturation) and 72°C for 1 min (extension); 25 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min. The PCR products were separated by 6% denaturing polyacrylamide gel.

8198

Afr. J. Biotechnol.

Cloning and sequence analysis of male-specific AFLP marker The fragment of interest was excised with a razor blade from a 6% denaturing polyacrylamide gel and redissolved in 50 μl of Tris-EDTA buffer (TE, pH 8.0) at 100°C for 10 min. The re-amplification PCR reaction was performed with the corresponding primers and 5 μl of the TE buffer under the same conditions as before. PCR products were recovered from agarose gel, cloned into pMD-18 T vector and sequenced using ABI 3730xl automated DNA Sequencer (Invitrogen, China). The sequence was submitted to GenBank, and sequence homology was assayed using BLASTn methods at GenBank database (http://www.ncbi.nlm.nih.gov/blast).

Conversion of the male-specific AFLP marker to STS marker Based on the sequence of the male-specific AFLP fragment, two pairs of STS primers termed as MADB-1 and MADB-2 (MaleAssociated DNA from B. papyrifera), respectively were designed (Table 1) to convert the male-specific AFLP marker into the STS marker. To confirm the validity of these STS primers, they were used to amplify the male and female individuals of B. papyrifera. PCR was performed in a 50 μl volume with 2 μl 10×EasyTaq buffer, 4 μl 2.5 mM dNTPs, 0.5 μl EasyTaq DNA polymerase, 2 μl EcoRI selective amplification primer, 2 μl MseI selective amplification primer, 3 μl diluted ligation mixture and distilled water was added to a final volume of 50 μl. PCR was conducted as follows: initial incubation at 95°C for 5 min, followed by 33 cycles of 95°C for 30 s, 60 to 66°C for 30 s; and 72°C for 60 s, with a final extension of 10 min at 72°C. The amplification was resolved on 1.5% agarose gel with a DL2000 DNA marker.

RESULTS Screening, cloning and sequence analysis of malespecific AFLP marker To identify male-specific DNA polymorphic fragments, nine primer combinations were used for AFLP analysis, which produced a total of 230 scorable bands with an average of 28.8 products per primer. One primer combination (E-ACT, M-CTG primer, Table 1) produced a significant fragment of 476 bp that was present in all male individuals but absent in all female samples (Figure 1). The male-specific AFLP marker was amplified and recovered from the gels, cloned and sequenced (GenBank accession no. HQ202152). The sequence of the malespecific polymorphic AFLP marker is shown in Figure 2. BLAST results indicated that no homologous sequence was found in the GenBank database and complete open reading frame was also absent in this fragment. Development of STS primer and sex identification via PCR in B. papyrifera Since the long primers (19 to 25-mer) are more reliable and accurate than short AFLP primers (about 10-mer), we designed two pairs of STS primers, MADB-1 and MADB2, based on the sequence of the male-specific AFLP fragments (Figure 2). To confirm their validity, these

primers were used to amplify the male and female individuals. It was found that a 177 bp-long fragment was present in both male and female individuals using MADB1 primers (Figure 3). It suggested that there exists considerable sequence homology between male and female samples. To identify the genetic sex of B. papyrifera, MADB-2 primers were used to test its suitability in identification of the plant sex. The result demonstrates that the appearance of fragment amplified via MADB-2 primer was closely related to annealing temperature. Although the fragment amplified from female samples was weak on agarose gel, the band appeared on both sexes of B. papyrifera with performance of relative low annealing temperature, 60, 62 and 64°C, (Figure 4a and b). However, the single 454 bp-length fragment existed in male B. papyrifera but none in females while the annealing temperature was increased to 66°C (Figure 4a and b). To further verify the reliability of this primer, another eight male and eight female samples were used to amplify the specific fragment with an annealing temperature of 66°C. The data were in accordance with the results described above (Figure 5). DISCUSSION Due to the different economic and medicinal values between male and female B. papyrifera, it’s an urgent need for early sex identification at the stage of seedlings on a large scale. Considering there are no available methods to distinguish the sexes before flowering. Efforts to identify dioecious plant sex type in an early stage of development are important for selecting female or hermaphrodite plants for transfer to the field, to gain time and reduce costs. AFLP is a fast and simple technique which provides a large number of polymorphic markers without requiring any prior knowledge about the DNA sequences of the organisms. By now, this protocol has been used for identifying sex type of several dioecious plants such as Asparagus officinalis L. (Reamon-Büttner et al., 1998), Rumex nivalis (Stehlik and Blattner 2004), fig (Parrish et al., 2004) and Patagonian Pejerrey (Koshimizu et al., 2010). However, no available method has been devoted to discriminate the sexes in B. papyrifera. Therefore, we described an available approach to identify it, and the male-specific marker obtained from AFLP technique was proved to be reliable and efficient fragment. It has been demonstrated that the majority of AFLP fragments were caused by single nucleotide polymorphisms (SNPs), insertion/deletion (indels) or point mutation at/within the restriction sites (Brugmans et al., 2003; Prins et al., 2001; von et al., 2003). The same length fragment appearance in both male and female samples indicated that the sex-linked marker was not caused by indel events. The PCR results from MADB-2 primers suggested that there were polymorphisms

Lianjun et al.

Figure 1. Male-specific AFLP marker obtained with EAGG/M-CAA primer combination using 6% polyacrylamide denaturing gel. Lanes 1 to 4 female (♀) individuals; lanes 5 to 8 male (♂) individuals. The malespecific AFLP marker is indicated by arrow.

Primer MADB-2 forward GACTGCGTACCAATTCACTCAAGCCCTTTGGATCGCGACTTAGAAGCAAATCTCCGAA GCCCCAGTTCTTCGCCAATAGCTCTTCGCTGAGTGATCTCTGAACTCTTAGGGAGTTAC AAGTGTTGGACCGATTTGGGCAGCCGGGAACTCCGTCATCAAGGCCCGTAACCGTGGA TCTAAAAAGCCGTTCAATAACGACGACGACGACTTCTATGGCTACAAGGATTCCGACG GCAGCGATATCGACTATGATAtcagttccagtgacgacgacGATGATGACGTTGACATGGCTTTTG ATGACGACGACGAGGAGGACGTTGGCAAGAAAGGGAAGAAGAGAAAGTAAAAGAATT TGAATATCATCATCGTTATTTGACCATTGTTTTGGGAAATGTTATTTGGTCTCTGttttccggat tcaaagttggTCTTGTCCAGTCTTTGTTCTTGATTACAGTTACTCAGGACTCATC Primer MADB-2 reverse Figure 2. DNA sequence of B. papyrifera male-specific AFLP-STS marker. Sequences in bold, E-AGG and M-CAA primers; sequences in small italic character, MADB-1 STS primers; sequences with underline, MADB-2 STS primers.

8199

8200

Afr. J. Biotechnol.

♀ M

♂ 6

9 10

11 12 13 14 15 16

(bp) 2000 1000 500 250 100

177

Figure 3. The amplification of B. papyrifera using MADB-1 STS primers with annealing temperature of 60°C. M, Marker; Lanes 1 to 8, female (♀) individuals; lanes 9 to 16 male (♂) individuals.

♀

a M 1

♀

♂ 3

♂

9 10 11 12 13 14 15 16

(bp) 2000 1000 500 250 100

454

62 ℃

60℃

b M 1

♀ 2 3

♂ 4

♀ ♂ 9 10 11 12 13 14 15 16

(bp) 2000 1000 500 250 100

454

64 ℃

66 ℃

Figure 4. Determination of optimum annealing temperature using MADB-2 STS primers. M, Marker; Lanes a1 to a4, a9 to a12, b1 to b4 and b9 to b12, female (♀) individuals; Lanes a5 to a8, a13 to a16, b5 to b8 and b13 to b16, male (♂) individuals. Lanes a1 to a8, Annealing temperature of 60°C; Lanes a9 to a16, annealing temperature of 62°C; Lanes b1 to b8, annealing temperature of 64°C; Lanes b9 to b16, annealing temperature of 66°C.

between male and female plants, and this difference was significantly affected by annealing temperature. We

assume that point mutants at or within the restriction sites might lead to the sequence polymorphisms of the partial

Lianjun et al.

♀ M

8201

♂ 5

9 10 11

12 13 14 15 16

(bp) 2000 1000 500

454

250 100

Figure 5. The verification of STS marker using another 16 individuals of B. papyrifera and MADB-2 STS primers with annealing temperature of 66°C. M, Marker, Lanes 1 to 8, female (♀) individuals; Lanes 9 to16 male (♂) individuals.

genome in B. papyrifera. In conclusion, we have provided an efficient and reliable AFLP-dependent molecular technique to identify the sex type of B. papyrifera based on STS marker derived from AFLP sequence. This marker can be used for large-scale screening of sex type of B. papyrifera at the stage of seedlings. ACKNOWLEDGEMENTS This work was supported by The National Project for Public Industry of China (No. nyhyzx07-012). REFERENCES Bensch S, Akesson M (2005). Ten years of AFLP in ecology and evolution: why so few animals?. Mol. Ecol. 14: 2899-2914. Brugmans B, Van der Hulst RG, Visser RG, Lindhout P, Van Eck HJ (2003). A new and versatile method for the successful conversion of AFLP markers into simple single locus markers. Nucleic Acids Res. 31: e55. Coder KD (2008). Tree sex: Gender & reproductive strategies. Warnell School, University of Georgia, Georgia, USA. Danilova TV, Karlov GI (2006). Application of inter simple sequence repeat (ISSR) polymorphism for detection of sex-specific molecular markers in hop (Humulus lupulus L.). Euphytica, 151: 15-21. Elevitch CR (2006). Traditional trees of Pacific islands: Their culture, environment, and use. Permanent Agriculture Resources, Holualoa, Hawaii, USA. Hua W, Liu Z, Zhu J, Xie C, Yang T, Zhou Y, Duan X, Sun Q, Liu Z (2009). Identification and genetic mapping of pm42, a new recessive wheat powdery mildew resistance gene derived from wild emmer (Triticum turgidum var. dicoccoides). Theor. Appl. Genet. 119: 223230. Ke L, Sun Y, Liu P, Yang G (2004). Identification of AFLP fragments linked to one recessive genic male sterility (RGMS) in rapeseed (Brassica napus L.) and conversion to SCAR markers for markeraided selection. Euphytica, 138: 163-168 Koshimizu E, Strussmann CA, Okamoto N, Fukuda H, Sakamoto T (2010). Construction of a genetic map and development of DNA markers linked to the sex-determining locus in the Patagonian pejerrey (Odontesthes hatcheri). Mar. Biotechnol. 12: 8-13.

Lee D, Bhat KP, Fong HH, Farnsworth NR, Pezzuto JM, Kinghorn AD (2001). Aromatase inhibitors from Broussonetia papyrifera. J. Nat. Prod. 64: 1286-1293. Ma H, Chen S, Yang J, Ji X, Chen S, Tian Y, Bi J (2010). Isolation of sex-specific AFLP markers in Spotted Halibut (Verasper variegatus). Environ. Biol. Fish. 88: 9-14. Malik RN, Husain SZ (2007). Broussonetia papyrifera (L.) L'hér. Ex Vent.: an environmental constraint on the himalayan foothills vegetation. Pak. J. Bot. 39: 1045-1053. Mei RQ, Wang YH, Du GH, Liu GM, Zhang L, Cheng YX (2009). Antioxidant lignans from the fruits of Broussonetia papyrifera. J. Nat. Prod. 72: 621-625. Meudt H, Clarke A (2007). Almost forgotten or latest practice? AFLP applications, analyses and advances. Trends Plant. Sci. 12: 106-117. Nagpal U, Bankar A, Pawar N, Kapadnis B, Zinjarde S (2011). Equilibrium and kinetic studies on biosorption of heavy metals by leaf powder of paper mulberry (Broussonetia papyrifera). Water. Air. Soil. Poll. 215: 1-12. Parrish T, Koelewijn H, Dijk P (2004). Identification of a male-specific AFLP marker in a functionally dioecious fig, Ficus fulva Reinw. ex Bl. (Moraceae). Sex. Plant Reprod. 17: 17-22. Prins R, Groenewald JZ, Marais GF, Snape JW, Koebner RMD (2001). AFLP and STS tagging of Lr19, a gene conferring resistance to leaf rust in wheat. Theor. Appl. Genet. 103: 618-624. Reamon-Büttner SM, Jung C (2000). AFLP-derived STS markers for the identification of sex in Asparagus officinalis L. Theor. Appl. Genet. 100: 432-438. Reamon-Büttner SM, Schondelmaier J, Jung C (1998). Aflp markers tightly linked to the sex locus in Asparagus officinalis L. Mol. Breed. 4: 91-98. Stehlik I, Blattner FR (2004). Sex-specific SCAR markers in the dioecious plant Rumex nivalis (Polygonaceae) and implications for the evolution of sex chromosomes. Theor. Appl. Genet. 108: 238-242. Von Stackelberg M, Lindemann S, Menke M, Riesselmann S, Jacobsen HJ (2003). Identification of AFLP and STS markers closely linked to the def locus in pea. Theor. Appl. Genet. 106: 1293-1299. Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M, Zabeau M (1995). AFLP: a new technique for DNA fingerprinting. Nucleic. Acids. Res. 23: 44074414. Zheng ZP, Cheng KW, Chao J, Wu J, Wang M (2008). Tyrosinase inhibitors from paper mulberry (Broussonetia papyrifera). Food Chem. 106: 529-535.

Full Length Research Paper

Simple sequence repeat (SSR) markers analysis of genetic diversity among Brassica napus inbred lines based on correlation between seed quality traits and seed pigments content Cunmin Qu1,2#, Fuyou Fu3#, Liezhao Liu1,3, Kun Lu1,2, Jieheng Huang1,2, Xiaolan Liu1,2, Jingmei Xie1,2, Li Chen1, Rui Wang1,2, Zhanglin Tang1,2 and Jiana Li1,2* 1

Chongqing Engineering Research Center for Rapeseed, College of Agronomy and Biotechnology, Southwest University, 216 Tiansheng Road, Beibei, Chongqing 400716, People’s Republic of China. 2 Engineering Research Center of South Upland Agriculture of Ministry of Education, Southwest University, Beibei, Chongqing 400716, People's Republic of China 2 Plant Gene Resources of Canada, Agriculture and Agri-Food Canada, Saskatoon SK, S7N 0X2 Canada. Accepted 22 March, 2012

Information regarding diversity and relationships among different quality traits and seed coat characterization of breeding material is necessary for hybrid Brassica napus breeding and seed coat color selecting. Simple-sequence repeat (SSR) analysis of the 62 loci distributed uniformly throughout the Brassica napus genome was carried out for 90 inbred lines which were derived from the blackseeded coat and the yellow-seeded coat parents in order to assess genetic diversity among the inbred lines and correlation to different traits with seed coat and seed pigment. The average-linkage (UPGMA) cluster analysis yellow-seeded coat lines and black-seeded coat lines were divided in two major groups; SSR clustering analysis results is linkage with the traits clustering analysis results. The correlation studies showed that seed coat color, anthocyanidin content, total phenol content, melanin content and flavonoid content in seed coat had significant negative correlation with oil content in different environments. The anthocyanidin content, flavonoid content, total phenol content and melanin content had significant positive correlation in seed coat. The results indicate that SSR analysis is effective for the assessment of genetic diversity among Brassica napus inbred lines and seed coat color is one of the most important traits to breeding of B. napus quality improvement. Keywords: Brassica napus L, quality traits, agronomic traits, correlation analysis. INTRODUCTION Brassica napus L. is the predominant rapeseed species grown worldwide. Improvements in the yield as well as in

*Corresponding author. E-mail: ljn1950@swu.edu.cn. Tel: +8623-68251950. Fax: +86-23-68251950. Abbreviations: SSR, Simple-sequence repeat; UPGMA, unweighted pair group method with arithmetic mean; AFLP, amplified fragment length polymorphism; RAPD, random amplification polymorphic DNA. # Co first authors.

the quality of oil and meal of rapeseed are two important objectives for rapeseed breeders (Liu, 1985). The successful development of B. napus L. cultivars with low erucic acid in the oil and low glucosinolate content in the meal has made rapeseed a valuable source of high quality oil for people and nutritional protein for live-stock (Qiu et al., 2006). Previous studies have demonstrated that yellow seeds have a thinner seed coat than black seeds in the same genetic background. In the other hand, thinner seed coat has been associated with higher oil content in the seed and higher protein and lower fiber contents in the meal (Xiao and Liu, 1982; Shirzadegan and Robbelen, 1985; Rashid and Rakow, 1995). Other

Qu et al.

research has demonstrated that the toxic substances were concentrated in the seed coat during the maturation (Yuan et al., 2003). Therefore, the quality of rapeseed oil may be greatly affected by seed coat pigments, most of which are fat-soluble and remain in the rapeseed oil. As genetic linkage maps in B. napus L. have become available, some major quantitative trait locus (QTL) of seed coat color and linked markers were found in recent years. Xiao et al. (2007) identified four amplified fragment length polymorphism (AFLP) markers linked to seed coat color in B. napus L. Somers et al. (2001) reported that in B. napus L. a single major gene (pigment 1) and 2 minor genes controlled seed color and that these genes were flanked by 8, 1, and 2 random amplification polymorphic DNA (RAPD) markers, respectively. Liu et al. (2005) found that AFLP and RAPD markers were linked to the Y gene in a DH population with the yellow-seeded parent line, No.2127-17. Badani et al. (2006) and Fu et al. (2007) reported 3 and 19 QTLs for seed colour in different populations. In comparison with other molecular marker techniques, simple-sequence repeat (SSR) markers are numerous, highly polymorphic and informative, codominant, technically simple, reproducible, and relatively inexpensive when primer information is available. Furthermore, SSR markers often occur in gene-rich genome regions, increasing their potential relevance for allele-trait association studies in well-characterized genome regions containing quantitative trait loci. SSR markers have been widely used in diversity studies in maize, rice and tomatoes (Reif et al., 2006; Vigouroux et al., 2005; Warburton et al., 2005; Olsen et al., 2006; Caicedo et al., 2007; Bredemeijer et al., 2002). It has been proved that SSR markers are useful for genetic diversity and structure studies of Brassica. Fu and Gugel (2010) studied the genetic diversity of 300 plants by employing 22 SSR primer pairs from eight linkage groups, detecting 88 polymorphic loci. The genetic diversity in Austalian canola cultivars were analyzed by using 18 SSR primer pairs and finding 112 polymorphic loci (Wang et al., 2009). By using 15 SSR markers with known locations on the Brassica A, B, and C genomes, Pradhan et al. (2011) assessed genetic diversity of 180 Brassica nigra (L.) Koch genotypes from 60 different accessions. Soengas et al. (2011) establish the genetic relationship among eight populations and studied the genetic structure by analyzing the polymorphic alleles of 18 SSR markers. The objectives of this study were to use a set of SSR markers to detect DNA polymorphism and analyzed the relationship of quality traits among B. napus RILs familly. It will provide useful information for Brassica breeding program and improving the seed meal in the future. MATERIALS AND METHODS Plant materials A total of 90 inbred lines were analyzed in this study. They were

8203

derived from a cross between black-seeded male parent cultivar Zhongyou 821 and yellow-seeded female parent line GH06, including 45 yellow-seeded lines and 45 black-seeded lines. In 2006 and 2007, they were simultaneously grown at Beibei and Wanzhou in Chongqing. Although Beibei and Wanzhou are at almost the same latitude, the altitude of Wanzhou is about 700 m higher than that of Beibei. Each plot contained 3 rows with 15 plants per row. Field management essentially followed the normal agronomic procedures in the region. Seeds were harvested from self-pollinated plants for analysis.

Measurements for the seed coat color, and content of oil and protein in the seeds Self seeds of all RILs were used to estimate the seed color (SC) and yellow seeded degree (YSD) following the methods described by Fu et al. (2007). The seed oil content and protein content in the seeds of RILs were measured by near infra-red reflectance spectroscopy (NIRS 5000; Denmark), in small circular cups in three parallel replications using the software WinISI II, vers. 1.50 at wave length range of 1100 to 2498 nm. All the spectra were computed at 8 cm−1 resolution between 4000 and 11 000 cm−1 with the scanning of 64 and expressed as percentage of oil or protein on total seed weight (%).

Measurement for the seed coat pigments 0.2 g seed coat was laid into a 10 ml polypropylene centrifuge tube, and then 5 ml methanolic HCl (95% methanol, 5% concentrated HCl) was added followed by an hour incubation at 80°C (supplying the solvent to maintain the stable volume). After centrifugation at 8228 G for 6 min, the supernatant was decanted and another 5 ml of methanolic HCl were added to the residue. Absorbance at 600, 530, 325 and 280 nm were recorded in the total supernatant. The anthocyanidin content was calculated as △530 - 600 nm = 0.1 and the flavonoid content was calculated as A325 nm g-1 (Pirie and Mullins, 1976). The total phenol content was calculated by gallic acid to make a standard curve (concentration range of 10 to 100 μg) (Yan et al., 1998). Two milliter (2 ml) 2% NaOH were added to the residue as explained above, and incubated at 80°C. The supernatant was decanted and another 5 ml of 2% NaOH was added to the residue. Total supernatant was measured at absorbance of 290 nm, and the melanin content was calculated by A290 nm g-1 (Zhou et al., 1997). Though the seed coat pigments were extracted, the residue of seed coat after drying should be white.

DNA extraction and SSR assays Leaves from 3 to 5 seedlings for each accession were pooled together for DNA isolation. Genomic DNA was extracted according to the protocol of Doyle and Doyle (1990). The concentration and purity of each DNA sample was measured using a GeneSpecⅠ spectrophotometer at wave-lengths of 260 and 280 nm, quantified by visual comparison to λ DNA standards on ethidium bromidestained agarose gels. We chose 100 SSR primers from the available literatures (Lowe et al., 2003; Piquemal et al., 2005; Rahman et al., 2007; Choi et al., 2007; Long et al., 2008; Cheng et al., 2009), and assayed their preliminary discriminatory power using the two parents. Sixty-two SSR markers were selected to analyze the genetic diversity according to their polymorphism (Table 2). All primers were synthesized by Shanghai Sangon Biological Engineering Service Co. Ltd. (China) and listed in Table 2. PCR reactions were

8204

Afr. J. Biotechnol.

performed in 96-well plates with a volume of 10 μL. The composition of the mixture include the following: 20 ng/μl of DNA template, 0.5 pmol of each primer, 0.2 mM dNTP mix, 1 mM MgCl2, 10×PCR reaction buffer (with 15 mM MgCl2, TransGen Biotech) and 0.5 unit of Taq DNA polymerase (TransGen Biotech). PCR was carried out in PTC-100 and PTC-200 thermo cycler with the following program: 94°C for 4 min; 35 cycles with 94°C denaturation, 55°C annealing, 72°C elongation, which slightly modified those reported by Piquemal et al. (2005). All PCR products were detected using non-denaturing polyacrylamide gel electrophoresis (10% polyacrylamide) and silver staining (Zhang et al., 2002).

Data analysis The PCR product by SSR primer pairs were scored based on their fragment size with comparing the fragment sizes reported in the literature (Piquemal et al., 2005; Long et al., 2008; Cheng et al., 2009; Choi et al., 2007; Lowe et al., 2003). Subsequently they were converted to a binary format matrix through coding as either present (1) or absent (0). We estimated genetic diversity (D) for each SSR locus using the formulas: Di =n (1−ΣPij2)/n−1, where n is the number of accessions analyzed, and Pij the frequency of the jth allele for the ith locus across all alleles at loci. Average marker diversity (D) was estimated as D = ΣDi/r, where r was the number of loci analyzed. To see the relationship between the different RILs, we estimated the genetic similarity according to Jaccard coefficients from the alleles across all the loci in the 90 accessions using the formula: J = Nij/ (N−N00), where Nij was the number of shared alleles in both accessions i and j, N was the number of all alleles across all accessions investigated and the N00 was the number of alleles present neither in line i nor in line j. To see the relationship between lines, a dendrogram based on similarity coefficients was constructed with the unweighted pair-group method using the arithmetic averages (UPGMA; Sneath and Sokal, 1973). The estimation of genetic diversity and the cluster analysis was performed using NTSYS-pc software package Version 2.2 (Rohlf, 2005). The mean of seed quality traits and seed coat pigments were calculated by the Microsoft office EXCEL. The Pearson correlation coefficient (r) and propability-value (p) were used to show correlation and their significance by using the software SPSS 13.0 in the present experiment. A probability value of p < 0.05 was considered statistically significant.

RESULTS Quality traits analysis The quality traits and seed coat pigments had significant differences between yellow-seeded female parent line GH06 and black-seeded male parent cultivar Zhongyou 821 (Table 1). Moreover, yellow seeds had significantly higher oil content but lower seed coat pigments than black seeds in different environments. The difference between the two parents was significant at a level of P < 0.01. The ninety B. napus L. RILs were classified into eight groups according to the k-means cluster analysis based on seed quality characters. There were significant differences among different groups (P< 0.01). The characteristics of each group were as follows; group 1: yellow seed with high oil and protein content, group 2:

yellow seed with low oil and high protein content, group 3: yellow seed with high oil and low protein content, group 4: yellow seed with low oil and protein content, group 5 to 8 had black seeds with the same quality traits as group 1 to 4, respectively. Correlation of quality traits in Beibei and Wanzhou in 2006 and 2007 The correlations of quality traits were analyzed in four different environments (Tables 3 and 4). The results show that the protein content and seed coat pigments had significant negative correlation with oil content, except the AC of seed coat pigments in 2006/Beibei (Tables 3 and 4). Moreover, the seed coat pigments were also significantly negatively correlated with seed coat colour in 2006/Beibei, 2006/Wanzhou and 2007/Beibei, respectively (Tables 3 and 4). However, the oil content had significant positive correlation with seed coat color in 2006/Beibei, 2006/Wanzhou and 2007/Beibei [0.41(P < 0.01), 0.37(P < 0.01) and 0.27(P < 0.01) respectively] (Tables 3 and 4). The protein content was significantly positively correlated with seed coat color [0.38(P < 0.01)], and significantly negatively correlated with seed coat pigments in 2007/Beibei (Table 3). In the seed coat, there is a significant positive correlation among the seed coat pigments, such as anthocyanidin content, flavonoid content, total phenol content and melanin content, except the anthocyanidin content in 2006/Beibei (Tables 3 and 4). Relationship among Brassica napus L inbred lines Forty eight markers had been mapped on the linkage groups according to previous researches in B. napus. L. (Lowe et al., 2003; Piquemal et al., 2005; Rahman et al., 2007; Choi et al., 2007; Long et al., 2008; Cheng et al., 2009), and some primers were also unknown. Sixty two primers produced 249 alleles in the 90 lines, and the allele number for the SSR loci ranged from 2 to 7 with a mean value of 4.0 (Table 2). Genetic similarities among accessions were estimated based on the Jaccard’s similarity. A UPGMA dendrogram was constructed for the two parents and the 90 RILs (Figure 1) unveiling two main groups. The yellow-seeded lines and black-seeded lines could be distinguished and the accessions in a given group have closer relationships. Group A included 46 inbred lines which were 44 yellowseeded lines and 2 black-seeded lines (Figure 1). This cluster was subdivided into three subclusters. The yellowseeded female parent line GH06 was classified into subcluster I. There were only two black-seeded lines (G6E434B and G7E462B) in the subclusters II. The other included only yellow-seeded lines. In group B, there were 46 inbred lines (Figure 1), including 2 yellow-seeded lines (G3E323Y and

Qu et al.

8205

Table 1. Phenotypic analysis of the seed oil content, seed protein content, seed coat color and seed coat pigments in two different environments for the RIL and parents of B. napus

Year

Trait Oil content Protein content Seed coat colour (YSD)

2006 Seed coat pigments

AC FC TPC MC

Oil content Protein content Seed coat colour (YSD) 2007 Seed coat pigments

AC FC TPC MC

Zhongyou 821 Mean 34.49/43.14 28.57/22.07 29.31/30.94

GH 06 Mean 37.2**/44.2** 28.48**/21.97** 86.42**/87.84**

Mean 38.5/44.67 26.52/22.03 67.65/64.84

Locations (Beibei / Wanzhou) F2:7 family populations B. napus lines Max Min SD CV 43.94/54.72 31.79/32.53 2.52/3.63 6.33/13.18 30.59/27.58 21.60/16.86 1.60/2.56 2.56/6.55 90.40/87.55 32.79/33.32 17.3/15.53 299.38/241.04

2.40/1.92 1.26/1.02 19.52/15.84 6.52/4.41

1.45**/1.07** 0.58**/0.47** 8.22**/8.42** 1.1**/1.02**

1.41/1.42 0.74/0.78 11.04/12.16 2.84/2.63

3.46/2.80 1.69/1.60 24.69/26.02 8.09/7.03

1.01/1.00 0.19/0.11 3.76/1.72 0.75/0.52

0.49/0.42 0.29/0.3 4.02/4.09 2.04/1.64

0.24/0.18 0.08/0.09 16.12/16.76 4.14/2.68

35.49/42.14 28.15/23.17 83.83/—

38.5**/43.9** 27.98**/22.88** 144.81**/—

37.41/42.68 28.07/24.99 104.05/—

44.01/47.46 31.67/29.47 159.8/—

31.37/35.34 22.58/21.28 43.92/—

2.47/2.51 1.32/1.33 25.01/—

0.06/0.06 0.05/0.05 0.24/—

26.05/18.64 60.63/48 80.71/49.17 329.3/204.14

3.47**/0.44** 34.43**/26.42** 46.57**/30.44** 67.88**/81.36**

7.94/7.74 40.13/36.34 42.63/37.07 160.15/179.56

32.89/34.48 72.24/65.68 88.74/61.22 431.82/466.45

0.79/0.27 20.92/18.83 27.73/20.9 69.65/69.45

8.49/8.65 13.22/12 2.28/10.12 92.33/104.16

1.07/1.12 0.33/0.33 0.1/0.27 0.58/0.58

Skewness -0.16/-0.02 -0.13/0.08 -0.49/-0.39

Kurtosis -0.27/0.16 -0.02/-0.78 -1.23/-1.14

1.24/0.95

0.92/-0.08

0.93/0.84 0.98/0.91 0.87/0.81

-0.07/-0.05 0.07/0.94 -0.7/-0.28

0.02/-0.42 -0.8/-0.31 -0.21/—

-0.26/-0.14 -2.56/1.59 -1.04/—

1.23/1.11

0.44/0.4

0.65/0.45 0.1/0.48 1.44/0.71

-0.55/-0.85 -0.44/-0.74 2.65/-0.79

AC, Anthocyanidin content; FC, flavoid content; TPC, total phenol content; MC, melanin content; YSD, yellow seeded degree. **Ssignificant at P<0.01.

G1E322Y) and 44 black-seeded lines. The blackseeded male cultivar Zhongyou 821 was classified into subcluster I. The yellow-seeded lines were classified into different subcluster. DISCUSSION In the past, great efforts have been made to better understand the seed coat color, quality traits and yield, and numerous genetic resources of B. napus L. were developed. There are many genetic variations in genetic origins, oil content, and protein content, seed coat color and seed pigment compositions and components (Zhang et al.,

2003). In this study, SSR markers revealed polymorphism in a RILs family. The distribution for the yellow-seeded and black-seeded lines in three clusters agreed fairly well with their pedigrees. The results indicate that SSR markers are effective and useful for analyzing the genetic diversity of B. napus genetic resources. Many other authors have also reached similar conclusions on the use of SSR markers in the breeding of rapeseed (Ahmad et al., 2011; Ana et al., 2011; Cruz et al., 2007; Li et al., 2011; Hasan et al., 2006; Tommasini et al., 2003). In recent years, developing yellow-seeded B. napus L. cultivars increased output and oil content remained an important objective of oilseed rape

breeding. Several lines of yellow-seed B. napus L. were bred by breeders in many areas (Hu et al., 1988; Wang and Liu, 1991, 1996; Chen and Liu, 1994). Despite numerous successes in modifying the genetic mechanism of the quality traits of B. napus L., enhancing the seed quality traits has proven to be more difficult. A previous study revealed that yellow seeds have thinner seed coats, higher oil contents, and higher protein and lower ﬁbre contents in the meal than black seeds with the same genetic background (Xiao and Liu, 1982). It showed that the quality of rapeseed oil and oilseed residues are greatly affected by seed coat. Some experiments indicated that the inheritance of oil content was controlled by an

8206

Afr. J. Biotechnol.

Table 2. SSR primers used for the genetic diversity analysis.

SSR-primer Au14 Au39 Au8 BN35D BnGMS351 BnGMS417 CB10196 CB10199 CB10504 CN1 CN17 CN35 CN52 CN53 CN57 CN62 CN67 CN71 CN78 CN79 cnu_ssr063 cnu_ssr076 cnu_ssr149 cnu_ssr167 cnu_ssr223 cnu_ssr235 cnu_ssr257 cnu_ssr269 cnu_ssr288 cnu_ssr343 cnu_ssr361 cnu_ssr370 cnu_ssr398 cnu_ssr409 EJU1

Linkage group Unkown Unkown N13 N1/N11 N9 N3 N4 N4 N18 N1/N11 N13 N2/N12 N5/N14 N5 N6 N7 N7 N8 N9/N18 N9/N18 N7 N9 N6 N7 N3 N1 N5 Unkown N3 Unkown Unkown N3 Unkown Unkown N9

Number of allele 3 2 6 7 4 3 4 2 3 2 6 6 2 4 5 3 4 4 6 5 3 3 7 4 6 3 3 4 6 3 2 4 4 2 4

Number of polymorphism 1 1 2 4 1 2 1 1 2 1 2 2 1 2 4 1 2 2 5 3 2 1 2 2 2 2 2 2 3 1 1 2 1 1 2

Sequence

Source

Unkown Unkown Unkown GCAGAAGGAGGAGAAGAGTTGG ATACTCGTTATGGCGAGAGA AATGGAACGACTCAACATAGT TTGTAGGCAATGATGAGGA CTCATCATATTCGGCGAC GGTGTCCCAACTGTTGAA TGGTTGGTGCAGACTTACGA CACCATCACCACCTTCACAA CGACAGAGGGTTCAAATGGT CCGGCTTGGTTCGATACTTA CACCGAACAAAACTGAGGGT CACACCCTTACCACGTTCCT AGGAAGCCCAACAGGACTTT CAGATTCGGATTTGGGAAGA CAGATGAGACAACACAGGAAACA AGTCGGGCTCGTATATCTCG TCAGTCACAAAAAGTCAACTCAAA GAGAGAAGAAGAAGAAGGAAGCAGAA GCCTGCACTAAAATAGCTGCAAA GGAAGCCTCTGTGCGAAAAA CGAGTTTGGACCCTCGATATG ACCCGAAAAGAGAATATGGCCT CAACCACATGAGATTGGTTTAGTT TGCATGATGTTCATGTCTTGTAAA GTCCATCTCCTACCTGCTCCA GCGTTTCGTCCTCTTCTCAC TGGATGATTTCGTCGTCTGG TTCTGCACATGAGAGCACAAGA CAAATCGGGCATTGTTCCAT TGACATTCGCATCAGATTTGT TTCCGGTCACTTCTAGCTTCA GGTGAAAGAGGAAGATTGGT

Long et al., 2008 Long et al., 2008 Long et al., 2008 Et al., 2008; Cheng et al., 2009 Cheng et al., 2009 Cheng et al., 2009 Piquemal et al., 2005 Piquemal et al., 2005 Piquemal et al., 2005 Long et al., 2008 Long et al., 2008 Long et al., 2008 Long et al., 2008 Long et al., 2008

TTGAGCCGTAAAGTTGTCACCT TGGTCAAATTCTTGAACATT GGATCGACTCAAAGTCACAT GAGAGAAGGGCTCCTTTG GCTTGAGTTTCCATGGTG CATTGGCATAGGAACAGG TTTCCCGAATCCTCAGATTG TGGTTCACTCATGTCTCCGA CGGTGTGTAGGTCTGCTCAA TTGCGAATCTTTAAGGGACG CGTTTCACTGCGTTCTACCA GCAACAAAGCATACTTCGCA AATTCGATTCTCCATCGTGC GGCGGAAGAATCAAAGGAGT ACTCAATACGTTTTTCGCGG GTTTCGTGGCGGAAATTAGA ACGGAGTAGGAGTTGGGAGG GATCTCGCGTGTGGCAACT GAATGGAAGGCGTCGATCAT TGCCGACGATTTGATAGAGGA AGCCCAAGGTTTACGGTGGT ACAGTGGCGTTAGGTGGGG GAAATGGTTTTGGAGCGGTA TCCTTCTGTAAACCGGTTGTAATTT GTTTTGAGCCGAATAATGGTTG TTACCCACCTTGGCTTCATC TGAAAGCCAAAACTAATAAAAGTCACA TCGATAAAAGAAACTCAAATGACTGC CAATCAAGGAAAAATCTGTACCAATC TTGGGCTTCACGCATAAGAT TTTTGGTGGTTAGTATGTCGCTAT AGGAGATACAGTTGAAGGGTC

Long et al., 2008 Long et al., 2008 Long et al., 2008 Long et al., 2008 Long et al., 2008 Long et al., 2008 Cheng et al 2009 Long et al., 2008 Long et al., 2008 Cheng et al., 2009 Long et al., 2008 Long et al., 2008 Long et al., 2008

Long et al., 2008 Long et al., 2008 Choi et al., 2007

Qu et al.

8207

Table 2. Contd.

EJU2 EJU4 ENA10 ENA14 ENA22 ENA23 ENA27 ENA6 ES-b09-1 GOL2 GOL3 MR119 MR47MR32 niab_ssr106 niab_ssr003 niab_ssr013 niab_ssr022 niab_ssr037 niab_ssr046 niab_ssr082 niab_ssr090 niab_ssr091 niab_ssr097 niab_ssr120 Ra2-A01 SA29 SA63

N9 N8 N5 N7 N9 N2,N3 N9 N7 N6 N5 N8 N5 SCAR

N5 N19 N6 Unkown Unkown N8 N1,N11 Unkown Unkown N7 N3 N1

2 5 3 5 4 4 3 2 6 4 3 5 4 2 3 5 8 6 5 3 4 3 4 2 4 4 7

1 3 2 2 3 1 1 2 4 1 2 4 1 1 2 4 5 2 2 1 2 1 2 1 2 1 5

additive-dominant genetic model and that is controlled by maternal genes instead of embryo genes (Liu et al., 1990; Steffansson et al., 1961; Zhang et al., 1996). Previous studies also showed the importance of environment and genotype x environment effects in the expression of oil content (Pritchard et al., 2000; Si et al., 2003). Other studies also showed that the protein had a significant negative correlation with the seed total

TTCACATCTTCTTCATCTTCC CACCTTATCATCTCTCTATCCC ATCGTCTCCTCTCATCTCAA CTTACGGTGGAAATGCTG TTTGTAGACGAACAGCCACG GCTGTGCCAGTTCCTCTTTC AAAGGACAAAGAGGAAGGGC CTCGTCTTCTTCACCTACAAC

TTGCTATTCGTTCTCAGTCTC CCTCTGTTTCTCTCCTTGTG ATTACATCCTCCACCTTCTTC TCGCTGGTGCTAAACTTG AGAATCGCATTTGATGGAGG TCATTCCAAATGGCCTTACC TTGAAATCAAATGAGAGTGACG CTGACATCTTTCTCACCCAC

AGACATCCCACATCGGCTAC ACTCACTTTTGTTGGGCGTC GCTGAAACGCGTAGAGACTAA TGAACTGTGGAAGCCAAGC GTCTCAAGCCAACATCCATC TGTGTCGCTCGTCTACGTCT GGAACCGTCCTTACTTTCTCTGT CTCTCGTCTCGGAGGATCTAAA GCGGTTAATAGGTTCCGGTT AACCATTGATCACAAAATTTTCAA CATTTCCCCGTGACTATCTG GCTGATTTCTCCGCTATCAC TGGTTCTGCTATTGCTGTCA TTCTTTGGAGATGGTGTGGT AAGAAAACTTATTTGATGGTACG TTCAAAGGATAAGGGCATCG TTGTTGTTGCGCTTTCTGTC AGCCGTGTAGCACCAGAACT

GACCCAAGACCCAAGACTCA GGAGCCGCTTTCTCTACCTT GCTGGGAAATACGTTGAAA TCACCACTACGCGGTAACTG AACGGAACCATAAGGAGACC ACCATCGACTTCGTGGAAAC AGGATTGTGTTTTCCACATTGTC GTGAGAGTGGTTGCTGAGTGAG CCAATTGCATCGATCTGTCA CCGTGGGCCTTTATCTTGTA CGTCTTCATCTCAATCTCGC AAGACACCGTTTGTGAATTT GAAGTTTGTGAGCCAGGAAA CAATCTTGTGGTGAGGGAAG CTAAATCCAAACCAGAATTGA TCTTCTTCTTTTGTTGTCTTCCG AATTGCGACCCAAGTAGGTG CGTGTAGTGTGCGCATCTTT

oil content (Sugimoto et al., 1989, 1992; Vazquez et al., 1993; Si et al., 2003). There were some research reports on the basic properties of protein and accumulation of storage protein subunits (Hoglund et al., 1992). Other studies indicate that the oil content in F1 is affected by genes of both maternal and embryo (Fu, 2004) but in F2 is mainly controlled by the gene effects of the individual itself (Liu et al., 1990; Lickfett et al.,

Choi et al., 2007 Choi et al., 2007 Choi et al., 2007 Choi et al., 2007 Choi et al., 2007 Choi et al., 2007 Choi et al., 2007 Choi et al., 2007 Long et al., 2008 Choi et al., 2007 Choi et al., 2007 Long et al., 2008 Rahman et al., 2007

Long et al., 2008 Long et al., 2008 Long et al., 2008

Long et al., 2008 Cheng et al., 2009

Lowe et al., 2003 Long et al., 2008

1999). In this study, correlation analysis was carried out among the quality traits of a RILS family in B. napus L. The results show that protein content and seed coat pigments had significant negative correlation with the oil content in different environments. This is in accordance with the results of previous researches (Sugimoto et al., 1989; Zhao et al., 2006) which show that the protein content had a significant negative

8208

Afr. J. Biotechnol.

Table 3. Correlation coefficient among all traits of F2:7 family populations in Beibei, in 2006 and 2007.

Year

Trait Oil content Protein content Seed color

2006 Seed coat Pigments

AC FC TPC MC

Oil content Protein content Seed color 2007 Seed coat Pigments

AC FC TPC MC

Oil content 1 -0.71** 0.41**

Protein content 1 0.08

-0.01 -0.30** -0.32** -0.30**

-0.09 -0.03 -0.01 -0.10

-0.04** -0.67** -0.66** -0.80**

1 -0.44** 0.27**

1 0.38**

-0.42** -0.36** -0.36** -0.46**

-0.32** -0.27** -0.31** -0.32**

-0.66** -0.64** -0.65** -0.68**

Seed colour

Seed coat pigment FC TPC

1 -0.05 -0.06 -0.01

1 0.96** 0.86**

1 0.86**

1 0.81** 0.80** 0.94**

1 0.88** 0.85**

1 0.84**

AC, Anthocyanidin content; FC, flavoid content; TPC, total phenol content; MC, melanin content; *, **: significant at P<0.05 and P<0.01, respectively.

Table 4. Correlation coefficient among all traits of F2:7 family populations in Wanzhou, in 2006 and 2007.

Year

Trait Oil content Protein content Seed color

2006 Seed coat Pigments

AC FC TPC MC

Oil content Protein content Seed color

Oil Content 1 -0.77** 0.37**

Protein content

Seed color

1 0.02

-0.23 -0.22** -0.24** ** -0.21

-0.05 -0.03 -0.02 -0.10

-0.67 -0.63** -0.56** ** -0.73

1 ** -0.37 -

1 -

-0.56** -0.46** -0.32** ** -0.57

-0.07 -0.11 -0.18* -0.11

Seed coat pigment AC FC TPC

1 0.88** 0.86** ** 0.82

1 0.88** ** 0.75

1 ** 0.76

1 0.82** 0.54** ** 0.93

1 0.73** ** 0.87

1 ** 0.64

2007 Seed coat pigments

AC FC TPC MC

AC, Anthocyanidin content; FC, flavoid content; TPC, total phenol content; MC, melanin content; *, **: significant at P<0.05 and P<0.01, respectively.

correlation with the oil content. Different fieldsâ&#x20AC;&#x2122; environments have no influence on the trade-off of oil content and protein content. Whereas, there is significant negative correlation between the seed color and seed coat pigments in different environments in two years. The

results show that seed coat pigments were involved in the seed coat color. So we can change the seed pigment components to arrive at the objectives of high oil content and protein content in B. napus L. In our study, we used SSR markers to assess the

Qu et al.

Figure 1. Relationship between 90 RILs of B. napus as revealed by hierarchical cluster analysis of SSR based genetic distance estimates; prefixes G1, G2, G3, â&#x20AC;Ś, G4 in genotype designations indicate the group membership of genotypes according to the k-means cluster analysis. Red color indicates the yellow-seeded lines and black color indicates the black-seeded lines.

8209

8210

Afr. J. Biotechnol.

genetic diversity, genetic structure and genetic relationship in a B. napus L. RILs familly. The correlation of seed coat colour, the oil content, protein content and seed pigment components in different environments were also analyzed. The grouping of 90 inbred lines by cluster analysis was generally consistent with known pedigrees. SSR marker information described in this work provides a useful starting point for structure-based association analyses of phenotypic traits in B. napus. The results of correlations between seed coat pigment content and seed coat colour, oil content, and protein content provided definitive information on different seed coat color germplasm characterization of B. napus RILs family. These results can give us more clues in the improving quality traits of rapeseed. In addition, the information of markers could be applied in association mapping analyses of quality traits or marker-assisted selection of yellow-seeded in B. napus.

ACKNOWLEDGEMENTS This work was supported by the National High Technology Research and Development (“863”) Programs of China (2011AA10A104), and Department of Agriculture projects of modern agricultural technology system (CARS-13), the Fundamental Research Funds for the Central Universities (XDJK2009C183), Science and Technology Innovation Fund of Southwest University (ky2009007). REFERENCES Ahmad M, Khan MW, Abbas SJ, Swati ZA (2011). Characterization of Brassica napus Germplasm Based on Molecular Markers. Afr. J. Biotechnol. 10: 3035-3039. Ana MJ, Ankica KS, Dejana SP, Radovan M, Nikola H (2011). Phenotypic and molecular evaluation of genetic diversity of rapeseed (Brassica napus L.) genotypes. Afr. J. Biotechnol. 8(19): 4835-4844. Badani AG, Snowdon RJ, Wittkop B, Lipsa FD, Baetzel R, Horn R, De Haro A, Font R, Lühs W, Friedt W (2006). Colocalization of a partially dominant gene for yellow seed colour with a major QTL influencing acid detergent fibre (ADF) content in different crosses of oilseed rape(Brassica napus). Genome, 49: 1499-1509. Bredemeijer GMM, Cooke RJ, Ganal MW, Peeters R, Isaac P, Noordijk Y, Rendell S, Jackson J, Röder M, Wendehake K, Dijcks M, Amelaine M, Wickaert V, Bertrand L, Vosman B (2002). Construction and testing of a microsatellite database containing more than 500 tomato varieties. Theor. Appl. Genet. 105: 1019-1026. Caicedo AS. Williamson RD, Hernandez A, Boyko A, Fledel-Alon A, York TL, Polato NR, Olsen KM, Nielsen R, McCouch SR, Bustamante CD, Purugganan MD (2007). Genome-wide patterns of nucleotide polymorphism in domesticated rice. PLoS Genet. 3: 1745-1756. Chen YP, Liu HL (1994). Dynamics of seedcoat pigments in development a stage in Brassica napus L. Chin. J. Oil Crop Sci. 16(4): 13-16. Cheng XM, Xu JS, Xia S, Gu JX, Yang Y, Fu J, Qian XJ, Zhang SC, Wu JS, Liu KD (2009). Development and genetic mapping of microsatellite markers from genome survey sequences in Brassica napus. Theor. Appl. Genet. 118: 1121-1131. Choi SR, Teakle GR, Prikshit P, Kim JH, Allender CJ, Beynon E, Piao ZY, Soengas P, Han TH, King GJ, Barker GC, Hand P, Lydiate DJ, Batley J, Edwards D, Koo DH, Bang JW, Park B-S, Lim YP (2007).

The reference genetic linkage map for the multinational Brassica rapa genome sequencing project. Theor. Appl. Genet. 115: 777-792. Cruz VMV, Luhman R, Marek LF, Rife CL, Shoemaker RC, Brummer EC, Gardner CAC (2007). Characterization of flowering time and SSR marker analysis of spring and winter type Brassica napus L. germplasm. Euphytica, 153: 43-57. Doyle JJ, Doyle JL (1990). Isolation of plant DNA from fresh tissue. Focus, 12: 3-15. Fu TD (2004). The present and future of rapeseed quality improvement. J. Huazhong Agric. Univ. 34: 1-4. Fu FY, Liu LZ, Chai YR, Chen L, Yang T, Jin MY, Ma AF, Yan XY, Zhang ZS, Li JN (2007). Localization of QTLs for seed color using recombinant inbred lines of Brassica napus in different environments. Genome, 50: 840-854. Fu YB, Gugel RK (2010). Genetic diversity of Canadian elite summer rape (Brassica napus L.) cultivars from the pre- to post-canola quality era. Can. J. Plant Sci. 90: 23-33. Hasan M, Seyis F, Badani AG, Pons-Kuhnemann J, Friedt W, Luhsand W, Snowdon RJ (2006). Analysis of genetic diversity in the Brassica napus L. gene pool using SSR markers. Genet. Resour. Crop. Evol. 53: 793-802. Höglund AS, Rödin J, Lenman M, Rask L (1992). Distribution of napin and cruciferin in developing rapeseed embryos. Plant Physical 98: 509-515. Hu XJ (1988). Studies on the relationship between seed-coat colour and pigment content in different types of rapeseed cultivars. Cruciferae Newsletter, 13: 43-47. Li L, Wanapu C, Huang X, Huang T, Li Q, Peng Y, Huang G (2011). Comparison of AFLP and SSR for Genetic Diversity Analysis of Brassica napus Hybrids. Agric. Sci. China, 3: 101-110. Lickfett T, Matthaus B, Velasco L, Mollers C (1999). Seed yield oil and phytate concentration in the seeds of two oilseed rape cultivars as affected by different phosphorus supply. Eur. J. Agron. 11: 293-299. Liu HL (1985). Inheritance and breeding on rapeseed. Shanghai: Sci. Technol. Press of Shanghai. Liu DF, Liu HL (1990). Gene effects on component of fatty acid Brassica napus L. Acta Agronomica Sinca. 16(3): 193-199 Liu Z, Fu TD, Tu JX, Chen BY (2005). Inheritance of seed color and identification of RAPD and AFLP markers linked to the seed color gene in rapeseed (Brassica napus L.). Theor. Appl. Genet. 110: 303310. Long Y, Shi J, Qiu D, Li R, Zhang C, Wang J, Hou J, Zhao J, Shi L, Park B-S, Choi SR, Lim YP, Meng J (2007). Flowering time quantitative trait loci analysis of oilseed Brassica in multiple environments and genomewide alignment with Arabidopsis. Genetic, 177: 2433-2444. Lowe AJ, Jones AE, Raybould AF, Trick M, Moule CL, Edwards KJ (2002). Transfer ability and genome speciﬁcity of a new set of microsatellite primers among Brassica species of the Utriangle. Mol. Ecol. Notes, 2: 7-11. Olsen KM, Caicedo AL, Polato N, McClung A, McCouch S, Purugganan MD (2006). Selection under domestication: evidence for a sweep in the rice Waxy genomic region. Genetic, 173: 975-983. Piquemal J, Cinquin E, Couton F, Rondeau C, Seignoret E, Doucet I, Perret D, Villeger MJ, Vincourt P, Blanchard P (2005). Construction of an oilseed rape (Brassica napus L.) genetic map with SSR markers. Theor. Appl. Genet. 111: 1514-1523. Pirie A, Mullins MG (1976). Changes in anthocyanin and phenolics content of grapevine leaf and fiuit tissue treated with sucrose, nitrate and abscisic acid. Plant Physiol. 58: 468-472. Pradhan A, Nelson MN, Plummer JA, Cowling WA, Yan G (2011). Characterization of Brassica nigra collections using simple sequence repeat markers reveals distinct groups associated with geographical location, and frequent mislabelling of species identity. Genome, 54: 50-63. Pritchard FM, Eagles HA, Norton RM, Salisbury PA, Nicolas M (2000). Environmental effects on seed composition of Victorian canola. Aust. J. Exp. Agric. 40: 679-685. Qiu D, Morgan C, Shi J, Long Y, Liu J, Li R, Zhuang X, Wang Y, Tan X, Dietrich E, Weihmann T, Everett C, Vanstraelen S, Beckett P, Fraser F, Trick M, Barnes S, Wilmer J, Schmidt R, Li J, Li D, Meng J, Bancroft I (2006). A comparative linkage map of oilseed rape and its use for QTL analysis of seed oil and erucic acid content. Theor. Appl.

Qu et al.

Genet. 114: 67-80. Rahman M, Peter BEM, (2007). Development of SRAP, SNP and Multiplexed SCAR molecular markers for the major seed coat color gene in Brassica rapa L. Theor. Appl. Genet. 115: 1101-1107. Rashid A, Rakow G (1995). Seed quality improvement in yellow seeded Brassica napus. Proceedings of 8th International Rapeseed Congress, Cambridge, UK. pp. 1144-1146. Reif JC, Warburton ML, Xia XC, Hoisington DA, Crossa J, Taba S, Muminovic J, Bohn M, Frisch M, Melchinger AE (2006). Grouping of accessions of Mexican races of maize revisited with SSR markers. Theor. Appl. Genet. 113: 177-185. Rohlf FJ (2005). NTSYS-pc: numerical taxonomy and multivariate analysis system, version 2.2. Exeter Software: Setauket, New York. Shirzadegan M, Robbelen G (1985). Influence of seed color and hull proportion on quality properties of seed in Brassica napus L. Fette. Seifen. Anstrichmittel, pp. 235-237. Si P, Mailer RJ, Galwey N, Turner DW (2003). Influence of genotype and environment on oil and protein concentrations of canola (Brassica napus L.) grown across southern Australia. Aust. J. Agric. Res. 54: 397-407. Sneath PHA, Sokal RR (1973). Numerical taxonomy: the principles and practice of numerical classification. W.H. Freeman and Co., San Francisco, Calif. Soengas P, Cartea ME, Francisco M, Lema M, Velasco P (2011). Genetic structure and diversity of a collection of Brassica rapa subsp. rapa L. revealed by simple sequence repeat markers. J. Agric. Sci. 18. Somers DJ, Rakow G, Prabhu, VK, Friesen K (2001). Identification of a major gene and RAPD markers for yellow seed coat color in Brassica napus. Genome 44: 1077-1082. Steffansson BR, Hougen FM, Downey RK (1961). Note on the isolation of rape plants with seed oil free from erucic acid. Can. J. Plant. Sci. 41: 218-219. Sugimoto T, Tanaka K, Monma M, Kawamura Y, Saio K (1989). Phosphoenol pyruvate carboxylase level in soybean seed highly correlates to its contents of protein and lipid. Agric. Biol. Chem. 53 (3): 885-887. Sugimoto T, Kawasaki T, Kato T, Whittier RF, Shibata D, Kawamura Y (1992). cDNA sequenceand expression of a phosphoenol pyruvate carboxylase gene from soybean. Plant Mol. Biol. 20: 743-747. Tommasini L, Batley J, Arnold G, Cooke R, Donini P, Lee D, Law J, Lowe C, Moule C, Trick M (2003). The development of multiplex simple sequence repeat (SSR) markers to complement distinctness, uniformity and stability testing of rape (Brassica napus L.) varieties. Theor. Appl. Genet. 106: 1091-1101. Vazquez-Tello A, Whittier RF, Kawasaki T, Sugimoto T, Kawamura Y, Shibata D (1993). Sequence of a soybean (Glycine max L) phos phoenol pyruvate carboxylase cDNA. Plant Physiol. 103: 1025-1026. Vigouroux Y, Mitchell S, Matsuoka Y, Hamblin M, Kresovich S, Smith JSC, Jaqueth J, Smith OS, Doebley J (2005). An analysis of genetic diversity across the maize genome using microsatellites. Genetic, 169: 1617-1630.

8211

Wang HZ, Liu HL (1991). Genetic analysis of seed color instability in yellow-seeded Brassica napus L. Proceedings o f 8th International Rapeseed Congress, Saskatoon, Canada, 21-218. Wang HZ, Liu HL (1996). Quantitative variation of anthocyanidins, polyphenols , trans-cinnamic acid and PAL activity in seed hulls of black- and yellow-seeded B. napus L. J. Huazhong Agric. Univ. 15(6): 509-513. Wang J, Kaur S, Cogan NOI, Dobrowolski MP, Salisbury PA, Burton WA, Baillie R, Hand M, Hopkins C, Forster JW, Smith KF, Spangenberg G (2009). Assessment of genetic diversity in Australian canola (Brassica napus L.) cultivars using SSR markers. Crop Pasture Sci. 60: 1193-1201. Warburton ML, Ribaut JM, Franco J, Crossa J, Dubreuil P, Betrรกn FJ (2005). Genetic characterization of 218 elite CIMMYT inbred maize lines using RFLP markers. Euphytica, 142: 97-106. Xiao SS, Xu JS, Li Y, Zhang L, Shi SJ, Wu JS, Liu KD (2007). Generation and mapping of SCAR and CAPS markers linked to the seed coat color gene in Brassica napus using a genome-walking technique. Genome, 50(7): 611-618. Xiao DR, Liu HL (1982). Correlation analysis of seed colour and seed oil in Brassica napus L. Acta Agron. Sin. 8: 24-27. Yan BJ, Li HX (1998). The Relationship between browning ratio in etro PPO and phenols of pear explants. J. Sichuan Agric. Univ. 16(3): 310-313. Yuan L, Ma Y, Li AK (2003). Application of Double-low rapeseed meal in feed. Sci. Technol. Cereals Oils Foods, 11(2): 34-36. Zhang J, Guo W, Zhang TZ (2002). Molecular linkage map of allotetraploid (Gossypium hirsutum L. ร Gossypium barbadense L.) with a haploid population. Theor. Appl. Genet. 105: 1166-1174. Zhang XK, Chen L, Yin JM, Tang ZL, Li JN (2003). Genetic diversity of RAPD marker and testa pigments of yellow-seeded rapeseed (Brassica napus L.). Sci. Agric. Sin. 36: 752-756. Zhang SF, Song WG, Wen YC, Wang JP, Song JC, Liu JM (1996). Studies on hereditary capacity of quantitative characters and gene effects of CMS double low Brassica napus L. Chin. J. Oil Crop Sci. 18 (3): 1-3. Zhao J, Becker HC, Zhang D, Zhang Y, Ecke W (2006). Conditional QTL mapping of oil content in rapeseed with respect to protein content and traits related to plant development and grain yield. Theor. Appl. Genet. 113: 33-38. Zhou XZ, Wei KH, Chen ZH, Xie K, Zhu JJ (1997). Black sesame extracted from melanoma study. J. Chem. Industry. For. Prod. 4: 1719.

African Journal of Biotechnology Vol. 11(33), pp. 8212-8217, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.082 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

The effects of activation time on the production of fructose and bioethanol from date extract Gaily, M. H.1, Sulieman, A. K.1, Zeinelabdeen, M. A.1, Al-Zahrani, S. M.1, Atiyeh, H. K.2 and Abasaeed, A. E.1* 1

Chemical Engineering Department, King Saud University, PO Box 800, Riyadh, 11241, Saudi Arabia. Biosystems and Agricultural Engineering, 227 Agricultural Hall, Oklahoma State University, Stillwater, OK 74078-6021, USA.

Accepted 30 March, 2012

In this study, fructose and bioethanol were produced from date's extract by fermentation using Saccharomyces cerevisiae, mutant strain ATCC 36858 and wild strain STAR brand, where the latter was activated at different periods: 30 min, 1, 2 and 3 days. Profiles of sugar consumption and bioethanol production using STAR were found to be almost having the same pattern for all activation periods, while fructose was consumed as well as glucose. Enhancement of fructose in sugar can only be obtained at the expense of ethanol. In order to obtain 75 and 90% fructose in sugar, the respective losses in fructose exceeded 39 and 63%. On the other hand, the results demonstrate that S. cerevisiae ATCC 36858 could selectively convert glucose to ethanol and biomass with minimal fructose conversion. A high fructose yield above 91% of the original fructose was obtained with ATCC 36858. In addition, the ethanol yield was found to be 63% of the theoretical. Key words: Saccharomyces cerevisiae, fructose, glucose, bioethanol, fermentation.

INTRODUCTION Sugars are carbohydrate materials produced each day from water and atmospheric carbon dioxide by photosynthesis (Hassoune et al., 2008). Dates are sugar-rich and low moisture fruits. On average, the sugar content is 0.8 g per gram dry matter (Guizani et al., 2010). Most of the carbohydrates in dates are in the form of reduced sugars, mainly fructose and glucose (Al-Farsi et al., 2007; Kulkarni et al., 2008). The global production of date fruits exceeds six million metric tons annually in the world (Boudries et al., 2007; Guizani et al., 2010). Dates are generally consumed as fresh or may be processed, especially low grade dates, into various products such as date paste, syrup or powder (Guizani et al., 2010). Fructose is 60% sweeter than sucrose and 150% more than glucose. The major use of fructose syrup is in food and beverage industries at relatively high concentrations.

*Corresponding author. E-mail: abasaeed@ksu.edu.sa. Fax: +966-1-4678770.

High fructose syrups (HFS) are produced from different raw materials including corn starch, sugar cane, and sugar beet, in addition to other starchy raw materials like rice and dates (Hanover and White, 1993; Vuilleumier, 1993). Enzymatic isomerization techniques are used to convert glucose into fructose, but the conversion is equilibrium-limited at around 42% fructose (Zhang et al., 2004). 90% HFS are produced through costly multistage chromatographic techniques (Atiyeh and Duvnjak, 2001; 2002). Ethanol is also an important renewable and sustainable alternative clean fuel source (Balat et al., 2008; Sassner et al., 2008). Nowadays, the world fuel bioethanol production exceeds 20,000 millions of gallons per year (Renewable Fuels Association, 2010; Astudillo and Alzate, 2011). Selective fermentation is an efficient process for large scale production of fructose and bioethanol. In fermentation process, several microorganisms (Saccharomyces cerevisiae and Zymomonas mobilis) can be used to produce fructose and bioethanol. Generally, the use of mutants of these microorganisms

Gaily et al.

8213

Figure 1. Profiles of sugars and ethanol for STAR yeast fermented at 33 C and zero activation days.

decreases the consumption of fructose (Atiyeh and Duvnjak, 2001, 2002, 2003). The objective of this study was to evaluate the production of fructose and/or bioethanol from date's extract by fermentation at a fixed temperature using a mutant strain S. cerevisiae ATCC 36858 and a commercial S. cerevisiae (STAR brand) activated at different periods.

transferred to a small vial for sugars and ethanol analysis. The other portion was transferred to sterile test tubes for cell count determination. The sugars and ethanol were determined quantitatively using high performance liquid chromatography (HPLC; Agilent 1200 Infinitely series) equipped with an RID detector and Aminex® column. Cell count was determined by NucleoCounter® YC-100TM system cell counter.

RESULTS AND DISCUSSION MATERIALS AND METHODS

Fermentation with STAR yeast

The substrate was prepared from dates (Ruzaiz variety) using deionized water. The concentration of total sugars in the extracted date syrup was adjusted to 15% sugars (before dilution with growth medium), and was sterilized in an autoclave at 121°C for 15 min. Two strains of S. cerevisiae were used; mutant ATCC 36858 and commercial strain (STAR brand). Both strains were inoculated in Yeast Malt Broth (YM broth) prepared by adding 3 g bacto-yeast extract, 3 g bacto-malt extract, 5 g bacto-peptone, and 10 g bactodextrose to 1.0 L deionized water. The broth was sterilized at 121°C for 15 min. 2 g of the STAR yeast was added to 100 ml sterilized broth and then propagated for different activation periods. Activations of the yeast were conducted in a controlled temperature water bath shaker at 30°C and 120 rpm. The mutant S. cerevisiae ATCC 36858 obtained from American Type Culture Collection, USA in a pellet form was activated and transferred according to the standard procedure of the ATCC. To study the effect of the activation time, four different sets of fermentation experiments were performed using the four different propagated broths (0, 1, 2 and 3 days) of STAR yeast at 33°C without controlling pH. 100 ml of the substrate and yeast medium was put in a sterile 500 ml conical flask for fermentation. Samples were taken every 4 h using a sterilized disposable pipette. A portion of the sample was centrifuged at 15000 rpm for 1 min to separate the cells from the solution and then the clear solution was

The profiles of sugars and ethanol produced during fermentation at different activation periods of 0, 1, 2 and 3 days are illustrated in Figures 1 to 4, respectively. Along with fermentation, glucose and fructose were consumed; however, glucose consumption rate was higher than that of fructose. For the three activation periods 0, 1 and 2 days (Figures 1 to 3), there was a sharp drop in glucose from 4 to 8 h fermentation time, while for the 3 days activation, glucose consumption was almost linear (Figure 4). However, for all activation periods, glucose was consumed totally after 24 h. This proves that longer activation periods enhance sugar consumption at constant rates. This pattern of sugar consumption is reflected on ethanol production as shown in Figures 1 to 4. For all activation periods under investigation, the ethanol yield was found to be in the range of 83.6 to 85.3% of the theoretical yield as shown in Table 1. The results show that over 93% of total sugars were consumed upon fermentation with S. cerevisiae STAR brand.

8214

Afr. J. Biotechnol.

Figure 2. Profiles of sugars and ethanol for STAR yeast, fermented at 33 C and 1 activation day.

Figure 3. Profiles of sugars and ethanol for STAR yeast fermented at 33째C and 2 activation days.

In order to produce higher fructose concentrations, the fermentation should be stopped at intermediate times; stopping the fermentation after 12 h would produce 70% fructose in syrup for activation time of 3 days. Moreover, Figure 5 shows the percentage fructose losses for the four different activation time of fermentation with S. cerevisiae STAR brand at 33째C. Enhancement of fructose in sugar can only be obtained at the expense of

ethanol production. The average ethanol yield was found to be about 83% at higher fructose losses of 63%. Fermentation pattern of ATCC 36858 Figure 6 shows the profiles of a typical fermentation process of sugars in dates syrup by S. cerevisiae ATCC

Gaily et al.

8215

Figure 4. Profiles of sugars and ethanol for STAR yeast fermented at 33째C and 3 activation days.

Table 1. Summary of fermentation results with STAR yeast.

Activation time (day) 0 1 2 3

Initial total sugars (g/100 ml) 13.43 13.32 13.33 13.17

Average fructose consumption rate (g L-1h-1) 2.1 2.2 2.2 2.1

36858. It is clear from the Figure that this strain can selectively ferment glucose with minimum effect on fructose, thus resulting in higher concentration of fructose in the remaining sugars after 48 h. All glucose was fermented and converted to ethanol and biomass, while fructose losses were less than 8.5% of the original fructose. On the other hand, production of ethanol from glucose was observed to increase as fermentation proceeded. The yield of ethanol produced on total sugars was found to be 63% of the theoretical ethanol yield. The biomass increased from 1.2 g/100 ml initially to 16.9 g/100 ml. In the beginning of the process, the yeast needed more than 4 h to start fermenting sugars, after that selective fermentation of glucose proceeded with an average glucose consumption rate of 1.4 g l-1h-1. Although S. cerevisiae yeast was found to be a suitable microorganism among others for fermentation of sugars and for ethanol production, however, different strains of S. cerevisiae was found to show different fermentation pattern on sugars depending on the strain type. In this study, the results demonestrate the ability of S.

Average glucose consumption rate (g L-1h-1)

Ethanol yield (%)

2.3 2.3 2.3 2.2

85.3 83.6 84.6 83.8

cerevisiae ATCC 36858 to selectively convert glucose to ethanol and biomass, while fructose accumulated. This strain is completely different from the STAR strain of S. cerevisiae that utilised both glucose and fructose to ethanol and biomass. Regarding fermentation temperature and shaking speed, both stains were found to be active at 33째C and 120 rpm, respectively, although the two strains fermented the sugars in different ways. This result agrees with the findings of Noor et al. (2003) who reported that for different S. cerevisiae strains, the best and suitable fermentation temperature was found to be in the range of 28 to 36째C with 120 rpm shaking speed. The pH was found to drop from 5.2 to around 4 at the end of the fermentation process for all fermentation runs under investigation. Conclusions Two S. cerevisiae yeast strains were used in this preliminary study; STAR and ATCC 36858. STAR yeast was

8216

Afr. J. Biotechnol.

Fermentation time (h) Figure 5. Percent (%) fructose losses during fermentation with STAR yeast.

Figure 6. Profiles of sugars and ethanol for ATCC 36858 yeast fermented at 33 C.

found to ferment indiscriminately, glucose and fructose in the dateâ&#x20AC;&#x2122;s syrups to mainly ethanol. Production of high fructose concentration can only be achieved with this yeast by sacrificing ethanol. Attempts to enhance the selectivity of the fermentation towards glucose by changing activation times resulted in insignificant improvements

in performance. Hence, while STAR yeast is functional in fermenting dates syrups to ethanol, it is not a preferred candidate for producing higher fructose concentration. On the other hand, ATCC 36858 was able to selectively convert glucose to ethanol and biomass, and very high fructose yields were obtained with ATCC 36858.

Gaily et al.

ACKNOWLEDGEMENT The authors extend their appreciation to the National Plan for Science and Technology (NPST) at King Saud University for their generous support and funding of this study as a part of project # 08-ADV391-02.

REFERENCES Al-Farsi M, Alasalvar C, Al-Abid M, Al-Shoaily K, Al-Amry M, Al-Rawahy F (2007). Compositional and functional characteristics of dates, syrups, and their by-products. Food Chem. 104: 943-947. Astudillo ICP, Alzate CAC (2011). Importance of stability study of continuous systems for ethanol production. J. Biotechnol. 151: 43-55. Atiyeh H, Duvnjak Z (2001). Production of fructose and ethanol from media with high sucrose concentrations by a mutant of S. cerevisiae. J. Chem. Technol. Biotechnol. 76: 1017-1022. Atiyeh H, Duvnjak Z (2002). Production of fructose and ethanol from sugar beet molasses using S. cerevisiae ATCC 36858. Biotechnol. Prog. 18: 234-239. Atiyeh H, Duvnjak Z (2003). Production of fructose and ethanol from cane molasses using S. cerevisiae ATCC 36858. Acta Biotechnol. 23(1): 37-48. Balat M, Balat H, Ĺ?z C (2008). Progress in bioethanol processing. Prog. Energy Combust. Sci. 34: 551-573. Boudries H, Kefalas P, Hornero-MĂŠndez D (2007). Carotenoid composition of Algerian date varieties (Phoenix Dactylifera) at different edible maturation stages. Food Chem. 101: 1372-1377.

8217

Guizani N, Al-Saidi GS, Rahman MS, Bornaz S, Al-Alawi AA (2010). State diagram of dates: Glass transition, freezing curve and maximalfreeze-concentration condition. J. Food Eng. 99: 92-97. Hanover ML, White JS (1993). Manufacturing, composition, and applications of fructose. Am. J. Clin. Nutr. 58: 724S-732S. Hassoune H, Rhlalou T, Verchere JF (2008). Studies on sugars extraction across a supported liquid membrane: Complexation site of glucose and galactose with methyl cholate. J. Membr. Sci. 315: 180186. Kulkarni SG, Vijayanand P, Aksha M, Reena P, Ramana KVR (2008). Effect of dehydration on the quality and storage stability of immature dates (Phoenix dactylifera). LWT-Food Sci. Technol. 41: 278-283. Noor AA, Hameed A, Bhatti KP, Tunio SA (2003). Bio-ethanol fermentation by the bioconversion of sugar from Dates by S. cerevisiae strains ASN-3 and HA-4. Biotechnol. 2(1): 8-17. Renewable Fuels Association (2010). Ethanol industry statistics: annual world ethanol production by country. Washington. Available from: http://www.ethanolrfa.org/pages/statistics/#E (11.10. 2010). Sassner P, Galbe M, Zacchi G (2008). Techno-economic evaluation of bioethanol production from three different lignocellulosic materials. Biomass Bioenerg. 32: 422-430. Vuilleumier S (1993). Worldwide production of high-fructose syrup and crystalline fructose. Am. J. Clin. Nutr. 58: 733S-736S. Zhang Y, Hidajat K, Ray AK (2004). Optimal design and operation of SMB bioreactor: production of high fructose syrup by isomerization of glucose. Biochem. Eng. J. 21: 111-121.

Full Length Research Paper

In vitro regeneration from internodal explants of bitter melon (Momordica charantia L.) via indirect organogenesis Muthu Thiruvengadam, Nagella Praveen and Ill-Min Chung* Department of Applied Life Science, Konkuk University, Seoul 143-701, South Korea. Accepted 22 March, 2012

Organogenic callus induction and high frequency shoot regeneration were achieved from internodal explants of bitter melon. About 97.5% of internodal explants derived from 30 day old in vivo grown plants produced green, compact nodular organogenic callus in Murashige and Skoog (MS) plus Gamborg et al. (1968) (B5) medium containing 5.0 μM 2,4-dichlorophenoxyacetic acid (2,4-D) and 2.0 μM thidiazuron (TDZ) after two successive transfers at 11 days interval. Adventitious shoots were produced from organogenic callus when it was transferred to MS medium supplemented with 4.0 μM TDZ, 1.5 μM 2,4-D and 0.07 mM L-glutamine with shoot induction frequency of 96.5% and regeneration of adventitious shoots from callus (48 shoots per explant). Shoot proliferation occurred when callus with emerging shoots was transferred in the same medium at an interval of 15 days. The regenerated shoots were elongated on the same medium. The elongated shoots were rooted in MS medium supplemented with 3.0 μM indole 3-butyric acid (IBA). Rooted plants were acclimatized in green-house and subsequently established in soil with a survival rate of 95%. This protocol yielded an average of 48 shoots per internodal explant after 80 days of culture. Key words: Adventitious shoots, growth regulators, hardening, organogenic callus, Momordica charantia. INTRODUCTION Bitter melon (Momordica charantia L.) is an important cucurbit crop species and one of the major vegetable grown in the tropical regions of Asia, Amazon, east Africa and the Caribbean and is cultivated throughout the world. The fruits of bitter melon contain rich amount of vitamins, iron, minerals, phosphorous and presents good dietary fiber levels (Sultana and Bari Miah, 2003). Medicinal properties of the plant include anti-microbial, anticancerous, anti-mutagenic, anti-tumor, anti-infertility, antidiabetic and anti-rheumatic properties (Singh et al.,

*Corresponding author. E-mail: imcim@konkuk.ac.kr. Tel: +822-450-3730. Fax: +82-2-446-7856. Abbreviations: BAP, 6-Benzylaminopurine; TDZ, thidiazuron; NAA, α-naphthaleneacetic acid; 2,4-D, 2,4dichlorophenoxyacetic acid; IBA, indole 3-butyric acid; MSB5, Murashige and Skoog basal salts mixture + B5 vitamins.

1998). Recently, phytochemists have isolated a number of potential medical components from this plant, such as the ribosome inactivating protein (RIP), MAP30 (Momordica anti-Hiv protein), which suppresses HIV (human immunodeficiency virus) activity, M. charantia lectin (MCL), M. charantia inhibitor (MCI) and momordicoside A and B, both of which can inhibit tumor (Bourinbaiar and Lee-Huang, 1996; Beloin et al., 2005). Recent developments in biotechnology has opened up several ways for cucurbit breeding using genetic transformation in which heterologous genes can be introduced into existing cultivars (Sarowar et al., 2003). However, in many instances, the lack of an efficient regeneration system causes limitations for the utilization of gene transfer technologies for these crops. An efficient plant regeneration system is therefore necessary for genetic transformation and propagation. During the past years, considerable efforts have been made for in vitro plant regeneration of this important plant

Thiruvengadam et al.

through organogenesis in nodal and shoot tips (Wang et al., 2001; Sultana and Bari Miah, 2003; Malik et al., 2007; Ma et al., 2012) and cotyledons (Islam et al.,1994). Paul et al. (2009) showed effect of exogenous polyamines (PAs) on enhancing somatic embryogenesis in M. charantia. Agrobacterium-mediated β-glucuronidase expression was detected in explants of immature cotyledonary nodes in M. charantia (Sikdar et al., 2005). In this study, we established for the first time, an efficient protocol for the regeneration of bitter melon using internodal explants. In the present investigation, an attempt was made to evaluate the choice of auxin, cytokinin and amino acid concentrations and their combination on MS medium, in order to develop a standard reproducible protocol for rapid adventitious shoot regeneration and propagation via organogenesis from internodal explants of bitter melon. We believe that our findings could facilitate genetic transformation of this commercially important vegetable and may also be applicable to other related species. MATERIALS AND METHODS Collection of seeds and germination Seeds of bitter melon (M. charantia cv. Coimbatore-1) were obtained from Arignar Anna Farm, Kudimianmalai, Pudukkottai, Tamilnadu, India. Seeds were potted in a mixture of peat : vermiculite : soil (1:2:1) and maintained in growth chamber (MLR350H, Sanyo, Tokyo, Japan) at 27°C day/22°C night under 16 h light and 8 h dark photoperiod. The plants were fertilized and watered at weekly intervals. Internodal explants were excised from highly proliferating (30 day old) plants in growth chamber and rinsed thoroughly in running tap water for 2 h. The internodes were then surface sterilized by agitating in 5% laboline and 0.1% HgCl2 for 10 min and rinsed five to seven times with sterile distilled water. The internodal explants were sliced into approximately 0.1 mm width and 0.7 mm length.

Callus induction The callus induction media consisted of MS salts (Murashige and Skoog, 1962), B5 vitamins (Gamborg et al., 1968) plus 3% sucrose and solidified with 0.8% agar; supplemented with different concentrations of 1.0 to 7.0 μM of naphthaleneacetic acid (NAA), 2,4-dichlorophenoxy acetic acid (2,4-D) either separately or in combination with 1.0 - 4.0 μM thiadiazuron (TDZ) or benzyl amino purine (BAP) were tested for callus induction. The medium was adjusted to pH 5.8 prior to autoclaving at 121°C for 15 min. The cultures were maintained at 25 ± 2°C under 16 h light and 8 h dark photoperiod with a light intensity of 150 μmol m-2 s-1. Two transfers were made at an interval of 11 days in the same induction medium.

Shoot bud induction and proliferation Organogenic callus obtained from internodal explants was selected for shoot regeneration. Green, compact, nodular calluses obtained from internodal explants were transferred to MS medium plus 3% sucrose, solidified with 0.8% agar supplemented with different concentrations of auxins (NAA and 2,4-D; 1.0 to 3.0 μM), cytokinins

8219

(TDZ and BAP; 1.0 to 6.0 μM) and amino acids (L-asparagine and L-glutamine; 0 to 0.1 mM). The medium was adjusted to pH 5.8 prior to autoclaving at 121°C for 15 min. All compounds, plant growth regulators (PGRs) and amino acids were from SigmaAldrich. The calluses were subcultured at 15 day interval on the shoot induction medium. The cultures were maintained at 25 ± 2°C under 16/8 h photoperiod with the light intensity of 30 μmol m-2 s-1 for shoot bud induction. The adventitious shoots produced on calli were then separated from them and cultured to induce further shoot development. Calli with regenerating adventitious buds were subcultured twice at 15 day intervals in the same medium for shoot multiplication and elongation.

Rooting and acclimatization Elongated shoots were transferred to rooting medium supplied with indole 3-butyric acid (IBA; 1.0 to 4.0 μM). The medium was adjusted to pH 5.8 prior to autoclaving at 121°C for 15 min. The cultures were maintained at 25 ± 2°C under 16/8 h photoperiod with light intensity of 30 μmol m-2 s-1. After 3 weeks, the rooted plants were transplanted to paper cups containing sterile soil, sand and vermiculite (1:1:1, v/v/v) and were placed in the green house. The plants were watered daily with Hoagland’s nutrient solution (Hoagland and Arnon, 1950). The potted plants were then covered with polyethylene to maintain a condition of high humidity (85% RH) and grown for 2 weeks at a photosynthetic photon flux density (PPFD) of 25 µmol m-2 s-1 before planting in the greenhouse. After the development of new leaves, the covers were removed, and hardened plants were transferred to earthen pots (diameter 18 cm) filled with soil mix (peat, perlite and vermiculite in equal proportions: 1:1:1, v/v/v) and grown to maturity. The survival percentage was calculated after 4 weeks in the greenhouse.

Histology For histological observations, the organogenic callus derived from internodal explant with regenerating adventitious shoot buds was fixed in FAA (formaldehyde, acetic acid, alcohol, 0.5:0.5:9.0 (v/v/v) ratio) for 48 h, and it was dehydrated in a graded series of tertiary butyl alcohol (TBA) and finally embedded in paraffin wax. The blocks were sectioned at 10 mm thickness (Leica microtome, Germany, RM 2135). The ribbons were placed on the slides smeared with Meyer’s albumin and flooded with 4% formalin. These slides were slightly warmed.

Statistical analysis The data were collected 3 weeks after the initiation of callus induction, after 4 weeks of shoot regeneration culture and after 3 weeks in the rooting experiments. All experiments were conducted with a minimum of 10 replicates per treatment. The data were analyzed statistically using SPSS ver. 14 (SPSS, Chicago, IL). The significance of differences among means was carried out using Duncan’s multiple range test at P = 0.05. The results were expressed as the mean ± standard error (SE) of three experiments.

RESULTS AND DISCUSSION Callus induction The callusing ability of internodal explants derived from 30 day old in vivo plants of bitter melon was evaluated on

8220

Afr. J. Biotechnol.

Table 1. Effect of auxin and cytokinin on organogenic callus induction from internodal explants of M. charantia.

Plant growth regulators (μM) 5.0 2,4-D 7.0 2,4-D 5.0 2,4-D + 2.0 BAP 7.0 2,4-D + 2.0 BAP 5.0 2,4-D + 2.0 TDZ 7.0 2,4-D + 2.0 TDZ 5.0 NAA 7.0 NAA 5.0 NAA + 2.0 BAP 7.0 NAA + 2.0 BAP 5.0 NAA + 2.0 TDZ 7.0 NAA + 2.0 TDZ

Percentage of explants exhibiting callus induction i

56.3 ± 1.5 g 65.5 ± 1.0 e 77.0 ± 2.0 82.1 ± 2.0d a 97.5 ± 1.0 bc 91.0 ± 1.2 51.4 ± 1.0j h 60.7 ± 1.2 ef 74.4 ± 1.0 de 80.0 ± 2.0 b 93.0 ± 1.6 89.2 ± 1.5c

Nature of callus YF YBF YGC YBC GCN GC YF YBF YGC YBC GC GC

Each value represents the mean ± SE of 10 replicates per treatment. In the same column, significant differences according to LSD at the P = 0.05 level are indicated by different letters. YF, Yellowish friable; YBF, yellowish-brown friable; YBC, yellowish-brown compact; YGC, yellowish-green compact; GC, green compact; GCN, green compact nodular.

MS medium supplemented with individual treatment of different auxins (NAA and 2,4-D) or their combination, either with BAP or TDZ (Table 1). The quality of the callus was assessed after 3 weeks of culture. The combination of 5.0 μM 2,4-D and 2.0 μM TDZ produced greenish compact callus (Figure 1a and Table 1) with high callusing response (97.5%). Nabi et al. (2002), Devendra et al. (2009) and Selvaraj et al. (2006) found that the combination of BAP with NAA or 2,4-D produced organogenic callus in Momordica dioica and Cucumis sativus. The combination of 7.7 μM NAA with 2.2 μM TDZ produced greenish compact callus from leaf explants of M. charantia. Handley and Chambliss (1979) reported that NAA and Kn combination in MS medium produced nodular compact callus in cucumber. Selvaraj et al. (2006) obtained nodular, greenish compact and organogenic callus in the presence of 2,4-D and BAP for hypocotyl explants of cucumber. Punja et al. (1990), Seo et al. (2000) and Selvaraj et al. (2007) reported callus formation in cucumber cultivars in the combination of NAA and BAP for petiole, leaf and cotyledon explants, respectively. Adventitious shoot formation Nodular, green compact callus obtained from internodal explants in 5.0 μM 2,4-D and 2.0 μM TDZ medium were transferred to MS medium containing different concentrations of cytokinins (TDZ and BAP) combined with auxins (NAA and 2,4-D) for adventitious shoot induction (Table 2). MS medium with 4.0 μM TDZ and 1.5 μM 2,4-D produced 25.4 shoots from callus which

reached 4.0 cm in length. Savitha et al. (2010) reported that MS medium with 2.5 mg/l 2,4-D and 0.5 mg/l TDZ produced high frequency shoot regeneration from leaf derived callus of Citrullus colosynthis. MS medium supplemented with 4.0 μM BAP and 1.5 μM 2,4-D produced 14.0 shoots from callus which attained 2.5 cm length after 4 weeks (Table 2). In the present study, TDZ was found to be more effective in shoot regeneration as compared to BAP. The effectiveness of TDZ over other cytokinins has also been reported in other cucurbits such as Cucurbita pepo (Pal et al., 2007), C. colosynthis (Savitha et al., 2010) and Melothria maderaspatana (Baskaran et al., 2009). MS medium containing 4.0 μM TDZ and 1.5 μM 2,4-D and various concentrations of L-asparagine and L-glutamine significantly increased adventitious shoots from internode derived callus (Table 3). The highest number of shoots (48 shoots) was produced on MS medium containing 4.0 μM TDZ, 1.5 μM 2,4-D and 0.07 mM L-glutamine from internode derived callus (Figure 1b and c). The shoots with 9.4 cm length were obtained after 4 weeks. NAA (1.34 µM), BAP (8.88 µM), zeatin (0.91 µM) together with L-glutamine (136.85 µM) produced large number of shoots in cucumber (Selvaraj et al., 2007). Addition of Lglutamine in the adventitious shoot regeneration medium greatly enhanced the production of shoots from callus. This is in agreement with the findings of Selvaraj et al. (2002) and Vasudevan et al. (2004) for C. sativus and M. maderaspatana (Baskaran et al., 2009). Adding nontoxic glutamine (Gamborg et al., 1968) to the medium maintains a high growth rate of cells for a longer period. Locy and Wehner (1982) demonstrated that L-asparagine was the best nitrogen source for the

Thiruvengadam et al.

8221

Figure 1. In vitro plant regeneration from internode derived callus of M. charantia L. (a) Greenish compact nodular organogenic callus (5.0 µM 2,4-D and 2.0 µM TDZ), bar: 10 mm; (b and c) Adventitious shoot regeneration and shoot proliferation (4.0 µM TDZ, 1.5 µM 2,4-D and 0.07 mM L-glutamine), bar: 10 mm; (d) Elongation of shoots (4.0 µM TDZ, 1.5 µM 2,4-D and 0.07 mM L-glutamine), bar: 10 mm; (e) In vitro rooting of shoots (3.0 µM IBA), bar: 10 mm, (f). Hardened plants, bar 3.0 cm; (g). Longitudinal section of internode derived callus showing the meristematic zone (bar = 50 mm). Arrows indicate emerging shoot primordia.

growth of cucumber shoots. The highest number of shoots (34.5 shoots) was produced on MS medium containing 4.0 μM TDZ, 1.5 μM 2,4-D and 0.07 mM Lasparagine (Table 3). In our present investigation, Lglutamine is the best for induction of shoots as compared to L-asparagine. After two transfers in shoot induction medium at 15 days interval, adventitious shoots were produced from the protuberances of the callus. Malepszy and Nadolska-Orezyk (1983), Bergervoet et al. (1989) and Trulson and Shahin (1986) advocated repeated subcultures of callus to obtain high frequency shoot regeneration in cucumber. Earlier studies of bitter melon regeneration via organogenesis showed the production of 30 to 40 shoots per leaf explant (Thiruvengadam et al., 2010). Cucumber regeneration via organogenesis

showed the production of 36 shoots per explant (Selvaraj et al., 2007). In the present study, we achieved a statistically significant better regeneration frequency (48 ± 1.0 shoots/internode) from internodal explants. Our study clearly indicates the requirement of high auxin : low cytokinin ratio for callus induction and low auxin : high cytokinin ratio for shoot induction from callus. The regenerated shoots when cultured in MS medium containing 4.0 μM TDZ, 1.5 μM 2,4-D and 0.07 mM Lglutamine favoured for shoot proliferation and elongation after 1 week (Figure 1d). There are similar reports on other cucurbits such as Cucumis melo (Kathal et al., 1988), Citullus vulgaris (Srivastava et al., 1989) and C. sativus (Handley and Chambliss, 1979) where elongation of shoots occurred on MS medium fortified with either

8222

Afr. J. Biotechnol.

Table 2. Effect of auxins and cytokinins on shoot regeneration from internode derived callus of M. charantia.

Plant growth regulators (μM) BAP + NAA 2.0 + 1.5 4.0 + 1.5 6.0 + 1.5

Percentage of calluses that regenerated into shoots

Mean number of regenerated shoots per explant

Mean shoot length (cm)

39.6 ± 1.5ij 47.4 ± 1.0g i 40.3 ± 2.0

6.4 ± 1.0i 10.5 ± 0.8g hi 7.2 ± 0.5

1.2 ± 0.4h 2.0 ± 0.5f i 1.0 ± 0.2

BAP + 2,4-D 2.0 + 1.5 4.0 + 1.5 6.0 + 1.5

42.4 ± 1.2 55.8 ± 1.0e hi 40.5 ± 1.5

9.1 ± 0.6 14.4 ± 1.2e h 8.5 ± 1.0

1.5 ± 0.5 2.5 ± 0.5d i 1.0 ± 0.4

TDZ + NAA 2.0 + 1.5 4.0 + 1.5 6.0 + 1.5

57.0 ± 2.0de bc 66.5 ± 1.0 f 53.2 ± 1.5

17.0 ± 1.2d b 21.4 ± 1.0 de 15.6 ± 0.5

2.4 ± 0.6de b 3.2 ± 0.5 f 2.0 ± 0.5

TDZ + 2,4-D 2.0 + 1.5 4.0 + 1.5 6.0 + 1.5

69.2 ± 1.0b 76.5 ± 2.0a 60.6 ± 1.5d

21.2 ± 1.0bc 25.4 ± 1.0a 14.0 ± 0.5ef

3.1 ± 0.8bc 4.0 ± 0.5a 2.4 ± 0.6de

Each value represents the mean ± SE of 10 replicates per treatment. In the same column, significant differences according to LSD at the P = 0.05 level are indicated by different letters.

Table 3. Effect of amino acids on shoot regeneration from internode derived callus of M. charantia in MS medium containing 4.0 μM TDZ and 1.5 μM 2,4-D.

Asparagine (mM) 0 0.03 0.07 0.1 -

Glutamine (mM) 0.03 0.07 0.1

Percentage of calluses that regenerated into shoots 76.5 ± 2.0f 81.4 ± 1.0d 88.0 ± 1.5c 80.5 ± 1.0de 90.3 ± 1.2b 96.5 ± 1.0a 89.0 ± 1.0bc

Mean number of regenerated shoots per explant 25.4 ± 1.0e 29.2 ± 1.0d 34.5 ± 1.5bc 30.4 ± 1.6cd 37.5 ± 1.5b 48.0 ± 1.0a 33.2 ± 1.3c

Mean shoot length (cm) 4.0 ± 1.0e 6.2 ± 0.8cd 7.0 ± 0.5c 6.0 ± 0.4d 8.5 ± 0.5ab 9.4 ± 0.6a 8.2 ± 0.8b

Each value represents the mean ± SE of 10 replicates per treatment. In the same column, significant differences according to LSD at the P = 0.05 level are indicated by different letters.

BAP or KIN but not GA3. In contrast, GA3 showed a better response for shoot elongation as reported in C. sativus (Selvaraj et al., 2007) and M. dioica (Thiruvengadam et al., 2006). Rooting and acclimatization For rooting, the elongated shoots were transferred to MS basal medium containing different concentrations of IBA (1.0 to 4.0 μM) (Figure 2). A maximum of roots per shoot (9 roots) were obtained in MS medium with 3.0 μM IBA

after 3 weeks culture period (Figure 1e). The effectiveness of IBA in rooting has been reported in M. dioica (Hoque et al., 1995; Nabi et al., 2002), Benincasa hispida (Thomas and Sreejesh, 2004) and M. maderaspatana (Baskaran et al., 2009). In contrast, NAA have been used for in vitro rooting in Cucurbita pepo (Kathiravan et al., 2006). BAP and IAA were used for rooting in C. sativus (Selvaraj et al., 2002). Thiruvengadam et al. (2006) and Han et al. (2004) reported that IAA is the best for root induction in M. dioica and Lagenaria siceraria. The rooted plants were gently removed from the vessels, washed initially to remove adhered agar and traces of the medium

Thiruvengadam et al.

8223

Figure 2. Effect of IBA on root induction from the in vitro shoot of M. charantia. Each value represents the mean ± SE of 10 replicates per treatment. The data were statistically analyzed using Duncan’s multiple range test (DMRT). In the same column, significant differences according to the least significant difference (LSD) at the P = 0.05 level are indicated by different letters. The data were recorded after 3 weeks of culture.

to avoid contamination, and then washed for 10 min in distilled water. They were then transferred to plastic vessels containing a sterile soil, sand and vermiculite mixture (1:1:1, v/v/v) (Figure 1f), and after 2 weeks, they were transferred to pots. The hardening of potted plants for 15 days in a growth chamber was found to be essential. We had a 95% survival rate of plants derived from internodal explants when rooted plantlets were transferred from pots to field conditions. Regenerated plants transferred to the field became fully established and grew well and were similar to the parental plants in their morphology (Figure 1f). Histology of organogenic callus Histological examination of 3 weeks old organogenic callus revealed the initiation of bud primordium beneath the epidermal region of the meristematic dome. The bud primordium is flanked by two leaf primordia (Figure 1g). It reveals de novo origin of adventitious shoot buds. Similarly, histological studies were observed in leaf derived callus of M. charantia, hypocotyl and cotyledon explants of C. sativus (Selvaraj et al., 2006, 2007) and

nodal explants of M. dioica (Thiruvengadam et al., 2006). In conclusion, high frequency regeneration of shoots was achieved using internodal explants of bitter melon via indirect organogenesis. MS medium containing 5.0 μM 2,4-D and 2.0 μM TDZ favoured organogenic callus induction, and 4.0 μM TDZ, 1.5 μM 2,4-D and 0.07 mM Lglutamine combination induced adventitious shoots from organogenic callus. About 48 shoots were produced per internodal explants in culture duration of 80 days. We believe that this regeneration system could be used in the production of transgenic bitter melon plants by Agrobacterium-mediated genetic transformation as the protocol would yield higher number of shoots and the chance of recovering transformed plants at a higher frequency may be high. ACKNOWLEDGEMENTS The author Muthu Thiruvengadam is a recipient of the Konkuk University Brain Pool Postdoctoral Program, Konkuk University, Seoul, South Korea. The authors wish to thank the Arignar Anna Farm, Kudimianmalai, Pudukkottai, Tamilnadu, India, for supplying the seed materials.

8224

Afr. J. Biotechnol.

REFERENCES Baskaran P, Velayutham P, Jayabalan N (2009). In vitro regeneration of Melothria maderaspatana via indirect organogenesis. In Vitro Cell Dev. Biol. Plant. 45: 407-413. Beloin N, Gbeassor M, Akpagana K, Hudson J, Soussa KD, Koumaglo K, Arnason JT (2005). Ethnomedicinal uses of Momordica charantia (Cucurbitaceae) in Togo and relation to its phytochemistry and biological activity. J. Ethnol. Pharmocol. 96: 49-55. Bergervoet JHW, Van der Mark F, Custers JBM (1989). Organogenesis versus embryogenesis from long-term suspension cultures of cucumber (Cucumis sativus L.). Plant Cell Rep. 8: 116-119. Bourinbaiar AS, Lee-Huang S (1996). The activity of plant derived antiretroviral proteins MAP30 and GAP31 against herpes simplex virus in vitro. Biochem. Biophy. Res. Commun. 219: 923-929. Devendra NK, Subhash B, Seetharam YN (2009). Callus growth and plant regeneration in Momordica dioica (Roxb.) Willd. Cucurbitaceae. Am. Eurasian J. Sustain Agric. 3: 743-748. Gamborg OL, Miller RA, Ojima K (1968). Nutrients requirements of suspension cultures of soybean root cells. Exp. Cell Res. 50: 151158. Han JS, Oh DG, Mok IG, Park HG, Kim CK (2004). Efficient plant regeneration from cotyledon explants of bottle gourd (Lagenaria siceraria Standl.). Plant Cell Rep. 23: 291-296. Handley LW, Chambliss OL (1979). In vitro propagation of Cucumis sativus L. Hort. Sci. 14: 22-23. Hoagland DR, Arnon DI (1950). The water culture method for growing plants without soil. California Agric. Exp. Station Bull. p. 347. Hoque A, Islam R, Joarder OI (1995). In vitro plantlets differentiation in kakrol (Momordica dioica Roxb.). Plant Tissue Cult. 5:119-124. Islam R, Sarkar PK, Naderuzzaman ATM, Joarder OI (1994). In vitro regeneration of plants from cotyledons of Momordica charantia L. Plant Tissue Cult. 4: 105-109. Kathal R, Bhatnagar SP, Bhojwani SS (1988). Regeneration of plants from leaf explants of Cucumis melo cv. Pusa sharbati. Plant Cell Rep. 7: 449-451. Kathiravan K, Vengedesan G, Singer S, Steinitz B, Paris H, Gaba V (2006). Adventitious regeneration in vitro occurs across a wide spectrum of squash (Cucurbita pepo) genotypes. Plant Cell Tissue Organ Cult. 85: 285-295. Locy RD, Wehner TC (1982). Cucumber shoot tip growth on 9 nitrogen sources in in vitro culture. Cucurbits Genet. Coop. Rep. 5: 10-11. Ma C, Tang Y, Li X, Li J, Wang L, Li HX (2012). In vitro induction of multiple buds from cotyledonary nodes of Balsam pear (Momordica charantia L.). Afr. J. Biotechol. 11: 3106-3115. Malepszy S, Nadolska-Orezyk A (1983). In vitro culture of Cucumis sativus. I. Regeneration of plantlets from callus formed by leaf explants. Z. Pflanzenphysiol. 111: 273-276. Malik S, Zia M, Rehman R, Chaudhary F (2007). In vitro plant regeneration from direct and indirect organogenesis of Momordica charantia. Pak. J. Biol. Sci. 10: 4118-4122. Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15: 473-497. Nabi SA, Rashid MM, Al-Amin M, Rasul MG (2002). Organogenesis in teasle gourd (Momordica dioica Roxb.). Plant Tissue Cult. 12: 173180. Pal SP, Alam I, Anisuzzaman M, Sarker KK, Sharmin SA, Alam MF (2007). Indirect organogenesis in summer squash (Cucurbita pepo L.). Turk. J. Agric. Forest. 31: 63-70. Paul A, Mitter K, Raychaudhuri SS (2009). Effect of polyamines on in vitro somatic embryogenesis in Momordica charantia L. Plant Cell Tissue Organ Cult. 97: 303-311.

Punja ZK, Abbas N, Sarmento GG, Tang FA (1990). Regeneration of Cucumis sativus vars, sativus and hardwickii, C. melo and C. metuliferus from explants through somatic embryogenesis and organogenesis. Influence of explant source, growth regulator regime and genotype. Plant Cell Tissue Organ Cult. 21: 93-102. Sarowar S, Oh HY, Hyung NI, Min BW, Harn CH, Yang SK, Ok SH, Shin JS (2003). In vitro micropropagation of a Cucurbita interspecific hybrid cultivar-a root stock plant. Plant Cell Tissue Organ Cult. 75: 179-182. Savitha R, Shasthree T, Sudhakar, Mallaiah B (2010). High frequency of plantlet regeneration and multiple shoot induction from leaf and stem explant of Citrullus colosynthis (L.) Schrad, an endangered medicinal cucurbit. Int. J. Pharma Biol. Sci. 6(2): 1-8. Selvaraj N, Vasudevan A, Manickavasagam M, Ganapathi A (2006). In vitro organogenesis and plant formation in cucumber. Biol. Plant. 50: 123-126. Selvaraj N, Vasudevan A, Manickavasagam M, Kasthurirengan S, Ganapathi A (2007). High frequency shoot regeneration from cotyledon explants of cucumber via organogenesis. Sci. Hortic. 112: 2-8. Selvaraj N, Vengadesan G, Vasudevan A, Prem Anand R, Ramesh Anbazhagan V, Ganapathi A (2002). Micropropagation of Cucumis sativus L. from field grown plants. In: Maynard DN (Ed.), Proceedings of the Cucurbitaceae 2002, ISHS Press, Belgium, pp 149-156. Seo SH, Bai DG, Park HY (2000). High frequency shoot regeneration from leaf explants of cucumber. J. Plant Biotechnol. 2: 51-54. Sikdar B, Shafiullah M, Chowdhury AR, Sharmin N, Nahar S, Joarder OI (2005). Agrobacterium-mediated GUS expression in bitter gourd (Momordica charantia L.). Biotechology, 4: 149-152. Singh A, Singh SP, Bamezai R (1998). Momordica charantia (Bitter gourd) peel, pulp, seed and whole fruit extract inhibits mouse skin papillomagenesis. Toxicol. Lett. 94: 37-46. Srivastava DR, Rianov VM, Piruzian ES (1989). Tissue culture and plant regeneration of watermelon (Citrullus vulgaris) Schrad. cv. Melitopolski. Plant Cell Rep. 8: 300-302. Sultana RS, Bari Miah MA (2003). In vitro propagation of karalla (Momordica charantia L). J. Biol. Sci. 3: 1134-1139. Thiruvengadam M, Rekha KT, Jayabalan N (2006). An efficient in vitro propagation of Momordica dioica Roxb. ex. Willd. Philipp Agric. Scientist. 89: 165-171. Thomas TD, Sreejesh KR (2004). Callus induction and plant regeneration from cotyledonary explants of ash gourd (Benincasa hispida L.). Sci. Hortic. 100: 359-367. Trulson AJ, Shahin EA (1986). In vitro plant generation in the genus Cucumis. Plant Sci. 47: 35-43. Vasudevan A, Selvaraj N, Ganapathi A, Kasthurirengan S, Ramesh Anbazhagan V, Manickavasagam M (2004). Glutamine: a suitable nitrogen source for enhanced shoot multiplication in cucumber (Cucumis sativus L.). Biol. Plant. 48: 125-128. Wang S, Tang L, Chen F (2001). In vitro flowering of bitter melon. Plant Cell Rep. 20: 393-397.

African Journal of Biotechnology Vol. 11(33), pp. 8225-8233, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.341 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Introgression of bacterial blight (BB) resistance genes Xa7 and Xa21 into popular restorer line and their hybrids by molecular marker-assisted backcross (MABC) selection scheme Junying Xu1, Jiefeng Jiang1, Xiaofei Dong1, Jauhar Ali2 and Tongmin Mou1* 1

National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China. 2 International Rice Research Institute, DAPO 7777, Metro Manila, Philippines. Accepted 30 March, 2012

Yihui1577 is an elite restorer line widely used in hybrid rice production in China, however, both the restorer and their derived hybrids are susceptible to bacterial blight (BB) caused by Xathomonas oryzae pv. oryzae (Xoo). In order to overcome this problem, we had introgressed two resistant genes Xa7 and Xa21 into Yihui1577 by marker-assisted backcross (MABC) with foreground selection scheme to speed up the process. Six breeding lines with different BB resistance genes: HH1202 (Xa7), HH1203 (Xa7), HH1204 (Xa21), HH1205 (Xa21), HH1206 (Xa7+Xa21) and HH1207 (Xa7+Xa21) were selected and crossed with four CMS and one TGMS lines. Seven most virulent and prevalent Xoo strains (PXO61, PXO99, ZHE173, GD1358, FuJ, YN24 and HeN11) from the Philippines and different provinces of China were inoculated for evaluating the BB-resistance of the selected lines and their derived hybrids. The results reveal that the two lines and their derived hybrids with single resistance gene Xa7 were resistant against six of the seven Xoo strains, except for PXO99. The lines with single resistance gene Xa21 were only susceptible to the Xoo strain FuJ, but some of their derived hybrids were susceptible to the Xoo strains FuJ and GD1358. Interestingly, the pyramiding lines carrying the two resistance genes Xa7 and Xa21 and also their derived hybrids were resistant against all the seven Xoo strains. The data of agronomic and grain quality characteristics demonstrated that the selected lines were similar to that of the recurrent parent Yihui1577. Corrective measures taken by way of introgression of BB-resistance genes: Xa7 and Xa21 into the popular restorer line, Yihui1577 through MABC approach for enhancing the BB-resistance level was effective and timely. Key words: Bacterial blight, resistance gene, Xa7 and Xa21, MABC, inoculation and reaction, agronomic traits, grain quality. INTRODUCTION Bacterial blight (BB) caused by Xanthomonas oryzae pv. Oryzae (Xoo) is one of the most destructive diseases widely prevalent in rice-growing regions of China, causing significant reduction in rice production and grain quality

*Corresponding auhor. E-mail: tongminmou@126.com. Tel: 0086-27-87287220. Fax: 0086-27-87287220.

losses in rice hybrids. BB is considered to be the second largest disease after blast covering all parts of China excluding Xinjiang province (Zhang et al., 2002). Breeding for disease resistance is the most effective and economical method for control of BB creating a neutral impact on the environment (Khush et al., 1989). Prior to 1980s in China, BB was effectively controlled by deploying the Xa3 and Xa4 resistance genes in rice varieties. However, the breakdown of resistance of these

8226

Afr. J. Biotechnol.

genes to new virulent BB strains had created BB outbreaks in rice growing areas in China (Xu et al., 2004). Until 2010, 38 BB-resistant genes have been reported and registered, and as many as five dominant resistant genes: Xa1, Xa21, Xa23, Xa3/Xa26, Xa27 and two recessive resistant genes (xa5 and xa13) have been cloned (Yoshimura et al., 1998; Song et al., 1995; Wang et al., 2009; Sun et al., 2004; Xiang et al., 2006; Gu et al., 2004; Blair et al., 2003; Chu et al., 2006). Amongst them, two dominant genes: Xa21 and Xa7 provide durable resistance to Xoo races. Broad spectrum resistance gene Xa21 was identified from the wild rice (Oryza longistaminata) that was mapped on chromosome 11 and also it happens to be the first cloned BB resistance gene (Song et al., 1995). Likewise, Xa7 is another broad spectrum resistance gene that was originally identified in rice cultivar DV85 (Sidhu et al., 1978) and was later on fine mapped (Chen et al., 2008). Yihui1577 is one of the elite restorer lines used in hybrid rice program of China. As many as seven hybrids in which Yihui1577 has been used as male parent were certified and released in South China, especially on account of its high yield and good grain quality. Unfortunately, all these hybrids were found to be susceptible to BB because both Yihui1577 and the male sterile lines that were used as female parents in hybrid rice breeding program were not resistant against the pathogen. Therefore, one of the key objectives of this study was to introgress Xa7 and Xa21 into the Yihui1577 background by marker assisted backcross (MABC) with foreground selection scheme. And develop the new BB resistant hybrids to replace the existing susceptible hybrids without compromising the grain yield and quality. MATERIALS AND METHODS Six BB-resistance lines previously developed at National Center of Plant Gene Research, Huazhong Agricultural University, Wuhan, China were used in this study as donors that include two lines each carrying single resistance gene Xa7, Xa21 and both Xa7 + Xa21 together. A total of 30 hybrids were produced by crossing these six BB resistant lines with five male sterile lines. Seven most prevalent and virulent strains of Xoo were inoculated artificially in field for evaluating the BB-resistance levels of the selected restorer lines and their derived hybrids. Huahui20 carrying Xa7 and Xa21, was used as a donor for BB resistance genes to be transferred to popular restorer line: Yihui1577 through MABC breeding approach. Recipient, Yihui1577 is one of the commercial restorer lines in South China with high combining ability, but is susceptible to BB. Donor, Huahui20 is a breeding line derived from pyramiding crosses among Minghui63, IRBB7 (Xa7) and IRBB21 (Xa21).

Transfer of the Xa7 and Xa21 genes by molecular marker-assisted backcross (MABC) with foreground selection scheme into Yihui1577 Yihui1577 was used as the female parent and was

crossed

with

Huahui20 in 2005 to obtain F1 plants. True F1 plants were used as the pollen plants and then backcrossed to Yihui1577 to obtain BC 1F1 seeds. Genotype of each BC1 F1 plant was determined by using tightly linked SSR/STS molecular markers and marker-assisted selection (MAS) was carried out. SSR marker, RM20582 was used in the presence of Xa7 to map a 0.14-cM interval between the markers RM20582 and RM20593 on chromosome 6 (Chen et al., 2008). STS marker, pTA248 was used in the presence of Xa21 (Huang et al., 1997). The BC1F1 plants with a genotype of Xa7xa7/Xa21xa21 were further backcrossed to Yihui1577 to produce the BC2F1 population. Consecutive backcrossing and MAS was employed in each generation. At BC3 F1 generation, plants were selfed to produce BC3 F2 population. Homozygous plants carrying Xa7, Xa21 and both of them were selected in BC3 F2 to produce BC3 F3 families. 20 plants of each breeding BC3F3 line were transplanted with a spacing of 16.7 by 20 cm between plants and rows. PCR analyses were done again to confirm the homozygous target genes. Two lines of each genotype with a phenotypically similar recurrent parent (Yihui1577) were selected and consecutively selfed to BC3F6. Finally, six selected breeding lines, HH1202 and HH1203 with Xa7Xa7 genotype, HH1204 and HH1205 (Xa21Xa21), HH1206 and HH1207 (Xa7Xa7/Xa21Xa21) were used for cross testing, resistance and agronomic trait evaluations.

Resistance evaluation through artificial BB inoculation Six breeding lines, recurrent parent (Yihui1577), donor parent (Huahui20), control varieties (IRBB7, IRBB21, and IR24), five male sterile lines (C815S, Jinke1A, Chuannong1A, Jufeng A and Chuan23A) and their F1s (Tables 2 to 4), were grown in the field of Experimental Farm of Huazhong Agricultural University (HZAU), Wuhan, China during the summer seasons of 2009 and 2010. Germinated seeds were sown in seed beds in early May. 25 days old seedlings was uprooted and transplanted as single plant per hill in the main field. Seven separate experiments were arranged for evaluation with seven Xoo strains. Each line comprised of eight plants in one row planted with a spacing of 16.7 × 26.7 cm. Amongst the seven Xoo strains, ZHE173 and GD1358 were the most prevalent and virulent in indica rice growing area of Southern China, while PXO61 and PXO99 were from Philippines. The remaining three new Xoo strains were YN24, FuJ and HEN11 from Yunnan, Fujian and Henan Provinces of Southwest China (Liu et al., 2007), respectively. All the seven Xoo strains that were provided by Department of Plant Pathology, Nanjing Agricultural University, were prepared following the method described by Maruthasalam et al. (2007). Plants were inoculated with the bacterial suspension at a density of 109 cells/ml at maximum tillering stage of plant development. All eight hills with three leaves per hill for each line were inoculated following the procedure described by Jennings et al. (1979). The lesion length was carefully measured in cm by scale after three weeks of inoculation on all inoculated leaves. Plant reaction to bacteria was scored according to Table 1, which is a standard method for scoring rice variety (including inbred and hybrid) reaction to BB in China National Rice Trial Program.

PCR amplification system Each 20 μl PCR reaction mixture contained 20 ng genomic DNA, 10 mM Tris-Hcl pH 9.0, 50 mM KCl, 2.5 mM MgCl2, 2 mM dNTPs, 10 μM each of the primer pair and 1.5 units Taq DNA polymerase. PCR reaction were performed in a Thermocycler using the following file: An initial denaturation was performed at 94°C for 5 min prior to 35 cycles of denaturation at 94°C (1 min), annealing at 55°C (1 min) for RM20582 or 60°C (1 min) for pTA248, and extension at 72°C (1 min)

Xu et al.

Table 1. Disease reaction scores for BB resistance.

Score 0 1 3 5 7 9

Lesion length (cm) <1.0 1.1 to 3.0 3.1 to 5.0 5.1 to 12.0 12.1 to 20.0 >20.0

Resistance level Highly resistance (HR) Resistance (R) Moderate resistance (MR) Moderate susceptible (MS) Susceptible (S) Highly susceptible (HS)

followed by a final extension of 10 min at 72Â°C. Polymorphism in the PCR products was detected after electrophoresis on 2.5% agarose gel for STS marker (pTA248) or 4% polyacrylamide gel for SSR marker RM20582 in 1Ă&#x2014;Tris/Borate/EDTA (TBE) buffer.

Evaluation of agronomic and grain quality traits Six selected lines and Yihui1577 were grown in a randomized block design with three replicates in the Experimental Farm of HZAU, Wuhan, China during summer season of 2009. 30 plants of each entry were planted over three rows with a plant to row spacing of 16 by 20 cm. All standard agronomic management and plant protection practices were adopted to ensure a good crop growth. Data on agronomic traits like heading date, plant height, productive panicles, average panicle length, spikelets per plant, spikelet fertility percent and 1000-grain weight were recorded as per the standard evaluation system (SES) (IRRI, 1996). Grain quality traits were measured after harvest at 12 to 14% moisture content. Grain quality characters that were analyzed were brown rice recovery rate (%), milled rice recovery rate (%), head rice recovery rate (%), milled head rice length (mm), length and breadth ratio, chalkiness degree (%), gel consistency (mm), alkali spreading (score) and amylose content (%). The grain samples were dehulled to brown rice using a Satake Rice Machine (Satake Corp. Japan) and then ground to pass through a 100-mesh sieve on a Cyclone Sample Mill (UDY Corp., Fort Collins, CO), and milled rice recovery rate, head rice recovery rate, length and breadth ratio, chalkiness degree were measured with an automatic machine (JMWT 12, China). Gel consistency was determined by the method of Cagampang et al. (1973). Alkali spreading was assayed following the procedure of Bhattacharya (1979). Amylose content (AC) was measured using the method of Tan et al. (1999). A standard curve made using rice samples of known amylose content was used to estimate the AC of each sample and for each sample, the measurements were taken in triplicate and their averages were taken.

RESULTS Molecular marker assisted selection of Xa7 and Xa21 resistance genes Analysis of polymorphism of Xa7 and Xa21 resistance gene between Yihui1577 and Huahui20 by RM20582 and pTA248 showed two markers to be co-dominant and polymorphic. We selected six lines with different resistance genes and designated them as HH1202 (Xa7),

8227

HH1203 (Xa7), HH1204 (Xa21), HH1205 (Xa21), HH1206 (Xa7+Xa21) and HH1207 (Xa7+ Xa21) based on marker data, BB resistance screening and phenotypic evaluation. Molecular identification and detection of representative line, HH1206 carrying Xa7 and Xa21 genes is depicted in Figure 1. Disease reaction of selected lines and controls to seven Xoo strains 11 entries comprising Yihui1577 (recipient parent), six selected lines (HH1202, HH1203, HH1204, HH1205, HH1206 annd HH1207), Huahui20 (donor parent) and three controls (IRBB7, IRBB21 and IR24) were evaluated for their resistance to seven strains of Xoo, PXO61 and PXO99 from the Philippines, ZHE173, GD1358, YN24, FuJ and HEN11 from China during summer seasons of 2009 and 2010 in the Experimental Farm Fields of Huazhong Agricultural University, Wuhan, China (Table 2). Results show that IR24 (susceptible control) was highly susceptible to all seven strains with the average lesion length of >12 cm, and it also indicated that inoculated pathogen reaction was stable and the pathogenicity of seven stains was normal. Resistance gene Xa7 (IRBB7) was effective against PXO61, ZHE173, GD1358, YN24 and FuJ, but was not resistant against PXO99 and HEN11. While resistance gene Xa21 (IRBB21) was resistant to six strains, except FuJ. Recurrent parent, Yihui1577 was classified as moderate susceptible, susceptible or highly susceptible towards Xoo strains PXO61, PXO99, ZHE173, GD1358, FuJ and YN24 with an average lesion length ranging from 7.20 to 23.89 cm over the two years of screening. Interestingly, Yihui1577 was resistant against HEN11 strain. Selected lines, HH1202 and HH1203 carrying single resistance gene Xa7 were moderately resistant or resistant or highly resistant to six Xoo stains with an average lesion length of 0.29 to 3.35 cm over two years, but was not resistant to PXO99. HH1204 and HH1205 carrying single resistance gene Xa21 were moderately resistant or resistant or highly resistant to six Xoo stains with the average lesion length of 0.13 to 4.82 cm over two years, but was susceptible to FuJ. The pyramiding lines, HH1206 and HH1207 carrying two R genes together (Xa7 and Xa21) were moderately resistant, resistant or highly resistant to all seven Xoo stains in this study over two years with an average lesion length in the range of 0.11 to 3.50 cm. These results indicate that the resistance effect of two resistance gene pyramiding lines were much superior to the lines carrying single resistance gene. BB resistance reaction in F1 rice hybrids Two cytoplasm male sterile (CMS) lines,

Jinke 1A and

8228

Afr. J. Biotechnol.

Figure 1. PCR detection of Xa7 (a) and Xa21 (b) in selected BB resistant line, HH1206. M, DNA marker; P1, recipient; P2, donor parent; lanes 1 to 10, 10 Plants of HH1206.

Chuannong1A, and one thermo-sensitive genic male sterile (TGMS) line, C815S, were used as female parents crossed with seven male parents that comprises six selected BB-resistant line (HH1202, HH1203, HH1204, HH1205, HH1206 and HH1207) and Yihui1577 (check) in spring season of 2009. A total of 21 F1 hybrids were evaluated for BB resistance in field along with the three female parents through artificial inoculation with seven Xoo strains in summer season of 2009 (Table 3). Results reveal that three male sterile lines were found to be susceptible to all seven Xoo strains. The lesion length of Chuannong1A was longest, followed closely by Jinke1A and that of C815S was relatively shorter. The hybrids in which the original recipient parent, Yihui1577, was used as male parent were susceptible to all seven Xoo strains. The levels of BB-resistance for hybrids in which the selected BB-resistant lines were used as male parents were significantly increased in comparison with the hybrids of Yihui1577 (original recipient parent) used as male parent. Among the crosses in which C815S was used as female parents, the hybrids with single R gene Xa7 were resistant against six of the seven Xoo strains, except PXO99, whereas the hybrids with single R gene Xa21 were resistant to six of the seven Xoo strains, except FuJ and the hybrids with two R genes Xa7 and Xa21 were resistant against all seven Xoo strains. When Chuannong1A which showed lower level of BB-resistance was used as a female parent, the resistance spectrum became narrow. Hybrids with single R gene Xa7 or Xa21 were resistant against four of the seven Xoo strains (Table 3), whereas the hybrids with two R genes Xa7 and Xa21 were resistant to six of the seven Xoo strains, except FuJ.

Another two CMS lines, Jufeng A and Chuan23A were crossed with six selected BB-resistant lines and Yihui1577 in spring season of 2010, and their 14 hybrids were evaluated for BB resistance during summer season of 2010 in a similar manner as mentioned above. Results indicate that two CMS were found to be susceptible to all seven Xoo strains (Table 4). As compared to the results among BB-resistance of hybrids in 2009, some differences had appeared in the resistance spectrum. All 12 hybrids with single or two R genes in which the selected BB-resistant lines were used as male parent were not resistant against both PXO99 and YN24. However, the hybrids with single R gene, Xa21 were highly susceptible to the Xoo strain, FuJ. In all the 30 hybrids, six selected BB-resistant lines that were evaluated for BB resistance in the study were found to be resistant against the two Xoo strains, ZHE173 and GD1358 that are widely prevalent in hybrid rice production area of Southern China. Phenotypic and grain quality evaluation Agronomic evaluation trial of the selected BB resistant lines was conducted at the Experimental Farm of HZAU, Wuhan in 2009 and the results are given in Table 5. Most agronomic traits showed non-significant difference between the selected lines and the recurrent parent Yihui1577 for all eight traits tested. However, some of the selections had shown significant difference with Yihui1577. As compared to Yihui1577, HH1202 had significant increase in the yield per plant, HH1205 had significant increase in the effective panicles per plant, and HH1206

Xu et al.

8229

Table 2. Disease reaction (average lesion length in cm ± S.E.) and resistance levels of selected BB resistant lines, recurrent parent and control varieties upon inoculation with seven Xoo strains over two consecutive years (2009 to 2010) at Wuhan.

Year

2009

2010

Line Yihui1577 HH1202 HH1203 HH1204 HH1205 HH1206 HH1207 Huahui20 IRBB7 IRBB21 IR24 Yihui1577 HH1202 HH1203 HH1204 HH1205 HH1206 HH1207 Huahui20 IRBB7

Generation BC3F6 BC3F6 BC3F6 BC3F6 BC3F6 BC3F6

BC3F8 BC3F8 BC3F8 BC3F8 BC3F8 BC3F8

Genotype of R gene Unknown Xa7Xa7 Xa7Xa7 Xa21Xa21 Xa21Xa21 Xa7Xa7/Xa21Xa21 Xa7Xa7/Xa21Xa21 Xa7Xa7/Xa21Xa21 Xa7Xa7 Xa21Xa21 Unknown

PXO61 4.07±1.23 (MR) 0.47±0.33 (HR) 0.43±0.28 (HR) 0.21±0.18 (HR) 0.22±0.10 (HR) 0.18±0.08 (HR) 0.16±0.08 (HR) 0.32±0.16 (HR) 0.35±0.31 (HR) 1.77±1.03 (R) 15.45±3.97 (S)

PXO99 12.76±2.31 (S) 15.07±2.83 (S) 11.84±2.70 (S) 2.19±1.50 (R) 2.43±1.69 (R) 1.28±0.61 (R) 1.82±1.10 (R) 4.49±1.90 (MR) 12.37±2.28 (S) 1.94±0.79 (R) 15.62±3.83 (S)

ZHE173 4.05±1.94 (MR) 0.24±0.11 (HR) 0.44±0.21 (HR) 0.23±0.15 (HR) 0.16±0.10 (HR) 0.13±0.05 (HR) 0.16±0.07 (HR) 0.38±0.22 (HR) 0.74±1.16 (HR) 1.59±0.65 (R) 21.53±3.27 (HS)

GD1358 23.89±3.68 (HS) 0.69±0.28 (HR) 0.29±0.18 (HR) 0.91±1.73 (HR) 0.44±0.28 (HR) 0.29±0.13 (HR) 0.36±0.22 (HR) 2.89±2.03 (R) 1.29±0.73 (R) 3.94±1.51 (MR) 20.88±3.07 (HS)

YN24 14.59±2.02 (S) 0.75±0.28 (HR) 1.03±0.67 (R) 0.88±0.50 (HR) 0.69±0.38 (HR) 0.36±0.21 (HR) 0.30±0.14 (HR) 1.71±1.01 (R) 1.72±0.94 (R) 1.25±0.76 (R) --

FuJ 16.34±2.98 (S) 3.31±1.64 (MR) 3.04±1.08 (MR) 13.88±3.63 (S) 12.24±1.12 (S) 1.69±0.75 (R) 1.88±0.69 (R) 3.12±1.29 (MR) 0.42±0.60 (HR) 17.86±2.88 (S) 21.26±3.86 (HS)

HEN11 2.38±1.08 (R) 2.77±0.55 (R) 1.55±0.72 (R) 0.58±0.17 (HR) 0.48±0.21 (HR) 0.52±0.18 (HR) 0.61±0.58 (HR) 1.45±0.46 (R) 6.72±2.05 (MS) 1.12±0.32 (R) 16.39±3.13 (S)

Unknown Xa7Xa7 Xa7Xa7 Xa21Xa21 Xa21Xa21 Xa7Xa7/Xa21Xa21 Xa7Xa7/Xa21Xa21 Xa7Xa7/Xa21Xa21 Xa7Xa7

7.20±2.49 (MS) 1.54±0.82 (R) 0.79±0.69 (HR) 0.28±0.42 (HR) 0.29±0.40 (HR) 0.15±0.16 (HR) 0.17±0.13 (HR) 0.76±0.56 (HR) 0.45±0.44 (HR)

13.13±3.70 (S) 13.59±2.98 (S) 16.29±4.20 (S) 4.82±1.62 (MR) 2.79±0.59 (R) 3.09±1.68 (MR) 3.50±1.08 (MR) 7.81±2.27 (MS) 9.96±3.98 (MS)

7.90±2.59 (MS) 0.36±0.43 (HR) 0.93±0.81 (HR) 0.13±0.07 (HR) 0.17±0.16 (HR) 0.11±0.04 (HR) 0.12±0.07 (HR) 0.95±0.60 (HR) 0.28±0.28 (HR)

9.45±1.75 (MS) 1.59±0.38 (R) 0.58±0.18 (HR) 0.90±0.51 (HR) 0.42±0.26 (HR) 0.21±0.20 (HR) 0.23±0.24 (HR) 0.62±0.22 (HR) 0.62±0.58 (HR)

10.15±2.31 (MS) 3.35±1.31 (MR) 2.29±0.80 (R) 1.73±0.55 (R) 1.47±0.66 (R) 0.86±0.42 (HR) 0.98±0.44 (HR) 7.68±2.16 (MS) 7.61±2.56 (MS)

21.17±3.43 (HS) 2.52±1.02 (R) 2.60±0.93 (R) 13.88±3.63 (S) 12.24±1.12 (S) 1.57±0.78 (R) 1.59±0.76 (R) 1.87±0.61 (R) 0.10±0.00 (HR)

2.84±0.72 (R) 2.68±0.39 (R) 1.71±0.43 (R) 0.74±0.23 (HR) 0.60±0.24 (HR) 0.78±0.37 (HR) 0.87±0.43 (HR) 0.56±0.18 (HR) 13.87±2.01 (S)

IRBB21

Xa21Xa21

1.43±0.41 (R)

5.00±1.92 (MR)

2.64±1.12（R）

8.27±1.91 (MS)

6.77±2.38 (MS)

20.63±3.41 (HS)

2.62±0.75 (R)

IR24

unknown

15.12±3.41 (S)

17.13±2.28 (S)

24.39±2.57 (HS)

14.58±3.85 (S)

18.32±3.32 (S)

24.54±4.22 (HS)

12.65±1.22 (S)

R, Resistant; MR, mediate resistant; HR, highly resistant; S, susceptible; MS, mediate susceptible; HS, highly susceptible.

had significant increase in the grains per plant and yield per plant, respectively, whereas HH1204 had significant decrease in the seed setting. Eight grain quality characteristics of six selected lines showed non-significant differences as compared to the recurrent parent, Yihui1577 (Table 5). These results indicate that six selected BB-resistant lines had recovered largely the

recipient parental genetic background for grain quality traits studied. DISCUSSION Currently, we understand that the BB resistance genes often breakdown if proper deployment

strategy of BB resistance genes is not done. We know the application of a single resistance gene could control rice BB but the pathogen appears to be fast evolving to overcome the resistance gene with more virulent new pathogenic races. Xa4 and Xa3 were two popular BB-resistance genes in indica hybrid rice in China before the 1980s since the indica restorer lines were introduced from IRRI

8230

Afr. J. Biotechnol.

Table 3. Disease reaction (average lesion length in cm ± S.E.) and resistance levels of hybrids and male sterile lines upon inoculation with seven Xoo strains in 2009 at Wuhan.

Entry C815S C815S/Yihui1577 C815S/HH1202 C815S/HH1203 C815S/HH1204 C815S/HH1205 C815S/HH1206 C815S/HH1207 Jinke1A Jinke1A/Yihui1577 Jinke1A/HH1202 Jinke1A/HH1203 Jinke1A/HH1204 Jinke1A/HH1205 Jinke1A/HH1206 Jinke1A/HH1207 Chuannong1A Chuannong1A/Yihui1577 Chuannong1A/HH1202 Chuannong1A/HH1203 Chuannong1A/HH1204 Chuannong1A/HH1205 Chuannong1A/HH1206 Chuannong1A/HH1207

Genotype of R gene Unknown Unknown xa7Xa7 xa7Xa7 xa21Xa21 xa21Xa21 xa7Xa7/xa21Xa21 xa7Xa7/xa21Xa21 Unknown Unknown xa7Xa7 xa7Xa7 xa21Xa21 xa21Xa21 xa7Xa7/xa21Xa21 xa7Xa7/xa21Xa21 Unknown Unknown xa7Xa7 xa7Xa7 xa21Xa21 xa21Xa21 xa7Xa7/xa21Xa21 xa7Xa7/xa21Xa21

PXO61 10.22±1.01 (MS) 4.57±1.90 (MR) 1.17±0.87 (R) 0.39±0.27 (HR) 0.57±0.33 (HR) 0.30±0.17 (HR) 0.17±0.09 (HR) 0.18±0.08 (HR) 15.96±1.25 (S) 4.58±1.31 ( MR) 2.00±0.99 (R) 0.77±0.50 (HR) 0.54±0.38 (HR) 0.28±0.16 (HR) 0.31±0.21 (HR) 0.27±0.11 (HR) 30.58±2.53 (HS) 12.91±2.93 (S) 2.35±1.43 (R) 3.12±1.43 (R) 0.30±0.15 (HR) 0.37±0.12 (HR) 0.37±0.26 (HR) 0.26±0.12 (HR)

and South Asian rice growing countries. Broad resistance gene like Xa21, had successfully controlled the spread of rice BB in the world in the past two decades, but it was overcome by new virulent races in recent years in the Philippines, India, Korea and China (Marella et al., 2001; Lee et al., 1999; Zeng et al., 2002). Therefore, it is necessary to identify and introduce new BB-resistance genes into rice breeding program besides finding tightly linked

PXO99 15.24±1.13 (S) 9.85±2.37 (MS) 14.17±2.98 (S) 14.20±2.87 (S) 1.93±1.09 (R) 2.79±0.70 (R) 2.57±0.79 (R) 4.23±2.20 (MR) 20.67±2.08 (S) 13.94±2.63 (S) 15.29±3.07 (S) 14.72±3.08 (S) 3.59±1.66 (MR) 2.91±1.79 (R) 2.68±1.31 (R) 2.29±0.55 (R) 35.22±2.89 (HS) 18.62±4.24 (S) 21.95±5.91 (HS) 17.91±3.38 (S) 6.22±1.73 (MS) 5.54±1.81 (MS) 4.90±1.89 (MR) 4.80±1.87 (MR)

ZHE173 16.21±1.23 (S) 5.16±1.49 (MS) 0.51±0.43 (HR) 0.79±0.58 (HR) 0.75±0.48 (HR) 0.20±0.08 (HR) 0.17±0.07 (HR) 0.19±0.09 (HR) 13.01±1.54 (S) 5.70±2.75 (MS) 0.51±0.41 (HR) 0.54±0.23 (HR) 0.77±1.54 (HR) 0.15±0.06 (HR) 0.13±0.06 (HR) 0.15±0.06 (HR) 36.65±2.33 (HS) 15.59±3.18 (S) 2.01±1.96 (R) 3.33±1.64 (MR) 0.63±0.63 (HR) 0.29±0.12 (HR) 0.32±0.32 (HR) 0.17±0.06 (HR)

GD1358 30.62±1.78 (HS) 23.29±3.20 (HS) 1.53±0.86 (R) 1.14±0.34 (R) 2.87±1.92 (R) 0.87±0.32 (HR) 0.68±0.33 (HR) 0.98±0.99 (HR) 35.56±2.33 (HS) 28.07±3.71 (HS) 3.74±1.35 (MR) 1.96±0.61 (R) 13.14±5.40 (S) 13.25±3.79 (S) 1.37±0.83 (R) 1.38±0.55 (R) 36.17±2.18 (HS) 29.82±4.57 (HS) 2.30±4.03 (R) 0.80±0.33 (HR) 5.94±2.08 (MS) 5.31±0.11 (MS) 0.57±0.28 (HR) 0.64±0.27 (HR)

molecular markers for MAS/MABC. Pyramiding resistance genes by MAS has been an effective method to control rice BB (Singh et al., 2001; Zhang et al., 2006; Loida et al., 2008; Gopalakrishnan et al., 2008). In this study, Xa7 and Xa21 were selected and used for transferring them to popular restorer line on account of their being highly resistant against the most virulent and prevalent Xoo races, ZHE173 and GD1358 in the indica hybrid rice

YN24 18.92±1.20 (S) 11.54±3.34 (MS) 1.45±0.62 (R) 0.66±0.24 (HR) 0.65±0.25 (HR) 0.75±0.32 (HR) 0.97±0.36 (HR) 0.43±0.17 (HR) 24.68±1.86 (HS) 14.79±3.21 (S) 0.45±0.27 (HR) 0.25±0.10 (HR) 1.16±0.80 (R) 1.69±1.31 (R) 0.46±0.22 (HR) 0.43±0.24 (HR) 35.20±2.26 (HS) 21.89±6.01 (HS) 0.31±0.17 (HR) 0.49±0.41 (HR) 0.55±0.31 (HR) 0.32±0.15 (HR) 0.46±0.45 (HR) 0.93±0.82 (HR)

FuJ 25.96±2.32 (HS) 17.74±3.21 (S) 4.93±1.71 (MR) 4.89±2.26 (MR) 15.69±2.65 (S) 16.37±4.08 (S) 3.16±1.29 (MR) 4.37±2.01 (MR) 30.68±2.79 (HS) 20.07±2.81 (S) 4.88±2.00 (MR) 5.03±1.71 (MR) 10.62±6.11 (MS) 6.29±1.92 (MS) 4.50±1.83 (MR) 4.94±1.33 (MR) 35.30±3.75 (HS) 23.23±5.20 (HS) 6.95±2.22 (MS) 5.78±2.48 (MS) 23.71±4.83 (HS) 15.70±2.84 (S) 7.43±1.99 (MS) 5.10±1.61 (MS)

HEN11 13.20±0.68 (S) 5.60±2.03 (MS) 3.15±1.49 (MR) 2.54±1.13 (R) 1.73±0.97 (R) 0.82±0.32 (HR) 0.85±0.27 (HR) 1.62±0.77 (R) 18.75±1.09 (S) 7.17±1.53 (MS) 4.69±1.35 (MR) 4.41±0.94 (MR) 1.66±0.58 (R) 1.32±0.53 (R) 1.73±0.51 (R) 1.84±0.77 (R) 25.44±3.12 (HS) 18.32±4.78 (S) 19.80±4.46 (S) 10.99±2.90 (MS) 3.55±1.06 (MR) 2.78±1.24 (R) 3.19±1.46 (MR) 3.05±0.94 (R)

growing area of Southern China (Zhang, 2009). Yihui1577 happens to be an elite restorer line and nearly seven hybrids had been released and planted in farmer fields over large areas in Southern China, but it was found to be susceptible to BB. In order to overcome the given constraint without changing much on agronomic and grain quality traits, we had selected six lines containing different BB-resistance genes by MABC approach. Evaluation of the six selected resistant lines and

Xu et al.

8231

Table 4. Disease reaction (average lesion length in cm ± S.E.) and resistance levels of hybrids and male sterile lines upon inoculation with seven Xoo strains in 2010 at Wuhan.

Entry JufengA JufengA/Yihui1577 JufengA/HH1202 JufengA/HH1203 JufengA/HH1204 JufengA/HH1205 JufengA/HH1206 JufengA/HH1207 Chuan23A Chuan23A/Yihui1577 Chuan23A/HH1202 Chuan23A/HH1203 Chuan23A/HH1204 Chuan23A/HH1205 Chuan23A/HH1206 Chuan23A/HH1207

Genotype of R gene unknown unknown xa7Xa7 xa7Xa7 xa21Xa21 xa21Xa21 xa7Xa7/xa21Xa21 xa7Xa7/xa21Xa21 unknown unknown xa7Xa7 xa7Xa7 xa21Xa21 xa21Xa21 xa7Xa7/xa21Xa21 xa7Xa7/xa21Xa21

PXO61 18.63±5.71 (S) 8.20±2.25 (MS) 1.88±0.78 (R) 0.30±0.20 (HR) 0.92±1.27 (HR) 0.26±0.22 (HR) 0.27±0.13 (HR) 0.38±0.18 (HR) 17.26±3.87 (S) 12.26±3.57 (S) 2.64±1.44 (R) 0.81±0.80 (HR) 1.31±0.92 (R) 0.78±0.64 (HR) 0.30±0.37 (HR) 0.83±0.64 (HR)

their derived hybrids showed that the different genotypes had different resistance spectrum of Xoo strains. These findings imply that we can use corresponding lines for deployment in different regions according to the distribution and prevalent degree of Xoo strains. Two selected resistant lines, HH1206 and HH1207 carrying two BB resistance genes Xa7 and Xa21 together and their derived hybrids had a stronger resistance level and much broader resistance spectrum than ILs carrying any one of the BB resistance gene individually. Therefore, it will be essential in the future to use pyramiding restorer lines with two or more Xa resistance genes in hybrid rice breeding program especially in continuous rice cropping regions where more Xoo strains are naturally available and BB diseases cause serious economic damage to rice farmers. In hybrid rice program, two parents (female and

PXO99 23.19±5.00 (HS) 19.90±5.32 (S) 18.57±2.62 (S) 21.21±6.67 (HS) 14.80±3.55 (S) 13.77±5.10 (S) 17.09±6.65 (S) 17.74±5.27 (S) 26.82±6.58 (HS) 29.16±5.72 (HS) 23.51±4.42 (HS) 28.23±6.25 (HS) 13.70±3.98 (S) 12.62±3.52 (S) 12.53±4.23 (S) 10.83±3.76 (MS)

ZHE173 17.03±3.80 (S) 8.97±2.31 (S) 0.92±0.77 (HR) 1.05±0.78 (R) 2.01±1.47 (R) 0.18±0.18 (HR) 0.16±0.15 (HR) 0.19±0.19 (HR) 20.43±4.20 (HS) 11.05±2.82 (MS) 1.24±1.01 (R) 2.61±1.47 (R) 1.11±1.12 (R) 0.26±0.28 (HR) 0.14±0.12 (HR) 0.21±0.21 (HR)

GD1358 12.81±1.61 (S) 10.91±1.44 (MS) 4.01±0.93 (MR) 1.76±0.79 (R) 2.22±0.84 (R) 0.68±0.38 (HR) 0.88±0.31 (HR) 0.98±0.41 (HR) 13.75±2.04 (S) 13.1±2.71 (S) 4.00±1.13 (MR) 3.37±1.85 (MR) 1.53±0.62 (R) 1.14±0.44 (R) 1.24±0.39 (R) 1.28±0.63 (R)

male) are involved in developing F1 hybrids, and developing resistant hybrids using dominant BB resistance genes in any one parent should be sufficient. In this case, we had developed the male parent, that is, restorer line Yihui1577 to be introgressed with Xa7 and Xa21 genes by simple MABC approach with foreground selection scheme. It is expected that the F1 should be equally resistant to the homozygous parental lines that contribute to it but we found that the susceptibility degree of female parents (male sterile lines) had a direct effect on the resistance degree of F1 hybrids to Xoo strains. BB resistance levels and spectrum of F1 hybrids with same male parents and different female parents were different from the same Xoo strains inoculated (Tables 3 and 4). This implies that it is necessary to introgress the BB-resistance genes into male sterile lines (female parents) while simultaneously

YN24 17.88±4.18 (S) 15.93±3.43 (S) 11.96±4.51 (MS) 7.30±1.88 (MS) 6.75±2.61 (MS) 6.58±2.57 (MS) 5.69±1.87 (MS) 5.52±1.14 (MS) 17.46±3.14 (S) 16.12±4.72 (S) 16.79±5.05 (S) 18.28±5.28 (S) 7.26±2.07 (MS) 8.96±2.71 (MS) 8.36±2.65 (MS) 9.21±2.56 (MS)

FuJ 24.35±2.85 (HS) 28.05±5.33 (HS) 4.21±2.23 (MR) 4.80±1.75 (MR) 28.25±3.28 (HS) 28.21±2.88 (HS) 2.81±1.00 (R) 2.64±1.03 (R) 25.14±4.35 (HS) 28.27±5.13 (HS) 8.37±2.37 (MS) 6.53±2.03 (MS) 22.07±6.6 (HS) 24.48±6.45 (HS) 5.44±2.24 (MS) 6.27±2.25 (MS)

HEN11 5.83±0.83 (MS) 4.08±0.61 (MR) 4.37±1.10 (MR) 2.69±0.73 (R) 1.75±0.40 (R) 1.43±0.37 (R) 2.07±0.52 (R) 1.86±0.48 (R) 15.17±2.71 (S) 6.46±1.39 (MS) 6.84±1.34 (MS) 5.74±1.09 (MS) 2.85±0.61 (R) 1.61±0.33 (R) 2.52±0.37 (R) 2.49±0.71 (R)

developing BB-resistance into male parents. It also suggests that the background effect of the hybrid in which the resistance genes are placed do matter. It may be due to several modifier genes that may influence the action of a given resistance gene. Recently, Xa7 resistance levels was found be enhanced by high temperature 35/31°C (day/ night) conditions (Webb et al., 2010).In general, foreground and background selections should be simultaneously carried out in backcrossing and MAS breeding program to maximize the gains. In this study, we had just made foreground and strong phenotypic selections in each backcross generation. This allowed us largely to achieve our objective of developing BB resistant Yihui1577 with Xa7 and Xa21 genes within three rounds of backcross as evident from the agronomic and grain quality traits evaluated. Similar findings have been reported by several researchers using MAS

8232

Afr. J. Biotechnol.

Table 5. Agronomic performance and grain quality traits of the select improved BB resistant lines in comparison with recurrent parent.

Characteristic Days to 50% flowering (days) Plant height (cm) Productive panicles/plant Panicle length (cm) spikelets/plant Percent spikelet fertility (%) Yield/plant (g) 1000-grain weight (g) Brown rice recovery rate (%) Milled rice recovery rate (%) Head rice recovery rate (%) Chalkiness degree (%) Length of milled head rice (mm) Gel consistency (mm) Alkali spreading value (score) Amylose content (%)

Yihui1577 97.33 113.59 6.44 22.03 1256.67 79.71 24.52 24.70 74.70 63.35 33.04 39.36 7.00 67.56 6 20.98

HH1202 96.00 114.98 6.89 21.66 1217.78 83.63 27.42* 26.94 75.57 62.92 32.77 38.40 6.96 68.87 6 21.13

HH1203 97.33 112.73 7.67 21.61 1346.56 82.71 27.87 25.03 74.81 61.22 34.07 37.05 6.90 68.23 5 20.36

HH1204 96.67 113.00 6.44 22.58 1368.53 76.45** 25.15 24.06 73.92 62.58 34.80 36.10 6.65 67.58 6 22.82

HH1205 97.33 114.30 8.33** 21.23 1411.67 77.69 26.86 24.53 74.24 62.48 34.33 39.77 6.58 66.96 6 21.79

HH1206 96.33 117.52 7.44 21.37 1532.33** 84.15 29.37* 22.80 76.41 63.59 33.95 38.00 6.75 68.34 6 20.77

HH1207 97.00 116.83 6.56 21.04 1368.22 85.09 26.90 23.12 75.21 63.25 33.66 37.35 6.82 68.26 6 21.35

Significant difference between the performance of Yihui1577 and six improved lines is indicated with single and double asterisk, *P = 0.05 and ** P = 0.01.

(Tian et al., 2011; Huang et al., 1997). Through this study, we have learnt that the foreground selection for markers can be cost effective and efficient provided we have a strong phenotypic selection which is kept in place primarily to identify segregants in each BC generation which is similar to the recurrent parent. ACKNOWLEDGEMENTS This study was supported by the National Program of High Technology Development of China (2010AA101805 and 2010AA101304), and the Bill and Melinda Gates Foundation “Green Super Rice for the Resources-Poor of Africa and Asia”. The authors are grateful to Dr. F. Liu and Dr Y. He for kindly providing Xoo races and BB resistance gene donor parents, respectively. Abbreviations BB, Bacterial blight; Xoo, Xathomonas oryzae pv. oryzae; MABC, marker-assisted backcross.

REFERENCES Bhattacharya KR (1979). Gelatinization temperature of rice starch and its determination. In: Proceedings of the Workshop on Chemical Aspects of Rice Grain Quality. Manila. IRRI: pp. 231-250. Blair MW, Carris AJ, Iyer AS, Chapman B, Kresorich S, McCouch SR (2003). High resolution genetic mapping and candidate gene

identification at the xa5 locus for bacterial blight resistance in rice (Oryza sativa L.). Theor. Appl. Genet. 107: 62-73. Cagampang GO, Perez CM, Juliano BO (1973). A gel consistency rest for eating quality of rice. J. Sci. Food Agric. 24(12): 1589-1594. Chen S, Huang ZH, Zeng LX, Yang JY, Liu QG, Zhu XY (2008). High-resolution mapping and gene prediction of Xanthomonas Oryzae pv. Oryzae resistance gene Xa7. Mol. Breed. 22: 433-441. Chu ZH, Yuan M, Yao JL, Ge XJ, Yuan B, Xu CG, Li XH, Fu BJ, Li ZK, Bennetzen JL, Zhang QF, Wang SP (2006). Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Gene. Dev. 20: 1250-1255. Gopalakrishnan S, Sharma RK, Anand K, Joseph M, Singh VP, Singh AK, Bhat KV, Singh NK, Mohapatra T (2008). Integrating marker assisted background analysis with foreground selection for identiﬁcation of superior bacterial blight resistant recombinants in Basmati rice. Plant Breed. 27: 131-139. Gu K, Tian D, Yang F, Wu L, Sreekala C, Wang D, Wang GL, Yin Z (2004). High-resolution genetic mapping of Xa27(t), a new bacterial blight resistance gene in rice, Oryzae sativa L. Theor. Appl. Genet. 108: 800-807. Huang N, Angeles ER, Domingo J, Mogpantay G, Singh S, Zhang G, Kumaravadivel N, Bennett J, Khush GS (1997). Pyramiding of bacterial blight resistance genes in rice: market-assisted selection using RFLP and PCR. Theor. Appl. Genet. 95(3): 313-320. IRRI (1996). Standard evaluation system. International Rice Research Institute, Manila, Philippines. Khush GS, Mackill DJ, Sidhu GS (1989). Breeding rice for resistance to bacterial blight. In: Bacterial Blight of rice. IRRI Manila, pp. 207-217. Jennings PR, Coffman WR, Kauffman HE (1979). Rice improvement. International Rice Reseach Institute, Los Banos, Philippes, pp. 139-146 Lee SW, Choi SH, Han SS, Lee DG, Lee BY (1999). Distribution of Xanthomonas oryzae pv. Oryzae strains virulent to Xa21 in Korea. Phytopathology, 89(10): 928-933. Liu H, Yang B, Hu B, liu F (2007). Virulence Analysis and Race Classification of Xanthomonas oryzae pv.oryzae in China. Phytopathology, 155(3): 129-139. Loida MP, Edilberto D, Merlyn S, Casiana M, Vera C, Leung H (2008).

Xu et al.

Introgression of Xa4, Xa7 and Xa21 for resistance to bacterial blight in thermo-sensitive genetic male sterile rice (Oryza sativa L.) for the development of two-line hybrids. Euphytica, 164(3): 627-636. Marella LS, Vera CM, George LC, Bernardo MA, Nelson RJ, Lenug H, Reddy JN, Sridhar R (2001). Idenification of resistance genes effective against rice bacterial bight pathogen in Eastern India. Plant Dis. 85(5): 506-512. Maruthasalam S, Kalpana K, Kumar KK, Loganathan M, Poovannan K, Raja AJ, Kokiladevi E, Samiyappan R, Balasubramanian P (2007). Pyramiding transgenic resistance in elite indica rice cultivars against sheath blight and bacterial blight. Plant. Cell. Rep. 26(6): 791-804. Sidhu GS, Khush GS, Mew TW (1978). Genetic analysis of bacterial blight resistance in seventy-four cultivars of rice, Oryza sativa L. Theor. Appl. Genet. 53(3): 105-111. Singh S, Sidhu JS, Huang N, Vikal Y, Li Z, Brar DS, Dhaliwal HS, Khush GS (2001). Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theor. Appl. Genet. 102(6): 1011-1015. Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu LH, Fauquet C, Ronald P (1995). A receptor kinase-like protein encoded by rice disease resistance gene Xa21. Science, 270(5243): 1772-1804. Sun XL, Cao YL, Yang ZF, Xu CG, Li XH, Wang SP, Zhang QF(2004). Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein. Plant. J. 37: 517-527. TanYF, Li JX, Yu SB, Xing YZ, Xu CG, Zhang QF (1999). The three important traits for cooking and eating quality of rice grains are controlled by a single locus in an elite rice hybrid, Shanyou 63. Theor. Appl. Genet. 99(3): 642-648. Tian Y, Xu JY, Li CH, Lin YJ, Mou TM (2011). Improvement of Insect-Resistance of 9311 and Development of Insect-Resistant Rice Hybrids. Sci. Agric. Sinica. 44(4): 664-672 (in Chinese with English abstract).

8233

Wang CL, Wu AB, Cao Y, Fan YL, Liang YT, Zhang KC, Sun LQ, Wang WQ, Zhao KJ (2009). Generation and characterisation of Tn5-tagged Xanthomonas oryzae pv. oryzae mutants that overcome Xa23-mediated resistance to bacterial blight of rice. Eur. J. Plant. Pathol. 123(3): 343-351. Webb KM, Ona I, Bai J, Garrett KA, Mew T, Vera Cruz CM, Leach JE (2010). A benefit of high temperature: increased effectiveness of a rice bacterial blight disease resistance gene. N. Phytol. 185(2): 568-576. Xiang Y, Cao YL, Xu CG, Wang SP (2006). Xa3, conferring resistance for rice bacterial blight and encoding a receptor kinase-like protein, is the same as Xa26. Theor. Appl. Genet. 113(7): 1347-1355. Xu ZG, Sun QM, Liu FQ, Chen ZY, Hu BS, Guo YH, Liu YF, Liu HX (2004). Race monitoring of rice bacterial blight ( Xanthomonas oryzae. Pv. Oryzae) in China. Chin. J. Rice. Sci. 18(5): 469-472 (in Chinese with English abstract). Yoshimura S, Yamanouchi U, Katayose Y, Toki S, Wang ZX, Kono I, Kurata N, Yano M, Iwata N, Sasaki T (1998). Expression of Xa1, a bacterial blight resistance gene in rice, is induced by bacterial inoculation. Proc. Natl. Acad. Sci. 95(4): 1663-1668. Zeng LX, Huang SH, Wu SZ (2002). Resistance of IRBB21 (Xa21) to five races of bacterial blight in Guangdong. J. Plant. Prot. 29: 97-100 (in Chinese with English abstract). Zhang JF, Li XH, Jiang GH, Xu Y, He YQ (2006). Pyramiding of Xa7 and Xa21 for the improvement of disease resistance to bacterial blight in hybrid rice. Plant Breed. 125(6): 600-605. Zhang Q (2009). Genetics and improvement of resistance to bacterial blight in hybrid rice in China. Chin. J. Rice. Sci. 23(2): 111-119 (in Chinese with English abstract). Zhang Q, Wang CL, Zhao KJ, Yang WC, Qiao F, Zhou YL, Jiang QX, Liu GC (2002). Development of near-isogenic line CBB23 with a new resistance gene to Bacterial Blight in rice and its application. Chin. J. Rice. Sci. 16(3): 206-210 (in Chinese with English abstract).

African Journal of Biotechnology Vol. 11(33), pp. 8234-8240, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3840 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Concentration of selected heavy metals in water of the Juru River, Penang, Malaysia IDRISS, A. A.* and AHMAD, A K. School of Environmental and Natural Resources, Universiti Kebangsaan Malaysia, Bangi, 43600, Selangor Science. Accepted 1 march, 2012

This study was conducted to determine heavy metal lead (Pb), cadmium (Cd), Zinc (Zn) and copper (Cu) concentrations in water body of the Juru River, Penang, Malaysia. A total of 20 sampling stations were chosen and water at 1 m below the surface was sampled using Van Dorn water sampler in December 2009 and April 2010. Collected water samples were kept in ice and acidified to pH 2 using nitrite acid (analytical grade HNO3). Heavy metal concentrations were determined using inductively couple plasma (ICP model Perkin elmer/elan 9000) following standard method procedures. For comparison purposes, the river was divided into three different zones in the first and second samplings that is, upstream zone, middle reach zone and estuary zone and each zone consists of 7, 7, 6 sampling sites, respectively. Generally, results indicate that Pb and Cd and Cu in the first sampling were higher than the second sampling while the concentrations of Zn in the second sampling were higher than the first sampling. Also the results indicate that the Cd and Pb and Zn in the estuary zone were the lowest as compared to other zones. Meanwhile the highest concentration of Cu was in the middle zone. In conclusion, the lowest concentrations of some heavy metals were in estuary zone, it seems to be naturally due to dilution to heavy metals from sea water. Average metal concentrations from 20 water samples indicate that studied metal concentrations were still lower than Malaysianâ&#x20AC;&#x2122;s National Water Quality Standards (INWQS) guideline. Key words: Heavy metals, pollution, river, inductively couple plasma. INTRODUCTION Aquatic ecosystem is the ultimate recipient of almost all the substances including heavy metals which are molecules of specific gravity >5.0 and non-biodegradable in nature. Pollution of heavy metals in aquatic ecosystem is growing at an alarming rate and has become an important problem worldwide (Fernandez and Olalla, 2000). Heavy metals including both essential and non-essential elements have a particular significance in ecotoxicology, since they are highly persistent and all have the potential to be toxic to living organisms (Storelli et al., 2005). Heavy metals do not exist in soluble forms for a long time in waters; they are present mainly as suspended colloids or are fixed by organic and mineral substances (Kabata-Pendias and Pendias, 2001). In aquatic

*Corresponding author. E-mail: idriss_73@yahoo.com.

ecosystems, water contamination by heavy metals is one of the main types of pollution that may stress the biotic community (Baldantoni et al., 2004). The rapid economical growth has resulted in increasing production and usage of toxic chemicals such as trace elements in Malaysia (Tetsuro et al., 2005). Following the introduction of heavy metal contaminants into a river, whether via natural or anthropogenic sources, they partition between aqueous (pore water and overlying water) and solid phases (sediment, suspended particulate matter and biota) (Prudencioa et al., 2007; Zhang et al., 2007). There is an increasing concern about heavy metal contamination in river systems. Rivers play major roles to the community especially in the fishing industry and a source of water supply for people residing within the vicinity of the area. River contamination either directly or indirectly will affect humans as a final consumer. Although some of heavy metals are required as micronutrients, it can be toxic when present higher than the

Idriss and Ahmad

8235

Figure 1. Map of the Juru River system.

minimum requirements. Rivers in Malaysia have sometimes been as dumping sites for heavy metal waste legally or illegally. Heavy metals have been introduced into rivers through land surface runoff, rainfall precipitation and factory waste outlet point discharge. Anthropogenic metals may consistently retain within the water bodies or may be taken up by organisms such as plankton, benthos or fish and finally transferred to humans (Ahmad et al., 2009). As heavy metals cannot be degraded, they are deposited, assimilated or incorporated in water, sediment and aquatic animals (Linnik and Zubenko, 2000), thus causing heavy metal pollution in water bodies. In an aquatic environment, metal toxicity can be influenced by various abiotic environmental factors such as oxygen, hardness (Ghillebaert et al., 1995), pH, alkalinity and temperature (Adhikari et al., 2006). The results of number of previous studies (Seng et al., 1987; DOE-USM, 1992; Mat et al., 1994; Lim and Kiu, 1995; DOE, 2005) conducted at various periods indicate that the Juru River Basin is grossly polluted by domestic wastes and discharges from pig farms. Other than carrying highly polluting organic materials, these wastes are also contaminated with heavy metals. Recently, Abbas et al. (2007) reported elevated concentrations of heavy metal concentrations in Kuala Juru based on the water samples collected in 2005. Juru River is one of the most productive mudflats for cockle farming in Peninsular Malaysia but the pollution inputs due to urban and

industrial activities in the Juru area are of much ecotoxicological concern (Yap and Tan, 2008). It is therefore important that a baseline study is conducted to determine the background of heavy metal concentrations in the area before any records of pollution might be accounted for. This is necessary to understand the source of heavy metal pollution for future environmental planning strategies. Therefore, the objectives of this study were to determine the total concentrations of (Pb, Cd, Zn and Cu) in the surface water collected from 20 sites in the Juru River. MATERIALS AND METHODS Study area Juru River originates from Bukit Mertajan hills located at 05째 22 N latitude and 100째 28 E longitudes, Penang, Northeastern of Malaysia (Figure 1) and drains approximately 7.95 km long. The sampling sites and locations in the Juru River are shown in Table 2. In this study latitude and longitude for all sites were marked using global positioning system (GPS) reading at the site. At sampling station 10 there are numerous plastic industries. Near sampling station 19, there is a fishing port and shipyards.

Sampling Sampling was undertaken two times along the Juru River which involves 20 sampling stations. The date for each sampling is illustrated in Table 1. Longitudinally, sampling stations in the two

8236

Afr. J. Biotechnol.

Table 1. The date for each sampling site.

Sampling First Second

Date 26, 27/12/2009 24, 25/4/2010

Table 2. List of sampling sites and geographical locations along in the Juru River.

Sampling station 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

Latitude (N) N 05˚19’54.2 N 05˚19΄59.7 N 05˚19.932΄ N 05˚19.862΄ N 05˚19΄49.7 N 05˚19΄48.2” N 05˚19΄47.1 N 05˚19΄52.4” N 05˚20΄00.9” N 05˚20΄08.2” N 05˚20΄08.3” N 05˚20΄06.6” N 05˚20΄02.1” N 05˚19΄49.2” N 05˚19΄42.4” N 05˚19΄57.0” N 05˚20΄35.0” N 05˚20΄27.0” N 05˚20΄09.1” N 05˚19΄49.6”

Longitude (E) E 100˚26΄41.8 E 100˚26΄30.6 E 100˚26.371΄ E 100˚26.250΄ E 100˚26΄05.9 E 100˚26΄01.2” E 100˚25΄55.3 E 100˚25΄52.1” E 100˚25΄51.4” E 100˚25΄46.1” E 100˚25΄36.5” E 100˚25΄27.7” E 100˚25΄18.9” E 100˚25΄19.2” E 100˚25΄14.3” E 100˚25΄02.1” E 100˚25΄07.7” E 100˚24΄30.6” E 100˚24΄04.9” E 100˚23΄45.1”

samplings were divided into three different zones, which cover upstream zone, middle reach zone and estuary zone and each zone consists of 7, 7 and 6 sampling sites, respectively. Prior to the sampling activities, in situ water quality measurements were done using multisensory probe YSI meter model 440D. Temperature, conductivity, total dissolved solids, salinity, dissolved oxygen and pH were measured in situ. The meter was calibrated in the laboratory prior to the measurements and all in situ measurements were done during the high tide period. River water was sampled at one meter below the surface using Van Dorn water sampler. Collected water samples were transferred into acid soaked teflon bottle (100 ml capacity) and acidified to pH 2 using analytical grade nitrite acid. A triplicates water samples were collected at each sampling point. All water samples were kept cooled in ice box and transported to the laboratory for analysis. In the laboratory, water samples were thawed to room temperature and were filtered through 0.45 µm pore size filter paper using vacuum pump. Heavy metals (Pb, Cd, Zn and Cu) concentrations in filtrates were determined using ICP model Perkin Elmer/Elan 9000. Reagents and quality assurance high purity chemicals and reagents (purchased from Merck and Aldrich Chemical Company), together with distilled – deionized water were used. Stock solutions (Merck) of 1,000 mg/L of the different metals were used to prepare the calibration standards.

RESULTS AND DISCUSSION Concentrations of Pb, Cd, Zn and Cu in water from the first sampling sites are given in Table 1. In general, the heavy metal concentrations of water were found to decrease in the sequence: Zn>Cu>Pb>Cd. The highest mean concentration of Pb in the first sampling was measured at site 10 at 2.25 ppb, while the lowest mean concentration of it was measured at site 20 at 0.33 ppb. The highest mean concentration of Cd was measured at sites 2 and 17 ppb, while the lowest mean concentration of Cd was measured at sites 1 and 3 at 0.06 ppb. The highest mean concentration of Zn was measured at site 7 at 71.30 ppb, while the lowest mean concentration of Zn in water was measured at site 1 at 15.38 ppb. The highest mean concentration of Cu was measured at site 12 at 10.81 ppb, while the lowest mean concentration of Cu was measured at site 5 at 1.58 ppb. Results for heavy metals concentrations in water from the second sampling are presented in Table 2. In general, the heavy metals concentrations in the second sampling were arranged in decreasing order of Zn>Cu>Pb>Cd. The highest mean concentration of Pb was measured at site 10 at 1.98 ppb, while the lowest mean concentration of it was measured at site 19 at 0.37 ppb. The highest mean concentration of Cd was measured at site 14 at 0.27 ppb, while the lowest mean concen-tration of Cd was measured at site 3 at 0.04 ppb. The highest mean concentration of Zn was measured at site 11 at 81.34 ppb, while the lowest mean concentration of Zn was measured at site 19 at 24.49 ppb. The highest mean concentration of Cu was measured at site 13 at 7.17 ppb, while the lowest mean concentration of Cu was measured at site 5 at 1.5 ppb. For comparison purpose, the river is divided into three zones named: upstream zone, middle reach zone and estuary zone in the first and second sampling. The concentration of Pb (0.001 mg/L) was in upstream and middle zones in the first and second samplings. Whereas, the concentration of Pb in the estuary zone was higher in the second sampling compared to the first sampling (0.0006 and 0.0005 mg/L, respectively) (Tables 3 and 4). However, the results illustrate that no appreciable amount of Cd was found in the upstream zones in the both samplings compared to Malaysian’s National Water Quality Standards (INWQS) requirements; it was (0.0002 mg/L) in the first sampling and (0.0001 mg/L) in the second sampling. In the middle zone, was the same Cd concentration was (0.0002 mg/L) in the first sampling while it was 0.0001 mg/L in the second sampling. Generally, in the second sampling the concentration of Zn in the three zone was higher than the concentration in the first sampling, in upstream it was 0.038 and 0.035 mg/L, in the middle zone was the same 0.052 mg/L, in estuary zone was 0.036 and 0.034 mg/L in the second and first samplings, respectively. The result clearly indicates that concen-tration of Cu (0.0004 mg/L) in the estuary zone in the first sampling was higher than

Idriss and Ahmad

Table 3. Means and SD for the first sampling of heavy metal concentrations ppb in water from 20 sites in Juru river.

Sites Pb Mean SD `1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

0.95 1.19 1.85 1.24 1.09 1.45 1.74 1.43 1.63 2.25 1.59 1.65 1.32 0.83 1.09 0.66 0.54 0.42 0.43 0.33

0.26 0.08 0.41 0.14 0.04 0.39 0.39 0.10 0.14 0.66 0.13 0.14 0.03 0.04 0.00 0.15 0.05 0.00 0.01 0.08

Cd Mean SD 0.06 0.49 0.06 0.43 0.10 0.16 0.34 0.11 0.19 0.08 0.09 0.37 0.35 0.21 0.16 0.16 0.49 0.12 0.41 0.26

0.03 0.10 0.01 0.18 0.01 0.07 0.08 0.04 0.05 0.03 0.04 0.06 0.04 0.08 0.05 0.08 0.20 0.01 0.11 0.06

Zn Mean 15.38 23.11 54.85 22.93 27.39 31.57 71.30 46.33 58.01 68.12 55.77 59.51 60.02 21.34 53.88 27.94 17.69 33.48 30.61 43.92

SD 2.62 0.10 8.08 5.00 3.00 0.42 0.35 8.76 9.27 9.57 2.78 8.72 5.20 3.71 1.92 0.40 9.71 3.00 3.04 11.47

Cu Mean 3.25 2.71 1.97 3.56 1.58 4.21 2.46 5.77 2.65 3.62 4.76 10.81 8.54 5.60 3.72 3.07 1.97 6.11 8.26 3.41

SD 0.44 0.40 0.32 0.68 0.39 1.06 0.07 1.36 0.65 0.75 0.56 0.79 1.32 1.25 0.43 0.59 1.20 0.49 0.26 1.51

Table 4. Means and SD for the second sampling of heavy metal concentrations ppb in water from 20 sites in Juru River.

Sites Pb Mean 1 1.19 2 1.07 3 1.50 4 0.82 5 1.37 6 1.26 7 1.79 8 1.31 9 1.83 10 1.98 11 1.40 12 1.56

SD 0.25 0.13 0.39 0.33 0.21 0.18 0.49 0.21 0.61 0.40 0.23 0.23

Cd Mean 0.10 0.23 0.04 0.07 0.25 0.08 0.06 0.21 0.12 0.10 0.11 0.15

SD 0.03 0.01 0.02 0.01 0.10 0.02 0.02 1.00 0.05 0.05 0.01 0.06

Zn Mean 38.73 42.51 39.82 41.48 40.04 34.20 35.44 46.50 43.81 39.26 81.34 61.16

SD 5.67 6.48 5.42 5.36 2.02 2.52 1.62 7.64 1.35 4.28 6.49 9.42

Cu Mean 2.62 1.61 1.90 1.89 1.50 2.76 2.81 2.89 2.56 2.42 3.50 6.07

SD 0.65 0.32 0.89 0.68 0.05 0.37 0.66 0.51 0.62 0.70 0.60 0.69

8237

8238

Afr. J. Biotechnol.

Table Contd

13 14 15 16 17 18 19 20

1.21 0.90 1.14 0.73 0.62 0.43 0.37 0.44

0.10 0.15 0.20 0.09 0.11 0.10 0.05 0.14

0.22 0.27 0.16 0.12 0.17 0.17 0.08 0.21

0.08 0.10 0.06 0.04 0.02 0.05 0.03 0.08

0.0012 0.001 0.0008

0.0006

Upst11 upst

0.0004

Upst22 upst

0.0002 0 Pb

60.004 32.56 51.64 35.38 27.74 43.37 24.49 38.49

10.05 6.94 5.00 7.92 1.76 7.426 1.66 7.07

7.17 4.83 2.06 3.28 1.92 5.18 6.32 3.34

0.77 1.41 0.42 0.38 0.60 0.64 1.10 0.66

0.04 0.035 0.03 0.025 0.02 0.015 0.01 0.005 0

upst Upst1 1 Upst2 2 upst

Figure 2. Comparison between the concentration of the metals in the upstream middle zone for first and second sampling (mg/L). Upst 1, Upstream zone in the first sampling. Upst 2, Upstream zone in the second sampling.

the concentration in the second sampling (0.0003 mg/L). the same concentration of Cu (0.002mg/L) was noted in was recorded in the middle zone in the first sampling, while the concentration (0.002 mg/L) resulted in the second sampling. Figures 2, 3 and 4 show the concentration of the studied metals in the three zones for the both samplings. A previous study (Yap and Tan, 2008) was conducted on water and sediments at the three sites (upstream, middle reach and estuary zones of the Juru River). Results show that the concentrations of heavy metals (Cd, Cu, Ni, Fe, Pb and Zn) in the estuary zone were 0.024, 0.005, 0.001, 2.520, 0.0287 and 0.240 mg/L, respectively. In the middle reach zone the concentrations were 0.019, 0.070, 0.001, 35.7, 0.677 and 0.609 mg/L, respectively. Concentrations of the metals in the upstream zone were 0.015, 0.017, 0.001, 0.761, 0.255 and 0.073 mg/L, respectively. In general the concentrations of the heavy metals in the present study were less than the concentrations men-tioned in the study above. Another study (Shuhaimi et al., 2008) with

the upstream zone in the both samplings. The concentration of Cu (0.005 mg/L) samples collected in October 2004 mentioned that the concentrations of heavy metals (Fe, Cu, Pb, Cd and Zn) were 1028, 0.871, 2.105, 0.473 and 5.589 Âľg/L, respectively. A study (Sanayei et al., 2009) conducted in the autumn at the Morgan site showed that the concentration of the heavy metals (Cd, Cu, Ni, Pb and Zn) were ND, 0.061, 0.72, 0.41 and 0.05 mg/L, respectively. A previous study (DOE-USM, 1992) had estimated that Juru River and industrial effluent from a nearby man made canal may be two of the main reasons for the decline in fisheries in the area since the early 1970s (Yahya and Leong, 1987). Sathiamurthy (2008) resulted that the sources of pollutants in Juru River are mainly from domestic sewage and agricultural runoff. According to the INWQS for Malaysia (DOE, 2002), levels of all the studied metals (Pb, Cd, Zn and Cu) in the three zones(upstream, middle reach zone and estuary zones) in the first and second samplings were all categorized in

Idriss and Ahmad

0.0012

0.12

0.001

0.1

0.0008

0.08

0.0006

middle Middle11

0.0004

middle Middle22

Middle22 middle

0.04

0.0002

0.02

0 Pb

Middle11 middle

0.06

Figure 3. Comparison between the concentrations of the metals in the middle zone for first and second sampling (mg/L). Middle 1, Middle zone in the first sampling; Middle 2, middle zone in the second sampling.

0.0006

0.1

0.0005

0.08

0.0004

0.06

0.0003

estaury Estuary 1 1

Estuary 1 1 estaury 0.04 estaury Estuary 2 2

0.0002 0.0001

0.02

Estuary 2 2 estaury

Figure 4. Comparison between the concentration of the metals in the estuary zone for first and second sampling (mg/L). Estuary 1, Estuary zone in the first sampling. Estuary 2, Estuary zone in the second sampling.

Table 5. The mean concentrations of the heavy metals in the first sampling in the three zones comparing with INWQS.

Mg/L Pb Zn Cd Cu

INWQS 0.02 0.4 0.01

Upstream 0.001 0.035 0.0002 0.002

Middle 0.001 0.052 0.0002 0.005

Estuary 0.0005 0.034 0.0002 0.004

8239

8240

Afr. J. Biotechnol.

Table 6. The mean concentrations of the heavy metals in the second sampling in the three zones comparing with INWQS.

Mg/L Pb Zn Cd Cu

INWQS 0.02 0.4 0.01

Upstream 0.001 0.038 0.00006 0.002

class I. As far as industrial waste is concerned, apparently the presence of heavy metals in Juru River is not alarming. Tables 5 and 6 explain the mean concentrations of the heavy metals in the three zones in the first sampling and the second sampling compared with the INWQS. Conclusion The river generally has low concentrations of the studied metals compared with the INWQS. Sources of pollutants in Juru River are mainly from domestic sewage and agricultural runoff. As far as industrial waste is concerned, apparently the presence of heavy metals levels in Juru River is not alarming. ACKNOWLEDGEMENT We would like to acknowledge high education in Libya for financial support and also the laboratory assistants for sampling and analysing the water samples. REFERENCES Abbas FMA, Ahmad A, Ismail N, Mat Easa A (2007). Multivariate analysis of heavy metals concentrations in river estuary. Environmental Monitoring and Assessment DOI. 10.1007/s10661007-9966-x. Press. Adhikari S, Ghosh L, Ayyappan S (2006). Combined effect of water pH and alkalinity on the accumulation of lead, cadmium and chromium to labeo rohita (hamilton). Internat. J. Environ. Sci. Technol. 3(3): 289296. Ahmad AK, Mushrifah I, Mohamad Shuhaimi-Othman (2009). Water Quality and Heavy Metal Concentrations in Sediment of Sungai Kelantan, Kelantan, Malaysia: A Baseline Study. Sains Malaysiana, 38(4): 435-442 Baldantoni D, Alfani A, Tommasi PD (2004). Assessment of macro and microelement accumulation capability of two aquatic plants. Environ. Pollut. 130: 149-156. DOE (2005). Malaysia Environmental Quality Report 2004. Department of Environment, Ministry of Natural Resources and Environment Malaysia. DOE (1995). Malaysia Environmental Quality Report. Department of Environment, Ministry of Natural Resources and Environment Malaysia. DOE-USM (1992). Development of Water Quality Criteria and Standards Classification-Juru River, Vol. VIII. Draft Final Report, Department of Environment, Malaysia, Innovation and Consultancy Centre, Universiti Sains Malaysia.

Middle 0.001 0.052 0.0001 0.002

Estuary 0.0005 0.036 0.0001 0.003

3-Fernandez LG, Olalla HY (2000). Toxicity and bioaccumulation of lead and cadmium in marine protozoan communities. Ecotoxicology and Environmental Safety. 47: 266–276. doi:10.1006/eesa.2000. 1944. Ghillebaert F, Chaillou C, Deschamps F, Roubaud P (1995). Toxic effects of three pH levels, of two reference molecules on common carp embryo. Ecotoxicology and Environmental Safety. 32: 19–28. doi:10.1006/eesa.1995.1080 Kabata-Pendias A, Pendias H (2001). Trace elements in soils and plants (3rd ed.). Boca Raton, FL: CRC Press. Lim PE, Kiu MY (1995). Determination and speciation of heavy metals in sediment of the Juru River, Penang, Malaysia. Environ. Monit. Assess. 35: 85-95. Linnik PM, Zubenko IB (2000). Role of bottom sediments in the secondary pollution of aquatic environments by heavy-metal compounds. Lakes and Reservoirs: Res. Manage. 5: 11-21. doi:10.1046/j.1440-1770.2000.00094.x. Mat I, Maah MJ, Johari A (1994). Trace metal geochemical associations in sediments from the culture-bed of Anadara granosa. Mar. Pollut. Bull. 28(5): 319-323. Prudencioa MI, Gonzalezb MI, Diasa MI, Galanb E, Ruizc F (2007). Geochemistry of sediments from El Melah lagoon (NE Tunisia): A contribution for the evaluation of anthropogenic inputs. J. Arid Environ. 69: 285-298. Sanayei Y, Norli I, Talebi SM (2009). Determination of heavy metals in Zayandeh rood river, Isfahan-Iran. World Appl. Sci. J. 6(9): 12091214 Sathiamurthy Dr.Edlic. recommendations for improving sungai juru (2008). Available from http://www.sungaijuru.com/v2/category/otherarticles/. Seng CE, Lim PE, Ang TT (1987). ‘Physical-Chemical Study in Environmental Base-line Studies on the Penang Development Corporation Proposed Land Reclamation in the Prai Industrial Estate, Consultancy Report Prepared for the Penang Development Corporation. Shuhaimi-Othman M, Ahmad A, Mushrifah I, Lim EC (2008). Seasonal influence on water quality and heavy metals concentration in Tasik Chini, Peninsular Malaysia. The 12th world lake conference, pp. 300303. Storelli MM, Storelli A, D’ddabbo R, Marano C, Bruno R, Marcotrigiano GO (2005). Trace elements in loggerhead turtles (Caretta caretta) from the eastern Mediterranean Sea: Overview and evaluation. Environ. Pollut. 135: 163-170. Tetsuro Agusa A, Takashi Kunito B, Genta Yasunaga A, Hisato Iwata A, Annamalai Subramanian A, Ahmad Ismail C, Shinsuke Tanabe A (2005). Concentrations of trace elements in marine fishand its risk assessment in Malaysia. Mar. Pollut. Bull. 51: 896-911. Yahya MN, Leong YK (1987). Environmental Baseline Studies on the Penang Development Corporation Proposed Land Reclamation in the Prai Industrial Estate. Final Consultancy report submitted to the Department of Environment, Malaysia. Yap CK, Tan SG (2008). Heavy metal pollution in the juru river basin receiving industrial effluents: the need for biochemical and molecular studies in the edible cockles anadara granosa. Malays. Appl. Biol. 37(2): 63-68. Zhang LP, Ye X, Feng H, Jing YH, Ouyang T, Yu XT, Liang RY, Gao CT, Chen WQ (2007). Heavy metal contamination in western Xiamen Bay sediments and its vicinity, China. Mar. Pollut. Bull. 54: 974-982.

African Journal of Biotechnology Vol. 11(33), pp. 8241-8249, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4300 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Influence of two inocula levels of Saccharomyces bayanus, BV 818 on fermentation and physico-chemical properties of fermented tomato (Lycopersicon esculentum Mill.) juice John Owusu1,2, Haile Ma1,5*, Ernest Ekow Abano1,3 and Felix Narku Engmann1,4 1

School of Food and Biological Engineering, Jiangsu University, 301 Xuefu Road, Zhenjiang 212013, China. Hospitality Department, School of Applied Science and Technology, Koforidua Polytechnic, Koforidua, Ghana. 3 Agricultural Engineering Department, University of Cape Coast, Cape Coast, Ghana. 4 Hotel Catering and Institutional Management Department, Kumasi Polytechnic, Kumasi, Ghana.

Key Laboratory for Physical Processing of Agricultural Products of Jiangsu Province, 301 Xuefu Road, Zhenjiang 212013 Accepted 2 April, 2012

The influence of two inocula levels of the yeast Saccharomyces bayanus, BV 818, 0.01 (w/v) and 0.02% (w/v) on physico-chemical properties of fermented tomato juice was investigated. The properties studied include alcoholic strength, dry extract, residual sugar, pH, titratable acidity and volatile acidity. During fermentation, the pH, titratable acidity, brix, CO2 production and changes in phenolic composition of the fermented juice were monitored. Both pH and titratable acidity showed an upward trend for the fermented juices. Alcoholic strength of the fermented juice produced with 0.01% (w/v) inoculum level was significantly higher (p<0.05) than that produced with 0.02% (w/v). The total phenolics and pH for wine obtained from 0.02% (w/v) inoculum level were significantly higher (p<0.05) than that from 0.01%. Volatile acidity values of both wines were below the permitted levels. During ageing, most colour parameters showed higher values in both fermented juices. Inoculum level 0.01% (w/v) gave better physico-chemical qualities and was therefore found to be better than 0.02% (w/v) in producing fermented tomato juice. The 0.01% (w/v) inoculum-fermented tomato juice scored higher for overall acceptance than that of 0.02% (w/v) inoculum-fermented tomato juice, but the acceptance levels were not significant. Key words: Tomato, inoculum level, wine, fermentation.

INTRODUCTION Wine is usually made through fermentation of grape juice. However, juices of many fruits are reported to have been used for making wine. This includes African bush mango (Akubor, 1996), guava (Anderson and Badrie, 2005; Sevda and Rodrigues, 2011), jamun fruit (Chowdhury and Ray, 2007), litchi fruit (Singh and Kaur, 2009), amla fruit (Soni et al., 2009), kinnow fruit (Panesar et al.,

*Corresponding author. E-mail: mhl@ujs.edu.cn. Tel: +86-51188790958. Fax: +86 511 88 78 0201.

2009), apples (Enidiok and Attah, 2010), papaya (Lee et al., 2010), raspberry (Duarte et al., 2010), and tomato 2009), apples (Enidiok and Attah, 2010), papaya (Lee et al., 2010), raspberry (Duarte et al., 2010), and tomato (Mathapati et al., 2010). Many fruits and vegetables are known to be good sources of vitamins, minerals, fibre and phytochemicals. The fermentation of juices of most of these fruits is likely to produce wines of varied nutritional, phytochemical and sensory qualities. The production of any alcoholic beverage involves alcoholic fermentation, which may start spontaneously either by wild yeast or by inoculation of must or juice with

8242

Afr. J. Biotechnol.

yeast of known characteristics (Jackson, 2008). The strain of the yeast and the level of yeast inoculated are among the most important factors in determining the quality of the alcoholic beverage produced. The inoculum level, which is the quantity of starter culture added to must or juice to initiate fermentation, is known to influence the duration of lag phase, specific growth rate, biomass yield, and the quality of final product in commercial industrial fermentation (Sen and Swaminathan, 2004). An inoculum level of 7.5% (v/v) is reported to be the optimum in producing 11% (v/v) ethanol from kinnow fruit (Panesar et al., 2009). The use of inappropriate inoculum levels may lead to problems such as competition among yeast cells leading to premature death and hence large quantities of residual sugar, etc. Therefore, it is important that the right level of inoculum is utilized in fermentation to make maximum use of the available fermentable sugar. Tomato is one of the most important crops of the world. It is the most prominent source of lycopene (von Elbe and Schwartz, 1996), the carotenoid known to be the most powerful antioxidant of all carotenoids (Di Mascio et al., 1989). In addition to lycopene, tomato is endowed with other types of antioxidants, including ascorbic acid, vitamin E, carotenoids and flavonoids (USDA, 2009). Epidemiological studies have suggested that consumption of tomato and tomato products is closely linked with lower incidence of cardiovascular disease, prostate, gastrointestinal, and epithelial cell cancer (Rao and Rao, 2007). Tomato is a perishable commodity and has to be processed to extend its shelf life. The well known existing processed forms of tomato include juice, paste, puree, soup, ketchup, sauce and canned tomatoes (Motamedzadegan and Tabarestani, 2011). Winemaking could help to broaden the processing avenues of tomato. Mathapati et al. (2010) have reported the production of wine from tomato juice using 2% (v/v) Saccharomyces cerevisiae 3282. However, in the present study Saccharomyces bayanus was used, because it is known to conduct equally effective alcoholic fermentation (Jackson, 2008), produce little volatile acidity, and give more aromatic alcohols and ethyl esters (Antonelli et al., 1999). The use of different levels of inocula in fermentation of tomato juice has not received any attention by any author. Against this background, this study was conducted to investigate the effect of two inocula levels (0.01 (w/v) and 0.02% (w/v)) of S. bayanus, BV 818 at 20±1°C on the physico-chemical properties of fermented tomato juice. MATERIALS AND METHODS Preparation of yeast culture The dry yeast used for tomato juice fermentation was S. bayanus BV 818 (Angel Yeast Company Ltd, Hubei Province, China). This was kept in a refrigerator at 5°C according to the manufacturer’s instructions. The media used to culture the yeast was yeast

peptone dextrose (YPD) (yeast extract – 0.5% (w/v), peptone 1.0% (w/v), and glucose - 2% (w/v)). The pH of the culture media was adjusted to 5.0 using tartaric acid. The culture was put into a250 Erlenmeyer flask, sterilized in an autoclave at 121°C for 20 min, and allowed to cool. Dry yeast of 0.3 g was then suspended in the 100 ml sterilized medium to obtain yeast concentration of 3 g/L. The suspension was heated to 40°C for 20 min to rehydrate the yeast (Kraus et al., 1981), then cooled to 25°C for adaptation (Jackson, 2008) before it was incubated in an incubator shaker (QYC 211 Incubator Shaker, Shanghai Test Equipment Co. Ltd.) at 30°C for 24 h using a speed of 160 rpm.

Preparation and inoculation of tomato must The tomato was washed thoroughly with tap water. It was then sterilized with 2% potassium metabisulphite (KSM), and rinsed with distilled water. The tomatoes were cut into smaller pieces and blended using a Kenwood blender (Philips HR 2006, China). Ammonium phosphate and pectic enzyme concentrations of 0.5 g/L each was added to the must. Table sugar of a concentration of 200 g/L was added (Ribereau-Gayon et al., 2006) to raise the total soluble solids (TSS) from 4.9±0.1 to 15.5±0.2 °Brix. The pH of the mixture was adjusted from 4.22±0.11 to 3.21±0.01 using equal amounts of tartaric and citric acids, thereby raising the titratable acidity (TA) from 2.8±0.1 to 4.9±0.1 g/L (citric acid). The must was pasteurized at 40°C in a water bath for 1 h. It was then allowed to cool to room temperature and inoculated with the 24-h yeast culture (S. bayanus BV 818).

Inocula levels Must of volume 0.9 L, which weighed 1.06 kg and had dry matter content of 5% was inoculated with 30 and 60 ml of the 24-h yeast culture of concentration 3.0 g/L. The must contained 855 ml of water and the resulting yeast concentrations were 0.1 (0.01% w/v) and 0.2 g/L (0.02% w/v) for the 30 and 60 ml inocula respectively. The wine produced with 0.01% w/v inoculum level was designated as fermented tomato juice Lo (FTJ Lo) while the one from 0.02% w/v was designated as fermented tomato juice Hi (FTJ Hi).

Fermentation of tomato must The mixture was incubated at 20±1°C for seven days. During fermentation, the pH, titratable acidity (TA), total soluble solids (TSS), weight loss of fermentor as a measure of the rate of carbon dioxide (CO2) production (El Haloui et al., 1988), total phenols and colour parameters were monitored starting from the second day up to the seventh day. After fermentation, the wine was cold stabilized at 5°C for 24 h and centrifuged at 5000 rpm for 10 min. It was then filtered and kept at 5°C until needed for analysis.

Analysis of fermented tomato juice The method of Sadler and Murphy (2010) was used to determine TA and the results were expressed in g/L citric acid. The pH was measured using a pH meter (PHS-2C Precision pH/mV meter, China) after calibration with solutions of pH 7 and 4, respectively according to the AOAC (1984). The acid taste index (ATI) was calculated using the formula: ATI = TA (g/L) - pH (Plane et al., 1980). The TSS was determined with the Abbe Refractometer with temperature compensation (WAY-2S, Germany) and the values expressed in degree brix (°Brix). Alcoholic strength was measured using the spectrophotometric method after distillation of the alcohol as in Caputi et al. (1968). The residual sugar content was mixed

Owusu et al.

determined by the dinitrosalicyclic (DNS) method (Miller, 1972). Total phenolics were monitored during fermentation by spectral analysis as described by Somers and Ziemelis (1985). Volatile acidity was determined by AOAC (1960). Dry extract was determined by AOAC (1995) and the results expressed in g/L. Colour parameters were measured following the method of Glories (1984). Absorbance was measured at 420 (A420), 520 (A520) and 620 nm (A620) and the values used for calculating colour density, intensity, tint, and % yellow colour, % red colour and % blue colour are as follows: Colour density (CD) = A420 + A520, colour intensity (CI) = A420 + A520 + A620, colour tint or hue (CT) = A420/A520, % yellow = 100 x (A420/CI), % red = 100 x (A520/CI), % blue =100 x (A620/CI). The absorbance at 280 and 420 nm is a measure of total phenols (Somers and Ziemelis, 1985) and browning index (Jackson, 2008), respectively.

Ageing The wines produced were aged in bottles at 5±2°C for eight months. During this period the following parameters were monitored: pH, TA, TSS, alcoholic strength, residual sugar, volatile acidity, dry extract, acid taste index, colour intensity, tint, density, % yellow, % red, % blue, absorbance at 280 and 420 nm.

Sensory evaluation A 10-member semi-trained panel was used to assess the taste, colour, aroma, and the overall acceptance of the two fermented tomato juices on a 5-point hedonic scale. On the scale: 1, dislike very much; 2, dislike much; 3, neither like nor dislike; 4, like much; 5, like very much. The mean scores of the panelists were analyzed.

Statistical analysis The data was analyzed using one-way analysis of variance (ANOVA). The statistical package used for the analysis was SPSS Statistics 17.0. Differences between means were separated using least significance difference (LSD).

RESULTS AND DISCUSSION Fermentation monitoring The results on fermentation monitoring are shown in Figures 1a, b, 2a, b and 3. In the present study, FTJ Hi achieved maximum CO2 production (1.6 g/L/h) at about 30 h while FTJ Lo had maximum CO2 production of 1.4 g/L/h at about 50 h after commencement of fermentation (Figure 1b). The maximum CO2 production figures recorded in this study were within the range of those reported for raspberry wine, produced from TSS of 16 °Brix (Duarte et al., 2010). The CO2 production assumed a constant value which was earlier for FTJ Hi than FTJ Lo. This is an indication that fermentation of FTJ Hi came to completion earlier than FTJ Lo. A sharp drop in TSS for both inocula levels was associated with a large CO2 production (Figures 1a and b). This agrees with what was reported for papaya juice fermentation in which both

8243

culture of S. cerevisiae and Williopsis saturnus and monoculture of S. cerevisiae experienced a sharp fall in brix with time (Lee et al., 2010). In the course of fermentation, both pH and TA showed upward trend (Figures 2a and b) for the two fermented tomato juices. Generally, the increase in TA was slightly higher for FTJ Lo than FTJ Hi. Increase in TA with fermentation time has been reported for African bush mango wine (Akubor, 1996). The increase in TA with fermentation time may be due to the production of acids by yeast during fermentation (Ribereau-Gayon et al., 2006). Titratable acidity increase in the course of fermentation is desirable because it can help prevent spoilage by microorganisms. The pH of the tomato must used for producing the fermented juices was ameliorated with citric and tartaric acids, so the increase in pH may be caused by crystallization of tartrate (Jackson, 2008). At the end of fermentation on the seventh day, the pH of FTJ Lo was lower than that of FTJ Hi (Figure 2b). Figure 2b shows the variation of total phenolics, expressed in absorbance units (AU) during fermentation. There was an initial fall in total phenolics up to the second day, followed by gradual increase with sharp increase in pH with fermentation time. The total phenolics of FTJ Hi were slightly higher than that of FTJ Lo from the first day of fermentation to the last day. Increased phenolics content with fermentation time may be attributed to increased dissolution of phenols in increasing ethanol concentration from the tomato pomace (Ribereau-Gayon et al., 2006). The results show that increasing pH may be a contributory factor in the extraction of phenolics during fermentation. Colour density of the fermenting must fluctuated over the fermentation period with increasing phenolic content (Figure 3). This may be due to changes in anthocyanin from one form to another with pH changes (RibereauGayon et al., 2006). Physico-chemical properties of fermented tomato juice before and after ageing The physico-chemical properties of the fermented tomato juices produced are shown in Table 1. FTJ Lo had a significantly lower (p<0.05) pH than FTJ Hi, both before and after ageing. Since FTJ Hi was produced by using a higher inoculum level than FTJ Lo, higher competition and more yeast deaths, leading to low acid production in the case of the former than the latter, may account for the pH variation observed (Ribereau-Gayon et al., 2006). The pH of the two FTJ Lo and FTJ Hi (Table 1) was around 3.5 (Ribereau- Gayon et al., 2006). The favourable pH range for white wine is 3.1 to 3.4, and that of red wine is 3.3 to 3.6 (Jackson, 2008). Enidiok and Attah (2010) reported pH value of 3.68 and 3.79, respectively for Syzygium malaccensis and Eugenia owariensis apple wines. Ribereau-Gayon et al. (2006) have observed that low pH values in wines enhance microbiological and physicochemical stability. Before ageing, the TA of both

8244

Afr. J. Biotechnol.

Figure 1. Variation in (a) TSS and (b) CO2 production with fermentation time for the two fermented tomato juices.

wines was almost the same, but after ageing, the values were the same (Table 1). In addition, the TA values for both wines after ageing were significantly higher (p<0.05) than those before ageing. Increase in TA after fermentation has been reported for jamun wine by Chowdhury and Ray (2007). Also, an increase in acidity during a six month ageing period had been reported for wines aged in bottles (Garde-Cerdan et al., 2008). The TA figures recorded in the present study fall within the range 5.5 to 8.5 g/L in most wines (Jackson, 2008). The acid taste index values of FTJ Lo was not significantly different (p>0.05) from that of FTJ Hi, both before and after ageing. However, each fermented tomato juice recorded a significantly higher acid taste index values after ageing than before ageing (Table 1). Dry red wines have acid taste index values of two to three and dry white

wines have 2.7 to 3.7, and values too far below these levels make wine flabby while those too above make the wine sharp and acidic (IIand et al., 2000). In the present study, the acid taste index values before ageing fell within the reported figures but were higher after ageing (Table 1). This gives an indication that the fermented tomato juices would taste a bit acidic after ageing than before. The TSS of tomato juice was 4.9±0.1 °Brix, but was ameliorated to 15.5±0.1 °Brix. The TSS of FTJ Lo and FTJ Hi were not significantly different (p>0.05) before and after ageing. Even though the residual sugar values recorded for FTJ Lo was lower than that of FTJ Hi, the difference was not significant (p>0.05) both before and after ageing. Both fermented tomato juices gave residual sugar levels lower than 2 g/L and this agrees with what was reported by Torija et al. (2003). Residual sugar

Owusu et al.

8245

Figure 2. a) Variation in TA, and b) total phenols (TP) and pH with fermentation time.

affects the microbial stability of wines (Jackson, 2008). FTJ Lo recorded a significantly higher (p<0.05) alcoholic strength value than FTJ Hi before ageing, and this difference may be attributed to a more efficient sugar consumption in FTJ Lo than FTJ Hi. Much residual sugar was left in FTJ Hi than FTJ Lo after fermentation, though this difference was not significant. The alcoholic strength values reported for icewines produced with 0.2 and 0.5 g active dried wine yeast/L are 7.8 and 12.0%, respectively (Kontkanen et al., 2004). Alcoholic strength values of 11.00Âą0.04 and 10.50Âą0.03 (%v/v) have been reported for S. malaccensis and E. owariensis apple wines (Enidiok and Attah, 2010). An inoculum level of 10% (v/v) is reported to produce 9% (v/v) ethanol from Amla (Emblica officinalis Gaertn.) fruit wine (Soni et al., 2009).

Mathapati et al. (2010) have reported a value of 7.88% alcoholic strength for tomato wine by using 2% (v/v) S. cerevisiae inoculum level. In the fermentation of kinnow sera, cane and kinnow-cane juice involving three inocula levels, 5, 7 and 9% (v/v), Pratima et al. (2006) reported maximum ethanol production for 5% (v/v) inoculum level. The optimum inoculum level for ethanol production in guava wine was reported as 8% (v/v) for S. cerevisiae NCIM 3095 (Sevda and Rodrigues, 2011). After ageing, even though both fermented juices recorded significant reduction (p<0.05) in alcoholic strength, FTJ Hi had a significantly higher value than FTJ Lo. Soni et al. (2009) reported a reduction in ethanol content during ageing for amla wine. The reduction in ethanol content during ageing may be due to oxidation of ethanol to acetal-

8246

Afr. J. Biotechnol.

Figure 3. Variation in colour density with fermentation time. Table 1. Physico-chemical properties of fermented tomato juice before and after ageing.

Parameter pH TA (g/L citric acid) Acid taste index TSS (°Brix) Ethanol (%v/v) Residual sugar (g/L) Volatile acidity(g/L) Dry extract (g/L) A420 CI (A420+A520+A620) CT (A420/A520) CD (A420+A520) % Yellow colour % Red colour % Blue colour A280 (AU)

Before ageing Fermented tomato Fermented tomato juice Lo juice Hi 3.49±0.02a 3.52±0.02b 6.3±0.0a 6.1±0.0a a 2.83±0.04 2.60±0.05a a 5.6±0.1 5.5±0.1a a 10.4±0.5 8.9±0.5b a 1.47±0.01 1.53±0.02a 0.03±0.01a 0.06±0.00b a 19.6±0.1 20.1±0.1a a 0.174±0.001 0.194±0.001b a 0.230±0.002 0.260±0.004b a 4.350±0.097 4.042±0.080b a 0.214±0.002 0.242±0.002b a 75.5±0.5 73.5±0.6b a 17.4±0.3 18.2±0.3a a 6.9±0.2 8.3±0.6b a 4.31±0.01 4.96±0.01b

After ageing Fermented tomato Fermented tomato juice Lo juice Hi 3.41±0.01c 3.44±0.02d 7.5±0.2b 7.5±0.2b b 4.12±0.17 4.03±0.18b b 5.0±0.1 4.9±0.1b c 6.9±0.1 7.5±0.2d b 1.73±0.17 1.77±0.07b 0.03±0.01a 0.06±0.00b b 17.3±0.9 17.0±0.5b c 0.218±0.001 0.216±0.000d c 0.276±0.002 0.269±0.001d c 5.883±0.031 6.292±0.105d c 0.255±0.001 0.250±0.001d c 78.8± 0.2 80.2± 0.2d b 13.4±0.1 12.7±0.2c b 7.8±0.2 7.1±0.1a c 1.47±0.00 1.61±0.00c

Means in the same row with different superscripts are significantly different (p<0.05). Means were obtained from triplicate measurements.

dehyde (Jackson, 2008). Much oxidation of ethanol to acetaldehyde might have occurred in FTJ Lo more than in FTJ Hi. The dry extract values recorded for FTJ Lo before and after ageing, was not significantly different (p>0.05) from that of FTJ Hi (Table 1). Dry extract values for dry white wines are less than 25 g/L (Ribereau-Gayon et al., 2006). Losada et al. (2011) reported dry extract ranges of 12.90 to 13.40 g/L for godello white wines. Dry extract is important as a measure of body of wine. Significant reduction in dry extract was recorded after ageing for the

two fermented tomato juices. Reduction in dry extract is reported for sherry wine during biological aging (Martinez De la ossa et al., 1987). Dry extract is reported to have a significant association with alcoholic content of wine (Mironeasa et al., 2011), so, reduction in alcohol level in the present study may account for the reduction in dry extract after ageing. FTJ Lo gave significantly (p<0.05) lower volatile acidity values, both before and after ageing than FTJ Hi. Also, the volatile acidity values of each wine remained the same after ageing. The results on volatile acidity (Table1)

Owusu et al.

8247

Figure 4. Mean scores of taste, aroma, colour and overall acceptance of fermented tomato juice based on a 5-point hedonic scale. Means with the same alphabets are not significantly different.

of the present study are below the range of 0.56 to 1.5 g/L reported by Bely et al. (2003). More acetic acid production in FTJ Hi than FTJ Lo may account for the difference in volatile acidity values of the wines. Volatile acidity gives an indication of possible microbial spoilage, and is used as an indicator of wine quality (RibereauGayon et al., 2006). No difference in acetic acid concentration for icewines produced with 0.2 and 0.5 g of active dried wine yeast/L has been reported (Kontkanen et al., 2004). The fact that volatile acidity values remained the same after ageing may be attributed to the absence of malolactic fermentation (Ribereau-Gayon et al., 2006). The colour parameters of the two fermented juices are shown in Table 1. Colour intensity (CI) and colour tint (CT) for FTJ Hi were significantly higher (p<0.05) than those of FTJ Lo, both before ageing and after ageing. In addition, each fermented tomato juice recorded significantly higher CI and CT after ageing than before ageing. In the case of colour density (CD), even though a significantly higher value (p<0.05) was reported for FTJ Hi than FTJ Lo before ageing, the trend showed otherwise after ageing. Browning index (BI) measured as absorbance at 420 nm (A420) (Jackson, 2008), before ageing, was significantly higher (p<0.05) in FTJ Hi than FTJ Lo, but after ageing, the trend was otherwise (Table 1). Also, both fermented tomato juices registered significantly higher (p<0.05) BI values after ageing than before ageing. Increased BI is an indication of ageing (Jackson, 2008). The total phenolics measured as absorbance at 280 nm (A280) (Somers and Ziemelis, 1985) for both fermented tomato juices were significantly lower after ageing than before ageing. In addition, before ageing, FTJ Hi recorded a significantly higher (p<0.05) A280 value than FTJ Lo, but after ageing, the difference in A280 values were not significant. Colour density gives an indication of colour depth, that is, how dark it is; colour tint shows a mixture of colour with white, which increases

lightness, and colour intensity gives an idea about the brightness or dullness of a colour. In the present study, before ageing, FTJ Lo had a higher colour tint due to its lower colour density, but in FTJ Hi, a higher colour density gave a lower colour tint. This resulted in higher colour brightness for FTJ Hi than FTJ Lo. The A420 and A280 values of FTJ Hi which were higher than FTJ Lo might have given a higher colour density, and hence, a lower colour tint in FTJ Hi than FTJ Lo (Jackson, 2008). After ageing, though the A280 values of the two fermented tomato juices were not significantly different, A420 values were significantly higher for FTJ Lo than FTJ Hi. This might have resulted in a higher colour density, a lower colour tint and a higher colour intensity (brightness) for FTJ Lo than FTJ Hi. In the present study, both FTJ Lo and FTJ Hi recorded increase in colour density, intensity, tint, and % yellow colour after eight months of ageing. Also, a decrease in % red colour and total polyphenolic content for the two fermented tomato juices was observed. Well-balanced and properly aged wines exhibit increase in colour intensity (Ribereau-Gayon et al., 2006). Increase in colour tint, % blue and % yellow colours, a decrease in % red colour and polyphenolic content after eight months of bottle aging had been reported (Bautista-Ortin et al., 2007). Soni et al. (2009) also reported a reduction in phenolic content of amla wine after ageing in glass bottles for 30 days. The phenols lost during ageing might have contributed to the increased browning index values of the two fermented tomato juices (Ribereau-Gayon et al., 2006). Sensory evaluation The taste, aroma, colour and overall acceptance of the two fermented tomato juices were evaluated by a 10â&#x20AC;&#x201C; member semi-trained panel. The results indicate that

8248

Afr. J. Biotechnol.

even though the FTJ Lo scored higher than FTJ Hi in all parameters, the differences were not significant (p>0.05) (Figure 4). The pH difference might have contributed to the differences in aroma and taste (Jackson, 2008), even though those differences were not significant.

Conclusion Inoculum levels of 0.01 and 0.02% (w/v) were used to produce FTJ Lo and FTJ Hi respectively. Alcoholic fermentation in FTJ Hi came to completion earlier than FTJ Lo. FTJ Lo recorded a significantly lower pH (p<0.05) than FTJ Hi, but the difference in their titratable acidity values was not significant. FTJ Lo may have a better microbiological and physicochemical stability than FTJ Hi. FTJ Lo registered a significantly higher alcoholic content than FTJ Hi, but the dry extract values of the two fermented tomato juices were not significantly different. The residual sugar value of FTJ Lo was lower than that of FTJ Hi, but the difference was not significant (p>0.05). Volatile acidity content of FTJ Lo was significantly lower (p<0.05) than FTJ Hi, but both values were lower than the permitted. Ageing generally led to increased colour parameters for both fermented tomato juices. After ageing, the browning index value of FTJ Lo was significantly higher (p<0.05) than FTJ Hi. The inoculum level 0.01% (w/v) generally produced a fermented tomato juice of better quality than the inoculum level 0.02% (w/v). Sensory evaluation results showed that FTJ Lo had a higher overall acceptance than FTJ Hi, even though there was no significant difference in the acceptance levels.

ACKNOWLEDGEMENTS This work was supported by a Project Funded by the Priority Academic Program Development (PAPD) of Jiangsu Higher Educational Institutions. REFERENCES Akubor PI (1996). The suitability of African bush mango juice for wine production. Plant Foods Hum. Nutr. 49: 213-219. Anderson C, Badrie N (2005). Physico-chemical quality and consumer acceptance of guava wines. J. Food Sci. Technol. 42 (3): 223-226. Antonelli A, Castellari L, Zambonelli C, Carnacini A (1999). Yeast influence on volatile composition of wines. In: Jackson SR (ed.). Wine rd Science: Principles and Applications. 3 ed. Elsevier Inc. London. pp. 532-417. AOAC (1995).Official method 920.151. Solids (total) in fruits and fruit th products. In Official methods of Analysis of AOAC International, 16 th ed. 5 Revision, Chapter 37, p. 5. th AOAC (1984). Official methods of Analysis. 4 ed. Association of Official Analytical chemists. Washington, DC. th AOAC (1960). Official methods of Analysis. 9 ed. Association of Official Analytical chemists. Washington, DC. p. 143. Bautista-Ortin AB, Romero-Cascales I, Fernandez-Fernandez, JI, Lopez-Roca, JM, Gomez-Plaza E (2007). Influence of the yeast strain

on Monastrell wine colour. Innov. Food Sci. Emerging Technol. 8: 322-328. Bely M, Rinaldi A, Dubourdieu D (2003). Influence of assimilable nitrogen on volatile acidity production by Saccharomyces cerevisiae during high sugar fermentation. J. Biosci. Bioeng. 96(6): 507-512. Caputi AJR, Masao U, Brown T (1968). Spectrophotometric determination of ethanol in wine. Am. J. Enol. Vitic. 19: 160-165. Chowdhury P, Ray RC (2007). Fermentation of Jamun (Syzgium cumini L.) fruits to form red wine. ASEAN Food J. 14(1): 15-23. Di Mascio P, Kaiser S, Sies H (1989). Lycopene as the most efficient biological carotenoid singlet oxygen quencher. Arch. Biochem. Biophys. 274: 532-538. Duarte WF, Dragone G, Dias DR, Oliveira JM, Teixeira JA, Almeida e Silva JB, Schwan RF (2010). Fermentative behavior of Saccharomyces strains during microvinification of raspberry juice (Rubus idaeus L.). Int. J. Food Microbiol. 143: 173-182. El Haloui N, Picque D, Corrieu G (1988). Alcoholic fermentation in winemaking: On line measurement of density and carbon dioxide evolution. J. Food Eng. 8: 17-30. Enidiok SE, Attah LE (2010). Chemical composition in relation to the quality of wines produced from Nigerian Syzygium malaccensis and Eugenia owariensis apples. Afr. J. Food Agric. Nutr. Dev. 10(2): 2124-2138. Garde-Cerdan T, Marselles-Fontanet AR, Arias-Gil M, Ancin-Azpilicueta C, Martin-Belloso O (2008). Effect of storage conditions on the volatile composition of wines obtained from must stabilized by PEF during ageing without SO2. Innov. Food Sci. Emerging Technol. 9: 469-476. Glories Y (1984). La couleur des vins rouges II. Mesure, origine et interpretation. Conn. Vigne et Vin, 18: 253-271. IIand W, Ewart A, Sitters J, Markides A, Bruer N (2000). Techniques for chemical analysis and quality monitoring during winemaking, Patrick Lland Wine Promotions, Campbelltown, S. A. Australia. rd Jackson SR (2008). Wine Science: Principles and Applications. 3 ed. Elsevier Inc. London, pp. 344-345. Kontkanen D, Inglis DL, Pickering GJ, Reynolds A (2004). Effect of Yeast Inoculation Rate, Acclimatization, and Nutrient Addition on Icewine Fermentation. Am. J. Vitic. 55: 4:363-370. Kraus JK, Scoop R, Chen SL (1981). Effect of rehydration on dry wine yeast activity. In: Jackson SR (ed.) Wine Science: Principles and rd Applications. 3 ed. Elsevier Inc. London. pp. 532-417. Lee P-R, Ong Y-L, Yu B, Curran P, Liu S-Q (2010). Profile of volatile compounds during papaya juice fermentation by a mixed culture of Saccharomyces cerevisiae and Williopsis saturnus. Food Microbiol. 27: 853-861. Losada MM, Andres J, Cacho J, Revilla E, Lopez JF (2011). Influence of some prefermentative treatments on aroma composition and sensory evaluation of white Godello wines. Food Chem. 125: 884891. Martinez De la ossa E, Caro I, Bonat M, PeREZ L Domecq B (1987). Dry extract in sherry and its evolution in the aging process. Am. J. Enol. Vitic. 38(4): 321-325. Mathapati PR, Ghasghase NV, Kulkarni MK (2010). Study of Saccharomyces cerevisiae 3282 for the production of tomato wine. Int. J. Chem. Sci. Appl. 1(1): 5-15. Miller GL (1972). Use of dinitrosalicyclic acid reagent for determination of reducing sugars. Anal Chem 31: 426-428 Mironeasa S, Codina GG, Leahu A, Mironeasa C (2011). Multivariate statistical analysis of royal feteasca wine quality from different regions of Romania country. Food Environ. Saf. 10(1): 47-52. Motamedzadegan A, Tabarestani HS (2011). Tomato Processing, Quality and Nutrition. In: Sinha NK (ed.) Handbook of Vegetables and Vegetables processing. Blackwell Publishing Ltd, Iowa, USA. pp. 739-757. Panesar PP, Panesar R, Singh B (2009). Application of response surface methodology in the optimization of process parameters for the production of kinnow wine. Nat. Prod. Rad. 8(4): 366-373. Plane RA, Mattick LR, Weirs LD (1980). An acidity taste index for the taste of wines. Am. J. Enol. Vitic. 31: 265-268. Pratima K, Vijay K, Niranjan D, Mohan TS (2006). Development of a process for preparation of pure and blended kinnow wine without debittering kinnow mandarin juice . Food Saf. Inform. Publish. 8: 24-

Owusu et al.

29. Rao AV, Rao LG (2007). Carotenoids and human health. J. Pharm. Res. 55: 207-216. Ribereau-Gayon P, Glories Y, Maujean A, Dubourdieu D (2006). Handbook of Enology Volume 2: The Chemistry of Wine and nd Stabilization and Treatments. 2 ed. John Wiley & Sons Ltd. Chichester, England. pp. 1-49, 92. Sadler GD, Murphy PA (2010). Ph and Titratable Acidity. In: Nielsen SS (ed). Food Analysis. Springer Science + Business Media, LLC, New York, pp. 219-238. Sen R, Swaminathan T (2004). Response surface modeling and optimization to elucidate and analyze the effects of inoculum age and size on surfactin production. Biochem. Eng. J. 21: 141-148. Sevda SB, Rodrigues L (2011). Fermentation behavior of Saccharomyces strains during guava (Psidium guajava L.) must fermentation and optimization of guava wine. J. Food Process Technol. 2(4): 1-9.

8249

Singh RS, Kaur P (2009). Evaluation of litchi juice concentrate for the production of wine. Nat. Prod. Rad. 8 (4): 386-391. Somers TC, Ziemelis G (1995). Spectral evaluation of total phenolic components in Vitis vinifera: Grapes and wine. J. Sci. Food Agric. 36: 1275-1284. Soni SK, Bansal N, Soni R (2009). Standardization of conditions for fermentation and maturation of wine from Amla (Emblica officinalis Gaertn.). Nat. Prod. Rad. 8(4): 436-444. Torija MJ, Rozes N, Poblet M, Guillamon JM, Mas A (2003). Effects of fermentation temperature on the strain population of Saccharomyces cerevisiae. Int. J. Food Microbiol. 80: 47-53. USDA (2009). USDA National Nutrient Database for Standard Reference, Release, p. 22. Von Elbe JH, Schwartz SJ (1996). Colorants. In: Fennema OR (ed) Food Chemistry. Marcel Dekker Inc. New York, pp. 651-722.

Full Length Research Paper

High-yield production of Streptavidin with native Cterminal in Escherichia coli Xuelan Chen1, Feng Xu2, Fuzhong Peng1, Hong Xu3, Wei Luo2, Hengyi Xu2 and Yonghua Xiong2* 1

School of Bioscience, Key Laboratory of Functional Small organic molecule, Ministry of Education, Jiangxi Normal University, Nanchang 330022, People’s Republic of China. 2 State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047, People’s Republic of China. 3 Ocean NanoTech, LLC, Springdale, AR72764, USA. Accepted 2 April, 2012

To increase the production yield of functional recombinant streptavidin in Escherichia coli, the effects of host strains and culture conditions on expression of streptavidin with native C terminal (CNSA, amino acid residues 13 to 159) were investigated. Results show that the CNSA, encoded by the CNSA gene, was produced by E. coli BL21(DE3)pLysS strain in the inclusion body with a high yield up to 46.3% of the total cell protein (about 230 mg/g dry cell weight) after culture condition optimization. The dialysis method was adapted to refold CNSA and the refolding conditions were optimized. More than 90% of inclusion body protein was refolded to mature CNSA under optimized refolding conditions. The purity of the recombinant CNSA achieved 95.0% without using any affinity separation method. Enzyme linked immunosorbent assay (ELISA) analysis indicated that the biotin binding capability of our recombinant CNSA was similar to that of commercial products. Key words: Streptavidin, Escherichia coli, protein refolding, recombinant protein.

INTRODUCTION Streptavidin (SA) is an approximately 60-kDa protein naturally secreted from bacterium Streptomyces avidinii, which can bind up to four molecules of D-biotin (Hunt, 2005). The interaction between streptavidin and biotin is noncovalent but extremely tight, with a dissociation constant of 10-15 M, which is about 3-6 orders of magnitude higher than that of a typical antigen–antibody interaction (Scholle et al., 2004). Because of its highly specific and almost irreversible binding to biotin, SA has been widely used as a capturing agent to bind biotinylated molecules for applications in immunology, molecular biology and histochemistry, etc (Peters and Rehm, 2008). The three-dimensional structure of mature SA shows, it is a homotetramer with each subunit folded into an eight-stranded antiparallel β-barrel (Laitinen et al.,

*Corresponding author. E-mail: yhxiongchen@163.com. Tel: +86 791 8818 2405. Fax: +86 791 8833 3708.

2006). Each monomer of the natural full-length SA (NFSA) is composed of 159 amino acids with a molecular weight of 16.5 kDa. However, the natural SA is usually in the form of a mixture of heterogeneous molecules because of cleavages at both N- and C-termini by host proteases and presents a smaller molecular weight than NFSA (Argarana and Kuntz, 1986; Miksch et al., 2008). In recent years, it has been found that the binding ability to biotins and solubility of the shorter recombinant SA are better than those of NFSA. The main reason for the lower binding capacity of NFSA is that the hydrophobic amino acid patches, at positions 10-12 from the N-terminal and positions 19-21 from the C-terminal, tend to form the steric hindrance due to the mutual cohesion and thus limit the accessibility of the biotin binding motifs of SA to those biotinylated molecules. This may also lead to lower solubility of NFSA (Sano and Cantor, 1995). To obtain highly functional recombinant SA for biomedical applications, SA monomers of different length, including NFSA (Miksch et al., 2008), natural core

Chen et al.

SA (NCSA, amino acid residues 13-139) (Bayer et al., 1989), and core SA [CSA, including Stv-13 (amino acid residues 16-133) and Stv-25 (amino acid residues 14138)], etc. (Thompson and Weber, 1993; Wu and Wong, 2002), have been expressed in various microbial expression hosts as a soluble protein or as an insoluble form in the inclusion body. However, the yield of SA never made great breakthrough and was generally 70120 mg per liter of bacterial culture (about 20 to 35% of the total bacterial protein) in soluble form (Takeshi et al., 1995; Thompson and Weber, 1993; Sano and Cantor, 1990), while the yields of SA expressed in insoluble form were about 35% of total cell protein (Wu and Wong, 2002; Sano and Cantor, 1995). In this study, one SA gene fragment, native C-terminal of SA (CNSA, amino acid residues 13-159), was amplified from S. avidinii genome. The polymerase chain reaction (PCR) product was sub cloned into the Escherichia coli expression vector plasmid pET11a-T7. The resulting plasmid was introduced into two E. coli strains to produce recombinant SA. By the optimization of culture conditions, the yield of recombinant CNSA of E. coli BL21(DE3)pLysS strain was higher, up to 46.3% of the total cell protein (about 230 mg/g dry cell weight). Under optimized conditions in the dialysis refolding process, more than 90% of inclusion body protein was refolded into mature streptavidin. MATERIALS AND METHODS

8251

PAGE) and a gel imaging analyzer (Bio-Rad, USA) were employed to evaluate CNSA expression. Denaturing SDS-PAGE was performed with a 12% acrylamide resolving gel with a 5% acrylamide stacking portion after heating the samples at 95°C for 5 min in the presence of 1% SDS. Non-denaturing SDS-PAGE was performed in the same discontinuous system except the heat treatment of samples (Bayer et al., 1996; Mark et al., 2004). To determine the SA concentration, a calibration curve of streptavidin standard (Promega, USA) was generated using Coomassie brilliant blue G250 staining (Bradford, 1976) and the CNSA samples of unknown concentration stained in the same way were compared to the linear region of the standard curve.

Purification and refolding of CNSA The cells were harvested by centrifugation at 3500 g for 10 min and washed twice with 100 ml of resuspension solution (20 mM Tris-HCl pH 7.4). The cell pellets were resuspended in 40 ml of resuspension solution and frozen at -70°C for 0.5 h. After fully thawed at 40°C, the cells were sonicated for 40 cycles of 3 s at full amplitude with 2 s interval. The inclusion body was collected by centrifugation at 15,000 g for 10 min and washed four times in buffers (pH 7.2) containing 1% Triton X-100, 0.3 mM ethylenediaminetetraacetic acid (EDTA) and 0.5 mM β-mercaptoethanol and four times in the same buffer without Triton X-100 (Sensen et al., 2003). The inclusion body was dissolved with 8.0 M urea and the denatured protein was refolded and purified by dialysis (Fang and Huang, 2001). The refolding efficiency (RE) was calculated as the following equation: RE = [Cs/ (Cs+ CP)] ×100% Where, CS is the amount of mature CNSA in the supernatant and CP is the amount of CNSA in the precipitation.

Bacterial strains, media, and growth conditions S. avidinii was obtained from China center of industrial culture collection (CCICC) and used for amplification of the SA gene. E. coli BL21 (DE3) and BL21 (DE3) pLysS were used for expression studies. E. coli was cultured at 37°C in ATM medium containing 20 g/L tryptone, 0.65 g/L Na2HPO4, 0.5 g/L KH2PO4, 4 g/L NaCl and 7.5 g/L yeast extract. The final pH of the medium was adjusted to 7.2 before autoclaving. The plates contained 15 g/L agar. When needed, ampicillin (50 μg/ml) and/or chloromycetin (10 μg/ml) were supplemented to the medium.

Amplification and expression of the CNSA fragment S. avidinii genomic DNA was extracted as described by (Saito and Miura, 1963). The fragment was amplified from the genomic template by PCR using the upstream primer CNSA F (5’TTCGGATCCGCCGAGGCCGGCATCACCG-3’, the introduction of a BamHI restriction site was underlined) and the downstream primer CNSA R (5′-ATTCGGCCGCTATTACTAGTGCTGAACGGCGTC-3′, the introduction of a NotI restriction site was underlined). The PCR product was purified using a QIAquick PCR purification kit (Qiagen, Germany), and cloned into the pET11a vector according to standard procedures. The resulting pET11acnsa vector was introduced into E. coli BL21 (DE3) and E. coli BL21 (DE3) pLysS by electroporation. Briefly 1.5 ml overnight E. coli culture was inoculated into 100 ml of ATM medium in a 250 ml flask and cultivated at 37°C with vigorous shaking. When OD600 nm of the culture reached 1.8-2.0, isopropyl β-D-thiogalactopyranoside (IPTG) was added to induce the protein expression for up to 13 h. Sodium dodecyl sulfite polyacrylamide gel electrophoresis (SDS-

ELISA assay for determination of the biotin binding capability of CNSA One hundred microliter (100 μL) of SA standard (5.0 μg/ml) or the mature CNSA (5.0 μg/ml ) and their serial dilutions (2, 4, 8, 16 and 64-folds) in 0.01 M phosphate buffered saline (PBS) were coated on micro titer plates (Dingguo Biotechnology, Shanghai, China) by incubation at 37°C for 1 h. After washing three times with PBST (PBS containing 0.5% Tween 20), the wells were blocked with 350 μL of 1% BSA in PBS at 37°C for 1 h and then washed three times with PBST. 0.01 μg of biotinylated HRP in 100 μL PBS (Zodolabs biotechnology, Wuxi, China) was added into each well and incubated at 37°C for 1 h. After final washing, 100 μL of 3, 3, 5, 5tetramethyl benzidine (TMB) substrate was added and the plate was kept in the dark at 37°C for 15 min. The enzymatic reactions were terminated by the addition of 50 μL of 2 M sulfuric acid, and the absorbance was read at 450 nm using a Multiskan MK3 micro plate reader (Thermo fisher scientific, USA).

RESULTS Expression of the CNSA fragment in different E. coli strains The CNSA fragment was amplified and cloned into pET11a-T7 expression vector. To compare the effects of different host strains on protein expression, two wellknown commercially available E. coli stains BL21 (DE3)

8252

Afr. J. Biotechnol.

Figure 1. Expression of CNSA fragment in different E. coli strains. Total proteins from BL21(DE3)pLysS cells (lane 1), BL21(DE3)pLysS cells transformed with an empty pET11a vector (lane 2), recombinant strain of BL21(DE3)pLysS with pET11a-cnsa vector (lane 3), BL21(DE3) cells (lane 4), BL21(DE3)cells transformed with an empty pET11a vector (lane 5), and recombinant strain of BL21(DE3)pLysS with pET11a-cnsa vector (lane 6) were extracted and subjected to SDS-PAGE analysis. Arrows indicate the monomer of CNSA. Lane M, protein molecular weight markers.

and BL21 (DE3) pLysS were used for plasmid transformation. As shown in lanes 3 and 6 of Figure 1, the amount of CNSA produced in the BL21(DE3)pLysS (pET11a-CNSA) strain was significantly higher than that in the BL21(DE3) (pET11a-CNSA) strain. Sodium dodecyl sulphate-polyacrylamide gel electrophresis (SDS-PAGE) analysis showed that CNSA mostly existed in the inclusion body. Optimization of culture condition for BL21 (DE3) pLysS (pET11a-cnsa) The protein expression in BL21 (DE3) pLysS (pET11aCNSA) was induced at different temperature (24, 28, 32 and 37째C) to determine the influence of induction temperatures on CNSA expression. The results shown in Figure 2, indicated that the CNSA expression in the inclusion body increased with the rise of the induction temperature (indicated by an arrow in lane 3 of Figure 2), while there was a small amount of protein expressed in a soluble form at the lower temperature (lane 6 of Figure 2). Analysis of the CNSA expression in BL21 (DE3)

pLysS induced by different concentration of IPTG (from 0.1 to 1.0 mM) revealed that the effect of IPTG concentration was minimum on the CNSA expression and 0.4 mM of IPTG was chosen as the induction concentration (data not shown). However, the IPTG induction time significantly influenced the production of CNSA during our experiment period (from 1 to 13 h). The CNSA expression increased progressively with the induction time and reached its plateau at 11 h. The maximal expression of CNSA exhibited nearly nine-fold increase than that at 2 h (Figure 3B). The effect of glucose concentration in the medium on CNSA expression was also investigated. Different concentrations of glucose (from 0.2 to 1.0% (w/v)) were tested. As shown in Figure 4, the expression of CNSA was highest in the ATM medium containing 0.4% of glucose and the yield reached about 230 mg/g dry cell weight (46.3% of the total cell protein). However, when the concentration of glucose was 1.0%, the expression level of CNSA dropped dramatically, about six-fold less than that with optimal concentration of glucose (Figure 4B).

Chen et al.

8253

Figure 2. CNSA expression at different induction temperature. Total protein of BL21(DE3) pLysS cells transformed with an empty pET11a vector (lane 1); soluble protein from cells expressing CNSA at 37, 32, 28 and 24째C, respectively (lanes 2, 4, 6 and 8), and insoluble fraction from cells expressing CNSA at 37, 32, 28 and 24째C, respectively (lanes 3, 5, 7 and 9) were extracted and subjected to SDS-PAGE analysis. Arrows indicate the monomer of CNSA. Lane M, protein molecular weight markers.

Figure 3. CNSA expression at the IPTG-induced time. Total proteins of recombinant strain without induced by IPTG (lane 1), and induced from 1 h to 13 h in steps of 1 h (lanes 2 to 14) were extracted and subjected to SDS-PAGE analysis (shown in Figure 3A, arrow indicates the monomer of CNSA). The expression level of CNSA at different induced time was shown in Figure 3B.

Optimization of CNSA refolding Refolding is a critical step to obtain fully functional

recombinant protein, especially those insoluble proteins accumulated in the inclusion body. In our study, the refolding temperature, refolding buffer composition and

8254

Afr. J. Biotechnol.

Figure 4. The effect of glucose concentration in the ATM medium on CNSA expression. Total proteins of recombinant strain cultured without glucose (lane 1), and with different concentration of glucose from 0.2% to 1.0% in steps of o.2% were extracted and analyzed with SDS-PAGE (shown in Figure 4A). The expression level of CNSA at different glucose concentration was shown in Figure 4B.

Figure 5. SDS-PAGE analysis of SA refolded in different buffer. Inclusion body protein dialysis with gradient dilution of urea buffer or PBS buffer was subjected to denaturing (lane 1 or 3, respectively) and non-denaturing (lane 2 or 4, respectively) SDS-PAGE analysis. Lane M, molecular weight markers. Arrow indicates the mature CNSA.

the initial protein concentration were optimized. The results of temperature effect on refolding of inclusion body indicated that there was no significant difference between refolding at room temperature and at 4째C (data not shown). In consideration of low temperature being helpful in stabilizing the protein, 4째C was selected as the refolding temperature. The effects of refolding buffer

constituents on CNSA refolding were studied by comparing the series dialysis against urea solutions of decreasing concentrations with the direct dialysis against 0.01 M PBS (pH 7.2). CNSA did not show any precipitation when refolded under the former conditions and most of the target protein in the supernatant was in the form of tetramer (lane 1 of Figure 5). However, this

Chen et al.

8255

Figure 6. The refolding efficiency of SA at different initial protein concentration. The inclusion body protein was dialyz ed with PBS buffer at different initial protein concentration and then centrifugated at 15 000 g for 10 min. The supernatant and precipitation were subjected to denaturing (lanes 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21, the initial refolding protein concentration decreasing from the range of 0.4 g/L to 2.4 g/L in steps of 0.2 g/L) and non-denaturing (lanes 2 , 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22, the initial refolding protein concentration decreasing from the range of 0.4 g/L to 2.4 g/L in steps of 0.2 g/L)) SDS-PAGE analysis, respectively (Figure 6A).The refolding efficiency of SA at different initial protein concentration was shown in Figure 6B.

method had several disadvantages which include large urea consumption, time consuming and especially high impurities (lane 2 of Figure 5). It was reported that direct dialysis against PBS overcame these disadvantages when relatively low initial

concentration of protein was used (Fang and Huang, 2001). The effect of initial protein concentration was studied in the refolding setup with PBS only. As shown in Figure 6, the refolding efficiency increased with the reduction of the protein concentration from 2.4 to 1.2 g/L,

8256

Afr. J. Biotechnol.

Figure 7. Determination of activity of recombinant CNSA binding biotin by direct ELISA.

whereas the efficiency remained flat from 1.2 to 0.4 g/L. The refolding efficiency was more than 90% at the optimal protein concentration and the purity achieved 95.0%. Therefore, 1.2 g/L was optimal as the initial protein concentration in the refolding dialysis. Taken together, the yield of refolded CNSA from 1L ATM medium by optimal culture conditions and optimal refolding conditions can reach about 370 mg. ELISA assay for the activity of refolded CNSA The binding activity of mature CNSA was determined by direct ELISA. The result indicates that the ability of the mature protein to bind biotinylated molecules had only a subtle difference from commercially available recombinant SA (Figure 7). DISCUSSION Over expression of recombinant proteins toxic to the host is often problematic, leading to either low production or insoluble proteins accumulated in inclusion bodies. SA is of no exception because biotin is necessary for the growth of cells. It was inferred, by analyzing the expression of different length SA, that the main function of those hydrophobic amino acid residues at both ends of NFSA was to make NFSA condense and lose the

capability to bind biotin in vivo to avoid self-damaging by SA. SA obtained its biotin binding ability only after NFSA was secreted out of cells and the hydrophobic termini were cut by proteases (Liu et al., 2005). Up till now, SA expressed by pET system in E. coil was different in the amino acid sequence at either or both ends, resulting to different yields (Gallizia et al., 1998). In our study, CNSA with C-terminal hydrophobic amino acid residues was successfully expressed in inclusion bodies at 37째C. At lower culture temperature, the toxic SA was expressed in soluble form (lane 6 of Figure 2), but the SA expression was quite low. The solubility of CNSA was higher than that of NFSA due to the lack of the N-terminal 12 hydrophobic amino acid residues in CNSA, which also leads to cell toxicity. For protection, the host cells had to impel CNSA to inclusion bodies when CNSA was expressed in cells in a large amount. The gene encoding SA from S. avidinii has high GC content in its DNA sequence (69%), which leads to some less frequently used codons in the NFSA gene (Humbert et al., 2008). E. coli generally shows a strong preference for codon usage. Replacement of unfavorable codons with highly utilized codons has been suggested to account for the increased production. In recent years, some host E. coli strains have been modified to overcome biased codon usage, such as B strains BL21 (DE3) and BL21 (DE3) pLysS. The expression vector pET11b and BL21(DE3) as the host stain were used to successfully express SA (amino acid residues 15-159),

Chen et al.

and the expression yield of soluble SA was 70 mg/L under optimized conditions (Gallizia et al., 1998). In another report, three recombinant polypeptides of SA, the NFSA with a signal peptide, NFSA and NCSA (amino acid residues 13-139), were also successfully expressed in E. coli strain BL21 (DE3) with the expression vector pET28a. The expression yield of the three recombinant proteins was about 80 mg/g dry cell weight and NCSA was expressed mainly as soluble native protein. However, the signal peptide and extra amino acid residues in NFSA made it difficult to fold into functional proteins (Liu et al, 2005). In our study, CNSA expression was compared in BL21 (DE3) and BL21 (DE3) pLysS host strains. Significantly more CNSA was produced in BL21 (DE3) pLysS than in BL21 (DE3) and expressed mainly in inclusion bodies. The result suggests that BL21 (DE3) pLysS was more suitable for expression of toxic recombinant CNSA. It was reported that the SA yield increased from 70 to 120 mg/L by adding 0.4% of glucose in culture medium (Humbert et al., 2008). In our study, less than 0.8% of glucose in culture medium had little impact on the CNSA expression while more than 0.8% of glucose made the CNSA expression suddenly decline. The reason remained unclear. Optimization of critical parameters, mainly including culture temperature, induced time, led to up to 46.3% protein expressed in cells was CNSA (about 230 mg/g dry cell weight). The presented CNSA expression yield was higher than any other assays developed thus far, suggesting that an optimal growth of bacteria be required to obtain a maximal protein yield. It was difficult for insoluble proteins in inclusion bodies to refold to active and mature form (Gallizia et al., 1998). By optimizing the refolding temperature, the refolding buffer and especially the initial protein concentration, the refolding efficiency was more than 90% and the purity can achieve 95.0% without any affinity chromatography. Our method to refold SA was simple and yet highly efficient, which was first used for SA expressed in inclusion body form. SA expressed in a soluble form was purified without refolding, but the biotin binding capability was lower than that of the proteins refolded from denatured inclusion bodies, implying that some of the active sites of soluble SA were occupied by intracellular biotin before purification (Liu et al., 2005). In our study, the active sites of SA present in the inclusion body was not subjected to biotin binding, thus the ELISA result showed that the ability of the mature CNSA to bind biotin was similar to that of commercially available recombinant SA. Conclusion The active CNSA from E. coli inclusion bodies was successfully obtained. In order to enhance the yield, the conditions of CNSA expression, including host strains, temperature of culture, the induction time of IPTG and the

8257

concentration of glucose in the culture medium were optimized. The results show that the CNSA, induced by 0.4 M IPTG at 37°C for 12 h, was produced by E. coli BL21(DE3)pLysS strain in the inclusion bodies with a high yield up to 46.3% of the total cell protein (about 230 mg/g dry cell weight) in the ATM medium containing 0.4% of glucose. In order to enhance the efficiency of refolding of the inclusion bodies, the refolding temperature, refolding buffer composition and the initial protein concentration were optimized. The results indicated that the effect of the initial protein concentration on the refolding efficiency was the most significant. More than 90% of inclusion body protein was refolded to mature CNSA under 1.2 g/L of the initial protein concentration with the dialysis against 0.01 M PBS (pH 7.2), and the purity of the recombinant CNSA achieved 95.0% without using any affinity separation method. ELISA analysis indicated that the biotin binding capability of our recombinant CNSA was similar to that of commercial products. ACKNOWLEDGEMENT This work was supported by the Natural Science Foundation of China (no. 30960012). REFERENCES Argarana CE, Kuntz ID (1986). Molecular cloning and nucleotide sequence of the streptavidin gene. Nucleic Acids Res. 14: 18711882. Bayer EA, Ben-Hur H, Hiller Y, Wilchek M (1989). Expression of a cloned streptavidin gene in Escherichia coli. Biochem. J. 259: 369375. Bayer EA, Ehrlich-Rogozinski S, Wilchek M (1996). Sodium dodecyl sulfate-polyacrylamide gel electrophoretic method for assessing the quaternary state and comparative thermostability of avidin and streptavidin. Electrophoresis, 17: 1319-1324. Bradford MM (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254. Fang M, Huang H (2001). Advances in vitro refolding of inclusion body. Biotech. J. Chin. 17: 608-611. Gallizia A, Lalla CD, Nardone E, Santambrogio P, Brandazza A, Sidoli A, Arosio P (1998). Production of a soluble and functional recombinant streptavidin in Escherichia coli. Protein Expr. Purif. 14: 192-196. Humbert N, Schürmann P, Zocchi A, Neuhaus JM, Thomas R (2008). High-yield production and purification of recombinant T7-Tag mature Streptavidin in glucose-stressed E. coli. Methods Mol. Biol. 418: 101110. Hunt I (2005). From gene to protein: a review of new and enabling technologies for multi-parallel protein expression. Protein Expr. Purif. 40: 1-22. Laitinen OH, Hytönen VP, Nordlund HR, Kulomaa MS (2006). Genetically engineered avidins and streptavidins. Cell Mol. Life Sci. 63: 2992-3017. Liu XP, Liu JH (2005). Signal peptide does not inhibit binding of biotin to Streptavidin Biotechnol. Lett. 27: 1067-1073. Mark JW, Navrotskaya I, Bain A, Oldham ED, Mascotti DP (2004). Thermal and Sodium Dodecylsulfate Induced Transitions of Streptavidin. Biophys. J. 87: 2701-2713. Miksch G, Ryu S, Risse JM, Flaschel E (2008). Factors that influence

8258

Afr. J. Biotechnol.

the extracellular expression of streptavidin in Escherichia coli using a bacteriocin release protein. Microbiol. Biotechnol. 81: 319-326. Peters V, Rehm BH (2008). Protein engineering of streptavidin for in vivo assembly of streptavidin beads. Biotechnol. J. 134: 266-274. Saito H, Miura K (1963). Preparation of transforming deoxyribonucleic acid by phenol treatment. Biochim. Biophys. Acta. 72: 619-629. Sano T, Cantor CR (1990). Expression of a cloned streptavidin gene in Escherichia coli. Proc. Natl. Acad. Sci. 87: 142-146. Sano T, Cantor CR (1995). Intersubunit contracts made by tryptophan 120 with biotin are essential for both strong biotin binding and biotininduced tighter subunit association streptavidin. Proc. Natl. Acad. Sci. 92: 3180-3184. Scholle MD, Collart FR, Kay BK (2004). In vivo biotinylated proteins as targets for phage-display selection experiments. Protein Expr. Purif. 37: 243-252.

Sensen HP, Sperling-Petersen HU, Mortensen KK (2003). Dialysis strategies for protein refolding: preparative streptavidin production. Protein Expr. Purif. 31: 149-154. Takeshi S, Mark WP, Chen XM, Cassandra LS, Charles RC (1995). Recombinant core Streptavidins. Biol. Chem. J. 270: 28204-28209. Thompson LD, Weber PC (1993). Construction and expression of a synthetic streptavidin-encoding gene in Escherichia coli. Gene J. 136: 243-246. Wu SC, Wong SL (2002). Engineering of a Bacillus subtilis strain with adjustable levels of intracellular biotin for secretory production of functional streptavidin. Appl. Environ. Microb. 3: 1102-1108.

Full Length Research Paper

Effect of garlic’s mode of administration on erythrocytes and plasma parameters in Wistar rat Sonia Hamlaoui-Gasmi1*, Meherzia Mokni1, 3, Nadia Limam1, Ferid Limam2, Mohamed Amri1, Ezzedine Aouani2 and Lamjed Marzouki1, 3 1

Laboratoire de Neurophysiologie Fonctionnelle et Pathologies, Faculté des Sciences de Tunis, Campus Universitaire Manar II 2092 Tunis, Tunisie. 2 Laboratoire des Substances Biologiquement Actives, Centre de Biotechnologie, Technopole Borj-Cedria, BP 901, 2050 Hammam-Lif, Tunis, Tunisie. 3 Institut supérieur de biotechnologie de Béja, Avenue Habib Bourguiba – B.P. 382 – 9000 Béja, Université de Jendouba, Tunisie. Accepted 7 December, 2011

Garlic preparations are recognized as hypolipidemic, cardioprotective and antihypertensive agents. However, there are some discrepancies about the beneficial effects of garlic according to dosage and mode of administration. We aimed to determine the ability of high dosage garlic (5 g/kg bw) to modulate erythrocytes and plasma parameters when administered orally (p.o.) or via intraperitoneal (i.p.) route. With regard to erythrocytes parameters, p.o. garlic treatment was found to have beneficial effects as it increased hemoglobin and hematocrit levels. Garlic i.p. treatment showed detrimental activity as it decreased these parameters. Our results reveal that garlic administered by p.o. does not involve any significant variation on mean cell volume (MCV), mean cell hemoglobin (MCH) and mean cell hemoglobin concentration (MCHC). Nevertheless, garlic i.p. increased MCV but reduced the MCH. The MCHC remained invariable even in intraperitoneal way. Concerning plasma parameters, our data show that garlic did not induce any variation on glycaemia and plasma electrolytes whatever its mode of administration. High garlic dosage was found to be relatively safe when administered orally. Key words: Garlic, erythrocytes, hemoglobin, hematocrit, glycaemia, plasmatic electrolytes, administration mode. INTRODUCTION It is well known that dietary factors play a key role in the prevention of metabolic disorders (Riccardi and Rivellese, 2000). Among all such agents, garlic (Allium sativum L.) has attracted the attention of modern medical science because of its widespread over the counter use. Garlic exhibits antihypertensive (Asdaq and Inamdar, 2011), hypolipidemic (Madkor et al., 2011) or antibacterial

*Corresponding author. E-mail: sonia_hamlaoui@yahoo.fr. Tel: 21698968113. Abbreviations: Hb, Hemoglobin; HCT, hematocrit; MCV, mean cell volume; MCH, mean cell hemoglobin; MCHC, mean cell hemoglobin concentration; bw, body weight.

(Rahman et al., 2011) activities. However, several reported effects were deviating and conflicting, depending on experimental duration, garlic dosage and mode of administration (Banerjee and Maulik, 2002). Garlic is generally administered either orally or by intraperitoneal route. The latter, which avoids gastric barrier, was previously shown to be more effective than gastric gavage (Alnaqeeb et al., 1996). It was interesting to observe that i.p. treatment with garlic was more effective with regard to its hypocholesterolemic effect when compared with other modes of treatment (Heidarian et al., 2011). From a recent study, it was established that garlic high dose oral treatment exhibited profound antianemic, antifatigue and lipid-lowering activity when compared with i.p. route of treatment (Hamlaoui-Gasmi et al., 2011a). This

8260

Afr. J. Biotechnol.

study compared the two modes of garlic administration on erythrocytes and plasma parameters, that is, p.o. and i.p. routes in chronic experiments of one month duration. The data obtained during the study showed that garlic oral treatment, possessed anti-anemia effect. The putative link between anti-anemia nature and effect of garlic on free iron overload was studied and the results were presented in a recent communication (Hamlaoui-Gasmi et al., 2011a).

auto blood analyzer (Coulter).

Statistical analyses All data were expressed by mean values ± SEM. Statistical analyses were carried out using student's t-test and one way analysis of variance (ANOVA test). Statistical P-values less than 0.05 were considered significant.

RESULTS MATERIALS AND METHODS Preparation of garlic extract Garlic was purchased from the local market, peeled and ground with an electric mincer. It was diluted in double distilled water at 4 g/ml on the basis of the weight of the starting material and centrifuged (Beckman J20, 15 min at 10,000 g and 4°C). The supernatant obtained was aliquoted and stored at – 80°C until it was used.

Animals and treatment Male Wistar rats (180–200 g) from Pasteur Institute (Tunis) were maintained in animal facility for one week at room temperature 22±1°C and a 12 h/12 h dark/light cycle. They were supplied with standard chow diet and tap water ad libitum. Procedures with laboratory animals and their care were conducted in conformity with institutional guidelines of Tunis University of Medical Sciences and in accordance with the National Institute of Health (NIH) guidelines (NIH, 1985). Animals were randomly divided into four groups of 10 animals each. Group I received standard diet (control). Group II received standard diet supplemented with aqueous extract of garlic (5 g/kg bw). Group III was injected (i.p.) with 9% NaCl (control). Group IV was injected (i.p.) with garlic (5 g/kg bw). Animals were treated daily for 30 days and checked for weight gain or loss. At the end of treatment duration, blood samples were collected following standard procedure and processed for studies on erythrocytes and plasma parameters.

Blood processing Whole blood was obtained by cardiac puncture and collected into heparinized tubes. Erythrocytes were isolated from plasma by centrifugation at 1000 g for 10 min at 4°C and homogenized using a hypotonic buffer Tris-HCl 10 mM pH 7.5, MgCl2 5 mM, NaCl 10 mM.

Hematological parameters

Differential effect of garlic (p.o. and i.p.) treatment on hemoglobin and hematocrit The results presented in Figure 1 showed the effects inside of data of garlic dosage administered either by p.o. or i.p. on hemoglobin (Figure 1A) and hematocrit (Figure 1B). When administered by p.o. route, garlic increased hemoglobin (+14%) and hematocrit (+18.16%). However, intraperitoneal garlic induced a highly significant reduction in the hemoglobin reaching (-18.93%) and the hematocrit (-12.54%). Erythrocytes parameters The data shown in Table 1 dealt with the effect of garlic mode of administration on erythrocyte parameters. Oral garlic treatment does not involve any significant variation on MCV, MCH and MCHC. Nethertheless, i.p. garlic increased the MCV, reduced the MCH but the MCHC remains invariable even in intraperitoneal way. Effect of garlic mode of administration on glycemia The effect of garlic mode of administration (p.o. and i.p.) on glycemia is presented in Figure 2 and the data showed that garlic did not induce any variation concerning the glycemia, however, it could be due to its mode of administration. Effect of garlic mode of administration on plasma electrolytes

Erythrocytes counts, hemoglobin, haematocrit, mean cell volume (MCV), mean cell hemoglobin (MCH) and mean cell hemoglobin concentration (MCHC) were determined using Coulter counts apparatus (Nihon Kohden Celtac E automate).

Table 2 shows that garlic did not induce any variation concerning the plasma electrolytes concentration whatever its mode of administration.

Estimation of glucose and plasma electrolytes

DISCUSSION

Plasma samples were analyzed for estimation of glycemia and electrolytes (calcium, phosphate, sodium and potassium) using an

In the present study, we used garlic in subchronic experiments of one month duration at high dosage and

Hamlaoui-Gasmi et al.

Hemoglobin (g/dl)

Co Control

Garlic

** 9

0 PO

A 60

Hematocrit (%)

Co Control

Garlic

* *

0 PO

B Figure 1. Effect of garlic (p.o. and i.p.) treatment on hemoglobin (A) and haematocrit (B).

Table 1. Effect of garlic mode of administration on erythrocyte parameters.

Parameter 3 MCV (µm ) MCH (g/l) MCHC (pg)

Control (p.o.) 52.85±0.7 33.6±0.3 18.15±0.3

Garlic (p.o.) 52.5±0.5 34. ±0.1 17.52±0.2

Control (i.p.) 52.32±0.2 34.78±0.4 19.18±0.1

Garlic (i.p.) 54.63±0.7** 33.32±0.4 18.20±0.3

8261

8262

Afr. J. Biotechnol.

Glucose level (g/L)

Co Control

Garlic

0 PO

Figure 2. Effect of garlic mode of administration (p.o. and i.p.) on glycemia.

Table 2. Effect of garlic mode of administration on plasma electrolytes

Parameter (mM/L) Calcium Sodium Potassium

Control (p.o.) 2.29± 0.08 132.54 ± 2 6.20 ± 1.10

Garlic (p.o.) 2.44 ± 0.1 129.86 ± 2 5.90 ± 1.00

compared i.p. versus p.o. mode of administration in order to bring some clues to several discrepancies about the effectiveness of garlic beneficial health effects (Agarwal, 1996). We used garlic at 5 g/kg dosage previously shown to exert cholesterol and glucose lowering activities (Mokni et al., 2006). In a previous study, we showed that when orally administered, garlic exerted positive growth effects evaluated by weight gain and increased the erythrocytes number (Hamlaoui-Gasmi et al., 2011a). Garlic-induced increase in erythrocytes count might be linked either to an increase in erythropoiesis (Morihara et al., 2007) or to the ability of garlic in decreasing membrane rigidity inherent to its cholesterol lowering effect (Hamlaoui-Gasmi et al., 2011a). Overall in this work, we found that p.o. garlic exhibited much more beneficial effects than the i.p. mode of administration. When orally administered garlic exerted positive growth effects evaluated by increased hemoglobin and hematocrit. The data reveal that garlic administered by p.o. did not result in any significant variation of MCV, MHV or MCHC. These data which fully corroborated previous works further strengthened its putative use as an antifatigue agent (Morihara et al., 2007). This last effect might have been provoked by garlic increased erythrocytes deformability due to its hypolipidemic effect (Hamlaoui-Gasmi et al., 2011a). In

Control (i.p.) 2.18 ± 0.01 130.9 ± 2.7 6.39 ± 0.30

Garlic (i.p.) 2.20 ± 0.02 134.6 ± 0.6 6.31 ± 0.14

this respect, osmotic fragility is a determinant of the deformability property which is essential for their function; and survival against the destruction by the spleen (Kempaiah and Srinivasan, 2005). Conversely, i.p. garlic induced weight loss, slightly decreased erythrocytes number as well as their deformability (Hamlaoui-Gasmi et al., 2011a). Thus, garlic mode of administration appeared essential. Intraperitoneal garlic administration exerted negative effects evaluated by decreased hemoglobin and hematocrit. Moreover, the results obtained in this study reveal that garlic administered by i.p. increased the MCV but reduced the MHV and has no effect on the MCHC. Garlic is commonly allowed like a hypoglycemiant agent whatever the mode of administration. We showed that garlic does not exert any effect on glycemia and on plasmatic electrolytes whatever the route of administration. In this order, Rosen et al. (2001) mentioned the absence of hypoglycemiant effect of garlic after intragastric way. In the same way it was shown (Liu et al., 2006) that a daily treatment of diabetics’ rats by p.o. garlic oil or by DADS did not affect the glycemia. Contradictory results showed (Chang and Johnson, 1980) that p.o. garlic powder induced a reduction in blood glucose. Moreover in diabetics rat treatment using garlic, improved all the changes of these parameters on a level comparable with

Hamlaoui-Gasmi et al.

that reached by treatments with insulin or the glibenclamide (Sheela and Augusti, 1992). Also, administration of raw garlic to fructose fed rats (diabetic) significantly reduced serum glucose, insulin as well as insulin resistance when compared with fructose fed rats after 8 weeks of treatment (Padiya et al., 2011). Garlic p.o. exhibited beneficial effects with no toxicity even at high dosage used in the present study. In this respect, p.o. garlic has been shown to exert antioxidant properties in plasma and erythrocytes of elderly subjects (Avc et al., 2008). Although, preliminary our data opened the way to putative use of high garlic concentration either as antioxidant (when p.o. administered) or as prooxidant (by i.p. way). In previous studies, we established that garlic high dose oral treatment exhibited profound antianemic, antifatigue, lipid-lowering activity and transaminases lowering when compared with i.p. route of treatment (Hamlaoui-Gasmi et al., 2011a). We also showed that garlic high dose oral treatment exhibited profound antioxidant activity in red blood cells and plasma (Hamlaoui-Gasmi et al., 2011b), liver and spleen (Hamlaoui-Gasmi et al., 20011c) and brain (HamlaouiGasmi et al., 2011d) when compared with i.p. route of treatment, which could even be detrimental by inducing a prooxidant effect and ultimately toxicity in these organs. From the above discussion, we conclude that the antianemic effects of p.o. garlic are original, interesting and could have promising therapeutic applications. ACKNOLEDGEMENT This work was financially supported by the Tunisian Ministry of Research. REFERENCES Agarwal KC (1996). Therapeutic actions of garlic constituents. Med. Res. Rev. 16: 111-124. Alnaqeeb MA, Thomson M, Bordia T, ALI M (1996). Histopathological effects of garlic on liver and lung of rats. Toxicol. Lett. 85: 157-164. Asdaq SM, Inamdar MN (2011). The potential benefits of a garlic and hydrochlorothiazide combination as antihypertensive and cardioprotective in rats. J. Nat. Med. 65: 81-88. Avc A, Atl T, ErgĂźder IB, Varl M, Devrim E, Aras S, Durk I (2008). Effects of garlic consumption on plasma and erythrocytes antioxidant parameters in elderly subjects. Gerontol., 54: 173-176. Banerjee SK, Maulik SK (2002). Effect of garlic on cardiovascular disorders: a review. Nutr. J. 1: 4. Chang MLW, Johnson MA (1980). Effect off garlic one carbohydrate metabolism and lipid synthesis in rats. J. Nutr. 110: 931-936.

8263

Hamlaoui-Gasmi S, Mokni M, Aouani E, Amri M, Marzouki L (2011a). Modulation of hematological parameters by garlic based on route of administration in rat. J. Food Biochem. 35: 442-453. Hamlaoui-Gasmi S, Mokni M, Limam F, Aouani E, Amri M, Marzouki L (2011b). Effect of the route of garlic treatment on modulation of erythrocytes and plasma redox status in rats. J. Med. Plants Res. 5(12): 2508-2513. Hamlaoui-Gasmi S, Limam N, Mokni M, Limam F, Aouani E, Amri M, Marzouki L (2011c). Effect of the route of garlic treatment on modulation of liver and spleen redox status in rats. August, In Press. J. Med. Plants Res. 5: 4 Hamlaoui-Gasmi S, Limam N, Mokni M, Limam F, Aouani E, Amri M, Marzouki L (2011d). Garlic-mode treatment effects on rat brain redox status. September, In Press. J. Med. Plants Res. 5: 18 Heidarian E, Jafari-Dehkordi E, Seidkhani-Nahal A (2011). Effect of garlic on liver phosphatidate phosphohydrolase and plasma lipid levels in hyperlipidemic rats. Food Chem. Toxicol. 49(5): 1110-1114. Kempaiah RK, Srinivasan K (2005). Influence of dietatary spices on the fluidity of erythrocytes in hypercholesterolaemic rats. Br. J. Nutr. 93: 81-91. Liu PL, Wong CK, Lii H, Sheen LY (2006). Antidiabetic effect off garlic oil drank not diallyl disulfide in rats with streptozotocin-induced diabetes. Food Chem. Toxicol. 44: 1377-1384. Madkor HR, Mansour SW, Ramadan G (2011). Modulatory effects of garlic, ginger, turmeric and their mixture on hyperglycaemia, dyslipidaemia and oxidative stress in streptozotocin-nicotinamide diabetic rats. Br. J. Nutr. 105: 1210-1217. Mokni M, Limam F, Amri M, Aouani E (2006). Acute effects of a partially purified fraction from garlic on plasma glucose and cholesterol levels in rats: Putative involvement of nitric oxide. Indian J. Biochem. Biophys. 43: 386-390. Morihara N, Nishihama T, Ushijima M, Ide N, Takeda H, Hayama M (2007). Garlic as an antifatigue agent. Mol. Nutr. Food Res. 51: 13291334. National Research Council (1985). Guide for the care and the use of laboratory animals. National institute of health, Bethesda, 20: p. 85. Padiya R, Khatua TN, Bagul PK, Kuncha M, Banerjee SK (2011). Garlic improves insulin sensitivity and associated metabolic syndromes in fructose fed rats. In Press. Nutr. Metab. Vol. 8 Rahman S, Parvez AK, Islam R, Khan MH (2011). Antibacterial activity of natural spices on multiple drug resistant Escherichia coli isolated from drinking water, Bangladesh. Ann. Clin. Microbiol. Antimicrob. 10: 10. Riccardi G, Rivellese AA (2000). Dietary treatment of the metabolic syndromeâ&#x20AC;&#x201C;the optimal diet. Br. J. Nutr. 83: 143-148. Rosen RT, Hiserodt RD, Fukuda EK, Ruiz RJ, Zhou Z, Lech J, Rosen SL, Hartman TG (2001). Determination off Al, S-Allylcystein and volatile metabolites off Garlic in breath, plasma gold simulated gastric fluids. J. Nutr. 131: 968-971. Sheela CG, Augusti KT (1992). Antidiabetic effects off Dirties cysteine sulphoxide isolated from garlic Al sativum Linn. Indian J. Exp. Biol. 30: 532-536.

African Journal of Biotechnology Vol. 11(33), pp. 8275-8279, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.4080 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Effects of dietary intake of red palm oil on fatty acid composition and lipid profiles in male Wistar rats A. O. Ayeleso1, O. O. Oguntibeju1 and N. L. Brooks2* 1

Oxidative Stress Research Centre, Department of Biomedical Sciences, Faculty of Health and Wellness Sciences, Cape Peninsula University of Technology, Bellville, South Africa. 2 Department of Wellness Sciences, Faculty of Health and Wellness Sciences, Cape Peninsula University of Technology, Cape Town, South Africa. Accepted 27 February, 2012

Little is known about the effects of the dietary intake of red palm oil (RPO) on fatty acid composition in the liver of rats. Male Wistar rats randomly divided into four groups were fed with different doses of red palm oil. The control group received no red palm oil; while the experimental groups were fed with 1 ml, 2 ml and 4 ml of red palm oil daily for seven weeks. In the liver of all the groups, palmitic acid (C16:0) followed by stearic acid (C18:0) were predominantly present among the saturated fatty acids. Oleic acid (C18:1c) and linoleic acid (C18:2) were largely present among the unsaturated fatty acids. There was no significant (P<0.05) increase in the levels of palmitic acid (C16:0) in all the groups while oleic acid (C18:1) significantly increased at 4 ml RPO when compared with the control (p<0.05). The total cholesterol (TC), triglycerides (TG) and very low-density lipoprotein (VLDL)-cholesterol levels were not significantly different in all the groups (P<0.05) when compared with the control group. Generally, there were no significant effects of RPO on levels of serum cholesterol, and triglycerides as well as accumulation of saturated fatty acids in the liver of the experimental rats. Key words: Lipid profiles, fatty acid, red palm oil, rats. INTRODUCTION Red palm oil (RPO) has a deep orange-red colour and is extracted from the mesocarp of fruits of palm oil trees (Elaeis guineensis). All over the world, 90% of the RPO produced is used for edible purposes (Idris and Samsuddin, 1993; Edem, 2002). Red palm oil contains a variety of antioxidant vitamins necessary for maintaining good health (Bayorh, 2005). It is a good source of vitamin A (carotenes) (Sundram et al., 2003; Arora et al., 2006; Oguntibeju et al., 2010; Aboua et al., 2011) and vitamin E (tocopherols and tocotrienols) (Sundram et al., 2003; Arora et al., 2006; Muharis et al., 2010) and these are capable of scavenging free radicals thus preventing the damaging effects of oxidation in tissues. The

*Corresponding +27214603436.

author.

Email:

brooksn@cput.ac.za.

Tel:

Abbreviations: RPO, Red palm oil; TC, total cholesterol; TG, triglycerides; VLDL, very low-density lipoprotein.

characteristic colour of RPO is as a result of the abundance of carotenoids (500 - 700 mg/L) in the crude oil (Edem and Akpanabiatu, 2006; Edem, 2009). The combined effect of carotenoids, tocopherols, tocotrienols and 50% of the unsaturated fatty acids gives palm oil a higher oxidative stability as compared to other vegetable oils (Arora et al., 2006). Red palm oil supplies fatty acids that are important for proper growth and development. Fatty acids play a vital role in metabolism because they are the building blocks of fat in the body and in food. They are a source of energy for the cell and form the structural basis of the cell. Red palm oil contains 50% saturated, 40% monounsaturated and 10% polyunsaturated fatty acids (Rukmini, 1994; Edem, 2002). From the nutritional point of view, the major concern for RPO has to do with their degree of saturation and the effect they have on blood lipids (Hayes and Khosla, 2007). Palmitic and stearic acids are saturated fatty acids which account for 45 and 5% of total fatty acids in red palm oil respectively (Hayes and Khosla, 2007; Dauqan

8276

Afr. J. Biotechnol.

Table 1. Nutritional composition of carotino red palm oil.

Serving size: 1 tablespoon 14 g Energy Total fat Monounsaturates Polyunsaturates Saturates Trans fat Cholesterol and Sodium Protein, carbohydrate and dietary fibre Natural carotenes Beta carotene Alpha carotene Other carotenes Natural vitamin E: 19.5% Tocopherols 80.5% Tocotrienols Co- Enzyme Q10

Per 100 ml 3400 KJ 92 g 43 g 12 g 37 g 0g 0 mg 0g 46 mg 22 mg 17 mg 7.3 mg 74 mg

Per 14g serving 510 KJ 14 g 6.5 g 1.9 g 5.6 g 0g 0 mg 0g 7.0 mg 3.3 mg 2.6 mg 1.1 mg 11 mg

4.0 mg

0.6 mg

Source: Table adapted from the nutritional label of the Carotino Palm Fruit Oil from Malaysia.

et al., 2011). More than 95% of palm oil consists of mixtures of triglycerides, each esterifiied with three fatty acids (Akinola et al., 2010). The various types of dietary lipids have shown to affect lipid metabolism differently (Ajayi and Ajayi, 2009). Wu et al. (2011) reported that dietary lipids directly affect fatty acids composition in animal tissues. The aim of this study was to investigate the levels of fatty acids and lipid profiles in rats following the dietary intake of red palm oil at different doses. MATERIALS AND METHODS

Association of Official Analytical Chemists (AOAC) (2005). The liver samples were placed on the vortex to achieve homogeneity. Liver samples ranging from 0.4 to 1 g were weighed into 70 ml digestion tubes and 100 mg pyrogallic acid was added followed by 2 ml of undecanoic acid (internal standard) solution, 2 ml of ethanol and 10 ml of 32% hydrochloric acid. The tubes were then placed in the water bath at 75°C with gently shaking for 40 min. The fatty acids were extracted by adding 25 ml of diethyl ether and 25 ml of petroleum ether. The organic phase was dried and the residue was derivatized using 2 ml of 2% sulphuric acid in methanol and 1 ml of toluene at 100°C for 45 min. After cooling to room temperature, 5 ml distilled water and 1 ml of hexane were added and the hexane solution was then dried with anhydrous sodium sulphate and transferred into a vial for gas chromatographic analyses.

Experimental animals and management Lipid profile determination Male Wistar rats (195- 240 g) were obtained from Stellenbosch University, Tygerberg, South Africa and used throughout the study. The study was conducted after obtaining Ethical Committee Clearance from Cape Peninsula University of Technology. The rats were housed in a well controlled environment set at 22°C±2 with 50±5% humidity and a 12 h light cycle. They were randomly placed in four groups. Group 1 (n=5) received no supplementation and served as the control while groups 2 (n=6), 3 (n=6) and 4 (n=6) received 1 ml, 2 ml and 4 ml red palm oil (RPO) respectively. Each group of rats was allowed free access to water and standard rat chow (SRC) for seven weeks. Carotino palm fruit oil from Malaysia at different doses (1ml, 2ml and 4ml) was added to the standard rat chow daily diet of the experimental animals for seven weeks. The nutritional composition of the red palm oil is shown in Table 1. At the end of the seven weeks, all the animals were sacrificed using euthanasia after overnight fasting. Blood samples were collected from the abdominal aorta and then centrifuged to obtain the serum used for lipid analysis while the liver was removed for fatty acid determination.

Triglycerides, total cholesterol and high density lipoprotein (HDL)cholesterol were evaluated with kits using a clinical chemistry analyzer (EasyRa medical) according to the manufacturer`s instructions. Very low-density lipoprotein (VLDL) and low-density lipoprotein (LDL)-cholesterol were calculated according to Friedewald’s formula (Friedewald et al., 1972). VLDL-cholesterol = TG/5 and LDL-cholesterol = TC – VLDL-cholesterol – HDLcholesterol.

Statistical analysis Data were expressed as the means ± standard deviations (S.D). Significant differences between mean values of different groups were determined by one-way analysis of variance (ANOVA) with Turkeys test using GraphPad Prism 5. Differences were considered significant at p<0.05.

Fatty acid determination

RESULTS AND DISCUSSION

Fatty acids determination was carried out by the modified method of

Table 2 indicates the percentage of body weights gain in

Ayeleso et al.

8277

Table 2. Body weights gain in the rats fed with different doses of red palm oil (RPO).

RPO Dosage (ml) 0 1 2 4

Initial weight(g) 225 ±11.79 222 ±10.52 212 ±11.31 214 ±17.25

Final weight(g) 352 ±18.43 360 ±29.93 359 ±21.26 387 ±26.62

% Body weight gain (%) 56 ±4.02 62 ±6.48 69 ±4.37* 80 ±6.04*

(*) Indicates significant difference from control group at p<0.05.

Table 3. Total fatty acids (g/100g) in the liver of rats fed with different doses of RPO.

RPO Dosage (ml) 0 1 2 4

Total fatty acid 1.136 ±0.0950 1.176 ±0.1383 1.131 ±0.1806 1.245 ±0.1025

(*) Indicates significant difference from control group at p<0.05.

Table 4. Levels of saturated fatty acids (g/100g) in the liver of rats fed with different doses of RPO.

RPO Dosage (ml) 0 1 2 4

C14 0.003±0.0004 0.004±0.0003 0.003±0.0006 0.003±0.0005

C15 0.004±0.0005 0.003*±0.0006 0.002*±0.0000 0.002*±0.0005

C16 0.298±0.0209 0.313±0.0350 0 .300±0.0441 0.330±0.0219

C17 0.010±0.0011 0.007*±0.0005 0.005*±0.0004 0.004*±0.0005

C18 0.254±0.0118 0.243±0.0242 0.228±0.0129 0.222*±0.0175

C24 0.008±0.0007 0.008±0.0005 0.007*±0.0005 0.006*±0.0006

(*) Indicates significant difference compared with control group at p<0.05.

the rats fed with different doses of RPO. There was a significant increase in the body weights gain in both 2 ml and 4 ml RPO fed groups when compared with the control group. Table 3 indicates the total fatty acids in the liver of rats fed with different doses of RPO. There was no significant difference in the total fatty acids in all palm oil fed groups when compared with the control group. The levels of saturated fatty acids in the liver of rats fed with different doses of red palm oil are indicated in Table 4. The two most abundant saturated fatty acids in the liver of all the groups were palmitic acid (C16) and stearic acid (C18). The values of palmitic acid were not significantly different in all RPO fed groups when compared with the control. Stearic acid was significantly lower for the 4 ml RPO group only when compared to the control. Other saturated fatty acids present were myristic acid (C14), pentadecylic acid (C15), margaric acid (C17) and lignoceric acid (C24). No significant differences were noted for myristic acid for any of RPO fed groups. Pentadecyclic acid (C15) and margaric acid (C17) significantly decreased in the all palm oil fed groups while C24 significantly decreased at 2 ml and 4 ml RPO when compared with the control group.

The levels of unsaturated fatty acids in the liver of rats fed with different doses of red palm oil are indicated in Table 5. The two most abundant liver unsaturated fatty acids in all the groups were oleic acid (C18:1c) and linoleic acid (C18:2). There was significant increase in the values of C18:1 at 4 ml RPO and the values of C18:2 at 2 ml and 4 ml RPO significantly decreased when compared with the control. Other unsaturated fatty acids present in minute amounts were elaidic acid (C18:1t), linolenic acid (C18:3) and docosahexaenoic acid (DHA) (C22:6). There was significant decrease in C18:1t and C18:3 levels in all experimental groups when compared with the control group. The level of C22:6 were significantly reduced for the 4 ml RPO fed group when compared with the control group. The serum lipid profiles of rats at different doses of palm oil are indicated in Table 6. There were no significant differences in the serum total cholesterol, triglycerides and VLDL-cholesterol when compared with the control group. There was a significant difference in the level of HDL-cholesterol at 1 ml RPO fed group and a significant decrease in LDL-cholesterol at 4 ml RPO fed group when compared with the control group.

8278

Afr. J. Biotechnol.

Table 5. Levels of unsaturated fatty acids (g/100g) in the liver of rats fed with different doses of palm oil.

RPO Dosage (ml) 0 1 2 4 (n=5)

C18:1t 0.020±0.0018 0.015*±0.0016 0.011* ±0.0008 0.009* ±0.0005

C18:1c 0.162 ±0.0279 0.249 ±0.0847 0.278 ±0.0898 0.386 ±0.0470*

C18:2 0.302 ±0.0392 0.265 ±0.0289 0.224 ±0.0340* 0.229 ±0.0193*

C18:3 0.009 ±0.0024 0.006 ±0.0017* 0.004 ±0.0011* 0.003 ±0.0005*

C22:6 0.065 ±0.0073 0.064 ±0.0038 0.060 ±0.0040 0.052 ±0.0043*

(*) Indicates significant difference compared with control group at p<0.05.

Table 6. The lipid profiles in the serum of the rats at different doses of palm oil.

RPO Dosage (ml) 0 1 2 4

Total Cholesterol (mmol/L) 1.70± 0.07 1.92 ±0.26 1.65 ±0.09 1.62 ±0.11

Triglycerides (mmol/L) 0.57± 0.14 1.07 ±0.49 0.53 ±0.12 0.79 ±0.28

HDL-Cholesterol (mmol/L) 0.48 ±0.05 0.60 ±0.05* 0.54 ±0.04 0.55 ±0.07

VLDL-Cholesterol (mmol/L) 0.11 ±0.03 0.21 ±0.10 0.11±0.02 0.16 ±0.06

LDL- Cholesterol (mmol/L) 1.11 ±0.06 1.10 ±0.15 1.01 ±0.08 0.91 ±0.11*

(*) means significantly different compared to with control at p < 0.05. HDL, High density lipoprotein; VLDL, very low density lipoprotein; LDL, low density liprotein.

Total cholesterol is made up of LDL cholesterol, HDL cholesterol, and VLDL cholesterol and increased levels of LDL increase the risk of heart disease and stroke while high levels of HDL reduce the risk of cardiovascular disease (Birtcher and Ballantyne, 2004). Hayes and Khosla (2007) also reported that circulating cholesterol is linked to heart disease and can serve as a relevant index of our nutritional well-being that is sensitive to fat intake and composition. The vital lipids whose increase are impli-cated in the hindrance of blood supply to the heart, brain, liver or kidney and could cause coronary heart diseases, stroke or kidney failure are cholesterol and triacyl-glycerols (Owolabi et al., 2010). Yuan et al. (2007) reported that high levels of triglycerides could contribute independently to increased risk of cardiovascular disease and severe hypertriglyceridemia is also associated with an increased risk of acute pancreatitis. Oguntibeju et al. (2009) reported that the link between dietary fats and cardiovascular disease has created an increasing interest in dietary red palm oil research. The intake of saturated fatty acids increased total cholesterol, LDL and HDL while polyunsaturated fatty acids in fats decreased these values (Hayes and Khosla, 2007). Dauqan et al. (2011) showed a significant decrease in cholesterol in animals fed with red palm olein. Red palm oil supplementation has been reported to have beneficial or neutral effects on serum total cholesterol despite its high saturated fat content (Kruger et al., 2007). Our results indicate that RPO does not significantly increase cholesterol and triglycerides levels in RPO fed rats after seven week feeding period. Ajayi and Ajayi (2009) reported that both polyunsaturated fatty acids (PUFA) and monounsaturated fatty acids (MUFA) could have an effect on lipoprotein metabolism with hypocholes-

terolemic effect. Palm oil contains only 0.2% lauric acid (Kochikuzhyil et al., 2010) and a high quantity of palmitic acid as well as considerable amounts of oleic and linoleic acids (Edem, 2002). Lauric and palmitic acids are hypercholesterolemic when compared with oleic acid while lauric acid increased cholesterol levels more than palmitic acid (Temme et al., 1996). Similarly, Sundram et al. (1994) reported that the dietary combination of lauric and myristic fatty acids increased serum cholesterol than palmitic acid in healthy normocholesterolemic men fed with low cholesterol diet. Red palm oil contains equivalent amounts of saturated and unsaturated fatty acids (Oguntibeju et al., 2010). Our results showed no abnormal retention of saturated fatty acids in the liver of the rats. Palmitic acid which is known to be largely present among the saturated fatty acids in RPO did not increase significantly in the liver of the RPO fed groups when compared with the control group. In conclusion, the dietary intake of RPO did not result in accumulation of saturated fatty acids in the liver. Also, it did not significantly alter the serum levels of both cholesterol and triglycerides levels and it could have the potential to reduce the levels of bad cholesterols and triglycerides especially in diseased conditions. Hence, further investigations are recommended as RPO could help to lower the risk of atherosclerosis and other related diseases. ACKNOWLEDGEMENT This work was carried out through the funding provided by Cape Peninsula University of Technology, Bellville, South Africa.

Ayeleso et al.

REFERENCES Aboua YG, Brooks N, Mahfouz RZ, Agarwal A, du Plessis SS (2011). A red palm oil diet can reduce the effects of oxidative stress on rat spermatozoa. Andrologia, pp. 1-9. Ajayi OB, Ajayi, DD (2009). Effect of oilseed diets on plasma lipid profile in albino rats. Pak. J. Nutr. 8: 116-118. Akinola FF, Oguntibeju OO, Adisa AW, Owojuyigbe OS (2010). Physico-chemical properties of palm oil from different palm oil local factories in Nigeria. J. Food Agric. Environ. 8(3-4): 264-269. Arora S, Manjula S, Gopala AG, Subramanian R (2006). Membrane processing of crude palm oil. Desalination, 191: 454-466. Association of Official Analytical Chemists AOAC 996.06 (2005). 18th edition, Chapter 41: 20-24 (Oils and Fat). Bayorh MA, Abukhalaf IK, Ganafa AA (2005). Effect of palm oil on blood pressure, endothelial function and oxidative stress. Asia Pac. J. Clin. Nutr. 14: 325-339. Birtcher KK, Ballantyne CM (2004). Cardiology patient page. Measurement of cholesterol: a patient perspective. Circulation, 110: e296-297. Dauqan E, Sani HA, Abdullah A, Kasim ZM (2011). Effect of Different Vegetable Oils (Red Palm Olein, Palm Olein, Corn Oil and Coconut Oil) on Lipid Profile in Rat. Food Nutr. Sci. 2: 253-258. Edem DO (2002). Palm oil: Biochemical, physiological, nutritional, haematological and toxicological aspects: A review. Plant Foods Hum. Nutr. 57: 319-341. Edem DO, Akpanabiatu MI (2006). Effects of Palm Oilâ&#x20AC;&#x201C;Containing Diets on Enzyme Activities of Rats. Pak. J. Nutr. 5(4): 301-305. Edem DO (2009). Haematological and Histological Alterations Induced in Rats by Palm Oil-Containing Diets. Eur. J. Sci. Res. 32(3): 405418. Friedewald WT, Levy RI, Fredrickson DS (1972). Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin. Chem. 18: 499-502. Hayes KC, Khosla P (2007). The complex interplay of palm oil fatty acids on blood lipids. Eur. J. Lipid Sci. Technol. 109: 453-464. Idris NA, Samsuddin S (1993). Developments in food uses of palm oil: a brief review. Palmas, 15(3): 66-69. Kochikuzhyil BM, Devi K, Fattepur SR (2010). Effect of saturated fatty acid-rich dietary vegetable oils on lipid profile, antioxidant enzymes and glucose tolerance in diabetic rats. Indian J. Pharmacol. 42(3): 142-145.

8279

Kruger MJ, Engelbrecht AM, Esterhuyse J, du Toit EF, van Rooyen J (2007). Dietary red palm oil reduces ischaemia-reperfusion injury in rats fed a hypercholesterolaemic diet. Br. J. Nutr. 97(4): 653-660. Muharis SP, Top AG, Murugan D, Mustafa MR (2010). Palm oil tocotrienol fractions restore endothelium dependent relaxation in aortic rings of streptozotocin-induced diabetic and spontaneously hypertensive rats. Nutr. Res. 30(3): 209-216. Oguntibeju OO, Esterhuyse AJ, Truter EJ (2009). Red palm oil: nutritional, physiological and therapeutic roles in improving human wellbeing and quality of life. Br. J. Biomed. Sci. 66(4): 216-222. Oguntibeju OO, Esterhuyse AJ, Truter EJ (2010). Possible role of red palm oil supplementation in reducing oxidative stress in HIV/AIDS and TB patients: A Review. J. Med. Plant Res. 4(3): 188-196. Owolabi OA, James DB, Ibrahim AB, Folorunsho OF, Bwalla I, Akanta F (2010). Changes in Lipid Profile of Aqueous and Ethanolic Extract of Blighia sapida in Rats. Asian J. Med. Sci. 2(4): 177-180. Rukmini C (1994). Red palm oil to combat vitamin A deficiency in developing countries. Food Nutr. Bull. 15(2): 126-129. Sundram K, Hayes KC, Siru OH (1994). Dietary palmitic acid results in lower serum cholesterol than does a lauric-myristic acid combination in normolipemic humans. Am. J. Clin. Nutr. 59: 841-846. Sundram K, Sambanthamurthi R, Tan YA (2003). Palm fruit chemistry and nutrition. Asia Pac. J. Clin. Nutr. 12: 355-362. Temme EHM, Mansink RP, Hornstra G (1996). Comparison of the effects of diets enriched in lauric, palmitic, or oleic acids on serum lipids and lipoproteins in healthy women and men. Am. J. Clin. Nutr. 63: 897-903. Wu X, Tong Y, Shankar K, Baumgardner JN, Kang J, Badeaux J, Badger TM, Ronis MJ (2011). Lipid fatty acid profile analyses in liver and serum in rats with nonalcoholic steatohepatitis using improved gas chromatography-mass spectrometry methodology. J. Agric. Food Chem. 59(2): 747-754. Yuan G, Al-Shali KZ, Hegele RA (2007). Hypertriglyceridemia: its etiology, effects and treatment. CMAJ, 176: 1113-1120.

Full Length Research Paper

Chemical modification of β-endoglucanase from Trichoderma viridin by methanol and determination of the catalytic functional groups Feng Cai#, Yangang Xie#, Xiaochun He and Tiejun Li* Department of Chemical and Biological Engineering, Nantong Vocational College, Nantong 226007, China. Accepted 26 March, 2012

β-Endoglucanase from Trichoderma viride was modified by methanol to explore the catalytic functional groups of cellulase. Crude cellulase was produced, and the conditions of saturation and pH by salting out with ammonium sulfate were optimized. Under optimal conditions, crude cellulase was isolated and purified. The pure cellulase was modified by excess methanol, and it was found that the carboxyl in the side-chain radical of cellulase proved to be the catalytic functional group by analysis of the infrared spectrum of modification of cellulase. Modification of cellulase with different concentrations of methanol was carried out and results show that the modified side-chain radical lies at the active site of cellulase or on essential groups. Sodium carboxymethyl cellulose (CMC-Na) which protected the cellulase from inactivation by methanol indicated that the carboxyl modified by methanol is not only a structural radical but also lies at the active site. The inactivation degree of cellulase modified by methanol could be decreased by glucose and it showed that the modification occurred in the active site of cellulase. The kinetic analysis according to Keech and Farrant equation demonstrated that one carboxyl was an essential group for cellulase activity. Key words: Chemical modification, cellulase, methanol, carboxyl. INTRODUCTION Cellulose, both the most widely distributed and the most abundant of carbohydrate forms in nature, represents 35 to 50% of biomaterials in the world (Ragauskas et al., 2006). It is also the largest number of the renewable substance for humans; and its degradation is the key link of carbon recycles in nature (Wang et al., 2004). The use of cellulases in cellulose’ hydrolysis is an ideal way of high efficient and non-pollution, which can make large cellulose resources into the required material of humans (Wu, 2008). Cellulases are enzymes that hydrolyze cellulose (beta1,4-glucan or beta D-glucosidic linkages) resulting in the formation of glucose, cellobiose, cellooligosaccharides, and the like (Su et al., 2010). Cellulases have been

*Corresponding author. E-mail: hxc2011ntvc@yahoo.com. Tel: 86 513 81050856. Fax: 86 513 81050815.

#These authors contributed equally to this research.

traditionally divided into three major classes: endoglucanases (EC 3.2.1.4) ("EG"), exoglucanases or cellobiohydrolases (EC 3.2.1.91) ("CBH") and betaglucosidases (EC 3.2.1.21) ("BG") (Lynd et al., 2002; Sinegania and Hosseinpour, 2006). The complete cellulase system needs different types of these various cellulases, by which the enzymatic process to hydrolyze cellulosic materials could be accomplished. Now, cellulases have a great application prospect in many fields, such as medicine, textile, chemical engineering, paper engineering, food and fermentation industries, commercial detergent, tobacco, waste water treatment, feed additive etc (Howard et al., 2003; Su et al., 2010). The application of cellulase has very important significance in solving the problems of the raw materials of industry and agriculture, the energy crisis, and the environmental pollution and so on. Unfortunately, cellulases, like all other enzymes, become unstable and lose activity in storage or catalytic process, due to the effect of external conditions. Therefore, scientists focus more on the stability of cellulase.

Cai et al.

There are several major and principally different routes to obtain cellulases with improved stability properties to date: (1) by selection from organisms living in appropriate extreme environments (Kashima et al., 2005; Huang et al., 2005; Kubartova et al., 2007), (2) by gene recombination and genetic engineering (Valenzuela et al., 2006; Feng et al., 2007; Kim et al., 2007; Brune, 2007; Schmidt, 2007; Liu et al., 2006), (3) by immobilization (Wu et al., 2005; Sinegania et al., 2005; Dong et al., 2008), and (4) by chemical modification (Kwinam et al., 2002; Yang et al., 2009). The main strategies of aforementioned ways are based on changing the cellulases’ molecule structure or living environments. So, further study on the amino acid composition at the active site of cellulase and the catalytic functional groups of cellulase could provide scientific basis research on the stability of cellulase. In the past decade, great progress has been made on the research of the amino acid composition at the active site of cellulase, which confirmed that they were mostly tryptophan, glutamic acid and aspartic acid (Liu and Xia, 2008). However, the research of the catalytic functional groups of cellulase by methanol modification has not been reported in detail to date. Chemical modification, especially by small molecular chemistry, has an important role in determining the catalytic functional groups of enzyme (Yan and Gao, 1997; Ackers and Smith, 1985). It is the process of covalent attachment of special group of modifiers to the side-chain group of certain amino-acid residue in enzyme. In this paper, chemical modification by using small organic molecular methanol as modifier was carried out to explore the catalytic functional groups of the cellulase from Trichoderma viride. The main objective of this present study was to verify the relation between the activity of cellulase and the catalytic functional groups. This, to our best knowledge, is the first report on cellulase modification by using methanol as the modifier, which may provide a theoretical reference for better understanding of the catalysis mechanism of cellulase. MATERIALS AND METHODS Strain, media and chemicals T. viride used to produce β-endoglucanase was provided from the institute of microbiology, Chinese academy of sciences. Nutrient solution of (NH4)3P04 contained (w/w): (NH4)3P04, 2.06%; MgS04·7H2 0, 0.05%; KH2P04, 0.01%. Citrate buffer at pH of 4.0, 50 and 6.0 correspondingly contained (mol/l): 0.1 mol/l citric acid, 13.1, 8.2 and 3.8 ml; sodium citrate, 6.9, 11.8 and 16.2 ml. Solid fermentation medium contained: rice straw powder, 4.0 g; wheat bran, 1.0 g; nutrient solution of (NH4)3P04, 12.5 ml. 3,5Dinitrosalicylic acid (DNS) solution contained (g/l): potassiumsodium tartrate, 200 g; DNS, 10.0 g; sodium hydroxide, 10.0 g; phenol, 2.0 g; sodium sulfite, 0.5 g. Disodium hydrogen phosphate (pH 5.0) contained (g/l): Na2 HP04·12H20, 1.4755 g; citric acid, 0.4076 g. Sodium carboxymethyl cellulose (CMC-Na) solution contained (g/l): CMC-Na, 6.25 g; disodium hydrogen phosphate (pH 5.0), 31.25 ml. Chemicals of the mentioned solution or medium

8265

and other chemicals were of analytical grade and purchased from Shanghai Sangon Co. Ltd, PR China. The Sephadex G-100 column and DEAE-Sepharose-FF anion exchange chromatography were purchased from Amersham Pharmacia.

Production of crude cellulase The T. viride strains preserved in a 4°C were incubated in an Erlenmeyer flask containing 20 ml nutrient solution of (NH4)3P04 and glass beads. The culture was grown at 30°C with vigorous shaking (200 rev/min) for 1 h and then 2.5 ml suspension was mixed into the solid fermentation medium equably. The mixture used to produce crude cellulase was then incubated at 30°C for 120 h. After solid state fermentation, 100 ml citrate buffer at pH of 4.0, 50 and 6.0 was added to each mixture, and incubated at 30°C for 1 h. The fermentation liquor was filtrated with two layers of sterile gauze and centrifuged at 8500 rev/min for 30 min at 4°C. The fermentation supernatant of crude cellulase was collected, respectively at the end.

Assay of cellulase activity Cellulase activity was measured by the DNS method (Miller et al., 1960), through the determination of the amount of reducing sugars liberated from CMC solubilized in 50 mM Tris-HCl buffer, at pH 8.0. Briefly, this mixture was incubated for 20 min at 50°C and the reaction was stopped by the addition of DNS solution. The treated samples were boiled for 10 min, cooled in water for color stabilization, and the optical density was measured at 550 nm (Lee et al., 2008). The cellulase activity was determined by using a calibration curve for glucose. One unit of enzyme activity was defined as the amount of enzyme that released 1 μmol of glucose per minute. Optimization of conditions of salting out with aluminum sulfate To determine the optimum saturation degree and pH of salting out with ammonium sulfate, 7 crude cellulase of 15 ml each at pH of 4.0 was salted out, respectively by relative saturation of ammonium sulfate at 20, 30, 40, 50, 60, 70 and 80%, left at 4°C for 12 h, and each centrifuged at 8500 rev/min for 20 min at 4°C. The supernatant and precipitate were collected from each mixture, respectively, and the precipitate of each was dissolved with the corresponding pH buffer to the original volume. The content of protein of each was determined by measuring the ultraviolet (UV) absorbance at 280 nm, and the activity of cellulase was measured as previously described. Crude cellulase at pH of 5.0 and 6.0 were processed as described at pH of 4.0. The precipitation curve of enzyme with ammonium sulfate was prepared to determine the optimum of saturation interval X1~X2% and pH of ammonium sulfate.

Production and purification of cellulase (NH4)2S04 was added into the crude cellulase solutions to X1% saturation with slow stirring. The reaction mixture was at 4°C for 12 h, and centrifuged at 8500 rev/min for 20 min at 4°C. The precipitate was removed and the supernatant was brought to 90% saturation with (NH4)2SO4, left at 4°C for 12 h, and centrifuged. The precipitate was dissolved in citric acid buffer solution (pH 6.0), and then was passed through a Sephadex G-100 column (2.2 at a flow rate of 1.0 ml/min. The fractions collected were filtered through a 0.22 μm membrane filter, and those desalted enzyme were subjected to 1 ml DEAE-Sepharose-FF anion exchange

8266

Afr. J. Biotechnol.

chromatography to remove large amounts of acidic protein. The results of separation were recorded by using a fast protein liquid chromatography system (FPLC). Active fractions were collected, combined and stored at 4°C. The purity and relative molecular mass of the purified β-endoglucanase were assessed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

Determination of side-chain radical modified by methanol The modification of pure cellulase was carried out by adding excess methanol and adequate hydrochloric acid (0.02~0.1 mol/l) that the reaction required (Zhou and Wang, 1998). The reaction mixture was at 20°C for a few hours, and made into solid by evaporation of low temperature. The Fourier transform infrared (FTIR) spectra of cellulase modified and unmodified were gotten by using Bruker EQUINOX 55 remote sensing FTIR spectrometer and OPUS/IR software control system. The side-chain radical of cellulase modified by methanol was confirmed by analysis of these spectra (Zhu, 2000).

Effect of methanol on cellulase activity To evaluate the effect of methanol on cellulase activity, methanol with the definite volume of different concentrations was added into the reaction system containing CMC-Na (0.625 g/l, pH 4.8). Deionized water was chosen as control instead of methanol, and its activity was defined as 100%. The activity of each reaction mixture was measured as previously described. To analyze the modification degree of methanol on cellulase activity, modification of cellulase was carried out with ratios of methanol to cellulase solution of (v/v): 0.2:0.5, 0.6:0.5 and 1.0:0.5, respectively. Deionized water was also chosen as control instead of methanol, and its activity was defined as 100%.

Effect of substrate on modification To analyze the effect of substrate on modification, methanol with a ratio of methanol to CMC-Na solution of 1:1(v/v), was added to CMC-Na solution (0.625 g/l) with different concentrations, and cellulase solution was added subsequently. The activity of cellulase was measured after the system had been reacted for 30 min at 50°C. Deionized water was chosen as control instead of methanol and CMC-Na, and its activity was defined as 100%.

Effect of glucose on modification To analyze the effect of glucose on modification, glucose solution with the definite volume of different concentrations was added to the cellulase solution modified by methanol. The activity of cellulase was measured after the system had been reacted for 30 min at 50°C. Deionized water was chosen as control instead of methanol and glucose, and its activity was defined as 100%.

Analysis of time process of methanol modification The relative activity of cellulase at different times was measured, respectively from the reaction mixture with a ratio of methanol to cellulase solution of 1/1 (v/v). Deionized water was chosen as control instead of methanol, and its activity was defined as 100%. The time process curve was plotted and t1/2 (the time required for 50% decrease in activity) was calculated. The linear equation was established by the curve plotted with logarithmic of activity against time, and the K I (the deactivation rate constant) was calculated.

Time process curves were plotted, respectively from different reaction mixtures with ratios of methanol to cellulase solution of 0.2:0.5, 0.35:0.5, 0.5:0.5, 0.65:0.5 and 0.80:0.5(v/v). Values of t1/2 were calculated from different time process curves. The linear regression equation was established by the standard curve plotted with logarithmic of 1/t1/2 against logarithmic of concentration of methanol, and values of n (apparent molecule number of inhibiter in the formation of the enzyme-inhibiter complex of inactivation) and k’ (apparent first-order inactivation rate constant) were calculated subsequently.

RESULTS AND DISCUSSION Optimization of saturation degree and pH by salting out with ammonium sulfate Effect of saturation degree of ammonium sulfate on the activity of cellulase is shown in Figure 1. The activity of cellulase salted out by ammonium sulfate increased rapidly in the 40 to 60% ammonium sulfate saturation range, while the activity in other range remained nearly constant. Changes of the activity of pH 4.0 were similar to that of pH 5.0, and the activity of cellulase over the saturation range of 40% of pH 6.0 were slightly higher than those of pH 4.0 and pH 5.0. Effect of saturation degree of ammonium sulfate on the content of protein is shown in Figure 2, which showed that small amounts of protein were precipitated at the 40% salt saturation. However, protein precipitated at the saturation of 40% was mostly impurity because the activity of cellulose was very low (Figure 1). Therefore, when proteins precipitated at the saturation of 40% were removed, cellulase could be isolated from the contamination proteins to a great extent. As shown in Figures 1 and 2, although large amounts of protein were salted out when the saturation increased from 60 to 80%, protein precipitated over the saturation range of 60% was mostly impurity because the content of protein and the activity of cellulase remained nearly constant. Then, these results indicate that the optimum process parameters for the precipitation and activity of cellulase salted out by ammonium sulfate were the saturation range from 40 to 60%, and a pH of 6.0. Isolation and purification of cellulase After optimization, crude cellulase was isolated and purified according to the described method. Results after each purification stage are as shown in Table 1. The cellulase attained 8.1 fold purification and 7.5% recovery through a series of purification stages: precipitation with ammonium sulphate, Sephadex G-100 gel filtration, and DEAE-Sepharose-FF anion exchange chromatography. The recovery observed in this study is higher than those reported by Saha (2004) and Yang et al., (2004). SDSPAGE of the purified cellulase demonstrated one band with a mobility corresponding to a molecular weight of 26.4 kDa (Figure 3), which showed the separation and

Cai et al.

0. 4

pH 4.0 pH 5.0 pH 6.0

Content of glucose (mg ml -1)

0. 35 0. 3 0. 25 0. 2 0. 15 0. 1 0. 05

0 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% Relative saturation of am m onium sulfate Figure 1. Effect of saturation degree of ammonium sulfate on the activity of c ellulase salted out by ammonium sulfate.

Content of protein A 280 nm

pH 4.0 2. 5

pH 5.0 pH 6.0

2 1. 5 1 0. 5 0 0- 20% 20- 30% 30- 40% 40- 50% 50- 60% 60- 70% 70- 80% Relative saturation of am m onium sulfate

Figure 2. Effect of saturation degree of ammonium sulfate on the content of protein salted out by ammonium sulfate.

8267

8268

Afr. J. Biotechnol.

Table 1. Isolation and purification of the β-endoglucanase.

Purification stage Crude cellulase Ammonium sulphate Sephadex G100 DEAE FF

Total protein (mg) 571.4 195.2 57.8 5.4

Total activity (U) 3869.6 1805.4 1238.2 288.6

Specific activity (U/mg) 6.7 9.2 21.4 53.4

Purification fold 1 1.4 3.2 8.1

Recovery (%) 100 46.9 32.2 7.5

chain radical of cellulase was modified by methanol (Zhu, 2000) (Figure 6). Effect of methanol on the activity of cellulase

Figure 3. SDS-PAGE analysis of the purification and molecular weight of β-endoglucanase. Lane 1, protein markers; lane 2, the purified β-endoglucanase.

purification reached to the electrophoretically pure samples. Confirmation of the side-chain radical modified The modification of pure cellulase by excess methanol was studied to determine the functional groups of cellulase. Information about the side-chain radical of modified and unmodified cellulase was confirmed by analysis of infrared spectra as shown in Figures 4 and 5. The -1 absorption peak at 1653 cm in Figure 5 clearly shows the existence of C = O, which had a little blue shift compared to C=O at the peak of 1625 cm-1 in Figure 4. In Figure 5, strong absorption peak at 1020 cm-1 within the fingerprint region was caused by the ester C-O stretching vibration. It is considered that the absorption peaks at -1 2840 and 2950 cm , along with the double peaks near -1 1430 cm in Figure 5 corresponded to CH3 ligand. In -1 Figure 4, the broad and intense band at 3700~3000 cm covered over the OH ligand. Therefore, these analyses of infrared spectra confirmed that the carboxyl in the side-

Modification of cellulase with different concentrations of methanol is shown in Figure 7. The relative enzyme activity of cellulase modified by methanol decreased almost linearly with the increasing addition of methanol concentration. Curves plotted with relative enzyme activity against reaction time are shown in Figure 8. It can be seen that the relative activity of cellulase modified by a certain concentration of methanol decreased with the increase of reaction time, while the relative activity of cellulase at a certain reaction time decreased with the increase of methanol concentrations. These results show that the activity of cellulase was linear with modificationdegree by methanol, which preliminary conformed that the modified side-chain radical by methanol lies at the active site of cellulase or on essential groups (Tao et al., 1995). Generally speaking, when the activity of a postmodification enzyme did not show significant changes, the radical of modification is definitely not in the active site. But, if a post-modification enzyme lost its activity to a great extent, there may be two possibilities: one is at the active site of cellulase, and the other is on essential groups. So, further experiments need to be done to determine whether the modification occurs at the active site of the enzyme or essential groups. Protective action of substrate Effect of substrate on cellulase modification is shown in Figure 9. As concentration of CMC increased, the relative activity of cellulase was increased correspondingly. The relative activity was 95% when the concentration of CMC was 0.5 g/ml; while it dropped to 68% when the concentration decreased to 0.1 g/ml. The phenomena indicate that the substrate had the function of protection on cellulase, and the protective action increased with the increase of the concentration of substrate. From the results, the inactivation of cellulase modified by methanol can be reduced by increasing the concentration of substrate. Hence, it can be assumed that the carboxyl modified by methanol is not only a structural

Cai et al.

3. 0

Absorbance units

2. 5 2. 0 1. 5 1. 0 0. 5

0. 0 4000 3500 3000 2500 2000 1500 1000 500 Wave number (cm-1) Figure 4. FTIR spectrum of cellulase unmodified.

3. 5

Absorbance units

3. 0 2. 5 2. 0 1. 5

1. 0 0. 5 0. 0 4000 3500 3000 2500 2000 1500 1000 500 Wave number (cm-1)

Figure 5. FTIR spectrum of cellulase modified by excess methanol.

8269

Afr. J. Biotechnol.

O P

OH + CH3OH

0.02~0.1mol/L HCl

0~25 ÂĄĂŚ

OCH3 + H2O

Figure 6. The carboxyl in the side-chain radical of cellulase modified by methanol.

100% 100

Relative activity (%)

80% 80 60 60% 40 40% 20 20% 0 0%

0. 1

0. 2

0. 3

0. 4

Methanol concentration (ml/ml) Figure 7. Modification of cellulase with different concentrations of methanol. The activity of cellulase modified by deionized water as control was defined as 100%.

Relative activity (%)

8270

100 100%

0.2mlMethanol

80 80%

0.6mlMethanol 1.0mlMethanol

60 60%

40 40%

20% 20 0%0 0

Time (min) Figure 8. The relative activity of cellulase modified by methanol at different times. The activity of cellulase modified by deionized water as control was defined as 100%.

Cai et al.

8271

Relative activity (%)

100% 100

90 90%

80 80%

70 70%

60 60%

0.0.1 1%

0.2 0. 2%

0.33% 0.

0.44% 0.

0.5 0. 5%

CMC concentration (g/ml) Figure 9. Effect of the concentration of substrate on the relative activity of cellulase modified by methanol. The activity of cellulase using deionized water as control instead of methanol and CMC-Na was defined as 100%.

radical but also lies at the active site (Tao et al., 1995). Methanol molecules approaching the radical at the active site of enzyme were obstructed effectively by competitive binding or dimensional block because of the increase of medial complex of enzyme-substrate, which can reduce the contact probability between the modifier and radical, and accordingly decreases the modified inactivation. Then, these confirmations show that the substrate puts up a protective action on cellulose. Inhibiting action of glucose Effect of glucose on cellulase modification is shown in Figure 10. The relative activity of cellulase increased when the concentration of glucose changed from 0 to 0.2 g/ml, and then tended to show steady-state over the concentration of 0.2 g/ml. The result show that glucose had an inhibiting action to cellulase modification by methanol. Glucose is one of the inhibitor of cellulase, and the action of inhibition was produced by competing for the active site of cellulase jointly with the substrate. The inactivation degree of cellulase modified by methanol could be decreased by glucose, and it showed that the modification occurred in the active site of cellulase. Analysis of time process of methanol modification The relative activity of cellulase modified by methanol at

different reaction times is shown in Figure11; the relative activity decreased with the increase of times. From the time process curve, when the relative activity dropped to half, the corresponding time was at 44.6 min. That is to say, t1/2, the time required for 50% decrease in activity was 44.6 min. A linear equation was fitted by the curve plotted with logarithmic of activity against times (data not shown), which illustrated that the inactivation reaction can be assumed as first-order kinetics (Liu et al., 2002). The inactivation rate constant Ki was the slope of the straight; 0.01794. According to the obtained result, time process curves were plotted, respectively from different reaction mixtures with ratios of methanol to cellulase solution of 0.2:0.5, 0.35:0.5, 0.5:0.5, 0.65:0.5 and 0.80:0.5 (v/v). The results show that logarithm of all the relative activity of cellulase had a linear relationship against time (data not shown). Then, values of t1/2 were calculated from equations of fitting straight lines, respectively. Based on the equation deduced by Keech and Farrant (1968) and Liang et al. (2001): lg(1/ t1/2)=lg k′+ nlgI (k′, apparent first-order inactivation rate constant; I, modifier’s concentration, n, apparent molecule number of inhibiter needed to form the enzyme-inhibiter complex), the standard curve plotted with logarithmic of 1/t1/2 against logarithmic of concentration of methanol was then drawn as shown in Figure 12. It can be seen that the standard curve was nearly a straight line, which can be deduced that the inactivation process followed first order reaction. Based on the fitting straight line in Figure 12, n and k′ -2 were calculated as n=1.01 and k′=6.01×10 . The results

8272

Afr. J. Biotechnol.

Relative activity (%)

100 100%

80 80%

60 60%

40 40%

0. 1

0. 2

0. 3

0. 4

Glucose concentration (mg/ml) Figure 10. Effect of the concentration of glucose on the relative activity of cellulase modified by methanol. The activity of cellulase using deionized water as control instead of methanol and glucose was defined as 100%.

Relative activity (%)

100% 100 80 80% 60 60% 40 40% 20 20% 0 0%

Time (min) Figure 11. The relative activity of cellulase modified by methanol at different reaction times. The activity of cellulase modified by deionized water as control was defined as 100%.

showed that inactivation of cellulase was caused by the carboxyl reacting with one methanol molecule, which can be concluded that there was one carboxyl which lies at the active site of cellulase during the processing of inactivation of cellulase.

Conclusions In this study, crude cellulase from T. viride could be purified and concentrated by salting out with ammonium sulfate at the optimum conditions of saturation range of

Cai et al.

8273

y = 1.0115x - 1.2211 R2 = 0.9257

- 1. 5

lg (1/t1/2)

- 1. 8

- 2. 1

- 2. 4 - 1. 2

- 0. 9

- 0. 6

- 0. 3

lg I Figure 12. The standard curve plotted with logarithmic of 1/t 1/2 against logarithmic of concentration of methanol. t1/2 and I are the time required for 50% decrease in activity and the concentration of methanol, respectively.

40 to 60%, and a pH of 6.0. Analyses of infrared spectra of cellulase unmodified or modified demonstrated that the carboxyl in the side-chain radical of cellulase was modified by methanol. Effect of methanol on cellulase activity showed that the modified side-chain radical lies at the active site of cellulase or on the essential groups. CMCNa which protected the cellulase from inactivation by methanol suggest that carboxyl modified by methanol is not only a structural radical but also lies at the active site. Effect of glucose on modification showed that the modification occurred in the active site of cellulase. The kinetic analysis confirmed that one carboxyl was an essential group for cellulase activity.

ACKNOWLEDGEMENTS Financial support was from Science and Technology Bureau of Nantong (KB2009008) and the Education Department of Jiangsu Province (JH10-17) of China. REFERENCES Ackers GK, Smith FR (1985). Effects of site-specific amino acid modification on protein interactions and biological function. Ann. Rev. Biochem. 53: 597-629. Brune A (2007). Microbiology: woodworker's digest. Nature, 450: 487488. Dong XW, Zhu QZ, Yu XM, LV XP, XU GY, YU T (2008). Studies on properties of immobilized cellulase on a carrier. J. Harbin Univ. Sci. Tech. 13: 118-122.

Feng Y, Duan CJ, Pang H, Mo XC, Wu CF, Yu Y, Hu YL, Wei J, Tang JL, Feng JX (2007). Cloning and identification of novel cellulase genes from uncultured microorganisms in rabbit cecum and characterization of the expressed cellulases. Appl. Microbiol. Biotechnol. 75: 319-328. Howard RL, Abotsi E, Jansen Van Rensburg EL, Howard S (2003). Lignocellulose biotechnology: issues of bioconversion and enzyme production. Afr. J. Biotechnol. 2: 602-619. Huang Y, Krauss G, Cottaz S, Driguez H, Lipps G (2005). A highly acidstable and thermostable endo-beta-glucanase from the thermoacidophilic archaeon Sulfolobus solfataricus. Biochem. J. 385: 581-588. Kashima Y, Mori K, Fukada H, Ishikawa, K (2005). Analysis of the function of a hyperthermophilic endoglucanase from Pyrococcus horikoshii that hydrolyzes crystalline cellulose. Extremophiles, 9: 3743. Keech DB, Farrant RK (1968). The reactive lysine residue at the allosteric site of sheep kidney pyruvate carboxylase. Biochem. Biophys. Acta. 151: 493-503. Kim SJ, Lee CM, Kim MY, Yeo YS, Yoon SH, Kang HC, Koo. BS (2007). Screening and characterization of an enzyme with betaglucosidase activity from environmental DNA. J. Microbiol. Biotechnol. 17: 905-912. Kubartova A, Moukoumi J, Beguiristain T, Ranger J, Berthelin J (2007). Microbial diversity during cellulose decomposition in different forest stands: Imicrobial communities and environmental conditions. Microb. Ecol. 54: 393-405. Kwinam P, Jongjin P, Hocheol S, Hochul S, Jinwon P, June-shu A (2002). Biological reprocessing of mixed office waste (mow) using modified cellulase by production of functional copolymer. Korean J. Chem. Eng. 19: 285-289. Lee YJ, Kim BK, Lee BH, Jo KI, Lee NK, Chung CH, Lee YC, Lee JW (2008). Purification and characterization of cellulase produced by Bacillus amyoliquefaciens DL-3 utilizing rice hull. Bioresour. Technol. 99: 378-386. Liang F, Cao HS, Guo HY, Liu LY, Sun H, Chen WJ, Liu SY (2001). Chemical modification of humanplasminogen. Chem. J. Chin. Univ. 22: 577-580.

8274

Afr. J. Biotechnol.

Liu G, Tang X, Tian SL, Deng X, Xing M (2006). Improvement of the celllulolytic activity of Trichoderma reesei endoglucanase IV with an additional catalytic domain. World J. Microbiol. Biotechnol. 22: 13011305. Liu J, Xia WS (2008). Modification of cellulase-chitosanase bifunctional enzyme by diethylpyrocarbonate and 1-ethyl-3-carbodiimide. Food Sci. 29: 460-463. Liu RT, Song X, Liu XM, Kang CB, Qu YB (2002). Active sites of alkaline xylanase molecules. Chin. J. Appl. Environ. Biol. 8: 520-524. Lynd LR, Paul JW, Vanzyl WH, Pretorius IS (2002). Microbial cellulose utilization: Fundamentals and biotechnology. Microbiol. Mol. Biol. R. 66: 506-577. Miller GL, Blum R, Glennon WE, Burton AL (1960). Measurement of carboxymethylcellulase activity. Anal. Biochem. 2: 127-132. Ragauskas AJ, Williams CK, Davison BH, Britovsek G, Cairney J, Eckert CA, Frederick Jr. WJ, Hallett JP, Leak DJ, Liotta CL, Mielenz JR, Murphy R, Templer R, Tschaplinski T (2006). The path forward for biofuels and biomaterials. Science, 311: 484-489. Saha BC (2004). Production, purification and properties of endoglucanase from a newly isolated strain of Mucor circinelloides. Process Biochem. 39: 1871-1876. Schmidt T (2007). Microbiology: Life in the Really Hard Places. Science, 318: 1727. Sinegania AS, Emtiazi G, Shariatmadar IH (2005). Sorption and immobilization of cellulase on silicate clay minerals. J. Colloid Interface Sci. 290: 39-44. Sinegania AAS, Hosseinpour A (2006). Factors affecting cellulase sorption in soil. Afr. J. Biotechnol. 5: 467-471. Su ZL, Zhang W, Yu ST (2010). Research progress of cellulsae activity. J. Anhui. Agric. Sci. 38: 10490-10491.

Tao WS, Li W, Jiang YM (1995). Protein molecule foundation. Higher Education Press, Beijing, China. Valenzuela L, Chi A, Beard S, Orell A, Guiliani N, Shabanowitz J, Hunt DF, Jerez CA (2006). Genomics, metagenomics and proteomics in biomining microorganisms. Biotechnol. Adv. 24: 197-211. Wang QL, Gang G, Lin FX (2004). Research summary of cellulose. Hubei Agric. Sci. 3: 14-18. Wu HX (2008). A study on immobilized cellulose. J. Southwest China Normal Univ. (Nat. Sci. Ed.) 33: 83-86. Wu L, Yuan X, Sheng J (2005). Immobilization of cellulase in nanofibrous PVA membranes by electrospinning. Membr. Sci. 250: 167-173. Yan BX, Gao PJ (1997). Purification of two cellobiohydrolases from Trichodema pseudokiningii S-38. Chin. J. Biochem. Mol. Biol. 13: 362-364. Yang G, Chen HZ, Liu Y (2009). Effect of additives on thermostability of Trichoderma viride JQF-04 Cellulase. Chin. J. Appl. Environ. Biol. 15: 134-138. Yang TC, Mo JC, Cheng JA (2004). Purification and some properties of cellulase from odontotermes formosanus(Isotera:termitidae). Entomologia sinica, 11: 1-10. Zhou H, Wang H (1998). Protein chemical modification. Tsinghua University Press, Beijing, China. Zhu MH (2000). Instrument Analysis. Higher Education Press, Beijing, China.

Full Length Research Paper

Effect of terrains on the volatiles of Cabernet Sauvignon wines grown in Loess Plateau region of China Bao Jiang1,3, Zhen-Wen Zhang1,2* and Jun-Xian Zhang1 1

College of Enology, Northwest A&F University, Yangling, 712100 Shaanxi Province, People’s Republic of China. Shaanxi Engineering Research Center for Viti-Viniculture, Northwest A&F University, Yangling, 712100 Shaanxi Province, People’s Republic of China. 3 Weinan Vocational & Technical College, Weinan, 714000 Shaanxi Province, People’s Republic of China

Accepted 1 April, 2011

Volatile compounds of young Cabernet Sauvignon wines from the flat and slope lands grown in Loess Plateau region (China) were investigated in this research. Among the volatile compounds analyzed by headspace solid phase microextraction (HS-SPME) with gas chromatography-mass spectrometry (GCMS), a total of 43 and 45 volatile compounds were identified and quantified in the flat and slope lands wines, respectively. In the volatiles detected, higher alcohols formed the most abundant group in the aroma components of two wines, followed by esters and fatty acids. According to their odor active values (OAVs) and relative odor contribution (ROC), the aromatic profiles for two wines were similar, showing only quantitative but not qualitative differences. Ethyl octanoate, ethyl hexanoate and isoamyl acetate were found to jointly contribute to 98.8 and 99.2% of the global aroma of the flat and slope wines, respectively. These odorants are associated with “fruity’’ and ‘‘ripe fruit’’ odor descriptors. Wine from flat land with higher OAVs of ethyl octanoate and isoamyl acetate seems to have more intense fruity aromas (pineapple, pear and banana), with floral notes. Key words: Cabernet Sauvignon wines, volatiles, terrains, Loess Plateau region, headspace solid phase microextraction (HS-SPME), gas chromatography-mass spectrometry (GC-MS).

INTRODUCTION Volatile composition is one of the most important factors in the determination of wine character and quality; it influences the organoleptic characteristics of wines, particularly the aromatic characteristics. Moreover, aroma is one of the most important quality attributes to con-

*Corresponding author. E-mail: zhangzhw60@nwsuaf.edu.cn. Tel: +86 29 87091847. Fax: 86 29 87091099. Abbreviations: HS-SPME, Headspace solid phase microextraction; GC-MS, chromatography-mass spectrometry; MS/EI, mass spectrometry in the electron impact mode; OAVs, odor activity values; ROC, relative odor contribution.

sumers when buying wine (Komes et al., 2006). Aroma constituents of different wines have been extensively studied in the last few years. The flavor of a wine presents an extremely complex chemical pattern in both qualitative and quantitative terms, because over 1000 volatile compounds have been found in wines, with a wide concentration range varying from hundreds of mg/l to the μg/l or ng/l level (Gómez-Míguez et al., 2007), such as alcohols, esters, organic acids, phenols, thiols, monoterpenes and norisoprenoids, have been found in wines and is responsible for the complexity of wine bouquet and ensures the specificity and character, but their contribution to wine aroma does not depend only on the concentration; the perception threshold also plays an

Jiang et al.

important role (Falqué et al., 2004). Wine flavor are mainly derived from varietal, fermentation and aging aroma. Furthermore, the varietal aroma of wines is due to the presence of monoterpenes, norisoprenoids, methoxypyrazines and thiols compounds; fermentation aroma from yeast metabolism is the esters, alcohols and acetates; ageing aroma from oak includes phenols, furans and oak-derived-vanillic compounds (Selli et al., 2004; Weldegergis et al., 2007). Since the aroma of young wines partly, is the result of grape metabolism, many factors (including soil, terrain, climate, etc.) can influence the volatile components of grape and wine and the role exerted by each individual factor is still not clearly established. Altitude can exert an important influence on grape maturation and wine composition that is strictly related to the local climate. Research on the aroma of cabernet sauvignon wine from Brazil indicates that, wines from higher altitudes have a ‘‘bell pepper’’ aroma, while wines from lower altitudes are correlated with ‘‘red fruits’’ and ‘‘jam’’ aromas (Falcao et al., 2007); in Italy, it has been reported that vineyard location has an influence on flavor compounds and wine quality by demonstrating that high monoterpene concentrations are associated with warm sites (Corino and Stefano, 1988); in Canada, Reynolds et al. (1996) have reported that, fruit and wine flavor components and sensory attributes overall in Gewürztraminer, were responsive to vineyard site. Solid-phase microextracton (SPME), first proposed by Arthur and Pawliszyn (1990), is a simple, solvent-free method for concentration of volatiles present in the headspace. This technique had been used to analyze the volatile compounds of wines (Tao et al., 2008; Pino and Queris, 2010). With the development of Chinese wine industry, areas of grapevines have been increasing, the new grape-growing regions were constantly discovered in recent years, including Loess Plateau region of China. Rongzi Chateau of Xiangning County located in Loess Plateau region, is situated approximately between 35° to 37°N, average altitude of 1100 m. Climatic characteristics of this region which are dryer climate, stronger sunshine and a wide swing in diurnal temperature differences are distinguished by lower night-time temperature creates an especially healthy environment for vines. But these characteristics of the Loess Plateau region such as crisscross gulleys, different slopes, slope direction and altitude contribute together to form the local mountainous microclimate which can significantly influence quality of grape berry and wine. Up till now, relevant research in this region has been a blank. For this study, we selected the Cabernet Sauvignon wines from the flat and slope lands and investigated the volatile compounds of the monovarietial wines, with volatiles being extracted by SPME and being detected by gas chromatography-mass spectrometry (GC-MS). The objectives of this study include to identify and quantify the principal volatile compounds present in the Cabernet Sauvignon wines

8281

produced from Loess Plateau region of China as well as to check whether there are differences between the Cabernet Sauvignon wines from two different terrains or not, namely, flat and slope lands. MATERIALS AND METHODS Vineyard conditions and vinification Two vineyards are located in the Rongzi Chateau of Xiangning County in Loess Plateau region, where the loess depth exceeds 200 m. In the collection, two vineyards have similar characteristics (age and cultivation management). All the vines were cultivated in 2007 spring and seedling root system with multiple main vine fantraining, and 2.5×1.0 m (row × vine) spacing. All grape berries were harvested manually at optimum technological maturity, as judged by indices of sugar and acid content in 2009. Pre-fermentation treatments and winemaking were done as described by Li (2002). Briefly, grapes were crushed on an experimental destemmer-crusher and then transferred to stainlesssteel containers. 90 L of each treatment wine were produced. 50 mg/l of SO2 and 30 mg/l of pectinase (Lallzyme Ex) were added to the musts and the contents were mixed by hand. After maceration of the musts for 24 h, 200 mg/l of dried active yeast (Saccharomyces cerevisiae strain, Lallemand, Danstar Ferment AG, Switzerland) was added to the musts, according to commercial specifications. Alcoholic fermentation was carried out at 20 to 25°C to dryness (reducing sugar < 4 g/l) which took place over a 6 to 8 days period and density controls were maintained during this period. At the end of fermentation, the wines were separated from pomace and then 50 mg/l of SO2 added. After fermentation, the wine samples were bottled and stored at 5°C prior to analysis. All the samples were 5 months old at the time of analysis. Total sugar, total acidity, pH, total phenolics, total tannins, reducing sugar and ethanol were analyzed according to OIV (1990) official methods (Table 1). Reagents All standards were purchased from Aldrich (Milwaukee, Wis., U.S.A.) and Fluka (Buchs, Switzerland). They were 4-methyl-2pentanol, isoamyl alcohol, 2-heptanol, 1-hexanol, (E)-3-hexen-1-ol, (Z)-3-hexen-1-ol, (E)-2-hexen-1-ol, (Z)-2-hexen-1-ol, 2-octanol, 1octen-3-ol, 1-heptanol, 2-ethyl-1-hexanol, 2-nonanol, 2,3butanediol, linalool, 1-octanol, 3-(methylthio)-1-propanol, 1-decanol, benzyl alcohol, 2-phenylethanol, 1-dodecanol, ethyl acetate, isoamyl acetate, ethyl hexanoate, hexyl acetate, ethyl lactate, ethyl octanoate, ethyl decanoate, diethyl succinate, ethyl dodecanoate, phenethyl acetate, acetic acid, hexanoic acid, octanoic acid, decanoic acid, hexanal, nonanal, benzaldehyde, geranylactone, acetoin, furfural, citronellol, limonene. Purity of all standards was above 99%. Model solutions were prepared using the methods reported by Howard et al. (2005). 4-Methyl-2-pentanol was used as the internal standard. For quantification, 8-point calibration curves for each compound were prepared using the method described by Ferreira et al. (2000), which was also used as a reference to determine the concentration range of standard solutions. The regression coefficients of calibration curves were above 98%. The standard deviation for the SPME method was below 10%. Headspace solid phase microextraction (HS-SPME) procedure Aroma compounds of the wine samples were extracted by HSSPME and analyzed using gas chromatography/mass spectrometry

8282

Afr. J. Biotechnol.

Table 1. General composition of the musts and wines of Cabernet Sauvignon from the different terrains.

Parameter Altitude (m) North latitude East longitude Total sugar (g/l) a Total acidity (g/l) pH b Total phenolics (mg/l) c Total tannins (mg/l) Reducing sugar (g/l) Ethanol (%,v/v)

Slope land Must Wine 1280.5 36°01′05″ 110°49′11″ 194.0 10.4 8.9 3.1 3.0 3430.1 1152.2 4060.4 933.3 1.7 11.8

Flat land Must Wine 909.3 35°57′09″ 110°47′47″ 195.3 9.6 8.4 3.3 3.1 3460.2 1881.4 4300.1 1630.4 1.8 12.8

Each data in the table was mean values of triplicate samples (maximum SD: ±10%); a acidity expressed as grams of tartaric acid equivalents per liter; b total phenolics expressed as milligrams of gallic acid equivalents per liter; c tannins expressed as milligrams of tannin acid equivalents per liter.

as described by Zhang et al. (2007). Five milliliters of wine sample and 1 g NaCl were placed in a 15-ml sample vial. The vial was tightly capped with a PTFE-silicon septum and heated at 40°C for 30 min on a heating platform agitation at 400 rpm. The SPME (50/30 μm DVB/Carboxen/PDMS, Supelco, Bellefonte, Pa., U.S.A.), preconditioned according to manufacturer’s instruction, was then inserted into the headspace, where extraction was allowed to occur for 30 min with continued heating and agitation by a magnetic stirrer. The fiber was subsequently desorbed in the GC injector for 25 min. GC–MS analysis The GC-MS system used was an Agilent 6890 GC equipped with an Agilent 5975 mass spectrometry. The column used was a 60 m × 0.25 mm HP-INNOWAX capillary with 0.25 μm film thickness (J & W Scientific, Folsom, Calif., U.S.A.). The carrier gas was helium at a flow rate of 1 ml/min. Samples were injected by placing the SPME fiber at the GC inlet for 25 min with the splitless mode. The oven’s starting temperature was 50°C, which was held for 1 min, then raised to 220°C at a rate of 3°C /min and held at 220°C for 5 min. The mass spectrometry in the electron impact mode (MS/EI) at 70 eV was recorded in the range m/z 20 to 450 U. The mass spectrophotometer was operated in the selective ion mode under autotune conditions and the area of each peak was determined by ChemStation software (Agilent Technologies). Analyses were carried out in triplicate.

ethanol concentration. But total phenolics and tannins contents of the Cabernet Sauvignon wines of the different terrains exist in obvious differences; the results were that total phenolics and tannins contents of the flat land wine were 1.6 and 1.7 times higher than those of the slope wine, respectively. The results were partially in agreement with the results in a previous study (Zhang et al., 2007) showing that the tannin contents of Cabernet Sauvignon wines in the slope land vineyard (1152 and 1096 m) were higher than that of the flat land vineyard (818 m); moreover, for two slope land vineyards, the tannin contents in lower altitude wine (1096 m) was higher than another slope land wine (1152 m). Bajda (2007) studies indicated that, total tannin contents of Malbec wine went steadily up with higher elevations, while bitter monomeric tannins decreased. To our knowledge, little data is available in literature concerning the effect of terrains on phenolic and tannin contents. It was speculated that, the characteristics of local climate and soil could lead to the discrepancy between our results and others or effect of terrains on their contents was different with these varietal wines.

Aroma composition of wines RESULTS AND DISCUSSION Physico-chemical indexes of musts and wines Table 1 shows some of the physico-chemical indexes of the Cabernet Sauvignon musts and wines from flat and slope lands. Results showed that, the sugar, titratable acidity, pH, total phenolics and total tannins of musts were not marked differently. Furthermore, after being stored in stainless steel tanks at 5°C for 5 months, young red wines made from the flat and slope grapes showed quite similar titratable acidity, pH, reducing sugar and

Two groups of typical total ion chromatograms were generated for Cabernet Sauvignon wines using HSSPME coupled with GC-MS. The mean concentrations of the key volatile compounds of the 2 monovarietal wines are given in Table 2 by chemical classes. In all, 43 and 45 volatile compounds were identified in the flat and slope lands wines, respectively, including alcohols, esters, fatty acids, terpenes, aldehydes and ketones compounds. Many of these volatile compounds are commonly found in wines and are derived from grapes and yeast strain fermentation and verification process

Jiang et al.

8283

Table 2. GC-MS analytical results of aroma components in cabernet sauvignon wines from the different terrains.

Compound name Alcohols 1-Propanol Isobutyl alcohol 1-Butanol Isoamyl alcohol 1-Pentanol 4-Methyl-1-pentanol 2-Heptanol 1-Hexanol (E)-3-hexen-1-ol (Z)-3-hexen-1-ol (E)-2-hexen-1-ol 2-Octanol 1-Heptanol 2-Ethyl-1-hexanol 2-Nonanol 2,3-Butanediol 1-Octanol 3-(Methylthio)-1-propanol 1-Decanol Benzyl alcohol 2-Phenylethanol 1-Dodecanol

Threshold (mg/l) c

306 a 40 b 150 a 30 g 50 d 0.07 a 8 a 0.4 a 0.4 d 0.1 d 0.058 h 120 a 0.12 a 0.5 a 0.4 e 200 a 14 h 1

Subtotal Subtotal (%) Esters Ethyl acetate Isoamyl acetate Ethyl hexanoate Hexyl acetate Ethyl lactate Heptyl acetate Methyl octanoate Ethyl octanoate Ethyl nonanoate Ethyl decanoate Diethyl succinate

7.5 a 0.03 a 0.005 c 0.67 b 154.6 a 0.002 h 1.3 a 0.2 b 500

Concentration (μg/l) Slope land

Flat land

ND 22.0 ± 0.2 (mg/l) 1587.6 ± 15.5 185.6 ± 3.6 (mg/l) 176.1 ± 1.9 106.8 ± 2.9 14.7 ± 0.5 4041.7 ± 76.8 133.8 ± 5.7 135.8 ± 17.7 47.3 ± 1.3 24.3 ± 0.5 (mg/l) 212.2 ± 5.5 Trace 6.3 ± 0.1 405.4 ± 8.3 44.2 ± 0.5 1990.2 ± 103.3 10.7 ± 0.4 150.4 ± 9.0 14.5 ± 0.1 (mg/l) 897.0 ± 77.2

5538.7 ± 74.6 31.0 ± 0.5 (mg/l) 3333.5 ± 56.1 211.2 ± 1.9 (mg/l) 223.6 ± 2.4 213.9 ± 10.5 18.1 ± 2.0 3429.0 ± 233.0 180.6 ± 13.1 146.3 ± 3.6 ND ND 121.2 ± 27.9 Trace ND 390.8 ± 11.8 39.0 ± 2.4 2459.8 ± 78.1 ND 150.0 ± 14.2 24.3 ± 0.1 (mg/l) ND

256.3 (mg/l) 64.7

282.8 (mg/l) 55.6

52.2 ± 0.5 (mg/l) 14.7 ± 0.8 (mg/l) 4107.2 ± 225.9 142.4 ± 5.4 11.7 ± 0.1 (mg/l) 14.1 ± 0.7 (mg/l) 8.5 ± 0.7 5107.9 ± 84.4 ND 1451.2 ± 48.4 182.9 ± 1.0

121.9 ± 2.9 (mg/l) 14.7 ± 0.2 (mg/l) 3851.4 ± 371.3 127.2 ± 6.9 19.7 ± 0.3 (mg/l) 10.6 ± 0.3 (mg/l) 8.9 ± 0.4 5154.0 ± 237.1 1137.8 ± 12.4 1373.7 ± 33.8 226.7 ± 9.9

(Cliff et al., 2002).

Alcohols Alcohols are formed from the degradation of amino acid, carbohydrates and lipids (Antonelli et al., 1999). Alcohols represented the largest group in terms of the numbers and concentration of aroma compounds identified in two

Sensory properties

Fresh, alcohol Fusel, alcohol Medicinal, alcohol Cheese Fruity, balsamic Fruity, mouldy, musty Green, grass Green grass, herb Green grass, herb Green grass, herb Unpleasant, perfumed Grape, sweet Mushroom, sweet fruity Intense fruity Butter, creamy Intense citrus , roses Boiled potato, rubber Orange flowery, special fatty Citrusy, sweet Flowery, pollen, perfumed Unpleasant in high concentration and flowery in low concentration

Fruity, sweet Banana Fruity, anise Pleasant fruity, pear Lactic, raspberry Pleasant fruity, pear, roses Intense citrus Pineapple, pear, floral Pleasant fruity, roses Fruity, fatty, pleasant Light fruity

wines, followed by esters and fatty acids. The subtotal concentration of alcohols in the flat and slope lands wines were 282.8 and 256.3 mg/l, being 55.6 and 64.7% of the total volatile compounds detected, respectively. This volatile fraction was mainly composed of isoamyl alcohol, isobutyl alcohol, 2-phenylethanol and 2-octanol, these four alcohols had concentrations of >14 mg/l (they existed in at least one of the wines studied). Isoamyl alcohol was the most abundant alcohol accounting for 75

8284

Afr. J. Biotechnol.

Table 2. Contd.

Compound name

Ethyl dodecanoate Subtotal Subtotal (%) Fatty acids Acetic acid Propanoic acid Isobutyric acid Hexanoic acid Heptanoic acid Octanoic acid Decanoic acid Subtotal Subtotal (%) Aldehydes and ketones Nonanal Benzaldehyde Geranylactone Furfural Decanal Acetoin Subtotal Subtotal (%) Terpenes Citronellol Limonene Subtotal Subtotal (%) Total

Threshold (mg/l) -

Slope land ND 222.7 ± 0.8 104.0 (mg/l) 26.3

Concentration (μg/l) Flat land 41.2 ± 1.7 156.4 ± 7.3 184.0 (mg/l) 36.2

Sensory property Pleasant, floral Flowery, fruity

200 e 8.1 a 200 a 3 f 3 a 0.5 a 15

18.9 ± 0.5 (mg/l) 213.3 ± 18.2 2916.4 ± 26.6 1709.8 ± 83.9 trace 5205.9 ± 335.6 2877.7 ± 150.1 31.8 (mg/l) 8.0

16.1 ± 0.6 (mg/l) ND 4975.8 ± 24.9 1033.5 ± 10.6 ND 2692.4 ± 72.2 1430.1 ± 43.3 26.2 (mg/l) 5.2

Acid, fatty Vinegarish Fatty Cheese, rancid, fatty Fatty, dry Rancid, harsh, cheese, fatty acid Fatty, unpleasant

c 2 a 14.1 g 1 a 150

49.0 ± 1.1 348.6 ± 2.4 29.8 ± 0.7 125.9 ± 5.9 ND 3378.5 ± 75.5 3931.8 1.0

56.5 ± 0.6 121.0 ± 8.8 28.9 ± 1.8 142.1 ± 10.7 3684.7 ± 302.4 11.0 ± 0.1 (mg/l) 15.0 (mg/l) 3.0

Green, slightly pungent Almond Floral Pungent Grassy, orange skin-like Flowery, wet

14.4 ± 0.6 ND 14.4 <0.1 396.1 (mg/l)

13.6 ± 0.2 156.9 ± 1.1 170.5 < 0.1 508.2 (mg/l)

Green lemon Flowery, green, citrus

0.1 d 0.2

Each data in the table was expressed as mean value ± S.D., n=3; ND, not determined; a Guth (1997); b Tominaga et al. (1998); c Peinado et al. (2004); d Du et al. (2010); e Gómez-Míguez et al. (2007); f Souid et al. (2007); g Lourdes et al. (2009); h Li et al. (2008).

and 72% of the total alcohols in the flat and slope lands wines, respectively. Compared with the flat land wine, the alcohol profile of the slope land wine was more diverse, containing 21 types of alcohols compared with only 17 in the flat land wine. (E)-2-Hexen-1-ol, 2-octanol, 2-nonanol, 1-decanol and 1-dodecanol were absent in the wine made from the flat Cabernet Sauvignon. Meanwhile, 1propanol was missed with alcohol in the slope land wine.

Esters Acetate esters are the result of the reaction of acetyl-CoA with higher alcohols that are formed from degradation of amino acids or carbohydrates (Perestrelo et al., 2006).

On the other hand, ethyl esters of fatty acids are produced enzymatically during yeast fermentation and from ethanolysis of acyl-CoA that are formed during fatty acids synthesis or degradation. Their concentration is dependent on several main factors: Yeast strain, fermentation temperature, aeration degree and sugar content (Perestrelo et al., 2006). There were also differences in the type and amount of esters present in two wines. In general, the concentration and proportion of esters in the flat land wine (36.2%) were higher than those of the slope land wine (26.3%) and the total number of esters in two wines exhibited the same order. Although, their amount varied between two wines, ethyl acetate, isoamyl acetate, ethyl lactate and heptyl acetate were the major esters found in the aroma

Jiang et al.

8285

Table 3. Comparison of odor activity values (OAVs) and relative odor contributiona (ROC) for the aroma compounds in cabernet sauvignon wines from the different terrains.

Compound name

Sensory properties

Ethyl octanoate Ethyl hexanoate Isoamyl acetate Ethyl acetate Octanoic acid Ethyl decanoate Isoamyl alcohol 3-(Methylthio)-1-propanol Decanal 2-Phenylethanol

Pineapple, pear, floral Fruity, anise Banana Fruity, sweet Rancid, harsh, cheese, fatty acid Fruity, fatty, pleasant Cheese Boiled potato, rubber — Flowery, pollen, perfumed

Cabernet sauvignon wines Slope land Flat land 2554.0 (65.5%) 2577.0 (63.6%) 821.4 (21.1%) 770.3 (19.0%) 491.1 (12.6%) 657.7 (16.2%) 7.0 (0.2%) 16.3 (0.4%) 10.4 (0.3%) 5.4 (0.1%) 7.3 (0.2%) 6.9 (0.2%) 6.2 (0.2%) 7.0 (0.2%) 4.0 (0.1%) 4.9 (0.1%) ND 3.7 (<0.1%) 1.0 (<0.1%) 1.7 (<0.1%)

Relative odor contribution (ROC) of each aroma compound is shown in parentheses and was calculated as the ratio of the OAV of the respective compound to the total OAV of each wine; ND, Not determined.

components of the 2 wines in terms of their concentrations. Ethyl nonanoate and phenethyl acetate were absent in the slope land wine.

Fatty acids The production of fatty acids has been reported to be dependent on the composition of the must and fermentation conditions (Schreirer, 1979). Acetic acid was the major fatty acid found, constituting 61 and 59% of the total fatty acid content of the flat and slope lands wines, respectively. Acetic acid is produced during alcoholic and malolactic fermentation. At low levels, this compound lifts wine flavors; however, at high levels, it is detrimental to the taste of wine by leaving the wine tasting sour and thin (Joyeux et al., 1984). Propanoic acid and heptanoic acid were only found in the slope land wine, although, amount of heptanoic acid and propanoic acid were only trace and 213.3 μg/l, respectively. Isobutyric, hexanoic, octanoic and decanoic acids were found in two wines, the concentration of them varied from 1033.5 to 5205.9 μg/l. These C6 to C10 fatty acids at concentrations of 4 to 10 mg/l impart mild and pleasant aroma to wine; however, at levels beyond 20 mg/l, their impact on wine becomes negative (Shinohara, 1985). The C6 to C10 fatty acids might have a positive impact on the aroma of the 2 wines examined in the current study since their levels were all far below 10 mg/l.

Terpenes Numerous studies have shown that, the terpenoid compounds are important component of varietal aroma and are not affected by yeast metabolism during fermentation (Rapp, 1988), they are hence, a good indicator for the variety and quality of grape (Begala et al., 2002). In the

present study, two terpenes were detected in the slope land wines, namely, citronellol and limonene. They are made up of less than 0.1% of the total volatile compounds in the 2 wines. Meanwhile, the limonene was absent in the slope wine. Hence, these terpenyl compounds could serve as potential indicators to distinguish quality of wine derived from the flat and slope lands wines of cabernet sauvignon variety.

Aldehydes and ketones The composition of aldehydes and ketones varied greatly between two wines. Nonanal, benzaldehyde, geranylactone, furfural and acetoin were found in two wines. Furthermore, acetoin was the most abundant component of the group in the flat and slope lands wines, accounting for 73 and 86%, respectively. Decanal was unique in the aroma components of the flat land wine.

Odor activity values (OAVs) Though dozens of volatiles were detected in each wine sample, not all of the components have great impact on the overall aroma character of this wine. Of all the compounds analyzed, only those displaying OAVs greater than 1 were deemed to contribute to wine aroma (Guth, 1997). OAVs were calculated by dividing the mean concentration of an aroma compound by its odor threshold value. Table 3 shows total 10 OAVs for compounds that exceeded their thresholds in two wines, namely, ethyl octanoate, ethyl hexanoate, isoamyl acetate, ethyl acetate, octanoic acid, ethyl decanoate, isoamyl alcohol, 3-(methylthio)-1-propanol, decanal and 2-phenylethanol. For the 10 volatile compounds with OAVs above 1, the majority of OAVs were not obviously different in the 2

8286

Afr. J. Biotechnol.

wines. The computation of relative odor contribution (ROC) proposed by Ohloff (1994) is a useful index for determining the important aroma components in a complex system. Based on the ROC values of single compounds, we found that, the global aroma of the 2 wines was dominated by fermentative aromas, namely, the ethyl esters of fatty acids (ethyl octanoate and ethyl hexanoate) that conferred fruity notes to the wines. Specifically, ethyl octanoate, ethyl hexanoate and isoamyl acetated jointly accounted for 98.8 and 99.2% of the global aroma of the flat and slope lands wines of cabernet sauvignon, respectively. These compounds are responsible for a major part of the aroma characteristics of young wines. The results in the present study were partially consistent with the results in a previous study (Zhang et al., 2007) indicating that, the three aroma compounds mentioned earlier jointly accounted for 97% of the global aroma of cabernet sauvignon wine from Huailai County of China. In this study, alcohols were the predominant groups which constituted the aroma compounds rather than acids as in the previous study (Zhang et al., 2007). The differences in our results from others come into being in various terroirs. Taking into account the OAVs and ROC of each compound, the aromatic profiles for the 2 wines were similar, showing only quantitative but not qualitative differences. Ethyl octanoate, ethyl hexanoate and isoamyl acetate were the compounds that showed higher differences between the 2 wines. Wine from flat land with higher OAVs of ethyl octanoate and isoamyl acetate seems to have more intense fruity aromas (pineapple, pear and banana) with floral notes.

Conclusions This was the first study on effect of terrains on the volatiles of cabernet sauvignon wines grown in Loess Plateau region of China. It could provide a better knowledge of the volatile composition of the flat and slope lands wines produced in this region, which could help winemakers to optimize operational conditions in order to emphasize one or more aromas in the respective wines. The study indicated the aromatic profiles for the 2 wines, which were only quantitative but not qualitative differences. Ethyl octanoate, ethyl hexanoate and isoamyl acetate were the most characteristic aromaactive compounds and they contributes to the global aroma of the 2 wines. Wine from the flat land seems to have more intense fruity aromas (pineapple, pear and banana) with floral notes. ACKNOWLEDGEMENTS The research was supported by the earmarked fund for Modern Agro-Industry Technology Research System(nycytx-30-zp-04). The authors are grateful to

Rongzi Chateau for the supply of the grape samples used in the study. REFERENCES Antonelli A, Castellari L, Zambonelli C, Carnacini A (1999). Yeast influence on volatile composition of wines. J. Agric. Food Chem. 47: 1139-1144. Arthur CL, Pawliszyn J (1990). Solid-phase microextraction with thermal desorption using fused silica optical fibres. Anal. Chem. 62: 21452148. Bajda E (2007). Lake county seeks to elevation high altitude wines. http://www.theelevationofwine.org. Begala M, Corda L, Podda G, Fedrigo MA, Traldi P (2002). Headspace solid-phase microextraction gas chromatography/mass spectrometry in the analysis of the aroma constituents of ‘Cannonau of Jerzu’ wine. Rapid Commun. Mass Spectrom. 16: 1086-1091. Cliff M, Yuksel D, Girard B, King M (2002). Characterization of Canadian ice wines by sensory and compositional analysis. Am. J. Enol. Vitic. 53: 46-50. Corino L, Stefano DR (1988). Response of white Muscat grapes in relation to various growing environments and evaluation of systems for training and pruning. Rivista Viticult. Enol. 41: 72-85. Du XF, Finn CE, Qian MC (2010). Volatile composition and odouractivity value of thornless ‘Black Diamond’ and ‘Marion’ blackberries. Food Chem. 119: 1127-1134. Falcao LD, de Revel G, Perello MC, Moutsiou A, Zanus MC, BordignonLuiz MT (2007). A survey of seasonal temperatures and vineyard altitude influences on 2-methoxy-3-isobutylpyrazine, C13norisoprenoids, and the sensory profile of Brazilian Cabernet sauvignon wines. J. Agric. Food Chem. 55: 3605-3612. Falqué E, Ferreira AC, Hogg T, Guedes-Pinho P (2004). Determination of aromatic descriptors of Touriga Nacional wines by sensory descriptive analysis. Flavour Fragr. J. 19: 298-302. Ferreira V, Lápez R, Cacho JF (2000). Quantitative determination of the odorants of young red wines from different grape varieties. J. Sci. Food Agric. 80: 1659-1667. Gómez-Míguez MJ, Cacho JF, Ferreira V, Vicario IM, Heredia FJ (2007). Volatile components of Zalema white wines. Food Chem. 100: 1464-1473. Guth H (1997). Quantitation and sensory studies of character impact odorants of different white varieties. J. Agric. Food Chem. 45: 30273032. Howard KL, Mike JH, Riesen R (2005). Validation of a solid-phase microextraction method for headspace analysis of wine aroma components. Am. J. Enol. Vitic. 56: 37-45. Joyeux A, Lafon-Lafourcade S, Ribereau-Gayon P (1984). Evolution of acetic acid bacteria during fermentation and storage of wine. Appl. Environ. Microbiol. 48: 153-156. Komes D, Ulrich D, Lovric T (2006). Characterization of odor-active compounds in Croatian Rhine Riesling wine, subregion Zagorje. Eur. Food Res. Technol. 222: 1-7. Li H (2002). Vinification. In Li H, Research progress of vine and wine: College of Enology (annual) pp: 97-99. Xi’an: Shaanxi Agricultural Press. Li H, Tao YS, Wang H, Zhang L (2008). Impact odorants of Chardonnay dry white wine from Changli County (China). Eur. Food Res. Technol. 227: 287-292. Lourdes M, Luis Z, Laura V, Manuel M (2009). Comparison of odoractive compounds in sherry wines processed from ecologically and conventionally grown Pedro Ximenez grapes. J. Agric. Food Chem. 57: 968-973. Ohloff G (1994). Scent and fragrances: the fashion of odors and their chemical perspectives Berlin: Springer-Verlag. pp. 57-68. OIV (1990). Recueil des methods internationals d’analyse des vins et des mouts. Office International de la Vigne et du Vin. Paris: O.I.V. pp. 13-96. Peinado RA, Moreno J, Bueno JE, Moreno JA, Mauricio JC (2004). Comparative study of aromatic compounds in two young white wines subjected to pre-fermentative cryomaceration. Food Chem. 84: 585-

Jiang et al.

590. Perestrelo R, Fernandes A, Albuquerque FF, Marques JC, Camara JS (2006). Analytical characterization of the aroma of Tinta Negra Mole red wine: identification of the main odorants compounds. Anal. Chim. Acta 563: 154-164. Pino JA, Queris O (2010). Analysis of volatile compounds of pineapple wine using solid-phase microextraction techniques. Food Chem. 122: 1241-1246. Rapp A (1988). Micro-element analysis in wine and grapes. In Linskens HF, Jackson HF, Conte LS, Wine analysis Berlin: Springer-Verlag. pp. 26-95. Reynolds AG, Wardle DA, Dever MJ (1996). Vine performance, fruit composition and wine sensory attributes of Gew端rztraminer in response to vineyard location and canopy manipulation. Am. J. Enol. Vitic. 47: 77-92. Selli S, Cabaroglu T, Canbas A, Erten H, Nurgel C, Lepoutre JP, Gunata Z (2004). Volatile composition of red wine from cv. Kalecik Karasi grown in central Anatolia. Food Chem. 85: 207-213. Schreirer P (1979). Flavor composition of wines-a review. Rev. Food Sci. Nutr. 12: 59-111. Shinohara T (1985). Gas chromatographic analysis of volatile fatty acids in wines. Agric. Biol. Chem. 49: 2211-2212. Souid I, Hassene Z, Palomo ES, Perez-Coello MS, Ghorbel A (2007). Varietal aroma compounds of Vitis vinifera L. cv Khamri grown in Tunisia. J. Food Qual. 30: 718-730. Tao YS, Li H, Wang H, Zhang L (2008). Volatile compounds of young Cabernet Sauvignon red wine from Changli County (China). J. Food

8287

Compos. Anal. 21: 689-694. Tominaga T, Murat ML, Dubourdieu D (1998). Development of a method for analyzing the volatile thiols involved in the characteristic aroma of wines made from Vitis vinifera L. cv Sauvignon Blanc. J. Agric. Food Chem. 46: 1044-1048. Weldegergis BT, Tredoux AGJ, Crouch AM (2007). Application of a headspace sorptive extraction method for the analysis of volatile components in South African wines. J. Agric. Food Chem. 55: 86968702. Zhang MX, Xu Q, Duan CQ, Qu WQ, Wu YW (2007). Comparative study of aromatic compounds in young red wines from Cabernet Sauvignon, Cabernet Franc, and Cabernet Gernischet varieties in China. J. Food Sci. 72: 248-252. Zhang ZW, Shi PB, Li X (2007). The effect of microclimate of hilly vineyard on grape and wine quality. J. Northwest A & F Univ. (Nat. Sci. Edition) 35: 193-198 (in Chinese).

Full Length Research Paper

Purification and characterization of α-amylase from Ganoderma tsuage growing in waste bread medium Muhammad Irshad1*, Zahid Anwar1, Muhammad Gulfraz 3, Hamama Islam Butt1, Amir Ejaz1, and Haq Nawaz2 1

Department of Biochemistry, NSMC, University of Gujrat, Pakistan Department of Animal Nutrition, University of Agriculture Faisalabad, Pakistan 3 Department of Biochemistry, Pir Mehr Ali Shah Arid Agriculture University Rawalpindi, Pakistan. 2

Accepted 30 March, 2012

The objective of this study was to purify and characterize the α-amylase for industrial perspective. The production of α-amylase through solid-state fermentation by Ganoderma tsuage was investigated by using waste bread as substrates. Production parameters were optimized as 2 mL of inoculum size, moisture 50%, additional carbon source (glucose) and nitrogen source (ammonium nitrate) 10:1, 1 mM/mL MgSO4, 0.75 mM/mL CaCl2 and 0.50 mM/mL KH2PO4. The purification value of α-amylase was observed as 1.2 fold with specific activity of 112 U/mg having a yield of 22%. Specific activity of αamylase increased up to the level of 143 U/mg and had 1.5-fold purification factor having a yield of 6% after Sephadex gel filtration. Optimum value of α-amylase was obtained at 35°C and at pH 6 for the time duration of 72 h. The Km and Vmax values for α-amylase were 1.3 mg and 39 mg/min, respectively. Calcium chloride (CaCl2) was found to increase the activity of α-amylase while all other compounds seemed to have inhibitory action against α-amylase. Silver nitrate (AgNO3) was the strongest inhibitor and therefore would not be advised for use in future research against α-amylase production. Key words: α-Amylase, purification, characterization, waste bread, Ganoderma tsuage

INTRODUCTION The sources of α-amylases are quite diverse such as plants, animals and microbes. The major advantages of using microorganisms for production of amylases are the bulk production capability and to obtain enzymes of desired characteristics (Aiyer, 2005). Amylases are enzymes that break down starch or glycogen into simple monomers of glucose. To meet the growing demands in the area of industry, it is essential to improve the performance of enzyme extraction techniques and thus increase the yield without increasing the expenses of production. α-Amylase purification has mainly been restricted to a few species of fungi (AbouZeid et, 1997). It is produced by a variety of living organisms ranging from bacteria, fungi to plants and humans (Pandey et al., 2000). α-Amylase (endo-1, 4-Dglucose- D glucohydrolase

*Corresponding author. E-mail: muhammad.irshad@uog.edu .pk. Tel: 092-3444931030.

3.2.1.1.) fits into the family of endo amylases that randomly slice the 1,4 – D glycoside linkage between adjoining glucose units in the product chain retaining the a anomeric carbon configuration in the product (Sasi et al., 2008). A great level of interest has paid attention on the potential of converting protein from agricultural waste like Cocos nucifera meal to microbial protein or single cell protein (Ravinder and Chaqndey, 2005). Microbial amylases especially produced by Ganoderma tsuage are utilized for food industry now days. Using current technologies, microbial amylases are commercially produced which have almost completely replaced chemical hydrolysis processes of starch in starch processing industries (Alva et al., 2007). Microorganisms can grow under controlled conditions in large number to yield amylases that are relatively easy to isolate and purify (M9). α-Amylase utilizes starch liquefaction to reduce their viscosity, production of maltose, oligosaccharide, high fructose syrup and maltotetraose syrup. α-Amylase preparations are mainly used in food industry,

Irshad et al.

brewing processes and continuous process for de-sizing of textile fabrics. Other applications include modification of starches suitable for preparation of adhesives, sizes and coatings for the paper industry, as well as manufacture of glucose and glucose syrup (Hanes and Stedt, 1988). Spectrum of applications of αamylase has extended in many sectors such as clinical medicinal and analytical chemistry (Ramachandran et al., 2004). The expenditure of enzyme production in submerged fermentation (SmF) is high, which lessens the cost by substitute methods. Baysal et al. (2003) have reported αamylase production in solid-state fermentation with wheat bran and rice husk as substrates. Ikram-ul-Haq et al. (2003) have illustrated the selection of an appropriate low cost fermentation medium for the production of αamylase by using agricultural by-products. The optimizations of fermentation parameters for α-amylase production establish a relationship between G. tsuage and waste bread medium. The purpose of this research was to study the purification and characterization of amylase by G. tsuage through the process of solid-state fermentation (Imran et al., 2011).

8289

filtered and then centrifuged. The supernatant was ultra-filtered through millipore filter and then filtrate examined for α-amylase production. α-Amylase production in solid-state protocol Triplicate flasks (500 mL) containing 10 g waste bread medium were adjusted to 70% moisture (w/w) with pre-optimized medium of pH 5.5, containing glucose as carbon source and NH4NO3 as nitrogen source in 10:1 C:N ratio and 1.5 mM MgSO4. The flasks were autoclaved, inoculated with 2 mL of inoculum, and incubated at 30°C for four days under stationary solid-state conditions.

Enzyme extraction The fermented biomass was harvested after four days by adding 100 mL of 100 mM sodium citrate buffer containing 1 mL Tween 80 of pH 5 and shaking at 150 rpm for 15 min. The contents of flask were filtered by Whatman No.1 filter paper (125 mm). The filtrate was centrifuged at 14,000 rpm at 4°C for 15 min and the supernatant used for enzyme assay and purification process (Mehboob et al., 2011).

Analysis of enzyme MATERIALS AND METHODS Screening for amylase producing fungi The medium was prepared and the pH of that medium was adjusted to 5.5 with 1 M HCl/1 M NaOH. It was autoclaved at 121°C for about 15 min. The media were then poured into the germ-free test tubes and some Petri plates; the test tubes were placed in slanting position. When medium became solidified, the slants were inoculated with the spores of G. tsuage aseptically in laminar airflow. These slants were incubated aerobically at 30°C for sporulation until 72 h, and by making little adjustments in the method, the sporulated slants was freezed at 4°C in refrigerator. Organism was sub cultured bimonthly (Imran et al., 2011) and its pH was maintained at 5.5 with M HCl and M NaOH. It was autoclaved for 15 min at 121°C and at a pressure of 1.1 kg/cm. A loopful culture of G. tsuage from potatoes dextrose agar (PDA) slants was transferred aseptically in laminar air floor into the conical flask (500 mL) containing 100 mL sterilized inoculum medium. It was incubated on orbital incubator shaker with 120 rpm at 37°C. After 72 h, the number of spores was counted in the medium with the help of haemocytometer by the method of Kolmer (1959). The spore concentration was adjusted at 1.52 x 108 spores per mL in the homogenous spore suspension. Five millliter (5 mL) of this inoculum was added to the fermentation flasks (500 mL) containing 70% moist substrate to optimize different parameters for amylase production. Fresh inoculum was prepared for each parameter under investigation (Imran et al., 2011). Microorganism and fermentation G. tsuage obtained from the Department of Biochemistry and Molecular Biology, University of Gujrat, Pakistan was maintained on potato starch-agar slants at pH 4 and 32°C (Asghar et al., 2000). Conical flasks with 100 mL of waste bread medium containing different concentrations of micronutrients inoculated with 5 mL of homogenous spore suspension (3 x 106 spores/mL) were incubated at pH 4 and 32°C on a shaker (120 rpm) for optimum fermentation period. The fermented biomass in each case was

α-Amylase activity was determined as described by Okolo et al. (1995). The reaction mixture consisted of 1.25 mL of 1% soluble starch, 0.5 mL of 0.1 M acetate buffer (acetic acid and sodium acetate) of pH=5.0, and 0.25 mL of crude enzyme extract. After 10 min of incubation at 50°C, the dinitrosalicylic acid (DNS) method of Miller (1959) was used to estimate the liberated reducing sugars (glucose equivalents).

Determination of protein content Protein contents of the crude and purified enzyme extracts was estimated by the method of Bradford (1976) by using Bovine serum albumin as standard.

Precipitation ammonium sulphate and dialysis In order to achieve maximum precipitation of enzyme, several (NH4)2SO4 concentrations (30, 40, 50, 60 and 70%) were used. Ammonium sulphate was used for salting out preferentially because it is soluble in water and high ionic strength can be attainable. At high ionic strength, salt may remove water of hydration from proteins and reduce solubility, hence proteins are coagulated. Crude enzyme extract was saturated to different concentrations of (NH4)2SO4 by adding calculated amount of (NH4)2SO4 in 10 mL crude extract under constant day. Then it was kept overnight at 4°C and centrifuged as 15000 rpm at 4°C by the centrifuge. The pellets were collected, dissolved in minimum quantity of buffer and dialyzed against distilled water while the supernatant was discarded (Irshad et al., 2011; Imran et al., 2011). Gel filtration chromatography A pooled fraction from dialysis loaded on Sephadex G-50 gel filtration column (16×2 cm) was equilibrated with 50 mM malonate buffer of pH 4.5. The 200 µL/run of sample applied and 100 mM phosphate buffer (pH 6.0) having 0.15 M NaCl was used as elution buffer and 12 major positive fractions collected with the flow rate of

8290

Afr. J. Biotechnol.

Table 1. Purification summary for α-amylase produced by G. tsuage.

S/N

Purification step

1 2 3 4

Crude α-amylase (NH4)2SO4 Ppt Dialysis Sephadex-100

Total volume (mL) 500 30 30 10

0.5 mLmin-1. After each purification step, the total protein content and enzyme activity were determined to calculate specific activity and purification factor (Irshad et al., 2011).

Characterization of α-amylase The purified α-amylase was subjected to characterization through kinetic studies by studying the following processes

Total enzyme activity (IU)

Total protein content (mg)

Specific activity (U/mg)

44000 9881 6659 2715

458 88 51 19

96 112 130 143

Effect of activators / inhibitors Effects of different metal ions including calcium chloride (CaCl2), silver nitrate (AgNO3) and organic compounds including tetramethylethylenediamine (TEMED), ethylenediamine tetra acetic acid (EDTA) in 1 to 50 mM concentration range on α-amylase activity were investigated. The enzyme was incubated at 35°C (assay temperature) in the presence of varying concentration solutions (pH 5.5) of the respective compounds for 10 to 15 min (Metin et al., 2010).

Effect of pH on α-amylase activity α-Amylase was checked at different pH levels ranging from 3 to 9. α-Amylase was analyzed at pH 3 to 3.5 in 100 mM succinate buffer, pH 4 to 5 in 100 mM citrate buffer, pH 6 to 7 in 100 mM phosphate (Na2HSO4 and NAH2 SO4) buffer, and pH 8 to 9 in 100 mM sodium phosphate buffer.

Effect of temperature on α-amylase activity Purified α-amylase was evaluated at different temperature ranging from 25 to 70°C at optimum pH 5.5; the enzyme was incubated at varying temperatures for 15 min.

Effect of substrate concentration: Determination of Km and Vmax The Michalis-Menten kinetic constants (Km, Vmax) were determined by using varying concentrations of starch ranging from 0.5 to 3 mg/mL following the method described by Metin et al. (2010).

RESULTS Purification of α-amylase The purification summary for α-amylase production is shown in Table 1. α-Amylase was purified using 60% saturation with (NH4)2SO4 having yield up to 1.2 fold purification. The specific activity for α-amylase production was reasonable (112 U/mg) with yield of 22%. After Sephadex G-100 filtration (Figure 1), the specific activity of α-amylase increased up to 143 U/mg with 1.5 fold purification having activity yield of 6%. The activity of α-amylase can be increased using various activators. Effect of pH on the activity of the amylase The effect of various level of pH on α-amylase

Yield (%) 100 22 15 6

Purification (fold) 1 1.2 1.4 1.5

production was investigated in buffer of pH ranges from 3.0 to 9.0 using starch as substrate. The pHactivity profile (Figure 2) showed that the activity of α-amylase revealed its highest activity (86 U/mL) at pH 6, which was its optimum pH. However, a further increase in pH caused denaturation of enzyme as a gradual decline of the enzyme activity was revealed. Effect of temperature on activity of the αamylase The incubation temperature of α-amylase production was checked for 15 min before the routine activity assessed. The optimum value for αamylase production was observed at 80 U/mL at 35°C, which was reasonable for this particular study (Figure 3). Km and Vmax Effect of different concentrations of starch on the activity of α-amylase studied and reciprocal plot of 1/S Vs 1/V was constructed for the determination of maximum velocity and Michaelis–Menten constant Km (Figure 4). The results reveal that the KM value for αamylase was observed as 1.3 mg and Vmax value was observed to be 39 mg/min.

Irshad et al.

8291

0.4

Absorbance (280nm)

0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 0

9 10 11 12 13 14 15 16 17 18 19 20 21 Fraction no.

Figure 1. Gel filtration chromatography of α-amylase produced by G. tsuage.

90 80

Activity (U/mL)

70 60 50 40 30 20 10 0 2

pH Figure 2. Effect of рH on the activity of α-amylase from G. tsuage.

Effect of inhibitors and denaturants on α-amylase activity The effects of varying concentrations of different activators and inhibitors such as CaCl2, EDTA, TEMED and AgNO3 on α-amylase activity were investigated using starch as a substrate (AbouZeid, 1997). CaCl2 was found to increase the activity of α-amylase. All other compounds had inhibitory action to α-amylase activity and AgNO3 was the strongest inhibitor (Figure 5). DISCUSSION In this study, the production of α-amylase was investi-

gated using waste breads as substrates and the results are quite reasonable and more or less productive for economic point of view. Production parameters having carbon, nitrogen and various mineral were optimized and checked for the production of α-amylase at best suitable conditions. The purification value of α-amylase was observed as 1.2 fold, which showed that it possessed some useful aspects in food industry. Reasonable specific activity of α-amylase (143 U/mg) after gel filtration revealed that this substrate had good utilization for α-amylase production. Optimum value of α-amylase was 80 U/mL which was obtained at 35°C and maximum activity of 83 U/mL achieved at pH of six for the duration of 72 h. The KM value for α-amylase was 1.3 mg, which revealed an affordable bonding between substrate and

8292

Afr. J. Biotechnol.

100 90 80

Activity (U/mL)

70 60 50 40 30 20 10 0 20

Temperature (°C) Figure 3. Effect of temperature on activity of α-amylase produced by G. tsuage.

100 90 80 70

1/[V]

60 50 40 30 20 10 0 -2

-1.75

-1.5

-1.25

-1

-0.75

-0.5

-0.25

0.25

0.5

0.75

1.25

1.5

1.75

1/[S] Figure 4. Reciprocal plot of 1/[S] vs 1/[V] for the determination of KM and Vmax of α-amylase.

enzyme. Maximum velocity value was observed as 39 mg/min. CaCl2 was found to enhance the activity of αamylase up to 92 U/mL while all other compounds especially AgNO3 seemed to have inhibitory action

against α-amylase production. The highest activity of α-amylase from Penicillium citrinum HBF62 was determined at pH 5.5 by Metin et al. (2010). Nouadri et al. (2010) obtained α-amylase from

Irshad et al.

8293

110 100 90 80

U/mL

70 Control

CaCl2

TEMED

EDTA AgNO3

30 20 10 0 1

Varying concentration of activator/inhibitors (mM) Figure 5. Effect of varying concentration of activator and inhibitors

Penicillium camemberti PL21 at pH 5.5. Purified αamylase was isolated from novel Bacillus cereus MS6, used for 1% starch as a media in liquid culture and the optimum activity of amylase observed at 45°C and pH 7.0 as reported by Al-ZaZaee et al. (2011). The enzyme activity produced 1% starch or urea by the Bacillus sp. isolated from paddy seeds, which was optimal at 30°C and pH 6.8, and increased by the presence of Ca2+ and Co2+ ions under submerged fermentation (Varalakshmi et al., 2008). The optimum temperature for α-amylases from fungal and yeast sources has generally been found to be between 30 and 70°C (Gupta et al., 2003; Sun et al., 2010). Optimum temperatures for α-amylase in earlier studies on the Penicillium species were reported between 30 and 60°C (Doyle et al., 1988; Ertan et al., 2006). The Km and Vmax values were 0.92 mg/ml and 38.5 μmole/min, respectively at 30°C and pH 6.0 with 0.1 M phosphate buffer from P. camemberti PL21 by Nouadri et al. (2010). The Km of α-amylase of P. citrinum HBF62 was lower than those of Penicillium amagasakiense (1.12 mg/ml) (Doyle et al., 1988) and Penicillium griseofulvum (9.1 mg/ml) (Ertan et al., 2006). The Km of fungal and yeast α-amylases have been reported to be between 0.13 to 5 mg/ml (Pandey et al., 2000; Gupta et al., 2003). 2+ The effect of 2 mM Ca increased the α-amylase activity obtained from P. camemberti PL21 by Nouadri et al. (2010) but other metals ions such as (Mg2+, Hg+2, Ag+ +2 and Cu ) inhibited the enzyme activity. Similar results have also been reported for α-amylases from Thermomyces lanuginosus (Petrova et al., 2000), Vibrio

sp. (Najafi and Kembhavi, 2005), Thermococcus profundus DT5432 (Chung et al., 1995) and other microbial amylases (Gupta et al., 2003). The enzyme activity was slightly stimulated in the presence of dithiothreitol (DTT), β-mercaptoethanol and 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB), indicating that cysteine residue(s) do not take part in catalysis. Also, the enzyme activation by DTT, β-mercaptoethanol and DTNB could be attributed to the reduction in aggregate size by destroying the intermolecular disulfide linkages and/or by the protection of thiol groups that stabilize the three dimensional structure of enzyme (Khedher et al., 2008). REFRENCES AbouZeid AM (1997). Production, purification and characterization of an extracellular α-amylase enzyme isolated from Aspergillus flavus. Microbios, 89(358): 55-66. Aiyer PV (2005). Amylases and their applications. Afr. J. Biotechnol. 4(13): 1525-1529. Alva S, Anumpama J, Savla J, Chiu YY, Vyshali P, Shruti M, Yogeetha BS, Bhavya D, Purvi J, Ruchi K, Kumudini BS, Varalakshmi KN (2007). Production and characterization of fungal amylase enzyme isolated from Aspergillus sp. JGI 12 in solid state culture. Afr. J. Biotechnol. 6(5): 576-581. Al-ZaZaee, Abdu MM, Neelgund S, Gurumurthy DM, Rajeshwara AN (2011). Identification, Characterization of Novel Halophilic Bacillus Cereus Ms6: a Source for Extra Cellular A-Amylase. Adv. Environ. Biol. 5(5): 992-999. Asghar M, Yuqub M, Sheikh MA, Baraque AR (2000). Optimization of cellulase production by Arachniotus sp. using corn stover as substrate. JAPS, 10: 37-40. Baysal Z, Uyar F, Aytekin C (2003). Solid-state fermentation for production of a -amylase by a thermotolerant Bacillus subtilis from

8294

Afr. J. Biotechnol.

hot-spring water, Process Biochem. 38: 1665-1668. Bradford MM (1976). A rapid and sensitive method for quantification of microgram quantities of proteins utilizing the principles of protein dye binding. Anal. Biochem. 72: 248-254. Chung YC, Kobayashi T, Kanai H, Akiba T, Kudo T (1995). Purification and properties of extracellular amylase from the hyperthermophilic archaeon Thermococcus profundus DT5432. Appl. Environ. Microbiol. 61: 1502-1506. Doyle EM, Kelly CT, Fogarty WM (1988). The amylolytic enzymes of Penicillium amagasakiense. Biochem. Soc. Trans. 16: 181-182. Ertan F, Yagar H, Balkan B (2006). Some properties of free and immobilized α-amylase from Penicillium griseofulvum by solid state fermentation. Prep. Biochem. Biotechnol. 36: 81-91. Gupta R, Gigras P, Mohapatra H, Goswami VK, Chauhan B (2003). Microbial α-amylases: a biotechnological perspective. Process Biochem. 38: 1599-616. Hanes B, Stedt S (1988). Milling and Baking Technology. John Willey and Sons USA. pp. 415-70. Ikram-ul-Haq, Ashraf H, Iqbal J, Qadeer MA (2003). Production of alpha amylase by Bacillus licheniformis using an eco-nomical medium. Bioresour. Technol. 38: 8757-8761. Imran M, Asad MJ, Gulfraz M, Mehboob N, Jabeen N, Hadri SH, Irfan M, Anwar Z, Ahmed D (2011). Hyper Production of glucoamylase by Aspergillus niger through chemical mutagenesis. Int. J. Physical Sci. 6(26): 6179-6190. Irshad M, Asgher M, Sheikh MA, Nawaz H (2011). Purification and characterization of laccase produced by Schyzophylum commune IBL-06 in solid state culture of banana stalks. Bioresour. 6(3): 28612873. Khedher IBA, Bressollier P, Urdaci MC, Limam F, Marzouki MN (2008). Production and biochemical characterization of Sclerotinia sclerotiorum α-amylase ScAmy1: assay in starch liquefaction treatments. J. Food Biochem. 32: 597-614. Khoo SL, Nazalan MN, Razip MS, Azizan MN (1994). Purification and properties of two forms of glucoamylase from Aspergillus niger. Folia Microbiol (Praha). 41(2): 65-174. Mehboob N, Asad MJ, Imran M, Gulfraz M, Wattoo FH, Hadri SH, Asghar M (2011). Production of lignin peroxidase by Ganoderma leucidum using solid state fermentation. Afr. J. Biotechnol. 10(48): 9880-9887. Metin K, Koç O, Ateslier ZBB, Bıyık HH (2010). Purification and characterization of α-amylase produced by Penicillium citrinum HBF62. Afr. J. Biotechnol. 9(45): 7692-7701. Miller GL (1959). Use of Dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 31: 426-428.

Mohammed MAA, Neelgund S, Gurumurthy DM, Rajeshwara AN (2011). Identification, Characterization of Novel Halophilic Bacillus Cereus Ms6: a Source for Extra Cellular A-Amylase. Adv. Environ. Biol. 5(5): 992-999 Najafi MF, Kembhavi A (2005). One step purification and characterization of an extracellular α-amylase from marine Vibrio sp. Enzyme Microb. Tech. 36: 535-539. Nouadri T, Meraihi Z, Shahrazed DD, Leila B (2010). Purification and characterization of the α-amylase isolated from Penicillium camemberti PL21. Afr. J. Biochem. Res. 4(6): 155-162. Okolo BN, Ezeogu LI, Mba CN (1995). Production of raw starch digesting amylase by Aspergillus niger grown on native starch sources. J. Sci. Food Agric. 69: 109-115. Pandey A, Nigam P, Soccol CR, Soccol VT, Singh D, Mohan R (2000). Advances in microbial amylases. Biotechnol. Appl. Biochem. 31: 135152. Petrova SD, Ilieva SZ, Bakalova NG, Atev AP, Bhat MK, Kolev DN (2000). Production and characterization of extracellular α-amylases from the thermophilic fungus Thermomyces lanuginosus (wild and mutant strains). Biotechnol. Lett. 22: 1619-1624. Ramachandran S, Patel AK, Nampoothiri KM, Chandran S, Szakacs G, Soccol CR, Pandey A (2004). Alpha amylase from a fungal culture grown on oil cakes and its properties. Braz. Arch. Biol. Technol. 47: 309-317. Ravinder R, Chaqndey A (2005). Optimization of protein environment of deoiled rice bran by solid state fermentation using A. flavus MTCC 1846. 25: 1-30. Sasi A, Baghyaraj R, Yogananth N, Chanthuru A, Ravikumar M (2008). Production of α-amylase in submerged fermentation by using Bacillus sp. Resear. J. Biol. Sci. 1: 50-57. Varalakshmi KN, Kumudini BS, Nandini BN, Solomon JD, Mahesh B, Suhas R, Kavitha AP (2008). Characterization of Alpha Amylase from Bacillus sp.1 isolated from paddy seeds. J. Appl. Biosci. 1(2): 46-53.

Full Length Research Paper

Extraordinary mullet growth through direct injection of foreign DNA Samy Yehya El-Zaeem1, 2 1

DNA Research Chair, Zoology Department, College of Sciences, P.O. Box 2455, King Saud University, Riyadh 11451, Saudi Arabia. 2 Animal and Fish Production Department, Faculty of Agriculture (Saba-Bacha), Alexandria University, Alexandria, Egypt. E-mail: selzaeem@ksu.edu.sa. Tel: +201003552398, +966592299396. Accepted 30 March, 2012

The present study aims to produce a genetically modified grey mullet, Mugil cephalus, with accelerated growth through direct injection of foreign DNA isolated from the liver of shark (Squalus acanthias L.) or African catfish (Clarias gariepinus) into muscles of fingerlings fish at the dose of 40 µg/fish. The results show a significant (P≤0.05) improvement in most of the growth performance and body composition parameters of genetically modified grey mullet fingerlings injected with shark DNA compared to both genetically modified grey mullet injected with catfish DNA and the control fish, while the results of feed conversion ratio (FCR) and protein efficiency ratio (PER) indicate that fish injected with shark DNA or catfish DNA had significant (P≤0.05) superiority compared to their control. The results of the random amplified polymorphic DNA (RAPD) fingerprinting show highly genetic polymorphic percentage among grey mullet that received foreign DNA and their control using different random primers. This may be due to some fragments of foreign DNA randomly integrated into grey mullet genome. Therefore, the result indicates a possible easy and rapid way for improving fish characteristics. Key words: Grey mullet, growth, foreign DNA, genetically modified. INTRODUCTION Grey mullet, Mugil cephalus, is a euryhaline fish widely distributed in tropical and subtropical estuaries. Mullets are catadromous spawning migrating fish; the young life before maturity remains predominantly in the system of rivers and lakes (Lee and Tamaru, 1988; El-Deeb et al., 1996). Natural spawning of grey mullet in captivity has not yet been demonstrated (Lee et al., 1988; ElGharabawy and Assem, 2006). Reports on induced spawning and larval rearing in grey mullet are primarily based on experiments carried out in Taiwan (Kuo, 1995; Liao, 1997) and Hawaii (Weber and Lee, 1985; Lee et al., 1987, 1988; Tamaru et al., 1989) where fertilized mullet eggs have been obtained consistently. However, no commercial production of mullet eggs has been reported to date in the Mediterranean basin. Grey mullet commands high price and the ability of juvenile and adult to tolerate large fluctuation of salinity qualifies them as an attractive species for farming (Monbrison et al., 2003; ElGharabawy and Assem, 2006). Since the first batch of transgenic fish was produced in China (Zhu et al., 1985 and 1986), many laboratories all

over the world have turned to the study of transgenic fish to gain new farming strains with the traits of fast-growing, disease resistance, cold or salt tolerance, sexual maturation, food quality and preservation (Shears et al., 1991; Chen et al., 1996; Martinez et al., 1996; Hernandez et al., 1997; Martinez et al., 1999, 2000; El-Zaeem, 2001, 2004 a, b; El-Zaeem and Assem 2006; El-Zaeem et al., 2011; El-Zaeem, 2011 a, b). A commonly used method to introduce foreign DNA is by microinjection into the nucleus or cytoplasm of fertilized eggs. This method, however, requires some skill and involves some difficulties and it is time consuming (Inoue et al., 1990; Sin et al., 1993). To avoid the difficulties accompanying microinjection, much more convenient methods are required, especially if such techniques are to be applied in aquaculture for fast breeding of commercially important species. The most common potential mass methods are: 1) the use of electroporation of fertilized eggs (Inoue et al., 1990; Inoue, 1992; Xie et al., 1993), 2) electroporated sperm (Muller et al., 1992; Symonds et al., 1994), 3) the use of sperm cells as vector to introduce foreign DNA into

8296

Afr. J. Biotechnol.

Table 1. The sequences, GC % and the annealing temperatures of the primers used.

Primers 1 2 3 4 5

Sequence 5`- 3` GGA CTG GAG TGT GAT CGC AG GGT GAC GCA GGG GTA ACG CC CAG GCC CTT CCA GCA CCC AC GTA AAA GTC CTG GTT CCC CG GGC GGA GCT GGA GGG CCT GG

fish eggs (Khoo et al., 1992) and 4) direct injection of foreign DNA into fish gonads (El-Zaeem, 2001). A quick method to introducing foreign DNA injected directly into the muscle tissue was reported (Wolff et al., 1990; Ono et al., 1990) in adult mice, (Thomson and Booth, 1990) in rat, and (Hansen et al., 1991; Rahman and Maclean, 1992; Tan and Chan 1997; Xu et al., 1999; El-Zaeem 2004a; Hemeida et al., 2004; El-Zaeem and Assem 2004; Assem and El-Zaeem 2005; El-Zaeem et al., 2012) in fish. This procedure is useful because muscle injection is much easier than the others and very rapid results are obtained (Rahman and Maclean, 1992). The foreign DNA was presented extrachromosomally up to six months following injection (Wolff et al., 1990). Moreover, Sudha et al. (2001) reported that the expression of muscular injection of DNA was evident in several non muscle tissues, such as skin epithelia, pigment cells, blood vessel cells and neuron-like cells. Therefore, the aim of this work was to study the effect of direct injection of foreign DNA extracted from shark (Squalus acanthias L.) or African catfish (Clarias gariepinus) into skeletal muscles of grey mullet (Mugil cephalus) on the productive performance characteristics. Moreover, genetic polymorphism among normal and injected fish was studied using random amplified polymorphic DNA (RAPD) fingerprinting. MATERIALS AND METHODS Fish origin The grey mullet, M. cephalus, used in this study were collected from the Mediterranean sea and transfer to the Laboratory of Breeding and Production of fish, Animal and Fish Production Department, Faculty of Agriculture, (Saba-Bacha) Alexandria University, Alexandria, Egypt.

Preparation of genomic DNA High molecular weight DNA was extracted according to Brem et al. (1988) method. Isolation of DNA was accomplished by reducing liver sample from shark (S. acanthias L.) and African catfish, C. gariepinus to small pieces, which were then transferred to a microfuge tube and incubated overnight until the samples were digested in a buffer containing 50 mM Tris, 100 mM ethylenediaminetetraacetic acid (EDTA; pH 8.0), 100 mM NaCl, 0.1% sodium dodecyl sulphate (SDS) and 0.5 mg/ml proteinase K. After incubation, samples were extracted twice for 15 to 20 min with one volume of phenol/chloroform (1:1) and then again twice for 15

GC (%) 60 70 70 55 80

Annealing Temperature (°C /s) 30 30 30 30

min with one volume of chloroform/isoamyl-alcohol (24:1). The aqueous phase was then precipitated with 2.5 volumes of 100% ethanol in the presence of 1/10 volume 3 M sodium acetate (pH 6.0). The pelleted DNA was washed with 70% ethanol and dissolved in 0.1X saline sodium citrate (SSC) buffer. The DNA concentrations were measured by ultraviolet (UV) spectrophotometry. The extracted DNA was restricted by EcoR1 restriction enzyme type II. The DNA between guanine and adenine was digested according to Tsai et al. (1993).

Experimental setup Management Ninety fingerlings of grey mullet (M. cephalus) with an initial live weight (2.11±0.01 g) were divided randomly into three groups and three replicates for each group. Each group was stocked separately at a rate of 1.0 fish/17.5 L in a half of rectangle fiberglass tank (total volume, 350 L, which was divided by plastic sieved connected with iron frame. Each tank was supplied with fresh water at a rate of 0.5 L/min with supplemental aeration. Fish were fed twice daily with pellet diet (28% protein) to satiation six days a week, and weighed biweekly for 63 days.

Injection of foreign DNA in vivo The DNA concentration of 40 µg/0.1 ml/fish (El-Zaeem, 2004a; ElZaeem and Assem, 2004; Hemeida et al., 2004; Assem and ElZaeem, 2005) were prepared from each type of DNA using 0.1X SSC buffer and injected into grey mullet muscles using a hypodermic needle. The injection was applied on two groups of grey mullet fingerlings, while the third group was left without injection as a control.

Quantitative traits studied The following traits were measured; body weight (g), weight gain (g), specific growth rate (SGR %/day), survival ratio, feed intake, Feed conversion ratio (FCR) and protein efficiency ratio (PER). Whole body composition of fish was analyzed according to the standard methods (AOAC, 1984) for moisture (oven drying), protein (micro-Kjeldahl method) and lipid (ether extract method).

Random amplified polymorphic DNA (RAPD) analysis By the end of the experiment, genomic DNA was extracted from tissue of injected fish and their control according to the method described by Baradakci and Skibinski (1994). In this work, 20 base long oligonucleotide primers (Table 1) were used to initiate PCR amplifications. Primers were randomly selected on the basis of GC content and annealing temperature for RAPD-PCR amplification.

El-Zaeem

8297

Table 2. Growth performance, survival and feed utilization of grey mullet injected with shark and catfish DNA.

Treatment Control Shark DNA Catfish DNA

IBW

FBW

2.11 ± 0.01 2.11 ± 0.02 2.10 ± 0.01

3.77 ± 0.11c a 5.65 ± 0.35 b 4.83 ± 0.18

1.66 ± 0.13c a 3.55 ± 0.37 2.73 ± 0.16b

SGR (%/ day) 0.92 ± 0.06c a 1.57 ± 0.12 1.32 ± 0.04b

Survival (%) 100 ± 0.00a b 75 ± 7.07 70 ± 0.00b

Feed intake (g) 2.87 ± 0.05c a 5.22 ± 0.04 4.40 ± 0.04b

FCR

PER

1.73 ± 0.10a b 1.48 ± 0.14 ab 1.62 ± 0.08

2.08 ± 0.12b a 2.45 ± 0.23 ab 2.24 ± 0.1

Means having different superscripts within column are significantly different (P≤0.05). Initial and final body weight (IBW and FBW) = body weight at start and end of experiment; weight gain (WG) = final weight - initial weight; specific growth rate (SGR% / day) = (Loge final weight - Loge initial weight) 100 / number of days; feed conversion ratio (FCR) = dry feed intake/weight gain; protein efficiency ratio (PER) = weight gain/protein intake.

The polymerase chain reaction amplifications were performed following the procedure of Williams et al. (1990, 1993). The reaction (25 µL) was carried out in a medium that consisted of 0.8 U of Taq DNA polymerase (Fanzyme), 25 pmol dNTPs and 25 pmol of random primer, 2.5 µL 10X Taq DNA polymerase buffer and 40 ng of genomic DNA. The final reaction mixture was placed in a DNA thermal cycler (Eppendorf). The PCR programme included an initial denaturation step at 94°C for 2 min followed by 45 cycles with 94°C for 30 s for DNA denaturation, annealing as mentioned with each primer, extension at 72°C for 30 s and final extension at 72°C for 10 min were carried out. The samples were cooled at 4°C. The amplified DNA fragments were separated on 1.5% agarose gel and stained with ethidium bromide. DNA marker (bp 1000, 900, 800,.…., 100) was used in this study. The amplified pattern was visualized on an UV transilluminator and photographed by Gel Documentation system. Scoring and analysis of RAPDs RAPD patterns were analyzed and scored from photographs. For the analysis and comparison of the patterns, a set of distinct, wellseparated bands were selected. The genotypes were determined by recording the presence (1) or absence (0) in the RAPD profiles. Furthermore, the genetic similarity (GS) of the three groups of injected mullet and their control, based on RAPD fingerprinting were analyzed by the index of similarity using the formula given by Nei and Li (1979): Bij=2 Nij/(Ni + Nj), where Nij is the number of common bands observed in individuals i and j, and N i and Nj are the total number of bands scored in individuals i and j, respectively, with regards to all assay units. Thus, GS reflects the proportion of bands shared between two individuals and ranges from zero (no common bands) to one (all bands identical). Genetic dissimilarity (GD) was calculated as: GD = 1- GS (Bartfai et al., 2003). Statistical analysis Data of the phenotypic traits were analyzed using the following model (CoStat, 1986): Yij = µ+ Ti + Bj + Eij Where, Yij is the observation of the ij th parameter measured; µ is the overall mean; Ti is the effect of ith dose; Bj is the effect of Jth block; Eij is the random error. Significant differences (P≤0.05) among means were tested by Duncan’s multiple range test (Duncan, 1955).

RESULTS AND DISCUSSION The data in Table 2 shows that the final body weight

(FBW), weight gain (WG), specific growth rate (SGR %/day) and feed intake of mullet injected with shark DNA were significantly (P≤0.05) increased compared with the mullet injected with catfish DNA and the control groups. The highest record of survival was achieved by the control group and differed significantly (P≤0.05) from those of the fish injected with each shark and catfish DNA. In addition, the best FCR and the highest PER were recorded by mullet injected with shark DNA, but did not differ significantly (P≤0.05) from that of fish injected with catfish DNA. The results of the previous studies (ElZaeem and Assem 2004; El-Zaeem 2004a; Hemeida et al., 2004; Assem and El-Zaeem 2005; El-Zaeem et al., 2012) state that the optimal dose of foreign DNA isolated from different donors and injected into different fish species, was 40 µg/ 0.1 ml / fish. The injected fish had significant (P≤0.05) improvement of growth performance, body composition, feed utilization and immunity traits. The results of this work are consistent with these findings. The results of body composition by the end of the experiment show that protein content of mullet injected with shark DNA were significantly (P≤0.05) higher than those of mullet injected with catfish DNA or the control group, while lipid content of control group was significantly (P≤0.05) lower than those of mullet injected with shark DNA or catfish DNA (Table 3). Martinez et al. (2000) and Lu et al. (2002) reported that anabolic stimulation and average protein synthesis were higher in transgenic fish than that of non-transgenic fish. The improvement of most traits may be explained according to Hemieda et al. (2004); they reported that, genetically investigation of Nile tilapia injected directly with shark DNA into skeletal muscles was carried out. The concentrations of such DNA up to 40 µg/0.1 ml/fish probably activated gradually cell proliferation in modified muscle tissues. Also, the measurements of DNA content in the muscles of modified fish indicated that shark DNA may be acting as a mutagen and it had no carcinogenic effect. This is mostly responsible for the enhancement of the productive performance shown in the modified fish injected with foreign DNA. Compared with the traditional approaches, genetically modified breeding avoids the productive isolation between two different species. Since more manipulated

8298

Afr. J. Biotechnol.

Table 3. Body composition of grey mullet injected with shark and catfish DNA.

Treatment At the start At the end Control Shark DNA Catfish DNA

Moisture (%) 73.98±0.04

Crude protein (%) 13.97±0.02

Crude fat (%) 8.89±0.05

72.06±0.06 71.98±0.04 72.01±0.07

15.67±0.02c 16.16±0.07a b 15.80±0.06

9.20±0.04b 10.50±0.08a a 10.47±0.05

Means at the end of experiment having different superscripts within column are significantly different (P≤0.05).

Table 4. The percentage of polymorphic (PB%) of control (T1) versus mullet injected with shark DNA (T2), control (T1) versus mullet injected with catfish DNA (T3) and mullet injected with shark DNA (T2) versus mullet injected with catfish DNA (T3).

Primers 1

Average

NTB 4

T1 vs. T2 NPB 4

PB (%) 100 20 45 75 0 48

NTB 6 13 6 4 8

T1 vs. T3 NPB PB (%) 4 67 3 23 6 100 2 50 2 25 53

NTB 4 11 5 10 8

T2 vs. T3 NPB PB (%) 4 100 5 45 5 100 4 40 2 25 62

NTB, Number of total bands; NPB, number of polymorphic bands.

genes are available for foreign DNA transfer, it is hopeful for the investigators to shorten the breeding period through directional genetic breeding (Wang et al., 2001). Also, Sin (1997) reported that the phenotypic changes, such as increased growth rate, are usually more prominent in the transgenic fish than those obtained by artificial selection or through efficient feeding regime. Furthermore, the technique used in this work is concerned with the utilization of the whole gene, introns and exons and not only exons through mRNA and reverse transcriptase treatments (Ali 2001). Thus, there is no need to utilize any kind of virus as the total DNA facilitates the introduction of foreign genes into cells with the aid of introns which act as retro-transposons (Hickey and Benkel, 1986). The identification of the injected fish and their control was made using RAPD technique. Five random primers (Table 1) were tested for their ability to produce DNA polymorphism in genomic DNA of each genotype selected. All the five random primers examined produced different RAPD bands patterns. The number of amplified fragments detected varied depending on primers and treatments. Moreover to ensure that the amplified DNA fragments originated from genomic DNA, not from primer artifacts, negative control was carried out for each primer/ genotype combination. No amplification was detected in the control reactions. All amplification products were found to be reproducible when reactions were repeated using the same reaction conditions (Table 4 and Figure

1). Data of genetic diversity among the injected fish and their control showed that the highest genetic polymorphic percentage (62.00%) was found between mullet injected with shark DNA and catfish DNA, while the lowest percentage (48.00 %) was recorded between mullet injected with shark DNA and their control (Table 4 and Figure 1). The results of genetic polymorphic between mullet injected with catfish DNA and their control show the percentage (53.00 %). This may be due to the differences in DNA molecule among normal and injected fish as a result of direct injection of foreign DNA isolated from shark or catfish. Moreover, some fragments of foreign DNA may be randomly integrated into mullet genomes. This integration could be functional or silent integration (Yaping et al., 2001). The results of this work are consistent with the findings obtained in previous studies (El-Zaeem, 2001; Hemeida et al., 2004; Ali, 2002; Assem and El-Zaeem, 2005, ElZaeem and Assem, 2006; El-Zaeem et al., 2011; ElZaeem 2011 a, b). Also, the sensitivity of the RAPD marker played an important role in the detection of these differences (Ahmed et al., 2004; Ali et al., 2004; ElZaeem et al, 2006; El-Zaeem and Ahmed, 2006; ElZaeem 2011 a, b). The specific characterization of the RAPD method (random, uncharacterized multiple genome loci; dominant nature of markers; and possibility of migration of no-homologous bands) result in limitations based on RAPD analysis alone. Despite these limitations, the RAPD analysis can be used effectively for initial

El-Zaeem

8299

Figure 1. DNA fingerprinting illustrating polymorphism among Mugil cephalus muscle tissues following direct injection with different types of DNA. Lanes M, 1, 2 and 3 are DNA marker, control, mullet injected with shark and catfish DNA, respectively.

assessment of genetic variation among fish species (Barman et al., 2003). The main advantages of RAPD markers are the possibility of working with anonymous DNA and the relatively low expense, and it is fast and simple to produce RAPD marker (Hadrys et al., 1992; Elo et al., 1997; Ali et al., 2004). On the other hand, the success of the growth enhancement in this study with injected fish is impressive and underscores their potential usefulness in aquaculture. Thus, mullet injected with shark DNA show a very good response, with more than two fold weight increase compared with non-injected control. In addition, most of the productive performance traits of injected fish were improved significantly. In this connection, several studies reported that transgenetically growth, body composition and feed utilization enhanced fish show some promise of improvement on both counts (Chatakondi et al., 1995; Rahman et al., 1998; Rahman and Maclean, 1999; Maclean and Laight, 2000; Matinez et al., 2000; Devlin et al., 2004 a, b; Kang and Devlin, 2003; Stevens and Devlin, 2000, 2005; Dunham et al., 2002; Raven et al., 2006; Hallerman et al., 2007; Oakes et al., 2007: ElMaremie, 2007; El-Zaeem et al., 2011; El-Zaeem, 2011 b). In conclusion, the results of this study suggest that genetically modified M. cephalus with extraordinary growth rate can be produced using a feasible and fast

methodology. ACKNOWLEDGEMENT This project was supported by King Saud University, Deanship of Scientific Research, College of Science Research Center. REFERENCES Ahmed MMM, Ali BA, El-Zaeem SY (2004). Application of RAPD markers in fish: Part I- Some genera (Tilapia, Sarotherodon and Oreochromis) and species (Oreochromis aureus and Oreochromis niloticus) of Tilapia. Int. J. Biotechnol. 6(1): 86-93. Ali AMM (2001). The role of genomic DNA and introns in gene transfer. Int. J. Biotechnol. 3: 411-418. Ali BA, Huang T, Qin D, Wang X (2004). A review of random amplified polymorphic DNA (RAPD) markers in fish research. Rev. Fish Biol. Fisheries, 14: 443-453. Ali FK (2002). The genetic construction of a salt and disease tolerant tilapia fish stain through the introduction some foreign genes. Ph.D. Thesis, Fac. Agric. Alex. Univ. Alexandria, Egypt. AOAC (Association of Official Analytical Chemists) (1984). Official methods of analysis. 14th ed. Association of Official analytical Chemists, Arlington, Virginia. Assem SS, El-Zaeem SY (2005). Application of biotechnology in fish breeding. II: Production of highly immune genetically modified redbelly tilapia, Tilapia zillii. Afr. J. Biotechnol. 5: 449-459. Baradakci F, Skibinski DOF (1994). Application of the RAPD technique

8300

Afr. J. Biotechnol.

in tilapia fish: species and subspecies identification. Heredity, 73: 117-123. Barman HK, Barat A, Yadav BM, Baneryec SM, Mahr PK, Reddy PVGK, Jana RK (2003). Genetic variation between four species of Indian major carps as revealed by random amplified polymorphic DNA assay. Aquaculture, 217: 115-123. Bartfai R, Egedi S, Yue GH, Kovacs B, Urbanyi B, Tamas G, Horvath L, Orban L (2003). Genetic analysis of two common carp broodstocks by RAPD and microsatellite markers. Aquaculture, 219:157-167. Brem G, Brenig B, Horstgen-Schwark G, Winnacker EL (1988). Gene transfer in tilapia (Oreochromis niloticus). Aquaculture, 68: 209-219. Chatakondi N, Lovell RT, Duncan PL, Hayat M, Chen TT, Powers DA, Weete JD, Cummins K, Dunham RA (1995). Body composition of transgenic common carp (Cyprinus carpio) containing rainbow trout growth hormone gene. Aquaculture, 138: 99-109. Chen TT, Nicholas HV, Jenn-Ran Lu, Chun-Mean Lin, Renate R, Rex AD (1996). Transgenic fish and its application in basic and applied res. Biotechnol. Annu. Rev. 2: 205-236. CoStat (1986). CoStat 3.03, Copyright, Co Hort Software. All rights reserved. P.O. Box 1149, Berkeley, CA 94701, USA. Devlin RH, Andrade MD, Biagi CA (2004a). Population effects of growth hormone transgenic Coho salmon depend on food availability and genotype by environment interactions, Proc. Natl. Acad. Sci. USA, 101: 9303-9308. Devlin RH, Yesak TY, Biagi CA (2004b). Growth viability and genetic characteristics of GH transgenic Coho salmon strains. Aquaculture, 236: 607-632. Duncan DB (1955). Multiple ranges and multiple F test. Biometrics, 11: 1-42. Dunham RA, Chatakondi N, Nichols AJ, Kucuktas H, Chen TT, Powers DA, Weete JD, Cummins K, Lovell RT (2002). Effect of rainbow trout growth hormone complementary DNA on body shape, carcass yield, and carcass composition of F 1 and F2 transgenic common carp (Cyprinus carpio). Mar. Biotechnol. 4: 604-611. El-Deeb SI, Zowail MEM, El-Serafy SS, El-Sayed HE (1996). Genetic variability of Mugil cephalus in freshwater and marine habitate. J. Agric. Sci. Mansura Univ. 21: 2093-2101. El-Gharabawy MM, Assem SS (2006). Spawning induction in the Mediterranean grey mullet Mugil cephalus and larval developmental stages. Afr. J. Biotechnol. 5(19): 1836-1845. El-Maremie HAT (2007). Usage of conventional and non conventional Breeding methods for the production of Nile tilapia in marine water. Ph.D. Thesis, Faculty of Agriculture (Saba Basha), Alexandria Univ. Alexandria, Egypt. Elo K, Ivanoff S, Vuorinen JA, Piironen J (1997). Inheretance of RAPD markers and detection of interspecific hybridization with brown trout and Atlantic salmon. Aquaculture, 152: 55-65. El-Zaeem SY (2004a). Alteration of the productive performance characterestics of Oreochromis niloticus and Tilapia zillii under the effect of foreign DNA injection. Egypt. J. Aquat. Biol. Fisheries, 8(1): 261-278. El-Zaeem SY (2004b). Evaluation of the first and second generations delivered from fast growing genetically-modified Tilapia zillii: A productive approach. Egypt. J. Aquat. Biol. Fisheries, 8(3): 53-66. El-Zaeem SY (2011a). Phenotype and genotype differentiation between flathead grey mullet [Mugil cephalus] and thinlip grey mullet [Liza ramada] (Pisces: Mugilidae). Afr. J. Biotechnol. 10(46): 9485-9492. El-Zaeem SY (2011b). Growth comparison of Nile tilapia (Oreochromis niloticus) and Blue tilapia, (Oreochromis aureus) as affected by classical and modern breeding methods. Afr. J. Biotechnol. 10(56): 12071-12078. El-Zaeem SY, Ahmed MMM, Salama ME, El-Maremie HAT (2011). Production of salinity tolerant Nile tilapia, Oreochromis niloticus through traditional and modern breeding methods: II. Application of genetically modified breeding by introducing foreign DNA into fish gonads. Afr. J. Biotechnol. 10(4): 684-695. El-Zaeem SY, Ahmed MMM (2006). Genetic differentiation between sex reversal and normal of full-sib Nile Tilapia (Oreochromis niloticus) based on DNA finger printing. Res. J. Fish. Hydrobiol. 1:1-5. El-Zaeem SY, Ali BA, Ahmed MMM (2006). Random amplified polymorphic DNA fingerprint and genetic similarity among four genera and between two phenotypes of cultured carps in

Egypt. Int. J. Agric. Biol. 8: 111-115. El-Zaeem SY, Assem SS (2004). Application of Biotechnology in fish breeding: production of highly immune genetically modified Nile Tilapia, Oreochromis niloticus with accelerated growth by direct injection of shark DNA into skeletal muscles. Egypt. J. Aquat. Biol. Fish 8(3): 67-92. El-Zaeem SY, Assem SS (2006). Evaluation of the first and second generations delivered from fast growing genetically-modified Tilapia zillii: Histological and genetic approach. J. Appl. Sci. Res. 7:364-374. El-Zaeem SY, El-Tawil NE, Amer TN (2012). Effect of direct injection of Shark DNA into skeletal muscles on the productive performance characteristics of Red Tilapia (Oreochromis sp.) fed Different dietary regimes. Afr. J. Agric. Res. (In Press). El-Zaeem SY (2001). Breeding studies in Tilapia. Ph.D. Thesis. Fac. of Agric. (Saba-Basha), Alex. Univ., Egypt. Hadrys H, Balick M, Schierwater B (1992). Applications of random amplified polymorphic DNA (RAPD) in Mol. Ecol. Mol. Ecol. 1: 55-63. Hallerman EM, Mclean E, Fleming IA (2007). Effects of growth hormone transgenes on the behavior and welfare of aquaculture fishes: A review identifying research needs. Appl. Anim. Behav. Sci. 104: 265294. Hansen E, Fernandes K, Goldspink G, Butterworth P, Umeda PK, Chang KC (1991). Strong expression of foreign genes following direct injection into fish muscle. FEBS Lett. 290: 73-76. Hemeida AA, Riad SA, El-Zaeem SY (2004). Genetic alteration following the production of genetically modified Nile Tilapia (Oreochromis niloticus). Egypt. J. Genet. Cytol. 33: 369-387. Hernandez O, Guillen I, Estrada MP, Cabrera E, Pimentel R, Pina JC, Abad Z, Sanchez T, Hidalgo Y, Martinez R, Lieonart R, de la Fuente J (1997). Characterization of transgenic tilapia lines with different ectopic expression of tilapia growth hormone. Mol. Mar. Biol. Biotechnol. 6(4): 364-375. Hickey DA, Benkel B (1986). Introns as relict retrotransposons for the evolutionary origin of eukaryotic mRNA splicing mechanisms. J. Theor. Biol. 121: 283-292. Inoue K, Yamashita S, Hata J, Kabino S, Asada S, Nagahisa E, Fujita T (1990). Electroporation as a new technique for producing transgenic fish. Cell Differ. Dev. 29: 123-128. Inoue K (1992). Expression of reporter genes introduced by microinjection and electroporation in fish embryos and fry. Mol. Mar. Biol. Biotechnol. 1(4/5): 266-270. Kang DY, Devlin RH (2003). Effects of 3,5,3 '-triiodo-L-thyronine (T-3) and 6-n-propyl-2-thiouracil (PTU) on growth of GH-transgenic coho salmon, Oncorhynchus kitsutch. Fish Physiol. Biochem. 29: 77-85. Khoo HW, Ang LH, Lim HB, Wong KY (1992). Sperm cells as vectors for introducing foreign DNA into zebrafish. Aquaculture, 107: 1-19. Kuo CM (1995). Manipulation of ovarian development and spawning in grey mullet (Mugil cephalus L.). Israeli. J. Aquacult. 47: 43-58. Lee CS, Tamaru CS (1988). Advances and future prospects of controlled maturation and spawning of grey mullet (Mugil cephalus L.) in captivity. Aquaculture, 74: 63-73. Lee CS, Tamaru CS, Kelley CD (1988). The cost and effectiveness of CPH, HCG and LHRH-a on the induced spawning of grey mullet, Mugil cephalus. Aquaculture, 73: 341-347. Lee CS, Tamaru CS, Miyamoto GT, Kelley CD (1987). Induced spawning of grey mullet (Mugil cephalus) by LHRH-a. Aquaculture, 62: 327-336. Liao IC (1997). Larviculture of finfish and shellfish in Taiwan. J. Fish. Soc. Taiwan, 23(4): 349-369. Lu J, Fu B, Wu J, Chen TT (2002). Production of trangenic silver seabream (Sparus sarba) by different gene transfer methods. Mar. Biotechnol. 4: 328-337. Maclean N, Laight RJ (2000). Transgenic fish: an evaluation of benefits and risks. Fish Fisheries, 1: 146-172. Martinez R, Juncal J, Zaldivar C, Arenal A, Guillen I, Morera V, Carrillo O, Estrada M, Morales A, Estrada MP (2000). Growth efficiency in transgenic tilapia (Oreochromis sp.) carrying a single copy of homologous cDNA growth hormone. Biochem. Biophys. Res. Commun. 267(1): 466-472. Martinez R, Arenal A, Estrada MP, Morales R, Herrera F, Huerta V, Vazquez J, Sanchez T, De la Fuente J (1999). Mendelian transmission, transgene gosage and growth phenotype in transgenic

El-Zaeem

tilapia (Oreochromis hornorum) showing ectopic expression of homologous growth hormone. Aquaculture, 173: 271-283. Martinez R, Estrada MP, Berlanga J, Guillen I, Hernandez O, Cabrena E, Pimentel R, Morales R, Herrera F, Morales A, Pina JC, Abad J, Sanchez V, Melamed P, Lleonart R, De la Fuente J (1996). Growth enhancement in transgenic tilapia by ectopic expression of tilapia growth hormone. Mol. Mar. Biol. Biotechnol. 5(1): 62-70. Monbrison D, Tzchori I, Holland MC, Zohar Y, Yaron Z, Elizuri A (2003). Acceleration of gonadal development and spawning induction in the Mediterranean grey mullet, Mugil cephalus: preliminary studies. Aquaculture, 220(1-4): 725-735. Muller F, Ivics Z, Erdelyi F, Papp T, Varadi L, Horvath L, Maclean N, Orban L (1992). Introducing foreign gene into fish eggs with electroporated sperm as a carrier. Mol. Mar. Biol. Biotechnol. 1(4/5): 276-281. Nei M, Li WH (1979). Mathematical modeling for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA, 76: 5269-5273. Oakes JD, Higgs DA, Eales JG, Devlin RH (2007). Influence of ration level on growth performance and body composition of non-transgenic and growth hormone transgenic Coho salmon. Aquaculture, 265: 309-324. Ono T, Fujino Y, Tsuchiya T, Tsuda M (1990). Plasmid DNAs directly injected into mouse brain with lipofectin can be incorporated and expressed by brain cells. Neurosci Lett. 117: 259-263. Rahman A, Mak R, Ayad H, Smith A, Maclean N (1998). Expression of a novel piscine growth enhancement in transgenic tilapia (Oreochromis niloticus). Transgenic Res. 7: 357-369. Rahman MA, Maclean N (1999). Growth performance of transgenic tilapia containing an exogenous piscine growth hormone gene. Aquaculture, 173: 333-346. Rahman A, Maclean N (1992). Fish transgene expression by direct injection into fish muscle. Mol. Mar. Biol. Biotechnol. 1(4/5): 286-289. Raven PA, Devlin RH, Higgs DA (2006). Influence of dietary digestible energy content on growth, protein and energy utilization and body composition of growth hormone transgenic and non- transgenic Coho salmon (Oncorhynchus kisutch). Aquaculture, 254: 730-747. Shears MA, Fletcher GL, Hew CL (1991). Transfer, expression and stable inheritance of antifreeze protein genes in Atlantic salmon (Salmo salar). Mol. Mar. Biol. Biotechnol. 1(1): p. 58. Sin FYT (1997). Transgenic fish. Rev. Fish Biol. Fish. 7: 417-441. Sin FYT, Bartley AL, Walker SP, Sin IL, Symonds JE, Hawke L, Hopkins CL (1993). Gene transfer in chinook salmon (Oncorhynchus tshawytscha) by electroporating sperm in the presence of pRSV-lacZ DNA. Aquaculture, 117: 57-69. Stevens ED, Devlin RH (2000). Itestinal morphology in growth hormone transgenic Coho salmon, J. Fish Biol. 56: 191-195. Stevens ED, Devlin RH (2005). Gut size in GH- transgenic Coho salmon is enhanced by both the GH- transgene and increased food intake, J. Fish Biol. 66:1633-1648. Sudha PM, Low S, Kwang J, Gong, Z (2001). Multiple tissue transformation in adult zebrafish by gene gun Bombardment and muscular injection of naked DNA. Mar. Biotechnol., 3: 119-125. Symonds JE, Walker SP, Sin FYT (1994). Electroporation of Salmon sperm with plasmid DNA: evidence of enhanced sperm/DNA association. Aquaculture, 119: 313-327. Tamaru CS, Kelley CD, Lee CS, Aida K, Hanyu I (1989). Effects of chorionic LHRH-a+ 17α–methyltestosterone or LHRH- a+ testosterone therapy on oocyte growth in the striped mullet (Mugil cephalus L.). Gen. Comp. Endocrinol. 76: 114-127.

8301

Tan JH, Chan WK (1997). Efficient gene transfer into zebrafish skeletal muscle by intramuscular injection of plasmid DNA. Mol. Mar. Biol. Biotechnol. 6 (2): 98-109. Thomson DB, Booth FW (1990). Stable incorporation of a bacterial gene into adult rat skeletal muscle in vivo. Am. J. Physiol. 258: C 578-582. Tsai HJ, Tseng CF, Kuo TT (1993). Expression of rainbow trout growth hormone cDNA in Yeast. Bull. Inst. Zool. Academic Sincia, 32(3): 162-170. Wang Y, Hu W, Wu G, Sun Y, Chen Sh, Zhang F, Zhu Z, Feng J, Zhang X (2001). Genetic analysis of all-fish growth hormone gene transferred carp (Cyprinus carpio L.) and its F1 generation. Chin. Sci. Bull. 46: 1174-1177. Weber GM, Lee CS (1985). Effects of 17α-methyltestosterone on spermatogenesis and spermiation in the grey mullet, Mugil cephalus L. J. Fish Biol. 26:77-84. Williams JGK, Hanafey MK, Rafalski JA, Tingey SV (1993). Genetic analysis using random amplified polymophic DNA markers. Methods Enzymol. 218: 704-740. Williams JGK, Kublik AR, Livak KJ, Rafaiski JA, Tingey SV (1990). DNA polymorphism amplified by arbitrary primers are useful as genetic markers. Nucleic Acid Res. 18: 6531- 6535. Wolff JA, Malone RW, Williams P, Chong W, Acsadi G, Jani A, Felgner PL (1990). Direct gene transfer into mouse muscle in vivo. Sci. 247: 1465-1468. Xie Y, Liu D, Zou J, Li G, Zhu Z (1993). Gene transfer via electroporation in fish. Aquaculture, 111: 207-213. Xu Y, Tian HL, Chan CH, Liao J, Yan T, Lam TJ, Gong Z (1999). Fast skeletal muscle-specific expression of a zebrafish myosin light chain 2 gene and characterization of its promoter by direct injection into skeletal muscle DNA. Cell Biol. 18(1): 85-95. Yaping W, Wei H, Gang W, Yonghua S, Shangping C, Fuying Z, Zuoyan Z, Jianxin F, Zirui Z (2001). Genetic analysis of all fish growth hormone gene transferred carp (Cyprinus carpio L.) and its F1 generation. Chinese Sci. Bull. 46(14): 1174-1177. Zhu Z, Li G, He L (1985). Novel gene transfer into the fertilized eggs for goldfish (Carassium auratus L. 1785). Z. Angew. Incthyol. 1: p. 31. Zhu Z, Xu K, Li G (1986). Biological effects of human growth hormone gene microinjected into the fertilized genes of loach Misgurnus anguillicaudatus (Cantor). Kexue Tongbao, 31(14): p. 988.

Full Length Research Paper

Comparison of liquid culture methods and effect of temporary immersion bioreactor on growth and multiplication of banana (Musa, cv. Dwarf Cavendish) Farah Farahani1* and Ahmad Majd2 1

Department of Microbiology, Qom Branch, Islamic Azad University, Qom, Iran. 2 Department of Biology, Tarbiat Moalem University, Tehran, Iran. Accepted 30 September, 2011

Four different liquids, as well as solid culture methods used in shoot propagation of banana were compared. Treatments studied were solid medium (A), liquid medium with immersion of plants (B), liquid medium with cotton culture support (C), liquid medium aerated by bubbling (D), and liquid medium with a temporary immersion bioreactor system (TIB) for 20 min every 1 h (E). After 4 weeks of culture, shoots in liquid medium with immersion and liquid medium aerated by bubbling showed none too little proliferation. Shoots in the solid medium and those cultured in liquid medium containing cotton culture supported played multiplication rates of 2.7 to 3.5 with the highest multiplication rate (> 7.00) observed in the explants that were subjected to the TIB in the medium. Three treated groups differed in the accumulation of dry matter; the lowest weight (around 0.6 g) was observed in treatments B and D, while 2 to 4 times greater accumulation was observed in the explants in the solid medium and those cultured in the liquid medium with a cotton culture support. The highest multiplication rates and weight gains were observed in the liquid medium with a TIB (E). Shoots in liquid medium continuously aerated by bubbling, displayed hyperhydricity of the outer leaf sheaths. However, this was not observed with temporary immersion of explants. Key words: Banana, micropropagation, dwarf cavendish, temporary immersion bioreactor (TIB).

INTRODUCTION Use of liquid medium for in vitro micropropagation is often described as a way of reducing both the cost of plantlet production and subculturing time of explants, in that explants do not require positioning in the medium but are simply placed in contact with it. The advantages of liquid media in enhancing the shoot propagation (Harris and Manson, 1983; Alvard et al., 1993; Levin et al., 1999), growth (Snir and Erez, 1980) and somatic embryogenesis (Jones and Petolino, 1988; Harrel et al., 1994; Liu et al., 1998; Hosokawa et al., 1998) have been reported for several plant species. However, the use of liquid media can lead to the problem of asphyxia in explants as a result of immersion. The most commonly used preventive methods are based on

the principle of partial immersion of explants to ensure aeration. Inserted absorbent substances are used to maintain contact between the medium and the lower part of the explant (filter paper, cellulose, cotton, etc.), or a depth of medium is used to enable partial emergence of the explant tissue. Direct oxygenation of the medium by bubbling could also be used in micropropagation (Preil, 1991). The purpose of the present study was to compare the effect of different liquid culture methods on banana [cv. Dwarf cavendish (group AAA)] plants. The culture method based on temporary immersion of explants was also evaluated. MATERIALS AND METHODS Plant Material

*Corresponding author. Farahfarahani2000@yahoo.com. Tel: +98912-2778171.

E-mail: +9821-44122070,

Proliferation of banana cv. dwarf cavendish was achieved by splitting shoot–clusters established from a sucker shoot-tip. Shoot

Farahani and Majd

8303

Figure 1. Vessel culture used for culturing plantlets in liquid medium aerated by bubbling 1, 22 µm filter; 2, air entrance tube; 3, upper compartment; 4, aerated heliconoid sparger; 5, extranet tube.

clusters obtained after successive proliferation subcultured on solid medium were used as initial material for the experiments. These clusters were splitted to keep 2 to 3 shoots per explant. Explants measuring approximately 1×1×1 cm with a fresh weight of 0.4 g were inoculated into the medium. Effects of treatments on the rate of proliferation and the increase in dry weight were evaluated after a 6-week subculture cycle.

Conditions of the culture The culture medium consisted of MS medium (Murashige and Skoog, 1962) containing, 30 g/L sucrose and supplemented with 3 mg/L 6- benzyladenine and 2 mgL-1 indoleacetic acid (Bhagyalakshmi and Singh, 1995). Solid medium contained 6 gL-1 agarose (Sigma, St. Louis, USA). The pH was adjusted to 5.7 before autoclaving at 121 C and 100 kPa for 20 min. Cultures were incubated at 28 C under cool white fluorescent light (50 μmol/m²/s¹) with a 16 h photoperiod.

Treatments Growth of the explants during a proliferation subculture cycle on solid medium culture (treatment A) was compared with growth on various types of liquid media. The treatments used were: treatment B, immersion of explants in liquid medium; treatment C, liquid medium with cotton culture support; treatment D, liquid medium aerated by bubbling humidified air through a fritted glass filter; treatment E, liquid medium with temporary immersion bioreactor (TIB) of the explants for 20 min every 1 h. In treatment B, explants were immersed to over three-quarters of their volume as a result of surface tension, resulting in an almost total covering of the explants by the medium. In treatment C, only the base of explants was in contact with the medium. In treatment D, the aeration system involving bubbling of the medium is shown in Figure 1. In treatment D, air was continuously circulated by an air pump and passed through a sterile filter, liquid medium was aerated by the air-pump, bubbles were initiated in vessels and explants were in contact with liquid medium aerated by bubbling. In treatment E (TIB), the two

8304

Afr. J. Biotechnol.

Figure 2. Vessel used for liquid culture with temporary immersion of the plantlets. 1, air pump; 2, timer set; 3, vessel culture; 4, 22 µm filter; 5, tube connecting the upper and lower compartments of the culture vessel; 6, upper compartment with plants.

compartments were connected by a tube and each was fitted with a 0.2 µm filter vent. The explants were placed in the upper compartment, and the lower compartment contained the nutrient solution (Figure 2). Putting the lower compartment under pressure by means of an air pump caused the culture medium to rise into the upper compartment and the immersed liquid was released through the filter vent in the upper compartment. The medium flowed back by gravity when the pump was switched off. The medium return flow to the lower compartment was accelerated by fitting a solenoid valve in the air circuit to enable a return to atmospheric pressure when the pump was stopped. The quantity of medium used in treatments A, B, C was 25 ml and in treatments D and E, was 100 ml and 250 ml, respectively.

Measurements and analysis of the results The explant multiplication rate was calculated by the ratio of the “number of shoots at the end of the subculture cycle’’/ “initial number of shoots’’. The dry weight of explants at the end of subculture was determined. Three culture vessels each containing 5 proliferation clumps were used in each treatment. The averages of the 3 replications are presented. The differences between treatments were evaluated using the ANOVA test (P < 0.05), and curves were drawn with the SPPS soft ware version 10.

RESULTS AND DISCUSSION Multiplication rate After 6 weeks of culturing, three treated groups were found to be different in their multiplication rates (Figure 3). The banana shoots clusters in the liquid medium with immersion or aerated by bubbling showed very little proliferation. Those grown on solid medium and subcultured in liquid medium with cotton substrate had multiplication rates of 2.7 to 3.5 and explants growing in the TIB had the highest rate of 7 (Figure 4). Dry weight gain Measurement of dry weight separated the treatments into three groups (Figure 5). The lowest dry weights (0.4 to 0.8 g) were recorded in treatments B and D; moderate dry weights were in treatments A and C and this was increased by 2 to 4 times in the B and D treatments. The highest dry weight was observed in treatment E (TIB)

Farahani and Majd

Figure 3. Comparison of solidified and liquid media culture methods with respect to banana multiplication rate. A, solid medium; B, simple liquid medium and total immersion of plants; C, liquid medium and cotton support; D, liquid medium and aeration by bubbling; E, liquid medium and temporary immersion bioreactor (TIB) of plant (1) Micropropagation (2,) growth.

8305

8306

Afr. J. Biotechnol.

Figure 4. Plantlet multiplication rates in different culture methods A, solid medium; B, simple liquid medium and total immersion of plants; C, liquid Medium and cotton support; D, liquid medium and aerat ion by bubbling; E, liquid medium and temporary immersion bioreactor (TIB) of plants.

(3.2 to 3.4 g). Appearance of in vitro shoots Explants in liquid medium with simple immersion and liquid medium aerated by bubbling (treatments B and D) displayed numerous necrotic zones and lacked leaves. Very small leaves appeared in shoots in liquid medium with cotton support (treatment C). Several external leaf sheaths in treatment D showed hyperhydricity and these leaves were sometimes fragile. Leaf development was considerable in the temporary immersion bioreactor. By comparing liquid and aerated liquid medium, roots grown in liquid medium are shown to be under hypoxic stress. Roots grown in a bubbling aerated system, were not hypoxic, but produced low biomass. Plantlets propagated in TIB showed better performance than those propagated by conventional methods such as micropropagation (Gonzales-Olmedo et al., 2005; Perez et al., 2004; Ilezuk et al., 2005). In the method of increasing the biomass level in the culture (Scragge, 1995) plantlets seem to use more of the nutrients of the medium than their photoassimilates (Escalona et al., 2003). These results showed that the

response of tissues to the gas phase composition are complex and requires further study (Weathers et al., 1999). These experiments showed that the type of liquid medium application greatly influences the development of banana explants in micropropagation. Up to a four-fold difference in proliferation and accumulation of dry matter was observed with the same medium composition. The photosynthetic capacity and the main enzymatic systems related to carbon metabolism, changed during the in vitro culture of plantain shoots (Musa AAB cv. CEMSA 他), in temporary immersion bioreactor and their subsequent acclimatization (Aragon et al., 2005). The relationships between morphological parameters, photosynthetic capacity of the plantlets and enzymes of carbon metabolism during both phases of the culture have been shown previously (Escalona et al., 2003). Differences in growth between the explants in simple liquid medium without aeration (immersion medium, treatment B), liquid medium aerated by bubbling (treatment D) and with TIB (treatment E) suggested that the lack of oxygen in the liquid media containing small explants and asphyxia of explants as a results of immersion, are the major limiting factors to growth. Banana explants in a simple liquid medium, are immersed to over three-quarters of their volume. Surface tension caused most of the explants to

Farahani and Majd

8307

Figure 5. Comparison of the effect of different forms of liquid medium application on the increase in dry matter in banana micropropagation. A, solid medium; B, simple liquid medium and total immersion of plants; C, liquid medium and cotton support; D, liquid medium and aeration by bubbling; E, liquid medium and temporary immersion bioreactor (TIB) of plants.

be covered by the medium. Lack of culture agitation apparently led to asphyxiation of the explants. The low proliferation rate observed in banana, cultured on cotton supports (treatment C) cannot be ascribed to the problem of oxygenation since small parts of each explants were immersed. However, the small surface area of explant in contact with the medium-soaked support may have limited water supply, a carbohydrate and mineral nutrition which may be the reason for the weak development and continuous contact of explants with the medium in treatment D may be the cause of the hyperhydricity observed. Vuylsteke (1989), reported the highest rates of proliferation in several cultivars of bananas and also the type of temporary immersion culture used for the propagation of Pinus (Aitken-Christie and Jones, 1987), Echinacea angustifolia (Lata et al., 2004), strawberry, pear, apple (Damiano et al., 2003), Eucalyptus, Aspen and Psidium (Ruffoni and Savona, 2005). Alvard et al. (1993) used a type of temporary immersion culture system for the propagation of banana cv. Grand Naine. Our system has also been successful in potato micropropagation, by singlenodes and microtubers production, by a considerable reduction of the immersion

time (Zarghami and Ebadi, 2001). Akita and Takayama (1994) also succeeded in the stimulation of potato tuberization. The duration of explant immersion is probably the fact that deserves the most attention in design of culture systems in liquid medium with temporary immersion for other species to be propagated in vitro. The temporary immersion culture system (TIB) described combines the ability to aerate plant tissue and provide contact of programmable duration, between the whole explant and the medium. In addition, the system used in this study had the decisive advantage of being easy to set up and use. Storage of the culture solution and explant immersion were performed in the same vessel with no external mechanical transfer system. This simplicity of use should make it easier to test the temporary immersion method for improvement of the in vitro development of other species or for developing automated culture systems. Methods of automation can reduce the cost, scaling-up in micropropagation can increase the number of explants handled, thereby decreasing the labour costs (Takayama and Akita, 1994). This can be achieved in several different ways: (1) Homogenisation of plant tissue in blenders rather than

8308

Afr. J. Biotechnol.

manual cutting, (2) Automation through use of liquid cultures and bioreactors, and (3) Robotics (Eide et al., 2003). ACKNOWLEDGMENTS Gratefully acknowledge, Dr. Sheidai and Dr. Zarghami for their assistance. REFERENCES Aitken-Christie J, Jones C (1987). Toward automation: radiate pine shoot hedges in vitro. Plant Cell Tissue Org. Cult. 8: 185-196. Akita M, Takayama S (1994). Stimulation of potato (Solanum tuberosum L.) tuberization by semicontinuous liquid medium surface level control. Plant Cell Rep. 13: 184-187. Alvard D, Cote F, Teisson C (1993). Comparison of method of liquid medium culture for banana micropropagation, effects of temporary immersion of explants. Plant Cell Tissue Org. Cult. 32: 55-60. Aragon EC, Escalona M, Capote I, Pina P, Cejas I, Rodriguez R, Canal MJ, Sandoval J, Roels S, Debergh P, Gonzalez- Olmedo J (2005). Photosynthesis and carbon metabolism in plantain (Musa AAB) plantlets growing in ex vitro acclimatization. In Vitro Cell Dev. Biol. Plant. 41: 550-554. Bhagyalakshmi N, Singh S (1995). Role of liquid versus agargelled media in mass propagation and ex vitro survival in bananas. Plant Cell Tissue Org. Cult. 41: 71-73. Damiano C, Monticelli S, La Starza SR, Gentile A, Frattarelli A (2003). Temperate fruit plant propagation through temporary immersion. XXVI International Horticultural Congress: Biotechnology in Horticultural Crop Improvement: Achievements, Opportunities and Limitations 1(56), ISBN 9066052589, ISSN 0567-7572. Eide AKH, Munster C, Heyerdahl PH, Lyngved R, Olsen S (2003). Liquid culture systems for plant propagation. 1(56), ISBN 9066052589, ISSN 0567-7572. Escalona M, Samson G, Borroto C (2003). Physiology of effects of temporary immersion bioreactors on micropropagated pineapple plantlets. In vitro Cell Dev. Biol. Plant. 39: 651-656. Gonzales-Olmedo JL, Fundora Z, Molina LA, Abdulnour J, Desjardins Y, Escalona M (2005). New contributions to propagation of pineapple (Ananas comosus L. Merr) in temporary immersion bioreactors. In Vitro Cell. Dev. Biol. Plant. 41: 87-90. Harris RE, Mason EBB (1983). Two machines for in vitro propagation of plants in liquid media. Can. J. Plant Sci. 63: 311-316. Harrel RC, Bieniek M, Hood CF, Munilla R, Cantliffe DJ (1994). Automated, in vitro harvest of somatic embryos. Plant Cell Tissue Org Cult. 39: 171-183. Hosokawa K, Oikawa Y, Yamamura S (1998). Mass propagation of ornamental gentian in liquid medium. Plant Cell Tissue Org. Cult. 17: 747-751. Ilczuk A, Winkelmann T, Richartz S, Witomska M, Serek M (2005). In vitro propagation of Hippeastrum Ă&#x2014; chmielii Chm.- influence of flurprimidol and the culture in solid or liquid medium and in temporary immersion systems. Plant Cell Tissue Org. Cult. 83: 330-346. 316.

Jones AM, Petolino JF (1988). Effects of support medium on embryo and plant production from cultured anthers of soft-red winter wheat. Plant Cell Tissue Org. Cult. 12: 253-261. Lata H, Bedir E, Moraes RM, Andrade Z (2004). Mass propagation of Echinacea angustifolia: a protocol refinement using shoot encapsulation and temporary immersion liquid system. XXVI International Horticultural Congress: The Future for Medicinal and Aromatic Plants 1(68), ISBN 9066055073, ISSN 0567-7572. Levin R, Alper Y, Stav R, Abed A, Watad A (1999). Methods and apparatus for liquid media and semi-automated micropropagation. Hort. Biotech. In Vitro Cult. Breed. pp. 659-663. Liu CZ, Wang YC, Guo C, Ouyang F, Ye HC (1998). Production of Artemisia by shoot cultures of Artemisia annua L. in a modified innerloop mist bioreactor. Plant Sci. 135: 211-217. Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15: 473-497. Perez A, Napoles L, Carvajal C, Hernandez M, Lorenzo C (2004). Effect of sucrose, inorganic salts, inositol, and thiamine on protease excretion during pineapple culture in temporary immersion bioreactors. In Vitro Cell Dev. Biol. plant, 40: 311-315. Preil A (1991). Application of bioreactors in plant propagation In: Debergh PC 7 Zimmerman RH (Eds) Micropropagation: Technology and Application. Kluwer Academic Publisher, Dordrecht. pp. 426-445. Ruffoni B, Savona M (2005). The temporary immersion system (T.I.S.) for the improvement of micropropagation of ornamental plants 1(59), ISBN 9066056584, ISSN.0567-7572. Scragge AH (1995). The problem associated with high biomass levels in plant cell suspension. Plant Cell Tissue Org. Cult. 43: 163-170. Snir I, Erez A(1980). In vitro propagation of Malling Merton apple rootstocks. Hort. Sci., 15: 597-598. Takayama S, Akita M (1994). The types of bioreactors used for shoots and embryos. Plant Cell Tissue Org. Cult. 39:147-156. Vuylsteke DR (1989). Shoot-tip culture for the propagation. Conservation and exchange of Musa germplasm. International Board for Plant Genetic Resources, Rome, pp. 1-59. ISBN 92-043-40-7. Weathers PJ, Wyslouzil BE, Wobbe KK, Kim YJ, Yigit E (1999). Of hairy roots to O2 levels in bioreactor. In Vitro Cell Dev. Biol. Plant. 35: 286289. Zarghami R, Ebadi M (2001). Stimulation of potato (Solanum tuberosum L.) tuberization by semicontinuous liquid medium. Horticultural Congress: Iranian society for Horticultural Sciences Karaj -Iran 1(361).

Full Length Research Paper

Effects of an ethanolic extract of Garcinia kola on glucose and lipid levels in streptozotocin induced diabetic rats B. N. Duze1, C. R. Sewani-Rusike1* and B. N. Nkeh-Chungag2 1

Walter Sisulu University, Faculty of Health Sciences, Department of Physiology, P. Bag X1, Mthatha 5117, South Africa. 2 Walter Sisulu University Faculty of Science, Engineering and Technology, Department of Zoology, P. Bag X1, Mthatha 5117, South Africa. Accepted 14 March, 2012

The effect of Garcinia kola on glucose and lipid levels in streptozotocin-induced diabetic rats was investigated. Ethanolic extract of G. kola was prepared and used for animal treatments. Diabetes was induced by a single intraperitoneal injection of streptozotocin (40 mg/kg body weight). Acute effects of G. kola on glucose were investigated by giving a single dose of distilled water or 300 mg/kg G. kola extract or metformin 300 mg/kg. Glucose levels were measured 2, 4 and 6 h after treatment. To investigate the long term effects, animals were treated daily for four weeks with either distilled water (controls) or 300 mg/kg G. kola extract. At termination, serum glucose, low density lipoprotein (LDL) and high density lipoprotein (HDL) levels were measured. There was no significant difference (P>0.05) in single dose glucose levels, long term HDL levels and body weights compared to the controls. However, in the four week treated rats, glucose (mmol/L) was significantly lower (16.2±2.9; P<0.05) than in the controls (21.6±3.6) and the LDL levels were significantly decreased by 66% in the treated group compared to controls (P<0.01; 86.8±18.2 versus 29.8±10.9). This confirms the hypoglycaemic and especially the hypolipidemic effects of G. kola in a diabetic rat model. Key words: G. kola, ethanolic extract, hyperglycemia, low density lipoprotein (LDL), high density lipoprotein (HDL), streptozotocin, INTRODUCTION There is growing concern that diabetes and obesity (diabesity) will reach epidemic proportions, affecting the developing world in Asia and Africa more than the developed world (Amos et al., 1997; Rheeder, 2006). Type 2 diabetes mellitus is the more common form of diabetes affecting over 200 million people worldwide (Emerson et al., 2009). Type 2 diabetes is characterized by a dual pathogenesis of insulin resistance and impaired insulin secretion leading to hyperglycaemia usually associated with dyslipidemia, a risk factor for

*Corresponding author. E-mail: crusike@wsu.ac.za. +2747502 2773. Fax: +27475022758.

Tel:

cardiovascular disease and stroke (Gong et al., 2009; Carmena, 2005). As such, in current management of diabetes, statins are included to control the dyslipidemia. Before the advent of current treatment methods, plants were used in the treatment of diabetes mellitus. Some of these plants are continually used for the management of diabetes today. Several plants have been shown to have glucose lowering (Amrani et al., 2009; AguilarSantamaria et al., 2009), lipid lowering (Goyal and Grewal, 2003; Hilaly et al., 2006; Chahlia, 2009) effects or both. A plant recommended traditionally for treatment of diabetes is the seed of Garcinia kola (Family: Guttiferae, sub-family: Clusoideae), a plant cultivated in West and Central Africa. Commonly known as bitter kola, this nut is served as refreshment, medicinally used for the

8310

Afr. J. Biotechnol.

treatment of abdominal pain, cough, laryngitis, liver disease infections and erectile problems (Irvine, 1961; Odebunmi et al., 2009; Njume et al., 2011). Traditionally, it is said that regular consumption of this nut lowers blood glucose levels and improves the complications of diabetes mellitus (Esomonu et al., 2005). The seed is chewed whole and one to three whole seeds may be taken a day. Phytochemical studies of the seeds revealed the presence of biflavonoids, xanthones, triterpenes, cycoartenols and benzophenones (Adaramoye et al., 2005). Kolaviron, consisting of the main bioactive components: biflavanones and kolaflavanones is the predominant constituent of G. kola. Kolaviron components account for most of the seed’s biological activities (Adaramoye and Adeyemi, 2006; Terashima et al., 2002). Although, kolaviron has been shown to have glucose and lipid lowering effects (Adaramoye et al., 2005; Adaramoye and Adeyemi, 2006), there has been no experimental work demonstrating effects of the crude extract of G. kola on glucose and lipids in a streptozotocin-induced diabetic model. Streptozotocin destroys pancreatic beta cells via oxidative stress thus inducing experimental diabetes. Metformin is a hypoglycemic biguanide diabetic medication which acts via increased peripheral tissue glucose uptake (Klip and Leiter, 1990). This forms a good positive control in hypoglycaemic studies. Therefore, the aim of this research work was to investigate the effects of G. kola on glucose levels and lipid profiles in streptozotocin-induced diabetic Wistar rats. MATERIALS AND METHODS Preparation of extract of G. kola The G. kola seeds were bought at a local market in Cameroon and were authenticated at the herbarium of the Department of Botany, University of Cameroon where a voucher specimen already exists. Extract was prepared using the method of Adaramoye (2010) with modifications. The seeds were peeled, cut into small pieces and then crushed using an electric household blender. The paste was dried in a fan oven at 35°C and then extracted twice with 70% ethanol at room temperature with continuous agitation. Ethanol was removed using rotary evaporator (Buchi RE111) under reduced pressure at 60°C. Water was removed by freeze drier (Modulyo Edwards) for 12 h. From approximately 1200 g of G. kola seeds, 564 g of solid matter was obtained giving a yield of 47%. The extract solid was stored at -70°C until used for bioassays. The dried extract was reconstituted in distilled water for animal oral treatments.

Animals Wistar strain albino rats (120 to 160 g) and mice for toxicity studies were supplied by Shalom Labs (Durban). Animals were housed in the Department of Physiology animal holding facility and maintained at a temperature of 24 to 28°C, in a 12:12 h light:dark cycle, with water and pellet food (Epol-SA) ad libitum. The study was approved by the ethical committee of the Faculty of Health Sciences and Walter Sisulu University; clearance number 0023/009.

Induction of diabetes After two weeks of acclimatization in the holding facility, diabetes was induced in rats (n=16) by a single intraperitoneal injection of freshly prepared streptozotocin (STZ) (40 mg/kg body weight) in 0.1 M citrate buffer (pH 4.5) into overnight-fasted rats. Rats were given 5% glucose solution in place of water on the first night to counter STZ induced hypoglycaemia due to insulin leakage from damaged β cells. After one week, fasting glucose levels were determined in blood from the tail by the glucose oxidase method using a portable glucometer (Accutrend Plus®). All animals developed diabetes. A blood glucose level ≥ 20 mmol/L was considered diabetic and used for G. kola treatments. All treatments were given orally by gavage using a 16 G feeding needle.

Animal treatments Single dose effects on blood glucose levels Single dose effects were determined in animals fasted overnight. This was done by determining glucose levels via tail vein (time 0) and giving a single oral dose of water (controls n=8), 300 mg/kg metformin (positive controls n=7) or 300 mg/kg G. kola (treated n=8). Glucose levels were then determined at 2, 4 and 6 h posttreatment by the glucose oxidase method using a portable glucometer (Accutrend Plus®). Metformin treatment (300 mg/kg) was used as positive hypoglycaemic control.

Long term treatment For long term effects of G. kola treatment, diabetic rats were orally treated daily with either distilled water (controls n=8) or 300 mg/kg G. kola extract (n=8) for a total of four weeks. Comparison was made between the G. kola treated and untreated group. Blood glucose levels were measured weekly from the tail vein by glucometer. On the final day, animals were weighed and glucose levels were determined by glucometer. Animals were deeply anaesthetized with sodium pentobarbital (65 mg/kg IP) and blood was collected by cardiac puncture into plain dry tubes. After clotting, the blood was centrifuged and serum collected and stored at -70°C until biochemical tests.

Lipid profiles HDL and LDL concentrations were determined using a commercial direct colorimetric ELISA method as per manufacturer’s instructions (Latest Diagnostics, Brazil). Values were reported in mg/dL.

Acute toxicity studies Acute toxicity was determined in healthy adult albino mice of either sex as previously described by Asare et al. (2011). Two groups of five mice/group received single oral dose of G. kola extract at 1200 and 2400 mg/kg body weight. The animals were observed continuously for 1 h, then hourly for the next 4 h, intermittently over the next 48 h and at least once a day for two weeks. Physical manifestations of toxicity such as writhing, gasping, salivation, hyperactivity, drowsiness and mortality were recorded during the experimental period.

Statistical analysis Results were expressed as mean ± standard error of mean (SEM).

Body weight (mg/Kg)

Duze et al.

8311

Controls

G. kola

Time (weeks) Figure 1. Effect of four week daily oral treatment with distilled water (controls) or G. kola (300 mg/kg) on body weights in diabetic rats. Body weights were similar between groups.

Statistical analysis was done using GraphPad InStat Version 3 and data was compared using the student t-test or ANOVA. Values were considered significantly different when P<0.05.

RESULTS Induction of diabetes mellitus After intraperitoneal administration of streptozotocin, all animals became diabetic with fasting glucose levelsâ&#x20AC;&#x2122; ranging between 23 to > 33 mmol/L. Diabetes was also confirmed by glycosuria, polyuria and polydipsia in the rats. Body weights The mean body weights of both G. kola treated and control groups during the four weeks duration are shown in Figure 1. There was no significant difference (P>0.05) in the body weights of the treated group compared to the control group throughout the four week treatment period. Single dose treatment: Effect on glucose levels G. kola treatment had no significant effect (P>0.05) on blood glucose levels over the 6 h post treatment. Blood glucose levels after a single oral dose of G. kola extract at a dose of 300 mg/kg are shown in Figure 2. Metformin showed a significant decrease in glucose levels over time compared to the controls and G. kola treated animals.

Long term treatment: Effect on blood glucose levels Treatment with G. kola for four weeks with weekly blood glucose level measurements showed no significant difference in glucose levels up to the end of the third week. However, there was a significant decrease (P<0.05) in glucose levels after four weeks of treatment compared to the controls (Figure 3). Long term treatment: Effect on serum lipid levels G. kola treatment resulted in a highly significant (P<0.01) decrease in LDL levels, a 66% decrease compared to the untreated controls (Figure 4). However, there was no difference (P>0.05) in HDL levels after a 4 week treatment period (Figure 5). Acute toxicity studies Toxicity studies carried out using oral doses of 1200 and 2400 mg/kg G. kola extract did not cause any obvious signs of toxicity as assessed by behavioral changes by the experimental mice. Mice looked active and healthy after two weeks of observation. DISCUSSION The streptozotocin induced diabetes rat model is valuable for the study of both type I and II diabetes (Szkudelsk, 2001). In addition to hyperglycaemia, this model also

Afr. J. Biotechnol.

Glucose (mg/dL)

8312

Controls G. kola Met

Time (h) Figure 2. Single dose effect of 300 mg/kg G. kola on blood glucose levels in diabetic rats. After giving a single dose of G. kola (n=8), distilled water (controls; n=8) or metformin (Met; 300 mg/kg; n=7), blood glucose levels were measured at 2, 4 and 6 h post treatment. Values are mean Âą SEM. ** P<0.01 versus controls.

Figure 3. Effect of four weeks treatment with G. kola on blood glucose levels of diabetic rats. Values are mean Âą SEM; * P<0.05 versus controls. G. kola treated group n=8; controls n=8.

exhibits diabetic complications including dyslipidaemia (Sharma et al., 1997). We used this rat model to investigate acute and subacute (four weeks) effects of a crude ethanolic extract of G. kola on glucose, LDL and HDL levels in streptozotocin induced diabetic rats. The results

show that, at a dose of 300 mg/kg, G. kola had no significant acute effects on glucose levels. However, after four weeks of treatment, G. kola had effective hypoglycaemic and LDL lowering effects with no effect on HDL levels.

Duze et al.

8313

Figure 4. Effect of four weeks treatment with G. kola on serum LDL levels of diabetic rats. Values are mean Âą SEM; ** P<0.01 versus controls. G. kola treated group n=8; controls n=8.

Figure 5. Effect of four weeks treatment with 300 mg/kg G. kola extract on serum HDL levels of diabetic rats. Values are mean Âą SEM; G. kola treated group n=8; controls n=8.

Several studies have demonstrated that a variety of plant extracts effectively lower glucose and lipid levels in streptozotocin-induced diabetic animals (Kim et al., 2006; Aguilar-Santamaria et al., 2009; Lu et al., 2009; Gupta et al., 2009). At a dose of 300 mg/kg, G. kola had no acute

effect after 6 h treatment on glucose levels. However, after a four week treatment period, glucose levels were lower in the treated diabetic rats compared to the untreated. These data imply that, daily chewing of at least three G. kola nuts by diabetic patients may assist with

8314

Afr. J. Biotechnol.

long term regulation of glucose levels but not as an acute effect. Mechanisms by which plant extracts may act as hypoglycaemic agents include inhibition of hepatic glucose production, inhibition of intestinal absorption and stimulation of glucose transport to correct insulin resistance (Ju et al., 2008). G. kola may be acting via one of these mechanisms, probably via induction of protein synthesis, although other mechanisms cannot be ruled out. In diabetes, hyperglycemia is further complicated by dyslipidemia characterized by increase in total cholesterol (TC), LDL, very low density lipoproteins (VLDL), triglycerides (TG) and a fall in HDL (Taskinen, 2005; Gadi and Samaha, 2007). This predisposes diabetic patients to the development of atherosclerosis, coronary insufficiency and myocardial infarction (Tang et al., 2004; Movahedian et al., 2010). As such, ideal treatment for diabetes should, in addition to glycemic control, include control of the dyslipidemia (Hilaly et al., 2006). The most significant finding in this study was the effect of G. kola treatment on LDL levels. There was a highly significant (P<0.01) reduction in LDL levels (66% decrease) in the treated animals compared to the controls. The two thirds decrease in LDL levels in treated animals compared to controls implies that G. kola lowers atherosclerotic lipids. Although, treatment with G. kola was highly effective in reducing LDL levels by 66%, but there was no effect on HDL levels which remained similar to controls. The mechanism(s) of the hypolipidemic actions of G. kola could be mediated by reduced activity of cholesterol biosynthetic enzymes or reduced lipolysis due to improved insulin secretion and/or action (Pepato et al., 2005; Zhou et al., 2009; Movahedian et al., 2010). This result is in agreement with the finding of Adaramoye et al. (2005), but using kolaviron treatment on hypercholesterolaemic rats. Cholesteryl ester transfer protein (CETP) transfers cholesteryl ester from HDL to apolipoprotein Bcontaining lipoproteins and plays an important role in regulating the concentration and composition of HDL (Arai et al., 2011; Redondo et al., 2011). Thus, G. kola treatment may not affect CETP activity, hence the unchanged HDL levels observed after four weeks of treatment. Acute toxicity tests showed no adverse effects or mortality in mice at a dose of 2400 mg/kg, eight times the test dose in this study. This confirms that G. kola is safe to use, although biochemical studies for organ function and chronic treatment studies may be necessary to determine LD50 and thus confirm safety. However, G. kola has been used for centuries as a food product in West and Central Africa. Conclusion In conclusion, the data obtained from this study shows that G. kola possesses both hypoglycaemic and hypo-

lipidemic effects after a 4 week treatment period. Therefore, using G. kola as a diet supplement may be beneficial in diabetes, especially by lowering LDL cholesterol thus protecting against cardiovascular disease. Traditional use of G. kola by diabetics to lower glucose levels and reducing complications of diabetes is thus validated. Further studies on the effects of G. kola on other complications of diabetes mellitus, such as erectile dysfunction, may be useful. ACKNOWLEDGEMENT We acknowledge the Directorate of Research and Development and the Physiology Department, WSU for funding this research. REFERENCES Adaramoye AO (2010). Protective effect of kolaviron, a biflavonoid from Garcinia kola seeds in brain of Wistar albino rats exposed to gamma radiation. Biol. Pharm. Bull. 33(2): 260-266. Adaramoye OA, Adeyemi O (2006). Hypoglycaemic and hypolipidaemic effects of fractions from kolaviron, a biflavonoid complex from Garcinia kola in streptozotocin induced diabetes mellitus rats. J. Pharm. Pharmacol. 58: 121-128. Adaramoye OA, Nwaneri VO, Anyanwu KC, Farombi EO, Emerole GO (2005). Possible anti-atherogenic effect of kolaviron (a Garcinia kola seed extract) in hypercholesterolaemic rats. Clin. Exp. Pharm. Phys. 32(1-2): 40-46. Aguilar-Santamaria L, Ramirez G, Nicosio P, Alegria-Reyes CA, Herrera-Arellano D (2009). Antidiabetic activities of Tecoma stans (L.) Juss. Ex Kunth. J. Ethnopharmacol. 10: 1010-1016. Amos AF, McCarty DJ, Zimmet P (1997). The Rising Global Burden of Diabetes and its Complications: Estimates and Projections to the Year 2010. Diab. Med. 14: S1-S85. Amrani FE, Rhallab A, Alaoui T, Badaoui KE, Chakir S (2009). Hypoglyceamic effect of Thymelaea hirsute in normal and streptozotocin-induced diabetic rats. J. Med. Plant Res. 3(9): 625629. Arai T, Yamashita S, Hirano K, Sakai N, Kotani K, Fujioka S, Nozaki S, Keno Y, Yamane M, Shinohara E (2011). Increased plasma cholesteryl ester transfer protein in obese subjects. A possible mechanism for the reduction of serum HDL cholesterol levels in obesity. Arterioscler. Thromb. 14: 1129-1136. Asare GA, Addo P, Bugyei K, Gyan B, Adjei S, Otu-Nyarko LS, Wiredu EK, Nyarko A (2011). Acute toxicity studies of aqueous leaf extract of Phyllanthus niruri. Interdiscip. Toxicol. 4(4): 206-210. Carmena R (2005). Type 2 diabetes, dyslipidemia, and vascular risk: rationale and evidence for correcting the lipid imbalance. Am. Heart. J. 150(5): 859-870. Chahlia N (2009). Effects of Capparis deciduas on hypolipidemic activity in rats. J. Med. Plants Res. 3(6): 481-484. Emerson P, Van Haeften TW, Pimenta W, Plummer E, Woerle HJ, Mitrakou A, Szoke E, Gerich J, Meyer C (2009). Different pathophysiology of impaired glucose tolerance in first-degree relatives of individuals with type 2 diabetes mellitus. Met. 58(5): 602607. Esomonu UG, El-Taalu AB, Anuka JA, Ndodo ND, Salim MA, Atik MK (2005). Effects of ingestion of ethanol extracts of Garcinia kola seed on erythrocytes in Wistar rats. Nig. J. Physiol. Sci. 20(1-2): 30-32. Gadi R, Samaha FF (2007). Dyslipidemia in type 2 diabetes mellitus. Curr. Diab. Rep. 7(3): 228-234. Gong W, Lu B, Yang Z, Ye W, Du Y, Wang M, Li Q, Zhang W, Pan Y, Feng X, Zhou W, Zhang Y, Yang Z, Yang Y, Zhu X, Hu R (2009). Early-stage atherosclerosis in newly diagnosed, untreated type 2

Duze et al.

diabetes mellitus and impaired glucose tolerance. Diab. Met. 35(6): 458-462. Goyal R, Grewal RB (2003). The influence Teent (C.Decidua) on human plasma triglycerides, total lipids and phospholipids. Nutr. Health, 17(1): 71-76. Gupta S, Sharma SB, Bansal SK, Prabhu KM (2009). Antihyperglaycemic and hypolipidemic activity of aqueous extract of Cassia auriculata L. leaves in experimental diabetes. J. Ethnopharmacol. 123: 499-503. Hilaly J, Tahraoui A, Israili Z, Lyaissio B (2006). Hypolipidemic effects of on acute and sub-chronic administration of aqueous extract of Ajuga iva whole plant in normal and diabetic rats. J. Ethnopharmacol. 103(3): 441-448. Irvine FR (1961). Woody plants of Ghana. Oxford University Press, Oxford. p. 146. Ju JB, Kim JS, Choi CW, Lee HK, Oh TS, Kim C (2008). Comparison between ethanolic and aqueous extracts from Chinese juniper berries for hypoglyceamic and hypolipidemic effects in alloxan-induced diabetic rats. J. Ethnopharmacol. 115: 110-115. Kim JS, Ju BB, Choi CW, Kim SC (2006). Hypoglycaemic and antihyperlipidaemic effects of four Korean medicinal plants in alloxan induced diabetic rats. Am. J. Biochem. Biotechnol. 2: 154-160. Klip A, Leiter LA (1990). Cellular Mechanism of Action of Metformin. Diabetes Care, 13(6): 696-704. Lu H, Chen J, Li WL, Ren BR, Wu JL, Kang HY, Zhang HQ, Adams A, De Kimpe N (2009). J. Ethnopharmacol. 122: 486-491. Movahedian A, Zolfaghari B, Sajjadi SE, Moknatjou R (2010). Antihyperlipidemic effect of Peucedanum pastinacifolium extract in streptozotocin-induced diabetic rats. Clin. 65(6): 629-633. Njume C, Afolayan AJ, Clarke AM, Ndip RN (2011). Crude Ethanolic Extracts of Garcinia kola Seeds Heckel (Guttiferae) Prolong the Lag Phase of Helicobacter pylori: Inhibitory and Bactericidal Potential. J. Med. Food 14(7-8): 822-827. Odebunmi EO, Oluwaniyi OO, Awolola GV, Adediji OD (2009). Proximate and nutritional composition of kola nut (Cola nitida), bitter kola (Garcinia kola) and alligator pepper (Afromomum melegueta). Afr. J. Biotechnol. 8(2): 308-310.

8315

Pepato MT, Mori DM, Baviera AM, Harami JB, Vendramini RC, Brunetti IL (2005). Fruit of the jambolan tree (Eugenia jambolana Lam.) and experimental diabetes. J. Ethnopharmacol. 96: 43-48. Redondo S, MartĂnez-GonzĂĄlez J, Urraca C, Teresa Tejerina T (2011). Emerging therapeutic strategies to enhance HDL function. Lipids Health Dis. 10: 175-182. Rheeder P (2006). Type 2 diabetes: the emerging epidemic. S. Afr. Fam. Pract. (48)10: 20-24. Sharma SB, Dwivedi SK, Swaruo D (1997). Hypoglycaemic, antihyperglycaemic and hypolipidaemic activities of Caesalpinia bonducella seeds in rats. J. Ethnopharmacol. 58: 39-44. Szkudelsk T (2001). The Mechanism of alloxan and streptozotocin action in beta cells of the pancreas. Physiol. Res. 50: 536-546. Tang WH, Maroo A, Young JB (2004). Ischemic heart disease and congestive heart failure in diabetic patients. Med. Clin. N. Am. 88: 1037-1061. Taskinen MR (2005).Type 2 diabetes as a lipid disorder. Curr. Mol. Med. 5(3): 297-308. Terashima K, Takaya Y, Niwa M (2002). Powerful antioxidants based on garcinoid acid from Garcinia kola. Bioorg. Med. Chem 10: 16191625. Zhou T, Luo D, Li X, Luo Y (2009). Hypoglycemic and hypolipidemic effects of flavonoids from lotus (Nelumbo nucifera Gaertn) leaf in diabetic mice. J. Med. Plant Res. 3(4): 290-293.

Full Length Research Paper

Optimization of cholesterol oxidase production by Brevibacterium sp. employing response surface methodology Shengli Yang1* and Hui Zhang2 1

The College of Pharmaceutical Science, Zhejiang University of Technology, Hangzhou 310014, People’s Republic of China. 2 Quality and Technical Supervision and Inspection Institute of Zhejiang Province, Physical and Chemical Test Center, Hangzhou 310013, People’s Republic of China. Accepted 30 March, 2012

An ultrasound-assisted emulsification as a pretreatment for cholesterol oxidase production by submerge fermentation using Brevibacterium sp. in a batch system was studied. Medium improvement for the production employing response surface methodology (RSM) was optimized in this paper. The concentration of Tween-80, cholesterol and the time of ultrasonic pretreatment medium were further optimized by RSM. Results from RSM showed that the initial concentration of cholesterol, Tween-80 and pretreatment time exerted a significant effect on cholesterol oxidase production, but these factors did not exert a significant effect on cell growth. The improved medium consisted of 4.076 g/L cholesterol, 0.2932‰ (v/v) Tween-80, 22.361 (min) treatment time, and cholesterol oxidase production reached 1.483 U/ml after 36 h culture, which was 83.57% greater than the control medium. Key words: Ultrasonic, cholesterol oxidase, response surface methodology. INTRODUCTION Ultrasonic is a sound wave with frequency beyond the normal hearing range of humans (>15 to 20 KHz). When ultrasonic wave propagates in a liquid medium, it can produce cavitation and acoustic streaming. This cavitation generates powerful shear forces, while the acoustic streaming increases the convection of solution (Guo et al., 2010; Suslick et al., 1999; Khanal et al., 2007). Effect of ultrasonic on reaction process has aroused strong interest and high attention with the popularity and development of ultrasonic equipment in recent years. Studies showed that a suitable intensity of ultrasonic irradiates biological reaction medium can enhance efficiency of emulsification, increase the permeability and selective of cell membranes, promote the secretion of enzymes and enhance cell metabolism and thus shorten the reaction time, improve product quality and yields.

*Corresponding author. E-mail: yangshengli01@zjut.edu.cn. Tel: +86 571 88320903. Fax: +86 571 88320913.

There are many reports about this aspect of research, such as the stimulating fermentative activities of bifidobacteria in milk by high intensity ultrasound (Thi My Phuc et al., 2009). Their results showed that the probiotic bacteria cells were ruptured by ultrasound and released intracellular enzyme β-galactosidase that promoted the hydrolysis of lactose and trans-galactosylation, and subsequently enhanced the growth of the remaining bacterial cells in inoculated milk during fermentation. The lower the concentration of lactose, the higher the amount of oligosaccharides (degree of polymerization = 3) found in the fermented milk with ultrasound treatment. Chang et al. (2007) also studied the enhancement of Bacillus thuringiensis (Bt) production from sewage sludge with alkaline and ultrasonic pretreatments. Suitable pretreatment conditions were optimized with 5 g/L sodium hydroxide for alkaline treatment and 1.2×105 kJ/kg of total solid for ultrasonic treatment. Fermentations of raw and pretreated sludge for biopesticides were carried out in a bench scale fermentor. These authors observed that both pretreatments were effective for Bt growth and

Yang and Zhang

O(2)

Cholesterol

8317

H(2)O(2)

cholest-4-en-3-one

Figure 1. The oxidation and isomerization reaction of cholesterol.

metabolism. Higher viable cells and viable spores’ counts, δ-endotoxin yields and entomotoxicity were achieved in the pretreated sludge. In addition, Runyan et al. (2006) used low-frequency ultrasonic to increase outer membrane permeability of microorganism. Gaikwad and Pandit (2008) carried out ultrasonic emulsification of oil and water and studied the effect of irradiation time, irradiation power and physicochemical properties of oil on the dispersed phase volume and dispersed phase droplet size. Meanwhile, increasing Brevibacterium sp. with a high cholesterol oxidase (COD) yield for reducing cholesterol by means of biological technique remains an importance task for researchers. COD from Brevibacterium sp., a flavin adenine dinucleotide (FAD)-dependent enzyme, catalyzes the oxidation and isomerization of cholesterol into cholest-4-en-3-one and yields hydrogen peroxide (Figure 1). However, some cholesterol oxidases like those from Burkholderia cepacia strain ST-200, Pseudomonas sp. and Chromobacterium sp. strain DS-1 oxidize cholesterol to 6β-hydroperoxycholest-4-en-3-one (HCEO) but not the cholest-4-en-3-one produced by most cholesterol oxidases (Doukyu et al., 1999, 2008, 2009). Cholesterol oxidase has two major biotechnological applications; in the determination of serum (and food) cholesterol levels and as biocatalyst providing valuable intermediates for industrial steroid drug production. This enzyme belongs to the family of oxidoreductases, specifically those acting on the CH-OH group of donor with oxygen as acceptor. Moreover, COD exhibits a potent insecticide activity and can inhibit the growth and generation of Lepidoptera (Purcell et al., 1993; Cho et al., 1995). It has also been reported that COD can degrade food cholesterol efficiently and economically, especially egg yolk cholesterol (Aihara and Watanabe, 1988; Speroulla et al., 1994). COD from different microorganisms has different physicochemical properties and substrate specificity. Brevibacterium sp. isolated previously from soil and subjected to genetic improvement, showed extracellular COD production with cholesterol as the inducer and supplementary carbon source (Wenming, 2000). Response surface methodology (RSM) is an efficient strategy to determine the optimum conditions for a multivariable system with a rational number of experiments. In addition, it is less laborious and time-consuming than

other approaches that are applied to optimize a process. It has already been successfully applied in medium optimization of many bioprocesses (Kamran et al., 2010; Lucio et al., 2011; Lotfy et al., 2007; Mutalik et al., 2008). The current paper describes the effect of cholesterol dispersion-improving factors on COD production and optimal media design of the factors. MATERIALS AND METHODS Microorganism and culture conditions Brevibacterium sp. DGCDC-2, preserved in our laboratory was used throughout this study. Agar medium consisted of 0.3% beef extract, 0.5% NaCl, 1% peptone and 2% agar; the pH was adjusted to 7.5 with 0.1 M NaOH. Seed culture medium consisted of 0.3% beef extract, 0.5% NaCl, 1% peptone; the pH was adjusted to 7.5 with 0.1 M NaOH. The fermentation medium consists of 2% glucose, 0.15% cholesterol, 0.75% yeast extract, 0.1% NaCl, 0.01% CaCl2, 0.2% CH3COONH4, 0.02% K2 HPO4, 0.005% MgSO4.7H2O, 0.001% FeSO4.7H2 O and 0.05% Tween-80; pH was adjusted to 7.5 with 0.1 M NaOH. After being autoclaved for 20 min, 150 ml aliquot of culture medium was inoculated with 5 ml activated seed culture and subjected to incubation in a 500 ml Hinton’s flask at 30°C for 36 h in an orbital shaker.

Ultrasonic pretreatment medium For dispersing cholesterol, the culture medium of Brevibacterium sp. was treated by ultrasonic before autoclaving. Irradiation times were 15, 20 and 25 min.

Measurement of cholesterol oxidase Briefly, 50 μL crude enzyme were incubated with 3 ml solution A (4amino-antipyrine, 1 mmol/L; phenol, 6 mmol/L; sodium azide, 0.2 g/L; peroxidase, 5000 U/L; potassium phosphate buffer, 25 mmol/L; pH, 7.5) and 150 μL solution B (cholesterol, 8.26 mg/ml; Triton X100, 4.26%; isopropanol for solvent) for 5 min at 37°C, then boiled, and was measured by spectrophotometry at 500 nm. The enzyme activity was calculated as: Enzyme activity (U/ml) = 0.1315A500 × 3.2 × 20÷5 = 1.6832 × A500 Design of experiments To explore the effect of the dispersion conditions variables on the response in the region of investigation, a central composite design

8318

Afr. J. Biotechnol.

Table 1. Independent variables and their coded and values.

Variable

Symbol

Cholesterol content (g/l) Tween-80 content (â&#x20AC;°, v/v) Ultrasonic pretreatment time(min)

-1 3.5 0.2 15

X1 X2 X3

Coded level 0 4.0 0.3 20

1 4.5 0.4 25

Table 2. The 3Ă&#x2014;3 factorial central composite designs and response values for medium optimization of cholesterol oxidase production.

Trial 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

X1 -1 -1 -1 -1 0 0 0 0 1 1 1 1 0 0 0

X2 -1 0 0 1 -1 -1 1 1 -1 0 0 1 0 0 0

X3 0 -1 1 0 -1 1 -1 1 0 -1 1 0 0 0 0

COD production (U/ml) 0.8932 0.7251 0.9349 0.9573 1.2794 1.3342 1.1906 1.3876 1.1953 1.1633 0.9347 1.0884 1.4041 1.4583 1.4528

COD, Cholesterol oxidase.

at three levels was performed. Tween-80, cholesterol and ultrasonic pretreatment medium were selected as independent variables. The range of values and coded levels of the variables are given in Table 1. A polynomial equation was used to predict the response as a function of independent variables and their interactions. In this work, the number of independent variables was three and therefore the response for the quadratic polynomials becomes: Y = A0 + A1X1 + A2 X2 + A3X3 + A12 X1 X2 + A13 X1 X3 + A23 X2 X3 + A11 X12 + A22 X22 + A33 X32 Where Y is the predicted response, X1 is the cholesterol, X2 is the Tween-80, X3 is the ultrasonic pretreatment time, A0 is the intercept coefficient, Aj are the linear terms, Aij are the interaction terms and Ajj are the square terms. Statistical analysis Data were processed using analysis of variance (ANOVA) to obtain the interaction parameters between the process variables and response. The fit quality of polynomial model was expressed by the coefficient of determination R2 and its statistical significance was checked by the F-test.

RESULTS AND DISCUSSION The experimental results on the effect of the independent

variables namely Tween-80, cholesterol and ultrasonic pretreatment time on the COD production are shown in Table 2. The coefficients of the variables in the models and corresponding R2 are shown in Table 3. The statistical analysis indicated that the proposed model was 2 adequate and with satisfactory values of R . The closer 2 the value R is to unity, the better the empirical model fits the actual data. The R2 value for COD production were 0.9917, indicating that the regression models explained the reaction well. The probability (p) values of all regression models were less than 0.001 except for browning indexes (p < 0.05). Table 4 clearly shows that the COD production were significantly affected by the linear (p < 0.001) and quadratic (p < 0.01) effects of cholesterol and ultrasonic pretreatment time. It was found that the linear terms of cholesterol and ultrasonic pretreatment time had a positive effect on the COD production, and showing a significantly effect in the quadratic term. The effect of interaction between cholesterol and ultrasonic pretreatment time on the COD production was negative (p < 0.05). Tween 80 showed no significant effect on the COD production (p < 0.05). The effect of cholesterol and Tween 80 on the variation of the COD production at fixed ultrasonic pretreatment time is shown in Figure 2. It may be observed that the

Yang and Zhang

8319

Table 3. Analysis of variance for the regression model of medium optimization of cholesterol oxidase production obtained from the experimental results.

Source Linear Quadratic Cross product Total regress Total error Sum

Degree of freedom 3 3 3 9 5 14

Sum of square 0.155185 0.567080 0.012454 0.734719 0.006142 0.740861

R 0.2095 0.7654 0.0168 0.9917

F-value 42.110 153.9 3.379 66.456

Prob > F 0.0006 0.0000 0.1115 0.0001

COD, Cholesterol oxidase.

Table 4. Regression coefficients of a full second-order polynomial model for medium optimization of cholesterol oxidase production.

Source Constants X1 X2 X3 X1*X1 X2*X1 X2*X2 X3*X1 X3*X2 X3*X3

Degree of freedom 1 1 1 1 1 1 1 1 1 1

Coefficients estimated 1.438400 0.108900 -0.009775 0.086275 -0.381650 -0.042750 -0.023200 0.004700 0.035550 -0.117250

Standard deviation 0.020235 0.012392 0.012392 0.012392 0.018240 0.017524 0.018240 0.017524 0.017524 0.018240

T-value 71.084 8.788 -0.789 6.962 -20.924 -2.439 -1.272 0.268 2.029 -6.428

Prob > |T| 0.0000 0.0003 0.4659 0.0009 0.0000 0.0587 0.2593 0.7993 0.0983 0.0014

COD, Cholesterol oxidase.

effect of cholesterol on the yield is curvilinear in nature at constant ultrasonic pretreatment time and Tween 80. The effect of Tween 80 on the yield is non-linear at fixed cholesterol and ultrasonic pretreatment time, and the interaction with cholesterol and Tween 80 was negative (p < 0.05). The effect of Tween 80 and ultrasonic pretreatment time on the variation of the COD production at fixed cholesterol is shown in Figure 3. It may be observed that the effect of ultrasonic pretreatment time on the yield is curvilinear in nature at constant cholesterol and Tween 80. The effect of Tween 80 on the yield is non-linear at fixed cholesterol and ultrasonic pretreatment time. The interaction with ultrasonic pretreatment time and Tween 80 is negative (p < 0.05). In addition, Figure 4 shows COD production increase with Tween 80 at fixed cholesterol and ultrasonic pretreatment time. However, the effect of Tween 80 on yield is not significant. COD from different microorganisms has different physicochemical properties and substrate specificity. The Brevibacterium sp. showed extracellular COD production with cholesterol as the inducer and supplementary carbon source, which suggested that the interface contact between cholesterol and the microorganism might be a key factor influencing COD production. Although methods employing the emulsifier to improve COD production were reported quantitatively, it is far from

being satisfactory. Ultrasonic has a strong biological effect. The mechanism is very complex, but the major effect might be the cavitation. Cavitation is a series of dynamics courses: vibration, enlargement, shrinking, and even collapse may occur when using ultrasonic treatment. These courses happen when small air bubbles (vapor bubbles, or holes) form in liquid phase. Cavitation bubbles shrink in heat insulation condition, and even instantly collapse. In the twinkling, the super high temperature of 5000Â°C and several thousand atmosphere may exist near bubbles, and associating with the powerful shockwave or shooting flow, it may lead to the change of interfacial tension, and generate the stable emulsification system. Thus, microorganisms can contact fully with the substrate and promote COD production. Conclusion Canonical analysis, a mathematical approach to examine the over-all shape and locate the stationary point of the response surface, showed that the stationary point of the current response surface was a maximum response. At the optimum medium composition: 4.076 g/L cholesterol, 0.2932â&#x20AC;° (v/v) Tween-80,22.361(min) treatment time, and COD production which reached 1.483U/ml was

8320

Afr. J. Biotechnol.

Figure 2. Effect of cholesterol and Tween 80 concentration on cholesterol oxidase production.

Figure 3. Effect of Tween 80 and ultrasonic pretreatment time concentration on cholesterol oxidase production.

Yang and Zhang

8321

Figure 4. Effect of cholesterol and ultrasonic pretreatment time concentration on cholesterol oxidase production.

predicted. Brevibacterium sp. was incubated in optimized medium in 500 ml shake-flasks. Maximum COD production of 1.469 U/ml was observed, quite close to the predicted maximum response value. Hence, COD production rate could be increased 83.57% greater than the control medium when ultrasonically stimulated directly on broth. ACKNOWLEDGEMENTS This project was financially supported by the Research Award. We also appreciate the efforts by all members of our laboratory for their enthusiastic participation in the research. REFERENCES Aihara H, Watanabe K (1988). Degradation of cholesterol in egg yolk by Rhodococcus equi no. 23. J. Food Sci. 53: 659-660. Cho HJ, Choi KP, Yamashita M (1995). Introduction and expression of the Streptomyces cholesterol oxidase gene (Cho A), a potent insecticidal protein active against Boll weevil larvae, into tobactoo cells. Appl. Microbiol. Biotechnol. 44: 133-138. Doukyu N, Aono R (1999). Two moles of O 2 consumption and one mole of H2O2 formation with cholesterol peroxidation by cholesterol oxidase from Pseudomonas sp. ST-200. Biochem. J. 341: 621-627.

Doukyu N, Shibata K, Ogino H, Sagermann M (2008). Purification and characterization of Chromobacterium sp. DS-1 cholesterol oxidase with thermal, organic solvent, and detergent tolerance. Appl Microbiol Biotechnol. 80: 59-70. Doukyu N (2009). Characteristics and biotechnological applications of microbial cholesterol oxidases. Appl Microbiol Biotechnol. 83: 825837 Gaikwad GS, Pandit BA (2008). Ultrasound emulsification: Effect of ultrasonic and physicochemical properties on dispersed phase volume and droplet size. Ultrason, Sonochem. 15: 554-563 Guo YP, Kim SH, Sung SH (2010). Effect of ultrasonic treatment of digestion sludge on bio-hydrogen production from sucrose by anaerobic fermentation. Int. J. Hydrogen, Energ. 35: 3450-3455 Kamran D, Atiye N, Mohammad AMM (2010). Optimizing the bake hardening behavior of Al7075 using response surface methodology. Mater. Design. 31: 1768-1775 Khanal SK, Grewell D, Sung SH, Leeuwen JV (2007). Ultrasound applications in wastewater sludge pretreatment: a review. Critl. Rev. Environ. Sci. Tech. 37: 277-313. Lotfy WA (2007). The utilization of beet molasses as a novel carbon source for cephalosporin C production by Acremonium chrysogenum: Optimization of process parameters through statistical experimental designs. Bioresour. Technol. 98: 3491-3498. Lucio CA, Sergi GS, Nerilso B, Enric B (2011). Solar photoelectroFenton degradation of paracetamol using a flow plant with a Pt/airdiffusion cell coupled with a compound parabolic collector: Process optimization by response surface methodology. Appl Catal. BEnviron. 103: 21-30. Chang M, Zhou SG, Lu N, Ni JR (2007). Enhanced Bacillus thuringiensis Production from Sewage Sludge with Alkaline and Ultrasonic Pretreatments. Water Air Soil Pollut. 186: 75-84 Mutalik RS, Vaidya KB, Joshi MR (2008). Use of response surface

8322

Afr. J. Biotechnol.

optimization for the production of biosurfactant from Rhodococcus spp. MTCC 2574. Bioresour. Technol. 99: 7875-7880 Purcell JP, Greenplate JT, Jennings MG (1993). Cholesterol oxidase: a potent insecticidal protein active against Boll weevil larvae. Biochem Biophys. Res. Commun. 196: 1406-1413. Runyan CM, Carmen JC, Beckstead B, Nelson J, Robison RA, Pitt WG (2006). Low-frequency ultrasound increase outer membrane permeability of Pseudomonas aeruginosa. J. Gen. Appl. Microbiol. 52: 295-301. Speroulla C, Tran VH, Maurie AT (1994). Enzymatic degradation of egg yolk cholesterol. J Food Prot. 57: 908-912.

Suslick KS, Didenko Y, Fang MM, Hyeon T, Kolbeck KJ (1999). Acoustic cavitation and its chemical consequences. Phil Trans. R. Soc. Lond. 357: 335-353. Thi My Phuc N, Yuan KL, Zhou WB (2009). Stimulating fermentative activities of bifidobacteria in milk by high intensity ultrasound. Int. Dairy J. 19: 410-416 Wenming J (2000). Production and properties of cholesterol oxidase from Breidbacterium sp., PhD Dissertation, Wuxi Univeristy of Light Industry, Wuxi, Peopleâ&#x20AC;&#x2122;s Repub. China.

Full Length Research Paper

Salvia miltiorrhiza inhibits the expressions of transcription factor T-bet (T-bet) and tumor necrosis factor α (TNFα) in the experimental colitis in mice Xu Dekui1, Wu Simeng1, Yu Hongbo2, Zheng Changqing1, Liu Dongmei1 and Lin yan1 1

Department of Gastroenterology, Shengjing Hospital of China Medical University, Shenyang, China. 2 Central Hospital of Pulandian City, Pulandian, China. Accepted 28 March, 2012

Salvia miltiorrhiza (SM) is mainly used for the treatment of coronary heart disease in china and it also represses inflammation, but the mechanism is not well known. This study aimed to investigate the effects of SM powder for injection on the expressions of transcription factor T-bet (T-bet) and tumor necrosis factor α (TNFα) in the experimental colitis in mice. Mice were grouped and treated with SM powder for injection at the time of colonic instillation of trinitrobenzene sulfonic acid (TNBS). Expression studies were performed by real-time polymerase chain reaction (PCR), western blot (WB) and immunohistochemistry (IHC), and histology studies were performed by hematoxylin and eosin stain (H&E). The survival of mice was also monitored. The expressions of TNFα in the colon, T-bet messenger ribonucleic acid (mRNA) and T-bet protein in the spleen decreased in the groups treated with SM powder for injection. The inflamed colonic lesions were relieved and the survival of mice also increased in the treated groups. SM powder for injection repressed the expressions of T-bet and TNFα in the experimental colitis in mice, which could relieve the inflamed colonic lesions and elevate the survival of mice. Key words: Salvia miltiorrhiza, T-bet, tumor necrosis factor α, colitis, mice, inflammatory bowel disease, Crohn’s disease, ulcerative colitis. INTRODUCTION Inflammatory bowel disease (IBD) is a chronic inflammatory condition affecting nearly any part of the gastrointestinal tract. IBD comprises two different disease entities, Crohn’s disease (CD) and ulcerative colitis (UC).

*Corresponding author. E-mail: hangqingzheng@yahoo.com zhengchang qing88@163.com . Tel: +86 024 23253517. Fax: +86 024 23253517. Abbreviations: SM, Salvia miltiorrhiza; T-bet, transcription factor T-bet; TNFα, tumor necrosis factor α; TNBS, trinitrobenzene sulfonic acid; PCR, polymerase chain reaction; WB, western blot; IHC, immunohistochemistry; H&E, hematoxylin and eosin stain; mRNA, messenger ribonucleic acid; IBD, inflammatory bowel disease; CD, Crohn's disease; UC, ulcerative colitis; PBS, phosphate-buffered saline; OB, interleukin; OR, odds ratio.

It is regarded that IBD results from the interactions between genetic predisposition, bacterial microflora, environmental influences and immune system disorders (Braus and Elliott, 2009; Oliva-Hemker and Fiocchi, 2002; Siminovitch, 2006; Cho and Weaver, 2007). It has been proven that cytokines are crucially involved in the pathogenesis of IBD and drugs used for the treatment of IBD have significant effects on the expressions of cytokines. Corticosteroids, 5-aminosalicylates, azathioprine (6-mercaptopurine), methotrexate, thalidomide, monoclonal antibody to TNFα (Infliximab) are drugs for the pharmacological treatment of IBD (Abdel-Hady and Bunn, 2004). However, concern should be raised about the safety of the drugs since patients with IBD are often treated with long-term immunosuppressive therapies. It was reported that use of corticosteroids, azathioprine/6mercaptopurine and infliximab were associated individually with significantly increased odds for opportunistic

8324

Afr. J. Biotechnol.

infection, use of any one of these drugs yielded an odds ratio (OR) of 2.9, whereas use of 2 or 3 of these drugs yielded an OR of 14.5 for opportunistic infection. Immunosuppressive medications, especially when used in combination, and older age are associated with increased risk of opportunistic infections (Toruner et al., 2008), hence efforts to improve immunization status among patients with IBD are needed (Melmed et al., 2006). For this reason, finding efficient and safe drug for the treatment of IBD is necessary. Salvia miltiorrhiza (SM), also known as Danshen, has been prepared as decoction, tablet, capsule, drop pill, injection and powder for injection for administration. It is effective in the management of coronary heart disease (Qin and Huang, 2009). Previous studies demonstrated that SM has the effect of anti-inflammation, which was due to inhibit the production of TNFα, interlukin-1β (IL-1β), IL-12, interferon-γ (IFNγ) and nuclear factor-κB (Bai et al., 2008; Bok et al., 2000; Yang and Xue, 2007). This study was intended to investigate the effects of SM powder for injection on the expressions of T-bet and TNFα in the trinitrobenzene sulfonic acid (TNBS) induced colitis in mice.

China). RNAsimple Total RNA Kit, TIANScript RT Kit and SYBR GREEN mastermix were purchased from TIANGEN Biotech. Co. Ltd. (Beijing, China).

Colitis induction Colitis was induced by intrarectal injection of TNBS as previously described (Neurath et al., 1995; Coquerelle et al., 2009). Briefly, after adaptively housed for 7 days, Balb/c mice were fasted for 24 h with free access to drinking. TNBS was administered intrarectally in a single dose of 100 mg/kg (1% TNBS contained in 30% ethanol solution) to the mice after been anaesthetized by 5% chloral hydrate (3 ml/kg, i.p.) via a polyethylene catheter of 5 cm length, 2 mm diameter. Mice were held in a vertical position for 30 s to ensure the distribution of TNBS within the entire colon and cecum.

Groups and treatments Mice with induced colitis were divided into 5 groups (5 per group) randomly. After the induction of colitis drugs were administered daily for 7 days and the treatments of groups were as follows: Group A: none; Group B: sterile normal saline 10 ml/kg by intraperitoneal injection daily; Group C: 2% SM normal saline 10 ml/kg by intraperitoneal injection daily; Group D: 4% SM normal saline 10 ml/kg by intraperitoneal injection daily; Group E: 6% SM normal saline 10 ml/kg by intraperitoneal injection daily. The normal mice were also studied as Group N when necessary.

MATERIALS AND METHODS Experimental animals

Disease activity index

Specific pathogen free, Balb/c female mice 6 to 8 weeks of age were purchased from the Laboratory Animals Center of China Medical University (Shenyang, Liaoning Province, China) and housed under standard conditions (25°C and 12-h light-dark cycle, 5 mice per 80 cm2 cage) for at least 1 week before starting the experiments. Throughout, the mice were fed with standard pellet diet ad libitum except for special procedures. The experimental settings involving mice were approved by the local authority for Animal Care and Use. The study was performed in compliance with the animal welfare legislations of China Medical University (Shenyang, Liaoning Province, China). All efforts were made to minimize animals’ suffering and to reduce the number of animals used.

In all protocol studies, mice were monitored for the appearance of activity, grooming behavior, mean food consumption, diarrhea, loss of body weight, and overall mortality for 7 days after TNBS instillation. For scoring colitis activity, weight changes were recorded daily. Faeces samples of each animal were visually inspected for signs of diarrhea and rectal bleedings. The disease activity index (DAI) was calculated by summarizing the scores for weight loss, stool consistency, OB test positivity or gross bleedings as described in Table 1 (Bank et al., 2006).

Drugs and reagents SM powder for injection (Lot No.20090612, permission code of State Food and Drug Administration: Z10970093) was purchased from the Second Chinese Medicine Factory of Harbin Pharm Group Co. Ltd. (Harbin, Heilongjiang Province, China), it was extracted from about 1500 g dried root of SM with boiled distilled water and then with ethanol. Filtration and lyophilization were also used to obtain the 40 g brownish powder. The dry powder contained 8% sodium Danshensu (C9H9 O5Na) and 16% protocatechuic aldehyde (C7H6O3) determined by colorimetric method (Ye, 2006). TNBS (5%) was purchased from Sigma-Aldrich Trading Co. Ltd. (Shanghai, China). Rabbit anti T-bet antibody was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, California, USA). Rabbit anti TNFα antibody was purchased from Nanjing KeyGen Biotech. Co. Ltd. (Nanjing, Jiangsu Province, China). Occult blood (OB) test kit was purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu Province, China). UltraSensitve™ S-P kit was purchased from Maixin-Bio. Co. Ltd. (Fuzhou, Fujian Province,

Colon sampling for histology and immunohistochemistry Mice were sacrificed by 10% chloral hydrate (3 ml/kg, i.p.) 7 days after colonic instillation of TNBS. The entire colon was dissected and the colon content was removed by gently rinsing with cold phosphate-buffered saline (PBS); 3 sections of about 0.5 cm were obtained from the distal, transversal and proximal segment of the colon respectively. Specimens were fixed in 4% paraformaldehyde about 24 h then paraffin embedded 5 μM sections were stained with hematoxylin and eosin (H&E) for routine histology. Immunohistochemistry was performed on 5 μM paraffin sections according to the manual of UltraSensitve™ S-P kit: deparaffinization, rehydration, heat assisted antigen retrieval, endogenous peroxidase inhibition and incubation with tumor necrosis factor α (TNFα) antibody. The antibody was used at 1:100 final dilutions. After repeated washings with PBS, sections were incubated with biotinIgG and then streptavidin-peroxidase. After washing with PBS, the reaction product was revealed by 0.6% 3,3-diaminobenzidine. Slides were counterstained with hematoxylin. Negative controls were incubated with PBS and yielded no staining. The optical density was measured by Image-Pro Plus 6.0 as the expression level of TNFα.

Dekui et al.

8325

Table 1. Scores for disease activity index.

Scores

Weight loss (%)

Stool consistency

Rectal bleeding

Well formed pellets

5 - 10

10 - 15

Pasty, semiformed stool

Hemoccult positive

3 4

15 - 20 > 20

Liquid stool

Visible gross bleeding

The disease activity index (DAI) was the summarizing scores for weight loss, stool consistency, occult blood (OB) test positivity or gross bleedings.

Spleen sampling for quantitative RT-PCR Spleen specimens were stored in RNase free tube, then put in liquid nitrogen immediately and stored at -80°C for quantitative realtime polymerase chain reaction (RT-PCR) of T-bet mRNA. The frozen spleen tissue was split into 3 parts and the RNAsimple Total RNA Kit was used for the extraction of total RNA following the protocol described by the manufacturer. RNA concentration was determined by ultra violet (UV)-spectroscopy and the integrity was assessed by denaturing agarose gel electrophoresis. TIANScript RT Kit was used for the reverse transcription of total RNA, and 1.5 μg of total RNA was transcribed into cDNA in a 14.5 μL reaction containing 1 μL oligo (dT)15, 1 μL random, 2 μL dNTP (2.5 mM each), ddH2O added to 14.5 μL, incubated at 70°C for 5 min, 0°C for 2 min, the product was mixed with 4 μL 5 × First-Strand Buffer, 0.5 μL RNasin and 1 μL (200 U) TIANScript M-MLV and then incubated at 42°C for 50 min, 95°C for 5 min to get 20 μL cDNA. The product of cDNA 1 μL mixed with 0.5 μL forward primers, 0.5 μL reverse primers, 10 μL SYBR Green mastermix and 8 μL ddH2O were used for the real-time fluorescent quantitative PCR in the Exicycler™ 96(Bioneer Corporation, Korea), an initial denaturation/ activation step (10 min 95 °C) was followed by 40 cycles (10 s at 95°C, 20 s at 60°C and 30 s at 72°C), and a final held at 4°C for 5 min. The gene specific primers were: T-bet: forward 5′AAGTTCAACCAGCACCAGACAG -3′ and reverse 5′CACCAAGACCACATCCACAAAC -3′; β-actin: forward 5′ACGTTGACATCCGTAAAGAC -3′ and reverse 5′GAAGGTGGACAGTGAGGC -3′. Triplicates were run for each sample. The specificity of the amplification products was controlled by a melting curve analysis. The amount of T-bet mRNA expression was normalized with housekeeping gene β-actin in the same samples and the relative quantification was performed using the comparative threshold cycle (2-∆∆ct) method (relative gene expression). The expression of T-bet mRNA measured in the pool of normal mice was considered the unit value, and the results obtained were reported as relative levels with respect to the unit value.

Spleen sampling for western blot Spleen specimens were stored in sterile tube, put into liquid nitrogen immediately and stored at -80°C for western blot (WB) of T-bet. In brief, spleen tissue was lysed in ice-cold radio immunoprecipitation assay (RIPA) buffer (150 mM sodium chloride, 1.0% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulphate, 50 mM Tris, pH 8.0, 1.0% phenylmethylsulfonyl fluoride ), and the amount of protein was determined by the bicinchoninic acid assay. A 30 µg aliquot of protein was loaded in each lane and subjected to 10% sodium dodecyl sulfate-

polyacrylamide get electrophoresis (SDS-PAGE). After electrophoresis, protein was transferred to polyvinylidene difluoride (PVDF) membrane. The primary antibody was rabbit anti T-bet (1:500 dilution), while sheep anti rabbit IgG conjugated to horseradish peroxidase was used as secondary antibody, and the reaction was developed with the electro-chemiluminescence (ECL) solution. Blots were stripped and analyzed for β-actin, as an internal loading control, using a rabbit anti β-actin (1:5000 dilution). The optical density of bands was measured by Image-Pro Plus 6.0, the value obtained was reported as relative level with respect to the βactin in the same sample, the value of normal mouse was considered the unit value.

Statistical analysis All data were presented as mean ± standard deviation (x ± SD) and differences between groups were analyzed with parametric test (t test) or nonparametric test (χ2 test). Software SPSS version 13.0 was used for the analysis when appropriate and p < 0.05 was considered significant.

RESULTS Manifestation of mice The mice appeared depressed, lazy, anorexia, had diarrhea and their body hair was in disorder and lack of gloss at day 2 after a single intracolonic administration of TNBS ethanol solution at 100 mg/kg. Bloody stool and weight loss occurred at day 3 as well as some death. The mice got better after day 4 and the total survival ratio at day 7 was 68%, but the survival ratio of group D was 91%, which was higher significantly compared with group A (50%, p < 0.05). However, the differences of group C (64%) and E (73%) compared with group A were not significant, and it was also not significant to compare between group A and group B (64%). The DAI scores of group D and E were (3.20 ± 1.09) and (2.8 ± 1.10) at day 7, which decreased significantly compared with group A (4.80 ± 1.09, p < 0.05) and B (4.40 ± 0.89, p < 0.05), but the difference was significant for group N (0.6 ± 0.55) compared with each other group (Figure 1).

8326

Afr. J. Biotechnol.

Figure 1. The disease activity index (DAI) scores of colitis. Balb/c mice were instilled with trinitrobenzene sulfonic acid (TNBS, 100 mg/kg) intracolonically and treated with daily injections of 2, 4 and 6% Salvia miltiorrhiza (SM, 10 ml/kg), normal saline (NS, 10 ml/kg) or not. Group A, TNBS; B, TNBS + NS; C, TNBS + 2% SM; D, TNBS+ 4% SM; E, TNBS + 6%S M; N, normal mice. ● p < 0.05 vs group A, ▲ p < 0.05 vs group B, p < 0.05 vs group A, B, C, D and E.

Histological evaluation of colitis Necrobiosis and loss of epithelial cells, mucosal erosion, hyperemia, hemorrhage, granulomas with infiltration of inflammatory cells, crypt abscess, ulceration, disorder of gland, goblet cells loss were the enteropathy in all groups administered with TNBS. The enteropathy of group D and E were significantly relieved compared with group A and B (Figure 2). Expression of TNFα in colon TNFα was expressed in the mucous membrane of colon, mainly in the cytoplasm of intestinal villus and gland epithelium (Figure 3). The mean OD values of TNFα were -3 -3 (21.39 ± 4.65)*10 and (19.39 ± 6.54)*10 in SM treated group D and E, respectively which decreased significantly (p < 0.05) compared with group A (29.28 ± 4.7)*10-3 and -3 B (31.81 ± 9.68)*10 . The difference, however, was not -3 significant for group N (15.67 ± 3.78) *10 compared with group D and E (Figure 4). Expression of T-bet mRNA in spleen The relative levels with respect to normal mice of T-bet

mRNA were 1.64 ± 0.04, 1.46 ± 0.09 and 1.25 ± 0.11 in group C, D and E, respectively which decreased significantly compared with group A (2.13 ± 0.06, p < 0.05) and B (2.13 ± 0.20, p < 0.05) (Figure 5). Expression of T-bet protein in spleen The relative levels of T-bet OD values with respect to normal mice were 2.25 ± 0.10, 1.90 ± 0.16 and 1.31 ± 0.08 in treated group C, D and E respectively which decreased significantly compared with group A (2.66 ± 0.16, p < 0.05) and B (2.72 ± 0.07, p < 0.05) (Figures 6 and 7). DISCUSSION IBD is a chronic gastrointestinal immune disorder characterized by intestinal inflammation and mucous membrane damage. Different animal models have been used for the studies of IBD. Colitis induced by intrarectal injection of TNBS ethanol solution was widely used for the testing of pharmacological molecules or agents that could lead to a possible cure for IBD. It was demonstrated that ethanol could destruct the mucosal barrier which enhanced TNBS

Dekui et al.

Figure 2. Hematoxylin-eosin (HE) stain of colon. Balb/c mice were instilled with trinitrobenzene sulfonic acid (TNBS, 100 mg/kg) intracolonically and treated with daily injections of 2, 4 and 6% Salvia miltiorrhiza (SM, 10 ml/kg), normal saline (NS, 10 ml/kg) or not. Arrows indicated that the colon walls were thickened and granulomas with infiltration of inflammatory cells were seen in the colons of group A (TNBS), B (TNBS + NS) and C (TNBS + 2%SM). Colon lesions were significantly improved in treated group D (TNBS+ 4%SM) and E (TNBS + 6%SM). N is the colon of normal mouse. Original magnification was X 400.

Figure 3. Immunohistochemistry (IHC) stains of tumor necrosis factor α (TNFα) in the colon. Balb/c mice were instilled with trinitrobenzene sulfonic acid (TNBS, 100 mg/kg) intracolonically and treated with daily injections of 2%, 4%, 6% Salvia miltiorrhiza (SM, 10 ml/kg), normal saline (NS, 10 ml/kg) or not. TNFα was expressed in the mucous membrane of colon, mainly in the cytoplasm of intestinal villus and gland epithelium (yellow to brown in the pictures). Group A: TNBS; B: TNBS + NS; C: TNBS + 2%SM; D: TNBS+ 4%SM; E: TNBS + 6%SM; N: normal mouse. Original magnification was X 400.

8327

Afr. J. Biotechnol.

Mean OD value of TNFα (10-3)

8328

Figure 4. Mean OD value of tumor necrosis factor α (TNFα) in the colon. Balb/c mice were instilled with trinitrobenzene sulfonic acid (TNBS, 100 mg/kg) intracolonically and treated with daily injections of 2, 4 and 6% Salvia miltiorrhiza (SM, 10 ml/kg), normal saline (NS, 10 ml/kg) or not. Group A: TNBS; B: TNBS + NS; C: TNBS + 2%SM; D: TNBS+ 4%SM; E: TNBS + 6%SM; N: normal mice. # p < 0.05 vs. group A, $ p < 0.05 vs. group B.

as hapten combined with intestinal protein to form a complete antigen and evoke a delayed type hypersensitivity, which proceeds to develop chronic colitis (Hibi et al., 2002). In our study, colitis was induced successfully, the therapeutic dose of SM was 400 mg/kg (group D), which was 50 times as much as for human. Murine colitis treated with SM showed that the survival ratio was higher, the DAI scores were decreased, the enteropathy was relieved significantly, and especially the formation of granulomas was inhibited (Figure 2). However, the survival ratio did not increase with dose changed in group E (75 times as much as for human) and the colon mucosa in group E was thin, rarefaction (Figures 2 and 4). The dysplastic of mucosa was due to the anti-fibrosis effect of SM, the expressions of collagen gene and collagen were both reduced by SM (Wasser et al., 1998; Hu et al., 2009), and so further study should be carried out to investigate whether the effects of antiinflammation and anti-fibrosis of SM were dose dependent. It was also demonstrated that large amount of interleukin-12 (IL-12) was produced by macrophages and large amounts of interferon-γ (IFNγ) and IL-2 were

produced by lymphocytes which suggested that the colitis induced by TNBS was a Th type-1 response, constituting a CD model (Neurath et al., 1995). The similarities between the human CD and colitis induced by TNBS were allowed to address the immune system involvement in the pathogenesis of IBD (Ilan et al., 2002). The Th type-1 response was mediated by Th1/ TNF pathways, TNF, IFN-γ, IL-12, IL-1 and IL-6 were produced to initiate the inflammation. The Crohn’s-like IBD, induced by the overexpression of TNF in an experimental mice model indicated that TNF was a key proinflammatory factor for inflammation (Kontoyiannis et al., 1999). Infliximab, a chimeric mouse-human monoclonal IgG1 antibody, is a powerful and selective anticytokine drug directed against TNFα and has been used worldwide. It is effective in the treatment of refractory luminal and fistulising CD (Rutgeerts et al., 2004; Sands et al., 2004). Results from a single centre cohort indicated that patients with CD receiving long-term treatment with infliximab were very efficacious to maintain improvement during a median follow-up of almost 5 years and changed disease outcome by decreasing the rate of hospitalizations and surgery (Schnitzler et al., 2009). Long-term

Dekui et al.

8329

Figure 5. Expression of T-bet mRNA in spleen. Balb/c mice were instilled with trinitrobenzene sulfonic acid (TNBS, 100 mg/kg) intracolonically and treated with daily injections of 2, 4 and 6% Salvia miltiorrhiza (SM, 10 ml/kg), normal saline (NS, 10 ml/kg) or not. Group A: TNBS; B: TNBS + NS; C: TNBS + 2%SM; D: TNBS+ 4%SM; E: TNBS + 6%SM; N: Normal mice. # p < 0.05 vs. group A, $ p < 0.05 vs. group B.

infliximab treatment had a good overall safety profile in the patient with IBD (Fidder et al., 2009). Intracolonic administration of antisense oligonucleotide against TNFα resulted in a significant reduction of colonic TNFα and amelioration of histopathology in mice with colitis induced by TNBS (Zuo et al., 2010). In our study, SM inhibited the expression of TNFα in the experiment colitis significantly and showed a good therapeutic effect for the colitis, which was the same result as previous study (Bai et al., 2008). In the differentiation of Th1 lymph cells, T-box family transcription factor T-bet (T-bet) is the specific hallmark for Th1 cells and it is essential for Th1 differentiation from naive T cells. Without the expression of T-bet, Th1 cells cannot be generated either in vitro or in vivo; however, overexpression of T-bet enable T cells to follow Th1 programming (Szabo et al., 2002). The ectopic expression of T-bet also transactivated the IFN-γ gene and induced endogenous IFN-γ production. Gene transduction of T-bet into polarized Th2 primary T cells redirected them into Th1 cells and expressed IFN-γ instead of IL-4 or IL-5; T-bet is the master regulator controlling the destiny of Th1 cells (Szabo et al., 2000). It was also revealed that both T-bet and the transcription factor Runx3 bond to the promoter of IFN-γ gene and the

silencer of IL-4 gene resulted in the maximal production of IFN-γ and silencing of the gene encoding IL-4 in Th1 cells. T-bet did not repress IL-4 in Runx3-deficient Th2 cells and the Runx3 was induced in Th1 cells in a T-betdependent manner, too (Djuretic et al., 2007). In this report, we showed that colitis induced by TNBS was a Th type-1 response. The expressions of T-bet mRNA and T-bet protein in the spleen were inhibited by SM greatly and as a result the expression of TNFα was also reduced significantly, which may be one of the mechanisms of anti-inflammation effect of SM that has not been previously mentioned. Further studies should be carried out to reveal the mechanism and signal pathway of the anti-inflammatory effect as well as the inhibition of Th1 cells differentiation of SM, which will enable to make a better understanding of Th1 inflammatory diseases and to implement future therapeutic approaches. ACKNOWLEDGEMENTS This study was supported by the fund for science and technology of Liaoning Province, China No. 2008225011, and was done in the Research Center of Shengjing Hospital. The authors are thankful for the support and

8330

Afr. J. Biotechnol.

Figure 6. Western blot of T-bet protein in spleen. Balb/c mice were instilled with trinitrobenzene sulfonic acid (TNBS, 100 mg/kg) intracolonically and treated with daily injections of 2, 4 and 6% Salvia miltiorrhiza (SM, 10 ml/kg), normal saline (NS, 10 ml/kg) or not. Group N: normal mice; A: TNBS; B: TNBS + NS; C: TNBS + 2%SM; D: TNBS+ 4%SM; E: TNBS + 6%SM.

Figure 7. Expression of T-bet protein in spleen. Balb/c mice were instilled with trinitrobenzene sulfonic acid (TNBS, 100 mg/kg) intracolonically and treated with daily injections of 2, 4 and 6% Salvia miltiorrhiza (SM, 10 ml/kg), normal saline (NS, 10 ml/kg) or not. Group N: normal mice; A: TNBS; B: TNBS + NS; C: TNBS + 2%SM; D: TNBS+ 4%SM; E: TNBS + 6%SM. # p < 0.05 vs. group A, $ p < 0.05 vs. group B.

cooperation of the directors. REFERENCES Abdel-Hady M, Bunn SK (2004). Inflammatory bowel disease. Curr. Paediatr. 14: 598-604. Bai A, Lu N, Guo Y, Fan X (2008). Tanshinone IIA ameliorates trinitrobenzene sulfonic acid (TNBS)-induced murine colitis. Diges, Dis. Sci. 53: 421-428. Bank Ute, Heimburg Anke, Helmuth Martin, Stefin Sofia, Lendeckel Uwe, Reinhold Dirk, Faust Jürgen, Fuchs Petra, Sens Bianca, Neubert Klaus, Täger Michael, Ansorge Siegfried (2006).Triggering endogenous immunosuppressive mechanisms by combined targeting

of Dipeptidyl peptidase IV (DPIV/CD26) and Aminopeptidase N (APN/ CD13) — A novel approach for the treatment of inflammatory bowel disease.Int. Immunopharmacol.6:1925-1934. Bok YK, Su WC, Seung HK, Shi YR, Tae SK (2000). Inhibition of interleukin-12 and interferon-γ production in immune cells by tanshinones from Salvia miltiorrhiza. Immunopharmacology, 49: 355361 Braus NA, Elliott DE (2009). Advances in the pathogenesis and treatment of IBD. Clin. Immunol. 132: 1-9. Cho JH, Weaver CT (2007). The genetics of inflammatory bowel disease. Gastroenterology, 133: 1327-1339. Coquerelle C, Oldenhove G, Acolty V, Denoeud J, Vansanten G, Verdebout JM, Mellor A, Bluestone JA, Moser M (2009). Anti-CTLA-4 treatment induces IL-10-producing ICOS+ regulatory T cells

Dekui et al.

displaying IDO-dependent anti-inflammatory properties in a mouse model of colitis. Gut. 58: 1363–1373. Djuretic IM, Levanon D, Negreanu V, Groner Y, Rao A, Mark Ansel K(2007). Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells. Nat. Immunol. 8: 1-9. Hu Q, Noor M, Wong YF, Hylands PJ, Simmonds MSJ, Xu Q, Jiang D, Hendry BM, Xu QH (2009). In vitro anti-fibrotic activities of herbal compounds and herbs. Nephrol. Dialysis Transplantation. 24: 30333041. Ilan Y, Weksler-Zangen S, Ben-Horin S, Diment J, Sauter B, Rahbani E, Engelhardt D, Roy Chowdhury N, Roy Chowdhury J, Goldin E (2002). Treatment of experimental colitis by oral tolerance induction: A central role for suppressor lymphocytes. American J. Gastroenterol. 95: 966-973. Kontoyiannis D, Pasparakis M, Pizarro TT, Cominelli F, Kollias G (1999). Impaired on/off regulation of TNF biosynthesis in mice lacking TNF AU-rich elements: implications for joint and gut-associated immunopathologies. Immunity, 10: 387-398. Melmed GY, Ippoliti AF, Papadakis KA, Tran TT, Birt JL, Lee SK, Frenck RW, Targan SR, Vasiliauskas EA (2006). Patients with inflammatory bowel disease are at risk for vaccine preventable illnesses. Am. J. Gastroenterol. 101: 1834-1840. Neurath MF, Fuss I, Kelsall BL, Stuber E, Strober W (1995). Antibodies to interleukin 12 abrogate established experimental colitis in mice. J. Exp. Med. 182:1281-1290. Oliva-Hemker M, Fiocchi C (2002). Etiopathogenesis of inflammatory bowel disease: the importance of the pediatric perspective. Inflamm. Bowel Dis. 8: 112-128. Qin Feng, Huang Xi(2009). Guanxin II (冠心号) for the management of coronary heart disease. Chin. J. Integr. Med. 15: 472-476. Rutgeerts P, Feagan BG, Lichtenstein GR, Mayer LF, Schreiber S, Colombel JF, Rachmilewitz D, Wolf DC, Olson A, Bao W, Hanauer SB (2004). Comparison of scheduled and episodic treatment strategies of infliximab in Crohn’s disease. Gastroenterology, 126: 402-413. Sands BE, Anderson FH, Bernstein CN, Chey WY (2004). Infliximab maintenance therapy for fistulizing Crohn’s disease. N. Engl. J. Med. 350: 876-885. Schnitzler F, Fidder H, Ferrante M, Noman M, Arijs I, Assche VG, Hoffman I, Steen KV, Vermeire S, Rutgeerts P (2009). Long term outcome of treatment with infliximab in 614 Crohn’s disease patients: results from a single centre cohort. Gut. 58: 492-500. Siminovitch KA (2006). Advances in the molecular dissection of inflammatory bowel disease. Seminars, Immunol. 18: 244-253.

8331

Szabo SJ, Kim ST, Costa GL, Zhang X, Fathman CG, Glimcher LH (2000). A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell. 100: 655-669. Szabo SJ, Sullivan BM, Stemmann C, Satoskar AR, Sleckman BP, Glimcher LH (2002). Distinct effects of T-bet in TH1 lineage commitment and IFN-gamma production in CD4 and CD8 T cells. Science, 295: 338-342. Toruner M, Loftus Jr EV, Harmsen WS, Zinsmeister AR, Orenstein R, Sandborn WJ, Colombel JF, Egan LJ (2008). Risk factors for opportunistic infections in patients with inflammatory bowel disease. Gastroenterology, 134: 929-936. Wasser S, Ho JM, Ang HK, Tan CE (1998). Salvia miltiorrhiza reduces experimentally-induced hepatic fibrosis in rats. J. Hepatol. 29: 760771. Yang XZ, Xue XP (2007). Effects of Danshen Injection on NF-κB Activation of Macrophages. J. Liaoning Univ. Tradit. Chin. Med. 4: 184-185. Ye Y (2006). Comparative study on the determination of salvianolic acids content by colorimetery and HPLC. J. Zhejiang, Univ. Traditional Chinese Med. 30: 350-351. Zuo L, Huang Z, Dong L, Xu L, Zhu Y, Zeng K, Zhang C, Chen J, Zhang J (2010). Targeting delivery of anti-TNFα oligonucleo tide into activated colonic macrophages protects against experimental colitis. Gut. 59: 470-47.

African Journal of Biotechnology Vol. 11(33), pp. 8332-8340, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3982 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Antimicrobial and antiviral activities against Newcastle disease virus (NDV) from marine algae isolated from Qusier and Marsa-Alam Seashore (Red Sea), Egypt Ibraheem Borie Mohammad Ibraheem1*, Neveen Abdel-Raouf2, Mohamed Sayed AbdelHameed3 and Khaled El-yamany4 1

Botany and Microbiology Department, Faculty of Science, King Saud University, Riyadh, Kingdom of Saudi Arabia. Botany and Microbiology Department, Faculty of Science and Medical Studies, Women Students Medical Studies and Sciences Sections, King Saud University for Girls, Riyadh, Kingdom of Saudi Arabia. 3 Biology Department, Faculty of Science, Jazan University, Jazan, Kingdom of Saudi Arabia. 4 Botany Department, Faculty of Science, Beni-Suef University, Beni-Suef, Egypt.

Accepted 23 March, 2012

Diethyl ether, acetone and ethanol extracts of ten marine macroalgae; two belonging to Chlorophyceae (Ulva lactuca and Caulerpa racemosa), two belonging to Rhodophyceae (Acanthophora spicifera and Galaxaura elongata) and six taxa belonging to Phaeophyceae (Liagora farinosa, Cystoseira compressa, Cystoseira myrica, Hydroclathrus clathratus, Turbinaria ornata and Padina pavonia) isolated from the inter tidal zone along Qusier Marsa-Alam seashore (Red Sea), Egypt, were evaluated for their antibacterial, antifungal and antiviral activities against 3 Gram-positive bacteria (Bacillus subtilis, Staphylococcus aureus and Sarcina maxima), 3 Gram-negative bacteria (Pseudomonas aeruginosa, Escherichia coli and Klebsiella pneumonia), one unicellular (Candida albicans) and two filamentous fungi (Aspergillus flavus and Fusarium oxysporum) and against the Newcastle sense Virus (NDV)(Paramyxoviridae) which is responsible for acute respiratory distress in chicken. Data showed that some extracts recorded strong inhibitory activities than the reference antibiotics, while others were with moderate and/or week inhibitory activities. However, many were without any inhibitory effects. The cytotoxicity effect of the tested algal extracts on chicken embryo showed that both diethyl ether and acetone extracts had toxic effects, but the ethanol extracts had no toxic effect, so that the ethanol extract was considered to be the most suitable for further studies. The antiviral activities of the ethanol extracts against NDV (Newcastle disease virus) showed that seven of the ten tested algal extracts have strong activities against NDV. Key words: Antimicrobial and antiviral activities, Newcastle disease virus (NDV), marine macroalgae, Qusier and Marsa-Alam, Red Sea, Egypt.

INTRODUCTION Research activities concerning the investigation of metabolic products of macroalgae were under taken not only for a better understanding of nature, but also to discover metabolites of possible use for humans in different fields of interest. The screening of extracts or isolated compounds from different natural sources is a

*Corresponding author. E-mail: ibraheemborie@hotmail.com.

common way to discover the biological active metabolites. Secondary or primary metabolites from macroalgae or seaweeds may be potential bioactive compounds of interest for the pharmacological industry (LimaFilho et al., 2002). Special attention has been reported for antibacterial, antifungal and antiviral activities related to marine algae against pathogens (Deig et al., 1974; Caccamese and Azzolina, 1979; Perez et al., 1990; Ballesteros et al., 1992; Nagayama et al., 2002; Haliki et al., 2005; Fitton

Ibraheem et al.

2006 Taskin et al., 2007; Zandi et al., 2007; and Salvador et al., 2007). Some algal substances have bacteriostatic, while others have bactericidal activities. Among the algal substances which have this kind of activity; amino acids, terpenoids, phlorotannins, steroids, phenolic compounds; halogenated ketones and alkanes, cyclic polysulphides, fatty acids and acrylic acid can be counted (Mtolera and Semesi, 1996). There are not enough published data on antimicrobial or antiviral activity of Egyptian Red Sea macroalgae. In this paper, 10 Egyptian marine macroalgae of Red Sea were subjected to in vitro studies for this purpose. MATERIALS AND METHODS

8333

evaluate antiviral activity of tested algal extracts. ECE were inoculated via allantoic sac route on 9 to 11-day old embryos and incubated at 35°C and 70% humidity for 5 days post inoculation. Red blood cells obtained from adult chicks were added to 4% sodium citrate as anticoagulant. The cells were washed three times with normal physiological saline and the packed cells were diluted to 1% for the haemagglutination test. Experimental solutions Physiological saline buffer (85% pH 7.2) was prepared by dissolving 8.5 g of sodium chloride in 1000 ml distilled water and sterilized by autoclaving. As regard the antibiotic solutions, crystalline penicillin and streptomycin were used to inhibit bacterial growth in the inoculated samples. Vial of each type was dissolved in 10 ml distilled water and then added in the form of 100 IU crystalline penicillin and 100 µg streptomycin/ 1ml of the inoculums.

Collection and identification of algal species The studied algal species collected from the inter-tidal region of Red Sea shores between Quseir and Marsa-Alam. Algal species were identified according to Borgesen (1900, 1931), Borgesen and Fremy (1936), Svedelius (1906), Hamel (1916), Setchell and Gardner (1920), Taylor (1928, 1960), Papenfuss (1940, 1946), Parr (1939), Nasr (1940a, b), Nasr and Aleem (1949), Smith (1944); Levring (1946), Bouk (1965), Scagel (1966) and Bold (1978). Taxonomic classification of the algal species was made and modified according to the system developed by Papenfuss (1955, 1968).

Detection of cytotoxicity of tested algal extracts to chicken embryos Three doses of diethyl ether extract of each tested algae (from ten tested samples) were inoculated into ECE aged 9 to 11-day old embryos via allantoic sac route (2 eggs prepared for each dose). The inoculated eggs were incubated at 37°C and 80% humidity for 7 days with daily candling for death. At the end of incubation period, embryos were harvested and examined for death or embryo lesion. The previous procedures were repeated with the other solvents (acetone and ethyl alcohol) separately.

Extraction of selected algal species Using three different solvent (diethyl ether as non polar solvent, acetone as aprotic polar solvent and ethanol as protic polar solvent), 25 g of dry weight of each algal species were socked in 250 ml of the previous three solvent for 24 h, then filtered and concentrated under reduced pressure by using rotary evaporator. Test microorganisms All tested microorganisms were kindly supplied from Biotechnological Research Center, AL-Azhar University (for boys), Cairo, Egypt.

Propagation of NDV mixed with different algal extract in SPF– ECE According to Allan et al. (1973), three SPF-ECE were prepared for each algal extract and inoculated via allantoic sac route (9 to 11day old embryos) by 0.2 ml mixture (containing 0.1 ml NDV + 10 mg ethanol algal extracts). The inoculated eggs were incubated at 37°C and 80% humidity for 5 days. Twice daily candling was performed and mortalities during the first 24 h after inoculation were considered non specific and discarded, while those that survived thereafter were kept at 4°C for 24 h. The allantoic fluids of each group were aseptically harvested and centrifuged at 1500 rpm for 15 min for clarification. The clarified allantoic fluids were stored at 20°C until used for virus titration.

Medium used for bacterial maintenance According to (Wedberg, 1966), nutrient agar medium was used to maintain the tested organisms. The modified Czapek-Doxs medium (Davet and Rouxel, 2000) was used to maintain the tested fungi.

Measurement of microbial inhibition Antimicrobial activity was conducted according to the agar diffusion assay which performed according to European Pharmacopoe (1997). Measurement of anti-viral activity was done in corporation with the Laboratory of Virology, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef, Egypt. A velogenic viscerotropic Newcastle disease virus (NDV) strain having a titer of 109.1 EID50/ml was obtained from the Veterinary Serum Research Institute, Newcastle Disease Unit, Abbasia, Cairo, Egypt. Specific Pathogen free embryonated chicken eggs (SPF-ECE) were purchased from Koum Oshim Farm, Fayoum, Egypt and used to

Infectivity titration of NDV in ECE Ten-fold serial dilution from each harvested allantoic fluid of the ten used samples from 10-1 to 10-10, were prepared in sterile saline solution containing antibiotic (each sample of the ten tested extracts was prepared separately). Four ECE of 9 to 11-day old embryos were prepared for each dilution from 10-1 to 10-10 and inoculated via allantoic sac route by 0.1 ml / egg. The inoculated eggs were sealed and incubated at 37°C and 80% humidity and candled twice daily for 5 days. Dead embryos within the first 24 h post inoculation were considered non specific death and discarded. Therefore, dead embryos were removed daily, recorded and kept at -4°C until the end of incubation period. At the end of incubation period all the remaining embryos were chilled for 24 h at 4°C. Allantoic fluids were harvested from dead and live embryos, and haemagglutination test was carried out. The value of egg infective dose fifty (EID50) was calculated according to Reed and Muench (1938). Control NDV without

8334

Afr. J. Biotechnol.

solvent extracts was also titrated with same procedure.

Haemagglutination test (HA) This test was done according to the standard procedure given by Anon (1971) as follows: Each well of HA micro titer plate was filled with 50 µL saline and 50 µL of the tested sample, then 50 µL of the freshly prepared 1% washed chicken red blood cells (RBCs) were added to each well and the plates were incubated at room temperature for 15 to 30 min. Positive and negative control wells should be included. The plates were examined when RBCs in negative control settled down forming bottom like shape, and positive control showed lattice shape agglutination.

RESULTS AND DISCUSSION Thirty extracts of 10 marine macroalgae were tested against 3 Gram-positive and 3 Gram-negative bacteria (Table 1). Crude extracts of all investigated macroalgal species except H. clathratus and Padina pavonia showed inhibitory effects at least against two of the tested bacterial species. In this respect, some extracts have shown high inhibition activities higher than recorded by Penicillin G. Among the active extracts, one extract (diethyl ether of Galaxaura elongata) showed specific inhibition against Bacillus subtilis, three extracts (diethyl ether and acetone of Ulva lactuca and acetone of Acanthophora spicifera) showed specific inhibition against Sarcina maxima, two extracts (diethyl ether of A. spicifera and ethanol of Liagora farinosa) showed specific inhibition against Escherichia coli and two extracts (diethyl ether of Ulva lactuca and Cystoseira myrica) showed specific inhibition against Pseudomonas aeruginosa. On the other hand, three extracts (ethanol extracts of Ulva lactuca and G. elongate, and acetone extract of Caulerpa racemosa) showed specific inhibition against P. aeruginosa resembles to that recorded by Penicillin G. Meanwhile, some extracts recorded moderate inhibitory activities; these were acetone extracts of C. racemosa against Staphylococcus aureus, diethyl ether and ethanol of A. spicifera against S. maxima and acetone of Ulva lactuca and Cystoseira compressa, ethanol extracts of C. racemosa and diethyl ether of L. farinosa against P. aeruginosa. Among the crude extracts, some of them exhibited week inhibitory effects; there were all extracts of U. lactuca, diethyl ether and acetone of Caulerpa racemosa and ethanol of C. compressa against B. subtilis, all extracts of U. lactuca, diethyl ether and ethanol of Caulerpa racemosa against S. aureus, ethanol of U. lactuca and all extracts of Caulerpa racemosa and G. elongata against S. maxima, all extracts of U. lactuca and Turbinaria ornata against E. coli, diethyl ether of C. racemosa, ethanol of L. farinosa and C. compressa and acetone and ethanol of C. myrica against P. aeruginosa. The other macroalgal extracts were unaffected. The

above results indicated that diethyl ether was the most effective solvent for extraction of the bioactive compounds followed by acetone. Furthermore, U. lactuca and C. racemosa (Chlorophyceae) were the most effective marine algae against tested bacterial species followed by the two red algal species (G. elongata and A. spicifera). Accordingly, we can suggest that antibacterial activities depend on both algal species and the efficiency of solvent used, which is in accordance with Olessen et al. (1963) and Kamat et al. (1992). The antimicrobial activity shown by U. lactuca might be due to acrylic acid commonly found in it. U. lactuca commonly known as sea lettuce, has long been used as food and as a traditional medical agent to treat helminthic infections, fever, urinary diseases, dropsy, etc (Chengkui and Junfu, 1984). The presence of active substances in U. lactuca is in agreement with that observed by Rao and Pareksh (1981) and Awad (2000). The antimicrobial activity shown by C. racemosa in this study may be attributed to caulerpin or caulerpicin (Doti and Santos, 1966; Paul et al., 1987) or flexin and trifarin (Blackman and Wells, 1976) or by caulerpanyene (Amico et al., 1978). Several studies have found stronger antibacterial effects of marine algae on Gram-positive bacteria than on Gram-negative bacteria (Ikigai et al., 1993; Ibraheem, 1995; Nakaamura et al., 1996). However, in the present study, we could not find any remarkable differences in susceptibility, and this was in accordance with Nagayama et al. (2002) who reported that Campylobacter spp., which are Gram-negative, were most susceptible among the tested bacteria undergoing brown algal extracts. Schulz et al. (1992), suggested that the antimicrobial activities of crude extracts may result from their interaction with bacterial enzymes and proteins. Other workers (Abdel-Raouf and Ibraheem, 2008) suggested that the inhibitory effects of the purified antibiotic on the bacterial growth could be attributed to one or more of the following actions; (1) the stopping of peptidoglycan step in cell wall synthesis, (2) disorganizing the structure or inhibiting the function of bacterial cell membrane, (3) inhibition of protein synthesis, (4) affecting the synthesis of DNA or RNA or binding to DNA or RNA so that their messages cannot be read, either case of course can block the growth cells, (5) act as competitive inhibitors (growth factor analogs) which are structurally similar to a bacterial growth factor but do not fulfill its metabolic function in the cell. Some are bacteriostatic, and some are bactericidal. Thirty crude extracts of 10 marine macroalgae were tested against 3 fungal species. The results of the screening tests are summarized in Table 2. Candida albicans was the most susceptible organism, which was strongly inhibited by acetone extract of U. lactuca, C. racemosa and L. farinosa, but exhibited moderate inhibitory activities by diethyl ether and acetone extracts of C. racemosa and C. myrica. However, 7 extracts (diethyl ether of U. lactuca, ethanol of U. lactuca and C.

Ibraheem et al.

8335

Table 1. Antibacterial activities of the investigated diethyl ether, acetone and ethanol extracts of ten marine macroalgal species against six bacterial species on the agar plate by diffusion assay method.

Inhibition zones (mm) against Antibiotic reference

*Bacillus Subtilis NCTC 1040

Reference antibiotic Penicillin G (50 Âľ/disk) Control (Diethyl ether, acetone and ethanol)

Algal species and algal extracts

+++ -

Staphylococcus aureus NCTC 7447 +++ -

Sarcina maxima ATCC 33910

Escherichia coli NCTC 10416

Pseudomonas aeruginosa ATCC 10145

+++ -

Klebsiella pneumonia NCIMB 911 +++ -

Ulva lactuca

Diethyl ether Acetone Ethanol

+ + +

++++ ++++ +

+ + +

++++ ++ +++

+ + +

Caulerpa racemosa

Diethyl ether Acetone Ethanol

+ + -

+ ++ +

+ + +

+ +++ ++

+ -

Galaxaura elongata

Diethyl ether Acetone Ethanol

++++ -

+ + +

+++

Diethyl ether Acetone Ethanol

++ ++++ ++

++++ -

Liagora farinosa

Diethyl ether Acetone Ethanol

++++

++ +

Cystoseira compressa

Diethyl ether Acetone Ethanol

++ +

Cystoseira. myrica

Diethyl ether Acetone Ethanol

++++ + +

Hydroclathrus clathratus

Diethyl ether

Acanthophora spicifera

8336

Afr. J. Biotechnol.

Turbinaria ornata

Padina pavonia

Acetone Ethanol

Diethyl ether Acetone Ethanol

+ + +

Diethyl ether Acetone Ethanol

Inhibition zones: - (no activity); + (3-10 mm); ++ (10-15 mm), +++ (15-20 mm) and ++++ (>20 mm). *Pathogen.

racemosa, acetone of A. spicifera, C. compressa, T. ornata and Padina pavonia) showed weak inhibition activity against C. albicans. Among the 30 marine algal extracts, only one extract (acetone extract of U. lactuca) showed strong inhibitory activity against Aspergillus flavus. Furthermore, 4 extracts (diethyl ether and ethanol of U. lactuca, diethyl ether of C. racemosa and acetone of L. farinosa) exhibited weak inhibitory activities against this fungus, which appeared more resistance for other algal extracts. On the other hand, three acetone extracts (L. farinosa, G. elongata and Turbinaria ornata) showed strong inhibitory activity against Fusarium oxysporum, which appeared more resistance for other algal extracts except diethyl ether extract of U. lactuca, which inhibits this fungus with weak proportion. These beneficial effects of the algal extracts on the investigated fungi could be attributed to the exudates which produced a range of compounds with inhibitor properties (secondary meta-bolites) retarding the growth of other microorganisms and antagonize the infection mechanisms of these organisms. These involved peptides, alkaloids and phenols (Campbell, 1984) and sometimes mono- and divalent cations

(Abdel-Rahman et al., 2004). Saffan (2001) reported that the quantitative analysis of some algal exudates revealed the presence of phytohormones, amino acids, total soluble nitrogen and total reducing sugars that might be implicated as allelochemical agents. Extra metabolites of algae may induce specific reactions or modify specific physiological activities either positively or negatively within the microbial pathogen. There appears to be no end to the discoveries of substances produced or liberated by some microalgae. Some workers reported that the analyses of extracellular sub-stances are difficult because of problems involved in separating organic substances one from another or from compounds in the medium (Prescott, 1969). Antibiotics have an important role in modern drug medicine. The philosophy behind their use in the treatment of infection is to kill the invading organisms without harming the host tissues. The development of antiviral drugs along similar lines has not lived up to early expectation because viruses do not show all the qualities of living organisms, However, with the discovery of the first antiviral drugs in 1950 and their first clinical use in 1962, it became clear that antiviral

therapy was possible (Bauer, 1985). Many traditional plants have been reported to have strong antiviral activity, and some of them have already been used to treat animals and people who suffer from viral infection (Hudson et al., 1999). One of these organisms is the marine algae, which have been reported to contain antiviral substances (Faulkner, 1986). In the present study, thirty crude extracts (each extracts was used with 3 doses) of 10 marine macroalgae were tested against the Newcastle sense virus (NDV)-(Paramyxoviridae) which is responsible for acute respiratory distress in chicken, and it represents a single-stranded RNA virus that can be successfully propagated in embryonated chicken eggs (ECE). The cytotoxicity of these 30 algal extracts to chicken embryos as a laboratory host system was detected, and data is presented in Table 3. The data showed clearly that both diethyl ether and acetone extracts of the tested algae are toxic to chicken embryos causing embryo death and presence of petechial hemorrhage all over the body of the embryo (Figure 1), while ethanol extract was not toxic, mainly in the lowest doses (0.05 and 0.01 ml). Therefore, ethanol extract was

Ibraheem et al.

8337

Table 2. Antifungal activities of the investigated diethyl ether, acetone and ethanol extracts of ten marine macroalgal species against three fungal species on the agar plate by diffusion assay method.

Antibiotic reference

Algal species & Algal extracts

Reference antibiotic (Amphotericin B 50 Âľ/disk) Control (Diethyl ether, acetone and ethanol)

*Candida albicans IMRU 3669 ++++ -

Inhibition zones (mm) Aspergillus flavus IMI 111023 +++ -

Fusarium oxysporum +++ -

Ulva lactuca

Diethyl ether Acetone Ethanol

++ ++++ ++

+ +++ +

+ -

Caulerpa racemosa

Diethyl ether Acetone Ethanol

+++ +++ ++

+ -

Galaxaura elongata

Diethyl ether Acetone Ethanol

++++ -

+++ -

Acanthophora spicifera

Diethyl ether Acetone Ethanol

++ -

Liagora farinosa

Diethyl ether Acetone Ethanol

++++ -

+ -

++++ -

Cystoseira compressa

Diethyl ether Acetone Ethanol

++ ++

Cystoseira. myrica

Diethyl ether Acetone Ethanol

+++ +++ -

Hydroclathrus clathratus

Diethyl ether Acetone Ethanol

Turbinaria ornata

Diethyl ether Acetone Ethanol

++ +++

+++ -

Padina pavonia

Diethyl ether Acetone Ethanol

++ -

Inhibition zones: - (no activity); + (3-10 mm); ++ (10-15 mm), +++ (15-20 mm) and ++++ (>20 mm). Pathogen*

used in a dose of 0.1 ml per egg (1 ml extract represent 100 mg dry algal matter). Evaluation of antiviral activity of ethanol extracts for the ten macro algae against NDV is

presented in Table 4. Data showed clearly that 7 out of 10 tested algal species have antiviral activity, resulting in 2 log or more reduction in virus titer. The antiviral activity

8338

Afr. J. Biotechnol.

Table 3. Cytotoxicity evaluation of ten marine algal extracts on chicken embryos (1 ml extract represent 100 mg dry algal matter).

Dose of extract Ulva lactuca Caulerpa racemosa Galaxaura elongata Acanthophora spicifera Liagora farinosa Cystoseira compressa Cystoseira myrica Hydroclathrus clathratus Turbinaria ornata Padina pavonia

0.05 L L L* L D L D L L L

Diethyl extract 0.1 D** D D L* D D D** D** D D

Type of solvent (ml crude extract / egg) Ethanol extract Acetone extract 0.2 0.05 0.1 0.2 0.05 0.1 0.2 D L L L L D D D D L D L D D D D L L L D D D L L D L D D D L L D L D D** D L L L L* D D D L L D L D D D L L L L* D D D L L L L D D D L L L L D D

L, Live embryo; D, dead embryo; *embryo lives with stunted (weak) growth; **embryo die with petechial hemorrhage all over the body.

Figure 1. (a) Petechial hemorrhage all over the body of the embryo; (b) normal chicken embryo; (c) lattice shape agglutination; (d) button-like precipitation.

Ibraheem et al.

8339

Table 4. Evaluation of 0.1 ml ethanol extracts of ten marine macro algae species in reduction of New Castle Disease Virus (NDV) titer in chicken embryos.

Algal species Ulva lactuca Caulerpa racemosa Galaxaura elongata Acanthophora spicifera Liagora farinosa Cystoseira compressa Cystoseira myrica Hydroclathrus clathratus Turbinaria ornate Padina pavonia

Virus alone 9.1 9.1 9.1 9.1 9.1 9.1 9.1 9.1 9.1 9.1

Virus titer log 10 EID50* Virus extract mixture Reduction in virus titer 6.4 2.7* 6.4 2.7* 6.7 2.4* 7.5 1.6 7.5 1.6 6.2 2.9* 6.8 2.3* 6.4 2.7* 8.1 1 6.3 2.8*

*2 log or more means significant reduction in virus titer.

of the tested algae may be attributed to their content of polysaccharides, which block viral adsorption point in the cell membrane of the host cell. This speculation comes in agreement with Baslow (1969), Baba et al. (1988), Mitsuya et al. (1988) and Ueno and Kuno (1987) who suggested that specific carbohydrates in marine red algae have antiviral activity against the infection of DNA and RNA virus. The data obtained therefore proved that some of the marine macro algae have antiviral activity, especially U. lactuca, C. racemosa, G. elongata, C. compressa, C. myrica, H. clathratus and P. pavonia. ACKNOWLEDGEMENTS The authors express their gratitude to the Deanship of Scientific Research and the Science Research Center in the College of Science, King Saud University, Saudi Arabia, for financially supporting this research effort. REFERENCES Abdel-Rahman IS, Sweiha HE, Mankarios AT, Hamoda RA (2004). Activity of some fresh-water and marine algae against tomato mosaic virus infectivity. 1. Effect of culture filtrates and water extracts, petrolium ether, chloroform and methanol extracts of algae on the virus activity in vitro. Abstract book of the Third International Conference on Biological Sciences. Fac. Sci. Tanta Univ. pp. 29-30. Abdel-Raouf N, Ibraheem IBM (2008). Antibiotic activity of two Anabaena species against four fish pathogenic Aeromonas species. Afr. J. Biotechnol. 7(15): 2644-2648. Allan WH, Lancoster JE, Toth B (1973). Production and use of New Castle disease Vaccines. Fao Rep. P.35, Rome. Italy, 111 spp. Amico V, Oriente G, Piattelli M, Tringali C (1978). Caulerpenyne, an unusual sesquiterpenoid from the green alga Caulerpa prolifera. Tetrahedron Lett. 38: 3593-3596. Anon A (1971). Methods for examination poultry biologics and for identifying & quantifying a vian pathogens. Natl. Acad. Sci. Washington, D.C. p. 1-184 Baba M, Nakjima M, Schools D, Pauwels R, Balzarini J, De Clercq E (1988). A sulphated oligosaccharides are potent and selective antiHiv agents in vitro. Anti-Viral. Res. (9): 335-343.

Ballesteros E, Martin D, Uriz MJ (1992). Biological activity of extracts from some Mediterranean macrophytes. Bot. Marina, 35: 481-485. Baslow MH (1969). Marine pharmacology the Williams and Williams Co. Baltimore. p. 56. Bauer DH (1985). A history of the discovery and clinical application of antiviral drugs. Br. Med. Bull. 41: 309-314. Blackman AG, Wells RG (1976). Caulerpol, a diterpene alcohol related to vitamin A, from Caulerpa brownie (algae). Tetrahedron Lett. 31: 2729-2730. Bold HC (1978). Introduction to the algae Structure and reproduction. Prentice. Hall. Inc., New-Jersey p. 07632. Borgesen F, Fremy P (1936). Marine algae from the Canary Islands especially from Teneriffre & Gran. Canaria: I- Chlorophyceae, IIPhaeophyceae, 111- Rhodophyceae, 1V-Cyanophyceae. Det. Kg I. Denske Videnskabernes. Borgesen F (1900). A contribution to the knowledge of the marine algal vegetation on the coasts of the Danish West-indian Islands. Botan. Tidskrift, 23 Bd. Koebenhavn, p. 49. Borgesen F (1931). Some Indian green and brown algae especially from the shores of the presidency of Bombay. J. Ind. Bot. Soc. 11: 51-70. Bouck GB (1965). Fine structure and organelle associations in brown algae. J. Cell. Biol. 26: 513-537. Caccamese S, Azzolina R (1979). Screening for antimicrobial activities in marine algae from eastern Sicily. Planta Med. 37(4): 333-339. Campbell JM (1984). Secondary metabolisms and microbial physiology. Adv. Microb. Physiol. 25: 2-57. Chengkui Z, Junfu Z (1984). Chinses seaweed in herbal medicine. In 11th International Seaweed Symposium (Bird, C.J & Ragan, M.A., editors), Dr. W. Junk Publishers, Dordrccht, Boston, Lancaster. pp. 135-140. Davet P, Rouxel F (2000). Detection and isolation of soil fungi. Sci. Publishers Inc. p. 188. Deig EF, Ehresmann DW, Hatch MT, Riedlinger DJ (1974). Inhibition of herpesvirus replication by marine algae extracts. Antimicrob. Agents Chemother. 6(4): 524-525. Doti MS, Santos GA (1966). Caulerpicin, toxic constituents of Caulerpa. Nature 211, 990, through C. A. 65: p. 15966. European Pharmacopoe (1997). Mikrobiologische Wertbestimmung von Antibiotika, Diffusionsmethode, 3. Ausgabe, Deutscher-ApothekerVerlag, Stuttgart, Kapitel 2,7,2. Faulkner DJ (1986). Marine natural Products. Nat. Prod. Rep. (3): 1-33. Fitton JH (2006). Antiviral properities of marine algae. In: Critchley AT, Ohno M, Largo DB (Eds). World seaweed resources. Windows and Macintosch. ETI Information Services, Workingham, U. K., p. 7. Haliki A, Denizci AA, Cetingul V (2005). An investigation on antifungal activities of some marine algae (Phaeophyta, Rhodophyta). Eur J. Fish. Aquat. Sci. 22: 13-15.

8340

Afr. J. Biotechnol.

Hamel G (1916). Chlorophycees des cotes francaise. Rev. Algol. (5): 381-430. Hudson JB, Kim JH, Lee MK, Dewreede RE, Hong YK (1999). Antiviral compounds in extracts of Korean seaweeds; evidence for multible activities. J. Appl. Phycol. (10): 427-434. Ibraheem IBM (1995). Phytochemical studies on some common algae of El-Sukhna and Abu-Qir Gulf. M.Sc. Thesis, Al-Azhar Univ., Fac. Sci. Cairo, Egypt. Ikigai H, Nakae T, Hara Y, Shimamura T (1993). Bactericidal catechins damage the lipid bilayer. Biochimica et Biophysica Acta. 1147: 132136. Kamat SY, Wahidulla S, D Souza L, Naik CG, Ambiye V, Bhakuni DS, Goel AK, Garg HS (1992). Bioactivity of marine organisms. VI. Antiviral evaluation of marine algal extracts from the Indian coast. Bot. Marina, 35: 161-164. Levring T (1946). A list of marine algae from Australia and Tasmania sartryck, meddelanden from Goteborgs Nataniska. Tragard. 16: 215227. Lima-Filho JVM, Carvalho AFFU, Freitas SM, Melo VMM (2002). Antibacterial activity of extract of six macroalgae from the northeastern Brazilian coast. Braz. J. Microbiol. 33: 3311-313. Mitsuya HDJ, Looney S, Kuno R, Ueno F, Wong-Staal F, Broder S (1988). Dextran sulphate suppression of viruses in the HIV family: inhibition of virion binding to CD4 and cells. Science, 240: 646-649. Mtolera MSP, Semesi AK (1996). Antimicrobial activity of extracts from six green algae from Tanzania. Curr. Trends Mar. Bot. Res. East Afr. Reg. pp. 211-217. Nagayama K, Iwamura Y, Shibata T, Hirayama I, Nakamura T (2002). Bactericidal activity of phlorotannins from the brown alga Ecklonia kurome. J. Antimicrob. Chemother. 50: 889-893. Nagayama K, Iwamura Y, Shibata T, Hirayama I, Nakamura T (2002). Bactericidal activity of phlorotannins from the brown alga Ecklonia kurome, J. Antimicrob. Chemo. 50: 889-893. Nakaamura T, Nagayama K, Uchida K, Tanaka R (1996). Antioxidant activity of phlorotannins isolated from the brown alga Eisenia bicyclis. Fish. Sci. 62: 923-926. Nasr AH (1940a). A repot on some marine algae collected from the vicinity of Alexandria. Fouad I Institute, Hydrobiol. Fisheries, 36: 133. Nasr AH (1940b). A study of the occurrence of some marine algae on the Egyptian Mediterranean coast. FouadI Hydrobiol. Fish. 2(37): 19. Nasr AH, Aleem AA (1949). Ecological studies of some marine algae from Alexandria. Hydrobiologia, 1: 251-281. Olessen PE, Maretzki A, Almodovar LA (1963). An investigation of antimicrobial substances from marine algae. Bot. Marina. 6: 226-232. Papenfuss GF (1940). Notes on south African Marine Algae. Chlorophyceae, Phaeophyceae, and Rhodophyceae. Botaniska Notiser. Lun. pp. 200-226. Papenfuss GF (1946). Proposed names for the phyla of algae. Bullet. Torrey Bot. Culb. 73(3): 217-218. Papenfuss GF (1955). Classification of the algae. In A century of Progress in the natural Sciences 1853-1953. Calif. Acad. Sci. San Francisco, pp. 115-224. Papenfuss GF (1968). A history, Catalogue and bibliography of Red Sea Benthic Algae. Israel J. Bot. 17: 1-118. Parr AE (1939). Quantitative observations on the pelagic Sargassum vegetation of the western North Atlantic, etc. Bull. Bingham Oceangr., Coll., Peabody Mus. Nat. 6: 1-94d. Paul VJ, Van-Alstyne KL (1987). The metabolism of diterpenoid from green seaweeds. J. Exp. Mar. Biol. Ecol. 119(1): p. 15.

Perez RM, Avila JG, Perez S, Martinez A, Martinez G (1990). Antimicrobial activity of some American algae. J. Ethnopharmacol. 29(1): 111-116. Prescott GW (1969). The algae. A review. Michigan State Univ., Butler & Tanner LTD, Frome and London. Great Br. p. 355. Rao PS, Parekh KS (1981). Antibacterial activity by Indian algal extracts. Botanica. Marina. 24: 577-582. Reed IJ, Muench H (1938). Simple methods of estimating fifty percent end points. Am. J. Hyg. 27: 493-497. Saffan SE (2001). Allelopathic effects of cyanobacterial exudates on some metabolic activities of Cynara cardunculus seeds during germination. Egypt. J. Biotecnol. 10: 157-178. Salvador N, Gomez-Garreta A, Lave L, Ribera MA (2007). Antimicrobial activity of Iberian macroalgae. Sci. Mar. 71m: 101-113. Scagel F (1966). The phaeophyceae in perepective oceanogr. Mar. Biol. Ann. Rev. 4: 123-194. Schulz J, Hunter M, Appel H (1992). Antimicrobial activity of polyphenols mediates plant-herbivore interactions. In Plant Polyphenols Hemingway RW and Lakes PE, Eds. pp. 621-637 Setchell WA, Gardner NL (1920). The marine algae of the pacific coast of North America. Part 11. Chlorophyceae. Univ. Calif. Publicat. Bot. 2: 139-374. Smith GM (1944). Marine algae of the Monterey Peninsula. Reprinted from Madrono. 7(7): 226-231. Svedelius N (1906). Ueber die Algenovegetation eines Ceylonischen Korallenriffes, etc., Bot. Stud. Till. F.R. Jjellman, Upsala. pp. 184-220. Taskin E, Ozturk M, Taskin E, Kurt O (2007). Antibacterial activities of some marine algae from the Aegean Sea (Turkey). Afr. J. Biotechnol. 6(24): 2746-2751. Taylor WR (1928). The marine algae of Florida with special reference to the dry Tortugas Pap. Tortugas Lab. of the Carnegie inst. Washington, 25: 1-219. Taylor WR (1960). Marine algae of the eastern tropical and subtropical coast of the Americas. Univ. Michigan press, Ann. Arbor. p. 870. Ueno R, Kuno S (1987). Dextran sulphate, a potent anti-HIV in vitro having synergism with zidovudine. Lancet. 1: 1379. Wedberg SE (1966). Introduction to microbiology. Reinhold Publishing Corporation. New York, p. 426. Zandi K, Fouladvan M, Pakdel P, Sartavi K (2007). Evaluation of in vitro antiviral activity of a brown alga (Cystoseira myrica) from the Persian Gulf against herpes simplex virus type 1. Afr. J. Biotechnol. 6(22): 2511-2514.

Full Length Research Paper

Chemical composition of essential oil of Psidium cattleianum var. lucidum (Myrtaceae) Raju K. Chalannavar1, Venugopala K. Narayanaswamy1, Himansu Baijnath1,2 and Bharti Odhav1* 1

Department of Biotechnology and Food Technology, Durban University of Technology, P O Box 1334, Durban 4000, South Africa. 2 School of Biological and Conservation Sciences, University of KwaZulu-Natal, Westville Campus, P Bag X54001, Durban 4000, South Africa. Accepted 12 April, 2012

The aim of this study was to investigate the essential oil composition of Psidium cattleianum var. lucidum from South Africa. The essential oils were extracted by hydrodistillation and the components were identified by gas chromatography coupled to mass spectrometry (GC-MS) to determine the chemical composition of the essential oil. A total of 53 chemical components were identified, accounting for 61% of the essential oil. The major component was caryophyllene oxide (12.43%), while other predominant constituents were identified as bicyclo(4.4.0)dec-l-ene (6.61%), 2,3-butanediol diacetate (4.84%) and patchoulene (4.73%). The presence of many terpenic and ester compounds is thought to contribute to the unique flavor of the P. cattleianum var. lucidum leaves. Key words:Psidium cattleianum var. lucidum, essential oil, hydrodistillation, caryophyllene oxide.

INTRODUCTION Global interest in biopreservation of food systems has recently been increased because of great economic costs of deterioration and poisoning of food products by food pathogens. Essential oils and extracts of various species of edible and medicinal plants consist of very potent natural biologically active agents (Nychas et al., 2003). However, until recently, very little significance was given to the natural, hidden and life-supporting services of the natural ecosystems. It is only when the disruption/loss of these natural resources poses/results in a severe threat to the very existence of human civilization that these intrinsic values have been highlighted. In fact, these services are ignored largely due to their non-marketable potential and a negligible role in modern trade economy. Nevertheless, during the last decade, the importance of these natural benefits has been highlighted and the perils linked to their loss realized. The phrase ‘ecosystem services’ has been widely used for these underpinned

*Corresponding author. E-mail: odhavb@dut.ac.za. Tel: +27 31 373 5330. Fax: +27 31 373 5351.

natural environmental benefits (Ehrlich and Ehrlich, 1981) and considered as ‘world’s natural capital’ (Costanza et al., 1997). As reported by the World Bank (2006), more than one billion people are directly dependent upon ecosystem services. Research into plant essential oils have also gained momentum due to their fumigant and contact insecticidal activities and the less stringent regulatory approval mechanisms for their exploration due to long history of use (Isman, 2006). Of late, the essential oils are being tried as potential candidates for weed control (Singh et al., 2003; Batish et al., 2004, 2007), and pest and disease management (Isman, 2000; Pawar and Thaker, 2006; Abad et al., 2007). Furthermore, essential oils are easily extractable, eco-friendly in that they are biodegradable and get easily catabolized in the environment (Zygadlo and Grosso, 1995), do not persist in soil and water (Misra and Pavlostathis, 1997; Isman, 2000, 2006), possess low or no toxicity against vertebrates, fishes, birds and mammals (Enan et al., 1998; Isman, 2000; Isman and Machial, 2006; Bakkali et al., 2008), and these enable the oils to have applications even in sensitive areas such as schools, restaurants, hospitals and homes.

8342

Afr. J. Biotechnol.

Looking at the importance of ecosystem services to mankind, it is worthwhile to explore environmental benefits of the natural products to mankind. Psidium cattleianum Sabine var. lucidum (Degener) Fosb. (P. cattleianum var. lucidum) is known as ‘Araca’ in Brazil and strawberry guava in many parts of the world. It belongs to the family Myrtaceae; the majority of these species are essential oil bearing plants. The family consists of about 75 genera and nearly 3000 species of mainly tropical evergreen trees and shrubs. Psidium is native to the Neotropics and is widely cultivated and naturalized in the tropical and subtropical areas of the world (Wagner et al., 1990). The species has been introduced to Hawaii, Mauritius, Australasia – Norfolk, Tropical Polynesia (Cronk and Fuller, 1995). Plants belonging to the Psidium genus have been known to exhibit several therapeutic properties, including antibacterial, hypoglycemic, anti-inflammatory, analgesic, anti-pyretic, spasmolytic and central nervous system depressant activities, and are therefore used as a popular medicine (Begum et al., 2002). The chemical composition of the essential oils can vary widely in different regions, principally because of environmental factors, as well as genetic factors that can induce modifications in the secondary metabolism of the plant (Taiz and Ziger, 1991). There are reports of the presence of isoflavonoids and volatile compounds from the leaves and the fruit oil of P. cattleianum Sabine (Pino et al., 2001; Lapcik et al., 2005.) The chemical compositions of the leaf oils of P. cattleianum Sabine from different geographical areas were assessed via gas chromatography (GC) and gas chromatography coupled to mass spectrometry (GC/MS). Depending on the location from which the samples were collected, the oil was composed of different percentages of the following primary components: β-caryophyllene, α-pinene, myrcene, α-thujene, 1,8-cineole, epi-α-murolol, α-cadinol, epi-αcadinol and caryophyllene oxide, at different percentages (Marques et al., 2008; Chen et al., 2007; Pino et al., 2004). The leaves of Psidium guajava a related species has been found to possess 1, 8-cineole and transcaryophyllene (Li et al., 1999; Chen et al., 2007; Cole and Setzer 2007). Pharmacological studies by recent workers (Manosroi, 2006; Sacchetti et al., 2005) show that these compounds have anti-proliferative, anti-oxidant and antimicrobial activities. No previous work on the chemical composition of the leaf oils of P. cattleianum var. lucidum has been reported, whereas three papers about P. cattleianum leaf oil composition has been published (Tucker et al., 1995; Pino et al., 2004; Limberger et al., 2001). In continuation of our ongoing research on extraction and characterization of essential oil constituents from natural plants (Chalannavar et al., 2011), herein we made an attempt to isolate and characterize the contents of the essential oils from leaves of P. cattleianum var. lucidum from KwaZuluNatal province of South Africa.

MATERIALS AND METHODS Leaves of P. cattleianum var. lucidum were collected in September 2010 in the KwaZulu-Natal province of South Africa. The species was identified and a voucher specimen has been deposited in the Ward Herbarium at University of KwaZulu-Natal, Westville Campus, Durban, South Africa. KwaZulu-Natal (Durban) lies at an altitude of ~40 m on latitude (29 48′S) and longitude (30 56′E).

Extraction of the essential oil The essential oil from dried leaves of P. cattleianum var. lucidum was extracted using a modification of an established procedure (Denny, 1989). Briefly, 100 g of milled leaves were hydrodistilled in a Clevenger apparatus. After 5 h of distillation, the essential oil was removed from the water surface. The oil was dried over anhydrous sodium sulphate and filtered. The solvent from the filtrate was removed by distillation under reduced pressure in a rotary evaporator at 35°C and the pure oil samples were sealed and kept in an amber colored bottle at 4°C in the refrigerator. The resulting pale yellow oil (40 µL) was dissolved in 1 ml of methyl ethyl ketone before the injection. 1 µl of this solution was directly used for GCMS analysis.

Gas chromatography-flame ionization detector (GC-FID) Capillary gas chromatography was performed using a Agilent system consisting of a model 6820 gas chromatograph (Agilent, USA), using a fused silica capillary column DB-5, 30 m × 0.35 mm, 0.1 μM film thickness (J & W Scientific, USA). The temperature program was set from 80 to 280°C in 1 to 20 min at 15°C/min. The injection temperature was 250°C and the injection volume was 1.0 µl. The inlet pressure was 100 kPa. Nitrogen was used as a carrier gas. Sampling rate was 2 Hz (0.01 min) and flow ionization detector temperature was set at 280°C.

Gas chromatography-mass spectrometry (GC-MS) The GC-MS analysis of the essential oil was performed on an Agilent GC 6890 model gas chromatograph-5973N model mass spectrometer equipped with a 7683 series auto-injector (Agilent, USA). A DB-5MS column (30 m × 0.25 mm × 0.25 μM film thickness) was used. Temperature program was set from 80 to 280°C in 1 to 20 min. Injection volume was 1 µL and inlet pressure was 38.5 kPa. Helium was used as carrier gas, with a linear velocity (u) of 31 cm/s. Injection mode was split (75:5). MS interface temperature was 230°C. MS mode was EI, detector voltage was 1.66 Kv, mass range was 10-700 u, scan speed was 2.86 scan/s and interval was 0.01 min (20 Hz).

Identification of components The components were identified by comparing the mass spectra with MS library. The NIST 98 spectrometer data bank was used for identification of the chemical composition and also compared on the basis of comparison of their retention indices and mass spectra with those given in the literature (Julian and Konig, 1988; Adams, 2007). Retention Indices (RI) were determined with reference to a homologous series of n-alkanes, by using the following formula (Kovats, 1958):

KI = 100 [n+(N-n) X

log t1R (unknown) -log t1R (Cn) log t1R (CN) -log t1R (Cn)

Chalannavar et al.

Where, t1R is the net retention time (tR-t0), t0 is the retention time of solvent (dead time), tR is the retention time of the compound, CN is the number of carbons in longer chain of alkane; Cn is the number of carbons in shorter chain of alkane; n is the number of carbon atoms in the smaller alkane and N is the number of carbon atoms in the larger alkane.

RESULTS AND DISCUSSION The average percentage of the essential oils of the dried leaves from P. cattleianum var. lucidum was light yellow with yields of 1.24% (v/w). A distribution of the different chemical groups of the compounds is shown in Figure 2. The compounds from essential oils are grouped in Table 1 based on their chemical structures in which they are classified. The GC-MS analysis of the oils of P. cattleianum var. lucidum resulted in 61% from 53 compounds (Table 1). The highest percentage of compounds (Figure 2) were oxygenated sesquiterpenes (17.53%), followed by hydrocarbons (16.70%), sesquiterpene hydrocarbons (5.87%), esters (5.34%), ketones (5.17%), acids (4.28%), alcohols (3.49%), oxygenated hydrocarbons (1.19%), amines (0.67%), amide (0.42%), aldehyde (0.35%) and diterpenes (0.33%). In the oxygenated sesquiterpenes, the major compounds of this populations are caryophyllene oxide made up (12.43%). Caryophyllene oxide is an important constituent of most of the Psidium species. Bicyclo(4.4.0)dec-l-ene (6.61%), 2,3-butanediol diacetate (4.84%), patchoulene (4.73%), butanone (2.71%), dodecatrien-3-ol (2.66%), alpha cadinol (2.24%), naphthalene (2.27%), azulene (2.22%), butonoic acid (1.97%), spiro(4.4)nonan-2-one (1.75%), naphthalene1,6-dimethyl (1.50%), 1H-cyclopropa (a) naphthalene (1.33%), cis-z-alpha-bisabolene epoxide (1.23%), ledol (1.08%) and acetic acid (1.07%) were found as other major compounds. The molecular structure of the major constituent of essential oil from P. cattleianum var. lucidum is depicted in Figure 1. Among the oxygenated sesquiterpenes, caryophyllene oxide (12.43%) was the major predominated compound. This compound is one of the main constituents of the essential oil from guava leaves from various countries such as China (18.8%), Cuba (21.6%), Nigeria (21.3%), Taiwan (27.7%) (Lie et al., 1999; Pino et al., 2001; Ogunwande et al., 2003; Chen et al., 2007). It is also found in Psidium myrsinoides as 19.7% (Freitas et al., 2002), Psidium salutare as 39.8% (Pino et al., 2003), Psidium striatulum as 7.6% (da Silva et al., 2003) and Psidium guajava fruit as 5.1% (Paniandy et al., 2000). This compound has been associated with antifungal activity against dermatophytes (Yang et al., 2000), has antimicrobial (de Souza et al., 2004; Brighteni et al., 2008) analgesic and anti-inflammatory activity (Chavan et al., 2010) and shows anti caries activity in rats (Menezes et al., 2010). It is also well known as a preservative in food, drugs and cosmetics (Yang et al., 2000). Despite its

8343

large array of biological activities, the other major compounds of this species are alpha cadinol, cis-Z-alphabisabolene epoxide and ledol. Within the sesquiterpene hydrocarbons, the major compounds of P. cattleianum var. lucidum were patchoulene, alpha-cubebene and caryophyllene. In the case of hydrocarbons and oxygenated hydrocarbons, the major compounds of P. cattleianum var. lucidum were bicyclo(4.4.0)dec-1-ene, azulene, naphthalene 1,2,3,4,4a,5,6,8 a-octahydro (1,2,3,4,4a,5,6,8aoctahydronapthalene), 1H-cyclopropa(a)naphthalene and ethoxy (methyl) chlorosilane, oxazole and oxirane. In the case of esters, alcohols, acids and ketones, the major compounds of P. cattleianum var. lucidum were 2,3butanediol diacetate, triacetin, dodecatrien-3-ol, 3heptanol, butanoic acid, acetic acid, 2-butanone and spiro(4.4)nonan-2-one. Among the diterpenes, the major compounds of P. cattleianum var. lucidum were hexadeca-2, 6, 10, 14-tetraen-1-ol, 3, 7, 11, 16tetramethyl (E, E, E). The compounds dioxolane-4carboxaldehyde (aldehyde), and 1-hexanamine, tetraacetylethylenediamine, tetradecanamine (amines) and butanamide (amide) were present in smaller quantities. Caryophyllene oxide, the main constituent of the essential oil in this study, is an important constituent of most of the Psidium species. Although most of these compounds are well documented as essential oil components in various plant species (Zhu et al., 1995), to our knowledge, this is the first report of their occurrence in the essential oil of P. cattleianum var. lucidum from South Africa. Interestingly, there were significant differences between the main components of the essential oil of P. cattleianum var. lucidum and those previously determined in other species of Psidium. Existing variations in oil content and composition may be attributed to factors related to ecotype, phenophases and the environment, including temperature, relative humidity, irradiance and photoperiod (Fahlen et al., 1997). Our results were generally different according to literature findings. The observed differences may be probably due to different environmental and genetic factors, different chemotypes and the nutritional status of the plants as well as other factors that can influence the oil composition. These results show that P. cattleianum var. lucidum are remarkably variable species. Actually, the high quantities of caryophyllene oxide make them a most interesting species from the economic point of view. The GC and GC-MS study of the essential from P. cattleianum var. lucidum led to the identification of 53 compounds, representing 61% of the total mass. The major components were terpenes and their derivatives and the most prominent one was caryophyllene oxide (12.43%). Essential oils are extensively used as flavor ingredient in a wide variety of food, beverage and confectionary products. The dominant presence of caryophyllene oxide in essential oils makes them

8344

Afr. J. Biotechnol.

Table 1. Chemical composition of essential oil from Psidium cattleianum var. lucidum.

Molecular formulae

Molecular weight

RIa

Percentage (%)

Aldehyde Dioxolane-4-carboxaldehyde Subtotal

C4H6O3

102

579

0.35 0.35

2 3 4 5 6 7

Ketones 2-Butanone Ethylene maleic anhydride 2H-Pyran-2-one Pentanedione (4-Fluorophenyl) acetone Spiro(4.4)nonan-2-one Subtotal

C4H8O C6H4O3 C5H4O2 C5H8O2 C9H9FO C9H14O

72 124 96 100 152 138

236 401 446 535 871 1004

2.71 0.29 0.13 0.25 0.04 1.75 5.17

8 9 10 11 12

Alcohols 3-Heptanol Pyrrolidinol Dodecatrien-3-ol 2,6-Octadien-1-ol Dodecatrien-1-ol Subtotal

C7H16O C4H9NO C12H20O C8H14O C12H20O

116 87 180 126 180

464 495 1478 965 1133

0.30 0.04 2.66 0.27 0.22 3.49

13 14 15 16 17 18

Acids Propanoic acid alpha-Chloroacrylic acid Hexanoic acid Butanoic acid Acetic acid Phenylacetic acid Subtotal

C3H6O2 C3H3ClO2 C6H12O2 C4H8O2 C2H4O2 C8H8O2

74 105 116 88 60 136

262 298 468 932 960 974

0.57 0.06 0.10 1.97 1.07 0.51 4.28

19 20 21

Esters 4-Trifluoroacetoxyoctane 2,3-Butanediol diacetate Triacetin Subtotal

C10H17F3O2 C8H14O4 C9H14O6

226 174 218

383 414 520

0.11 4.84 0.39 5.34

22 23 24

Amines 1-Hexanamine Tetraacetylethylenediamine Tetradecanamine Subtotal

C6H15N C10H16N2O4 C14H31N

101 228 213

481 547 605

0.02 0.59 0.06 0.67

Amides Butanamide Subtotal

C4H9NO

575

0.42 0.42

C7H8 C5H10 C6H11NS

92 70 129

755 512 559

0.59 0.13 0.32

Peak number

Chemical constituent

26 27 28

Hydrocarbons Toluene 2-Pentene Neopentyl isothiocyanate

Chalannavar et al.

8345

Table 1. Contd.

29 30 31 32 33 34 35 36 37 38 39

Butane 1H-Cycloprop(e)azulene Cycloundecatriene Cyclohexene 1H-Cyclopropa(a)naphthalene 1,2,3,4,4a,5,6,8a-octahydronaphthalene Naphthalene, decahydro-4a Bicyclo(4.4.0)dec-1-ene Azulene Naphthalene 1,6-dimethyl Cyclohexane Subtotal

C4H10 C11H8 C11H16 C6H10 C11H8 C10H16 C10H18 C10H16 C10H8 C12H12 C6H12

58 140 148 82 140 136 138 2033 128 156 84

588 866 878 890 904 916 991 1027 1299 1763 1100

0.64 0.19 0.04 0.14 1.33 2.27 0.15 6.61 2.22 1.50 0.57 16.70

C2H4O C4H9NO2 C3H3NO C3H9ClOSi

44 103 69 124

347 367 730 1192

0.13 0.05 0.38 0.63 1.19

C15H24 C15H24 C15H24 C15H24

204 204 204 204

1353 1423 1454 1360

0.89 0.20 0.05 4.73 5.87

40 41 42 43

Oxygenated hydrocarbons Oxirane sec-Butyl nitrite Oxazole Ethoxy(methyl)chlorosilane Subtotal

44 45 46 47

Sesquiterpene hydrocarbons alpha-Cubebene Caryophyllene alpha-Caryophyllene Patchoulene Subtotal

48 49 50 51 52

Oxygenated sesquiterpenes Caryophyllene oxide Ledol alpha-Cadinol trans-Z-alpha-Bisabolene epoxide cis-Z-alpha-Bisabolene epoxide Subtotal

C15H24O C15H26O C15H26O C15H24O C15H24O

220 222 222 220 220

1581 1602 1610 1495 1680

12.43 1.08 2.24 0.55 1.23 17.53

Diterpenes Hexadeca-2,6,10,14-tetraen-1-ol, 3,7,11,16-tetramethyl(E,E,E)Subtotal

C20H34O

290

1084

0.33 0.33

Total

CH3 H

O H

H H2C Figure 1. Structure of caryophyllene oxide.

8346

Afr. J. Biotechnol.

Figure 2. Essential oil constituents in Psidium cattleianum var. lucidum

potential natural preservatives in the food industry. ACKNOWLEDGEMENTS This work was financially supported by the National Research Foundation and the Durban University of Technology, South Africa. REFERENCES Abad MJ, Ansuategui M, Bermejo P (2007). Active antifungal substances from natural sources. ARKIVOC (vii), pp. 116-145. Adams RP (2007). Identification of Essential oil components by Gas th Chromatography/Mass spectrometry, (4 Ed). Allured Publishing Corporation. Carol Stream, Illinois. Bakkali F, Averbeck S, Averbeck D, Idaomar M (2008).Biological effects of essential oils - a review. Food Chem. Toxicol. 46: 446-475. Batish DR, Setia N, Singh HP, Kohli RK (2004). Phytotoxicity of lemonscented eucalypt oil and its potential use as a bioherbicide. Crop Prot. 23: 1209-1214. Batish DR, Singh HP, Setia N, Kohli RK, Kaur S, Yadav SS (2007). Alternative control of littleseed canary grass using eucalypt oil. Agron. Sust. Dev. 27: 171-177. Begum S, Hassan SI, Siddiqui BS, Shaheen F, Ghayur MN, Gilani AH (2002). Terpenoids from the leaves of Psidium guajava. Phytochemistry, 61: 399-403. Brighenti FL, Luppens SB, Delbem AC, Deng DM, Hoogenkamp MA, Gaetti-Jardim EJr, Dekker HL, Crielaard W, Ten Cate JM (2008). Effect of Psidium cattleianum leaf extract on Streptococcus mutans viability, protein expression and acid production, Caries Res. 42: 148154. Chalannavar RK, Baijnath H, Odhav B (2011). Chemical constituents of the essential oil from Syzygium cordatum (Myrtaceae). Afr. J. Biotechnol. 10(14): 2741-2745.

Chavan MJ, Wakte PS, Shinde DB (2010). Analgesic and antiinflammtory activity of caryophyllene oxide from Annona squamosa L. bark. Phytomedicine, 17(2): 149-151. Chen HC, Sheu MJ, Lin LY, Wu CM (2007). Chemical composition of the leaf essential oil of Psidium guajava L. from Taiwan. J. Essent. Oil Res. 19: 345-347. Cole RA, Setzer WN (2007). Chemical composition of the leaf essential oil of Psidium guajava from Monteverde, Costa Rica. J Essent. OilBear Plants. 10: 365-373. Costanza R, d’Arge R, de Groot R, Farberk S, Grasso M, Hannon B, Limburg K, Naeem S, O’Neill RV, Paruelo J, Raskin RG, Suttonkk P, van den Belt M (1997). The value of the world’s ecosystem services and natural capital. Nature, 387: 257-260. Cronk QCB, Fuller JL (eds.) (1995). Plant Invaders: The Threat to Natural Ecosystems. Chapman and Hall, London, UK. p. 241. da Silva JD, Luz AIR, da Silva MHL. Andrade EHA, Zoghibi MGB (2003). Essential oils of the leaves and stems of four Psidium spp. Flavour and Fragrance J. Vol. 18(3): 240-243. Denny EFK (1989). Hydrodistillation of oils from aromatic herbs. Perfum. Flavor. 14: 57-63. de Menezes TEC, Delbem ACB, Brighenti FL, Okamoto AC, GaettiJardim Jr. E (2010). Protective efficacy of Psidium cattleianum and Myracrodruon urundeuva aqueous extracts against caries development in rats. Pharma. Biol. 48: 300-305. de Souza GC, Haas AP, von Poser GL, Schapoval EE, Elisabetsky E (2004). Ethnopharmacological studies of antimicrobial remedies in the south of Brazil. J. Ethnopharmacol. 90: 135-143. Ehrlich PR, Ehrlich A (1981). Extinction: The Causes and Consequences of the Disappearance of Species, Random House, New York. p. 305. Enan E, Beigler M, Kende A (1998). Insecticidal action of terpenes and phenols to cockroaches: effect on octopamine receptors. In: Proceedings of the International Symposium on Plant Protection. Gent. Belgium. Fahlen A, Walander M, Wennersten R (1997). Effect of lighttemperature regime on growth and essential oil yield of selected aromatic plants. J. Sci. Food Agric. 73: 111-119. Freitas MO, De Morais SM, Silveira ER (2002). Volatile constituents of

Chalannavar et al.

Psidium myrsinoides O. Berg. J. Essent. Oil. Res. 14 (5): 364-365. Isman MB, Machial CM (2006). Pesticides based on plant essential oils: from traditional practice to commercialization. In: Rai M, Carpinella MC (Eds.). Naturally Occurring Bioactive Compounds. Advances in Phytomedicine, vol. 3. Elsevier. pp. 29-44. Isman MB (2000). Plant essential oils for pest and disease management. Crop Prot. 19: 603-608. Isman MB (2006). Botanical insecticides, deterrents, and repellents in modern agriculture and an increasingly regulated world. Annu. Rev. Entomol. 51: 45-66. Julian D, Konig WA (1988). The Atlas of Spectral Data of Sesquiterpene Hydrocarbons. E.B. Verlag, Hamburg, Germany. Kovats E (1958). Characterization of organic compounds by gas chromatography. Part 1. Retention. Indices of aliphatic halides, alcohols, aldehydes and ketones. Helv. Chem. Acta. 41: 1915-1932. Lapcik O, Klejdus B, Kokoska L, Davidova M, Afandi K, Kuban V, Richard H (2005). Identification of isoflavones in Acca sellowiana and two Psidium species (Myrtaceae). Biochem. Syst. Ecol. 33: 983-992. Li J, Chen F, Luo J (1999). GC-MS analysis of essential oil from the leaves of Psidium guajava. Zhong Yao Cai. 22: 78-80. Limberger RP, Farias FM, Sobral M, Zuanazzl JA, Henrtques AT (2001). Chemical composition of the volatile oil from Psidium cattleyanum, Psidium guajava, Psidium incanum and Psidium luridum (Myrtaceae). Revlsta Bras. Farm. 82: 53-55. Marques FA, Wendler EP, Maia BHLNS, Coffani-Nunes JV, Campana J, Guerrero Jr PG (2008). Volatile Oil of Psidium cattleianum Sabine from the Brazilian Atlantic forest. J. Essent. Oil Res. 20: 519-520. Manosroi J, Dhumtanom P, Manosroi A (2006). Anti-proliferative activity of essential oil extracted from Thai medicinal plants on KB and P388 cell lines. Cancer Lett. 235: 114-120. Misra G, Pavlostathis SG (1997). Biodegradation kinetics of monoterpenes in liquid and in soil-slurry system. Appl. Microbiol. Biotechnol. 47: 572-577. Nychas GJE, Tassou CC, Skandamis P (2003). Antimicrobials from herbs and spices. In Roller SM (Ed.), Natural antimicrobials for the minimal processing of foods. New York: CRC Press, Woodhead Publishers. pp. 176-200. Ogunwande IA, Olawore NO, Adeleke KA, Ekundayo O, Koenig WA (2003). Chemical composition of the leaf volatile oil of Psidium guajava L. growing in Nigeria. Flavour Fragrance J. 18: 136-138. Paniandy JC, Chane-Ming J, Pieribattesti JC (2000). Chemical composition of the essential oil and headspace solid-phase microextraction of the guava fruit (Psidium guajava L.). J. Essent. Oil Res. 12 (2): 153-158. Pawar VC, Thaker VS (2006). In vitro efficacy of 75 essential oils against Aspergillus niger. Mycoses, 49: 316-323. Pino JA, Marbot R, Vazquez DC (2001). Characterization of volatiles in strawberry guava (Psidium cattleianum Sabine) fruit. J. Agric. Food Chem. 49: 5883-5887. Pino JA, Aguero J, Marbot R, Fuentes V (2001). Leaf oil of Psidium guajava L. from Cuba. J. Essent. Oil Res. 13: 61-62.

8347

Pino JA, Bello A, Urquiola A, Aguero J, Marbot R (2003). Leaf oils of Psidium cymosum Urb. and Psidium sartorianum Niedz. from Cuba. J. Essent. Oil Res. 15: 187-188. Pino JA, Bello A, Urquiola A, Marbot R, Marti MP (2004). Leaf oils of Psidium parvifolium Griseb. and Psidium cattleianum Sabine from Cuba. J. Essent. Oil Res. 16: 370-371. Sacchetti G, Maietti S, Muzzoli MV, Scaglianti M, Manfredini S, Radice M, Bruni R (2005). Comparative evaluation of 11 essential oils of different origin as functional antioxidants, antiradicals and antimicrobials in foods. Food Chem. 91: 621-632. Sibanda S, Chigwada G, Poole M, Gwebu ET, Noletto JA, Schmidt JM, Reac AI, Setzer WN (2004). Composition and bioactivity of the leaf essential oil of Heteropyxis dehniae from Zimbabwe. J. Ethnopharmacol. 92: 107-111. Singh HP, Batish DR, Kohli RK (2003). Allelopathic interactions and allelochemicals: new possibilities for sustainable weed management. Crit. Rev. Plant Sci. 22: 239-311. Taiz L, Zeiger E (1991). Surface protection and secondary defense compound. In: Plant Physiol. California: Benjamin/Cumming. pp. 318345. Tucker AO, Maciarello MJ, Landrum LR (1995). Volatile leaf oils of American Myrtaceae. III. Psidium cattleianum Sabine, P. friedrichsthalianum (Berg) Niedenzu, P.guajava L., Psidium guineense Sw., and Psidium sartorianum (Berg) Niedenzu. J. Essent. Oil Res. 7: 187-190. World Bank (2006). Strengthening Forest Law Enforcement and Governance. World Bank, Washington DC. Wagner WL, Herbst DR, Sohmer SH (1990). Manual of flowering plants of Hawaii. University of Hawaii and Bishop Museum Press, Honolulu, USA. Yang D, Michel L, Chaumont JP, Clerc JM (2000). Use of caryophyllene oxide as an antifungal agent in an in vitro experimental model of onychomycosis. Mycopathologia. 148(2): 79-82 Zhu LF, Li YH, Li BL, Lu BY, Zhang WL (1995). Aromatic plants and essential constituents (supplement 1). South China Institute of Botany, Chinese Academy of Sciences (Ed); Hai-Feng Publishing Co. Hong kong. Zygadlo JA, Grosso NR (1995). Comparative study of the antifungal activity of essential oils from aromatic plants growing wild in the central region of Argentina. Flavors Frag. J. 10: 113-118.

African Journal of Biotechnology Vol. 11(33), pp. 8348-8352, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.340 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Regulatory effects of Tenebrio molitor Linnaeus on immunological function in mice Qingfeng Tang1, Yin Dai2 and Benguo Zhou3* 1

Institute of Insect Resources Development and Utilization, School of Plant Protection, Anhui Agricultural University, 130# West Changjiang Road, Hefei 230036, P. R. China. 2 Institute of Animal Husbandry and Veterinary Science, Anhui Academy of Agricultural Sciences, 40# South Nongke Road, Hefei 230031, P. R. China. 3 Institute of Tobacco Research, Anhui Academy of Agriculture Sciences, 40# South Nongke Road, Hefei 230031, P. R. China. Accepted 28 March, 2012

This paper describes the results of experiments to test the effect of the larvae of Tenebrio molitor Linnaeus on the immune systems of mice. Mice were given a decoction of T. molitor in water at doses of 1.87, 3.75 and 7.50 g/kg/d for four weeks, after which their immune function was studied. The results indicate that T. molitor observably enhanced the carbon expurgatory index and phagocytic index. The half of hemolysis values in serum of treated mice increased compared to the control group. Furthermore, serum nitric oxide (NO) content in all treatment groups was higher than that of the control group whereas acid phosphatase and alkaline phosphatase activity was only significantly higher in the high dose group relative to the control group. We conclude that T. molitor can enhance the immune function of mice and therefore, this insect has the potential of a health food supplement. Key words: Tenebrio molitor Linnaeus, mice, immunoregulation, immunological function. INTRODUCTION Yellow mealworm beetles Tenebrio molitor Linnaeus (Tenebrionidae, Coleoptera) are considered scavengers and are typically found to be injurious to insects in warehouses for agricultural products. Most prefer to feed on decaying grain or milled cereals in damp, poor conditions, sometimes infesting cornmeal, flour, cake mixes, cereals, meat scraps, dead insects, bran and litter from chicken houses; they have even been found in sparrow's nests where they feed on the droppings (Cotton, 1963; Weaver et al., 1990; Ye et al., 2001).Traditionally, mealworm has a long history of use as food supplement. They are typically used as a food source for reptile, fish, and avian pets. They are also

*Corresponding author. E-mail: tangqf55@163.com. Tel/Fax: +86 551 5786321. Abbreviations: SRBC, sheep red blood cells; HC50, half of hemolysis values.

provided to wild birds in bird feeders, particularly during the nesting season, when birds are raising their young and appreciate a ready food supply. T. molitor larvae are generally regarded as a rich source of protein, vitamins, essential amino acids, minerals and essential fatty acids like linolenic acid. The contents of toxic heavy metals were lower than national standards (Bai and Cheng, 2003; Gerber, 1984; Xia, 1994). Experiments on mice fed with the filtrate of larval powder solution showed that the insect sample was safe to the mice, and it was effective as an antifatigue, delaying aging, decreasing the level of serum total cholesterol and micronuclear rate in polychromatic erythrocytes, and increasing the perilymphocyte transformative rate in tested mice or mice (Yang et al., 1999). The various healthful function of the insect sample is based on the integration of its effective nutrition components. As a result, they are known as "golden grubs" and make excellent fish bait and serve as food for animals in aquariums and zoological parks. The insect is worthy of exploration as the healthful food for human. Chang (1994) reported that yellow mealworm

Tang et al.

larvae could become an ingredient for Chinese sauces, biscuits, etc. They can be purchased at many pet stores. The potential for annual mealworm production in China is estimated at more than 100 tons (Zhang et al., 2008). The immune system is involved in the etiology as well as pathophysiologic mechanisms of various diseases and its function and efficiency is influenced by many exogenous and endogenous factors such as food, pharmaceuticals, physical and psychological stress, resulting in either immunosuppression or immunostimulation (Geetha et al., 2005). There is growing interest in identifying and characterizing insects with immunomodulatory activity. A number of insects used in Chinese traditional medicines and food systems for rejuvenation therapy have been demonstrated to modulate immune responses (Zhang and Xu, 1990). Unfortunately, our knowledge and understanding of the immunological function of mealworm is very limited. No systematic studies have been reported to prove scientifically the immunomodulatory activity of T. molitor larvae. Here, we investigated the immunomodulatory activity of T. molitor larvae in normal mice. The objective of this work was to provide the scientific basis for the comprehensive utilization of the insect, improve the insect utilization efficiency, and evaluate the potential for future applications.

with larvae powder extract (high-dosage group 7.50 g · kg-1 · d-1). Mice were orally administered a dose of 0.025 ml · g-1 body weight of larvae powder extract once daily for four consecutive weeks. The control mice were given distilled water only by the same method. After four weeks of oral administration, the immunomodulatory effect of the larvae of yellow mealworm was obtained from each experimental group by the previously described method.

Carbon clearance test To test the function of the macrophages in treated and control animals, experimental mouse was injected with Indian ink which was used as granular foreign body. The Indian ink was phagocytized and cleared by mononuclear macrophage after it went into circulation. After four consecutive weeks of oral administration, each mouse was injected with Indian ink (0.1 ml/10 g body weight) through mouse tail vein. In the second (t 1) and tenth minute (t2) after injection, 20 μl of blood was drawn from the orbital venous plexus of mice’ eye sockets with suction tube which was moistened with heparin solution and diluted in 2 ml 0.1% sodium carbonate solution. Mice were sacrificed and the body, thymus, and spleen were collected and weighed. The optical density (OD) values of blood solution were assayed with a 721 spectrophotometer at a wavelength of 600 nm, and the K (representing the capability of carbon granule clearance from mouse blood) and α (representing the phagocytosis activity of macrophage) values were calculated according to the formula: K=

lgOD at 2 min lgOD at 10 min t 2 t1

α=

Body weight Spleen weight Thymus weight

MATERIALS AND METHODS Insect The yellow mealworm were subsequently cultured in the insect rearing room at the Anhui Agricultural University, on a diet of wheat bran, whole wheat flour, and brewer's yeast (50:45:5 w/w) at 26±1°C and 55± 5% relative humidity and a photoperiodic regime of 12 h light and 12 h darkness. Mealworm larvae (7 to 10 th instars) that were used were obtained from the laboratory stocks. The larvae, which were removed from culture and held in clean Petri dish without food for 24 h, were burnt to death by boiling water and dried to constant weight at 80°C. Lastly, the powders of dried T. molitor larvae were pulverized. 30 g powdered larvae samples were weighed and extracted with distilled water by stirring at room temperature for 2 h. The resultant suspension was filtered through a two-fold layer of muslin. The filtrate was concentrated to 100 ml with rotary evaporator, and the liquid was 0.3 g/ml (equivalent to raw material) and diluted before use. The extract was prepared just before the experiments.

Animals Normal KunMing mice were purchased from the laboratory animal center of Anhui Institute of Medical Science, and the animals were kept in air controlled rooms. The experiments were conducted on female KunMing mice weighing 20±2 g maintained at 25±2°C with normal mouse chow and water ad libitum. The animals were housed, five per cage, and maintained on 12 h day and night cycle. The animals were divided into four groups comprising ten mice each: Group I, control animals (distilled water control); Group II: animals fed with larvae powder extract (low-dosage group 1.87 g · kg-1 · d-1); Group III: animals fed with larvae powder extract (moderate-dosage group 3.75 g · kg-1 · d-1); Group IV, animals fed

8349

Serum hemolysin assay Sheep blood was put into a sterile flask containing crystal ball and shaken to remove the fiber. The solution was rinsed three times with saline before centrifugation at 2000 rpm for 10 min. The supernatant was abandoned and the sheep red blood cells (SRBC) were prepared. After 24 days oral administration, 0.2 ml of 20% (v/v) SRBC was intraperitoneally injected into each mouse. Five days later, blood was drawn from the orbital venous plexus of mice’ eye sockets with suction tube and serum was isolated from normal mice’ blood as well. Serum samples were diluted with normal saline to 1/400. The value of absorbance at the 50% hemolytic dose (HC50) was determined by colorimetric method with a 721 spectrophotometer at a wavelength of 540 nm: HC50 =

Value of samples absorbance Dilution of serum Value of absorbance at SRBC 50% hemolytic dose

Acid phosphatase and alkaline phosphatase assay After four consecutive weeks of oral administration, blood was drawn from the orbital venous plexus of mice’ eye sockets with suction tube. The centrifuge tubes remained relatively static for 10 min and were incubated at 4°C in the refrigerator overnight, fixed with the blood from which serum precipitated. According to the method of Reagent Kit (Nanjing jiancheng Bioengineering Institute),

8350

Afr. J. Biotechnol.

Table 1. Effect of T. molitor on the carbon particles clearance of mice (n=10,

Group Negative control Low-dosage group Moderate-dosage group High-dosage group

-1

Dosage (g · kg · d ) 0 1.87 3.75 7.50

±SD).

Expurgatory index (K) 0.009±0.005 0.012±0.008 0.019±0.011* 0.027±0.009*

Phagocytic index (α) 5.02±1.32 5.09±1.09 5.19±1.21 5.95±1.02*

Values in the same column followed by one asterisk means significant difference at 0.05 level compared to the control group.

Table 2. Effect of T. molitor on the hemolysin of mice (n=10,

Group Negative control Low-dosage group Moderate-dosage group High-dosage group

Dosage (g · kg-1 · d-1) 0 1.87 3.75 7.50

±SD).

Half of hemolysin values (HC50) 105.23±7.26 108.11±6.13 110.94±9.65 119.84±9.06*

Values in the same column followed by one asterisk means significant difference at 0.05 level compared to the control group.

the activity of acid phosphatase and alkaline phosphatase was measured.

weight T. molitor. The phagocytic index was significantly increased from 5.02 in negative control to 5.95, in the −1 group treated with 7.50 g · kg body weight T. molitor.

Serum nitric oxide (NO) assay After four consecutive weeks of oral administration, blood was drawn from the orbital venous plexus of mice’ eye sockets with suction tube. The centrifuge tubes remained relatively static for 10 min and were incubated at 4°C in the refrigerator overnight, fixed with the blood from which serum precipitated. According to the method of Reagent Kit (Nanjing jiancheng Bioengineering Institute), the content of NO was measured.

Statistical analysis The results are reported as mean ± standard deviations. Statistical evaluation of the data was done using Student’s t-test. A probability value of < 0.05 was considered significant.

RESULTS Effect of T. molitor on the carbon particles clearance of mice Effect of T. molitor administration on the carbon particles clearance of mice is given in Table 1. T. molitor extract administration was found to enhance the expurgatory index (K) and phagocytic index (α). It was dosedependent to potentiate the capability of carbon granule clearance and the phagocytosis activity of macrophage in mice. Expurgatory index was significantly increased from 0.009 in negative control to 0.019 and 0.027, respectively in the group treated with 3.75 g and 7.50 g · kg−1 body

Effect of T. molitor on the hemolysin of mice The effect of T. molitor on humoral immune response in mice was tested. As shown in Table 2, difference in HC50 was significantly increased from 105.23 in negative control to 119.84, in group treated with 7.50 g · kg−1 body weight T. molitor. No significant differences were found in dosage of 1.87 g and 3.75 g · kg−1 body weight compared to negative control. However, it was dose-dependent to potentiate the humoral immune response in mice.

Effect of T. molitor on the acid phosphatase and alkaline phosphatase activity of mice Effect of T. molitor administration on the acid phosphatase and alkaline phosphatase activity of mice is given in Table 3. T. molitor extract administration was found to enhance the acid phosphatase and alkaline phosphatase activity. It was dose-dependent to potentiate the activity of the acid phosphatase and alkaline phosphatase in mice. The acid phosphatase activity was significantly increased from 4.81 in the negative control to 7.09 in the group treated with 7.50 g · kg−1 body weight T. molitor. The alkaline phosphatase activity was significantly increased from 8.01 in the negative control to 11.93 in the group treated with 7.50 g · kg−1 body weight T. molitor. However, no significant differences were found

Tang et al.

Table 3. Effect of T. molitor on the acid phosphatase and alkaline phosphatase activity of mice (n=10,

Group Negative control Low-dosage group Moderate-dosage group High-dosage group

Dosage (g · kg-1 · d-1) 0 1.87 3.75 7.50

8351

±SD).

Acid phosphatase activity (U/100 ml)

Alkaline phosphatase activity (King unit /100 ml)

4.81±0.94 5.04±1.21 5.59±1.04 7.09±1.38*

8.01±1.64 8.29±2.18 8.37±2.06 11.93±1.98*

Values in the same column followed by one asterisk means significant difference at 0.05 level compared to the control group.

Table 4. Effect of T. molitor on the serum NO content of mice (n=10,

Group Negative control Low-dosage group Moderate-dosage group High-dosage group

-1

Dosage (g · kg · d ) 0 1.87 3.75 7.50

±SD).

NO content (μmol/L) 8.94±1.49 8.62±1.98 14.65±2.31* 16.69±2.88*

Values in the same column followed by one asterisk means significant difference at 0.05 level compared to the control group.

in dosage of 1.87 g and 3.75 g · kg−1 body weight compared to the negative control. Effect of T. molitor on the serum NO content of mice The effect of T. molitor on the serum NO content in mice was tested. As shown in Table 4, difference in ear thickness was significantly increased from 8.94 in the negative control to 14.65 and 16.69, in the group treated with 3.75 and 7.50 g · kg−1 body weight T. molitor, respectively. However, no significant differences were found in dosage of 1.87 g · kg−1 body weight compared to the negative control. DISCUSSION Immunoregulation is a complex balance between regulatory and effector cell and any imbalance in the immunological mechanism can lead to pathogenesis (Davis and Kuttan, 2000). Immunity has been shown to be suppressed in cancer. Chemotherapy and radiation therapy, useful in cancer treatment, were found to deteriorate the immunity. The yellow mealworm, as an important food supplement, contains abundant active components such as proteins, amino acids, unsaturated fatty acids, flavones and alkaloids, etc. In fact, essential nutrients and an array of phytonutrients have been shown to affect almost every aspect of the immune system (Geetha et al., 2005). Our laboratory has reported earlier that an extract from the yellow mealworm could stimulate the immunity in normal mouse. In this study, the

immunomodulatory activity of T. molitor, an important food supplement was explored. It is well known that macrophages are important cells in the immune response, especially in the anti-infection immunity. Administration of T. molitor was found to increase the carbon expurgatory index and phagocytic index significantly, indicating that the extract could stimulate the nonspecific phagocytic function. The humoral immune response is the aspect of immunity that is mediated by secreted antibodies produced in the cells of the B lymphocyte lineage. Humoral immunity is so named because it involves substances found in the humours, or body fluids. Through the determination of hemolysin in serum content, we can know the immune response and its intensity (Zheng, 1995; Jin, 2001; Si, 1999). The extract was found to enhance half of hemolysin values indicating that the extract could stimulate humoral immune response. Macrophages are cells produced by the differentiation of monocytes in tissues. Macrophages function in both non-specific defense (innate immunity) as well as help initiate specific defense mechanisms (adaptive immunity) of vertebrate animals. Their role is to phagocytose cellular debris and pathogens, either as stationary or as mobile cells. They also stimulate lymphocytes and other immune cells to respond to pathogens. Phosphatase is an important biological detoxification enzyme systems and its activity reflects the activated degree of macrophages. NO is the important medium and the initial factor that play important cell functions, involved in a series of immune regulation effects (He and Sun, 1992; Ding et al., 2005). T. molitor extract administration was found to enhance the serum NO content, acid

8352

Afr. J. Biotechnol.

phosphatase and alkaline phosphatase activity, indicating that T. molitor can effectively protect the biological immune system of mice, and enhance non-specific immune function. Conclusion In conclusion, T. molito enhanced immune indexes compared with the negative control. The results indicate that T. molito had a potency to potentiate the immune responses in mice. At present, we do not know which compounds are responsible for the immunostimulatory activity produced by this extract. Further studies using isolated compounds are in progress. ACKNOWLEDGEMENT This work was financially supported by the Youth Foundation of Anhui Agricultural University (Grant No. 2009ZR16). REFERENCES Bai Y, Cheng J (2003). Nutritive value and rearing methods of Tenebrio molitor in China. Entomol. Knowl. 40(4): 317-322. Chang T (1994). The insects food processing from yellow mealworm. The Paper Presentation Congress of Northwest Agricultural University. Cotton RT (1963). Pests of stored grain and grain products. Burgess Publishing Co., Minneapolis, Minnesota. p. 10-21 Davis L, Kuttan G (2000). Immunomodulatory activity of Withania somnifera. J. Ethnopharmacol. 71(1-2): 193-200. Ding TM, Chen J, Zhang ZX (2005). The methods for determination of nitric oxide in vivo and their applications. Prog. Pharm. Sci. 29(5): 221-226. Geetha S, Singh V, Ram MS, Ilavazhagan G, Banerjee PK, Sawhney RC (2005). Immunomodulatory effects of seabuckthorn (Hippophae rhamnoides L.) against chromium (VI) induced immunosuppression. Mol. Cell. Biochem. 278(1-2): 101-109.

Gerber GH (1984). Ovipesition site selection in Tenebrio molitor (Coleoptera; Tenebrionidae). Can. Entomol. 116(1): 27-39. He HQ, Sun F (1992). Study on the characteristics of acid and alkaline phosphatases in Chinese shrimp, Penaeus chinensis. Oceanol. Limnol. Sin. 23(5): 555-560. Jin ZL (2001). Health food function evaluation and development. China Light Industry Press. Si CP (1999). Medical immunology experiment. People's Medical Publishing House. p. 81-89 Weaver DK, Mcfarlane JE, Alli I (1990). Repellency of volatile fatty acids present in frass of larval yellow mealworms, Tenebrio molitor L. (Coleoptera: Tenebrionidae), to larval conspecifics. J. Chem. Ecol. 16(2): 585-593. Xia B (1994). A study on the yellow mealworm Nutr. Element. Insect. Knowl. 31(3): 175-176. Yang ZF, Lin YX, Chen YS, Wu XN (1999). Nutritional components of the larvae of Tenebrio molitor L. and its control. Entomol. Knowl. 36(2): 97-100. Ye XQ, Liu DH, Hu C (2001). Some factorsâ&#x20AC;&#x2122; effects on the solubility of protein from yellow mealworm (Tenebrio molitor L) larvae. J. Zhejiang Univ. Sci. 2(4): 436-438. Zhang C, Tang X, Cheng J (2008). The utilization and industrialization of insect resources in China. Entomol. Res. 38(1): S38-S47. Zhang C, Xu WH (1990). Resource insects. Shanghai Sci. Technol. Press. Zheng JX (1995). Functional food. China Light Industry Press.

Full Length Research Paper

Effect of dietary protein, lipid and carbohydrate contents on the carcass composition of Cyprinus carpio communis fingerlings Muzaffar Ahmad*, Qureshi T. A. and Singh A. B. Department of Zoology and Applied Aquaculture, Barkatullah University, Bhopal, M. P. 462026, India. Accepted 1 December, 2011

Fingerlings having average weight of 1.64 ± 0.13 g and length 5.26 ± 0.10 cm were fed on four different formulated feeds and a control feed (each in a triplicate set), 6% of their body weight, three times a day, during 90 days. Feeds were formulated using groundnut oil cake, mustard oil cake, rice bran, wheat bran, fish meal and soybean meal in order to suffice the balanced need of protein and energy of the Common carp. Carcass composition was determined initially, at the end of 30 days and at the end of the study. At the end of 30 days, carcass composition of fingerlings was not affected significantly (P>0.05) with protein, lipid and carbohydrate contents in the feeds. At the end of the study, carcass composition of fingerlings was affected significantly (P<0.05) with protein, lipid and carbohydrate contents in the feeds. Highest carcass dry matter, crude protein, crude lipid, ash and energy content, lowest moisture content and carbohydrate content were observed in fingerlings fed with Feed B which contained 40 ± 0.21% protein, 9.31 ± 0.25% lipid and 10.08 ± 0.10% carbohydrate. The fingerlings fed with Feed C which contained 25.98 ± 0.19% protein, 5.49 ± 0.18% lipid and 34.63 ± 0.19% carbohydrate showed least carcass dry matter, crude protein, crude lipid, ash and energy content, highest moisture content and carbohydrate content. This study concluded that Feed B containing 40% protein, 9.31% lipid and 10.08% carbohydrate is the best one in terms of carcass composition for a more profitable and successful culture of the common carp. Key words: Cyprinus carpio communis, fingerlings, carcass composition.

INTRODUCTION Proteins are the major organic materials in most fish tissue, and form an important component of the diet. One of the major requirements of fish culture is the efficient transformation of dietary protein into tissue protein (Webster and Lim, 2002). However, protein is essential for normal tissue function, for the maintenance and renewal of fish body protein and for growth. Because of the cost of the protein, the feed will be more cost effective if all the protein is used for tissue repair and growth and little catabolized for energy (Gauquelin et al., 2007). From a practical point of view, the ideal situation should tend to maximize the use of dietary protein for growth, minimizing

*Corresponding author. Email: muzaffarahmad8@gmail.com. Tel: 9018877446 or 9086768832.

the use of proteins for functional protein synthesis, gluconeogenesis, lipogenesis and energy (Jamabo and Alfred, 2008). If adequate protein is not provided in the diet, there is a rapid reduction or cessation of growth and a loss of weight due to withdrawal of protein from less vital tissues to maintain the functions of more vital tissues. On the other hand, if too much protein is supplied in the diet, only part of it will be used to make new proteins and the remainder will be catabolized to produce energy (Alatise et al., 2006). Although the utilization of proteins for basal energy metabolism is a well-established phenomenon, conventional “energy- yielding” nutrients like fats and carbohydrates can reduce the oxidation of protein to satisfy the energy needs of fish and thus improve the utilization of dietary protein (Kim et al., 2004). Lipids are an extremely diverse group of compounds

8354

Afr. J. Biotechnol.

many of which function as important sources of metabolic energy. Among the various types of lipid it is the simple, glycerol based, fats and oils that are of most interest in terms of general nutrition (Du et al., 2008). Lipids normally occur in foodstuffs and in the fat deposits of most animals in the form of triglycerides, which are esters of fatty acids and glycerol (Kiessling et al., 2001). Thus, dietary lipids provide a source of indispensable nutrients, the essential fatty acids. In addition, they also act as carriers of certain non-fat nutrients, notably the fat-soluble vitamins A, D, E and K and they are also an important source of energy (Storebakken, 2002). Lipids contain more energy per unit weight than any other biological compound. For example, one gram of lipid contains almost twice, as much total energy as either one gram of carbohydrate or one gram of protein (Gullaine et al, 2001). Dietary lipids, mainly in the form of triglycerides, are hydrolyzed to free fatty acids and glycerol by pancreatic lipase, aided by the saponifying and emulsifying action of bile acids in the digestive tract. Absorption generally occurs primarily in the anterior ileum including the caecum (Subhadra et al., 2006). Energy that is not utilized immediately is stored for future use as glycogen and carcass fat. Since glycogen reserves in fish are usually low, the main energy stored is fat. Experiments show that during starvation or food restriction in fish most of the metabolic energy is derived from lipid and, to a more limited degree from protein and carbohydrate (Kikuchi et al., 2002). Lipid is digested and metabolized with greater relative ease and so serves as a much better source of energy for protein sparing than carbohydrate. Unlike protein and fat, carbohydrate as a nutrient was not considered essential to fish because of their ability to synthesize carbohydrate metabolites (glucose, glycogen etc.) from excess dietary protein and fat. Compared to the farmed terrestrial animals, the utilization of dietary carbohydrates in fish is limited, but the inclusion of carbohydrate in fish feeds has certain beneficial effects (Shiau and Lin, 2001). The utilization of carbohydrate in fish varies depending on its complexity, source, level in the diet, pre-treatment and degree of gelatinization. The ability of fish to utilize carbohydrate also differs greatly between species and life stage as a consequence of the marked variations in the anatomy of the digestive tract and in the food habits (Mustafizur et al., 2008). It is also thought that herbivorous and omnivorous fish species utilize carbohydrate better than carnivorous fishes (Hamre et al., 2002). The inability of fish to utilize dietary carbohydrate has been illustrated by glucose tolerance tests. Oral administration of glucose to different fish species led to linear increase of blood glucose concentration, with a poor response of plasma insulin levels. This implies that glucose levels in blood are poorly regulated by fish, their response being frequently similar to diabetic mammals (Stone, 2003; Amoah et al., 2008; Tian et al., 2010). Other carbohydrates such as fibres,

hemicellulose, lignin and pentosans generally form indigestible fractions in the feed, often act as pellet binders. Some fish species can tolerate up to 8% of dietary fibre and depressed growth may occur when the fibre content reaches 20% (NRC, 1993; Amoah et al., 2008; Jesu et al., 2008). The aim of the present study was to carry out orderly nutritional research with Common carp by using different dietary protein, lipid and carbohydrate contents for determination of a feed formulation with optimum protein to energy ratio (P/E ratio) which would result in better carcass composition so as to make production of Common carp economical. MATERIALS AND METHODS Four feeds (Feed A, B, C and D) were formulated using the ingredients like ground nut oil cake, mustard oil cake, rice bran, wheat bran, fish meal and soybean meal. The ingredients were selected so as to suffice the balanced need of protein and energy of the Common carp. Feeds were formulated using “Pearson-Square method” with different protein, carbohydrate and lipid contents. Control feed consisted of 50% mustard oil cake and 50% rice bran. Vegetable oil (1.5 ml per 100 g of feed) and cod liver oil (1.5 ml per 100 g of feed) were incorporated in each formulated feed to ensure adequate supply of fatty acids of both n - 6 and n - 3 series, assumed to be essential for Common carp. Vitamin-mineral mixture (2 g per 100 g of feed) was added to each formulated feed for the maintenance of fish health. Sodium alginate (5 g per 100 g of feed) was used as binder and oxytetracycline (500 mg per 100 g of feed) as antibiotic for control and formulated feeds. A pelleting machine (Hobart, model, A 200) was used to pellet the feeds. An appropriate die was used to form pellets of desired sizes (1.0 to 3.0 mm). Pellets were oven dried and fed to the fishes at 6% of the body weight, three times a day at 10 A.M., 2.0 and 5.0 P.M. every day. Cyprinus carpio communis fingerlings having average weight 1.64 ± 0.13 g and length 5.26 ± 0.10 cm were used for the experiment. Prior to the initiation of the feeding trail, fingerlings were acclimatized for one week. During this period, traditional mixture of mustard oil cake and rice bran (1:1) was fed to the fingerlings. Each formulated feed and control feed was fed to triplicate group of fingerlings for 90 days. Fifty fingerlings were reared in each fiber glass tank. Water analysis of the experimental tanks was done regularly to monitor any unusual changes. The tanks were aerated throughout the experiments with aquarium air pumps (RS-180, Zhongshan Risheng Co. Ltd., China). Biochemical analysis (dry matter, moisture, crude protein, crude lipid, carbohydrate and ash of feed ingredients, feeds and carcass) was determined by using standard procedures (AOAC, 1995). The energy content of feed ingredients, feeds and carcass were calculated calorimetically.

RESULTS Biochemical composition of fish feed ingredients Biochemical composition of fish feed ingredients (% in dry weight basis) used for the present study is given in Table 1. The dry matter content of fish feed ingredients is the highest (95.37 ± 0.17%) in mustard oil cake and the

Ahmad et al.

8355

Table 1. Biochemical composition of fish feed ingredients (% in dry weight basis).

S/N 1 2 3 4 5 6

Ingredient Ground nut oil cake Mustard oil cake Rice bran Wheat bran Fish meal Soybean meal

Dry matter 95.09c ± 0.21 c 95.37 ± 0.17 91.55a± 0.28 91.84a± 0.23 93.82b± 0.19 93.63b± 0.12

Moisture 4.91a± 0.18 a 4.63 ± 0.13 8.45c± 0.21 8.16c± 0.26 6.18b± 0.16 6.37b± 0.15

Crude protein 42.21b± 0.17 b 39.56 ± 0.18 13.45a± 0.13 16.10a± 0.12 53.60c± 0.21 50.12c± 0.17

Crude lipid 9.05c± 0.28 c 9.73 ± 0.19 3.37a± 0.17 4.58a± 0.13 7.78b± 0.26 7.56b± 0.24

Carbohydrate 8.62b± 0.13 b 7.32 ± 0.12 19.61c± 0.17 16.26c± 0.19 4.33a± 0.14 4.72a± 0.10

Ash 4.62a± 0.21 a 4.12 ± 0.17 12.50c± 0.16 11.92c± 0.21 10.60 b± 0.20 10.05 b± 0.18

Energy (Kcal/g) 4.74b± 0.13 b 4.92 ± 0.21 1.86a± 0.22 1.99a± 0.26 3.92c± 0.23 3.63c± 0.13

Values are means ± SD. Means in the same column having different superscripts are significantly different (P<0.05) and means in the same column with same superscript are not significantly different (P>0.05).

least (91.55 ± 0.28%) in rice bran. The moisture content of fish feed ingredients is the highest (8.45 ± 0.21%) in rice bran and the least (4.63 ± 0.13%) in mustard oil cake. The crude protein of fish feed ingredients is the highest (53.60 ± 0.21%) in fish meal and the least (13.45 ± 0.13%) in rice bran. The crude lipid of fish feed ingredients is the highest (9.73% ± 0.19) in mustard oil cake and the least (3.37 ± 0.17%) in rice bran. The carbohydrate content of fish feed ingredients is the highest (19.61 ± 0.17%) in rice bran and the least (4.33 ± 0.14%) in fish meal. The ash content of fish feed ingredients is the highest (12.50% ± 0.16) in rice bran and the least (4.12 ± 0.17%) in mustard oil cake. The energy content of fish feed ingredients is the highest (4.92 Kcal/g ± 0.21) in mustard oil cake and the least (1.86 ± 0.22 Kcal/g) in rice bran. Out of six ingredients, ground nut oil cake and mustard oil cake were used as the source of lipid to provide energy of 4.74 ± 0.13 and 4.92 ± 0.21 Kcal/g, respectively. Fish meal and soybean meal were used as protein source, providing 53.60 ± 0.21% and 50.12 ± 0.17% crude protein, respectively. Rice bran and wheat bran were used as the source of carbohydrate to provide instant energy of 1.86 ± 0.22 and 1.99 ± 0.26 Kcal/g, respectively. There is no significant difference (P>0.05) in the

biochemical composition of ground nut oil cake and mustard oil cake; rice bran and wheat bran; fish meal and soybean meal. Composition of control and formulated feeds experimented Four feeds (Feed A, B, C and D) were formulated using the ingredients like groundnut oil cake, mustard oil cake, rice bran, wheat bran, fish meal and soybean meal. The ingredients were selected so as to suffice the balanced need of protein and energy of the Common carp. Feeds were formulated using “Pearson-Square method” with different protein, carbohydrate and lipid contents in order to ascertain their effect on growth parameters. Control feed consisted of 50% mustard oil cake and 50% rice bran. Feed A consisted of groundnut oil cake (15%), mustard oil cake (15%), rice bran (10%), wheat bran (10%), fish meal (25%) and soybean meal (25%). The combination aimed at the supply of maximum protein component than the energy. Feed B consisted of ground nut oil cake (18%), mustard oil cake (60%), rice bran (2%), wheat bran (8%), fish meal (4%) and soybean meal (8%). This combination, instead of having fish meal as a source of protein had

mustard oil cake. Feed C consisted of ground nut oil cake (8%), mustard oil cake (12%), rice bran (40%), wheat bran (30%), fish meal (6%) and soybean meal (4%). This combination aimed at the use of carbohydrate rich diet for the growth. Feed D consisted of the mixture of equal quantity (16.66%) of all the ingredients. Vegetable oil (1.5 ml per 100 g of feed) and cod liver oil (1.5 ml per 100 g of feed) were incorporated in each formulated feed to ensure adequate supply of fatty acids of both n-6 and n-3 series, assumed to be essential for Common carp. Vitamin-mineral mixture (2 g per 100 g of feed) was added to each formulated feed for the maintenance of fish health. Sodium alginate (5 g per 100 g of feed) was used as binder and oxytetracycline (500 mg per 100 g of feed) as antibiotic for control and formulated feeds. Composition of control and formulated feeds (% in dry weight basis) experimented is given in Table 2. Biochemical composition of formulated feeds experimented

control

and

Biochemical composition of control and formulated feeds experimented (% in dry weight basis) is given in table 3.

8356

Afr. J. Biotechnol.

Table 2. Composition of control and formulated feeds experimented (% in dry weight basis).

Ingredients Ground nut oil cake Mustard oil cake Rice bran Wheat bran Fish meal Soybean meal Sodium alginate (g) 1 Vitamin mineral mixture (g) Vegetable oil (ml) Cod liver oil2 (ml) Oxytetracycline (mg) 1

Control Nil 50 50 Nil Nil Nil 5 Nil Nil Nil 500

Feed A 15 15 10 10 25 25 5 2 1.5 1.5 500

Feed B 18 60 2 8 4 8 5 2 1.5 1.5 500

Feed C 8 12 40 30 6 4 5 2 1.5 1.5 500

Feed D 16.66 16.66 16.66 16.66 16.66 16.66 5 2 1.5 1.5 500

Supplevite – M (Sarabhai Chemicals India); Cod liver oil (Sea cod, M/S Universal Medicare Ltd. Mumbai).

Table 3. Biochemical composition of control and formulated feeds experimented (% in dry weight basis).

Biochemical composition Dry Matter Moisture Crude Protein Crude Lipid Carbohydrate Ash Energy (Kcal/g) P/E (mg protein/Kj)

Control 92.89a± 0.17 7.11b± 0.21 26.50a± 0.31 5.80a± 0.26 b 32.95 ± 0.18 a 8.68 ± 0.21 3.66a± 0.15 17.33a± 0.22

Feed A 93.77b± 0.21 6.23a± 0.16 42.00c± 0.26 8.94b± 0.19 a 12.92 ± 0.16 b 9.39 ± 0.19 4.44b± 0.11 22.64c± 0.36

Feed B 94.01b± 0.19 5.99a± 0.17 40.00b± 0.21 9.31b± 0.25 a 10.08 ± 0.10 b 9.45 ± 0.16 4.65b± 0.13 20.54b± 0.21

Feed C 92.73a± 0.28 7.27 b± 0.23 25.98a± 0.19 5.49a± 0.18 b 34.63 ± 0.19 a 8.59 ± 0.26 3.48a± 0.16 17.18a± 0.19

Feed D 93.44b± 0.16 6.56a± 0.19 34.75ab±0.17 8.22b± 0.16 a 15.07 ± 0.22 b 9.15 ± 0.15 4.26b± 0.19 19.53ab±0.15

Values are means ± SD. Means in the same row having different superscripts are significantly different (P<0.05) and means in the same row with same superscript are not significantly different (P>0.05).

The highest dry matter content (94.01% ± 0.19) was recorded in Feed B and the least (92.73 ± 0.28%) in Feed C. The highest moisture content (7.27 ± 0.23%) was recorded in Feed C and the least (5.99 ± 0.17%) in Feed B. The highest crude protein (42 ± 0.26%) was recorded in Feed A and the least (25.98 ± 0.19%) in Feed C. The highest crude lipid (9.31 ± 0.25%) was recorded in Feed B and the least (5.49 ± 0.18%) in Feed C. The highest carbohydrate content (34.63 ± 0.19%) was recorded in Feed C and the least (10.08 ± 0.10%) in Feed B. The highest ash content (9.45% ± 0.16) was recorded in Feed B and the least (8.59 ± 0.26%) in Feed C. The highest energy content (4.65 ± 0.13 Kcal/g) was recorded in Feed B and the least (3.48 ± 0.16 Kcal/g) in Feed C. The highest P/E ratio (22.64 ± 0.36 mg protein/Kj) was recorded in Feed A and the least (17.18 ± 0.19 mg protein/Kj) in Feed C. Carcass composition Carcass composition (% mean wet weight basis) of the fingerlings fed on control and formulated feeds after 30 and 90 days of experiment is given in Table 4.

Dry matter The initial carcass dry matter content of the fingerlings was recorded 24.18% ± 0.19. After 30 days, there was no significant difference (P>0.05) in the carcass dry matter content of the fingerlings fed on control feed, Feed A, Feed B, Feed C and Feed D. After 90 days, the carcass dry matter content was recorded the highest (29.35±0.14%) in the fingerlings fed on Feed B and the least (28.18 ± 0.19%) in the fingerlings fed on Feed C. There was no significant difference (P > 0.05) in the carcass dry matter content of the fingerlings fed on control feed and Feed C; Feed A, B and D. Moisture The initial carcass moisture content of the fingerlings was recorded 75.82 ± 0.31%. After 30 days, there was no significant difference (P>0.05) in the carcass moisture content of the fingerlings fed on control feed, Feed A, Feed B, Feed C and Feed D. After 90 days, the carcass moisture content was recorded the highest (71.82 ± 0.13%) in the fingerlings fed on Feed C and the least (70.65 ±

Ahmad et al.

8357

Table 4. Carcass composition (% mean wet weight basis) of fingerlings fed on control and formulated f eeds after 30 and 90 days of experiment

Parameters (%) Initial Observations after 30 days of experiment Dry matter 24.18± 0.19 Moisture 75.82± 0.31 Crude protein 18.43± 0.24 Crude lipid 2.19± 0.12 Carbohydrate 1.43± 0.10 Ash 2.58± 0.16 Energy (Kcal/g) 7.67± 0.26

Control

Feed A

Feed B

Feed C

Feed D

± SEM

25.22a± 0.16 a 74.78 ± 0.23 19.16a± 0.17 2.83a± 0.22 1.71a± 0.21 2.86a± 0.15 a 8.15 ± 0.21

25.64a± 0.12 a 74.36 ± 0.21 19.76a± 0.14 3.16a± 0.26 1.49a± 0.16 3.12a± 0.21 a 8.67 ± 0.18

25.79a± 0.10 a 74.21 ± 0.19 19.83a± 0.16 3.21a± 0.16 1.46a± 0.10 3.18a± 0.20 a 8.76 ± 0.17

25.14a± 0.24 a 74.86 ± 0.27 19.06a± 0.21 2.76a± 0.24 1.76a± 0.19 2.79a± 0.19 a 8.06 ± 0.20

25.57a± 0.16 a 74.43 ± 0.22 19.52a± 0.19 3.06a± 0.18 1.54a± 0.18 3.04a± 0.16 a 8.53 ± 0.19

0.17 0.22 0.19 0.23 0.15 0.18 0.22

Observations after 90 days of experiment Dry matter Moisture Crude protein Crude lipid Carbohydrate Ash Energy (Kcal/g)

28.27a± 0.17 71.73b± 0.12 a 21.63 ± 0.34 a 3.61 ± 0.20 2.79a± 0.11 5.19a± 0.16 10.36a± 0.26

29.26b± 0.16 70.74a± 0.10 b 24.23 ± 0.16 b 4.23 ± 0.16 2.47a± 0.12 5.53a± 0.19 12.38b± 0.22

29.35b± 0.14 70.65a± 0.11 c 25.03 ± 0.12 b 4.30 ± 0.22 2.42a± 0.10 5.59a± 0.18 12.47b± 0.19

28.18a± 0.19 71.82b± 0.13 a 21.54 ± 0.29 a 3.53 ± 0.19 2.88a± 0.13 5.12a± 0.22 10.24a± 0.20

29.18b± 0.22 70.82a± 0.14 ab 23.92 ± 0.16 b 4.12 ± 0.17 2.56a± 0.14 5.38a± 0.15 12.13b± 0.21

0.18 0.11 0.20 0.18 0.12 0.18 0.23

Values are means ± SD of five replications (d.f. 5, 35). Means in the same row in the same block having different superscripts are significantly different (P<0.05) and means in the same row in the same block with same superscript are not significantly different (P>0.05).

0.11%) in the fingerlings fed on Feed B. There was no significant difference (P>0.05) in the carcass moisture content of the fingerlings fed on control feed and Feed C; Feed A, B and D. Crude protein The initial carcass crude protein of the fingerlings was recorded 18.43 ± 0.24%. After 30 days, there was no significant difference (P>0.05) in the carcass crude protein of the fingerlings fed on control feed, Feed A, B, C and D. After 90 days, the carcass crude protein was recorded the highest (25.03 ± 0.12%) in the fingerlings fed on Feed B and the least (21.54 ± 0.29%) in the fingerlings

fed on Feed C. There was no significant difference (P>0.05) in the carcass crude protein of the fingerlings fed on control feed and Feed C. The carcass crude protein of the fingerlings fed on Feed A was significantly lower (P<0.05) as compared to the carcass crude protein of the fingerlings fed on Feed B.

90 days, the carcass crude lipid was recorded the highest (4.30 ± 0.22%) in the fingerlings fed on Feed B and the least (3.53 ± 0.19%) in the fingerlings fed on Feed C. There was no significant difference (P>0.05) in the carcass crude lipid of the fingerlings fed on control feed and Feed C; Feed A, B and D.

Crude lipid

Carbohydrate

The initial carcass crude lipid of the fingerlings was recorded 2.19 ± 0.12%. After 30 days, there was no significant difference (P>0.05) in the carcass crude lipid of the fingerlings fed on control feed, Feed A, Feed B, Feed C and Feed D. After

The initial carcass carbohydrate content of the fingerlings was recorded 1.43 ± 0.10%. After 30 days, there was no significant difference (P>0.05) in the carcass carbohydrate content of the fingerlings fed on control feed, Feed A, Feed B,

8358

Afr. J. Biotechnol.

Feed C and Feed D. After 90 days, the carcass carbohydrate content was recorded the highest (2.88 ± 0.13%) in the fingerlings fed on Feed C and the least (2.42 ± 0.10%) in the fingerlings fed on Feed B. There was no significant difference (P>0.05) in the carcass carbohydrate content of the fingerlings fed on control feed, Feed A, B, C and D. Ash The initial carcass ash content of the fingerlings was recorded 2.58 ± 0.16%. After 30 days, there was no significant difference (P>0.05) in the carcass ash content of the fingerlings fed on control feed, Feed A, B, C and D. After 90 days, the carcass ash content was recorded the highest (5.59 ± 0.18%) in the fingerlings fed on Feed B and the least (5.12 ± 0.22%) in the fingerlings fed on Feed C. There was no significant difference (P>0.05) in the carcass ash content of the fingerlings fed on the control feed, Feed A, B, C and D. Energy The initial carcass energy content of the fingerlings was 7.67 ± 0.26 Kcal/g. After 30 days, there was no significant difference (P>0.05) in the carcass energy content of the fingerlings fed on control feed, Feed A, B, C and D. After 90 days, the carcass energy content was recorded the highest (12.47 ± 0.19 Kcal/g) in the fingerlings fed on Feed B and the least carcass energy content (10.24 ± 0.20 Kcal/g) was recorded in the fingerlings fed on Feed C. There was no significant difference (P>0.05) in the carcass energy content of the fingerlings fed on control feed and Feed C; Feed A, B and D. DISCUSSION The carcass dry matter content, moisture content, crude protein, crude lipid, carbohydrate content, ash content and energy content of the fingerlings fed on control and formulated feeds did not vary significantly (P>0.05) after 30 days of the experiment. After 90 days of experiment, the carcass dry matter content was recorded the highest (29.35 ± 0.14%) in the fingerlings fed on Feed B. The least carcass dry matter content (28.18 ± 0.19%) was recorded in the fingerlings fed on Feed C. There was no significant difference (P>0.05) in the carcass dry matter content of the fingerlings fed on control feed and Feed C; Feed A, B and D. Pedro et al. (2001) reported 30% carcass dry matter content in tench fed diets with 35% dietary protein level and Amoah et al. (2008) reported 31% carcass dry matter content in largemouth bass fed diets with 38% dietary protein level. Both the findings lend support to the present observation of highest

carcass dry matter content in Feed B having 40% dietary protein level. The carcass moisture content was recorded the highest (71.82 ± 0.13%) in the fingerlings fed on Feed C. The least carcass moisture content (70.65 ± 0.11%) was recorded in the fingerlings fed on Feed B. There was no significant difference (P>0.05) in the carcass moisture content of the fingerlings fed on control feed and Feed C; Feed A, Feed B and Feed D. The carcass moisture content exhibited inverse relationship with the carcass lipid and also with the dietary lipid level. The same observations have been reported in European white fish (Vielma et al., 2003) and largemouth bass (Tidwell et al., 2005). The carcass crude protein was recorded the highest (25.03 ± 0.12%) in the fingerlings fed on Feed B. The least carcass crude protein (21.54 ± 0.29%) was recorded in the fingerlings fed on Feed C. There was no significant difference (P>0.05) in the carcass crude protein of the fingerlings fed on control feed and Feed C. The carcass crude protein of the fingerlings fed on Feed A was significantly lower (P<0.05) as compared to the carcass crude protein of the fingerlings fed on Feed B. The carcass protein content increased significantly (P<0.05) with the increase in dietary protein level up to 40% and above 40% of dietary protein level, the carcass protein content decreased significantly (P<0.05). The increase in carcass protein content with the increase in dietary protein level up to 40% is due to the increase in protein utilization and digestibility with the increase in dietary protein level up to 40%. The decrease in the carcass protein above 40% dietary protein level is due to the decrease in protein utilization and digestibility above 40% dietary protein level. Pedro et al. (2001) and Tidwell et al. (2005) reported the increase in carcass protein content with the increase in dietary protein level. The carcass crude lipid was recorded the highest (4.30 ± 0.22%) in the fingerlings fed on Feed B. The least carcass crude lipid (3.53 ± 0.19%) was recorded in the fingerlings fed on Feed C. There was no significant difference (P>0.05) in the carcass crude lipid of the fingerlings fed on control feed and Feed C; Feed A, B and D. The carcass lipid content exhibited positive relationship with the dietary lipid level which is in agreement with the results reported by Yamamoto et al. (2000) in rainbow trout and Gumus and Ikiz (2009) in rainbow trout. The carcass lipid content and the carcass energy content exhibited direct relationship. It is a finding comparable with the observations of Gumus and Ikiz (2009) in rainbow trout. The carcass lipid content decreased significantly (P<0.05) with the increase in dietary carbohydrate level. The decrease in lipid digestibility and lipid utilization with the increase in dietary carbohydrate level resulted in the decrease in carcass lipid with the increase in dietary carbohydrate level. Morais et al. (2001) reported the decrease in carcass lipid with the increase in dietary carbohydrate level.

Ahmad et al.

The carcass carbohydrate content was recorded the highest (2.88 ± 0.13%) in the fingerlings fed on Feed C. The least carcass carbohydrate content (2.42 ± 0.10%) was recorded in the fingerlings fed on Feed B. There was no significant difference (P>0.05) in the carcass carbohydrate content of the fingerlings fed on control feed, Feed A, B, C and D. The carcass carbohydrate content did not show significant difference (P>0.05) with the increase in dietary carbohydrate level from 10.08 to 34.63%. This is in conformation to the results reported in European white fish (Vielma et al., 2003) and largemouth bass (Amoah et al., 2008). The carcass ash content was recorded the highest (5.59 ± 0.18%) in the fingerlings fed on Feed B. The least carcass ash content (5.12 ± 0.22%) was recorded in the fingerlings fed on Feed C. The carcass ash content did not vary significantly (P>0.05) among the fingerlings fed on control and formulated feeds. The same trend has been reported in grass carp by Du et al. (2008) and Atlantic halibut by Hamre et al. (2003). The carcass energy content was recorded the highest (12.47 ± 0.19 Kcal/g) in the fingerlings fed on Feed B. The least carcass energy content (10.24 ± 0.20 Kcal/g) was recorded in the fingerlings fed on Feed C. There was no significant difference (P>0.05) in the carcass energy content of the fingerlings fed on control feed and Feed C; Feed A, B and D. Yamamoto et al. (2000) reported 12 Kcal/g carcass energy content in rainbow trout fed diets with 37% crude protein. Pedro et al. (2001) reported 13 Kcal/g carcass energy content in tench fed diets with 40% crude protein. Both the findings lend support to present observation of the highest carcass energy content in Feed B having 40% dietary protein level. Based on carcass composition this work concludes that Feed B containing 40% protein, 9.31% lipid, 10.08% carbohydrate and having P/E ratio 20.54 mg protein/Kj is the best one for a more profitable and successful culture of the common carp. ACKNOWLEDGEMENTS The authors are greatly indebted to Prof. Pradeep Shrivasthava, Head of the Department of Zoology and Applied Aquaculture, Barkatullah University, Bhopal, M.P. and Director, Indian Institute of Soil Sciences, Bhopal, for providing the laboratory facilities. The first author (Muzaffar Ahmad) thanks the University Grants Commission (UGC), New Delhi, for providing Maulana Azad National Minority Fellowship (No.F.40-14(M)/2009(SA-III/MANF). REFERENCES Alatise PS, Ogundele O, Eyo AA, Oludunjoye F (2006). Evaluation of different soybean-based diets on growth and nutrient utilization of Heterobranchus longifilis in aquaria tanks. FISON conference proceeding. pp. 255-262. Amoah A, Shawn DC, Carl DW, Robert MD, Leigh AB, James HD

8359

(2008). Effect of graded levels of carbohydrates on growth and survival of largemouth bass, Micropterus salmoides. J. World Aquacult. Soc. 39(3): 397-405. AOAC (1995). Official methods of analysis of the Association of Official th Analytical Chemist. 16 edition, Association of Official Analytical Chemist, Washington, DC, USA. pp.1234-1565. Du ZY, Clouet P, Huang LM, Degrace P, Zheng WH, Tian LX, Liu YJ (2008). Utilization of different dietary lipid sources at high level in herbivorous grass carp, Ctenopharyngodon idella and mechanism related to hepatic fatty acid oxidation. J. Aquacult. Nutr. 14: 77-92. Gauquelina F, Cuzona G, Gaxiolab G, Rosasb C, Arenab L, Bureauc DP, Cocharda JC (2007). Effect of dietary protein level on growth and energy utilization by Litopenaeus stylirostris under laboratory conditions. J. Aquacult. 271(1-4): 439-448. Gullaine JC, Kaushik S, Bergot P, Metailler R (2001). Nutrition and feeding of fish and crustaceans. Springer-Praxis books edition. pp. 1396. Gumus E, Ikiz R (2009). Effect of dietary levels of lipid and carbohydrate on performance, chemical contents and digestibility in rainbow trout, Oncorhynchus mykiss. Pak. Vet. J. 29(2): 59-63. Hamre K, Ofsti A, Naess T, Nortvedt R, Holm JC (2003). Macronutrient composition of formulated diets for Atlantic halibut, Hippoglossus hippoglossus juveniles. J. Aquacult. 227: 233-244. Hemre GI, Mommsen TP, Krogdahl A (2002). Carbohydrates in fish nutrition: effects of growth, glucose metabolism and hepatic enzymes. Aquac. Nutr. 8: 175-194. Jamabo NA, Alfred OJF (2008). Effects of dietary protein levels on the growth performance of Heterobranchus bidorsalis fingerlings from Niger delta. Afr. J. Biotechnol. 7(14): 2483-2485. Jesu AR, Haniffa MA, Seetharaman S, Appelbaum S (2008). Utilization of various dietary carbohydrate levels by the freshwater Catfish, Mystus montanus (Jerdon). Turk. J. Fish. Aqua. Sci. 8: 31-35. Kiessling A, Pickova J, Johansson L, Asgard T, Storebakken T, Kiessling KH (2001). Changes in fatty acid composition in muscle and adipose tissue of farmed rainbow trout, Oncorhynchus mykiss in relation to ration and age. J. Food Chem. 73: 271-284. Kikuchi K, Takeuchi T (2002). Japanese flounder, Paralichthys olivareas. Nutrient requirements and feeding of finfish for aquaculture. CABI Publishing, New York, New York, USA. pp. 113120. Kim KW, Wang X, Choi SM, Park GJ, Bai SC (2004). Evaluation of optimum dietary protein to energy ratio in juvenile olive flounder, Paralichthys olivaceus. J. Aquac. Res. 35: 250-255. Morais S, Bell JG, Robertson DA, Roy WJ, Morris RC (2001). Protein /lipid ratios in extruded diets for Atlantic cod, Gadus morhua. Effects of growth, feed utilization, muscle composition and liver histology. J. Aquacult. 203: 101-19. Mustafizur R, Leopold AJ, Nagelkerke MCJ, Verdegem M, Wahab A, Johan AJ (2008). Relationships among water quality, food resources, fish diet and fish growth in polyculture ponds. J. Aquacult. 272(1): 108-115. NRC (1993). Nutrient requirements of fish. National Academy Press, Washington, DC, USA. pp. 114-398. Pedro ND, Guijarro AI, Delgado MJ, Patina LP, Pinillos ML, Bedate MA (2001). Influence of dietary composition on growth and energy reserves in tench, Tincta ticta. J. Appl. Icthyol. 17: 25-29. Shiau SY, Lin YH (2001). Carbohydrate utilization and its proteinsparing effect in diets for grouper, Epinephelus malabaricus. J. Anim. Sci. 73: 299-304. Stone DAJ (2003). Dietary carbohydrate utilization by fish. Rev. Fish. Sci. 11: 337-369. Storebakken T (2002). Atlantic salmon. Webster, CD and Lim C, editors. Nutrient requirements and feeding of finfish for aquaculture. CABI Publishing, Wallingford, UK. pp. 79-102. Subhadra B, Lochmann R, Rawles S, Chen R (2006). Effect of dietary lipid source on the growth, tissue composition, and hematological parameters of largemouth bass, Micropterus salmoides. J. Aquacult. 255: 210-222. Tian LX, Liu YJ, Hung SSO, Deng DF, Yang HJ, Niu J, Liang GY (2010). Effect of feeding strategy and carbohydrate source on carbohydrate utilization by Grass carp, Ctenopharyngodon idella. Am. J. Agric. Bio. Sci. 5(2): 135-142.

8360

Afr. J. Biotechnol.

Tidwell JH, Coyle SD, Bright LA, Yasharian D (2005). Evaluation of plant and animal source proteins for replacement of fish meal in practical diets for the largemouth bass, Micropterus salmoides. J. World Aquacult. Soci. 36: 454-463. Vielma J, Koskela J, Ruohonen K, Jokinen I, Kettunen J (2003). Optimal diet composition for European whitefish, Coregonus lavaretus. Carbohydrate stress and immune parameter responses. J. Aquacult. 225: 3-16. Webster CD, Lim L (2002). Introduction to fish nutrition. Webster, CD and Lim C, editors. Nutrient requirements and feeding of finfish for aquaculture. CABI Publishing, Wallingford, UK. pp. 1-27.

Yamamoto T, Unuma T, Akiyama T (2000). The effect of dietary protein and lipid levels on growth, feed efficiency, digestive enzyme activity and body composition of rainbow trout, Oncorhynchus mykiss fingerling. J. Aquacult. 191(3): 353-362.

Full Length Research Paper

Effect of dietary protein, lipid and carbohydrate contents on the nutrient and energy utilization and digestibility of Cyprinus carpio communis fingerlings Muzaffar Ahmad*, T. A. Qureshi and Singh A. B. Department of Zoology and Applied Aquaculture, Barkatullah University, 462026, M.P., India. Accepted 2 December, 2011

Fingerlings having average weight 1.64 ± 0.13 g and length 5.26 ± 0.10 cm were fed on four different formulated feeds and a control feed (each in a triplicate set), 6% of their body weight, three times a day, during 90 days. Feeds were formulated using ground nut oil cake, mustard oil cake, rice bran, wheat bran, fish meal and soybean meal in order to suffice the balanced need of protein and energy of the common carp. Nutrient and energy utilization and digestibility were measured. At the end of the study, the nutrient and energy utilization and digestibility of fingerlings were affected significantly (P<0.05) with protein, lipid and carbohydrate contents in the feeds. Highest nutrient and energy utilization and digestibility were observed in fingerlings fed with feed B containing 40 ± 0.21% protein, 9.31 ± 0.25% lipid and 10.08 ± 0.10% carbohydrate. The fingerlings fed with feed C containing 25.98 ± 0.19% protein, 5.49 ± 0.18% lipid and 34.63 ± 0.19% carbohydrate showed least nutrient and energy utilization and digestibility. This work concluded that feed B containing 40% protein, 9.31% lipid and 10.08% carbohydrate is the best one for a more profitable and successful culture of the common carp. Key words: Cyprinus carpio communis, fingerlings, nutrient utilization, energy utilization, digestibility. INTRODUCTION Proteins are the major organic materials in most fish tissue, and form an important component of the diet. One of the major requirements of fish culture is the efficient transformation of dietary protein into tissue protein (Webster and Lim, 2002). However, protein is essential for normal tissue function, for the maintenance and renewal of fish body protein and for growth. Due to the cost of the protein, the feed will be more cost effective if all the protein is used for tissue repair and growth and little catabolized for energy (Gauquelina et al., 2007). From a practical point of view, the ideal situation should tend to maximize the use of dietary protein for growth, minimizing the use of proteins for functional protein synthesis, gluconeogenesis, lipogenesis and energy (Jamabo and Alfred, 2008). If adequate protein is not provided in the diet, there is a rapid reduction or cessation of growth and a

*Corresponding author. E-mail: muzaffarahmad8@gmail.com. Tel: 9018877446.

loss of weight due to withdrawal of protein from less vital tissues to maintain the functions of more vital tissues. On the other hand, if too much protein is supplied in the diet, only part of it will be used to make new proteins and the remainder will be catabolized to produce energy (Alatise et al., 2006). Although the utilization of proteins for basal energy metabolism is a well-established phenomenon, conventional “energy- yielding” nutrients like fats and carbohydrates can reduce the oxidation of protein to satisfy the energy needs of fish and thus improve the utilization of dietary protein (Kim et al., 2004). Lipids are an extremely diverse group of compounds, many of which function as important sources of metabolic energy. Among the various types of lipid, it is the simple, glycerol based, fats and oils that are of most interest in terms of general nutrition (Du et al., 2008). Lipids normally occur in foodstuffs and in the fat deposits of most animals in the form of triglycerides, which are esters of fatty acids and glycerol (Kiessling et al., 2001). Thus, dietary lipids provide a source of indispensable nutrients, the essential fatty acids. In addition, they also act as

8368

Afr. J. Biotechnol.

carriers of certain non - fat nutrients, notably the fat-soluble vitamins A, D, E and K and they are also an important source of energy (Storebakken, 2002). Lipids contain more energy per unit weight than any other biological compound e.g., one gram of lipid contains almost twice as much total energy as either one gram of carbohydrate or one gram of protein (Gullaine, 2001). Dietary lipids, mainly in the form of triglycerides, are hydrolyzed to free fatty acids and glycerol by pancreatic lipase, aided by the saponifying and emulsifying action of bile acids in the digestive tract. Absorption generally occurs primarily in the anterior ileum including the caecum (Subhadra et al., 2006). Lipids are transported in the bloodstream either as lipoprotein complexes called very low-density lipoproteins (VLDLs) or as very small droplets called chylomicrons. The triglycerol components of VLDL and chylomicrons are hydrolyzed to free fatty acids and glycerol in the target tissues (generally adipose tissue and skeletal muscle) outside of the cell by an enzyme called lipoprotein lipase (LPL). The other source of long chain fatty acid is synthesized (lipogenesis) from acetyl-CoA derived from carbohydrate (glucose), mainly in adipose tissue and the liver (Mourente et al., 2005). Unlike protein and fat, carbohydrate as a nutrient was not considered essential to fish because of their ability to synthesize carbohydrate metabolites (glucose/glycogen etc.) from excess dietary protein and fat. Compared to the farmed terrestrial animals, the utilization of dietary carbohydrates in fish is limited, but the inclusion of carbohydrate in fish feeds has certain beneficial effects (Shiau and Lin, 2001). The utilization of carbohydrate in fish varies depending on its complexity, source, level in the diet, pre-treatment and degree of gelatinization. The ability of fish to utilize carbohydrate also differs greatly between species and life stage as a consequence of the marked variations in the anatomy of the digestive tract and in the food habits (Mustafizur et al., 2008). It is also thought that herbivorous and omnivorous fish species utilize carbohydrate better than carnivorous fishes (Hemre et al., 2002). The inability of fish to utilize dietary carbohydrate has been illustrated by glucose tolerance tests. Oral administration of glucose to different fish species led to linear increase of blood glucose concentration, with a poor response of plasma insulin levels. This implies that glucose levels in blood are poorly regulated by fish, their response being frequently similar to diabetic mammals (Stone, 2003; Amoah et al., 2008; Tian et al., 2010). Other carbohydrates such as fibres, hemicellulose, lignin and pentosans which generally form indigestible fractions in the feed, often act as pellet binders. Some fish species can tolerate up to 8% of dietary fibre and depressed growth may occur when the fibre content reaches 20% (NRC, 1993; Amoah et al., 2008; Jesu et al., 2008). Digestibility is the quantification of the digestive processes. Digestibility gives relative measures of the extent to which ingested food and its nutrient components are digested and absorbed by the animal. Part of the food

consumed by fish will pass through the gastrointestinal tract without being digested and absorbed i.e., part of the ingested food will be lost as faeces. If digestibility is high then faecal losses will be low and vice versa (Burel et al., 2000). Proteins in most feedstuffs that are properly processed are highly digestible to fish. The digestion coefficients for protein in protein rich feedstuffs are usually in the range of 75 to 95%. Protein digestibility tends to be depressed as the concentration of dietary carbohydrate increases (Hemre et al., 2002). Digestibility of lipids ranges from 85 to 95% in most fish species (NRC, 1993; Menoyo et al., 2003). Long chain fatty acids exhibit a higher digestibility than short chain ones. Polyunsaturated fatty acids such as 20:5 or 22:6 are up to 100% digested by rainbow trout (Kaushik, 2004) and, in general, the essential PUFA show a very high digestibility in this fish species (Kaushik, 2004). Source or type, dietary level, and heat treatment affect the digestibility of carbohydrates in fish (Krogdahl et al., 2005). Considerable differences in carbohydrate digestibility between the various fish species can be expected as a consequence of the marked variations in the anatomy of the digestive tract and in the native diet (Gumus and Ikiz, 2009). A factor, which has a major effect on carbohydrate digestibility in fish, is the degree of polymerization. The monosaccharides are well absorbed by fish, while dextrin is moderately digestible and crude starches have comparatively low digestibilities (Krogdahl et al., 2005). The aim of the present study was to carry out orderly nutritional research with common carp by using different dietary protein, lipid and carbohydrate contents for determination of a feed formulation with optimum protein to energy ratio (P/E ratio) which would result in better nutrient and energy utilization and digestibility so as to make production of Common carp economical. MATERIALS AND METHODS Four feeds (feeds A, B, C and D) were formulated using the ingredients like ground nut oil cake, mustard oil cake, rice bran, wheat bran, fish meal and soybean meal. The ingredients were selected so as to suffice the balanced need of protein and energy of the common carp. Feeds were formulated using â&#x20AC;&#x153;Pearson-Square methodâ&#x20AC;? with different protein, carbohydrate and lipid contents. Control feed consisted of 50% mustard oil cake and 50% rice bran. Vegetable oil (1.5 ml per 100 g of feed) and cod liver oil (1.5 ml per 100 g of feed) were incorporated in each formulated feed to ensure adequate supply of fatty acids of both n - 6 and n - 3 series, which is assumed to be essential for common carp. Vitamin - mineral mixture (2 g per 100 g of feed) was added to each formulated feed for the maintenance of fish health. Sodium alginate (5 g per 100 g of feed) was used as binder and oxytetracycline (500 mg per 100 g of feed) as antibiotic for control and formulated feeds. 1% chromic oxide (BDH 277572Q) was included in control and formulated feeds, as inert indicator for digestibility studies. A pelleting machine (Hobart, model, A 200) was used to pellet the feeds. An appropriate die was used to form pellets of desired sizes (1.0 to 3.0 mm). Pellets were oven dried and fed to the fishes at 6% of the body weight, three times a day at 10 A.M., 2.0 and 5.0 P.M. every day. Cyprinus carpio communis fingerlings having average weight

Ahmad et al.

1.64 ± 0.13 g and length 5.26 ± 0.10 cm were used for the experiment. Prior to the initiation of the feeding trail, fingerlings were acclimatized for one week. During this period, traditional mixture of mustard oil cake and rice bran (1:1) was fed to the fingerlings. Each formulated feed and control feed was fed to triplicate group of fingerlings for 90 days. Fifty fingerlings were reared in each fiber glass tank. Water analysis of the experimental tanks was done regularly to monitor any unusual changes. The tanks were aerated throughout the experiments with aquarium air pumps (RS-180, Zhongshan Risheng Co. Ltd., China). Fingerlings were weighed on an Elite electronic balance. Faecal matter was collected once a day at about 08.30 A.M. before the feeding commenced for digestibility studies. Faeces of each dietary treatment were pooled together. Biochemical analysis (dry matter, moisture, crude protein, crude lipid, carbohydrate and ash of feed ingredients, feeds, carcass and feacal matter) was determined by using standard procedures (AOAC, 1995). The energy content of feed ingredients, feeds, carcass and feacal matter were calculated calorimetically. The biochemical analysis of carcass was carried out for the determination of nutrient and energy utilization. The biochemical analysis of feacal matter was carried out for the digestibility determination. Nutrient and energy utilization The following parameters were recorded to assess the nutrient and energy utilization of fingerlings fed on control and formulated feeds. Protein efficiency ratio (PER) PER = Live weight gain (g) / protein consumed (g) Apparent

net protein utilization (ANPU)

ANPU (%) = [(P2 - P1) / total protein consumed (g)] × 100 Where, P1 is the protein in fish carcass (g) at the beginning of the study and P2 is the protein in fish carcass (g) at the end of the study.

Apparent net lipid utilization (ANLU) ANLU (%) = [(L2 - L1) / total lipid consumed (g)] × 100 Where, L1 is the lipid in fish carcass (g) at the beginning of the study and L2 is the lipid in fish carcass (g) at the end of the study.

Apparent net energy utilization (ANEU) ANEU (%) = [(E2 - E1) / (Total feed consumed (g) × Dietary energy in feed (Kcal))] × 100 Where, E1 is the energy in fish carcass (Kcal) at the beginning of the study and E2 is the energy in fish carcass (Kcal) at the end of the study.

Digestibility determination The inert indicator chromic oxide was used in feeds for determining digestibility. It passes unaffected by digestion through the alimentary tract of fish. This provides a convenient method of measuring digestibility without the need of quantitative collection of faeces.

8369

Chromic oxide was measured in feed and faeces using acid digestion method of Furukawa and Tsukahara (1966). The digestibility of dry matter, protein, lipid, carbohydrate and energy were calculated using the formula of Maynard and Loosli (1969). Digestibility (%) = 100–[100 (% Cr2O3 in feed / % Cr2O3 in faeces) (% nutrient in faeces / % nutrient in feed)]

RESULTS Biochemical composition of fish feed ingredients Biochemical composition of fish feed ingredients (% in dry weight basis) used for the present research work is given in Table 1. The dry matter content of fish feed ingredients was the highest (95.37 ± 0.17%) in mustard oil cake and the least (91.55± 0.28%) in rice bran. The moisture content of fish feed ingredients was the highest (8.45 ± 0.21%) in rice bran and the least (4.63 ± 0.13%) in mustard oil cake. The crude protein of fish feed ingredients was the highest (53.60 ± 0.21%) in fish meal and the least (13.45 ± 0.13%) in rice bran. The crude lipid of fish feed ingredients was the highest (9.73 ± 0.19%) in mustard oil cake and the least (3.37 ± 0.17%) in rice bran. The carbohydrate content of fish feed ingredients was the highest (19.61 ± 0.17%) in rice bran and the least (4.33 ± 0.14%) in fish meal. The ash content of fish feed ingredients was the highest (12.50 ± 0.16%) in rice bran and the least (4.12 ± 0.17%) in mustard oil cake. The energy content of fish feed ingredients was the highest (4.92 ± 0.21 Kcal/g) in mustard oil cake and the least (1.86 ± 0.22 Kcal/g) in rice bran. Out of six ingredients, ground nut oil cake and mustard oil cake were used as the source of lipid to provide energy of 4.74 ± 0.13 and 4.92 ± 0.21 Kcal/g, respectively. Fish meal and soybean meal were used as protein source, providing 53.60 ± 0.21 and 50.12± 0.17% crude protein, respectively. Rice bran and wheat bran were used as the source of carbohydrate to provide instant energy of 1.86 ± 0.22 and 1.99 ± 0.26 Kcal/g, respectively. There was no significant difference (P>0.05) in the biochemical composition of ground nut oil cake and mustard oil cake; rice bran and wheat bran; fish meal and soybean meal. Composition of experimented

control

and

formulated

feeds

Four feeds (feeds A, B, C and D) were formulated using the ingredients like ground nut oil cake, mustard oil cake, rice bran, wheat bran, fish meal and soybean meal. The ingredients were selected so as to suffice the balanced need of protein and energy of the common carp. Feeds were formulated using “Pearson-Square method” with different protein, carbohydrate and lipid contents in order to ascertain their effect on growth parameters. Control feed consisted of 50% mustard oil cake and 50% rice bran. Feed A consisted of ground nut oil cake (15%),

8370

Afr. J. Biotechnol.

Table 1. Biochemical composition of fish feed ingredients (% in dry weight basis)

S/N 1 2 3 4 5 6

Ingredient Ground nut oil cake Mustard oil cake Rice bran Wheat bran Fish meal Soybean meal

Dry matter 95.09c ± 0.21 c 95.37 ± 0.17 a 91.55 ± 0.28 91.84a ± 0.23 93.82b ± 0.19 93.63b ± 0.12

Moisture 4.91a ± 0.18 a 4.63 ± 0.13 8.45c ± 0.21 8.16c ± 0.26 6.18b ± 0.16 6.37b ± 0.15

Crude protein 42.21b ± 0.17 b 39.56 ± 0.18 a 13.45 ± 0.13 16.10a ± 0.12 53.60c ± 0.21 50.12c ± 0.17

Crude lipid 9.05c ± 0.28 c 9.73 ± 0.19 3.37a ± 0.17 4.58a ± 0.13 7.78b ± 0.26 7.56b ± 0.24

Carbohydrate 8.62b ± 0.13 b 7.32 ± 0.12 19.61c ± 0.17 16.26c ± 0.19 4.33a ± 0.14 4.72a ± 0.10

Ash 4.62a ± 0.21 a 4.12 ± 0.17 12.50c ± 0.16 11.92c ± 0.21 10.60 b ± 0.20 10.05 b ± 0.18

Energy (Kcal/g) 4.74b ± 0.13 b 4.92 ± 0.21 1.86a ± 0.22 1.99a ± 0.26 3.92c ± 0.23 3.63c ± 0.13

Table 2. Composition of control and formulated feeds experimented (% in dry weight basis)

Ingredient Ground nut oil cake Mustard oil cake Rice bran Wheat bran Fish meal Soybean meal Sodium alginate (g) Vitamin1 mineral mixture (g) Vegetable oil (ml) Cod liver oil2 (ml) Oxytetracycline (mg) Chromic oxide (%) 1

Control Nil 50 50 Nil Nil Nil 5 Nil Nil Nil 500 1.00

Feed A 15 15 10 10 25 25 5 2 1.5 1.5 500 1.00

Feed B 18 60 2 8 4 8 5 2 1.5 1.5 500 1.00

Feed C 8 12 40 30 6 4 5 2 1.5 1.5 500 1.00

Feed D 16.66 16.66 16.66 16.66 16.66 16.66 5 2 1.5 1.5 500 1.00

Supplevite – M (Sarabhai Chemicals India) Cod liver oil (Sea cod, M/S Universal Medicare Ltd. Mumbai).

mustard oil cake (15%), rice bran (10%), wheat bran (10%), fish meal (25%) and soybean meal (25%). The combination aimed at the supply of maximum protein component than the energy. Feed B consisted of ground nut oil cake (18%), mustard oil cake (60%), rice bran (2%), wheat bran (8%), fish meal (4%) and soybean meal (8%). This combination, instead of having fish meal as a source of protein had mustard oil cake. Feed C consisted of ground nut oil cake (8%), mustard oil

cake (12%), rice bran (40%), wheat bran (30%), fish meal (6%) and soybean meal (4%). This combination aimed at the use of carbohydrate rich diet for the growth. Feed D consisted of the mixture of equal quantity (16.66%) of all the ingredients. Vegetable oil (1.5 ml per 100 g of feed) and cod liver oil (1.5 ml per 100 g of feed) were incorporated in each formulated feed to ensure adequate supply of fatty acids of both n - 6 and n - 3 series, assumed to be essential for common carp. Vitamin

- mineral mixture (2 per 100 g of feed) was added to each formulated feed for the maintenance of fish health. Sodium alginate (5 per 100 g of feed) was used as binder and oxytetra-cycline (500 mg per 100 g of feed) as antibiotic for control and formulated feeds. 1% chromic oxide (BDH 277572Q) was included in control and formulated feeds, as inert indicator for digestibility studies. Composition of control and formulated feeds (% in dry weight basis) experimented is given in Table 2.

Ahmad et al.

8371

Table 3. Biochemical composition of control and formulated feeds experimented (% in dry weight basis).

Biochemical composition Dry Matter Moisture Crude Protein Crude Lipid Carbohydrate Ash Energy (Kcal/g) P/E (mg protein/Kj)

Control 92.89a ± 0.17 7.11b ± 0.21 a 26.50 ± 0.31 a 5.80 ± 0.26 b 32.95 ± 0.18 a 8.68 ± 0.21 3.66a ± 0.15 a 17.33 ± 0.22

Feed A 93.77b ± 0.21 6.23a ± 0.16 c 42.00 ± 0.26 b 8.94 ± 0.19 a 12.92 ± 0.16 b 9.39 ± 0.19 4.44b ± 0.11 c 22.64 ± 0.36

Feed B 94.01b ± 0.19 5.99a ± 0.17 b 40.00 ± 0.21 b 9.31 ± 0.25 a 10.08 ± 0.10 b 9.45 ± 0.16 4.65b ± 0.13 b 20.54 ± 0.21

Feed C 92.73a ± 0.28 7.27 b ± 0.23 a 25.98 ± 0.19 a 5.49 ± 0.18 b 34.63 ± 0.19 a 8.59 ± 0.26 3.48a ± 0.16 a 17.18 ± 0.19

Feed D 93.44b ± 0.16 6.56a ± 0.19 ab 34.75 ± 0.17 b 8.22 ± 0.16 a 15.07 ± 0.22 b 9.15 ± 0.15 4.26b± 0.19 ab 19.53 ± 0.15

Biochemical composition of control and formulated feeds experimented Biochemical composition of control and formulated feeds experimented (% in dry weight basis) is given in Table 3. The highest dry matter content (94.01 ± 0.19%) was recorded in feed B and the least (92.73 ± 0.28%) in feed C. The highest moisture content (7.27 ± 0.23%) was recorded in feed C and the least (5.99 ± 0.17%) in feed B. The highest crude protein (42± 0.26%) was recorded in feed A and the least (25.98± 0.19%) in feed C. The highest crude lipid (9.31 ± 0.25%) was recorded in feed B and the least (5.49 ± 0.18%) in feed C. The highest carbohydrate content (34.63 ± 0.19%) was recorded in feed C and the least (10.08 ± 0.10%) in feed B. The highest ash content (9.45 ± 0.16%) was recorded in feed B and the least (8.59 ± 0.26%) in feed C. The highest energy content (4.65 ± 0.13 Kcal/g) was recorded in feed B and the least (3.48 ± 0.16 Kcal/g) in feed C. The highest P/E ratio (22.64 ± 0.36 mg protein/Kg) was recorded in feed A and the least (17.18 ± 0.19 mg protein/Kg) in feed C. Nutrient and energy utilization The nutrient and energy utilization of fingerlings fed on control and a formulated feed for 90 days is given in Table 4. Protein efficiency ratio (PER) After 90 days, the highest PER (2.66 ± 0.01) was recorded in the fingerlings fed on feed B and the least (2.06 ± 0.02) in the fingerlings fed on feed C. There was no significant difference (P>0.05) in the PER of the fingerlings fed on control feed and feed C. The PER of the fingerlings fed on Feed A was significantly lower (P<0.05) as compared to the PER of the fingerlings fed on Feed B.

recorded in the fingerlings fed on feed B and the least (26.24 ± 0.24%) in the fingerlings fed on feed C. There was no significant difference (P>0.05) in the ANPU of the fingerlings fed on control feed and feed C. The ANPU of the fingerlings fed on feed A was significantly lower (P<0.05) as compared to the ANPU of the fingerlings fed on feed B. Apparent net lipid utilization (ANLU) After 90 days, the highest ANLU (32.43 ± 0.12%) was recorded in the fingerlings fed on feed B and the least (25.15 ± 0.21%) in the fingerlings fed on feed C. There was no significant difference (P>0.05) in the ANLU of the fingerlings fed on control feed and feeds C, A, B and D. Apparent net energy utilization (ANEU) After 90 days, the highest ANEU (28.65 ± 0.27%) was recorded in the fingerlings fed on feed B and the least (21.53 ± 0.21%) in the fingerlings fed on feed C. There was no significant difference (P>0.05) in the ANEU of the fingerlings fed on control feed and feed C, A, B and D. Digestibility The nutrient and energy digestibility shown by the fingerlings fed on control and a formulated feed for 90 days is given in Table 4. Dry matter digestibility The highest dry matter digestibility (58.87%) was recorded in the fingerlings fed on feed B and the least (48.14%) in the fingerlings fed on feed C.

Apparent net protein utilization (ANPU)

Protein digestibility

After 90 days, the highest ANPU (36.67 ± 0.19%) was

The highest protein digestibility (75.02%) was recorded in

8372

Afr. J. Biotechnol.

Table 4. Nutrient and energy utilization and digestibility of fingerlings fed on control and formulated feeds for 90 days.

Parameter

Feed

Protein efficiency ratio (PER) Apparent net protein utilization (ANPU %)

Control 2.09 ± 0.03a 26.88 ± 0.18a

Feed A 2.48 ± 0.04b 35.48 ± 0.28b

Feed B 2.66 ± 0.01c 36.67 ± 0.19c

Feed C 2.06 ± 0.02a 26.24 ± 0.24a

Feed D 2.26 ± 0.02ab 32.62 ± 0.17ab

± SEM 0.02 0.21

Apparent net lipid utilization (ANLU %) Apparent net energy utilization (ANEU %)

25.61 ± 0.17a a 21.78 ± 0.19

31.63 ± 0.26b b 26.32 ± 0.31

32.43 ± 0.12b b 28.65 ± 0.27

25.15 ± 0.21a a 21.53 ± 0.21

29.54 ± 0.14b b 25.18 ± 0.19

0.16 0.23

48.64 59.50 66.16 49.64 55.18

57.21 73.10 87.10 55.53 61.05

58.87 75.02 88.14 55.95 62.15

48.14 59 65.21 48.82 54.60

56.13 71.65 86.14 54.97 60.12

-----

Dry matter digestibility (%)* Protein digestibility (%)* Lipid digestibility (%)* Carbohydrate digestibility (%)* Energy digestibility (%)*

Values are means ± SD of three replications (d.f. 5, 17). Means in the same row having different superscripts are significantly different (P < 0.05) and means in the same row with same superscript are not significantly different (P > 0.05).*No statistical analysis was possible as determinations were performed on pooled samples.

the fingerlings fed on feed B and the least (59%) in the fingerlings fed on feed C.

DISCUSSION Nutrient and energy utilization

Lipid digestibility The highest lipid digestibility (88.14%) was recorded in the fingerlings fed on feed B and the least (65.21%) in the fingerlings fed on feed C. Carbohydrate digestibility The highest carbohydrate digestibility (55.95%) was recorded in the fingerlings fed on feed B and the least (48.82%) in the fingerlings fed on feed C. Energy digestibility The highest energy digestibility (62.15%) was recorded in the fingerlings fed on feed B and the least (54.60%) in the fingerlings fed on feed C.

The PER was recorded the highest (2.66 ± 0.01) in the fingerlings fed on feed B and the least (2.06 ± 0.02) in the fingerlings fed on feed C. There was no significant difference (P>0.05) in the PER of the fingerlings fed on control feed and feed C. The PER of the fingerlings fed on feed A was significantly lower (P<0.05) as compared to the PER of the fingerlings fed on feed B. The highest PER in feed B having 40% dietary protein level gets support from the work of Babalola and Adebayo (2006) who reported the highest PER 3.98 in catfish fed with higher crude protein (50%). Similar values of higher PER attained at higher dietary protein levels has been reported by Gul et al. (2007), Diyaware et al. (2009), Adewolu and Adoti (2010) and Sotolu (2010) in several fish species. The ANPU was recorded the highest (36.67 ± 0.19%) in the fingerlings fed on feed B and the least (26.24 ± 0.24%) in the fingerlings

fed on feed C. There was no significant difference (P>0.05) in the ANPU of the fingerlings fed on control feed and feed C. The ANPU of the fingerlings fed on feed A was significantly lower (P<0.05) as compared to the ANPU of the fingerlings fed on feed B. Diler et al. (2007), while replacing fish meal with Ulva rigida having 11.50% crude protein reported the lowest ANPU (23.41%) in common carp, in contrast to Samsons and Fasakin (2008) who reported 45.62% ANPU in African catfish, after inclusion of animal protein meals with crude protein > 50 to 55%, but reported decrease in ANPU and PER after the crude protein content was enhanced to 60%. These findings lend support to the present work showing the highest ANPU in feed B having 40% dietary protein level and the least ANPU in feed C having 25.98% dietary protein level, barring the protein requirements of the test fish species. The protein utilization in terms of PER and ANPU exhibited positive correlation with the dietary protein level up to 40% and above 40% dietary protein level, both the parameters decreased significantly

Ahmad et al.

(P<0.05). The PER and ANPU also exhibited positive correlation with the lipid level of feed. Lupatsch et al. (2001) and Bright et al. (2005) reported increase in protein utilization with the increase in dietary protein and lipid level in catfish, these observations support present finding related to the increase in protein utilization with the increase in dietary protein and lipid levels. The ANLU was found the highest (32.43 ± 0.12%) in the fingerlings fed on feed B and the least (25.15±0.21%) in the fingerlings fed on feed C. The ANEU was found the highest (28.65 ± 0.27%) in the fingerlings fed on feed B and the least (21.53 ± 0.21%) in the fingerlings fed on feed C. There was no significant difference (P>0.05) in the ANLU and ANEU of the fingerlings fed on control feed and feeds C, A, B and D. Morais et al. (2001) reported ANLU 36.25% in Atlantic cod at 40% dietary protein level, which strongly supports the present observation showing the highest ANLU in feed B having 40% dietary protein level. Kalita et al. (2008) and Alessio et al. (2010) reported higher ANLU and ANEU values in Catla catla, Cirrhinus mrigala and gilthead sea bream, Sparus aurata, respectively, after increasing the dietary crude protein levels from 30 to 40%, which lend support to the present observation of the highest ANLU and ANEU in feed B having 40% dietary protein level. Both ANLU and ANEU exhibited positive correlation with the dietary lipid level, which is in accordance with the findings of Morais et al. (2001) and Lee et al. (2002), who reported the increase in lipid utilization and energy utilization with the increase in dietary lipid levels. Digestibility The highest dry matter digestibility (58.87%) was recorded in the fingerlings fed on feed B. The least dry matter digestibility (48.14%) was recorded in the fingerlings fed on feed C. The highest dry matter digestibility in feed B having 40% dietary protein conforms with the work of Cheng et al. (2003) and Gul et al. (2007) who reported better dry matter digestibility in fish fed higher dietary protein levels. The highest protein digestibility (75.02%) was recorded in the fingerlings fed on feed B. The least protein digestibility (59%) was recorded in the fingerlings fed on feed C. The protein digestibility increased with the increase in dietary protein level up to 40% and above 40% of the dietary protein level, decrease in protein digestibility was observed. Gul et al. (2007), Portz and Cyrino (2004) and Tidwell et al. (2005) reported the increase in protein digestibility with the increase in dietary protein level. The highest lipid digestibility (88.14%) was recorded in the fingerlings fed on feed B. The least lipid digestibility (65.21%) was recorded in the fingerlings fed on feed C. The highest carbohydrate digestibility (55.95%) was recorded in the fingerlings fed on feed B. The least carbohydrate digestibility (48.82%) was recorded in the fingerlings fed on feed C. The highest energy digestibility

8373

(62.15%) was recorded in the fingerlings fed on feed B. The least energy digestibility (54.60%) was recorded in the fingerlings fed on feed C. Similar findings have been reported in literature by Steven and Delbert (2000), Maina et al. (2002) and Perla et al. (2004) who reported higher lipid, carbohydrate and energy digestibility in fishes fed on diets having higher crude protein and low carbohydrate contents. Perla et al. (2004) reported higher carbohydrate and energy digestibility values of 60.5 and 65.3% respectively at dietary crude protein > 45% in juvenile grouper, which lend support to present finding of highest carbohydrate and energy digestibility in feed B having 40% dietary protein level. The dry matter, protein, lipid, energy and carbohydrate digestibilities decreased with the increase in dietary carbohydrate level. This observation is in conformation to those of Stone (2003), Jesu et al. (2008), Gumus and Ikiz (2009) and Tian et al. (2010). Based on nutrient and energy utilization and digestibility this work concludes that feed B containing 40% protein, 9.31% lipid, 10.08% carbohydrate and having P/E ratio 20.54 mg protein/Kg is the best one for a more profitable and successful culture of the common carp. ACKNOWLEDGEMENTS The authors are greatly indebted to Prof. Pradeep Shrivasthava, Head of the Department of Zoology and Applied Aquaculture, Barkatullah University, Bhopal, M.P. and Director, Indian Institute of Soil Sciences, Bhopal, for providing the laboratory facilities. The first author (Muzaffar Ahmad) thanks the University Grants Commission (UGC), New Delhi, for providing Maulana Azad National Minority Fellowship (No.F.40-14(M)/2009(SAIII/MANF). REFERENCES Adewolu MA, Adoti AJ (2010). Effect of mixed feeding of varying dietary protein levels on the growth and feed utilization of Clarias gariepinus fingerlings. J. Anim. Vet. Adv. 9(10): 1415-1419. Alatise PS, Ogundele O, Eyo AA, Oludunjoye F (2006). Evaluation of different soybean-based diets on growth and nutrient utilization of Heterobranchus longifilis in aquaria tanks. FISON conference proceeding. pp. 255-262. Alessio B, Gloria I, Ramon F, Luca P, Ester G, Pier PG (2010). Growth and feed utilization of gilthead sea bream, Sparus aurata fed increasing dietary energy levels. J. Aquacult. 282(2): 309-314. Amoah A, Shawn DC, Carl DW, Robert MD, Leigh AB, James HD (2008). Effect of graded levels of carbohydrates on growth and survival of largemouth bass, Micropterus salmoides. J. World Aquacult. Soc. 39(3): 397-405. AOAC (1995). Official methods of analysis of the Association of Official th Analytical Chemist. 16 edition, Association of Official Analytical Chemist, Washington, DC, USA. pp. 1234-1565. Babalola F, Adebayo P (2006). Effect of dietary protein on the growth of catfish. J. Aquacult. Int. 39(4): 233-237. Bright LA, Coyle SD, Tidwell JH (2005). Effect of dietary lipid level and protein energy ratio on growth and body composition of largemouth bass, Micropterus salmoides. J. World Aquacult. Soci. 36(1): 129134.

8374

Afr. J. Biotechnol.

Burel C, Boujard T, Tulli F, Kaushik SJ (2000). Digestibility of extruded peas, extruded lupin, and rapeseed meal in rainbow trout, Oncorhynchus mykiss and turbot, Psetta maxima. J. Aquacult. 188: 285-298. Cheng ZJ, Hardy RW, Idler DR (2003). Assessment of dry matter and protein digestibilities of selected raw ingredients by discus fish, Symphysodon aequifasciata. J. Aquacult. Nutri. 9(2): 123-128. Diler I, Adem TD, Guroy BK, Soyuturk M (2007). Effects of Ulva rigida on the growth, feed intake and body composition of Common carp, Cyprinus carpio. J. Bio. Sci. 7(2): 305-309. Diyaware MY, Modu BM, Yakubu UP (2009). Effect of dietary protein levels on growth performance and feed utilization of hybrid catfish, Heterobranchus bidorsalis Ă&#x2014; Clarias anguillaris. Afr. J. Biotech. 8(16): 3954-3957. Du ZY, Clouet P, Huang LM, Degrace P, Zheng WH, Tian LX, Liu YJ (2008). Utilization of different dietary lipid sources at high level in herbivorous grass carp, Ctenopharyngodon idella and mechanism related to hepatic fatty acid oxidation. J. Aquacult. Nutr. 14: 77-92. Gauquelina F, Cuzona G, Gaxiolab G, Rosasb C, Arenab L, Bureauc DP, Cocharda JC (2007). Effect of dietary protein level on growth and energy utilization by Litopenaeus stylirostris under laboratory conditions. J. Aquacult. 271(1-4): 439-448. Gul Y, Salim M, Rabbani B (2007). Evaluation of apparent digestibility coefficients of different dietary protein levels with and without fish meal for Labeo rohita. Pak. Vet. J. 27(3): 121-125. Gullaine JC, Kaushik S, Bergot P, Metailler R (2001). Nutrition and feeding of fish and crustaceans. Springer-Praxis books edition. pp. 1396. Gumus E, Ikiz R (2009). Effect of dietary levels of lipid and carbohydrate on growth performance, chemical contents and digestibility in rainbow trout, Oncorhynchus mykiss. Pak. Vet. J. 29(2): 59-63. Hemre GI, Mommsen TP, Krogdahl A (2002). Carbohydrates in fish nutrition: effects of growth, glucose metabolism and hepatic enzymes. Aquacult. Nutr. 8:175-194. Jamabo NA, Alfred OJF (2008). Effects of dietary protein levels on the growth performance of Heterobranchus bidorsalis fingerlings from Niger delta. Afr. J. Biotechnol. 7(14): 2483-2485. Jesu AR, Haniffa MA, Seetharaman S, Appelbaum S (2008). Utilization of various dietary carbohydrate levels by the freshwater Catfish, Mystus montanus (Jerdon). Turk. J. Fish. Aquacult. Sci. 8: 31-35. Kalita S, Dabrowski J, Haynu S (2008). Effect of supplementation of four non- conventional aquatic weeds to the basal diet on growth, nutrient utilization and body composition of Catla catla and Cirrhinus mrigala fingerlings. J. World Aquacult. Soc. 39(3): 353-359. Kaushik SJ (2004). Fish oil replacement in aquafeeds. Aqua Feeds: Formulation and Beyond. pp. 1: 3-6. Kiessling A, Pickova J, Johansson L, Asgard T, Storebakken T, Kiessling KH (2001). Changes in fatty acid composition in muscle and adipose tissue of farmed rainbow trout, Oncorhynchus mykiss in relation to ration and age. J. Food Chem. 73: 271-284. Kim KW, Wang X, Choi SM, Park GJ, Bai SC (2004). Evaluation of optimum dietary protein to energy ratio in juvenile olive flounder, Paralichthys olivaceus. J. Aquacult. Res. 35: 250-255. Krogdahl A, Hemre GI, Mommsen TP (2005). Carbohydrates in fish nutrition. Digestion and absorption in postlarval stages. J. Aquacult. Nutri. 11: 103-122. Lee SM, Jeon IG, Lee JY (2001). Effects of digestible protein and lipid levels in practical diets on growth, protein utilization and body composition of juvenile rockfish, Sebastes schlegeli. J. Aquacult. 211: 227-39. Lupatsch I, Kissil GW, Sklan D, Pfeffer, E (2001). Effects of varying dietary protein and energy supply on growth, body composition and protein utilization in gilthead seabream, Sparus aurata. J. Aquacult. Nutri. 7: 71-80. Maina JG, Beames RM, Higgs D, Iwama G, Kisia SM (2002). Digestibility of some feed ingredients fed to tilapia, Oreochromis niloticus. J. Aquacult. Res. 33(2): 853-859. th Maynard LA, Loosli JK (1969). Animal nutrition. 6 edition, McGraw-Hill, New York, USA. pp. 234-236.

Menoyo D, Lopez BCJ, Baustita JM, Obach A (2003). Growth, digestibility and fatty acid utilization in large Atlantic salmon, Salmo salar fed varying levels of n-3 and saturated fatty acids. J. Aquacult. 225: 295-307. Morais S, Bell JG, Robertson DA, Roy WJ, Morris PC (2001). Proteinlipid ratios in extruded diets for Atlantic cod, Gadus morhua. Effects on growth, feed utilization, muscle composition and liver histology. J. Aquacult. 203: 101-119. Mourente G, Goodand JE, Bell JG (2005). Partial substitution of fish oil with rapeseed, linseed and olive oils in diets for European sea bass, Dicentrarchus labrax. Effects on flesh fatty acid composition, plasma prostaglandins E2 and F2a, immune function and effectiveness of a fish oil finishing diet. J. Aquacult. Nutr. 11: 25-40. Mustafizur R, Leopold AJ, Nagelkerke MCJ, Verdegem M, Wahab A, Johan AJ (2008). Relationships among water quality, food resources, fish diet and fish growth in polyculture ponds. J. Aquacult. 272(1): 108-115. NRC (1993). Nutrient requirements of fish. National Academy Press, Washington, DC, USA. pp. 114-398. Perla S, Eusebio R, Coloso M, Roger EP (2004). Apparent digestibility of selected ingredients in diets for juvenile grouper, Epinephelus coioides. J. Aquacult. Res. 35(3): 1261-1268. Portz L, Cyrino JEP (2004). Digestibility of nutrients and amino acids of different protein sources in practical diets by largemouth bass, Micropterus salmoides. J. Aquacult. Res. 35: 312-320. Samsons YA, Fasakin AE (2008). Use of animal protein meals as fish meal replacer in the diets of the African catfish, Clarias gariepinus juveniles. J. Tropicult. 26(2): 89- 93. Shiau SY, Lin YH (2001). Carbohydrate utilization and its proteinsparing effect in diets for grouper, Epinephelus malabaricus. J. Anim. Sci. 73: 299-304. Sotolu AO (2010). Effect of varying dietary protein levels on the growth performance of Clarias gariepinus fry. J. Livestock Res. Rural Dev. 22(4): 312-318. Steven D, Delbert M (2000). Nutrient digestibility of common feedstuffs in extruded diets for sunshine bass, Morone chrysops Ă&#x2014; M. saxatilis. J. World Aquacult. Soc. 31(4): 570-575. Stone DAJ (2003). Dietary carbohydrate utilization by fish. Rev. Fish. Sci. 11: 337-369. Storebakken T (2002). Atlantic salmon. Webster, CD and Lim C, editors. Nutrient requirements and feeding of finfish for aquaculture. CABI Publishing, Wallingford, UK. pp. 79-102. Subhadra B, Lochmann R, Rawles S, Chen R (2006). Effect of dietary lipid source on the growth, tissue composition, and hematological parameters of largemouth bass, Micropterus salmoides. J. Aquacult. 255: 210-222. Tian LX, Liu YJ, Hung SSO, Deng DF, Yang HJ, Niu J, Liang GY (2010). Effect of feeding strategy and carbohydrate source on carbohydrate utilization by Grass carp, Ctenopharyngodon idella. Am. J. Agric. Bio. Sci. 5(2): 135-142. Tidwell JH, Coyle SD, Bright LA, Yasharian D (2005). Evaluation of plant and animal source proteins for replacement of fish meal in practical diets for the largemouth bass, Micropterus salmoides. J. World Aquacult. Soc. 36: 454-463. Webster CD, Lim L (2002). Introduction to fish nutrition. Webster, CD and Lim C, editors. Nutrient requirements and feeding of finfish for aquaculture. CABI Publishing, Wallingford, UK. pp. 1-27.

Full Length Research Paper

Effect of dietary protein, lipid and carbohydrate contents on the viscera composition and organ Indices of Cyprinus carpio communis fingerlings Muzaffar Ahmad*, T. A. Qureshi and A. B. Singh Department of Zoology and Applied Aquaculture, Barkatullah University, Bhopal 462026, M. P., India. Accepted 4 November, 2011

This study aimed to determine a feed formulation with the best protein to energy ratio that would result in a better viscera composition and organ indices (OI) of Cyprinus carpio communis. Fingerlings having average weight of 1.64 ± 0.13 g and length of 5.26 ± 0.10 cm were fed on four different formulated feeds and a control feed (each in a triplicate set), 6% of their body weight, three times a day, during 90 days. Feeds were formulated using ground nut oil cake, mustard oil cake, rice bran, wheat bran, fish meal and soybean meal in order to suffice the balanced need of protein and energy of the common carp. Viscera composition and OI of fingerlings were measured. Results indicate that there was a significant increase in viscera lipid content with the increase in dietary carbohydrate level. The viscera lipid content was found highest in the fingerling fed on feed C and the least in the fingerlings fed on feed B. The eviscerosomatic index (EVSI) decreased significantly (P<0.05) with the increase in the dietary carbohydrate level, whereas the viscero-somatic and hepato-somatic indexes (HSI) increased significantly (P<0.05) with the increase in dietary carbohydrate level. The EVSI was the highest, whereas viscero-somatic index (VSI) and HSI were least in the fingerlings fed on the feed B. Moreover, the EVSI was the least, whereas viscero-somatic and HSI were highest in the fingerlings fed on feed C. This work concludes that feed B containing 40% protein, 9.31% lipid, 10.08% carbohydrate and having protein to energy ratio of 20.54 mg protein/kJ was the best feed for a more profitable and successful culture of the common carp. Key words: Protein to energy ratio, carp production, viscera composition, organ indices.

INTRODUCTION The dietary protein to energy ratio, in fish diets, is of great importance. Levels of dietary protein and energy not only influence the growth and body composition, but also digestive enzymes’ activities and plasma metabolites in various fishes (Gangadhara et al., 1997; McGoogan and Gatlin III, 2000; Yamamoto et al., 2000; Yigit 2001; Wang et al., 2005; Zhen et al., 2009). Providing adequate energy through dietary lipids can minimize the use of more costly protein as an energy source (Van der Meer

*Corresponding author. E-mail: muzaffarahmad8@gmail.com. Tel: 9018877446, 9086768832. Abbreviations: OI, Organ indices; HSI, hepato-somatic indexes; EVSI, eviscero-somatic index; VSI, viscero-somatic index.

et al., 1997; Jantrarotai et al., 1998; Company et al., 1999; McGoogan and Gatlin III, 2000; Pedro et al., 2001).High-energy diets can also lead to excessive deposition of carcass lipids (Morais et al., 2001) and reduced growth rate (McGoogan and Gatlin III, 2000). Excess carcass lipid accumulation and reduced growth rate due to increased dietary energy have also been shown for juvenile rockfish (Lee et al., 2002) and Atlantic halibut (Hamre et al., 2003). To reduce feeding costs in aquaculture, approaches to reducing dietary protein levels or improving protein utilization have been studied extensively. Most studies concentrated on increasing dietary energy levels or lowering the protein to energy ratio (P/E ratio), as well as to reduce the amount of protein in fish diets, and these have been confined mainly to studies of growth performance such as largemouth bass; grass carp; hybrid

8362

Afr. J. Biotechnol.

catfish, Heterobranchus bidorsalis × Clarias anguillaris and rainbow trout (Amoah et al., 2008; Du et al., 2008; Diyaware et al., 2009; Gumus and Ikiz, 2009). The aim of the present study was to carry out orderly nutritional research with common carp by using different dietary protein, lipid and carbohydrate contents for determination of a feed formulation with optimum protein to energy ratio (P/E ratio) that would result in a better viscera composition and organ indices (OI) so as to make production of common carp economical. MATERIALS AND METHODS Cyprinus carpio communis fingerlings having average weight of 1.64 ± 0.13 g and length of 5.26 ± 0.10 cm were used for the experiment. Prior to the initiation of the feeding trail, fingerlings were acclimatized for one week. During this period, traditional mixture of mustard oil cake and rice bran (1:1) was fed to the fingerlings. Each formulated feed and control feed was fed to triplicate group of fingerlings for 90 days. 50 fingerlings were reared in each fiber glass tank. Water was supplied to each tank at the rate of 1 L min-1. About 30% of water was replaced weekly with freshwater to adjust water quality. Water analysis of the experimental tanks was done regularly to monitor any unusual changes. The tanks were aerated throughout the experiments with aquarium air pumps (RS-180, Zhongshan Risheng Co. Ltd., China). Biochemical analysis (dry matter, moisture, crude protein, crude lipid, carbohydrate and ash of feed ingredients, feeds and viscera) was determined by using standard procedures (AOAC, 1995). The energy content of feed ingredients and feeds were calculated calorimetrically. Composition of control and formulated feeds experimented Four feeds (feed A, B, C and D) were formulated using ground nut oil cake, mustard oil cake, rice bran, wheat bran, fish meal and soybean meal. The ingredients were selected so as to suffice the balanced need of protein and energy of the common carp. Feeds were formulated using “Pearson-Square method” with different protein, carbohydrate and lipid contents. Control feed consisted of 50% mustard oil cake and 50% rice bran. Feed A consisted of ground nut oil cake (15%), mustard oil cake (15%), rice bran (10%), wheat bran (10%), fish meal (25%) and soybean meal (25%). The combination was aimed at the supply of maximum protein component than energy. Feed B consisted of ground nut oil cake (18%), mustard oil cake (60%), rice bran (2%), wheat bran (8%), fish meal (4%) and soybean meal (8%). This combination, instead of having fish meal as a source of protein had mustard oil cake. Feed C consisted of ground nut oil cake (8%), mustard oil cake (12%), rice bran (40%), wheat bran (30%), fish meal (6%) and soybean meal (4%). This combination aimed at the use of carbohydrate rich diet for the growth and feed D consisted of the mixture of equal quantity (16.66%) of all the ingredients. In addition, vegetable oil (1.5 ml per 100 g of feed) and cod liver oil (1.5 ml per 100 g of feed) were incorporated in each formulated feed to ensure adequate supply of fatty acids of both n-6 and n-3 series, assumed to be essential for common carp. Vitamin - mineral mixture (2 g per 100 g of feed) was added to each formulated feed for the maintenance of fish health. Sodium alginate (5 g per 100 g of feed) was used as binder and oxytetracycline (500 mg per 100 g of feed) as antibiotic for control and formulated feeds. Composition of control and formulated feeds (% in dry weight basis) experimented are given in Table 2. Dry ingredients were mixed for about 30 min in a Hobart mixer

(Belle, Mini 150; England) to ensure that the mixture was well homogenized and then blended with oil for about 15 min. Water was added at 20 to 30% v/w to give a pelletable mixture. A pelleting machine (Hobart, model, A 200) was used to pellet the feeds. An appropriate die was used to form pellets of desired sizes (1.0 to 3.0 mm). Pellets were oven dried and fed to the fishes, 6% of the body weight, three times a day at 10 a.m., 2.0 p.m. and 5.0 p.m. every day.

Organ indices (OI) OI; eviscero-somatic index (EVSI), viscero-somatic index (VSI) excluding liver and hepato-somatic index (HSI) were calculated using the following formulae:

Weight of eviscerated fish (g) EVSI (%) =

× 100 Body weight (g) Weight of viscera excluding liver (g)

VSI excluding liver (%) =

× 100 Body weight (g)

Weight of liver (g) HSI (%) =

× 100 Body weight (g)

RESULTS Biochemical composition of fish feed Ingredients Biochemical composition of fish feed ingredients (% in dry weight basis) used for the present research work is given in Table 1. The dry matter content of fish feed ingredients was highest (95.37% ± 0.17) in mustard oil cake and the least (91.55% ± 0.28) in rice bran, moisture content was highest (8.45% ± 0.21) in rice bran and the least (4.63% ± 0.13) in mustard oil cake, crude protein was highest (53.60% ± 0.21) in fish meal and the least (13.45% ± 0.13) in rice bran, crude lipid was highest (9.73% ± 0.19) in mustard oil cake and the least (3.37% ± 0.17) in rice bran and carbohydrate content was highest (19.61% ± 0.17) in rice bran and the least (4.33% ± 0.14) in fish meal. More also, the ash content of fish feed ingredients is the highest (12.50 ± 0.16%) in rice bran and the least (4.12 ± 0.17%) in mustard oil cake while the energy content was the highest (4.92 ± 0.21 kcal/g) in mustard oil cake and the least (1.86 ± 0.22 kcal/g) in rice bran. Out of six ingredients, ground nut oil cake and mustard oil cake were used as the source of lipid to provide energy of 4.74 ± 0.13 and 4.92 ± 0.21 kcal/g, respectively. Fish meal and soybean meal were used as protein source, providing 53.60 ± 0.21 and 50.12 ± 0.17 % crude protein, respectively. Rice bran and wheat bran were used as the source of carbohydrate to provide instant energy of 1.86 ± 0.22 and 1.99 ± 0.26 kcal/g, respectively. There was no significant difference (P > 0.05) in the biochemical

Ahmad et al.

8363

Table 1. Biochemical composition of fish feed ingredients (% in dry weight basis).

S/N 1 2 3 4 5 6

Ingredient Ground nut oil cake Mustard oil cake Rice bran Wheat bran Fish meal Soybean meal

Dry matter

Moisture

Crude protein

Crude lipid

Carbohydrate

Ash

Energy (kcal/g)

95.09c ± 0.21 95.37c ± 0.17 91.55a ± 0.28 91.84a ± 0.23 93.82b ± 0.19 b 93.63 ± 0.12

4.91a ± 0.18 4.63a ± 0.13 8.45c ± 0.21 8.16c ± 0.26 6.18b ± 0.16 b 6.37 ± 0.15

42.21b ± 0.17 39.56b ± 0.18 13.45a ± 0.13 16.10a ± 0.12 53.60c ± 0.21 c 50.12 ± 0.17

9.05c ± 0.28 9.73c ± 0.19 3.37a ± 0.17 4.58a ± 0.13 7.78b ± 0.26 b 7.56 ± 0.24

8.62b ± 0.13 7.32b ± 0.12 19.61c ± 0.17 16.26c ± 0.19 4.33a ± 0.14 a 4.72 ± 0.10

4.62a ± 0.21 4.12a ± 0.17 12.50c ± 0.16 11.92c ± 0.21 10.60b ± 0.20 b 10.05 ± 0.18

4.74b ± 0.13 4.92b ± 0.21 1.86a ± 0.22 1.99a ± 0.26 3.92c ± 0.23 c 3.63 ± 0.13

Values are means ± SD. Means in the same column having different superscripts are significantly different (P < 0.05), while m eans in the same column with same superscript are not significantly different (P > 0.05). kcal, Kilo-calorie; SD, standard deviation.

composition of ground nut oil cake and mustard oil cake; rice bran and wheat bran; fish meal and soybean meal.

protein/kJ) was recorded in feed A and the least (17.18 ± 0.19 mg protein/ kJ) in feed C. Viscera composition

Biochemical composition of formulated feeds experimented

control

and

Biochemical composition of control and formulated feeds experimented (% in dry weight basis) is given in Table 3. The highest dry matter content (94.01 ± 0.19%) was recorded in feed B and the least (92.73 ± 0.28%) in feed C, highest moisture content (7.27 ± 0.23%) was recorded in feed C and the least (5.99 ± 0.17%) in feed B and highest crude protein (42 ± 0.26%) was recorded in feed A and the least (25.98 ± 0.19%) in feed C. Moreover, the highest crude lipid (9.31 ± 0.25%) was recorded in feed B and the least (5.49 ± 0.18%) in feed C, highest carbohydrate content (34.63 ± 0.19%) was recorded in feed C and the least (10.08 ± 0.10%) in feed B, highest ash content (9.45 ± 0.16%) was recorded in feed B and the least (8.59% ± 0.26) in feed C, highest energy content (4.65 kcal/g ± 0.13) was recorded in feed B and the least (3.48 ± 0.16 kcal/g) in feed C while highest P/E ratio (22.64 ± 0.36 mg

Viscera composition (% mean wet weight basis) of the fingerlings fed on control and formulated feeds after 30 and 90 days of experiment is given in Table 4. Moisture The initial viscera moisture content of the fingerlings was recorded as 81.65 ± 0.24%. After 30 days, however,there was no significant difference (P > 0.05) in the viscera moisture content of the fingerlings fed on control feed, feed A, feed B, feed C and feed D. After 90 days, the highest viscera moisture content was recorded (78.68 ± 0.17%) in the fingerlings fed on feed B and the least (72.12% ± 0.27) in the fingerlings fed on feed C. There was no significant difference (P > 0.05) in the viscera moisture content of the fingerlings fed on control feed and feed C; feed A, feed B and feed D.

Crude protein The initial viscera crude protein of the fingerlings was recorded as 12.16 ± 0.28%. After 30 days, there was no significant difference (P > 0.05) in the viscera crude protein of the fingerlings fed on control feed, feed A, feed B, feed C and feed D. After 90 days, the highest viscera crude protein was recorded (15.63% ± 0.16) in the fingerlings fed on feed B and the least (14.86% ± 0.17) in the fingerlings fed on feed C. There was, however, no significant difference (P > 0.05) in the viscera crude protein of the fingerlings fed on control feed, feed A, feed B, feed C and feed D. Crude lipid The initial viscera crude lipid of the fingerlings was recorded as 4.96 ± 0.18%. After 30 days, there was no significant difference (P > 0.05) in the viscera crude lipid of the fingerlings fed on control feed, feed A, feed B, feed C and feed D. After 90 days, the highest viscera crude lipid was recorded (9.16% ± 0.11) in the fingerlings fed on feed C and the least (6.76% ± 0.19) in the fingerlings fed on feed B. There was no significant difference (P

8364

Afr. J. Biotechnol.

Table 2. Composition of control and formulated feeds experimented (% in dry weight basis).

Ingredient Ground nut oil cake Mustard oil cake Rice bran Wheat bran Fish meal Soybean meal Sodium alginate (g) 1 Vitamin mineral mixture (g) Vegetable oil (ml) Cod liver oil2 (ml) Oxytetracycline (mg) 1

Control Nil 50 50 Nil Nil Nil 5 Nil Nil Nil 500

Feed A 15 15 10 10 25 25 5 2 1.5 1.5 500

Feed B 18 60 2 8 4 8 5 2 1.5 1.5 500

Feed C 8 12 40 30 6 4 5 2 1.5 1.5 500

Feed D 16.66 16.66 16.66 16.66 16.66 16.66 5 2 1.5 1.5 500

Supplevite-M (Sarabhai Chemicals, India); Cod liver oil (Sea cod, M/S Universal Medicare Ltd. Mumbai),

Table 3. Biochemical composition of control and formulated feeds experimented (% in dry weight basis).

Biochemical composition Dry matter Moisture Crude protein Crude lipid Carbohydrate Ash Energy (kcal/g) P/E (mg protein/kJ)

Control 92.89a ± 0.17 7.11b ± 0.21 26.50a ± 0.31 5.80a ± 0.26 b 32.95 ± 0.18 a 8.68 ± 0.21 3.66a ± 0.15 17.33a ± 0.22

Feed A 93.77b ± 0.21 6.23a ± 0.16 42.00c ± 0.26 8.94b ± 0.19 a 12.92 ± 0.16 b 9.39 ± 0.19 4.44b ± 0.11 22.64c ± 0.36

Feed B 94.01b ± 0.19 5.99a ± 0.17 40.00b ± 0.21 9.31b ± 0.25 a 10.08 ± 0.10 b 9.45 ± 0.16 4.65b ± 0.13 20.54b ± 0.21

Feed C 92.73a ± 0.28 7.27 b ± 0.23 25.98a ± 0.19 5.49a ± 0.18 b 34.63 ± 0.19 a 8.59 ± 0.26 3.48a ± 0.16 17.18a ± 0.19

Feed D 93.44b ± 0.16 6.56a ± 0.19 34.75ab ± 0.17 8.22b ± 0.16 a 15.07 ± 0.22 b 9.15 ± 0.15 4.26b ± 0.19 19.53ab ± 0.15

Values are means ± SD. Means in the same row having different superscripts are significantly different (P < 0.05), while means in the same row with same superscript are not significantly different (P > 0.05). mg protein/kJ, Milligram protein/ kilo-Joule; SD, standard deviation.

> 0.05) in the viscera crude lipid of the fingerlings fed on control feed and feed C; feed A, feed B and feed D. Organ indices EVSI, VSI excluding liver and HIS of fingerlings fed on control and formulated feeds after 30 and 90 days of experiment are given in Table 5.

Viscero-somatic index (VSI) The initial VSI of the fingerlings was recorded as 5.61 ± 0.19%. After 30 days, there was no significant difference (P > 0.05) in the VSI of the fingerlings fed on control feed, feed A, feed B, feed C and feed D. After 90 days, the VSI was recorded the highest (8.56% ± 0.21) in the fingerlings fed on feed C and the least (6.80% ± 0.27) in the fingerlings fed on feed B. There was no significant difference (P > 0.05) in the VSI of the fingerlings fed on control feed and feed C; feed A, feed B and feed D.

Eviscero-somatic index (EVSI) The initial EVSI of the fingerlings was recorded as 93.18% ± 0.16. After 30 days, there was no significant difference (P > 0.05) in the EVSI of the fingerlings fed on control feed, feed A, feed B, feed C and feed D. Moreover, after 90 days the EVSI was recorded the highest (91.57 ± 0.19%) in the fingerlings fed on feed B and the least (88.25 ± 0.21%) in the fingerlings fed on feed C. There was no significant difference (P > 0.05) in the EVSI of the fingerlings fed on the control feed and feed C; feed A, Feed B and feed D.

Hepato-somatic index The initial HSI of the fingerlings was recorded as 1.21 ± 0.17%. After 30 days, there was no significant difference (P > 0.05) in the HSI of the fingerlings fed on control feed, feed A, feed B feed C and feed D. After 90 days, the highest HSI was recorded (3.19% ± 0.14) in the fingerlings fed on feed C and the least (1.63% ± 0.21) in the fingerlings fed on feed B. There was no significant difference (P > 0.05) in the HSI of the fingerlings fed on

Ahmad et al.

8365

Table 4. Viscera composition (% mean wet weight basis) of fingerlings fed on control and formulated feeds after 30 and 90 days of experiment.

Feed A

Feed B

Feed C

Feed D

 SEM

79.92  0.16 13.58a  0.16

80.16  0.19 13.64a  0.13

78.71  0.14 13.27a  0.23

79.43  0.10 13.46a  0.22

5.18a  0.11

5.08a  0.14

5.78a  0.12

5.27a  0.21

0.19 0.22 0.16

Observations after 90 days of experiment Moisture 72.56a  0.37

78.21b  0.21

78.68b  0.17

72.12a  0.27

77.51b  0.10

0.24

14.92  0.30 b 8.96  0.31

15.48  0.12 a 6.98  0.21

15.63  0.16 a 6.76  0.19

14.86  0.17 b 9.16  0.11

15.16  0.20 a 7.12  0.15

0.22 0.19

Parameter (%) Initial Control Observations after 30 days of experiment a Moisture 81.65  0.24 78.86  0.17 Crude protein 12.16  0.28 13.32a  0.21 Crude lipid 4.96  0.18 5.63a  0.17

Crude protein Crude lipid

Values are means ± SD of five replications (d.f. 5, 35). Means in the same row in the same block having different superscripts are significantly .05). SEM, Standard error of mean, SD, standard deviation.

Table 5. Eviscero-somatic index (EVSI), viscero-somatic index (VSI) excluding liver and hepato-somatic index (HSI) of fingerlings fed on control and formulated feeds after 30 and 90 days of experiment.

Parameters (%) Initial Control Observations after 30 days of experiment EVSI 93.18  0.16 92.01a  0.14 a VSI 5.61  0.19 6.36  0.18 HSI 1.21  0.17 1.63a  0.16

Feed A

Feed B

Feed C

Feed D

 SEM

92.64a  0.19 a 5.99  0.16 1.37a  0.19

92.75a  0.21 a 5.93  0.15 1.32a  0.13

91.87a  0.16 a 6.41  0.21 1.72a  0.12

92.46a  0.18 a 6.08  0.17 1.46a  0.11

0.16 0.17 0.14

Observations after 90 days of experiment EVSI 88.50a  0.31 VSI 8.43b  0.16 b HSI 3.07  0.24

91.43b  0.17 6.85a  0.21 a 1.72  0.16

91.57b  0.19 6.80a  0.27 a 1.63  0.21

88.25a  0.21 8.56b  0.21 b 3.19  0.14

91.27b  0.14 6.92a  0.19 a 1.81  0.21

0.20 0.23 0.18

Values are means ± SD of five replications (d.f. 5, 35). Means in the same row in the same block having different superscripts are significantly different SEM, Standard error of mean, SD, standard deviation.

control feed and feed C; feed A, feed B and feed D. DISCUSSION Viscera composition After 90 days, the viscera crude lipid of the fingerlings increased significantly (P < 0.05) and viscera moisture content of the fingerlings decreased significantly (P < 0.05) with the increase in dietary carbohydrate level from 10.08 to 34.63%, whereas the viscera crude protein did not vary significantly (P > 0.05) among the fingerlings fed on control and formulated feeds. The viscera lipid content was found highest in the fingerling fed on feed C and the least in the fingerlings fed on feed B. The higher viscera lipid content in fingerlings fed on feed C and control feed was due to the inability of the common carp to utilize excess dietary carbohydrate level (above 15%) due to

omnivorous feeding habit, which get converted into viscera lipid and is not desirable for economic production of fish. The least lipid content in the viscera of the fingerlings fed on feed B was due to the optimum dietary carbohydrate level (10.08%) required for common carp, which does not result in accumulation of lipid in viscera. The findings of Yigit (2001), Stone (2003), Vielma et al. (2003) and Zhen et al. (2006) who reported the increase in viscera lipid content with the increase in dietary carbohydrate content supported to present observation. Organ indices After 90 days, the EVSI decreased significantly (P<0.05) with the increase in the dietary carbohydrate level from 10.08 to 34.63%, whereas the VSI and HSI increased significantly (P<0.05) with the increase in dietary carbohydrate level from 10.08 to 34.63%. The excess

8366

Afr. J. Biotechnol.

carbohydrates got deposited in the liver and viscera as fat, hence VSI and HSI increased and EVSI decreased with the increase in dietary carbohydrate level in the present study. The EVSI was the highest, whereas viscerosomatic and hepato-somatic indexes were least in the fingerlings fed on the feed B. Furthermore, the EVSI was the least, whereas VSI and hepato-somatic index were highest in the fingerlings fed on feed C. The results of the present finding are similar to those of Lee et al. (2002), Nandeesha et al. (2002) and Kumar et al. (2010) who reported the lowest VSI and HSI in C. carpio fed on higher crude protein and lower carbohydrate diets. Other authors who reported the same trend also include Hamre et al. (2003), Krogdahl et al. (2005) and Gumus and Ikiz (2009). Conclusion Based on viscera composition and organ indices, this work concludes that a diet containing 40% protein, 9.31% lipid, 10.08% carbohydrate and having P/E ratio of 20.54 mg protein/kJ is the best for a more profitable and successful culture of the common carp. ACKNOWLEDGEMENTS The authors thank Prof. Pradeep Shrivasthava, Head of the Department of Zoology and Applied Aquaculture, Barkatullah University, Bhopal, Madhya Pradesh (M.P.), and Director, Indian Institute of Soil Sciences, Bhopal, for providing the laboratory facilities. The first author (Muzaffar Ahmad) thanks the University Grants Commission (UGC), New Delhi, for providing Maulana Azad National Minority Fellowship (No.F.40-14(M)/ 2009(SA-III/MANF). REFERENCES Amoah A, Shawn DC, Carl DW, Robert MD, Leigh AB, James HD (2008). Effect of graded levels of carbohydrates on growth and survival of largemouth bass, Micropterus salmoides. J. World Aquacult. Soc. 39(3): 397-405. AOAC (1995). Official methods of analysis of the Association of Official th Analytical Chemist. 16 edition, Association of Official Analytical Chemist, Washington, DC, USA. pp. 1234-1565. Company R, Calduch GJA, Perez SJ, Kaushik S (1999). Protein-sparing effect of dietary lipids in dentex, Dentex dentex. A comparative study with sea bream, Sparus aurata and sea bass, Dicentrachus labrax. J. Aquacult. Nutr. 5(1): 23-31. Diyaware MY, Modu BM, Yakubu UP (2009). Effect of dietary protein levels on growth performance and feed utilization of hybrid catfish, Heterobranchus bidorsalis Ă&#x2014; Clarias anguillaris. Afr. J. Biotechnol. 8(16): 3954-3957. Du ZY, Clouet P, Huang LM, Degrace P, Zheng WH, Tian LX, Liu YJ (2008). Utilization of different dietary lipid sources at high level in herbivorous grass carp, Ctenopharyngodon idella. Mechanism related to hepatic fatty acid oxidation. J. Aquacult. Nutr. 14: 77-92. Gangadhara B, Nandeesha MC, Varghese TJ, Keshavanath P (1997). Effect of varying protein and lipid levels on the growth and digestive enzyme activity of rohu, Labeo rohita. J. Asian Fish. Sci. 10(2): 139145.

Gumus E, Ikiz R (2009). Effect of dietary levels of lipid and carbohydrate on performance, chemical contents and digestibility in rainbow trout, Oncorhynchus mykiss. Pak. Vet. J. 29(2): 59-63. Gumus E, Ikiz R (2009). Effect of dietary levels of lipid and carbohydrate on performance, chemical contents and digestibility in rainbow trout, Oncorhynchus mykiss. Pak. Vet. J. 29(2): 59-63. Hamre K, Ofsti A, Naess T, Nortvedt R, Holm JC (2003). Macronutrient composition of formulated diets for Atlantic halibut, Hippoglossus hippoglossus juveniles. J. Aquacult. 227: 233-244. Jantrarotai W, Sitasit P, Jantrarotai P, Viputhanumas T, Srabua P (1998). Protein and energy levels for maximum growth, diet utilization, and protein sparing of hybrid catfish, Clarias macrocephalus Ă&#x2014; C. gariepinus. J. World Aquacult. Soc. 29(3): 281287. Krogdahl A, Hemre GI, Mommsen TP (2005). Carbohydrates in fish nutrition. Digestion and absorption in postlarval stages. J. Aquacult. Nutr. 11: 103-122. Kumar V, Makkar HPS, Becker K (2010). Dietary inclusion of detoxified Jatropha curcas meal. Effects on growth performance and metabolic efficiency of common carp, Cyprinus carpio. J. Fish Physiol. Biochem. 98(4): 1159-1170. Lee SM, Jeon IG, Lee JY (2002). Effects of digestible protein and lipid levels in practical diets on growth, protein utilization and body composition of juvenile rockfish, Sebastes schlegeli. J. Aquacult. 211: 227-239. McGoogan BB, Gatlin III DM (2000). Dietary manipulations affecting growth, digestive enzyme activity and nitrogenous waste production of red drum, Sciaenops ocellatus. Effects of energy level and nutrient density at various feeding levels. J. Aquacult. 191(3): 271-282. Morais S, Bell JG, Robertson DA, Roy WJ, Morris RC (2001). Protein /lipid ratios in extruded diets for Atlantic cod, Gadus morhua. Effects of growth, feed utilization, muscle composition and liver histology. J . Aquacult. 203: 101-19. Nandeesha MC, Gangadhara B, Varghese TJ, Keshavanath P (2002). Growth response and flesh quality of common carp, Cyprinus carpio fed with high levels of earthworm meal. J. Asian Fish. Sci. 15(3): 235239. Pedro ND, Guijarro AI, Delgado MJ, Patina LP, Pinillos ML, Bedate MA (2001). Influence of dietary composition on growth and energy reserves in tench, Tincta ticta. J. Appl. Icthyol. 17: 25-29. Stone DAJ (2003). Dietary carbohydrate utilization by fish. Rev. Fish. Sci. 11: 337-369. Van Der Meer MB, Zamore JE, Verdegem MCJ (1997). Effect of dietary lipid level on protein utilization and body composition of Colossoma macropomum. J. Aquacult. Res. 28(6): 405-412. Vielma J, Koskela J, Ruohonen K, Jokinen I, Kettunen J (2003). Optimal diet composition for European whitefish, Coregonus lavaretus. Carbohydrate stress and immune parameter responses. J. Aquacult. 225: 3-16. Wang JT, Liu YJ, Tian LX, Mai KS, Du ZY, Wang Y, Yang HJ (2005). Effect of dietary lipid levels on growth performance, lipid deposition and hepatic lipogenesis in juvenile cobia, Rachycentron canadum. J. Aquacult. 249(2): 439-447. Yamamoto T, Unuma T, Akiyama T (2000). The effect of dietary protein and lipid levels on growth, feed efficiency, digestive enzyme activity and body composition of rainbow trout, Oncorhynchus mykiss fingerling. J. Aquacult. 191(3): 353-362. Yigit M (2001). Effect of dietary protein and energy levels on growth, body composition, feed efficiency and nitrogen excretion of juvenile Japanese flounder, Paralicthys olivaceus. Ph.D. thesis, Ondokuz Mayis University, Instit. Sci. Samsun. Turk. pp. 72-75. Zhen YD, Li XT, Gui YL, Yong JL (2009). Effect of dietary energy to protein ratios on growth performance and feed efficiency of juvenile Grass carp, Ctenopharyngodon idella. J. Open Fish Sci. 2: 25-31. Zhen YD, Yong JL, Li XT, Jian GH, Jun MC, Gui YL (2006). The effect of dietary energy levels on growth, feed efficiency and body composition of juvenile grass carp, Ctenopharyngodon idella. J. Aquacult. Int. 14(3): 247-257.

Full Length Research Paper

Preparation of immunoaffinity column for rapid purification of human DNA polymerase delta and its subassemblies Xiao Li, Huiqing Chen, Lei Zhang, Liu Liu, Yujue Wang, Qian Zhang, Xiaoyong Liu, Yuanqing He, Yan Chen, Keping Chen and Yajing Zhou* Institute of Life Sciences, Jiangsu University, Zhenjiang 212013, Jiangsu, People’s Republic of China. Accepted 30 March, 2012

Mammalian deoxyribonucleic acid (DNA) polymerase delta (pol δ) is well characterized as a tightly associated heterotetrameric complex. It is thought to play a central role in chromosomal DNA replication and various DNA repair processes. However, the availability of highly purified active pol δ becomes one of the major barriers for its in-depth functional and structural analysis. In this work, a powerful immunoaffinity column was prepared. The human DNA pol δ and its subassemblies were reconstituted with a novel MultiBac system, over-expressed in insect cells, and followed by purification using immunoaffinity chromatography in combination with ion-exchange chromatography. Starting from 500 ml of infected Sf-9 cells, as much as 5 mg of recombinant pol δ with different subunit combinations was isolated near homogeneity with active forms that were conformed by the assays both on sparsely primed poly (dA)/oligo (dT) template-primer and on singly primed M13 DNA template. Thus, our home-made immunoaffinity column provides a significant advance in the isolation of pol δ, allowing its facile isolation from over-expressed insect cells or natural source in good yield and high purity. Key words: DNA polymerase delta, immunoaffinity chromatography, reconstitution, MultiBac system, subassemblies. INTRODUCTION Among a family of eukaryotic deoxyribonucleic acid (DNA)-dependent DNA polymerases, three major replicative polymerases, α (pol α), δ (pol δ), and ε (pol ε), are viewed to be responsible for chromosomal DNA replication (Burgers, 1998; Waga and Stillman, 1998). The subunit composition of pol δ may vary among different eukaryotes. In fission yeast Schizosaccharomyces pombe, pol δ consists of four subunits, Pol3, Cdc1, Cdc27 and Cdm1 (Reynolds et al., 1998; Zuo et al., 2000; Bermudez et al., 2002). While, budding yeast Saccharomyces cerevisiae pol δ is a trimer of the first three subunits, Pol3p, Pol31p/Hys2, and Pol32p (Burgers and Gerik, 1998; Gerik et al., 1998). The smallest non-essential subunit Cdm1 has no apparent

*Corresponding author. E-mail: yajingzhou@ujs.edu.cn. Fax: +86 511 88791923.

homologue in budding yeast (Reynolds et al., 1998). Human/mammalian pol δ was discovered as a new eukaryotic DNA polymerase that possesses both 5’-3’ DNA polymerase and 3’-5’ proofreading exonuclease activity in the laboratory of Dr. So (Byrnes et al., 1976; Byrnes et al., 1977). It contains four subunits, p125, p50, p68, and p12, as a counterpart of S. pombe pol δ (Hughes et al., 1999; Liu et al., 2000; Mo et al., 2000; Shikata et al., 2001). In addition to its crucial role in DNA replication, pol δ is also a major participant in DNA repair processes and genetic recombination in which it is generally regarded as a primary enzyme to perform gap-filling (Sancar et al., 2004; Garg and Burgers, 2005; Branzei and Foiani, 2008). Extensive studies showed that pol δ itself may be a target of the DNA damage response. As replication stress or genotoxic agents triggered the degradation of the p12, pol δ was consequently converted from a heterotetramer to a trimer lacking the p12 subunit (Zhang et al., 2007).

8376

Afr. J. Biotechnol.

Also, it seems likely that loss of p12 modulated the rate of single-nucleotide (SN) and long patch (LP) in uracilintiated base excision repair (BER) in vitro (Zhou et al., 2011). These findings raise a number of questions about the regulation of this enzyme and the integration of its functions, and how alterations in its function could contribute to the etiology of human cancer or other diseases that can result from loss of genomic stability. Therefore, a more in-depth investigation will be needed for its functional and structural analysis. However, one of the major obstacles is to obtain active pol δ complex and its subassemblies as an intact form in good yield and high purity. While we have developed efficient methods for the expression and purification of pol δ and its subassemblies, we have sought to improve both the quality and yields to facilitate our next study. In this work, we have made a great advance on: a) preparation of immunoaffinity column for its utilization for immunoaffinity chromatography by immobilizing a polyclonal antibody against p125 subunit onto the CarboLink coupling gel and b) improvement of over expression of pol δ subassemblies in Sf-9 cells with a novel baculovirus-based MultiBac system in which one or multiple subunits were constructed into one single recombinant virus with different combinations. From 500 ml of infected Sf-9 cells, as much as 5 mg of different pol δ multi-subunit complexes could be obtained by purification using immunoaffinity chromatography in combination with ion-exchange chromatography. Thus, our work here offers a powerful approach to obviate those difficulties illustrated in the case of pol δ isolation from infected insect cells, from mammalian tissues or cultured mammalian cells (Lee et al., 1984; Jiang et al., 1995; Podust et al., 2002; Xie et al., 2002). MATERIALS AND METHODS All reagents and chemicals used in this study were purchased from Sigma-Aldrich (St. Louis, MO), Ge Healthcare (Piscataway, Nj), Gibco-Brl, or Invitrogen, except as otherwise indicated.

Production of polyclonal antibody For antigen preparation, the His-tagged p125 was generated by the polymerase chain reaction (PCR) using a full-length POLD 1 cDNA as a template. The generated PCR fragments were digested with BamHI and EcoRI, subcloned in-frame into the BamHI-EcoRI sites of pFastBac HTc expression vector, and sequenced. The primer pairs used here were as follows: forward, 5’AGCTACGGATCCGGATGGATGGCAAGCGGCGGCC-3’; backward, 5’-AGCTACGAATTCTCACCAGGCCTCAGGTCCAGGG-3’ (BamHI and EcoRI sides are underlined). Growth and maintenance of Sf-9 insect cells, preparation of recombinant baculoviruses and infection of the cells were performed according to manufacture’s instruction (Invitrogen). His-tagged p125 was expressed in one liter of Sf-9 cells in suspension culture, purified by nickel-nitrilotriacetic acid agarose (Qiagen), and followed by further purification using fast protein liquid chromatography (FPLC) on mono Q 5/50 Glitch (GL) column

(Ge Healthcare). The highly purified protein was analyzed by mass spectrometry to further confirm amino acid sequence before immunization. The polyclonal antibody against human pol δ catalytic subunit was produced by immunizing rabbits with highly purified His-tagged p125 protein. The collected antiserums were precipitated at 40 to 50% saturation of (NH4)2SO4 and followed by the low-salt purification on a column packed with 5 ml pierce protein A/G plus agarose as described (Harlow and Lane, 1988).

Mass spectrometry analysis The specific bands corresponding to human pol δ catalytic subunit p125 protein were excised manually from the polyacrylamide gel with a sterile scalpel and digested with trypsin according to Li et al. (2006b) method. The digested samples were analyzed by an ultraflex matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF–TOF) instrument (Bruker, Germany). Peptide mass fingerprinting (PMF) was performed by comparing the masses of identified peptides to NCBI protein database using the MASCOT search engine (http://www.matrixscience.com).

Preparation of immunoaffinity column The preparation of immunoaffinity column was performed using CarboLink™ immobilization kit (Pierce) according to the manufacture’s instruction. The support was the CarboLink coupling gel (6% cross-linked beaded agarose) which is ideal for immobilizing polyclonal antibodies via its abundant carbohydrates located on the Fc portion of the molecules. Briefly, the highly purified antibody (about 200 mg) in a total volume of 30 ml of coupling buffer was oxidized by adding 100 mg of sodium metaperiodate (resulting in 460 mM NaIO4). The mixture was incubated at room temperature for 30 min and then desalted by desalting column. CarboLink resin (30 ml) was washed with 5 gel-bed volumes of coupling buffer and mixed with the desalted oxidized antibody. The column contents were mixed in suspension by endover-end rotating at room temperature for 6 h and then at 4°C overnight. The coupled resins were washed with three gel-bed volumes of coupling buffer subsequently with phosphate buffered saline (PBS) and 10 gel-bed volumes of wash solution (1 M NaCl) and equilibrated with TGEE buffer (50 mM Tris-HCl, 0.1 mM EGTA, 0.5 mM EDTA, 10% glycerol, pH 7.8). Construction, expression and purification of recombinant human DNA pol δ assemblies The construction of recombinant human DNA pol δ and its subassemblies was performed with a novel MultiBac system as described (Zhou et al., 2011), according to manufacture’s instruction provided by Dr. T. J. Richmond (Berger et al., 2004). Four subunit fragments of p125, p50, p68 and p12 containing BamHI and XbaI restriction sites in each fragment were generated by PCR using the templates kindly provided by Dr. Ellen H. Fanning. The generated PCR products were digested with BamHI and XbaI, subcloned in-frame into the BamHI- XbaI sites of MCS1 of transfer vector pFBDM with different subunit combinations and sequenced. The preparation of recombinant baculoviruses harboring different subunit combinations was performed according to manufacture’s instruction (Invitrogen). For the expression of the pol δ four-subunit enzyme and its subassemblies, 500 ml of Sf-9 cells at 2×106 cells/ml in suspension culture was infected with generated corresponding baculoviruses at a multiplicity of infection (MOI) of two. The cells were collected 72 h post-infection, and the cell pellets were either treated directly with lysis buffer or stored at 80°C.

Li et al.

A highly standardized protocol for rapid isolation of recombinant pol δ heterotetramer and its subassemblies was developed using newly made immunoaffinity column in combination with FPLC chromatography on mono Q column essentially as described for the isolation from a Bombyx mori bioreactor generated pol δ (Zhou et al., 2011). Purification of pol δ complex from Hela cell extracts The purification of pol δ four-subunit complex from Hela cells was performed essentially as described for its isolation from HEK 293T or Hela cells (Zhang et al., 2007; Meng et al., 2009).

Preparation of recombinant human proliferating cell nuclear antigen (PCNA) The recombinant human PCNA expressed in Escherichia coli was purified to near homogeneity by a protocol as previously described (Zhang et al., 1995; Zhou et al., 2011).

DNA polymerase activity assay The standard assay for pol δ activity was performed using sparsely primed poly (dA)/oligo (dT) as the template as described (Zhang et al., 2007; Meng et al., 2009; Zhou et al., 2011). Assay using singly primed M13 DNA as the template was performed as previously described (Zhang et al., 2007; Zhou et al., 2011).

Western blotting analysis Western blotting was performed as described (Zhou et al., 2011). The antibodies used here were mouse polyclonal antibody against p50 (ZJM5002), rabbit polyclonal antibodies against p68 (ZJR6803), p12 (ZJR1204) previously prepared in our laboratory, and newly made rabbit polyclonal antibody against p125 (ZJR12501) prepared in this work. The second antibodies were alkaline phosphatase (AP)-conjugated goat anti-mouse or anti-rabbit IgG. Perfect protein western blot kit (Novagen) was used for signal generation.

Protein concentration determination Protein concentrations were determined by the Bradford method with bovine serum albumin as a standard, or by “in-gel” determination of the catalytic subunit p125 concentration using catalase as a protein standard (Zhou et al., 2011).

RESULTS

8377

recombinant pFastBacHTc-POLD1 plasmid was transformed into DH10Bac competent cells. After transposition, the recombinant bacmids harboring POLD1 were isolated from the selected white phenotypes. PCR analysis confirmed that POLD1 gene was successfully transposed to the bacmid with an expected band of -4 kb of the PCR products with the p125 forward amplification primer and RV-M reverse amplification primer (Figure 1B). The recombinant baculoviruses were then generated by the transfection of recombinant bacmid DNAs into Sf-9 cells and verified by western blotting with the anti-His antibody. The bands of His-p125 protein were detected as expected molecular mass (Figure 1C). About 2 mg of highly purified soluble His-p125 protein from one liter of infected Sf-9 cells was obtained (Figure 1D). The amino acid sequence of obtained protein was further verified by mass spectrometry (data not shown). After immunizing two New Zealand rabbits using highly purified His-p125 protein as immunogen, about 200 mg of polyclonal antibody was purified in high purity from 120 ml of collected antiserum (final termination bleeds) by the precipitation of (NH4)2SO4 and on a protein A/G plus agarose packed column (Figure 2A). The efficiency of obtained antibody was tested by western blotting with Hela cell extracts. Optimized concentration of purified antibody at 0.05 to 0.1 µg/ml could result in a high sensitivity for detecting the interaction between antibody and endogenous p125 subunit of pol δ in good specificity (Figure 2B, lanes 4 and 5). Preparation of immunoaffinity column To develop immunoaffinity column, about 200 mg, a combination of four preparations of highly purified polyclonal antibody, was used for its immobilization. After periodate oxidation of the carboxyl groups in the Fc portion of the antibodies, -140 mg of antibody was coupled to 30 ml of hydrazide-activated CarboLink™ gel, that is, about 4.7 mg of antibody was coupled per milliliter of resin. The coupling efficiency was also judged by comparing starting material (before coupling, Bc) with that after coupling (Ac) reaction on 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) stained with Coomassie blue (Figure 2C).

Production of polyclonal antibody against human pol δ catalytic subunit p125

Expression and purification of recombinant human pol δ and its subassemblies

We chose baculovirus expression system to produce Histagged p125 fusion protein by inserting full-length POLD1 fragment into the pFastBacHTc plasmid between the BamHI and EcoRI sites. Restriction analysis of selected colonies showed that a 3332 bp fragment was inserted into pFastBacHTc (Figure 1A). DNA sequencing confirmed that the POLD1 was correctly fused to N-terminal His-tag with correct DNA sequence. The obtained

A set of recombinant baculoviruses for heterotetramer, two trimers lacking p12 or p68, and two-subunit enzyme (p125/p50) were generated with a novel MultiBac system by inserting the cDNAs for the pol δ subunits into a single transfer vector pFBDM in any one of combinations, each in an individual expression cassette. About 500 ml of Sf-9 cells in suspension culture was infected with generated recombinant viruses in individuals. The infected cell

8378

Afr. J. Biotechnol.

Figure 1. Analysis for the preparation of the immunogen used in the production of polyclonal antibody against human DNA pol δ catalytic subunit p125. A, Agarose gel electrophoresis of recombinant plasmid pFastBacHTc-POLD1 digested with BamHI and EcoRI. M, DNA marker; lane 1, pFastBacHTc-POLD3 as a control; lanes 2 to 4, pFastBacHTc-POLD1 selected from three colonies. B, Agarose gel electrophoresis of PCR analysis for confirmation of the transposition of POLD1 into bacmids through Tn7. M, DNA marker; lane 1, PCR product amplified from bacmid alone (as a control) with M13-47 forward and RV-M reverse primers; lanes 2 to 4, PCR product amplified from the bacmids transposed with pFastBacHTc-POLD1 isolated from the selected white phenotypes with the p125 forward and RV-M reverse primers. C: Western blotting analysis for the generation of recombinant viruses for His-tagged p125 with anti-His antibody. M, protein maker in kDa; lane 1 and 2, two preparations of recombinant viruses. D, A peak fraction of highly purified His-p125 protein on Mono Q column analyzed on 12% SDS-PAGE gel stained with Coomassie blue.

extract was directly applied onto a 20 ml immunoaffinity column. Of each assembly, the eluted peak fractions containing all expected subunits were combined, dialyzed, loaded on a 1 ml mono Q 5/50 GL column, and eluted with 20-bed volumes of a linear gradient of NaCl from 0.1 to1 M in TGEED buffer (50 mM Tris–HCl, pH 7.8, 10% glycerol, 0.5 M EDTA, 0.1 mM EGTA and 1 mM dithiothreitol), respectively. The peak activities were eluted between 350 and 400 mM NaCl in TGEED buffer (data not shown). Eluted fractions were judged by 12%

SDS-PAGE gel and stained with Coomassie blue (Figure 3). Thus far, a pol δ heterotetramer and its subassemblies, purified to near homogeneity, were obtained. We routinely obtained as much as 4 to 5 mg of pol δ complexes from 500 ml Sf-9 cell culture. A summary for the specific activities and yield of preparations for purification of recombinant pol δ heterotetramer is shown in Table 1. Besides its excellent behavior in purification of recombinant pol δ complexes, our newly made

Li et al.

8379

Figure 2. Analysis for the production of polyclonal antibody and preparation of immunoaffinity column. A, Coomassie blue stained SDS-PAGE analysis for the purified polyclonal antibody against p125 after affinity chromatography by a 5 ml protein A/G plus colu mn. The dialyzed sample in PBS after ammonium sulfate precipitation (Bc), flow-through (Ft), wash (W 1 and W 2), and eluted fractions were analyzed on 12% SDS-PAGE followed by Coomassie blue staining. Protein marker in kDa is indicated by M. The heavy and light chains are marked by arrows. B, Measurement of sensitivity and specificity of purified antibody by western blotting with Hela cell extracts. The seven lanes showing decreasing concentrations of antibody contained 0.8, 0.4, 0.2, 0.1, 0.05, 0.01 and 0 µg/ml of antibody/slice membrane, respectively. The detected endogenous p125 is marked by an arrow. C, Judgment of coupling efficiency of immunoaffinity column on 12% SDS-PAGE stained with Coomassie blue. Bc, starting material before coupling reaction; Ac, the material after coupling reaction; M, protein marker in kDa.

Figure 3. Coomassie blue stained SDS-PAGE analysis for the preparations of pol δ assemblies after their further purification on Mono column. The fractions across peak from the immunoaffinity chromatography step were c ombined, dialyzed, and passed through a Mono Q column. The starting materials after immunoaffinity chromatography (Bc) and eluted fractions were analyzed by 12% SDSPAGE followed by Coomassie blue staining. Pol δ four subunits are marked by arrows. Panels A, B, C, and D show the preparations of pol δ4, trimer lacking p68 (pol δ3-p68), trimer lacking p12 (pol δ3-p12), and dimer p125/p50, respectively. Protein marker in kDa is indicated by M.

8380

Afr. J. Biotechnol.

Table 1. Purification of recombinant DNA pol δ four-subunit complex from 500 ml of infected Sf-9 cellsa.

Step Cell extract Immunoaffinity Mono Q

Total volume (ml) 200 120 3.0

Protein (mg) 801.5 12.21 5.01

Activity (unit) b ND 148962 131262

Specific activity (unit/mg) 12200 26200

The purification procedure was carried out as described under materials and methods. DNA polymerase activity was assayed on b poly(dA)/oligo(dT) template-primer. Activity in supernatant of cell extracts cannot be accurately measured.

Figure 4. Comparison of the activities of pol δ and its subassemblies on poly (dA)/oligo(dT) primer-template. A, The proteins used in polymerase activity assays judged on Coomassie blue stained SDS-PAGE gel. Lane 1, A peak fraction of native pol δ enzyme isolated from cultured Hela cells by immunoaffinity chromatography used as a control; lanes 2 to 5, the peak fractions of pol δ4, pol δ3-p68, pol δ3-p12, and dimer p125/p50 purified to near-homogeneity after Mono Q column step, respectively; lane 6, a Histagged p125 protein after purification by nickel-nitrilotriacetic acid agarose and Mono Q column. B, Pol δ activity assay. Six lanes show the same preparations of pol δ assemblies as indicated in panel A. 200 fmoles of each assembly were used in each assay i n the presence of PCNA. The vertical axis indicates the specific activity (in triplicate) in units/mg and the horizontal axis shows th e different enzyme assemblies as shown in panel A. PCNA, proliferating cell nuclear antigen.

immunoaffinity column was also suitable for the isolation of native pol δ complexes from natural source. We tested the column by the isolation of pol δ from 150 plates of cultured Hela cells (about 3×108 cells), resulting in an intact four-subunit complex near homogeneity with expected molecular masses judged by Coomassie blue stained 12% SDS-PAGE gel from which a peak fraction on the gel was shown (Figure 4A, lane 1). Comparison of the activities of highly purified pol δ complexes The specific activities of highly purified recombinant pol δ complexes in the eluted peak fraction 12 after FPLC chromatography on mono Q (Figure 4A, lane 2 to 6) were compared with that of the native pol δ holoenzyme isolated from cultured Hela cell extract after immunoaffinity chromatography (Figure 4A, lane 1) on sparsely primed poly (dA)/oligo(dT) template-primer in the presence of PCNA. As shown in Figure 4B, the specific

activity of recombinant pol δ4 was calculated to be 26,200 units/mg, almost the same as the 27,000 units/mg of native pol δ holoenzyme isolated from Hela cells. The trimer lacking p68 was as active (26,130 units/mg) as pol δ4, which is consistent with that previously reported (Podust et al., 2002; Li et el., 2006a). Surprisely, the trimer lacking p12 exhibited a 45% activity over its progenitor; while, the dimer of p125/p50 was PCNA responsive and also exhibited an unexpected 10% activity over pol δ4. The DNA elongation activities of these purified pol δ complexes were also compared on singly primed M13 DNA. As shown in Figure 5, the pol δ4 exhibited a perfect ability to elongate primer DNA on M13 template. The synthesized products are around 7 kb, but, the trimer lacking p68 (pol δ3-p68) showed lowered activities and the presence of shorter products around 3 kb. The trimer lacking p12 (pol δ3-p12) possessed almost the same activity as pol δ4 at higher enzyme concentrations. Interestingly, the dimer of p125/p50 also appeared lower activities at high enzyme concentrations which is

Li et al.

8381

Figure 5. Analysis of DNA elongation activities on singly primed M13 DNA template. Horizontal bar on the left indicates the positions in Kbs of DNA markers labeled with [γ-32P] ATP. The panels from left to right show the behaviors of the enzymes in M13 assays as pol δ4, pol δ3-p12, pol δ3-p68, and dimmer p125/p50. The lanes in each panel from left to right show decreasing amounts of enzyme as 200, 100, 50, 25, 0 fmoles.

consistent with that in poly (dA)/oligo(dT) assays. DISCUSSION The study of the enzymology of the mammalian DNA polymerases has been extremely difficult due to the small amounts of enzyme that could be recovered (Lee et al., 1984; Jiang et al., 1995; Hughes et al., 1999). Although the procedure was improved by the introduction of immunoaffinity chromatography in which a column was developed by immobilizing a monoclonal antibody against catalytic subunit onto AvidChrom hydrazide gel, only small amount, that is, -0.3 mg of enzyme could be obtained from 0.75 kg of calf thymus in which four columns were involved (Jiang et al., 1995). While we sought to develop an efficient strategy for the overproduction and isolation of pol δ complexes, we focused mainly on two aspects, the improvement of expression system and the development of a powerful immunoaffinity column for rapid isolation of enzymes in both good purity and high yields. MultiBac is a simple and versatile system for generating recombinant baculovirus DNA to express protein complexes comprising many subunits. With MultiBac system, we have greatly simplified our constructions of pol δ multiple subunits assemblies in any one of subunitcombinations, that is, heterotetramer pol δ4, two trimers of pol δ3-p68 and pol δ3-p12, as well as a dimer of p125/p50. CarboLink™ coupling gel is ideal for immobilizing polyclonal antibodies through Fc portion of the molecule. Such antibodies are properly oriented with their antigen-binding sites unobstructed, offering greater purification capability. With our newly made powerful column by immobilizing a polyclonal antibody against catalytic subunit onto the CarboLink coupling gel, we developed a highly standardized protocol for rapid

isolation of recombinant pol δ complexes in milligrams by two columns only. The activities of highly purified pol δ and its subassemblies using this column were analyzed both on sparsely primed poly (dA)/oligo (dT) templateprimer and on singly primed M13 DNA template. The specific activity of high purified recombinant pol δ4, as much as 5 mg protein from 500 ml Sf-9 infection, exhibited a high value up to 26200 units/mg (Table 1) which is comparable with those of pol δ preparations isolated from Hela cells (27,000 units/mg in this work), calf thymus (26,400 units/mg by four columns) (Lee et al., 1984; Jiang et al., 1995), and baculoviral co-infectionbased reconstitution (20830 units/mg by three columns) (Xie et al., 2002). The trimer lacking p12 exhibited a 45% activity over its progenitor (Figure 4B), which differs from those (extremely low levels of activity, generally 5 to 7% of that of pol δ4) previously reported by us and others (Podust et al., 2002; Li et al., 2006a). It could be partially explained by the fact that these isolated enzymes might be highly unstable. Surprisely, the dimer of p125/p50 was PCNA responsive and exhibited an unexpected 10% activity over pol δ4. We now for the first time have a recombinant dimer that behaves like the native source pol δ dimer isolated from calf thymus and human tissues (Lee et al., 1984, 1991). Similar behaviors of these purified enzymes were observed on singly primed M13 DNA template except the pol δ3-p68 which was defective in M13 assay while it was active in poly (dA)/oligo(dT) assay. These different behaviors on our observation need to be further investigated. Thus, the availability of highly purified pol δ complexes in milligrams with reproducible purity and specific activities, as well as the facilitated production of pol δ subassemblies by the use of our immunoaffinity column in combination with ion-exchange chromategraphy, will have and has already had a major impact on our research.

8382

Afr. J. Biotechnol.

ACKNOWLEDGEMENTS We wish to thank Dr. Timothy J. Richmond for providing the vector pFBDM; Dr. Ellen H. Fanning for the generous gift of cDNAs for human pol Î´ four subunits. This research was supported by the National Natural Science Foundation of China (30970612, 31100118) and Startup Scientific Research Fund from Jiangsu University for Advanced Professionals (09JDG002). REFERENCES Berger I, Fitzgerald DJ, Richmond TJ (2004). Baculovirus expression system for heterologous multiprotein complexes. Nat. Biotechnol. 22: 1583-1587. Bermudez VP, MacNeill SA, Tappin I, Hurwitz J (2002). The influence of the Cdc27 subunit on the properties of the Schizosaccharomyces pombe DNA polymerase delta. J. Biol. Chem. 277: 36853-36862. Branzei D, Foiani M (2008). Regulation of DNA repair throughout the cell cycle. Nat Rev. Mol. Cell Biol. 9: 297-308. Burgers PM (1998). Eukaryotic DNA polymerases in DNA replication and DNA repair. Chromosoma, 107: 218-227. Burgers PM, Gerik KJ (1998). Structure and processivity of two forms of Saccharomyces cerevisiae DNA polymerase delta. J. Biol. Chem. 273: 19756-62. Byrnes JJ, Downey KM, Black VL, So AG (1976). A new mammalian DNA polymerase with 3' to 5' exonuclease activity: DNA polymerase delta. Biochemistry, 15: 2817-2823. Byrnes JJ, Downey KM, Que BG, Lee MY, Black VL, So AG (1977). Selective inhibition of the 3' to 5' exonuclease activity associated with DNA polymerases: a mechanism of mutagenesis. Biochemistry, 16: 3740-3746. Garg P, Burgers PM (2005). DNA polymerases that propagate the eukaryotic DNA replication fork. Crit Rev Biochem Mol Biol 40:11528. Gerik KJ, Li X, Pautz A, Burgers PM (1998). Characterization of the two small subunits of Saccharomyces cerevisiae DNA polymerase delta. J. Biol Chem. 273: 19747-19755. Harlow E, Lane D (1988). Antibodies: a laboratory manual. Cold Spring Harbor Laboratory Press, New York. Hughes P, Tratner I, Ducoux M, Piard K, Baldacci G (1999). Isolation and identification of the third subunit of mammalian DNA polymerase delta by PCNA-affinity chromatography of mouse FM3A cell extracts. Nucleic Acids Res. 27: 2108-2114. Jiang Y, Zhang SJ, Wu SM, Lee MY (1995). Immunoaffinity purification of DNA polymerase delta. Arch. Biochem. Biophys. 320: 297-304. Lee MY, Tan CK, Downey KM, So AG (1984). Further studies on calf thymus DNA polymerase delta purified to homogeneity by a new procedure. Biochemistry, 23: 1906-1913. Lee MY, Jiang YQ, Zhang SJ, Toomey NL (1991). Characterization of human DNA polymerase delta and its immunochemical relationships with DNA polymerase alpha and epsilon. J. Biol. Chem. 266: 24232429.

Li H, Xie B, Zhou Y, Rahmeh A, Trusa S, Zhang S, Gao Y, Lee EY, Lee MY (2006a). Functional roles of p12, the fourth subunit of human DNA polymerase delta. J. Biol. Chem. 281: 14748-14755. Li XH, Wu XF, Yue WF, Liu JM, Li GL, Miao YG (2006b). Proteomic analysis of the silkworm (Bombyx mori L.) hemolymph during developmental stage. J. Proteome Res. 5: 2809-2814. Liu L, Mo J, Rodriguez-Belmonte EM, Lee MY (2000). Identification of a fourth subunit of mammalian DNA polymerase delta. J. Biol. Chem. 275: 18739-18744. Meng X, Zhou Y, Zhang S, Lee EY, Frick DN, Lee MY (2009). DNA damage alters DNA polymerase delta to a form that exhibits increased discrimination against modified template bases and mismatched primers. Nucleic Acids Res. 37: 647-657. Mo J, Liu L, Leon A, Mazloum N, Lee MY (2000). Evidence that DNA polymerase delta isolated by immunoaffinity chromatography exhibits high-molecular weight characteristics and is associated with the KIAA0039 protein and RPA. Biochemistry, 39: 7245-7254. Podust VN, Chang LS, Ott R, Dianov GL, Fanning E (2002). Reconstitution of human DNA polymerase delta using recombinant baculoviruses: the p12 subunit potentiates DNA polymerizing activity of the four-subunit enzyme. J. Biol. Chem. 277: 3894-3901. Reynolds N, Watt A, Fantes PA, MacNeill SA (1998). Cdm1, the smallest subunit of DNA polymerase d in the fission yeast Schizosaccharomyces pombe, is non-essential for growth and division. Curr. Genet. 34: 250-258. Sancar A, Lindsey-Boltz LA, Unsal-Kacmaz K, Linn S (2004). Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu. Rev. Biochem. 73: 39-85. Shikata K, Ohta S, Yamada K, Obuse C, Yoshikawa H, Tsurimoto T (2001). The human homologue of fission Yeast cdc27, p66, is a component of active human DNA polymerase delta. J. Biochem. 129: 699-708. Waga S, Stillman B (1998). The DNA replication fork in eukaryotic cells. Annu. Rev. Biochem. 67: 721-751. Xie B, Mazloum N, Liu L, Rahmeh A, Li H, Lee MY (2002). Reconstitution and characterization of the human DNA polymerase delta four-subunit holoenzyme. Biochemistry, 41: 13133-13142. Zhang P, Zhang SJ, Zhang Z, Woessner Jr. JF, Lee MY (1995). Expression and physicochemical characterization of human proliferating cell nuclear antigen. Biochemistry, 34: 10703-10712. Zhang S, Zhou Y, Trusa S, Meng X, Lee EY, Lee MY (2007). A novel DNA damage response: rapid degradation of the p12 subunit of dna polymerase delta. J. Biol. Chem. 282: 15330-40. Zhou Y, Chen H, Li X, Wang Y, Chen K, Zhang S, Meng X, Lee EY, Lee MY (2011). Production of Recombinant Human DNA Polymerase Delta in a Bombyx mori Bioreactor. PLoS One, 6: e22224. Zuo S, Bermudez V, Zhang G, Kelman Z, Hurwitz J (2000). Structure and activity associated with multiple forms of Schizosaccharomyces pombe DNA polymerase delta. J. Biol. Chem. 275: 5153-5162.

Full Length Research Paper

Variation in quantitative characters of faba bean after seed irradiation and associated molecular changes Sonia MEJRI1,2, Yassine MABROUK1,2*, Marie VOISIN3, Philippe DELAVAULT 3, Philippe SIMIER3, Mouldi SAIDI1 and Omrane BELHADJ 2 1

Unité d’Utilisation Médicale et Agricole des Techniques Nucléaires, Centre National des Sciences et Technologies Nucléaires Sidi Thabet, 2020, Tunisie. 2 Laboratoire de Biochimie et de Technobiologie, Faculté des Sciences de Tunis, Université de Tunis El-Manar 2092 Tunis, Tunisie. 3 Laboratoire de Biologie et Pathologies Végétales (EA 1157), IFR149 QUASAV, Université de Nantes, France. Accepted 25 July, 2011

The successful use of faba bean breeding for broomrape resistance requires the existence of genetic variation. Unfortunately, the desired variation is often lacking. However, radiation can be used to induce mutations and thereby generate genetic variation from which desired mutants may be selected. This investigation was carried out to study the effects of gamma radiation on various quantitative characters in faba bean. Micro-mutations were scored for percentage of germinated seeds, pod length and photosynthetic pigment contents. The variation in DNA profile in responses to gamma irradiation treatments was detected by ISSR-PCR technique. 15 ISSR primers were used on 22 samples of faba bean issued from irradiated samples; four primers produced clear bands, which were polymorphic and the (AG)8YC was the best one. Nei’s standard genetic distances test showed that the ISSR markers classification was statistically different. Conclusively, this study supported the suggestion that gamma irradiation induce a genetic diversity in faba bean germplasm. The studied samples are promising for the production of synthetic varieties resistant/tolerant to plant parasites. Key words: Faba bean, gamma rays, genetic diversity, ISSR.

INTRODUCTION Faba bean is widely used in the Mediterranean region as source of protein in both human and animal nutrition (Larralde, 1982). The nutritional value of field bean has been traditionally attributed to its high protein content (Cubero and Moreno, 1982). It is also a good source of sugars, minerals and vitamins. Thus, the chemical analysis of this legume reveals a 50 to 60% content of carbohydrate, which is mainly constituted by starch, while the proportion of lipids is relatively low at about l to 2.5% with oleic and linoleic acids representing about 75% of fats (Mataix and Salido, 1985). Faba bean also contributes to farmer’s income and improves the soil fertility through biological nitrogen fixation. Despite all these beneficial aspects, the area and the production of legumes in Tunisia have not increased in

*Corresponding author. E-mail: mabrouk.yassine@cnstn.rnrt.tn

the last years. Diseases and pests have been reported as recurrent problems in Tunisia (Kharrat et al., 1991). This was highlighted during many seasons, where the majority of faba bean crop was devastated by chocolate spot incited by Botrytis fabae. Nematode (Ditylenchus dipsaci), rust (Uromyces fabae virus diseases and root rot (Rhizoctonia spp.) were also present (Hooper, 1983; Kerkoud et al. 2007). Chocolate spot was identified in almost all the areas covered by the survey including the semi-arid and arid areas of the central and southern parts of the country where the climatic conditions are normally not conducive for disease development. Aphids and others insects such as Sitona spp. and stem borer (Lixus algirus) cause some damage to faba bean (Bardner, 1983). The presence of Orobanche spp. in some faba bean growing areas is considered as a limiting factor to the expansion of the crop (Stoddard et al., 2010). Genetic resistance is considered as the most desirable control method since it is more cost effective and

8384

Afr. J. Biotechnol.

environment friendly than the use of chemicals. Gamma irradiation was found to increase plant productivity. In this connection, Jaywardena and Peiris (1988) stated that gamma rays represent one of the important physical agents used to improve the characters and productivity of many plants (for example rice, maize, bean, cowpea and potato). Gamma rays belong to ionizing radiation and interact with atoms or molecules to produce free radicals in cells. These radicals can damage or modify important components of plant cells and have been reported to affect differentially the morphology, anatomy, biochemistry and physiology of plants depending on the irradiation level. These effects include changes in the plant cellular structure and metabolism; dilation of thylakoid membranes, alteration in photosynthesis, modulation of the antioxidative system and accumulation of phenolic compounds (Kim et al., 2004; Kovacs and Keresztes, 2002; Wi et al., 2005). Radiation mediated in vitro mutagenesis and selection has been successfully used to improve agronomic traits such as salinity and drought tolerance in different crop plants (Foster, 2001; Biswas et al., 2002; Predieri and Gatti, 2004; Zhu et al., 2004), advocating that tissue culture selection is useful to select stress-tolerant clones. Several works have shown that mutagenesis with gamma rays can be successfully used to develop new lines useful for breeding, such as sweet potato, grass pea (Ochatt et al., 2004), cocoyam, Xanthosoma sagittifolium (Blaye et al., 2004). A major aim for any crop breeding program is the development of good quality lines with an adequate resistance/tolerance to yield-reducing stresses. The aim of this work was to investigate the response of one variety of faba bean to different doses of gamma irradiation (50, 100, 150 and 200 Gy). Seeds percentage germination, plant growth, morphological modifications and nutrients contents were recorded. Certain associated molecular changes were also studied. The results of this work could be used in the breeding programs of faba bean resistant to broomrape.

MATERIALS AND METHODS Seeds irradiation and germination The humidity level of the seeds of faba bean was determined before irradiation. It showed humidity percentages of 8% for the variety used. The seeds were irradiated with gamma rays at the Center for Nuclear Sciences and Technologies, Sidi Thabet, Tunisia, derived from Co60 source. The dose rate was 19.234 Gy min-1. A completely randomized design was used with different treatments (0, 50, 100,150, 200, 300, 400, 500, 600 and 700 Gy of gamma rays) to determine LD50. The irradiated seeds were surface-sterilized with 10% calcium hypochlorite for 30 min, and then rinsed three times with sterile water. Seeds were placed in Petri dishes on a sterile filter paper, imbibed with distilled water and allowed to germinate at 28°C in the dark for 5 days. The seeds that were not subjected to gamma rays served as controls. Germination rate was calculated according to the following formula (Hegazi and Hamideldin, 2010):

(G1  N1) + (G2  N) +…………..(Gn  Nn) Germination rate = G1 + G2 + ……………………..Gn

Where G = number of germinated seeds in a particular day and n = number of this particular day.

Vegetative growth characters The irradiated seed lots (M0) and the untreated seeds, which served as controls were sown in pots in order to study the development of established plants under greenhouse conditions at 25°C with a 16 h photoperiod. After 13 weeks from sowing, the following growth criteria were recorded, using six random plants from each treatment: plant height (cm), number of branches/plant, fresh weight/plant (g) and dry weight/plant (g). Also, photosynthetic pigments: Chlorophylls a, b, "a+b" in leaves was determined calorimetrically. It was recorded that chlorophyll a showed the maximum absorbance at 662 nm and chlorophyll b at 645 nm, the amount of these pigments was calculated according to the formulas of Lichtentaler and Wellburn (1985). The formulas were used in the calculation of chlorophyll a (Ca) and b (Cb) levels: Ca = Chlorophyll a; C b = chlorophyll b Ca = 11.75 A662 - 2.350A645 Cb = 18.61A645 - 3.960A662 The nitrogen content was determined using the micro-Kjeldahl method as initially described by the Association of Official Analytical Chemist (AOAC 1975). The nitrogen percentage was then multiplied by 6.25 (N percentage in legume proteins) to obtain the protein percentage.

ISSR analysis A thousand of faba bean seeds already irradiated with 150 Gy gamma ray dose were planted. Experiments were conducted in field naturally infested with Orobanche foetida seeds. Only twenty two from these plants which presents less parasite were selected for ISSR analysis. The ISSR markers were used in order to study faba bean genetic polymorphism after gamma irradiation.

DNA extraction and ISSR-PCR procedure DNeasy TM plant mini kit (igenomic plant, Intron biotechnology, Inc) was used for DNA isolations from plants. Leaf tissue (100 mg) was ground under liquid nitrogen to a fine powder. Extraction and purification of samples were carried out with the use of DNeasy mini spin columns. ISSR-PCR reaction was conducted using fifteen primers with the sequences shown later. Amplification was carried out in a programmed PCR, the amplification program included a denaturing step at 94°C for 5 min, followed by 40 cycles with denaturing step at 94°C for 1 min, an annealing step at 53°C for 1 min and an extension step at 72°C for 2 min. The last cycle was closed by 72°C for 5 min. Agarose (1.5%) was used for analyzing the PCR products. (AG)8YC, (GA)8T, (GACA)5, (GA)8CC, (AG)8T, (CA)8G, (CA)6RG, (CA)5RC, (GA)8TC, (CAC)5RC, (CA)8AC, (TG)6YA, (AC)8YG, (AG)8YA. R = A/T, Y = C/G. Statistical analysis Data were analysed by using SPSS software. Means were

Mejri et al.

8385

100 90 80

60 50 40 30 20 10

(%)

Germination rate (%)

0 0

100

200

300

400

500

600

700

Dose (Gy) Figure 1. Effect of irradiation on seeds germination of faba bean (100 seeds were used for each dose).

compared using the Benferroni test at P<0.05. In the tables, means followed by the same letter are not significantly different.

700 Gy irradiation. The same observations are reported by Chaudhuri (2002) in the case of irradiated rice and lentil seeds.

RESULTS AND DISCUSSION Effect of irradiation on germination and survival rate

Effect of irradiation on dry weight and height

Treated seeds were evaluated for lethality from different doses of gamma irradiations. It was observed that seed germination was independent of dose of gamma rays and was mainly affected by the germination capability, which is in agreement with Ciftci et al. (2006). Gamma irradiations had an insignificant effect on germination. Irradiation with doses from 200 to 700 Gy, however, resulted in a germination score significantly lower than those of the unirradiated control (Figure 1). It was found that each increase in the dose of gamma irradiation was accompanied by a corresponding decrease in seeds germination. The LD50 for the genotype of faba bean used in this study was 150 Gy, causing 50% of reduction in seed germination. After exposure to 200 Gy, seedlings exhibited a high rate of mortality (Figure 2). The highest exposure (700 Gy) caused death of all seedlings 10 days after germination. This result clearly shows that the significant biological damage for the growth of seeds is induced by the gamma irradiation. The results indicate that the seeds can repair damage produced by Îł-irradiation below 100 Gy, whereas they are killed completely after

Different radiation exposures influenced plant dry weight during the course of the growth (Table 1). Except for 100 Gy, root length was significantly reduced as dosage increased (Table 1). With exception of 100 Gy, the seeds treated with 150 and 200 Gy significantly reduced shoot dry weight (Table 1). This observation suggests that dry matter production of faba bean reduces with increasing gamma ray radiation. The height reduction caused by the doses was in agreement with the findings of Preussa and Britta (2003) who reported that reduction of plant heights is the most frequently arising type in mutation experiment. Zaka et al. (2002) also got dwarf or shorter plant height in their study on faba bean. The reduction in root length with increasing dosage also partly explains the reduction in plant height as these two variables are interrelated. Other physical damages that occurred on the leaves of faba bean (Figure 3) seem to fit the description of Long and Sparrow (1954). Gamma irradiation is known to alter both morphological and physiological processes in crops (Long and Kersten, 1936; Sax, 1963; Sparrow, 1954). Kuzin et al. (1964) suggested that radiation at lower

8386

Afr. J. Biotechnol.

120 110 100 90

Survival rate (%)

80 70 60 50 40

(%)

30 20 10 0

100

120

140

160

180

200

Dose (Gy) Figure 2. Effect of irradiation on survival of faba bean seedlings after 90 days seed germination (six seedlings were used for each dose).

Table 1. Effect of irradiation on dry weight and length of roots and shoot of faba bean 90 days after planting.

Parameter Control 100 Gy 150 Gy 200 Gy

Root FW (g) 15.73 ± 5.15a b 13.41 ± 4.40 11.71 ± 2.62c 10.3 ± 2.30d

Height (cm) 55.5 ± 11.51a a 52.66 ± 9.9 45.66 ± 6.56b 43.5 ± 4.88b

Shoot FW (g) Height (cm) 14.56 ± 3.28a 26.16 ± 4.79a b a 9.31 ± 4.61 28.83 ± 3.86 b a 9.5 ± 1.32 25.5 ± 2.94 7.85 ± 3.72c 24.5 ± 3.01a

Values within the same column followed by the same letters were not significantly different using Benferroni test at 5% level.

Table 2. Nitrogen percentages (N%) of irradiated and wild-type samples at different localisation in the plant.

Parameter Control 100 Gy 150 Gy 200 Gy

Flowering time Root Shoot a a 2.576 ± 0.103 3.652 ± 0.146 b b 1.178 ± 0.047 3.332 ± 0.133 c 1.204 ± 0.048 3.108 ± 0.124c d 1.26 ± 0.050 2.66 ± 0.106d

Root a 1.31 ± 0.052 b 1.93 ± 0.077 1.24 ± 0.049a 1.156 ± 0.046a

Harvest time Shoot a 1.79 ± 0.071 b 1.38 ± 0.055 1.176 ± 0.047c 1.904 ± 0.076a

Seed a 4.25 ± 0.17 b 4.36 ± 0.147 3.94 ± 0.157c 4.17 ± 0.166d

Values within the same column followed by the same letters are not significantly different, using Benferroni test at 5 % level

doses often induced the production of small quantities of radiotoxins which resulted in a gross stimulation of growth and development. As mentioned earlier, gamma irradiation would induce noticeable morphological changes in plant tissues as well as a variety of biochemical responses at the cellular level (Blaye et al., 2004; Yang et al., 2004).

Chlorophyll and nitrogen content Data presented in Figure 4 and Table 2 indicated that there was significant difference between plant from irradiated seeds and the control in chlorophyll and nitrogen contents. The results show that chlorophyll a and b content was significantly decreased as a result of gamma

Mejri et al.

8387

Figure 3. Morphological variance of faba bean leaves response to gamma irradiation. a, Wild type; b, c and d, irradiated samples (six seedlings were used for each dose).

irradiation treatments (Figure 4). Results suggest that seeds irradiation serve to modify plant metabolism and photosynthetic capacity. Pigments decrease gradually in leaves at increasing γ-ray irradiation doses. Chlorophyll concentration in faba bean leaves of the plant that emerged from treatment with 200 Gy, when compared with the wild type, decreased by 58.18 and 41.80% for Responses of plants to gamma rays and effects on chlorophyll were studied by Wada et al. (1998). They stated that gamma radiation with high doses of γ rays (100 to 500 Gy), caused plant growth inhibition, chlorophyll degradation and morphological aberration in Nicotiana plants. A dose dependent increase in the frequency of chlorophyll mutations was noticed. Other researches have shown that after gamma radiation with high doses of γ-rays, plants at the late developmental stage of seed maturation suffer leaf senescence and lose cellular components, for example proteins and chlorophylls (Crafts-Brandner and Egli, 1987; Abarca et al., 2001).

In contrast to our results, Rejili (2008) showed that exposure of two Medicago sativa populations (Mareth and Gannouch) to gamma irradiation (350 Gy), alone or in combination with salt stress, increased significantly chlorophyll b content, especially for the Gannouch population, while no change occurred for the Mareth population. Nitrogen content measured at harvest time was close to 3.94, 1.24 and 1.176% N, respectively in seed, roots and shoot after 150 Gy irradiation dose. The protein levels were found to decrease upon gamma irradiation on faba bean seeds when compared with the wild-type. In contrast, these results show that the protein content in faba bean seeds was not affected by gamma irradiation treatment (Table 2). ISSR-PCR of genomic DNA ISSR-PCR was used for the detection of DNA profile

8388

Afr. J. Biotechnol.

Pigments (µg/gFW)

Chlorophyll a Chlorophyll b

10 8 6 4 2 0 0

100

150

200

250

300

Dose (Gy) Figure 4. Effect of irradiation on pigments variance (µg/g of fresh weight) in faba bean leaves (six seedlings were used for each dose).

Figure 5. A representative ISSR amplification of faba bean population samples using primer (AG) 8 YC. Population code is on top of each lane, followed by a letter indicating the study sample. Samples 1 to 20 were issued from irradiated seeds culture and samples 21 and 22 are the wild types.

changes in mutants generated by gamma ray. 15 ISSR primers were evaluated in a preliminary experiment. Only four primers [(AG)8YC, (GA)8T, (GACA)5 and (GA)8CC] successfully amplified DNA fragments from faba bean DNA samples. As a result, they were used in this study. Genetic analyses of faba bean DNA showed a high degree of polymorphism in gamma rays irradiated seeds as compared to the controls. A high proportion of polymorphic bands were found using this ISSR marker

(Figure 5). Genetic analyses of faba bean’s DNA showed a high degree of polymorphism in gamma rays irradiated seeds when compared with the controls. Among the 15 tested primers, the ISSR primer (AG)8YC selected for this analysis generated a total of 187 fragments. The size of amplified products ranged from 900 to 300 bp. The number of scorable markers produced per primer ranged from 6 to 11. The total number of polymorphic markers and the percentage of polymorphism were 182 and

Mejri et al.

97.32%, respectively. ISSR marker profile produced by the primer (AG)8YC in agarose gel is shown in Figure 5. ISSR primers generated six to 11 markers with an average of 8.5 per mutant. The main changes observed in the ISSR profiles are appearance or disappearance of different bands (Figure 5) with variation of their intensity as well. These effects might be connected with structural rearrangements in DNA caused by different types of DNA damages (breaks, transpositions, deletion, etc). Conclusions Exposing seeds of faba bean to higher gamma ray dosages, particularly 600 and 700 Gy cause reduction in seeds germination and survival rate. The lethal doses for these variables increase with increasing dosage of gamma ray. According to the germination seeds, the LD50 was determined to be 150 Gy. Gamma irradiation also causes mutation of the leaflets and chlorophyll deficiency in faba bean. From this study, it can be generally concluded that irradiating seeds of faba bean with higher amounts of gamma rays greatly induce morphological changes. These modifications in growth traits and morphological changes were accompanied with a marked modulation in the DNA profile. ACKNOWLEDGEMENTS This work was supported by a Grant-in-Aid for Scientific Research Project (No 10G0921) géré par Comité Mixte de Cooperation Universitaire, Tunisie-France (CMCU).

REFERENCES Abarca D, Martín M, Sabater B (2001). Differential leaf stress responses in young and senescent plants. Physiol. Plant, 113: 409415. Association of Official Analytical Chemists (AOAC) 1975. 12th ed. William Hortwits, Washington, DC. Bardner R (1983). Pests of Vicia faba other than aphids and nematodes. In hebblethwaite, P.D. (Ed.), The Faba Bean (Vicia faba L.) Butterworths, London, pp. 371-390. Biswas J, Chowdhary B, Bhattacharya A, Mandal AB (2002). In vitro screening for increased drought tolerance in rice. In vitro Cellular and Developmental. Biol. Plant. 38: 525-530. Blaye ET, Offei SK, Danquah EY, Amoatey HA, Asare E (2004). Improvement of cocoyam (Xanthosoma sagittifolium) using gamma irradiation and tissue culture, in Genetic improvement of underutilized and neglected crops in low income food deficit countries through irradiation and related techniques, Pretoria, South Africa, pp. 127-130. Chaudhuri S (2002). A simple and reliable method to detect gamma irradiated lentil (Lensculinaris Medik) seeds by germination efficiency and Seedling growth test. Radiat. Phys. Chem. 64:131– 136. Ciftci CY, TÜrkan AD, Khawar KM, Atak M, Özcan S (2006). Use of gamma rays to induce mutations in four pea (Pisum sativum L.) cultivars. Turk. J. Biol., 30: 29-37. Crafts-Brandner SJ, Egli DB (1987). Modification of seed growth in soybean by physical restraint: effect on leaf senescence. J. Exp.

8389

Bot., 38: 2043-2049. Cubero JI, Moreno MT (1983). Leguminosas de grano. Mundi-Prensa, Madrid, Spain, 359p. Foster BP (2001). Mutation genetics of salt tolerance in barley: an assessment of golden promise and other semi-dwarf mutants. Euph.120: 317-328. Hegazi AZ, Hamideldin N (2010). The effect of gamma irradiation on enhancement of growth and seed yield of okra [Abelmoschus esculentus (L.) Monech] and associated molecular changes. J. Hortic. For., 2: 38-51. Hooper DJ (1983). Nematode pests of Vicia faba L. In The Faba bean (Vicia faba L.), Hebblethwaite, P.D., Ed., Butterworths, London, p. 347. Jaywardena SDL, Peiris R (1988). Food crop breeding in Srilanks Archivements and challenges. Biol N., 2: 22-34. Kerkoud M, Esquibet M, Plantard O, Avrillon M, Guimier C, Franck M, Léchappé J, Mathis R (2007). Identification of Ditylenchus species associated with Fabaceae seeds based on a specific polymerase chain reaction of riboso-332. Kharrat M, Ben Salah H, Halila HM (1991). Faba bean status and prospects in Tunisia. Options Méditerranéennes - Série Séminaires, 10 : 169-172. Kim JH, Baek MH, Chung BY, Wi SG, Kim JS (2004) Alterations in the photosynthic pigments and antioxidant machineries of red pepper (Capsicum annuum L.) seedlings from gamma-irradiated seeds. J. Plant Biol., 47: 314-321. Kovács E, Keresztes À (2002). Effect of gamma and UV-B/C radiation on plant cell. Micron.33: 199-210. Kuzin AM, Kasvmov A, Karyukova LM (1964). On the mechanism of stimulating and inhibiting actions of radiation in the irradiation of potato tubers. Radiobiology, 4: 201- 208. Larralde J (1982). Estudio de algunos trastornos que se presentan en los animales tras la ingestión de semillas de Vicia faba. Rev. Esp. Fisiol., 38: 345-351. Lichtentaler HK, Wellburn AR (1985). Determination of total carotenoids and chlorophylls a and b of leaf in different solvents. Biol. Soc. Trans., 11: 591-592. Long TP, Kersten H (1936). Stimulation of growth of soy bean seeds by soft X-rays. PIant Physiol., 11: 615-621. Mataix FJ, Salido GM (1985). Importancia de las legumbres en nutricion humana. Fund Esp Nutr. 1,Granada, Spain. Ochatt SJ, Guinchard A, Marget P, Abirached-Darmency M, Aubert G, Elmaghrabi A, Nichterlein K (2004). Deveoplment and exploitation of biotechnological approaches of Grass pea (Lathyrus sativus L.), in Genetic improvement of under-utilized and neglected crops in low income food deficit countries through irradiation and related techniques, Pretoria, South Africa, pp. 37-86. Predieri S, Gatti E (2004). In vitro techniques and physical mutagens for improvement of fruit crops. In: Mujib A, Je Cho M, Predieri S, Banerjee S, eds, In vitro Application in Crop Improvement. Oxford and IBH Publishing Co. Pvt. Ltd, New Delhi, pp. 19-34. Preussa SB, Britta AB (2003). A DNA-damage-induced cell cycle checkpoing in Arabidopsis. Genetics, 164: 323-334. Rejili M, Telahigue D, Lachiheb B, Mrabet A, Ferchichi A (2008). Impact of gamma radiation and salinity on growth and K+/Na+ balance in two populations of Medicago sativa L. cultivar Gabès. Prog. Nat. Sci., 18: 1095-1105. Sax K (1963). The stimulation of plant growth by ionizing radiation. Radial. Bol., 3: 179-186. Sparrow AH (1954). Stimulation and inhibition of plant growth by ionizing radiation. Radial. Res., 1: 562-563. Stoddard FL, Nicholas AH, Rubiales D, Thomas J, Villegas-Fernández AM (2010). Integrated pest management in faba bean. Field Crop Res., 115: 308-318. Wada H, Koshiba T, Matsui T, Satô M (1998). Involvement of peroxidase in differential sensitivity to γ-radiation in seedlings of two Nicotiana species. Plant Sci., 132: 109-119. Wi SG, Chung BY, Kim JH, Baek MH, Yang DH, Lee JW, Kim JS (2005). Ultrastructural changes of cell organelles in Arabidopsis stem after gamma irradiation. J. Plant Biol., 48: 195-200. Yang C, Mulligan BJ, Zoe A (2004). Molecular Genetic Analysis of Pollen Irradiation Mutagenesis in Arabidopsis. N. Phytol., 164:

8390

Afr. J. Biotechnol.

279-288. Zaka R, Vandecasteele CM, Misset MT (2002). Effects of low chronic doses of ionizing radiation on antioxidant enzymes and G6PDH activities in Stipa capillata (Poaceae). J. Exp. Bot., 53: 1979-1987.

Zhu GY, Kinetand JM, Lutts S (2004). Characterization of rice (Oryza sativa) F populations selected for salt resistance and relationships between yield related parameters and physiological properties. Aust. J. Exp. Agro., 44: 333-342.

Full Length Research Paper

Decolorization of azo dyes by Pycnoporus sanguineus and Trametes membranacea Da Paz, E. S. L.1*, Paz Júnior, F. B.2, Neto, B. B.3 and Cavalcanti, M. A. Q.4 1

School of Dentistry, Federal University of Pernambuco, Recife, Brazil. Federal Institute of Education, Science and Technology, Pernambuco, Recife, Brazil. 3 Fundamental Chemistry Department, Federal University of Pernambuco, Recife, Brazil. 4 Mycology Department, Federal University of Pernambuco, Recife, Brazil. 2

Accepted 27 January, 2012

In the present work, decolorization of dyes Orange II and Black V by the fungi Pycnoporus sanguineus and Trametes membranacea was assessed at six, 12 and 18 days, through fractional design, with a total of 16 trials, statistically represented by 26-2. The fungi were grown in Erlenmeyer flasks containing the malt and King media supplemented with 0.05% m/v of the dyes Orange II and Black V, respectively under pH 4.5 and 5.0 in the presence or absence of agitation and/or luminosity. The fungal species showed different behaviors on the biomass production and decolorization of the dyes under different growing conditions. P. sanguineus showed the highest production of biomass (7.5 g/l) when grown on King medium supplemented with dye Black V, under the absence or presence of agitation, luminosity and at pH 4.5 and 5.0, while T. membranacea showed a 7.5 g/l of biomass in all growing conditions for the two dyes tested. As for the agitation of the flasks, the rotation speed of 130 rpm was the best condition for color removal. The fungi studied reached a decolorization percentage of over 50% for the dyes in all flasks under agitation. Key words: Basidiomycetes, white rot fungi, azo dyes, decolorizations. INTRODUCTION Most of the produced dyes go to the textile industry, although the leather or paper, food, cosmetics, paints and plastics industries are also important users (Minatti, 2005; Aksu, 2005). Half of the dyes used today are of the azo kind (Zanoni and Carneiro, 2001). Azo dyes have in common, the group-N = N- called "azo". The reaction of nitrous acid (HONO) with an Ar-NH2 aniline results in the diazonium ion Ar-N = N+, which reacts quickly with other anilines or phenols to form azo compounds.According to the Brazilian Association of Chemical Industry- ABIQUIM (2006), dyes and pigments can be classified according to the chemical classes they belong and the applications they are destined to have. For example, the azo chemical class may be divided according to their application in

*Corresponding author. E-mail: eslyra2005@yahoo.com.br. Tel: +55 81 31847667. Fax: +55 81 31847652.

acid, direct, disperse, basic, mordant and reactive dyes. The reactive azo dyes have been the cause of major environmental concern due to its intense use in the textile industry (Balan, 2002) and are considered recalcitrant and highly toxic, and may have carcinogenic and genotoxic properties when present in any living organism (Al-Sabti, 2000; Guaratini and Zanoni, 2000; Gnanamani et al., 2004). Although, decolorization is a much challenging process for both the textile industry and systems of wastewater treatment, there is a great potential for the systems development of microbiological decolorization with the total mineralization of dyes. Within this process, the serious wood destroying Basidiomycetes has been shown to have strong oxidative activity and low specificity of their ligninolytic enzymes to the substrate (Kamida and Durrant, 2005; Seys and Aksoz, 2005; Da Paz et al., 2010). The great biotechnological potential of white rot fungi is directly related to its capability to degrade a wide variety

8392

Afr. J. Biotechnol.

Table 1. Chemical features of dyes investigated in this work.

Dye Orange II Black V a

Ionization Acid Acid

(nm) 485 595

Chemical class Azo Diazo

Empirical formula C16H11N2NaO4S C26H21N5Na4O19S6

Molecular weight (g/mol) 350.32 991.82

Maximum absorption.

Table 2. Factor levels used for the 26-2 fractional factorial designs.

Level Fungi Culture media Shaker (rev/min) Lighting regime pH Dye

T. membranacea Malt 0 dark 4.5 Orange II

of textile wastewater, especially synthetic dyes. The ability of these fungi to decolorize various types of dyes due the action of their extracellular enzymes such as laccase, lignin peroxidase and manganese peroxidase was reported (Tuor et al., 1995; Sevil and Buket, 2011). According to Lyra et al. (2009), the decolorization of dyes could be used as a simple and effective way to indirectly select fungi producers of lignocellulolytic enzymes. However, fungi are affected by environmental conditions. Since there are many factors that influence the development of fungi, it is extremely importance to know the influence and effects of growing conditions of these organisms, to obtain greater efficiency in the process of decolorization of industrial pollutants. This study aimed to evaluate the potential of Pycnoporus sanguineus and Trametes membranacea in the decolorization of azo dyes (Orange II and Black V) under different growing conditions (pH, shaking speed, light and culture media). MATERIALS AND METHODS The species T. membranacea and P. sanguineus were collected and isolated in the Atlantic Rain Forest in Pernambuco, Brazil. Collection, preparation of the material and micro- and macro-scopic analysis were done following the usual methods for these fungi (Singer, 1951; Teixeira, 1955). For identification, the following literatures were used: Cavalcanti (1976) and Gugliotta (1997). The fungal cultures were isolated and grown at 28°C in glass tubes containing culture media agar-malt. The following synthetic dyes were used: Orange II (Sigma, St. Louis, MO, USA) and Black V (Suape Têxtil S/A, Pernambuco, Brazil) (Table 1). Their main chemical characteristics are summarized in Table 1. Cultural conditions For the aliquots of 2 cm2 of mycelium, each of the aliquots that was

Factor P. sanguineus King 130 light 5.5 Black V

isolated was seeded in agar-malt medium and grown for 10 days in 125 ml Erlenmeyer flasks containing 30 ml of King medium (Silva et al., 2003) and malt medium (20 g/l), in pH 4.5 and 5.5, after which 0.05% w/v of each selected dye was added. Then, they were incubated in orbital shaker (130 and 0 rev/min) at 28°C, for six, 12 and 18 days (Table 2). After this period of time, the mycelium was separated by filtration through membranes with 0.45 µm-pore diameter (Millipore, Barueri, SP, Brazil). The filtrate was used to evaluate the degree of decolorization of each dye. Each treatment was carried out twice, using as control, the same medium without any inoculation that was presented for the same operations. The determination of biomass was estimated gravimetrically using the oven at 70°C until constant weight. Color reduction measurements The color reduction was determined by means of a spectrophotometer, ultraviolet–visible spectroscopy (UV–VIS), model B582 (Micronal, São Paulo, SP, Brazil) by optical density measurements at the wavelengths listed in Table 1. The decolorization efficiency was calculated according to the equation: decolorization (%) = (A B/A) × 100, where A is the absorbance of the filtrate of the cultures after 10 days of growth and B, the absorbance of control. The factor levels used in both designs are shown in Tables 2 and 3. The data were analyzed using Statistic 6.1 computer program (StatSoft, Tulsa).

RESULTS AND DISCUSSION The process of decolorization of Orange II and Black V dyes by T. membranacea and P. sanguineus was investigated in different culture conditions (growth media, shaking speed, luminosity and pH). The obtained results are shown in Table 4. P. sanguineus showed the highest biomass (7.5 g/l) when grown on King medium supplemented with Black V dye, pH 4.5, without aeration and luminosity. However, when it was grown on King medium with the Orange dye, without agitation, with luminosity and pH 4.5 (flask 12), it

Da Paz et al.

8393

Table 3. Experimental matrix used in the 26-2 fractional factorial design.

Assay 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Fungi T. membranacea P. sanguineus T. membranacea P. sanguineus T. membranacea P. sanguineus T. membranacea P. sanguineus T. membranacea P.sanguineus T. membranacea P. sanguineus T. membranacea P. sanguineus T. membranacea P. sanguineus

Media Malt Malt King King Malt Malt King King Malt Malt King King Malt Malt King King

Shaker (rev/min) 0 0 0 0 130 130 130 130 0 0 0 0 130 130 130 130

Lighting regime dark dark dark dark dark dark dark dark light light light light light light light light

pH 4.5 5.5 5.5 4.5 5.5 4.5 4.5 5.5 4.5 5.5 5.5 4.5 5.5 4.5 4.5 5.5

Dye Orange II Orange II Black V Black V Black V Black V Orange II Orange II Black V Black V Orange II Orange II Orange II Orange II Black V Black V

Table 4. Efficiency of decolorization of Orange II and Black V dyes and biomass of T. membranacea and P. sanguineus.

Assay 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Fungi T.m P.s T.m P.s T.m P.s T.m P.s T.m P.s T.m P.s T.m P.s T.m P.s

DT1 41 18 24 29 95 89 70 94 37 50 80 91 98 96 50 50

BT1 (g/L) 2.5 2.5 2.5 2.5 2.5 2.5 5.0 2.5 2.5 2.5 2.5 2.5 5.0 2.5 5.0 2.5

DT2 61 43 36 57 97 96 91 96 79 62 90 91 99 97 67 57

BT2 (g/L) 5.0 5.0 7.5 2.5 5.0 2.5 5.0 5.0 5.0 5.0 7.5 2.5 7.5 5.0 5.0 5.0

DT3 74 51 43 86 97 97 92 97 87 79 94 91 99 98 78 93

BT3 (g/L) 5.0 5.0 7.5 7.5 7.5 5.0 7.5 5.0 7.5 5.0 7.5 2.5 7.5 5.0 7.5 7.5

T.m, T. membranacea; P.s, P. sanguineus; DT1, discoloration at time 1 (6 days); DT2, discoloration at time 2 (12 days); DT3, discoloration at time 3 (18 days); BT1, biomass at time 1; BT2, biomass at time 2; BT3, biomass at time 3.

had the lowest biomass, although it was effective in decolorization the dye. Overall, the biomass production by T. membranacea was superior in comparison to the other species studied, with the biomass of 7.5 g/l under the growing conditions tested (except for flask 3). The two fungal isolates were efficient in decolorization of Orange II in the first week of growth, reaching values

ranging from 70 to 98% in the different forms of cultivation, except when they were cultured on malt, without agitation and without light, showing a percentage of decolorization below 42%. The maximum decolorization rate (98%) for the Black V dye was achieved with the P. sanguineus when cultured in malt medium, at 130 rpm shaking speed, in the presence of light and pH 4.5.

8394

Afr. J. Biotechnol.

Figure 1. Pareto chart of effects on the response degradation on the 6th day of growth.

Similar results were obtained by NovotnĂ˝ et al. (2004), as they assessed the ability of the fungus Irpex lacteus, after two weeks of growth in liquid medium containing the Black V dye, under different growing conditions. Tychanowicz et al. (2004) correlated the ability of the white rot fungus Pleurotus pulmonarius to decolorize industrial dyes with its production of phenoloxidases. The Pareto charts (Figures 1 and 2) represent the estimated effects of the variables studied (main effect or first order) and interactions between variables (second order effect) on the response variable (decolorization percentage of dyes by fungi) in order of magnitude, in the sixth and twelfth days after incubation. The length of each bar is proportional to the standardized effect of the variable. The vertical line can be used to evaluate that the effects were statistically significant, that is, the bars that extended through this line correspond to statistically significant effects with a confidence level of 95%.

The significance (P = 0.05) of the six variables employed in the fractional planning, as well as the interactions between them is shown in Figure 1. The variables and their interactions are represented by symbols and numbers on the vertical axis. The analysis of interactions between the variables showed that agitation was the only significant additional effect on the percentage of decolorization of dyes on the 6th day, regardless of the isolate. Sevil and Buket (2011) also revealed an increase in the decolorization of synthetic dyes when the fungal species were subjected to conditions of agitation. According to Tuor et al. (1995), aeration is one of the environmental conditions that may interfere with enzymatic activity of fungal decomposers of wood, increasing their efficiency in reducing the color of the dye. Researchers have shown that agitation of fungal species in liquid media increases the efficiency of the isolates in the color removal of dyes. Swamy and Ramsay (1999)

Da Paz et al.

8395

Figure 2. Pareto chart of effects on the response degradation on the 12th day of growth.

observed that the percentage of decolorization of azo dyes was higher with the fungi Phanerochaete chrsisoporium, Trametes versicolor and Bjerkandera when subjected to agitation. The same was reported by Ge et al. (2004) as they subjected Phanerochaete sordida to an increased rotational speed (rpm). Cultural conditions can affect the physiology and metabolism of the fungus, activating its enzymes. In Figure 2, the variables present agitation and dyes, singly or in combination, and significant additive effects on decolorization of dyes used on the twelfth day of growth. Evaluating the variable agitation, it appears that its effect was positive and it means that the shaking of the flasks at 130 rpm was the best condition for the decolorization of dyes on the 12th day of growth. Regarding the second variable (dyes), it was also significantly affected; moreover, the culture medium interferes with the percentage of decolorization of dyes by the fungi selected. When the two variables are associated (aeration and culture medium), the interactive effect is as large as possible. This kind of effect on the percentage of color removal of synthetic dyes was observed with white-

rot fungi by other authors (Sathiya moorthi et al., 2007; Sevil and Buket 2011). The interaction between variables, culture media and kinds of dyes, had a significant effect. This means that a variable does not act alone on the responses, its effect depends on another variable. This interaction effect is more evident in the graphs of geometric interpretation in Figure 3. It is observed that the Black V dye was better bleached when the fungi grew in malt medium. As for the Orange II that was cultivated in two ways, the fungi showed high degradation capacities of the dye; however, in King medium, the optimization of this process occurred. The biomasses (dry weight) of fungi studied were evaluated at six, 12 and 18 days. The increase in biomass of fungi is not necessarily reflected in the increase in the percentage of decolorization of the dyes evaluated. On the 18th day of growth, although there was an increased percentage of discoloration, no significant increase for the two responses was seen (percentage of decolorization and biomass). However, Yonne et al., (2004) found a relationship between the fungal biomass and

8396

Afr. J. Biotechnol.

Figure 3. Diagram for geometric interpretation of the effects of planning (26-2) on the 12th day of growth.

enzymatic activity of manganese peroxidase (MnP), with a directly proportional relationship between enzyme production and the increase in biomass of white rot fungi. Conclusions The results show that T. membranacea and P. sanguineus were efficient in decolorization of the dyes investigated in all culture conditions tested in this study, suggesting their use in the treatment of textile dyes. However, the decolorization rate of Orange II was the maximum in pH 5.5, malt medium, shaking speed of 130 rpm in the presence of light for the fungus T. membranacea and pH 4.5, malt medium, shaking speed of 130 rpm in the presence of light for the fungus P. sanguineus. The optimum decolorization rate for Black V was at pH 5.5, malt medium, shaking speed of 130 rpm in the dark (T. Membranacea) and pH 4.5, malt medium, shaking speed of 130 rpm in the dark (P. sanguineus). REFERENCES Aksu Z (2005). Application of biosorption for the removal of organic pollutants: a review. Process Biochem. 40: 997-1026.

Al-Sabti K (2000). Chlorotriazine Reactive Azo Red 120 Textile Dye Induces Micronuclei in Fish. Ecotox. Environ. Saf. 47: 149-155. Brazilian Association of Chemical Industry-ABIQUIM. Corantes e pigmentos. (2006). Available: <http://www.abiquim.org.br/corantes/ cor_classificacao.asp > Acessed: 02 jan. 2006. Balan DSL (2002). Biodegradação e toxicidade de efluentes tóxicos. Revista ABTT (Edição de lançamento), pp.16-19, Da Paz ESL, Gomes da Fonseca AP, Guaraná CFR, Freitas LR, Paz Júnior FB (2010). Isolamento e avaliação da atividade fenoloxidase de Basidiomycetes coletados em área de Mata Atlântica-PE. CIENTEC. 2: 37-44. Ge Y, Yan L, Qinge K (2004). Effect of environment factors on dye decolorization by Phanerochaete sordida ATCC90872 in an aerated reactor. Process Biochem. 39: 1401-1405. Gnanamani A, Bhaskar M, Ganga R, Sekaran G, Sadulla S (2004). Chemical and enzymatic interactions of Direct Black 38 and Direct Brown 1 on release of carcinogenic amines. Chemosphere 56: 833841. Guaratini CCI, Zanoni MVB (2000). Corantes têxteis. Química Nova, 23: 71-78. Gugliotta AM. (1997). Polyporaceae de mata ciliar da Estação Experimental e reserva Biológica de Moji-Guaçu. Hohenea, 24(2): 89-106. Lyra ES, Moreira KA, Porto TS, Carneiro da Cunha MN, Paz Júnior FB, Neto BB, Lima-Filho JL, Cavalcanti MAQ, Converti S, Porto ALP (2009). Decolorization of synthetic dyes by basidiomycetes isolated from woods of the Atlantic Forest (PE), Brazil. World J. Microbiol. Biotechnol. 25: 1-5. Kamida HM, Durrant LR (2005). Biodegradação de efluentes têxtil por Pleurotus sajor-caju. Química Nova 28: 629-632. Minatti E (2005). Corantes-a química das cores. Revista Eletrônica de

Da Paz et al.

Química. Ano 4. Available: <http://quark.qmc.ufsc.br/qmcweb/ artigos/dye/corantes.html> Acessed: Jan. Novotny C, Svobodová K, Kasinath A, Erbanová P (2004). Biodegradation of synthetic dyes by Irpex lacteus under various growth conditions. Int. Biodeterior. Biodegrad. 54: 215-223. Sathiya moorthi P, Periyar selvam S, Sasikalaveni A, Murugesan K, Kalaichelvan PT (2007). Decolorization of textile dyes and their effluents using white rot fungi. Afr. J. Biotechnol. 6(4): 424-429. Sevil P, Buket K (2011). Decolorization of textile dyes by newly isolated Trametes versicolor strain. Anadolu Univ. J. Soc. Sci. 2: 125-135. Seys I, Aksoz N (2005). Effect of carbon and nitrogen sources on xylanase production by Trichoderma harzianum 1073 D3. Int. Biodeter. Biodegr. 55: 115-119. Silva CMMS, Melo IS, Oliveira PR (2003). Production of phenoloxidases and peroxidases by fungi isolated from irrigated rice. Braz. J. Microb. 34: 53-55. Singer R (1951). The Agaricales (mushrooms) in Modern Taxonomy. Lilloa. Tucumán. Swamy J, Ramsay A (1999). The evaluation of white rot fungi in the decoloration of textile dyes. Enzyme, Microbiol. Technol. 24: 130137.

8397

Teixeira AR (1955). Método para estudo das hifas do basidiocarpo de fungos poliporáceos. Instituto de Botânica, 6: 1-20. Tychanowicz GK, Zilly A, Souza CGM, Peralta RM (2004). Decolourisation of industrial dyes by solid-state cultures of Pleurotus pulmonarius. Process Biochem. 39: 855-859. Tuor U, Winterhalter K, Fiechter A (1995). Enzymes of white-rot fungi involved in lignin degradation and ecological determinants for wood decay. J. Biotechnol. 41: 1-17. Yonni F, Moreira MT, Fasoli H, Grandi L, Cabral D (2004). Simple and easy method for the determination of fungal growth and decolourative capacity in solid media. Int. Biodeter. Biodegr. 54: 283-287. Zanoni MVB, Carneiro PA (2001). O descarte dos corantes têxteis. Ciência Hoje, 29: 61-65.

African Journal of Biotechnology Vol. 11(33), pp. 8398-8403, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB12.118 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Effect of cadmium chloride and ascorbic acid exposure on the vital organs of freshwater Cyprinid, Labeo rohita Abdul Latif1, Muhammad Ali2, Rahila Kaoser3, Rehana Iqbal1, Kashif Umer1, Muhammad Latif1, Shazia Qadir1 and Furhan Iqbal1* 1

Institute of Pure and Applied Biology, Zoology Division. Bahauddin Zakariya University Multan 60800, Pakistan. 2 Institute of Biotechnology. Bahauddin Zakariya University Multan 60800, Pakistan. 3 Department of Chemistry,. Bahauddin Zakariya University Multan 60800, Pakistan. Accepted 28 March, 2012

The present study was carried out to evaluate the impact of sub lethal concentrations of heavy metal, cadmium chloride (CdCl2.H2O), ascorbic acid (vitamin C) and their combination on Labeo rohita. The effect was investigated on the basis of histopathological examinations of control and experimental groups exposed to heavy metal. The acute semi statistical toxicity test for L. rohita revealed 96 h LC50 value 22.92 mg L-1 for cadmium chloride (CdCl2.H2O). 215 fingerlings of L. rohita were exposed to three different experimental conditions for 96 h: 11.46 mg L-1 CdCl2.H2O, or 450 mg Kg-1 ascorbic acid or combination of both these doses. No alterations were observed in gill sections upon comparison between treated and untreated groups. Congestion in sinusoids, fatty change, an increase in Kupffer cells and intrahepatic lymphocytes was observed in CdCl2.H2O treated group. In kidney sections of heavy metal treated group, degeneration of the glomerular tissue, occlusion in tubular lumen and necrosis were observed. Similar changes but in less severe form, as described above, were observed in the fish exposed to combination of CdCl2.H2O and ascorbic indicating that ascorbic acid do detoxify the effect of heavy metal to some extant. Our results indicate that cadmium chloride (CdCl2.H2O), if present in fresh water bodies, may act as strong toxic agent for L. rohita. Key words: Labeo rohita, cadmium chloride (CdCl2.H2O), ascorbic acid, histopathology. INTRODUCTION Heavy metals are beneficial for living organisms under normal conditions but they tend to be toxic when their concentrations cross the established safe limits (Farombi et al., 2007; Patel and Bahadur, 2011). Presently, heavy metal environmental pollution becomes an alarming signal and global issue for man, as it may cause deleterious and adverse effects on the existing natural ecological balance of the recipient environment (Vutukuru, 2005). The diverse causative factors and the sources of contamination of the essential and nonessential heavy metals, such as zinc, copper, cadmium, in aquatic environment are numerous that is, increased urbanization, expansion of industrial activity, industrial wasteful effluents, exploration of natural resources, muni-

*Corresponding author. E-mail: furhan.iqbal@bzu.edu.pk. Tel: 0092-61-9210053. Fax: 0092-61-9210098.

cipal wastes, and frequent use of automobiles (Ashraj, 2005; Vosyliene and Jankaite, 2006; Vinodhini and Narayanan, 2008; Saxsena and Garg, 2011). Besides these, the most common source of heavy metal toxicity is from dental amalgam fillings and other metal dental appliances (Farombi et al., 2007). It is informed that these heavy metals when present in high enough concentrations interfere in the metabolic disciplines, inducing thereby the chronic stress conditions that have negative effect on the lives of the living organisms; because they decline the life sustaining physico-chemical properties of the environment (Patel and Bahadur, 2011; Baki et al.,2011). Biochemical effects of essential and nonessential heavy metals like cadmium, mercury, and lead on fish and other aquatic animals have recently been the topic of interest, because freshwater bodies in developing countries like India and Pakistan are tending to be highly contaminated by the direct or indirect discharge of untreated waste, dumping of industrial effluent and run-

Latif et al.

off from agricultural fields (Uysal and Emre, 2011; Patel and Bahadur, 2011; Saxsena and Garg, 2011). In fish, gills, liver, and kidneys are pivotal organs primarily involved in respiration, osmoregulation, detoxification, biotransformation and excretion respectively (Iqbal et al., 2004; Waqar, 2006; Vesey, 2010). The kinds of histopathological abnormalities observed most commonly in fish are hepatic and renal lesions upon exposure to heavy metals (Iqbal et al., 2005). These abnormalities are important for evaluating the biological effects of metal contamination because numerous field and laboratory studies have established a putative cause/effect relationship between the prevalence of hepatic and renal lesions and exposure of fish to heavy metal toxicity (Wang et al., 2004; Uysal and Emre, 2011; Patel and Bahadur, 2011; Gernhofer et al., 2001). Cadmium toxicity is pronounced because its concentrations are continuously increasing in the environment. Its biological role in living organisms is unknown although it is the major contaminant of aquatic ecosystems, causing thereby detrimental effects on aquatic organisms (Jiraungkoorskul et al., 2006). Other sources of aquatic contamination with cadmium are diverse, for example, the use of cadmium as a coloring agent, acting as stabilizer, in mining and smoldering units, metallurgical operation, electroplating industries manufacturing vinyl plastics, electrical contacts, metallic, plastic pipes, paper, ceramic industries, pigments and in alloy mixtures (Gupta et al., 2003; Drastichova et al., 2004; Patro, 2006). Ascorbic acid (vitamin C) is an indispensable conutrient in aqua-feeds and an essential nutrient for a number of aquatic animals (Patro, 2006). It is strong reducing agent in various tissues and it is required to balance the cellular and biochemical, physiological processes, including growth, immunity, and reproduction of different animals including fish. It is also informed that vitamin C may act as anti carcinogenic and anti mutagenic. It has been reported that high levels of ascorbic acid are efficient in reducing toxicity, preventing disease and enhancing fish tolerance to environmental stress (Wang et al., 2004). Rauf et al. (2011) reported in Pakistan that, the level of cadmium in various freshwater bodies such as in River Ravi is in range of 2.46 to 8.52 mg/L which is alarming and will affect the aquatic life. Little information is available regarding the effect of cadmium on the histology of vital organs in Labeo rohita, the commercially most important carp species in Pakistan. Present study was designed to investigate the detrimental effect of CdCl2 on the vital organs, gill, liver and kidneys of L. rohita and to determine whether ascorbic acid plays a role to balance or reduce the damage done by the heavy metal. MATERIALS AND METHODS Animal collection 215 juveniles of freshwater Cyprinid fish, L. rohita, of both sex

8399

(body length 7.265 + 1.521 cm and body weight 9.571 + 1.536 g) were obtained from the Faheem fish farm, Mattital Road, Multan and were transported to Fisheries Laboratory, Institute of Pure and Applied Biology at Bahauddin Zakariya University, Multan, (Punjab), Pakistan and acclimatized for 30 days to laboratory conditions. All the experimental procedure and fish handling protocols were approved by Ethical Committee of Zoology Department. The physicochemical characteristics of water were measured daily, according to the experimental procedures described in Standard Methods for the Examination of Water and Wastewater (APHA, 1998). A 16:8 h light-dark cycle was maintained throughout the experiment. Fish was fed twice a day with 30% protein containing commercial fish food. The quantity of food was 3.5% of the initial body weight per day.

LC50 determination For determination of 96 h LC50 values, each group of 22 juveniles of L. rohita was exposed to one of the 11 concentrations; 1.5, 2.0, 2.5, 3.0, 4.5, 6.0, 8.5, 10.5, 15.0, 20.5 and 25.5 mg/L of cadmium chloride [Cd Cl2.H2O]. Fish mortality was observed after 12, 24, 36, 48, 60, 72, 84, and 96 h. LC50 values were calculated following Iqbal et al. (2005).

Experimental design Fish were exposed to sub lethal concentration, 11.46 mg L-1, of cadmium chloride (CdCl2.H2O). Groups, each containing 32 L. rohita were exposed to one of the following four treatments: Group 1, heavy metal free distilled water; group 2, 11.46 mg L-1 CdCl2.H2O; group 3, 450 mg kg-1 body weight of ascorbic acid and group 4, combination of 11.46 mg L-1 CdCl2.H2 O and 450 mg kg-1 body weight of ascorbic acid. All experiments were carried out in semi-static systems with water renewal after every 12 h following Little and Brewer (2001).

Histological study of the vital organs At the end of experiments, gill, liver and kidney were surgically removed from each treated and untreated fish, sliced and fixed in fixative solution (containing ethanol, formaldehyde and glacial acetic acid: 1:3:7) followed by dehydration in ethanol, clearing in Cedar wood oil and embedding in Paraffin (Iqbal et al., 2005). Sections of 2 Âľm were then cut at a microtome and stained with hematoxylin-eosin. Light microscopy was performed and stained section was photographed under photoscope.

RESULTS LC50 Value of CdCl2.H2O The 96 h LC50 value for experimental group of L. rohita treated with cadmium chloride was 22.92 mg/L. In a separate experimental series (data not shown), groups of 22 juveniles of L. rohita were exposed to one of the 11 concentrations of ascorbic acid 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 and 550 mg kg-1 body weight along with sub lethal (11.46 mg/L) concentration of cadmium chloride to investigate whether ascorbic acid minimizes the detrimental effect of heavy metal or not. It was observed that 450 mg kg-1 body weight of ascorbic

8400

Afr. J. Biotechnol.

Figure 1. Sections (2 µm thick) of liver of the control fresh water Cyprinid, L. rohita. (A) Central vein (arrow) and sinusoids (double arrow). (B) Hepatocytes (black arrow) and Kupffer cells (green arrow).

acid may reduce the detrimental effect of cadmium chloride. Histological changes in gill structure Light microscopic examination of the photomicrograph of the vertical section of the gills revealed no significant alteration in the arrangement of primary and secondary lamellar processes of control and experimentally treated groups. The primary gill lamellae in the microscopic sections showed the normal anatomy with quite flat leaf like structures having a central rod like supporting axis and a row of secondary gill lamellae on each side of it. The secondary lamellae (SL) were equally spaced along the columnar structures with intact cellular layer attached at their bases with the primary lamellae and free at their distal ends. The normal secondary lamellar epithelium was simple, consisting of a thin single sheet of epithelial cells, blood vessels and a row of pilaster cells. The region between the two adjacent secondary gill lamellae is known as inter-lamellar region and it did not exhibit any abnormality in the normal structure in control and treated groups of fish. Histological changes in liver Liver is composed of roundish polygonal hepatocytes, within the network of minute canalicules, containing centrally placed spherical large prominent nucleus. In liver histology of control group (Figure 5a), the bile duct, blood capillaries, and sinusoids were randomly distributed. The sinusoids were filled with erythrocytes. The hepatocytes around the central vessels appear to be lightly arranged in a rosette like pattern with approximately 10 to 12 cells in each group (Figure 1). Hepatic tissues of the fish exposed to cadmium chloride showed high degree of congestion of central

vein, resulting to hemorrhage and fatty change was prominent along with darkly stained hepatocytes. An increase of Kupffer cells and intrahepatic lymphocytes was also observed (Figure 2). No change in hepatocytes, their nuclei and Kupffer cells was observed when liver histology was compared between ascorbic acid treated group and untreated (control) fish (Figure 3). In group 4, where fish were treated with combination of cadmium chloride and ascorbic acid, similar abnormallities were observed in liver histology as those observed in the cadmium treated group but these changes were less severe indicating that ascorbic acid does detoxify the effect of heavy metal to some extant (Figure 4). Histological changes in kidneys The most prominent alterations investigated in the kidneys of L. rohita were the degeneration of the glomerular tissue, occlusion tubular lumen and necrosis in the series of cadmium chloride treated groups (Figure 5b), but the sections of the kidneys of ascorbic acid treated groups showed normal histology (Figure 5c). It was interesting in our findings that less severe impact of cadmium chloride was observed when applied in combination with ascorbic acid to treated groups (Figure 5d). DISCUSSION Cadmium, a non-essential, non-biodegradable heavy metal has been included in the “Black list”, because cadmium exerts most of their toxicity by destroying important proteins by stealing off sulphur from them, many of which are enzymes, hormones, or cell receptors (Mason, 1996) while ascorbic acid is best known for its antioxidant activity in its mode of action, by protecting the

Latif et al.

Figure 2. Sections (2 Âľm thick) of liver of the cadmium chloride treated fresh water Cyprinid, L. rohita. Congestion of central vein, resulting in hemorrhage (single arrow) and fatty change (double arrow) and dark stained hepatocytes (triple arrow). An increase of Kupffer cells (green arrow). An increase in intrahepatic lymphocytes (double green arrow).

Figure 3. Sections (2 Âľm thick) of liver of the ascorbic acid treated fresh water Cyprinid, L. rohita. Central vein (single arrow) and sinusoids (double arrow). Hepatocytes (triple arrow) and Kupffer cells (green arrow).

structure and membrane fluidity of biological system. The aim of the present study was to determine if ascorbic acid supplementation nullifies the damage caused by cadmium chloride to the histology of gill, liver and kidney of L. rohita. In fish, the gills remain in direct contact with the immediate external environment, thus they are useful biomarkers for any change in the quality of water, as they are sensitive to any detrimental changes (Mazon et al., 2002; Fernandes and Mazon, 2003; Patel and Bahadur, 2011). No prominent alteration in gill histology was observed in present study. Our results are contradictory to Ribeiro et al. (2000) and Martinez et al. (2004) who

8401

Figure 4. Sections (2 Âľm thick) of liver of the cadmium chloride and ascorbic acid treated fresh water Cyprinid, L. rohita. Fatty change (double arrow) and dark stained hepatocytes (triple arrow).

had reported visible changes in gill structure upon heavy metal exposure in fish. Our study reveals that cadmium chloride had detrimental effects on the liver histopathology of L. rohita. Cadmium can be taken up by the candidate fish through at least four routes; the food ingestion, simple diffusion via gills pore, through drinking process and by intestinal or skin absorption (Sindayigaya et. al., 1994; Fanta et al., 2003). The hepatocytic abnormalities were observed by a number of researchers following exposure of various heavy metals including cadmium; these heavy metals show affinity to interact with legends in proteins particularity; enzymes and these may retard their biochemical and physiological activities in living organisms, thus causing adverse effects in them (Filho et al., 2001; Fanta et al., 2003; Samanta et al., 2005; Patel and Bahadur, 2011). We have observed sinusoidal dilatation in fish exposed to cadmium chloride. Nobuyoshi et al. (2005) has reported that the liver being the detoxification center of the body receives cadmium quickly and frequently hence it suffers from increased arterial flow leading to sinusoidal dilatation. In our study, an increase of intrahepatic lymphocytes (Kupffer cells) and fatty change were observed in cadmium treated fish, indicating that the liver is severely affected by the toxic chemical leading to the loss of typical metabolism. Our results are in agreement with Wang et al. (2004) and Palacios et al. (2000) who had observed that the lymphocytes were directly or indirectly involved in the immunopathogenesis of chronic or acute liver diseases. The fish kidneys are one of the first and foremost organs to be affected by the detrimental effects of the metals toxicity in water (Thophon et al., 2003). In the present study, degeneration of the glomerular tissue, parenchymatous cells, occlusion tubular lumen and necrosis were observed which are the most probable changes in the fish kidneys, caused by water borne metal contamination. These results are in agreement with

8402

Afr. J. Biotechnol.

Figure 5. Sections (2 Âľm thick) through kidney of L. rohita. A, Control group: normal kidney histology. Normal glomerulus (green arrow) and normal proximal tubule (double arrow). B, Kidney section of fish exposed to CdCl2.H2O; arrow showing degeneration of the glomerular tissue (black arrow), necrosis and apoptotic cells (double arrow) and occlusion tubular lumen (green arrow). C, Kidney section of fish exposed to ascorbic acid, showing normal kidney histology. D, Kidney section exposed to both CdCl2.H2O and ascorbic acid, arrow showing the glomerular degeneration and necrosis. All photographs are taken X400 of original.

findings of Reimschuessel (2001), Veiga et al. (2002), Pacheco and Santos (2002) and Thophon et al. (2003). The induction of tubular degeneration, coupled with the presence of necrosis in the kidney in our study indicates that the kidneys had suffered detrimental damage induced by the exposure of cadmium. The development of new nephrons in fish continues throughout life (Reimschuessel, 2001). During the process of recovery of damaged kidney in fish, an increase in the frequency of new nephrons and regeneration of tubules has been reported previously (Hinton and Lauren, 1990; Cormier et al., 1995; Reimschuessel, 2001). In our study, new nephrons were observed relatively less. It might be suggested that the short period of metal exposure had not been sufficient to start the process of regeneration, as this process of regeneration of nephrons normally takes a period ranging from two to four weeks after the exposure

to the pollutants (Reimschuessel, 2001) and could be completed even in two months (Gernhofer et al., 2001). Conclusion Our results conclude that histopathology is a powerful biomarker for evaluating the quality of the environment. We had observed that cadmium chloride may act as strong toxicant for the commercially most important fish in Pakistan, L. rohita, as it severely affects the histology of liver and kidney, and ascorbic acid supplementation do detoxify the effect of heavy metal to some extent. REFERENCES APHA, (1998). bb Standard methods for examination of water and

Latif et al.

wastes. 12 ed. Washington, DC: Join Editorial board. p. 18-21 Ashraj W (2005). Accumulation of heavy metals in kidney and heart tissues of Epinephelus microdon fish from the Arabian Gulf. Environ. Monit. Assess. 101(1-3): 311-316. Baki AS, Dkhil MA, Al-Quraishy S (2011). Bioaccumulation of some heavy metals in tilapia fish relevant to their concentration in water and sediment of Wadi Hanifah, Saudi Arabia. Afr. J. Biotechnol. 10(13): 2541-2547. Cormier SM, Neiheisel TW, Wersing P, Racine RN, Reimschuessel R (1995). New nephron development in fish from polluted waters: a possible biomarker. Ecotoxicology, 4: 157-168. Drastichova J, Svobodova Z, Luskova V, Machova J (2004). Effect of cadmium on hematological indices of common carp (Cyprinus carpio). Bull. Environ. Contamin. Toxicol. 72(4): 725-735. Fanta E, Rios FS, Romao S, Vianna ACC, Freiberger S (2003). Histopathology of the fish Corydoras paleatus contaminated with sub lethal levels of organophosphorus in water and food. Ecotoxicol. Environ. Saf. 54: 119-130. Farombi EO, Adelowo OA, Ajimoko YR (2007). Biomarkers of oxidative stress and heavy metal levels as indicators of environmental pollution in African Cat fish (Clarias gariepinus) from Nigeria Ogun River. Int. J. Environ. Res. Pub. Health, 4(2): 158-165. Fernandes MN, Mazon AF (2003). Environmental Pollution and Fish Gill Morphology. Science Publishers, Enfield, USA. Filho D, Torres MA, Tribess TB, Pedrosa RC, Soares CHL (2001). Influence of season and pollution on the antioxidant defenses of the cichlid fish Acara (Geophagus brasiliensis). Brazil. J. Med. Biol. Res. 34: 719-726. Gernhofer M, Pawet M, Schramm M, Muller E. Triebskorn R (2001). Ultrastructural biomarkers as tool to characterize the health status of fish in contaminated streams. J. Aquat. Ecosyst. Stress Rec. 8: 241260. Gupta DK, Rai UN, Singh A, Inouhe M (2003). Cadmium accumulation and toxicity in Cicer arietinum L. Poll. Res. 22: 457-463. Hinton DE, Lauren DJ (1990). Liver structural alterations accompanying chronic toxicity in fishes: potential biomarkers of exposure. Boca Raton, Lewis Publishers, USA. p. 112-117 Iqbal F, Qureshi IZ, Ali M (2005). Histopathological changes in liver of farmed Cyprinid fish, Cyprinus carpio, following nitrate exposure. Pak. J. Zool. 37(4): 297-300. Iqbal F, Qureshi IZ, Ali M (2004). Histopathological changes in kidney of common carp, Cyprinus carpio, following nitrate exposure. J. Res. Sci. B. Z. Univ. Multan., 15(4): 411-418. Jiraungkoorskul W, Sahaphong S, Kangwanrangsan N, Kim M (2006). Histopathlogical Study: The Effect of Ascorbic Acid on Cadmium Exposure in Fish (Puntius altus). J. Fish. Aquat. Sci. 1(2): 191-199. Little EE, Brewer SK (2001). Target Organ Toxicity in Marine and Freshwater Teleosts New Perspectives: Toxicology and the Environment. Taylor, Francis, London. p. 64-69 Martinez CBR, Nagae MY, Zaia CTBV, Zaia DAM (2004). Morphological and physiological acute effect of lead in the neotropical fish Prochilodus lineatus. Brazil. J. Biol. 64(4): 797-807. Mason CF (1996). Biology of freshwater pollution. Longman, U.K. p. 184-187 Mazon AF, Pinheiro GHD, Fernandes MN (2002). Hematological and physiological changes induced by short-term exposure to copper in the freshwater fish, Prochilodus scrofa. Brazil. J. Biol. 62(4A): 621631. Nobuyoshi O, Hisaya N, Kazuo I, Saori N, Yoshinoro I, Makoto O, Isao O (2005). Telangiectatic focal nodular hyperplasia of the liver in the perinatal period: Case report. Pediatr. Dev. Pathol. 8: 581-586. Ribeiro, OCA., Pelletier E, Pfeiffer WC, Rouleau C (2000). Comparative uptake, bioaccumulation, and gill damages of inorganic mercury in tropical and nordic freshwater fish. Environ. Res. 83: 286-292. Pacheco M, Santos MA (2002). Biotransformation, genotoxic and histopathological effects of environmental contaminants in European eel (Anguilla anguilla L.). Ecotoxicol. Environ. Saf. 53: 331-347.

8403

Palacios PS, Biagianti-Risbourg S. Vernet G (2000). Biochemical and (ultra)structural hepatic perturbations of Brachyodanio rerio (Teleostei, Cyprinidae) exposed to two sublethal concentrations of copper sulphate. Aqua. Toxicol. 50: 109-124. Passow H, Rothstein A, Clarkson TW (1961). The general pharmacology of the heavy metals. Pharmacol. Rev. 13: 185-224. Patel JM. Bahadur A (2011). Histopathological Manifestations of Sub Lethal toxicity of Copper Ions in Catla catla. Am. Eur. J. Toxicol. Sci. 3(1): 01-05. Patro L (2006). Toxicological effects of cadmium chloride on Acetyl cholinesterase activity of freshwater fish, Oreochromis mossambicus Peters. Asia. J. Exp. Sci. 20(1): 171-180. Rauf A, Javed M, Ubaidullah M, Abdullah S (2011). Assessment of Heavy Metals in Sediments of the River Ravi, Pakistan. Int. J. Agric. Biol. 2: 197-200. Reimschuessel R (2001). A fish model of renal regeneration and development. Ilar. J. 42: 285-291. Samanta S, Mitra K, Chandra K, Saha K, Bandopadhyaya S, Ghosh A (2005). Heavy metals in water of the Rivers Hoogley and Haldi and their impact on fish. J. Environ. Biol. 26(3): 517-523. Saxsena R, Garg P (2011). Vitamin E provides protection against In vitro oxidative stress due to pesticide (Chlorphrifos and Endosulfan) in goat RBC. GERF Bull. Biosci. Article, press. Sindayigaya E, Van Cauwenbergh R, Robberecht H, Deelstra H (1994). Copper, zinc, manganese, iron, lead, cadmium, mercury and arsenic in fish from Lake Tanganyika, Burundi. Sci. Total Environ. 144: 10315. Thophon S, Kruatrachue M, Upathan ES, Pokethitiyook P, Sahaphong S, Jarikhuan S (2003). Histopathological alterations of white seabass, Lates calcarifer in acute and subchronic cadmium exposure. Environ Pollut. 121: 307-320. Uysal K, Emre Y (2011). Bioaccumulation of copper, zinc, manganese, iron and magnesium in some economically important fish from the western shores of Antalya. Life Sci. Biotechnol. 1: 95-102. Veiga ML, Rodrigues EL, Pacheco FJ, Ranzani-Paiva MJT (2002). Histopathologic changes in the kidney tissue of Prochilodus lineatus, 1836 (Characiformes, Prochilodontidae) induced by sublethal concentration of Trichlorfon exposure. Brazil. Arch. Biol. Technol. 45: 171-175. Vesey DA (2010). Transport pathways for cadmium in the intestine and kidney proximal tubule: Focuson the interaction with essential metals. Toxicol. Lett. 198(1): 13-19. Vinodhini R, Muthuswamy N (2008). Effect of heavy metals induced toxicity on metabolic biomarkers in common carp, Cyprinus carpio. Maejo Int. J. Sci. Techol. 2: 192-200. Vosyliene MZ, Jankaite A (2006). Effect of heavy metal model mixture on rainbow trout biological parameters. Ecol. 4: 12-17. Vutukuru SS (2005). Acute effects of Hexavalent chromium on survival, oxygen consumption, hematological parameters and some biochemical profiles of the Indian Major carp, L. rohita. Int. J. Environ. Res. Public Health, 2 (3): 456- 462. Wang J, Holmes TH, Cheung R, Greenberg HB, He XS (2004). Expression of chemokine receptors on intrahepatic and peripheral lymphocytes in chronic hepatitis C infections: its relationship to liver inflammation. Environ. Int. 5: 605-609. Waqar A (2006). Levels of selected heavy metals in Tuna fish. Arab. J. Sci. Eng. 31(1A): 89-92.

African Journal of Biotechnology Vol. 11(33), pp. 8404-8406, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3173 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Short Communication

Antibacterial spectrum of traditionally used medicinal plants of Hazara, Pakistan Ihtisham Bukhari1*, Mukhtiar Hassan1, Fida M Abassi2, Yasmeen Shakir1, Asfandyar Khan1, Sohail Ahmed3 , Rabia Masood4 , Zeba G Burki3, Muhammad Afzal4, Uzma Khan4, Faisal Shahzad2 and Sajjad Hussain5 1

Department of Biochemistry, Hazara University, Garden Campus, Mansehra, Pakistan. 2 Department of Genetics, Hazara University, Garden Campus, Mansehra, Pakistan. 3 Department of Microbiology, Hazara University, Garden Campus, Mansehra, Pakistan. 4 Department of Botany, Hazara University, Garden Campus, Mansehra, Pakistan. 5 Institute of chemical sciences, University of Peshawar Pakistan. Accepted 1 February, 2012

The use of medicinal plants for treatment of infections is an old age practice. On the basis of this important practice, this study was initiated to evaluate the antibacterial effects of medicinal plants, commonly used by the community of Hazara region of Pakistan. Antibacterial spectrum of traditionally used medicinal plants was determined by disc diffusion method under incubation period of 24 to 48 h at 37Â°C. Four medicinal plants were tested against the different species of human pathogenic bacteria. It was observed that Incarvillea emodi have good activity against Proteus and significantly active against Staphylococcus. Vernonia anthelmintica revealed significant activity against Staphylococcus and Proteus. However, Pseudomonas is resistant to Adiantum capilus-veneries and this plant is negligibly active against other tested microorganism. Mentha longifolia is significantly active against Proteus, while negligibly active against other tested microorganisms. Escherichia coli is however, resistant to M longifolia. Key words: Biological activity, medicinal plants, Incarvillea emodi, Vernonia anthelmintica, Adiantum capilusveneries, Mentha longifolia, Hazara, Pakistan.

INTRODUCTION Majority of herbs used by humans as a seasonal food yield useful medicinal compounds. These substances are useful for the maintenance of human and animal health. Majority of the people from Hazara (Pakistan) still rely on specific herbs for the treatment of their skin infections, injuries and gastrointestinal problems. These plants are also traditionally in practice from generation to generation. The use of herbs for treatment of diseases is as old as human origin. Modern scientists have conducted many studies on the importance of medicinal plants and their less toxic effects on human health. Several natural products have been isolated from plants

*Corresponding author. E-mail: bukhari5408@gmail.com.

and used as the remedy for many diseases. Majority of people in Pakistan, especially at hilly areas, treat their disease by using medicinal plants rather than allopathic drugs (Bukhari et al., 2011). Humans have been using plants for centuries because plants provide them medically useful compounds (Cordell, 1981). It has been estimated that more than two thirds of the world's population rely on plant-derived drugs; More than 7000 medicinal compounds used in the Western pharmacopoeia are derived from plants (Caufield, 1991). In South African traditional medicine, the use of plants is a widespread practice, and the persistence in the use of medicinal plants among people of urban and rural communities in South Africa could be considered as evidence of their efficacy (Meyer and Afolayan, 1996). It has only been in the past two decades or so that interest

Bukhari et al.

8405

Table 1. Antibacterial spectrum of medicinal plants.

Bacteria Escherichia coli Pseudomonas Staphylococcus Proteus

Vernonia anthelmintica + + ++ ++

Mentha longifolia n.a + + ++

Incarvillea emodi + + ++ +++

Adiantum capillus-veneris + n.a + +

Ampicillin ++++ ++++ ++++ ++++

Control (distilled water) n.a n.a n.a n.a

+ + + +, Excellent activity (80 to 100% inhibition); + + +, good activity (60 to 70% inhibition); + +, significant activity (30 to 50% inhibition), +, negligible activity (10 to 20% inhibition); n.a, no activity. Size of blank filter paper disc = 6 mm (diameter).

in higher plant antimicrobial agents has been reawakened worldwide and the literature in this area is becoming substantial (Mistscher et al., 1984). Unani system of medicine is reliable and support the utility of herbal medicines. Keeping in view this important practice and literature regarding use of herbs in Unani Medicine and preparation, this study was designed. The plants selected for this research are commonly in practice and recommended by Unani system of medicine for different infirmities. This study only focused on the evaluation of antibacterial effects of medicinal plants commonly in practice by the people of Hazara, Pakistan.

MATERIALS AND METHODS Plants (Incarvillea emodi, Vernonia anthelmintica, Adiantum capilus-veneries and Mentha longifolia) were collected from different altitudes of Hazara division, Pakistan. Taxonomical and Botanical identification of the plants were done by taxonomists of Botany Department of Hazara University, Mansehra, Pakistan. Plants were kept at room temperature for 15 days for complete drying, and then ground to fine powder with the help of electric grinder. Subsequently, the plantsâ&#x20AC;&#x2122; powder was sunk into methanol for 15 days at room temperature. After 15 days each plant solution was filtered separately and condensation of filtered solution was done with the help of condenser; methanol was separated, leaving behind pure plants extracts. The pharmacological evaluation was done by disc diffusion method. Hydric solution of each plant extract was prepared separately; a blank disc of filter paper with diameter of 6 mm was dipped in each solution. These socked discs were picked out from the solution and allowed to dry for few seconds near fire lamp and then kept on agar plates after streaking microbes. After incubation of 24 to 48 h at 37Â°C, diameter of the clear zone around the discs was measured and compared against the inhibition produce by standard antimicrobial agent.

RESULTS AND DISCUSSION The findings of this study showed that V. anthelmintica has 30 to 50% inhibition against Staphylococcus and Proteus, while it exhibits 10 to 20% inhibition against the Escherichia coli and Pseudomonas. E. coli showed resistance to the medicinal plant, M. longifolia and Pseudomonas was resistant to Adiantum capillusveneris. Moreover, M. longifolia revealed 10 to 20%

activity against the Pseudomonas and Staphylococcus, and 30 to 50% activity against the Proteus. I. emodi had 10 to 20% activity against the E. coli and Pseudomonas, while against the Staphylococcus and Proteus it showed 30 to 50 and 60 to 70% activity, respectively. Furthermore, the medicinal plant A. capillus-veneris was inactive against Pseudomonas, and had 10 to 20% activity against the all other tested bacteria (Table 1). The percentage activity of medicinal plants is represented in its comparison with the activity produced by the standard antibacterial drug ampicillin that has 80 to 100% activity against all the tested bacteria. Excellent activity was 80 to 100% activity, 60 to 70% good activity, 30 to 50% significant activity and 10 to 20% negligible activity. Ampicillin and other antibiotics are commonly recommended by physicians for infections, but beside their beneficial role in treatment they also have some adverse effects for those who use them for long time and sometimes show immediate adverse reaction in patients. The use of many antibiotics is strictly prohibited for pregnant women because of their role in miscarriage. The most common adverse effects of antibiotics are allergy, nausea, vomiting, etc. Though the plants screened for their biological activity did not show excellent activity against the tested bacteria, they are still in practice by people, especially by pregnant women, without any reported adverse effects. This statement is supported by Bukhari et al. (2011) who reported that persons with different human illness like swollen eyes, soar throat, wounds and infections in fractured bones treated with Berberis lycium had no adverse effect from the said medicinal plant. Traditional healers have long used plants to prevent or cure infectious conditions. Plants are rich in a wide variety of secondary metabolites, such as tannins, terpenoids, alkaloids and flavonoids, which have been found in vitro to have antimicrobial properties (Cowan, 1999). Concerning the plant Adiantum cuneatum, results have confirmed and justified the popular use of this plant for the treatment of dolorous processes (Louisiane et al., 2003). In this study, we have used A. capillus-veneris that do not have valuable antibacterial activity. The extract of I. emodi a plant of Bignoniaceae family, shows good activity against the Staphylococcus and Proteus. A study by Rasadah and Houghton (1998) revealed that crude

8406

Afr. J. Biotechnol.

extract of all species of Bignoniaceae family have antibacterial activity against Gram positive and negative bacteria and yeast. Tabebuia spectabilis, a plant of Bignoniaceae family is the most active against the Gram positive bacteria. In present study, V. anthelmintica presents good activity against Staphylococcus and Proteus, but was negligibly active against E. coli and Pseudomonas. It has also been reported that Vernonia amygdalina has significant bactericidal activity against five Gram positive bacteria, while lacking efficacy against the Gram negative strains (Erasto, 2006). It is therefore recommended that the plants showing good activity against the tested bacteria can be use as safer antimicrobial agents or phytomedicine. REFERENCES Bukhari I, Hassan M, Abbasi FM, Mujtaba G, Mahmood N, Noshin, Fatima A, Afzal M, Mujaddad-Ur-Rehman, Perveen F, Khan MT (2011). A study on comparative pharmacological efficacy of Berberis Lycium and Penicillin G. Afr. J. Microbiol. Res. 5(6): 725-728. Cordell, G.A. (1981). Introduction to the alkaloids: Biogenetic approach. New York: John Wiley and Sons. Cowan MM (1999). Plant Products as Antimicrobial Agents. Clin. Microbiol. Rev. 12(4): 564-582. Caufield C (1991). In the rain forest. Chicago: The Oxford University Press. Erasto P, Grierson DS, Afolayan AJ (2006). Bioactive sesquiterpene lactones from the leaves of Vernonia amygdalina. J. Ethnopharmacol. 106(1): 117-120. Louisiane FVB, Jacks PP, Rosendo AY, Jacir DM, Franco DM, De Campos F, De Souza MM, Valdir C-F (2003). Pharmacological and phytochemical evaluation of adiantum cuneatum growing in Brazil. Z. Naturforsch C. 58(3-4): 191-194.

Meyer JJM, Afolayan AJ, Taylor MB, Engelbrecht L (1996). Inhibition of herpes simplex virus type 1 by aqrueous extracts from shoots of Helichrysum aureonitens (Asteraceae). J. Ethnopharmacol., 52(1): 41- 43. Mitscher, L.A., & Reghar Rao GS (1984). In: Natural Products and Drug Development. Krogsgaard-Larsen, S. Brogger Christensen and H. Kofod, eds. Munksgaard, Copenhagen. pp.193- 212. Rasadah MA, Houghton PJ (1998). Antimicrobial activity of some species of bignoniaceae. ASEAN Rev. Biodiver. Environ. Conserv. 3: 1-3, article available on http://www.arbec.com.my/pdf/may-3.pdf.

African Journal of Biotechnology Vol. 11(33), pp. 8407-8413, 24 April, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3190 ISSN 1684â&#x20AC;&#x201C;5315 ÂŠ 2012 Academic Journals

Full Length Research Paper

Supplementation of broiler feed with leaves of Vernonia amygdalina and Azadirachta indica protected birds naturally infected with Eimeria sp. Oyagbemi, T. O.* and Adejinmi, J. O. Department of Veterinary Microbiology and Parasitology, Faculty of Veterinary Medicine, University of Ibadan, Oyo State, Nigeria. Accepted 23 February, 2012

Anticoccidial efficacy of the herbal mixture of Vernonia amygdalina (VA 10%) and Azadirachta indica (AI 10%) was tested against naturally infected broiler coccidiosis. A total of 100 four week old broilers naturally infected with coccidiosis were divided into five treatment groups based on the number of coccidian oocyst they contained. Group I which contained 20,700 oocyst counts served as a negative control. Group II contained 20,000 oocyst counts served as a positive control and was treated with a synthetic drug, amprolium, at recommended dose of 0.6 g/L for seven days. Groups III and IV with 20,200 and 20,500 oocyst counts were treated with 10% of V. amygdalina and 10% A. indica, respectively. Group V contained 20,400 oocyst count and was treated with the mixture of 10% each of V. amygdalina and A. indica. Groups II, III, IV and V were treated continuously for seven days. Oocysts were identified using the sodium chloride floatation method. The number of oocysts egg per gram (EPG) of faeces was determined by modified McMaster counting technique. Oocysts EPG decreased steadily in all the treated groups with a marked reduction in groups II and V. The packed cell volume (PCV), red blood cell (RBC) and white blood cell (WBC) count were determined using standard haematological methods. PVC, haemoglobin (Hb) and RBC count of the treated birds were significantly (p< 0.05) higher than those of the infected untreated groups. Hematological parameters and histological features showed a significant increase in WBC, RBC and lymphocytic infiltration; indicative of cell mediated immune response. Lower heterophil/lymphocytic ratio of the groups III, IV and V after treatment suggested immunomudulatory effect of the herbs (V. amygdalina and A. indica). Hence, the plants are capable of boosting the immunity of birds with either clinical or sub-clinical coccidia infection following subsequent exposure. Key words: Vernonia amygdalina, Azadirachta indica, haematology, immunity, coccidiosis.

INTRODUCTION Coccidiosis of chicken is an enteric parasitic disease caused by multiple species of the protozoan parasite genus Eimeria (Apicomplexa: Eucoccidia: Eimeriidae) and is one of the commonest and economically most

*Corresponding author. E-mail: akantai2002@yahoo.com. Tel: +2348025734860. Fax: 02-803043. Abbreviations: EPG, Egg per gram; PCV, packed cell volume; RBC, red blood cell; WBC, white blood cell; Hb, haemoglobin.

important diseases of poultry worldwide (Shirley et al.,2005). Yunus et al., 2008) and Lee (2009) also reported coccidiosis as one of the most important diseases of poultry worldwide. It is characterized by marked anorexia, bloody diarrhoea, morbidity, mortalities and reduction in productivity and feed conversion efficiency of affected chicken (Jang et al., 2007). The control of coccidiosis has relied mainly on the preventive use of anticoccidial drugs (coccidiostats), together with the induction of species-specific natural immunity in chicken flocks (Shirley et al., 2004, 2005). In Nigeria, the use of sulphonamides and pyrimidine

8408

Afr. J. Biotechnol.

derivatives such as amprolium as coccidiostats is common practise (Oladoja and Olusanya, 2007). Lillehoj et al. (2007) reported the use of anticoccidial drugs in feed or water and/or vaccines using live strains of Eimeria in intensively reared poultry settings. Due to the emergence of drug-resistant strains of Eimeria in populations of commercial flocks and increasing public concern about drug residues in meat (Williams, 2006; Bafundo et al., 2008), alternative treatments are urgently needed (Dongjean et al., 2011). Medicinal plants and herbs have been used for many years in the treatment of various diseases in animal and man. Plants native to Nigeria have also been shown to possess anticoccidial activity (Nweze and Obiwulu, 2009). Nigeria herbal plants Vernonia amygdalina (VA) and Azadirachta indica (AI) have been considered potentially effective chemo-preventive and chemotherapeutic agents against breast cancer cells (Luo et al., 2010; Kumar et al., 2009). V. amygdalina was reported to have an anthelmintic and hepatoprotective properties (Adedapo et al., 2007; Adesanoye and Farombi, 2010). Recently, Ademola and Eloff (2011) reported anthelminthic activity of V. amygdalina against Haemonchus contortus eggs and larvae. Therefore, several studies have been undertaken to identify various dietary supplements and probiotics to control Eimeria infections (Jang et al., 2007; Molan et al, 2009). Here, we examined dietary supplementation with amprolium (reference drug), V. amygdalina and A. indica to control coccidiosis in naturally infected broiler chicken. MATERIALS AND METHODS A total of 100 day old broilers were obtained from Obasanjo Hatchery, Oluyole Estate, Ibadan. The broiler chicks were reared under standard management practices in the experimental animal house of the Faculty of Veterinary Medicine, University of Ibadan, for eight weeks. The birds were administered orally with antibiotic (Doxygen 20/20; Kepro B.V Holland) containing gentamycin sulphate and doxycline hydrate at the dose rate of 1 g per 3 L of drinking water for the first five days. The birds were vaccinated against Infectious bursa disease and Newcastle disease on days 8 and 28 respectively, using potent locally produced vaccine from National Veterinary Research Institute, Jos (NVRI). The birds were fed with a well standard broiler feed (anticoccidial free feed) and water ad libitum for the first few weeks of life on deep litter before transferred into battery cage system. V. amygdalina leaves and A. indica leaves were air-dried at room temperature, grounded and incorporated into broiler starter at the rate of 10%.

Grouping and dosage of experimental birds Broiler chicks were then divided into five treatment groups (I, II, III, IV and V) of 10 birds of two replicates per group. Group I containing average oocyst count of 20,700, was left untreated (negative control). Group II containing average oocyst count of 20,000 was treated with amprolium hydrochloride (1 g per 2.5 kg body weight) for five days. Group III containing 20,200 average oocysts count was supplemented with 10% V. amygdalina leaves in feed. Group IV containing 20,500 average oocyst count, was treated with 10%

A. indica leaves in feed, while group V containing 20,400 average oocyst count was supplemented with the mixture of 10% V. amygdalina and 10% A. indica. Clinical signs typical of coccidiosis (Mc Dougald and Reid, 1997), oocyst egg per gram (EPG) of faeces, red blood cell (RBC) counts, packed cell volume (PCV) and other erythrocyte indices were used to evaluate the anticoccidial activity of amprolium hydrochloride (standard drug), V. amygdalina and A. indica. The modified McMaster technique as described by Vassilev (2002) was used to estimate EPG.

Blood collection Blood samples (5 ml) were collected from the jugular vein into lithium heparinized tubes. The PCV was determined by microhaematocrit method (Goldenfarb et al., 1971). The values found were expressed as a percentage of the total blood volume. RBC and white blood cells (WBC) were counted using the haemocytometer (Jain, 1986). Haemoglobin concentration was determined by standard cyanometahemoglobin method as described by Jain (1986) and its values were expressed in g/% ml of blood. The mean corpuscular haemoglobin concentration (MCHC), mean corpuscular volume (MCV) and mean corpuscular haemoglobin (MCH) were calculated according to Jain (1986). Blood samples were collected twice (before the commencement of the treatment and after the treatment). All the chickens that died during the study were subjected to necropsy.

Statistical analysis All values are expressed as mean Âą standard deviation (SD). Statistical analysis were performed using the analysis of variance (ANOVA) followed by Turkey post test. Differences were considered to be significant at p<0.05.

RESULTS Clinical observation The experimental birds exhibited a diarrhoeic brownish blood tinged feaces characteristic of coccidial infection. Mortality was only recorded in group I (infecteduntreated) and group III (treated with V. amygdalina).

Growth performance Changes in body weight of broiler chickens infected with coccidiosis after treatment were as shown in Table 1. Infected broiler chickens (group I) exhibited 15% reduction in body weight while group II treated with amprolium resulted in 22% increase in body weight. However, group III (V. amygdalina), group IV (AI) and group V (V. amygdalina and A. indica) resulted in 5, 11 and respectively. Though the group treated with V. amygdalina has the least weight gain compared to all other treated groups (Table 1), there is a strong indication that treatment with the mixture of V. amygdalina and A. indica significantly alleviated the weight loss in broiler coccidiosis in a similar manner to amprolium (p<0.05).

Oyagbemi and Adejinmi

8409

Table 1. Daily weight gain during treatment.

Experimental groups Group I Group II Group III Group IV Group V

Day 1 618.30±20.07 610.30±36.67 640.00±27.33 635.00±36.22 620.70±37.45

Day 2 579.30±10.14* 640.70±22.57* 566.00±15.92* 650.70±30.92 635.70±17.06

Day 3 560.00±29.66* 670.30±46.58 572.70±29.06 662.30±46.79 650.40±37.12

Day 4 540.30±21.51* 700.50±49.37 600.30±21.20 680.90±28.68 670.00±35.78

Day 5 532.00±29.77* 710.30±34.39* 620.00±30.89 690.00±29.77 690.00±14.72*

Day 6 528.30±25.78* 720.00±29.60* 645.00±36.77* 700.30±30.73* 720.50±6.29*

Day 7 526.00±37.48* 744.00±24.15* 670.30±32.08* 705.50±22.13* 732.00±15.12*

Values are expressed as mean±SEM (N=10). Asterisks (*) indicate significant difference (P<0.05) when days 2, 3, 4, 5, 6 and 7 are compared wi th day 1. Group I: control, group II: amprolium, group III: Vernonia amygdalina (VA), group IV: Azadirachta indica (AI), group V: VA+AI.

Haematological parameters Tables 2a, 2b and 2c show haematological parameters of broiler chickens infected with Eimeria sp. and treated with amprolium, V. amygdalina and A. indica. There was significant (p<0.05) increase in parked cell volume of birds that were treated with V. amygdalina (27.20± 2.68), and A. indica (25.80±2.17), compared with infected-untreated (22.20±3.96). Similarly, there was significant (p<0.05) increase in heamoglobin concentration in birds treated with V. amygdalina and A. indica compared with the control (infecteduntreated). In the same vein, red blood cell count also increased significantly (p<0.05) in birds treated with V. amygdalina (7.32±0.88) and A. indica (7.20±0.67), compared with control (5.85±1.47). The WBC of broiler chickens treated with AI (5.68±0.76) and VA+AI (5.50±0.53) were significantly higher (p<0.05) compared with control (4.32±1.29). However, the erythrocyte sedimentation rate of bird treated with V. amygdalina and A. indica (3.80±0.84) increased significantly (p<0.05) compared with control (1.6±0.89). Effect on oocyst count Table 3 shows the effect of amprolium (AP), VA and AI on oocyst counts of broiler chickens

infected with Eimeria sp. Initial oocyst egg per gram of infected broiler chicken before treatment were: control (20,700), AP (20,000), VA (20,200), AI (20,200) and VA+AI (20,400), respectively. There was gradual decrease in oocyst EPG of feaces for all the treatment groups except infected-untreated (control). The EPG for the treatment groups AP (50), VA (150), AI (100), VA+AI (50) and control (22,750) differ significantly (p<0.05) compared with initial values (Table 2). Also, there were significant reductions in EPG in birds treated with AP (0), VA (100), AI (50), VA+AI (50) two weeks post treatment compared with the control (25,000). Immuno-modulatory effect Figure 1 shows immuno-modulatory property of V. amygdalina and A. indica on broiler chickens naturally infected with Eimeria sp. using mean heterophil/lymphocyte ratio. The level of mean heterophil/lymphocyte ratio of all the birds in the groups were ascertained before treatment (Figure 1). The mean results obtained after treatment showed reduction in mean heterophil/lymphocyte ratio in infected-untreated birds compared with birds treated with AP, VA, AI and VA+AI (Figure 2). This reduction was also closely followed with AI and VA+AI treated groups. This result therefore

shows induction of natural immunity in birds naturally infected with Eimeria sp. but left untreated. Similarly, the result shows evidence of immuno-modulatory effect of leaves of A. indica and V. amygdalina. However, the groups treated with the leaves A. indica and V. amygdalina have their immunity maintained and even boosted in AI group.

DISCUSSION In this study, a gradual but significant weight in both infected-untreated and infected-treated groups was recorded, although, the weight gain observed in the infected-untreated group was not consistent. Improvement in weight gain and decreased weight loss has also been reported in birds infected with Eimeria tenella strain treated with medicinal plant in reference to amprolium (ElAbasy et al., 2003; Ogbe et al., 2009). The birds in groups III, IV and V did not have appreciable weight gain, possibly due to the bitterness of the leaves. According to our findings, there were significant reductions in haematological parameters such PCV, RBC, haemoglobin (Hb), and WBC in birds that were naturally infected with E. tenella. This is in line with findings of Ellakany et al. (2011) who

8410

Afr. J. Biotechnol.

Table 2a. Haematological parameters of naturally infected broiler chickens before and after treatment with amprolium, Vernonia amygdalina and Azadirachta indica.

Parameter PCV1 (%) PCV2 (%) Hb1 (g/dl) Hb2 (g/dl) RBC1(×106/µL) 6 RBC2 (×10 /µL)

Group I 22.20±3.96 14.0±7.0* 6.50±2.42 4.6±2.35* 5.85±1.47 3.74±2.11*

Group II 23.40±2.79 14.67±7.23* 7.68±0.92 4.73±2.40* 6.60±0.57 3.72±1.70*

Group III 27.20±2.68 26.67±7.37 8.98±0.89 7.10±2.48 7.32±0.88 6.57±4.33

Group IV 25.80±2.17 27.75±4.5* 8.48±0.74 7.98±1.52 7.20±0.67 7.20±2.87

Group V 24.40±0.83 26.25±2.22* 8.00±0.31 8.65±0.09 6.64±0.53 7.09±1.41

Values are expressed as mean±SEM (N=10). Asterisks indicate significant difference (P<0.05) when groups II, III, IV and V are compared with control. Group I, control; group II, amprolium (AP); group III, Vernonia amygdalina (VA); group IV, Azadirachta indica (AI); group V, VA+AI. PCV, Packed cell volume; RBC, red blood cell; Hb, haemoglobin.

Table 2b. Haematological parameters of naturally infected broiler chickens before and after treatment with amprolium, Vernonia amygdalina and Azadirachta indica.

WBC1(×103/µL) 4.32±1.29 4.56±0.48 5.54±1.09 5.68±0.76 5.5±0.53

WBC2 (×103/µL)) 3.33±1.01 4.33±1.03 7.13±5.00* 7.40±0.88* 9.10±2.58*

MCHC1 (fl) 11.54±4.21 11.62±0.56 36.74±0.85 35.88±0.7 36.74±0.88*

MCHC2 (fl) 12.47±2.80 12.55±0.57 38.14±12.75* 34.78±6.15 12.49±2.20*

MCV1 (pg) 39.06±6.12 35.25±6.37 12.35±0.45 11.78±0.26 12.05±0.31

MCV2 (pg) 38.10±7.44 37.04±3.95* 12.45±0.57 11.68±2.09 37.92±6.58*

Values are expressed as mean±SEM (N=10). Asterisks (*) indicate significant difference (P<0.05) when groups II, III, IV and V are compared with control. Group I, control; group II, amprolium (AP); group III, Vernonia amygdalina (VA); group IV, Azadirachta indica (AI); group V, VA+AI. MCHC, Mean corpuscular haemoglobin concentration; MCV, mean corpuscular volume; MCH, mean corpuscular haemoglobin.

Table 2c. Haematological parameters of naturally infected broiler chickens before and after treatment with amprolium, Vernonia amygdalina and Azadirachta indica.

Parameter MCHC1 (g/dl) MCHC2 (g/dl) ESR1 (×103/µL) ESR2 (×103/µL)

Group I 32.84±0.43 32.63±1.09 1.6±0.89 7.0±1.0*

Group II 32.82±0.09 32.14±0.41 1.80±0.84 3.67±0.58*

Group III 33.10±0.92 28.45±7.40* 2.60±1.34 2.33±0.58

Group IV 32.86±0.15 32.84±0.43 1.60±0.89 4.25±0.05*

Group V 32.79±0.11 32.94±0.25 3.80±0.84 2.25±1.26*

Values are expressed as mean±SEM (N=10). Asterisks indicate significant difference (P<0.05) when groups II, III, IV and V are compared with control. Group I, control; group II, amprolium (AP); group III, Vernonia amygdalina (VA); group IV, Azadirachta indica (AI); group V, VA+AI. MCHC, Mean corpuscular haemoglobin concentration; ESR, erythrocyte sedimentation rate.

Table 3. Oocyst egg per gram (EPG) of broiler chickens naturally infected with Eimeria species and treated with Amprolium, Vernonia amygdalina and Azadirachta indica.

Day 0 1 2 3 4 5 6 7

Group I 20,700 20,800 21,000 21,200 21,400 22,000 22,750 23,000

Group II 20,000 12,000 3,000 1,400 800 100 50 -

Group III 20,200 9,000 3,500 2,000 1,100 400 150 100

Group IV 20, 200 7,500 2,500 1,650 900 500 100 50

Group V 20,400 6,000 1,500 1,000 600 150 50 50

Group I, control; group II, amprolium (AP); group III, Vernonia amygdalina (VA); group IV, Azadirachta indica (AI); group V, VA+AI.

Oyagbemi and Adejinmi

8411

heter/lymp

Heterophyl/lymphocyte (×10 µL)

1.3 1.2 1.1 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 Grp I

Group I

Grp II

Group II

Grp III

Group III

Grp IV

Group IV

Grp V

Group V

Figure 1. Mean heterophil/lymphocytes ratio (×103/µL) of broiler chickens before treatment. Group I, control; group II, amprolium (AP); group III, Vernonia amygdalina (VA); group IV, Azadirachta indica (AI); group V, VA+AI.

Data 1

Heterophyl/lymphocyte Heter/Lymp (×10 µL)

0 Grp I

Group I

Grp II

Group II

Grp III

Group III

Grp IV

Group IV

Grp V

Group V

Figure 2. Mean heterophil/lymphocytes ratio (×103/µL) of broiler chickens after treatment. Group I, control; group II, amprolium (AP); group III, Vernonia amygdalina (VA); group IV, Azadirachta indica (AI); group V, VA+AI.

reported significant reduction in packed cell volume, haemoglobin content and lymphocyte percentage of E. tenella infected broilers. Broiler chickens supplemented with either VA or AI had significant increase in the values of their haematological parameters seven days post treatment. This therefore confirms the haematinic property of the supplemented diet. Similarly, dietary supplementation with either VA or AI also improved haematological parameters of the broiler chickens compared with infected-untreated birds 14 days post treatment. The improvement in the haematological

parameters of the infected-treated birds was consistent throughout the course of the experiment. As part of the underlying protective mechanisms responsible for coccidiosis, humoral immune responses have also been extensively studied in coccidiosis (Lee et al., 2009; Dalloul et al., 2003). In this study, anticoccidial antibody responses were significantly influenced by the diet supplemented with VA and AI; although significantly lower mean heterophil/lymphocyte ratio detected in the group supplemented with AI was closely followed with VA as compared to the infected-untreated group (control)

8412

Afr. J. Biotechnol.

seven days post dietary supplementation. Lower heterophil/lymphocyte ratio which is a strong pointer to increased potentiation of the immune system has been reported (Oyagbemi et al., 2008). This work therefore collaborates the findings of other workers who reported significant association between lower heterophil/ lymphocyte ratio and potentiation of immune system (Aengwanich and Suttajit, 2010; Butler et al., 2010). Also, according to the findings, infected-untreated birds showed significant lower heterophil/lymphocyte ratio after one week compared to other birds that were supplemented with either VA or AI. This confirms natural immunity against coccidiosis, although with characteristics morbidity and mortality. As part of the underlying protective mechanisms responsible for coccidiosis, humoral immune responses have also been extensively studied in coccidiosis (Waihenya et al., 2002a, b; Dalloul et al., 2003). Recently, the use of alternative treatment including Aloe vera and medicinal plant (extract) has been reported for controlling avian coccidiosis (Anosa and Okoro, 2011; Yim et al., 2011). In this study, dietary VA and or AI resulted in significantly reduced faecal oocyst shedding as compared to the infected group fed the amprolium (reference drug) seven days post treatment. In the same vein, dietary supplementation with either VA or AI reduced faecal oocyst shedding near normal (amprolium) 14 days post treatment. There was observable and continuous increase in faecal oocyst shedding in infected-untreated group. Conclusion The reduced faecal oocyst shedding obtained in this study conferred a protective role against Eimeria infection. However, supplementation with V. amygdalina and A. indica-based diet for chickens could be associated with more cellular-mediated responses than humoral responses. In conclusion, the results of this study suggest that dietary V. amygdalina and A. indica can inhibit invasion and/ or replication of E. tenella in the gut tissues of chickens. However, the mode of action remains to be determined. The findings of this study suggest that V. amygdalina and A. indica could be a cheaper, safe, and beneficial dietary supplement to control coccidiosis in sub-Saharan Africa. Hence, the promising results obtained from the mixture of 10% each of A.I and V.A justify its ethno-veterinary importance in broiler coccidiosis. REFERENCES Adedapo AA, Omoloye OA, Ohore OG (2007). Studies on the anthelmintic activity on Vernonia amygdalina on puppies. Asian J. Pharmacol. Vet. Res. 74: 31-36. Ademola IO, Eloff JN (2011). Anthelminthic activity of acetone extract and fractions of Vernonia amygdalina against Haemonchus contortus

eggs and larvae. Trop. Anim. Health Prod. 43(2): 521-527. Adesanoye OA, Farombi EO (2010). Hepatoprotective effects of Vernonia amygdalina (astereaceae) in rats treated with carbon tetrachloride. Exp. Toxicol. Pathol. 62(2): 197-206. Aengwanich W, Suttajit M (2010). Effect of polyphenols extracted from Tamarind (Tamarindus indica L.) seed coat on physiological changes, heterophil/lymphocyte ratio, oxidative stress and body weight of broilers (Gallus domesticus) under chronic heat stress. Anim. Sci. J. 81(2): 264-270. Anosa GN, Okoro OJ (2011). Anticoccidial activity of the methanolic extract of Musa paradisiaca root in chickens. Trop. Anim. Health Prod. 43: 245-248. Bafundo KW, Cervantes HM, Mathis GH (2008). Sensitivity of Eimeria field isolates in the United States: responses of nicarbazin-containing anticoccidials. Poultry Sci. 87: 1760-1767. Butler MW, leppert LL, Dufty AM (2010). Effects of small increases in corticosterone levels on morphology, immune function, and feather development. Physiol. Biochem. Zool. 83: 78-86. Dalloul RA, Lillehoj HS, Shellem TA, Doerr JA (2003). Enhanced mucosal immunity against Eimeria acervulina in broilers fed a Lactobacillus-based probiotic. Poult. Sci. 82: 62-66. El-Abasy M, Motobu M, NA KJ, Shimura K, Nakamura K, Koge K, Onodera T, Hirota Y (2003). Protective effects of sugar cane extracts (SCE) on Eimeria tenella infection in chickens. J. Vet. Med. Sci. 65: 865-871. Ellakany HF, Abuakkada SS, Oda SS, El-Sayed YS (2011). Influence of low levels of dietary aflatoxins on Eimeria tenella infections in broilers. Trop. Anim. Health Prod. 43: 249-257. Goldenfarb PB, Bowyer FP, Hall T, Brosious E (1971). Reproducibility in the hematology laboratory: the microhematocrit determination, Am. J. Clin. Pathol. 52: 35-36. Jain NC (1986). Schalm's veterinary haematology. Lea and Febiger, Schalm's Veterinary Haematology, 4th ed. Philadelphia: Lea. Febiger, pp. 71-74. Jang SI, Jun M, LillehoJ HS, Dalloul RI, Kong I, Kim S, Min W (2007). Anticoccidial effect of green tea-based diets against Eimeria maxima. Vet. Parasitol. 144: 172-175. Kumar H, Mohan CKVP, Rao J, Nagini S (2009). Nimbolide a limonoid from Azadirachta indica inhibits proliferation and induces apoptosis of human choriocarcinoma (Bewo) cells. Invest. New Drugs, 3: 246-252. Lee SH, Lillehoj HS, Park DW, Jang SI, Morales A, Garcia D, Lucio E, Larios R, Victoria R, Marrufo D, Lillehoj EP (2009). Protective effect of hyperimmune egg yolk IGY antibodies against Eimeria maxima infections. Vet. Parasitol. 163: 123-126. Lillehoj HS, Kim CH, Keeler CL, Zhang S (2007). Immunogenomic approaches to study host immunity to enteric pathogens. Poult. Sci. 86: 1491-1500. Luo X, Oyugi DA, Lin C, Izevbigie EB, Lee KS (2010). Isolation and characterization of the antibreast carcinoma cell growth components of Vernonia amygdalina extracts. Exp. Biol. Med. (Maywood). 235: 1472-1478. Mcdougald LR, Reid WM (1997). Coccidiosis. In: Calnek BW (eds), Diseases of Poultry, 10th Ed., (Iowa State University Press, Ames). pp. 865-883. Molan AL, Liu Z, De S (2009). Effect of pine bark (Pinus radiata) extracts on sporulation of coccidian oocysts. Folia Parasitol. 56: 1-5. Nweze NE, Obiwulu IS (2009). Anticoccidial effects of Ageratum conyzoides. J. Ethnopharmacol. 122: 6-9. Ogbe AO, Atawodi SE, Abdu PA, Sannusi A, Itodo AE (2009). Changes in weight gain, faecal oocyst count and packed cell volume of Eimeria tenella-infected broilers treated with a wild mushroom (Ganoderma lucidum) aqueous extract. J. S. Afr. Vet. Assoc. 80: 97-102. Oladoja MA, Olusanya TP (2007). Adoption of coccidiosis vaccines by poultry farmers in Ijebu Area of Ogun State, Nigeria. Int. J. Poult. Sci. 6: 883-887. Oyagbemi AA, Saba AB, Arowolo ROA (2008). Safety Evaluation of prolonged Administration of Stresroak in grower Broilers. Int. J. Poult. Sci. 7: 574-578. Shirley MW, Smith AL, Tomley FM (2005). The biology of avian Eimeria with an emphasis on their control by vaccination. Adv. Parasitol. 60: 285-330. Shirley MW, Ivens A, Gruber A, Madeira AM, Wan KL, Dear PH, Tomley

Oyagbemi and Adejinmi

FM (2004). The Eimeria genome projects: a sequence of events. Trends Parasitol. 20: 199-201. Vassilev DG (2002). Special modification of Mc Master. In: Cumming B (ed), Manual of veterinary parasitological techniques. (Central Veterinary Laboratory, London). Waihenya RK, Mtambo MM, Nkwengulila G, Minga UM (2002a). Efficacy of crude extract of Aloe secundiflora against Salmonella gallinarum in experimentally infected free-range chickens in Tanzania. J. Ethnopharmacol. 79: 317-323. Waihenya RK, Mtambo MM, Nkwengulila G (2002b). Evaluation of the efficacy of the crude extract of Aloe secundiflora in chickens experimentally infected with Newcastle disease virus. J. Ethnopharmacol. 79: 299-304.

8413

Williams RB (2006). Tracing the emergence of drug-resistance in coccidia (Eimeria sp.) of commercial broiler flocks medicated with decoquinate for the first time in the United Kingdom. Vet. Parasitol. 135: 1-14. Yim D, Kim DW, Kim SH, lillehoj HS, Min W (2011). Protective effects of Aloe vera-based diets in Eimeria maxima-infected broiler chickens. Exp. Parasitol. 127: 322-325. Yunus AW, Nasir MK, Farooq U, Bรถhm J (2008). Prevalence of Poultry Diseases and Their Interaction with Mycotoxicosis in District Chakwal: 1. Effects of Age and Flock Size. J. Anim. Plant Sci. 18: 107-113.

UPCOMING CONFERENCES 2012 International Conference on Biotechnology and Food Engineering ICBFE 2012 Dubai, UAE. August 4-5, 2012

15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012

Conferences and Advert August 2012 International Conference on Biotechnology and Food Engineering (ICBFE 2012) Dubai, UAE, 4 Aug 2012 September 2012 Agricultural Biotechnology International Conference (ABIC2012), Christchurch, New Zealand, 1 Sep 2012 15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 Sep 2012 October 2012 Biotechnology and Bioinformatics Symposium, Provo, USA, 25 Oct 2012

African Journal of

Biotechnology Related Journals Published by Academic Journals ■ ■ ■ ■ ■ ■

Journal of Evolutionary Biology Research Journal of Yeast and Fungal Research Journal of Brewing and Distilling African Journal of Biochemistry Research African Journal of Food Science African Journal of Plant Science