Query Query GH*
Date
183 substances in Reaxys
2016-07-13 00h:27m:29s (EST)
NO 2
O
1. Query
Results GH*
GH* GH*
GH*
O
GH* GH*
Search as: As drawn, No mixtures, No isotopes, No charges, No radicals
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
1/249
2016-07-13 00:31:19
Reaxys ID 15499 View in Reaxys
1/183 CAS Registry Number: 1485-00-3; 22568-48-5 Chemical Name: 5-((E)-2-nitroethenyl)-1,3-benzodioxole; NSC 10120; (E)-1,2-methylenedioxy-4-(2-nitrovinyl)benzene; (E)-1(3,4-methylenedioxyphenyl)-2-nitroethene; (E)-(3,4-methylenedioxyphenyl)-1-nitroethene; (E)-3,4-(methylenedioxy)-β-nitrostyrene; 2-(3,4-(methylenedioxy)phenyl)-1-nitroethene Linear Structure Formula: C9H7O4N Molecular Formula: C9H7NO4 Molecular Weight: 193.159 Type of Substance: heterocyclic InChI Key: KFLWBZPSJQPRDD-ONEGZZNKSA-N Note:
O O
E
N
O
O
Substance Label (43) Label References 2h
Evans, David A.; Mito, Shizue; Seidel, Daniel; Journal of the American Chemical Society; vol. 129; nb. 37; (2007); p. 11583 - 11592, View in Reaxys; Guo, Chang; Xue, Meng-Xia; Zhu, Ming-Kui; Gong, Liu-Zhu; Angewandte Chemie - International Edition; vol. 47; nb. 18; (2008); p. 3414 - 3417, View in Reaxys; Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys; Luridiana, Alberto; Frongia, Angelo; Aitken, David J.; Guillot, Regis; Sarais, Giorgia; Secci, Francesco; Organic and Biomolecular Chemistry; vol. 14; nb. 13; (2016); p. 3394 - 3403, View in Reaxys
8f
Sagamanova, Irina; Rodrguez-Escrich, Carles; Molnr, Istvn Gbor; Sayalero, Sonia; Gilmour, Ryan; Perics, Miquel A.; ACS Catalysis; vol. 5; nb. 11; (2015); p. 6241 - 6248, View in Reaxys
1
Kobayashi, Takumi; Shimura, Tatsuki; Kurita, Yuzuru; Katsumata, Yoshitaka; Kezuka, Satoko; Tetrahedron Letters; vol. 55; nb. 17; (2014); p. 2818 - 2821, View in Reaxys
6e
Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys
5
McNulty, James; Mao, Justin; Gibe, Romelo; Mo, Ruowei; Wolf, Sonja; Pettit, George R.; Herald, Delbert L.; Boyd, Michael R.; Bioorganic and Medicinal Chemistry Letters; vol. 11; nb. 2; (2001); p. 169 - 172, View in Reaxys; Zanwar, Manoj R.; Kavala, Veerababurao; Gawande, Sachin D.; Kuo, Chun-Wei; Kuo, Ting-Shen; Chen, Mei-Ling; He, Chiu-Hui; Yao, Ching-Fa; European Journal of Organic Chemistry; nb. 36; (2013); p. 8288 - 8298, View in Reaxys
2e
Watanabe, Masahito; Ikagawa, Ayako; Wang, Hui; Murata, Kunihiko; Ikariya, Takao; Journal of the American Chemical Society; vol. 126; nb. 36; (2004); p. 11148 - 11149, View in Reaxys; Ansari, Samira; Raabe, Gerhard; Enders, Dieter; Monatshefte fur Chemie; vol. 144; nb. 5; (2013); p. 641 - 646, View in Reaxys
4i
Enders, Dieter; Hahn, Robert; Atodiresei, Iuliana; Advanced Synthesis and Catalysis; vol. 355; nb. 6; (2013); p. 1126 - 1136, View in Reaxys
8j
Singh, Kamalnain; Singh, Paramjit; Kaur, Amarjit; Singh, Pushpinder; Sharma, Sandeepkumar; Khullar, Sadhika; Mandal, Sanjay K.; Synthesis (Germany); vol. 45; nb. 10; (2013); p. 1406 - 1413; Art.No: SS-2013-Z0008-O, View in Reaxys
3h
Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys
11c
Puerto Galvis, Carlos E.; Kouznetsov, Vladimir V.; Organic and Biomolecular Chemistry; vol. 11; nb. 42; (2013); p. 7372 - 7386, View in Reaxys
7f
Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys
1c
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys
3
Boyd, Steven A.; Mantei, Robert A.; Tasker, Andrew S.; Liu, Gang; Sorensen, Bryan K.; Henry Jr., Kenneth J.; Von Geldern, Thomas W.; Winn, Martin; Wu-Wong, Jinshyun R.; Chiou, William J.; Dixon, Douglas B.; Hutchins, Charles W.; Marsh, Kennan C.; Nguyen, Bach; Opgenorth, Terry J.; Bioorganic and Medicinal Chemistry; vol. 7; nb. 6; (1999); p. 991 - 1002, View in Reaxys; Kusurkar, Radhika S.; Alkobati, Nabil A. H.; Gokule, Anita S.; Chaudhari, Purnima M.; Waghchaure, Prasad B.; Synthetic Communications; vol. 36; nb. 8; (2006); p. 1075 - 1081, View in Reaxys; Kusurkar, Radhika S.; Alkobati, Nabil A.H.; Gokule, Anita S.; Puranik, Vedavati G.; Tetrahedron; vol. 64; nb. 8; (2008); p. 1654 - 1662, View in Reaxys
2
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
2/249
2016-07-13 00:31:19
8h
Rastogi, Namrata; Namboothiri, Irishi N. N.; Cojocaru, Miriam; Tetrahedron Letters; vol. 45; nb. 24; (2004); p. 4745 - 4748, View in Reaxys; Puleo, Gian Luigi; Iuliano, Anna; Tetrahedron Asymmetry; vol. 19; nb. 17; (2008); p. 2045 - 2050, View in Reaxys
4a
Muruganantham; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 9; nb. 6; (2007); p. 1125 - 1128, View in Reaxys
6
Das, Jaya Prakash; Sinha, Pradipta; Roy, Sujit; Organic Letters; vol. 4; nb. 18; (2002); p. 3055 - 3058, View in Reaxys; Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys
3, Ar=3,4(OCH2O)Ph
Toth, Judit; Varadi, Linda; Dancso, Andras; Blasko, Gabor; Toke, Laszlo; Nyerges, Miklos; Synlett; nb. 8; (2007); p. 1259 - 1263, View in Reaxys
25c
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys
2j
Wang, Jian; Heikkinen, Lora D.; Li, Hao; Zu, Liansuo; Jiang, Wei; Xie, Hexin; Wang, Wei; Advanced Synthesis and Catalysis; vol. 349; nb. 7; (2007); p. 1052 - 1056, View in Reaxys
1d
Garcia-Torres, Alejandro; Cruz-Almanza, Rymundo; Miranda, Luis D.; Tetrahedron Letters; vol. 45; nb. 10; (2004); p. 2085 - 2088, View in Reaxys; Rai, Vishal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Tetrahedron Asymmetry; vol. 18; nb. 22; (2007); p. 2719 - 2726, View in Reaxys
1e
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys
1 (Table 3, run 4)
Li, Hao; Wang, Jian; Zu, Liansuo; Wang, Wei; Tetrahedron Letters; vol. 47; nb. 15; (2006); p. 2585 - 2589, View in Reaxys
VIa
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys
MNS
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 - 1389, View in Reaxys
1i
Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys
1h
Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys; Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys
1g
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys
2d
Batra, Sanjay; Sabnis, Yogesh A.; Rosenthal, Philip J.; Avery, Mitchell A.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 10; (2003); p. 2293 - 2299, View in Reaxys; Okino, Tomotaka; Hoashi, Yasutaka; Furukawa, Tomihiro; Xu, Xuenong; Takemoto, Yoshiji; Journal of the American Chemical Society; vol. 127; nb. 1; (2005); p. 119 - 125, View in Reaxys
2n
Evans, David A.; Seidel, Daniel; Journal of the American Chemical Society; vol. 127; nb. 28; (2005); p. 9958 - 9959, View in Reaxys
8
McNulty, James; Larichev, Vladimir; Pandey, Siyaram; Bioorganic and Medicinal Chemistry Letters; vol. 15; nb. 23; (2005); p. 5315 - 5318, View in Reaxys
3, Tab. 1, entry 5
Nyerges, Miklos; Somfai, Barbara; Toth, Judit; Toke, Laszlo; Dancso, Andras; Blasko, Gabor; Synthesis; nb. 12; (2005); p. 2039 - 2045; Art.No: P00405SS, View in Reaxys
4e
Nyerges, Miklos; Dancso, Andras; Bitter, Istvan; Blasko, Gabor; Toke, Laszlo; Tetrahedron Letters; vol. 46; nb. 40; (2005); p. 6927 - 6930, View in Reaxys
educt, table 2/ entry 7
Arstad, Erik; Barrett, Anthony G. M.; Tedeschi, Livio; Tetrahedron Letters; vol. 44; nb. 13; (2003); p. 2703 - 2707, View in Reaxys
substr., Tab.1, en- Lee, Seung Hwan; Park, Yong June; Yoon, Cheol Min; Organic and Biomolecular Chemistry; vol. 1; nb. 7; try 8 (2003); p. 1099 - 1100, View in Reaxys 20
Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys
3f
Liu, Ju-Tsung; Yao, Ching-Fa; Tetrahedron Letters; vol. 42; nb. 35; (2001); p. 6147 - 6150, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
3/249
2016-07-13 00:31:19
16c
El-Ahl, Abdel Aziz S.; El Bialy, Serry A.A.; Ismail, Mohamed A.; Heterocycles; vol. 55; nb. 7; (2001); p. 1315 - 1321, View in Reaxys
2b
Fierro; Rezende; Sepulveda-Boza; Reyes-Parada; Cassels; Journal of Chemical Research - Part S; nb. 7; (2001); p. 294 - 296, View in Reaxys
4
Banwell; Edwards; Jolliffe; Kemmler; Journal of the Chemical Society. Perkin Transactions 1; nb. 12; (2001); p. 1345 - 1348, View in Reaxys
2g
Enders, Dieter; Teschner, Pascal; Raabe, Gerhard; Synlett; nb. 5; (2000); p. 637 - 640, View in Reaxys; Enders, Dieter; Teschner, Pascal; Raabe, Gerhard; Runsink, Jan; European Journal of Organic Chemistry; nb. 23; (2001); p. 4463 - 4477, View in Reaxys
1j
Yadav; Subba Reddy; Srinivas; Ramalingam; Synlett; nb. 10; (2000); p. 1447 - 1449, View in Reaxys
25
Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys
Patent-Specific Data (1) Prophetic ComLocation in Patent References pound prophetic product
Page/page column 9; 61
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys
Melting Point (18) 1 of 18
Melting Point [°C]
163
Location
supporting information
Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys 2 of 18
Melting Point [°C]
139
Solvent (Melting Point)
chloroform
Location
supporting information
Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys 3 of 18
Melting Point [°C]
148
Location
supporting information
Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys 4 of 18
Melting Point [°C]
158 - 160
Solvent (Melting Point)
ethyl acetate; n-heptane
Location
supporting information
Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys 5 of 18
Melting Point [°C]
159 - 160
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 6 of 18
Melting Point [°C]
140 - 141
Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys 7 of 18
Melting Point [°C]
165 - 167
Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 1528, View in Reaxys 8 of 18
Melting Point [°C]
164 - 165
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
4/249
2016-07-13 00:31:19
9 of 18
Melting Point [°C]
166
Solvent (Melting Point)
nitromethane; CHCl3
Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys 10 of 18
Melting Point [°C]
150
Solvent (Melting Point)
acetone
Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys 11 of 18
Melting Point [°C]
166 - 168
Solvent (Melting Point)
CHCl3
Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys 12 of 18
Melting Point [°C]
132
Solvent (Melting Point)
ethanol
Rao; Ravishankar; Trivedi; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 207 - 214, View in Reaxys 13 of 18
Melting Point [°C]
161 - 164
Solvent (Melting Point)
ethanol
Bryce; Gardiner; Tetrahedron; vol. 44; nb. 2; (1988); p. 599 - 612, View in Reaxys 14 of 18
Melting Point [°C]
158
Solvent (Melting Point)
ethanol
Bourguignon, Jean; Le Nard, Gilles; Queguiner, Guy; Canadian Journal of Chemistry; vol. 63; (1985); p. 2354 2361, View in Reaxys 15 of 18
Melting Point [°C]
161 - 162
McDonald; Martin; Tetrahedron Letters; (1977); p. 1317,1318, View in Reaxys 16 of 18
Melting Point [°C]
158
Dore,J.-C. et al.; Chimica Therapeutica; vol. 6; (1971); p. 167 - 185, View in Reaxys 17 of 18
Melting Point [°C]
162 - 163
Gensler; Samour; Journal of the American Chemical Society; vol. 73; (1951); p. 5555, View in Reaxys 18 of 18
Melting Point [°C]
161.5
Solvent (Melting Point)
ethanol
Lange; Hambourger; Journal of the American Chemical Society; vol. 53; (1931); p. 3865, View in Reaxys Density (1) 1 of 1
Density [g·cm-3]
1.58
Type (Density)
crystallographic
Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys Chromatographic Data (1) Chromatographic Location data TLC (Thin layer chromatography)
supporting information
References Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys
Crystal Phase (2) Description (Crys- Comment (Crystal References tal Phase) Phase) Crystal structure determination
α=90 grad, β=92.4 grad, χ=90 grad, a=3.75 Angstroem, b=20.25
Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
5/249
2016-07-13 00:31:19
Angstroem, c=10.73 Angstroem, n=4.; Temperature: 273 C. Method of determination: Single Crystal X-ray Diffraction Interplanar spacing
Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys
Crystal Property Description (5) Colour & Other Location Properties
References
yellow-orange
supporting information
Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys
yellow
supporting information
Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys; Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys
yellow
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys
yellow
Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 - 1528, View in Reaxys; Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys
Gelb
Gensler; Samour; Journal of the American Chemical Society; vol. 73; (1951); p. 5555, View in Reaxys; Lange; Hambourger; Journal of the American Chemical Society; vol. 53; (1931); p. 3865, View in Reaxys
Crystal System (1) Crystal System References monoclinic
Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys
Electrochemical Characteristics (2) 1 of 2
Description (Electrochemical Characteristics)
reduction potential
Solvent (Electrochemical Characteristics)
aq. phosphate buffer
pH-Value (Electrochemi- 7.3 cal Characteristics) Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 2 of 2
Description (Electrochemical Characteristics)
polarographic current/voltage curve
Ried; Wilk; Justus Liebigs Annalen der Chemie; vol. 590; (1954); p. 91,109, View in Reaxys Interatomic Distances and Angles (1) Description References Interatomic distances and angles Space Group (1) Space Group 14
Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys
References Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
6/249
2016-07-13 00:31:19
NMR Spectroscopy (24) 1 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys 2 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys 3 of 24
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys 4 of 24
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
101
Location
supporting information
Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys 5 of 24
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- chloroform-d1 scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
7/249
2016-07-13 00:31:19
Frequency (NMR Spectroscopy) [MHz]
300
Location
supporting information
Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys 6 of 24
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Location
supporting information
Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys; Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys 7 of 24
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Location
supporting information
Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys 8 of 24
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
500
Location
supporting information
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 9 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Location
supporting information
Burkhard, Johannes A.; Tchitchanov, Boris H.; Carreira, Erick M.; Angewandte Chemie - International Edition; vol. 50; nb. 23; (2011); p. 5379 - 5382, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
8/249
2016-07-13 00:31:19
10 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys; Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys 11 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- acetone-d6 scopy) Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys 12 of 24
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- acetone-d6 scopy) Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys 13 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 1528, View in Reaxys 14 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]
300.13
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 15 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]
75.47
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
9/249
2016-07-13 00:31:19
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 16 of 24
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]
300.13
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 17 of 24
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys 18 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys 19 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
75.5
Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys 20 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Rao; Ravishankar; Trivedi; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 207 - 214, View in Reaxys; Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 16, View in Reaxys 21 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
10/249
2016-07-13 00:31:19
Solvents (NMR Spectro- CDCl3 scopy) Marsden, Richard; MacLean, David B.; Canadian Journal of Chemistry; vol. 62; (1984); p. 1392 - 1399, View in Reaxys; Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys 22 of 24
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys 23 of 24
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Marsden, Richard; MacLean, David B.; Canadian Journal of Chemistry; vol. 62; (1984); p. 1392 - 1399, View in Reaxys; Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys 24 of 24
Description (NMR Spec- Spin-spin coupling constants troscopy) Comment (NMR Spectroscopy)
1H-1H
Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys IR Spectroscopy (11) 1 of 11
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
neat (no solvent, solid phase)
Location
supporting information
Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys 2 of 11
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 3 of 11
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 1528, View in Reaxys 4 of 11
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
nujol
Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys 5 of 11
Description (IR Spectroscopy)
Bands
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
11/249
2016-07-13 00:31:19
Solvent (IR Spectroscopy)
KBr
Comment (IR Spectroscopy)
1629 - 817 cm**(-1)
Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys 6 of 11
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Comment (IR Spectroscopy)
2925 cm**(-1)
Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys 7 of 11
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
nitrobenzene
Comment (IR Spectroscopy)
2980 - 2900 cm**(-1)
Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys 8 of 11
Description (IR Spectroscopy)
Bands
Comment (IR Spectroscopy)
1550 - 1370 cm**(-1)
Rao; Ravishankar; Trivedi; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 207 - 214, View in Reaxys 9 of 11
Description (IR Spectroscopy)
Bands
Comment (IR Spectroscopy)
1500 - 1370 cm**(-1)
Nachtsheim, Corina M.; Frahm, August W.; Archiv der Pharmazie (Weinheim, Germany); vol. 322; (1989); p. 187 - 197, View in Reaxys 10 of 11
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
nujol
Comment (IR Spectroscopy)
1500 - 900 cm**(-1); Wahrscheinlich aus Piperonal und Nitromethan hergestelltes Praep..
Briggs et al.; Analytical Chemistry; vol. 29; (1957); p. 904,905, View in Reaxys 11 of 11
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
CHCl3
Comment (IR Spectroscopy)
1500 - 900 cm**(-1); Wahrscheinlich aus Piperonal und Nitromethan hergestelltes Praep..
Briggs et al.; Analytical Chemistry; vol. 29; (1957); p. 904,905, View in Reaxys Mass Spectrometry (5) Description (Mass Location Spectrometry) high resolution mass spectrometry (HRMS); elec-
supporting information
References Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 - 3018,11, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
12/249
2016-07-13 00:31:19
trospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum gas chromatogra- supporting inforphy mass specmation trometry (GCMS); spectrum
Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys
electron impact (EI); spectrum
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys
spectrum; electron impact (EI)
Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys; Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys
spectrum
Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 1432, View in Reaxys
UV/VIS Spectroscopy (1) 1 of 1
Description (UV/VIS Spectroscopy)
Absorption maxima
Solvent (UV/VIS Spectroscopy)
methanol
Absorption Maxima (UV/ 257; 363 VIS) [nm] Kamlet; Glover; Journal of the American Chemical Society; vol. 77; (1955); p. 5696, View in Reaxys Pharmacological Data (91) 1 of 91
Comment (Pharmacological Data)
Bioactivities present
Seebach,D. et al.; Chemische Berichte; vol. 108; (1975); p. 1924 - 1945, View in Reaxys; Ehrig,V.; Seebach,D.; Chemische Berichte; vol. 108; (1975); p. 1961 - 1973, View in Reaxys; Patent; Abbott Laboratories; US5767144; (1998); (A1) English, View in Reaxys; Dore,J.-C. et al.; Chimica Therapeutica; vol. 6; (1971); p. 167 - 185, View in Reaxys; Patent; Abbott Laboratories; US5622971; (1997); (A1) English, View in Reaxys; Patent; Kanto Kagaku Kabushiki Kaisha; EP1512678; (2005); (A1) English, View in Reaxys; Patent; ABBOTT LABORATORIES; WO2006/34094; (2006); (A1) English, View in Reaxys; Patent; ABBOTT LABORATORIES; WO2006/34234; (2006); (A1) English, View in Reaxys; Briggs et al.; Analytical Chemistry; vol. 29; (1957); p. 904,905, View in Reaxys; Gensler; Samour; Journal of the American Chemical Society; vol. 73; (1951); p. 5555, View in Reaxys; Kindler; Brandt; Archiv der Pharmazie (Weinheim, Germany); vol. 273; (1935); p. 478,482, View in Reaxys; Reichert; Koch; Archiv der Pharmazie (Weinheim, Germany); vol. 273; (1935); p. 265,271, View in Reaxys; Kamlet; Glover; Journal of the American Chemical Society; vol. 77; (1955); p. 5696, View in Reaxys; Lange; Hambourger; Journal of the American Chemical Society; vol. 53; (1931); p. 3865, View in Reaxys; Kamlet; Journal of the American Chemical Society; vol. 77; (1955); p. 4896, View in Reaxys; Erne; Ramirez; Helvetica Chimica Acta; vol. 33; (1950); p. 912,915, View in Reaxys; Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys; Kondo et al.; Itsuu Kenkyusho Nempo; nb. 2; (1951); p. 11; dtsch. Ref. S. 48; Chem.Abstr.; (1953); p. 7519, View in Reaxys; Schales; Chemische Berichte; vol. 68; (1935); p. 1579,1581, View in Reaxys; Musante; Gazzetta Chimica Italiana; vol. 67; (1937); p. 579,586, View in Reaxys 2 of 91
Comment (Pharmacological Data)
Bioactivities present
Ried; Wilk; Justus Liebigs Annalen der Chemie; vol. 590; (1954); p. 91,109, View in Reaxys; Kondo et al.; Itsuu Kenkyusho Nempo; nb. 4; (1953); p. 20,29;engl.Ref.S.70; Chem.Abstr.; (1956); p. 11982, View in Reaxys; Benington et al.; Journal of Organic Chemistry; vol. 23; (1958); p. 1979,1980, View in Reaxys; McDonald; Martin; Tetrahedron Letters; (1977); p. 1317,1318, View in Reaxys; Li, Yu-Gui; Liu, Yun-Shan; Miao, Fang-Ming; Liu, XiaoLan; Cao, Jin-Hong; et al.; Phosphorus, Sulfur and Silicon and the Related Elements; vol. 47; nb. 1 + 2; (1990); p. 229 - 242, View in Reaxys; Ishibashi, Hiroyuki; Okano, Masahiko; Tamaki, Hiroshi; Maruyama, Kazumi; Yakura, Takayuki; Ikeda, Masazumi; Journal of the Chemical Society, Chemical Communications; nb. 20; (1990); p. 1436 - 1437, View in Reaxys; Rao; Ravishankar; Trivedi; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 207 - 214, View in Reaxys; Gupta; Seth; Bhaduri; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 235 - 238, View in Reaxys; Padwa, Albert; Chen, Yon-Yih; Tetrahedron Letters; vol. 24; nb. 33; (1983); p. 3447 - 3450, View in Reaxys; Karmarkar, Pradeep G.; Thakar, Alka A.; Wadia, Murzban S.; Tetrahedron Letters; vol. 22; nb. 24; (1981); p. 2301 - 2302, View in Reaxys; Bhattacharjya, Anup; Mukhopadhyay, Ranjan; Pakrashi, Satyesh C.;
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
13/249
2016-07-13 00:31:19
Synthesis; nb. 9; (1985); p. 886 - 887, View in Reaxys; Deshpande, S. R.; Mathur, H. H.; Trivedi, G. K.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 2; (1983); p. 166 167, View in Reaxys; Padwa, Albert; Chen, Yon-Yih; Chiacchio, Ugo; Dent, William; Tetrahedron; vol. 41; nb. 17; (1985); p. 3529 - 3535, View in Reaxys; Bryce; Gardiner; Tetrahedron; vol. 44; nb. 2; (1988); p. 599 - 612, View in Reaxys; Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys; Bryce; Gardiner; Hursthouse; Short; Tetrahedron Letters; vol. 28; nb. 5; (1987); p. 577 - 580, View in Reaxys; Ashwell, Mark A.; Jackson, Richard F. W.; Synthesis; nb. 3; (1988); p. 229 - 231, View in Reaxys; Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 320, View in Reaxys; Marsden, Richard; MacLean, David B.; Canadian Journal of Chemistry; vol. 62; (1984); p. 1392 - 1399, View in Reaxys; Bourguignon, Jean; Le Nard, Gilles; Queguiner, Guy; Canadian Journal of Chemistry; vol. 63; (1985); p. 2354 - 2361, View in Reaxys 3 of 91
Comment (Pharmacological Data)
Bioactivities present
Blarer, Stefan J.; Seebach, Dieter; Chemische Berichte; vol. 116; nb. 9; (1983); p. 3086 - 3096, View in Reaxys; Schoellkopf, Ulrich; Kuehnle, Wulf; Egert, Ernst; Dyrbusch, Michael; Angewandte Chemie; vol. 99; nb. 5; (1987); p. 480 - 482, View in Reaxys; Enders; Meyer; Raabe; Synthesis; nb. 12; (1992); p. 1242 - 1244, View in Reaxys; Seebach, Dieter; Schaefer, Harald; Schmidt, Beat; Schreiber, Martin; Angewandte Chemie; vol. 104; nb. 12; (1992); p. 1680 - 1681, View in Reaxys; Ikeda; Okano; Kosaka; Kido; Ishibashi; Chemical and Pharmaceutical Bulletin; vol. 41; nb. 2; (1993); p. 276 - 281, View in Reaxys; Hill, Richard K.; Sawada, Seiji; Bock, Mark G.; Greene, Joseph R.; Heterocycles; vol. 25; (1987); p. 515 - 520, View in Reaxys; Blarer, Stefan J.; Schweizer, W. Bernd; Seebach, Dieter; Helvetica Chimica Acta; vol. 65; nb. 5; (1982); p. 1637 - 1654, View in Reaxys; Nachtsheim, Corina M.; Frahm, August W.; Archiv der Pharmazie (Weinheim, Germany); vol. 322; (1989); p. 187 - 197, View in Reaxys; Seebach, Dieter; Golinski, Jerzy; Helvetica Chimica Acta; vol. 64; nb. 5; (1981); p. 1413 - 1423, View in Reaxys; Ghera, Eugene; Yechezkel, Tamar; Hassner, Alfred; Journal of Organic Chemistry; vol. 58; nb. 24; (1993); p. 6716 - 6724, View in Reaxys; Nyerges, Miklos; Bitter, Istvan; Kadas, Istvan; Toth, Gabor; Toeke, Laszlo; Tetrahedron Letters; vol. 35; nb. 25; (1994); p. 4413 - 4414, View in Reaxys; Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys; Hassner; Rai; Dehaen; Synthetic Communications; vol. 24; nb. 12; (1994); p. 1669 - 1682, View in Reaxys; Nyerges, Miklos; Balazs, Laszlo; Kadas, Istvan; Bitter, Istvan; Koevesdi, Istvan; Toeke, Laszlo; Tetrahedron; vol. 51; nb. 24; (1995); p. 6783 - 6788, View in Reaxys; Torres; Cassels; Rezende; Synthetic Communications; vol. 25; nb. 8; (1995); p. 1239 - 1247, View in Reaxys; Nyerges, Miklos; Rudas, Monika; Toth, Gabor; Herenyi, Bulcsu; Kadas, Istvan; et al.; Tetrahedron; vol. 51; nb. 48; (1995); p. 13321 - 13330, View in Reaxys; Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys; Laso, Nieves M.; Quiclet-Sire, Beatrice; Zard, Samir Z.; Tetrahedron Letters; vol. 37; nb. 10; (1996); p. 1605 - 1608, View in Reaxys; Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys; Winn, Martin; Von Geldern, Thomas W.; Opgenorth, Terry J.; Jae, Hwan-Soo; Tasker, Andrew S.; Boyd, Steven A.; Kester, Jeffrey A.; Mantei, Robert A.; Bal, Radhika; Sorensen, Bryan K.; Wu-Wong, Jinshyun R.; Chiou, William J.; Dixon, Douglas B.; Novosad, Eugene I.; Hernandez, Lisa; Marsh, Kennan C.; Journal of Medicinal Chemistry; vol. 39; nb. 5; (1996); p. 1039 1048, View in Reaxys 4 of 91
Comment (Pharmacological Data)
Bioactivities present
Nyerges, Miklos; Bitter, Istvan; Kadas, Istvan; Toth, Gabor; Toeke, Laszlo; Tetrahedron; vol. 51; nb. 42; (1995); p. 11489 - 11502, View in Reaxys; Jae, Hwan-Soo; Winn, Martin; Dixon, Douglas B.; Marsh, Kennan C.; Nguyen, Bach; Opgenorth, Terry J.; Von Geldern, Thomas W.; Journal of Medicinal Chemistry; vol. 40; nb. 20; (1997); p. 3217 - 3227, View in Reaxys; McNulty, James; Mo, Ruowei; Chemical Communications; nb. 8; (1998); p. 933 934, View in Reaxys; McNulty, James; Steere, Jennifer A.; Wolf, Sonja; Tetrahedron Letters; vol. 39; nb. 44; (1998); p. 8013 - 8016, View in Reaxys; Liu, Gang; Henry Jr., Kenneth J.; Szczepankiewics, Bruce G.; Winn, Martin; Kozmina, Natasha S.; Boyd, Steven A.; Wasicak, James; Von Geldern, Thomas W.; Wu-Wong, Jinshyun R.; Chiou, William J.; Dixon, Douglas B.; Nguyen, Bach; Marsh, Kennan C.; Opgenorth, Terry J.; Journal of Medicinal Chemistry; vol. 41; nb. 17; (1998); p. 3261 - 3275, View in Reaxys; Hintermann, Tobias; Seebach, Dieter; Helvetica Chimica Acta; vol. 81; nb. 11; (1998); p. 2093 - 2126, View in Reaxys; Boyd, Steven A.; Mantei, Robert A.; Tasker, Andrew S.; Liu, Gang; Sorensen, Bryan K.; Henry Jr., Kenneth J.; Von Geldern, Thomas W.; Winn, Martin; Wu-Wong, Jinshyun R.; Chiou, William J.; Dixon, Douglas B.; Hutchins, Charles W.; Marsh, Kennan C.; Nguyen, Bach; Opgenorth, Terry J.; Bioorganic and Medicinal Chemistry; vol. 7; nb. 6; (1999); p. 991 - 1002, View in Reaxys; Enders, Dieter; Teschner, Pascal; Raabe, Gerhard; Synlett; nb. 5; (2000); p. 637 - 640, View in Reaxys; Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys; Yadav; Subba Reddy; Srinivas; Ramalingam; Synlett; nb. 10; (2000); p. 1447 - 1449, View in Reaxys; McNulty, James; Mao, Justin; Gibe, Romelo; Mo, Ruowei; Wolf, Sonja; Pettit, George R.; Herald, Delbert L.; Boyd, Michael R.; Bioorganic and Medicinal Chemistry Letters; vol. 11; nb. 2; (2001); p. 169 - 172, View in Reaxys; Banwell; Edwards; Jolliffe; Kemmler; Journal of the Chemical Society. Perkin Transactions 1; nb. 12; (2001); p. 1345 - 1348, View in Reaxys; Liu, Ju-Tsung; Yao, Ching-Fa; Tetrahedron Letters; vol. 42; nb. 35; (2001); p. 6147 - 6150, View in Reaxys; El-Ahl, Abdel Aziz S.; El Bialy, Serry A.A.; Ismail, Mohamed A.; Heterocycles; vol. 55; nb. 7; (2001); p. 1315 - 1321, View in Reaxys; Enders, Dieter; Teschner, Pascal; Raabe, Gerhard; Runsink, Jan; European Journal of Organic Chemistry; nb. 23; (2001); p. 4463 - 4477, View in Reaxys; Fierro; Rezende; SepulvedaBoza; Reyes-Parada; Cassels; Journal of Chemical Research - Part S; nb. 7; (2001); p. 294 - 296, View in Reaxys; Jae; Winn; Von Geldern; Sorensen; Chiou; Nguyen; Marsh; Opgenorth; Journal of Medicinal Chemistry; vol. 44;
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
14/249
2016-07-13 00:31:19
nb. 23; (2001); p. 3978 - 3984, View in Reaxys; Das, Jaya Prakash; Sinha, Pradipta; Roy, Sujit; Organic Letters; vol. 4; nb. 18; (2002); p. 3055 - 3058, View in Reaxys; Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys; Lee, Seung Hwan; Park, Yong June; Yoon, Cheol Min; Organic and Biomolecular Chemistry; vol. 1; nb. 7; (2003); p. 1099 - 1100, View in Reaxys 5 of 91
Comment (Pharmacological Data)
Bioactivities present
Arstad, Erik; Barrett, Anthony G. M.; Tedeschi, Livio; Tetrahedron Letters; vol. 44; nb. 13; (2003); p. 2703 - 2707, View in Reaxys; Garcia-Torres, Alejandro; Cruz-Almanza, Rymundo; Miranda, Luis D.; Tetrahedron Letters; vol. 45; nb. 10; (2004); p. 2085 - 2088, View in Reaxys; Rastogi, Namrata; Namboothiri, Irishi N. N.; Cojocaru, Miriam; Tetrahedron Letters; vol. 45; nb. 24; (2004); p. 4745 - 4748, View in Reaxys; Batra, Sanjay; Sabnis, Yogesh A.; Rosenthal, Philip J.; Avery, Mitchell A.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 10; (2003); p. 2293 2299, View in Reaxys; Watanabe, Masahito; Ikagawa, Ayako; Wang, Hui; Murata, Kunihiko; Ikariya, Takao; Journal of the American Chemical Society; vol. 126; nb. 36; (2004); p. 11148 - 11149, View in Reaxys; Okino, Tomotaka; Hoashi, Yasutaka; Furukawa, Tomihiro; Xu, Xuenong; Takemoto, Yoshiji; Journal of the American Chemical Society; vol. 127; nb. 1; (2005); p. 119 - 125, View in Reaxys; Evans, David A.; Seidel, Daniel; Journal of the American Chemical Society; vol. 127; nb. 28; (2005); p. 9958 - 9959, View in Reaxys; McNulty, James; Larichev, Vladimir; Pandey, Siyaram; Bioorganic and Medicinal Chemistry Letters; vol. 15; nb. 23; (2005); p. 5315 5318, View in Reaxys; Nyerges, Miklos; Somfai, Barbara; Toth, Judit; Toke, Laszlo; Dancso, Andras; Blasko, Gabor; Synthesis; nb. 12; (2005); p. 2039 - 2045; Art.No: P00405SS, View in Reaxys; Nyerges, Miklos; Dancso, Andras; Bitter, Istvan; Blasko, Gabor; Toke, Laszlo; Tetrahedron Letters; vol. 46; nb. 40; (2005); p. 6927 - 6930, View in Reaxys; Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys; Kusurkar, Radhika S.; Alkobati, Nabil A. H.; Gokule, Anita S.; Chaudhari, Purnima M.; Waghchaure, Prasad B.; Synthetic Communications; vol. 36; nb. 8; (2006); p. 1075 - 1081, View in Reaxys; Li, Hao; Wang, Jian; Zu, Liansuo; Wang, Wei; Tetrahedron Letters; vol. 47; nb. 15; (2006); p. 2585 - 2589, View in Reaxys; Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 - 1528, View in Reaxys; Cao, Chun-Li; Ye, Meng-Chun; Sun, Xiu-Li; Tang, Yong; Organic Letters; vol. 8; nb. 14; (2006); p. 2901 - 2904, View in Reaxys; Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 4088, View in Reaxys; Deng, Xiaohu; Mani, Neelakandha S.; Organic Letters; vol. 8; nb. 16; (2006); p. 3505 3508, View in Reaxys; Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 - 1389, View in Reaxys; Luo, Sanzhong; Mi, Xueling; Zhang, Long; Liu, Song; Xu, Hui; Cheng, Jin-Pei; Angewandte Chemie - International Edition; vol. 45; nb. 19; (2006); p. 3093 - 3097, View in Reaxys; Trost, Barry M.; Hisaindee, Soleiman; Organic Letters; vol. 8; nb. 26; (2006); p. 6003 - 6005, View in Reaxys 6 of 91
Comment (Pharmacological Data)
Bioactivities present
Yan, Ze-Yi; Niu, Yan-Ning; Wei, Hai-Long; Wu, Lu-Yong; Zhao, Ya-Bin; Liang, Yong-Min; Tetrahedron Asymmetry; vol. 17; nb. 23; (2006); p. 3288 - 3293, View in Reaxys; Luo, Sanzhong; Xu, Hui; Mi, Xueling; Li, Jiuyuan; Zheng, Xiaoxi; Cheng, Jin-Pei; Journal of Organic Chemistry; vol. 71; nb. 24; (2006); p. 9244 - 9247, View in Reaxys; Vishnumaya; Singh, Vinod K.; Organic Letters; vol. 9; nb. 6; (2007); p. 1117 - 1119, View in Reaxys; Muruganantham; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 9; nb. 6; (2007); p. 1125 - 1128, View in Reaxys; Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys; Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys; Toth, Judit; Varadi, Linda; Dancso, Andras; Blasko, Gabor; Toke, Laszlo; Nyerges, Miklos; Synlett; nb. 8; (2007); p. 1259 - 1263, View in Reaxys; Xu, Rong; Lever, John R.; Lever, Susan Z.; Bioorganic and Medicinal Chemistry Letters; vol. 17; nb. 9; (2007); p. 2594 - 2597, View in Reaxys; Wang, Jian; Li, Hao; Lou, Bihshow; Zu, Liansuo; Guo, Hua; Wang, Wei; Chemistry - A European Journal; vol. 12; nb. 16; (2006); p. 4321 - 4332, View in Reaxys; Wang, Wei-Ya; Hsieh, Pei-Wen; Wu, YangChang; Wu, Chin-Chung; Biochemical Pharmacology; vol. 74; nb. 4; (2007); p. 601 - 611, View in Reaxys; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys; Gao, Shijay; Tu, Zhijay; Kuo, Chun-Wei; Liu, Ju-Tsung; Chu, Cheng-Ming; Yao, Ching-Fa; Organic and Biomolecular Chemistry; vol. 4; nb. 15; (2006); p. 2851 - 2857, View in Reaxys; Hayashi, Yujiro; Okano, Tsubasa; Aratake, Seiji; Hazelard, Damien; Angewandte Chemie - International Edition; vol. 46; nb. 26; (2007); p. 4922 - 4925, View in Reaxys; Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys; Ranu, Brindaban C.; Mandal, Tanmay; Australian Journal of Chemistry; vol. 60; nb. 3; (2007); p. 223 - 227, View in Reaxys; Wu, Lu-Yong; Yan, Ze-Yi; Xie, Yong-Xin; Niu, Yan-Ning; Liang, Yong-Min; Tetrahedron Asymmetry; vol. 18; nb. 17; (2007); p. 2086 - 2090, View in Reaxys; Alza, Esther; Cambeiro, Xacobe C.; Jimenez, Ciril; Pericas, Miquel A.; Organic Letters; vol. 9; nb. 19; (2007); p. 3717 - 3720, View in Reaxys; Luo, Sanzhong; Zhang, Long; Mi, Xueling; Qiao, Yupu; Cheng, Jin-Pei; Journal of Organic Chemistry; vol. 72; nb. 24; (2007); p. 9350 - 9352, View in Reaxys; Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys; Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
15/249
2016-07-13 00:31:19
7 of 91
Comment (Pharmacological Data)
Bioactivities present
Evans, David A.; Mito, Shizue; Seidel, Daniel; Journal of the American Chemical Society; vol. 129; nb. 37; (2007); p. 11583 - 11592, View in Reaxys; Wang, Jian; Heikkinen, Lora D.; Li, Hao; Zu, Liansuo; Jiang, Wei; Xie, Hexin; Wang, Wei; Advanced Synthesis and Catalysis; vol. 349; nb. 7; (2007); p. 1052 - 1056, View in Reaxys; Patent; Abbott Laboratories; US6124341; (2000); (A1) English, View in Reaxys; Patent; Abbott Laboratories; US6162927; (2000); (A1) English, View in Reaxys; Luo, Sanzhong; Li, Jiuyuan; Zhang, Long; Xu, Hui; Cheng, Jin-Pei; Chemistry - A European Journal; vol. 14; nb. 4; (2008); p. 1273 - 1281, View in Reaxys; Kusurkar, Radhika S.; Alkobati, Nabil A.H.; Gokule, Anita S.; Puranik, Vedavati G.; Tetrahedron; vol. 64; nb. 8; (2008); p. 1654 1662, View in Reaxys; Rai, Vishal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Tetrahedron Asymmetry; vol. 18; nb. 22; (2007); p. 2719 - 2726, View in Reaxys; Xiong, Yan; Wen, Yuehong; Wang, Fei; Gao, Bo; Liu, Xiaohua; Huang, Xiao; Feng, Xiaoming; Advanced Synthesis and Catalysis; vol. 349; nb. 13; (2007); p. 2156 - 2166, View in Reaxys; Patent; ABBOTT LABORATORIES; US2008/132710; (2008); (A1) English, View in Reaxys; Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys; Li, Pinhua; Wang, Lei; Zhang, Yicheng; Wang, Guanwu; Tetrahedron; vol. 64; nb. 32; (2008); p. 7633 - 7638, View in Reaxys; Puleo, Gian Luigi; Iuliano, Anna; Tetrahedron Asymmetry; vol. 19; nb. 17; (2008); p. 2045 - 2050, View in Reaxys; Guo, Chang; Xue, Meng-Xia; Zhu, Ming-Kui; Gong, Liu-Zhu; Angewandte Chemie - International Edition; vol. 47; nb. 18; (2008); p. 3414 - 3417, View in Reaxys; Belot, Sebastien; Sulzer-Mosse, Sarah; Kehrli, Stefan; Alexakis, Alexandre; Chemical Communications; nb. 39; (2008); p. 4694 - 4696, View in Reaxys; Li, Pinhua; Wang, Lei; Wang, Min; Zhang, Yicheng; European Journal of Organic Chemistry; nb. 7; (2008); p. 1157 - 1160, View in Reaxys; Hong, Bor-Cherng; Nimje, Roshan Y.; Wu, Ming-Fun; Sadani, Amit A.; European Journal of Organic Chemistry; nb. 8; (2008); p. 1449 - 1457, View in Reaxys; Miao, Tao; Wang, Lei; Li, Pinhua; Yan, Jincan; Synthesis; nb. 23; (2008); p. 3828 - 3834; Art.No: F16708SS, View in Reaxys; Li, Hao; Zhang, Shilei; Yu, Chenguang; Song, Xixi; Wang, Wei; Chemical Communications; nb. 16; (2009); p. 2136 - 2138, View in Reaxys; Tan, Bin; Zeng, Xiaofei; Lu, Yunpeng; Chua, Pei Juan; Zhong, Guofu; Organic Letters; vol. 11; nb. 9; (2009); p. 1927 - 1930, View in Reaxys; Wang, Shi-Wen; Chen, Jun; Chen, Gui-Hua; Peng, Yun-Gui; Synlett; nb. 9; (2009); p. 1457 - 1462, View in Reaxys 8 of 91
Comment (Pharmacological Data)
Bioactivities present
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys; Li, Hao; Zu, Liansuo; Xie, Hexin; Wang, Wei; Synthesis; nb. 9; (2009); p. 1525 - 1530; Art.No: C00309SS, View in Reaxys; Zhu, Ye; Malerich, Jeremiah P.; Rawal, Viresh H.; Angewandte Chemie - International Edition; vol. 49; nb. 1; (2010); p. 153 - 156, View in Reaxys; Arai, Takayoshi; Mishiro, Asami; Yokoyama, Naota; Suzuki, Kuniko; Sato, Hiroyasu; Journal of the American Chemical Society; vol. 132; nb. 15; (2010); p. 5338 - 5339, View in Reaxys; Nakamura, Ayako; Lectard, Sylvain; Shimizu, Ryo; Hamashima, Yoshitaka; Sodeoka, Mikiko; Tetrahedron Asymmetry; vol. 21; nb. 13-14; (2010); p. 1682 - 1687, View in Reaxys; Patent; Dziki, Walter; Lu, Ziqi; Rasmussen, Michael W.; Wardrop, Jaqueline; Zhane, Geoff G.Z.; Linton, Cathie L.; US2006/63825; (2006); (A1) English, View in Reaxys; Patent; ABBOTT LABORATORIES; WO2006/34085; (2006); (A1) English, View in Reaxys; Shanbhag, Pramod; Nareddy, Pradeep R.; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 8; nb. 21; (2010); p. 4867 - 4873, View in Reaxys; Wang, Lei; Liu, Jie; Miao, Tao; Zhou, Wei; Li, Pinhua; Ren, Kai; Zhang, Xiuli; Advanced Synthesis and Catalysis; vol. 352; nb. 14-15; (2010); p. 2571 - 2578, View in Reaxys; Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys; Bako, Peter; Rapi, Zsolt; Keglevich, Gyoergy; Szabo, Tamas; Soti, Peter L.; Vigh, Tamas; Grn, Alajos; Holczbauer, Tamas; Tetrahedron Letters; vol. 52; nb. 13; (2011); p. 1473 - 1476, View in Reaxys; Patora-Komisarska, Krystyna; Benohoud, Meryem; Ishikawa, Hayato; Seebach, Dieter; Hayashi, Yujiro; Helvetica Chimica Acta; vol. 94; nb. 5; (2011); p. 719 - 745, View in Reaxys; Burkhard, Johannes A.; Tchitchanov, Boris H.; Carreira, Erick M.; Angewandte Chemie - International Edition; vol. 50; nb. 23; (2011); p. 5379 - 5382, View in Reaxys; Trost, Barry M.; Bringley, Dustin A.; Seng, Pamela S.; Organic Letters; vol. 14; nb. 1; (2012); p. 234 - 237, View in Reaxys; Li, Sheng-Nan; Xu, Lan-Ting; Chenb, Yue; Lia, JuLian; He, Ling; Letters in Organic Chemistry; vol. 8; nb. 6; (2011); p. 416 - 422, View in Reaxys; Enders, Dieter; Urbanietz, Gregor; Cassens-Sasse, Elisa; Keess, Sebastian; Raabe, Gerhard; Advanced Synthesis and Catalysis; vol. 354; nb. 8; (2012); p. 1481 - 1488, View in Reaxys; Trost, Barry M.; Hirano, Keiichi; Angewandte Chemie - International Edition; vol. 51; nb. 26; (2012); p. 6480 - 6483, View in Reaxys; Zanwar, Manoj R.; Raihan, Mustafa J.; Gawande, Sachin D.; Kavala, Veerababurao; Janreddy, Donala; Kuo, Chun-Wei; Ambre, Ram; Yao, ChingFa; Journal of Organic Chemistry; vol. 77; nb. 15; (2012); p. 6495 - 6504, View in Reaxys; Anastassiadis, Theonie; Deacon, Sean W.; Devarajan, Karthik; Ma, Haiching; Peterson, Jeffrey R.; Nature Biotechnology; vol. 29; nb. 11; (2011); p. 1039 - 1045, View in Reaxys; Enders, Dieter; Hahn, Robert; Atodiresei, Iuliana; Advanced Synthesis and Catalysis; vol. 355; nb. 6; (2013); p. 1126 - 1136, View in Reaxys 9 of 91
Comment (Pharmacological Data)
Bioactivities present
Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys; Singh, Kamalnain; Singh, Paramjit; Kaur, Amarjit; Singh, Pushpinder; Sharma, Sandeepkumar; Khullar, Sadhika; Mandal, Sanjay K.; Synthesis (Germany); vol. 45; nb. 10; (2013); p. 1406 - 1413; Art.No: SS-2013-Z0008-O, View in Reaxys; Ansari, Samira; Raabe, Gerhard; Enders, Dieter; Monatshefte fur Chemie; vol. 144; nb. 5; (2013); p. 641 - 646, View in Reaxys; Lavoie, Hugo; Thevakumar-
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
16/249
2016-07-13 00:31:19
an, Neroshan; Gavory, Gwenaelle; Li, John J.; Padeganeh, Abbas; Guiral, Sebastien; Duchaine, Jean; Mao, Daniel Y.L.; Bouvier, Michel; Sicheri, Frank; Therrien, Marc; Nature Chemical Biology; vol. 9; nb. 7; (2013); p. 428 - 436, View in Reaxys; Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys; Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys; Puerto Galvis, Carlos E.; Kouznetsov, Vladimir V.; Organic and Biomolecular Chemistry; vol. 11; nb. 42; (2013); p. 7372 - 7386, View in Reaxys; Tang, Ying; Gu, Xuefan; Meng, Mei; Xu, Jingfang; Research on Chemical Intermediates; vol. 39; nb. 8; (2013); p. 3715 - 3725, View in Reaxys; Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys; Zanwar, Manoj R.; Kavala, Veerababurao; Gawande, Sachin D.; Kuo, Chun-Wei; Kuo, TingShen; Chen, Mei-Ling; He, Chiu-Hui; Yao, Ching-Fa; European Journal of Organic Chemistry; nb. 36; (2013); p. 8288 - 8298, View in Reaxys; Patent; THE TEXAS AandM UNIVERSITY SYSTEM; LEWIS, Kyle, G.; GLADYSZ, John, A.; GHOSH, Subrata, K.; WO2014/18978; (2014); (A2) English, View in Reaxys; Kobayashi, Takumi; Shimura, Tatsuki; Kurita, Yuzuru; Katsumata, Yoshitaka; Kezuka, Satoko; Tetrahedron Letters; vol. 55; nb. 17; (2014); p. 2818 - 2821, View in Reaxys; Rana, Nirmal K.; Huang, Huicai; Zhao, John C.-G.; Angewandte Chemie International Edition; vol. 53; nb. 29; (2014); p. 7619 - 7623; Angew. Chem.; vol. 126; nb. 29; (2014); p. 7749 7753,5, View in Reaxys; Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 - 3018,11, View in Reaxys; Begari, Eeshwaraiah; Singh, Chandani; Nookaraju; Kumar, Pradeep; Synlett; vol. 25; nb. 14; (2014); p. 1997 - 2000; Art.No: ST-2014-D0206-L, View in Reaxys; Mukherjee, Tathagata; Ganzmann, Carola; Bhuvanesh, Nattamai; Gladysz, John A.; Organometallics; vol. 33; nb. 23; (2014); p. 6723 6737, View in Reaxys; Sagamanova, Irina; Rodrguez-Escrich, Carles; Molnr, Istvn Gbor; Sayalero, Sonia; Gilmour, Ryan; Perics, Miquel A.; ACS Catalysis; vol. 5; nb. 11; (2015); p. 6241 - 6248, View in Reaxys; Luridiana, Alberto; Frongia, Angelo; Aitken, David J.; Guillot, Regis; Sarais, Giorgia; Secci, Francesco; Organic and Biomolecular Chemistry; vol. 14; nb. 13; (2016); p. 3394 - 3403, View in Reaxys 10 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
leukemia P388 cells of mouse
Further Details (Pharmacological Data)
effective dose (ED)
Type (Pharmacological Data)
ED50
Value of Type (Pharmacological Data)
2 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 11 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
pancreas cancer BXPC-3 cells of human
Further Details (Pharmacological Data)
growth inhibition (GI)
Type (Pharmacological Data)
GI50
Value of Type (Pharmacological Data)
1.7 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 12 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
breast cancer MCF-7 cells of human
Further Details (Pharmacological Data)
growth inhibition (GI)
Type (Pharmacological Data)
GI50
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
17/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
0.58 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 13 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
CNS cancer SF295 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 14 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
prostate cancer DU-145 cells of human
Further Details (Pharmacological Data)
growth inhibition (GI)
Type (Pharmacological Data)
GI50
Value of Type (Pharmacological Data)
1.8 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 15 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
ovary cancer OVCAR-3 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 16 of 91
Effect (Pharmacological Data)
tubulin polymerization; inhibition of
Species or Test-System (Pharmacological Data)
not explicitly stated by authors
Further Details (Pharmacological Data)
inhibitory concentration (IC); IC50 related to: tubulin
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
5.3 μmol/l
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 17 of 91
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Cryptococcus neoformans ATCC 90112
Kind of Dosing (Pharmacological Data)
DMSO solution
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
18/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
0.78 - 1.56 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 18 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Streptococcus pneumoniae ATCC 6303
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
0.78 - 1.56 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 19 of 91
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Cryptococcus neoformans ATCC 90112
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
8 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 20 of 91
Effect (Pharmacological Data)
fungicidal
Species or Test-System (Pharmacological Data)
Candida albicans ATCC 90028
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal fungicidal concentration (MFC)
Type (Pharmacological Data)
MFC
Value of Type (Pharmacological Data)
16 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
19/249
2016-07-13 00:31:19
21 of 91
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Candida albicans ATCC 90028
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
8 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 22 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Neisseria gonorrhoeae ATCC 49226
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
< 0.78 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 23 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterobacter cloacae ATCC 13047
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
12.5 - 25 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 24 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Escherichia coli ATCC 25922
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
20/249
2016-07-13 00:31:19
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
6.25 - 12.5 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 25 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Stenotrophomonas maltophilia ATCC 13637
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
6.25 - 12.5 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 26 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Micrococcus luteus Presque Isle 456
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
50 - 100 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 27 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis ATCC 29212
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
6.25 - 12.5 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 28 of 91
Effect (Pharmacological Data)
bactericidal
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
21/249
2016-07-13 00:31:19
Species or Test-System (Pharmacological Data)
Neisseria gonorrhoeae ATCC 49226
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal bactericidal concentration (MBC)
Type (Pharmacological Data)
MBC
Value of Type (Pharmacological Data)
2 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 29 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Neisseria gonorrhoeae ATCC 49226
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
1 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 30 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterobacter cloacae ATCC 13047
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 31 of 91
Effect (Pharmacological Data)
bactericidal
Species or Test-System (Pharmacological Data)
Escherichia coli ATCC 25922
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal bactericidal concentration (MBC)
Type (Pharmacological Data)
MBC
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
22/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 32 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Escherichia coli ATCC 25922
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 33 of 91
Effect (Pharmacological Data)
bactericidal
Species or Test-System (Pharmacological Data)
Stenotrophomonas maltophilia ATCC 13637
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal bactericidal concentration (MBC)
Type (Pharmacological Data)
MBC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 34 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Stenotrophomonas maltophilia ATCC 13637
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 35 of 91
Effect (Pharmacological Data)
bactericidal
Species or Test-System (Pharmacological Data)
Micrococcus luteus Presque Isle 456
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
23/249
2016-07-13 00:31:19
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal bactericidal concentration (MBC)
Type (Pharmacological Data)
MBC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 36 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Micrococcus luteus Presque Isle 456
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 37 of 91
Effect (Pharmacological Data)
bactericidal
Species or Test-System (Pharmacological Data)
Enterococcus faecalis ATCC 29212
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal bactericidal concentration (MBC)
Type (Pharmacological Data)
MBC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 38 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis ATCC 29212
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
64 μg/ml
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
24/249
2016-07-13 00:31:19
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 39 of 91
Effect (Pharmacological Data)
bactericidal
Species or Test-System (Pharmacological Data)
Streptococcus pneumoniae ATCC 6303
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal bactericidal concentration (MBC)
Type (Pharmacological Data)
MBC
Value of Type (Pharmacological Data)
32 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 40 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Streptococcus pneumoniae ATCC 6303
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
16 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 41 of 91
Effect (Pharmacological Data)
bactericidal
Species or Test-System (Pharmacological Data)
Staphylococcus aureus ATCC 29213
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal bactericidal concentration (MBC)
Type (Pharmacological Data)
MBC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 42 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Staphylococcus aureus ATCC 29213
Kind of Dosing (Pharmacological Data)
DMSO solution
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
25/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
32 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 43 of 91
Effect (Pharmacological Data)
fungicidal
Species or Test-System (Pharmacological Data)
Cryptococcus neoformans ATCC 90112
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal fungicidal concentration (MFC)
Type (Pharmacological Data)
MFC
Value of Type (Pharmacological Data)
16 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 44 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Staphylococcus aureus ATCC 29213
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
6.25 - 12.5 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 45 of 91
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Candida albicans ATCC 90028
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
1.56 - 3.12 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
26/249
2016-07-13 00:31:19
46 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
renal cancer A498 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 47 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
melanoma SK-MEL-5 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 48 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
colon cancer KM20L2 cells of human
Further Details (Pharmacological Data)
growth inhibition (GI)
Type (Pharmacological Data)
GI50
Value of Type (Pharmacological Data)
1.8 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 49 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
lung-NSC cancer NCI-H460 cells of human
Further Details (Pharmacological Data)
growth inhibition (GI)
Type (Pharmacological Data)
GI50
Value of Type (Pharmacological Data)
2 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 50 of 91
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
CNS cancer SF268 cells of human
Further Details (Pharmacological Data)
growth inhibition (GI)
Type (Pharmacological Data)
GI50
Value of Type (Pharmacological Data)
1.9 μg/ml
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
27/249
2016-07-13 00:31:19
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 51 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis KE77F2 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 52 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis Med100 F3 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 53 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis Med150 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
28/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 54 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis 536540 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 55 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis H 181A strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 56 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis H 318 strain
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
29/249
2016-07-13 00:31:19
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 57 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Salmonella enteritidis 09 FF-D strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; sulfonamide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 58 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Salmonella typhimurium FFUP40 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; sulfonamide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
30/249
2016-07-13 00:31:19
59 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Staphylococcus aureus ATCC 29213 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 60 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis ATCC 29212 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 61 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Acetinobacter baumannii FFUP10 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
31/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 62 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Pseudomonas aeruginosa ATCC 27853 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 63 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Salmonella typhimurium FFUP1 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 64 of 91
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Escherichia coli ATCC 25922 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
32/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
128 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 65 of 91
Effect (Pharmacological Data)
anticoagulant
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
<= 100 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, activated with 2 μmol/l U46619; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer
Further Details (Pharmacological Data)
U46619: 9,11-dideoxy-9α,11α-methanoepoxy prostaglandin F2α
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
2.1 μmol/l
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 66 of 91
Effect (Pharmacological Data)
anticoagulant
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
<= 100 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, activated with 5 μmol/l ADP; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer
Further Details (Pharmacological Data)
further investigation of title comp. ability to induced platelet disaggregation
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
4.1 μmol/l
Results
title comp. dose-dependently inhibited ADP-induced platelet aggregation and induced rapid disaggregation of platelet aggregated by ADP (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 67 of 91
Effect (Pharmacological Data)
anticoagulant
Species or Test-System (Pharmacological Data)
human platelets
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
33/249
2016-07-13 00:31:19
Concentration (Pharmacological Data)
<= 100 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, activated with 100 μmol/l arachidonic acid; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
5.8 μmol/l
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 68 of 91
Effect (Pharmacological Data)
anticoagulant
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
<= 100 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, activated with 10 μg/ml collagen; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
7.0 μmol/l
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 69 of 91
Effect (Pharmacological Data)
anticoagulant
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
<= 100 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, activated with 0.1 U/ml thrombin; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
12.7 μmol/l
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 70 of 91
Effect (Pharmacological Data)
anticoagulant
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
<= 100 μmol/l
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
34/249
2016-07-13 00:31:19
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, activated with 1 μmol/l A23187; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer
Further Details (Pharmacological Data)
A23187: calcimycin
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
25.9 μmol/l
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 71 of 91
Effect (Pharmacological Data)
anticoagulant
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
<= 100 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, activated with 200 nmol/l PDBu; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer
Further Details (Pharmacological Data)
PDBu: phorbol 12,13-dibutyrate, protein kinase C activator
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
4.8 μmol/l
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 72 of 91
Effect (Pharmacological Data)
transmitter release; inhibition of
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
0.2 - 20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. for 5 min, treated with 200 μmol/l arachidonic acid; thromboxane B2 formation measured by enzyme immunoassay
Comment (Pharmacological Data)
No effect
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 73 of 91
Effect (Pharmacological Data)
protein expression; inhibition of
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
0.2 - 20 μmol/l
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
35/249
2016-07-13 00:31:19
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. for 5 min, treated with 0.2 U/ml thrombin in presence of FITC-conjugated anti-CD62P for 15 min; P-selectin expression measured by flow cytometry
Further Details (Pharmacological Data)
reference comp.: prostaglandin E1 (5 μmol/l); FITC: fluorescein isothiocyanate
Results
title comp. decreased thrombin-induced P-selectin expression similar to that of reference comp. (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 74 of 91
Effect (Pharmacological Data)
protein activation; inhibition of
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
0.2 - 20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. for 5 min, treated with 0.2 U/ml thrombin in presence of FITC-conjugated anti-PAC-1 for 15 min; GPIIb/IIIa activation determined as PAC-1 binding analyzing by flow cytometry
Further Details (Pharmacological Data)
reference comp.: prostaglandin E1 (5 μmol/l); FITC: fluorescein isothiocyanate; GP: glycoprotein
Results
title comp. inhibited thrombin-induced GPIIb/IIIa activation (increased PAC-1 binding similar to that of reference comp.) (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 75 of 91
Effect (Pharmacological Data)
anticoagulant
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
ADP-stimulated (20 μmol/l) fixed platelets treated with title comp. before and after addition 200 μg/ml fibrinogen; fibrinogen-induced platelet aggregation measured turbidimetrically with light-transmission aggregometer
Further Details (Pharmacological Data)
reference comp.: prostaglandin E1 (10 μmol/l), RGDS (Arg-Gly-Asp-Ser; 100 μmol/l)
Comment (Pharmacological Data)
No effect
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 76 of 91
Effect (Pharmacological Data)
second messanger level; effect on
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
36/249
2016-07-13 00:31:19
Method (Pharmacological Data)
effect of title comp. on cyclic nucleotide levels studied; platelets incubated with title comp. at 37 deg C for 3 min; cAMP, cGMP levels determined by enzyme immunoassay
Comment (Pharmacological Data)
No effect
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 77 of 91
Effect (Pharmacological Data)
intracellular Ca(2+) level; effect on
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
effect of title comp. on intracellular calcium mobilization studied; Fluo-3-loaded platelets incubated with title comp. at 37 deg C for 3 min in presence of 1 mmol/l extracellular Ca(2+) and 100 μmol/l AA, 10 μg/ml collagen, 0.1 U/ml thrombin,
Further Details (Pharmacological Data)
5 μmol/l ADP or 2 μmol/l U46619; fluorescence measured; AA: arachidonic acid; U46619: 9,11-dideoxy-9α,11α-methanoepoxy prostaglandin F2α
Results
title comp. inhibited collagen-induced but did not change thrombin-, ADP-, AA-, or U46619-induce intracellular Ca(2+) mobilization (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 78 of 91
Effect (Pharmacological Data)
enzyme; inhib. of
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 1 μmol/l A23187 for 30 s; MLC kinase activity determined by measuring phosphorylation of MLC using Western blotting
Further Details (Pharmacological Data)
reference comp.: ML-7 (50 μmol/l; MLC kinase inhibitor); MLC: myosin light chain
Comment (Pharmacological Data)
No effect
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 79 of 91
Effect (Pharmacological Data)
enzyme; inhib. of
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 1 μmol/l A23187 for 30 s; calpain activity determined by measuring cleavage of talin using Western blotting
Further Details (Pharmacological Data)
reference comp.: calpeptin (100 μmol/l; calpain inhibitor); A23187: calcimycin
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
37/249
2016-07-13 00:31:19
Comment (Pharmacological Data)
No effect
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 80 of 91
Effect (Pharmacological Data)
enzyme; inhib. of
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 200 mnol/l PDBu for 30 s; PKC activity determined by measuring phosphorylation of MARCKS using Western blotting
Further Details (Pharmacological Data)
reference comp.: GF109203X (10 μmol/l; PKC inhibitor); PDBu: phorbol 12,13-dibutyrate; PKC: protein kinase C; MARCKS: myristoylated alanine-rich C kinase substrate
Results
title comp. did not inhibit directly PKC; title comp. inhibited thrombin- but not PDBu-induced MARCKS phosphorylation (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 81 of 91
Effect (Pharmacological Data)
protein phosphorylation; inhibition of
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 10 μg/ml collagen for 0.5 - 3 min; tyrosine-phosphorylated proteins (130, 110, 90, 80, 75, 60 kDa and cytoskeletal) determined using Western blotting
Further Details (Pharmacological Data)
reference comp.: genistein (20 and 600 μmol/l)
Results
title comp. inhibited thrombin- and collagen-induced protein tyrosine phosphorylation (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 82 of 91
Effect (Pharmacological Data)
protein distribution; effect on
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin for 0.5 - 3 min; cytoskeletal fraction isolated; talin and β3 integrin levels determined using Western blotting
Further Details (Pharmacological Data)
reference comp.: genistein (600 μmol/l)
Results
title comp. inhibited thrombin-induced increase in talin and integrin levels in cytoskeletal fraction (figure)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
38/249
2016-07-13 00:31:19
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 83 of 91
Effect (Pharmacological Data)
anticoagulant
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
2 - 20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min in presence of 250 μg/ml fibrinogen; fibrin clot formation induced by 1 U/ml thrombin; kinetic of clot retraction monitored at 37 deg C for up to 4 h
Results
title comp. caused delay in kinetic of clot retraction; effect was dose-dependent (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 84 of 91
Effect (Pharmacological Data)
enzyme; inhib. of
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 30 μg/ml collagen for 0.5-2.5 min; Src tyrosine kinase activity determined as autophosphorylation of Tyr416 using immunoprecipitation and Western blotting;
Further Details (Pharmacological Data)
activity of immunoprecipitated kinase determined using tyrosine kinase assay kit with biotinylated poly(glu:Tyr); reference comp.: PP1 (20 μmol/l; Src inhibitor)
Results
title comp. inhibited thrombin- and collagen-induced Src activity (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 85 of 91
Effect (Pharmacological Data)
enzyme; inhib. of
Species or Test-System (Pharmacological Data)
human platelets
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 30 μg/ml collagen for 0.5 - 2.5 min; Syc tyrosine kinase activation determined using immunoprecipitation and Western blotting;
Further Details (Pharmacological Data)
activity of immunoprecipitated kinase determined using tyrosine kinase assay kit with biotinylated poly(glu:Tyr); reference comp.: piceatannol (100 μmol/l)
Results
title comp. inhibited thrombin- and collagen-induced Syc activity (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 86 of 91
Effect (Pharmacological Data)
protein phosphorylation; inhibition of
Species or Test-System (Pharmacological Data)
human platelets
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
39/249
2016-07-13 00:31:19
Concentration (Pharmacological Data)
20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 30 μg/ml collagen for 0.5 - 2.5 min; PKCγ2 phosphorylation determined using immunoprecipitation and Western blotting
Further Details (Pharmacological Data)
PKC: protein kinase C
Results
title comp. inhibited thrombin- and collagen-induced PKCγ2 phosphorylation (figure)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 87 of 91
Effect (Pharmacological Data)
enzyme; inhib. of
Species or Test-System (Pharmacological Data)
human recombinant Src tyrosine kinase
Concentration (Pharmacological Data)
5 - 50 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
enzyme treated with title comp. for 5 min; Src tyrosine kinase activity determined as phosphorylation of biotinylated poly(Glu:Tyr)(4:1) using tyrosine kinase assay kit
Further Details (Pharmacological Data)
reference comp.: PP1 (1 μmol/l; Src inhibitor), piceatannol (20 - 100 μmol/l), genistein (50 - 100 μmol/l)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
29.3 μmol/l
Results
title comp. dose-dependently inhibited activity of Src (88.5 percent at highest dose) (table)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 88 of 91
Effect (Pharmacological Data)
enzyme; inhib. of
Species or Test-System (Pharmacological Data)
human recombinant Syc tyrosine kinase
Concentration (Pharmacological Data)
1 - 20 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
enzyme treated with title comp. for 5 min; Syc tyrosine kinase activity determined as phosphorylation of biotinylated poly(Glu:Tyr)(4:1) using tyrosine kinase assay kit
Further Details (Pharmacological Data)
reference comp.: PP1 (1 μmol/l; Src inhibitor), piceatannol (20-100 μmol/l), genistein (50-100 μmol/l)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
2.5 μmol/l
Results
title comp. dose-dependently inhibited activity of Syc (94.4 percent at highest dose) (table)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 89 of 91
Effect (Pharmacological Data)
enzyme; inhib. of
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
40/249
2016-07-13 00:31:19
Species or Test-System (Pharmacological Data)
human recombinant FAK tyrosine kinase
Concentration (Pharmacological Data)
50 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
enzyme treated with title comp. for 5 min; FAK tyrosine kinase activity determined as phosphorylation of biotinylated poly(Glu:Tyr)(4:1) using tyrosine kinase assay kit
Further Details (Pharmacological Data)
reference comp.: genistein (50 - 100 μmol/l)
Results
title comp. inhibited activity of FAK (36.6 percent) (table)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 90 of 91
Effect (Pharmacological Data)
enzyme; inhib. of
Species or Test-System (Pharmacological Data)
human recombinant Janus tyrosine kinase 2
Concentration (Pharmacological Data)
50 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. was dissolved in dimethyl sulfoxide
Method (Pharmacological Data)
enzyme treated with title comp. for 5 min; Janus tyrosine kinase 2 activity determined as phosphorylation of biotinylated poly(Glu:Tyr)(4:1) using tyrosine kinase assay kit
Further Details (Pharmacological Data)
reference comp.: genistein (100 μmol/l);
Results
title comp. slightly inhibited activity of JAK2 (5.2 percent) (table)
Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 91 of 91
Effect (Pharmacological Data)
antiproliferative
Species or Test-System (Pharmacological Data)
HeLa cells
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Method (Pharmacological Data)
test cells in MEM incubated with title comp. at 37 deg C for 24 h; cell growth stopped by addition of 10 percent trichloroacetic acid; sulforhodamine B assay; absorbance measured at 560 nm
Further Details (Pharmacological Data)
IC50: concentration of title comp. that inhibited cell proliferation by 50 percent; MEM: Eagle's minimum essential medium
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
18 μmol/l
Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys Use (1) Laboratory Use and Handling
References
cytotoxic
Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
41/249
2016-07-13 00:31:19
Reaxys ID 192350 View in Reaxys
2/183 CAS Registry Number: 1485-00-3 Chemical Name: 5-(2-nitrovinyl)benzo[1,3]dioxole; SYK Inhibitor III; MNS; 3,4-methylenedioxy-β-methyl-β-nitrostyrene; 3,4(methylenedioxy)-β-nitrostyrene; 3,4-methylenedioxy-(2-nitrovinyl)benzene; 3,4-methylenedioxy-β-nitrostyrene Linear Structure Formula: C9H7NO4 Molecular Formula: C9H7NO4 Molecular Weight: 193.159 Type of Substance: heterocyclic InChI Key: KFLWBZPSJQPRDD-UHFFFAOYSA-N Note:
O O
N
O
O
Substance Label (31) Label References 2f
Kim, Shinae; Kang, Ki-Tae; Kim, Sung-Gon; Tetrahedron; vol. 70; nb. 34; (2014); p. 5114 - 5121, View in Reaxys; Boyce, Gregory R.; Johnson, Jeffrey S.; Journal of Organic Chemistry; vol. 81; nb. 4; (2016); p. 1712 - 1717, View in Reaxys
3q
Rao, Kadiyala Srinivasa; Ramesh, Pambala; Trivedi, Rajiv; Kantam, M. Lakshmi; Tetrahedron Letters; vol. 57; nb. 11; (2016); p. 1227 - 1231, View in Reaxys
574713
Patent; Janssen Biotech, Inc.; Rezania, Alireza; Fryer, Benjamin; (49 pag.); US9234178; (2016); (B2) English, View in Reaxys
8
Yang, Chen; Zhang, En-Ge; Li, Xin; Cheng, Jin-Pei; Angewandte Chemie - International Edition; vol. 55; nb. 22; (2016); p. 6506 - 6510; Angew. Chem.; vol. 128; (2016); p. 6616 - 6620,5, View in Reaxys
3h
Fan, Xinyuan; Rodriguez-Escrich, Carles; Sayalero, Sonia; Pericas, Miquel A.; Chemistry - A European Journal; vol. 19; nb. 33; (2013); p. 10814 - 10817, View in Reaxys; Xue, Fengjun; Dong, Yahao; Hu, Peibo; Deng, Yanan; Wei, Yuping; RSC Advances; vol. 5; nb. 90; (2015); p. 73684 - 73691, View in Reaxys
1n
Kiyokawa, Kensuke; Nagata, Takaya; Hayakawa, Junpei; Minakata, Satoshi; Chemistry - A European Journal; vol. 21; nb. 3; (2015); p. 1280 - 1285, View in Reaxys
3r
Rao, Kadiyala Srinivasa; Trivedi, Rajiv; Kantam, M. Lakshmi; Synlett; vol. 26; nb. 2; (2015); p. 221 - 227; Art.No: ST-2014-D0721-L, View in Reaxys
1e
Ghosh, Monoranjan; Mishra, Subhajit; Hajra, Alakananda; Journal of Organic Chemistry; vol. 80; nb. 10; (2015); p. 5364 - 5368, View in Reaxys
10
Tanabe, Genzoh; Sugano, Youta; Shirato, Miki; Sonoda, Naoki; Tsutsui, Nozomi; Morikawa, Toshio; Ninomiya, Kiyofumi; Yoshikawa, Masayuki; Muraoka, Osamu; Journal of Natural Products; vol. 78; nb. 7; (2015); p. 1536 - 1542, View in Reaxys
5d
Flores-Ferrndiz, Jess; Stiven, Alexander; Sotorros, Lia; Gmez-Bengoa, Enrique; Chinchilla, Rafael; Tetrahedron Asymmetry; vol. 26; nb. 17; (2015); p. 970 - 979; Art.No: 59347, View in Reaxys
3k
Chandrasekhara Rao; Satish Kumar; Meshram; RSC Advances; vol. 5; nb. 87; (2015); p. 70949 - 70957, View in Reaxys
Compound 2
Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys
MNS
Wei, Chien-Kei; Chang, Fang-Rong; Hsieh, Pei-Wen; Wu, Chin-Chung; Life Sciences; vol. 143; (2015); p. 147 - 155, View in Reaxys
2e
Keene, Craig; Kuerti, Laszlo; Synthesis (Germany); vol. 45; nb. 13; (2013); p. 1719 - 1729; Art.No: SS-2013-C0260-FA, View in Reaxys; Kasaplar, Pinar; Rodriguez-Escrich, Carles; Pericas, Miquel A.; Organic Letters; vol. 15; nb. 14; (2013); p. 3498 - 3501, View in Reaxys; Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys
3i
Rapi, Zsolt; Demuth, Balazs; Keglevich, Gyoergy; Grun, Alajos; Drahos, Laszlo; Soti, Peter L.; Bako, Peter; Tetrahedron Asymmetry; vol. 25; nb. 2; (2014); p. 141 - 147, View in Reaxys
13g
Nakashima, Kosuke; Hirashima, Shin-Ichi; Kawada, Masahiro; Koseki, Yuji; Tada, Norihiro; Itoh, Akichika; Miura, Tsuyoshi; Tetrahedron Letters; vol. 55; nb. 16; (2014); p. 2703 - 2706, View in Reaxys
9p
Vinayagam, Poopathy; Vishwanath, Manjunatha; Kesavan, Venkitasamy; Tetrahedron Asymmetry; vol. 25; nb. 6-7; (2014); p. 568 - 577, View in Reaxys
2d
Hahn, Robert; Raabe, Gerhard; Enders, Dieter; Organic Letters; vol. 16; nb. 14; (2014); p. 3636 - 3639, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
42/249
2016-07-13 00:31:19
2g
Rahmani-Nezhad, Samira; Safavi, Maliheh; Pordeli, Mahboobeh; Ardestani, Sussan Kabudanian; Khosravani, Leila; Pourshojaei, Yaghoub; Mahdavi, Mohammad; Emami, Saeed; Foroumadi, Alireza; Shafiee, Abbas; European Journal of Medicinal Chemistry; vol. 86; (2014); p. 562 - 569, View in Reaxys
3
Radivojevic, Jelena; Maslak, Veselin; Minovska, Gordana; Senerovic, Lidija; Nikodinovic-Runic, Jasmina; O'Connor, Kevin; Jovanovic, Predrag; Savic, Vladimir; Tokic-Vujosevic, Zorana; ; vol. 4; nb. 105; (2014); p. 60502 - 60510, View in Reaxys
2
Wang, Yao; Luo, Yong-Chun; Zhang, Hong-Bo; Xu, Peng-Fei; Organic and Biomolecular Chemistry; vol. 10; nb. 41; (2012); p. 8211 - 8215, View in Reaxys; Meshram; Satish Kumar, Nandigama; Nanubolu, Jagadeesh Babu; Chandrasekhara Rao; Nageswara Rao; Tetrahedron Letters; vol. 54; nb. 45; (2013); p. 5941 - 5944, View in Reaxys; Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys
2b
Nageswara Rao; Meshram; Tetrahedron Letters; vol. 54; nb. 10; (2013); p. 1315 - 1317, View in Reaxys
3b
Sun, Haifeng; Zhu, Liyuan; Yang, Huicui; Qian, Wangke; Guo, Lin; Zhou, Shengbin; Gao, Bo; Li, Zeng; Zhou, Yu; Jiang, Hualiang; Chen, Kaixian; Zhen, Xuechu; Liu, Hong; Bioorganic and Medicinal Chemistry; vol. 21; nb. 4; (2013); p. 856 - 868, View in Reaxys
2h
Liang, Lei; Liu, Qiang; Zhang, Jianli; Wang, Fengyuan; Yuan, Yu; Research on Chemical Intermediates; vol. 39; nb. 5; (2013); p. 1957 - 1962, View in Reaxys
1c
Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys
5s
Mo, Lei; Tang, Huang; Yao, Zhu-Jun; Tetrahedron; vol. 69; nb. 33; (2013); p. 6897 - 6905, View in Reaxys
3d
Cui, Bao-Dong; Han, Wen-Yong; Wu, Zhi-Jun; Zhang, Xiao-Mei; Yuan, Wei-Cheng; Journal of Organic Chemistry; vol. 78; nb. 17; (2013); p. 8833 - 8839, View in Reaxys
2i
Huang, Wei-Gen; Wang, Heng-Shan; Huang, Guo-Bao; Wu, Yong-Ming; Pan, Ying-Ming; European Journal of Organic Chemistry; nb. 29; (2012); p. 5839 - 5843, View in Reaxys
3l
Jin, Cheng-Yong; Wang, Yao; Liu, Yao-Zong; Shen, Chao; Xu, Peng-Fei; Journal of Organic Chemistry; vol. 77; nb. 24; (2012); p. 11307 - 11312, View in Reaxys
9
Koseki, Yuji; Katsura, Shinya; Kusano, Shuichi; Sakata, Harumi; Sato, Hiroto; Monzene, Yoshinori; Nagasaka, Tatsuo; Heterocycles; vol. 59; nb. 2; (2003); p. 527 - 540, View in Reaxys; Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys
3e
Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys
Patent-Specific Data (2) References Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys Melting Point (13) 1 of 13
Melting Point [°C]
162 - 163
Location
Paragraph 0134
Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys 2 of 13
Melting Point [°C]
158 - 159
Location
Page/Page column 17
Comment (Melting Point)
with decomposition
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 3 of 13
Melting Point [°C]
162 - 163
Location
Page/Page column 17
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
43/249
2016-07-13 00:31:19
4 of 13
Melting Point [°C]
165 - 166
Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys 5 of 13
Melting Point [°C]
153 - 154
Solvent (Melting Point)
acetic acid
Vinogradova, V. I.; Yunusov, M. S.; Kuchin, A. V.; Tolstikov, G. A.; Sagandykov, R. T.; et al.; Chemistry of Natural Compounds; vol. 26; nb. 1; (1990); p. 54 - 59; Khimiya Prirodnykh Soedinenii; nb. 1; (1990); p. 67 - 74, View in Reaxys 6 of 13
Melting Point [°C]
156 - 157
Kihara; Kobayashi; Chemical and Pharmaceutical Bulletin; vol. 26; nb. 1; (1978); p. 155 - 160, View in Reaxys 7 of 13
Melting Point [°C]
161.5 - 162
Solvent (Melting Point)
ethanol
Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys 8 of 13
Melting Point [°C]
158
Wiegrebe,W.; Archiv der Pharmazie und Berichte der Deutschen Pharmazeutischen Gesellschaft; vol. 297; (1964); p. 362 - 367, View in Reaxys; Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys 9 of 13
Melting Point [°C]
159 - 160
Biniecki; Zlakowska; Acta Poloniae Pharmaceutica; vol. 21; (1964); p. 571,574,575, View in Reaxys 10 of 13
Melting Point [°C]
162
Solvent (Melting Point)
benzene
Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys 11 of 13
Melting Point [°C]
162.5 - 163
Byrdy et al.; Bulletin de l'Academie Polonaise des Sciences, Serie des Sciences Chimiques; vol. 9; (1961); p. 627,629, View in Reaxys 12 of 13
Melting Point [°C]
159
Solvent (Melting Point)
benzene
Bouveault; Wahl; Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences; vol. 135; (1902); p. 41; Bulletin de la Societe Chimique de France; vol. <3> 29; (1903); p. 524, View in Reaxys 13 of 13
Melting Point [°C]
159
Solvent (Melting Point)
ethanol
Bouveault; Wahl; Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences; vol. 135; (1902); p. 41; Bulletin de la Societe Chimique de France; vol. <3> 29; (1903); p. 524, View in Reaxys Crystal Property Description (1) References Ishida et al.; Chemical and Pharmaceutical Bulletin; vol. 26; (1978); p. 3603,3605, View in Reaxys Further Information (2) Description (Fur- References ther Information) Further information
Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys
Further information
Dubravkova et al.; Chemicke Zvesti; vol. 13; (1959); p. 16,20, 24; Chem. Zentralbl.; vol. 130; (1959); p. 17162, View in Reaxys
Liquid/Liquid Systems (MCS) (1) 1 of 1
Description (Liquid/ Liquid Systems (MCS))
Distribution between solvent 1 + 2
Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys Solubility (MCS) (2) 1 of 2
Location
Paragraph 0134
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
44/249
2016-07-13 00:31:19
Comment (Solubility (MCS))
non-soluble in water, soluble in acetone, alcohol, acetic acid and in a majority of organic solvents
Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys 2 of 2
Location
Page/Page column 17
Comment (Solubility (MCS))
non-soluble in water, soluble in acetone, alcohol, acetic acid and in a majority of organic solvents
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys 2 of 2
Description (NMR Spec- NMR troscopy) Ishida et al.; Chemical and Pharmaceutical Bulletin; vol. 26; (1978); p. 3603,3605, View in Reaxys
IR Spectroscopy (2) 1 of 2
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys 2 of 2
Description (IR Spectroscopy)
IR
Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys; Ishida et al.; Chemical and Pharmaceutical Bulletin; vol. 26; (1978); p. 3603,3605, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1
Description (UV/VIS Spectroscopy)
Absorption maxima
Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1567 - 1580, View in Reaxys; Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys; Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys; Crowell; Francis; Journal of the American Chemical Society; vol. 83; (1961); p. 591, View in Reaxys Pharmacological Data (81) 1 of 81
Comment (Pharmacological Data)
Bioactivities present
Kihara; Kobayashi; Chemical and Pharmaceutical Bulletin; vol. 26; nb. 1; (1978); p. 155 - 160, View in Reaxys; Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys; Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys; Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1567 - 1580, View in Reaxys; Petersen,U.; Heitzer,H.; Justus Liebigs Annalen der Chemie; (1973); p. 944 - 960, View in Reaxys; Wiegrebe,W.; Archiv der Pharmazie und Berichte der Deutschen Pharmazeutischen Gesellschaft; vol. 297; (1964); p. 362 - 367, View in Reaxys; Bouveault; Wahl; Bulletin de la Societe Chimique de France; vol. <3> 29; (1903); p. 525, View in Reaxys; Medinger; Monatshefte fuer Chemie; vol. 27; (1906); p. 238, View in Reaxys; Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys; Bouveault; Wahl; Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences; vol. 135; (1902); p. 41; Bulletin de la Societe Chimique de France; vol. <3> 29; (1903); p. 524, View in Reaxys; Patent; Bayer and Co.; DE245523; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 10; p. 1192, View in Reaxys; Patent; Bayer and Co.; DE254861; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 11; p. 1006, View in Reaxys; Sonn; Schellenberg; Chemische Berichte; vol. 50; (1917); p. 1520, View in Reaxys; Rosenmund; Kuhnhenn; Chemische Berichte; vol. 56; (1923); p. 1265, View in Reaxys; Mannich; Walther; Archiv der Pharmazie (Weinheim, Germany); (1927); p. 7, View in Reaxys; Tanaka; Midzuno; Yakugaku Zasshi; vol. 49; (1929); p. 47; Chem. Zentralbl.; vol. 100; nb. I; (1929); p. 2978, View in Reaxys; Patent; Skita; DE406149; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 14; p. 344, View in Reaxys; Rosenmund; Nothnagel; Riesenfeldt;
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
45/249
2016-07-13 00:31:19
Chemische Berichte; vol. 60; (1927); p. 397, View in Reaxys; Schultz; Arnold; Journal of the American Chemical Society; vol. 71; (1949); p. 1911,1913, View in Reaxys; Gensler; Samour; Journal of the American Chemical Society; vol. 73; (1951); p. 5555, View in Reaxys 2 of 81
Comment (Pharmacological Data)
Bioactivities present
Erne; Ramirez; Helvetica Chimica Acta; vol. 33; (1950); p. 912,915, View in Reaxys; Reichert; Koch; Chemische Berichte; vol. 68; (1935); p. 445,450, View in Reaxys; Kondo et al.; Itsuu Kenkyusho Nempo; nb. 2; (1951); p. 11; dtsch. Ref. S. 48; Chem.Abstr.; (1953); p. 7519, View in Reaxys; Reichert; Wegner; Chemische Berichte; vol. 71; (1938); p. 1254,1258, View in Reaxys; Tomita; Kikkawa; Yakugaku Zasshi; vol. 77; (1957); p. 1011,1014; Chem.Abstr.; (1958); p. 3833, View in Reaxys; Bills; Noller; Journal of the American Chemical Society; vol. 70; (1948); p. 957,960, View in Reaxys; Schales; Chemische Berichte; vol. 68; (1935); p. 1579,1581, View in Reaxys; Slotta; Haberland; Angewandte Chemie; vol. 46; (1933); p. 766,770, 771, View in Reaxys; Dubravkova et al.; Chemicke Zvesti; vol. 13; (1959); p. 16,20, 24; Chem. Zentralbl.; vol. 130; (1959); p. 17162, View in Reaxys; Rosenmund; Chemische Berichte; vol. 43; (1910); p. 3415; Chem. Zentralbl.; vol. 83; nb. I; (1912); p. 961, View in Reaxys; Cason; Wanser; Journal of the American Chemical Society; vol. 73; (1951); p. 142, View in Reaxys; Benington et al.; Journal of Organic Chemistry; vol. 23; (1958); p. 1979,1980, View in Reaxys; Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys; Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys; Landeryou et al.; Tetrahedron; vol. 25; (1969); p. 4307,4313, View in Reaxys; Byrdy et al.; Bulletin de l'Academie Polonaise des Sciences, Serie des Sciences Chimiques; vol. 9; (1961); p. 627,629, View in Reaxys; Crowell; Francis; Journal of the American Chemical Society; vol. 83; (1961); p. 591, View in Reaxys; Crowell; Kim; Journal of the American Chemical Society; vol. 95; (1973); p. 6781,6782-6786, View in Reaxys; Biniecki; Zlakowska; Acta Poloniae Pharmaceutica; vol. 21; (1964); p. 571,574,575, View in Reaxys; Ishida et al.; Chemical and Pharmaceutical Bulletin; vol. 26; (1978); p. 3603,3605, View in Reaxys 3 of 81
Comment (Pharmacological Data)
Bioactivities present
Kohno; Sasao; Murahashi; Bulletin of the Chemical Society of Japan; vol. 63; nb. 4; (1990); p. 1252 - 1254, View in Reaxys; Hassner, Alfred; Dehaen, Wim; Journal of Organic Chemistry; vol. 55; nb. 20; (1990); p. 5505 5510, View in Reaxys; Vinogradova, V. I.; Yunusov, M. S.; Kuchin, A. V.; Tolstikov, G. A.; Sagandykov, R. T.; et al.; Chemistry of Natural Compounds; vol. 26; nb. 1; (1990); p. 54 - 59; Khimiya Prirodnykh Soedinenii; nb. 1; (1990); p. 67 - 74, View in Reaxys; Mukherjee, Anita; Sharma, V. L.; Seth, M.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 27; (1988); p. 537 - 541, View in Reaxys; Arora, P. K.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. <B> 20; nb. 11; (1981); p. 951 - 954, View in Reaxys; Pandey, G. D.; Tiwari, K. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 19; nb. 4; (1980); p. 272 275, View in Reaxys; Crowell, Thomas I.; Journal of Organic Chemistry; vol. 48; nb. 19; (1983); p. 3294 - 3297, View in Reaxys; Ranu, Brindaban C.; Chakraborty, Rupak; Tetrahedron Letters; vol. 32; nb. 29; (1991); p. 3579 3582, View in Reaxys; Sera, Akira; Tani, Hiroyuki; Nishiguchi, Ikuzo; Hirashima, Tsuneaki; Synthesis; nb. 7; (1987); p. 631 - 633, View in Reaxys; Ranu; Chakraborty; Tetrahedron; vol. 48; nb. 25; (1992); p. 5317 - 5322, View in Reaxys; Nimgirawath; Taylor; Australian Journal of Chemistry; vol. 36; nb. 5; (1983); p. 1061 - 1065, View in Reaxys; Zueger, Max; Weller, Thomas; Seebach, Dieter; Helvetica Chimica Acta; vol. 63; nb. 7; (1980); p. 2005 - 2009, View in Reaxys; Patra, Amarendra; Mitra, Alok K.; Ghosh, Arundhati; Mukhopadhyay, Prabir K.; Organic Magnetic Resonance; vol. 16; nb. 1; (1981); p. 65 - 67, View in Reaxys; Trefouel, Thierry; Tintillier, Patrik; Dupas, Georges; Bourguignon, Jean; Queguiner, Guy; Bulletin of the Chemical Society of Japan; vol. 60; nb. 12; (1987); p. 4492 - 4494, View in Reaxys; Ghabrial, Sami S.; Zaki, Mayasoune Y.; Journal of Chemical Research, Miniprint; nb. 7; (1997); p. 1560 - 1575, View in Reaxys; Cutter, Paul S; Miller, R.Bryan; Schore, Neil E; Tetrahedron; vol. 58; nb. 8; (2002); p. 1471 - 1478, View in Reaxys; Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys; Koseki, Yuji; Katsura, Shinya; Kusano, Shuichi; Sakata, Harumi; Sato, Hiroto; Monzene, Yoshinori; Nagasaka, Tatsuo; Heterocycles; vol. 59; nb. 2; (2003); p. 527 - 540, View in Reaxys; Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys; Arai, Takayoshi; Yokoyama, Naota; Yanagisawa, Akira; Chemistry - A European Journal; vol. 14; nb. 7; (2008); p. 2052 - 2059, View in Reaxys 4 of 81
Comment (Pharmacological Data)
Bioactivities present
Deng, Xiaohu; Mani, Neelakandha S.; Organic Letters; vol. 10; nb. 6; (2008); p. 1307 - 1310, View in Reaxys; Habib, Pateliya Mujjamil; Kavala, Veerababurao; Kuo, Chun-Wei; Yao, Ching-Fa; Tetrahedron Letters; vol. 49; nb. 49; (2008); p. 7005 - 7007, View in Reaxys; Ganesh, Madhu; Seidel, Daniel; Journal of the American Chemical Society; vol. 130; nb. 49; (2008); p. 16464 - 16465, View in Reaxys; Vaccari, Daniele; Davoli, Paolo; Ori, Claudia; Spaggiari, Alberto; Prati, Fabio; Synlett; nb. 18; (2008); p. 2807 - 2810, View in Reaxys; Namboothiri, Irishi N. N.; Sahu, Bichismita; Gururaja, Guddeangadi N.; Mobin, Shaikh M.; Journal of Organic Chemistry; vol. 74; nb. 6; (2009); p. 2601 - 2604, View in Reaxys; Yang, Zhigang; Liu, Jie; Liu, Xiaohua; Wang, Zhen; Feng, Xiaoming; Su, Zhishan; Hua, Changwei; Advanced Synthesis and Catalysis; vol. 350; nb. 13; (2008); p. 2001 - 2006, View in Reaxys; Xue, Fei; Zhang, Shilei; Duan, Wenhu; Wang, Wei; Advanced Synthesis and Catalysis; vol. 350; nb. 14-15; (2008); p. 2194 - 2198, View in Reaxys; Chuan, Yongming; Chen, Guihua; Peng, Yungui; Tetrahedron Letters; vol. 50; nb. 25; (2009); p. 3054 - 3058, View in Reaxys; Liu, Jie; Yang, Zhigang; Liu, Xiaohua; Wang,
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
46/249
2016-07-13 00:31:19
Zhen; Liu, Yanling; Bai, Sha; Lin, Lili; Feng, Xiaoming; Organic and Biomolecular Chemistry; vol. 7; nb. 19; (2009); p. 4120 - 4127, View in Reaxys; Habib, Pateliya Mujjamil; Rama Raju; Kavala, Veerababurao; Kuo, Chun-Wei; Yao, Ching-Fa; Tetrahedron; vol. 65; nb. 29-30; (2009); p. 5799 - 5804, View in Reaxys; Deb, Indubhusan; Shanbhag, Pramod; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; European Journal of Organic Chemistry; nb. 24; (2009); p. 4091 - 4101, View in Reaxys; Yu, Zhipeng; Liu, Xiaohua; Zhou, Lin; Lin, Lili; Feng, Xiaoming; Angewandte Chemie - International Edition; vol. 48; nb. 28; (2009); p. 5195 - 5198, View in Reaxys; Hong, BorCherng; Jan, Rei-Hau; Tsai, Chih-Wei; Nimje, Roshan Y.; Liao, Ju-Hsiou; Lee, Gene-Hsiang; Organic Letters; vol. 11; nb. 22; (2009); p. 5246 - 5249, View in Reaxys; Zeng, Xiaofei; Zhong, Guofu; Synthesis; nb. 9; (2009); p. 1545 - 1550; Art.No: C00509SS, View in Reaxys; Zhang, Fang-Lin; Xu, Ai-Wen; Gong, Yue-Fa; Wei, Mo-Hui; Yang, Xiang-Liang; Chemistry - A European Journal; vol. 15; nb. 28; (2009); p. 6815 - 6818, View in Reaxys; Allu, Suresh; Selvakumar, Sermadurai; Singh, Vinod K.; Tetrahedron Letters; vol. 51; nb. 2; (2010); p. 446 - 448, View in Reaxys; Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys; Pansare, Sunil V.; Lingampally, Rajinikanth; Kirby, Raie Lene; Organic Letters; vol. 12; nb. 3; (2010); p. 556 - 559, View in Reaxys; Li, Xin; Zhang, Bo; Xi, Zhi-Guo; Luo, Sanzhong; Chenga, Jin-Pei; Advanced Synthesis and Catalysis; vol. 352; nb. 2-3; (2010); p. 416 - 424, View in Reaxys; Lu, Aidang; Wu, Ronghua; Wang, Youming; Zhou, Zhenghong; Wu, Guiping; Fang, Jianxin; Tang, Chuchi; European Journal of Organic Chemistry; nb. 11; (2010); p. 2057 - 2061, View in Reaxys 5 of 81
Comment (Pharmacological Data)
Bioactivities present
Wang, Yan-Xiang; Wang, Yu-Ping; Zhang, Hao; Kong, Wei-Jia; Li, Ying-Hong; Liu, Fei; Gao, Rong-Mei; Liu, Ting; Jiang, Jian-Dong; Song, Dan-Qing; Bioorganic and Medicinal Chemistry Letters; vol. 19; nb. 21; (2009); p. 6004 - 6008, View in Reaxys; Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys; Lu, Dengfu; Gong, Yuefa; Wang, Weizhou; Advanced Synthesis and Catalysis; vol. 352; nb. 4; (2010); p. 644 - 650, View in Reaxys; Liu, Jie; Li, Pinhua; Zhang, Yicheng; Ren, Kai; Wang, Lei; Wang, Guanwu; Chirality; vol. 22; nb. 4; (2010); p. 432 - 441, View in Reaxys; Enders, Dieter; Wang, Chuan; Mukanova, Meruyert; Greb, Andreas; Chemical Communications; vol. 46; nb. 14; (2010); p. 2447 - 2449, View in Reaxys; Habib, Pateliya Mujjamil; Kavala, Veerababurao; Kuo, Chun-Wei; Raihan, Mustafa J.; Yao, Ching-Fa; Tetrahedron; vol. 66; nb. 34; (2010); p. 7050 - 7056, View in Reaxys; Shumaila, Abdullah M. A.; Kusurkar, Radhika S.; Synthetic Communications; vol. 40; nb. 19; (2010); p. 2935 - 2940, View in Reaxys; Lu, Aidang; Liu, Tao; Wu, Ronghua; Wang, Youming; Zhou, Zhenghong; Wu, Guiping; Fang, Jianxin; Tang, Chuchi; European Journal of Organic Chemistry; nb. 30; (2010); p. 5777 - 5781, View in Reaxys; Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys; Zhang, Fanglin; Wei, Mohui; Dong, Junfang; Zhou, Yirong; Lu, Dengfu; Gong, Yuefa; Yang, Xiangliang; Advanced Synthesis and Catalysis; vol. 352; nb. 17; (2010); p. 2875 - 2880, View in Reaxys; Arai, Takayoshi; Yokoyama, Naota; Mishiro, Asami; Sato, Hiroyasu; Angewandte Chemie - International Edition; vol. 49; nb. 43; (2010); p. 7895 - 7898, View in Reaxys; Ayyagari, Narasimham; Jose, Deena; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 52; nb. 2; (2011); p. 258 - 262, View in Reaxys; Toth, Judit; Varadi, Linda; Dancso, Andras; Blasko, Gabor; Toke, Laszlo; Nyerges, Miklos; Synthesis; nb. 24; (2009); p. 4149 - 4158; Art.No: P10409SS, View in Reaxys; Lu, Aidang; Gao, Peng; Wu, Yang; Wang, Youming; Zhou, Zhenghong; Tang, Chuchi; Organic and Biomolecular Chemistry; vol. 7; nb. 15; (2009); p. 3141 - 3147, View in Reaxys; Shumaila, Abdullah M.A.; Puranik, Vedavati G.; Kusurkar, Radhika S.; Tetrahedron; vol. 67; nb. 5; (2011); p. 936 - 942, View in Reaxys; Lu, Aidang; Wu, Ronghua; Wang, Youming; Zhou, Zhenghong; Wu, Guiping; Fang, Jianxin; Tang, Chuchi; European Journal of Organic Chemistry; nb. 1; (2011); p. 122 - 127, View in Reaxys; Anwar, Shaik; Lee, Pei-Hsun; Chou, Tsai-Yung; Chang, Chihliang; Chen, Kwunmin; Tetrahedron; vol. 67; nb. 6; (2011); p. 1171 - 1177, View in Reaxys; Ji, Xiang; Tong, Haibo; Yuan, Yu; Synthetic Communications; vol. 41; nb. 3; (2011); p. 372 - 379, View in Reaxys; McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys; He, Peng; Liu, Xiaohua; Shi, Jian; Lin, Lili; Feng, Xiaoming; Organic Letters; vol. 13; nb. 5; (2011); p. 936 - 939, View in Reaxys 6 of 81
Comment (Pharmacological Data)
Bioactivities present
Lu, Aidang; Liu, Tao; Wu, Ronghua; Wang, Youming; Wu, Guiping; Zhou, Zhenghong; Fang, Jianxin; Tang, Chuchi; Journal of Organic Chemistry; vol. 76; nb. 10; (2011); p. 3872 - 3879, View in Reaxys; Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 2146, View in Reaxys; Kumar, Rahul; Namboothiri, Irishi N. N.; Organic Letters; vol. 13; nb. 15; (2011); p. 4016 4019, View in Reaxys; Hong, Deng; Zhu, Yuanxun; Li, Yao; Lin, Xufeng; Lu, Ping; Wang, Yanguang; Organic Letters; vol. 13; nb. 17; (2011); p. 4668 - 4671, View in Reaxys; Alagiri, Kaliyamoorthy; Kumara, Guralamatta Siddappa Ravi; Prabhu, Kandikere Ramaiah; Chemical Communications; vol. 47; nb. 42; (2011); p. 11787 11789, View in Reaxys; Chintala, Poornima; Ghosh, Subrata K.; Long, Elizabeth; Headley, Allan D.; Ni, Bukuo; Advanced Synthesis and Catalysis; vol. 353; nb. 16; (2011); p. 2905 - 2909, View in Reaxys; Alagiri, Kaliyamoorthy; Prabhu, Kandikere Ramaiah; Organic and Biomolecular Chemistry; vol. 10; nb. 4; (2012); p. 835 - 842, View in Reaxys; Alagiri, Kaliyamoorthy; Devadig, Pradeep; Prabhu, Kandikere R.; Tetrahedron Letters; vol. 53; nb. 12; (2012); p. 1456 - 1459, View in Reaxys; Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys; Singh, Kamal Nain; Singh, Paramjit; Singh, Pushpinder; Lal, Nand; Sharma, Sandeep Kumar; Bioorganic and Medicinal Chemistry Letters; vol. 22; nb. 13; (2012); p. 4225 - 4228, View in Reaxys; Ayyagari, Nar-
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
47/249
2016-07-13 00:31:19
asimham; Namboothiri, Irishi N.N.; Tetrahedron Asymmetry; vol. 23; nb. 8; (2012); p. 605 - 610, View in Reaxys; Qian, Wangke; Lu, Weijian; Sun, Haifeng; Li, Zeng; Zhu, Liyuan; Zhao, Rui; Zhang, Lei; Zhou, Shengbin; Zhou, Yu; Jiang, Hualiang; Zhen, Xuechu; Liu, Hong; Bioorganic and Medicinal Chemistry; vol. 20; nb. 15; (2012); p. 4862 - 4871, View in Reaxys; Huang, Wei-Gen; Wang, Heng-Shan; Huang, Guo-Bao; Wu, Yong-Ming; Pan, Ying-Ming; European Journal of Organic Chemistry; nb. 29; (2012); p. 5839 - 5843, View in Reaxys; Wang, Yao; Luo, Yong-Chun; Zhang, Hong-Bo; Xu, Peng-Fei; Organic and Biomolecular Chemistry; vol. 10; nb. 41; (2012); p. 8211 - 8215, View in Reaxys; Qiao, Yupu; He, Junpeng; Ni, Bukuo; Headley, Allan D.; Advanced Synthesis and Catalysis; vol. 354; nb. 14-15; (2012); p. 2849 - 2853,5, View in Reaxys; Qiao, Yupu; He, Junpeng; Ni, Bukuo; Headley, Allan D.; Advanced Synthesis and Catalysis; vol. 354; nb. 14-15; (2012); p. 2849 - 2853, View in Reaxys; Jin, Cheng-Yong; Wang, Yao; Liu, Yao-Zong; Shen, Chao; Xu, Peng-Fei; Journal of Organic Chemistry; vol. 77; nb. 24; (2012); p. 11307 - 11312, View in Reaxys; Nageswara Rao; Meshram; Tetrahedron Letters; vol. 54; nb. 10; (2013); p. 1315 - 1317, View in Reaxys; Sun, Haifeng; Zhu, Liyuan; Yang, Huicui; Qian, Wangke; Guo, Lin; Zhou, Shengbin; Gao, Bo; Li, Zeng; Zhou, Yu; Jiang, Hualiang; Chen, Kaixian; Zhen, Xuechu; Liu, Hong; Bioorganic and Medicinal Chemistry; vol. 21; nb. 4; (2013); p. 856 - 868, View in Reaxys; Zeng, Xiaofei; Ni, Qijian; Raabe, Gerhard; Enders, Dieter; Angewandte Chemie - International Edition; vol. 52; nb. 10; (2013); p. 2977 - 2980; Angew. Chem.; vol. 125; nb. 10; (2013); p. 3050 - 3054,5, View in Reaxys 7 of 81
Comment (Pharmacological Data)
Bioactivities present
Liang, Lei; Liu, Qiang; Zhang, Jianli; Wang, Fengyuan; Yuan, Yu; Research on Chemical Intermediates; vol. 39; nb. 5; (2013); p. 1957 - 1962, View in Reaxys; Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys; Mo, Lei; Tang, Huang; Yao, Zhu-Jun; Tetrahedron; vol. 69; nb. 33; (2013); p. 6897 - 6905, View in Reaxys; Keene, Craig; Kuerti, Laszlo; Synthesis (Germany); vol. 45; nb. 13; (2013); p. 1719 - 1729; Art.No: SS-2013-C0260-FA, View in Reaxys; Kasaplar, Pinar; Rodriguez-Escrich, Carles; Pericas, Miquel A.; Organic Letters; vol. 15; nb. 14; (2013); p. 3498 3501, View in Reaxys; Fan, Xinyuan; Rodriguez-Escrich, Carles; Sayalero, Sonia; Pericas, Miquel A.; Chemistry - A European Journal; vol. 19; nb. 33; (2013); p. 10814 - 10817, View in Reaxys; Cui, Bao-Dong; Han, WenYong; Wu, Zhi-Jun; Zhang, Xiao-Mei; Yuan, Wei-Cheng; Journal of Organic Chemistry; vol. 78; nb. 17; (2013); p. 8833 - 8839, View in Reaxys; Meshram; Satish Kumar, Nandigama; Nanubolu, Jagadeesh Babu; Chandrasekhara Rao; Nageswara Rao; Tetrahedron Letters; vol. 54; nb. 45; (2013); p. 5941 - 5944, View in Reaxys; Ceban, Victor; Hands, Kane; Meazza, Marta; Light, Mark E.; Rios, Ramon; Tetrahedron Letters; vol. 54; nb. 52; (2013); p. 7183 - 7187, View in Reaxys; Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys; Rapi, Zsolt; Demuth, Balazs; Keglevich, Gyoergy; Grun, Alajos; Drahos, Laszlo; Soti, Peter L.; Bako, Peter; Tetrahedron Asymmetry; vol. 25; nb. 2; (2014); p. 141 - 147, View in Reaxys; Vinayagam, Poopathy; Vishwanath, Manjunatha; Kesavan, Venkitasamy; Tetrahedron Asymmetry; vol. 25; nb. 6-7; (2014); p. 568 - 577, View in Reaxys; Amutha, Chinnadurai; Saravanan, Sivaperuman; Muthusubramanian, Shanmugam; Indian Journal of Chemistry - Section B Organic and Medicinal Chemistry; vol. 53; nb. 4; (2014); p. 377 - 383, View in Reaxys; Nakashima, Kosuke; Hirashima, Shin-Ichi; Kawada, Masahiro; Koseki, Yuji; Tada, Norihiro; Itoh, Akichika; Miura, Tsuyoshi; Tetrahedron Letters; vol. 55; nb. 16; (2014); p. 2703 - 2706, View in Reaxys; Wang, Ying-Chun; Xie, Yu-Yang; Qu, Hong-En; Wang, Heng-Shan; Pan, YingMing; Huang, Fu-Ping; Journal of Organic Chemistry; vol. 79; nb. 10; (2014); p. 4463 - 4469, View in Reaxys; Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys; Kim, Shinae; Kang, Ki-Tae; Kim, Sung-Gon; Tetrahedron; vol. 70; nb. 34; (2014); p. 5114 - 5121, View in Reaxys; Hahn, Robert; Raabe, Gerhard; Enders, Dieter; Organic Letters; vol. 16; nb. 14; (2014); p. 3636 - 3639, View in Reaxys; Kim, Shinae; Kang, Ki-Tae; Kim, Sung-Gon; Tetrahedron; vol. 70; nb. 34; (2014); p. 5114 - 5121, View in Reaxys; Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys 8 of 81
Comment (Pharmacological Data)
Bioactivities present
Rahmani-Nezhad, Samira; Safavi, Maliheh; Pordeli, Mahboobeh; Ardestani, Sussan Kabudanian; Khosravani, Leila; Pourshojaei, Yaghoub; Mahdavi, Mohammad; Emami, Saeed; Foroumadi, Alireza; Shafiee, Abbas; European Journal of Medicinal Chemistry; vol. 86; (2014); p. 562 - 569, View in Reaxys; Chen, I-Hua; Chang, Fang-Rong; Wu, Yang-Chang; Kung, Po-Hsiung; Wu, Chin-Chung; Biochimie; vol. 110; (2015); p. 81 - 92, View in Reaxys; Kiyokawa, Kensuke; Nagata, Takaya; Hayakawa, Junpei; Minakata, Satoshi; Chemistry - A European Journal; vol. 21; nb. 3; (2015); p. 1280 - 1285, View in Reaxys; Rao, Kadiyala Srinivasa; Trivedi, Rajiv; Kantam, M. Lakshmi; Synlett; vol. 26; nb. 2; (2015); p. 221 - 227; Art.No: ST-2014-D0721-L, View in Reaxys; Ghosh, Monoranjan; Mishra, Subhajit; Hajra, Alakananda; Journal of Organic Chemistry; vol. 80; nb. 10; (2015); p. 5364 - 5368, View in Reaxys; Tanabe, Genzoh; Sugano, Youta; Shirato, Miki; Sonoda, Naoki; Tsutsui, Nozomi; Morikawa, Toshio; Ninomiya, Kiyofumi; Yoshikawa, Masayuki; Muraoka, Osamu; Journal of Natural Products; vol. 78; nb. 7; (2015); p. 1536 - 1542, View in Reaxys; Flores-Ferrndiz, Jess; Stiven, Alexander; Sotorros, Lia; Gmez-Bengoa, Enrique; Chinchilla, Rafael; Tetrahedron Asymmetry; vol. 26; nb. 17; (2015); p. 970 - 979; Art.No: 59347, View in Reaxys; Chandrasekhara Rao; Satish Kumar; Meshram; RSC Advances; vol. 5; nb. 87; (2015); p. 70949 - 70957, View in Reaxys; Xue, Fengjun; Dong, Yahao; Hu, Peibo; Deng, Yanan; Wei, Yuping; RSC Advances; vol. 5; nb. 90; (2015); p. 73684 - 73691, View in Reaxys; Patent; Novo Nordisk A/S; Cellectis SA; Ekberg, Jenny; Hansson, Mattias; Doehn, Ulrik; Hess, Katja; Funa, Nina; US2015/247123; (2015); (A1) English, View in Reaxys; Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys; Radivojevic, Jelena; Maslak, Veselin; Minovska, Gordana; Senerovic, Lidija; Nikodinovic-Runic, Jasmina; O'Connor, Kevin; Jova-
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
48/249
2016-07-13 00:31:19
novic, Predrag; Savic, Vladimir; Tokic-Vujosevic, Zorana; ; vol. 4; nb. 105; (2014); p. 60502 - 60510, View in Reaxys; Wei, Chien-Kei; Chang, Fang-Rong; Hsieh, Pei-Wen; Wu, Chin-Chung; Life Sciences; vol. 143; (2015); p. 147 - 155, View in Reaxys; Patent; Janssen Biotech, Inc.; Rezania, Alireza; Fryer, Benjamin; (49 pag.); US9234178; (2016); (B2) English, View in Reaxys; Chen, Yanling; Sakamuru, Srilatha; Huang, Ruili; Reese, David H.; Xia, Menghang; Toxicology in Vitro; vol. 32; (2016); p. 287 - 296, View in Reaxys; Boyce, Gregory R.; Johnson, Jeffrey S.; Journal of Organic Chemistry; vol. 81; nb. 4; (2016); p. 1712 - 1717, View in Reaxys; Rao, Kadiyala Srinivasa; Ramesh, Pambala; Trivedi, Rajiv; Kantam, M. Lakshmi; Tetrahedron Letters; vol. 57; nb. 11; (2016); p. 1227 - 1231, View in Reaxys; An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 147, View in Reaxys; Zimmermann, Stephan; Hall, Laurence; Riley, Sean; Sorensen, Jesper; Amaro, Rommie E.; Schnaufer, Achim; Nucleic Acids Research; vol. 44; nb. 3; (2015); Art.No: E24, View in Reaxys; Yang, Chen; Zhang, En-Ge; Li, Xin; Cheng, Jin-Pei; Angewandte Chemie - International Edition; vol. 55; nb. 22; (2016); p. 6506 - 6510; Angew. Chem.; vol. 128; (2016); p. 6616 - 6620,5, View in Reaxys 9 of 81
Comment (Pharmacological Data)
physiological behaviour discussed
Chen, Yanling; Sakamuru, Srilatha; Huang, Ruili; Reese, David H.; Xia, Menghang; Toxicology in Vitro; vol. 32; (2016); p. 287 - 296, View in Reaxys 10 of 81
Comment (Pharmacological Data)
physiological behaviour discussed
Chen, I-Hua; Chang, Fang-Rong; Wu, Yang-Chang; Kung, Po-Hsiung; Wu, Chin-Chung; Biochimie; vol. 110; (2015); p. 81 - 92, View in Reaxys 11 of 81
Comment (Pharmacological Data)
physiological behaviour discussed
Patent; Novo Nordisk A/S; Cellectis SA; Ekberg, Jenny; Hansson, Mattias; Doehn, Ulrik; Hess, Katja; Funa, Nina; US2015/247123; (2015); (A1) English, View in Reaxys 12 of 81
Comment (Pharmacological Data)
physiological behaviour discussed
Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys 13 of 81
Comment (Pharmacological Data)
physiological behaviour discussed
Wei, Chien-Kei; Chang, Fang-Rong; Hsieh, Pei-Wen; Wu, Chin-Chung; Life Sciences; vol. 143; (2015); p. 147 155, View in Reaxys 14 of 81
Comment (Pharmacological Data)
physiological behaviour discussed
Zimmermann, Stephan; Hall, Laurence; Riley, Sean; Sorensen, Jesper; Amaro, Rommie E.; Schnaufer, Achim; Nucleic Acids Research; vol. 44; nb. 3; (2015); Art.No: E24, View in Reaxys 15 of 81
Effect (Pharmacological Data)
thrombin-induced platelet aggregation; inhibition of
Species or Test-System (Pharmacological Data)
blood of human
Further Details (Pharmacological Data)
inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 16 of 81
Effect (Pharmacological Data)
collagen-induced platelet aggregation; inhibition of
Species or Test-System (Pharmacological Data)
blood of human
Further Details (Pharmacological Data)
inhibitory concentration (IC)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
49/249
2016-07-13 00:31:19
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
7.2 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 17 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 26.5percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 18 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 4.9percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 19 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 10percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 20 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
50/249
2016-07-13 00:31:19
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 2.4percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 21 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 1.8percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 22 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 8.8percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 23 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 38.2percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
51/249
2016-07-13 00:31:19
24 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 33.2percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 25 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 25.1percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 26 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 28.9percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 27 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
52/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 28 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 12.5percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 29 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 34.9percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 30 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 18.2percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 31 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
53/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
inhibition = 19.1percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 32 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 23.2percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 33 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 2.5percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 34 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 22.7percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 35 of 81
Effect (Pharmacological Data)
cytotoxic
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
54/249
2016-07-13 00:31:19
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 8percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 36 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 7.9percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 37 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = -7.3percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 38 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = -4.9percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
55/249
2016-07-13 00:31:19
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 39 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 6.3percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 40 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 9.1percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 41 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 7.3percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 42 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 19percent at 20 μmol/l concentration; inhibitory concentration (IC)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
56/249
2016-07-13 00:31:19
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 43 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 24.7percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 44 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 0.5percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 45 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 22.1percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 46 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
57/249
2016-07-13 00:31:19
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 16percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 47 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 18.5percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 48 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 4.1percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 49 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 25.5percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
58/249
2016-07-13 00:31:19
50 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = -2.1percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 51 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 34.2percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 52 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 34.9percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 53 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 35.2percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
59/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 54 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 79.8percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 55 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 47.4percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 56 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 16.6percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 57 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
60/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
inhibition = 1.1percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 58 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 3.7percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 59 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 15.6percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 60 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 20percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 61 of 81
Effect (Pharmacological Data)
cytotoxic
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
61/249
2016-07-13 00:31:19
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 15.2percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 62 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 9.4percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 63 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 9.9percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 64 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = -0.1percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
62/249
2016-07-13 00:31:19
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 65 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 11.5percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 66 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 44.9percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 67 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 68 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 36.3percent at 20 μmol/l concentration; inhibitory concentration (IC)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
63/249
2016-07-13 00:31:19
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 69 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 20.4percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 70 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 8.3percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 71 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
non-malignant breast epithelial HBL-100 cells of human
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 8.2percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 20 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 72 of 81
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
breast cancer MDA-MB-231 cells of human
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
64/249
2016-07-13 00:31:19
Kind of Dosing (Pharmacological Data)
as solution in DMSO
Further Details (Pharmacological Data)
inhibition = 7percent at 20 μmol/l concentration; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
14 μmol/l
Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 73 of 81
Effect (Pharmacological Data)
antagonist
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human DAT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (6 μmol/l, 0.2 Ci/mmol) for 20 min and exposed to buffer containing title comp.; 4 min later cells superfused with buffer containing MDMA (3 μmol/l); 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
DAT: dopamine transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4-methylenedioxy-methamphetamine
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 74 of 81
Effect (Pharmacological Data)
antagonist
Species or Test-System (Pharmacological Data)
HEK293 cells expressing human SERT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (10 μmol/l, 0.4 Ci/mmol) for 30 min and exposed to buffer containing title comp.; 4 min later cells superfused with buffer containing MDMA (3 μmol/l); 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
SERT: serotonin transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4-methylenedioxy-methamphetamine
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 75 of 81
Effect (Pharmacological Data)
antagonist
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human NET
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (0.1 μmol/l, 29 Ci/mmol) for 20 min and exposed to buffer containing title comp.; 4 min later cells superfused with buffer containing MDMA (3 μmol/l); 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
NET: norepinephrine transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4methylenedioxy-methamphetamine
Comment (Pharmacological Data)
No effect
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
65/249
2016-07-13 00:31:19
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 76 of 81
Effect (Pharmacological Data)
transport; effect on
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human DAT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (6 μmol/l, 0.2 Ci/mmol) for 20 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
DAT: dopamine transporter; MPP(1+): 1-methyl-4-phenylpyridinium
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 77 of 81
Effect (Pharmacological Data)
transport; effect on
Species or Test-System (Pharmacological Data)
HEK293 cells expressing human SERT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (10 μmol/l, 0.4 Ci/mmol) for 30 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
SERT: serotonin transporter; MPP(1+): 1-methyl-4-phenylpyridinium
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 78 of 81
Effect (Pharmacological Data)
transport; effect on
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human NET
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (0.1 μmol/l, 29 Ci/mmol) for 20 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
NET: norepinephrine transporter; MPP(1+): 1-methyl-4-phenylpyridinium
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 79 of 81
Effect (Pharmacological Data)
transport; inhibition of
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human DAT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells preincubated with title comp. for 2 min, and uptake started by addition of <3H>dopamine (1 μmol/l, 0.14 Ci/mmol); after incubation for 2.5 min at 25 deg C radioactivity remaining in each well determined
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
66/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
nonspecific uptake determined in presence of mazindol (10 μmol/l); DAT: dopamine transporter
Results
title comp. slightly inhibited dopamine uptake
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 80 of 81
Effect (Pharmacological Data)
transport; inhibition of
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human NET
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells preincubated with title comp. for 2 min, and uptake started by addition of <3H>norepinephrine (1 μmol/l, 0.14 Ci/mmol); after incubation for 2.5 min at 25 deg C radioactivity remaining in each well determined
Further Details (Pharmacological Data)
nonspecific uptake determined in presence of mazindol (10 μmol/l); NET: norepinephrine transporter
Results
title comp. slightly inhibited norepinephrine uptake
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 81 of 81
Effect (Pharmacological Data)
transport; inhibition of
Species or Test-System (Pharmacological Data)
HEK-293 cells expressing human SERT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells preincubated with title comp. for 2 min, and uptake started by addition of <3H>serotonin (1 μmol/l, 0.14 Ci/mmol); after incubation for 2.5 min at 25 deg C radioactivity remaining in each well determined
Further Details (Pharmacological Data)
nonspecific uptake determined in presence of clomipramine (3 μmol/l); SERT: serotonin transporter
Results
title comp. slightly inhibited serotonin uptake (table)
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys
Reaxys ID 18660 View in Reaxys
3/183 CAS Registry Number: 5438-41-5 Chemical Name: 5-(2-nitroprop-1-enyl)benzo[d][1,3]dioxole; βnitroisosafrole; 3,4-methylenedioxy-β-methyl-β-nitrostyrene; 1(3,4-methylenedioxyphenyl)-2-nitropropene; 5-(2-nitropropenyl)benzo[1,3]dioxole; 5-(2-nitro-propenyl)-benzo[1,3]dioxole; 5(2-Nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 Type of Substance: heterocyclic InChI Key: CCEVJKZHAJJQJR-UHFFFAOYSA-N Note:
O O
N
O
O
Substance Label (10) Label References 3f
Ghosh, Monoranjan; Santra, Sougata; Mondal, Pallab; Kundu, Dhiman; Hajra, Alakananda; Chemistry An Asian Journal; vol. 10; nb. 11; (2015); p. 2525 - 2536, View in Reaxys
Compound 1
Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
67/249
2016-07-13 00:31:19
2
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys; Mitra, Shubhanjan; Bagdi, Avik Kumar; Majee, Adinath; Hajra, Alakananda; Tetrahedron Letters; vol. 54; nb. 36; (2013); p. 4982 - 4985, View in Reaxys
1
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys
6
Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys
Example 1
Patent; Alcon, Inc.; US7884228; (2011); (B1) English, View in Reaxys
entry 10
Ranu, Brindaban C.; Chakraborty, Rupak; Tetrahedron Letters; vol. 32; nb. 29; (1991); p. 3579 - 3582, View in Reaxys; Ranu; Chakraborty; Tetrahedron; vol. 48; nb. 25; (1992); p. 5317 - 5322, View in Reaxys
educt of 1b: NO2- Eijk, Peter, J. S. S van; Verboom, Willem; Veggel, Frank C. J. M. van; Reinhoudt, David N.; Harkema, alkene Sybolt; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 3; (1988); p. 142 - 151, View in Reaxys 3h
Karmarkar, Sanjay N.; Kelkar, Shriniwas L.; Wadia, Murzban S.; Synthesis; nb. 5; (1985); p. 510 - 512, View in Reaxys
8
Shono, Tatsuya; Hamaguchi, Hiroshi; Mikami, Hiroshi; Nogusa, Hideo; Kashimura, Shigenori; Journal of Organic Chemistry; vol. 48; nb. 12; (1983); p. 2103 - 2105, View in Reaxys
Patent-Specific Data (2) References Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys Related Structure (1) References Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys Melting Point (10) 1 of 10
Melting Point [°C]
98
Location
Page/Page column 15
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 2 of 10
Melting Point [°C]
94 - 98
Location
Page/Page column 16
Comment (Melting Point)
with decomposition
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 3 of 10
Melting Point [°C]
96 - 98
Solvent (Melting Point)
ethanol
Location
Page/Page column 16
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 4 of 10
Melting Point [°C]
94
Solvent (Melting Point)
benzene; hexane
Karmarkar, Sanjay N.; Kelkar, Shriniwas L.; Wadia, Murzban S.; Synthesis; nb. 5; (1985); p. 510 - 512, View in Reaxys 5 of 10
Melting Point [°C]
96 - 97
Solvent (Melting Point)
ethanol
Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys 6 of 10
Melting Point [°C]
95.5 - 96.5
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
68/249
2016-07-13 00:31:19
Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys 7 of 10
Melting Point [°C]
96
Biniecki et al.; Acta Poloniae Pharmaceutica; vol. 19; (1962); p. 31; Chem.Abstr.; vol. 58; nb. 3334; (1963), View in Reaxys 8 of 10
Melting Point [°C]
103
Solvent (Melting Point)
ethanol
Sugasawa; Sakurai; Yakugaku Zasshi; vol. 56; (1936); p. 563,566; Chem.Abstr.; (1939); p. 9307, View in Reaxys 9 of 10
Melting Point [°C]
103 - 104
Solvent (Melting Point)
ethanol
Bruckner; Justus Liebigs Annalen der Chemie; vol. 518; (1935); p. 226,241, View in Reaxys 10 of 10
Melting Point [°C]
98
Solvent (Melting Point)
ethanol
Angeli; Gazzetta Chimica Italiana; vol. 22 II; (1892); p. 464 Anm., View in Reaxys; Patent; Schmidt; Wagner; DE347818; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 14; p. 1438, View in Reaxys; Schmidt; Fischer; Chemische Berichte; vol. 53; (1920); p. 1539, View in Reaxys Crystal Property Description (5) Colour & Other Location Properties
References
yellow
Page/Page column 16
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys
yellow
Page/Page column 6
Patent; Alcon, Inc.; US7884228; (2011); (B1) English, View in Reaxys
Gelb
Bruckner; Justus Liebigs Annalen der Chemie; vol. 518; (1935); p. 226,241, View in Reaxys; Sugasawa; Sakurai; Yakugaku Zasshi; vol. 56; (1936); p. 563,566; Chem.Abstr.; (1939); p. 9307, View in Reaxys
gelbe Nadeln
Patent; Schmidt; Wagner; DE347818; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 14; p. 1438, View in Reaxys; Schmidt; Fischer; Chemische Berichte; vol. 53; (1920); p. 1539, View in Reaxys
gelbe Nadeln oder Schuppen
Angeli; Gazzetta Chimica Italiana; vol. 22 II; (1892); p. 464 Anm., View in Reaxys
Liquid/Liquid Systems (MCS) (1) 1 of 1
Description (Liquid/ Liquid Systems (MCS))
Distribution between solvent 1 + 2
Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys Solubility (MCS) (1) 1 of 1
Location
Page/Page column 16
Comment (Solubility (MCS))
soluble in ethanol, acetone, benzene, methanol, acetonitrile, chloroform, DMSO almost insoluble in water
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys NMR Spectroscopy (1) 1 of 1
Nucleus (NMR Spectroscopy)
1H
Location
Figure 1
Comment (NMR Spectroscopy)
Signals given
Patent; Alcon, Inc.; US7884228; (2011); (B1) English, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1
Description (UV/VIS Spectroscopy)
Absorption maxima
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
69/249
2016-07-13 00:31:19
Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1567 - 1580, View in Reaxys; Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys Pharmacological Data (16) 1 of 16
Comment (Pharmacological Data)
Bioactivities present
Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys; Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys; Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1567 - 1580, View in Reaxys; Angeli; Gazzetta Chimica Italiana; vol. 22 II; (1892); p. 464 Anm., View in Reaxys; Angeli; Rimini; Gazzetta Chimica Italiana; vol. 26 I; (1896); p. 10, View in Reaxys; Wallach; Mueller,H.; Justus Liebigs Annalen der Chemie; vol. 332; (1904); p. 331, View in Reaxys; Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys; Patent; Schmidt; Wagner; DE347818; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 14; p. 1438, View in Reaxys; Bruckner; Justus Liebigs Annalen der Chemie; vol. 518; (1935); p. 226,241, View in Reaxys; Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys; Sugasawa; Sakurai; Yakugaku Zasshi; vol. 56; (1936); p. 563,566; Chem.Abstr.; (1939); p. 9307, View in Reaxys; Govindan; Proceedings - Indian Academy of Sciences, Section A; nb. 44; (1956); p. 126,127, View in Reaxys; Schmidt; Fischer; Chemische Berichte; vol. 53; (1920); p. 1539, View in Reaxys; Benington et al.; Journal of Organic Chemistry; vol. 23; (1958); p. 1979,1980, View in Reaxys; Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys; Pearl; Beyer; Journal of Organic Chemistry; vol. 16; (1951); p. 216,217, 220, View in Reaxys; Biniecki et al.; Acta Poloniae Pharmaceutica; vol. 19; (1962); p. 31; Chem.Abstr.; vol. 58; nb. 3334; (1963), View in Reaxys; Karmarkar, Sanjay N.; Kelkar, Shriniwas L.; Wadia, Murzban S.; Synthesis; nb. 5; (1985); p. 510 - 512, View in Reaxys; Shono, Tatsuya; Hamaguchi, Hiroshi; Mikami, Hiroshi; Nogusa, Hideo; Kashimura, Shigenori; Journal of Organic Chemistry; vol. 48; nb. 12; (1983); p. 2103 - 2105, View in Reaxys; Ranu, Brindaban C.; Chakraborty, Rupak; Tetrahedron Letters; vol. 32; nb. 29; (1991); p. 3579 - 3582, View in Reaxys 2 of 16
Comment (Pharmacological Data)
Bioactivities present
Glennon, Richard A.; Raghupathi, Reva; Bartyzel, Piotr; Teitler, Milt; Leonhardt, Sigrun; Journal of Medicinal Chemistry; vol. 35; nb. 4; (1992); p. 734 - 740, View in Reaxys; Ranu; Chakraborty; Tetrahedron; vol. 48; nb. 25; (1992); p. 5317 - 5322, View in Reaxys; Eijk, Peter, J. S. S van; Verboom, Willem; Veggel, Frank C. J. M. van; Reinhoudt, David N.; Harkema, Sybolt; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 3; (1988); p. 142 - 151, View in Reaxys; Braun; Shulgin; Journal of Pharmaceutical Sciences; vol. 69; nb. 2; (1980); p. 192 195, View in Reaxys; Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys; Namboothiri, Irishi N. N.; Sahu, Bichismita; Gururaja, Guddeangadi N.; Mobin, Shaikh M.; Journal of Organic Chemistry; vol. 74; nb. 6; (2009); p. 2601 - 2604, View in Reaxys; Baumann, Marcus; Baxendale, Ian R.; Ley, Steven V.; Synlett; nb. 5; (2010); p. 749 - 752, View in Reaxys; Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys; Patent; Alcon, Inc.; US7884228; (2011); (B1) English, View in Reaxys; Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys; Mitra, Shubhanjan; Bagdi, Avik Kumar; Majee, Adinath; Hajra, Alakananda; Tetrahedron Letters; vol. 54; nb. 36; (2013); p. 4982 - 4985, View in Reaxys; Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys; Ghosh, Monoranjan; Santra, Sougata; Mondal, Pallab; Kundu, Dhiman; Hajra, Alakananda; Chemistry - An Asian Journal; vol. 10; nb. 11; (2015); p. 2525 - 2536, View in Reaxys; Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys; Ghosh, Monoranjan; Hajra, Alakananda; European Journal of Organic Chemistry; vol. 2015; nb. 35; (2015); p. 7836 - 7841, View in Reaxys 3 of 16
Comment (Pharmacological Data)
physiological behaviour discussed
Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys 4 of 16
Comment (Pharmacological Data)
physiological behaviour discussed
Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 5 of 16
Effect (Pharmacological Data)
enzyme activity; inhibition of
Species or Test-System (Pharmacological Data)
recombinant microsomal monoamine oxidase A of human
Concentration (Pharmacological Data)
<= 100 μmol/l
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
70/249
2016-07-13 00:31:19
Method (Pharmacological Data)
name of assay/method: Amplex Red® monoamine oxidase assay
Results
no effect
Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys 6 of 16
Effect (Pharmacological Data)
enzyme activity; inhibition of
Species or Test-System (Pharmacological Data)
recombinant microsomal monoamine oxidase B of human
Method (Pharmacological Data)
name of assay/method: Amplex Red® monoamine oxidase assay
Further Details (Pharmacological Data)
inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
8.32 μmol/l
Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys 7 of 16
Effect (Pharmacological Data)
enzyme activity; inhibition of
Species or Test-System (Pharmacological Data)
recombinant microsomal monoamine oxidase B of human
Method (Pharmacological Data)
name of assay/method: Amplex Red® monoamine oxidase assay
Results
molecular target: microsomal monoamine oxidase B; species of target: human
Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys 8 of 16
Effect (Pharmacological Data)
antagonist
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human DAT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (6 μmol/l, 0.2 Ci/mmol) for 20 min and exposed to buffer containing title comp.; 4 min later cells superfused with buffer containing MDMA (3 μmol/l); 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
DAT: dopamine transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4-methylenedioxy-methamphetamine
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 9 of 16
Effect (Pharmacological Data)
antagonist
Species or Test-System (Pharmacological Data)
HEK293 cells expressing human SERT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (10 μmol/l, 0.4 Ci/mmol) for 30 min and exposed to buffer containing title comp.; 4 min later cells superfused with buffer containing MDMA (3 μmol/l); 4-min fractions collected, and MPP(1+) efflux determined
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
71/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
SERT: serotonin transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4-methylenedioxy-methamphetamine
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 10 of 16
Effect (Pharmacological Data)
antagonist
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human NET
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (0.1 μmol/l, 29 Ci/mmol) for 20 min and exposed to buffer containing title comp.; 4 min later cells superfused with buffer containing MDMA (3 μmol/l); 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
NET: norepinephrine transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4methylenedioxy-methamphetamine
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 11 of 16
Effect (Pharmacological Data)
transport; effect on
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human DAT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (6 μmol/l, 0.2 Ci/mmol) for 20 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
DAT: dopamine transporter; MPP(1+): 1-methyl-4-phenylpyridinium
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 12 of 16
Effect (Pharmacological Data)
transport; effect on
Species or Test-System (Pharmacological Data)
HEK293 cells expressing human SERT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (10 μmol/l, 0.4 Ci/mmol) for 30 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
SERT: serotonin transporter; MPP(1+): 1-methyl-4-phenylpyridinium
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 13 of 16
Effect (Pharmacological Data)
transport; effect on
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human NET
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
72/249
2016-07-13 00:31:19
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells loaded with <3H>MPP(1+) (0.1 μmol/l, 29 Ci/mmol) for 20 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined
Further Details (Pharmacological Data)
NET: norepinephrine transporter; MPP(1+): 1-methyl-4-phenylpyridinium
Comment (Pharmacological Data)
No effect
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 14 of 16
Effect (Pharmacological Data)
transport; inhibition of
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human DAT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells preincubated with title comp. for 2 min, and uptake started by addition of <3H>dopamine (1 μmol/l, 0.14 Ci/mmol); after incubation for 2.5 min at 25 deg C radioactivity remaining in each well determined
Further Details (Pharmacological Data)
nonspecific uptake determined in presence of mazindol (10 μmol/l); DAT: dopamine transporter
Results
title comp. slightly inhibited dopamine uptake
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 15 of 16
Effect (Pharmacological Data)
transport; inhibition of
Species or Test-System (Pharmacological Data)
human neuroblastoma SK-N-MC cells expressing human NET
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells preincubated with title comp. for 2 min, and uptake started by addition of <3H>norepinephrine (1 μmol/l, 0.14 Ci/mmol); after incubation for 2.5 min at 25 deg C radioactivity remaining in each well determined
Further Details (Pharmacological Data)
nonspecific uptake determined in presence of mazindol (10 μmol/l); NET: norepinephrine transporter
Results
title comp. slightly inhibited norepinephrine uptake
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys 16 of 16
Effect (Pharmacological Data)
transport; inhibition of
Species or Test-System (Pharmacological Data)
HEK-293 cells expressing human SERT
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells preincubated with title comp. for 2 min, and uptake started by addition of <3H>serotonin (1 μmol/l, 0.14 Ci/mmol); after incubation for 2.5 min at 25 deg C radioactivity remaining in each well determined
Further Details (Pharmacological Data)
nonspecific uptake determined in presence of clomipramine (3 μmol/l); SERT: serotonin transporter
Results
title comp. slightly inhibited serotonin uptake (table)
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
73/249
2016-07-13 00:31:19
Reaxys ID 1622843 View in Reaxys
4/183 CAS Registry Number: 5438-41-5; 37629-56-4 Chemical Name: (E)-5-(2-nitroprop-1-en-1-yl)benzo[d][1,3]dioxole; (E)-5-(2-nitroprop-1-enyl)benzo[d][1,3]dioxole; 5-((E)-2nitroprop-1-enyl)benzo[d][1,3]dioxole; 1-(3,4-methylendioxyphenyl)-2-nitroprop-1-ene; 2-nitro-1-(3,4-methylenedioxyphenyl)-propane; 5-(2-nitropropenyl)benzo[1,3]dioxole; 3,4-methylenedioxy-β-methyl-β-nitrostyrene Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 Type of Substance: heterocyclic InChI Key: CCEVJKZHAJJQJR-QPJJXVBHSA-N Note:
O O
E
N
O
O
Substance Label (11) Label References 4a
Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 3198, View in Reaxys
1j
Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys
1q
Seebach,D. et al.; Chemische Berichte; vol. 108; (1975); p. 1924 - 1945, View in Reaxys; Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys
1; Compound 1
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys
VIb
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys
21
Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys
1
Akhtar, M. S.; Sharma, V. L.; Seth, M.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 27; nb. 1-12; (1988); p. 448 - 451, View in Reaxys
3f
Eijk, Peter J. S. S. van; Overkempe, Cor; Trompenaars, Willem P.; Reinhoudt, David N.; Manninen, Lauri M.; et al.; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 2; (1988); p. 27 - 39, View in Reaxys
table, entry 3, product
Sy, Wing-Wah; By, Arnold W.; Tetrahedron Letters; vol. 26; nb. 9; (1985); p. 1193 - 1196, View in Reaxys
3
Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 9; (1983); p. 914 - 915, View in Reaxys
15
Dore,J.-C.; Viel,C.; Chimica Therapeutica; vol. 7; (1972); p. 214 - 220, View in Reaxys
Patent-Specific Data (2) References Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys Patent; BIODIEM LTD; WO2004/76423; (2004); (A1) English, View in Reaxys Melting Point (4) 1 of 4
Melting Point [°C]
76 - 78
Solvent (Melting Point)
hexane; ethyl acetate
Location
supporting information
Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys 2 of 4
Melting Point [°C]
101 - 102
Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys 3 of 4
Melting Point [°C]
98 - 99
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
74/249
2016-07-13 00:31:19
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 4 of 4
Melting Point [°C]
98
Dore,J.-C.; Viel,C.; Chimica Therapeutica; vol. 7; (1972); p. 214 - 220, View in Reaxys Crystal Property Description (2) Colour & Other Location Properties yellow
supporting information
yellow
References Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys; Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 5504, View in Reaxys
Electrochemical Characteristics (1) 1 of 1
Description (Electrochemical Characteristics)
reduction potential
Solvent (Electrochemical Characteristics)
aq. phosphate buffer
pH-Value (Electrochemi- 7.3 cal Characteristics) Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys NMR Spectroscopy (6) 1 of 6
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
20
Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys 2 of 6
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys 3 of 6
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
75/249
2016-07-13 00:31:19
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys 4 of 6
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
26.84
Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys 5 of 6
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
500
Location
supporting information
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 6 of 6
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
26.9
Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys; Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys Mass Spectrometry (3) Description (Mass Location Spectrometry)
References
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
76/249
2016-07-13 00:31:19
high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum
supporting information
Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys
electrospray ionisation (ESI); spectrum
Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys
electron impact (EI); spectrum
Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys
Pharmacological Data (41) 1 of 41
Comment (Pharmacological Data)
Bioactivities present
Seebach,D. et al.; Chemische Berichte; vol. 108; (1975); p. 1924 - 1945, View in Reaxys; Dore,J.-C.; Viel,C.; Chimica Therapeutica; vol. 7; (1972); p. 214 - 220, View in Reaxys; Patent; BIODIEM LTD; WO2004/76423; (2004); (A1) English, View in Reaxys; Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys; Sy, Wing-Wah; By, Arnold W.; Tetrahedron Letters; vol. 26; nb. 9; (1985); p. 1193 - 1196, View in Reaxys; Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 9; (1983); p. 914 - 915, View in Reaxys; Akhtar, M. S.; Sharma, V. L.; Seth, M.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 27; nb. 1-12; (1988); p. 448 - 451, View in Reaxys; Eijk, Peter J. S. S. van; Overkempe, Cor; Trompenaars, Willem P.; Reinhoudt, David N.; Manninen, Lauri M.; et al.; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 2; (1988); p. 27 - 39, View in Reaxys; Eijk, Peter J. S. S. van; Overkempe, Cor; Trompenaars, Willem P.; Reinhoudt, David N.; Harkema, Sybolt; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 2; (1988); p. 40 - 51, View in Reaxys; Trautwein, Axel W.; Jung, Guenther; Tetrahedron Letters; vol. 39; nb. 45; (1998); p. 8263 - 8266, View in Reaxys; Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 4088, View in Reaxys; Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys; Patent; INSTITUT PASTEUR KOREA; INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE; BRODIN, Priscille; CHRISTOPHE, Thierry; NO, Zaesung; KIM, Jaeseung; GENOVESIO, Auguste; FENISTEIN, Denis, Philippe, Cedric; JEON, Heekyoung; EWANN, Fanny, Anne; KANG, Sunhee; LEE, Saeyeon; SEO, Min, Jung; PARK, Eunjung; CONTRERAS DOMINGUEZ, Monica; NAM, Ji, Youn; KIM, Eun, Hye; WO2010/3533; (2010); (A3) English, View in Reaxys; Alvarez, Guzman; Aguirre-Lopez, Beatriz; Varela, Javier; Cabrera, Mauricio; Merlino, Alicia; Lopez, Gloria V.; Lavaggi, Maria Laura; Porcal, Williams; Di Maio, Rossanna; Gonzalez, Mercedes; Cerecetto, Hugo; Cabrera, Nallely; Perez-Montfort, Ruy; De Gomez-Puyou, Marieta Tuena; GomezPuyou, Armando; European Journal of Medicinal Chemistry; vol. 45; nb. 12; (2010); p. 5767 - 5772, View in Reaxys; Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys; Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys; Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys; Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 5504, View in Reaxys; Joana Reis; Catarina Oliveira; Nuno Milhazes; Dolores Vina; Fernanda Borges; Letters in drug design & discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys 2 of 41
Effect (Pharmacological Data)
nucleocapsid-viral Fl-SL-2 DNA interaction; inhibition of
Species or Test-System (Pharmacological Data)
recombinant GST-p2-nucleocapsid of HIV-1
Further Details (Pharmacological Data)
fluorescence polarization-based competitive equilibrium binding assay; competition was carried out with Fl-SL-2 DNA (fluorescein-labeled stem loop DNA GGGGCGACTGGTGAGTACGCCCC)
Results
molecular target: GST-p2-nucleocapsid
Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys 3 of 41
Effect (Pharmacological Data)
nucleocapsid-viral Fl-SL-2 DNA interaction; inhibition of
Species or Test-System (Pharmacological Data)
recombinant GST-p2-nucleocapsid of HIV-1
Further Details (Pharmacological Data)
fluorescence polarization-based competitive equilibrium binding assay; competition was carried out with Fl-SL-2 DNA (fluorescein-labeled stem loop DNA GGGGCGACTGGTGAGTACGCCCC); binding affinity (Ki)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
77/249
2016-07-13 00:31:19
Type (Pharmacological Data)
Ki
Value of Type (Pharmacological Data)
18 nmol/l
Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys 4 of 41
Effect (Pharmacological Data)
viral replication; inhibition of
Species or Test-System (Pharmacological Data)
CD4+ T cells of human; genetically modified/infected with: p24 HIV-1LAI virus
Concentration (Pharmacological Data)
200 nmol/l
Kind of Dosing (Pharmacological Data)
title comp. in DMSO
Further Details (Pharmacological Data)
p24 flow cytometry
Results
molecular target: nucleocapsid
Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys 5 of 41
Effect (Pharmacological Data)
viral replication; inhibition of
Species or Test-System (Pharmacological Data)
CD4+ T cells of human; genetically modified/infected with: p24 HIV-1LAI virus
Concentration (Pharmacological Data)
200 nmol/l
Kind of Dosing (Pharmacological Data)
title comp. in DMSO
Further Details (Pharmacological Data)
p24 flow cytometry; inhibition rate related to: p24 HIV-1LAI virus
Type (Pharmacological Data)
inhibition rate
Value of Type (Pharmacological Data)
18 percent
Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys 6 of 41
Effect (Pharmacological Data)
enzyme activity; inhibition of
Species or Test-System (Pharmacological Data)
recombinant triosephosphate isomerase of Trypanosoma cruzi
Concentration (Pharmacological Data)
100 - 400 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in dimethyl sulfoxide
Type (Pharmacological Data)
inhibition rate
Value of Type (Pharmacological Data)
55 - 74 percent
Location
supporting information
Alvarez, Guzman; Aguirre-Lopez, Beatriz; Varela, Javier; Cabrera, Mauricio; Merlino, Alicia; Lopez, Gloria V.; Lavaggi, Maria Laura; Porcal, Williams; Di Maio, Rossanna; Gonzalez, Mercedes; Cerecetto, Hugo; Cabrera, Nallely; Perez-Montfort, Ruy; De Gomez-Puyou, Marieta Tuena; Gomez-Puyou, Armando; European Journal of Medicinal Chemistry; vol. 45; nb. 12; (2010); p. 5767 - 5772, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
78/249
2016-07-13 00:31:19
7 of 41
Effect (Pharmacological Data)
enzyme activity; inhibition of
Species or Test-System (Pharmacological Data)
recombinant triosephosphate isomerase of Trypanosoma cruzi
Concentration (Pharmacological Data)
100 - 400 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in dimethyl sulfoxide
Results
molecular target: triosephosphate isomerase
Location
supporting information
Alvarez, Guzman; Aguirre-Lopez, Beatriz; Varela, Javier; Cabrera, Mauricio; Merlino, Alicia; Lopez, Gloria V.; Lavaggi, Maria Laura; Porcal, Williams; Di Maio, Rossanna; Gonzalez, Mercedes; Cerecetto, Hugo; Cabrera, Nallely; Perez-Montfort, Ruy; De Gomez-Puyou, Marieta Tuena; Gomez-Puyou, Armando; European Journal of Medicinal Chemistry; vol. 45; nb. 12; (2010); p. 5767 - 5772, View in Reaxys 8 of 41
Effect (Pharmacological Data)
growth; inhibition of
Species or Test-System (Pharmacological Data)
Trypanosoma cruzi Tulahuen 2
Concentration (Pharmacological Data)
25 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in dimethyl sulfoxide
Further Details (Pharmacological Data)
epimastigotes were used
Type (Pharmacological Data)
inhibition rate
Value of Type (Pharmacological Data)
100 percent
Alvarez, Guzman; Aguirre-Lopez, Beatriz; Varela, Javier; Cabrera, Mauricio; Merlino, Alicia; Lopez, Gloria V.; Lavaggi, Maria Laura; Porcal, Williams; Di Maio, Rossanna; Gonzalez, Mercedes; Cerecetto, Hugo; Cabrera, Nallely; Perez-Montfort, Ruy; De Gomez-Puyou, Marieta Tuena; Gomez-Puyou, Armando; European Journal of Medicinal Chemistry; vol. 45; nb. 12; (2010); p. 5767 - 5772, View in Reaxys 9 of 41
Effect (Pharmacological Data)
growth; inhibition of
Species or Test-System (Pharmacological Data)
Trypanosoma cruzi Tulahuen 2
Kind of Dosing (Pharmacological Data)
dissolved in dimethyl sulfoxide
Further Details (Pharmacological Data)
epimastigotes were used; inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
5.1 μmol/l
Alvarez, Guzman; Aguirre-Lopez, Beatriz; Varela, Javier; Cabrera, Mauricio; Merlino, Alicia; Lopez, Gloria V.; Lavaggi, Maria Laura; Porcal, Williams; Di Maio, Rossanna; Gonzalez, Mercedes; Cerecetto, Hugo; Cabrera, Nallely; Perez-Montfort, Ruy; De Gomez-Puyou, Marieta Tuena; Gomez-Puyou, Armando; European Journal of Medicinal Chemistry; vol. 45; nb. 12; (2010); p. 5767 - 5772, View in Reaxys 10 of 41
Effect (Pharmacological Data)
protein tyrosine phosphatase (PTP1B); inhibition of
Species or Test-System (Pharmacological Data)
protein tyrosine phosphatase (PTP1B) of human
Method (Pharmacological Data)
Example 1 - PROTEIN TYROSINE PHOSPHATASE INHIBITIONInhibition of tyrosine phosphatases (TP) was investigated using the Promega ProFluor.(TM). Tyrosine Phos-
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
79/249
2016-07-13 00:31:19
phatase Assay. Specific inhibition of tyrosine phosphatase activity by a test compound is demonstrated by inhibition of dephosphorylation of a bisamide rhodaminellO-phosphopeptide. Release of fluorescent RIlO is achieved by addition of a protease which can only hydrolyse non-phosphorylated peptide. Fluorescence is therefore directly associated with phosphatase activity and inhibition of phosphatase activity is demonstrated by a decrease in fluorescence. Non-specific protease inhibition in the test compound is assessed by inhibition of protease digestion of a control peptide containing 7- amino-4-methyl-coumarin (AMC) and resultant reduction in the release of fluorescent AMC. If the test compound is a specific inhibitor of tyrosine phosphatase and not a protease inhibitor, fluorescence from the phosphor-peptide RIlO substrate will decrease and fluorescence from liberated AMC from the control peptide will remain high. If the test compound is a general protease inhibitor, fluorescence from both substrates will decrease. Compounds 1 and 7 were tested from 3.7 to 900 μM. Sodium vanadate (SV) (10 to 100 nM) was used as a positive inhibitor control. Compounds 1 and 7 and SV were assayed against 2 mU PTPlB (human) , 5 CD 45 (human) and 3 U Yop (bacterial) PTPs (all Calbiochem) . Enzymes were added to opaque 96-well plates (Greiner LIA Plates) containing Compound 1 or Compound 7or SV or no compound. A reaction mixture, containing bisamide rhodamine 110 phospho-peptide and a control AMC-peptide was added and the plate incubated in the dark at 240C for 1 hour. A protease reagent (Promega) was added to stop the phosphatase reaction and to digest the control peptide. The assay was incubated for a further 30 min at 24°C and then terminated by addition of a Stabiliser Solution (Promega) and the plate read on a fluorescent microplate reader (BMG Laboratories Fluostar Optima) with excitation at 485 nM and emission at 520 nM to detect rhodamine 110 and with excitation at 355 nM and emission at 460 nM to detect AMC fluorescence.ResultsCompounds 1 and 7 show dose-dependent inhibition of human tyrosine phosphatases, PTPlB and CD 45 and bacterial Yop phosphatase (Fig. 1) . Inhibitory concentrations (IC50 or ICi5) are shown in the table below. Compound 7 did not inhibit CD45.Yop is produced by Yersinia enterocolitica, an enteric Gram negative rod and significant pathogen causing enterocolitis in humans and animals .Bacterial protein phosphatases show a high degree of identity with human homologs and share the same catalytic mechanism. Genome homology searches have shown a general distribution of orthologs for eukaryotic protein tyrosine phosphatases in many bacteria. Bacterial PTPs are not as specialized as eukaryotic PTPs, show functional overlap, greater catalytic versatility and a heterogeneous distribution.Tyrosine phosphorylation influences gene regulation and enzyme activity in bacteria and is frequently related to stress resistance and virulence mechanisms of many pathogens. For example, YopH is an extracellular protein, encoded in a virulence plasmid in pathogenic strains of Yersinia pseudotuberculosis Compound 1 and 7 have an MIC against Y. enterocolitica of 16μg/mL and 64 μg/mL. Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
3 mmol/l
Results
title compound showed dose-dependent inhibition of human tyrosine phosphatases, PTP1B; figure given
Location
Page/Page column 37-40; Sheet 1/6
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 11 of 41
Effect (Pharmacological Data)
protein tyrosine phosphatase (CD45); inhibition of
Species or Test-System (Pharmacological Data)
protein tyrosine phosphatase (CD45) of human
Method (Pharmacological Data)
Example 1 - PROTEIN TYROSINE PHOSPHATASE INHIBITIONInhibition of tyrosine phosphatases (TP) was investigated using the Promega ProFluor.(TM). Tyrosine Phosphatase Assay. Specific inhibition of tyrosine phosphatase activity by a test compound is demonstrated by inhibition of dephosphorylation of a bisamide rhodaminellO-phosphopeptide. Release of fluorescent RIlO is achieved by addition of a protease which can only hydrolyse non-phosphorylated peptide. Fluorescence is therefore directly associated with phosphatase activity and inhibition of phosphatase activity is demonstrated by a decrease in fluorescence. Non-specific protease inhibition in the test compound is assessed by inhibition of protease digestion of a control peptide containing 7- amino-4-methyl-coumarin (AMC) and resultant reduction in the release of fluorescent AMC. If the test compound is a specific inhibitor of tyrosine phosphatase and not a protease inhibitor, fluorescence from the phosphor-peptide RIlO substrate will decrease and fluorescence from liberated AMC from the control peptide will remain high. If the test compound is a general protease inhibitor, fluorescence from both substrates will decrease. Compounds 1 and 7 were tested from 3.7 to 900 μM. Sodium vanadate (SV) (10 to 100 nM) was used as a positive inhibitor
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
80/249
2016-07-13 00:31:19
control. Compounds 1 and 7 and SV were assayed against 2 mU PTPlB (human) , 5 CD 45 (human) and 3 U Yop (bacterial) PTPs (all Calbiochem) . Enzymes were added to opaque 96-well plates (Greiner LIA Plates) containing Compound 1 or Compound 7or SV or no compound. A reaction mixture, containing bisamide rhodamine 110 phospho-peptide and a control AMC-peptide was added and the plate incubated in the dark at 240C for 1 hour. A protease reagent (Promega) was added to stop the phosphatase reaction and to digest the control peptide. The assay was incubated for a further 30 min at 24°C and then terminated by addition of a Stabiliser Solution (Promega) and the plate read on a fluorescent microplate reader (BMG Laboratories Fluostar Optima) with excitation at 485 nM and emission at 520 nM to detect rhodamine 110 and with excitation at 355 nM and emission at 460 nM to detect AMC fluorescence.ResultsCompounds 1 and 7 show dose-dependent inhibition of human tyrosine phosphatases, PTPlB and CD 45 and bacterial Yop phosphatase (Fig. 1) . Inhibitory concentrations (IC50 or ICi5) are shown in the table below. Compound 7 did not inhibit CD45.Yop is produced by Yersinia enterocolitica, an enteric Gram negative rod and significant pathogen causing enterocolitis in humans and animals .Bacterial protein phosphatases show a high degree of identity with human homologs and share the same catalytic mechanism. Genome homology searches have shown a general distribution of orthologs for eukaryotic protein tyrosine phosphatases in many bacteria. Bacterial PTPs are not as specialized as eukaryotic PTPs, show functional overlap, greater catalytic versatility and a heterogeneous distribution.Tyrosine phosphorylation influences gene regulation and enzyme activity in bacteria and is frequently related to stress resistance and virulence mechanisms of many pathogens. For example, YopH is an extracellular protein, encoded in a virulence plasmid in pathogenic strains of Yersinia pseudotuberculosis Compound 1 and 7 have an MIC against Y. enterocolitica of 16μg/mL and 64 μg/mL. Type (Pharmacological Data)
IC15
Value of Type (Pharmacological Data)
3.7 mmol/l
Results
title compound showed dose-dependent inhibition of human tyrosine phosphatases, CD45; figure given
Location
Page/Page column 37-40; Sheet 1/6
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 12 of 41
Effect (Pharmacological Data)
bacterial Yop phosphatase; inhibition of
Species or Test-System (Pharmacological Data)
Yop phosphatase produced by Yersinia enterocolitica
Method (Pharmacological Data)
Example 1 - PROTEIN TYROSINE PHOSPHATASE INHIBITIONInhibition of tyrosine phosphatases (TP) was investigated using the Promega ProFluor.(TM). Tyrosine Phosphatase Assay. Specific inhibition of tyrosine phosphatase activity by a test compound is demonstrated by inhibition of dephosphorylation of a bisamide rhodaminellO-phosphopeptide. Release of fluorescent RIlO is achieved by addition of a protease which can only hydrolyse non-phosphorylated peptide. Fluorescence is therefore directly associated with phosphatase activity and inhibition of phosphatase activity is demonstrated by a decrease in fluorescence. Non-specific protease inhibition in the test compound is assessed by inhibition of protease digestion of a control peptide containing 7- amino-4-methyl-coumarin (AMC) and resultant reduction in the release of fluorescent AMC. If the test compound is a specific inhibitor of tyrosine phosphatase and not a protease inhibitor, fluorescence from the phosphor-peptide RIlO substrate will decrease and fluorescence from liberated AMC from the control peptide will remain high. If the test compound is a general protease inhibitor, fluorescence from both substrates will decrease. Compounds 1 and 7 were tested from 3.7 to 900 μM. Sodium vanadate (SV) (10 to 100 nM) was used as a positive inhibitor control. Compounds 1 and 7 and SV were assayed against 2 mU PTPlB (human) , 5 CD 45 (human) and 3 U Yop (bacterial) PTPs (all Calbiochem) . Enzymes were added to opaque 96-well plates (Greiner LIA Plates) containing Compound 1 or Compound 7or SV or no compound. A reaction mixture, containing bisamide rhodamine 110 phospho-peptide and a control AMC-peptide was added and the plate incubated in the dark at 240C for 1 hour. A protease reagent (Promega) was added to stop the phosphatase reaction and to digest the control peptide. The assay was incubated for a further 30 min at 24°C and then terminated by addition of a Stabiliser Solution (Promega) and the plate read on a fluorescent microplate reader (BMG Laboratories Fluostar Optima) with excitation at 485 nM and emission at 520 nM to detect rhodamine 110 and with excitation at 355 nM and emission at 460 nM to detect AMC fluorescence.ResultsCompounds 1 and 7 show dose-dependent inhibition of human tyrosine phosphatases, PTPlB and CD 45 and bacterial Yop phosphatase (Fig. 1) . Inhibitory concentrations (IC50 or ICi5) are shown in the table below. Com-
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
81/249
2016-07-13 00:31:19
pound 7 did not inhibit CD45.Yop is produced by Yersinia enterocolitica, an enteric Gram negative rod and significant pathogen causing enterocolitis in humans and animals .Bacterial protein phosphatases show a high degree of identity with human homologs and share the same catalytic mechanism. Genome homology searches have shown a general distribution of orthologs for eukaryotic protein tyrosine phosphatases in many bacteria. Bacterial PTPs are not as specialized as eukaryotic PTPs, show functional overlap, greater catalytic versatility and a heterogeneous distribution.Tyrosine phosphorylation influences gene regulation and enzyme activity in bacteria and is frequently related to stress resistance and virulence mechanisms of many pathogens. For example, YopH is an extracellular protein, encoded in a virulence plasmid in pathogenic strains of Yersinia pseudotuberculosis Compound 1 and 7 have an MIC against Y. enterocolitica of 16μg/mL and 64 μg/mL. Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
27 mmol/l
Results
title compound showed dose-dependent inhibition of bacterial Yop phosphatase; figure given
Location
Page/Page column 37-40; Sheet 1/6
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 13 of 41
Effect (Pharmacological Data)
bacterial Yop phosphatase; inhibition of
Species or Test-System (Pharmacological Data)
Yop phosphatase produced by Yersinia enterocolitica of Yersinia enterocolitica
Method (Pharmacological Data)
Example 1 - PROTEIN TYROSINE PHOSPHATASE INHIBITIONInhibition of tyrosine phosphatases (TP) was investigated using the Promega ProFluor.(TM). Tyrosine Phosphatase Assay. Specific inhibition of tyrosine phosphatase activity by a test compound is demonstrated by inhibition of dephosphorylation of a bisamide rhodaminellO-phosphopeptide. Release of fluorescent RIlO is achieved by addition of a protease which can only hydrolyse non-phosphorylated peptide. Fluorescence is therefore directly associated with phosphatase activity and inhibition of phosphatase activity is demonstrated by a decrease in fluorescence. Non-specific protease inhibition in the test compound is assessed by inhibition of protease digestion of a control peptide containing 7- amino-4-methyl-coumarin (AMC) and resultant reduction in the release of fluorescent AMC. If the test compound is a specific inhibitor of tyrosine phosphatase and not a protease inhibitor, fluorescence from the phosphor-peptide RIlO substrate will decrease and fluorescence from liberated AMC from the control peptide will remain high. If the test compound is a general protease inhibitor, fluorescence from both substrates will decrease. Compounds 1 and 7 were tested from 3.7 to 900 μM. Sodium vanadate (SV) (10 to 100 nM) was used as a positive inhibitor control. Compounds 1 and 7 and SV were assayed against 2 mU PTPlB (human) , 5 CD 45 (human) and 3 U Yop (bacterial) PTPs (all Calbiochem) . Enzymes were added to opaque 96-well plates (Greiner LIA Plates) containing Compound 1 or Compound 7or SV or no compound. A reaction mixture, containing bisamide rhodamine 110 phospho-peptide and a control AMC-peptide was added and the plate incubated in the dark at 240C for 1 hour. A protease reagent (Promega) was added to stop the phosphatase reaction and to digest the control peptide. The assay was incubated for a further 30 min at 24°C and then terminated by addition of a Stabiliser Solution (Promega) and the plate read on a fluorescent microplate reader (BMG Laboratories Fluostar Optima) with excitation at 485 nM and emission at 520 nM to detect rhodamine 110 and with excitation at 355 nM and emission at 460 nM to detect AMC fluorescence.ResultsCompounds 1 and 7 show dose-dependent inhibition of human tyrosine phosphatases, PTPlB and CD 45 and bacterial Yop phosphatase (Fig. 1) . Inhibitory concentrations (IC50 or ICi5) are shown in the table below. Compound 7 did not inhibit CD45.Yop is produced by Yersinia enterocolitica, an enteric Gram negative rod and significant pathogen causing enterocolitis in humans and animals .Bacterial protein phosphatases show a high degree of identity with human homologs and share the same catalytic mechanism. Genome homology searches have shown a general distribution of orthologs for eukaryotic protein tyrosine phosphatases in many bacteria. Bacterial PTPs are not as specialized as eukaryotic PTPs, show functional overlap, greater catalytic versatility and a heterogeneous distribution.Tyrosine phosphorylation influences gene regulation and enzyme activity in bacteria and is frequently related to stress resistance and virulence mechanisms of many pathogens. For example, YopH is an extracellular protein, encoded in a virulence plasmid in pathogenic strains of Yersinia pseudotuberculosis Compound 1 and 7 have an MIC against Y. enterocolitica of 16μg/mL and 64 μg/mL.
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
82/249
2016-07-13 00:31:19
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
16 mg/ml
Location
Page/Page column 38-39
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 14 of 41
Effect (Pharmacological Data)
cancer cell growth; inhibition of
Species or Test-System (Pharmacological Data)
A549 non small cell lung cancer cell of human
Method (Pharmacological Data)
Example 2 - ANTI-TUMOUR ACTIVITYSJRB Assay Human non small cell lung cancer cell line or human neonatal foreskin fibroblasts (normal cells) were seeded (in 100 μl) into the wells of two 96-well culture plates and incubated overnight at 370C in a humidified 5percent CO2, 95 percent air atmosphere. One plate was then fixed with TCA (as a measure of cells present at the time of addition of drug) . Compound 1 was dissolved in DMSO and diluted in medium to 10 concentrations spanning a 4-log range. 100 μl of each drug solution was then added to each of 5 wells of the second plate . The plate was then incubated for a further 72 hr after which viable cells are measured using the sulforhodamine B assay (Skehan et al. , 1990; Monks et al., 1991) . Briefly, the cells were fixed with 10 percent cold trichloroacetic acid for 1 hr at 40C and the plates then rinsed with distilled water, left to air dry and then stained with 0.4 percent SRB (Aldrich) in 1percent acetic acid (v/v) for 30 min. Unbound dye was removed by washing twice with distilled water and finally with 1 percent acetic acid. Protein- bound dye is then solubilised in 10 mM unbuffered Tris base and the absorbance read at 550 nm using an automatic plate reader. The mean absorbance for time zero growth (Tz) , control growth (C) and test drug growth (Ti) is determined and the percentage growth is calculated at each drug concentration as : [ (Ti-Tz) / (C-Tz)] x 100 for concentrations where Ti > Tz [(Ti-Tz) /Tz] x 100 for concentrations where Ti 50) : is then determined as the drug concentration that results in a 50 percent reduction in the net cellular protein increase in control cells following drug incubation.ResultsGrowth inhibitionThe mean GI50 for Compound 1 for human non small cell lung cancer cell line (1.7 μM) was seven-fold lower than its activity against normal human neonatal foreskin fibroblasts (12.5 μM) . This is an acceptable differential toxicity for cytotoxic agents.Growth inhibition of cancer cell line and normal cell line by Compound 1 using the Sulforhodamine B (SRB) assay. GI50 is the concentration required to inhibit cell growth by 50percent.1 A549 human non small cell lung cancer cell2 FF human neonatal foreskin fibroblasts (normal)The results are shown in Figs 2 to 6.
Type (Pharmacological Data)
GI50
Value of Type (Pharmacological Data)
1.4 - 2.1 μmol/l
Results
title compound showed the growth inhibition of human non small cell lung carcinoma (A549) by seven-fold lower than normal cell lines; figure given
Location
Page/Page column 37; 40-41; Sheet 2/6
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 15 of 41
Effect (Pharmacological Data)
cancer cell growth; inhibition of
Species or Test-System (Pharmacological Data)
FF neonatal foreskin fibroblasts (normal) of human
Method (Pharmacological Data)
Example 2 - ANTI-TUMOUR ACTIVITYSJRB Assay Human non small cell lung cancer cell line or human neonatal foreskin fibroblasts (normal cells) were seeded (in 100 μl) into the wells of two 96-well culture plates and incubated overnight at 370C in a humidified 5percent CO2, 95 percent air atmosphere. One plate was then fixed with TCA (as a measure of cells present at the time of addition of drug) . Compound 1 was dissolved in DMSO and diluted in medium to 10 concentrations spanning a 4-log range. 100 μl of each drug solution was then added to each of 5 wells of the second plate . The plate was then incubated for a further 72 hr after which viable cells are measured using the sulforhodamine B assay (Skehan et al. , 1990; Monks et al., 1991) . Briefly, the cells were fixed with 10 percent cold trichloroacetic acid for 1 hr at 40C and the plates then rinsed with distilled water, left to air dry and then stained with 0.4 percent SRB (Aldrich) in 1percent acetic acid (v/v) for 30 min. Unbound dye was removed by washing twice with distilled water and finally with 1 percent acetic acid. Protein- bound dye is then solubilised in 10 mM unbuffered Tris
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
83/249
2016-07-13 00:31:19
base and the absorbance read at 550 nm using an automatic plate reader. The mean absorbance for time zero growth (Tz) , control growth (C) and test drug growth (Ti) is determined and the percentage growth is calculated at each drug concentration as : [ (Ti-Tz) / (C-Tz)] x 100 for concentrations where Ti > Tz [(Ti-Tz) /Tz] x 100 for concentrations where Ti 50) : is then determined as the drug concentration that results in a 50 percent reduction in the net cellular protein increase in control cells following drug incubation.ResultsGrowth inhibitionThe mean GI50 for Compound 1 for human non small cell lung cancer cell line (1.7 μM) was seven-fold lower than its activity against normal human neonatal foreskin fibroblasts (12.5 μM) . This is an acceptable differential toxicity for cytotoxic agents.Growth inhibition of cancer cell line and normal cell line by Compound 1 using the Sulforhodamine B (SRB) assay. GI50 is the concentration required to inhibit cell growth by 50percent.1 A549 human non small cell lung cancer cell2 FF human neonatal foreskin fibroblasts (normal)The results are shown in Figs 2 to 6. Type (Pharmacological Data)
GI50
Value of Type (Pharmacological Data)
10 - 15 μmol/l
Results
title compound showed the growth inhibition of human neonatal foreskin fibroblasts and normal cell lines; figure given
Location
Page/Page column 37; 40-41; Sheet 3/6-4/6
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 16 of 41
Effect (Pharmacological Data)
toxic
Species or Test-System (Pharmacological Data)
Sprague-Dawley rat
Route of Application
peroral
Method (Pharmacological Data)
Example 3 - TOXICOLOGY AND PHARMACOKINETICSSummary of acute toxicity Compound 1 in aqueous suspension is relatively non toxic . Solvents such as DMSO and ethanol increase toxicity.Compound 1 in aqueous suspension by oral administration is not toxic to rats up to 1200 mg/kg. 1500 mg/kg is toxic.Absorption from the gastrointestinal tract in rats is low. An oral dose of 500 mg/kg aqueous suspension producing blood levels of 16 25 μg/ml .Compound 1 in aqueous suspension by oral administration is non toxic to dayold chicks at > 400 mg/kg .Compound 1 in DMSO or ethanol given orally to chicks is not toxic at 125 mg/kg and toxic at 150 mg/kg.Compound 1 in DMSO given intraperitonealIy to mice is toxic at 50 mg/kg and non-toxic at 40 mg/kg. Experimental Detail on Toxicology and Pharmacokinetic studiesExperimental Detail on Toxicology and Pharmacokinetic StudiesDosing range test of Compound 1 in ratThe aim of this example was to establish absorption and blood levels of Compound 1 in the rat after a single dose oral administration. Sprague-Dawley rats (6 w/o) were acclimatised for 6 days in the Animal Facility under standardized environmental conditions (22°C +/- 3°C, rel hum 30-70percent, artificial light, 12 h light/12 h dark) . Rats were fed a conventional laboratory diet with food and water ad lib and caged 5 rats per cage. Compound 1 was prepared as an aqueous suspension in sterile LPW. At higher concentrations the suspension was sonicated to reduce particle size sufficiently to pass through the gavage needle . Compound 1 suspensions and the water control were administered at approx 100 mL/kg. One control and five treatment rats were weighed immediately before each dose administration, the dose volume calculated and the dose delivered by gavage (22 gauge stainless steel, smooth- balled end attached to a syringe) . Approximately 100-200 μL of blood (microfuge tube) was removed from the tail at 4 and 8 hours. Tails were prewarmed using a heat lamp and snipped at the tip with a large scalpel . Blood was massaged into a microfuge tube . Twenty four hour blood samples were not attempted because of the difficulty of snipping scarred tails and the distress caused to rats. Blood was allowed to clot, centrifuged in a microfuge for 3 minutes and the serum separated and stored at -2O0C.Compound 1 was extracted (x2) from serum by toluene and absorbance measured at 370 nm (Hitachi U2000) . A spiked control using 100 μg/mL Compound 1 in 50percent methanol/water (V/V) and untreated controls were also assayed.Animals were observed twice daily for 7 days and all observations recorded individually for each animal. Animals were not weighed after the initial weighing. Sacrifice and necropsy was performed at 7 days. Animals were euthanized by carbon dioxide.Gross pathology was recorded and samples of heart, lung, liver, kidney, stomach, spleen, duodenum and colon removed (10percent formalin) for histology. Compound 1 was tested at 100, 500 (fasted and non fasted groups) , 1000 and 1250 mg/kg. At doses of 100 and 500 mg/kg there were no adverse symptoms over the 7-day study period. Tissues at necropsy looked normal.After 1000 mg/kg one rat was euthanised approx 28 hrs showed discharge around the nose and mouth, blood in urine and a hunched position in
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
84/249
2016-07-13 00:31:19
the cage. Post mortem examination revealed spotty and congested lung and a bloated stomach. Liver heart and kidney appeared normal. Histology revealed early changes indicative of dilated cardiomyopathy due possibly to toxaemia or chemical interaction. Other rats showed no visible lesions except for some lung congestion.One rat dosed at 1250 mg/kg was distressed and euthanized 8 hours later. Lung congestion was noted. Histology showed mild congestion in the liver, lung and of myocardium associated with some sinusoidal cell degeneration. Other rats in the group had no visible lesions and appeared to tolerate treatment.Compound 1 appears to be well tolerated at dose be Results
title compound in aqueous suspension is not toxic up to 1200 mg/kg; 1500 mg/kg is toxic; at doses of 100 and 500 mg/kg there were no adverse symptoms over the 7-day period; after 1000 mg/kg one rat was euthanised approx 28 hrs showed discharge around the nose and mouth, blood in urine and a hunched position in the cage; one rat dosed at 1250 mg/kg was distressed and euthanized 8 hrs later; other rats showed no visible lesions; title compound appears to be well tolerated at dose below 1000 mg/kg
Location
Page/Page column 41-44
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 17 of 41
Effect (Pharmacological Data)
toxic
Species or Test-System (Pharmacological Data)
broiler chicken
Route of Application
peroral
Method (Pharmacological Data)
28 day repeat dose toxicity study in broiler chickensExperimental protocolThis study investigated the cumulative toxicity of Compound 1 for up to 28 days oral dosing and the distribution of Compound 1 at weekly intervals. Blood and tissue samples were collected after 7, 14, 21 and 28 days daily dosing and 4 days after withdrawal of Compound 1.This experiment was conducted in two stages as shown. Stage A commenced dosing at 2 days old and Stage B at 5 days old.Table 2. Dosing schedule for 28 day toxicity study in chickensTreatment Sampling at days NumberCompound 1 of mg/kg birds bw/day- 7 14 21 28 32Stage A 0 5 5 5 5 5 2550 5 5 5 5 5 25Stage B 0 5 5 5 5 5 25100 5 5 5 5 5 25200 5 5 5 5 5 25400 5 5 5 5 5 25150Administration of Compound 1All doses of Compound 1 were administered orally using an automatic pipette in volumes less than lmL/lOOg body weight. Doses, based on the mean group weight for the group were administered by separating the beak and inserting the plastic tip (1 mL plastic disposable pipette tips) . Compound 1 was dissolved in canola oil in stock solutions of 12.5, 25 and 50 mg/mL. Stock solution 12.5 mg/ml required heating to 40° C and 25 45 mg/ml required heating to 50°C to dissolve Compound 1. Dosing solutions were prepared immediately before use and kept at 40 °C and administered warm. Control groups received an equal volume of canola oil . ResultsAll chicks appeared well, with no adverse reactions and behaved normally for all doses over the 28 day- treatment period. The only observable differences between treatment groups were in weight gain and mortality. A very modest weight gain over canolatreated control was observed for 50 mg/kg bw, particularly after the 5 day withdrawal period, however this was not significant Dosing at 100 to 400 mg/kg/day showed a decreased weight gain compared to untreated controls, the 200 mg/kg dose showing the lowest weight gain. 100 mg/kg (-6.3percent); 200 mg/kg (- 32.6percent); 400 mg/kg (-15.3percent).No mortality was observed for 50 and 100 mg/kg doses and comparable mortality of 3/25 birds for 200 and 400 mg/kg bw. At necropsy the only observable gross pathology was that birds receiving 200 and 400 mg/kg bw had pale livers
Results
all chicks appeared well for all doses of title compound over the 28 day-treatment period; dosing at 100 to 400 mg/kg/day showed a decreased weight gain compared to untreated controls, the 200 mg/kg dose showing the lowest weight gain, 100 mg/kg (-6.3percent); 200 mg/kg (-32.6percent); 400 mg/kg (-15.3percent); no mortality was observed for 50 and 100 mg/kg doses and comparable mortality of 3/25 birds for 200 and 400 mg/kg bw; title compound in aqueous suspension is non toxic to day-old chicks at > 400 mg/kg
Location
Page/Page column 42; 45-46
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 18 of 41
Effect (Pharmacological Data)
toxic
Species or Test-System (Pharmacological Data)
Balb/c nude mouse
Sex
female
Route of Application
intravenous
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
85/249
2016-07-13 00:31:19
Method (Pharmacological Data)
IV repeat dose in nude mice Compound 1 was formulated in 12.5percent DMSO, 12.5percent ethanol, 12.5percent Cremophor EL, 62.5percent saline at concentrations of 0.2- 4 mg/mL or in 15percent DMSO, 12.5percent ethanol, 12.5percent Cremophor EL, 60 percent saline at a concentration of 5 mg/mL.MethodsGroups of two female Balb/c nude mice (Animal Resources Centre, Western Australia) were given compound 1 (0. 1. 5. 10 15, 20 and 25 mg/kg) at a rate of 0.05 ml/10 g body weight) by intravenous injection twice weekly for three weeks. Mice were weighed daily and watched closely for signs of toxicity. Animals were given a feed supplement (Ensure) daily..Results No Maximum Tolerated Dose was established due to the inability to solubilise compound 1 for IV delivery of concentrations higher than 25 mg/kg mouse weight.All doses up to 25 mg/kg did not adversely affect mouse weight or general health and wellbeing. The observed increase in mouse weight is likely to be due to the effects of the feed supplement.The results using Vehicle 1 (12.5 percent DMSO, 12.5 percent ethanol, 12.5 percent Cremophor EL, 62.5 percent saline) are summarised in Figs . 8 and 9.
Results
No Maximum Tolerated Dose was established due to the inability to solubilise title compound for IV delivery of concentrations higher than 25 mg/kg mouse weight; all doses up to 25 mg/kg did not adversely affect mouse weight or general health and wellbeing; the observed increase in mouse weight is likely to be due to the effects of the feed supplement; figure given
Location
Page/Page column 37; 46-47; Sheet 5/6-6/6
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 19 of 41
Effect (Pharmacological Data)
pharmacokinetics
Species or Test-System (Pharmacological Data)
Sprague-Dawley rat
Sex
male
Route of Application
peroral
Method (Pharmacological Data)
GLP PharmacokineticsPharmacokinetics of Compound 1 following a single oral dose in the rat. This study was conducted in compliance with GLP and in accordance with OECD guidelines.Study designFor oral dosing Compound 1 was formulated as a suspension in 1percent CMC 0.05percent tween 80, and animals received a single oral dose at 1000mg/ kg.Three blood samples were collected at each timepoint at; 0.25, 0.5, 1, 2, 4, 8, 12 24 hrs post dose.Compound 1 levels in the plasma were determined by an LC/MS assay. The LLOQ was 200 ng/mLThe toxicokinetic parameters determined from the mean plasma concentration profile were:> maximum concentration (Cmax)> time to maximal concentration (Tmax) > area under the curve to last measurable concentration (AUCt)> apparent terminal elimination rate (KeI) > terminal half-life (Thalf) , calculated as Thalf = Ln (2) / KeI> area under the curve extrapolated to infinite time (AUCinf) , calculated as AUCinf = AUCt + Clast/Kel where Clast is the last measurable concentration> clearance (CL) , calculated as CL = Dose / AUCinf ^- volume of distribution (Vd) , calculated as CL/KelResults For an oral dose level of 1000 mg/kg of Compound 1 in male Sprague-Dawley rats, the maximum concentration (Cmax) was determined to be 3073 ng/mL at 2 hours post-dose. The apparent elimination half-life (Thalf) was 5.85 hours. The area under the curve extrapolated to infinite time (AUCinf) was 38628 ng*h/mL with clearance (CL) of 25.9L/h/kg and volume of distribution (Vd) of 218 L/kg (Table 3 ; Figure 7) . Table 3. Pharmacokinetic Parameters of Compound 1
Results
pharmacokinetic parameters of title compound: dose - 1000 mg/kg, maximum concentration (Cmax) - 3073 ng/mL, time to maximal concentration (Tmax) - 2.0 h, area under the curve to last measurable concentration (AUC (0-24)) - 36502 ng*h/mL, apparent terminal elimination rate (Kel) - 0.119 1/h, terminal half-life (Thalf) - 5.85 h, area under the curve extrapolated to infinite time (AUCinf) - 38628 ng*h/mL, clearance (CL) - 25.9L/h/kg, volume of distribution (Vd) - 218 L/kg; figure given
Location
Page/Page column 37; 47-49; Sheet 4/6
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 20 of 41
Effect (Pharmacological Data)
toxic
Species or Test-System (Pharmacological Data)
rat
Sex
male and female
Route of Application
peroral
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
86/249
2016-07-13 00:31:19
Method (Pharmacological Data)
GLP toxicologyAcute oral toxicity in the ratThis study was conducted in compliance with GLP and in accordance with OECD guidelines.Study designCompound 1 was formulated as a suspension in 1percent CMC 0.05percent tween 80.Each animal received a single dose by oral gavage (0, 500, 1000, 1500 2000 mg/kg) according to the following schedule .Table 4. Dosing schedule for acute oral toxicity studyAnimals were observed daily for 14 days for morbidity, mortality and overt signs of toxicity. On Day 14 all animals were sacrificed and subject to a gross necropsy.ResultsThere were no deaths and no significant morbidity at any dose.Clinical signs were transient and included red staining in the urogenital region, soft faeces and poor grooming. There were no significant findings at necropsy.The maximum tolerated oral dose is greater than 2g/kg.
Results
there were no deaths and no significant morbidity at dose (0-2000 mg/kg) of title compound; clinical signs were transient and included red staining in the urogenital region, soft faeces and poor grooming; there were no significant findings at necropsy; the maximum tolerated oral dose is greater than 2g/kg
Location
Page/Page column 50
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 21 of 41
Effect (Pharmacological Data)
toxic
Species or Test-System (Pharmacological Data)
rat
Sex
male and female
Route of Application
intravenous
Method (Pharmacological Data)
Acute intravenous toxicity in the ratThis study was conducted in compliance with GLP and in accordance with OECD guidelines .Study designCompound 1 was formulated as a solution in 100percent DMSO. Each animal received a single dose by intravenous injection in the lateral tail vein (0, 0.5, 1 and 5 mg/kg) in a volume of 1 mL/kg, according to the schedule in table 32. All animals were observed daily for overt signs of toxicity for 7 days . On day 8 all surviving animals were sacrificed and subject to gross necropsy examination. Histopathology of the liver, kidney, heart, spleen and lung were conducted in 1 male and 1 female rat at 0.5 and 1 mg/kg, and in 3 male rats at 5 mg/kg.Table 5. Dosing schedule for acute intravenous study in the ratResultsThe vehicle group did not show any clinical signs of toxicity during the study . There were no other mortalities during the study. All animals treated with Compound 1 exhibited struggling and vocalisation during injection. The animals dosed with 0.5 mg/kg did not show any other clinical abnormalities. The animals dosed with 1 mg/kg exhibited subdued behaviour and wobbly gait for 5- 10 minutes after injection. The animals dosed with 5 mg/kg exhibited subdued behaviour, eye closure, gasping, wobbly gait and prostration for up to 10 minutes after injection. The female of this group died 5 minutes after injection. There were no other clinical abnormalities throughout the study.There were no gross abnormalities found in the major organs of any animal treated with the vehicle or BDM-I at autopsy. Histological examination did not show any abnormalities in any animal . In this study Compound 1 produced toxicity and death when administered up to doses of 5 mg/kg.A NOEL was not established.
Results
the animals dosed with 0.5 mg/kg of title compound did not show any other clinical abnormalities; the animals dosed with 1 mg/kg exhibited subdued behaviour and wobbly gait for 5-10 minutes after injection; the animals dosed with 5 mg/kg exhibited subdued behaviour, eye closure, gasping, wobbly gait and prostration for up to 10 minutes after injection; title compound produced toxicity and death when administered up to doses of 5 mg/kg
Location
Page/Page column 51-52
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 22 of 41
Effect (Pharmacological Data)
toxic
Species or Test-System (Pharmacological Data)
rat
Sex
male and female
Route of Application
peroral
Method (Pharmacological Data)
Following repeated administration of Compound 1 at a dose of 1150 mg/kg/day, 3 males and 1 female were found dead during the study and 2 males were moribund sacrificed. Administration of 2000 mg/kg/day Compound 1 resulted in the moribund sacrifice of 5 males and 4 females while the remaining female was found dead on DayClinical signs of toxicity noted in this study following administration of 1150 and 2000 mg/kg/day Com-
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
87/249
2016-07-13 00:31:19
pound 1 included brown staining around anus, soft faeces, red staining of the cage paper, abdomen and nares, decreased activity, and ruffled haircoat . Clinical signs of toxicity for the low-dose group (300 mg/kg/day) were limited to red staining of the cage paper in a few males on days 3 and 4.Body weight data was limited due to the loss of most animals in the mid- and high-dose groups. Males dosed with 300 mg/kg/day Compound 1 had a decreased group mean weight gain and body weight on Day 7 as compared to controls. Decreased weight gain and body weight was also noted for the females in the low-and mid-dose groups.There were no definitive test article-related effects on food consumption.For the moribund sacrificed animals, increases in red blood cells, hemoglobin, hematocrit and platelets were observed. This may have been as a result of dehydration due to their moribund condition. Also noted was an increase in neutrophils, which may be related to stress. For animals surviving until the scheduled sacrifice on Day 8, there were no definitive test article-related changes in hematology for males in the low-dose group. Females in the mid-dose-group had decreased red blood cells, hemoglobin, and hematocrit with increased platelets, monocytes and reticulocytes. There were no test article-related effects on erythrocyte morphology. Any other statistically significant changes from control were considered incidental and unrelated to treatment .There were no definitive test article-related changes in coagulation parameters. A few statistically significant changes were noted. However, they are considered incidental and unrelated to treatment. The animals sacrificed moribund had increased creatinine, alkaline phosphatase, blood urea nitrogen, potassium, bilirubin, phosphorus and triglycerides. Animals also had decreased sodium, cholesterol, total protein, albumin, globulin, and calcium. There were no definitive test article-related changes in clinical chemistry parameters for animals sacrificed on Day 8. Although some statistically significant changes were noted, all values were comparable to historical control values and therefore, were considered incidental.Gross necropsy findings for the moribund sacrificed animals included small spleens, dark fluid filled cecum, colon, ileum, duodenum and bladder, and yellow fluid in the stomach. There were no test article-related gross necropsy findings noted at necropsy on Day 8.Test article related changes in liver weights were noted for females at necropsy on Day 8. females had statistically significantly increased liver weights (absolute and relative to body and brain weight) for mid- dose animals. Low-dose females also has increased liver to body weight ratios . Although statistically significantly increased liver to body weight ratios were noted for males in the low-dose group, this was considered incidental as it was most likely associated with the decreased body weight. Increased adrenal to body and adrenal to brain weight ratios were noted for females in the mid-dose group.ConclusionBased on the findings in this study, the no-observed adverse-effect level (NOAEL) was less than 300 mg/kg/ day, while the lowest lethal dose (LLD) was less than 1150 mg/kg/day. Results
administration of title compound at a dose of 1150 mg/kg/day for 3 males and 1 female showed death during the study and 2 males were moribund sacrificed; administration of 2000 mg/kg/day resulted in the moribund sacrifice of 5 males and 4 females while the remaining female was found dead on DayClinical signs of toxicity following administration of 1150 and 2000 mg/kg/day; no-observed adverse-effect level (NOAEL) was less than 300 mg/kg/day, lowest lethal dose (LLD) was less than 1150 mg/kg/day
Location
Page/Page column 52-55
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 23 of 41
Effect (Pharmacological Data)
plasma level
Species or Test-System (Pharmacological Data)
bird
Method (Pharmacological Data)
Determination of Compound 1 levels in plasma Compound 1 was not detected by LCMS assay in plasma samples taken from birds dosed with 200 and 400 mg/kg Compound 1. The LLOQ of the assay was 200 ng/mL
Results
title compound was not detected by LCMS assay in plasma samples taken from birds dosed with 200 and 400 mg/kg title compound; the LLOQ of the assay was 200 ng/mL
Location
Page/Page column 46
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 24 of 41
Effect (Pharmacological Data)
toxic
Species or Test-System (Pharmacological Data)
mouse
Route of Application
intraperitoneal
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
88/249
2016-07-13 00:31:19
Method (Pharmacological Data)
Compound 1 in DMSO given intraperitonealIy to mice is toxic at 50 mg/kg and non-toxic at 40 mg/kg
Results
title compound in DMSO is toxic at 50 mg/kg and non-toxic at 40 mg/kg
Location
Page/Page column 42
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 25 of 41
Effect (Pharmacological Data)
plasma level
Species or Test-System (Pharmacological Data)
rat
Route of Application
peroral
Method (Pharmacological Data)
Plasma levels of Compound 1Absorption of Compound 1 from the gastrointestinal tract is very low, approximately 2percent of the oral dose reaching the blood. Blood levels increased with dose level. Eight-hour levels were generally higher than 4- hour levels. The results, although limited, suggest low oral absorption (Table 1)Table 1. Plasma levels of Compound 1 in the rat following single oral dosingCompound 1 dose Sample time Blood level μg/mL (mg/kg) (hours) Mean500 fed 4 88 17500 fasted 4 128 141000 fasted 4 268 211250 4 + 8 h 27
Results
absorption from the gastrointestinal tract in rats is low, approximately 2percent of the oral dose reaching the blood; blood levels increased with dose level; eight-hour levels were generally higher than 4- hour levels; doses of 500, 1000 and 1250 mg/kg producing blood levels of 8-17, 21-26 and 27 μg/ml, respectively; an oral dose of 500 mg/kg aqueous suspension producing blood levels of 16-25 μg/ml
Location
Page/Page column 41-42; 44
Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 26 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis KE77F2 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
32 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 27 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis Med100 F3 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
89/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
32 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 28 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis Med150 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
32 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 29 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis 536540 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
32 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 30 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis H 181A strain
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
90/249
2016-07-13 00:31:19
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
32 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 31 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis H 318 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
32 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 32 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Salmonella enteritidis 09 FF-D strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; sulfonamide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
256 mg/l
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
91/249
2016-07-13 00:31:19
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 33 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Salmonella typhimurium FFUP40 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; sulfonamide-resistant strain; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
256 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 34 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Staphylococcus aureus ATCC 29213 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
32 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 35 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis ATCC 29212 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
92/249
2016-07-13 00:31:19
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
32 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 36 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Acetinobacter baumannii FFUP10 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
256 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 37 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Pseudomonas aeruginosa ATCC 27853 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
256 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 38 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Salmonella typhimurium FFUP1 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
93/249
2016-07-13 00:31:19
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
256 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 39 of 41
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Escherichia coli ATCC 25922 strain
Concentration (Pharmacological Data)
16 - 512 mg/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in ethanol or water
Method (Pharmacological Data)
agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight
Further Details (Pharmacological Data)
MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
256 mg/l
Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 40 of 41
Effect (Pharmacological Data)
growth stimulant
Species or Test-System (Pharmacological Data)
chicken
Route of Application
peroral
Method (Pharmacological Data)
single dosing with 12 and 100 mu g/g title comp. in DMSO and 200 and 400 mu g/g title comp. in distilled water(DW)/Tween20; control: untreated chicks
Results
increased weight gain 4 days after a single treatment; chichs treated with 100 mu g/g title comp. in DMSO showed 32percent increase in weight gain over the control group; treatment wtih 12 mu g/g DMSO, 200 and 400 mu g/g DW/T20 gave a mean weight gain of 17 percent; diagram
Location
Page 20-21
Patent; BIODIEM LTD; WO2004/76423; (2004); (A1) English, View in Reaxys 41 of 41
Effect (Pharmacological Data)
pharmacokinetics
Species or Test-System (Pharmacological Data)
chicken
Route of Application
peroral
Method (Pharmacological Data)
day-old chicks; administration of title comp. in DMSO at 100 mu g/g - 200 mu g/g and in distilled water (DW)/5percent Tween20 at 100 - 500 mu g/g; plasma levels after treatment with title comp. at 100 mu g/g in DMSO and at 400 mu g/g in DW/Tween20
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
94/249
2016-07-13 00:31:19
Results
very little absorbtion from a single oral dosing; blood levels for doses 12 mu g/g DMSO or 200 mu g/g DW below the limits of detection; at 100 mu g/g DMSO and 400 mu g/g DW peak levels of 850 ng/g at 48 h; diagram
Location
Page 20-21
Patent; BIODIEM LTD; WO2004/76423; (2004); (A1) English, View in Reaxys
Reaxys ID 9768596 View in Reaxys
5/183 CAS Registry Number: 905564-21-8 Chemical Name: (E)-3-[3,4-(methylenedioxy)phenyl]-2-nitroprop-2-en-1-ol; (2E)-3-(benzo[d][1,3]dioxol-5-yl)-2-nitroprop-2en-1-ol; (E)-3-(benzo[d][1,3]dioxol-5-yl)-2-nitroprop-2-en-1-ol; (2E)-3-(1,3-benzodioxol-5-yl)-2-nitroprop-2-en-1-ol; (E)-3-(benzo[d][1,3]dioxol-6-yl)-2-nitroprop-2-en-1-ol Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: WGMJOSLIKRMTQU-FPYGCLRLSA-N Note:
O E
O O
N
O
HO
Substance Label (6) Label References 1g
Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Tetrahedron Letters; vol. 56; nb. 35; (2015); p. 4980 - 4983; Art.No: 46492, View in Reaxys
IIa6
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
2e
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
Ib
Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys
3i
Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys
9h
Rastogi, Namrata; Namboothiri, Irishi N. N.; Cojocaru, Miriam; Tetrahedron Letters; vol. 45; nb. 24; (2004); p. 4745 - 4748, View in Reaxys
Melting Point (4) 1 of 4
Melting Point [°C]
96 - 98
Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys 2 of 4
Melting Point [°C]
60
Solvent (Melting Point)
dichloromethane; hexane
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 3 of 4
Melting Point [°C]
89 - 93
Solvent (Melting Point)
diethyl ether; hexane
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys 4 of 4
Melting Point [°C]
100 - 102
Solvent (Melting Point)
CH2Cl2; petroleum ether
Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys Crystal Property Description (2)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
95/249
2016-07-13 00:31:19
Colour & Other Properties
References
orange
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
yellow
Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys
Electrochemical Characteristics (2) 1 of 2
Description (Electrochemical Characteristics)
oxidation potential
Solvent (Electrochemical Characteristics)
methanol; H2SO4
Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys 2 of 2
Description (Electrochemical Characteristics)
reduction potential
Solvent (Electrochemical Characteristics)
methanol; H2SO4
Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys NMR Spectroscopy (13) 1 of 13
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys 2 of 13
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys 3 of 13
Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
62.5
Original Text (NMR Spectroscopy)
13C
Comment (NMR Spectroscopy)
Signals given
NMR (CDCl3, 62.5 MHz) δ 56.5, 101.8, 108.9, 109.6, 125.0, 126.5, 137.9, 147.6, 148.4, 150.3
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
96/249
2016-07-13 00:31:19
4 of 13
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
250
Original Text (NMR Spectroscopy)
1H
Comment (NMR Spectroscopy)
Signals given
NMR (CDCl3, 250 MHz) δ 2.88 (broad s, IH), 4.71 (s, 2H), 6.05 (s, 2H), 6.88 (d, IH), 7.11 (m, 2H), 8.11 (s, IH).
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 5 of 13
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
250
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys 6 of 13
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
62.5
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys 7 of 13
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
62.5
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys 8 of 13
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
250
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
97/249
2016-07-13 00:31:19
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys 9 of 13
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys 10 of 13
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys 11 of 13
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys 12 of 13
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys 13 of 13
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys IR Spectroscopy (4) 1 of 4
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys 2 of 4
Solvent (IR Spectroscopy)
chloroform
Original Text (IR Spectroscopy)
IR (CHCl3) 3534 (OH), 1503 (NO2) cm"1
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
98/249
2016-07-13 00:31:19
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 3 of 4
Description (IR Spectroscopy)
Bands
Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys 4 of 4
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys Mass Spectrometry (4) Description (Mass Comment (Mass Spectrometry) Spectrometry)
References
Spectrum
Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys
CI (Chemical ioni- Molecular peak zation)
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
spectrum; chemical ionization (CI)
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
spectrum; desorption chemical ionization (DCI)
Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys
Pharmacological Data (2) 1 of 2
Comment (Pharmacological Data)
Bioactivities present
Rastogi, Namrata; Namboothiri, Irishi N. N.; Cojocaru, Miriam; Tetrahedron Letters; vol. 45; nb. 24; (2004); p. 4745 - 4748, View in Reaxys; Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys; Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys; Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys; Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys; Bakthadossn, Manickam; Sivakumar, Nagappan; Synlett; nb. 6; (2009); p. 1014 - 1018, View in Reaxys; Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys; Lima-Junior, Claudio G.; Vasconcellos, Mario L.A.A.; Bioorganic and Medicinal Chemistry; vol. 20; nb. 13; (2012); p. 3954 - 3971, View in Reaxys; Urbanietz, Gregor; Atodiresei, Iuliana; Enders, Dieter; Synthesis (Germany); vol. 46; nb. 9; (2014); p. 1261 - 1269; Art.No: SS-2014-Z0060-OP, View in Reaxys; Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Tetrahedron Letters; vol. 56; nb. 35; (2015); p. 4980 - 4983; Art.No: 46492, View in Reaxys 2 of 2
Effect (Pharmacological Data)
antiproliferative
Species or Test-System (Pharmacological Data)
HeLa cells
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Method (Pharmacological Data)
test cells in MEM incubated with title comp. at 37 deg C for 24 h; cell growth stopped by addition of 10 percent trichloroacetic acid; sulforhodamine B assay; absorbance measured at 560 nm
Further Details (Pharmacological Data)
IC50: concentration of title comp. that inhibited cell proliferation by 50 percent; MEM: Eagle's minimum essential medium
Type (Pharmacological Data)
IC50
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
99/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
38 μmol/l
Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys
Reaxys ID 4689696 View in Reaxys
CAS Registry Number: 5438-41-5; 37629-56-4 Chemical Name: 2-nitro-1-(3,4-methylenedioxyphenyl)-1-propene; 5-(2-nitro-1(Z)-ethenyl)benzo[d][1,3]dioxol Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 Type of Substance: heterocyclic InChI Key: CCEVJKZHAJJQJR-DAXSKMNVSA-N Note:
Z
O O
6/183
O
N
O
Substance Label (8) Label References 2f
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys
1g
Pradhan, Prasun K.; Dey, Sumit; Jaisankar, Parasuraman; Giri, Venkatachalam S.; Synthetic Communications; vol. 35; nb. 7; (2005); p. 913 - 922, View in Reaxys
Tab.1.col.3.run 2,3
Ranu, Brindaban C.; Dey, Suvendu S.; Tetrahedron Letters; vol. 44; nb. 14; (2003); p. 2865 - 2868, View in Reaxys
1b/1l
Yadav; Subba Reddy; Srinivas; Ramalingam; Synlett; nb. 10; (2000); p. 1447 - 1449, View in Reaxys
3a, R1R2=OCH2O
Kelkar, Shriniwas L.; Phadke, Chetan P.; Marina, Sister; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 23; nb. 5; (1984); p. 458 - 459, View in Reaxys
2
Rastogi, Shri Niwas; Kansal, V. K.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 3; (1983); p. 234 - 237, View in Reaxys
4
Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 8; (1983); p. 725 - 726, View in Reaxys
XVI
Bhide, Bhaskar H.; Shah, Kashmira K.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 19; nb. 1; (1980); p. 9 - 12, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
97 - 98
Solvent (Melting Point)
ethanol
Bhide, Bhaskar H.; Shah, Kashmira K.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 19; nb. 1; (1980); p. 9 - 12, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys
NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
29.84
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
100/249
2016-07-13 00:31:19
Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys 2 of 3
Description (NMR Spec- HSQC (Heteronuclear Single Quantum Coherence); Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H; 13C
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
29.84
Location
supporting information
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys 3 of 3
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
29.84
Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) electron impact (EI); spectrum
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys
UV/VIS Spectroscopy (1) 1 of 1
Absorption Maxima (UV/ 366 VIS) [nm] Ext./Abs. Coefficient [l·mol-1cm-1]
9500
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys Pharmacological Data (2) 1 of 2
Comment (Pharmacological Data)
Bioactivities present
Kelkar, Shriniwas L.; Phadke, Chetan P.; Marina, Sister; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 23; nb. 5; (1984); p. 458 - 459, View in Reaxys; Bhide, Bhaskar H.; Shah, Kashmira K.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 19; nb. 1; (1980); p. 9 - 12, View in Reaxys; Rastogi, Shri Niwas; Kansal, V. K.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 3; (1983); p. 234 - 237, View in Reaxys; Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 8; (1983); p. 725 - 726, View in Reaxys; Yadav; Subba Reddy; Srinivas; Ramalingam; Synlett; nb. 10; (2000); p. 1447 - 1449, View in Reaxys; Mulholland; Zheng; Synthetic Communications; vol. 31; nb. 20; (2001); p. 3059 - 3068, View in Reaxys; Ranu, Brindaban C.; Dey, Suvendu S.; Tetrahedron Letters; vol. 44; nb. 14; (2003); p. 2865 - 2868, View in Reaxys; Pradhan, Prasun K.; Dey, Sumit; Jaisankar, Parasuraman; Giri, Venkatachalam S.; Synthetic Communications; vol. 35; nb. 7; (2005); p. 913 - 922,
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
101/249
2016-07-13 00:31:19
View in Reaxys; Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys 2 of 2
Comment (Pharmacological Data)
physiological behaviour discussed
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys
Reaxys ID 24583 View in Reaxys
7/183 CAS Registry Number: 15896-78-3 Chemical Name: (E?)-3-methoxy-4,5-methylenedioxy-β-nitrostyrene; 4-methoxy-6-(2-nitro-vinyl)-benzo[1,3]dioxole; (E?)-3Methoxy-4,5-methylendioxy-β-nitro-styrol; 4-Methoxy-6-(2-nitrovinyl)-benzo[1,3]dioxol; 4-methoxy-6-(2-nitrovinyl)-1,3-benzodioxole Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: XMXLXUDKGGRTAW-NSCUHMNNSA-N Note:
O E
O
N
O
O O
Substance Label (2) Label References 2
Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys
table 1, entry 8
Nyerges, Miklos; Balazs, Laszlo; Kadas, Istvan; Bitter, Istvan; Koevesdi, Istvan; Toeke, Laszlo; Tetrahedron; vol. 51; nb. 24; (1995); p. 6783 - 6788, View in Reaxys
Melting Point (3) 1 of 3
Melting Point [°C]
210 - 211
Solvent (Melting Point)
butan-1-ol
Hamlin; Weston; Journal of the American Chemical Society; vol. 71; (1949); p. 2210, View in Reaxys 2 of 3
Melting Point [°C]
212 - 213
Solvent (Melting Point)
ethanol
Spaeth; Gangl; Monatshefte fuer Chemie; vol. 44; (1923); p. 110, View in Reaxys 3 of 3
Melting Point [°C]
212 - 213
Solvent (Melting Point)
benzene
Spaeth; Gangl; Monatshefte fuer Chemie; vol. 44; (1923); p. 110, View in Reaxys NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys 2 of 3
Nucleus (NMR Spectroscopy)
1H
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
102/249
2016-07-13 00:31:19
Coupling Nuclei
1H
Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys 3 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys Pharmacological Data (35) 1 of 35
Comment (Pharmacological Data)
Bioactivities present
Spaeth; Gangl; Monatshefte fuer Chemie; vol. 44; (1923); p. 110, View in Reaxys; Kindler; Brandt; Archiv der Pharmazie (Weinheim, Germany); vol. 273; (1935); p. 478,482, View in Reaxys; Hamlin; Weston; Journal of the American Chemical Society; vol. 71; (1949); p. 2210, View in Reaxys; Nyerges, Miklos; Balazs, Laszlo; Kadas, Istvan; Bitter, Istvan; Koevesdi, Istvan; Toeke, Laszlo; Tetrahedron; vol. 51; nb. 24; (1995); p. 6783 - 6788, View in Reaxys; Ji, Jianguo; Barnes, David M.; Zhang, Ji; King, Steven A.; Wittenberger, Steven J.; Morton, Howard E.; Journal of the American Chemical Society; vol. 121; nb. 43; (1999); p. 10215 - 10216, View in Reaxys; Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys; Patent; Abbott Laboratories; US6162927; (2000); (A1) English, View in Reaxys; Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 - 6612, View in Reaxys 2 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
leukemia P388 cells of mouse
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 3 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis ATCC 29212
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 100 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
103/249
2016-07-13 00:31:19
4 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Streptococcus pneumoniae ATCC 6303
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 100 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 5 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Staphylococcus aureus ATCC 29213
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 100 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 6 of 35
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Cryptococcus neoformans ATCC 90112
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
3.12 - 6.25 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 7 of 35
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Candida albicans ATCC 90028
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
104/249
2016-07-13 00:31:19
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
1.56 - 3.12 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 8 of 35
Effect (Pharmacological Data)
tubulin polymerization; inhibition of
Species or Test-System (Pharmacological Data)
not explicitly stated by authors
Further Details (Pharmacological Data)
inhibitory concentration (IC); IC50 related to: tubulin
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
5.6 μmol/l
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 9 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
renal cancer A498 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 10 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
ovary cancer OVCAR-3 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 11 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
melanoma SK-MEL-5 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 12 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Staphylococcus aureus ATCC 29213
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
105/249
2016-07-13 00:31:19
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 13 of 35
Effect (Pharmacological Data)
fungicidal
Species or Test-System (Pharmacological Data)
Cryptococcus neoformans ATCC 90112
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal fungicidal concentration (MFC)
Type (Pharmacological Data)
MFC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 14 of 35
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Cryptococcus neoformans ATCC 90112
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 15 of 35
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Candida albicans ATCC 90028
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 16 of 35
Effect (Pharmacological Data)
antibacterial
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
106/249
2016-07-13 00:31:19
Species or Test-System (Pharmacological Data)
Neisseria gonorrhoeae ATCC 49226
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
1.56 - 3.12 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 17 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterobacter cloacae ATCC 13047
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 100 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 18 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Escherichia coli ATCC 25922
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 100 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 19 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Stenotrophomonas maltophilia ATCC 13637
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
107/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
> 100 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 20 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Micrococcus luteus Presque Isle 456
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 100 μg/disc
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 21 of 35
Effect (Pharmacological Data)
bactericidal
Species or Test-System (Pharmacological Data)
Neisseria gonorrhoeae ATCC 49226
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal bactericidal concentration (MBC)
Type (Pharmacological Data)
MBC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 22 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Neisseria gonorrhoeae ATCC 49226
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 23 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterobacter cloacae ATCC 13047
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
108/249
2016-07-13 00:31:19
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 24 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Escherichia coli ATCC 25922
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 25 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Stenotrophomonas maltophilia ATCC 13637
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 26 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Micrococcus luteus Presque Isle 456
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
109/249
2016-07-13 00:31:19
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 27 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Enterococcus faecalis ATCC 29212
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 28 of 35
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Streptococcus pneumoniae ATCC 6303
Kind of Dosing (Pharmacological Data)
DMSO solution
Further Details (Pharmacological Data)
minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
> 64 μg/ml
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 29 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
CNS cancer SF295 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 30 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
CNS cancer SF268 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 31 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
lung-NSC cancer NCI-H460 cells of human
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
110/249
2016-07-13 00:31:19
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 32 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
prostate cancer DU-145 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 33 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
colon cancer KM20L2 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 34 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
breast cancer MCF-7 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys 35 of 35
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
pancreas cancer BXPC-3 cells of human
Results
no effect
Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys
Reaxys ID 87862 View in Reaxys
8/183 CAS Registry Number: 33036-23-6 Chemical Name: 5-[(E)-2-nitro-2-phenylvinyl]benzeno[d][1,3]dioxole; 3,4-methylenedioxy-α'-nitro-cis-stilbene; 3,4-Methylendioxy-α'-nitro-cis-stilben; 3',4'-Methylendioxy-α-nitrostilben Linear Structure Formula: C15H11NO4 Molecular Formula: C15H11NO4 Molecular Weight: 269.257 Type of Substance: heterocyclic InChI Key: OZZVAPJRDQCACG-MDWZMJQESA-N Note:
O O
E
N
O
O
Substance Label (4) Label References 12c
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
111/249
2016-07-13 00:31:19
3n
Eijk, Peter J. S. S. van; Overkempe, Cor; Trompenaars, Willem P.; Reinhoudt, David N.; Manninen, Lauri M.; et al.; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 2; (1988); p. 27 - 39, View in Reaxys
E
Blake,K.W.; Jaques,B.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); (1973); p. 1660 - 1663, View in Reaxys
60
Dore,J.-C. et al.; Chimica Therapeutica; vol. 6; (1971); p. 167 - 185, View in Reaxys
Related Structure (1) Related Structure References Ueber die Konfiguration der Stereoisomeren s..
Blake; Jaques; J.C.S. Perkin; vol. II; p. 1973,1660, 1661, View in Reaxys
Melting Point (2) 1 of 2
Melting Point [°C]
126
Dore,J.-C. et al.; Chimica Therapeutica; vol. 6; (1971); p. 167 - 185, View in Reaxys 2 of 2
Melting Point [°C]
129 - 129.5
Reichert; Kuhn; Chemische Berichte; vol. 74; (1941); p. 328,333, View in Reaxys Crystal Property Description (1) Colour & Other References Properties deep-yellow
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys
NMR Spectroscopy (5) 1 of 5
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
399.883
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 2 of 5
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
399.883
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 3 of 5
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]
100.562
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 4 of 5
Description (NMR Spec- Chemical shifts troscopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
112/249
2016-07-13 00:31:19
Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 5 of 5
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Blake,K.W.; Jaques,B.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); (1973); p. 1660 - 1663, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; electron impact (EI)
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys
Reaxys ID 264011 View in Reaxys
9/183 CAS Registry Number: 97383-34-1 Chemical Name: 4-methoxy-6-(2-nitro-propenyl)-benzo[1,3]dioxole; 4-Methoxy-6-(2-nitro-propenyl)-benzo[1,3]dioxol; 1-<3Methoxy-4,5-methylendioxy-phenyl>-2-nitro-propen Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: URIZGFKLZDNSIH-XVNBXDOJSA-N Note:
O E
O
N
O
O O
Substance Label (3) Label References 2
Patent; DADE BEHRING INC.; WO2005/61482; (2005); (A1) English, View in Reaxys
31
Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys
table, entry 4, product
Sy, Wing-Wah; By, Arnold W.; Tetrahedron Letters; vol. 26; nb. 9; (1985); p. 1193 - 1196, View in Reaxys
Derivative (1) Comment (Derivative) Addukt m. (+-)-αMethyl-benzylamin C19H22N2O5 : beim Erhitzen v. 1-<3-Methoxy-4,5-methylendioxy-phenyl>-2-nitro-propen m. einem Ueberschuss v. (+-)-
References Shulgin; Canadian Journal of Chemistry; vol. 46; (1968); p. 75, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
113/249
2016-07-13 00:31:19
α-Methyl-benzylamin u. Bhdln. des Rk.prod. m. W. ; F: 161grad (Zers.) Melting Point (3) 1 of 3
Melting Point [°C]
110
Solvent (Melting Point)
methanol
Shulgin; Canadian Journal of Chemistry; vol. 46; (1968); p. 75, View in Reaxys 2 of 3
Melting Point [°C]
110
Shulgin; Experientia; vol. 20; nb. 7; (1964); p. 366 - 367, View in Reaxys 3 of 3
Melting Point [°C]
112
Solvent (Melting Point)
ethanol
Rimini; Gazzetta Chimica Italiana; vol. 35 I; (1905); p. 413,414, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelbe Nadeln
Rimini; Gazzetta Chimica Italiana; vol. 35 I; (1905); p. 413,414, View in Reaxys
Further Information (1) Description (Fur- References ther Information) Further information
Shulgin; Canadian Journal of Chemistry; vol. 46; (1968); p. 75, View in Reaxys
NMR Spectroscopy (3) 1 of 3
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Original Text (NMR Spectroscopy)
1H- NMR (CDCI3, 400 MHz) 8 : 7.97 (s, 2H), 6.65 (s, 1H), 6.63 (s, 1H), 3.92 (s, 3H), 2.45 (s, 3H);
Comment (NMR Spectroscopy)
Signals given
Patent; DADE BEHRING INC.; WO2005/61482; (2005); (A1) English, View in Reaxys 2 of 3
Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Original Text (NMR Spectroscopy)
13C-NMR (CDCI3, 100 MHz) 8 : 149.7, 146.8, 144.1, 137.5, 134.1, 127.0, 111.7 104.1, 102.6, 57.2, 14.57.
Comment (NMR Spectroscopy)
Signals given
Patent; DADE BEHRING INC.; WO2005/61482; (2005); (A1) English, View in Reaxys 3 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
114/249
2016-07-13 00:31:19
Temperature (NMR Spectroscopy) [°C]
26.9
Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys
Reaxys ID 87863 View in Reaxys
10/183 CAS Registry Number: 50882-25-2 Chemical Name: 3,4-methylenedioxy-α'-nitro-trans-stilbene; 3,4-methylenedioxy-α'-nitro-stilbene; 3,4-Methylendioxy-α'-nitrotrans-stilben; 3,4-Methylendioxy-α'-nitro-stilben; 3.4-Methylendioxy-α'-nitro-stilben Linear Structure Formula: C15H11NO4 Molecular Formula: C15H11NO4 Molecular Weight: 269.257 Type of Substance: heterocyclic InChI Key: OZZVAPJRDQCACG-JYRVWZFOSA-N Note:
Z
O O
O
N
O
Related Structure (1) Related Structure References Konfiguration der Stereoisomeren s..
Blake; Jaques; J.C.S. Perkin; vol. II; p. 1973,1660, 1661, View in Reaxys
Melting Point (3) 1 of 3
Melting Point [°C]
129 - 129.5
Solvent (Melting Point)
ethanol; acetic acid
Robertson,D.N.; Journal of Organic Chemistry; vol. 25; (1960); p. 47 - 49, View in Reaxys 2 of 3
Melting Point [°C]
123 - 123.5
Solvent (Melting Point)
ethanol
Reichert; Kuhn; Chemische Berichte; vol. 74; (1941); p. 328,333, View in Reaxys 3 of 3
Melting Point [°C]
124
Solvent (Melting Point)
ethanol
Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys Crystal Property Description (2) Colour & Other References Properties Orange
Reichert; Kuhn; Chemische Berichte; vol. 74; (1941); p. 328,333, View in Reaxys
gelb
Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys
Reaxys ID 226696 View in Reaxys
11/183 CAS Registry Number: 960211-64-7 Chemical Name: (Z)-5-(2-bromo-2-nitrovinyl)benzeno[d][1,3]dioxole; (Z)-5-(2-bromo-2-nitrovinyl)benzo[d][1,3]dioxole; β-bromo-3,4-methylenedioxy-β-nitro-styrene; β-Brom-3,4-methylendioxy-β-nitro-styrol Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 Type of Substance: heterocyclic InChI Key: WEYZGKQDMSTRQD-RUDMXATFSA-N Note:
O O O
Z
N
O
Br
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
115/249
2016-07-13 00:31:19
Substance Label (2) Label References 1q
Feng, Juhua; Lin, Lili; Yu, Kunru; Liu, Xiaohua; Feng, Xiaoming; Advanced Synthesis and Catalysis; vol. 357; nb. 6; (2015); p. 1305 - 1310, View in Reaxys
1c
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys
Related Structure (2) Related Structure References Eine Verbindung Neber; Burgard; Thier; Justus Liebigs Annalen der Chemie; vol. 526; (1936); p. 277,287, View in Reaxys dieser Konstitution hat vermutlich auch in einem von .... ... als α-Brom-3,4- Beilstein Handbook, View in Reaxys methylendioxy-βnitro-styrol (C9H6BrNO4) beschriebenen Praeparat (F: 98-99grad) vorgelegen, das nach dem fuer ξ-βBrom-3,4-methylendioxy-ξ-β-nitrostyrol angegebenen (s. E II 27) Verfahren hergestellt worden ist.. Melting Point (3) 1 of 3
Melting Point [°C]
100 - 101
Solvent (Melting Point)
hexane; CH2Cl2
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 2 of 3
Melting Point [°C]
99
Reichert; Koch; Chemische Berichte; vol. 68; (1935); p. 445,450, View in Reaxys 3 of 3
Melting Point [°C]
101 - 102
Solvent (Melting Point)
ethanol
Rosenmund; Kuhnhenn; Chemische Berichte; vol. 56; (1923); p. 1265, View in Reaxys Crystal Property Description (2) Colour & Other References Properties light-yellow
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys
gelbe Nadeln
Rosenmund; Kuhnhenn; Chemische Berichte; vol. 56; (1923); p. 1265, View in Reaxys
NMR Spectroscopy (6) 1 of 6
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Feng, Juhua; Lin, Lili; Yu, Kunru; Liu, Xiaohua; Feng, Xiaoming; Advanced Synthesis and Catalysis; vol. 357; nb. 6; (2015); p. 1305 - 1310, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
116/249
2016-07-13 00:31:19
2 of 6
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
101
Location
supporting information
Feng, Juhua; Lin, Lili; Yu, Kunru; Liu, Xiaohua; Feng, Xiaoming; Advanced Synthesis and Catalysis; vol. 357; nb. 6; (2015); p. 1305 - 1310, View in Reaxys 3 of 6
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
399.883
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 4 of 6
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
399.883
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 5 of 6
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
100.562
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 6 of 6
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
100.562
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
117/249
2016-07-13 00:31:19
Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys
Reaxys ID 255079 View in Reaxys
12/183 CAS Registry Number: 15794-43-1 Chemical Name: 6,β-dinitro-3,4-methylenedioxystyrene; 5-nitro-6-(2-nitro-vinyl)-benzo[1,3]dioxole; ο,2-Dinitro-4,5-methylendioxy-styrol Linear Structure Formula: C9H6N2O6 Molecular Formula: C9H6N2O6 Molecular Weight: 238.156 Type of Substance: heterocyclic InChI Key: WWYLHVBUDLOVIP-UHFFFAOYSA-N Note:
O N
O
O O
N
O
O
Substance Label (3) Label References 1E
Sinhababu; Borchardt; Journal of Organic Chemistry; vol. 48; nb. 19; (1983); p. 3347 - 3349, View in Reaxys
1d
Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys
XII
Adlerova,E. et al.; Collection of Czechoslovak Chemical Communications; vol. 25; (1960); p. 784 - 796, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
121 - 122
Solvent (Melting Point)
ethanol
Adlerova,E. et al.; Collection of Czechoslovak Chemical Communications; vol. 25; (1960); p. 784 - 796, View in Reaxys
Reaxys ID 1348589 View in Reaxys
13/183 CAS Registry Number: 1211-65-0 Chemical Name: 1-(3,4-Methylenedioxyphenyl)-2-nitro-1-butene; 5-(2-nitro-but-1-enyl)-benzo[1,3]dioxole; 3,4-Methylendioxy-1-(2-nitro-but-1-enyl)-benzol; 2-Nitro-(3,4-methylendioxyphenyl)-but-1-en; 6β-Nitrobutenyl-benzo<1,3>dioxol; 1-(3'4'Methylendioxyphenyl)-2-nitro-buten Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: LHWIZYOSZOQHOY-UHFFFAOYSA-N Note:
O O
N
O
O
Substance Label (2) Label References VII
Azafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 39; nb. 4.1; (1990); p. 738 - 741; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 4; (1990); p. 829 - 832, View in Reaxys
I
Agafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 38; nb. 2; (1989); p. 1982; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; vol. 9; (1989); p. 2153, View in Reaxys
Melting Point (3) 1 of 3
Melting Point [°C]
66 - 66.5
Solvent (Melting Point)
methanol
Agafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 38; nb. 2; (1989); p. 1982; Izvestiya Akademii Nauk SSSR, Seriya Khimiche-
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
118/249
2016-07-13 00:31:19
skaya; vol. 9; (1989); p. 2153, View in Reaxys; Azafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 39; nb. 4.1; (1990); p. 738 741; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 4; (1990); p. 829 - 832, View in Reaxys 2 of 3
Melting Point [°C]
64.2 - 65
Solvent (Melting Point)
diethyl ether; hexane
Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys 3 of 3
Melting Point [°C]
60 - 61
Koremura; Nippon Kagaku Kaishi; vol. 36; nb. 7; (1962); p. 552,553-556; Chem.Abstr.; vol. 62; nb. 3962d; (1965), View in Reaxys Liquid/Liquid Systems (MCS) (1) 1 of 1
Description (Liquid/ Liquid Systems (MCS))
Distribution between solvent 1 + 2
Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CHCl3 scopy) Azafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 39; nb. 4.1; (1990); p. 738 - 741; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 4; (1990); p. 829 - 832, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Agafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 38; nb. 2; (1989); p. 1982; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; vol. 9; (1989); p. 2153, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1
Description (UV/VIS Spectroscopy)
Absorption maxima
Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1567 - 1580, View in Reaxys
Reaxys ID 27296 View in Reaxys
14/183 CAS Registry Number: 124201-30-5 Chemical Name: trans-1-(3,4-(Methylenedioxy)-6-nitrophenyl)-2-nitroethene; (E)-5-nitro-6-(2-nitrovinyl)benzo[d][1,3]dioxole; (E?)-4,5-methylenedioxy-2,β-dinitro-styrene; (E?)-4,5Methylendioxy-2,β-dinitro-styrol Linear Structure Formula: C9H6N2O6 Molecular Formula: C9H6N2O6 Molecular Weight: 238.156 Type of Substance: heterocyclic InChI Key: WWYLHVBUDLOVIP-OWOJBTEDSA-N Note:
O N E
O
O O
N
O
O
Substance Label (4) Label References
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
119/249
2016-07-13 00:31:19
4p
Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 - 3358, View in Reaxys
4n
Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys
1c
Nyerges, Miklos; Rudas, Monika; Toth, Gabor; Herenyi, Bulcsu; Kadas, Istvan; et al.; Tetrahedron; vol. 51; nb. 48; (1995); p. 13321 - 13330, View in Reaxys
35
Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys
Melting Point (4) 1 of 4
Melting Point [°C]
110 - 111
Location
supporting information
Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 - 3358, View in Reaxys 2 of 4
Melting Point [°C]
110 - 111
Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys 3 of 4
Melting Point [°C]
111 - 112.5
Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys 4 of 4
Melting Point [°C]
118
Solvent (Melting Point)
ethanol
Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys Crystal Property Description (3) Colour & Other Location Properties yellow
supporting information
References Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 3358, View in Reaxys
yellow
Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys
Gelb
Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys
NMR Spectroscopy (7) 1 of 7
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 - 3358, View in Reaxys 2 of 7
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
101
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
120/249
2016-07-13 00:31:19
Location
supporting information
Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 - 3358, View in Reaxys 3 of 7
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys 4 of 7
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys 5 of 7
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys 6 of 7
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys 7 of 7
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys IR Spectroscopy (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
121/249
2016-07-13 00:31:19
1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Comment (IR Spectroscopy)
3105 - 408 cm**(-1)
Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys Mass Spectrometry (3) Description (Mass Location Spectrometry)
References
high resolution supporting informass spectrome- mation try (HRMS); electrospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum
Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 3358, View in Reaxys
gas chromatogra- supporting inforphy mass specmation trometry (GCMS); spectrum
Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 3358, View in Reaxys
gas chromatography mass spectrometry (GCMS); spectrum
Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys
Reaxys ID 1347548 View in Reaxys
15/183 CAS Registry Number: 1805-90-9 Chemical Name: 5-(2-nitro-phenyl)-benzo[1,3]dioxole; 2'-Nitro-3,4-methylendioxy-biphenyl; 3,4-Methylendioxy-2'-nitro-biphenyl Linear Structure Formula: C13H9NO4 Molecular Formula: C13H9NO4 Molecular Weight: 243.219 Type of Substance: heterocyclic InChI Key: PAXLFPPTTCKNAD-UHFFFAOYSA-N Note:
O O
O
N
O
Substance Label (4) Label References 3aj
Katayev, Dmitry; Exner, Benjamin; Goossen, Lukas J.; ChemCatChem; vol. 7; nb. 14; (2015); p. 2028 2032, View in Reaxys
3ae
Creech, Gardner S.; Kwon, Ohyun; Chemical Science; vol. 4; nb. 6; (2013); p. 2670 - 2674, View in Reaxys
IV
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
V
Hill; Carlson; Tetrahedron Letters; (1964); p. 1157,1158, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
84 - 85
Solvent (Melting Point)
acetone
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys Further Information (1) Description (Fur- References ther Information)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
122/249
2016-07-13 00:31:19
Further information
Hill; Carlson; Tetrahedron Letters; (1964); p. 1157,1158, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Spectrum troscopy) Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Spectrum
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Reaxys ID 6410710 View in Reaxys
16/183 Chemical Name: 1-(2'-Brom-4',5'-methylendioxyphenyl)-2-nitroaethylen; (E)-5-bromo-6-(2-nitrovinyl)benzo[d][1,3]dioxole Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 Type of Substance: heterocyclic InChI Key: UKQZUXNFVBFRRY-OWOJBTEDSA-N Note:
O N E
O
O O
Br
Substance Label (4) Label References 2f
Gonzlez-Olvera; Vergara-Arenas; Negrn-Silva; Angeles-Beltrn; Lomas-Romero; Gutirrez-Carrillo; Lara; Morales-Serna; RSC Advances; vol. 5; nb. 120; (2015); p. 99188 - 99192, View in Reaxys
1d
Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 - 4239, View in Reaxys
1c
Garcia-Torres, Alejandro; Cruz-Almanza, Rymundo; Miranda, Luis D.; Tetrahedron Letters; vol. 45; nb. 10; (2004); p. 2085 - 2088, View in Reaxys
2d
Blarer, Stefan J.; Schweizer, W. Bernd; Seebach, Dieter; Helvetica Chimica Acta; vol. 65; nb. 5; (1982); p. 1637 - 1654, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
163 - 166
Solvent (Melting Point)
hexane; dichloromethane
Location
supporting information
Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 4239, View in Reaxys Crystal Property Description (1) Colour & Other Location Properties yellow
supporting information
References Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 - 4239, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Location
supporting information
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
123/249
2016-07-13 00:31:19
Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 4239, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Location
supporting information
Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 4239, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
neat (no solvent, solid phase)
Location
supporting information
Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 4239, View in Reaxys Mass Spectrometry (1) Description (Mass Location Spectrometry) high resolution mass spectrometry (HRMS); electron impact (EI); spectrum
References
supporting information
Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 - 4239, View in Reaxys
Reaxys ID 22682218 View in Reaxys
17/183 CAS Registry Number: 1381932-34-8 Linear Structure Formula: C15H15NO8 Molecular Formula: C15H15NO8 Molecular Weight: 337.286 InChI Key: PUBDUNNNNNHLRH-UHFFFAOYSA-N Note:
O N
O O
O
O O
O
O
Substance Label (2) Label References 1d
Kumar, Tarun; Verma, Deepti; Menna-Barreto, Rubem F. S.; Valena, Wagner O.; Da Silva Jnior, Eufrnio N.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 13; nb. 7; (2015); p. 1996 - 2000, View in Reaxys; Mane, Vaijinath; Kumar, Tarun; Pradhan, Sourav; Katiyar, Savita; Namboothiri, Irishi N. N.; RSC Advances; vol. 5; nb. 86; (2015); p. 69990 - 69999, View in Reaxys; Gopi, Elumalai; Kumar, Tarun; Menna-Barreto, Rubem F. S.; Valena, Wagner O.; Da Silva Jnior, Eufrnio N.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 13; nb. 38; (2015); p. 9862 - 9871, View in Reaxys
7d
Gopi, Elumalai; Namboothiri, Irishi N. N.; Journal of Organic Chemistry; vol. 79; nb. 16; (2014); p. 7468 7476, View in Reaxys
Reaxys ID 356933 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
18/183
124/249
2016-07-13 00:31:19
O
CAS Registry Number: 15433-98-4 Chemical Name: 3-(2-benzo[1,3]dioxol-5-yl-7-methoxy-3-nitrobenzofuran-5-yl)-propan-1-ol; 3-Nitro-egonol Linear Structure Formula: C19H17NO7 Molecular Formula: C19H17NO7 Molecular Weight: 371.346 Type of Substance: heterocyclic InChI Key: UZQRAWVQRTYFBF-UHFFFAOYSA-N Note:
OH
O O N
O
O
O
Substance Label (1) Label References 11
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys
Melting Point (3) 1 of 3
Melting Point [°C]
140.7 - 142.7
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 2 of 3
Melting Point [°C]
146 - 147
Solvent (Melting Point)
cyclohexane; acetone
Hopkins et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1425,1428, View in Reaxys 3 of 3
Melting Point [°C]
151
Solvent (Melting Point)
acetone
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys Crystal Property Description (2) Colour & Other References Properties yellow
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys
gelb
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys
NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
30
Frequency (NMR Spectroscopy) [MHz]
400
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
30
Frequency (NMR Spectroscopy) [MHz]
100
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
125/249
2016-07-13 00:31:19
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 3 of 3
Description (NMR Spec- Spectrum troscopy) Hopkins et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1425,1428, View in Reaxys
IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
CH2Cl2
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; chemical ionization (CI)
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys
UV/VIS Spectroscopy (1) 1 of 1
Solvent (UV/VIS Spectroscopy)
CH2Cl2
Absorption Maxima (UV/ 228; 268; 384 VIS) [nm] Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys Pharmacological Data (5) 1 of 5
Comment (Pharmacological Data)
Bioactivities present
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys; Hopkins et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1425,1428, View in Reaxys; Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys; Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Escherichia coli
Kind of Dosing (Pharmacological Data)
stock solution of title comp. 10 mg dissolved in methanol and dichloromethane separately and prepared in 1/2 Muller Hilton Broth solution
Method (Pharmacological Data)
title comp. antibacterial activity assayed by Muller Hilton Broth method
Comment (Pharmacological Data)
No effect
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 3 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Candida albicans
Kind of Dosing (Pharmacological Data)
stock solution of title comp. 10 mg dissolved in methanol and dichloromethane separately and prepared in 1/2 Muller Hilton Broth solution
Method (Pharmacological Data)
title comp. antibacterial activity assayed by Muller Hilton Broth method
Type (Pharmacological Data)
MIC
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
126/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
800 mg/g
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 4 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Staphylococcus aureus
Kind of Dosing (Pharmacological Data)
stock solution of title comp. 10 mg dissolved in methanol and dichloromethane separately and prepared in 1/2 Muller Hilton Broth solution
Method (Pharmacological Data)
title comp. antibacterial activity assayed by Muller Hilton Broth method
Comment (Pharmacological Data)
No effect
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 5 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Bacillus subtilis
Kind of Dosing (Pharmacological Data)
stock solution of title comp. 10 mg dissolved in methanol and dichloromethane separately and prepared in 1/2 Muller Hilton Broth solution
Method (Pharmacological Data)
title comp. antibacterial activity assayed by Muller Hilton Broth method
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
800 mg/l
Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys
Reaxys ID 4491188 View in Reaxys
19/183 CAS Registry Number: 43017-82-9 Chemical Name: Methyl 3-<3',4'-(methylenedioxy)phenyl>-2nitropropenoate; methyl 3-(1,3-benzodioxol-5-yl)-2-nitroacrylate; 3-benzo[1,3]dioxol-5-yl-2-nitro-acrylic acid methyl ester Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 Type of Substance: heterocyclic InChI Key: IGDFMGQGZSISDX-UHFFFAOYSA-N Note:
O O O
O O
N
O
Substance Label (3) Label References 2d
Wei, Yi; Lu, Liang-Qiu; Li, Tian-Ren; Feng, Bin; Wang, Qiang; Xiao, Wen-Jing; Alper, Howard; Angewandte Chemie - International Edition; vol. 55; nb. 6; (2016); p. 2200 - 2204; Angew. Chem.; vol. 128; nb. 6; (2016); p. 2240 - 2244,5, View in Reaxys
5j
Foucaud, Andre; Razorilalana-Rabearivony, Claudia; Loukakou, Emile; Person, Herve; Journal of Organic Chemistry; vol. 48; nb. 21; (1983); p. 3639 - 3644, View in Reaxys
(IIIc)
Kochetkov, K. A.; Babievskii, K. K.; Belikov, V. M.; Garbalinskaya, N. S.; Bakhmutov, V. I.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 29; nb. 3; (1980); p. 458 - 461; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 3; (1980); p. 639 - 641, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
127/249
2016-07-13 00:31:19
Melting Point (1) 1 of 1
Melting Point [°C]
133 - 134
Kochetkov, K. A.; Babievskii, K. K.; Belikov, V. M.; Garbalinskaya, N. S.; Bakhmutov, V. I.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 29; nb. 3; (1980); p. 458 461; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 3; (1980); p. 639 - 641, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Foucaud, Andre; Razorilalana-Rabearivony, Claudia; Loukakou, Emile; Person, Herve; Journal of Organic Chemistry; vol. 48; nb. 21; (1983); p. 3639 - 3644, View in Reaxys
Reaxys ID 23247 View in Reaxys
20/183 CAS Registry Number: 49711-31-1 Chemical Name: (E)-1-cyano-2-(1',3'-benzodioxol-5'-yl)-1-nitroethene; 3c-benzo[1,3]dioxol-5-yl-2-nitro-acrylonitrile; 3c-Benzo[1,3]dioxol-5-yl-2-nitro-acrylonitril Linear Structure Formula: C10H6N2O4 Molecular Formula: C10H6N2O4 Molecular Weight: 218.169 Type of Substance: heterocyclic InChI Key: RJEGGRRFXZJFLI-FPYGCLRLSA-N Note:
O O
N
E
O
O N
Substance Label (1) Label References 1e
Amantini, David; Fringuelli, Francesco; Piermatti, Oriana; Pizzo, Ferdinando; Zunino, Ennio; Vaccaro, Luigi; Journal of Organic Chemistry; vol. 70; nb. 16; (2005); p. 6526 - 6529, View in Reaxys
Related Structure (1) Related Structure References Configuration.
Dore et al.; Chimica therap.; vol. 8; (1973); p. 80,83, View in Reaxys
Melting Point (3) 1 of 3
Melting Point [°C]
143
Dore et al.; Chimica therap.; vol. 8; (1973); p. 80,83, View in Reaxys 2 of 3
Solvent (Melting Point)
acetic acid
Ried; Koehler; Justus Liebigs Annalen der Chemie; vol. 598; (1956); p. 145,155, View in Reaxys 3 of 3
Melting Point [°C]
149
Ried; Koehler; Justus Liebigs Annalen der Chemie; vol. 598; (1956); p. 145,155, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb
Ried; Koehler; Justus Liebigs Annalen der Chemie; vol. 598; (1956); p. 145,155, View in Reaxys
Reaxys ID 40135 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
21/183
128/249
2016-07-13 00:31:19
CAS Registry Number: 15794-52-2 Chemical Name: 4-methoxy-5-nitro-6-(2-nitro-vinyl)-benzo[1,3]dioxole; 3-methoxy-4,5-methylenedioxy-2,β-dinitro-styrene; 3-Methoxy-4,5-methylendioxy-2,β-dinitro-styrol Linear Structure Formula: C10H8N2O7 Molecular Formula: C10H8N2O7 Molecular Weight: 268.183 Type of Substance: heterocyclic InChI Key: BKMDSMXMYBNRJS-UHFFFAOYSA-N Note:
O N
O
O O
N O
O
O
Substance Label (1) Label References 3d
Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys
Related Structure (1) Related Structure References Constitution.
Salway; Journal of the Chemical Society; vol. 99; (1911); p. 267, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
148
Solvent (Melting Point)
ethanol
Salway; Journal of the Chemical Society; vol. 95; (1909); p. 1209; Journal of the Chemical Society; vol. 97; (1910); p. 2416, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelbe Nadeln
Salway; Journal of the Chemical Society; vol. 95; (1909); p. 1209; Journal of the Chemical Society; vol. 97; (1910); p. 2416, View in Reaxys
Reaxys ID 1291451 View in Reaxys
22/183 CAS Registry Number: 2139-41-5 Chemical Name: [6-(2-nitro-phenyl)-benzo[1,3]dioxol-5-yl]methanol; 2-<2-Nitrophenyl>-4,5-methylendioxy-benzylalkohol; 2'-Nitro-4,5-methylendioxy-2-hydroxymethyl-biphenyl Linear Structure Formula: C14H11NO5 Molecular Formula: C14H11NO5 Molecular Weight: 273.245 Type of Substance: heterocyclic InChI Key: AIALWSNWGJYWRU-UHFFFAOYSA-N Note:
HO
O
O
N
O
O
Substance Label (2) Label References X
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
VI
Hill; Carlson; Tetrahedron Letters; (1964); p. 1157,1158, View in Reaxys
Melting Point (3) 1 of 3
Melting Point [°C]
103 - 104.5
Solvent (Melting Point)
ethanol
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys 2 of 3
Melting Point [°C]
168 - 169
Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys 3 of 3
Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys
Further Information (1) Description (Fur- References ther Information)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
129/249
2016-07-13 00:31:19
Further information
Hill; Carlson; Tetrahedron Letters; (1964); p. 1157,1158, View in Reaxys
IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Spectrum
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Reaxys ID 1393111 View in Reaxys
23/183 CAS Registry Number: 63141-48-0 Chemical Name: Ethyl (Z)-3-(2H-1,3-benzodioxol-5-yl)-2-nitropropenoate; 3,4-Methylendioxy-α-nitro-ethylcinnamat Linear Structure Formula: C12H11O6N Molecular Formula: C12H11NO6 Molecular Weight: 265.222 Type of Substance: heterocyclic InChI Key: DHFPSLRVINJCHD-UITAMQMPSA-N Note:
O Z
O O
O
O N
O
Substance Label (3) Label References (Z)-2d
Sui, Yong; Liu, Li; Zhao, Jun-Ling; Wang, Dong; Chen, Yong-Jun; Tetrahedron; vol. 63; nb. 24; (2007); p. 5173 - 5183, View in Reaxys
22
Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 - 863, View in Reaxys
1c
Pages; Wermuth; Bulletin de la Societe Chimique de France; vol. II; nb. 11-12; (1976); p. 1847 - 1848, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
108
Pages; Wermuth; Bulletin de la Societe Chimique de France; vol. II; nb. 11-12; (1976); p. 1847 - 1848, View in Reaxys NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 863, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 863, View in Reaxys 3 of 3
Description (NMR Spec- NMR troscopy) Pages; Wermuth; Bulletin de la Societe Chimique de France; vol. II; nb. 11-12; (1976); p. 1847 - 1848, View in Reaxys
IR Spectroscopy (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
130/249
2016-07-13 00:31:19
1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
neat (no solvent)
Comment (IR Spectroscopy)
2986 - 1360 cm**(-1)
Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 863, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; electron impact (EI)
Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 - 863, View in Reaxys
Reaxys ID 7093370 View in Reaxys
Chemical Name: 5-(2-nitro-1(Z)-ethenyl)benzo[d][1,3]dioxol Linear Structure Formula: C9H7NO4 Molecular Formula: C9H7NO4 Molecular Weight: 193.159 Type of Substance: heterocyclic InChI Key: KFLWBZPSJQPRDD-ARJAWSKDSA-N Note:
Z
O O
24/183
O
N
O
Substance Label (3) Label References 1f
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys
4b
Pradhan, Prasun K.; Dey, Sumit; Jaisankar, Parasuraman; Giri, Venkatachalam S.; Synthetic Communications; vol. 35; nb. 7; (2005); p. 913 - 922, View in Reaxys
6h
Chikashita, Hidenori; Nishida, Shuichi; Miyazaki, Makoto; Morita, Yasuhiro; Itoh, Kazuyoshi; Bulletin of the Chemical Society of Japan; vol. 60; nb. 2; (1987); p. 737 - 746, View in Reaxys
Crystal Property Description (1) Colour & Other References Properties yellow
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Original Text (NMR Spectroscopy)
1H
Signals [ppm]
7.55; 7.62; 7.64; 7.97
Kind of signal
d, 1H, J = 13.6; d, 2H, J = 8.0; d, 1H, J = 8.0; d, 1H, J = 13.6
NMR (CDCl3, 400 MHz) δ (ppm): 7.55 (d, 1H, J = 13.6), 7.62 (d, 2H, J = 8.0), 7.64 (d, 1H, J = 8.0), 7.97 (d, 1H, J = 13.6)
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
131/249
2016-07-13 00:31:19
2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Original Text (NMR Spectroscopy)
13C NMR (CDCl , 100 MHz) δ (ppm): 101.5, 107.0, 109.0, 124.0, 127.0, 134.0, 139.5, 3 149.0, 151.0
Signals [ppm]
101.5; 107; 109; 124; 127; 134; 139.5; 149; 151
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys Mass Spectrometry (1) Description (Mass Peak Spectrometry) electron impact (EI); spectrum
193.0 m/z; 170.0 m/z; 169.1 m/z; 156.0 m/z; 100.0 m/z
Intensity [%]
References
97.2; 7; 26.6; 13
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys
UV/VIS Spectroscopy (1) 1 of 1
Absorption Maxima (UV/ 375; 291 VIS) [nm] Ext./Abs. Coefficient [l·mol-1cm-1]
3200; 3400
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys Pharmacological Data (2) 1 of 2
Comment (Pharmacological Data)
Bioactivities present
Chikashita, Hidenori; Nishida, Shuichi; Miyazaki, Makoto; Morita, Yasuhiro; Itoh, Kazuyoshi; Bulletin of the Chemical Society of Japan; vol. 60; nb. 2; (1987); p. 737 - 746, View in Reaxys; Pradhan, Prasun K.; Dey, Sumit; Jaisankar, Parasuraman; Giri, Venkatachalam S.; Synthetic Communications; vol. 35; nb. 7; (2005); p. 913 - 922, View in Reaxys; Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys 2 of 2
Comment (Pharmacological Data)
physiological behaviour discussed
Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys
Reaxys ID 10535744 View in Reaxys
25/183 CAS Registry Number: 916245-11-9 Chemical Name: 3-(benzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 Type of Substance: heterocyclic InChI Key: DQZGRWFDDAYALP-UHFFFAOYSA-N Note:
O N
O O
O
O
Substance Label (3) Label References
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
132/249
2016-07-13 00:31:19
3c
Cagide-Fagin, Fernando; Nieto-Garcia, Olaia; Lago-Santome, Hugo; Alonso, Ricardo; Journal of Organic Chemistry; vol. 77; nb. 24; (2012); p. 11377 - 11382, View in Reaxys
II7d
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
6b
Ortiz, Juan Carlos; Ozores, Lidia; Cagide-Fagin, Fernando; Alonso, Ricardo; Chemical Communications; nb. 40; (2006); p. 4239 - 4241, View in Reaxys
Reaxys ID 10540785 View in Reaxys
26/183 CAS Registry Number: 718597-87-6 Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: WGMJOSLIKRMTQU-UHFFFAOYSA-N Note:
O N
O O
O
HO
Substance Label (2) Label References 1f
Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Kumar, Polu Vijay; RSC Advances; vol. 5; nb. 113; (2015); p. 93447 - 93451, View in Reaxys
5b
Ortiz, Juan Carlos; Ozores, Lidia; Cagide-Fagin, Fernando; Alonso, Ricardo; Chemical Communications; nb. 40; (2006); p. 4239 - 4241, View in Reaxys
Reaxys ID 10545971 View in Reaxys
27/183 CAS Registry Number: 916245-12-0 Chemical Name: 3-(4-methoxybenzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 Type of Substance: heterocyclic InChI Key: PBPMXZVQTIWHSZ-UHFFFAOYSA-N Note:
O N
O O
O
O O
Substance Label (3) Label References 3b
Cagide-Fagin, Fernando; Nieto-Garcia, Olaia; Lago-Santome, Hugo; Alonso, Ricardo; Journal of Organic Chemistry; vol. 77; nb. 24; (2012); p. 11377 - 11382, View in Reaxys
IIp
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
6c
Ortiz, Juan Carlos; Ozores, Lidia; Cagide-Fagin, Fernando; Alonso, Ricardo; Chemical Communications; nb. 40; (2006); p. 4239 - 4241, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
250
Original Text (NMR Spectroscopy)
1H
NMR (CDCl3, 250 MHz) δ 3.91, 3.96 (s, 3H), 6.07, 6.14 (s, 2H), 6.78, 6.82 (s, IH), 7.21 (s, 0.5H), 7.42 (s, 0.5H) 7.59 (s, 0.5H), 8.30 (d, J= 2.5 Hz, 0.5H), 9.48 (s, 0.5H), 10.23 (d, J= 2.5 Hz, 0.5H).
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
133/249
2016-07-13 00:31:19
Comment (NMR Spectroscopy)
Signals given
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 2 of 2
Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
62.5
Original Text (NMR Spectroscopy)
13C
Comment (NMR Spectroscopy)
Signals given
NMR (CDCl3, 62.5 MHz) δ 56.90, 102.86, 103.05, 103.22, 103.80, 104.87, 108.27, 113.39, 116.11, 122.97, 123.85, 128.21, 132.13, 133.35, 133.64, 139.27, 142.05, 142.93, 143.71, 144.04, 145.62, 146.12, 149.42, 149.95, 181.84, 184.18
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
Reaxys ID 10665814 View in Reaxys
28/183 CAS Registry Number: 916487-06-4 Chemical Name: 7-nitro-6H-[1,3]methylenedioxy[4,5-g]chromene; 3-nitro-2H-6,7-methylenedioxychromene; 6,7-Methylenedioxy-3-nitrochromene Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 Type of Substance: heterocyclic InChI Key: JRTRWYLTILKTDP-UHFFFAOYSA-N Note:
O N
O O
O
O
Substance Label (2) Label References 3a; 3
Patent; PURDUE RESEARCH FOUNDATION; US2009/30025; (2009); (A1) English, View in Reaxys
19
Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys
Melting Point (3) 1 of 3
Melting Point [°C]
139
Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys 2 of 3
Melting Point [°C]
139
Solvent (Melting Point)
methanol
Patent; PURDUE RESEARCH FOUNDATION; US2009/30025; (2009); (A1) English, View in Reaxys 3 of 3
Melting Point [°C]
139
Solvent (Melting Point)
methanol
Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys Crystal Property Description (1) Colour & Other References Properties red
Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys; Patent; PURDUE RESEARCH FOUNDATION; US2009/30025; (2009); (A1) English, View in Reaxys; Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys
NMR Spectroscopy (3)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
134/249
2016-07-13 00:31:19
1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys 2 of 3
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Original Text (NMR Spectroscopy)
1H-NMR
Comment (NMR Spectroscopy)
Signals given
Signals [ppm]
5.2; 6.02; 6.49; 6.69; 7.75
Kind of signal
s, 2, ArOCH&2%; s, 2, OCH&2%O; s, 1, ArH; s, 1, ArH; s, 1, ArCH
(CDCl3) δ 5.20 (s, 2, ArOCH2), 6.02 (s, 2, OCH2O), 6.49 (s, 1, ArH), 6.69 (s, 1, ArH), 7.75 (s, 1, ArCH)
Patent; PURDUE RESEARCH FOUNDATION; US2009/30025; (2009); (A1) English, View in Reaxys 3 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) CI (Chemical ioni- Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, zation); Spectrum David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys
Reaxys ID 11137130 View in Reaxys
29/183 Chemical Name: (E)-6-(3,4-methylenedioxyphenyl)-5-nitrohex-5-en-2-one; (E)-6-(benzo[d][1,3]dioxol-6-yl)-5-nitrohex-5en-2-one Linear Structure Formula: C13H13NO5 Molecular Formula: C13H13NO5 Molecular Weight: 263.25 InChI Key: QORRHPQPMZWQST-IZZDOVSWSA-N Note:
O O
E
N
O
O O
Substance Label (2) Label References 1k
Roy, Suparna; Amireddy, Mamatha; Chen, Kwunmin; Tetrahedron; vol. 69; nb. 41; (2013); p. 8751 - 8757, View in Reaxys
3h
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys
Melting Point (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
135/249
2016-07-13 00:31:19
1 of 1
Melting Point [°C]
102 - 104
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys
Pharmacological Data (3) 1 of 3
Comment (Pharmacological Data)
Bioactivities present
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys; Shanbhag, Pramod; Nareddy, Pradeep R.; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 8; nb. 21; (2010); p. 4867 4873, View in Reaxys; Roy, Suparna; Amireddy, Mamatha; Chen, Kwunmin; Tetrahedron; vol. 69; nb. 41; (2013); p. 8751 - 8757, View in Reaxys 2 of 3
Effect (Pharmacological Data)
anticancer, other
Species or Test-System (Pharmacological Data)
human cervical cancer HeLa cells
Concentration (Pharmacological Data)
5 - 25 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Method (Pharmacological Data)
standard sulforhodamine B assay; cells density: 1E5 cells/ml; title comp. incubated with cells for 24 h; absorbance measured at 560 nm
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
136/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
average of 3 determinations
Results
title compound produced 30 and 82percent inhibition of cell proliferation at a dose of 5 and 25 μmol/l, resp.
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys 3 of 3
Effect (Pharmacological Data)
protein binding
Species or Test-System (Pharmacological Data)
goat brain tubulin
Concentration (Pharmacological Data)
10 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in PEM buffer
Method (Pharmacological Data)
intrinsic tubulin fluorescence measured; title comp. incubated with tubulin (1 μM) for 30 min at room temperature; fluorescence assay with excitation and emission wavelengths of 280 and 335 nm, resp.
Results
title comp. quenched the intrinsic tryptophan fluorescence of tubulin which indicated a binding of title comp. to tubulin; fig., tables
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys
Reaxys ID 19786427 View in Reaxys
30/183 CAS Registry Number: 66425-16-9 Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 InChI Key: UKQZUXNFVBFRRY-UHFFFAOYSA-N Note:
O N
O O
O
Br
Substance Label (1) Label References S5
Eliasen, Anders M.; Christy, Mitchell; Claussen, Karin R.; Besandre, Ronald; Thedford, Randal P.; Siegel, Dionicio; Organic Letters; vol. 17; nb. 18; (2015); p. 4420 - 4423, View in Reaxys
Reaxys ID 20299515 View in Reaxys
31/183 CAS Registry Number: 858467-42-2 Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 InChI Key: WEYZGKQDMSTRQD-UHFFFAOYSA-N Note:
O N
O O
O
Br
Substance Label (1) Label References 8c
Gopi, Elumalai; Kumar, Tarun; Menna-Barreto, Rubem F. S.; Valena, Wagner O.; Da Silva Jnior, Eufrnio N.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 13; nb. 38; (2015); p. 9862 - 9871, View in Reaxys
Reaxys ID 20299517 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
32/183
137/249
2016-07-13 00:31:19
O N
O
Linear Structure Formula: C13H13NO5 Molecular Formula: C13H13NO5 Molecular Weight: 263.25 InChI Key: QORRHPQPMZWQST-UHFFFAOYSA-N Note:
O
O O
Substance Label (2) Label References 6f
Mane, Vaijinath; Kumar, Tarun; Pradhan, Sourav; Katiyar, Savita; Namboothiri, Irishi N. N.; RSC Advances; vol. 5; nb. 86; (2015); p. 69990 - 69999, View in Reaxys
2c
Shanbhag, Pramod; Mane, Vaijinath; Hazra, Chinmoy; Namboothiri, Irishi N. N.; Journal of the Indian Chemical Society; vol. 90; nb. 10; (2013); p. 1713 - 1719, View in Reaxys
Reaxys ID 22332976 View in Reaxys
33/183 CAS Registry Number: 1355334-09-6 Chemical Name: 2-(benzo[d][1,3]dioxol-5-yl)-3-nitroimidazo[1,2-a]pyridine Linear Structure Formula: C14H9N3O4 Molecular Formula: C14H9N3O4 Molecular Weight: 283.243 InChI Key: WAEFWBCILWUKRX-UHFFFAOYSA-N Note:
O O
N
O
N N
O
Substance Label (2) Label References 3d
An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys
4an
Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys
Melting Point (2) 1 of 2
Melting Point [°C]
198 - 200
Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys 2 of 2
Melting Point [°C]
198 - 199
Location
supporting information
Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys Crystal Property Description (2) Colour & Other Location Properties yellow
yellow
References Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys
supporting information
Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys
NMR Spectroscopy (5) 1 of 5
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
138/249
2016-07-13 00:31:19
An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys 2 of 5
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys 3 of 5
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys 4 of 5
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys; Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys 5 of 5
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Comment (IR Spectroscopy)
neat (no solvent, solid phase)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
139/249
2016-07-13 00:31:19
Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys Mass Spectrometry (3) Description (Mass Location Spectrometry)
References
high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum
An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys
HRMS (High resolution mass spectrometry); Spectrum
Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys
high resolution supporting informass spectrome- mation try (HRMS); spectrum
Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys
Reaxys ID 232026 View in Reaxys
34/183 Chemical Name: 5-methyl-6-(2-nitro-propenyl)-benzo[1,3]dioxole; 5-Methyl-6-(2-nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: VOZKBROGGMTSQH-XBXARRHUSA-N Note:
O N
O
E O O
Melting Point (1) 1 of 1
Melting Point [°C]
122 - 123
Solvent (Melting Point)
ethanol
Sugasawa; Hino; Pharmaceutical Bulletin; vol. 2; (1954); p. 242,245, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Gelb
Sugasawa; Hino; Pharmaceutical Bulletin; vol. 2; (1954); p. 242,245, View in Reaxys
Reaxys ID 307141 View in Reaxys
35/183
O
O E
O
CAS Registry Number: 22959-13-3 Chemical Name: 4,7-dimethoxy-5-(2-nitro-propenyl)-benzo[1,3]dioxole; 4,7-Dimethoxy-5-(2-nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C12H13NO6 Molecular Formula: C12H13NO6 Molecular Weight: 267.238 Type of Substance: heterocyclic InChI Key: WQRDYLOJWQMEFW-QPJJXVBHSA-N Note:
N
O
O O
Melting Point (2) 1 of 2
Melting Point [°C]
110 - 111
Solvent (Melting Point)
ethanol
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
140/249
2016-07-13 00:31:19
Schmidt,E. et al.; Chemische Berichte; vol. 55; (1922); p. 1756, View in Reaxys 2 of 2
Melting Point [°C]
96
Solvent (Melting Point)
ethanol
Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> II; p. 139, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelbe Nadeln
Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> II; p. 139, View in Reaxys; Schmidt,E. et al.; Chemische Berichte; vol. 55; (1922); p. 1756, View in Reaxys
Reaxys ID 367664 View in Reaxys
36/183 CAS Registry Number: 873419-85-3 Chemical Name: 5-(3-acetoxy-propyl)-2-benzo[1,3]dioxol-5yl-7-methoxy-3-nitro-benzofuran Linear Structure Formula: C21H19NO8 Molecular Formula: C21H19NO8 Molecular Weight: 413.384 Type of Substance: heterocyclic InChI Key: YGAZFABZNVTLOR-UHFFFAOYSA-N Note:
O
O
O
O O N
O
O
O
Related Structure (1) Related Structure References Constitution.
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
160
Solvent (Melting Point)
acetone
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 586,591; Nippon Kagaku Kaishi; vol. 61; (1940); p. 487,491, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 586,591; Nippon Kagaku Kaishi; vol. 61; (1940); p. 487,491, View in Reaxys
Reaxys ID 1264618 View in Reaxys
37/183 CAS Registry Number: 65762-51-8 Chemical Name: 2-[6-(2-nitro-vinyl)-benzo[1,3]dioxol-5-yl]-benzoic acid methyl ester Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 Type of Substance: heterocyclic InChI Key: BQGXRJUZSSTSQK-UHFFFAOYSA-N Note:
O N
O
O O O O
Substance Label (2) Label References 19a
Kobayashi; Kihara; Shizu; Katayama; Ikeda; Kitahiro; Matsumoto; Chemical and Pharmaceutical Bulletin; vol. 25; nb. 12; (1977); p. 3312 - 3323, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
141/249
2016-07-13 00:31:19
V
Kobayashi; Kihara; Yamasaki; Ishida; Watanabe; Chemical and pharmaceutical bulletin; vol. 23; nb. 11; (1975); p. 3036 - 3037, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
167 - 170
Kobayashi; Kihara; Shizu; Katayama; Ikeda; Kitahiro; Matsumoto; Chemical and Pharmaceutical Bulletin; vol. 25; nb. 12; (1977); p. 3312 - 3323, View in Reaxys; Kobayashi; Kihara; Yamasaki; Ishida; Watanabe; Chemical and pharmaceutical bulletin; vol. 23; nb. 11; (1975); p. 3036 - 3037, View in Reaxys NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- NMR troscopy) Comment (NMR Spectroscopy)
1H
Kobayashi; Kihara; Shizu; Katayama; Ikeda; Kitahiro; Matsumoto; Chemical and Pharmaceutical Bulletin; vol. 25; nb. 12; (1977); p. 3312 - 3323, View in Reaxys 2 of 2
Description (NMR Spec- NMR troscopy) Kobayashi; Kihara; Yamasaki; Ishida; Watanabe; Chemical and pharmaceutical bulletin; vol. 23; nb. 11; (1975); p. 3036 - 3037, View in Reaxys
IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
IR
Kobayashi; Kihara; Shizu; Katayama; Ikeda; Kitahiro; Matsumoto; Chemical and Pharmaceutical Bulletin; vol. 25; nb. 12; (1977); p. 3312 - 3323, View in Reaxys; Kobayashi; Kihara; Yamasaki; Ishida; Watanabe; Chemical and pharmaceutical bulletin; vol. 23; nb. 11; (1975); p. 3036 - 3037, View in Reaxys
Reaxys ID 1320328 View in Reaxys
38/183 CAS Registry Number: 109512-11-0 Chemical Name: 4,5-methylenedioxy-2'-nitro-2-biphenylcarbaldehyde; 6-(2-nitro-phenyl)-benzo[1,3]dioxole-5-carbaldehyde; 2'-Nitro-4,5-methylendioxy-2-formyl-biphenyl Linear Structure Formula: C14H9NO5 Molecular Formula: C14H9NO5 Molecular Weight: 271.229 Type of Substance: heterocyclic InChI Key: BJWAFJVRXLZOCR-UHFFFAOYSA-N Note:
O
O
O
N
O
O
Substance Label (1) Label References 34
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys
Melting Point (2) 1 of 2
Melting Point [°C]
135 - 138
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 2 of 2
Melting Point [°C]
227 - 228
Solvent (Melting Point)
ethyl acetate
Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys Sublimation (1) Comment (Sublimation) bei 200-210grad/3 Torr
References Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
142/249
2016-07-13 00:31:19
Crystal Property Description (1) Colour & Other References Properties yellow
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys
NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
20
Frequency (NMR Spectroscopy) [MHz]
75
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
20
Frequency (NMR Spectroscopy) [MHz]
300
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 3 of 3
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
20
Frequency (NMR Spectroscopy) [MHz]
300
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; electron impact (EI)
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
143/249
2016-07-13 00:31:19
Reaxys ID 1330573 View in Reaxys
39/183 CAS Registry Number: 5025-67-2 Chemical Name: 2'-Iod-methoxycarbonyl-4',5'-methylendioxyα-nitro-cis-stilben Linear Structure Formula: C17H12INO6 Molecular Formula: C17H12INO6 Molecular Weight: 453.19 Type of Substance: heterocyclic InChI Key: JRDLWETYBWYSSG-MKMNVTDBSA-N Note:
O
O E
O
N O O O
I
Substance Label (1) Label References LXVI
Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
118 - 119
Solvent (Melting Point)
ethanol
Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1
Description (UV/VIS Spectroscopy)
Absorption maxima
Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys
Reaxys ID 1990310 View in Reaxys
40/183 CAS Registry Number: 1215-58-3 Chemical Name: 1-(3,4-methylenedioxyphenyl)-2-nitro-1-pentene; 1-(3'.4'-Methylendioxyphenyl)-2-nitro-penten Linear Structure Formula: C12H13NO4 Molecular Formula: C12H13NO4 Molecular Weight: 235.24 Type of Substance: heterocyclic InChI Key: BDRAJGDAPYLXOK-UHFFFAOYSA-N Note:
O O
N
O
O
Substance Label (1) Label References 1, Ar = 3,4(OCH2O)C6H3
Yoneda, Fumio; Moto, Toshiaki; Sakae, Masatoshi; Ohde, Hironori; Knoll, Berta; Miklya, Ildiko; Knoll, Joseph; Bioorganic and Medicinal Chemistry; vol. 9; nb. 5; (2001); p. 1197 - 1212, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
49 - 50
Koremura; Nippon Kagaku Kaishi; vol. 36; nb. 7; (1962); p. 552,553-556; Chem.Abstr.; vol. 62; nb. 3962d; (1965), View in Reaxys Crystal Property Description (1) Colour & Other References Properties light-yellow
Yoneda, Fumio; Moto, Toshiaki; Sakae, Masatoshi; Ohde, Hironori; Knoll, Berta; Miklya, Ildiko; Knoll, Joseph; Bioorganic and Medicinal Chemistry; vol. 9; nb. 5; (2001); p. 1197 - 1212, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
144/249
2016-07-13 00:31:19
Frequency (NMR Spectroscopy) [MHz]
270
Yoneda, Fumio; Moto, Toshiaki; Sakae, Masatoshi; Ohde, Hironori; Knoll, Berta; Miklya, Ildiko; Knoll, Joseph; Bioorganic and Medicinal Chemistry; vol. 9; nb. 5; (2001); p. 1197 - 1212, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
270
Yoneda, Fumio; Moto, Toshiaki; Sakae, Masatoshi; Ohde, Hironori; Knoll, Berta; Miklya, Ildiko; Knoll, Joseph; Bioorganic and Medicinal Chemistry; vol. 9; nb. 5; (2001); p. 1197 - 1212, View in Reaxys
Reaxys ID 4699552 View in Reaxys
41/183 CAS Registry Number: 88484-87-1 Linear Structure Formula: C10H8N2O6 Molecular Formula: C10H8N2O6 Molecular Weight: 252.183 Type of Substance: heterocyclic InChI Key: KVTULAZMZRAQOD-KXFIGUGUSA-N Note:
O O
N Z
O O
N
O
O
Substance Label (2) Label References 1b
Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Synthesis; nb. 12; (1983); p. 1027 - 1028, View in Reaxys
7
Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 8; (1983); p. 725 - 726, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
153 - 154
Solvent (Melting Point)
CHCl3; hexane
Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Synthesis; nb. 12; (1983); p. 1027 - 1028, View in Reaxys
Reaxys ID 5069542 View in Reaxys
42/183 CAS Registry Number: 49571-78-0 Chemical Name: methyl (Z)-3-(1,3-benzodioxol-5-yl)-2-nitroacrylate; methyl 2-nitro 3-piperonyl acrylate Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 Type of Substance: heterocyclic InChI Key: IGDFMGQGZSISDX-YWEYNIOJSA-N Note:
O Z
O O
O
O N
O
Substance Label (1) Label References 17c
Melot, Jean Marie; Texier-Boullet, Francoise; Foucaud, Andre; Tetrahedron; vol. 44; nb. 8; (1988); p. 2215 - 2224, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
105
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
145/249
2016-07-13 00:31:19
Solvent (Melting Point)
benzene
Melot, Jean Marie; Texier-Boullet, Francoise; Foucaud, Andre; Tetrahedron; vol. 44; nb. 8; (1988); p. 2215 2224, View in Reaxys NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
24.84
Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Blanco-Ania, Daniel; Hermkens, Pedro H.H.; Sliedregt, Leo A.J.M.; Scheeren, Hans W.; Rutjes, Floris P.J.T.; Tetrahedron; vol. 65; nb. 27; (2009); p. 5393 - 5401, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
24.84
Frequency (NMR Spectroscopy) [MHz]
75
Location
supporting information
Blanco-Ania, Daniel; Hermkens, Pedro H.H.; Sliedregt, Leo A.J.M.; Scheeren, Hans W.; Rutjes, Floris P.J.T.; Tetrahedron; vol. 65; nb. 27; (2009); p. 5393 - 5401, View in Reaxys 3 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Melot, Jean Marie; Texier-Boullet, Francoise; Foucaud, Andre; Tetrahedron; vol. 44; nb. 8; (1988); p. 2215 2224, View in Reaxys
Reaxys ID 5640782 View in Reaxys
O
CAS Registry Number: 107092-58-0 Linear Structure Formula: C19H19NO7 Molecular Formula: C19H19NO7 Molecular Weight: 373.362 Type of Substance: heterocyclic InChI Key: RQXWTKIJIMMSQE-NSIKDUERSA-N Note:
O
Z
O O
43/183
N
O
O O
Substance Label (1) Label References 3d
Dauzonne; Royer; Chemical and Pharmaceutical Bulletin; vol. 34; nb. 4; (1986); p. 1628 - 1633, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
146/249
2016-07-13 00:31:19
Melting Point (1) 1 of 1
Melting Point [°C]
119 - 120
Solvent (Melting Point)
propan-2-ol; diisopropyl ether
Dauzonne; Royer; Chemical and Pharmaceutical Bulletin; vol. 34; nb. 4; (1986); p. 1628 - 1633, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Dauzonne; Royer; Chemical and Pharmaceutical Bulletin; vol. 34; nb. 4; (1986); p. 1628 - 1633, View in Reaxys Pharmacological Data (1) 1 of 1
Comment (Pharmacological Data)
Bioactivities present
Dauzonne; Royer; Chemical and Pharmaceutical Bulletin; vol. 34; nb. 4; (1986); p. 1628 - 1633, View in Reaxys; Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys
Reaxys ID 7708770 View in Reaxys
44/183 Chemical Name: 1,2-Dihydro-6,7-methylenedioxy-3-nitronaphthalene Linear Structure Formula: C11H9NO4 Molecular Formula: C11H9NO4 Molecular Weight: 219.197 Type of Substance: heterocyclic InChI Key: HAWXIHDZBMRQIY-UHFFFAOYSA-N Note:
O N
O
O
O
NMR Spectroscopy (1) 1 of 1
Original Text (NMR Spectroscopy)
NMR (CDCl3) δ:7.78 (s, 1H), 6.80 (s, 1H), 6,72 (s, 1H), 6.01 (s, 2H), 2.46 (bs, 4H)
Comment (NMR Spectroscopy)
Signals given
Signals [ppm]
7.78; 6.8; 6.01; 2.46
Kind of signal
s, 1H; s, 1H; s, 1H; s, 2H; bs, 4H
Patent; Abbott Laboratories; US5597832; (1997); (A1) English, View in Reaxys Mass Spectrometry (1) Comment (Mass Peak Spectrometry)
References
Molecular peak
Patent; Abbott Laboratories; US5597832; (1997); (A1) English, View in Reaxys
220 m/z
Reaxys ID 9499882 View in Reaxys
45/183 CAS Registry Number: 562840-92-0 Chemical Name: (E)-trimethyl(2-(6-(2-nitrovinyl)benzo[d] [1,3]dioxol-5-yl)ethynyl)silane; trimethyl[6-(2-nitrovinyl)benzo[1,3]dioxol-5-ylethynyl]silane Linear Structure Formula: C14H15NO4Si Molecular Formula: C14H15NO4Si Molecular Weight: 289.363 Type of Substance: heterocyclic
O N E
O
O O Si
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
147/249
2016-07-13 00:31:19
InChI Key: MKWASMOBFNINBI-GQCTYLIASA-N Note: Substance Label (2) Label References 15
Shimizu, Kazuya; Takimoto, Masanori; Sato, Yoshihiro; Mori, Miwako; Journal of Organometallic Chemistry; vol. 691; nb. 24-25; (2006); p. 5466 - 5475, View in Reaxys
10
Shimizu, Kazuya; Takimoto, Masanori; Mori, Miwako; Organic Letters; vol. 5; nb. 13; (2003); p. 2323 2325, View in Reaxys
NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Shimizu, Kazuya; Takimoto, Masanori; Mori, Miwako; Organic Letters; vol. 5; nb. 13; (2003); p. 2323 - 2325, View in Reaxys; Shimizu, Kazuya; Takimoto, Masanori; Sato, Yoshihiro; Mori, Miwako; Journal of Organometallic Chemistry; vol. 691; nb. 24-25; (2006); p. 5466 - 5475, View in Reaxys 2 of 3
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Shimizu, Kazuya; Takimoto, Masanori; Mori, Miwako; Organic Letters; vol. 5; nb. 13; (2003); p. 2323 - 2325, View in Reaxys; Shimizu, Kazuya; Takimoto, Masanori; Sato, Yoshihiro; Mori, Miwako; Journal of Organometallic Chemistry; vol. 691; nb. 24-25; (2006); p. 5466 - 5475, View in Reaxys 3 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Shimizu, Kazuya; Takimoto, Masanori; Mori, Miwako; Organic Letters; vol. 5; nb. 13; (2003); p. 2323 - 2325, View in Reaxys; Shimizu, Kazuya; Takimoto, Masanori; Sato, Yoshihiro; Mori, Miwako; Journal of Organometallic Chemistry; vol. 691; nb. 24-25; (2006); p. 5466 - 5475, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
film
Shimizu, Kazuya; Takimoto, Masanori; Mori, Miwako; Organic Letters; vol. 5; nb. 13; (2003); p. 2323 - 2325, View in Reaxys; Shimizu, Kazuya; Takimoto, Masanori; Sato, Yoshihiro; Mori, Miwako; Journal of Organometallic Chemistry; vol. 691; nb. 24-25; (2006); p. 5466 - 5475, View in Reaxys
Reaxys ID 10098478 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
46/183
148/249
2016-07-13 00:31:19
CAS Registry Number: 156775-35-8 Chemical Name: 2-nitro-1,3-bis(benzo[1,3]dioxol-5-yl)propene Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 Type of Substance: heterocyclic InChI Key: KXZILZHHXSZSJP-UHFFFAOYSA-N Note:
O O
O O
O
N
O
Substance Label (1) Label References 11
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys
Pharmacological Data (11) 1 of 11
Comment (Pharmacological Data)
Bioactivities present
Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys; McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 1348, View in Reaxys 2 of 11
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
HEK293 cells
Further Details (Pharmacological Data)
neutral red assay; HEK: human embryonic kidney; effective concentration (EC)
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-5.1
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 3 of 11
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
HEK293 cells; genetically modified/infected with: human serotonin transporter
Further Details (Pharmacological Data)
neutral red assay; HEK: human embryonic kidney; effective concentration (EC)
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-4.9
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 4 of 11
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
DG-75 cells
Further Details (Pharmacological Data)
DG-75 cells: B-lymphocyte Burkitt's lymphoma cell line derived from lung metastatic pleural effusion of Burkitt's lymphoma sporadic case; neutral red assay; effective concentration (EC)
Type (Pharmacological Data)
log EC50
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
149/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
-6
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 5 of 11
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
SHSY-5Y cells
Further Details (Pharmacological Data)
SHSY-5Y cells: thrice cloned (SK-N-SH->SH-SY->SH-SY5->SH-SY5Y) subline of human neuroblastoma cell line SK-N-SH established from metastatic bone tumour; neutral red assay; effective concentration (EC)
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-4.8
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 6 of 11
Effect (Pharmacological Data)
transporter activity; inhibition of
Species or Test-System (Pharmacological Data)
HEK293 cells; genetically modified/infected with: human serotonin transporter
Concentration (Pharmacological Data)
1 - 100 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in Hanks balanced salt solution containing 0.1percent bovine serum albumin
Further Details (Pharmacological Data)
fluorescence neurotransmitter transporter uptake assay; HEK: human embryonic kidney; inhibition rate related to: human serotonin transporter
Type (Pharmacological Data)
inhibition rate
Value of Type (Pharmacological Data)
15 - 36 percent
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 7 of 11
Effect (Pharmacological Data)
transporter activity; inhibition of
Species or Test-System (Pharmacological Data)
HEK293 cells; genetically modified/infected with: human serotonin transporter
Concentration (Pharmacological Data)
1 - 100 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in Hanks balanced salt solution containing 0.1percent bovine serum albumin
Further Details (Pharmacological Data)
fluorescence neurotransmitter transporter uptake assay; HEK: human embryonic kidney
Results
molecular target: human serotonin transporter
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 8 of 11
Effect (Pharmacological Data)
antiproliferative
Species or Test-System (Pharmacological Data)
DG-75 cells
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
150/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
DG-75 cells: B-lymphocyte Burkitt's lymphoma cell line derived from lung metastatic pleural effusion of Burkitt's lymphoma sporadic case; Alamar Blue assay; effective concentration (EC)
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-4.3
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 9 of 11
Effect (Pharmacological Data)
antiproliferative
Species or Test-System (Pharmacological Data)
SHSY-5Y cells
Further Details (Pharmacological Data)
SHSY-5Y cells: thrice cloned (SK-N-SH->SH-SY->SH-SY5->SH-SY5Y) subline of human neuroblastoma cell line SK-N-SH established from metastatic bone tumour; Alamar Blue assay; effective concentration (EC)
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-4.5
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 10 of 11
Effect (Pharmacological Data)
antiproliferative
Species or Test-System (Pharmacological Data)
MUTU-I c179 cells
Further Details (Pharmacological Data)
MUTU-I c179 cells: isogenic stable group I Burkitt's lymphoma cell line derived from biopsy; Alamar Blue assay; effective concentration (EC)
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-5.5
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 11 of 11
Effect (Pharmacological Data)
cell cycle; effect on
Species or Test-System (Pharmacological Data)
MUTU-I c179 cells
Concentration (Pharmacological Data)
10 μmol/l
Further Details (Pharmacological Data)
MUTU-I c179 cells: isogenic stable group I Burkitt's lymphoma cell line derived from biopsy; propidium iodide FACS assay
Type (Pharmacological Data)
pre-G1 phase cell rate
Value of Type (Pharmacological Data)
30 percent
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
151/249
2016-07-13 00:31:19
Reaxys ID 10268209 View in Reaxys
47/183 Chemical Name: (E)-ethyl 4-(benzo[d][1,3]dioxol-6-yl)-2-hydroxy-3-nitrobut-3-enoate Linear Structure Formula: C13H13NO7 Molecular Formula: C13H13NO7 Molecular Weight: 295.249 Type of Substance: heterocyclic InChI Key: KQFWZJSFTQDJIV-WEVVVXLNSA-N Note:
O E
O O
N
O O
HO O
Substance Label (1) Label References 3e
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
90
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys
NMR Spectroscopy (6) 1 of 6
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Location
supporting information
Deb, Indubhusan; Shanbhag, Pramod; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; European Journal of Organic Chemistry; nb. 24; (2009); p. 4091 - 4101, View in Reaxys 2 of 6
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
299.95
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys 3 of 6
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
299.95
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys 4 of 6
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
152/249
2016-07-13 00:31:19
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
299.95
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys 5 of 6
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
100.561
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys 6 of 6
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
100.561
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
film
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum
Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys
Reaxys ID 11137132 View in Reaxys
48/183 Chemical Name: (E)-ethyl-5-(benzo[d][1,3]dioxol-6-yl)-4-nitropent-4-enoate Linear Structure Formula: C14H15NO6 Molecular Formula: C14H15NO6 Molecular Weight: 293.276 InChI Key: RJKSKTYAFMPORI-YRNVUSSQSA-N Note:
O O
E
N
O
O O
O
Substance Label (1) Label References 5h
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys
Melting Point (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
153/249
2016-07-13 00:31:19
1 of 1
Melting Point [°C]
72 - 73
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys
Pharmacological Data (3) 1 of 3
Comment (Pharmacological Data)
Bioactivities present
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys; Shanbhag, Pramod; Nareddy, Pradeep R.; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 8; nb. 21; (2010); p. 4867 4873, View in Reaxys 2 of 3
Effect (Pharmacological Data)
anticancer, other
Species or Test-System (Pharmacological Data)
human cervical cancer HeLa cells
Concentration (Pharmacological Data)
5 - 25 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Method (Pharmacological Data)
standard sulforhodamine B assay; cells density: 1E5 cells/ml; title comp. incubated with cells for 24 h; absorbance measured at 560 nm
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
154/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
average of 3 determinations
Results
title compound produced 32 and 94percent inhibition of cell proliferation at a dose of 5 and 25 μmol/l, resp.
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys 3 of 3
Effect (Pharmacological Data)
protein binding
Species or Test-System (Pharmacological Data)
goat brain tubulin
Concentration (Pharmacological Data)
10 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in PEM buffer
Method (Pharmacological Data)
intrinsic tubulin fluorescence measured; title comp. incubated with tubulin (1 μM) for 30 min at room temperature; fluorescence assay with excitation and emission wavelengths of 280 and 335 nm, resp.
Results
title comp. quenched the intrinsic tryptophan fluorescence of tubulin which indicated a binding of title comp. to tubulin; fig., tables
Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys
Reaxys ID 11241388 View in Reaxys
49/183 Chemical Name: (E)-3-(benzo-[d][1,3]dioxol-5-yl)-2-nitro-1phenyl-N-tosylprop-2-en-1-amine Linear Structure Formula: C23H20N2O6S Molecular Formula: C23H20N2O6S Molecular Weight: 452.488 InChI Key: AVEBWBBNAUKMDJ-DEDYPNTBSA-N Note:
O O
E
N
O N H
O O
O
S
Substance Label (1) Label References 3k
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
168 - 169
Solvent (Melting Point)
CH2Cl2; petroleum ether
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys
NMR Spectroscopy (4) 1 of 4
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
155/249
2016-07-13 00:31:19
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys 2 of 4
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys 3 of 4
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys 4 of 4
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys
Pharmacological Data (2) 1 of 2
Comment (Pharmacological Data)
Bioactivities present
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys; Lima-Junior, Claudio G.; Vasconcellos, Mario L.A.A.; Bioorganic and Medicinal Chemistry; vol. 20; nb. 13; (2012); p. 3954 - 3971, View in Reaxys 2 of 2
Effect (Pharmacological Data)
antiproliferative
Species or Test-System (Pharmacological Data)
human cervical cancer HeLa cells
Concentration (Pharmacological Data)
1 - 10 μmol/l
Method (Pharmacological Data)
title comp. incubated with cells for 24 h
Results
title comp. inhibited cell proliferation in a dose-dependent manner (17percent, 29percent and 61percent at on dose of 1, 5 and 10 μM, resp.)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
156/249
2016-07-13 00:31:19
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys
Reaxys ID 15782472 View in Reaxys
O
CAS Registry Number: 1003600-22-3 Linear Structure Formula: C14H15NO7 Molecular Formula: C14H15NO7 Molecular Weight: 309.276 InChI Key: DQQSIONMFBONOG-UHFFFAOYSA-N Note:
O
N
O
50/183
O
O O
O
Substance Label (1) Label References intermed. pr. to 8
Aubry, Sylvain; Razafindrabe, Christian R.; Bourdon, Benjamin; Pellet-Rostaing, Stephane; Lemaire, Marc; Tetrahedron Letters; vol. 48; nb. 52; (2007); p. 9163 - 9166, View in Reaxys
Reaxys ID 15842355 View in Reaxys O O
51/183 Chemical Name: (Z)-3-(benzo[d][1,3]dioxol-5-yl)-2-nitroacrylaldehyde; 3-(benzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 InChI Key: DQZGRWFDDAYALP-BAQGIRSFSA-N Note:
O
N Z
O O
Substance Label (2) Label References II7d
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
Z-3e
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
Reaxys ID 15842356 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
52/183
157/249
2016-07-13 00:31:19
O
Chemical Name: (E)-3-(benzo[d][1,3]dioxol-5-yl)-2-nitroacrylaldehyde; 3-(benzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 InChI Key: DQZGRWFDDAYALP-FPYGCLRLSA-N Note:
O N
O
E O O
Substance Label (2) Label References II7d
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
E-3e
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
Reaxys ID 15842362 View in Reaxys
53/183 Chemical Name: (Z)-3-(4-methoxybenzo[d][1,3]dioxol-5-yl)-2nitroacrylaldehyde; 3-(4-methoxybenzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 InChI Key: PBPMXZVQTIWHSZ-WAPJZHGLSA-N Note:
O
O N O
Z
O O O
Substance Label (2) Label References IIp
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
Z-3f
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
158/249
2016-07-13 00:31:19
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
Reaxys ID 15842363 View in Reaxys
54/183 Chemical Name: (E)-3-(4-methoxybenzo[d][1,3]dioxol-5-yl)-2nitroacrylaldehyde; 3-(4-methoxybenzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 InChI Key: PBPMXZVQTIWHSZ-KRXBUXKQSA-N Note:
O
O
N E
O
O O O
Substance Label (2) Label References IIp
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
E-3f
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
Reaxys ID 15842364 View in Reaxys
55/183 CAS Registry Number: 1019636-29-3 Chemical Name: (E)-3-(4-methoxybenzo[d][1,3]dioxol-5-yl)-2nitroprop-2-en-1-ol; (E)-3-(4-methoxybenzo[d][1,3]dioxol-6yl)-2-nitroprop-2-en-1-ol Linear Structure Formula: C11H11NO6 Molecular Formula: C11H11NO6 Molecular Weight: 253.211 InChI Key: DPUBWQOCTWSMJR-KRXBUXKQSA-N Note:
O
OH
N E
O
O O O
Substance Label (2) Label References IIa7
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
2f
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
101
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
159/249
2016-07-13 00:31:19
Solvent (Melting Point)
dichloromethane; hexane
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
NMR Spectroscopy (6) 1 of 6
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
250
Original Text (NMR Spectroscopy)
1H
Comment (NMR Spectroscopy)
Signals given
NMR (CDCl3, 250 MHz) δ 2.63 (broad s, IH), 3.94 (s, 3H), 4.71 (s, 2H), 6.07 (s, 2H), 6.84 (s,2H), 8.11 (s, IH).
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 2 of 6
Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
62.5
Original Text (NMR Spectroscopy)
13C
Comment (NMR Spectroscopy)
Signals given
NMR (CDCl3, 62.5 MHz) 5 56.61, 56.69, 102.77, 104.21, 111.21, 125.38, 138.04, 143.80, 147.98, 149.42;
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 3 of 6
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys 4 of 6
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
160/249
2016-07-13 00:31:19
5 of 6
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys 6 of 6
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
CHCl3
Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys Mass Spectrometry (1) Description (Mass Comment (Mass Spectrometry) Spectrometry)
References
CI (Chemical ioni- Molecular peak zation)
Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys
Reaxys ID 19874161 View in Reaxys
O
O
CAS Registry Number: 1201566-85-9 Chemical Name: 2-(5-nitroquinolin-6-yl)-4,5-methylenedioxybenzoic acid methyl ester Linear Structure Formula: C18H12N2O6 Molecular Formula: C18H12N2O6 Molecular Weight: 352.303 InChI Key: HUXJIKIGRBXMQW-UHFFFAOYSA-N Note:
N
O
O
56/183
N
O
O
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
161/249
2016-07-13 00:31:19
Frequency (NMR Spectroscopy) [MHz]
300
Location
supporting information
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Location
supporting information
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
dichloromethane
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys Mass Spectrometry (2) Description (Mass References Spectrometry) ESI (Electrospray ionisation); Spectrum
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys
HRMS (High resolution mass spectrometry); ESI (Electrospray ionisation); TOFMS (Time of flight mass spectrum); Spectrum
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys
UV/VIS Spectroscopy (1) 1 of 1
Solvent (UV/VIS Spectroscopy)
dichloromethane
Absorption Maxima (UV/ 222; 231 VIS) [nm] Log epsilon
4.48; 4.68
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys
Reaxys ID 19874162 View in Reaxys O
O
CAS Registry Number: 1201566-91-7 Chemical Name: 2-(5-nitroisoquinolin-6-yl)-4,5-methylenedioxybenzoic acid methyl ester Linear Structure Formula: C18H12N2O6 Molecular Formula: C18H12N2O6 Molecular Weight: 352.303
N
O
O
57/183
N
O
O
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
162/249
2016-07-13 00:31:19
InChI Key: SSLYKAGSWRVVPS-UHFFFAOYSA-N Note: NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Location
supporting information
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Location
supporting information
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
dichloromethane
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys Mass Spectrometry (2) Description (Mass References Spectrometry) ESI (Electrospray ionisation); Spectrum
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys
HRMS (High resolution mass spectrometry); ESI (Electrospray ionisation); TOFMS (Time of flight mass spectrum); Spectrum
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys
UV/VIS Spectroscopy (1) 1 of 1
Solvent (UV/VIS Spectroscopy)
dichloromethane
Absorption Maxima (UV/ 235; 272; 297; 304 VIS) [nm] Log epsilon
4.8; 4.3; 4.1; 3.7
Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
163/249
2016-07-13 00:31:19
Reaxys ID 28492503 View in Reaxys
58/183 O N
Linear Structure Formula: C11H9NO5 Molecular Formula: C11H9NO5 Molecular Weight: 235.196 InChI Key: VAZQCRWKQZBIAF-UHFFFAOYSA-N Note:
O
O O
O
Substance Label (2) Label References 2g
Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Tetrahedron Letters; vol. 56; nb. 35; (2015); p. 4980 - 4983; Art.No: 46492, View in Reaxys
10g
Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Kumar, Polu Vijay; RSC Advances; vol. 5; nb. 113; (2015); p. 93447 - 93451, View in Reaxys
Reaxys ID 20598 View in Reaxys
59/183 CAS Registry Number: 13326-78-8 Chemical Name: (E?)-3-bromo-4,5-methylenedioxy-β-nitrostyrene; (E?)-3-Brom-4,5-methylendioxy-β-nitro-styrol Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 Type of Substance: heterocyclic InChI Key: GJSWOWZFZTZZPJ-OWOJBTEDSA-N Note:
O N
E
O
O
O Br
Melting Point (1) 1 of 1
Melting Point [°C]
160 - 161
Solvent (Melting Point)
ethanol
Erne; Ramirez; Helvetica Chimica Acta; vol. 33; (1950); p. 912,915, View in Reaxys
Reaxys ID 22024 View in Reaxys
60/183 Chemical Name: 5-allyl-6-(2t-nitro-vinyl)-benzo[1,3]dioxole; 5Allyl-6-(2t-nitro-vinyl)-benzo[1,3]dioxol Linear Structure Formula: C12H11NO4 Molecular Formula: C12H11NO4 Molecular Weight: 233.224 Type of Substance: heterocyclic InChI Key: YFOADMGKSXGCJU-SNAWJCMRSA-N Note:
O N E
O
O O
Melting Point (1) 1 of 1
Melting Point [°C]
104
Solvent (Melting Point)
ethanol
Sugasawa et al.; Pharmaceutical Bulletin; vol. 2; (1954); p. 149, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb
Sugasawa et al.; Pharmaceutical Bulletin; vol. 2; (1954); p. 149, View in Reaxys
Reaxys ID 22598 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
61/183
164/249
2016-07-13 00:31:19
CAS Registry Number: 116056-17-8 Chemical Name: 3-nitro-[1,3]dioxolo[4,5-g]cinnoline; 3-Nitro[1,3]dioxolo[4,5-g]cinnolin Linear Structure Formula: C9H5N3O4 Molecular Formula: C9H5N3O4 Molecular Weight: 219.156 Type of Substance: heterocyclic InChI Key: PBFCNJCIOYGXLP-UHFFFAOYSA-N Note:
O N
O O
O
N
N
Melting Point (1) 1 of 1
Solvent (Melting Point)
ethyl acetate
Comment (Melting Point)
Decomp.at:250 degreeC.
Baumgarten et al.; Journal of the American Chemical Society; vol. 80; (1958); p. 1977,1979, View in Reaxys
Reaxys ID 55623 View in Reaxys
62/183 Chemical Name: (+-)-1ξ,3-bis-benzo[1,3]dioxol-5-yl-3-methoxy-2-nitro-propene; (+-)-1ξ,3-Bis-benzo[1,3]dioxol-5-yl-3-methoxy-2-nitro-propen Linear Structure Formula: C18H15NO7 Molecular Formula: C18H15NO7 Molecular Weight: 357.32 Type of Substance: heterocyclic InChI Key: WMMABVIJELGKTE-UHFFFAOYSA-N Note:
O O
O
O
O
O
N
O
Melting Point (1) 1 of 1
Solvent (Melting Point)
benzene
Comment (Melting Point)
with:0.5 Mol.Wasser (solvent).Decomp.at:226 degreeC.
Kametani; Masuda; Yakugaku Zasshi; vol. 72; (1952); p. 81,84; Chem.Abstr.; (1952); p. 11208, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Gelbbraun
Kametani; Masuda; Yakugaku Zasshi; vol. 72; (1952); p. 81,84; Chem.Abstr.; (1952); p. 11208, View in Reaxys
Reaxys ID 62633 View in Reaxys
63/183 O N
E
Chemical Name: (E?)-3-[2-methoxy-4-(trans(?)-2-nitro-vinyl)phenoxy]-4,5-methylenedioxy-β-nitro-styrene; (E?)-3-[2-Methoxy-4-(trans(?)-2-nitro-vinyl)-phenoxy]-4,5-methylendioxy-βnitro-styrol Linear Structure Formula: C18H14N2O8 Molecular Formula: C18H14N2O8 Molecular Weight: 386.318 Type of Substance: heterocyclic InChI Key: OMJSGKJFXJACTQ-YDFGWWAZSA-N Note:
O
O O
O O
E N
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
171 - 172
Solvent (Melting Point)
ethyl acetate
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
165/249
2016-07-13 00:31:19
Kondo et al.; Itsuu Kenkyusho Nempo; nb. 2; (1951); p. 11; dtsch. Ref. S. 48; Chem.Abstr.; (1953); p. 7519, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Gelb
Kondo et al.; Itsuu Kenkyusho Nempo; nb. 2; (1951); p. 11; dtsch. Ref. S. 48; Chem.Abstr.; (1953); p. 7519, View in Reaxys
Reaxys ID 214967 View in Reaxys
64/183 Chemical Name: 7-nitro-[1,3]dioxolo[4,5-g]quinoline; 7-Nitro[1,3]dioxolo[4,5-g]chinolin Linear Structure Formula: C10H6N2O4 Molecular Formula: C10H6N2O4 Molecular Weight: 218.169 Type of Substance: heterocyclic InChI Key: ACPVVLFXRKRACL-UHFFFAOYSA-N Note:
O N
O O
O
N
Melting Point (1) 1 of 1
Melting Point [°C]
188 - 190
Solvent (Melting Point)
methanol; acetone
Clemo; Swan; Journal of the Chemical Society; (1945); p. 867,869, View in Reaxys
Reaxys ID 237616 View in Reaxys
65/183 CAS Registry Number: 118898-63-8 Chemical Name: 6-methyl-7-nitro-[1,3]dioxolo[4,5-g]quinoline; 6-Methyl-7-nitro-[1,3]dioxolo[4,5-g]chinolin Linear Structure Formula: C11H8N2O4 Molecular Formula: C11H8N2O4 Molecular Weight: 232.196 Type of Substance: heterocyclic InChI Key: YHGLQPOMIUQYJY-UHFFFAOYSA-N Note:
O N
O O
O
N
Melting Point (1) 1 of 1
Melting Point [°C]
205 - 206
Solvent (Melting Point)
propan-2-ol
Dornow; Sassenberg; Justus Liebigs Annalen der Chemie; vol. 602; (1957); p. 14,18, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelbbraeunlich
Dornow; Sassenberg; Justus Liebigs Annalen der Chemie; vol. 602; (1957); p. 14,18, View in Reaxys
Reaxys ID 261519 View in Reaxys
66/183 CAS Registry Number: 88484-87-1 Chemical Name: 5-nitro-6-(2-nitro-propenyl)-benzo[1,3]dioxole; 5-Nitro-6-(2-nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C10H8N2O6 Molecular Formula: C10H8N2O6 Molecular Weight: 252.183 Type of Substance: heterocyclic
O N E
O
O O
N
O
O
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
166/249
2016-07-13 00:31:19
InChI Key: KVTULAZMZRAQOD-QHHAFSJGSA-N Note: Melting Point (1) 1 of 1
Melting Point [°C]
155
Solvent (Melting Point)
ethanol
Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Gelb
Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys
Reaxys ID 289157 View in Reaxys
67/183
O
CAS Registry Number: 15794-56-6 Chemical Name: 2,5-dimethoxy-3,4-methylenedioxy-β-nitrostyrene; 2,5-Dimethoxy-3,4-methylendioxy-β-nitro-styrol Linear Structure Formula: C11H11NO6 Molecular Formula: C11H11NO6 Molecular Weight: 253.211 Type of Substance: heterocyclic InChI Key: QTWLFKAHIOECED-ONEGZZNKSA-N Note:
O E
O
N
O
O O
Melting Point (1) 1 of 1
Melting Point [°C]
164
Solvent (Melting Point)
methanol
Mannich; Falber; Archiv der Pharmazie (Weinheim, Germany); (1929); p. 608, View in Reaxys Crystal Property Description (1) Colour & Other References Properties orangegelbe Nadeln
Mannich; Falber; Archiv der Pharmazie (Weinheim, Germany); (1929); p. 608, View in Reaxys
Reaxys ID 307144 View in Reaxys
68/183 CAS Registry Number: 22959-14-4 Chemical Name: 4,5-dimethoxy-6-(2-nitro-propenyl)-benzo[1,3]dioxole; 4,5-Dimethoxy-6-(2-nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C12H13NO6 Molecular Formula: C12H13NO6 Molecular Weight: 267.238 Type of Substance: heterocyclic InChI Key: SARJGJXAGRMIPC-QPJJXVBHSA-N Note:
O N E
O
O O
O O
Melting Point (1) 1 of 1
Melting Point [°C]
94 - 95
Solvent (Melting Point)
ethanol
Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> 15 II; (1906); p. 139, View in Reaxys Crystal Property Description (1) Colour & Other References Properties
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
167/249
2016-07-13 00:31:19
gelb
Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> 15 II; (1906); p. 139, View in Reaxys
Reaxys ID 307992 View in Reaxys
69/183
Br
O E
O O
Chemical Name: 4,6-dibromo-7-methoxy-5-(2-nitro-propenyl)benzo[1,3]dioxole; 4,6-Dibrom-7-methoxy-5-(2-nitro-propenyl)benzo[1,3]dioxol Linear Structure Formula: C11H9Br2NO5 Molecular Formula: C11H9Br2NO5 Molecular Weight: 395.004 Type of Substance: heterocyclic InChI Key: PSIXDPSNQHHAFX-HWKANZROSA-N Note:
N
O
Br O
Melting Point (1) 1 of 1
Melting Point [°C]
160
Solvent (Melting Point)
ethanol
Rimini; Gazzetta Chimica Italiana; vol. 35 I; (1905); p. 413,414, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Blaetter
Rimini; Gazzetta Chimica Italiana; vol. 35 I; (1905); p. 413,414, View in Reaxys
Reaxys ID 322927 View in Reaxys
70/183
O
O E
O O
Chemical Name: 5-bromo-4,7-dimethoxy-6-(2-nitro-propenyl)benzo[1,3]dioxole; 5-Brom-4,7-dimethoxy-6-(2-nitro-propenyl)benzo[1,3]dioxol Linear Structure Formula: C12H12BrNO6 Molecular Formula: C12H12BrNO6 Molecular Weight: 346.134 Type of Substance: heterocyclic InChI Key: BBBLPQNMCPSOHX-GQCTYLIASA-N Note:
N
O
Br O
Melting Point (1) 1 of 1
Melting Point [°C]
120
Solvent (Melting Point)
ethanol
Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> 15 II; (1906); p. 139, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Blaetter
Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> 15 II; (1906); p. 139, View in Reaxys
Reaxys ID 324453 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
71/183
168/249
2016-07-13 00:31:19
O
CAS Registry Number: 109722-66-9 Chemical Name: 4-methoxy-5-(3-nitro-benzofuran-2-yl)-benzo[1,3]dioxole; 4-Methoxy-5-(3-nitro-benzofuran-2-yl)-benzo[1,3]dioxol Linear Structure Formula: C16H11NO6 Molecular Formula: C16H11NO6 Molecular Weight: 313.266 Type of Substance: heterocyclic InChI Key: LLHWWFGPWWDDLL-UHFFFAOYSA-N Note:
O
O N
O
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
152 - 153
Solvent (Melting Point)
cyclohexane
Wagner et al.; Journal of the American Chemical Society; vol. 81; (1959); p. 5441,5443, View in Reaxys
Reaxys ID 344547 View in Reaxys
72/183 Chemical Name: 6-benzo[1,3]dioxol-5-yl-5-nitro-naphtho[2,3-d] [1,3]dioxole; 6-Benzo[1,3]dioxol-5-yl-5-nitro-naphtho[2,3-d] [1,3]dioxol Linear Structure Formula: C18H11NO6 Molecular Formula: C18H11NO6 Molecular Weight: 337.288 Type of Substance: heterocyclic InChI Key: FRIHIEVZVRYHJO-UHFFFAOYSA-N Note:
O O
O
O
O
N
O
Melting Point (1) 1 of 1
Melting Point [°C]
225 - 227
Solvent (Melting Point)
ethanol; acetic acid
Gopinath et al.; Journal of the Chemical Society; (1958); p. 504,508, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb
Gopinath et al.; Journal of the Chemical Society; (1958); p. 504,508, View in Reaxys
Reaxys ID 371560 View in Reaxys
73/183 Chemical Name: 5-(3-acetoxy-propyl)-2-benzo[1,3]dioxol-5yl-3-nitro-benzofuran-4,7-dione; 5-(3-Acetoxy-propyl)-2-benzo[1,3]dioxol-5-yl-3-nitro-benzofuran-4,7-dion Linear Structure Formula: C20H15NO9 Molecular Formula: C20H15NO9 Molecular Weight: 413.34 Type of Substance: heterocyclic InChI Key: MRMVNYIWTIQNQX-UHFFFAOYSA-N Note:
O
O
O
O O O O
N O
O
Melting Point (1) 1 of 1
Melting Point [°C]
144 - 145
Solvent (Melting Point)
1,2-dichloro-ethane; ethanol
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 586,591; Nippon Kagaku Kaishi; vol. 61; (1940); p. 487,491, View in Reaxys Crystal Property Description (1) Colour & Other References Properties
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
169/249
2016-07-13 00:31:19
orangerot
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 586,591; Nippon Kagaku Kaishi; vol. 61; (1940); p. 487,491, View in Reaxys
Reaxys ID 374891 View in Reaxys
74/183 Chemical Name: 5-(3-acetoxy-propyl)-2-benzo[1,3]dioxol-5yl-4-bromo-7-methoxy-3-nitro-benzofuran; 5-(3-Acetoxy-propyl)-2-benzo[1,3]dioxol-5-yl-4-brom-7-methoxy-3-nitro-benzofuran Linear Structure Formula: C21H18BrNO8 Molecular Formula: C21H18BrNO8 Molecular Weight: 492.28 Type of Substance: heterocyclic InChI Key: MBNMHOFKDZBLRU-UHFFFAOYSA-N Note:
O
O
O
O O Br O
N O
O
Melting Point (1) 1 of 1
Melting Point [°C]
139
Solvent (Melting Point)
acetic acid
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb
Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys
Reaxys ID 381636 View in Reaxys
75/183
O O
Chemical Name: 5-(3-acetoxy-propyl)-2-benzo[1,3]dioxol-5yl-7-methoxy-3,4,6-trinitro-benzofuran Linear Structure Formula: C21H17N3O12 Molecular Formula: C21H17N3O12 Molecular Weight: 503.379 Type of Substance: heterocyclic InChI Key: UUBUBTXMMHOBRC-UHFFFAOYSA-N Note:
O N
O
O
O O N O
N O
O
OO
Melting Point (1) 1 of 1
Melting Point [°C]
198
Solvent (Melting Point)
acetic acid
Kawai et al.; Nippon Kagaku Kaishi; vol. 64; (1943); p. 1213; Chem.Abstr.; (1947); p. 3804, View in Reaxys Crystal Property Description (1) Colour & Other References Properties hellgelb
Kawai et al.; Nippon Kagaku Kaishi; vol. 64; (1943); p. 1213; Chem.Abstr.; (1947); p. 3804, View in Reaxys
Reaxys ID 1032483 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
76/183
170/249
2016-07-13 00:31:19
OH
N
O
CAS Registry Number: 73998-88-6 Linear Structure Formula: C13H10N2O6 Molecular Formula: C13H10N2O6 Molecular Weight: 290.232 Type of Substance: heterocyclic InChI Key: ZNTHYZGHJITGJA-UHFFFAOYSA-N Note:
O
O N
O
O
Substance Label (1) Label References I(Z) <Rgrad=Patent; Sandoz,Inc.; US4192876; (1980); DE2631317; Chem.Abstr.; vol. 86; nb. 189742, View in Reaxys CH2CH=CH2,Mp=H,R ,R'=-O-CH2-O-> Melting Point (1) 1 of 1
Melting Point [°C]
235 - 236
Patent; Sandoz,Inc.; US4192876; (1980); DE2631317; Chem.Abstr.; vol. 86; nb. 189742, View in Reaxys
Reaxys ID 1254479 View in Reaxys
77/183 CAS Registry Number: 90945-72-5 Chemical Name: 5-methoxy-6-(2-nitro-vinyl)-benzo[1,3]dioxole; 2-Methoxy-4,5-methylendioxy-ω-nitro-styryl Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: GPZHSRJBTWPMMQ-UHFFFAOYSA-N Note:
O N
O
O O
O
Substance Label (1) Label References XVII
Daly,J. et al.; Journal of the American Chemical Society; vol. 83; (1961); p. 4787 - 4792, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
158 - 160
Solvent (Melting Point)
benzene
Daly,J. et al.; Journal of the American Chemical Society; vol. 83; (1961); p. 4787 - 4792, View in Reaxys
Reaxys ID 1318313 View in Reaxys
78/183 CAS Registry Number: 93258-98-1 Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: GPNFVPUFZPUPCQ-UHFFFAOYSA-N Note:
O N
O
O O
O
Melting Point (1) 1 of 1
Melting Point [°C]
163
Shulgin; Experientia; vol. 20; nb. 7; (1964); p. 366 - 367, View in Reaxys
Reaxys ID 1319451 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
79/183
171/249
2016-07-13 00:31:19
O
CAS Registry Number: 15794-47-5 Chemical Name: 4-methoxy-5-(2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: NAODMGXGMXCCDV-UHFFFAOYSA-N Note:
O N
O
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
130 - 140
Cleaver,L. et al.; Australian Journal of Chemistry; vol. 29; (1976); p. 2003 - 2021, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- NMR troscopy) Cleaver,L. et al.; Australian Journal of Chemistry; vol. 29; (1976); p. 2003 - 2021, View in Reaxys
IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
IR
Cleaver,L. et al.; Australian Journal of Chemistry; vol. 29; (1976); p. 2003 - 2021, View in Reaxys
Reaxys ID 1320689 View in Reaxys
80/183 CAS Registry Number: 1962-04-5 Chemical Name: 2-Brom-2'-nitro-3,4-methylendioxy-biphenyl Linear Structure Formula: C13H8BrNO4 Molecular Formula: C13H8BrNO4 Molecular Weight: 322.115 Type of Substance: heterocyclic InChI Key: ZIZMZZVEIHNFLC-UHFFFAOYSA-N Note:
O O
N
O O
Br
Substance Label (1) Label References V
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
157 - 160
Solvent (Melting Point)
acetone; hexane
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Reaxys ID 1321342 View in Reaxys
O O
81/183 CAS Registry Number: 93258-97-0 Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: KSRMSJJZIIODBH-UHFFFAOYSA-N Note:
O N
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
106
Shulgin; Experientia; vol. 20; (1964); p. 306, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
172/249
2016-07-13 00:31:19
Reaxys ID 1322144 View in Reaxys
82/183 CAS Registry Number: 1805-91-0 Chemical Name: 6-(2-nitro-phenyl)-benzo[1,3]dioxole-5-carbonitrile; 2'-Nitro-2-cyan-4.5-methylendioxy-biphenyl Linear Structure Formula: C14H8N2O4 Molecular Formula: C14H8N2O4 Molecular Weight: 268.229 Type of Substance: heterocyclic InChI Key: DKUJMCOCCZXYDE-UHFFFAOYSA-N Note:
N
N
O
O
O
O
Substance Label (1) Label References VI
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
188 - 190
Solvent (Melting Point)
benzene; heptane
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Spectrum
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Reaxys ID 1325156 View in Reaxys
HO
83/183 CAS Registry Number: 1805-93-2 Chemical Name: 6-(2-nitro-phenyl)-benzo[1,3]dioxole-5-carboxylic acid; 2-<2-Nitro-phenyl>-4,5-methylendioxy-benzoesaeure Linear Structure Formula: C14H9NO6 Molecular Formula: C14H9NO6 Molecular Weight: 287.229 Type of Substance: heterocyclic InChI Key: DCPJLYJCYLWHNM-UHFFFAOYSA-N Note:
O
O
O
N
O
O
Substance Label (1) Label References VIII
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
235 - 240
Solvent (Melting Point)
acetone; heptane
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Spectrum
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Reaxys ID 1325157 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
84/183
173/249
2016-07-13 00:31:19
O
CAS Registry Number: 1805-92-1 Chemical Name: 6-(2-nitro-phenyl)-benzo[1,3]dioxole-5-carboxylic acid amide; 2-<2-Nitro-phenyl>-4.5-methylendioxy-benzamid Linear Structure Formula: C14H10N2O5 Molecular Formula: C14H10N2O5 Molecular Weight: 286.244 Type of Substance: heterocyclic InChI Key: RHMZINYMIODERN-UHFFFAOYSA-N Note:
NH 2
N
O
O
O
O
Substance Label (1) Label References VII
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
179 - 181
Solvent (Melting Point)
acetone; heptane
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Spectrum
Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys
Reaxys ID 1325263 View in Reaxys
85/183 CAS Registry Number: 7106-79-8 Chemical Name: 6-nitro-[5,5']bi[benzo[1,3]dioxolyl]; 2-Nitro-4,5,4',5'-bis-methylendioxy-diphenyl Linear Structure Formula: C14H9NO6 Molecular Formula: C14H9NO6 Molecular Weight: 287.229 Type of Substance: heterocyclic InChI Key: NBIXJPOXTSOYRF-UHFFFAOYSA-N Note:
O O
O
O
N
O
O
Substance Label (1) Label References 1f
Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
164 - 165
Solvent (Melting Point)
ethanol
Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys
Reaxys ID 1327933 View in Reaxys
86/183 CAS Registry Number: 7106-80-1 Chemical Name: 6-bromo-6'-nitro-[5,5']bi[benzo[1,3]dioxolyl]; 2-Brom-2'-nitro-4,5,4',5'-bis-methylendioxy-diphenyl Linear Structure Formula: C14H8BrNO6 Molecular Formula: C14H8BrNO6 Molecular Weight: 366.125 Type of Substance: heterocyclic InChI Key: NUDYKKYZPFWWLF-UHFFFAOYSA-N Note:
O O Br
O
O
N
O
O
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
174/249
2016-07-13 00:31:19
Substance Label (1) Label References 1g
Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
168 - 169
Solvent (Melting Point)
ethanol
Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys
Reaxys ID 1328513 View in Reaxys
87/183 CAS Registry Number: 5025-68-3 Chemical Name: 5-nitro-phenanthro[2,3-d][1,3]dioxole-4-carboxylic acid methyl ester; 6,7-Methylendioxy-10-nitro-phenanthren-1-carbonsaeure-methylester Linear Structure Formula: C17H11NO6 Molecular Formula: C17H11NO6 Molecular Weight: 325.277 Type of Substance: heterocyclic InChI Key: ZVJSDUQJTVKXMC-UHFFFAOYSA-N Note:
O N
O
O O
O O
Substance Label (1) Label References LXVII
Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys
Further Information (1) Description (Fur- References ther Information) Further information
Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys
Reaxys ID 1348923 View in Reaxys
88/183 CAS Registry Number: 90225-11-9 Chemical Name: 5-chloro-6-(2-nitro-vinyl)-benzo[1,3]dioxole; 6-Chlor-3,4-methylendioxy-ο-nitrostyrol Linear Structure Formula: C9H6ClNO4 Molecular Formula: C9H6ClNO4 Molecular Weight: 227.604 Type of Substance: heterocyclic InChI Key: LGPGWNSINLOLBN-UHFFFAOYSA-N Note:
O N
O
O O
Cl
Substance Label (1) Label References III
Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
156
Solvent (Melting Point)
ethanol
Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
IR
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
175/249
2016-07-13 00:31:19
Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1
Description (UV/VIS Spectroscopy)
Absorption maxima
Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys
Reaxys ID 1349095 View in Reaxys
89/183 CAS Registry Number: 109161-82-2 Chemical Name: 5-methyl-6-(2-nitro-phenyl)-benzo[1,3]dioxole; 2'-Nitro-4,5-methylendioxy-2-methyl-biphenyl Linear Structure Formula: C14H11NO4 Molecular Formula: C14H11NO4 Molecular Weight: 257.246 Type of Substance: heterocyclic InChI Key: VLDQLMNQSSWXBT-UHFFFAOYSA-N Note:
O O
N
O O
Purification (1) References Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys Melting Point (2) 1 of 2
Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys
2 of 2
Melting Point [°C]
134 - 135
Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys Sublimation (1) Comment (Sublimation) bei 120-122grad/ 2 Torr
References Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys
Reaxys ID 1350331 View in Reaxys
90/183 CAS Registry Number: 109478-07-1 Chemical Name: 5-methyl-6-(3-methyl-2-nitro-phenyl)-benzo[1,3]dioxole; 2'-Nitro-4,5-methylendioxy-2,3'-dimethyl-biphenyl Linear Structure Formula: C15H13NO4 Molecular Formula: C15H13NO4 Molecular Weight: 271.273 Type of Substance: heterocyclic InChI Key: RWBOUTHSHXKNOI-UHFFFAOYSA-N Note:
O O
N
O O
Melting Point (1) 1 of 1
Melting Point [°C]
127 - 128
Solvent (Melting Point)
petroleum ether
Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys
Reaxys ID 1356171 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
91/183
176/249
2016-07-13 00:31:19
CAS Registry Number: 7106-75-4 Chemical Name: 6,6'-dinitro-[5,5']bi[benzo[1,3]dioxolyl]; 2,2'-Dinitro-4,5,4',5'-bis-methylendioxy-diphenyl Linear Structure Formula: C14H8N2O8 Molecular Formula: C14H8N2O8 Molecular Weight: 332.226 Type of Substance: heterocyclic InChI Key: IUGHRDLHZJVTNS-UHFFFAOYSA-N Note:
O O
N
O
O
O
O
N
O
O
Substance Label (1) Label References 1b
Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
225 - 226
Solvent (Melting Point)
ethanol
Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys
Reaxys ID 1384088 View in Reaxys
92/183 CAS Registry Number: 61675-23-8 Chemical Name: 2-Hydroxy-4,5-methylendioxy-β-nitrostyrol; 2Hydroxy-5-methylendioxy-β-nitrostyrol Linear Structure Formula: C9H7NO5 Molecular Formula: C9H7NO5 Molecular Weight: 209.158 Type of Substance: heterocyclic InChI Key: IZQDCWXYBYGLMU-OWOJBTEDSA-N Note:
O N E
O
O O
OH
Substance Label (1) Label References 19
Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
200
Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- NMR troscopy) Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys
IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
IR
Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys Mass Spectrometry (1) References Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1
Description (UV/VIS Spectroscopy)
UV/VIS
Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
177/249
2016-07-13 00:31:19
Reaxys ID 1387075 View in Reaxys
93/183 CAS Registry Number: 38288-42-5 Chemical Name: 5-nitro-phenanthro[2,3-d][1,3]dioxole Linear Structure Formula: C15H9NO4 Molecular Formula: C15H9NO4 Molecular Weight: 267.241 Type of Substance: heterocyclic InChI Key: CVNYSLBWKUZHCV-UHFFFAOYSA-N Note:
O N
O
O
O
Substance Label (1) Label References 2b
Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
182 - 183
Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- NMR troscopy) Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys
Reaxys ID 1400160 View in Reaxys
O
94/183
OH
N
O
CAS Registry Number: 38288-39-0 Chemical Name: 5-nitro-phenanthro[2,3-d][1,3]dioxole-6-carboxylic acid Linear Structure Formula: C16H9NO6 Molecular Formula: C16H9NO6 Molecular Weight: 311.251 Type of Substance: heterocyclic InChI Key: CJGDWYJUUNIYDC-UHFFFAOYSA-N Note:
O O
O
Substance Label (1) Label References 6c
Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
246 - 248
Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys
Reaxys ID 1402390 View in Reaxys
O O
95/183
O
CAS Registry Number: 38288-41-4 Chemical Name: 5-nitro-phenanthro[2,3-d][1,3]dioxole-6-carboxylic acid methyl ester Linear Structure Formula: C17H11NO6 Molecular Formula: C17H11NO6 Molecular Weight: 325.277 Type of Substance: heterocyclic InChI Key: UUGGGRLTYCSVAA-UHFFFAOYSA-N Note:
O N
O
O
Substance Label (1) Label References 6d
Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys
Melting Point (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
178/249
2016-07-13 00:31:19
1 of 1
Melting Point [°C]
216 - 218
Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- NMR troscopy) Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys
Reaxys ID 1402969 View in Reaxys O
N
O
O
96/183 CAS Registry Number: 38288-32-3 Chemical Name: 5,7-dinitro-phenanthro[2,3-d][1,3]dioxole Linear Structure Formula: C15H8N2O6 Molecular Formula: C15H8N2O6 Molecular Weight: 312.238 Type of Substance: heterocyclic InChI Key: JMIYIFGIHCCGGD-UHFFFAOYSA-N Note:
O N
O
O
Substance Label (1) Label References 3b
Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
303 - 307
Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- NMR troscopy) Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys
Reaxys ID 1577335 View in Reaxys
97/183 CAS Registry Number: 71203-58-2 Chemical Name: 2,2-dimethyl-5-(2-nitro-propenyl)-benzo[1,3]dioxole Linear Structure Formula: C12H13NO4 Molecular Formula: C12H13NO4 Molecular Weight: 235.24 Type of Substance: heterocyclic InChI Key: CTQQKTNIVFMWIU-UHFFFAOYSA-N Note:
O O
N
O
O
Substance Label (1) Label References 10
Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
60
Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- NMR troscopy) Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
179/249
2016-07-13 00:31:19
Reaxys ID 1580091 View in Reaxys
98/183 CAS Registry Number: 71203-55-9 Chemical Name: 2-methyl-5-(2-nitro-propenyl)-benzo[1,3]dioxole Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: OYGYLAZCQZHGQN-UHFFFAOYSA-N Note:
O N
O
O
O
Substance Label (1) Label References 9
Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
36
Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- NMR troscopy) Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys
Reaxys ID 1580359 View in Reaxys
99/183 CAS Registry Number: 13326-78-8 Chemical Name: 5-Bromo-3,4-methylendioxy-β-nitrostyrol Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 Type of Substance: heterocyclic InChI Key: GJSWOWZFZTZZPJ-UPHRSURJSA-N Note:
Z
O O
O
N
O
Br
Substance Label (1) Label References III
Kametani; Wakisaka; Yakugaku Zasshi; vol. 86; (1966); p. 984,987; Chem.Abstr.; vol. 66; nb. 28635; (1967), View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
158 - 159
Solvent (Melting Point)
ethanol
Kametani; Wakisaka; Yakugaku Zasshi; vol. 86; (1966); p. 984,987; Chem.Abstr.; vol. 66; nb. 28635; (1967), View in Reaxys
Reaxys ID 1584953 View in Reaxys
100/183 CAS Registry Number: 37162-74-6 Linear Structure Formula: C10H8BrNO4 Molecular Formula: C10H8BrNO4 Molecular Weight: 286.082 Type of Substance: heterocyclic InChI Key: LFCHGSZICRSDHE-UHFFFAOYSA-N Note:
O N
O
O O
Br
Substance Label (1) Label References 5 (Table II)
Sepulveda,S. et al.; Journal of Medicinal Chemistry; vol. 15; (1972); p. 413 - 415, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
180/249
2016-07-13 00:31:19
Melting Point (1) 1 of 1
Melting Point [°C]
157.5 - 158.5
Sepulveda,S. et al.; Journal of Medicinal Chemistry; vol. 15; (1972); p. 413 - 415, View in Reaxys
Reaxys ID 1587007 View in Reaxys O
O
N Z
O
101/183 CAS Registry Number: 55902-37-9 Linear Structure Formula: C10H8N2O6 Molecular Formula: C10H8N2O6 Molecular Weight: 252.183 Type of Substance: heterocyclic InChI Key: AUGKZVVAJHKIID-POHAHGRESA-N Note:
O N
O
O
Substance Label (1) Label References Z-11
Dore; Viel; European Journal of Medicinal Chemistry; vol. 9; nb. 6; (1974); p. 673 - 680, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
157.5
Dore; Viel; European Journal of Medicinal Chemistry; vol. 9; nb. 6; (1974); p. 673 - 680, View in Reaxys
Reaxys ID 1992524 View in Reaxys
102/183 CAS Registry Number: 1219-48-3 Chemical Name: 1-(3'.4'-Methylendioxyphenyl)-2-nitro-hexen Linear Structure Formula: C13H15NO4 Molecular Formula: C13H15NO4 Molecular Weight: 249.266 Type of Substance: heterocyclic InChI Key: HBQRNTAAMWQGFE-UHFFFAOYSA-N Note:
O N
O
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
44.5
Koremura; Nippon Kagaku Kaishi; vol. 36; nb. 7; (1962); p. 552,553-556; Chem.Abstr.; vol. 62; nb. 3962d; (1965), View in Reaxys
Reaxys ID 4278183 View in Reaxys
103/183
O O
N
O
CAS Registry Number: 128902-99-8 Chemical Name: 13-Nitrooxyberberine Linear Structure Formula: C20H16N2O7 Molecular Formula: C20H16N2O7 Molecular Weight: 396.356 Type of Substance: heterocyclic InChI Key: VHQAMPGQRNHULN-UHFFFAOYSA-N Note:
O
O N
O
O
Substance Label (1) Label References 2
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
226.5 - 227.5
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
181/249
2016-07-13 00:31:19
Solvent (Melting Point)
methanol; CH2Cl2
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys 3 of 3
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Comment (IR Spectroscopy)
2910 - 910 cm**(-1)
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys
Reaxys ID 4280663 View in Reaxys
104/183 CAS Registry Number: 128903-00-4 Chemical Name: 12,12-Dinitrooxyberberine Linear Structure Formula: C20H15N3O9 Molecular Formula: C20H15N3O9 Molecular Weight: 441.354 Type of Substance: heterocyclic InChI Key: AGTKYDBQHQFNGC-UHFFFAOYSA-N Note:
O O
O
N
OO
N
N
O
O O
O
Substance Label (1) Label References 3
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys
Melting Point (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
182/249
2016-07-13 00:31:19
1 of 1
Melting Point [°C]
231 - 232
Solvent (Melting Point)
methanol
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys Density (1) 1 of 1
Density [g·cm-3]
1.552
Type (Density)
crystallographic
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys Crystal Phase (1) Description (Crys- Comment (Crystal References tal Phase) Phase) Crystal structure determination
β=97.5 grad, a=8.25 Angstroem, b=14.26 Angstroem, c=16.19 Angstroem, n=4.; Temperature: 20 C. Method of determination: Single Crystal X-ray Diffraction
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys
Crystal System (1) Crystal System References monoclinic
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys
Space Group (1) Space Group 4
References Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys
NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys 3 of 3
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
183/249
2016-07-13 00:31:19
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Comment (IR Spectroscopy)
3446 - 868 cm**(-1)
Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys
Reaxys ID 4318903 View in Reaxys
105/183 CAS Registry Number: 134040-37-2 Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: GPNFVPUFZPUPCQ-XVNBXDOJSA-N Note:
O N
O
E O O
O
Substance Label (1) Label References 28
Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
26.9
Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys
Reaxys ID 5065942 View in Reaxys
106/183 CAS Registry Number: 112616-89-4; 112616-90-7 Chemical Name: (E/Z)-2-<1-(3,4-methylenedioxyphenylethen)-2-nitroethen-1-yl>furan Linear Structure Formula: C13H9NO5 Molecular Formula: C13H9NO5 Molecular Weight: 259.218 Type of Substance: heterocyclic InChI Key: HGJKTOIWAODNEU-UHFFFAOYSA-N Note:
O N O
O O
O
Substance Label (1) Label References 14, R=R=OCH2O
Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys
NMR Spectroscopy (3)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
184/249
2016-07-13 00:31:19
1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys 3 of 3
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Comment (IR Spectroscopy)
1600 - 1550 cm**(-1)
Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum
Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys
Reaxys ID 5390722 View in Reaxys
107/183
O
O N
O O
CAS Registry Number: 15794-49-7 Chemical Name: 4-methoxy-6-nitro-5-(2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C10H8N2O7 Molecular Formula: C10H8N2O7 Molecular Weight: 268.183 Type of Substance: heterocyclic InChI Key: WEUISNZNOUUVPB-UHFFFAOYSA-N Note:
N
O
O
O
Substance Label (1) Label References 2d
Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
185/249
2016-07-13 00:31:19
Reaxys ID 5391778 View in Reaxys
108/183 CAS Registry Number: 15794-57-7 Chemical Name: 4,7-dimethoxy-5-nitro-6-(2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C11H10N2O8 Molecular Formula: C11H10N2O8 Molecular Weight: 298.209 Type of Substance: heterocyclic InChI Key: LLVQPVXTNOINRZ-UHFFFAOYSA-N Note:
O N
O
O
O O
N O
O
O
Substance Label (1) Label References 4d
Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys
Reaxys ID 5391779 View in Reaxys
O
N
109/183
O
O N
O O
CAS Registry Number: 15794-66-8 Chemical Name: 4,5-dimethoxy-7-nitro-6-(2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C11H10N2O8 Molecular Formula: C11H10N2O8 Molecular Weight: 298.209 Type of Substance: heterocyclic InChI Key: GABGUGHVAVKULR-UHFFFAOYSA-N Note:
O
O O
Substance Label (1) Label References 6d
Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys
Reaxys ID 5575303 View in Reaxys
110/183 CAS Registry Number: 17055-07-1; 97383-34-1 Chemical Name: 1-<3-methoxy-4,5-(methylenedioxy)phenyl>-2-nitropropene; 1-[3-methoxy-4,5-(methylenedioxy)phenyl]-2-nitropropene Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: URIZGFKLZDNSIH-CLTKARDFSA-N Note:
Z
O O
O
N
O
O
Substance Label (1) Label References 4b
Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 3607, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
106 - 108
Solvent (Melting Point)
methanol
Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 - 3607, View in Reaxys NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
186/249
2016-07-13 00:31:19
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 - 3607, View in Reaxys 2 of 2
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 - 3607, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Comment (IR Spectroscopy)
1640 - 1520 cm**(-1)
Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 - 3607, View in Reaxys
Reaxys ID 6252392 View in Reaxys
O
111/183
O
CAS Registry Number: 86588-24-1 Chemical Name: 12-Brom-13-nitro-4,8-dimethoxy-bis<1,3>dioxolo<4,5>benzo<1,2-d:1',2'-f><1,3>dioxepin; 12-Brom-13-nitro-4,8-dimethoxy-bis[1,3]dioxolo[4,5]benzo[1,2-d:1',2'-f][1,3]dioxepin Linear Structure Formula: C17H12BrNO10 Molecular Formula: C17H12BrNO10 Molecular Weight: 470.187 Type of Substance: heterocyclic InChI Key: NZCHUVZAMWYVLP-UHFFFAOYSA-N Note:
O
O N Br
O
O O
O
O O
Substance Label (1) Label References 3d
Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
256 - 257
Solvent (Melting Point)
acetic acid
Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- dimethylsulfoxide scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
187/249
2016-07-13 00:31:19
Temperature (NMR Spectroscopy) [°C]
34
Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Comment (IR Spectroscopy)
1526 - 1337 cm**(-1)
Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys
Reaxys ID 6255542 View in Reaxys
112/183 CAS Registry Number: 86588-23-0 Chemical Name: 12,13-Dinitro-4,8-dimethoxy-bis<1,3>dioxolo<4,5>benzo<1,2-d:1',2'-f><1,3>dioxepin; 12,13-Dinitro-4,8-dimethoxy-bis[1,3]dioxolo[4,5]benzo[1,2-d:1',2'-f][1,3]dioxepin Linear Structure Formula: C17H12N2O12 Molecular Formula: C17H12N2O12 Molecular Weight: 436.288 Type of Substance: heterocyclic InChI Key: RNRLEUHCBPESPY-UHFFFAOYSA-N Note:
OO
O
N OO N
O
O O
O
O
O O
Substance Label (1) Label References 3c
Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
288 - 290
Solvent (Melting Point)
acetic acid
Comment (Melting Point)
Decomposition
Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- dimethylsulfoxide scopy) Temperature (NMR Spectroscopy) [°C]
34
Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
188/249
2016-07-13 00:31:19
Comment (IR Spectroscopy)
1520 - 1337 cm**(-1)
Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys
Reaxys ID 6553403 View in Reaxys
113/183 Chemical Name: benzyl N-(4,5-methylenedioxybenzocyclobuten-1-yl)-N-<5,6-methylenedioxy-2-<(E)-2-nitrovinyl>benzyl>carbamate; benzyl N-(4,5-methylenedioxybenzocyclobuten-1-yl)N-[5,6-methylenedioxy-2-((E)-2-nitrovinyl)benzyl]carbamate Linear Structure Formula: C27H22N2O8 Molecular Formula: C27H22N2O8 Molecular Weight: 502.48 Type of Substance: heterocyclic InChI Key: GMSQFQCUZPPUOC-UVIRAJKCSA-N Note:
O O
O
N O O
O E
N
O
O
Substance Label (1) Label References 29
Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys 2 of 2
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
CH2Cl2
Comment (IR Spectroscopy)
2905 - 915 cm**(-1)
Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum
Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys
Reaxys ID 6823502 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
114/183
189/249
2016-07-13 00:31:19
Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 Type of Substance: heterocyclic InChI Key: KXZILZHHXSZSJP-WLRTZDKTSA-N Note:
O O
O O E
O
N O
Substance Label (1) Label References 4e
Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
142
Solvent (Melting Point)
petroleum ether; ethyl acetate
Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
CHCl3
Comment (IR Spectroscopy)
1650 - 1240 cm**(-1)
Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys Pharmacological Data (3) 1 of 3
Comment (Pharmacological Data)
Bioactivities present
Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys 2 of 3
Comment (Pharmacological Data)
activity against yeasts: Salmonella typhosa and Saccharomyces cervesciae
Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys 3 of 3
Comment (Pharmacological Data)
antimicrobial activity against gram positive bacteria: Streptomyces aureus, Bacillus subtilis and against gram negative bacteria: Escherischia coli and Salmonella typhosa; no activity against Sarcina lutea
Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys
Reaxys ID 7253689 View in Reaxys
115/183 Chemical Name: (E)-6,7-(Methylenedioxy)-4-(nitromethylene)-3,4-dihydro-1H-2-benzopyran Linear Structure Formula: C11H9NO5 Molecular Formula: C11H9NO5 Molecular Weight: 235.196 Type of Substance: heterocyclic InChI Key: DFSFYDOYEHECIY-BAQGIRSFSA-N Note:
O O
N E
O O
O
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
190/249
2016-07-13 00:31:19
Substance Label (1) Label References (E)-2
Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys 2 of 2
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys
Reaxys ID 7253690 View in Reaxys
116/183 Chemical Name: (Z)-6,7-(Methylenedioxy)-4-(nitromethylene)-3,4-dihydro-1H-2-benzopyran Linear Structure Formula: C11H9NO5 Molecular Formula: C11H9NO5 Molecular Weight: 235.196 Type of Substance: heterocyclic InChI Key: DFSFYDOYEHECIY-FPYGCLRLSA-N Note:
O N Z
O
O O
O
Substance Label (1) Label References (Z)-2
Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
161 - 162
Solvent (Melting Point)
ethyl acetate
Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
191/249
2016-07-13 00:31:19
Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CD2Cl2 scopy) Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys 3 of 3
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
CHCl3
Comment (IR Spectroscopy)
3023 - 1322 cm**(-1)
Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys
Reaxys ID 7926964 View in Reaxys
117/183 Chemical Name: 4-methyl-5-(2-nitro-1-propenyl)-1,3-benzodioxole Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: SJYNAAUNZLNCRC-FNORWQNLSA-N Note:
O O
E
N
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
91 - 92
Solvent (Melting Point)
methanol
Parker, Matthew A.; Marona-Lewicka, Danuta; Kurrasch, Deborah; Shulgin, Alexander T.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 41; nb. 6; (1998); p. 1001 - 1005, View in Reaxys NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Parker, Matthew A.; Marona-Lewicka, Danuta; Kurrasch, Deborah; Shulgin, Alexander T.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 41; nb. 6; (1998); p. 1001 - 1005, View in Reaxys 2 of 2
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
192/249
2016-07-13 00:31:19
Comment (NMR Spectroscopy)
1H-1H
Parker, Matthew A.; Marona-Lewicka, Danuta; Kurrasch, Deborah; Shulgin, Alexander T.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 41; nb. 6; (1998); p. 1001 - 1005, View in Reaxys
Reaxys ID 7927054 View in Reaxys
118/183 Chemical Name: 4-methyl-6-(2-nitro-1-propenyl)-1,3-benzodioxole Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: SNWYNMRQQXBEPF-XBXARRHUSA-N Note:
O E
O
N
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
97 - 98
Solvent (Melting Point)
methanol
Parker, Matthew A.; Marona-Lewicka, Danuta; Kurrasch, Deborah; Shulgin, Alexander T.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 41; nb. 6; (1998); p. 1001 - 1005, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Parker, Matthew A.; Marona-Lewicka, Danuta; Kurrasch, Deborah; Shulgin, Alexander T.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 41; nb. 6; (1998); p. 1001 - 1005, View in Reaxys
Reaxys ID 7998370 View in Reaxys
S O
119/183 CAS Registry Number: 212332-76-8 Linear Structure Formula: C10H9NO4S Molecular Formula: C10H9NO4S Molecular Weight: 239.252 Type of Substance: heterocyclic InChI Key: MDQKUHJOTDHHII-SNAWJCMRSA-N Note:
O E
N
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
119 - 120
Solvent (Melting Point)
ethanol
Schlosser, Manfred; Simig, Gyula; Geneste, Herve; Tetrahedron; vol. 54; nb. 31; (1998); p. 9023 - 9032, View in Reaxys NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
193/249
2016-07-13 00:31:19
Schlosser, Manfred; Simig, Gyula; Geneste, Herve; Tetrahedron; vol. 54; nb. 31; (1998); p. 9023 - 9032, View in Reaxys 2 of 2
Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)
1H-1H
Schlosser, Manfred; Simig, Gyula; Geneste, Herve; Tetrahedron; vol. 54; nb. 31; (1998); p. 9023 - 9032, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; electron impact (EI)
Schlosser, Manfred; Simig, Gyula; Geneste, Herve; Tetrahedron; vol. 54; nb. 31; (1998); p. 9023 - 9032, View in Reaxys
Reaxys ID 8985761 View in Reaxys
120/183 Linear Structure Formula: C10H8INO4 Molecular Formula: C10H8INO4 Molecular Weight: 333.082 Type of Substance: heterocyclic InChI Key: IPRMBQGMMQIULQ-KXFIGUGUSA-N Note:
O O
N Z
O O
I
Reaxys ID 8985762 View in Reaxys
121/183 Linear Structure Formula: C10H8INO4 Molecular Formula: C10H8INO4 Molecular Weight: 333.082 Type of Substance: heterocyclic InChI Key: QKEGOTGIVGLTFW-XQRVVYSFSA-N Note:
I Z
O O
O
N
O
Reaxys ID 8997478 View in Reaxys
122/183 Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 Type of Substance: heterocyclic InChI Key: GLIVYAMKDCGTAE-RIYZIHGNSA-N Note:
O N
E
O
O O
O O
Reaxys ID 9127240 View in Reaxys
123/183 Chemical Name: 2-(3,4-methylenedioxyphenyl)-3-nitropyridine Linear Structure Formula: C12H8N2O4 Molecular Formula: C12H8N2O4 Molecular Weight: 244.207 Type of Substance: heterocyclic
N O O
O
N
O
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
194/249
2016-07-13 00:31:19
InChI Key: MEDDHFQVDSUOKX-UHFFFAOYSA-N Note: Melting Point (1) 1 of 1
Melting Point [°C]
99 - 101
Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys
NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys 2 of 3
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys 3 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
solid
Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys
Reaxys ID 9429632 View in Reaxys O
N
124/183 CAS Registry Number: 566872-48-8 Chemical Name: 6-(4,5-methylenedioxy-2-nitrophenyl)-3-methoxy-5-nitronaphthalene Linear Structure Formula: C18H12N2O7 Molecular Formula: C18H12N2O7 Molecular Weight: 368.302 Type of Substance: heterocyclic
O
O O
O
N
O
O
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
195/249
2016-07-13 00:31:19
InChI Key: QPKZGCLWAKNWFI-UHFFFAOYSA-N Note: Substance Label (1) Label References 53
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
187 - 189
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys NMR Spectroscopy (3) 1 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
50
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 3 of 3
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys
Reaxys ID 9435428 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
125/183
196/249
2016-07-13 00:31:19
O
CAS Registry Number: 566872-50-2 Chemical Name: 2-(4,5-methylenedioxy-2-nitrophenyl)-7-acetoxy-1-nitronaphthalene Linear Structure Formula: C19H12N2O8 Molecular Formula: C19H12N2O8 Molecular Weight: 396.313 Type of Substance: heterocyclic InChI Key: BBITYAAGEIRHRV-UHFFFAOYSA-N Note:
O O O
N
O O
N
O
O
Substance Label (1) Label References 55
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
166 - 167
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys NMR Spectroscopy (3) 1 of 3
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 3 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
50
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys
Reaxys ID 9442002 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
126/183
197/249
2016-07-13 00:31:19
O
N
CAS Registry Number: 566872-49-9 Chemical Name: 2-(4,5-methylenedioxy-2-nitrophenyl)-7-benzyloxy-1-nitronaphthalene Linear Structure Formula: C24H16N2O7 Molecular Formula: C24H16N2O7 Molecular Weight: 444.4 Type of Substance: heterocyclic InChI Key: JUDMWHINUWZQAN-UHFFFAOYSA-N Note:
O
O O
O
N
O
O
Substance Label (1) Label References 54
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
151 - 152
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys NMR Spectroscopy (3) 1 of 3
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 2 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 3 of 3
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
50
Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys
Reaxys ID 9485333 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
127/183
198/249
2016-07-13 00:31:19
Chemical Name: 3,4-methylenedioxybenzylidene-1-nitro-2propanone Linear Structure Formula: C11H9NO5 Molecular Formula: C11H9NO5 Molecular Weight: 235.196 Type of Substance: heterocyclic InChI Key: LIQFNOIFKPNYFO-WTKPLQERSA-N Note:
O Z
O O
N
O
O
Substance Label (1) Label References 1c
Kravchenko; Pirozhenko; Vdovenko; Sorochinsky; Remennikov; Chemistry of Heterocyclic Compounds; vol. 39; nb. 2; (2003); p. 188 - 194, View in Reaxys
Reaxys ID 9763037 View in Reaxys
128/183 CAS Registry Number: 743430-92-4 Chemical Name: 5-fluoro-6-(2-nitrovinyl)-benzo[1,3]dioxole Linear Structure Formula: C9H6FNO4 Molecular Formula: C9H6FNO4 Molecular Weight: 211.149 Type of Substance: heterocyclic InChI Key: AJTOAZCXDVAPKC-UHFFFAOYSA-N Note:
O N
O
O O
F
Substance Label (1) Label References 12
Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
143 - 144
Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys
NMR Spectroscopy (4) 1 of 4
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys 2 of 4
Nucleus (NMR Spectroscopy)
13C
Coupling Nuclei
19F
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
199/249
2016-07-13 00:31:19
Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys 3 of 4
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
19F; 1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys 4 of 4
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys
Reaxys ID 9859679 View in Reaxys
O
129/183 Chemical Name: 6-(2-nitrobiphenyl)benzo[1,3]dioxole-5-carboxylic acid methyl ester Linear Structure Formula: C15H11NO6 Molecular Formula: C15H11NO6 Molecular Weight: 301.255 Type of Substance: heterocyclic InChI Key: GVHDCXHYKJUYND-UHFFFAOYSA-N Note:
O
O
O
N
O
O
Substance Label (1) Label References 58
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
133 - 134
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys
NMR Spectroscopy (4) 1 of 4
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
20
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
200/249
2016-07-13 00:31:19
Frequency (NMR Spectroscopy) [MHz]
300
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 2 of 4
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
20
Frequency (NMR Spectroscopy) [MHz]
300
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 3 of 4
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
20
Frequency (NMR Spectroscopy) [MHz]
300
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 4 of 4
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]
20
Frequency (NMR Spectroscopy) [MHz]
125
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; electron impact (EI)
Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
201/249
2016-07-13 00:31:19
Reaxys ID 10101572 View in Reaxys
O
N
130/183 CAS Registry Number: 669769-61-3 Chemical Name: 4-nitro-3-(6-nitrobenzo[1,3]-dioxol-5-yl)quinoline Linear Structure Formula: C16H9N3O6 Molecular Formula: C16H9N3O6 Molecular Weight: 339.264 Type of Substance: heterocyclic InChI Key: UGDKSLLNRWSVQV-UHFFFAOYSA-N Note:
N
O
O
O
N
O
O
Substance Label (1) Label References 26
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys 2 of 2
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
Reaxys ID 10102380 View in Reaxys
131/183 CAS Registry Number: 669769-52-2 Chemical Name: 5-nitro-6-(6-nitrobenzo[1,3]dioxol-5-yl)quinoline Linear Structure Formula: C16H9N3O6 Molecular Formula: C16H9N3O6 Molecular Weight: 339.264 Type of Substance: heterocyclic InChI Key: PDUGQMLWNPCXMK-UHFFFAOYSA-N Note:
O O
N
N
O O
N
O
O
Substance Label (1) Label References 11
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
148 - 149
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
202/249
2016-07-13 00:31:19
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys 2 of 2
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
Reaxys ID 10102407 View in Reaxys
O
N
O
132/183 CAS Registry Number: 669769-56-6 Chemical Name: 4-nitro-3-(6-nitrobenzo[1,3]dioxol-5-yl)isoquinoline Linear Structure Formula: C16H9N3O6 Molecular Formula: C16H9N3O6 Molecular Weight: 339.264 Type of Substance: heterocyclic InChI Key: CYFWCRURMGSAPR-UHFFFAOYSA-N Note:
N
O
O
N
O
O
Substance Label (1) Label References 18
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
183 - 184
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
203/249
2016-07-13 00:31:19
Reaxys ID 10111071 View in Reaxys
O
N
O
133/183 CAS Registry Number: 669769-57-7 Chemical Name: 6,7-dimethoxy-4-nitro-3-(6-nitrobenzo[1,3]dioxol-5-yl)isoquinoline Linear Structure Formula: C18H13N3O8 Molecular Formula: C18H13N3O8 Molecular Weight: 399.317 Type of Substance: heterocyclic InChI Key: CDYYTMREEYIDKY-UHFFFAOYSA-N Note:
O
N
O O
O
N
O
O
Substance Label (1) Label References 19
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
238 - 239
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
Reaxys ID 10112710 View in Reaxys
O
N
N
O
134/183 CAS Registry Number: 669769-62-4 Chemical Name: 6,7-dimethoxy-4-nitro-3-(6-nitrobenzo[1,3]-dioxol-5-yl)quinoline Linear Structure Formula: C18H13N3O8 Molecular Formula: C18H13N3O8 Molecular Weight: 399.317 Type of Substance: heterocyclic InChI Key: GRWXRGAIBNTVTB-UHFFFAOYSA-N Note:
O
O O
O
N
O
O
Substance Label (1) Label References 27
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
200
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
204/249
2016-07-13 00:31:19
Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys
Reaxys ID 10549314 View in Reaxys
135/183 CAS Registry Number: 916245-17-5 Linear Structure Formula: C11H11NO6 Molecular Formula: C11H11NO6 Molecular Weight: 253.211 Type of Substance: heterocyclic InChI Key: DPUBWQOCTWSMJR-UHFFFAOYSA-N Note:
O N
O O
O
HO O
Substance Label (1) Label References 5c
Ortiz, Juan Carlos; Ozores, Lidia; Cagide-Fagin, Fernando; Alonso, Ricardo; Chemical Communications; nb. 40; (2006); p. 4239 - 4241, View in Reaxys
Reaxys ID 10710827 View in Reaxys
136/183 CAS Registry Number: 916487-02-0 Chemical Name: 6,7-methylenedioxy-4-(2-[1,3]dioxolan-2-ylphenyl)-3-nitro-2H-chromene Linear Structure Formula: C19H15NO7 Molecular Formula: C19H15NO7 Molecular Weight: 369.331 Type of Substance: heterocyclic InChI Key: HELQUDNQTZEGAJ-UHFFFAOYSA-N Note:
O O O
O O
N O O
Substance Label (1) Label References 14
Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
129 - 131
Solvent (Melting Point)
methanol
Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys Crystal Property Description (1) Colour & Other References Properties orange
Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
205/249
2016-07-13 00:31:19
2 of 2
Nucleus (NMR Spectroscopy)
1H
Coupling Nuclei
1H
Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys
Reaxys ID 11090863 View in Reaxys
137/183 Chemical Name: (E)-diisopropyl 1-(2-(benzo[d][1,3]dioxol-5yl)-1-nitrovinyl)hydrazine-1,2-dicarboxylate Linear Structure Formula: C17H21N3O8 Molecular Formula: C17H21N3O8 Molecular Weight: 395.369 InChI Key: WKMLJKPXCIPXFV-OVCLIPMQSA-N Note:
O N
E
O O
HN O
N
O
O O
O
Substance Label (1) Label References 3h
Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
98 - 99
Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys
NMR Spectroscopy (5) 1 of 5
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys 2 of 5
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys 3 of 5
Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys 4 of 5
Description (NMR Spec- Chemical shifts troscopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
206/249
2016-07-13 00:31:19
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys 5 of 5
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
KBr
Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum
Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys
Reaxys ID 13676601 View in Reaxys
138/183 Chemical Name: 1-(1,3-benzodioxol-5-yl)-2-nitro-1-pentene Linear Structure Formula: C12H13NO4 Molecular Formula: C12H13NO4 Molecular Weight: 235.24 InChI Key: BDRAJGDAPYLXOK-POHAHGRESA-N Note:
Z
O O
O
N
O
Reaxys ID 14550839 View in Reaxys
139/183 CAS Registry Number: 885067-87-8 Chemical Name: 2,2-difluoro-5-(-2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C9H5F2NO4 Molecular Formula: C9H5F2NO4 Molecular Weight: 229.14 InChI Key: QDPFQTZFVOZJEL-UHFFFAOYSA-N Note:
O F F
O
N
O
O
Substance Label (1) Label References 61
Patent; AVENTIS PHARMACEUTICALS INC.; WO2006/44732; (2006); (A2) English, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
207/249
2016-07-13 00:31:19
Reaxys ID 14647126 View in Reaxys
O
N
140/183 CAS Registry Number: 338948-54-2 Chemical Name: 6-(4,5-Methylenedioxy-2-nitrophenyl)-2,3-dimethoxy-5-nitronaphthalene Linear Structure Formula: C19H14N2O8 Molecular Formula: C19H14N2O8 Molecular Weight: 398.329 InChI Key: DJGMTAZCKLNFDR-UHFFFAOYSA-N Note:
O
O
O N
O
O
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
187 - 189
Patent; LaVoie, Edmond J.; Liu, Leroy Fong; Yu, Younong; US2003/100560; (2003); (A1) English, View in Reaxys NMR Spectroscopy (2) 1 of 2
Nucleus (NMR Spectroscopy)
1H
Original Text (NMR Spectroscopy)
1H NMR (CDCl3) δ 3.92 (3H, s), 6.19 (2H, d), 6.76 (1H, s), 7.12 (1H, d, J=2.5), 7.18 (1H, d, J=8.3), 7.28 (1H, dd, J1=9.0, J2=2.3), 7.70 (1H, s), 7.85 (1H, d, J=9.2), 7.93 (1H, d, J=8.4)
Comment (NMR Spectroscopy)
Signals given
Signals [ppm]
3.92; 6.19; 6.76; 7.12; 7.18; 7.28; 7.7; 7.85; 7.93
Kind of signal
3H, s; 2H, d; 1H, s; 1H, d, J=2.5; 1H, d, J=8.3; 1H, dd, J&1%=9.0, J&2%=2.3; 1H, s; 1H, d, J=9.2; 1H, d, J=8.4
Patent; LaVoie, Edmond J.; Liu, Leroy Fong; Yu, Younong; US2003/100560; (2003); (A1) English, View in Reaxys 2 of 2
Nucleus (NMR Spectroscopy)
13C
Original Text (NMR Spectroscopy)
13C NMR δ 56.08, 100.59, 103.93, 106.31, 110.70, 121.54, 124.07, 126.47, 128.71, 129.55, 130.33, 130.99, 131.23, 142.83, 148.92, 152.07, 160.68
Comment (NMR Spectroscopy)
Signals given
Signals [ppm]
56.08; 100.59; 103.93; 106.31; 110.7; 121.54; 124.07; 126.47; 128.71; 129.55; 130.33; 130.99; 131.23; 142.83; 148.92; 152.07; 160.68
Patent; LaVoie, Edmond J.; Liu, Leroy Fong; Yu, Younong; US2003/100560; (2003); (A1) English, View in Reaxys IR Spectroscopy (1) 1 of 1
Solvent (IR Spectroscopy)
KBr
Original Text (IR Spectroscopy)
IR (KBr) 2925, 1628, 1526, 1487, 1364, 1332, 1265, 1230 cm-1;
Signals [cm-1]
2925; 1628; 1526; 1487; 1364; 1332; 1265; 1230
Patent; LaVoie, Edmond J.; Liu, Leroy Fong; Yu, Younong; US2003/100560; (2003); (A1) English, View in Reaxys
Reaxys ID 15703124 View in Reaxys
141/183 Chemical Name: 3-(3,4-Methylenedioxyphenyl) amino-4-nitrophenol Linear Structure Formula: C13H10N2O5 Molecular Formula: C13H10N2O5 Molecular Weight: 274.233 InChI Key: DPDHNXUPRUYRDN-UHFFFAOYSA-N
OH H 2N O O
O
N
O
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
208/249
2016-07-13 00:31:19
Note: NMR Spectroscopy (1) 1 of 1
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- d6-DMSO scopy) Original Text (NMR Spectroscopy)
1H-NMR
Comment (NMR Spectroscopy)
Signals given
Signals [ppm]
6
(D6-DMSO): δ=6
Patent; Schering AG; US2002/6948; (2002); (A1) English, View in Reaxys
Reaxys ID 19047826 View in Reaxys
142/183 CAS Registry Number: 1155287-34-5 Chemical Name: 4-Benzo[1,3]dioxol-5-yl-6-chloro-2-(4-fluorobenzyl)-5-nitro-pyrimidine; 4-benzo[1,3]dioxol-5-yl-6-chloro-2(4-fluorobenzyl)-5-nitropyrimidine Linear Structure Formula: C18H11ClFN3O4 Molecular Formula: C18H11ClFN3O4 Molecular Weight: 387.754 InChI Key: OYIKBGVGIKOMHL-UHFFFAOYSA-N Note:
F
N
N Cl
O
O
N
O
O
Substance Label (1) Label References 29
Patent; DECODE GENETICS EHF; US2009/130076; (2009); (A1) English, View in Reaxys
Reaxys ID 19510434 View in Reaxys
143/183 CAS Registry Number: 49571-79-1 Chemical Name: methyl (E)-3-(1,3-benzodioxol-5-yl)-2-nitroacrylate Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 InChI Key: IGDFMGQGZSISDX-XBXARRHUSA-N Note:
O E
O O
O
N
O
O
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
24.84
Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Blanco-Ania, Daniel; Hermkens, Pedro H.H.; Sliedregt, Leo A.J.M.; Scheeren, Hans W.; Rutjes, Floris P.J.T.; Tetrahedron; vol. 65; nb. 27; (2009); p. 5393 - 5401, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
209/249
2016-07-13 00:31:19
2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
24.84
Frequency (NMR Spectroscopy) [MHz]
75
Location
supporting information
Blanco-Ania, Daniel; Hermkens, Pedro H.H.; Sliedregt, Leo A.J.M.; Scheeren, Hans W.; Rutjes, Floris P.J.T.; Tetrahedron; vol. 65; nb. 27; (2009); p. 5393 - 5401, View in Reaxys
Reaxys ID 19954700 View in Reaxys
144/183 CAS Registry Number: 1211909-49-7 Chemical Name: (E)-4-(3-(benzo[d][1,3]dioxol-5-yl)-2-nitroallyl)morpholine Linear Structure Formula: C14H16N2O5 Molecular Formula: C14H16N2O5 Molecular Weight: 292.291 InChI Key: KWCSMXONLVLGBA-KPKJPENVSA-N Note:
O O
E
O
N
O
N O
Melting Point (1) 1 of 1
Melting Point [°C]
127 - 130
Location
supporting information
Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys Crystal Property Description (1) Colour & Other Location Properties yellow
supporting information
References Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
210/249
2016-07-13 00:31:19
Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Location
supporting information
Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys Mass Spectrometry (2) Description (Mass Location Spectrometry)
References
ESI (Electrospray ionisation); Spectrum
supporting information
Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys
ESI (Electrospray supporting inforionisation); HRMS mation (High resolution mass spectrometry); Spectrum
Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys
Reaxys ID 20065431 View in Reaxys F
145/183
F
CAS Registry Number: 1206795-06-3 Linear Structure Formula: C14H7F3N2O6 Molecular Formula: C14H7F3N2O6 Molecular Weight: 356.215 InChI Key: OUWXMQXYKGQGNE-UHFFFAOYSA-N Note:
O N
F
O
O O
O
N
O
Patent-Specific Data (1) References Patent; MURDOCH UNIVERSITY; BEST, Wayne Morris; SIMS, Colette Gloria; SCAFFIDI, Adrian; GIUSEPPE, Luna; THOMPSON, Richard Christopher Andrew; ARMSTRONG, Tanya; WO2010/9508; (2010); (A1) English, View in Reaxys Melting Point (1) 1 of 1
Melting Point [°C]
147 - 149
Patent; MURDOCH UNIVERSITY; BEST, Wayne Morris; SIMS, Colette Gloria; SCAFFIDI, Adrian; GIUSEPPE, Luna; THOMPSON, Richard Christopher Andrew; ARMSTRONG, Tanya; WO2010/9508; (2010); (A1) English, View in Reaxys Pharmacological Data (3) 1 of 3
Comment (Pharmacological Data)
Bioactivities present
Patent; MURDOCH UNIVERSITY; BEST, Wayne Morris; SIMS, Colette Gloria; SCAFFIDI, Adrian; GIUSEPPE, Luna; THOMPSON, Richard Christopher Andrew; ARMSTRONG, Tanya; WO2010/9508; (2010); (A1) English, View in Reaxys 2 of 3
Effect (Pharmacological Data)
antiparasitic
Species or Test-System (Pharmacological Data)
Trypanosoma brucei rhodesiense
Method (Pharmacological Data)
B. Dose response curves against Trypanosomes.As with screening, dose response curves against Trypanosomes are performed in 96 well plates with 3 curves per plate. Ini-
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
211/249
2016-07-13 00:31:19
tial curves start at 10μM and decrease to 0.01 μM.1. Using a haemocytometer count a 10 ml culture of Trypanosomes at optimum growth (i.e. high in numbers without any short and stumpy forms apparent). Calculate the dilution factor needed to achieve a concentration of organisms at about 1X105/ml. The Trypanosomes will be diluted a further 1 :2 during plate set up, so that the final concentration of organisms should be about 5X104AnI.2. Drugs are pre-diluted in a 48 well plate. As with the screening plates, a volume sufficient to allow 50μl to be dispensed to each test and drug blank well is prepared. Dilute Diminazene stock to give 10ng/ml3. Add 100μl of warm media to the Media only and Media + aB wells. 4. Add 50μl of warm media to the Drug + Media blank wells, Trypanosome only and Diminazene Control wells.5. Add 50μl of drug dilution to the appropriate test wells and drug blank wells on the DRC plate.6. Add 50μl of Trypanosome suspension to all wells excluding Drug + Media blanks. The addition of Trypanosomes completes the dilution of the drugs. Incubate plate at 37 0C and 5percent CO2 for 48 hours.7. After about 48 hours alamarBlue (aB) should be added to the plate as follows. Add 10μl of aB to all of the drug screening wells, the Trypanosome only wells, the Diminazene control wells and the Media + aB wells (DONOT add the aB to the Drug + Media blank wells or the Media only wells). 8. Return to the incubator for a further 24 hrs.9. Once a total of 72 hours has elapsed, read the plate on a Biorad microplate reader at 570nm and 630nm.ResultsThe results are set out in Figures 1 to 6. Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
0.22 μmol/l
Location
Page/Page column 51-52
Patent; MURDOCH UNIVERSITY; BEST, Wayne Morris; SIMS, Colette Gloria; SCAFFIDI, Adrian; GIUSEPPE, Luna; THOMPSON, Richard Christopher Andrew; ARMSTRONG, Tanya; WO2010/9508; (2010); (A1) English, View in Reaxys 3 of 3
Effect (Pharmacological Data)
antiparasitic
Species or Test-System (Pharmacological Data)
Trypanosoma cruzi
Method (Pharmacological Data)
B. Dose response curves against Trypanosomes.As with screening, dose response curves against Trypanosomes are performed in 96 well plates with 3 curves per plate. Initial curves start at 10μM and decrease to 0.01 μM.1. Using a haemocytometer count a 10 ml culture of Trypanosomes at optimum growth (i.e. high in numbers without any short and stumpy forms apparent). Calculate the dilution factor needed to achieve a concentration of organisms at about 1X105/ml. The Trypanosomes will be diluted a further 1 :2 during plate set up, so that the final concentration of organisms should be about 5X104AnI.2. Drugs are pre-diluted in a 48 well plate. As with the screening plates, a volume sufficient to allow 50μl to be dispensed to each test and drug blank well is prepared. Dilute Diminazene stock to give 10ng/ml3. Add 100μl of warm media to the Media only and Media + aB wells. 4. Add 50μl of warm media to the Drug + Media blank wells, Trypanosome only and Diminazene Control wells.5. Add 50μl of drug dilution to the appropriate test wells and drug blank wells on the DRC plate.6. Add 50μl of Trypanosome suspension to all wells excluding Drug + Media blanks. The addition of Trypanosomes completes the dilution of the drugs. Incubate plate at 37 0C and 5percent CO2 for 48 hours.7. After about 48 hours alamarBlue (aB) should be added to the plate as follows. Add 10μl of aB to all of the drug screening wells, the Trypanosome only wells, the Diminazene control wells and the Media + aB wells (DONOT add the aB to the Drug + Media blank wells or the Media only wells). 8. Return to the incubator for a further 24 hrs.9. Once a total of 72 hours has elapsed, read the plate on a Biorad microplate reader at 570nm and 630nm.ResultsThe results are set out in Figures 1 to 6.
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
0.07 μmol/l
Location
Page/Page column 51-52
Patent; MURDOCH UNIVERSITY; BEST, Wayne Morris; SIMS, Colette Gloria; SCAFFIDI, Adrian; GIUSEPPE, Luna; THOMPSON, Richard Christopher Andrew; ARMSTRONG, Tanya; WO2010/9508; (2010); (A1) English, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
212/249
2016-07-13 00:31:19
Reaxys ID 20299549 View in Reaxys
O O
P
146/183
O N NH
O O
N O
Related Structure (1) Related Structure Location The tautomers given are discussed.
CAS Registry Number: 1220140-26-0 Chemical Name: diethyl 4-(benzo[d][1,3]dioxol-5-yl)-5-nitro-1Hpyrazol-3-yl-3-phosphonate Linear Structure Formula: C14H16N3O7P Molecular Formula: C14H16N3O7P Molecular Weight: 369.271 InChI Key: GMOWBANHPFOOML-UHFFFAOYSA-N Note:
supporting information
O
Referenced Com- References pound C14H16N3O7P
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
177
Location
supporting information
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys Crystal Property Description (1) Colour & Other Location Properties yellow
supporting information
References Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys
NMR Spectroscopy (5) 1 of 5
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
31P
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
24.84
Frequency (NMR Spectroscopy) [MHz]
161.8
Location
supporting information
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys 2 of 5
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
31P
Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Temperature (NMR Spectroscopy) [°C]
24.84
Frequency (NMR Spectroscopy) [MHz]
121.4
Location
supporting information
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys 3 of 5
Description (NMR Spec- Chemical shifts; Spectrum troscopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
213/249
2016-07-13 00:31:19
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys 4 of 5
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]
300
Location
supporting information
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys 5 of 5
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
75
Location
supporting information
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Intensity of IR bands; Bands
Solvent (IR Spectroscopy)
potassium bromide
Location
supporting information
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys Mass Spectrometry (2) Description (Mass Location Spectrometry)
References
ESI (Electrospray ionisation); Spectrum
supporting information
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys
HRMS (High resolution mass spectrometry); ESI (Electrospray ionisation); TOFMS (Time of flight mass spectrum); Spectrum
supporting information
Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
214/249
2016-07-13 00:31:19
Reaxys ID 20370727 View in Reaxys
147/183 Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 InChI Key: FUERCDRQIMGLOO-UHFFFAOYSA-N Note:
O N
O
O
O O
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys Mass Spectrometry (1) Description (Mass Location Spectrometry) HRMS (High resolution mass spectrometry); ESI (Electrospray ionisation); Spectrum
References
supporting information
Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys
Reaxys ID 20370729 View in Reaxys
148/183 Linear Structure Formula: C12H11NO6 Molecular Formula: C12H11NO6 Molecular Weight: 265.222 InChI Key: AAJUSLUYUIWOGN-UHFFFAOYSA-N Note:
O N
O
O
O
O O
Reaxys ID 20370731 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
149/183
215/249
2016-07-13 00:31:19
O N
O
Linear Structure Formula: C14H13NO6 Molecular Formula: C14H13NO6 Molecular Weight: 291.26 InChI Key: XMOVPTJQKQJLHB-UHFFFAOYSA-N Note:
O
O O O
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys Mass Spectrometry (1) Description (Mass Location Spectrometry) HRMS (High resolution mass spectrometry); ESI (Electrospray ionisation); Spectrum
References
supporting information
Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys
Reaxys ID 21166825 View in Reaxys
150/183 CAS Registry Number: 1276028-83-1 Chemical Name: 5-(3''-chloropropyl)-7-methoxy-3-nitro-2-(3',4'methylenedioxyphenyl)benzofuran Linear Structure Formula: C19H16ClNO6 Molecular Formula: C19H16ClNO6 Molecular Weight: 389.792 InChI Key: CEVOCNZOYXPUDA-UHFFFAOYSA-N Note:
O O O Cl O
N O
O
Melting Point (1) 1 of 1
Melting Point [°C]
137.3 - 138.3
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys NMR Spectroscopy (2)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
216/249
2016-07-13 00:31:19
1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
dichloromethane
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) LCMS (Liquid Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. chromatography 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys mass spectrometry); APCI (atmospheric pressure chemical ionization); Spectrum UV/VIS Spectroscopy (1) 1 of 1
Solvent (UV/VIS Spectroscopy)
dichloromethane
Absorption Maxima (UV/ 228; 268; 381 VIS) [nm] Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys Pharmacological Data (5) 1 of 5
Comment (Pharmacological Data)
Bioactivities present
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Staphylococcus aureus ATCC 29213
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
217/249
2016-07-13 00:31:19
Further Details (Pharmacological Data)
Mueller-Hilton broth method
Results
no effect
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 3 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Bacillus subtilis ATCC 6633
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Further Details (Pharmacological Data)
Mueller-Hilton broth method
Results
no effect
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 4 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Escherichia coli ATCC 8739
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Further Details (Pharmacological Data)
Mueller-Hilton broth method; minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
800 μg/ml
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 5 of 5
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Candida albicans ATCC 10231
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Further Details (Pharmacological Data)
Mueller-Hilton broth method; minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
25 μg/ml
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys
Reaxys ID 21166831 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
151/183
218/249
2016-07-13 00:31:19
CAS Registry Number: 1276028-81-9 Chemical Name: 5-[3''-hydroxypropyl]-7-methoxy-3,6-dinitro-2(3',4'-methylenedioxyphenyl)benzofuran Linear Structure Formula: C19H16N2O9 Molecular Formula: C19H16N2O9 Molecular Weight: 416.344 InChI Key: MLUOXHJNDYDFBU-UHFFFAOYSA-N Note:
O O
N
O
OH
O
N
O
O
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
188.7 - 189
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
dichloromethane
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) LCMS (Liquid Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. chromatography 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys mass spectrometry); APCI (atmospheric pressure chemical ionization); Spectrum UV/VIS Spectroscopy (1) 1 of 1
Solvent (UV/VIS Spectroscopy)
dichloromethane
Absorption Maxima (UV/ 229; 269; 384 VIS) [nm]
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
219/249
2016-07-13 00:31:19
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys Pharmacological Data (5) 1 of 5
Comment (Pharmacological Data)
Bioactivities present
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Staphylococcus aureus ATCC 29213
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Further Details (Pharmacological Data)
Mueller-Hilton broth method; minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
800 μg/ml
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 3 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Bacillus subtilis ATCC 6633
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Further Details (Pharmacological Data)
Mueller-Hilton broth method; minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
400 μg/ml
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 4 of 5
Effect (Pharmacological Data)
antibacterial
Species or Test-System (Pharmacological Data)
Escherichia coli ATCC 8739
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Further Details (Pharmacological Data)
Mueller-Hilton broth method; minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
400 μg/ml
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 5 of 5
Effect (Pharmacological Data)
antifungal
Species or Test-System (Pharmacological Data)
Candida albicans ATCC 10231
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
220/249
2016-07-13 00:31:19
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO
Further Details (Pharmacological Data)
Mueller-Hilton broth method; minimal inhibitory concentration (MIC)
Type (Pharmacological Data)
MIC
Value of Type (Pharmacological Data)
400 μg/ml
Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys
Reaxys ID 21381198 View in Reaxys
152/183 O N
O O
Linear Structure Formula: C9H6N4O4 Molecular Formula: C9H6N4O4 Molecular Weight: 234.171 InChI Key: JLCGSEIOFIYIPQ-UHFFFAOYSA-N Note:
O
N N N
Use (2) Laboratory Use and Handling
Location
References
supporting information
Stokes, Benjamin J.; Liu, Sheng; Driver, Tom G.; Journal of the American Chemical Society; vol. 133; nb. 13; (2011); p. 4702 - 4705, View in Reaxys
avoid contact with supporting inforskin mation
Stokes, Benjamin J.; Liu, Sheng; Driver, Tom G.; Journal of the American Chemical Society; vol. 133; nb. 13; (2011); p. 4702 - 4705, View in Reaxys
irritant
Reaxys ID 21676860 View in Reaxys
153/183 Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 InChI Key: FGLGFTKHOBZXNU-UHFFFAOYSA-N Note:
O N
O
O
O
Reaxys ID 22032763 View in Reaxys
154/183 CAS Registry Number: 1227182-21-9 Chemical Name: (E)-5-(1,3-dioxolan-2-yl)-6-(2-nitrovinyl)benzo[d][1,3]dioxole Linear Structure Formula: C12H11NO6 Molecular Formula: C12H11NO6 Molecular Weight: 265.222 InChI Key: AAJUSLUYUIWOGN-OWOJBTEDSA-N Note:
O N
E
O
O
O
O O
Melting Point (1) 1 of 1
Melting Point [°C]
179 - 180
Solvent (Melting Point)
hexane; ethyl acetate
Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys Crystal Property Description (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
221/249
2016-07-13 00:31:19
Colour & Other Properties
References
yellow
Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
500
Location
supporting information
Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
125
Location
supporting information
Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys
Reaxys ID 22268559 View in Reaxys
155/183 CAS Registry Number: 1357912-38-9 Chemical Name: 3-nitro-2H-6,7-methylenedioxythiochromene Linear Structure Formula: C10H7NO4S Molecular Formula: C10H7NO4S Molecular Weight: 237.236 InChI Key: KFMIWMXUFVSCMD-UHFFFAOYSA-N Note:
O N
O O
O
S
Melting Point (1) 1 of 1
Melting Point [°C]
128 - 131
Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys Crystal Property Description (1) Colour & Other References Properties red
Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
222/249
2016-07-13 00:31:19
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys Mass Spectrometry (2) Description (Mass References Spectrometry) EI (Electron impact); Spectrum
Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys
HRMS (High resolution mass spectrometry); EI (Electron impact); Spectrum
Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys
Reaxys ID 22769065 View in Reaxys
156/183 CAS Registry Number: 1393750-61-2 Chemical Name: 2-(benzo-[1,3]-dioxol-5-yl)-1-(3,4,5-trimethoxybenzyl)-1-nitroethene Linear Structure Formula: C19H19NO7 Molecular Formula: C19H19NO7 Molecular Weight: 373.362 InChI Key: RQXWTKIJIMMSQE-UHFFFAOYSA-N Note:
O O
O
O
O
N
O
O
Pharmacological Data (5) 1 of 5
Comment (Pharmacological Data)
Bioactivities present
Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys 2 of 5
Effect (Pharmacological Data)
cell morphology; effect on
Species or Test-System (Pharmacological Data)
EAhy 926 endothelial cells of human
Further Details (Pharmacological Data)
EAhy 926 cells derived from the fusion of human umbilical vein endothelial cells (HUVEC) with the permanent human cell line A549; minimal active concentration (MAC)
Type (Pharmacological Data)
MAC
Value of Type (Pharmacological Data)
0.4 μmol/l
Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys 3 of 5
Effect (Pharmacological Data)
cytotoxic
Species or Test-System (Pharmacological Data)
murine B16 melanoma cells
Further Details (Pharmacological Data)
MTT assay; inhibitory concentration (IC)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
223/249
2016-07-13 00:31:19
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
3 μmol/l
Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys 4 of 5
Effect (Pharmacological Data)
tubulin polymerization; inhibition of
Species or Test-System (Pharmacological Data)
tubulin
Further Details (Pharmacological Data)
inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
10.5 μmol/l
Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys 5 of 5
Effect (Pharmacological Data)
tubulin polymerization; inhibition of
Species or Test-System (Pharmacological Data)
tubulin
Results
molecular target: tubulin
Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys
Reaxys ID 22800695 View in Reaxys
157/183
O
N
O
CAS Registry Number: 1427306-76-0 Chemical Name: 13-nitro-8-thiocoptisine Linear Structure Formula: C19H12N2O6S Molecular Formula: C19H12N2O6S Molecular Weight: 396.38 InChI Key: OZSIXFAEWRAKHP-UHFFFAOYSA-N Note:
O
O
O N
S
O
Melting Point (1) 1 of 1
Melting Point [°C]
244 - 252
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Crystal Property Description (1) Colour & Other References Properties orange
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
224/249
2016-07-13 00:31:19
IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) ESI (Electrospray ionisation); Spectrum
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
Pharmacological Data (3) 1 of 3
Comment (Pharmacological Data)
Bioactivities present
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 2 of 3
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Type (Pharmacological Data)
growth inhibition rate
Value of Type (Pharmacological Data)
2.69 percent
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 3 of 3
Effect (Pharmacological Data)
multidrug resistance reversal activity
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Type (Pharmacological Data)
reversion rate
Value of Type (Pharmacological Data)
5.55 percent
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
Reaxys ID 22800696 View in Reaxys
158/183
O O
CAS Registry Number: 1427306-71-5 Chemical Name: 13-nitro-8-oxocoptisine Linear Structure Formula: C19H12N2O7 Molecular Formula: C19H12N2O7 Molecular Weight: 380.313 InChI Key: VYOHNIHCLNYDFJ-UHFFFAOYSA-N Note:
O
O N
O N
O
O
Crystal Property Description (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
225/249
2016-07-13 00:31:19
Colour & Other Properties
References
orange
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) ESI (Electrospray ionisation); Spectrum
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
Pharmacological Data (4) 1 of 4
Comment (Pharmacological Data)
Bioactivities present
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 2 of 4
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Further Details (Pharmacological Data)
inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
2.74 μmol/l
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 3 of 4
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Type (Pharmacological Data)
growth inhibition rate
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
226/249
2016-07-13 00:31:19
Value of Type (Pharmacological Data)
12.05 percent
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 4 of 4
Effect (Pharmacological Data)
multidrug resistance reversal activity
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Type (Pharmacological Data)
reversion rate
Value of Type (Pharmacological Data)
46.99 percent
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
Reaxys ID 22800699 View in Reaxys O
159/183 CAS Registry Number: 1427306-72-6 Chemical Name: 12,13-dinitro-8-oxocoptisine Linear Structure Formula: C19H11N3O9 Molecular Formula: C19H11N3O9 Molecular Weight: 425.311 InChI Key: RIFNSPGEPTYXJJ-UHFFFAOYSA-N Note:
O O
N
O
O
N
N OO
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
266 - 269
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Crystal Property Description (1) Colour & Other References Properties orange
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Mass Spectrometry (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
227/249
2016-07-13 00:31:19
Description (Mass References Spectrometry) ESI (Electrospray ionisation); Spectrum
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
Pharmacological Data (4) 1 of 4
Comment (Pharmacological Data)
Bioactivities present
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 2 of 4
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Further Details (Pharmacological Data)
inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
1.3 μmol/l
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 3 of 4
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Type (Pharmacological Data)
growth inhibition rate
Value of Type (Pharmacological Data)
9.52 percent
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 4 of 4
Effect (Pharmacological Data)
multidrug resistance reversal activity
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Type (Pharmacological Data)
reversion rate
Value of Type (Pharmacological Data)
52.96 percent
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
Reaxys ID 22800700 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
160/183
228/249
2016-07-13 00:31:19
S
CAS Registry Number: 1427306-77-1 Chemical Name: 12,13-dinitro-8-thiocoptisine Linear Structure Formula: C19H11N3O8S Molecular Formula: C19H11N3O8S Molecular Weight: 441.378 InChI Key: URABDJWSBYEDQM-UHFFFAOYSA-N Note:
O O
N
O
O
N
N O O
O
O
Melting Point (1) 1 of 1
Melting Point [°C]
184 - 190
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Crystal Property Description (1) Colour & Other References Properties orange
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) ESI (Electrospray ionisation); Spectrum
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
Pharmacological Data (4) 1 of 4
Comment (Pharmacological Data)
Bioactivities present
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 2 of 4
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Further Details (Pharmacological Data)
inhibitory concentration (IC)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
2.37 μmol/l
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
229/249
2016-07-13 00:31:19
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 3 of 4
Effect (Pharmacological Data)
cell growth; inhibition of
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Type (Pharmacological Data)
growth inhibition rate
Value of Type (Pharmacological Data)
13.89 percent
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 4 of 4
Effect (Pharmacological Data)
multidrug resistance reversal activity
Species or Test-System (Pharmacological Data)
breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp
Concentration (Pharmacological Data)
10 μmol/l
Type (Pharmacological Data)
reversion rate
Value of Type (Pharmacological Data)
42.8 percent
Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys
Reaxys ID 23598406 View in Reaxys
161/183 CAS Registry Number: 1182199-91-2 Chemical Name: 5-(2-nitrobut-1-enyl)benzo[1,3]dioxole Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 InChI Key: LHWIZYOSZOQHOY-WEVVVXLNSA-N Note:
O O
E
N
O
O
Substance Label (1) Label References 6a
Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 3198, View in Reaxys
Crystal Property Description (1) Colour & Other Location Properties yellow
supporting information
References Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
230/249
2016-07-13 00:31:19
Temperature (NMR Spectroscopy) [°C]
25
Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys Mass Spectrometry (1) Description (Mass Location Spectrometry) high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum
References
supporting information
Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys
Reaxys ID 23604579 View in Reaxys
162/183 CAS Registry Number: 1431708-82-5 Chemical Name: (E)-5-(2-nitro-4,4-bis(phenylsulfonyl)but-1-enyl)benzo[d]-[1,3]dioxole Linear Structure Formula: C23H19NO8S2 Molecular Formula: C23H19NO8S2 Molecular Weight: 501.538 InChI Key: KCPWWVKTMQIJNN-QGOAFFKASA-N Note:
O E
N OO S
O
O O
O
S
O
Substance Label (1) Label References 3c
Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
184 - 186
Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
231/249
2016-07-13 00:31:19
Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
20.94
Frequency (NMR Spectroscopy) [MHz]
400.1
Location
supporting information
Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
20.44
Frequency (NMR Spectroscopy) [MHz]
100.6
Location
supporting information
Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Intensity of IR bands; Bands
Solvent (IR Spectroscopy)
potassium bromide
Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys Mass Spectrometry (2) Description (Mass References Spectrometry) electrospray ionisation (ESI); spectrum
Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys
high resolution Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; mass spectrome- vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys try (HRMS); electrospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum
Reaxys ID 23690159 View in Reaxys
O
O
N
163/183 Linear Structure Formula: C13H13NO4 Molecular Formula: C13H13NO4 Molecular Weight: 247.251 InChI Key: ITXGMBLZKYGZRG-UHFFFAOYSA-N Note:
O
O
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
232/249
2016-07-13 00:31:19
Substance Label (1) Label References 3be
Creech, Gardner S.; Kwon, Ohyun; Chemical Science; vol. 4; nb. 6; (2013); p. 2670 - 2674, View in Reaxys
Reaxys ID 24868020 View in Reaxys
164/183 Linear Structure Formula: C14H15NO6 Molecular Formula: C14H15NO6 Molecular Weight: 293.276 InChI Key: JVSXIXYPFPDPBY-GHXNOFRVSA-N Note:
O Z
O O
O N
O
O
Pharmacological Data (1) 1 of 1
Comment (Pharmacological Data)
Bioactivities present
Zee-Cheng; Cheng; Journal of medicinal chemistry; vol. 12; nb. 1; (1969); p. 157 - 161, View in Reaxys
Reaxys ID 25080877 View in Reaxys
165/183 Linear Structure Formula: C23H20N2O6S Molecular Formula: C23H20N2O6S Molecular Weight: 452.488 InChI Key: AVEBWBBNAUKMDJ-MOSHPQCFSA-N Note:
O Z
O O
O
N
N H
S O
O
Pharmacological Data (1) 1 of 1
Comment (Pharmacological Data)
Bioactivities present
Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys
Reaxys ID 25806756 View in Reaxys
166/183 Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 InChI Key: KXZILZHHXSZSJP-ACAGNQJTSA-N Note:
Z O
O
N
O
O
O O
Pharmacological Data (1) 1 of 1
Comment (Pharmacological Data)
Bioactivities present
McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys
Reaxys ID 25868978 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
167/183
233/249
2016-07-13 00:31:19
Z
O O
O
Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 InChI Key: WGMJOSLIKRMTQU-BAQGIRSFSA-N Note:
OH N
O
Pharmacological Data (1) 1 of 1
Comment (Pharmacological Data)
Bioactivities present
Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys
Reaxys ID 26495905 View in Reaxys
168/183
O N E O
CAS Registry Number: 1526944-24-0 Chemical Name: (E)-2,2'-dinitrovinyl-4',5'-methylenedioxy-4,5,6-trimethoxybiphenyl Linear Structure Formula: C20H18N2O9 Molecular Formula: C20H18N2O9 Molecular Weight: 430.371 Note:
O
O O
O
E O
O
N O
Substance Label (1) Label References 9d
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
114 - 115
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Chromatographic Data (1) Chromatographic Location data HPLC (High performance liquid chromatography)
supporting information
References Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Crystal Property Description (1) Colour & Other References Properties yellow
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
234/249
2016-07-13 00:31:19
Original Text (NMR Spectroscopy)
NMR δ ppm 8.04 (1H, s, ArH), 7.24 (2H, d, J = 12.8 Hz, =CH), 6.83 (2H, d, J = 12.8 Hz, =CH), 6.05 and 6.00 (each 1H, s, ArH), 4.28 (2H, m, OCH2O), 4.05, 3.96, and 3.51 (each 3H, s, OMe)
Signals [ppm]
8.04; 7.24; 6.83; 6.05; 6; 4.28; 4.05; 3.96; 3.51
Kind of signal
1H, s, ArH; 2H, d, J = 12.8 Hz, =CH; 2H, d, J = 12.8 Hz, =CH; each 1H, s, ArH; 2H, m, OCH&2%O; each 3H, s, OMe
1H
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Mass Spectrometry (1) Description (Mass Peak Spectrometry) electrospray ionisation (ESI); spectrum
431.1 m/z; 453.2 m/z; 370.0 m/z
Intensity [%]
References
10; 50; 100
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; MorrisNatschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 333, View in Reaxys
Pharmacological Data (2) 1 of 2
Comment (Pharmacological Data)
Bioactivities present
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys 2 of 2
Comment (Pharmacological Data)
physiological behaviour discussed
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Reaxys ID 26495907 View in Reaxys
169/183 O N
E
CAS Registry Number: 1526944-28-4 Chemical Name: (E)-2,2'-di(2-methylnitrovinyl)-6-methoxy-4,5methylenedioxybiphenyl Linear Structure Formula: C20H18N2O7 Molecular Formula: C20H18N2O7 Molecular Weight: 398.372 Note:
O
O O O O
E N O
Substance Label (1) Label References 11a
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Chromatographic Data (1) Chromatographic Location data HPLC (High performance liquid chromatography)
supporting information
References Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Crystal Property Description (1) Colour & Other References Properties
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
235/249
2016-07-13 00:31:19
yellow
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Original Text (NMR Spectroscopy)
1H
Signals [ppm]
7.74; 7.21 - 7.46; 6.69; 6.02; 4.62; 3.79; 2.36; 1.97
Kind of signal
1H, s, =CH; 4H, m, ArH; 1H, s, =CH; 1H, s, ArH; 2H, s, OCH&2%O; 3H, s, OCH&3%; 3H, s, CH&3%; 3H, s, CH&3%
NMR δ ppm 7.74 (1H, s, =CH), 7.46-7.21 (4H, m, ArH), 6.69 (1H, s, =CH), 6.02 (1H, s, ArH), 4.62 (2H, s, OCH2O), 3.79 (3H, s, OCH3), 2.36 (3H, s, CH3), 1.97 (3H, s, CH3)
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Mass Spectrometry (1) Description (Mass Peak Spectrometry) electrospray ionisation (ESI); spectrum
399.2 m/z
Intensity [%]
References
20
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; MorrisNatschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 333, View in Reaxys
Pharmacological Data (2) 1 of 2
Comment (Pharmacological Data)
Bioactivities present
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys 2 of 2
Comment (Pharmacological Data)
physiological behaviour discussed
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Reaxys ID 26495908 View in Reaxys
O
N O
170/183
E
CAS Registry Number: 1526944-29-5 Chemical Name: (E)-2,2'-di(2-methylnitrovinyl)-4-methoxy-5,6methylenedioxybiphenyl Linear Structure Formula: C20H18N2O7 Molecular Formula: C20H18N2O7 Molecular Weight: 398.372 Note:
O E
O
N
O
O O
Substance Label (1) Label References 11b
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
236/249
2016-07-13 00:31:19
Chromatographic Data (1) Chromatographic Location data HPLC (High performance liquid chromatography)
supporting information
References Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Crystal Property Description (1) Colour & Other References Properties yellow
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Original Text (NMR Spectroscopy)
1H
Signals [ppm]
7.68; 7.36 - 7.51; 6.61; 6.07; 5.98; 3.98; 2.3; 2.26
Kind of signal
1H, s, =CH; 4H, m, ArH; 1H, s, =CH; 1H, s, ArH; 2H, s, OCH&2%O; 3H, s, OCH&3%; 3H, s, CH&3%; 3H, s, CH&3%
NMR δ ppm 7.68 (1H, s, =CH), 7.51-7.36 (4H, m, ArH), 6.61 (1H, s, =CH), 6.07 (1H, s, ArH), 5.98 (2H, s, OCH2O), 3.98 (3H, s, OCH3), 2.30 (3H, s, CH3), 2.26 (3H, s, CH3)
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Mass Spectrometry (1) Description (Mass Peak Spectrometry) electrospray ionisation (ESI); spectrum
399.2 m/z
Intensity [%]
References
30
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; MorrisNatschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 333, View in Reaxys
Pharmacological Data (2) 1 of 2
Comment (Pharmacological Data)
Bioactivities present
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys 2 of 2
Comment (Pharmacological Data)
physiological behaviour discussed
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Reaxys ID 26495914 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
171/183
237/249
2016-07-13 00:31:19
O N E O
CAS Registry Number: 1526944-21-7 Chemical Name: (E)-2,2'-di(2-methylnitrovinnyl)-4',5'-methylenedioxy-4,5,6-trimethoxybiphenyl Linear Structure Formula: C22H22N2O9 Molecular Formula: C22H22N2O9 Molecular Weight: 458.425 Note:
O
O O
O
O
E
O
N O
Substance Label (1) Label References 9a
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
98 - 99
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Chromatographic Data (1) Chromatographic Location data HPLC (High performance liquid chromatography)
supporting information
References Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Conformation (1) Object of Investi- References gation Conformation
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Crystal Property Description (1) Colour & Other References Properties yellow
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
NMR Spectroscopy (1) 1 of 1
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Original Text (NMR Spectroscopy)
1H
Signals [ppm]
8.05; 7.47; 6.87; 6.75; 6.66; 6.13; 3.9 - 3.95; 2.5; 2.29
Kind of signal
1H, s, CH=; 1H, s, CH=; 1H, s, ArH; 1H, s, ArH; 1H, s, ArH; 2H, s, OCH&2%O; 9H, ms, OCH&3%; 3H, s, CH&3%; 3H, s, CH&3%
NMR δ ppm 8.05 (1H, s, CH=), 7.47 (1H, s, CH=), 6.87 (1H, s, ArH), 6.75 (1H, s, ArH), 6.66 (1H, s, ArH), 6.13 (2H, s, OCH2O), 3.95-3.90 (9H, ms, OCH3), 2.50 (3H, s, CH3), 2.29 (3H, s, CH3)
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Mass Spectrometry (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
238/249
2016-07-13 00:31:19
Description (Mass Peak Spectrometry)
Intensity [%]
References
electrospray ionisation (ESI); spectrum
95; 100
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; MorrisNatschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 333, View in Reaxys
459.2 m/z; 384.2 m/z
Pharmacological Data (2) 1 of 2
Comment (Pharmacological Data)
Bioactivities present
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys 2 of 2
Comment (Pharmacological Data)
physiological behaviour discussed
Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys
Reaxys ID 26932918 View in Reaxys
172/183 CAS Registry Number: 77834-77-6 Linear Structure Formula: C12H11NO6 Molecular Formula: C12H11NO6 Molecular Weight: 265.222 InChI Key: SNNITTBVYNHLRY-UHFFFAOYSA-N Note:
O O
N
O
O
O
O
Substance Label (1) Label References 2h
Nair, Divya K.; Menna-Barreto, Rubem F. S.; Da Silva Junior, Eufranio N.; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; vol. 50; nb. 53; (2014); p. 6973 - 6976, View in Reaxys
Reaxys ID 27037810 View in Reaxys
173/183 CAS Registry Number: 1616871-69-2 Chemical Name: 5-(5-methyl-2-nitrophenyl)benzo[d][1,3]dioxole Linear Structure Formula: C14H11NO4 Molecular Formula: C14H11NO4 Molecular Weight: 257.246 InChI Key: GHLZASOGGUQWHS-UHFFFAOYSA-N Note:
O O
O
N
O
Substance Label (1) Label References 46
Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys
Chromatographic Data (1) Chromatographic Location data TLC (Thin layer chromatography)
supporting information
References Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys
NMR Spectroscopy (2)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
239/249
2016-07-13 00:31:19
1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
24.84
Frequency (NMR Spectroscopy) [MHz]
300
Location
supporting information
Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
24.84
Frequency (NMR Spectroscopy) [MHz]
75
Location
supporting information
Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
ATR (attenuated total reflectance); Intensity of IR bands; Bands
Location
supporting information
Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys Mass Spectrometry (2) Description (Mass Location Spectrometry)
References
electron impact (EI); spectrum
supporting information
Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys
high resolution mass spectrometry (HRMS); electron impact (EI); spectrum
supporting information
Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys
Reaxys ID 27610376 View in Reaxys
174/183
O O
Chemical Name: 1-nitro-6-tosyl-5,6-dihydro-[1,3]dioxolo[4,5-b]phenanthridine Linear Structure Formula: C21H16N2O6S Molecular Formula: C21H16N2O6S Molecular Weight: 424.434 InChI Key: HCLZRFZBLYJRQE-UHFFFAOYSA-N Note:
N
O O
N
O S
O
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
240/249
2016-07-13 00:31:19
Substance Label (1) Label References 44
Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
220 - 222
Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Location
supporting information
Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Location
supporting information
Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) high resolution Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; mass spectrome- (2014); p. 10899 - 10907, View in Reaxys try (HRMS); electrospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum
Reaxys ID 27615393 View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
175/183
241/249
2016-07-13 00:31:19
Chemical Name: 3-(benzo[d][1,3]dioxol-5-yl)-2-nitroimidazo[1,2-a]pyridine Linear Structure Formula: C14H9N3O4 Molecular Formula: C14H9N3O4 Molecular Weight: 283.243 InChI Key: BSPGAICHZAMPLO-UHFFFAOYSA-N Note:
O O
N
N
O
N
O
Substance Label (1) Label References 3ae
Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
25.14
Frequency (NMR Spectroscopy) [MHz]
400.2
Location
supporting information
Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]
16.34
Frequency (NMR Spectroscopy) [MHz]
100.6
Location
supporting information
Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys
Reaxys ID 27969998 View in Reaxys
176/183 Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 InChI Key: FUERCDRQIMGLOO-OWOJBTEDSA-N Note:
O E
O
N
O
O O
Substance Label (1) Label References 2b
Mahajan, Suruchi; Chauhan, Pankaj; Loh, Charles C. J.; Uzungelis, Server; Raabe, Gerhard; Enders, Dieter; Synthesis (Germany); vol. 47; nb. 7; (2015); p. 1024 - 1031, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
242/249
2016-07-13 00:31:19
Reaxys ID 28680347 View in Reaxys
177/183 Chemical Name: 5-(benzo[d][1,3]dioxol-5-yl)-2,2-dimethyl-6-nitro-2H-chromene Linear Structure Formula: C18H15NO5 Molecular Formula: C18H15NO5 Molecular Weight: 325.321 InChI Key: KOXDQHGVQKUORZ-UHFFFAOYSA-N Note:
O
O O
O
N
O
Substance Label (1) Label References 4s
Ranjith Reddy; Siva Reddy; Dhaked, Devendra K.; Rasheed; Pathania, Anup Singh; Shankar, Ravi; Malik, Fayaz; Das, Parthasarathi; Organic and Biomolecular Chemistry; vol. 13; nb. 35; (2015); p. 9285 9293, View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
112 - 114
Ranjith Reddy; Siva Reddy; Dhaked, Devendra K.; Rasheed; Pathania, Anup Singh; Shankar, Ravi; Malik, Fayaz; Das, Parthasarathi; Organic and Biomolecular Chemistry; vol. 13; nb. 35; (2015); p. 9285 - 9293, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow
Ranjith Reddy; Siva Reddy; Dhaked, Devendra K.; Rasheed; Pathania, Anup Singh; Shankar, Ravi; Malik, Fayaz; Das, Parthasarathi; Organic and Biomolecular Chemistry; vol. 13; nb. 35; (2015); p. 9285 9293, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Ranjith Reddy; Siva Reddy; Dhaked, Devendra K.; Rasheed; Pathania, Anup Singh; Shankar, Ravi; Malik, Fayaz; Das, Parthasarathi; Organic and Biomolecular Chemistry; vol. 13; nb. 35; (2015); p. 9285 - 9293, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
125
Location
supporting information
Ranjith Reddy; Siva Reddy; Dhaked, Devendra K.; Rasheed; Pathania, Anup Singh; Shankar, Ravi; Malik, Fayaz; Das, Parthasarathi; Organic and Biomolecular Chemistry; vol. 13; nb. 35; (2015); p. 9285 - 9293, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); time-
Ranjith Reddy; Siva Reddy; Dhaked, Devendra K.; Rasheed; Pathania, Anup Singh; Shankar, Ravi; Malik, Fayaz; Das, Parthasarathi; Organic and Biomolecular Chemistry; vol. 13; nb. 35; (2015); p. 9285 9293, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
243/249
2016-07-13 00:31:19
of-flight mass spectra (TOFMS); liquid chromatography mass spectrometry (LCMS); spectrum
Reaxys ID 28704132 View in Reaxys
178/183 Chemical Name: 6-nitro-8-methoxy-7, 8-dihydronitidine; 2,3methylenedioxy-6-nitro-8,10,11-trimethoxy-7-methylbenzo[c]phenanthridine Linear Structure Formula: C22H20N2O7 Molecular Formula: C22H20N2O7 Molecular Weight: 424.41 InChI Key: NLSNOQANCKDUCM-UHFFFAOYSA-N Note:
O N
O
O O
O N
O O
Substance Label (1) Label References 2
Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Dominique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys
Crystal Property Description (1) Colour & Other References Properties yellow
Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Dominique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- d(4)-methanol scopy) Frequency (NMR Spectroscopy) [MHz]
500
Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Dominique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- d(4)-methanol scopy) Frequency (NMR Spectroscopy) [MHz]
125
Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Dominique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
Bands
Solvent (IR Spectroscopy)
potassium bromide
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
244/249
2016-07-13 00:31:19
Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Dominique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys Mass Spectrometry (2) Description (Mass References Spectrometry) electrospray ioni- Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Domisation (ESI); time- nique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; of-flight mass Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys spectra (TOFMS); spectrum high resolution Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Domimass spectrome- nique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; try (HRMS); elec- Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys trospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum UV/VIS Spectroscopy (1) 1 of 1
Solvent (UV/VIS Spectroscopy)
methanol
Absorption Maxima (UV/ 271; 293; 307; 328 VIS) [nm] Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Dominique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys Pharmacological Data (1) 1 of 1
Comment (Pharmacological Data)
physiological behaviour discussed
Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Dominique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys Isolation from Natural Product (1) Isolation from References Natural Product roots of Zanthoxy- Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Domilum atchoum; col- nique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; lected by Prof. Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys Ake Assi in Yapo (Agboville), Ivory Coast, April 2003
Reaxys ID 28768227 View in Reaxys
179/183 Linear Structure Formula: C17H14N2O6 Molecular Formula: C17H14N2O6 Molecular Weight: 342.308 InChI Key: JXGDTDGTJUXEHA-VOTSOKGWSA-N Note:
O N E
O
O O
NH O
O
Substance Label (1) Label References 1j
Ramachary, Dhevalapally B.; Shruthi, Kodambahalli S.; Madhavachary; European Journal of Organic Chemistry; vol. 2015; nb. 29; (2015); p. 6413 - 6418, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
245/249
2016-07-13 00:31:19
Reaxys ID 29049931 View in Reaxys
180/183 Chemical Name: (E)-5-ethinyl-6-(2-nitrovinyl)benzo[d][1,3]dioxole Linear Structure Formula: C11H7NO4 Molecular Formula: C11H7NO4 Molecular Weight: 217.181 InChI Key: NCCOHRSLHCBPFY-ONEGZZNKSA-N Note:
O O
E
N
O
O
Substance Label (1) Label References 1d
Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 - 1800; Angew. Chem.; (2015), View in Reaxys
Melting Point (1) 1 of 1
Melting Point [°C]
178 - 183
Location
supporting information
Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 - 1800; Angew. Chem.; (2015), View in Reaxys Chromatographic Data (1) Chromatographic Location data TLC (Thin layer chromatography)
supporting information
Crystal Property Description (1) Colour & Other Location Properties yellow
supporting information
References Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 1800; Angew. Chem.; (2015), View in Reaxys References Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 1800; Angew. Chem.; (2015), View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
600
Location
supporting information
Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 - 1800; Angew. Chem.; (2015), View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
151
Location
supporting information
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
246/249
2016-07-13 00:31:19
Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 - 1800; Angew. Chem.; (2015), View in Reaxys IR Spectroscopy (1) 1 of 1
Description (IR Spectroscopy)
ATR (attenuated total reflectance); Bands
Location
supporting information
Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 - 1800; Angew. Chem.; (2015), View in Reaxys Mass Spectrometry (3) Description (Mass Location Spectrometry)
References
electron impact supporting infor(EI); fragmentamation tion pattern; spectrum
Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 1800; Angew. Chem.; (2015), View in Reaxys
high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum
supporting information
Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 1800; Angew. Chem.; (2015), View in Reaxys
CI (Chemical ioni- supporting inforzation); fragmen- mation tation pattern; spectrum
Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 1800; Angew. Chem.; (2015), View in Reaxys
Reaxys ID 29131193 View in Reaxys
181/183 O N
E
O O
Linear Structure Formula: C12H11NO6 Molecular Formula: C12H11NO6 Molecular Weight: 265.222 InChI Key: SNNITTBVYNHLRY-ONNFQVAWSA-N Note:
O
O O
Substance Label (1) Label References 2
Shu, Tao; Ni, Qijian; Song, Xiaoxiao; Zhao, Kun; Wu, Tianyu; Puttreddy, Rakesh; Rissanen, Kari; Enders, Dieter; Chemical Communications; vol. 52; nb. 12; (2016); p. 2609 - 2611, View in Reaxys
Reaxys ID 29359752 View in Reaxys
182/183 Chemical Name: (E)-5-(1-nitroprop-1-en-2-yl)benzo[d][1,3]dioxole Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 InChI Key: FGLGFTKHOBZXNU-FNORWQNLSA-N Note:
O N E
O
O O
Substance Label (1) Label References 1m
Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys
Melting Point (1)
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
247/249
2016-07-13 00:31:19
1 of 1
Melting Point [°C]
124 - 126
Location
supporting information
Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys Crystal Property Description (1) Colour & Other Location Properties yellow
References
supporting information
Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
Location
supporting information
Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
Location
supporting information
Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys Mass Spectrometry (1) Description (Mass Location Spectrometry) high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum
References
supporting information
Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys
Reaxys ID 29392875 View in Reaxys O
183/183 Chemical Name: 2-(benzo[d][1,3]dioxol-5-yl)-8-methyl-3-nitroimidazo[1,2-a]pyridine Linear Structure Formula: C15H11N3O4 Molecular Formula: C15H11N3O4 Molecular Weight: 297.27 InChI Key: ZNPRITICMDSRSJ-UHFFFAOYSA-N Note:
O
O
O
N N N
Substance Label (1) Label References
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
248/249
2016-07-13 00:31:19
3l
An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys
NMR Spectroscopy (2) 1 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
1H
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
400
An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys 2 of 2
Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)
13C
Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]
100
An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum
An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys
Copyright © 2016 Reed Elsevier Properties SA. All rights reserved. Authorized use only. Reaxys® and the Reaxys® trademark are owned and protected by Reed Elsevier Properties SA and used under license.
249/249
2016-07-13 00:31:19