2,2,4,5,7-penta'GHstar'-6-(1,2-di'GHstar'-2-nitrovinyl)benzo[d][1,3]dioxole by Asch

Query Query GH*

Date

183 substances in Reaxys

2016-07-13 00h:27m:29s (EST)

NO 2

1. Query

Results GH*

GH* GH*

GH*

GH* GH*

Search as: As drawn, No mixtures, No isotopes, No charges, No radicals

1/249

2016-07-13 00:31:19

Reaxys ID 15499 View in Reaxys

1/183 CAS Registry Number: 1485-00-3; 22568-48-5 Chemical Name: 5-((E)-2-nitroethenyl)-1,3-benzodioxole; NSC 10120; (E)-1,2-methylenedioxy-4-(2-nitrovinyl)benzene; (E)-1(3,4-methylenedioxyphenyl)-2-nitroethene; (E)-(3,4-methylenedioxyphenyl)-1-nitroethene; (E)-3,4-(methylenedioxy)-β-nitrostyrene; 2-(3,4-(methylenedioxy)phenyl)-1-nitroethene Linear Structure Formula: C9H7O4N Molecular Formula: C9H7NO4 Molecular Weight: 193.159 Type of Substance: heterocyclic InChI Key: KFLWBZPSJQPRDD-ONEGZZNKSA-N Note:

O O

Substance Label (43) Label References 2h

Evans, David A.; Mito, Shizue; Seidel, Daniel; Journal of the American Chemical Society; vol. 129; nb. 37; (2007); p. 11583 - 11592, View in Reaxys; Guo, Chang; Xue, Meng-Xia; Zhu, Ming-Kui; Gong, Liu-Zhu; Angewandte Chemie - International Edition; vol. 47; nb. 18; (2008); p. 3414 - 3417, View in Reaxys; Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys; Luridiana, Alberto; Frongia, Angelo; Aitken, David J.; Guillot, Regis; Sarais, Giorgia; Secci, Francesco; Organic and Biomolecular Chemistry; vol. 14; nb. 13; (2016); p. 3394 - 3403, View in Reaxys

Sagamanova, Irina; Rodrguez-Escrich, Carles; Molnr, Istvn Gbor; Sayalero, Sonia; Gilmour, Ryan; Perics, Miquel A.; ACS Catalysis; vol. 5; nb. 11; (2015); p. 6241 - 6248, View in Reaxys

Kobayashi, Takumi; Shimura, Tatsuki; Kurita, Yuzuru; Katsumata, Yoshitaka; Kezuka, Satoko; Tetrahedron Letters; vol. 55; nb. 17; (2014); p. 2818 - 2821, View in Reaxys

Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys

McNulty, James; Mao, Justin; Gibe, Romelo; Mo, Ruowei; Wolf, Sonja; Pettit, George R.; Herald, Delbert L.; Boyd, Michael R.; Bioorganic and Medicinal Chemistry Letters; vol. 11; nb. 2; (2001); p. 169 - 172, View in Reaxys; Zanwar, Manoj R.; Kavala, Veerababurao; Gawande, Sachin D.; Kuo, Chun-Wei; Kuo, Ting-Shen; Chen, Mei-Ling; He, Chiu-Hui; Yao, Ching-Fa; European Journal of Organic Chemistry; nb. 36; (2013); p. 8288 - 8298, View in Reaxys

Watanabe, Masahito; Ikagawa, Ayako; Wang, Hui; Murata, Kunihiko; Ikariya, Takao; Journal of the American Chemical Society; vol. 126; nb. 36; (2004); p. 11148 - 11149, View in Reaxys; Ansari, Samira; Raabe, Gerhard; Enders, Dieter; Monatshefte fur Chemie; vol. 144; nb. 5; (2013); p. 641 - 646, View in Reaxys

Enders, Dieter; Hahn, Robert; Atodiresei, Iuliana; Advanced Synthesis and Catalysis; vol. 355; nb. 6; (2013); p. 1126 - 1136, View in Reaxys

Singh, Kamalnain; Singh, Paramjit; Kaur, Amarjit; Singh, Pushpinder; Sharma, Sandeepkumar; Khullar, Sadhika; Mandal, Sanjay K.; Synthesis (Germany); vol. 45; nb. 10; (2013); p. 1406 - 1413; Art.No: SS-2013-Z0008-O, View in Reaxys

Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys

11c

Puerto Galvis, Carlos E.; Kouznetsov, Vladimir V.; Organic and Biomolecular Chemistry; vol. 11; nb. 42; (2013); p. 7372 - 7386, View in Reaxys

Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys

Boyd, Steven A.; Mantei, Robert A.; Tasker, Andrew S.; Liu, Gang; Sorensen, Bryan K.; Henry Jr., Kenneth J.; Von Geldern, Thomas W.; Winn, Martin; Wu-Wong, Jinshyun R.; Chiou, William J.; Dixon, Douglas B.; Hutchins, Charles W.; Marsh, Kennan C.; Nguyen, Bach; Opgenorth, Terry J.; Bioorganic and Medicinal Chemistry; vol. 7; nb. 6; (1999); p. 991 - 1002, View in Reaxys; Kusurkar, Radhika S.; Alkobati, Nabil A. H.; Gokule, Anita S.; Chaudhari, Purnima M.; Waghchaure, Prasad B.; Synthetic Communications; vol. 36; nb. 8; (2006); p. 1075 - 1081, View in Reaxys; Kusurkar, Radhika S.; Alkobati, Nabil A.H.; Gokule, Anita S.; Puranik, Vedavati G.; Tetrahedron; vol. 64; nb. 8; (2008); p. 1654 - 1662, View in Reaxys

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys

2/249

2016-07-13 00:31:19

Rastogi, Namrata; Namboothiri, Irishi N. N.; Cojocaru, Miriam; Tetrahedron Letters; vol. 45; nb. 24; (2004); p. 4745 - 4748, View in Reaxys; Puleo, Gian Luigi; Iuliano, Anna; Tetrahedron Asymmetry; vol. 19; nb. 17; (2008); p. 2045 - 2050, View in Reaxys

Muruganantham; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 9; nb. 6; (2007); p. 1125 - 1128, View in Reaxys

Das, Jaya Prakash; Sinha, Pradipta; Roy, Sujit; Organic Letters; vol. 4; nb. 18; (2002); p. 3055 - 3058, View in Reaxys; Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys

3, Ar=3,4(OCH2O)Ph

Toth, Judit; Varadi, Linda; Dancso, Andras; Blasko, Gabor; Toke, Laszlo; Nyerges, Miklos; Synlett; nb. 8; (2007); p. 1259 - 1263, View in Reaxys

25c

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys

Wang, Jian; Heikkinen, Lora D.; Li, Hao; Zu, Liansuo; Jiang, Wei; Xie, Hexin; Wang, Wei; Advanced Synthesis and Catalysis; vol. 349; nb. 7; (2007); p. 1052 - 1056, View in Reaxys

Garcia-Torres, Alejandro; Cruz-Almanza, Rymundo; Miranda, Luis D.; Tetrahedron Letters; vol. 45; nb. 10; (2004); p. 2085 - 2088, View in Reaxys; Rai, Vishal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Tetrahedron Asymmetry; vol. 18; nb. 22; (2007); p. 2719 - 2726, View in Reaxys

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys

1 (Table 3, run 4)

Li, Hao; Wang, Jian; Zu, Liansuo; Wang, Wei; Tetrahedron Letters; vol. 47; nb. 15; (2006); p. 2585 - 2589, View in Reaxys

VIa

Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys

MNS

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 - 1389, View in Reaxys

Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys

Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys; Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys

Batra, Sanjay; Sabnis, Yogesh A.; Rosenthal, Philip J.; Avery, Mitchell A.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 10; (2003); p. 2293 - 2299, View in Reaxys; Okino, Tomotaka; Hoashi, Yasutaka; Furukawa, Tomihiro; Xu, Xuenong; Takemoto, Yoshiji; Journal of the American Chemical Society; vol. 127; nb. 1; (2005); p. 119 - 125, View in Reaxys

Evans, David A.; Seidel, Daniel; Journal of the American Chemical Society; vol. 127; nb. 28; (2005); p. 9958 - 9959, View in Reaxys

McNulty, James; Larichev, Vladimir; Pandey, Siyaram; Bioorganic and Medicinal Chemistry Letters; vol. 15; nb. 23; (2005); p. 5315 - 5318, View in Reaxys

3, Tab. 1, entry 5

Nyerges, Miklos; Somfai, Barbara; Toth, Judit; Toke, Laszlo; Dancso, Andras; Blasko, Gabor; Synthesis; nb. 12; (2005); p. 2039 - 2045; Art.No: P00405SS, View in Reaxys

Nyerges, Miklos; Dancso, Andras; Bitter, Istvan; Blasko, Gabor; Toke, Laszlo; Tetrahedron Letters; vol. 46; nb. 40; (2005); p. 6927 - 6930, View in Reaxys

educt, table 2/ entry 7

Arstad, Erik; Barrett, Anthony G. M.; Tedeschi, Livio; Tetrahedron Letters; vol. 44; nb. 13; (2003); p. 2703 - 2707, View in Reaxys

substr., Tab.1, en- Lee, Seung Hwan; Park, Yong June; Yoon, Cheol Min; Organic and Biomolecular Chemistry; vol. 1; nb. 7; try 8 (2003); p. 1099 - 1100, View in Reaxys 20

Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys

Liu, Ju-Tsung; Yao, Ching-Fa; Tetrahedron Letters; vol. 42; nb. 35; (2001); p. 6147 - 6150, View in Reaxys

3/249

2016-07-13 00:31:19

16c

El-Ahl, Abdel Aziz S.; El Bialy, Serry A.A.; Ismail, Mohamed A.; Heterocycles; vol. 55; nb. 7; (2001); p. 1315 - 1321, View in Reaxys

Fierro; Rezende; Sepulveda-Boza; Reyes-Parada; Cassels; Journal of Chemical Research - Part S; nb. 7; (2001); p. 294 - 296, View in Reaxys

Banwell; Edwards; Jolliffe; Kemmler; Journal of the Chemical Society. Perkin Transactions 1; nb. 12; (2001); p. 1345 - 1348, View in Reaxys

Enders, Dieter; Teschner, Pascal; Raabe, Gerhard; Synlett; nb. 5; (2000); p. 637 - 640, View in Reaxys; Enders, Dieter; Teschner, Pascal; Raabe, Gerhard; Runsink, Jan; European Journal of Organic Chemistry; nb. 23; (2001); p. 4463 - 4477, View in Reaxys

Yadav; Subba Reddy; Srinivas; Ramalingam; Synlett; nb. 10; (2000); p. 1447 - 1449, View in Reaxys

Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys

Patent-Specific Data (1) Prophetic ComLocation in Patent References pound prophetic product

Page/page column 9; 61

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys

Melting Point (18) 1 of 18

Melting Point [°C]

163

Location

supporting information

Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys 2 of 18

Melting Point [°C]

139

Solvent (Melting Point)

chloroform

Location

supporting information

Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys 3 of 18

Melting Point [°C]

148

Location

supporting information

Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys 4 of 18

Melting Point [°C]

158 - 160

Solvent (Melting Point)

ethyl acetate; n-heptane

Location

supporting information

Melting Point [°C]

159 - 160

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 6 of 18

Melting Point [°C]

140 - 141

Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys 7 of 18

Melting Point [°C]

165 - 167

Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 1528, View in Reaxys 8 of 18

Melting Point [°C]

164 - 165

4/249

2016-07-13 00:31:19

9 of 18

Melting Point [°C]

166

Solvent (Melting Point)

nitromethane; CHCl3

Melting Point [°C]

150

Solvent (Melting Point)

acetone

Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys 11 of 18

Melting Point [°C]

166 - 168

Solvent (Melting Point)

CHCl3

Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys 12 of 18

Melting Point [°C]

132

Solvent (Melting Point)

ethanol

Rao; Ravishankar; Trivedi; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 207 - 214, View in Reaxys 13 of 18

Melting Point [°C]

161 - 164

Solvent (Melting Point)

ethanol

Bryce; Gardiner; Tetrahedron; vol. 44; nb. 2; (1988); p. 599 - 612, View in Reaxys 14 of 18

Melting Point [°C]

158

Solvent (Melting Point)

ethanol

Bourguignon, Jean; Le Nard, Gilles; Queguiner, Guy; Canadian Journal of Chemistry; vol. 63; (1985); p. 2354 2361, View in Reaxys 15 of 18

Melting Point [°C]

161 - 162

McDonald; Martin; Tetrahedron Letters; (1977); p. 1317,1318, View in Reaxys 16 of 18

Melting Point [°C]

158

Dore,J.-C. et al.; Chimica Therapeutica; vol. 6; (1971); p. 167 - 185, View in Reaxys 17 of 18

Melting Point [°C]

162 - 163

Gensler; Samour; Journal of the American Chemical Society; vol. 73; (1951); p. 5555, View in Reaxys 18 of 18

Melting Point [°C]

161.5

Solvent (Melting Point)

ethanol

Lange; Hambourger; Journal of the American Chemical Society; vol. 53; (1931); p. 3865, View in Reaxys Density (1) 1 of 1

Density [g·cm-3]

1.58

Type (Density)

crystallographic

Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys Chromatographic Data (1) Chromatographic Location data TLC (Thin layer chromatography)

supporting information

References Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys

Crystal Phase (2) Description (Crys- Comment (Crystal References tal Phase) Phase) Crystal structure determination

α=90 grad, β=92.4 grad, χ=90 grad, a=3.75 Angstroem, b=20.25

5/249

2016-07-13 00:31:19

Angstroem, c=10.73 Angstroem, n=4.; Temperature: 273 C. Method of determination: Single Crystal X-ray Diffraction Interplanar spacing

Crystal Property Description (5) Colour & Other Location Properties

References

yellow-orange

supporting information

Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys

yellow

supporting information

Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys; Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys

yellow

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys

yellow

Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 - 1528, View in Reaxys; Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys

Gelb

Gensler; Samour; Journal of the American Chemical Society; vol. 73; (1951); p. 5555, View in Reaxys; Lange; Hambourger; Journal of the American Chemical Society; vol. 53; (1931); p. 3865, View in Reaxys

Crystal System (1) Crystal System References monoclinic

Electrochemical Characteristics (2) 1 of 2

Description (Electrochemical Characteristics)

reduction potential

Solvent (Electrochemical Characteristics)

aq. phosphate buffer

pH-Value (Electrochemi- 7.3 cal Characteristics) Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys 2 of 2

Description (Electrochemical Characteristics)

polarographic current/voltage curve

Ried; Wilk; Justus Liebigs Annalen der Chemie; vol. 590; (1954); p. 91,109, View in Reaxys Interatomic Distances and Angles (1) Description References Interatomic distances and angles Space Group (1) Space Group 14

References Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 - 320, View in Reaxys

6/249

2016-07-13 00:31:19

NMR Spectroscopy (24) 1 of 24

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys 2 of 24

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys 3 of 24

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys 4 of 24

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

101

Location

supporting information

Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys 5 of 24

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- chloroform-d1 scopy)

7/249

2016-07-13 00:31:19

Frequency (NMR Spectroscopy) [MHz]

300

Location

supporting information

Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys 6 of 24

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

Location

supporting information

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Location

supporting information

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

500

Location

supporting information

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 9 of 24

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Location

supporting information

Burkhard, Johannes A.; Tchitchanov, Boris H.; Carreira, Erick M.; Angewandte Chemie - International Edition; vol. 50; nb. 23; (2011); p. 5379 - 5382, View in Reaxys

8/249

2016-07-13 00:31:19

10 of 24

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys; Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys 11 of 24

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- acetone-d6 scopy) Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys 12 of 24

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- acetone-d6 scopy) Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys 13 of 24

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 1528, View in Reaxys 14 of 24

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]

300.13

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]

75.47

9/249

2016-07-13 00:31:19

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]

300.13

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

75.5

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Rao; Ravishankar; Trivedi; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 207 - 214, View in Reaxys; Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 16, View in Reaxys 21 of 24

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

10/249

2016-07-13 00:31:19

Solvents (NMR Spectro- CDCl3 scopy) Marsden, Richard; MacLean, David B.; Canadian Journal of Chemistry; vol. 62; (1984); p. 1392 - 1399, View in Reaxys; Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys 22 of 24

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys 23 of 24

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

Marsden, Richard; MacLean, David B.; Canadian Journal of Chemistry; vol. 62; (1984); p. 1392 - 1399, View in Reaxys; Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys 24 of 24

Description (NMR Spec- Spin-spin coupling constants troscopy) Comment (NMR Spectroscopy)

1H-1H

Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys IR Spectroscopy (11) 1 of 11

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

neat (no solvent, solid phase)

Location

supporting information

Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 3018,11, View in Reaxys 2 of 11

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 3 of 11

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 1528, View in Reaxys 4 of 11

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

nujol

Description (IR Spectroscopy)

Bands

11/249

2016-07-13 00:31:19

Solvent (IR Spectroscopy)

KBr

Comment (IR Spectroscopy)

1629 - 817 cm**(-1)

Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys 6 of 11

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Comment (IR Spectroscopy)

2925 cm**(-1)

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

nitrobenzene

Comment (IR Spectroscopy)

2980 - 2900 cm**(-1)

Description (IR Spectroscopy)

Bands

Comment (IR Spectroscopy)

1550 - 1370 cm**(-1)

Rao; Ravishankar; Trivedi; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 207 - 214, View in Reaxys 9 of 11

Description (IR Spectroscopy)

Bands

Comment (IR Spectroscopy)

1500 - 1370 cm**(-1)

Nachtsheim, Corina M.; Frahm, August W.; Archiv der Pharmazie (Weinheim, Germany); vol. 322; (1989); p. 187 - 197, View in Reaxys 10 of 11

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

nujol

Comment (IR Spectroscopy)

1500 - 900 cm**(-1); Wahrscheinlich aus Piperonal und Nitromethan hergestelltes Praep..

Briggs et al.; Analytical Chemistry; vol. 29; (1957); p. 904,905, View in Reaxys 11 of 11

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

CHCl3

Comment (IR Spectroscopy)

1500 - 900 cm**(-1); Wahrscheinlich aus Piperonal und Nitromethan hergestelltes Praep..

Briggs et al.; Analytical Chemistry; vol. 29; (1957); p. 904,905, View in Reaxys Mass Spectrometry (5) Description (Mass Location Spectrometry) high resolution mass spectrometry (HRMS); elec-

supporting information

References Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 - 3018,11, View in Reaxys

12/249

2016-07-13 00:31:19

trospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum gas chromatogra- supporting inforphy mass specmation trometry (GCMS); spectrum

Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys

electron impact (EI); spectrum

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys

spectrum; electron impact (EI)

Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys; Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 - 4088, View in Reaxys

spectrum

Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 1432, View in Reaxys

UV/VIS Spectroscopy (1) 1 of 1

Description (UV/VIS Spectroscopy)

Absorption maxima

Solvent (UV/VIS Spectroscopy)

methanol

Absorption Maxima (UV/ 257; 363 VIS) [nm] Kamlet; Glover; Journal of the American Chemical Society; vol. 77; (1955); p. 5696, View in Reaxys Pharmacological Data (91) 1 of 91

Comment (Pharmacological Data)

Bioactivities present

Seebach,D. et al.; Chemische Berichte; vol. 108; (1975); p. 1924 - 1945, View in Reaxys; Ehrig,V.; Seebach,D.; Chemische Berichte; vol. 108; (1975); p. 1961 - 1973, View in Reaxys; Patent; Abbott Laboratories; US5767144; (1998); (A1) English, View in Reaxys; Dore,J.-C. et al.; Chimica Therapeutica; vol. 6; (1971); p. 167 - 185, View in Reaxys; Patent; Abbott Laboratories; US5622971; (1997); (A1) English, View in Reaxys; Patent; Kanto Kagaku Kabushiki Kaisha; EP1512678; (2005); (A1) English, View in Reaxys; Patent; ABBOTT LABORATORIES; WO2006/34094; (2006); (A1) English, View in Reaxys; Patent; ABBOTT LABORATORIES; WO2006/34234; (2006); (A1) English, View in Reaxys; Briggs et al.; Analytical Chemistry; vol. 29; (1957); p. 904,905, View in Reaxys; Gensler; Samour; Journal of the American Chemical Society; vol. 73; (1951); p. 5555, View in Reaxys; Kindler; Brandt; Archiv der Pharmazie (Weinheim, Germany); vol. 273; (1935); p. 478,482, View in Reaxys; Reichert; Koch; Archiv der Pharmazie (Weinheim, Germany); vol. 273; (1935); p. 265,271, View in Reaxys; Kamlet; Glover; Journal of the American Chemical Society; vol. 77; (1955); p. 5696, View in Reaxys; Lange; Hambourger; Journal of the American Chemical Society; vol. 53; (1931); p. 3865, View in Reaxys; Kamlet; Journal of the American Chemical Society; vol. 77; (1955); p. 4896, View in Reaxys; Erne; Ramirez; Helvetica Chimica Acta; vol. 33; (1950); p. 912,915, View in Reaxys; Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys; Kondo et al.; Itsuu Kenkyusho Nempo; nb. 2; (1951); p. 11; dtsch. Ref. S. 48; Chem.Abstr.; (1953); p. 7519, View in Reaxys; Schales; Chemische Berichte; vol. 68; (1935); p. 1579,1581, View in Reaxys; Musante; Gazzetta Chimica Italiana; vol. 67; (1937); p. 579,586, View in Reaxys 2 of 91

Comment (Pharmacological Data)

Bioactivities present

Ried; Wilk; Justus Liebigs Annalen der Chemie; vol. 590; (1954); p. 91,109, View in Reaxys; Kondo et al.; Itsuu Kenkyusho Nempo; nb. 4; (1953); p. 20,29;engl.Ref.S.70; Chem.Abstr.; (1956); p. 11982, View in Reaxys; Benington et al.; Journal of Organic Chemistry; vol. 23; (1958); p. 1979,1980, View in Reaxys; McDonald; Martin; Tetrahedron Letters; (1977); p. 1317,1318, View in Reaxys; Li, Yu-Gui; Liu, Yun-Shan; Miao, Fang-Ming; Liu, XiaoLan; Cao, Jin-Hong; et al.; Phosphorus, Sulfur and Silicon and the Related Elements; vol. 47; nb. 1 + 2; (1990); p. 229 - 242, View in Reaxys; Ishibashi, Hiroyuki; Okano, Masahiko; Tamaki, Hiroshi; Maruyama, Kazumi; Yakura, Takayuki; Ikeda, Masazumi; Journal of the Chemical Society, Chemical Communications; nb. 20; (1990); p. 1436 - 1437, View in Reaxys; Rao; Ravishankar; Trivedi; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 207 - 214, View in Reaxys; Gupta; Seth; Bhaduri; Indian Journal of Chemistry - Section B Organic Chemistry Including Medicinal Chemistry; vol. 29; nb. 3; (1990); p. 235 - 238, View in Reaxys; Padwa, Albert; Chen, Yon-Yih; Tetrahedron Letters; vol. 24; nb. 33; (1983); p. 3447 - 3450, View in Reaxys; Karmarkar, Pradeep G.; Thakar, Alka A.; Wadia, Murzban S.; Tetrahedron Letters; vol. 22; nb. 24; (1981); p. 2301 - 2302, View in Reaxys; Bhattacharjya, Anup; Mukhopadhyay, Ranjan; Pakrashi, Satyesh C.;

13/249

2016-07-13 00:31:19

Synthesis; nb. 9; (1985); p. 886 - 887, View in Reaxys; Deshpande, S. R.; Mathur, H. H.; Trivedi, G. K.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 2; (1983); p. 166 167, View in Reaxys; Padwa, Albert; Chen, Yon-Yih; Chiacchio, Ugo; Dent, William; Tetrahedron; vol. 41; nb. 17; (1985); p. 3529 - 3535, View in Reaxys; Bryce; Gardiner; Tetrahedron; vol. 44; nb. 2; (1988); p. 599 - 612, View in Reaxys; Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys; Bryce; Gardiner; Hursthouse; Short; Tetrahedron Letters; vol. 28; nb. 5; (1987); p. 577 - 580, View in Reaxys; Ashwell, Mark A.; Jackson, Richard F. W.; Synthesis; nb. 3; (1988); p. 229 - 231, View in Reaxys; Pedireddi, V. Rao; Sarma, Jagarlapudi A. R. P.; Desiraju, Gautam R.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); nb. 2; (1992); p. 311 320, View in Reaxys; Marsden, Richard; MacLean, David B.; Canadian Journal of Chemistry; vol. 62; (1984); p. 1392 - 1399, View in Reaxys; Bourguignon, Jean; Le Nard, Gilles; Queguiner, Guy; Canadian Journal of Chemistry; vol. 63; (1985); p. 2354 - 2361, View in Reaxys 3 of 91

Comment (Pharmacological Data)

Bioactivities present

Blarer, Stefan J.; Seebach, Dieter; Chemische Berichte; vol. 116; nb. 9; (1983); p. 3086 - 3096, View in Reaxys; Schoellkopf, Ulrich; Kuehnle, Wulf; Egert, Ernst; Dyrbusch, Michael; Angewandte Chemie; vol. 99; nb. 5; (1987); p. 480 - 482, View in Reaxys; Enders; Meyer; Raabe; Synthesis; nb. 12; (1992); p. 1242 - 1244, View in Reaxys; Seebach, Dieter; Schaefer, Harald; Schmidt, Beat; Schreiber, Martin; Angewandte Chemie; vol. 104; nb. 12; (1992); p. 1680 - 1681, View in Reaxys; Ikeda; Okano; Kosaka; Kido; Ishibashi; Chemical and Pharmaceutical Bulletin; vol. 41; nb. 2; (1993); p. 276 - 281, View in Reaxys; Hill, Richard K.; Sawada, Seiji; Bock, Mark G.; Greene, Joseph R.; Heterocycles; vol. 25; (1987); p. 515 - 520, View in Reaxys; Blarer, Stefan J.; Schweizer, W. Bernd; Seebach, Dieter; Helvetica Chimica Acta; vol. 65; nb. 5; (1982); p. 1637 - 1654, View in Reaxys; Nachtsheim, Corina M.; Frahm, August W.; Archiv der Pharmazie (Weinheim, Germany); vol. 322; (1989); p. 187 - 197, View in Reaxys; Seebach, Dieter; Golinski, Jerzy; Helvetica Chimica Acta; vol. 64; nb. 5; (1981); p. 1413 - 1423, View in Reaxys; Ghera, Eugene; Yechezkel, Tamar; Hassner, Alfred; Journal of Organic Chemistry; vol. 58; nb. 24; (1993); p. 6716 - 6724, View in Reaxys; Nyerges, Miklos; Bitter, Istvan; Kadas, Istvan; Toth, Gabor; Toeke, Laszlo; Tetrahedron Letters; vol. 35; nb. 25; (1994); p. 4413 - 4414, View in Reaxys; Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys; Hassner; Rai; Dehaen; Synthetic Communications; vol. 24; nb. 12; (1994); p. 1669 - 1682, View in Reaxys; Nyerges, Miklos; Balazs, Laszlo; Kadas, Istvan; Bitter, Istvan; Koevesdi, Istvan; Toeke, Laszlo; Tetrahedron; vol. 51; nb. 24; (1995); p. 6783 - 6788, View in Reaxys; Torres; Cassels; Rezende; Synthetic Communications; vol. 25; nb. 8; (1995); p. 1239 - 1247, View in Reaxys; Nyerges, Miklos; Rudas, Monika; Toth, Gabor; Herenyi, Bulcsu; Kadas, Istvan; et al.; Tetrahedron; vol. 51; nb. 48; (1995); p. 13321 - 13330, View in Reaxys; Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys; Laso, Nieves M.; Quiclet-Sire, Beatrice; Zard, Samir Z.; Tetrahedron Letters; vol. 37; nb. 10; (1996); p. 1605 - 1608, View in Reaxys; Menicagli, Rita; Samaritani, Simona; Tetrahedron; vol. 52; nb. 4; (1996); p. 1425 - 1432, View in Reaxys; Winn, Martin; Von Geldern, Thomas W.; Opgenorth, Terry J.; Jae, Hwan-Soo; Tasker, Andrew S.; Boyd, Steven A.; Kester, Jeffrey A.; Mantei, Robert A.; Bal, Radhika; Sorensen, Bryan K.; Wu-Wong, Jinshyun R.; Chiou, William J.; Dixon, Douglas B.; Novosad, Eugene I.; Hernandez, Lisa; Marsh, Kennan C.; Journal of Medicinal Chemistry; vol. 39; nb. 5; (1996); p. 1039 1048, View in Reaxys 4 of 91

Comment (Pharmacological Data)

Bioactivities present

Nyerges, Miklos; Bitter, Istvan; Kadas, Istvan; Toth, Gabor; Toeke, Laszlo; Tetrahedron; vol. 51; nb. 42; (1995); p. 11489 - 11502, View in Reaxys; Jae, Hwan-Soo; Winn, Martin; Dixon, Douglas B.; Marsh, Kennan C.; Nguyen, Bach; Opgenorth, Terry J.; Von Geldern, Thomas W.; Journal of Medicinal Chemistry; vol. 40; nb. 20; (1997); p. 3217 - 3227, View in Reaxys; McNulty, James; Mo, Ruowei; Chemical Communications; nb. 8; (1998); p. 933 934, View in Reaxys; McNulty, James; Steere, Jennifer A.; Wolf, Sonja; Tetrahedron Letters; vol. 39; nb. 44; (1998); p. 8013 - 8016, View in Reaxys; Liu, Gang; Henry Jr., Kenneth J.; Szczepankiewics, Bruce G.; Winn, Martin; Kozmina, Natasha S.; Boyd, Steven A.; Wasicak, James; Von Geldern, Thomas W.; Wu-Wong, Jinshyun R.; Chiou, William J.; Dixon, Douglas B.; Nguyen, Bach; Marsh, Kennan C.; Opgenorth, Terry J.; Journal of Medicinal Chemistry; vol. 41; nb. 17; (1998); p. 3261 - 3275, View in Reaxys; Hintermann, Tobias; Seebach, Dieter; Helvetica Chimica Acta; vol. 81; nb. 11; (1998); p. 2093 - 2126, View in Reaxys; Boyd, Steven A.; Mantei, Robert A.; Tasker, Andrew S.; Liu, Gang; Sorensen, Bryan K.; Henry Jr., Kenneth J.; Von Geldern, Thomas W.; Winn, Martin; Wu-Wong, Jinshyun R.; Chiou, William J.; Dixon, Douglas B.; Hutchins, Charles W.; Marsh, Kennan C.; Nguyen, Bach; Opgenorth, Terry J.; Bioorganic and Medicinal Chemistry; vol. 7; nb. 6; (1999); p. 991 - 1002, View in Reaxys; Enders, Dieter; Teschner, Pascal; Raabe, Gerhard; Synlett; nb. 5; (2000); p. 637 - 640, View in Reaxys; Revial, Gilbert; Lim, Sethy; Viossat, Bernard; Lemoine, Pascale; Tomas, Alain; Duprat, Arthur F.; Pfau, Michel; Journal of Organic Chemistry; vol. 65; nb. 15; (2000); p. 4593 - 4600, View in Reaxys; Yadav; Subba Reddy; Srinivas; Ramalingam; Synlett; nb. 10; (2000); p. 1447 - 1449, View in Reaxys; McNulty, James; Mao, Justin; Gibe, Romelo; Mo, Ruowei; Wolf, Sonja; Pettit, George R.; Herald, Delbert L.; Boyd, Michael R.; Bioorganic and Medicinal Chemistry Letters; vol. 11; nb. 2; (2001); p. 169 - 172, View in Reaxys; Banwell; Edwards; Jolliffe; Kemmler; Journal of the Chemical Society. Perkin Transactions 1; nb. 12; (2001); p. 1345 - 1348, View in Reaxys; Liu, Ju-Tsung; Yao, Ching-Fa; Tetrahedron Letters; vol. 42; nb. 35; (2001); p. 6147 - 6150, View in Reaxys; El-Ahl, Abdel Aziz S.; El Bialy, Serry A.A.; Ismail, Mohamed A.; Heterocycles; vol. 55; nb. 7; (2001); p. 1315 - 1321, View in Reaxys; Enders, Dieter; Teschner, Pascal; Raabe, Gerhard; Runsink, Jan; European Journal of Organic Chemistry; nb. 23; (2001); p. 4463 - 4477, View in Reaxys; Fierro; Rezende; SepulvedaBoza; Reyes-Parada; Cassels; Journal of Chemical Research - Part S; nb. 7; (2001); p. 294 - 296, View in Reaxys; Jae; Winn; Von Geldern; Sorensen; Chiou; Nguyen; Marsh; Opgenorth; Journal of Medicinal Chemistry; vol. 44;

14/249

2016-07-13 00:31:19

nb. 23; (2001); p. 3978 - 3984, View in Reaxys; Das, Jaya Prakash; Sinha, Pradipta; Roy, Sujit; Organic Letters; vol. 4; nb. 18; (2002); p. 3055 - 3058, View in Reaxys; Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys; Lee, Seung Hwan; Park, Yong June; Yoon, Cheol Min; Organic and Biomolecular Chemistry; vol. 1; nb. 7; (2003); p. 1099 - 1100, View in Reaxys 5 of 91

Comment (Pharmacological Data)

Bioactivities present

Arstad, Erik; Barrett, Anthony G. M.; Tedeschi, Livio; Tetrahedron Letters; vol. 44; nb. 13; (2003); p. 2703 - 2707, View in Reaxys; Garcia-Torres, Alejandro; Cruz-Almanza, Rymundo; Miranda, Luis D.; Tetrahedron Letters; vol. 45; nb. 10; (2004); p. 2085 - 2088, View in Reaxys; Rastogi, Namrata; Namboothiri, Irishi N. N.; Cojocaru, Miriam; Tetrahedron Letters; vol. 45; nb. 24; (2004); p. 4745 - 4748, View in Reaxys; Batra, Sanjay; Sabnis, Yogesh A.; Rosenthal, Philip J.; Avery, Mitchell A.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 10; (2003); p. 2293 2299, View in Reaxys; Watanabe, Masahito; Ikagawa, Ayako; Wang, Hui; Murata, Kunihiko; Ikariya, Takao; Journal of the American Chemical Society; vol. 126; nb. 36; (2004); p. 11148 - 11149, View in Reaxys; Okino, Tomotaka; Hoashi, Yasutaka; Furukawa, Tomihiro; Xu, Xuenong; Takemoto, Yoshiji; Journal of the American Chemical Society; vol. 127; nb. 1; (2005); p. 119 - 125, View in Reaxys; Evans, David A.; Seidel, Daniel; Journal of the American Chemical Society; vol. 127; nb. 28; (2005); p. 9958 - 9959, View in Reaxys; McNulty, James; Larichev, Vladimir; Pandey, Siyaram; Bioorganic and Medicinal Chemistry Letters; vol. 15; nb. 23; (2005); p. 5315 5318, View in Reaxys; Nyerges, Miklos; Somfai, Barbara; Toth, Judit; Toke, Laszlo; Dancso, Andras; Blasko, Gabor; Synthesis; nb. 12; (2005); p. 2039 - 2045; Art.No: P00405SS, View in Reaxys; Nyerges, Miklos; Dancso, Andras; Bitter, Istvan; Blasko, Gabor; Toke, Laszlo; Tetrahedron Letters; vol. 46; nb. 40; (2005); p. 6927 - 6930, View in Reaxys; Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys; Kusurkar, Radhika S.; Alkobati, Nabil A. H.; Gokule, Anita S.; Chaudhari, Purnima M.; Waghchaure, Prasad B.; Synthetic Communications; vol. 36; nb. 8; (2006); p. 1075 - 1081, View in Reaxys; Li, Hao; Wang, Jian; Zu, Liansuo; Wang, Wei; Tetrahedron Letters; vol. 47; nb. 15; (2006); p. 2585 - 2589, View in Reaxys; Sawant, Devesh; Kumar, Rishi; Maulik, Prakas R.; Kundu, Bijoy; Organic Letters; vol. 8; nb. 8; (2006); p. 1525 - 1528, View in Reaxys; Cao, Chun-Li; Ye, Meng-Chun; Sun, Xiu-Li; Tang, Yong; Organic Letters; vol. 8; nb. 14; (2006); p. 2901 - 2904, View in Reaxys; Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 4088, View in Reaxys; Deng, Xiaohu; Mani, Neelakandha S.; Organic Letters; vol. 8; nb. 16; (2006); p. 3505 3508, View in Reaxys; Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 - 1389, View in Reaxys; Luo, Sanzhong; Mi, Xueling; Zhang, Long; Liu, Song; Xu, Hui; Cheng, Jin-Pei; Angewandte Chemie - International Edition; vol. 45; nb. 19; (2006); p. 3093 - 3097, View in Reaxys; Trost, Barry M.; Hisaindee, Soleiman; Organic Letters; vol. 8; nb. 26; (2006); p. 6003 - 6005, View in Reaxys 6 of 91

Comment (Pharmacological Data)

Bioactivities present

Yan, Ze-Yi; Niu, Yan-Ning; Wei, Hai-Long; Wu, Lu-Yong; Zhao, Ya-Bin; Liang, Yong-Min; Tetrahedron Asymmetry; vol. 17; nb. 23; (2006); p. 3288 - 3293, View in Reaxys; Luo, Sanzhong; Xu, Hui; Mi, Xueling; Li, Jiuyuan; Zheng, Xiaoxi; Cheng, Jin-Pei; Journal of Organic Chemistry; vol. 71; nb. 24; (2006); p. 9244 - 9247, View in Reaxys; Vishnumaya; Singh, Vinod K.; Organic Letters; vol. 9; nb. 6; (2007); p. 1117 - 1119, View in Reaxys; Muruganantham; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 9; nb. 6; (2007); p. 1125 - 1128, View in Reaxys; Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys; Hirao, Haruna; Yamauchi, Satoshi; Ishibashi, Fumio; Bioscience, Biotechnology and Biochemistry; vol. 71; nb. 3; (2007); p. 741 - 745, View in Reaxys; Toth, Judit; Varadi, Linda; Dancso, Andras; Blasko, Gabor; Toke, Laszlo; Nyerges, Miklos; Synlett; nb. 8; (2007); p. 1259 - 1263, View in Reaxys; Xu, Rong; Lever, John R.; Lever, Susan Z.; Bioorganic and Medicinal Chemistry Letters; vol. 17; nb. 9; (2007); p. 2594 - 2597, View in Reaxys; Wang, Jian; Li, Hao; Lou, Bihshow; Zu, Liansuo; Guo, Hua; Wang, Wei; Chemistry - A European Journal; vol. 12; nb. 16; (2006); p. 4321 - 4332, View in Reaxys; Wang, Wei-Ya; Hsieh, Pei-Wen; Wu, YangChang; Wu, Chin-Chung; Biochemical Pharmacology; vol. 74; nb. 4; (2007); p. 601 - 611, View in Reaxys; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys; Gao, Shijay; Tu, Zhijay; Kuo, Chun-Wei; Liu, Ju-Tsung; Chu, Cheng-Ming; Yao, Ching-Fa; Organic and Biomolecular Chemistry; vol. 4; nb. 15; (2006); p. 2851 - 2857, View in Reaxys; Hayashi, Yujiro; Okano, Tsubasa; Aratake, Seiji; Hazelard, Damien; Angewandte Chemie - International Edition; vol. 46; nb. 26; (2007); p. 4922 - 4925, View in Reaxys; Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys; Ranu, Brindaban C.; Mandal, Tanmay; Australian Journal of Chemistry; vol. 60; nb. 3; (2007); p. 223 - 227, View in Reaxys; Wu, Lu-Yong; Yan, Ze-Yi; Xie, Yong-Xin; Niu, Yan-Ning; Liang, Yong-Min; Tetrahedron Asymmetry; vol. 18; nb. 17; (2007); p. 2086 - 2090, View in Reaxys; Alza, Esther; Cambeiro, Xacobe C.; Jimenez, Ciril; Pericas, Miquel A.; Organic Letters; vol. 9; nb. 19; (2007); p. 3717 - 3720, View in Reaxys; Luo, Sanzhong; Zhang, Long; Mi, Xueling; Qiao, Yupu; Cheng, Jin-Pei; Journal of Organic Chemistry; vol. 72; nb. 24; (2007); p. 9350 - 9352, View in Reaxys; Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys; Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys

15/249

2016-07-13 00:31:19

7 of 91

Comment (Pharmacological Data)

Bioactivities present

Evans, David A.; Mito, Shizue; Seidel, Daniel; Journal of the American Chemical Society; vol. 129; nb. 37; (2007); p. 11583 - 11592, View in Reaxys; Wang, Jian; Heikkinen, Lora D.; Li, Hao; Zu, Liansuo; Jiang, Wei; Xie, Hexin; Wang, Wei; Advanced Synthesis and Catalysis; vol. 349; nb. 7; (2007); p. 1052 - 1056, View in Reaxys; Patent; Abbott Laboratories; US6124341; (2000); (A1) English, View in Reaxys; Patent; Abbott Laboratories; US6162927; (2000); (A1) English, View in Reaxys; Luo, Sanzhong; Li, Jiuyuan; Zhang, Long; Xu, Hui; Cheng, Jin-Pei; Chemistry - A European Journal; vol. 14; nb. 4; (2008); p. 1273 - 1281, View in Reaxys; Kusurkar, Radhika S.; Alkobati, Nabil A.H.; Gokule, Anita S.; Puranik, Vedavati G.; Tetrahedron; vol. 64; nb. 8; (2008); p. 1654 1662, View in Reaxys; Rai, Vishal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Tetrahedron Asymmetry; vol. 18; nb. 22; (2007); p. 2719 - 2726, View in Reaxys; Xiong, Yan; Wen, Yuehong; Wang, Fei; Gao, Bo; Liu, Xiaohua; Huang, Xiao; Feng, Xiaoming; Advanced Synthesis and Catalysis; vol. 349; nb. 13; (2007); p. 2156 - 2166, View in Reaxys; Patent; ABBOTT LABORATORIES; US2008/132710; (2008); (A1) English, View in Reaxys; Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys; Li, Pinhua; Wang, Lei; Zhang, Yicheng; Wang, Guanwu; Tetrahedron; vol. 64; nb. 32; (2008); p. 7633 - 7638, View in Reaxys; Puleo, Gian Luigi; Iuliano, Anna; Tetrahedron Asymmetry; vol. 19; nb. 17; (2008); p. 2045 - 2050, View in Reaxys; Guo, Chang; Xue, Meng-Xia; Zhu, Ming-Kui; Gong, Liu-Zhu; Angewandte Chemie - International Edition; vol. 47; nb. 18; (2008); p. 3414 - 3417, View in Reaxys; Belot, Sebastien; Sulzer-Mosse, Sarah; Kehrli, Stefan; Alexakis, Alexandre; Chemical Communications; nb. 39; (2008); p. 4694 - 4696, View in Reaxys; Li, Pinhua; Wang, Lei; Wang, Min; Zhang, Yicheng; European Journal of Organic Chemistry; nb. 7; (2008); p. 1157 - 1160, View in Reaxys; Hong, Bor-Cherng; Nimje, Roshan Y.; Wu, Ming-Fun; Sadani, Amit A.; European Journal of Organic Chemistry; nb. 8; (2008); p. 1449 - 1457, View in Reaxys; Miao, Tao; Wang, Lei; Li, Pinhua; Yan, Jincan; Synthesis; nb. 23; (2008); p. 3828 - 3834; Art.No: F16708SS, View in Reaxys; Li, Hao; Zhang, Shilei; Yu, Chenguang; Song, Xixi; Wang, Wei; Chemical Communications; nb. 16; (2009); p. 2136 - 2138, View in Reaxys; Tan, Bin; Zeng, Xiaofei; Lu, Yunpeng; Chua, Pei Juan; Zhong, Guofu; Organic Letters; vol. 11; nb. 9; (2009); p. 1927 - 1930, View in Reaxys; Wang, Shi-Wen; Chen, Jun; Chen, Gui-Hua; Peng, Yun-Gui; Synlett; nb. 9; (2009); p. 1457 - 1462, View in Reaxys 8 of 91

Comment (Pharmacological Data)

Bioactivities present

Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 6612, View in Reaxys; Li, Hao; Zu, Liansuo; Xie, Hexin; Wang, Wei; Synthesis; nb. 9; (2009); p. 1525 - 1530; Art.No: C00309SS, View in Reaxys; Zhu, Ye; Malerich, Jeremiah P.; Rawal, Viresh H.; Angewandte Chemie - International Edition; vol. 49; nb. 1; (2010); p. 153 - 156, View in Reaxys; Arai, Takayoshi; Mishiro, Asami; Yokoyama, Naota; Suzuki, Kuniko; Sato, Hiroyasu; Journal of the American Chemical Society; vol. 132; nb. 15; (2010); p. 5338 - 5339, View in Reaxys; Nakamura, Ayako; Lectard, Sylvain; Shimizu, Ryo; Hamashima, Yoshitaka; Sodeoka, Mikiko; Tetrahedron Asymmetry; vol. 21; nb. 13-14; (2010); p. 1682 - 1687, View in Reaxys; Patent; Dziki, Walter; Lu, Ziqi; Rasmussen, Michael W.; Wardrop, Jaqueline; Zhane, Geoff G.Z.; Linton, Cathie L.; US2006/63825; (2006); (A1) English, View in Reaxys; Patent; ABBOTT LABORATORIES; WO2006/34085; (2006); (A1) English, View in Reaxys; Shanbhag, Pramod; Nareddy, Pradeep R.; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 8; nb. 21; (2010); p. 4867 - 4873, View in Reaxys; Wang, Lei; Liu, Jie; Miao, Tao; Zhou, Wei; Li, Pinhua; Ren, Kai; Zhang, Xiuli; Advanced Synthesis and Catalysis; vol. 352; nb. 14-15; (2010); p. 2571 - 2578, View in Reaxys; Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys; Bako, Peter; Rapi, Zsolt; Keglevich, Gyoergy; Szabo, Tamas; Soti, Peter L.; Vigh, Tamas; Grn, Alajos; Holczbauer, Tamas; Tetrahedron Letters; vol. 52; nb. 13; (2011); p. 1473 - 1476, View in Reaxys; Patora-Komisarska, Krystyna; Benohoud, Meryem; Ishikawa, Hayato; Seebach, Dieter; Hayashi, Yujiro; Helvetica Chimica Acta; vol. 94; nb. 5; (2011); p. 719 - 745, View in Reaxys; Burkhard, Johannes A.; Tchitchanov, Boris H.; Carreira, Erick M.; Angewandte Chemie - International Edition; vol. 50; nb. 23; (2011); p. 5379 - 5382, View in Reaxys; Trost, Barry M.; Bringley, Dustin A.; Seng, Pamela S.; Organic Letters; vol. 14; nb. 1; (2012); p. 234 - 237, View in Reaxys; Li, Sheng-Nan; Xu, Lan-Ting; Chenb, Yue; Lia, JuLian; He, Ling; Letters in Organic Chemistry; vol. 8; nb. 6; (2011); p. 416 - 422, View in Reaxys; Enders, Dieter; Urbanietz, Gregor; Cassens-Sasse, Elisa; Keess, Sebastian; Raabe, Gerhard; Advanced Synthesis and Catalysis; vol. 354; nb. 8; (2012); p. 1481 - 1488, View in Reaxys; Trost, Barry M.; Hirano, Keiichi; Angewandte Chemie - International Edition; vol. 51; nb. 26; (2012); p. 6480 - 6483, View in Reaxys; Zanwar, Manoj R.; Raihan, Mustafa J.; Gawande, Sachin D.; Kavala, Veerababurao; Janreddy, Donala; Kuo, Chun-Wei; Ambre, Ram; Yao, ChingFa; Journal of Organic Chemistry; vol. 77; nb. 15; (2012); p. 6495 - 6504, View in Reaxys; Anastassiadis, Theonie; Deacon, Sean W.; Devarajan, Karthik; Ma, Haiching; Peterson, Jeffrey R.; Nature Biotechnology; vol. 29; nb. 11; (2011); p. 1039 - 1045, View in Reaxys; Enders, Dieter; Hahn, Robert; Atodiresei, Iuliana; Advanced Synthesis and Catalysis; vol. 355; nb. 6; (2013); p. 1126 - 1136, View in Reaxys 9 of 91

Comment (Pharmacological Data)

Bioactivities present

Manna, Srimanta; Jana, Sandipan; Saboo, Tapish; Maji, Arun; Maiti, Debabrata; Chemical Communications; vol. 49; nb. 46; (2013); p. 5286 - 5288, View in Reaxys; Singh, Kamalnain; Singh, Paramjit; Kaur, Amarjit; Singh, Pushpinder; Sharma, Sandeepkumar; Khullar, Sadhika; Mandal, Sanjay K.; Synthesis (Germany); vol. 45; nb. 10; (2013); p. 1406 - 1413; Art.No: SS-2013-Z0008-O, View in Reaxys; Ansari, Samira; Raabe, Gerhard; Enders, Dieter; Monatshefte fur Chemie; vol. 144; nb. 5; (2013); p. 641 - 646, View in Reaxys; Lavoie, Hugo; Thevakumar-

16/249

2016-07-13 00:31:19

an, Neroshan; Gavory, Gwenaelle; Li, John J.; Padeganeh, Abbas; Guiral, Sebastien; Duchaine, Jean; Mao, Daniel Y.L.; Bouvier, Michel; Sicheri, Frank; Therrien, Marc; Nature Chemical Biology; vol. 9; nb. 7; (2013); p. 428 - 436, View in Reaxys; Jalal, Swapnadeep; Sarkar, Soumen; Bera, Krishnendu; Maiti, Sukhendu; Jana, Umasish; European Journal of Organic Chemistry; nb. 22; (2013); p. 4823 - 4828, View in Reaxys; Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys; Puerto Galvis, Carlos E.; Kouznetsov, Vladimir V.; Organic and Biomolecular Chemistry; vol. 11; nb. 42; (2013); p. 7372 - 7386, View in Reaxys; Tang, Ying; Gu, Xuefan; Meng, Mei; Xu, Jingfang; Research on Chemical Intermediates; vol. 39; nb. 8; (2013); p. 3715 - 3725, View in Reaxys; Crestey, Francois; Jensen, Anders A.; Borch, Morten; Andreasen, Jesper Tobias; Andersen, Jacob; Balle, Thomas; Kristensen, Jesper Langgaard; Journal of Medicinal Chemistry; vol. 56; nb. 23; (2013); p. 9673 - 9682, View in Reaxys; Zanwar, Manoj R.; Kavala, Veerababurao; Gawande, Sachin D.; Kuo, Chun-Wei; Kuo, TingShen; Chen, Mei-Ling; He, Chiu-Hui; Yao, Ching-Fa; European Journal of Organic Chemistry; nb. 36; (2013); p. 8288 - 8298, View in Reaxys; Patent; THE TEXAS AandM UNIVERSITY SYSTEM; LEWIS, Kyle, G.; GLADYSZ, John, A.; GHOSH, Subrata, K.; WO2014/18978; (2014); (A2) English, View in Reaxys; Kobayashi, Takumi; Shimura, Tatsuki; Kurita, Yuzuru; Katsumata, Yoshitaka; Kezuka, Satoko; Tetrahedron Letters; vol. 55; nb. 17; (2014); p. 2818 - 2821, View in Reaxys; Rana, Nirmal K.; Huang, Huicai; Zhao, John C.-G.; Angewandte Chemie International Edition; vol. 53; nb. 29; (2014); p. 7619 - 7623; Angew. Chem.; vol. 126; nb. 29; (2014); p. 7749 7753,5, View in Reaxys; Chandrasekhar, Sosale; Shrinidhi, Annadka; Synthetic Communications; vol. 44; nb. 20; (2014); p. 3008 - 3018,11, View in Reaxys; Begari, Eeshwaraiah; Singh, Chandani; Nookaraju; Kumar, Pradeep; Synlett; vol. 25; nb. 14; (2014); p. 1997 - 2000; Art.No: ST-2014-D0206-L, View in Reaxys; Mukherjee, Tathagata; Ganzmann, Carola; Bhuvanesh, Nattamai; Gladysz, John A.; Organometallics; vol. 33; nb. 23; (2014); p. 6723 6737, View in Reaxys; Sagamanova, Irina; Rodrguez-Escrich, Carles; Molnr, Istvn Gbor; Sayalero, Sonia; Gilmour, Ryan; Perics, Miquel A.; ACS Catalysis; vol. 5; nb. 11; (2015); p. 6241 - 6248, View in Reaxys; Luridiana, Alberto; Frongia, Angelo; Aitken, David J.; Guillot, Regis; Sarais, Giorgia; Secci, Francesco; Organic and Biomolecular Chemistry; vol. 14; nb. 13; (2016); p. 3394 - 3403, View in Reaxys 10 of 91

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

leukemia P388 cells of mouse

Further Details (Pharmacological Data)

effective dose (ED)

Type (Pharmacological Data)

ED50

Value of Type (Pharmacological Data)

2 μg/ml

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

pancreas cancer BXPC-3 cells of human

Further Details (Pharmacological Data)

growth inhibition (GI)

Type (Pharmacological Data)

GI50

Value of Type (Pharmacological Data)

1.7 μg/ml

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

breast cancer MCF-7 cells of human

Further Details (Pharmacological Data)

growth inhibition (GI)

Type (Pharmacological Data)

GI50

17/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

0.58 μg/ml

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

CNS cancer SF295 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

prostate cancer DU-145 cells of human

Further Details (Pharmacological Data)

growth inhibition (GI)

Type (Pharmacological Data)

GI50

Value of Type (Pharmacological Data)

1.8 μg/ml

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

ovary cancer OVCAR-3 cells of human

Results

no effect

Effect (Pharmacological Data)

tubulin polymerization; inhibition of

Species or Test-System (Pharmacological Data)

not explicitly stated by authors

Further Details (Pharmacological Data)

inhibitory concentration (IC); IC50 related to: tubulin

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

5.3 μmol/l

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Cryptococcus neoformans ATCC 90112

Kind of Dosing (Pharmacological Data)

DMSO solution

18/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

0.78 - 1.56 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Streptococcus pneumoniae ATCC 6303

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

0.78 - 1.56 μg/disc

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Cryptococcus neoformans ATCC 90112

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

8 μg/ml

Effect (Pharmacological Data)

fungicidal

Species or Test-System (Pharmacological Data)

Candida albicans ATCC 90028

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal fungicidal concentration (MFC)

Type (Pharmacological Data)

MFC

Value of Type (Pharmacological Data)

16 μg/ml

19/249

2016-07-13 00:31:19

21 of 91

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Candida albicans ATCC 90028

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

8 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Neisseria gonorrhoeae ATCC 49226

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

< 0.78 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterobacter cloacae ATCC 13047

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

12.5 - 25 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Escherichia coli ATCC 25922

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

20/249

2016-07-13 00:31:19

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

6.25 - 12.5 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Stenotrophomonas maltophilia ATCC 13637

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

6.25 - 12.5 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Micrococcus luteus Presque Isle 456

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

50 - 100 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis ATCC 29212

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

6.25 - 12.5 μg/disc

Effect (Pharmacological Data)

bactericidal

21/249

2016-07-13 00:31:19

Species or Test-System (Pharmacological Data)

Neisseria gonorrhoeae ATCC 49226

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal bactericidal concentration (MBC)

Type (Pharmacological Data)

MBC

Value of Type (Pharmacological Data)

2 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Neisseria gonorrhoeae ATCC 49226

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

1 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterobacter cloacae ATCC 13047

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

bactericidal

Species or Test-System (Pharmacological Data)

Escherichia coli ATCC 25922

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal bactericidal concentration (MBC)

Type (Pharmacological Data)

MBC

22/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Escherichia coli ATCC 25922

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

64 μg/ml

Effect (Pharmacological Data)

bactericidal

Species or Test-System (Pharmacological Data)

Stenotrophomonas maltophilia ATCC 13637

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal bactericidal concentration (MBC)

Type (Pharmacological Data)

MBC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Stenotrophomonas maltophilia ATCC 13637

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

64 μg/ml

Effect (Pharmacological Data)

bactericidal

Species or Test-System (Pharmacological Data)

Micrococcus luteus Presque Isle 456

23/249

2016-07-13 00:31:19

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal bactericidal concentration (MBC)

Type (Pharmacological Data)

MBC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Micrococcus luteus Presque Isle 456

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

64 μg/ml

Effect (Pharmacological Data)

bactericidal

Species or Test-System (Pharmacological Data)

Enterococcus faecalis ATCC 29212

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal bactericidal concentration (MBC)

Type (Pharmacological Data)

MBC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis ATCC 29212

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

64 μg/ml

24/249

2016-07-13 00:31:19

Effect (Pharmacological Data)

bactericidal

Species or Test-System (Pharmacological Data)

Streptococcus pneumoniae ATCC 6303

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal bactericidal concentration (MBC)

Type (Pharmacological Data)

MBC

Value of Type (Pharmacological Data)

32 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Streptococcus pneumoniae ATCC 6303

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

16 μg/ml

Effect (Pharmacological Data)

bactericidal

Species or Test-System (Pharmacological Data)

Staphylococcus aureus ATCC 29213

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal bactericidal concentration (MBC)

Type (Pharmacological Data)

MBC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Staphylococcus aureus ATCC 29213

Kind of Dosing (Pharmacological Data)

DMSO solution

25/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

32 μg/ml

Effect (Pharmacological Data)

fungicidal

Species or Test-System (Pharmacological Data)

Cryptococcus neoformans ATCC 90112

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal fungicidal concentration (MFC)

Type (Pharmacological Data)

MFC

Value of Type (Pharmacological Data)

16 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Staphylococcus aureus ATCC 29213

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

6.25 - 12.5 μg/disc

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Candida albicans ATCC 90028

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

1.56 - 3.12 μg/disc

26/249

2016-07-13 00:31:19

46 of 91

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

renal cancer A498 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

melanoma SK-MEL-5 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

colon cancer KM20L2 cells of human

Further Details (Pharmacological Data)

growth inhibition (GI)

Type (Pharmacological Data)

GI50

Value of Type (Pharmacological Data)

1.8 μg/ml

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

lung-NSC cancer NCI-H460 cells of human

Further Details (Pharmacological Data)

growth inhibition (GI)

Type (Pharmacological Data)

GI50

Value of Type (Pharmacological Data)

2 μg/ml

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

CNS cancer SF268 cells of human

Further Details (Pharmacological Data)

growth inhibition (GI)

Type (Pharmacological Data)

GI50

Value of Type (Pharmacological Data)

1.9 μg/ml

27/249

2016-07-13 00:31:19

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis KE77F2 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis Med100 F3 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis Med150 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

28/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis 536540 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis H 181A strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis H 318 strain

29/249

2016-07-13 00:31:19

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Salmonella enteritidis 09 FF-D strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; sulfonamide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Salmonella typhimurium FFUP40 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; sulfonamide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

30/249

2016-07-13 00:31:19

59 of 91

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Staphylococcus aureus ATCC 29213 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis ATCC 29212 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Acetinobacter baumannii FFUP10 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

31/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Pseudomonas aeruginosa ATCC 27853 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Salmonella typhimurium FFUP1 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Escherichia coli ATCC 25922 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

32/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

128 mg/l

Effect (Pharmacological Data)

anticoagulant

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

<= 100 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, activated with 2 μmol/l U46619; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer

Further Details (Pharmacological Data)

U46619: 9,11-dideoxy-9α,11α-methanoepoxy prostaglandin F2α

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

2.1 μmol/l

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 66 of 91

Effect (Pharmacological Data)

anticoagulant

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

<= 100 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, activated with 5 μmol/l ADP; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer

Further Details (Pharmacological Data)

further investigation of title comp. ability to induced platelet disaggregation

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

4.1 μmol/l

Results

title comp. dose-dependently inhibited ADP-induced platelet aggregation and induced rapid disaggregation of platelet aggregated by ADP (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 67 of 91

Effect (Pharmacological Data)

anticoagulant

Species or Test-System (Pharmacological Data)

human platelets

33/249

2016-07-13 00:31:19

Concentration (Pharmacological Data)

<= 100 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, activated with 100 μmol/l arachidonic acid; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

5.8 μmol/l

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 68 of 91

Effect (Pharmacological Data)

anticoagulant

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

<= 100 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, activated with 10 μg/ml collagen; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

7.0 μmol/l

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 69 of 91

Effect (Pharmacological Data)

anticoagulant

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

<= 100 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, activated with 0.1 U/ml thrombin; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

12.7 μmol/l

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 70 of 91

Effect (Pharmacological Data)

anticoagulant

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

<= 100 μmol/l

34/249

2016-07-13 00:31:19

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, activated with 1 μmol/l A23187; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer

Further Details (Pharmacological Data)

A23187: calcimycin

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

25.9 μmol/l

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 71 of 91

Effect (Pharmacological Data)

anticoagulant

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

<= 100 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, activated with 200 nmol/l PDBu; 5 min later platelet aggregation measured turbidimetrically with light-transmission aggregometer

Further Details (Pharmacological Data)

PDBu: phorbol 12,13-dibutyrate, protein kinase C activator

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

4.8 μmol/l

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 72 of 91

Effect (Pharmacological Data)

transmitter release; inhibition of

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

0.2 - 20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. for 5 min, treated with 200 μmol/l arachidonic acid; thromboxane B2 formation measured by enzyme immunoassay

Comment (Pharmacological Data)

No effect

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 73 of 91

Effect (Pharmacological Data)

protein expression; inhibition of

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

0.2 - 20 μmol/l

35/249

2016-07-13 00:31:19

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. for 5 min, treated with 0.2 U/ml thrombin in presence of FITC-conjugated anti-CD62P for 15 min; P-selectin expression measured by flow cytometry

Further Details (Pharmacological Data)

reference comp.: prostaglandin E1 (5 μmol/l); FITC: fluorescein isothiocyanate

Results

title comp. decreased thrombin-induced P-selectin expression similar to that of reference comp. (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 74 of 91

Effect (Pharmacological Data)

protein activation; inhibition of

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

0.2 - 20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. for 5 min, treated with 0.2 U/ml thrombin in presence of FITC-conjugated anti-PAC-1 for 15 min; GPIIb/IIIa activation determined as PAC-1 binding analyzing by flow cytometry

Further Details (Pharmacological Data)

reference comp.: prostaglandin E1 (5 μmol/l); FITC: fluorescein isothiocyanate; GP: glycoprotein

Results

title comp. inhibited thrombin-induced GPIIb/IIIa activation (increased PAC-1 binding similar to that of reference comp.) (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 75 of 91

Effect (Pharmacological Data)

anticoagulant

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

ADP-stimulated (20 μmol/l) fixed platelets treated with title comp. before and after addition 200 μg/ml fibrinogen; fibrinogen-induced platelet aggregation measured turbidimetrically with light-transmission aggregometer

Further Details (Pharmacological Data)

reference comp.: prostaglandin E1 (10 μmol/l), RGDS (Arg-Gly-Asp-Ser; 100 μmol/l)

Comment (Pharmacological Data)

No effect

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 76 of 91

Effect (Pharmacological Data)

second messanger level; effect on

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

36/249

2016-07-13 00:31:19

Method (Pharmacological Data)

effect of title comp. on cyclic nucleotide levels studied; platelets incubated with title comp. at 37 deg C for 3 min; cAMP, cGMP levels determined by enzyme immunoassay

Comment (Pharmacological Data)

No effect

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 77 of 91

Effect (Pharmacological Data)

intracellular Ca(2+) level; effect on

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

effect of title comp. on intracellular calcium mobilization studied; Fluo-3-loaded platelets incubated with title comp. at 37 deg C for 3 min in presence of 1 mmol/l extracellular Ca(2+) and 100 μmol/l AA, 10 μg/ml collagen, 0.1 U/ml thrombin,

Further Details (Pharmacological Data)

5 μmol/l ADP or 2 μmol/l U46619; fluorescence measured; AA: arachidonic acid; U46619: 9,11-dideoxy-9α,11α-methanoepoxy prostaglandin F2α

Results

title comp. inhibited collagen-induced but did not change thrombin-, ADP-, AA-, or U46619-induce intracellular Ca(2+) mobilization (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 78 of 91

Effect (Pharmacological Data)

enzyme; inhib. of

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 1 μmol/l A23187 for 30 s; MLC kinase activity determined by measuring phosphorylation of MLC using Western blotting

Further Details (Pharmacological Data)

reference comp.: ML-7 (50 μmol/l; MLC kinase inhibitor); MLC: myosin light chain

Comment (Pharmacological Data)

No effect

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 79 of 91

Effect (Pharmacological Data)

enzyme; inhib. of

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 1 μmol/l A23187 for 30 s; calpain activity determined by measuring cleavage of talin using Western blotting

Further Details (Pharmacological Data)

reference comp.: calpeptin (100 μmol/l; calpain inhibitor); A23187: calcimycin

37/249

2016-07-13 00:31:19

Comment (Pharmacological Data)

No effect

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 80 of 91

Effect (Pharmacological Data)

enzyme; inhib. of

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 200 mnol/l PDBu for 30 s; PKC activity determined by measuring phosphorylation of MARCKS using Western blotting

Further Details (Pharmacological Data)

reference comp.: GF109203X (10 μmol/l; PKC inhibitor); PDBu: phorbol 12,13-dibutyrate; PKC: protein kinase C; MARCKS: myristoylated alanine-rich C kinase substrate

Results

title comp. did not inhibit directly PKC; title comp. inhibited thrombin- but not PDBu-induced MARCKS phosphorylation (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 81 of 91

Effect (Pharmacological Data)

protein phosphorylation; inhibition of

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 10 μg/ml collagen for 0.5 - 3 min; tyrosine-phosphorylated proteins (130, 110, 90, 80, 75, 60 kDa and cytoskeletal) determined using Western blotting

Further Details (Pharmacological Data)

reference comp.: genistein (20 and 600 μmol/l)

Results

title comp. inhibited thrombin- and collagen-induced protein tyrosine phosphorylation (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 82 of 91

Effect (Pharmacological Data)

protein distribution; effect on

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin for 0.5 - 3 min; cytoskeletal fraction isolated; talin and β3 integrin levels determined using Western blotting

Further Details (Pharmacological Data)

reference comp.: genistein (600 μmol/l)

Results

title comp. inhibited thrombin-induced increase in talin and integrin levels in cytoskeletal fraction (figure)

38/249

2016-07-13 00:31:19

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 83 of 91

Effect (Pharmacological Data)

anticoagulant

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

2 - 20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min in presence of 250 μg/ml fibrinogen; fibrin clot formation induced by 1 U/ml thrombin; kinetic of clot retraction monitored at 37 deg C for up to 4 h

Results

title comp. caused delay in kinetic of clot retraction; effect was dose-dependent (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 84 of 91

Effect (Pharmacological Data)

enzyme; inhib. of

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 30 μg/ml collagen for 0.5-2.5 min; Src tyrosine kinase activity determined as autophosphorylation of Tyr416 using immunoprecipitation and Western blotting;

Further Details (Pharmacological Data)

activity of immunoprecipitated kinase determined using tyrosine kinase assay kit with biotinylated poly(glu:Tyr); reference comp.: PP1 (20 μmol/l; Src inhibitor)

Results

title comp. inhibited thrombin- and collagen-induced Src activity (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 85 of 91

Effect (Pharmacological Data)

enzyme; inhib. of

Species or Test-System (Pharmacological Data)

human platelets

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 30 μg/ml collagen for 0.5 - 2.5 min; Syc tyrosine kinase activation determined using immunoprecipitation and Western blotting;

Further Details (Pharmacological Data)

activity of immunoprecipitated kinase determined using tyrosine kinase assay kit with biotinylated poly(glu:Tyr); reference comp.: piceatannol (100 μmol/l)

Results

title comp. inhibited thrombin- and collagen-induced Syc activity (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 86 of 91

Effect (Pharmacological Data)

protein phosphorylation; inhibition of

Species or Test-System (Pharmacological Data)

human platelets

39/249

2016-07-13 00:31:19

Concentration (Pharmacological Data)

20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

platelets incubated with title comp. at 37 deg C for 3 min, stimulated with 0.1 U/ml thrombin or 30 μg/ml collagen for 0.5 - 2.5 min; PKCγ2 phosphorylation determined using immunoprecipitation and Western blotting

Further Details (Pharmacological Data)

PKC: protein kinase C

Results

title comp. inhibited thrombin- and collagen-induced PKCγ2 phosphorylation (figure)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 87 of 91

Effect (Pharmacological Data)

enzyme; inhib. of

Species or Test-System (Pharmacological Data)

human recombinant Src tyrosine kinase

Concentration (Pharmacological Data)

5 - 50 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

enzyme treated with title comp. for 5 min; Src tyrosine kinase activity determined as phosphorylation of biotinylated poly(Glu:Tyr)(4:1) using tyrosine kinase assay kit

Further Details (Pharmacological Data)

reference comp.: PP1 (1 μmol/l; Src inhibitor), piceatannol (20 - 100 μmol/l), genistein (50 - 100 μmol/l)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

29.3 μmol/l

Results

title comp. dose-dependently inhibited activity of Src (88.5 percent at highest dose) (table)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 88 of 91

Effect (Pharmacological Data)

enzyme; inhib. of

Species or Test-System (Pharmacological Data)

human recombinant Syc tyrosine kinase

Concentration (Pharmacological Data)

1 - 20 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

enzyme treated with title comp. for 5 min; Syc tyrosine kinase activity determined as phosphorylation of biotinylated poly(Glu:Tyr)(4:1) using tyrosine kinase assay kit

Further Details (Pharmacological Data)

reference comp.: PP1 (1 μmol/l; Src inhibitor), piceatannol (20-100 μmol/l), genistein (50-100 μmol/l)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

2.5 μmol/l

Results

title comp. dose-dependently inhibited activity of Syc (94.4 percent at highest dose) (table)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 89 of 91

Effect (Pharmacological Data)

enzyme; inhib. of

40/249

2016-07-13 00:31:19

Species or Test-System (Pharmacological Data)

human recombinant FAK tyrosine kinase

Concentration (Pharmacological Data)

50 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

enzyme treated with title comp. for 5 min; FAK tyrosine kinase activity determined as phosphorylation of biotinylated poly(Glu:Tyr)(4:1) using tyrosine kinase assay kit

Further Details (Pharmacological Data)

reference comp.: genistein (50 - 100 μmol/l)

Results

title comp. inhibited activity of FAK (36.6 percent) (table)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 90 of 91

Effect (Pharmacological Data)

enzyme; inhib. of

Species or Test-System (Pharmacological Data)

human recombinant Janus tyrosine kinase 2

Concentration (Pharmacological Data)

50 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. was dissolved in dimethyl sulfoxide

Method (Pharmacological Data)

enzyme treated with title comp. for 5 min; Janus tyrosine kinase 2 activity determined as phosphorylation of biotinylated poly(Glu:Tyr)(4:1) using tyrosine kinase assay kit

Further Details (Pharmacological Data)

reference comp.: genistein (100 μmol/l);

Results

title comp. slightly inhibited activity of JAK2 (5.2 percent) (table)

Wang, Wei-Ya; Wu, Yang-Chang; Wu, Chin-Chung; Molecular Pharmacology; vol. 70; nb. 4; (2006); p. 1380 1389, View in Reaxys 91 of 91

Effect (Pharmacological Data)

antiproliferative

Species or Test-System (Pharmacological Data)

HeLa cells

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Method (Pharmacological Data)

test cells in MEM incubated with title comp. at 37 deg C for 24 h; cell growth stopped by addition of 10 percent trichloroacetic acid; sulforhodamine B assay; absorbance measured at 560 nm

Further Details (Pharmacological Data)

IC50: concentration of title comp. that inhibited cell proliferation by 50 percent; MEM: Eagle's minimum essential medium

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

18 μmol/l

Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys Use (1) Laboratory Use and Handling

References

cytotoxic

Schmidt; Eger; Pharmazie; vol. 51; nb. 1; (1996); p. 11 - 16, View in Reaxys

41/249

2016-07-13 00:31:19

Reaxys ID 192350 View in Reaxys

2/183 CAS Registry Number: 1485-00-3 Chemical Name: 5-(2-nitrovinyl)benzo[1,3]dioxole; SYK Inhibitor III; MNS; 3,4-methylenedioxy-β-methyl-β-nitrostyrene; 3,4(methylenedioxy)-β-nitrostyrene; 3,4-methylenedioxy-(2-nitrovinyl)benzene; 3,4-methylenedioxy-β-nitrostyrene Linear Structure Formula: C9H7NO4 Molecular Formula: C9H7NO4 Molecular Weight: 193.159 Type of Substance: heterocyclic InChI Key: KFLWBZPSJQPRDD-UHFFFAOYSA-N Note:

O O

Substance Label (31) Label References 2f

Kim, Shinae; Kang, Ki-Tae; Kim, Sung-Gon; Tetrahedron; vol. 70; nb. 34; (2014); p. 5114 - 5121, View in Reaxys; Boyce, Gregory R.; Johnson, Jeffrey S.; Journal of Organic Chemistry; vol. 81; nb. 4; (2016); p. 1712 - 1717, View in Reaxys

Rao, Kadiyala Srinivasa; Ramesh, Pambala; Trivedi, Rajiv; Kantam, M. Lakshmi; Tetrahedron Letters; vol. 57; nb. 11; (2016); p. 1227 - 1231, View in Reaxys

574713

Patent; Janssen Biotech, Inc.; Rezania, Alireza; Fryer, Benjamin; (49 pag.); US9234178; (2016); (B2) English, View in Reaxys

Yang, Chen; Zhang, En-Ge; Li, Xin; Cheng, Jin-Pei; Angewandte Chemie - International Edition; vol. 55; nb. 22; (2016); p. 6506 - 6510; Angew. Chem.; vol. 128; (2016); p. 6616 - 6620,5, View in Reaxys

Fan, Xinyuan; Rodriguez-Escrich, Carles; Sayalero, Sonia; Pericas, Miquel A.; Chemistry - A European Journal; vol. 19; nb. 33; (2013); p. 10814 - 10817, View in Reaxys; Xue, Fengjun; Dong, Yahao; Hu, Peibo; Deng, Yanan; Wei, Yuping; RSC Advances; vol. 5; nb. 90; (2015); p. 73684 - 73691, View in Reaxys

Kiyokawa, Kensuke; Nagata, Takaya; Hayakawa, Junpei; Minakata, Satoshi; Chemistry - A European Journal; vol. 21; nb. 3; (2015); p. 1280 - 1285, View in Reaxys

Rao, Kadiyala Srinivasa; Trivedi, Rajiv; Kantam, M. Lakshmi; Synlett; vol. 26; nb. 2; (2015); p. 221 - 227; Art.No: ST-2014-D0721-L, View in Reaxys

Ghosh, Monoranjan; Mishra, Subhajit; Hajra, Alakananda; Journal of Organic Chemistry; vol. 80; nb. 10; (2015); p. 5364 - 5368, View in Reaxys

Tanabe, Genzoh; Sugano, Youta; Shirato, Miki; Sonoda, Naoki; Tsutsui, Nozomi; Morikawa, Toshio; Ninomiya, Kiyofumi; Yoshikawa, Masayuki; Muraoka, Osamu; Journal of Natural Products; vol. 78; nb. 7; (2015); p. 1536 - 1542, View in Reaxys

Flores-Ferrndiz, Jess; Stiven, Alexander; Sotorros, Lia; Gmez-Bengoa, Enrique; Chinchilla, Rafael; Tetrahedron Asymmetry; vol. 26; nb. 17; (2015); p. 970 - 979; Art.No: 59347, View in Reaxys

Chandrasekhara Rao; Satish Kumar; Meshram; RSC Advances; vol. 5; nb. 87; (2015); p. 70949 - 70957, View in Reaxys

Compound 2

Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys

MNS

Wei, Chien-Kei; Chang, Fang-Rong; Hsieh, Pei-Wen; Wu, Chin-Chung; Life Sciences; vol. 143; (2015); p. 147 - 155, View in Reaxys

Keene, Craig; Kuerti, Laszlo; Synthesis (Germany); vol. 45; nb. 13; (2013); p. 1719 - 1729; Art.No: SS-2013-C0260-FA, View in Reaxys; Kasaplar, Pinar; Rodriguez-Escrich, Carles; Pericas, Miquel A.; Organic Letters; vol. 15; nb. 14; (2013); p. 3498 - 3501, View in Reaxys; Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys

Rapi, Zsolt; Demuth, Balazs; Keglevich, Gyoergy; Grun, Alajos; Drahos, Laszlo; Soti, Peter L.; Bako, Peter; Tetrahedron Asymmetry; vol. 25; nb. 2; (2014); p. 141 - 147, View in Reaxys

13g

Nakashima, Kosuke; Hirashima, Shin-Ichi; Kawada, Masahiro; Koseki, Yuji; Tada, Norihiro; Itoh, Akichika; Miura, Tsuyoshi; Tetrahedron Letters; vol. 55; nb. 16; (2014); p. 2703 - 2706, View in Reaxys

Vinayagam, Poopathy; Vishwanath, Manjunatha; Kesavan, Venkitasamy; Tetrahedron Asymmetry; vol. 25; nb. 6-7; (2014); p. 568 - 577, View in Reaxys

Hahn, Robert; Raabe, Gerhard; Enders, Dieter; Organic Letters; vol. 16; nb. 14; (2014); p. 3636 - 3639, View in Reaxys

42/249

2016-07-13 00:31:19

Radivojevic, Jelena; Maslak, Veselin; Minovska, Gordana; Senerovic, Lidija; Nikodinovic-Runic, Jasmina; O'Connor, Kevin; Jovanovic, Predrag; Savic, Vladimir; Tokic-Vujosevic, Zorana; ; vol. 4; nb. 105; (2014); p. 60502 - 60510, View in Reaxys

Wang, Yao; Luo, Yong-Chun; Zhang, Hong-Bo; Xu, Peng-Fei; Organic and Biomolecular Chemistry; vol. 10; nb. 41; (2012); p. 8211 - 8215, View in Reaxys; Meshram; Satish Kumar, Nandigama; Nanubolu, Jagadeesh Babu; Chandrasekhara Rao; Nageswara Rao; Tetrahedron Letters; vol. 54; nb. 45; (2013); p. 5941 - 5944, View in Reaxys; Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys

Nageswara Rao; Meshram; Tetrahedron Letters; vol. 54; nb. 10; (2013); p. 1315 - 1317, View in Reaxys

Sun, Haifeng; Zhu, Liyuan; Yang, Huicui; Qian, Wangke; Guo, Lin; Zhou, Shengbin; Gao, Bo; Li, Zeng; Zhou, Yu; Jiang, Hualiang; Chen, Kaixian; Zhen, Xuechu; Liu, Hong; Bioorganic and Medicinal Chemistry; vol. 21; nb. 4; (2013); p. 856 - 868, View in Reaxys

Liang, Lei; Liu, Qiang; Zhang, Jianli; Wang, Fengyuan; Yuan, Yu; Research on Chemical Intermediates; vol. 39; nb. 5; (2013); p. 1957 - 1962, View in Reaxys

Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys

Mo, Lei; Tang, Huang; Yao, Zhu-Jun; Tetrahedron; vol. 69; nb. 33; (2013); p. 6897 - 6905, View in Reaxys

Cui, Bao-Dong; Han, Wen-Yong; Wu, Zhi-Jun; Zhang, Xiao-Mei; Yuan, Wei-Cheng; Journal of Organic Chemistry; vol. 78; nb. 17; (2013); p. 8833 - 8839, View in Reaxys

Huang, Wei-Gen; Wang, Heng-Shan; Huang, Guo-Bao; Wu, Yong-Ming; Pan, Ying-Ming; European Journal of Organic Chemistry; nb. 29; (2012); p. 5839 - 5843, View in Reaxys

Jin, Cheng-Yong; Wang, Yao; Liu, Yao-Zong; Shen, Chao; Xu, Peng-Fei; Journal of Organic Chemistry; vol. 77; nb. 24; (2012); p. 11307 - 11312, View in Reaxys

Koseki, Yuji; Katsura, Shinya; Kusano, Shuichi; Sakata, Harumi; Sato, Hiroto; Monzene, Yoshinori; Nagasaka, Tatsuo; Heterocycles; vol. 59; nb. 2; (2003); p. 527 - 540, View in Reaxys; Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys

Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys

Patent-Specific Data (2) References Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys Melting Point (13) 1 of 13

Melting Point [°C]

162 - 163

Location

Paragraph 0134

Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys 2 of 13

Melting Point [°C]

158 - 159

Location

Page/Page column 17

Comment (Melting Point)

with decomposition

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 3 of 13

Melting Point [°C]

162 - 163

Location

Page/Page column 17

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys

43/249

2016-07-13 00:31:19

4 of 13

Melting Point [°C]

165 - 166

Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys 5 of 13

Melting Point [°C]

153 - 154

Solvent (Melting Point)

acetic acid

Vinogradova, V. I.; Yunusov, M. S.; Kuchin, A. V.; Tolstikov, G. A.; Sagandykov, R. T.; et al.; Chemistry of Natural Compounds; vol. 26; nb. 1; (1990); p. 54 - 59; Khimiya Prirodnykh Soedinenii; nb. 1; (1990); p. 67 - 74, View in Reaxys 6 of 13

Melting Point [°C]

156 - 157

Kihara; Kobayashi; Chemical and Pharmaceutical Bulletin; vol. 26; nb. 1; (1978); p. 155 - 160, View in Reaxys 7 of 13

Melting Point [°C]

161.5 - 162

Solvent (Melting Point)

ethanol

Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys 8 of 13

Melting Point [°C]

158

Wiegrebe,W.; Archiv der Pharmazie und Berichte der Deutschen Pharmazeutischen Gesellschaft; vol. 297; (1964); p. 362 - 367, View in Reaxys; Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys 9 of 13

Melting Point [°C]

159 - 160

Biniecki; Zlakowska; Acta Poloniae Pharmaceutica; vol. 21; (1964); p. 571,574,575, View in Reaxys 10 of 13

Melting Point [°C]

162

Solvent (Melting Point)

benzene

Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys 11 of 13

Melting Point [°C]

162.5 - 163

Byrdy et al.; Bulletin de l'Academie Polonaise des Sciences, Serie des Sciences Chimiques; vol. 9; (1961); p. 627,629, View in Reaxys 12 of 13

Melting Point [°C]

159

Solvent (Melting Point)

benzene

Melting Point [°C]

159

Solvent (Melting Point)

ethanol

Bouveault; Wahl; Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences; vol. 135; (1902); p. 41; Bulletin de la Societe Chimique de France; vol. <3> 29; (1903); p. 524, View in Reaxys Crystal Property Description (1) References Ishida et al.; Chemical and Pharmaceutical Bulletin; vol. 26; (1978); p. 3603,3605, View in Reaxys Further Information (2) Description (Fur- References ther Information) Further information

Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys

Further information

Dubravkova et al.; Chemicke Zvesti; vol. 13; (1959); p. 16,20, 24; Chem. Zentralbl.; vol. 130; (1959); p. 17162, View in Reaxys

Liquid/Liquid Systems (MCS) (1) 1 of 1

Description (Liquid/ Liquid Systems (MCS))

Distribution between solvent 1 + 2

Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys Solubility (MCS) (2) 1 of 2

Location

Paragraph 0134

44/249

2016-07-13 00:31:19

Comment (Solubility (MCS))

non-soluble in water, soluble in acetone, alcohol, acetic acid and in a majority of organic solvents

Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys 2 of 2

Location

Page/Page column 17

Comment (Solubility (MCS))

non-soluble in water, soluble in acetone, alcohol, acetic acid and in a majority of organic solvents

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys 2 of 2

Description (NMR Spec- NMR troscopy) Ishida et al.; Chemical and Pharmaceutical Bulletin; vol. 26; (1978); p. 3603,3605, View in Reaxys

IR Spectroscopy (2) 1 of 2

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys 2 of 2

Description (IR Spectroscopy)

Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys; Ishida et al.; Chemical and Pharmaceutical Bulletin; vol. 26; (1978); p. 3603,3605, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1

Description (UV/VIS Spectroscopy)

Absorption maxima

Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1567 - 1580, View in Reaxys; Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys; Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys; Crowell; Francis; Journal of the American Chemical Society; vol. 83; (1961); p. 591, View in Reaxys Pharmacological Data (81) 1 of 81

Comment (Pharmacological Data)

Bioactivities present

Kihara; Kobayashi; Chemical and Pharmaceutical Bulletin; vol. 26; nb. 1; (1978); p. 155 - 160, View in Reaxys; Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys; Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys; Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1567 - 1580, View in Reaxys; Petersen,U.; Heitzer,H.; Justus Liebigs Annalen der Chemie; (1973); p. 944 - 960, View in Reaxys; Wiegrebe,W.; Archiv der Pharmazie und Berichte der Deutschen Pharmazeutischen Gesellschaft; vol. 297; (1964); p. 362 - 367, View in Reaxys; Bouveault; Wahl; Bulletin de la Societe Chimique de France; vol. <3> 29; (1903); p. 525, View in Reaxys; Medinger; Monatshefte fuer Chemie; vol. 27; (1906); p. 238, View in Reaxys; Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys; Bouveault; Wahl; Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences; vol. 135; (1902); p. 41; Bulletin de la Societe Chimique de France; vol. <3> 29; (1903); p. 524, View in Reaxys; Patent; Bayer and Co.; DE245523; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 10; p. 1192, View in Reaxys; Patent; Bayer and Co.; DE254861; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 11; p. 1006, View in Reaxys; Sonn; Schellenberg; Chemische Berichte; vol. 50; (1917); p. 1520, View in Reaxys; Rosenmund; Kuhnhenn; Chemische Berichte; vol. 56; (1923); p. 1265, View in Reaxys; Mannich; Walther; Archiv der Pharmazie (Weinheim, Germany); (1927); p. 7, View in Reaxys; Tanaka; Midzuno; Yakugaku Zasshi; vol. 49; (1929); p. 47; Chem. Zentralbl.; vol. 100; nb. I; (1929); p. 2978, View in Reaxys; Patent; Skita; DE406149; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 14; p. 344, View in Reaxys; Rosenmund; Nothnagel; Riesenfeldt;

45/249

2016-07-13 00:31:19

Chemische Berichte; vol. 60; (1927); p. 397, View in Reaxys; Schultz; Arnold; Journal of the American Chemical Society; vol. 71; (1949); p. 1911,1913, View in Reaxys; Gensler; Samour; Journal of the American Chemical Society; vol. 73; (1951); p. 5555, View in Reaxys 2 of 81

Comment (Pharmacological Data)

Bioactivities present

Erne; Ramirez; Helvetica Chimica Acta; vol. 33; (1950); p. 912,915, View in Reaxys; Reichert; Koch; Chemische Berichte; vol. 68; (1935); p. 445,450, View in Reaxys; Kondo et al.; Itsuu Kenkyusho Nempo; nb. 2; (1951); p. 11; dtsch. Ref. S. 48; Chem.Abstr.; (1953); p. 7519, View in Reaxys; Reichert; Wegner; Chemische Berichte; vol. 71; (1938); p. 1254,1258, View in Reaxys; Tomita; Kikkawa; Yakugaku Zasshi; vol. 77; (1957); p. 1011,1014; Chem.Abstr.; (1958); p. 3833, View in Reaxys; Bills; Noller; Journal of the American Chemical Society; vol. 70; (1948); p. 957,960, View in Reaxys; Schales; Chemische Berichte; vol. 68; (1935); p. 1579,1581, View in Reaxys; Slotta; Haberland; Angewandte Chemie; vol. 46; (1933); p. 766,770, 771, View in Reaxys; Dubravkova et al.; Chemicke Zvesti; vol. 13; (1959); p. 16,20, 24; Chem. Zentralbl.; vol. 130; (1959); p. 17162, View in Reaxys; Rosenmund; Chemische Berichte; vol. 43; (1910); p. 3415; Chem. Zentralbl.; vol. 83; nb. I; (1912); p. 961, View in Reaxys; Cason; Wanser; Journal of the American Chemical Society; vol. 73; (1951); p. 142, View in Reaxys; Benington et al.; Journal of Organic Chemistry; vol. 23; (1958); p. 1979,1980, View in Reaxys; Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys; Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys; Landeryou et al.; Tetrahedron; vol. 25; (1969); p. 4307,4313, View in Reaxys; Byrdy et al.; Bulletin de l'Academie Polonaise des Sciences, Serie des Sciences Chimiques; vol. 9; (1961); p. 627,629, View in Reaxys; Crowell; Francis; Journal of the American Chemical Society; vol. 83; (1961); p. 591, View in Reaxys; Crowell; Kim; Journal of the American Chemical Society; vol. 95; (1973); p. 6781,6782-6786, View in Reaxys; Biniecki; Zlakowska; Acta Poloniae Pharmaceutica; vol. 21; (1964); p. 571,574,575, View in Reaxys; Ishida et al.; Chemical and Pharmaceutical Bulletin; vol. 26; (1978); p. 3603,3605, View in Reaxys 3 of 81

Comment (Pharmacological Data)

Bioactivities present

Kohno; Sasao; Murahashi; Bulletin of the Chemical Society of Japan; vol. 63; nb. 4; (1990); p. 1252 - 1254, View in Reaxys; Hassner, Alfred; Dehaen, Wim; Journal of Organic Chemistry; vol. 55; nb. 20; (1990); p. 5505 5510, View in Reaxys; Vinogradova, V. I.; Yunusov, M. S.; Kuchin, A. V.; Tolstikov, G. A.; Sagandykov, R. T.; et al.; Chemistry of Natural Compounds; vol. 26; nb. 1; (1990); p. 54 - 59; Khimiya Prirodnykh Soedinenii; nb. 1; (1990); p. 67 - 74, View in Reaxys; Mukherjee, Anita; Sharma, V. L.; Seth, M.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 27; (1988); p. 537 - 541, View in Reaxys; Arora, P. K.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. <B> 20; nb. 11; (1981); p. 951 - 954, View in Reaxys; Pandey, G. D.; Tiwari, K. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 19; nb. 4; (1980); p. 272 275, View in Reaxys; Crowell, Thomas I.; Journal of Organic Chemistry; vol. 48; nb. 19; (1983); p. 3294 - 3297, View in Reaxys; Ranu, Brindaban C.; Chakraborty, Rupak; Tetrahedron Letters; vol. 32; nb. 29; (1991); p. 3579 3582, View in Reaxys; Sera, Akira; Tani, Hiroyuki; Nishiguchi, Ikuzo; Hirashima, Tsuneaki; Synthesis; nb. 7; (1987); p. 631 - 633, View in Reaxys; Ranu; Chakraborty; Tetrahedron; vol. 48; nb. 25; (1992); p. 5317 - 5322, View in Reaxys; Nimgirawath; Taylor; Australian Journal of Chemistry; vol. 36; nb. 5; (1983); p. 1061 - 1065, View in Reaxys; Zueger, Max; Weller, Thomas; Seebach, Dieter; Helvetica Chimica Acta; vol. 63; nb. 7; (1980); p. 2005 - 2009, View in Reaxys; Patra, Amarendra; Mitra, Alok K.; Ghosh, Arundhati; Mukhopadhyay, Prabir K.; Organic Magnetic Resonance; vol. 16; nb. 1; (1981); p. 65 - 67, View in Reaxys; Trefouel, Thierry; Tintillier, Patrik; Dupas, Georges; Bourguignon, Jean; Queguiner, Guy; Bulletin of the Chemical Society of Japan; vol. 60; nb. 12; (1987); p. 4492 - 4494, View in Reaxys; Ghabrial, Sami S.; Zaki, Mayasoune Y.; Journal of Chemical Research, Miniprint; nb. 7; (1997); p. 1560 - 1575, View in Reaxys; Cutter, Paul S; Miller, R.Bryan; Schore, Neil E; Tetrahedron; vol. 58; nb. 8; (2002); p. 1471 - 1478, View in Reaxys; Wang, Cunde; Wang, Song; Synthetic Communications; vol. 32; nb. 22; (2002); p. 3481 - 3486, View in Reaxys; Koseki, Yuji; Katsura, Shinya; Kusano, Shuichi; Sakata, Harumi; Sato, Hiroto; Monzene, Yoshinori; Nagasaka, Tatsuo; Heterocycles; vol. 59; nb. 2; (2003); p. 527 - 540, View in Reaxys; Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys; Arai, Takayoshi; Yokoyama, Naota; Yanagisawa, Akira; Chemistry - A European Journal; vol. 14; nb. 7; (2008); p. 2052 - 2059, View in Reaxys 4 of 81

Comment (Pharmacological Data)

Bioactivities present

Deng, Xiaohu; Mani, Neelakandha S.; Organic Letters; vol. 10; nb. 6; (2008); p. 1307 - 1310, View in Reaxys; Habib, Pateliya Mujjamil; Kavala, Veerababurao; Kuo, Chun-Wei; Yao, Ching-Fa; Tetrahedron Letters; vol. 49; nb. 49; (2008); p. 7005 - 7007, View in Reaxys; Ganesh, Madhu; Seidel, Daniel; Journal of the American Chemical Society; vol. 130; nb. 49; (2008); p. 16464 - 16465, View in Reaxys; Vaccari, Daniele; Davoli, Paolo; Ori, Claudia; Spaggiari, Alberto; Prati, Fabio; Synlett; nb. 18; (2008); p. 2807 - 2810, View in Reaxys; Namboothiri, Irishi N. N.; Sahu, Bichismita; Gururaja, Guddeangadi N.; Mobin, Shaikh M.; Journal of Organic Chemistry; vol. 74; nb. 6; (2009); p. 2601 - 2604, View in Reaxys; Yang, Zhigang; Liu, Jie; Liu, Xiaohua; Wang, Zhen; Feng, Xiaoming; Su, Zhishan; Hua, Changwei; Advanced Synthesis and Catalysis; vol. 350; nb. 13; (2008); p. 2001 - 2006, View in Reaxys; Xue, Fei; Zhang, Shilei; Duan, Wenhu; Wang, Wei; Advanced Synthesis and Catalysis; vol. 350; nb. 14-15; (2008); p. 2194 - 2198, View in Reaxys; Chuan, Yongming; Chen, Guihua; Peng, Yungui; Tetrahedron Letters; vol. 50; nb. 25; (2009); p. 3054 - 3058, View in Reaxys; Liu, Jie; Yang, Zhigang; Liu, Xiaohua; Wang,

46/249

2016-07-13 00:31:19

Zhen; Liu, Yanling; Bai, Sha; Lin, Lili; Feng, Xiaoming; Organic and Biomolecular Chemistry; vol. 7; nb. 19; (2009); p. 4120 - 4127, View in Reaxys; Habib, Pateliya Mujjamil; Rama Raju; Kavala, Veerababurao; Kuo, Chun-Wei; Yao, Ching-Fa; Tetrahedron; vol. 65; nb. 29-30; (2009); p. 5799 - 5804, View in Reaxys; Deb, Indubhusan; Shanbhag, Pramod; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; European Journal of Organic Chemistry; nb. 24; (2009); p. 4091 - 4101, View in Reaxys; Yu, Zhipeng; Liu, Xiaohua; Zhou, Lin; Lin, Lili; Feng, Xiaoming; Angewandte Chemie - International Edition; vol. 48; nb. 28; (2009); p. 5195 - 5198, View in Reaxys; Hong, BorCherng; Jan, Rei-Hau; Tsai, Chih-Wei; Nimje, Roshan Y.; Liao, Ju-Hsiou; Lee, Gene-Hsiang; Organic Letters; vol. 11; nb. 22; (2009); p. 5246 - 5249, View in Reaxys; Zeng, Xiaofei; Zhong, Guofu; Synthesis; nb. 9; (2009); p. 1545 - 1550; Art.No: C00509SS, View in Reaxys; Zhang, Fang-Lin; Xu, Ai-Wen; Gong, Yue-Fa; Wei, Mo-Hui; Yang, Xiang-Liang; Chemistry - A European Journal; vol. 15; nb. 28; (2009); p. 6815 - 6818, View in Reaxys; Allu, Suresh; Selvakumar, Sermadurai; Singh, Vinod K.; Tetrahedron Letters; vol. 51; nb. 2; (2010); p. 446 - 448, View in Reaxys; Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys; Pansare, Sunil V.; Lingampally, Rajinikanth; Kirby, Raie Lene; Organic Letters; vol. 12; nb. 3; (2010); p. 556 - 559, View in Reaxys; Li, Xin; Zhang, Bo; Xi, Zhi-Guo; Luo, Sanzhong; Chenga, Jin-Pei; Advanced Synthesis and Catalysis; vol. 352; nb. 2-3; (2010); p. 416 - 424, View in Reaxys; Lu, Aidang; Wu, Ronghua; Wang, Youming; Zhou, Zhenghong; Wu, Guiping; Fang, Jianxin; Tang, Chuchi; European Journal of Organic Chemistry; nb. 11; (2010); p. 2057 - 2061, View in Reaxys 5 of 81

Comment (Pharmacological Data)

Bioactivities present

Wang, Yan-Xiang; Wang, Yu-Ping; Zhang, Hao; Kong, Wei-Jia; Li, Ying-Hong; Liu, Fei; Gao, Rong-Mei; Liu, Ting; Jiang, Jian-Dong; Song, Dan-Qing; Bioorganic and Medicinal Chemistry Letters; vol. 19; nb. 21; (2009); p. 6004 - 6008, View in Reaxys; Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys; Lu, Dengfu; Gong, Yuefa; Wang, Weizhou; Advanced Synthesis and Catalysis; vol. 352; nb. 4; (2010); p. 644 - 650, View in Reaxys; Liu, Jie; Li, Pinhua; Zhang, Yicheng; Ren, Kai; Wang, Lei; Wang, Guanwu; Chirality; vol. 22; nb. 4; (2010); p. 432 - 441, View in Reaxys; Enders, Dieter; Wang, Chuan; Mukanova, Meruyert; Greb, Andreas; Chemical Communications; vol. 46; nb. 14; (2010); p. 2447 - 2449, View in Reaxys; Habib, Pateliya Mujjamil; Kavala, Veerababurao; Kuo, Chun-Wei; Raihan, Mustafa J.; Yao, Ching-Fa; Tetrahedron; vol. 66; nb. 34; (2010); p. 7050 - 7056, View in Reaxys; Shumaila, Abdullah M. A.; Kusurkar, Radhika S.; Synthetic Communications; vol. 40; nb. 19; (2010); p. 2935 - 2940, View in Reaxys; Lu, Aidang; Liu, Tao; Wu, Ronghua; Wang, Youming; Zhou, Zhenghong; Wu, Guiping; Fang, Jianxin; Tang, Chuchi; European Journal of Organic Chemistry; nb. 30; (2010); p. 5777 - 5781, View in Reaxys; Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys; Zhang, Fanglin; Wei, Mohui; Dong, Junfang; Zhou, Yirong; Lu, Dengfu; Gong, Yuefa; Yang, Xiangliang; Advanced Synthesis and Catalysis; vol. 352; nb. 17; (2010); p. 2875 - 2880, View in Reaxys; Arai, Takayoshi; Yokoyama, Naota; Mishiro, Asami; Sato, Hiroyasu; Angewandte Chemie - International Edition; vol. 49; nb. 43; (2010); p. 7895 - 7898, View in Reaxys; Ayyagari, Narasimham; Jose, Deena; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 52; nb. 2; (2011); p. 258 - 262, View in Reaxys; Toth, Judit; Varadi, Linda; Dancso, Andras; Blasko, Gabor; Toke, Laszlo; Nyerges, Miklos; Synthesis; nb. 24; (2009); p. 4149 - 4158; Art.No: P10409SS, View in Reaxys; Lu, Aidang; Gao, Peng; Wu, Yang; Wang, Youming; Zhou, Zhenghong; Tang, Chuchi; Organic and Biomolecular Chemistry; vol. 7; nb. 15; (2009); p. 3141 - 3147, View in Reaxys; Shumaila, Abdullah M.A.; Puranik, Vedavati G.; Kusurkar, Radhika S.; Tetrahedron; vol. 67; nb. 5; (2011); p. 936 - 942, View in Reaxys; Lu, Aidang; Wu, Ronghua; Wang, Youming; Zhou, Zhenghong; Wu, Guiping; Fang, Jianxin; Tang, Chuchi; European Journal of Organic Chemistry; nb. 1; (2011); p. 122 - 127, View in Reaxys; Anwar, Shaik; Lee, Pei-Hsun; Chou, Tsai-Yung; Chang, Chihliang; Chen, Kwunmin; Tetrahedron; vol. 67; nb. 6; (2011); p. 1171 - 1177, View in Reaxys; Ji, Xiang; Tong, Haibo; Yuan, Yu; Synthetic Communications; vol. 41; nb. 3; (2011); p. 372 - 379, View in Reaxys; McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys; He, Peng; Liu, Xiaohua; Shi, Jian; Lin, Lili; Feng, Xiaoming; Organic Letters; vol. 13; nb. 5; (2011); p. 936 - 939, View in Reaxys 6 of 81

Comment (Pharmacological Data)

Bioactivities present

Lu, Aidang; Liu, Tao; Wu, Ronghua; Wang, Youming; Wu, Guiping; Zhou, Zhenghong; Fang, Jianxin; Tang, Chuchi; Journal of Organic Chemistry; vol. 76; nb. 10; (2011); p. 3872 - 3879, View in Reaxys; Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 2146, View in Reaxys; Kumar, Rahul; Namboothiri, Irishi N. N.; Organic Letters; vol. 13; nb. 15; (2011); p. 4016 4019, View in Reaxys; Hong, Deng; Zhu, Yuanxun; Li, Yao; Lin, Xufeng; Lu, Ping; Wang, Yanguang; Organic Letters; vol. 13; nb. 17; (2011); p. 4668 - 4671, View in Reaxys; Alagiri, Kaliyamoorthy; Kumara, Guralamatta Siddappa Ravi; Prabhu, Kandikere Ramaiah; Chemical Communications; vol. 47; nb. 42; (2011); p. 11787 11789, View in Reaxys; Chintala, Poornima; Ghosh, Subrata K.; Long, Elizabeth; Headley, Allan D.; Ni, Bukuo; Advanced Synthesis and Catalysis; vol. 353; nb. 16; (2011); p. 2905 - 2909, View in Reaxys; Alagiri, Kaliyamoorthy; Prabhu, Kandikere Ramaiah; Organic and Biomolecular Chemistry; vol. 10; nb. 4; (2012); p. 835 - 842, View in Reaxys; Alagiri, Kaliyamoorthy; Devadig, Pradeep; Prabhu, Kandikere R.; Tetrahedron Letters; vol. 53; nb. 12; (2012); p. 1456 - 1459, View in Reaxys; Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys; Singh, Kamal Nain; Singh, Paramjit; Singh, Pushpinder; Lal, Nand; Sharma, Sandeep Kumar; Bioorganic and Medicinal Chemistry Letters; vol. 22; nb. 13; (2012); p. 4225 - 4228, View in Reaxys; Ayyagari, Nar-

47/249

2016-07-13 00:31:19

asimham; Namboothiri, Irishi N.N.; Tetrahedron Asymmetry; vol. 23; nb. 8; (2012); p. 605 - 610, View in Reaxys; Qian, Wangke; Lu, Weijian; Sun, Haifeng; Li, Zeng; Zhu, Liyuan; Zhao, Rui; Zhang, Lei; Zhou, Shengbin; Zhou, Yu; Jiang, Hualiang; Zhen, Xuechu; Liu, Hong; Bioorganic and Medicinal Chemistry; vol. 20; nb. 15; (2012); p. 4862 - 4871, View in Reaxys; Huang, Wei-Gen; Wang, Heng-Shan; Huang, Guo-Bao; Wu, Yong-Ming; Pan, Ying-Ming; European Journal of Organic Chemistry; nb. 29; (2012); p. 5839 - 5843, View in Reaxys; Wang, Yao; Luo, Yong-Chun; Zhang, Hong-Bo; Xu, Peng-Fei; Organic and Biomolecular Chemistry; vol. 10; nb. 41; (2012); p. 8211 - 8215, View in Reaxys; Qiao, Yupu; He, Junpeng; Ni, Bukuo; Headley, Allan D.; Advanced Synthesis and Catalysis; vol. 354; nb. 14-15; (2012); p. 2849 - 2853,5, View in Reaxys; Qiao, Yupu; He, Junpeng; Ni, Bukuo; Headley, Allan D.; Advanced Synthesis and Catalysis; vol. 354; nb. 14-15; (2012); p. 2849 - 2853, View in Reaxys; Jin, Cheng-Yong; Wang, Yao; Liu, Yao-Zong; Shen, Chao; Xu, Peng-Fei; Journal of Organic Chemistry; vol. 77; nb. 24; (2012); p. 11307 - 11312, View in Reaxys; Nageswara Rao; Meshram; Tetrahedron Letters; vol. 54; nb. 10; (2013); p. 1315 - 1317, View in Reaxys; Sun, Haifeng; Zhu, Liyuan; Yang, Huicui; Qian, Wangke; Guo, Lin; Zhou, Shengbin; Gao, Bo; Li, Zeng; Zhou, Yu; Jiang, Hualiang; Chen, Kaixian; Zhen, Xuechu; Liu, Hong; Bioorganic and Medicinal Chemistry; vol. 21; nb. 4; (2013); p. 856 - 868, View in Reaxys; Zeng, Xiaofei; Ni, Qijian; Raabe, Gerhard; Enders, Dieter; Angewandte Chemie - International Edition; vol. 52; nb. 10; (2013); p. 2977 - 2980; Angew. Chem.; vol. 125; nb. 10; (2013); p. 3050 - 3054,5, View in Reaxys 7 of 81

Comment (Pharmacological Data)

Bioactivities present

Liang, Lei; Liu, Qiang; Zhang, Jianli; Wang, Fengyuan; Yuan, Yu; Research on Chemical Intermediates; vol. 39; nb. 5; (2013); p. 1957 - 1962, View in Reaxys; Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys; Mo, Lei; Tang, Huang; Yao, Zhu-Jun; Tetrahedron; vol. 69; nb. 33; (2013); p. 6897 - 6905, View in Reaxys; Keene, Craig; Kuerti, Laszlo; Synthesis (Germany); vol. 45; nb. 13; (2013); p. 1719 - 1729; Art.No: SS-2013-C0260-FA, View in Reaxys; Kasaplar, Pinar; Rodriguez-Escrich, Carles; Pericas, Miquel A.; Organic Letters; vol. 15; nb. 14; (2013); p. 3498 3501, View in Reaxys; Fan, Xinyuan; Rodriguez-Escrich, Carles; Sayalero, Sonia; Pericas, Miquel A.; Chemistry - A European Journal; vol. 19; nb. 33; (2013); p. 10814 - 10817, View in Reaxys; Cui, Bao-Dong; Han, WenYong; Wu, Zhi-Jun; Zhang, Xiao-Mei; Yuan, Wei-Cheng; Journal of Organic Chemistry; vol. 78; nb. 17; (2013); p. 8833 - 8839, View in Reaxys; Meshram; Satish Kumar, Nandigama; Nanubolu, Jagadeesh Babu; Chandrasekhara Rao; Nageswara Rao; Tetrahedron Letters; vol. 54; nb. 45; (2013); p. 5941 - 5944, View in Reaxys; Ceban, Victor; Hands, Kane; Meazza, Marta; Light, Mark E.; Rios, Ramon; Tetrahedron Letters; vol. 54; nb. 52; (2013); p. 7183 - 7187, View in Reaxys; Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys; Rapi, Zsolt; Demuth, Balazs; Keglevich, Gyoergy; Grun, Alajos; Drahos, Laszlo; Soti, Peter L.; Bako, Peter; Tetrahedron Asymmetry; vol. 25; nb. 2; (2014); p. 141 - 147, View in Reaxys; Vinayagam, Poopathy; Vishwanath, Manjunatha; Kesavan, Venkitasamy; Tetrahedron Asymmetry; vol. 25; nb. 6-7; (2014); p. 568 - 577, View in Reaxys; Amutha, Chinnadurai; Saravanan, Sivaperuman; Muthusubramanian, Shanmugam; Indian Journal of Chemistry - Section B Organic and Medicinal Chemistry; vol. 53; nb. 4; (2014); p. 377 - 383, View in Reaxys; Nakashima, Kosuke; Hirashima, Shin-Ichi; Kawada, Masahiro; Koseki, Yuji; Tada, Norihiro; Itoh, Akichika; Miura, Tsuyoshi; Tetrahedron Letters; vol. 55; nb. 16; (2014); p. 2703 - 2706, View in Reaxys; Wang, Ying-Chun; Xie, Yu-Yang; Qu, Hong-En; Wang, Heng-Shan; Pan, YingMing; Huang, Fu-Ping; Journal of Organic Chemistry; vol. 79; nb. 10; (2014); p. 4463 - 4469, View in Reaxys; Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys; Kim, Shinae; Kang, Ki-Tae; Kim, Sung-Gon; Tetrahedron; vol. 70; nb. 34; (2014); p. 5114 - 5121, View in Reaxys; Hahn, Robert; Raabe, Gerhard; Enders, Dieter; Organic Letters; vol. 16; nb. 14; (2014); p. 3636 - 3639, View in Reaxys; Kim, Shinae; Kang, Ki-Tae; Kim, Sung-Gon; Tetrahedron; vol. 70; nb. 34; (2014); p. 5114 - 5121, View in Reaxys; Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys 8 of 81

Comment (Pharmacological Data)

Bioactivities present

Rahmani-Nezhad, Samira; Safavi, Maliheh; Pordeli, Mahboobeh; Ardestani, Sussan Kabudanian; Khosravani, Leila; Pourshojaei, Yaghoub; Mahdavi, Mohammad; Emami, Saeed; Foroumadi, Alireza; Shafiee, Abbas; European Journal of Medicinal Chemistry; vol. 86; (2014); p. 562 - 569, View in Reaxys; Chen, I-Hua; Chang, Fang-Rong; Wu, Yang-Chang; Kung, Po-Hsiung; Wu, Chin-Chung; Biochimie; vol. 110; (2015); p. 81 - 92, View in Reaxys; Kiyokawa, Kensuke; Nagata, Takaya; Hayakawa, Junpei; Minakata, Satoshi; Chemistry - A European Journal; vol. 21; nb. 3; (2015); p. 1280 - 1285, View in Reaxys; Rao, Kadiyala Srinivasa; Trivedi, Rajiv; Kantam, M. Lakshmi; Synlett; vol. 26; nb. 2; (2015); p. 221 - 227; Art.No: ST-2014-D0721-L, View in Reaxys; Ghosh, Monoranjan; Mishra, Subhajit; Hajra, Alakananda; Journal of Organic Chemistry; vol. 80; nb. 10; (2015); p. 5364 - 5368, View in Reaxys; Tanabe, Genzoh; Sugano, Youta; Shirato, Miki; Sonoda, Naoki; Tsutsui, Nozomi; Morikawa, Toshio; Ninomiya, Kiyofumi; Yoshikawa, Masayuki; Muraoka, Osamu; Journal of Natural Products; vol. 78; nb. 7; (2015); p. 1536 - 1542, View in Reaxys; Flores-Ferrndiz, Jess; Stiven, Alexander; Sotorros, Lia; Gmez-Bengoa, Enrique; Chinchilla, Rafael; Tetrahedron Asymmetry; vol. 26; nb. 17; (2015); p. 970 - 979; Art.No: 59347, View in Reaxys; Chandrasekhara Rao; Satish Kumar; Meshram; RSC Advances; vol. 5; nb. 87; (2015); p. 70949 - 70957, View in Reaxys; Xue, Fengjun; Dong, Yahao; Hu, Peibo; Deng, Yanan; Wei, Yuping; RSC Advances; vol. 5; nb. 90; (2015); p. 73684 - 73691, View in Reaxys; Patent; Novo Nordisk A/S; Cellectis SA; Ekberg, Jenny; Hansson, Mattias; Doehn, Ulrik; Hess, Katja; Funa, Nina; US2015/247123; (2015); (A1) English, View in Reaxys; Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys; Radivojevic, Jelena; Maslak, Veselin; Minovska, Gordana; Senerovic, Lidija; Nikodinovic-Runic, Jasmina; O'Connor, Kevin; Jova-

48/249

2016-07-13 00:31:19

novic, Predrag; Savic, Vladimir; Tokic-Vujosevic, Zorana; ; vol. 4; nb. 105; (2014); p. 60502 - 60510, View in Reaxys; Wei, Chien-Kei; Chang, Fang-Rong; Hsieh, Pei-Wen; Wu, Chin-Chung; Life Sciences; vol. 143; (2015); p. 147 - 155, View in Reaxys; Patent; Janssen Biotech, Inc.; Rezania, Alireza; Fryer, Benjamin; (49 pag.); US9234178; (2016); (B2) English, View in Reaxys; Chen, Yanling; Sakamuru, Srilatha; Huang, Ruili; Reese, David H.; Xia, Menghang; Toxicology in Vitro; vol. 32; (2016); p. 287 - 296, View in Reaxys; Boyce, Gregory R.; Johnson, Jeffrey S.; Journal of Organic Chemistry; vol. 81; nb. 4; (2016); p. 1712 - 1717, View in Reaxys; Rao, Kadiyala Srinivasa; Ramesh, Pambala; Trivedi, Rajiv; Kantam, M. Lakshmi; Tetrahedron Letters; vol. 57; nb. 11; (2016); p. 1227 - 1231, View in Reaxys; An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 147, View in Reaxys; Zimmermann, Stephan; Hall, Laurence; Riley, Sean; Sorensen, Jesper; Amaro, Rommie E.; Schnaufer, Achim; Nucleic Acids Research; vol. 44; nb. 3; (2015); Art.No: E24, View in Reaxys; Yang, Chen; Zhang, En-Ge; Li, Xin; Cheng, Jin-Pei; Angewandte Chemie - International Edition; vol. 55; nb. 22; (2016); p. 6506 - 6510; Angew. Chem.; vol. 128; (2016); p. 6616 - 6620,5, View in Reaxys 9 of 81

Comment (Pharmacological Data)

physiological behaviour discussed

Chen, Yanling; Sakamuru, Srilatha; Huang, Ruili; Reese, David H.; Xia, Menghang; Toxicology in Vitro; vol. 32; (2016); p. 287 - 296, View in Reaxys 10 of 81

Comment (Pharmacological Data)

physiological behaviour discussed

Chen, I-Hua; Chang, Fang-Rong; Wu, Yang-Chang; Kung, Po-Hsiung; Wu, Chin-Chung; Biochimie; vol. 110; (2015); p. 81 - 92, View in Reaxys 11 of 81

Comment (Pharmacological Data)

physiological behaviour discussed

Patent; Novo Nordisk A/S; Cellectis SA; Ekberg, Jenny; Hansson, Mattias; Doehn, Ulrik; Hess, Katja; Funa, Nina; US2015/247123; (2015); (A1) English, View in Reaxys 12 of 81

Comment (Pharmacological Data)

physiological behaviour discussed

Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys 13 of 81

Comment (Pharmacological Data)

physiological behaviour discussed

Wei, Chien-Kei; Chang, Fang-Rong; Hsieh, Pei-Wen; Wu, Chin-Chung; Life Sciences; vol. 143; (2015); p. 147 155, View in Reaxys 14 of 81

Comment (Pharmacological Data)

physiological behaviour discussed

Zimmermann, Stephan; Hall, Laurence; Riley, Sean; Sorensen, Jesper; Amaro, Rommie E.; Schnaufer, Achim; Nucleic Acids Research; vol. 44; nb. 3; (2015); Art.No: E24, View in Reaxys 15 of 81

Effect (Pharmacological Data)

thrombin-induced platelet aggregation; inhibition of

Species or Test-System (Pharmacological Data)

blood of human

Further Details (Pharmacological Data)

inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 16 of 81

Effect (Pharmacological Data)

collagen-induced platelet aggregation; inhibition of

Species or Test-System (Pharmacological Data)

blood of human

Further Details (Pharmacological Data)

inhibitory concentration (IC)

49/249

2016-07-13 00:31:19

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

7.2 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 17 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 26.5percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 18 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 4.9percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 19 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 10percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 20 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

50/249

2016-07-13 00:31:19

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 2.4percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 21 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 1.8percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 22 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 8.8percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 23 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 38.2percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys

51/249

2016-07-13 00:31:19

24 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 33.2percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 25 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 25.1percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 26 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 28.9percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 27 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

52/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 28 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 12.5percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 29 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 34.9percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 30 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 18.2percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 31 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

53/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

inhibition = 19.1percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 32 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 23.2percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 33 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 2.5percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 34 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 22.7percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 35 of 81

Effect (Pharmacological Data)

cytotoxic

54/249

2016-07-13 00:31:19

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 8percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 36 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 7.9percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 37 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = -7.3percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 38 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = -4.9percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

55/249

2016-07-13 00:31:19

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 39 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 6.3percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 40 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 9.1percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 41 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 7.3percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 42 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 19percent at 20 μmol/l concentration; inhibitory concentration (IC)

56/249

2016-07-13 00:31:19

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 43 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 24.7percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 44 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 0.5percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 45 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 22.1percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 46 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

57/249

2016-07-13 00:31:19

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 16percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 47 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 18.5percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 48 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 4.1percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 49 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 25.5percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys

58/249

2016-07-13 00:31:19

50 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = -2.1percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 51 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 34.2percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 52 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 34.9percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 53 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 35.2percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

59/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 54 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 79.8percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 55 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 47.4percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 56 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 16.6percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 57 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

60/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

inhibition = 1.1percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 58 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 3.7percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 59 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 15.6percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 60 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 20percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 61 of 81

Effect (Pharmacological Data)

cytotoxic

61/249

2016-07-13 00:31:19

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 15.2percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 62 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 9.4percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 63 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 9.9percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 64 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = -0.1percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

62/249

2016-07-13 00:31:19

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 65 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 11.5percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 66 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 44.9percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 67 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 68 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 36.3percent at 20 μmol/l concentration; inhibitory concentration (IC)

63/249

2016-07-13 00:31:19

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 69 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 20.4percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 70 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 8.3percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 71 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

non-malignant breast epithelial HBL-100 cells of human

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 8.2percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

> 20 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 72 of 81

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

breast cancer MDA-MB-231 cells of human

64/249

2016-07-13 00:31:19

Kind of Dosing (Pharmacological Data)

as solution in DMSO

Further Details (Pharmacological Data)

inhibition = 7percent at 20 μmol/l concentration; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

14 μmol/l

Hsieh, Pei-Wen; Chang, Yu-Ting; Chuang, Wen Yin; Shih, Hsin-Chu; Chiang, Shin-Zan; Wu, Chin-Chung; Bioorganic and Medicinal Chemistry; vol. 18; nb. 21; (2010); p. 7621 - 7627, View in Reaxys 73 of 81

Effect (Pharmacological Data)

antagonist

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human DAT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells loaded with <3H>MPP(1+) (6 μmol/l, 0.2 Ci/mmol) for 20 min and exposed to buffer containing title comp.; 4 min later cells superfused with buffer containing MDMA (3 μmol/l); 4-min fractions collected, and MPP(1+) efflux determined

Further Details (Pharmacological Data)

DAT: dopamine transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4-methylenedioxy-methamphetamine

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

antagonist

Species or Test-System (Pharmacological Data)

HEK293 cells expressing human SERT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells loaded with <3H>MPP(1+) (10 μmol/l, 0.4 Ci/mmol) for 30 min and exposed to buffer containing title comp.; 4 min later cells superfused with buffer containing MDMA (3 μmol/l); 4-min fractions collected, and MPP(1+) efflux determined

Further Details (Pharmacological Data)

SERT: serotonin transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4-methylenedioxy-methamphetamine

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

antagonist

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human NET

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells loaded with <3H>MPP(1+) (0.1 μmol/l, 29 Ci/mmol) for 20 min and exposed to buffer containing title comp.; 4 min later cells superfused with buffer containing MDMA (3 μmol/l); 4-min fractions collected, and MPP(1+) efflux determined

Further Details (Pharmacological Data)

NET: norepinephrine transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4methylenedioxy-methamphetamine

Comment (Pharmacological Data)

No effect

65/249

2016-07-13 00:31:19

Effect (Pharmacological Data)

transport; effect on

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human DAT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells loaded with <3H>MPP(1+) (6 μmol/l, 0.2 Ci/mmol) for 20 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined

Further Details (Pharmacological Data)

DAT: dopamine transporter; MPP(1+): 1-methyl-4-phenylpyridinium

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

transport; effect on

Species or Test-System (Pharmacological Data)

HEK293 cells expressing human SERT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells loaded with <3H>MPP(1+) (10 μmol/l, 0.4 Ci/mmol) for 30 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined

Further Details (Pharmacological Data)

SERT: serotonin transporter; MPP(1+): 1-methyl-4-phenylpyridinium

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

transport; effect on

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human NET

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells loaded with <3H>MPP(1+) (0.1 μmol/l, 29 Ci/mmol) for 20 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined

Further Details (Pharmacological Data)

NET: norepinephrine transporter; MPP(1+): 1-methyl-4-phenylpyridinium

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

transport; inhibition of

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human DAT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells preincubated with title comp. for 2 min, and uptake started by addition of <3H>dopamine (1 μmol/l, 0.14 Ci/mmol); after incubation for 2.5 min at 25 deg C radioactivity remaining in each well determined

66/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

nonspecific uptake determined in presence of mazindol (10 μmol/l); DAT: dopamine transporter

Results

title comp. slightly inhibited dopamine uptake

Effect (Pharmacological Data)

transport; inhibition of

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human NET

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells preincubated with title comp. for 2 min, and uptake started by addition of <3H>norepinephrine (1 μmol/l, 0.14 Ci/mmol); after incubation for 2.5 min at 25 deg C radioactivity remaining in each well determined

Further Details (Pharmacological Data)

nonspecific uptake determined in presence of mazindol (10 μmol/l); NET: norepinephrine transporter

Results

title comp. slightly inhibited norepinephrine uptake

Effect (Pharmacological Data)

transport; inhibition of

Species or Test-System (Pharmacological Data)

HEK-293 cells expressing human SERT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells preincubated with title comp. for 2 min, and uptake started by addition of <3H>serotonin (1 μmol/l, 0.14 Ci/mmol); after incubation for 2.5 min at 25 deg C radioactivity remaining in each well determined

Further Details (Pharmacological Data)

nonspecific uptake determined in presence of clomipramine (3 μmol/l); SERT: serotonin transporter

Results

title comp. slightly inhibited serotonin uptake (table)

Reaxys ID 18660 View in Reaxys

3/183 CAS Registry Number: 5438-41-5 Chemical Name: 5-(2-nitroprop-1-enyl)benzo[d][1,3]dioxole; βnitroisosafrole; 3,4-methylenedioxy-β-methyl-β-nitrostyrene; 1(3,4-methylenedioxyphenyl)-2-nitropropene; 5-(2-nitropropenyl)benzo[1,3]dioxole; 5-(2-nitro-propenyl)-benzo[1,3]dioxole; 5(2-Nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 Type of Substance: heterocyclic InChI Key: CCEVJKZHAJJQJR-UHFFFAOYSA-N Note:

O O

Substance Label (10) Label References 3f

Ghosh, Monoranjan; Santra, Sougata; Mondal, Pallab; Kundu, Dhiman; Hajra, Alakananda; Chemistry An Asian Journal; vol. 10; nb. 11; (2015); p. 2525 - 2536, View in Reaxys

Compound 1

Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys

67/249

2016-07-13 00:31:19

Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys; Mitra, Shubhanjan; Bagdi, Avik Kumar; Majee, Adinath; Hajra, Alakananda; Tetrahedron Letters; vol. 54; nb. 36; (2013); p. 4982 - 4985, View in Reaxys

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys

Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys

Example 1

Patent; Alcon, Inc.; US7884228; (2011); (B1) English, View in Reaxys

entry 10

Ranu, Brindaban C.; Chakraborty, Rupak; Tetrahedron Letters; vol. 32; nb. 29; (1991); p. 3579 - 3582, View in Reaxys; Ranu; Chakraborty; Tetrahedron; vol. 48; nb. 25; (1992); p. 5317 - 5322, View in Reaxys

educt of 1b: NO2- Eijk, Peter, J. S. S van; Verboom, Willem; Veggel, Frank C. J. M. van; Reinhoudt, David N.; Harkema, alkene Sybolt; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 3; (1988); p. 142 - 151, View in Reaxys 3h

Karmarkar, Sanjay N.; Kelkar, Shriniwas L.; Wadia, Murzban S.; Synthesis; nb. 5; (1985); p. 510 - 512, View in Reaxys

Shono, Tatsuya; Hamaguchi, Hiroshi; Mikami, Hiroshi; Nogusa, Hideo; Kashimura, Shigenori; Journal of Organic Chemistry; vol. 48; nb. 12; (1983); p. 2103 - 2105, View in Reaxys

Melting Point [°C]

Location

Page/Page column 15

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 2 of 10

Melting Point [°C]

94 - 98

Location

Page/Page column 16

Comment (Melting Point)

with decomposition

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 3 of 10

Melting Point [°C]

96 - 98

Solvent (Melting Point)

ethanol

Location

Page/Page column 16

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 4 of 10

Melting Point [°C]

Solvent (Melting Point)

benzene; hexane

Karmarkar, Sanjay N.; Kelkar, Shriniwas L.; Wadia, Murzban S.; Synthesis; nb. 5; (1985); p. 510 - 512, View in Reaxys 5 of 10

Melting Point [°C]

96 - 97

Solvent (Melting Point)

ethanol

Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys 6 of 10

Melting Point [°C]

95.5 - 96.5

68/249

2016-07-13 00:31:19

Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys 7 of 10

Melting Point [°C]

Biniecki et al.; Acta Poloniae Pharmaceutica; vol. 19; (1962); p. 31; Chem.Abstr.; vol. 58; nb. 3334; (1963), View in Reaxys 8 of 10

Melting Point [°C]

103

Solvent (Melting Point)

ethanol

Sugasawa; Sakurai; Yakugaku Zasshi; vol. 56; (1936); p. 563,566; Chem.Abstr.; (1939); p. 9307, View in Reaxys 9 of 10

Melting Point [°C]

103 - 104

Solvent (Melting Point)

ethanol

Bruckner; Justus Liebigs Annalen der Chemie; vol. 518; (1935); p. 226,241, View in Reaxys 10 of 10

Melting Point [°C]

Solvent (Melting Point)

ethanol

Angeli; Gazzetta Chimica Italiana; vol. 22 II; (1892); p. 464 Anm., View in Reaxys; Patent; Schmidt; Wagner; DE347818; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 14; p. 1438, View in Reaxys; Schmidt; Fischer; Chemische Berichte; vol. 53; (1920); p. 1539, View in Reaxys Crystal Property Description (5) Colour & Other Location Properties

References

yellow

Page/Page column 16

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys

yellow

Page/Page column 6

Patent; Alcon, Inc.; US7884228; (2011); (B1) English, View in Reaxys

Gelb

Bruckner; Justus Liebigs Annalen der Chemie; vol. 518; (1935); p. 226,241, View in Reaxys; Sugasawa; Sakurai; Yakugaku Zasshi; vol. 56; (1936); p. 563,566; Chem.Abstr.; (1939); p. 9307, View in Reaxys

gelbe Nadeln

Patent; Schmidt; Wagner; DE347818; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 14; p. 1438, View in Reaxys; Schmidt; Fischer; Chemische Berichte; vol. 53; (1920); p. 1539, View in Reaxys

gelbe Nadeln oder Schuppen

Angeli; Gazzetta Chimica Italiana; vol. 22 II; (1892); p. 464 Anm., View in Reaxys

Liquid/Liquid Systems (MCS) (1) 1 of 1

Description (Liquid/ Liquid Systems (MCS))

Distribution between solvent 1 + 2

Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys Solubility (MCS) (1) 1 of 1

Location

Page/Page column 16

Comment (Solubility (MCS))

soluble in ethanol, acetone, benzene, methanol, acetonitrile, chloroform, DMSO almost insoluble in water

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys NMR Spectroscopy (1) 1 of 1

Nucleus (NMR Spectroscopy)

Location

Figure 1

Comment (NMR Spectroscopy)

Signals given

Patent; Alcon, Inc.; US7884228; (2011); (B1) English, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1

Description (UV/VIS Spectroscopy)

Absorption maxima

69/249

2016-07-13 00:31:19

Comment (Pharmacological Data)

Bioactivities present

Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys; Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys; Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1567 - 1580, View in Reaxys; Angeli; Gazzetta Chimica Italiana; vol. 22 II; (1892); p. 464 Anm., View in Reaxys; Angeli; Rimini; Gazzetta Chimica Italiana; vol. 26 I; (1896); p. 10, View in Reaxys; Wallach; Mueller,H.; Justus Liebigs Annalen der Chemie; vol. 332; (1904); p. 331, View in Reaxys; Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys; Patent; Schmidt; Wagner; DE347818; Fortschr. Teerfarbenfabr. Verw. Industriezweige; vol. 14; p. 1438, View in Reaxys; Bruckner; Justus Liebigs Annalen der Chemie; vol. 518; (1935); p. 226,241, View in Reaxys; Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys; Sugasawa; Sakurai; Yakugaku Zasshi; vol. 56; (1936); p. 563,566; Chem.Abstr.; (1939); p. 9307, View in Reaxys; Govindan; Proceedings - Indian Academy of Sciences, Section A; nb. 44; (1956); p. 126,127, View in Reaxys; Schmidt; Fischer; Chemische Berichte; vol. 53; (1920); p. 1539, View in Reaxys; Benington et al.; Journal of Organic Chemistry; vol. 23; (1958); p. 1979,1980, View in Reaxys; Skulski; Plenkiewicz; Roczniki Chemii; vol. 37; (1963); p. 45,61; Chem.Abstr.; vol. 59; (1963); p. 8634, View in Reaxys; Pearl; Beyer; Journal of Organic Chemistry; vol. 16; (1951); p. 216,217, 220, View in Reaxys; Biniecki et al.; Acta Poloniae Pharmaceutica; vol. 19; (1962); p. 31; Chem.Abstr.; vol. 58; nb. 3334; (1963), View in Reaxys; Karmarkar, Sanjay N.; Kelkar, Shriniwas L.; Wadia, Murzban S.; Synthesis; nb. 5; (1985); p. 510 - 512, View in Reaxys; Shono, Tatsuya; Hamaguchi, Hiroshi; Mikami, Hiroshi; Nogusa, Hideo; Kashimura, Shigenori; Journal of Organic Chemistry; vol. 48; nb. 12; (1983); p. 2103 - 2105, View in Reaxys; Ranu, Brindaban C.; Chakraborty, Rupak; Tetrahedron Letters; vol. 32; nb. 29; (1991); p. 3579 - 3582, View in Reaxys 2 of 16

Comment (Pharmacological Data)

Bioactivities present

Glennon, Richard A.; Raghupathi, Reva; Bartyzel, Piotr; Teitler, Milt; Leonhardt, Sigrun; Journal of Medicinal Chemistry; vol. 35; nb. 4; (1992); p. 734 - 740, View in Reaxys; Ranu; Chakraborty; Tetrahedron; vol. 48; nb. 25; (1992); p. 5317 - 5322, View in Reaxys; Eijk, Peter, J. S. S van; Verboom, Willem; Veggel, Frank C. J. M. van; Reinhoudt, David N.; Harkema, Sybolt; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 3; (1988); p. 142 - 151, View in Reaxys; Braun; Shulgin; Journal of Pharmaceutical Sciences; vol. 69; nb. 2; (1980); p. 192 195, View in Reaxys; Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys; Namboothiri, Irishi N. N.; Sahu, Bichismita; Gururaja, Guddeangadi N.; Mobin, Shaikh M.; Journal of Organic Chemistry; vol. 74; nb. 6; (2009); p. 2601 - 2604, View in Reaxys; Baumann, Marcus; Baxendale, Ian R.; Ley, Steven V.; Synlett; nb. 5; (2010); p. 749 - 752, View in Reaxys; Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys; Patent; Alcon, Inc.; US7884228; (2011); (B1) English, View in Reaxys; Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys; Mitra, Shubhanjan; Bagdi, Avik Kumar; Majee, Adinath; Hajra, Alakananda; Tetrahedron Letters; vol. 54; nb. 36; (2013); p. 4982 - 4985, View in Reaxys; Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys; Ghosh, Monoranjan; Santra, Sougata; Mondal, Pallab; Kundu, Dhiman; Hajra, Alakananda; Chemistry - An Asian Journal; vol. 10; nb. 11; (2015); p. 2525 - 2536, View in Reaxys; Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys; Ghosh, Monoranjan; Hajra, Alakananda; European Journal of Organic Chemistry; vol. 2015; nb. 35; (2015); p. 7836 - 7841, View in Reaxys 3 of 16

Comment (Pharmacological Data)

physiological behaviour discussed

Patent; BioDiem, Ltd; Denisenko, Peter Prokofievich; Sapronov, Nikolay Sergeevich; Tarasenko, Alexander Alexandrovich; US2015/258059; (2015); (A1) English, View in Reaxys 4 of 16

Comment (Pharmacological Data)

physiological behaviour discussed

Patent; BIODIEM LIMITED; PHILLIPS, Julie; SORRELL, Tania; CHEN, Sharon; WO2013/177608; (2013); (A1) English, View in Reaxys 5 of 16

Effect (Pharmacological Data)

enzyme activity; inhibition of

Species or Test-System (Pharmacological Data)

recombinant microsomal monoamine oxidase A of human

Concentration (Pharmacological Data)

<= 100 μmol/l

70/249

2016-07-13 00:31:19

Method (Pharmacological Data)

name of assay/method: Amplex Red® monoamine oxidase assay

Results

no effect

Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys 6 of 16

Effect (Pharmacological Data)

enzyme activity; inhibition of

Species or Test-System (Pharmacological Data)

recombinant microsomal monoamine oxidase B of human

Method (Pharmacological Data)

name of assay/method: Amplex Red® monoamine oxidase assay

Further Details (Pharmacological Data)

inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

8.32 μmol/l

Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys 7 of 16

Effect (Pharmacological Data)

enzyme activity; inhibition of

Species or Test-System (Pharmacological Data)

recombinant microsomal monoamine oxidase B of human

Method (Pharmacological Data)

name of assay/method: Amplex Red® monoamine oxidase assay

Results

molecular target: microsomal monoamine oxidase B; species of target: human

Reis, Joana; Oliveira, Catarina; Milhazes, Nuno; Vina, Dolores; Borges, Fernanda; Letters in Drug Design and Discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys 8 of 16

Effect (Pharmacological Data)

antagonist

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human DAT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

Further Details (Pharmacological Data)

DAT: dopamine transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4-methylenedioxy-methamphetamine

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

antagonist

Species or Test-System (Pharmacological Data)

HEK293 cells expressing human SERT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

71/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

SERT: serotonin transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4-methylenedioxy-methamphetamine

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

antagonist

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human NET

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

Further Details (Pharmacological Data)

NET: norepinephrine transporter; MPP(1+): 1-methyl-4-phenylpyridinium; MDMA: 3,4methylenedioxy-methamphetamine

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

transport; effect on

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human DAT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells loaded with <3H>MPP(1+) (6 μmol/l, 0.2 Ci/mmol) for 20 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined

Further Details (Pharmacological Data)

DAT: dopamine transporter; MPP(1+): 1-methyl-4-phenylpyridinium

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

transport; effect on

Species or Test-System (Pharmacological Data)

HEK293 cells expressing human SERT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells loaded with <3H>MPP(1+) (10 μmol/l, 0.4 Ci/mmol) for 30 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined

Further Details (Pharmacological Data)

SERT: serotonin transporter; MPP(1+): 1-methyl-4-phenylpyridinium

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

transport; effect on

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human NET

72/249

2016-07-13 00:31:19

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

cells loaded with <3H>MPP(1+) (0.1 μmol/l, 29 Ci/mmol) for 20 min and superfused with buffer containing title comp.; 4-min fractions collected, and MPP(1+) efflux determined

Further Details (Pharmacological Data)

NET: norepinephrine transporter; MPP(1+): 1-methyl-4-phenylpyridinium

Comment (Pharmacological Data)

No effect

Effect (Pharmacological Data)

transport; inhibition of

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human DAT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

Further Details (Pharmacological Data)

nonspecific uptake determined in presence of mazindol (10 μmol/l); DAT: dopamine transporter

Results

title comp. slightly inhibited dopamine uptake

Effect (Pharmacological Data)

transport; inhibition of

Species or Test-System (Pharmacological Data)

human neuroblastoma SK-N-MC cells expressing human NET

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

Further Details (Pharmacological Data)

nonspecific uptake determined in presence of mazindol (10 μmol/l); NET: norepinephrine transporter

Results

title comp. slightly inhibited norepinephrine uptake

Effect (Pharmacological Data)

transport; inhibition of

Species or Test-System (Pharmacological Data)

HEK-293 cells expressing human SERT

Concentration (Pharmacological Data)

100 μmol/l

Method (Pharmacological Data)

Further Details (Pharmacological Data)

nonspecific uptake determined in presence of clomipramine (3 μmol/l); SERT: serotonin transporter

Results

title comp. slightly inhibited serotonin uptake (table)

73/249

2016-07-13 00:31:19

Reaxys ID 1622843 View in Reaxys

4/183 CAS Registry Number: 5438-41-5; 37629-56-4 Chemical Name: (E)-5-(2-nitroprop-1-en-1-yl)benzo[d][1,3]dioxole; (E)-5-(2-nitroprop-1-enyl)benzo[d][1,3]dioxole; 5-((E)-2nitroprop-1-enyl)benzo[d][1,3]dioxole; 1-(3,4-methylendioxyphenyl)-2-nitroprop-1-ene; 2-nitro-1-(3,4-methylenedioxyphenyl)-propane; 5-(2-nitropropenyl)benzo[1,3]dioxole; 3,4-methylenedioxy-β-methyl-β-nitrostyrene Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 Type of Substance: heterocyclic InChI Key: CCEVJKZHAJJQJR-QPJJXVBHSA-N Note:

O O

Substance Label (11) Label References 4a

Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 3198, View in Reaxys

Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys

Seebach,D. et al.; Chemische Berichte; vol. 108; (1975); p. 1924 - 1945, View in Reaxys; Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys

1; Compound 1

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys

VIb

Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys

Akhtar, M. S.; Sharma, V. L.; Seth, M.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 27; nb. 1-12; (1988); p. 448 - 451, View in Reaxys

Eijk, Peter J. S. S. van; Overkempe, Cor; Trompenaars, Willem P.; Reinhoudt, David N.; Manninen, Lauri M.; et al.; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 2; (1988); p. 27 - 39, View in Reaxys

table, entry 3, product

Sy, Wing-Wah; By, Arnold W.; Tetrahedron Letters; vol. 26; nb. 9; (1985); p. 1193 - 1196, View in Reaxys

Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 9; (1983); p. 914 - 915, View in Reaxys

Dore,J.-C.; Viel,C.; Chimica Therapeutica; vol. 7; (1972); p. 214 - 220, View in Reaxys

Patent-Specific Data (2) References Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys Patent; BIODIEM LTD; WO2004/76423; (2004); (A1) English, View in Reaxys Melting Point (4) 1 of 4

Melting Point [°C]

76 - 78

Solvent (Melting Point)

hexane; ethyl acetate

Location

supporting information

Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys 2 of 4

Melting Point [°C]

101 - 102

Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys 3 of 4

Melting Point [°C]

98 - 99

74/249

2016-07-13 00:31:19

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 4 of 4

Melting Point [°C]

Dore,J.-C.; Viel,C.; Chimica Therapeutica; vol. 7; (1972); p. 214 - 220, View in Reaxys Crystal Property Description (2) Colour & Other Location Properties yellow

supporting information

yellow

References Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys; Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 5504, View in Reaxys

Electrochemical Characteristics (1) 1 of 1

Description (Electrochemical Characteristics)

reduction potential

Solvent (Electrochemical Characteristics)

aq. phosphate buffer

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys 2 of 6

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys 3 of 6

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

75/249

2016-07-13 00:31:19

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys 4 of 6

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

26.84

Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys 5 of 6

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

500

Location

supporting information

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys 6 of 6

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

26.9

Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys; Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys Mass Spectrometry (3) Description (Mass Location Spectrometry)

References

76/249

2016-07-13 00:31:19

high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum

supporting information

Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys

electrospray ionisation (ESI); spectrum

Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 - 5504, View in Reaxys

electron impact (EI); spectrum

Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys

Pharmacological Data (41) 1 of 41

Comment (Pharmacological Data)

Bioactivities present

Seebach,D. et al.; Chemische Berichte; vol. 108; (1975); p. 1924 - 1945, View in Reaxys; Dore,J.-C.; Viel,C.; Chimica Therapeutica; vol. 7; (1972); p. 214 - 220, View in Reaxys; Patent; BIODIEM LTD; WO2004/76423; (2004); (A1) English, View in Reaxys; Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys; Sy, Wing-Wah; By, Arnold W.; Tetrahedron Letters; vol. 26; nb. 9; (1985); p. 1193 - 1196, View in Reaxys; Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 9; (1983); p. 914 - 915, View in Reaxys; Akhtar, M. S.; Sharma, V. L.; Seth, M.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 27; nb. 1-12; (1988); p. 448 - 451, View in Reaxys; Eijk, Peter J. S. S. van; Overkempe, Cor; Trompenaars, Willem P.; Reinhoudt, David N.; Manninen, Lauri M.; et al.; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 2; (1988); p. 27 - 39, View in Reaxys; Eijk, Peter J. S. S. van; Overkempe, Cor; Trompenaars, Willem P.; Reinhoudt, David N.; Harkema, Sybolt; Recueil des Travaux Chimiques des Pays-Bas; vol. 107; nb. 2; (1988); p. 40 - 51, View in Reaxys; Trautwein, Axel W.; Jung, Guenther; Tetrahedron Letters; vol. 39; nb. 45; (1998); p. 8263 - 8266, View in Reaxys; Milhazes, Nuno; Calheiros, Rita; Marques, M. Paula M.; Garrido, Jorge; Cordeiro, M. Natalia D.S.; Rodrigues, Catia; Quinteira, Sandra; Novais, Carla; Peixe, Luisa; Borges, Fernanda; Bioorganic and Medicinal Chemistry; vol. 14; nb. 12; (2006); p. 4078 4088, View in Reaxys; Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys; Patent; INSTITUT PASTEUR KOREA; INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE; BRODIN, Priscille; CHRISTOPHE, Thierry; NO, Zaesung; KIM, Jaeseung; GENOVESIO, Auguste; FENISTEIN, Denis, Philippe, Cedric; JEON, Heekyoung; EWANN, Fanny, Anne; KANG, Sunhee; LEE, Saeyeon; SEO, Min, Jung; PARK, Eunjung; CONTRERAS DOMINGUEZ, Monica; NAM, Ji, Youn; KIM, Eun, Hye; WO2010/3533; (2010); (A3) English, View in Reaxys; Alvarez, Guzman; Aguirre-Lopez, Beatriz; Varela, Javier; Cabrera, Mauricio; Merlino, Alicia; Lopez, Gloria V.; Lavaggi, Maria Laura; Porcal, Williams; Di Maio, Rossanna; Gonzalez, Mercedes; Cerecetto, Hugo; Cabrera, Nallely; Perez-Montfort, Ruy; De Gomez-Puyou, Marieta Tuena; GomezPuyou, Armando; European Journal of Medicinal Chemistry; vol. 45; nb. 12; (2010); p. 5767 - 5772, View in Reaxys; Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys; Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys; Yang, Jianxin; Dong, Jing; Lue, Xia; Zhang, Qiang; Ding, Wei; Shi, Xiaoxin; Chinese Journal of Chemistry; vol. 30; nb. 12; (2012); p. 2827 - 2833, View in Reaxys; Rokhum, Lalthazuala; Bez, Ghanashyam; Tetrahedron Letters; vol. 54; nb. 40; (2013); p. 5500 5504, View in Reaxys; Joana Reis; Catarina Oliveira; Nuno Milhazes; Dolores Vina; Fernanda Borges; Letters in drug design & discovery; vol. 9; nb. 10; (2012); p. 958 - 961, View in Reaxys 2 of 41

Effect (Pharmacological Data)

nucleocapsid-viral Fl-SL-2 DNA interaction; inhibition of

Species or Test-System (Pharmacological Data)

recombinant GST-p2-nucleocapsid of HIV-1

Further Details (Pharmacological Data)

fluorescence polarization-based competitive equilibrium binding assay; competition was carried out with Fl-SL-2 DNA (fluorescein-labeled stem loop DNA GGGGCGACTGGTGAGTACGCCCC)

Results

molecular target: GST-p2-nucleocapsid

Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys 3 of 41

Effect (Pharmacological Data)

nucleocapsid-viral Fl-SL-2 DNA interaction; inhibition of

Species or Test-System (Pharmacological Data)

recombinant GST-p2-nucleocapsid of HIV-1

Further Details (Pharmacological Data)

fluorescence polarization-based competitive equilibrium binding assay; competition was carried out with Fl-SL-2 DNA (fluorescein-labeled stem loop DNA GGGGCGACTGGTGAGTACGCCCC); binding affinity (Ki)

77/249

2016-07-13 00:31:19

Type (Pharmacological Data)

Value of Type (Pharmacological Data)

18 nmol/l

Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys 4 of 41

Effect (Pharmacological Data)

viral replication; inhibition of

Species or Test-System (Pharmacological Data)

CD4+ T cells of human; genetically modified/infected with: p24 HIV-1LAI virus

Concentration (Pharmacological Data)

200 nmol/l

Kind of Dosing (Pharmacological Data)

title comp. in DMSO

Further Details (Pharmacological Data)

p24 flow cytometry

Results

molecular target: nucleocapsid

Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys 5 of 41

Effect (Pharmacological Data)

viral replication; inhibition of

Species or Test-System (Pharmacological Data)

CD4+ T cells of human; genetically modified/infected with: p24 HIV-1LAI virus

Concentration (Pharmacological Data)

200 nmol/l

Kind of Dosing (Pharmacological Data)

title comp. in DMSO

Further Details (Pharmacological Data)

p24 flow cytometry; inhibition rate related to: p24 HIV-1LAI virus

Type (Pharmacological Data)

inhibition rate

Value of Type (Pharmacological Data)

18 percent

Breuer, Sebastian; Chang, Max W.; Yuan, Jinyun; Torbett, Bruce E.; Journal of Medicinal Chemistry; vol. 55; nb. 11; (2012); p. 4968 - 4977, View in Reaxys 6 of 41

Effect (Pharmacological Data)

enzyme activity; inhibition of

Species or Test-System (Pharmacological Data)

recombinant triosephosphate isomerase of Trypanosoma cruzi

Concentration (Pharmacological Data)

100 - 400 μmol/l

Kind of Dosing (Pharmacological Data)

dissolved in dimethyl sulfoxide

Type (Pharmacological Data)

inhibition rate

Value of Type (Pharmacological Data)

55 - 74 percent

Location

supporting information

Alvarez, Guzman; Aguirre-Lopez, Beatriz; Varela, Javier; Cabrera, Mauricio; Merlino, Alicia; Lopez, Gloria V.; Lavaggi, Maria Laura; Porcal, Williams; Di Maio, Rossanna; Gonzalez, Mercedes; Cerecetto, Hugo; Cabrera, Nallely; Perez-Montfort, Ruy; De Gomez-Puyou, Marieta Tuena; Gomez-Puyou, Armando; European Journal of Medicinal Chemistry; vol. 45; nb. 12; (2010); p. 5767 - 5772, View in Reaxys

78/249

2016-07-13 00:31:19

7 of 41

Effect (Pharmacological Data)

enzyme activity; inhibition of

Species or Test-System (Pharmacological Data)

recombinant triosephosphate isomerase of Trypanosoma cruzi

Concentration (Pharmacological Data)

100 - 400 μmol/l

Kind of Dosing (Pharmacological Data)

dissolved in dimethyl sulfoxide

Results

molecular target: triosephosphate isomerase

Location

supporting information

Effect (Pharmacological Data)

growth; inhibition of

Species or Test-System (Pharmacological Data)

Trypanosoma cruzi Tulahuen 2

Concentration (Pharmacological Data)

25 μmol/l

Kind of Dosing (Pharmacological Data)

dissolved in dimethyl sulfoxide

Further Details (Pharmacological Data)

epimastigotes were used

Type (Pharmacological Data)

inhibition rate

Value of Type (Pharmacological Data)

100 percent

Effect (Pharmacological Data)

growth; inhibition of

Species or Test-System (Pharmacological Data)

Trypanosoma cruzi Tulahuen 2

Kind of Dosing (Pharmacological Data)

dissolved in dimethyl sulfoxide

Further Details (Pharmacological Data)

epimastigotes were used; inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

5.1 μmol/l

Effect (Pharmacological Data)

protein tyrosine phosphatase (PTP1B); inhibition of

Species or Test-System (Pharmacological Data)

protein tyrosine phosphatase (PTP1B) of human

Method (Pharmacological Data)

Example 1 - PROTEIN TYROSINE PHOSPHATASE INHIBITIONInhibition of tyrosine phosphatases (TP) was investigated using the Promega ProFluor.(TM). Tyrosine Phos-

79/249

2016-07-13 00:31:19

phatase Assay. Specific inhibition of tyrosine phosphatase activity by a test compound is demonstrated by inhibition of dephosphorylation of a bisamide rhodaminellO-phosphopeptide. Release of fluorescent RIlO is achieved by addition of a protease which can only hydrolyse non-phosphorylated peptide. Fluorescence is therefore directly associated with phosphatase activity and inhibition of phosphatase activity is demonstrated by a decrease in fluorescence. Non-specific protease inhibition in the test compound is assessed by inhibition of protease digestion of a control peptide containing 7- amino-4-methyl-coumarin (AMC) and resultant reduction in the release of fluorescent AMC. If the test compound is a specific inhibitor of tyrosine phosphatase and not a protease inhibitor, fluorescence from the phosphor-peptide RIlO substrate will decrease and fluorescence from liberated AMC from the control peptide will remain high. If the test compound is a general protease inhibitor, fluorescence from both substrates will decrease. Compounds 1 and 7 were tested from 3.7 to 900 μM. Sodium vanadate (SV) (10 to 100 nM) was used as a positive inhibitor control. Compounds 1 and 7 and SV were assayed against 2 mU PTPlB (human) , 5 CD 45 (human) and 3 U Yop (bacterial) PTPs (all Calbiochem) . Enzymes were added to opaque 96-well plates (Greiner LIA Plates) containing Compound 1 or Compound 7or SV or no compound. A reaction mixture, containing bisamide rhodamine 110 phospho-peptide and a control AMC-peptide was added and the plate incubated in the dark at 240C for 1 hour. A protease reagent (Promega) was added to stop the phosphatase reaction and to digest the control peptide. The assay was incubated for a further 30 min at 24°C and then terminated by addition of a Stabiliser Solution (Promega) and the plate read on a fluorescent microplate reader (BMG Laboratories Fluostar Optima) with excitation at 485 nM and emission at 520 nM to detect rhodamine 110 and with excitation at 355 nM and emission at 460 nM to detect AMC fluorescence.ResultsCompounds 1 and 7 show dose-dependent inhibition of human tyrosine phosphatases, PTPlB and CD 45 and bacterial Yop phosphatase (Fig. 1) . Inhibitory concentrations (IC50 or ICi5) are shown in the table below. Compound 7 did not inhibit CD45.Yop is produced by Yersinia enterocolitica, an enteric Gram negative rod and significant pathogen causing enterocolitis in humans and animals .Bacterial protein phosphatases show a high degree of identity with human homologs and share the same catalytic mechanism. Genome homology searches have shown a general distribution of orthologs for eukaryotic protein tyrosine phosphatases in many bacteria. Bacterial PTPs are not as specialized as eukaryotic PTPs, show functional overlap, greater catalytic versatility and a heterogeneous distribution.Tyrosine phosphorylation influences gene regulation and enzyme activity in bacteria and is frequently related to stress resistance and virulence mechanisms of many pathogens. For example, YopH is an extracellular protein, encoded in a virulence plasmid in pathogenic strains of Yersinia pseudotuberculosis Compound 1 and 7 have an MIC against Y. enterocolitica of 16μg/mL and 64 μg/mL. Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

3 mmol/l

Results

title compound showed dose-dependent inhibition of human tyrosine phosphatases, PTP1B; figure given

Location

Page/Page column 37-40; Sheet 1/6

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 11 of 41

Effect (Pharmacological Data)

protein tyrosine phosphatase (CD45); inhibition of

Species or Test-System (Pharmacological Data)

protein tyrosine phosphatase (CD45) of human

Method (Pharmacological Data)

80/249

2016-07-13 00:31:19

control. Compounds 1 and 7 and SV were assayed against 2 mU PTPlB (human) , 5 CD 45 (human) and 3 U Yop (bacterial) PTPs (all Calbiochem) . Enzymes were added to opaque 96-well plates (Greiner LIA Plates) containing Compound 1 or Compound 7or SV or no compound. A reaction mixture, containing bisamide rhodamine 110 phospho-peptide and a control AMC-peptide was added and the plate incubated in the dark at 240C for 1 hour. A protease reagent (Promega) was added to stop the phosphatase reaction and to digest the control peptide. The assay was incubated for a further 30 min at 24°C and then terminated by addition of a Stabiliser Solution (Promega) and the plate read on a fluorescent microplate reader (BMG Laboratories Fluostar Optima) with excitation at 485 nM and emission at 520 nM to detect rhodamine 110 and with excitation at 355 nM and emission at 460 nM to detect AMC fluorescence.ResultsCompounds 1 and 7 show dose-dependent inhibition of human tyrosine phosphatases, PTPlB and CD 45 and bacterial Yop phosphatase (Fig. 1) . Inhibitory concentrations (IC50 or ICi5) are shown in the table below. Compound 7 did not inhibit CD45.Yop is produced by Yersinia enterocolitica, an enteric Gram negative rod and significant pathogen causing enterocolitis in humans and animals .Bacterial protein phosphatases show a high degree of identity with human homologs and share the same catalytic mechanism. Genome homology searches have shown a general distribution of orthologs for eukaryotic protein tyrosine phosphatases in many bacteria. Bacterial PTPs are not as specialized as eukaryotic PTPs, show functional overlap, greater catalytic versatility and a heterogeneous distribution.Tyrosine phosphorylation influences gene regulation and enzyme activity in bacteria and is frequently related to stress resistance and virulence mechanisms of many pathogens. For example, YopH is an extracellular protein, encoded in a virulence plasmid in pathogenic strains of Yersinia pseudotuberculosis Compound 1 and 7 have an MIC against Y. enterocolitica of 16μg/mL and 64 μg/mL. Type (Pharmacological Data)

IC15

Value of Type (Pharmacological Data)

3.7 mmol/l

Results

title compound showed dose-dependent inhibition of human tyrosine phosphatases, CD45; figure given

Location

Page/Page column 37-40; Sheet 1/6

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 12 of 41

Effect (Pharmacological Data)

bacterial Yop phosphatase; inhibition of

Species or Test-System (Pharmacological Data)

Yop phosphatase produced by Yersinia enterocolitica

Method (Pharmacological Data)

Example 1 - PROTEIN TYROSINE PHOSPHATASE INHIBITIONInhibition of tyrosine phosphatases (TP) was investigated using the Promega ProFluor.(TM). Tyrosine Phosphatase Assay. Specific inhibition of tyrosine phosphatase activity by a test compound is demonstrated by inhibition of dephosphorylation of a bisamide rhodaminellO-phosphopeptide. Release of fluorescent RIlO is achieved by addition of a protease which can only hydrolyse non-phosphorylated peptide. Fluorescence is therefore directly associated with phosphatase activity and inhibition of phosphatase activity is demonstrated by a decrease in fluorescence. Non-specific protease inhibition in the test compound is assessed by inhibition of protease digestion of a control peptide containing 7- amino-4-methyl-coumarin (AMC) and resultant reduction in the release of fluorescent AMC. If the test compound is a specific inhibitor of tyrosine phosphatase and not a protease inhibitor, fluorescence from the phosphor-peptide RIlO substrate will decrease and fluorescence from liberated AMC from the control peptide will remain high. If the test compound is a general protease inhibitor, fluorescence from both substrates will decrease. Compounds 1 and 7 were tested from 3.7 to 900 μM. Sodium vanadate (SV) (10 to 100 nM) was used as a positive inhibitor control. Compounds 1 and 7 and SV were assayed against 2 mU PTPlB (human) , 5 CD 45 (human) and 3 U Yop (bacterial) PTPs (all Calbiochem) . Enzymes were added to opaque 96-well plates (Greiner LIA Plates) containing Compound 1 or Compound 7or SV or no compound. A reaction mixture, containing bisamide rhodamine 110 phospho-peptide and a control AMC-peptide was added and the plate incubated in the dark at 240C for 1 hour. A protease reagent (Promega) was added to stop the phosphatase reaction and to digest the control peptide. The assay was incubated for a further 30 min at 24°C and then terminated by addition of a Stabiliser Solution (Promega) and the plate read on a fluorescent microplate reader (BMG Laboratories Fluostar Optima) with excitation at 485 nM and emission at 520 nM to detect rhodamine 110 and with excitation at 355 nM and emission at 460 nM to detect AMC fluorescence.ResultsCompounds 1 and 7 show dose-dependent inhibition of human tyrosine phosphatases, PTPlB and CD 45 and bacterial Yop phosphatase (Fig. 1) . Inhibitory concentrations (IC50 or ICi5) are shown in the table below. Com-

81/249

2016-07-13 00:31:19

pound 7 did not inhibit CD45.Yop is produced by Yersinia enterocolitica, an enteric Gram negative rod and significant pathogen causing enterocolitis in humans and animals .Bacterial protein phosphatases show a high degree of identity with human homologs and share the same catalytic mechanism. Genome homology searches have shown a general distribution of orthologs for eukaryotic protein tyrosine phosphatases in many bacteria. Bacterial PTPs are not as specialized as eukaryotic PTPs, show functional overlap, greater catalytic versatility and a heterogeneous distribution.Tyrosine phosphorylation influences gene regulation and enzyme activity in bacteria and is frequently related to stress resistance and virulence mechanisms of many pathogens. For example, YopH is an extracellular protein, encoded in a virulence plasmid in pathogenic strains of Yersinia pseudotuberculosis Compound 1 and 7 have an MIC against Y. enterocolitica of 16μg/mL and 64 μg/mL. Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

27 mmol/l

Results

title compound showed dose-dependent inhibition of bacterial Yop phosphatase; figure given

Location

Page/Page column 37-40; Sheet 1/6

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 13 of 41

Effect (Pharmacological Data)

bacterial Yop phosphatase; inhibition of

Species or Test-System (Pharmacological Data)

Yop phosphatase produced by Yersinia enterocolitica of Yersinia enterocolitica

Method (Pharmacological Data)

82/249

2016-07-13 00:31:19

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

16 mg/ml

Location

Page/Page column 38-39

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 14 of 41

Effect (Pharmacological Data)

cancer cell growth; inhibition of

Species or Test-System (Pharmacological Data)

A549 non small cell lung cancer cell of human

Method (Pharmacological Data)

Example 2 - ANTI-TUMOUR ACTIVITYSJRB Assay Human non small cell lung cancer cell line or human neonatal foreskin fibroblasts (normal cells) were seeded (in 100 μl) into the wells of two 96-well culture plates and incubated overnight at 370C in a humidified 5percent CO2, 95 percent air atmosphere. One plate was then fixed with TCA (as a measure of cells present at the time of addition of drug) . Compound 1 was dissolved in DMSO and diluted in medium to 10 concentrations spanning a 4-log range. 100 μl of each drug solution was then added to each of 5 wells of the second plate . The plate was then incubated for a further 72 hr after which viable cells are measured using the sulforhodamine B assay (Skehan et al. , 1990; Monks et al., 1991) . Briefly, the cells were fixed with 10 percent cold trichloroacetic acid for 1 hr at 40C and the plates then rinsed with distilled water, left to air dry and then stained with 0.4 percent SRB (Aldrich) in 1percent acetic acid (v/v) for 30 min. Unbound dye was removed by washing twice with distilled water and finally with 1 percent acetic acid. Protein- bound dye is then solubilised in 10 mM unbuffered Tris base and the absorbance read at 550 nm using an automatic plate reader. The mean absorbance for time zero growth (Tz) , control growth (C) and test drug growth (Ti) is determined and the percentage growth is calculated at each drug concentration as : [ (Ti-Tz) / (C-Tz)] x 100 for concentrations where Ti > Tz [(Ti-Tz) /Tz] x 100 for concentrations where Ti 50) : is then determined as the drug concentration that results in a 50 percent reduction in the net cellular protein increase in control cells following drug incubation.ResultsGrowth inhibitionThe mean GI50 for Compound 1 for human non small cell lung cancer cell line (1.7 μM) was seven-fold lower than its activity against normal human neonatal foreskin fibroblasts (12.5 μM) . This is an acceptable differential toxicity for cytotoxic agents.Growth inhibition of cancer cell line and normal cell line by Compound 1 using the Sulforhodamine B (SRB) assay. GI50 is the concentration required to inhibit cell growth by 50percent.1 A549 human non small cell lung cancer cell2 FF human neonatal foreskin fibroblasts (normal)The results are shown in Figs 2 to 6.

Type (Pharmacological Data)

GI50

Value of Type (Pharmacological Data)

1.4 - 2.1 μmol/l

Results

title compound showed the growth inhibition of human non small cell lung carcinoma (A549) by seven-fold lower than normal cell lines; figure given

Location

Page/Page column 37; 40-41; Sheet 2/6

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 15 of 41

Effect (Pharmacological Data)

cancer cell growth; inhibition of

Species or Test-System (Pharmacological Data)

FF neonatal foreskin fibroblasts (normal) of human

Method (Pharmacological Data)

83/249

2016-07-13 00:31:19

base and the absorbance read at 550 nm using an automatic plate reader. The mean absorbance for time zero growth (Tz) , control growth (C) and test drug growth (Ti) is determined and the percentage growth is calculated at each drug concentration as : [ (Ti-Tz) / (C-Tz)] x 100 for concentrations where Ti > Tz [(Ti-Tz) /Tz] x 100 for concentrations where Ti 50) : is then determined as the drug concentration that results in a 50 percent reduction in the net cellular protein increase in control cells following drug incubation.ResultsGrowth inhibitionThe mean GI50 for Compound 1 for human non small cell lung cancer cell line (1.7 μM) was seven-fold lower than its activity against normal human neonatal foreskin fibroblasts (12.5 μM) . This is an acceptable differential toxicity for cytotoxic agents.Growth inhibition of cancer cell line and normal cell line by Compound 1 using the Sulforhodamine B (SRB) assay. GI50 is the concentration required to inhibit cell growth by 50percent.1 A549 human non small cell lung cancer cell2 FF human neonatal foreskin fibroblasts (normal)The results are shown in Figs 2 to 6. Type (Pharmacological Data)

GI50

Value of Type (Pharmacological Data)

10 - 15 μmol/l

Results

title compound showed the growth inhibition of human neonatal foreskin fibroblasts and normal cell lines; figure given

Location

Page/Page column 37; 40-41; Sheet 3/6-4/6

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 16 of 41

Effect (Pharmacological Data)

toxic

Species or Test-System (Pharmacological Data)

Sprague-Dawley rat

Route of Application

peroral

Method (Pharmacological Data)

Example 3 - TOXICOLOGY AND PHARMACOKINETICSSummary of acute toxicity Compound 1 in aqueous suspension is relatively non toxic . Solvents such as DMSO and ethanol increase toxicity.Compound 1 in aqueous suspension by oral administration is not toxic to rats up to 1200 mg/kg. 1500 mg/kg is toxic.Absorption from the gastrointestinal tract in rats is low. An oral dose of 500 mg/kg aqueous suspension producing blood levels of 16 25 μg/ml .Compound 1 in aqueous suspension by oral administration is non toxic to dayold chicks at > 400 mg/kg .Compound 1 in DMSO or ethanol given orally to chicks is not toxic at 125 mg/kg and toxic at 150 mg/kg.Compound 1 in DMSO given intraperitonealIy to mice is toxic at 50 mg/kg and non-toxic at 40 mg/kg. Experimental Detail on Toxicology and Pharmacokinetic studiesExperimental Detail on Toxicology and Pharmacokinetic StudiesDosing range test of Compound 1 in ratThe aim of this example was to establish absorption and blood levels of Compound 1 in the rat after a single dose oral administration. Sprague-Dawley rats (6 w/o) were acclimatised for 6 days in the Animal Facility under standardized environmental conditions (22°C +/- 3°C, rel hum 30-70percent, artificial light, 12 h light/12 h dark) . Rats were fed a conventional laboratory diet with food and water ad lib and caged 5 rats per cage. Compound 1 was prepared as an aqueous suspension in sterile LPW. At higher concentrations the suspension was sonicated to reduce particle size sufficiently to pass through the gavage needle . Compound 1 suspensions and the water control were administered at approx 100 mL/kg. One control and five treatment rats were weighed immediately before each dose administration, the dose volume calculated and the dose delivered by gavage (22 gauge stainless steel, smooth- balled end attached to a syringe) . Approximately 100-200 μL of blood (microfuge tube) was removed from the tail at 4 and 8 hours. Tails were prewarmed using a heat lamp and snipped at the tip with a large scalpel . Blood was massaged into a microfuge tube . Twenty four hour blood samples were not attempted because of the difficulty of snipping scarred tails and the distress caused to rats. Blood was allowed to clot, centrifuged in a microfuge for 3 minutes and the serum separated and stored at -2O0C.Compound 1 was extracted (x2) from serum by toluene and absorbance measured at 370 nm (Hitachi U2000) . A spiked control using 100 μg/mL Compound 1 in 50percent methanol/water (V/V) and untreated controls were also assayed.Animals were observed twice daily for 7 days and all observations recorded individually for each animal. Animals were not weighed after the initial weighing. Sacrifice and necropsy was performed at 7 days. Animals were euthanized by carbon dioxide.Gross pathology was recorded and samples of heart, lung, liver, kidney, stomach, spleen, duodenum and colon removed (10percent formalin) for histology. Compound 1 was tested at 100, 500 (fasted and non fasted groups) , 1000 and 1250 mg/kg. At doses of 100 and 500 mg/kg there were no adverse symptoms over the 7-day study period. Tissues at necropsy looked normal.After 1000 mg/kg one rat was euthanised approx 28 hrs showed discharge around the nose and mouth, blood in urine and a hunched position in

84/249

2016-07-13 00:31:19

the cage. Post mortem examination revealed spotty and congested lung and a bloated stomach. Liver heart and kidney appeared normal. Histology revealed early changes indicative of dilated cardiomyopathy due possibly to toxaemia or chemical interaction. Other rats showed no visible lesions except for some lung congestion.One rat dosed at 1250 mg/kg was distressed and euthanized 8 hours later. Lung congestion was noted. Histology showed mild congestion in the liver, lung and of myocardium associated with some sinusoidal cell degeneration. Other rats in the group had no visible lesions and appeared to tolerate treatment.Compound 1 appears to be well tolerated at dose be Results

title compound in aqueous suspension is not toxic up to 1200 mg/kg; 1500 mg/kg is toxic; at doses of 100 and 500 mg/kg there were no adverse symptoms over the 7-day period; after 1000 mg/kg one rat was euthanised approx 28 hrs showed discharge around the nose and mouth, blood in urine and a hunched position in the cage; one rat dosed at 1250 mg/kg was distressed and euthanized 8 hrs later; other rats showed no visible lesions; title compound appears to be well tolerated at dose below 1000 mg/kg

Location

Page/Page column 41-44

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 17 of 41

Effect (Pharmacological Data)

toxic

Species or Test-System (Pharmacological Data)

broiler chicken

Route of Application

peroral

Method (Pharmacological Data)

28 day repeat dose toxicity study in broiler chickensExperimental protocolThis study investigated the cumulative toxicity of Compound 1 for up to 28 days oral dosing and the distribution of Compound 1 at weekly intervals. Blood and tissue samples were collected after 7, 14, 21 and 28 days daily dosing and 4 days after withdrawal of Compound 1.This experiment was conducted in two stages as shown. Stage A commenced dosing at 2 days old and Stage B at 5 days old.Table 2. Dosing schedule for 28 day toxicity study in chickensTreatment Sampling at days NumberCompound 1 of mg/kg birds bw/day- 7 14 21 28 32Stage A 0 5 5 5 5 5 2550 5 5 5 5 5 25Stage B 0 5 5 5 5 5 25100 5 5 5 5 5 25200 5 5 5 5 5 25400 5 5 5 5 5 25150Administration of Compound 1All doses of Compound 1 were administered orally using an automatic pipette in volumes less than lmL/lOOg body weight. Doses, based on the mean group weight for the group were administered by separating the beak and inserting the plastic tip (1 mL plastic disposable pipette tips) . Compound 1 was dissolved in canola oil in stock solutions of 12.5, 25 and 50 mg/mL. Stock solution 12.5 mg/ml required heating to 40° C and 25 45 mg/ml required heating to 50°C to dissolve Compound 1. Dosing solutions were prepared immediately before use and kept at 40 °C and administered warm. Control groups received an equal volume of canola oil . ResultsAll chicks appeared well, with no adverse reactions and behaved normally for all doses over the 28 day- treatment period. The only observable differences between treatment groups were in weight gain and mortality. A very modest weight gain over canolatreated control was observed for 50 mg/kg bw, particularly after the 5 day withdrawal period, however this was not significant Dosing at 100 to 400 mg/kg/day showed a decreased weight gain compared to untreated controls, the 200 mg/kg dose showing the lowest weight gain. 100 mg/kg (-6.3percent); 200 mg/kg (- 32.6percent); 400 mg/kg (-15.3percent).No mortality was observed for 50 and 100 mg/kg doses and comparable mortality of 3/25 birds for 200 and 400 mg/kg bw. At necropsy the only observable gross pathology was that birds receiving 200 and 400 mg/kg bw had pale livers

Results

all chicks appeared well for all doses of title compound over the 28 day-treatment period; dosing at 100 to 400 mg/kg/day showed a decreased weight gain compared to untreated controls, the 200 mg/kg dose showing the lowest weight gain, 100 mg/kg (-6.3percent); 200 mg/kg (-32.6percent); 400 mg/kg (-15.3percent); no mortality was observed for 50 and 100 mg/kg doses and comparable mortality of 3/25 birds for 200 and 400 mg/kg bw; title compound in aqueous suspension is non toxic to day-old chicks at > 400 mg/kg

Location

Page/Page column 42; 45-46

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 18 of 41

Effect (Pharmacological Data)

toxic

Species or Test-System (Pharmacological Data)

Balb/c nude mouse

Sex

female

Route of Application

intravenous

85/249

2016-07-13 00:31:19

Method (Pharmacological Data)

IV repeat dose in nude mice Compound 1 was formulated in 12.5percent DMSO, 12.5percent ethanol, 12.5percent Cremophor EL, 62.5percent saline at concentrations of 0.2- 4 mg/mL or in 15percent DMSO, 12.5percent ethanol, 12.5percent Cremophor EL, 60 percent saline at a concentration of 5 mg/mL.MethodsGroups of two female Balb/c nude mice (Animal Resources Centre, Western Australia) were given compound 1 (0. 1. 5. 10 15, 20 and 25 mg/kg) at a rate of 0.05 ml/10 g body weight) by intravenous injection twice weekly for three weeks. Mice were weighed daily and watched closely for signs of toxicity. Animals were given a feed supplement (Ensure) daily..Results No Maximum Tolerated Dose was established due to the inability to solubilise compound 1 for IV delivery of concentrations higher than 25 mg/kg mouse weight.All doses up to 25 mg/kg did not adversely affect mouse weight or general health and wellbeing. The observed increase in mouse weight is likely to be due to the effects of the feed supplement.The results using Vehicle 1 (12.5 percent DMSO, 12.5 percent ethanol, 12.5 percent Cremophor EL, 62.5 percent saline) are summarised in Figs . 8 and 9.

Results

No Maximum Tolerated Dose was established due to the inability to solubilise title compound for IV delivery of concentrations higher than 25 mg/kg mouse weight; all doses up to 25 mg/kg did not adversely affect mouse weight or general health and wellbeing; the observed increase in mouse weight is likely to be due to the effects of the feed supplement; figure given

Location

Page/Page column 37; 46-47; Sheet 5/6-6/6

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 19 of 41

Effect (Pharmacological Data)

pharmacokinetics

Species or Test-System (Pharmacological Data)

Sprague-Dawley rat

Sex

male

Route of Application

peroral

Method (Pharmacological Data)

GLP PharmacokineticsPharmacokinetics of Compound 1 following a single oral dose in the rat. This study was conducted in compliance with GLP and in accordance with OECD guidelines.Study designFor oral dosing Compound 1 was formulated as a suspension in 1percent CMC 0.05percent tween 80, and animals received a single oral dose at 1000mg/ kg.Three blood samples were collected at each timepoint at; 0.25, 0.5, 1, 2, 4, 8, 12 24 hrs post dose.Compound 1 levels in the plasma were determined by an LC/MS assay. The LLOQ was 200 ng/mLThe toxicokinetic parameters determined from the mean plasma concentration profile were:> maximum concentration (Cmax)> time to maximal concentration (Tmax) > area under the curve to last measurable concentration (AUCt)> apparent terminal elimination rate (KeI) > terminal half-life (Thalf) , calculated as Thalf = Ln (2) / KeI> area under the curve extrapolated to infinite time (AUCinf) , calculated as AUCinf = AUCt + Clast/Kel where Clast is the last measurable concentration> clearance (CL) , calculated as CL = Dose / AUCinf ^- volume of distribution (Vd) , calculated as CL/KelResults For an oral dose level of 1000 mg/kg of Compound 1 in male Sprague-Dawley rats, the maximum concentration (Cmax) was determined to be 3073 ng/mL at 2 hours post-dose. The apparent elimination half-life (Thalf) was 5.85 hours. The area under the curve extrapolated to infinite time (AUCinf) was 38628 ng*h/mL with clearance (CL) of 25.9L/h/kg and volume of distribution (Vd) of 218 L/kg (Table 3 ; Figure 7) . Table 3. Pharmacokinetic Parameters of Compound 1

Results

pharmacokinetic parameters of title compound: dose - 1000 mg/kg, maximum concentration (Cmax) - 3073 ng/mL, time to maximal concentration (Tmax) - 2.0 h, area under the curve to last measurable concentration (AUC (0-24)) - 36502 ng*h/mL, apparent terminal elimination rate (Kel) - 0.119 1/h, terminal half-life (Thalf) - 5.85 h, area under the curve extrapolated to infinite time (AUCinf) - 38628 ng*h/mL, clearance (CL) - 25.9L/h/kg, volume of distribution (Vd) - 218 L/kg; figure given

Location

Page/Page column 37; 47-49; Sheet 4/6

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 20 of 41

Effect (Pharmacological Data)

toxic

Species or Test-System (Pharmacological Data)

rat

Sex

male and female

Route of Application

peroral

86/249

2016-07-13 00:31:19

Method (Pharmacological Data)

GLP toxicologyAcute oral toxicity in the ratThis study was conducted in compliance with GLP and in accordance with OECD guidelines.Study designCompound 1 was formulated as a suspension in 1percent CMC 0.05percent tween 80.Each animal received a single dose by oral gavage (0, 500, 1000, 1500 2000 mg/kg) according to the following schedule .Table 4. Dosing schedule for acute oral toxicity studyAnimals were observed daily for 14 days for morbidity, mortality and overt signs of toxicity. On Day 14 all animals were sacrificed and subject to a gross necropsy.ResultsThere were no deaths and no significant morbidity at any dose.Clinical signs were transient and included red staining in the urogenital region, soft faeces and poor grooming. There were no significant findings at necropsy.The maximum tolerated oral dose is greater than 2g/kg.

Results

there were no deaths and no significant morbidity at dose (0-2000 mg/kg) of title compound; clinical signs were transient and included red staining in the urogenital region, soft faeces and poor grooming; there were no significant findings at necropsy; the maximum tolerated oral dose is greater than 2g/kg

Location

Page/Page column 50

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 21 of 41

Effect (Pharmacological Data)

toxic

Species or Test-System (Pharmacological Data)

rat

Sex

male and female

Route of Application

intravenous

Method (Pharmacological Data)

Acute intravenous toxicity in the ratThis study was conducted in compliance with GLP and in accordance with OECD guidelines .Study designCompound 1 was formulated as a solution in 100percent DMSO. Each animal received a single dose by intravenous injection in the lateral tail vein (0, 0.5, 1 and 5 mg/kg) in a volume of 1 mL/kg, according to the schedule in table 32. All animals were observed daily for overt signs of toxicity for 7 days . On day 8 all surviving animals were sacrificed and subject to gross necropsy examination. Histopathology of the liver, kidney, heart, spleen and lung were conducted in 1 male and 1 female rat at 0.5 and 1 mg/kg, and in 3 male rats at 5 mg/kg.Table 5. Dosing schedule for acute intravenous study in the ratResultsThe vehicle group did not show any clinical signs of toxicity during the study . There were no other mortalities during the study. All animals treated with Compound 1 exhibited struggling and vocalisation during injection. The animals dosed with 0.5 mg/kg did not show any other clinical abnormalities. The animals dosed with 1 mg/kg exhibited subdued behaviour and wobbly gait for 5- 10 minutes after injection. The animals dosed with 5 mg/kg exhibited subdued behaviour, eye closure, gasping, wobbly gait and prostration for up to 10 minutes after injection. The female of this group died 5 minutes after injection. There were no other clinical abnormalities throughout the study.There were no gross abnormalities found in the major organs of any animal treated with the vehicle or BDM-I at autopsy. Histological examination did not show any abnormalities in any animal . In this study Compound 1 produced toxicity and death when administered up to doses of 5 mg/kg.A NOEL was not established.

Results

the animals dosed with 0.5 mg/kg of title compound did not show any other clinical abnormalities; the animals dosed with 1 mg/kg exhibited subdued behaviour and wobbly gait for 5-10 minutes after injection; the animals dosed with 5 mg/kg exhibited subdued behaviour, eye closure, gasping, wobbly gait and prostration for up to 10 minutes after injection; title compound produced toxicity and death when administered up to doses of 5 mg/kg

Location

Page/Page column 51-52

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 22 of 41

Effect (Pharmacological Data)

toxic

Species or Test-System (Pharmacological Data)

rat

Sex

male and female

Route of Application

peroral

Method (Pharmacological Data)

Following repeated administration of Compound 1 at a dose of 1150 mg/kg/day, 3 males and 1 female were found dead during the study and 2 males were moribund sacrificed. Administration of 2000 mg/kg/day Compound 1 resulted in the moribund sacrifice of 5 males and 4 females while the remaining female was found dead on DayClinical signs of toxicity noted in this study following administration of 1150 and 2000 mg/kg/day Com-

87/249

2016-07-13 00:31:19

pound 1 included brown staining around anus, soft faeces, red staining of the cage paper, abdomen and nares, decreased activity, and ruffled haircoat . Clinical signs of toxicity for the low-dose group (300 mg/kg/day) were limited to red staining of the cage paper in a few males on days 3 and 4.Body weight data was limited due to the loss of most animals in the mid- and high-dose groups. Males dosed with 300 mg/kg/day Compound 1 had a decreased group mean weight gain and body weight on Day 7 as compared to controls. Decreased weight gain and body weight was also noted for the females in the low-and mid-dose groups.There were no definitive test article-related effects on food consumption.For the moribund sacrificed animals, increases in red blood cells, hemoglobin, hematocrit and platelets were observed. This may have been as a result of dehydration due to their moribund condition. Also noted was an increase in neutrophils, which may be related to stress. For animals surviving until the scheduled sacrifice on Day 8, there were no definitive test article-related changes in hematology for males in the low-dose group. Females in the mid-dose-group had decreased red blood cells, hemoglobin, and hematocrit with increased platelets, monocytes and reticulocytes. There were no test article-related effects on erythrocyte morphology. Any other statistically significant changes from control were considered incidental and unrelated to treatment .There were no definitive test article-related changes in coagulation parameters. A few statistically significant changes were noted. However, they are considered incidental and unrelated to treatment. The animals sacrificed moribund had increased creatinine, alkaline phosphatase, blood urea nitrogen, potassium, bilirubin, phosphorus and triglycerides. Animals also had decreased sodium, cholesterol, total protein, albumin, globulin, and calcium. There were no definitive test article-related changes in clinical chemistry parameters for animals sacrificed on Day 8. Although some statistically significant changes were noted, all values were comparable to historical control values and therefore, were considered incidental.Gross necropsy findings for the moribund sacrificed animals included small spleens, dark fluid filled cecum, colon, ileum, duodenum and bladder, and yellow fluid in the stomach. There were no test article-related gross necropsy findings noted at necropsy on Day 8.Test article related changes in liver weights were noted for females at necropsy on Day 8. females had statistically significantly increased liver weights (absolute and relative to body and brain weight) for mid- dose animals. Low-dose females also has increased liver to body weight ratios . Although statistically significantly increased liver to body weight ratios were noted for males in the low-dose group, this was considered incidental as it was most likely associated with the decreased body weight. Increased adrenal to body and adrenal to brain weight ratios were noted for females in the mid-dose group.ConclusionBased on the findings in this study, the no-observed adverse-effect level (NOAEL) was less than 300 mg/kg/ day, while the lowest lethal dose (LLD) was less than 1150 mg/kg/day. Results

administration of title compound at a dose of 1150 mg/kg/day for 3 males and 1 female showed death during the study and 2 males were moribund sacrificed; administration of 2000 mg/kg/day resulted in the moribund sacrifice of 5 males and 4 females while the remaining female was found dead on DayClinical signs of toxicity following administration of 1150 and 2000 mg/kg/day; no-observed adverse-effect level (NOAEL) was less than 300 mg/kg/day, lowest lethal dose (LLD) was less than 1150 mg/kg/day

Location

Page/Page column 52-55

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 23 of 41

Effect (Pharmacological Data)

plasma level

Species or Test-System (Pharmacological Data)

bird

Method (Pharmacological Data)

Determination of Compound 1 levels in plasma Compound 1 was not detected by LCMS assay in plasma samples taken from birds dosed with 200 and 400 mg/kg Compound 1. The LLOQ of the assay was 200 ng/mL

Results

title compound was not detected by LCMS assay in plasma samples taken from birds dosed with 200 and 400 mg/kg title compound; the LLOQ of the assay was 200 ng/mL

Location

Page/Page column 46

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 24 of 41

Effect (Pharmacological Data)

toxic

Species or Test-System (Pharmacological Data)

mouse

Route of Application

intraperitoneal

88/249

2016-07-13 00:31:19

Method (Pharmacological Data)

Compound 1 in DMSO given intraperitonealIy to mice is toxic at 50 mg/kg and non-toxic at 40 mg/kg

Results

title compound in DMSO is toxic at 50 mg/kg and non-toxic at 40 mg/kg

Location

Page/Page column 42

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 25 of 41

Effect (Pharmacological Data)

plasma level

Species or Test-System (Pharmacological Data)

rat

Route of Application

peroral

Method (Pharmacological Data)

Plasma levels of Compound 1Absorption of Compound 1 from the gastrointestinal tract is very low, approximately 2percent of the oral dose reaching the blood. Blood levels increased with dose level. Eight-hour levels were generally higher than 4- hour levels. The results, although limited, suggest low oral absorption (Table 1)Table 1. Plasma levels of Compound 1 in the rat following single oral dosingCompound 1 dose Sample time Blood level μg/mL (mg/kg) (hours) Mean500 fed 4 88 17500 fasted 4 128 141000 fasted 4 268 211250 4 + 8 h 27

Results

absorption from the gastrointestinal tract in rats is low, approximately 2percent of the oral dose reaching the blood; blood levels increased with dose level; eight-hour levels were generally higher than 4- hour levels; doses of 500, 1000 and 1250 mg/kg producing blood levels of 8-17, 21-26 and 27 μg/ml, respectively; an oral dose of 500 mg/kg aqueous suspension producing blood levels of 16-25 μg/ml

Location

Page/Page column 41-42; 44

Patent; BIODIEM LTD; WO2008/61308; (2008); (A1) English, View in Reaxys 26 of 41

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis KE77F2 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

32 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis Med100 F3 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

89/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

32 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis Med150 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

32 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis 536540 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

32 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis H 181A strain

90/249

2016-07-13 00:31:19

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

32 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis H 318 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; ampicillin, aminoglycoside, tetracycline, macrolide and glycopeptide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

32 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Salmonella enteritidis 09 FF-D strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; sulfonamide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

256 mg/l

91/249

2016-07-13 00:31:19

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Salmonella typhimurium FFUP40 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; sulfonamide-resistant strain; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

256 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Staphylococcus aureus ATCC 29213 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

32 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis ATCC 29212 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

92/249

2016-07-13 00:31:19

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

32 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Acetinobacter baumannii FFUP10 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

256 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Pseudomonas aeruginosa ATCC 27853 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

256 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Salmonella typhimurium FFUP1 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

93/249

2016-07-13 00:31:19

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

256 mg/l

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Escherichia coli ATCC 25922 strain

Concentration (Pharmacological Data)

16 - 512 mg/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in ethanol or water

Method (Pharmacological Data)

agar dilution method; test bacteria incubated with title comp. in Mueller-Hinton II culture medium at 35 deg C overnight

Further Details (Pharmacological Data)

MIC: lowest concentration of title comp. that prevented visible growth; solvent had no effect on microorganism

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

256 mg/l

Effect (Pharmacological Data)

growth stimulant

Species or Test-System (Pharmacological Data)

chicken

Route of Application

peroral

Method (Pharmacological Data)

single dosing with 12 and 100 mu g/g title comp. in DMSO and 200 and 400 mu g/g title comp. in distilled water(DW)/Tween20; control: untreated chicks

Results

increased weight gain 4 days after a single treatment; chichs treated with 100 mu g/g title comp. in DMSO showed 32percent increase in weight gain over the control group; treatment wtih 12 mu g/g DMSO, 200 and 400 mu g/g DW/T20 gave a mean weight gain of 17 percent; diagram

Location

Page 20-21

Patent; BIODIEM LTD; WO2004/76423; (2004); (A1) English, View in Reaxys 41 of 41

Effect (Pharmacological Data)

pharmacokinetics

Species or Test-System (Pharmacological Data)

chicken

Route of Application

peroral

Method (Pharmacological Data)

day-old chicks; administration of title comp. in DMSO at 100 mu g/g - 200 mu g/g and in distilled water (DW)/5percent Tween20 at 100 - 500 mu g/g; plasma levels after treatment with title comp. at 100 mu g/g in DMSO and at 400 mu g/g in DW/Tween20

94/249

2016-07-13 00:31:19

Results

very little absorbtion from a single oral dosing; blood levels for doses 12 mu g/g DMSO or 200 mu g/g DW below the limits of detection; at 100 mu g/g DMSO and 400 mu g/g DW peak levels of 850 ng/g at 48 h; diagram

Location

Page 20-21

Patent; BIODIEM LTD; WO2004/76423; (2004); (A1) English, View in Reaxys

Reaxys ID 9768596 View in Reaxys

5/183 CAS Registry Number: 905564-21-8 Chemical Name: (E)-3-[3,4-(methylenedioxy)phenyl]-2-nitroprop-2-en-1-ol; (2E)-3-(benzo[d][1,3]dioxol-5-yl)-2-nitroprop-2en-1-ol; (E)-3-(benzo[d][1,3]dioxol-5-yl)-2-nitroprop-2-en-1-ol; (2E)-3-(1,3-benzodioxol-5-yl)-2-nitroprop-2-en-1-ol; (E)-3-(benzo[d][1,3]dioxol-6-yl)-2-nitroprop-2-en-1-ol Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: WGMJOSLIKRMTQU-FPYGCLRLSA-N Note:

O E

O O

Substance Label (6) Label References 1g

Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Tetrahedron Letters; vol. 56; nb. 35; (2015); p. 4980 - 4983; Art.No: 46492, View in Reaxys

IIa6

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys

Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys

Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys

Rastogi, Namrata; Namboothiri, Irishi N. N.; Cojocaru, Miriam; Tetrahedron Letters; vol. 45; nb. 24; (2004); p. 4745 - 4748, View in Reaxys

Melting Point (4) 1 of 4

Melting Point [°C]

96 - 98

Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys 2 of 4

Melting Point [°C]

Solvent (Melting Point)

dichloromethane; hexane

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 3 of 4

Melting Point [°C]

89 - 93

Solvent (Melting Point)

diethyl ether; hexane

Melting Point [°C]

100 - 102

Solvent (Melting Point)

CH2Cl2; petroleum ether

95/249

2016-07-13 00:31:19

Colour & Other Properties

References

orange

yellow

Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys

Electrochemical Characteristics (2) 1 of 2

Description (Electrochemical Characteristics)

oxidation potential

Solvent (Electrochemical Characteristics)

methanol; H2SO4

Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys 2 of 2

Description (Electrochemical Characteristics)

reduction potential

Solvent (Electrochemical Characteristics)

methanol; H2SO4

Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys NMR Spectroscopy (13) 1 of 13

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys 2 of 13

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys 3 of 13

Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

62.5

Original Text (NMR Spectroscopy)

13C

Comment (NMR Spectroscopy)

Signals given

NMR (CDCl3, 62.5 MHz) δ 56.5, 101.8, 108.9, 109.6, 125.0, 126.5, 137.9, 147.6, 148.4, 150.3

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

96/249

2016-07-13 00:31:19

4 of 13

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

250

Original Text (NMR Spectroscopy)

Comment (NMR Spectroscopy)

Signals given

NMR (CDCl3, 250 MHz) δ 2.88 (broad s, IH), 4.71 (s, 2H), 6.05 (s, 2H), 6.88 (d, IH), 7.11 (m, 2H), 8.11 (s, IH).

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 5 of 13

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

250

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

62.5

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

62.5

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

250

97/249

2016-07-13 00:31:19

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys 10 of 13

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys 2 of 4

Solvent (IR Spectroscopy)

chloroform

Original Text (IR Spectroscopy)

IR (CHCl3) 3534 (OH), 1503 (NO2) cm"1

98/249

2016-07-13 00:31:19

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 3 of 4

Description (IR Spectroscopy)

Bands

Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys 4 of 4

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

References

Spectrum

Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys

CI (Chemical ioni- Molecular peak zation)

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

spectrum; chemical ionization (CI)

spectrum; desorption chemical ionization (DCI)

Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys

Pharmacological Data (2) 1 of 2

Comment (Pharmacological Data)

Bioactivities present

Rastogi, Namrata; Namboothiri, Irishi N. N.; Cojocaru, Miriam; Tetrahedron Letters; vol. 45; nb. 24; (2004); p. 4745 - 4748, View in Reaxys; Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys; Mascarenhas, Ronald J.; Namboothiri, Irishi N.; Sherigara, Bailure S.; Mahadevan, Kittappa M.; Croatica Chemica Acta; vol. 80; nb. 1; (2007); p. 53 - 59, View in Reaxys; Martinez-Bescos, Patricia; Cagide-Fagin, Fernando; Roa, Luis F.; Ortiz-Lara, Juan Carlos; Kierus, Krzysztof; Ozores-Viturro, Lidia; Fernandez-Gonzalez, Marta; Alonso, Ricardo; Journal of Organic Chemistry; vol. 73; nb. 10; (2008); p. 3745 - 3753, View in Reaxys; Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys; Bakthadossn, Manickam; Sivakumar, Nagappan; Synlett; nb. 6; (2009); p. 1014 - 1018, View in Reaxys; Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Sharada, Duddu S.; Synthesis; nb. 13; (2011); p. 2136 - 2146, View in Reaxys; Lima-Junior, Claudio G.; Vasconcellos, Mario L.A.A.; Bioorganic and Medicinal Chemistry; vol. 20; nb. 13; (2012); p. 3954 - 3971, View in Reaxys; Urbanietz, Gregor; Atodiresei, Iuliana; Enders, Dieter; Synthesis (Germany); vol. 46; nb. 9; (2014); p. 1261 - 1269; Art.No: SS-2014-Z0060-OP, View in Reaxys; Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Tetrahedron Letters; vol. 56; nb. 35; (2015); p. 4980 - 4983; Art.No: 46492, View in Reaxys 2 of 2

Effect (Pharmacological Data)

antiproliferative

Species or Test-System (Pharmacological Data)

HeLa cells

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Method (Pharmacological Data)

test cells in MEM incubated with title comp. at 37 deg C for 24 h; cell growth stopped by addition of 10 percent trichloroacetic acid; sulforhodamine B assay; absorbance measured at 560 nm

Further Details (Pharmacological Data)

IC50: concentration of title comp. that inhibited cell proliferation by 50 percent; MEM: Eagle's minimum essential medium

Type (Pharmacological Data)

IC50

99/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

38 μmol/l

Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys

Reaxys ID 4689696 View in Reaxys

CAS Registry Number: 5438-41-5; 37629-56-4 Chemical Name: 2-nitro-1-(3,4-methylenedioxyphenyl)-1-propene; 5-(2-nitro-1(Z)-ethenyl)benzo[d][1,3]dioxol Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 Type of Substance: heterocyclic InChI Key: CCEVJKZHAJJQJR-DAXSKMNVSA-N Note:

O O

6/183

Substance Label (8) Label References 2f

Pradhan, Prasun K.; Dey, Sumit; Jaisankar, Parasuraman; Giri, Venkatachalam S.; Synthetic Communications; vol. 35; nb. 7; (2005); p. 913 - 922, View in Reaxys

Tab.1.col.3.run 2,3

Ranu, Brindaban C.; Dey, Suvendu S.; Tetrahedron Letters; vol. 44; nb. 14; (2003); p. 2865 - 2868, View in Reaxys

1b/1l

Yadav; Subba Reddy; Srinivas; Ramalingam; Synlett; nb. 10; (2000); p. 1447 - 1449, View in Reaxys

3a, R1R2=OCH2O

Kelkar, Shriniwas L.; Phadke, Chetan P.; Marina, Sister; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 23; nb. 5; (1984); p. 458 - 459, View in Reaxys

Rastogi, Shri Niwas; Kansal, V. K.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 3; (1983); p. 234 - 237, View in Reaxys

Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 8; (1983); p. 725 - 726, View in Reaxys

XVI

Bhide, Bhaskar H.; Shah, Kashmira K.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 19; nb. 1; (1980); p. 9 - 12, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

97 - 98

Solvent (Melting Point)

ethanol

Bhide, Bhaskar H.; Shah, Kashmira K.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 19; nb. 1; (1980); p. 9 - 12, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

29.84

100/249

2016-07-13 00:31:19

Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys 2 of 3

Description (NMR Spec- HSQC (Heteronuclear Single Quantum Coherence); Spectrum troscopy) Nucleus (NMR Spectroscopy)

1H; 13C

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

29.84

Location

supporting information

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

29.84

Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

UV/VIS Spectroscopy (1) 1 of 1

Absorption Maxima (UV/ 366 VIS) [nm] Ext./Abs. Coefficient [l·mol-1cm-1]

9500

Comment (Pharmacological Data)

Bioactivities present

Kelkar, Shriniwas L.; Phadke, Chetan P.; Marina, Sister; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 23; nb. 5; (1984); p. 458 - 459, View in Reaxys; Bhide, Bhaskar H.; Shah, Kashmira K.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 19; nb. 1; (1980); p. 9 - 12, View in Reaxys; Rastogi, Shri Niwas; Kansal, V. K.; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 3; (1983); p. 234 - 237, View in Reaxys; Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 8; (1983); p. 725 - 726, View in Reaxys; Yadav; Subba Reddy; Srinivas; Ramalingam; Synlett; nb. 10; (2000); p. 1447 - 1449, View in Reaxys; Mulholland; Zheng; Synthetic Communications; vol. 31; nb. 20; (2001); p. 3059 - 3068, View in Reaxys; Ranu, Brindaban C.; Dey, Suvendu S.; Tetrahedron Letters; vol. 44; nb. 14; (2003); p. 2865 - 2868, View in Reaxys; Pradhan, Prasun K.; Dey, Sumit; Jaisankar, Parasuraman; Giri, Venkatachalam S.; Synthetic Communications; vol. 35; nb. 7; (2005); p. 913 - 922,

101/249

2016-07-13 00:31:19

View in Reaxys; Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys 2 of 2

Comment (Pharmacological Data)

physiological behaviour discussed

Reaxys ID 24583 View in Reaxys

7/183 CAS Registry Number: 15896-78-3 Chemical Name: (E?)-3-methoxy-4,5-methylenedioxy-β-nitrostyrene; 4-methoxy-6-(2-nitro-vinyl)-benzo[1,3]dioxole; (E?)-3Methoxy-4,5-methylendioxy-β-nitro-styrol; 4-Methoxy-6-(2-nitrovinyl)-benzo[1,3]dioxol; 4-methoxy-6-(2-nitrovinyl)-1,3-benzodioxole Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: XMXLXUDKGGRTAW-NSCUHMNNSA-N Note:

O E

O O

Substance Label (2) Label References 2

table 1, entry 8

Nyerges, Miklos; Balazs, Laszlo; Kadas, Istvan; Bitter, Istvan; Koevesdi, Istvan; Toeke, Laszlo; Tetrahedron; vol. 51; nb. 24; (1995); p. 6783 - 6788, View in Reaxys

Melting Point (3) 1 of 3

Melting Point [°C]

210 - 211

Solvent (Melting Point)

butan-1-ol

Hamlin; Weston; Journal of the American Chemical Society; vol. 71; (1949); p. 2210, View in Reaxys 2 of 3

Melting Point [°C]

212 - 213

Solvent (Melting Point)

ethanol

Spaeth; Gangl; Monatshefte fuer Chemie; vol. 44; (1923); p. 110, View in Reaxys 3 of 3

Melting Point [°C]

212 - 213

Solvent (Melting Point)

benzene

Spaeth; Gangl; Monatshefte fuer Chemie; vol. 44; (1923); p. 110, View in Reaxys NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Nucleus (NMR Spectroscopy)

102/249

2016-07-13 00:31:19

Coupling Nuclei

Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys Pharmacological Data (35) 1 of 35

Comment (Pharmacological Data)

Bioactivities present

Spaeth; Gangl; Monatshefte fuer Chemie; vol. 44; (1923); p. 110, View in Reaxys; Kindler; Brandt; Archiv der Pharmazie (Weinheim, Germany); vol. 273; (1935); p. 478,482, View in Reaxys; Hamlin; Weston; Journal of the American Chemical Society; vol. 71; (1949); p. 2210, View in Reaxys; Nyerges, Miklos; Balazs, Laszlo; Kadas, Istvan; Bitter, Istvan; Koevesdi, Istvan; Toeke, Laszlo; Tetrahedron; vol. 51; nb. 24; (1995); p. 6783 - 6788, View in Reaxys; Ji, Jianguo; Barnes, David M.; Zhang, Ji; King, Steven A.; Wittenberger, Steven J.; Morton, Howard E.; Journal of the American Chemical Society; vol. 121; nb. 43; (1999); p. 10215 - 10216, View in Reaxys; Barnes, David M.; Wittenberger, Steven J.; Zhang, Ji; Ji, Jianguo; Fickes, Michael G.; Fitzgerald, Michael A.; King, Steven A.; Morton, Howard E.; Plagge, Frederick A.; Preskill, Margo; Wagaw, Seble H.; Journal of the American Chemical Society; vol. 124; nb. 44; (2002); p. 13097 - 13105, View in Reaxys; Patent; Abbott Laboratories; US6162927; (2000); (A1) English, View in Reaxys; Pettit, Robin K.; Pettit, George R.; Hamel, Ernest; Hogan, Fiona; Moser, Bryan R.; Wolf, Sonja; Pon, Sandy; Chapuis, Jean-Charles; Schmidt, Jean M.; Bioorganic and Medicinal Chemistry; vol. 17; nb. 18; (2009); p. 6606 - 6612, View in Reaxys 2 of 35

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

leukemia P388 cells of mouse

Results

no effect

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis ATCC 29212

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 100 μg/disc

103/249

2016-07-13 00:31:19

4 of 35

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Streptococcus pneumoniae ATCC 6303

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 100 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Staphylococcus aureus ATCC 29213

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 100 μg/disc

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Cryptococcus neoformans ATCC 90112

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

3.12 - 6.25 μg/disc

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Candida albicans ATCC 90028

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

104/249

2016-07-13 00:31:19

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

1.56 - 3.12 μg/disc

Effect (Pharmacological Data)

tubulin polymerization; inhibition of

Species or Test-System (Pharmacological Data)

not explicitly stated by authors

Further Details (Pharmacological Data)

inhibitory concentration (IC); IC50 related to: tubulin

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

5.6 μmol/l

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

renal cancer A498 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

ovary cancer OVCAR-3 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

melanoma SK-MEL-5 cells of human

Results

no effect

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Staphylococcus aureus ATCC 29213

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

105/249

2016-07-13 00:31:19

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

fungicidal

Species or Test-System (Pharmacological Data)

Cryptococcus neoformans ATCC 90112

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal fungicidal concentration (MFC)

Type (Pharmacological Data)

MFC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Cryptococcus neoformans ATCC 90112

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

64 μg/ml

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Candida albicans ATCC 90028

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

106/249

2016-07-13 00:31:19

Species or Test-System (Pharmacological Data)

Neisseria gonorrhoeae ATCC 49226

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

1.56 - 3.12 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterobacter cloacae ATCC 13047

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 100 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Escherichia coli ATCC 25922

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 100 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Stenotrophomonas maltophilia ATCC 13637

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

107/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

> 100 μg/disc

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Micrococcus luteus Presque Isle 456

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 100 μg/disc

Effect (Pharmacological Data)

bactericidal

Species or Test-System (Pharmacological Data)

Neisseria gonorrhoeae ATCC 49226

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal bactericidal concentration (MBC)

Type (Pharmacological Data)

MBC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Neisseria gonorrhoeae ATCC 49226

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterobacter cloacae ATCC 13047

108/249

2016-07-13 00:31:19

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Escherichia coli ATCC 25922

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Stenotrophomonas maltophilia ATCC 13637

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Micrococcus luteus Presque Isle 456

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

109/249

2016-07-13 00:31:19

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Enterococcus faecalis ATCC 29212

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Streptococcus pneumoniae ATCC 6303

Kind of Dosing (Pharmacological Data)

DMSO solution

Further Details (Pharmacological Data)

minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

> 64 μg/ml

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

CNS cancer SF295 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

CNS cancer SF268 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

lung-NSC cancer NCI-H460 cells of human

110/249

2016-07-13 00:31:19

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

prostate cancer DU-145 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

colon cancer KM20L2 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

breast cancer MCF-7 cells of human

Results

no effect

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

pancreas cancer BXPC-3 cells of human

Results

no effect

Reaxys ID 87862 View in Reaxys

8/183 CAS Registry Number: 33036-23-6 Chemical Name: 5-[(E)-2-nitro-2-phenylvinyl]benzeno[d][1,3]dioxole; 3,4-methylenedioxy-α'-nitro-cis-stilbene; 3,4-Methylendioxy-α'-nitro-cis-stilben; 3',4'-Methylendioxy-α-nitrostilben Linear Structure Formula: C15H11NO4 Molecular Formula: C15H11NO4 Molecular Weight: 269.257 Type of Substance: heterocyclic InChI Key: OZZVAPJRDQCACG-MDWZMJQESA-N Note:

O O

Substance Label (4) Label References 12c

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys

111/249

2016-07-13 00:31:19

Blake,K.W.; Jaques,B.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); (1973); p. 1660 - 1663, View in Reaxys

Dore,J.-C. et al.; Chimica Therapeutica; vol. 6; (1971); p. 167 - 185, View in Reaxys

Related Structure (1) Related Structure References Ueber die Konfiguration der Stereoisomeren s..

Blake; Jaques; J.C.S. Perkin; vol. II; p. 1973,1660, 1661, View in Reaxys

Melting Point (2) 1 of 2

Melting Point [°C]

126

Dore,J.-C. et al.; Chimica Therapeutica; vol. 6; (1971); p. 167 - 185, View in Reaxys 2 of 2

Melting Point [°C]

129 - 129.5

Reichert; Kuhn; Chemische Berichte; vol. 74; (1941); p. 328,333, View in Reaxys Crystal Property Description (1) Colour & Other References Properties deep-yellow

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys

NMR Spectroscopy (5) 1 of 5

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

399.883

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 2 of 5

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

399.883

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 3 of 5

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]

100.562

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 4 of 5

Description (NMR Spec- Chemical shifts troscopy)

112/249

2016-07-13 00:31:19

Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 5 of 5

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Blake,K.W.; Jaques,B.; Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999); (1973); p. 1660 - 1663, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; electron impact (EI)

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys

Reaxys ID 264011 View in Reaxys

9/183 CAS Registry Number: 97383-34-1 Chemical Name: 4-methoxy-6-(2-nitro-propenyl)-benzo[1,3]dioxole; 4-Methoxy-6-(2-nitro-propenyl)-benzo[1,3]dioxol; 1-<3Methoxy-4,5-methylendioxy-phenyl>-2-nitro-propen Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: URIZGFKLZDNSIH-XVNBXDOJSA-N Note:

O E

O O

Substance Label (3) Label References 2

Patent; DADE BEHRING INC.; WO2005/61482; (2005); (A1) English, View in Reaxys

Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys

table, entry 4, product

Sy, Wing-Wah; By, Arnold W.; Tetrahedron Letters; vol. 26; nb. 9; (1985); p. 1193 - 1196, View in Reaxys

Derivative (1) Comment (Derivative) Addukt m. (+-)-αMethyl-benzylamin C19H22N2O5 : beim Erhitzen v. 1-<3-Methoxy-4,5-methylendioxy-phenyl>-2-nitro-propen m. einem Ueberschuss v. (+-)-

References Shulgin; Canadian Journal of Chemistry; vol. 46; (1968); p. 75, View in Reaxys

113/249

2016-07-13 00:31:19

α-Methyl-benzylamin u. Bhdln. des Rk.prod. m. W. ; F: 161grad (Zers.) Melting Point (3) 1 of 3

Melting Point [°C]

110

Solvent (Melting Point)

methanol

Shulgin; Canadian Journal of Chemistry; vol. 46; (1968); p. 75, View in Reaxys 2 of 3

Melting Point [°C]

110

Shulgin; Experientia; vol. 20; nb. 7; (1964); p. 366 - 367, View in Reaxys 3 of 3

Melting Point [°C]

112

Solvent (Melting Point)

ethanol

Rimini; Gazzetta Chimica Italiana; vol. 35 I; (1905); p. 413,414, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelbe Nadeln

Rimini; Gazzetta Chimica Italiana; vol. 35 I; (1905); p. 413,414, View in Reaxys

Further Information (1) Description (Fur- References ther Information) Further information

Shulgin; Canadian Journal of Chemistry; vol. 46; (1968); p. 75, View in Reaxys

NMR Spectroscopy (3) 1 of 3

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Original Text (NMR Spectroscopy)

1H- NMR (CDCI3, 400 MHz) 8 : 7.97 (s, 2H), 6.65 (s, 1H), 6.63 (s, 1H), 3.92 (s, 3H), 2.45 (s, 3H);

Comment (NMR Spectroscopy)

Signals given

Patent; DADE BEHRING INC.; WO2005/61482; (2005); (A1) English, View in Reaxys 2 of 3

Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Original Text (NMR Spectroscopy)

13C-NMR (CDCI3, 100 MHz) 8 : 149.7, 146.8, 144.1, 137.5, 134.1, 127.0, 111.7 104.1, 102.6, 57.2, 14.57.

Comment (NMR Spectroscopy)

Signals given

Patent; DADE BEHRING INC.; WO2005/61482; (2005); (A1) English, View in Reaxys 3 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy)

114/249

2016-07-13 00:31:19

Temperature (NMR Spectroscopy) [°C]

26.9

Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys

Reaxys ID 87863 View in Reaxys

10/183 CAS Registry Number: 50882-25-2 Chemical Name: 3,4-methylenedioxy-α'-nitro-trans-stilbene; 3,4-methylenedioxy-α'-nitro-stilbene; 3,4-Methylendioxy-α'-nitrotrans-stilben; 3,4-Methylendioxy-α'-nitro-stilben; 3.4-Methylendioxy-α'-nitro-stilben Linear Structure Formula: C15H11NO4 Molecular Formula: C15H11NO4 Molecular Weight: 269.257 Type of Substance: heterocyclic InChI Key: OZZVAPJRDQCACG-JYRVWZFOSA-N Note:

O O

Related Structure (1) Related Structure References Konfiguration der Stereoisomeren s..

Blake; Jaques; J.C.S. Perkin; vol. II; p. 1973,1660, 1661, View in Reaxys

Melting Point (3) 1 of 3

Melting Point [°C]

129 - 129.5

Solvent (Melting Point)

ethanol; acetic acid

Robertson,D.N.; Journal of Organic Chemistry; vol. 25; (1960); p. 47 - 49, View in Reaxys 2 of 3

Melting Point [°C]

123 - 123.5

Solvent (Melting Point)

ethanol

Reichert; Kuhn; Chemische Berichte; vol. 74; (1941); p. 328,333, View in Reaxys 3 of 3

Melting Point [°C]

124

Solvent (Melting Point)

ethanol

Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys Crystal Property Description (2) Colour & Other References Properties Orange

Reichert; Kuhn; Chemische Berichte; vol. 74; (1941); p. 328,333, View in Reaxys

gelb

Knoevenagel; Walter; Chemische Berichte; vol. 37; (1904); p. 4508, View in Reaxys

Reaxys ID 226696 View in Reaxys

11/183 CAS Registry Number: 960211-64-7 Chemical Name: (Z)-5-(2-bromo-2-nitrovinyl)benzeno[d][1,3]dioxole; (Z)-5-(2-bromo-2-nitrovinyl)benzo[d][1,3]dioxole; β-bromo-3,4-methylenedioxy-β-nitro-styrene; β-Brom-3,4-methylendioxy-β-nitro-styrol Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 Type of Substance: heterocyclic InChI Key: WEYZGKQDMSTRQD-RUDMXATFSA-N Note:

O O O

115/249

2016-07-13 00:31:19

Substance Label (2) Label References 1q

Feng, Juhua; Lin, Lili; Yu, Kunru; Liu, Xiaohua; Feng, Xiaoming; Advanced Synthesis and Catalysis; vol. 357; nb. 6; (2015); p. 1305 - 1310, View in Reaxys

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys

Related Structure (2) Related Structure References Eine Verbindung Neber; Burgard; Thier; Justus Liebigs Annalen der Chemie; vol. 526; (1936); p. 277,287, View in Reaxys dieser Konstitution hat vermutlich auch in einem von .... ... als α-Brom-3,4- Beilstein Handbook, View in Reaxys methylendioxy-βnitro-styrol (C9H6BrNO4) beschriebenen Praeparat (F: 98-99grad) vorgelegen, das nach dem fuer ξ-βBrom-3,4-methylendioxy-ξ-β-nitrostyrol angegebenen (s. E II 27) Verfahren hergestellt worden ist.. Melting Point (3) 1 of 3

Melting Point [°C]

100 - 101

Solvent (Melting Point)

hexane; CH2Cl2

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 2 of 3

Melting Point [°C]

Reichert; Koch; Chemische Berichte; vol. 68; (1935); p. 445,450, View in Reaxys 3 of 3

Melting Point [°C]

101 - 102

Solvent (Melting Point)

ethanol

Rosenmund; Kuhnhenn; Chemische Berichte; vol. 56; (1923); p. 1265, View in Reaxys Crystal Property Description (2) Colour & Other References Properties light-yellow

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys

gelbe Nadeln

Rosenmund; Kuhnhenn; Chemische Berichte; vol. 56; (1923); p. 1265, View in Reaxys

NMR Spectroscopy (6) 1 of 6

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Feng, Juhua; Lin, Lili; Yu, Kunru; Liu, Xiaohua; Feng, Xiaoming; Advanced Synthesis and Catalysis; vol. 357; nb. 6; (2015); p. 1305 - 1310, View in Reaxys

116/249

2016-07-13 00:31:19

2 of 6

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

101

Location

supporting information

Feng, Juhua; Lin, Lili; Yu, Kunru; Liu, Xiaohua; Feng, Xiaoming; Advanced Synthesis and Catalysis; vol. 357; nb. 6; (2015); p. 1305 - 1310, View in Reaxys 3 of 6

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

399.883

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 4 of 6

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

399.883

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 5 of 6

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

100.562

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys 6 of 6

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

100.562

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

117/249

2016-07-13 00:31:19

Ganesh, Madhu; Namboothiri, Irishi N.N.; Tetrahedron; vol. 63; nb. 48; (2007); p. 11973 - 11983, View in Reaxys

Reaxys ID 255079 View in Reaxys

12/183 CAS Registry Number: 15794-43-1 Chemical Name: 6,β-dinitro-3,4-methylenedioxystyrene; 5-nitro-6-(2-nitro-vinyl)-benzo[1,3]dioxole; ο,2-Dinitro-4,5-methylendioxy-styrol Linear Structure Formula: C9H6N2O6 Molecular Formula: C9H6N2O6 Molecular Weight: 238.156 Type of Substance: heterocyclic InChI Key: WWYLHVBUDLOVIP-UHFFFAOYSA-N Note:

O N

O O

Substance Label (3) Label References 1E

Sinhababu; Borchardt; Journal of Organic Chemistry; vol. 48; nb. 19; (1983); p. 3347 - 3349, View in Reaxys

Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys

XII

Adlerova,E. et al.; Collection of Czechoslovak Chemical Communications; vol. 25; (1960); p. 784 - 796, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

121 - 122

Solvent (Melting Point)

ethanol

Adlerova,E. et al.; Collection of Czechoslovak Chemical Communications; vol. 25; (1960); p. 784 - 796, View in Reaxys

Reaxys ID 1348589 View in Reaxys

13/183 CAS Registry Number: 1211-65-0 Chemical Name: 1-(3,4-Methylenedioxyphenyl)-2-nitro-1-butene; 5-(2-nitro-but-1-enyl)-benzo[1,3]dioxole; 3,4-Methylendioxy-1-(2-nitro-but-1-enyl)-benzol; 2-Nitro-(3,4-methylendioxyphenyl)-but-1-en; 6β-Nitrobutenyl-benzo<1,3>dioxol; 1-(3'4'Methylendioxyphenyl)-2-nitro-buten Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: LHWIZYOSZOQHOY-UHFFFAOYSA-N Note:

O O

Substance Label (2) Label References VII

Azafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 39; nb. 4.1; (1990); p. 738 - 741; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 4; (1990); p. 829 - 832, View in Reaxys

Agafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 38; nb. 2; (1989); p. 1982; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; vol. 9; (1989); p. 2153, View in Reaxys

Melting Point (3) 1 of 3

Melting Point [°C]

66 - 66.5

Solvent (Melting Point)

methanol

118/249

2016-07-13 00:31:19

skaya; vol. 9; (1989); p. 2153, View in Reaxys; Azafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 39; nb. 4.1; (1990); p. 738 741; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 4; (1990); p. 829 - 832, View in Reaxys 2 of 3

Melting Point [°C]

64.2 - 65

Solvent (Melting Point)

diethyl ether; hexane

Silver,R.F. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1001 - 1006, View in Reaxys 3 of 3

Melting Point [°C]

60 - 61

Koremura; Nippon Kagaku Kaishi; vol. 36; nb. 7; (1962); p. 552,553-556; Chem.Abstr.; vol. 62; nb. 3962d; (1965), View in Reaxys Liquid/Liquid Systems (MCS) (1) 1 of 1

Description (Liquid/ Liquid Systems (MCS))

Distribution between solvent 1 + 2

Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 44; (1966); p. 1035 - 1043, View in Reaxys NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CHCl3 scopy) Azafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 39; nb. 4.1; (1990); p. 738 - 741; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 4; (1990); p. 829 - 832, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Agafonov, N. E.; Sedishev, I. P.; Zhulin, V. M.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 38; nb. 2; (1989); p. 1982; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; vol. 9; (1989); p. 2153, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1

Description (UV/VIS Spectroscopy)

Absorption maxima

Currie,D.J. et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1567 - 1580, View in Reaxys

Reaxys ID 27296 View in Reaxys

14/183 CAS Registry Number: 124201-30-5 Chemical Name: trans-1-(3,4-(Methylenedioxy)-6-nitrophenyl)-2-nitroethene; (E)-5-nitro-6-(2-nitrovinyl)benzo[d][1,3]dioxole; (E?)-4,5-methylenedioxy-2,β-dinitro-styrene; (E?)-4,5Methylendioxy-2,β-dinitro-styrol Linear Structure Formula: C9H6N2O6 Molecular Formula: C9H6N2O6 Molecular Weight: 238.156 Type of Substance: heterocyclic InChI Key: WWYLHVBUDLOVIP-OWOJBTEDSA-N Note:

O N E

O O

Substance Label (4) Label References

119/249

2016-07-13 00:31:19

Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 - 3358, View in Reaxys

Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys

Nyerges, Miklos; Rudas, Monika; Toth, Gabor; Herenyi, Bulcsu; Kadas, Istvan; et al.; Tetrahedron; vol. 51; nb. 48; (1995); p. 13321 - 13330, View in Reaxys

Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys

Melting Point (4) 1 of 4

Melting Point [°C]

110 - 111

Location

supporting information

Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 - 3358, View in Reaxys 2 of 4

Melting Point [°C]

110 - 111

Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys 3 of 4

Melting Point [°C]

111 - 112.5

Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys 4 of 4

Melting Point [°C]

118

Solvent (Melting Point)

ethanol

Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys Crystal Property Description (3) Colour & Other Location Properties yellow

supporting information

References Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 3358, View in Reaxys

yellow

Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys

Gelb

Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys

NMR Spectroscopy (7) 1 of 7

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 - 3358, View in Reaxys 2 of 7

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

101

120/249

2016-07-13 00:31:19

Location

supporting information

Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 - 3358, View in Reaxys 3 of 7

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys 4 of 7

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys 5 of 7

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys 6 of 7

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys 7 of 7

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys IR Spectroscopy (1)

121/249

2016-07-13 00:31:19

1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Comment (IR Spectroscopy)

3105 - 408 cm**(-1)

Gardiner; Bryce; Bates; Hursthouse; Journal of Organic Chemistry; vol. 55; nb. 4; (1990); p. 1261 - 1266, View in Reaxys Mass Spectrometry (3) Description (Mass Location Spectrometry)

References

high resolution supporting informass spectrome- mation try (HRMS); electrospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum

Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 3358, View in Reaxys

gas chromatogra- supporting inforphy mass specmation trometry (GCMS); spectrum

Maity, Soham; Manna, Srimanta; Rana, Sujoy; Naveen, Togati; Mallick, Arijit; Maiti, Debabrata; Journal of the American Chemical Society; vol. 135; nb. 9; (2013); p. 3355 3358, View in Reaxys

gas chromatography mass spectrometry (GCMS); spectrum

Naveen, Togati; Maity, Soham; Sharma, Upendra; Maiti, Debabrata; Journal of Organic Chemistry; vol. 78; nb. 12; (2013); p. 5949 - 5954, View in Reaxys

Reaxys ID 1347548 View in Reaxys

15/183 CAS Registry Number: 1805-90-9 Chemical Name: 5-(2-nitro-phenyl)-benzo[1,3]dioxole; 2'-Nitro-3,4-methylendioxy-biphenyl; 3,4-Methylendioxy-2'-nitro-biphenyl Linear Structure Formula: C13H9NO4 Molecular Formula: C13H9NO4 Molecular Weight: 243.219 Type of Substance: heterocyclic InChI Key: PAXLFPPTTCKNAD-UHFFFAOYSA-N Note:

O O

Substance Label (4) Label References 3aj

Katayev, Dmitry; Exner, Benjamin; Goossen, Lukas J.; ChemCatChem; vol. 7; nb. 14; (2015); p. 2028 2032, View in Reaxys

3ae

Creech, Gardner S.; Kwon, Ohyun; Chemical Science; vol. 4; nb. 6; (2013); p. 2670 - 2674, View in Reaxys

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Hill; Carlson; Tetrahedron Letters; (1964); p. 1157,1158, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

84 - 85

Solvent (Melting Point)

acetone

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys Further Information (1) Description (Fur- References ther Information)

122/249

2016-07-13 00:31:19

Further information

Hill; Carlson; Tetrahedron Letters; (1964); p. 1157,1158, View in Reaxys

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Spectrum troscopy) Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Spectrum

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Reaxys ID 6410710 View in Reaxys

16/183 Chemical Name: 1-(2'-Brom-4',5'-methylendioxyphenyl)-2-nitroaethylen; (E)-5-bromo-6-(2-nitrovinyl)benzo[d][1,3]dioxole Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 Type of Substance: heterocyclic InChI Key: UKQZUXNFVBFRRY-OWOJBTEDSA-N Note:

O N E

O O

Substance Label (4) Label References 2f

Gonzlez-Olvera; Vergara-Arenas; Negrn-Silva; Angeles-Beltrn; Lomas-Romero; Gutirrez-Carrillo; Lara; Morales-Serna; RSC Advances; vol. 5; nb. 120; (2015); p. 99188 - 99192, View in Reaxys

Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 - 4239, View in Reaxys

Garcia-Torres, Alejandro; Cruz-Almanza, Rymundo; Miranda, Luis D.; Tetrahedron Letters; vol. 45; nb. 10; (2004); p. 2085 - 2088, View in Reaxys

Blarer, Stefan J.; Schweizer, W. Bernd; Seebach, Dieter; Helvetica Chimica Acta; vol. 65; nb. 5; (1982); p. 1637 - 1654, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

163 - 166

Solvent (Melting Point)

hexane; dichloromethane

Location

supporting information

Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 4239, View in Reaxys Crystal Property Description (1) Colour & Other Location Properties yellow

supporting information

References Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 - 4239, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Location

supporting information

123/249

2016-07-13 00:31:19

Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 4239, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

Location

supporting information

Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 4239, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

neat (no solvent, solid phase)

Location

supporting information

Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 4239, View in Reaxys Mass Spectrometry (1) Description (Mass Location Spectrometry) high resolution mass spectrometry (HRMS); electron impact (EI); spectrum

References

supporting information

Kolarovic, Andrej; Kaeslin, Alexander; Wennemers, Helma; Organic Letters; vol. 16; nb. 16; (2014); p. 4236 - 4239, View in Reaxys

Reaxys ID 22682218 View in Reaxys

17/183 CAS Registry Number: 1381932-34-8 Linear Structure Formula: C15H15NO8 Molecular Formula: C15H15NO8 Molecular Weight: 337.286 InChI Key: PUBDUNNNNNHLRH-UHFFFAOYSA-N Note:

O N

O O

Substance Label (2) Label References 1d

Kumar, Tarun; Verma, Deepti; Menna-Barreto, Rubem F. S.; Valena, Wagner O.; Da Silva Jnior, Eufrnio N.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 13; nb. 7; (2015); p. 1996 - 2000, View in Reaxys; Mane, Vaijinath; Kumar, Tarun; Pradhan, Sourav; Katiyar, Savita; Namboothiri, Irishi N. N.; RSC Advances; vol. 5; nb. 86; (2015); p. 69990 - 69999, View in Reaxys; Gopi, Elumalai; Kumar, Tarun; Menna-Barreto, Rubem F. S.; Valena, Wagner O.; Da Silva Jnior, Eufrnio N.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 13; nb. 38; (2015); p. 9862 - 9871, View in Reaxys

Gopi, Elumalai; Namboothiri, Irishi N. N.; Journal of Organic Chemistry; vol. 79; nb. 16; (2014); p. 7468 7476, View in Reaxys

Reaxys ID 356933 View in Reaxys

18/183

124/249

2016-07-13 00:31:19

CAS Registry Number: 15433-98-4 Chemical Name: 3-(2-benzo[1,3]dioxol-5-yl-7-methoxy-3-nitrobenzofuran-5-yl)-propan-1-ol; 3-Nitro-egonol Linear Structure Formula: C19H17NO7 Molecular Formula: C19H17NO7 Molecular Weight: 371.346 Type of Substance: heterocyclic InChI Key: UZQRAWVQRTYFBF-UHFFFAOYSA-N Note:

O O N

Substance Label (1) Label References 11

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys

Melting Point (3) 1 of 3

Melting Point [°C]

140.7 - 142.7

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 2 of 3

Melting Point [°C]

146 - 147

Solvent (Melting Point)

cyclohexane; acetone

Hopkins et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1425,1428, View in Reaxys 3 of 3

Melting Point [°C]

151

Solvent (Melting Point)

acetone

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys Crystal Property Description (2) Colour & Other References Properties yellow

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys

gelb

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys

NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

400

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

100

125/249

2016-07-13 00:31:19

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 3 of 3

Description (NMR Spec- Spectrum troscopy) Hopkins et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1425,1428, View in Reaxys

IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

CH2Cl2

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; chemical ionization (CI)

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys

UV/VIS Spectroscopy (1) 1 of 1

Solvent (UV/VIS Spectroscopy)

CH2Cl2

Absorption Maxima (UV/ 228; 268; 384 VIS) [nm] Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys Pharmacological Data (5) 1 of 5

Comment (Pharmacological Data)

Bioactivities present

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys; Hopkins et al.; Canadian Journal of Chemistry; vol. 45; (1967); p. 1425,1428, View in Reaxys; Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys; Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Escherichia coli

Kind of Dosing (Pharmacological Data)

stock solution of title comp. 10 mg dissolved in methanol and dichloromethane separately and prepared in 1/2 Muller Hilton Broth solution

Method (Pharmacological Data)

title comp. antibacterial activity assayed by Muller Hilton Broth method

Comment (Pharmacological Data)

No effect

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 3 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Candida albicans

Kind of Dosing (Pharmacological Data)

stock solution of title comp. 10 mg dissolved in methanol and dichloromethane separately and prepared in 1/2 Muller Hilton Broth solution

Method (Pharmacological Data)

title comp. antibacterial activity assayed by Muller Hilton Broth method

Type (Pharmacological Data)

MIC

126/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

800 mg/g

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 4 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Staphylococcus aureus

Kind of Dosing (Pharmacological Data)

stock solution of title comp. 10 mg dissolved in methanol and dichloromethane separately and prepared in 1/2 Muller Hilton Broth solution

Method (Pharmacological Data)

title comp. antibacterial activity assayed by Muller Hilton Broth method

Comment (Pharmacological Data)

No effect

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys 5 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Bacillus subtilis

Kind of Dosing (Pharmacological Data)

stock solution of title comp. 10 mg dissolved in methanol and dichloromethane separately and prepared in 1/2 Muller Hilton Broth solution

Method (Pharmacological Data)

title comp. antibacterial activity assayed by Muller Hilton Broth method

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

800 mg/l

Oeztuerk, Safiye Emirdag; Akguel, Yurdanur; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 16; nb. 8; (2008); p. 4431 - 4437, View in Reaxys

Reaxys ID 4491188 View in Reaxys

19/183 CAS Registry Number: 43017-82-9 Chemical Name: Methyl 3-<3',4'-(methylenedioxy)phenyl>-2nitropropenoate; methyl 3-(1,3-benzodioxol-5-yl)-2-nitroacrylate; 3-benzo[1,3]dioxol-5-yl-2-nitro-acrylic acid methyl ester Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 Type of Substance: heterocyclic InChI Key: IGDFMGQGZSISDX-UHFFFAOYSA-N Note:

O O O

O O

Substance Label (3) Label References 2d

Wei, Yi; Lu, Liang-Qiu; Li, Tian-Ren; Feng, Bin; Wang, Qiang; Xiao, Wen-Jing; Alper, Howard; Angewandte Chemie - International Edition; vol. 55; nb. 6; (2016); p. 2200 - 2204; Angew. Chem.; vol. 128; nb. 6; (2016); p. 2240 - 2244,5, View in Reaxys

Foucaud, Andre; Razorilalana-Rabearivony, Claudia; Loukakou, Emile; Person, Herve; Journal of Organic Chemistry; vol. 48; nb. 21; (1983); p. 3639 - 3644, View in Reaxys

(IIIc)

Kochetkov, K. A.; Babievskii, K. K.; Belikov, V. M.; Garbalinskaya, N. S.; Bakhmutov, V. I.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 29; nb. 3; (1980); p. 458 - 461; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 3; (1980); p. 639 - 641, View in Reaxys

127/249

2016-07-13 00:31:19

Melting Point (1) 1 of 1

Melting Point [°C]

133 - 134

Kochetkov, K. A.; Babievskii, K. K.; Belikov, V. M.; Garbalinskaya, N. S.; Bakhmutov, V. I.; Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation); vol. 29; nb. 3; (1980); p. 458 461; Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya; nb. 3; (1980); p. 639 - 641, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Foucaud, Andre; Razorilalana-Rabearivony, Claudia; Loukakou, Emile; Person, Herve; Journal of Organic Chemistry; vol. 48; nb. 21; (1983); p. 3639 - 3644, View in Reaxys

Reaxys ID 23247 View in Reaxys

20/183 CAS Registry Number: 49711-31-1 Chemical Name: (E)-1-cyano-2-(1',3'-benzodioxol-5'-yl)-1-nitroethene; 3c-benzo[1,3]dioxol-5-yl-2-nitro-acrylonitrile; 3c-Benzo[1,3]dioxol-5-yl-2-nitro-acrylonitril Linear Structure Formula: C10H6N2O4 Molecular Formula: C10H6N2O4 Molecular Weight: 218.169 Type of Substance: heterocyclic InChI Key: RJEGGRRFXZJFLI-FPYGCLRLSA-N Note:

O O

O N

Substance Label (1) Label References 1e

Amantini, David; Fringuelli, Francesco; Piermatti, Oriana; Pizzo, Ferdinando; Zunino, Ennio; Vaccaro, Luigi; Journal of Organic Chemistry; vol. 70; nb. 16; (2005); p. 6526 - 6529, View in Reaxys

Related Structure (1) Related Structure References Configuration.

Dore et al.; Chimica therap.; vol. 8; (1973); p. 80,83, View in Reaxys

Melting Point (3) 1 of 3

Melting Point [°C]

143

Dore et al.; Chimica therap.; vol. 8; (1973); p. 80,83, View in Reaxys 2 of 3

Solvent (Melting Point)

acetic acid

Ried; Koehler; Justus Liebigs Annalen der Chemie; vol. 598; (1956); p. 145,155, View in Reaxys 3 of 3

Melting Point [°C]

149

Ried; Koehler; Justus Liebigs Annalen der Chemie; vol. 598; (1956); p. 145,155, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb

Ried; Koehler; Justus Liebigs Annalen der Chemie; vol. 598; (1956); p. 145,155, View in Reaxys

Reaxys ID 40135 View in Reaxys

21/183

128/249

2016-07-13 00:31:19

CAS Registry Number: 15794-52-2 Chemical Name: 4-methoxy-5-nitro-6-(2-nitro-vinyl)-benzo[1,3]dioxole; 3-methoxy-4,5-methylenedioxy-2,β-dinitro-styrene; 3-Methoxy-4,5-methylendioxy-2,β-dinitro-styrol Linear Structure Formula: C10H8N2O7 Molecular Formula: C10H8N2O7 Molecular Weight: 268.183 Type of Substance: heterocyclic InChI Key: BKMDSMXMYBNRJS-UHFFFAOYSA-N Note:

O N

O O

N O

Substance Label (1) Label References 3d

Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys

Related Structure (1) Related Structure References Constitution.

Salway; Journal of the Chemical Society; vol. 99; (1911); p. 267, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

148

Solvent (Melting Point)

ethanol

Salway; Journal of the Chemical Society; vol. 95; (1909); p. 1209; Journal of the Chemical Society; vol. 97; (1910); p. 2416, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelbe Nadeln

Salway; Journal of the Chemical Society; vol. 95; (1909); p. 1209; Journal of the Chemical Society; vol. 97; (1910); p. 2416, View in Reaxys

Reaxys ID 1291451 View in Reaxys

22/183 CAS Registry Number: 2139-41-5 Chemical Name: [6-(2-nitro-phenyl)-benzo[1,3]dioxol-5-yl]methanol; 2-<2-Nitrophenyl>-4,5-methylendioxy-benzylalkohol; 2'-Nitro-4,5-methylendioxy-2-hydroxymethyl-biphenyl Linear Structure Formula: C14H11NO5 Molecular Formula: C14H11NO5 Molecular Weight: 273.245 Type of Substance: heterocyclic InChI Key: AIALWSNWGJYWRU-UHFFFAOYSA-N Note:

Substance Label (2) Label References X

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Hill; Carlson; Tetrahedron Letters; (1964); p. 1157,1158, View in Reaxys

Melting Point (3) 1 of 3

Melting Point [°C]

103 - 104.5

Solvent (Melting Point)

ethanol

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys 2 of 3

Melting Point [°C]

168 - 169

Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys 3 of 3

Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys

Further Information (1) Description (Fur- References ther Information)

129/249

2016-07-13 00:31:19

Further information

Hill; Carlson; Tetrahedron Letters; (1964); p. 1157,1158, View in Reaxys

IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Spectrum

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Reaxys ID 1393111 View in Reaxys

23/183 CAS Registry Number: 63141-48-0 Chemical Name: Ethyl (Z)-3-(2H-1,3-benzodioxol-5-yl)-2-nitropropenoate; 3,4-Methylendioxy-α-nitro-ethylcinnamat Linear Structure Formula: C12H11O6N Molecular Formula: C12H11NO6 Molecular Weight: 265.222 Type of Substance: heterocyclic InChI Key: DHFPSLRVINJCHD-UITAMQMPSA-N Note:

O Z

O O

O N

Substance Label (3) Label References (Z)-2d

Sui, Yong; Liu, Li; Zhao, Jun-Ling; Wang, Dong; Chen, Yong-Jun; Tetrahedron; vol. 63; nb. 24; (2007); p. 5173 - 5183, View in Reaxys

Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 - 863, View in Reaxys

Pages; Wermuth; Bulletin de la Societe Chimique de France; vol. II; nb. 11-12; (1976); p. 1847 - 1848, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

108

Pages; Wermuth; Bulletin de la Societe Chimique de France; vol. II; nb. 11-12; (1976); p. 1847 - 1848, View in Reaxys NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 863, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 863, View in Reaxys 3 of 3

Description (NMR Spec- NMR troscopy) Pages; Wermuth; Bulletin de la Societe Chimique de France; vol. II; nb. 11-12; (1976); p. 1847 - 1848, View in Reaxys

IR Spectroscopy (1)

130/249

2016-07-13 00:31:19

1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

neat (no solvent)

Comment (IR Spectroscopy)

2986 - 1360 cm**(-1)

Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 863, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; electron impact (EI)

Hull, Hilary M.; Knight, David W.; Journal of the Chemical Society - Perkin Transactions 1; nb. 6; (1997); p. 857 - 863, View in Reaxys

Reaxys ID 7093370 View in Reaxys

Chemical Name: 5-(2-nitro-1(Z)-ethenyl)benzo[d][1,3]dioxol Linear Structure Formula: C9H7NO4 Molecular Formula: C9H7NO4 Molecular Weight: 193.159 Type of Substance: heterocyclic InChI Key: KFLWBZPSJQPRDD-ARJAWSKDSA-N Note:

O O

24/183

Substance Label (3) Label References 1f

Pradhan, Prasun K.; Dey, Sumit; Jaisankar, Parasuraman; Giri, Venkatachalam S.; Synthetic Communications; vol. 35; nb. 7; (2005); p. 913 - 922, View in Reaxys

Chikashita, Hidenori; Nishida, Shuichi; Miyazaki, Makoto; Morita, Yasuhiro; Itoh, Kazuyoshi; Bulletin of the Chemical Society of Japan; vol. 60; nb. 2; (1987); p. 737 - 746, View in Reaxys

Crystal Property Description (1) Colour & Other References Properties yellow

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Original Text (NMR Spectroscopy)

Signals [ppm]

7.55; 7.62; 7.64; 7.97

Kind of signal

d, 1H, J = 13.6; d, 2H, J = 8.0; d, 1H, J = 8.0; d, 1H, J = 13.6

NMR (CDCl3, 400 MHz) δ (ppm): 7.55 (d, 1H, J = 13.6), 7.62 (d, 2H, J = 8.0), 7.64 (d, 1H, J = 8.0), 7.97 (d, 1H, J = 13.6)

131/249

2016-07-13 00:31:19

2 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Original Text (NMR Spectroscopy)

13C NMR (CDCl , 100 MHz) δ (ppm): 101.5, 107.0, 109.0, 124.0, 127.0, 134.0, 139.5, 3 149.0, 151.0

Signals [ppm]

101.5; 107; 109; 124; 127; 134; 139.5; 149; 151

193.0 m/z; 170.0 m/z; 169.1 m/z; 156.0 m/z; 100.0 m/z

Intensity [%]

References

97.2; 7; 26.6; 13

UV/VIS Spectroscopy (1) 1 of 1

Absorption Maxima (UV/ 375; 291 VIS) [nm] Ext./Abs. Coefficient [l·mol-1cm-1]

3200; 3400

Comment (Pharmacological Data)

Bioactivities present

Chikashita, Hidenori; Nishida, Shuichi; Miyazaki, Makoto; Morita, Yasuhiro; Itoh, Kazuyoshi; Bulletin of the Chemical Society of Japan; vol. 60; nb. 2; (1987); p. 737 - 746, View in Reaxys; Pradhan, Prasun K.; Dey, Sumit; Jaisankar, Parasuraman; Giri, Venkatachalam S.; Synthetic Communications; vol. 35; nb. 7; (2005); p. 913 - 922, View in Reaxys; Celano, Laura; Carabio, Claudio; Frache, Renata; Cataldo, Nicolas; Cerecetto, Hugo; Gonzalez, Mercedes; Thomson, Leonor; European Journal of Medicinal Chemistry; vol. 74; (2014); p. 31 - 40, View in Reaxys 2 of 2

Comment (Pharmacological Data)

physiological behaviour discussed

Reaxys ID 10535744 View in Reaxys

25/183 CAS Registry Number: 916245-11-9 Chemical Name: 3-(benzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 Type of Substance: heterocyclic InChI Key: DQZGRWFDDAYALP-UHFFFAOYSA-N Note:

O N

O O

Substance Label (3) Label References

132/249

2016-07-13 00:31:19

Cagide-Fagin, Fernando; Nieto-Garcia, Olaia; Lago-Santome, Hugo; Alonso, Ricardo; Journal of Organic Chemistry; vol. 77; nb. 24; (2012); p. 11377 - 11382, View in Reaxys

II7d

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

Ortiz, Juan Carlos; Ozores, Lidia; Cagide-Fagin, Fernando; Alonso, Ricardo; Chemical Communications; nb. 40; (2006); p. 4239 - 4241, View in Reaxys

Reaxys ID 10540785 View in Reaxys

26/183 CAS Registry Number: 718597-87-6 Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: WGMJOSLIKRMTQU-UHFFFAOYSA-N Note:

O N

O O

Substance Label (2) Label References 1f

Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Kumar, Polu Vijay; RSC Advances; vol. 5; nb. 113; (2015); p. 93447 - 93451, View in Reaxys

Ortiz, Juan Carlos; Ozores, Lidia; Cagide-Fagin, Fernando; Alonso, Ricardo; Chemical Communications; nb. 40; (2006); p. 4239 - 4241, View in Reaxys

Reaxys ID 10545971 View in Reaxys

27/183 CAS Registry Number: 916245-12-0 Chemical Name: 3-(4-methoxybenzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 Type of Substance: heterocyclic InChI Key: PBPMXZVQTIWHSZ-UHFFFAOYSA-N Note:

O N

O O

Substance Label (3) Label References 3b

Cagide-Fagin, Fernando; Nieto-Garcia, Olaia; Lago-Santome, Hugo; Alonso, Ricardo; Journal of Organic Chemistry; vol. 77; nb. 24; (2012); p. 11377 - 11382, View in Reaxys

IIp

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

Ortiz, Juan Carlos; Ozores, Lidia; Cagide-Fagin, Fernando; Alonso, Ricardo; Chemical Communications; nb. 40; (2006); p. 4239 - 4241, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

250

Original Text (NMR Spectroscopy)

NMR (CDCl3, 250 MHz) δ 3.91, 3.96 (s, 3H), 6.07, 6.14 (s, 2H), 6.78, 6.82 (s, IH), 7.21 (s, 0.5H), 7.42 (s, 0.5H) 7.59 (s, 0.5H), 8.30 (d, J= 2.5 Hz, 0.5H), 9.48 (s, 0.5H), 10.23 (d, J= 2.5 Hz, 0.5H).

133/249

2016-07-13 00:31:19

Comment (NMR Spectroscopy)

Signals given

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 2 of 2

Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

62.5

Original Text (NMR Spectroscopy)

13C

Comment (NMR Spectroscopy)

Signals given

NMR (CDCl3, 62.5 MHz) δ 56.90, 102.86, 103.05, 103.22, 103.80, 104.87, 108.27, 113.39, 116.11, 122.97, 123.85, 128.21, 132.13, 133.35, 133.64, 139.27, 142.05, 142.93, 143.71, 144.04, 145.62, 146.12, 149.42, 149.95, 181.84, 184.18

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

Reaxys ID 10665814 View in Reaxys

28/183 CAS Registry Number: 916487-06-4 Chemical Name: 7-nitro-6H-[1,3]methylenedioxy[4,5-g]chromene; 3-nitro-2H-6,7-methylenedioxychromene; 6,7-Methylenedioxy-3-nitrochromene Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 Type of Substance: heterocyclic InChI Key: JRTRWYLTILKTDP-UHFFFAOYSA-N Note:

O N

O O

Substance Label (2) Label References 3a; 3

Patent; PURDUE RESEARCH FOUNDATION; US2009/30025; (2009); (A1) English, View in Reaxys

Melting Point (3) 1 of 3

Melting Point [°C]

139

Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys 2 of 3

Melting Point [°C]

139

Solvent (Melting Point)

methanol

Patent; PURDUE RESEARCH FOUNDATION; US2009/30025; (2009); (A1) English, View in Reaxys 3 of 3

Melting Point [°C]

139

Solvent (Melting Point)

methanol

Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys; Patent; PURDUE RESEARCH FOUNDATION; US2009/30025; (2009); (A1) English, View in Reaxys; Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys

NMR Spectroscopy (3)

134/249

2016-07-13 00:31:19

1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys 2 of 3

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Original Text (NMR Spectroscopy)

1H-NMR

Comment (NMR Spectroscopy)

Signals given

Signals [ppm]

5.2; 6.02; 6.49; 6.69; 7.75

Kind of signal

s, 2, ArOCH&2%; s, 2, OCH&2%O; s, 1, ArH; s, 1, ArH; s, 1, ArCH

(CDCl3) δ 5.20 (s, 2, ArOCH2), 6.02 (s, 2, OCH2O), 6.49 (s, 1, ArH), 6.69 (s, 1, ArH), 7.75 (s, 1, ArCH)

Patent; PURDUE RESEARCH FOUNDATION; US2009/30025; (2009); (A1) English, View in Reaxys 3 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Cueva, Juan Pablo; Giorgioni, Gianfabio; Grubbs, Russell A.; Chemel, Benjamin R.; Watts, Val J.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 49; nb. 23; (2006); p. 6848 - 6857, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) CI (Chemical ioni- Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, zation); Spectrum David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys

Reaxys ID 11137130 View in Reaxys

29/183 Chemical Name: (E)-6-(3,4-methylenedioxyphenyl)-5-nitrohex-5-en-2-one; (E)-6-(benzo[d][1,3]dioxol-6-yl)-5-nitrohex-5en-2-one Linear Structure Formula: C13H13NO5 Molecular Formula: C13H13NO5 Molecular Weight: 263.25 InChI Key: QORRHPQPMZWQST-IZZDOVSWSA-N Note:

O O

Substance Label (2) Label References 1k

Roy, Suparna; Amireddy, Mamatha; Chen, Kwunmin; Tetrahedron; vol. 69; nb. 41; (2013); p. 8751 - 8757, View in Reaxys

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys

Melting Point (1)

135/249

2016-07-13 00:31:19

1 of 1

Melting Point [°C]

102 - 104

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys

Pharmacological Data (3) 1 of 3

Comment (Pharmacological Data)

Bioactivities present

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys; Shanbhag, Pramod; Nareddy, Pradeep R.; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 8; nb. 21; (2010); p. 4867 4873, View in Reaxys; Roy, Suparna; Amireddy, Mamatha; Chen, Kwunmin; Tetrahedron; vol. 69; nb. 41; (2013); p. 8751 - 8757, View in Reaxys 2 of 3

Effect (Pharmacological Data)

anticancer, other

Species or Test-System (Pharmacological Data)

human cervical cancer HeLa cells

Concentration (Pharmacological Data)

5 - 25 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Method (Pharmacological Data)

standard sulforhodamine B assay; cells density: 1E5 cells/ml; title comp. incubated with cells for 24 h; absorbance measured at 560 nm

136/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

average of 3 determinations

Results

title compound produced 30 and 82percent inhibition of cell proliferation at a dose of 5 and 25 μmol/l, resp.

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys 3 of 3

Effect (Pharmacological Data)

protein binding

Species or Test-System (Pharmacological Data)

goat brain tubulin

Concentration (Pharmacological Data)

10 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in PEM buffer

Method (Pharmacological Data)

intrinsic tubulin fluorescence measured; title comp. incubated with tubulin (1 μM) for 30 min at room temperature; fluorescence assay with excitation and emission wavelengths of 280 and 335 nm, resp.

Results

title comp. quenched the intrinsic tryptophan fluorescence of tubulin which indicated a binding of title comp. to tubulin; fig., tables

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys

Reaxys ID 19786427 View in Reaxys

30/183 CAS Registry Number: 66425-16-9 Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 InChI Key: UKQZUXNFVBFRRY-UHFFFAOYSA-N Note:

O N

O O

Substance Label (1) Label References S5

Eliasen, Anders M.; Christy, Mitchell; Claussen, Karin R.; Besandre, Ronald; Thedford, Randal P.; Siegel, Dionicio; Organic Letters; vol. 17; nb. 18; (2015); p. 4420 - 4423, View in Reaxys

Reaxys ID 20299515 View in Reaxys

31/183 CAS Registry Number: 858467-42-2 Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 InChI Key: WEYZGKQDMSTRQD-UHFFFAOYSA-N Note:

O N

O O

Substance Label (1) Label References 8c

Gopi, Elumalai; Kumar, Tarun; Menna-Barreto, Rubem F. S.; Valena, Wagner O.; Da Silva Jnior, Eufrnio N.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 13; nb. 38; (2015); p. 9862 - 9871, View in Reaxys

Reaxys ID 20299517 View in Reaxys

32/183

137/249

2016-07-13 00:31:19

O N

Linear Structure Formula: C13H13NO5 Molecular Formula: C13H13NO5 Molecular Weight: 263.25 InChI Key: QORRHPQPMZWQST-UHFFFAOYSA-N Note:

O O

Substance Label (2) Label References 6f

Mane, Vaijinath; Kumar, Tarun; Pradhan, Sourav; Katiyar, Savita; Namboothiri, Irishi N. N.; RSC Advances; vol. 5; nb. 86; (2015); p. 69990 - 69999, View in Reaxys

Shanbhag, Pramod; Mane, Vaijinath; Hazra, Chinmoy; Namboothiri, Irishi N. N.; Journal of the Indian Chemical Society; vol. 90; nb. 10; (2013); p. 1713 - 1719, View in Reaxys

Reaxys ID 22332976 View in Reaxys

33/183 CAS Registry Number: 1355334-09-6 Chemical Name: 2-(benzo[d][1,3]dioxol-5-yl)-3-nitroimidazo[1,2-a]pyridine Linear Structure Formula: C14H9N3O4 Molecular Formula: C14H9N3O4 Molecular Weight: 283.243 InChI Key: WAEFWBCILWUKRX-UHFFFAOYSA-N Note:

O O

N N

Substance Label (2) Label References 3d

An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys

4an

Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys

Melting Point (2) 1 of 2

Melting Point [°C]

198 - 200

Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys 2 of 2

Melting Point [°C]

198 - 199

Location

supporting information

Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys Crystal Property Description (2) Colour & Other Location Properties yellow

yellow

References Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys

supporting information

Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys

NMR Spectroscopy (5) 1 of 5

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

138/249

2016-07-13 00:31:19

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys 4 of 5

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys; Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys 5 of 5

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Comment (IR Spectroscopy)

neat (no solvent, solid phase)

139/249

2016-07-13 00:31:19

References

high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum

HRMS (High resolution mass spectrometry); Spectrum

Yan, Ru-Long; Yan, Hao; Ma, Chao; Ren, Zhi-Yong; Gao, Xi-Ai; Huang, Guo-Sheng; Liang, Yong-Min; Journal of Organic Chemistry; vol. 77; nb. 4; (2012); p. 2024 - 2028, View in Reaxys

high resolution supporting informass spectrome- mation try (HRMS); spectrum

Yan, Hao; Yan, Rulong; Yang, Sizhuo; Gao, Xiai; Wang, Yuling; Huang, Guosheng; Liang, Yongmin; Chemistry - An Asian Journal; vol. 7; nb. 9; (2012); p. 2028 - 2031, View in Reaxys

Reaxys ID 232026 View in Reaxys

34/183 Chemical Name: 5-methyl-6-(2-nitro-propenyl)-benzo[1,3]dioxole; 5-Methyl-6-(2-nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: VOZKBROGGMTSQH-XBXARRHUSA-N Note:

O N

E O O

Melting Point (1) 1 of 1

Melting Point [°C]

122 - 123

Solvent (Melting Point)

ethanol

Sugasawa; Hino; Pharmaceutical Bulletin; vol. 2; (1954); p. 242,245, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Gelb

Sugasawa; Hino; Pharmaceutical Bulletin; vol. 2; (1954); p. 242,245, View in Reaxys

Reaxys ID 307141 View in Reaxys

35/183

O E

CAS Registry Number: 22959-13-3 Chemical Name: 4,7-dimethoxy-5-(2-nitro-propenyl)-benzo[1,3]dioxole; 4,7-Dimethoxy-5-(2-nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C12H13NO6 Molecular Formula: C12H13NO6 Molecular Weight: 267.238 Type of Substance: heterocyclic InChI Key: WQRDYLOJWQMEFW-QPJJXVBHSA-N Note:

O O

Melting Point (2) 1 of 2

Melting Point [°C]

110 - 111

Solvent (Melting Point)

ethanol

140/249

2016-07-13 00:31:19

Schmidt,E. et al.; Chemische Berichte; vol. 55; (1922); p. 1756, View in Reaxys 2 of 2

Melting Point [°C]

Solvent (Melting Point)

ethanol

Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> II; p. 139, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelbe Nadeln

Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> II; p. 139, View in Reaxys; Schmidt,E. et al.; Chemische Berichte; vol. 55; (1922); p. 1756, View in Reaxys

Reaxys ID 367664 View in Reaxys

36/183 CAS Registry Number: 873419-85-3 Chemical Name: 5-(3-acetoxy-propyl)-2-benzo[1,3]dioxol-5yl-7-methoxy-3-nitro-benzofuran Linear Structure Formula: C21H19NO8 Molecular Formula: C21H19NO8 Molecular Weight: 413.384 Type of Substance: heterocyclic InChI Key: YGAZFABZNVTLOR-UHFFFAOYSA-N Note:

O O N

Related Structure (1) Related Structure References Constitution.

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

160

Solvent (Melting Point)

acetone

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 586,591; Nippon Kagaku Kaishi; vol. 61; (1940); p. 487,491, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 586,591; Nippon Kagaku Kaishi; vol. 61; (1940); p. 487,491, View in Reaxys

Reaxys ID 1264618 View in Reaxys

37/183 CAS Registry Number: 65762-51-8 Chemical Name: 2-[6-(2-nitro-vinyl)-benzo[1,3]dioxol-5-yl]-benzoic acid methyl ester Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 Type of Substance: heterocyclic InChI Key: BQGXRJUZSSTSQK-UHFFFAOYSA-N Note:

O N

O O O O

Substance Label (2) Label References 19a

Kobayashi; Kihara; Shizu; Katayama; Ikeda; Kitahiro; Matsumoto; Chemical and Pharmaceutical Bulletin; vol. 25; nb. 12; (1977); p. 3312 - 3323, View in Reaxys

141/249

2016-07-13 00:31:19

Kobayashi; Kihara; Yamasaki; Ishida; Watanabe; Chemical and pharmaceutical bulletin; vol. 23; nb. 11; (1975); p. 3036 - 3037, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

167 - 170

Kobayashi; Kihara; Shizu; Katayama; Ikeda; Kitahiro; Matsumoto; Chemical and Pharmaceutical Bulletin; vol. 25; nb. 12; (1977); p. 3312 - 3323, View in Reaxys; Kobayashi; Kihara; Yamasaki; Ishida; Watanabe; Chemical and pharmaceutical bulletin; vol. 23; nb. 11; (1975); p. 3036 - 3037, View in Reaxys NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- NMR troscopy) Comment (NMR Spectroscopy)

Kobayashi; Kihara; Shizu; Katayama; Ikeda; Kitahiro; Matsumoto; Chemical and Pharmaceutical Bulletin; vol. 25; nb. 12; (1977); p. 3312 - 3323, View in Reaxys 2 of 2

Description (NMR Spec- NMR troscopy) Kobayashi; Kihara; Yamasaki; Ishida; Watanabe; Chemical and pharmaceutical bulletin; vol. 23; nb. 11; (1975); p. 3036 - 3037, View in Reaxys

IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Reaxys ID 1320328 View in Reaxys

38/183 CAS Registry Number: 109512-11-0 Chemical Name: 4,5-methylenedioxy-2'-nitro-2-biphenylcarbaldehyde; 6-(2-nitro-phenyl)-benzo[1,3]dioxole-5-carbaldehyde; 2'-Nitro-4,5-methylendioxy-2-formyl-biphenyl Linear Structure Formula: C14H9NO5 Molecular Formula: C14H9NO5 Molecular Weight: 271.229 Type of Substance: heterocyclic InChI Key: BJWAFJVRXLZOCR-UHFFFAOYSA-N Note:

Substance Label (1) Label References 34

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys

Melting Point (2) 1 of 2

Melting Point [°C]

135 - 138

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 2 of 2

Melting Point [°C]

227 - 228

Solvent (Melting Point)

ethyl acetate

Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys Sublimation (1) Comment (Sublimation) bei 200-210grad/3 Torr

References Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys

142/249

2016-07-13 00:31:19

Crystal Property Description (1) Colour & Other References Properties yellow

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys

NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

300

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 3 of 3

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

300

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; electron impact (EI)

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys

143/249

2016-07-13 00:31:19

Reaxys ID 1330573 View in Reaxys

39/183 CAS Registry Number: 5025-67-2 Chemical Name: 2'-Iod-methoxycarbonyl-4',5'-methylendioxyα-nitro-cis-stilben Linear Structure Formula: C17H12INO6 Molecular Formula: C17H12INO6 Molecular Weight: 453.19 Type of Substance: heterocyclic InChI Key: JRDLWETYBWYSSG-MKMNVTDBSA-N Note:

O E

N O O O

Substance Label (1) Label References LXVI

Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

118 - 119

Solvent (Melting Point)

ethanol

Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1

Description (UV/VIS Spectroscopy)

Absorption maxima

Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys

Reaxys ID 1990310 View in Reaxys

40/183 CAS Registry Number: 1215-58-3 Chemical Name: 1-(3,4-methylenedioxyphenyl)-2-nitro-1-pentene; 1-(3'.4'-Methylendioxyphenyl)-2-nitro-penten Linear Structure Formula: C12H13NO4 Molecular Formula: C12H13NO4 Molecular Weight: 235.24 Type of Substance: heterocyclic InChI Key: BDRAJGDAPYLXOK-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 1, Ar = 3,4(OCH2O)C6H3

Yoneda, Fumio; Moto, Toshiaki; Sakae, Masatoshi; Ohde, Hironori; Knoll, Berta; Miklya, Ildiko; Knoll, Joseph; Bioorganic and Medicinal Chemistry; vol. 9; nb. 5; (2001); p. 1197 - 1212, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

49 - 50

Koremura; Nippon Kagaku Kaishi; vol. 36; nb. 7; (1962); p. 552,553-556; Chem.Abstr.; vol. 62; nb. 3962d; (1965), View in Reaxys Crystal Property Description (1) Colour & Other References Properties light-yellow

Yoneda, Fumio; Moto, Toshiaki; Sakae, Masatoshi; Ohde, Hironori; Knoll, Berta; Miklya, Ildiko; Knoll, Joseph; Bioorganic and Medicinal Chemistry; vol. 9; nb. 5; (2001); p. 1197 - 1212, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy)

144/249

2016-07-13 00:31:19

Frequency (NMR Spectroscopy) [MHz]

270

Yoneda, Fumio; Moto, Toshiaki; Sakae, Masatoshi; Ohde, Hironori; Knoll, Berta; Miklya, Ildiko; Knoll, Joseph; Bioorganic and Medicinal Chemistry; vol. 9; nb. 5; (2001); p. 1197 - 1212, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

270

Yoneda, Fumio; Moto, Toshiaki; Sakae, Masatoshi; Ohde, Hironori; Knoll, Berta; Miklya, Ildiko; Knoll, Joseph; Bioorganic and Medicinal Chemistry; vol. 9; nb. 5; (2001); p. 1197 - 1212, View in Reaxys

Reaxys ID 4699552 View in Reaxys

41/183 CAS Registry Number: 88484-87-1 Linear Structure Formula: C10H8N2O6 Molecular Formula: C10H8N2O6 Molecular Weight: 252.183 Type of Substance: heterocyclic InChI Key: KVTULAZMZRAQOD-KXFIGUGUSA-N Note:

O O

N Z

O O

Substance Label (2) Label References 1b

Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Synthesis; nb. 12; (1983); p. 1027 - 1028, View in Reaxys

Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry; vol. 22; nb. 8; (1983); p. 725 - 726, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

153 - 154

Solvent (Melting Point)

CHCl3; hexane

Niwas, Shri; Kumar, Shiv; Bhaduri, A. P.; Synthesis; nb. 12; (1983); p. 1027 - 1028, View in Reaxys

Reaxys ID 5069542 View in Reaxys

42/183 CAS Registry Number: 49571-78-0 Chemical Name: methyl (Z)-3-(1,3-benzodioxol-5-yl)-2-nitroacrylate; methyl 2-nitro 3-piperonyl acrylate Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 Type of Substance: heterocyclic InChI Key: IGDFMGQGZSISDX-YWEYNIOJSA-N Note:

O Z

O O

O N

Substance Label (1) Label References 17c

Melot, Jean Marie; Texier-Boullet, Francoise; Foucaud, Andre; Tetrahedron; vol. 44; nb. 8; (1988); p. 2215 - 2224, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

105

145/249

2016-07-13 00:31:19

Solvent (Melting Point)

benzene

Melot, Jean Marie; Texier-Boullet, Francoise; Foucaud, Andre; Tetrahedron; vol. 44; nb. 8; (1988); p. 2215 2224, View in Reaxys NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

24.84

Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Blanco-Ania, Daniel; Hermkens, Pedro H.H.; Sliedregt, Leo A.J.M.; Scheeren, Hans W.; Rutjes, Floris P.J.T.; Tetrahedron; vol. 65; nb. 27; (2009); p. 5393 - 5401, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

24.84

Frequency (NMR Spectroscopy) [MHz]

Location

supporting information

Blanco-Ania, Daniel; Hermkens, Pedro H.H.; Sliedregt, Leo A.J.M.; Scheeren, Hans W.; Rutjes, Floris P.J.T.; Tetrahedron; vol. 65; nb. 27; (2009); p. 5393 - 5401, View in Reaxys 3 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Melot, Jean Marie; Texier-Boullet, Francoise; Foucaud, Andre; Tetrahedron; vol. 44; nb. 8; (1988); p. 2215 2224, View in Reaxys

Reaxys ID 5640782 View in Reaxys

CAS Registry Number: 107092-58-0 Linear Structure Formula: C19H19NO7 Molecular Formula: C19H19NO7 Molecular Weight: 373.362 Type of Substance: heterocyclic InChI Key: RQXWTKIJIMMSQE-NSIKDUERSA-N Note:

O O

43/183

O O

Substance Label (1) Label References 3d

Dauzonne; Royer; Chemical and Pharmaceutical Bulletin; vol. 34; nb. 4; (1986); p. 1628 - 1633, View in Reaxys

146/249

2016-07-13 00:31:19

Melting Point (1) 1 of 1

Melting Point [°C]

119 - 120

Solvent (Melting Point)

propan-2-ol; diisopropyl ether

Dauzonne; Royer; Chemical and Pharmaceutical Bulletin; vol. 34; nb. 4; (1986); p. 1628 - 1633, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Dauzonne; Royer; Chemical and Pharmaceutical Bulletin; vol. 34; nb. 4; (1986); p. 1628 - 1633, View in Reaxys Pharmacological Data (1) 1 of 1

Comment (Pharmacological Data)

Bioactivities present

Dauzonne; Royer; Chemical and Pharmaceutical Bulletin; vol. 34; nb. 4; (1986); p. 1628 - 1633, View in Reaxys; Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys

Reaxys ID 7708770 View in Reaxys

44/183 Chemical Name: 1,2-Dihydro-6,7-methylenedioxy-3-nitronaphthalene Linear Structure Formula: C11H9NO4 Molecular Formula: C11H9NO4 Molecular Weight: 219.197 Type of Substance: heterocyclic InChI Key: HAWXIHDZBMRQIY-UHFFFAOYSA-N Note:

O N

NMR Spectroscopy (1) 1 of 1

Original Text (NMR Spectroscopy)

NMR (CDCl3) δ:7.78 (s, 1H), 6.80 (s, 1H), 6,72 (s, 1H), 6.01 (s, 2H), 2.46 (bs, 4H)

Comment (NMR Spectroscopy)

Signals given

Signals [ppm]

7.78; 6.8; 6.01; 2.46

Kind of signal

s, 1H; s, 1H; s, 1H; s, 2H; bs, 4H

Patent; Abbott Laboratories; US5597832; (1997); (A1) English, View in Reaxys Mass Spectrometry (1) Comment (Mass Peak Spectrometry)

References

Molecular peak

Patent; Abbott Laboratories; US5597832; (1997); (A1) English, View in Reaxys

220 m/z

Reaxys ID 9499882 View in Reaxys

45/183 CAS Registry Number: 562840-92-0 Chemical Name: (E)-trimethyl(2-(6-(2-nitrovinyl)benzo[d] [1,3]dioxol-5-yl)ethynyl)silane; trimethyl[6-(2-nitrovinyl)benzo[1,3]dioxol-5-ylethynyl]silane Linear Structure Formula: C14H15NO4Si Molecular Formula: C14H15NO4Si Molecular Weight: 289.363 Type of Substance: heterocyclic

O N E

O O Si

147/249

2016-07-13 00:31:19

InChI Key: MKWASMOBFNINBI-GQCTYLIASA-N Note: Substance Label (2) Label References 15

Shimizu, Kazuya; Takimoto, Masanori; Sato, Yoshihiro; Mori, Miwako; Journal of Organometallic Chemistry; vol. 691; nb. 24-25; (2006); p. 5466 - 5475, View in Reaxys

Shimizu, Kazuya; Takimoto, Masanori; Mori, Miwako; Organic Letters; vol. 5; nb. 13; (2003); p. 2323 2325, View in Reaxys

NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Shimizu, Kazuya; Takimoto, Masanori; Mori, Miwako; Organic Letters; vol. 5; nb. 13; (2003); p. 2323 - 2325, View in Reaxys; Shimizu, Kazuya; Takimoto, Masanori; Sato, Yoshihiro; Mori, Miwako; Journal of Organometallic Chemistry; vol. 691; nb. 24-25; (2006); p. 5466 - 5475, View in Reaxys 2 of 3

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

film

Reaxys ID 10098478 View in Reaxys

46/183

148/249

2016-07-13 00:31:19

CAS Registry Number: 156775-35-8 Chemical Name: 2-nitro-1,3-bis(benzo[1,3]dioxol-5-yl)propene Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 Type of Substance: heterocyclic InChI Key: KXZILZHHXSZSJP-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 11

Pharmacological Data (11) 1 of 11

Comment (Pharmacological Data)

Bioactivities present

Pifl, Christian; Nagy, Gabor; Berenyi, Sandor; Kattinger, Alexandra; Reither, Harald; Antus, Sandor; Journal of Pharmacology and Experimental Therapeutics; vol. 314; nb. 1; (2005); p. 346 - 354, View in Reaxys; McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 1348, View in Reaxys 2 of 11

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

HEK293 cells

Further Details (Pharmacological Data)

neutral red assay; HEK: human embryonic kidney; effective concentration (EC)

Type (Pharmacological Data)

log EC50

Value of Type (Pharmacological Data)

-5.1

McNamara, Yvonne M.; Cloonan, Suzanne M.; Knox, Andrew J.S.; Keating, John J.; Butler, Stephen G.; Peters, Guenther H.; Meegan, Mary J.; Williams, D. Clive; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1328 - 1348, View in Reaxys 3 of 11

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

HEK293 cells; genetically modified/infected with: human serotonin transporter

Further Details (Pharmacological Data)

neutral red assay; HEK: human embryonic kidney; effective concentration (EC)

Type (Pharmacological Data)

log EC50

Value of Type (Pharmacological Data)

-4.9

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

DG-75 cells

Further Details (Pharmacological Data)

DG-75 cells: B-lymphocyte Burkitt's lymphoma cell line derived from lung metastatic pleural effusion of Burkitt's lymphoma sporadic case; neutral red assay; effective concentration (EC)

Type (Pharmacological Data)

log EC50

149/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

-6

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

SHSY-5Y cells

Further Details (Pharmacological Data)

SHSY-5Y cells: thrice cloned (SK-N-SH->SH-SY->SH-SY5->SH-SY5Y) subline of human neuroblastoma cell line SK-N-SH established from metastatic bone tumour; neutral red assay; effective concentration (EC)

Type (Pharmacological Data)

log EC50

Value of Type (Pharmacological Data)

-4.8

Effect (Pharmacological Data)

transporter activity; inhibition of

Species or Test-System (Pharmacological Data)

HEK293 cells; genetically modified/infected with: human serotonin transporter

Concentration (Pharmacological Data)

1 - 100 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in Hanks balanced salt solution containing 0.1percent bovine serum albumin

Further Details (Pharmacological Data)

fluorescence neurotransmitter transporter uptake assay; HEK: human embryonic kidney; inhibition rate related to: human serotonin transporter

Type (Pharmacological Data)

inhibition rate

Value of Type (Pharmacological Data)

15 - 36 percent

Effect (Pharmacological Data)

transporter activity; inhibition of

Species or Test-System (Pharmacological Data)

HEK293 cells; genetically modified/infected with: human serotonin transporter

Concentration (Pharmacological Data)

1 - 100 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in Hanks balanced salt solution containing 0.1percent bovine serum albumin

Further Details (Pharmacological Data)

fluorescence neurotransmitter transporter uptake assay; HEK: human embryonic kidney

Results

molecular target: human serotonin transporter

Effect (Pharmacological Data)

antiproliferative

Species or Test-System (Pharmacological Data)

DG-75 cells

150/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

DG-75 cells: B-lymphocyte Burkitt's lymphoma cell line derived from lung metastatic pleural effusion of Burkitt's lymphoma sporadic case; Alamar Blue assay; effective concentration (EC)

Type (Pharmacological Data)

log EC50

Value of Type (Pharmacological Data)

-4.3

Effect (Pharmacological Data)

antiproliferative

Species or Test-System (Pharmacological Data)

SHSY-5Y cells

Further Details (Pharmacological Data)

SHSY-5Y cells: thrice cloned (SK-N-SH->SH-SY->SH-SY5->SH-SY5Y) subline of human neuroblastoma cell line SK-N-SH established from metastatic bone tumour; Alamar Blue assay; effective concentration (EC)

Type (Pharmacological Data)

log EC50

Value of Type (Pharmacological Data)

-4.5

Effect (Pharmacological Data)

antiproliferative

Species or Test-System (Pharmacological Data)

MUTU-I c179 cells

Further Details (Pharmacological Data)

MUTU-I c179 cells: isogenic stable group I Burkitt's lymphoma cell line derived from biopsy; Alamar Blue assay; effective concentration (EC)

Type (Pharmacological Data)

log EC50

Value of Type (Pharmacological Data)

-5.5

Effect (Pharmacological Data)

cell cycle; effect on

Species or Test-System (Pharmacological Data)

MUTU-I c179 cells

Concentration (Pharmacological Data)

10 μmol/l

Further Details (Pharmacological Data)

MUTU-I c179 cells: isogenic stable group I Burkitt's lymphoma cell line derived from biopsy; propidium iodide FACS assay

Type (Pharmacological Data)

pre-G1 phase cell rate

Value of Type (Pharmacological Data)

30 percent

151/249

2016-07-13 00:31:19

Reaxys ID 10268209 View in Reaxys

47/183 Chemical Name: (E)-ethyl 4-(benzo[d][1,3]dioxol-6-yl)-2-hydroxy-3-nitrobut-3-enoate Linear Structure Formula: C13H13NO7 Molecular Formula: C13H13NO7 Molecular Weight: 295.249 Type of Substance: heterocyclic InChI Key: KQFWZJSFTQDJIV-WEVVVXLNSA-N Note:

O E

O O

HO O

Substance Label (1) Label References 3e

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys

NMR Spectroscopy (6) 1 of 6

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Location

supporting information

Deb, Indubhusan; Shanbhag, Pramod; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; European Journal of Organic Chemistry; nb. 24; (2009); p. 4091 - 4101, View in Reaxys 2 of 6

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

299.95

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys 3 of 6

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

299.95

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys 4 of 6

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

152/249

2016-07-13 00:31:19

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

299.95

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys 5 of 6

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

100.561

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys 6 of 6

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

100.561

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

film

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum

Deb, Indubhusan; Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic Letters; vol. 8; nb. 6; (2006); p. 1201 - 1204, View in Reaxys

Reaxys ID 11137132 View in Reaxys

48/183 Chemical Name: (E)-ethyl-5-(benzo[d][1,3]dioxol-6-yl)-4-nitropent-4-enoate Linear Structure Formula: C14H15NO6 Molecular Formula: C14H15NO6 Molecular Weight: 293.276 InChI Key: RJKSKTYAFMPORI-YRNVUSSQSA-N Note:

O O

Substance Label (1) Label References 5h

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys

Melting Point (1)

153/249

2016-07-13 00:31:19

1 of 1

Melting Point [°C]

72 - 73

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys

Pharmacological Data (3) 1 of 3

Comment (Pharmacological Data)

Bioactivities present

Effect (Pharmacological Data)

anticancer, other

Species or Test-System (Pharmacological Data)

human cervical cancer HeLa cells

Concentration (Pharmacological Data)

5 - 25 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Method (Pharmacological Data)

standard sulforhodamine B assay; cells density: 1E5 cells/ml; title comp. incubated with cells for 24 h; absorbance measured at 560 nm

154/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

average of 3 determinations

Results

title compound produced 32 and 94percent inhibition of cell proliferation at a dose of 5 and 25 μmol/l, resp.

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys 3 of 3

Effect (Pharmacological Data)

protein binding

Species or Test-System (Pharmacological Data)

goat brain tubulin

Concentration (Pharmacological Data)

10 μmol/l

Kind of Dosing (Pharmacological Data)

title comp. dissolved in PEM buffer

Method (Pharmacological Data)

Results

title comp. quenched the intrinsic tryptophan fluorescence of tubulin which indicated a binding of title comp. to tubulin; fig., tables

Dadwal, Mamta; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; nb. 3; (2006); p. 338 - 340, View in Reaxys

Reaxys ID 11241388 View in Reaxys

49/183 Chemical Name: (E)-3-(benzo-[d][1,3]dioxol-5-yl)-2-nitro-1phenyl-N-tosylprop-2-en-1-amine Linear Structure Formula: C23H20N2O6S Molecular Formula: C23H20N2O6S Molecular Weight: 452.488 InChI Key: AVEBWBBNAUKMDJ-DEDYPNTBSA-N Note:

O O

O N H

O O

Substance Label (1) Label References 3k

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

168 - 169

Solvent (Melting Point)

CH2Cl2; petroleum ether

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys

NMR Spectroscopy (4) 1 of 4

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy)

155/249

2016-07-13 00:31:19

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys 2 of 4

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys 3 of 4

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys

Pharmacological Data (2) 1 of 2

Comment (Pharmacological Data)

Bioactivities present

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys; Lima-Junior, Claudio G.; Vasconcellos, Mario L.A.A.; Bioorganic and Medicinal Chemistry; vol. 20; nb. 13; (2012); p. 3954 - 3971, View in Reaxys 2 of 2

Effect (Pharmacological Data)

antiproliferative

Species or Test-System (Pharmacological Data)

human cervical cancer HeLa cells

Concentration (Pharmacological Data)

1 - 10 μmol/l

Method (Pharmacological Data)

title comp. incubated with cells for 24 h

Results

title comp. inhibited cell proliferation in a dose-dependent manner (17percent, 29percent and 61percent at on dose of 1, 5 and 10 μM, resp.)

156/249

2016-07-13 00:31:19

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys

Reaxys ID 15782472 View in Reaxys

CAS Registry Number: 1003600-22-3 Linear Structure Formula: C14H15NO7 Molecular Formula: C14H15NO7 Molecular Weight: 309.276 InChI Key: DQQSIONMFBONOG-UHFFFAOYSA-N Note:

50/183

O O

Substance Label (1) Label References intermed. pr. to 8

Aubry, Sylvain; Razafindrabe, Christian R.; Bourdon, Benjamin; Pellet-Rostaing, Stephane; Lemaire, Marc; Tetrahedron Letters; vol. 48; nb. 52; (2007); p. 9163 - 9166, View in Reaxys

Reaxys ID 15842355 View in Reaxys O O

51/183 Chemical Name: (Z)-3-(benzo[d][1,3]dioxol-5-yl)-2-nitroacrylaldehyde; 3-(benzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 InChI Key: DQZGRWFDDAYALP-BAQGIRSFSA-N Note:

N Z

O O

Substance Label (2) Label References II7d

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

Z-3e

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Reaxys ID 15842356 View in Reaxys

52/183

157/249

2016-07-13 00:31:19

Chemical Name: (E)-3-(benzo[d][1,3]dioxol-5-yl)-2-nitroacrylaldehyde; 3-(benzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 InChI Key: DQZGRWFDDAYALP-FPYGCLRLSA-N Note:

O N

E O O

Substance Label (2) Label References II7d

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

E-3e

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Reaxys ID 15842362 View in Reaxys

53/183 Chemical Name: (Z)-3-(4-methoxybenzo[d][1,3]dioxol-5-yl)-2nitroacrylaldehyde; 3-(4-methoxybenzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 InChI Key: PBPMXZVQTIWHSZ-WAPJZHGLSA-N Note:

O N O

O O O

Substance Label (2) Label References IIp

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

Z-3f

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

158/249

2016-07-13 00:31:19

Reaxys ID 15842363 View in Reaxys

54/183 Chemical Name: (E)-3-(4-methoxybenzo[d][1,3]dioxol-5-yl)-2nitroacrylaldehyde; 3-(4-methoxybenzo[d][1,3]dioxol-6-yl)-2-nitroacrylaldehyde Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 InChI Key: PBPMXZVQTIWHSZ-KRXBUXKQSA-N Note:

N E

O O O

Substance Label (2) Label References IIp

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

E-3f

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Reaxys ID 15842364 View in Reaxys

55/183 CAS Registry Number: 1019636-29-3 Chemical Name: (E)-3-(4-methoxybenzo[d][1,3]dioxol-5-yl)-2nitroprop-2-en-1-ol; (E)-3-(4-methoxybenzo[d][1,3]dioxol-6yl)-2-nitroprop-2-en-1-ol Linear Structure Formula: C11H11NO6 Molecular Formula: C11H11NO6 Molecular Weight: 253.211 InChI Key: DPUBWQOCTWSMJR-KRXBUXKQSA-N Note:

N E

O O O

Substance Label (2) Label References IIa7

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

101

159/249

2016-07-13 00:31:19

Solvent (Melting Point)

dichloromethane; hexane

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

NMR Spectroscopy (6) 1 of 6

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

250

Original Text (NMR Spectroscopy)

Comment (NMR Spectroscopy)

Signals given

NMR (CDCl3, 250 MHz) δ 2.63 (broad s, IH), 3.94 (s, 3H), 4.71 (s, 2H), 6.07 (s, 2H), 6.84 (s,2H), 8.11 (s, IH).

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 2 of 6

Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

62.5

Original Text (NMR Spectroscopy)

13C

Comment (NMR Spectroscopy)

Signals given

NMR (CDCl3, 62.5 MHz) 5 56.61, 56.69, 102.77, 104.21, 111.21, 125.38, 138.04, 143.80, 147.98, 149.42;

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys 3 of 6

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

160/249

2016-07-13 00:31:19

5 of 6

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

CHCl3

References

CI (Chemical ioni- Molecular peak zation)

Patent; UNIVERSIDAD DE SANTIAGO DE COMPOSTELA; WO2009/26961; (2009); (A1) English, View in Reaxys

Reaxys ID 19874161 View in Reaxys

CAS Registry Number: 1201566-85-9 Chemical Name: 2-(5-nitroquinolin-6-yl)-4,5-methylenedioxybenzoic acid methyl ester Linear Structure Formula: C18H12N2O6 Molecular Formula: C18H12N2O6 Molecular Weight: 352.303 InChI Key: HUXJIKIGRBXMQW-UHFFFAOYSA-N Note:

56/183

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy)

161/249

2016-07-13 00:31:19

Frequency (NMR Spectroscopy) [MHz]

300

Location

supporting information

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

Location

supporting information

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

dichloromethane

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys Mass Spectrometry (2) Description (Mass References Spectrometry) ESI (Electrospray ionisation); Spectrum

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys

HRMS (High resolution mass spectrometry); ESI (Electrospray ionisation); TOFMS (Time of flight mass spectrum); Spectrum

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys

UV/VIS Spectroscopy (1) 1 of 1

Solvent (UV/VIS Spectroscopy)

dichloromethane

Absorption Maxima (UV/ 222; 231 VIS) [nm] Log epsilon

4.48; 4.68

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys

Reaxys ID 19874162 View in Reaxys O

CAS Registry Number: 1201566-91-7 Chemical Name: 2-(5-nitroisoquinolin-6-yl)-4,5-methylenedioxybenzoic acid methyl ester Linear Structure Formula: C18H12N2O6 Molecular Formula: C18H12N2O6 Molecular Weight: 352.303

57/183

162/249

2016-07-13 00:31:19

InChI Key: SSLYKAGSWRVVPS-UHFFFAOYSA-N Note: NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Location

supporting information

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

Location

supporting information

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

dichloromethane

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys

HRMS (High resolution mass spectrometry); ESI (Electrospray ionisation); TOFMS (Time of flight mass spectrum); Spectrum

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys

UV/VIS Spectroscopy (1) 1 of 1

Solvent (UV/VIS Spectroscopy)

dichloromethane

Absorption Maxima (UV/ 235; 272; 297; 304 VIS) [nm] Log epsilon

4.8; 4.3; 4.1; 3.7

Genes, Constance; Michel, Sylvie; Tillequin, Francois; Poree, Francois-Hugues; Tetrahedron; vol. 65; nb. 48; (2009); p. 10009 - 10015, View in Reaxys

163/249

2016-07-13 00:31:19

Reaxys ID 28492503 View in Reaxys

58/183 O N

Linear Structure Formula: C11H9NO5 Molecular Formula: C11H9NO5 Molecular Weight: 235.196 InChI Key: VAZQCRWKQZBIAF-UHFFFAOYSA-N Note:

O O

Substance Label (2) Label References 2g

Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Tetrahedron Letters; vol. 56; nb. 35; (2015); p. 4980 - 4983; Art.No: 46492, View in Reaxys

10g

Bakthadoss, Manickam; Sivakumar, Nagappan; Devaraj, Anthonisamy; Kumar, Polu Vijay; RSC Advances; vol. 5; nb. 113; (2015); p. 93447 - 93451, View in Reaxys

Reaxys ID 20598 View in Reaxys

59/183 CAS Registry Number: 13326-78-8 Chemical Name: (E?)-3-bromo-4,5-methylenedioxy-β-nitrostyrene; (E?)-3-Brom-4,5-methylendioxy-β-nitro-styrol Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 Type of Substance: heterocyclic InChI Key: GJSWOWZFZTZZPJ-OWOJBTEDSA-N Note:

O N

O Br

Melting Point (1) 1 of 1

Melting Point [°C]

160 - 161

Solvent (Melting Point)

ethanol

Erne; Ramirez; Helvetica Chimica Acta; vol. 33; (1950); p. 912,915, View in Reaxys

Reaxys ID 22024 View in Reaxys

60/183 Chemical Name: 5-allyl-6-(2t-nitro-vinyl)-benzo[1,3]dioxole; 5Allyl-6-(2t-nitro-vinyl)-benzo[1,3]dioxol Linear Structure Formula: C12H11NO4 Molecular Formula: C12H11NO4 Molecular Weight: 233.224 Type of Substance: heterocyclic InChI Key: YFOADMGKSXGCJU-SNAWJCMRSA-N Note:

O N E

O O

Melting Point (1) 1 of 1

Melting Point [°C]

104

Solvent (Melting Point)

ethanol

Sugasawa et al.; Pharmaceutical Bulletin; vol. 2; (1954); p. 149, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb

Sugasawa et al.; Pharmaceutical Bulletin; vol. 2; (1954); p. 149, View in Reaxys

Reaxys ID 22598 View in Reaxys

61/183

164/249

2016-07-13 00:31:19

CAS Registry Number: 116056-17-8 Chemical Name: 3-nitro-[1,3]dioxolo[4,5-g]cinnoline; 3-Nitro[1,3]dioxolo[4,5-g]cinnolin Linear Structure Formula: C9H5N3O4 Molecular Formula: C9H5N3O4 Molecular Weight: 219.156 Type of Substance: heterocyclic InChI Key: PBFCNJCIOYGXLP-UHFFFAOYSA-N Note:

O N

O O

Melting Point (1) 1 of 1

Solvent (Melting Point)

ethyl acetate

Comment (Melting Point)

Decomp.at:250 degreeC.

Baumgarten et al.; Journal of the American Chemical Society; vol. 80; (1958); p. 1977,1979, View in Reaxys

Reaxys ID 55623 View in Reaxys

62/183 Chemical Name: (+-)-1ξ,3-bis-benzo[1,3]dioxol-5-yl-3-methoxy-2-nitro-propene; (+-)-1ξ,3-Bis-benzo[1,3]dioxol-5-yl-3-methoxy-2-nitro-propen Linear Structure Formula: C18H15NO7 Molecular Formula: C18H15NO7 Molecular Weight: 357.32 Type of Substance: heterocyclic InChI Key: WMMABVIJELGKTE-UHFFFAOYSA-N Note:

O O

Melting Point (1) 1 of 1

Solvent (Melting Point)

benzene

Comment (Melting Point)

with:0.5 Mol.Wasser (solvent).Decomp.at:226 degreeC.

Kametani; Masuda; Yakugaku Zasshi; vol. 72; (1952); p. 81,84; Chem.Abstr.; (1952); p. 11208, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Gelbbraun

Kametani; Masuda; Yakugaku Zasshi; vol. 72; (1952); p. 81,84; Chem.Abstr.; (1952); p. 11208, View in Reaxys

Reaxys ID 62633 View in Reaxys

63/183 O N

Chemical Name: (E?)-3-[2-methoxy-4-(trans(?)-2-nitro-vinyl)phenoxy]-4,5-methylenedioxy-β-nitro-styrene; (E?)-3-[2-Methoxy-4-(trans(?)-2-nitro-vinyl)-phenoxy]-4,5-methylendioxy-βnitro-styrol Linear Structure Formula: C18H14N2O8 Molecular Formula: C18H14N2O8 Molecular Weight: 386.318 Type of Substance: heterocyclic InChI Key: OMJSGKJFXJACTQ-YDFGWWAZSA-N Note:

O O

E N

Melting Point (1) 1 of 1

Melting Point [°C]

171 - 172

Solvent (Melting Point)

ethyl acetate

165/249

2016-07-13 00:31:19

Kondo et al.; Itsuu Kenkyusho Nempo; nb. 2; (1951); p. 11; dtsch. Ref. S. 48; Chem.Abstr.; (1953); p. 7519, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Gelb

Kondo et al.; Itsuu Kenkyusho Nempo; nb. 2; (1951); p. 11; dtsch. Ref. S. 48; Chem.Abstr.; (1953); p. 7519, View in Reaxys

Reaxys ID 214967 View in Reaxys

64/183 Chemical Name: 7-nitro-[1,3]dioxolo[4,5-g]quinoline; 7-Nitro[1,3]dioxolo[4,5-g]chinolin Linear Structure Formula: C10H6N2O4 Molecular Formula: C10H6N2O4 Molecular Weight: 218.169 Type of Substance: heterocyclic InChI Key: ACPVVLFXRKRACL-UHFFFAOYSA-N Note:

O N

O O

Melting Point (1) 1 of 1

Melting Point [°C]

188 - 190

Solvent (Melting Point)

methanol; acetone

Clemo; Swan; Journal of the Chemical Society; (1945); p. 867,869, View in Reaxys

Reaxys ID 237616 View in Reaxys

65/183 CAS Registry Number: 118898-63-8 Chemical Name: 6-methyl-7-nitro-[1,3]dioxolo[4,5-g]quinoline; 6-Methyl-7-nitro-[1,3]dioxolo[4,5-g]chinolin Linear Structure Formula: C11H8N2O4 Molecular Formula: C11H8N2O4 Molecular Weight: 232.196 Type of Substance: heterocyclic InChI Key: YHGLQPOMIUQYJY-UHFFFAOYSA-N Note:

O N

O O

Melting Point (1) 1 of 1

Melting Point [°C]

205 - 206

Solvent (Melting Point)

propan-2-ol

Dornow; Sassenberg; Justus Liebigs Annalen der Chemie; vol. 602; (1957); p. 14,18, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelbbraeunlich

Dornow; Sassenberg; Justus Liebigs Annalen der Chemie; vol. 602; (1957); p. 14,18, View in Reaxys

Reaxys ID 261519 View in Reaxys

66/183 CAS Registry Number: 88484-87-1 Chemical Name: 5-nitro-6-(2-nitro-propenyl)-benzo[1,3]dioxole; 5-Nitro-6-(2-nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C10H8N2O6 Molecular Formula: C10H8N2O6 Molecular Weight: 252.183 Type of Substance: heterocyclic

O N E

O O

166/249

2016-07-13 00:31:19

InChI Key: KVTULAZMZRAQOD-QHHAFSJGSA-N Note: Melting Point (1) 1 of 1

Melting Point [°C]

155

Solvent (Melting Point)

ethanol

Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Gelb

Burton; Duffield; Journal of the Chemical Society; (1949); p. 78, View in Reaxys

Reaxys ID 289157 View in Reaxys

67/183

CAS Registry Number: 15794-56-6 Chemical Name: 2,5-dimethoxy-3,4-methylenedioxy-β-nitrostyrene; 2,5-Dimethoxy-3,4-methylendioxy-β-nitro-styrol Linear Structure Formula: C11H11NO6 Molecular Formula: C11H11NO6 Molecular Weight: 253.211 Type of Substance: heterocyclic InChI Key: QTWLFKAHIOECED-ONEGZZNKSA-N Note:

O E

O O

Melting Point (1) 1 of 1

Melting Point [°C]

164

Solvent (Melting Point)

methanol

Mannich; Falber; Archiv der Pharmazie (Weinheim, Germany); (1929); p. 608, View in Reaxys Crystal Property Description (1) Colour & Other References Properties orangegelbe Nadeln

Mannich; Falber; Archiv der Pharmazie (Weinheim, Germany); (1929); p. 608, View in Reaxys

Reaxys ID 307144 View in Reaxys

68/183 CAS Registry Number: 22959-14-4 Chemical Name: 4,5-dimethoxy-6-(2-nitro-propenyl)-benzo[1,3]dioxole; 4,5-Dimethoxy-6-(2-nitro-propenyl)-benzo[1,3]dioxol Linear Structure Formula: C12H13NO6 Molecular Formula: C12H13NO6 Molecular Weight: 267.238 Type of Substance: heterocyclic InChI Key: SARJGJXAGRMIPC-QPJJXVBHSA-N Note:

O N E

O O

Melting Point (1) 1 of 1

Melting Point [°C]

94 - 95

Solvent (Melting Point)

ethanol

Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> 15 II; (1906); p. 139, View in Reaxys Crystal Property Description (1) Colour & Other References Properties

167/249

2016-07-13 00:31:19

gelb

Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> 15 II; (1906); p. 139, View in Reaxys

Reaxys ID 307992 View in Reaxys

69/183

O E

O O

Chemical Name: 4,6-dibromo-7-methoxy-5-(2-nitro-propenyl)benzo[1,3]dioxole; 4,6-Dibrom-7-methoxy-5-(2-nitro-propenyl)benzo[1,3]dioxol Linear Structure Formula: C11H9Br2NO5 Molecular Formula: C11H9Br2NO5 Molecular Weight: 395.004 Type of Substance: heterocyclic InChI Key: PSIXDPSNQHHAFX-HWKANZROSA-N Note:

Br O

Melting Point (1) 1 of 1

Melting Point [°C]

160

Solvent (Melting Point)

ethanol

Rimini; Gazzetta Chimica Italiana; vol. 35 I; (1905); p. 413,414, View in Reaxys Crystal Property Description (1) Colour & Other References Properties Blaetter

Rimini; Gazzetta Chimica Italiana; vol. 35 I; (1905); p. 413,414, View in Reaxys

Reaxys ID 322927 View in Reaxys

70/183

O E

O O

Chemical Name: 5-bromo-4,7-dimethoxy-6-(2-nitro-propenyl)benzo[1,3]dioxole; 5-Brom-4,7-dimethoxy-6-(2-nitro-propenyl)benzo[1,3]dioxol Linear Structure Formula: C12H12BrNO6 Molecular Formula: C12H12BrNO6 Molecular Weight: 346.134 Type of Substance: heterocyclic InChI Key: BBBLPQNMCPSOHX-GQCTYLIASA-N Note:

Br O

Melting Point (1) 1 of 1

Melting Point [°C]

120

Solvent (Melting Point)

ethanol

Rimini; Olivari; Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti; vol. <5> 15 II; (1906); p. 139, View in Reaxys

Reaxys ID 324453 View in Reaxys

71/183

168/249

2016-07-13 00:31:19

CAS Registry Number: 109722-66-9 Chemical Name: 4-methoxy-5-(3-nitro-benzofuran-2-yl)-benzo[1,3]dioxole; 4-Methoxy-5-(3-nitro-benzofuran-2-yl)-benzo[1,3]dioxol Linear Structure Formula: C16H11NO6 Molecular Formula: C16H11NO6 Molecular Weight: 313.266 Type of Substance: heterocyclic InChI Key: LLHWWFGPWWDDLL-UHFFFAOYSA-N Note:

O N

Melting Point (1) 1 of 1

Melting Point [°C]

152 - 153

Solvent (Melting Point)

cyclohexane

Wagner et al.; Journal of the American Chemical Society; vol. 81; (1959); p. 5441,5443, View in Reaxys

Reaxys ID 344547 View in Reaxys

72/183 Chemical Name: 6-benzo[1,3]dioxol-5-yl-5-nitro-naphtho[2,3-d] [1,3]dioxole; 6-Benzo[1,3]dioxol-5-yl-5-nitro-naphtho[2,3-d] [1,3]dioxol Linear Structure Formula: C18H11NO6 Molecular Formula: C18H11NO6 Molecular Weight: 337.288 Type of Substance: heterocyclic InChI Key: FRIHIEVZVRYHJO-UHFFFAOYSA-N Note:

O O

Melting Point (1) 1 of 1

Melting Point [°C]

225 - 227

Solvent (Melting Point)

ethanol; acetic acid

Gopinath et al.; Journal of the Chemical Society; (1958); p. 504,508, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb

Gopinath et al.; Journal of the Chemical Society; (1958); p. 504,508, View in Reaxys

Reaxys ID 371560 View in Reaxys

73/183 Chemical Name: 5-(3-acetoxy-propyl)-2-benzo[1,3]dioxol-5yl-3-nitro-benzofuran-4,7-dione; 5-(3-Acetoxy-propyl)-2-benzo[1,3]dioxol-5-yl-3-nitro-benzofuran-4,7-dion Linear Structure Formula: C20H15NO9 Molecular Formula: C20H15NO9 Molecular Weight: 413.34 Type of Substance: heterocyclic InChI Key: MRMVNYIWTIQNQX-UHFFFAOYSA-N Note:

O O O O

N O

Melting Point (1) 1 of 1

Melting Point [°C]

144 - 145

Solvent (Melting Point)

1,2-dichloro-ethane; ethanol

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 586,591; Nippon Kagaku Kaishi; vol. 61; (1940); p. 487,491, View in Reaxys Crystal Property Description (1) Colour & Other References Properties

169/249

2016-07-13 00:31:19

orangerot

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 586,591; Nippon Kagaku Kaishi; vol. 61; (1940); p. 487,491, View in Reaxys

Reaxys ID 374891 View in Reaxys

74/183 Chemical Name: 5-(3-acetoxy-propyl)-2-benzo[1,3]dioxol-5yl-4-bromo-7-methoxy-3-nitro-benzofuran; 5-(3-Acetoxy-propyl)-2-benzo[1,3]dioxol-5-yl-4-brom-7-methoxy-3-nitro-benzofuran Linear Structure Formula: C21H18BrNO8 Molecular Formula: C21H18BrNO8 Molecular Weight: 492.28 Type of Substance: heterocyclic InChI Key: MBNMHOFKDZBLRU-UHFFFAOYSA-N Note:

O O Br O

N O

Melting Point (1) 1 of 1

Melting Point [°C]

139

Solvent (Melting Point)

acetic acid

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys Crystal Property Description (1) Colour & Other References Properties gelb

Kawai et al.; Chemische Berichte; vol. 73; (1940); p. 1328; Nippon Kagaku Kaishi; vol. 62; (1941); p. 112, View in Reaxys

Reaxys ID 381636 View in Reaxys

75/183

O O

Chemical Name: 5-(3-acetoxy-propyl)-2-benzo[1,3]dioxol-5yl-7-methoxy-3,4,6-trinitro-benzofuran Linear Structure Formula: C21H17N3O12 Molecular Formula: C21H17N3O12 Molecular Weight: 503.379 Type of Substance: heterocyclic InChI Key: UUBUBTXMMHOBRC-UHFFFAOYSA-N Note:

O N

O O N O

N O

Melting Point (1) 1 of 1

Melting Point [°C]

198

Solvent (Melting Point)

acetic acid

Kawai et al.; Nippon Kagaku Kaishi; vol. 64; (1943); p. 1213; Chem.Abstr.; (1947); p. 3804, View in Reaxys Crystal Property Description (1) Colour & Other References Properties hellgelb

Kawai et al.; Nippon Kagaku Kaishi; vol. 64; (1943); p. 1213; Chem.Abstr.; (1947); p. 3804, View in Reaxys

Reaxys ID 1032483 View in Reaxys

76/183

170/249

2016-07-13 00:31:19

CAS Registry Number: 73998-88-6 Linear Structure Formula: C13H10N2O6 Molecular Formula: C13H10N2O6 Molecular Weight: 290.232 Type of Substance: heterocyclic InChI Key: ZNTHYZGHJITGJA-UHFFFAOYSA-N Note:

O N

Substance Label (1) Label References I(Z) <Rgrad=Patent; Sandoz,Inc.; US4192876; (1980); DE2631317; Chem.Abstr.; vol. 86; nb. 189742, View in Reaxys CH2CH=CH2,Mp=H,R ,R'=-O-CH2-O-> Melting Point (1) 1 of 1

Melting Point [°C]

235 - 236

Patent; Sandoz,Inc.; US4192876; (1980); DE2631317; Chem.Abstr.; vol. 86; nb. 189742, View in Reaxys

Reaxys ID 1254479 View in Reaxys

77/183 CAS Registry Number: 90945-72-5 Chemical Name: 5-methoxy-6-(2-nitro-vinyl)-benzo[1,3]dioxole; 2-Methoxy-4,5-methylendioxy-ω-nitro-styryl Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: GPZHSRJBTWPMMQ-UHFFFAOYSA-N Note:

O N

O O

Substance Label (1) Label References XVII

Daly,J. et al.; Journal of the American Chemical Society; vol. 83; (1961); p. 4787 - 4792, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

158 - 160

Solvent (Melting Point)

benzene

Daly,J. et al.; Journal of the American Chemical Society; vol. 83; (1961); p. 4787 - 4792, View in Reaxys

Reaxys ID 1318313 View in Reaxys

78/183 CAS Registry Number: 93258-98-1 Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: GPNFVPUFZPUPCQ-UHFFFAOYSA-N Note:

O N

O O

Melting Point (1) 1 of 1

Melting Point [°C]

163

Shulgin; Experientia; vol. 20; nb. 7; (1964); p. 366 - 367, View in Reaxys

Reaxys ID 1319451 View in Reaxys

79/183

171/249

2016-07-13 00:31:19

CAS Registry Number: 15794-47-5 Chemical Name: 4-methoxy-5-(2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 Type of Substance: heterocyclic InChI Key: NAODMGXGMXCCDV-UHFFFAOYSA-N Note:

O N

Melting Point (1) 1 of 1

Melting Point [°C]

130 - 140

Cleaver,L. et al.; Australian Journal of Chemistry; vol. 29; (1976); p. 2003 - 2021, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- NMR troscopy) Cleaver,L. et al.; Australian Journal of Chemistry; vol. 29; (1976); p. 2003 - 2021, View in Reaxys

IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Cleaver,L. et al.; Australian Journal of Chemistry; vol. 29; (1976); p. 2003 - 2021, View in Reaxys

Reaxys ID 1320689 View in Reaxys

80/183 CAS Registry Number: 1962-04-5 Chemical Name: 2-Brom-2'-nitro-3,4-methylendioxy-biphenyl Linear Structure Formula: C13H8BrNO4 Molecular Formula: C13H8BrNO4 Molecular Weight: 322.115 Type of Substance: heterocyclic InChI Key: ZIZMZZVEIHNFLC-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References V

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

157 - 160

Solvent (Melting Point)

acetone; hexane

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Reaxys ID 1321342 View in Reaxys

O O

81/183 CAS Registry Number: 93258-97-0 Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: KSRMSJJZIIODBH-UHFFFAOYSA-N Note:

O N

Melting Point (1) 1 of 1

Melting Point [°C]

106

Shulgin; Experientia; vol. 20; (1964); p. 306, View in Reaxys

172/249

2016-07-13 00:31:19

Reaxys ID 1322144 View in Reaxys

82/183 CAS Registry Number: 1805-91-0 Chemical Name: 6-(2-nitro-phenyl)-benzo[1,3]dioxole-5-carbonitrile; 2'-Nitro-2-cyan-4.5-methylendioxy-biphenyl Linear Structure Formula: C14H8N2O4 Molecular Formula: C14H8N2O4 Molecular Weight: 268.229 Type of Substance: heterocyclic InChI Key: DKUJMCOCCZXYDE-UHFFFAOYSA-N Note:

Substance Label (1) Label References VI

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

188 - 190

Solvent (Melting Point)

benzene; heptane

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Spectrum

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Reaxys ID 1325156 View in Reaxys

83/183 CAS Registry Number: 1805-93-2 Chemical Name: 6-(2-nitro-phenyl)-benzo[1,3]dioxole-5-carboxylic acid; 2-<2-Nitro-phenyl>-4,5-methylendioxy-benzoesaeure Linear Structure Formula: C14H9NO6 Molecular Formula: C14H9NO6 Molecular Weight: 287.229 Type of Substance: heterocyclic InChI Key: DCPJLYJCYLWHNM-UHFFFAOYSA-N Note:

Substance Label (1) Label References VIII

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

235 - 240

Solvent (Melting Point)

acetone; heptane

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Spectrum

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Reaxys ID 1325157 View in Reaxys

84/183

173/249

2016-07-13 00:31:19

CAS Registry Number: 1805-92-1 Chemical Name: 6-(2-nitro-phenyl)-benzo[1,3]dioxole-5-carboxylic acid amide; 2-<2-Nitro-phenyl>-4.5-methylendioxy-benzamid Linear Structure Formula: C14H10N2O5 Molecular Formula: C14H10N2O5 Molecular Weight: 286.244 Type of Substance: heterocyclic InChI Key: RHMZINYMIODERN-UHFFFAOYSA-N Note:

NH 2

Substance Label (1) Label References VII

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

179 - 181

Solvent (Melting Point)

acetone; heptane

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Spectrum

Hill; Carlson; Journal of Organic Chemistry; vol. 30; (1965); p. 1571,1572, View in Reaxys

Reaxys ID 1325263 View in Reaxys

85/183 CAS Registry Number: 7106-79-8 Chemical Name: 6-nitro-[5,5']bi[benzo[1,3]dioxolyl]; 2-Nitro-4,5,4',5'-bis-methylendioxy-diphenyl Linear Structure Formula: C14H9NO6 Molecular Formula: C14H9NO6 Molecular Weight: 287.229 Type of Substance: heterocyclic InChI Key: NBIXJPOXTSOYRF-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 1f

Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

164 - 165

Solvent (Melting Point)

ethanol

Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys

Reaxys ID 1327933 View in Reaxys

86/183 CAS Registry Number: 7106-80-1 Chemical Name: 6-bromo-6'-nitro-[5,5']bi[benzo[1,3]dioxolyl]; 2-Brom-2'-nitro-4,5,4',5'-bis-methylendioxy-diphenyl Linear Structure Formula: C14H8BrNO6 Molecular Formula: C14H8BrNO6 Molecular Weight: 366.125 Type of Substance: heterocyclic InChI Key: NUDYKKYZPFWWLF-UHFFFAOYSA-N Note:

O O Br

174/249

2016-07-13 00:31:19

Substance Label (1) Label References 1g

Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

168 - 169

Solvent (Melting Point)

ethanol

Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys

Reaxys ID 1328513 View in Reaxys

87/183 CAS Registry Number: 5025-68-3 Chemical Name: 5-nitro-phenanthro[2,3-d][1,3]dioxole-4-carboxylic acid methyl ester; 6,7-Methylendioxy-10-nitro-phenanthren-1-carbonsaeure-methylester Linear Structure Formula: C17H11NO6 Molecular Formula: C17H11NO6 Molecular Weight: 325.277 Type of Substance: heterocyclic InChI Key: ZVJSDUQJTVKXMC-UHFFFAOYSA-N Note:

O N

O O

Substance Label (1) Label References LXVII

Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys

Further Information (1) Description (Fur- References ther Information) Further information

Kupchan,S.M.; Wormser,H.C.; Journal of Organic Chemistry; vol. 30; (1965); p. 3792 - 3800, View in Reaxys

Reaxys ID 1348923 View in Reaxys

88/183 CAS Registry Number: 90225-11-9 Chemical Name: 5-chloro-6-(2-nitro-vinyl)-benzo[1,3]dioxole; 6-Chlor-3,4-methylendioxy-ο-nitrostyrol Linear Structure Formula: C9H6ClNO4 Molecular Formula: C9H6ClNO4 Molecular Weight: 227.604 Type of Substance: heterocyclic InChI Key: LGPGWNSINLOLBN-UHFFFAOYSA-N Note:

O N

O O

Substance Label (1) Label References III

Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

156

Solvent (Melting Point)

ethanol

Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

175/249

2016-07-13 00:31:19

Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1

Description (UV/VIS Spectroscopy)

Absorption maxima

Singh; Berlinguet; Canadian Journal of Chemistry; vol. 42; (1964); p. 1901,1903, View in Reaxys

Reaxys ID 1349095 View in Reaxys

89/183 CAS Registry Number: 109161-82-2 Chemical Name: 5-methyl-6-(2-nitro-phenyl)-benzo[1,3]dioxole; 2'-Nitro-4,5-methylendioxy-2-methyl-biphenyl Linear Structure Formula: C14H11NO4 Molecular Formula: C14H11NO4 Molecular Weight: 257.246 Type of Substance: heterocyclic InChI Key: VLDQLMNQSSWXBT-UHFFFAOYSA-N Note:

O O

Purification (1) References Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys Melting Point (2) 1 of 2

Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys

2 of 2

Melting Point [°C]

134 - 135

Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys Sublimation (1) Comment (Sublimation) bei 120-122grad/ 2 Torr

References Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys

Reaxys ID 1350331 View in Reaxys

90/183 CAS Registry Number: 109478-07-1 Chemical Name: 5-methyl-6-(3-methyl-2-nitro-phenyl)-benzo[1,3]dioxole; 2'-Nitro-4,5-methylendioxy-2,3'-dimethyl-biphenyl Linear Structure Formula: C15H13NO4 Molecular Formula: C15H13NO4 Molecular Weight: 271.273 Type of Substance: heterocyclic InChI Key: RWBOUTHSHXKNOI-UHFFFAOYSA-N Note:

O O

Melting Point (1) 1 of 1

Melting Point [°C]

127 - 128

Solvent (Melting Point)

petroleum ether

Kallianpur; Merchant; Journal of the Indian Chemical Society; vol. 38; (1961); p. 27,29, View in Reaxys

Reaxys ID 1356171 View in Reaxys

91/183

176/249

2016-07-13 00:31:19

CAS Registry Number: 7106-75-4 Chemical Name: 6,6'-dinitro-[5,5']bi[benzo[1,3]dioxolyl]; 2,2'-Dinitro-4,5,4',5'-bis-methylendioxy-diphenyl Linear Structure Formula: C14H8N2O8 Molecular Formula: C14H8N2O8 Molecular Weight: 332.226 Type of Substance: heterocyclic InChI Key: IUGHRDLHZJVTNS-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 1b

Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

225 - 226

Solvent (Melting Point)

ethanol

Dallacker,F.; Adolphen,G.; Justus Liebigs Annalen der Chemie; vol. 694; (1966); p. 110 - 116, View in Reaxys

Reaxys ID 1384088 View in Reaxys

92/183 CAS Registry Number: 61675-23-8 Chemical Name: 2-Hydroxy-4,5-methylendioxy-β-nitrostyrol; 2Hydroxy-5-methylendioxy-β-nitrostyrol Linear Structure Formula: C9H7NO5 Molecular Formula: C9H7NO5 Molecular Weight: 209.158 Type of Substance: heterocyclic InChI Key: IZQDCWXYBYGLMU-OWOJBTEDSA-N Note:

O N E

O O

Substance Label (1) Label References 19

Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

200

Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- NMR troscopy) Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys

IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys Mass Spectrometry (1) References Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys UV/VIS Spectroscopy (1) 1 of 1

Description (UV/VIS Spectroscopy)

UV/VIS

Buechi; Mak; Journal of Organic Chemistry; vol. 42; (1977); p. 1784, View in Reaxys

177/249

2016-07-13 00:31:19

Reaxys ID 1387075 View in Reaxys

93/183 CAS Registry Number: 38288-42-5 Chemical Name: 5-nitro-phenanthro[2,3-d][1,3]dioxole Linear Structure Formula: C15H9NO4 Molecular Formula: C15H9NO4 Molecular Weight: 267.241 Type of Substance: heterocyclic InChI Key: CVNYSLBWKUZHCV-UHFFFAOYSA-N Note:

O N

Substance Label (1) Label References 2b

Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

182 - 183

Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- NMR troscopy) Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys

Reaxys ID 1400160 View in Reaxys

94/183

CAS Registry Number: 38288-39-0 Chemical Name: 5-nitro-phenanthro[2,3-d][1,3]dioxole-6-carboxylic acid Linear Structure Formula: C16H9NO6 Molecular Formula: C16H9NO6 Molecular Weight: 311.251 Type of Substance: heterocyclic InChI Key: CJGDWYJUUNIYDC-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 6c

Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

246 - 248

Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys

Reaxys ID 1402390 View in Reaxys

O O

95/183

CAS Registry Number: 38288-41-4 Chemical Name: 5-nitro-phenanthro[2,3-d][1,3]dioxole-6-carboxylic acid methyl ester Linear Structure Formula: C17H11NO6 Molecular Formula: C17H11NO6 Molecular Weight: 325.277 Type of Substance: heterocyclic InChI Key: UUGGGRLTYCSVAA-UHFFFAOYSA-N Note:

O N

Substance Label (1) Label References 6d

Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys

Melting Point (1)

178/249

2016-07-13 00:31:19

1 of 1

Melting Point [°C]

216 - 218

Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- NMR troscopy) Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys

Reaxys ID 1402969 View in Reaxys O

96/183 CAS Registry Number: 38288-32-3 Chemical Name: 5,7-dinitro-phenanthro[2,3-d][1,3]dioxole Linear Structure Formula: C15H8N2O6 Molecular Formula: C15H8N2O6 Molecular Weight: 312.238 Type of Substance: heterocyclic InChI Key: JMIYIFGIHCCGGD-UHFFFAOYSA-N Note:

O N

Substance Label (1) Label References 3b

Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

303 - 307

Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- NMR troscopy) Pailer et al.; Monatshefte fuer Chemie; vol. 103; (1972); p. 659,669,674, View in Reaxys

Reaxys ID 1577335 View in Reaxys

97/183 CAS Registry Number: 71203-58-2 Chemical Name: 2,2-dimethyl-5-(2-nitro-propenyl)-benzo[1,3]dioxole Linear Structure Formula: C12H13NO4 Molecular Formula: C12H13NO4 Molecular Weight: 235.24 Type of Substance: heterocyclic InChI Key: CTQQKTNIVFMWIU-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 10

Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- NMR troscopy) Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys

179/249

2016-07-13 00:31:19

Reaxys ID 1580091 View in Reaxys

98/183 CAS Registry Number: 71203-55-9 Chemical Name: 2-methyl-5-(2-nitro-propenyl)-benzo[1,3]dioxole Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: OYGYLAZCQZHGQN-UHFFFAOYSA-N Note:

O N

Substance Label (1) Label References 9

Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- NMR troscopy) Nichols; Kostuba; Journal of Medicinal Chemistry; vol. 22; nb. 10; (1979); p. 1264 - 1267, View in Reaxys

Reaxys ID 1580359 View in Reaxys

99/183 CAS Registry Number: 13326-78-8 Chemical Name: 5-Bromo-3,4-methylendioxy-β-nitrostyrol Linear Structure Formula: C9H6BrNO4 Molecular Formula: C9H6BrNO4 Molecular Weight: 272.055 Type of Substance: heterocyclic InChI Key: GJSWOWZFZTZZPJ-UPHRSURJSA-N Note:

O O

Substance Label (1) Label References III

Kametani; Wakisaka; Yakugaku Zasshi; vol. 86; (1966); p. 984,987; Chem.Abstr.; vol. 66; nb. 28635; (1967), View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

158 - 159

Solvent (Melting Point)

ethanol

Kametani; Wakisaka; Yakugaku Zasshi; vol. 86; (1966); p. 984,987; Chem.Abstr.; vol. 66; nb. 28635; (1967), View in Reaxys

Reaxys ID 1584953 View in Reaxys

100/183 CAS Registry Number: 37162-74-6 Linear Structure Formula: C10H8BrNO4 Molecular Formula: C10H8BrNO4 Molecular Weight: 286.082 Type of Substance: heterocyclic InChI Key: LFCHGSZICRSDHE-UHFFFAOYSA-N Note:

O N

O O

Substance Label (1) Label References 5 (Table II)

Sepulveda,S. et al.; Journal of Medicinal Chemistry; vol. 15; (1972); p. 413 - 415, View in Reaxys

180/249

2016-07-13 00:31:19

Melting Point (1) 1 of 1

Melting Point [°C]

157.5 - 158.5

Sepulveda,S. et al.; Journal of Medicinal Chemistry; vol. 15; (1972); p. 413 - 415, View in Reaxys

Reaxys ID 1587007 View in Reaxys O

N Z

101/183 CAS Registry Number: 55902-37-9 Linear Structure Formula: C10H8N2O6 Molecular Formula: C10H8N2O6 Molecular Weight: 252.183 Type of Substance: heterocyclic InChI Key: AUGKZVVAJHKIID-POHAHGRESA-N Note:

O N

Substance Label (1) Label References Z-11

Dore; Viel; European Journal of Medicinal Chemistry; vol. 9; nb. 6; (1974); p. 673 - 680, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

157.5

Dore; Viel; European Journal of Medicinal Chemistry; vol. 9; nb. 6; (1974); p. 673 - 680, View in Reaxys

Reaxys ID 1992524 View in Reaxys

102/183 CAS Registry Number: 1219-48-3 Chemical Name: 1-(3'.4'-Methylendioxyphenyl)-2-nitro-hexen Linear Structure Formula: C13H15NO4 Molecular Formula: C13H15NO4 Molecular Weight: 249.266 Type of Substance: heterocyclic InChI Key: HBQRNTAAMWQGFE-UHFFFAOYSA-N Note:

O N

Melting Point (1) 1 of 1

Melting Point [°C]

44.5

Koremura; Nippon Kagaku Kaishi; vol. 36; nb. 7; (1962); p. 552,553-556; Chem.Abstr.; vol. 62; nb. 3962d; (1965), View in Reaxys

Reaxys ID 4278183 View in Reaxys

103/183

O O

CAS Registry Number: 128902-99-8 Chemical Name: 13-Nitrooxyberberine Linear Structure Formula: C20H16N2O7 Molecular Formula: C20H16N2O7 Molecular Weight: 396.356 Type of Substance: heterocyclic InChI Key: VHQAMPGQRNHULN-UHFFFAOYSA-N Note:

O N

Substance Label (1) Label References 2

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

226.5 - 227.5

181/249

2016-07-13 00:31:19

Solvent (Melting Point)

methanol; CH2Cl2

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys 3 of 3

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Comment (IR Spectroscopy)

2910 - 910 cm**(-1)

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys

Reaxys ID 4280663 View in Reaxys

104/183 CAS Registry Number: 128903-00-4 Chemical Name: 12,12-Dinitrooxyberberine Linear Structure Formula: C20H15N3O9 Molecular Formula: C20H15N3O9 Molecular Weight: 441.354 Type of Substance: heterocyclic InChI Key: AGTKYDBQHQFNGC-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 3

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys

Melting Point (1)

182/249

2016-07-13 00:31:19

1 of 1

Melting Point [°C]

231 - 232

Solvent (Melting Point)

methanol

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys Density (1) 1 of 1

Density [g·cm-3]

1.552

Type (Density)

crystallographic

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys Crystal Phase (1) Description (Crys- Comment (Crystal References tal Phase) Phase) Crystal structure determination

β=97.5 grad, a=8.25 Angstroem, b=14.26 Angstroem, c=16.19 Angstroem, n=4.; Temperature: 20 C. Method of determination: Single Crystal X-ray Diffraction

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys

Crystal System (1) Crystal System References monoclinic

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys

Space Group (1) Space Group 4

References Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys

NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys 3 of 3

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

183/249

2016-07-13 00:31:19

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Comment (IR Spectroscopy)

3446 - 868 cm**(-1)

Cushman; Chinnasamy; Patrick; McKenzie; Toma; Journal of Organic Chemistry; vol. 55; nb. 24; (1990); p. 5995 - 6000, View in Reaxys

Reaxys ID 4318903 View in Reaxys

105/183 CAS Registry Number: 134040-37-2 Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: GPNFVPUFZPUPCQ-XVNBXDOJSA-N Note:

O N

E O O

Substance Label (1) Label References 28

Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

26.9

Dawson, Brian A.; By, Arnold W.; Avdovich, Hajro W.; Magnetic Resonance in Chemistry; vol. 29; nb. 2; (1991); p. 188 - 189, View in Reaxys

Reaxys ID 5065942 View in Reaxys

106/183 CAS Registry Number: 112616-89-4; 112616-90-7 Chemical Name: (E/Z)-2-<1-(3,4-methylenedioxyphenylethen)-2-nitroethen-1-yl>furan Linear Structure Formula: C13H9NO5 Molecular Formula: C13H9NO5 Molecular Weight: 259.218 Type of Substance: heterocyclic InChI Key: HGJKTOIWAODNEU-UHFFFAOYSA-N Note:

O N O

O O

Substance Label (1) Label References 14, R=R=OCH2O

Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys

NMR Spectroscopy (3)

184/249

2016-07-13 00:31:19

1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys 3 of 3

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Comment (IR Spectroscopy)

1600 - 1550 cm**(-1)

Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum

Campbell, Malcolm M.; Cosford, Nicholas; Zongli, Li; Sainsbury, Malcolm; Tetrahedron; vol. 43; nb. 6; (1987); p. 1117 - 1122, View in Reaxys

Reaxys ID 5390722 View in Reaxys

107/183

O N

O O

CAS Registry Number: 15794-49-7 Chemical Name: 4-methoxy-6-nitro-5-(2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C10H8N2O7 Molecular Formula: C10H8N2O7 Molecular Weight: 268.183 Type of Substance: heterocyclic InChI Key: WEUISNZNOUUVPB-UHFFFAOYSA-N Note:

Substance Label (1) Label References 2d

Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys

185/249

2016-07-13 00:31:19

Reaxys ID 5391778 View in Reaxys

108/183 CAS Registry Number: 15794-57-7 Chemical Name: 4,7-dimethoxy-5-nitro-6-(2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C11H10N2O8 Molecular Formula: C11H10N2O8 Molecular Weight: 298.209 Type of Substance: heterocyclic InChI Key: LLVQPVXTNOINRZ-UHFFFAOYSA-N Note:

O N

O O

N O

Substance Label (1) Label References 4d

Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys

Reaxys ID 5391779 View in Reaxys

109/183

O N

O O

CAS Registry Number: 15794-66-8 Chemical Name: 4,5-dimethoxy-7-nitro-6-(2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C11H10N2O8 Molecular Formula: C11H10N2O8 Molecular Weight: 298.209 Type of Substance: heterocyclic InChI Key: GABGUGHVAVKULR-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 6d

Dallacker,F.; Bernabei,D.; Monatshefte fuer Chemie; vol. 98; nb. 3; (1967); p. 785 - 797, View in Reaxys

Reaxys ID 5575303 View in Reaxys

110/183 CAS Registry Number: 17055-07-1; 97383-34-1 Chemical Name: 1-<3-methoxy-4,5-(methylenedioxy)phenyl>-2-nitropropene; 1-[3-methoxy-4,5-(methylenedioxy)phenyl]-2-nitropropene Linear Structure Formula: C11H11NO5 Molecular Formula: C11H11NO5 Molecular Weight: 237.212 Type of Substance: heterocyclic InChI Key: URIZGFKLZDNSIH-CLTKARDFSA-N Note:

O O

Substance Label (1) Label References 4b

Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 3607, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

106 - 108

Solvent (Melting Point)

methanol

Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 - 3607, View in Reaxys NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy)

186/249

2016-07-13 00:31:19

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 - 3607, View in Reaxys 2 of 2

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 - 3607, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Comment (IR Spectroscopy)

1640 - 1520 cm**(-1)

Takeya; Okubo; Nishida; Tobinaga; Chemical and Pharmaceutical Bulletin; vol. 33; nb. 9; (1985); p. 3599 - 3607, View in Reaxys

Reaxys ID 6252392 View in Reaxys

111/183

CAS Registry Number: 86588-24-1 Chemical Name: 12-Brom-13-nitro-4,8-dimethoxy-bis<1,3>dioxolo<4,5>benzo<1,2-d:1',2'-f><1,3>dioxepin; 12-Brom-13-nitro-4,8-dimethoxy-bis[1,3]dioxolo[4,5]benzo[1,2-d:1',2'-f][1,3]dioxepin Linear Structure Formula: C17H12BrNO10 Molecular Formula: C17H12BrNO10 Molecular Weight: 470.187 Type of Substance: heterocyclic InChI Key: NZCHUVZAMWYVLP-UHFFFAOYSA-N Note:

O N Br

O O

Substance Label (1) Label References 3d

Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

256 - 257

Solvent (Melting Point)

acetic acid

Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- dimethylsulfoxide scopy)

187/249

2016-07-13 00:31:19

Temperature (NMR Spectroscopy) [°C]

Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Comment (IR Spectroscopy)

1526 - 1337 cm**(-1)

Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys

Reaxys ID 6255542 View in Reaxys

112/183 CAS Registry Number: 86588-23-0 Chemical Name: 12,13-Dinitro-4,8-dimethoxy-bis<1,3>dioxolo<4,5>benzo<1,2-d:1',2'-f><1,3>dioxepin; 12,13-Dinitro-4,8-dimethoxy-bis[1,3]dioxolo[4,5]benzo[1,2-d:1',2'-f][1,3]dioxepin Linear Structure Formula: C17H12N2O12 Molecular Formula: C17H12N2O12 Molecular Weight: 436.288 Type of Substance: heterocyclic InChI Key: RNRLEUHCBPESPY-UHFFFAOYSA-N Note:

N OO N

O O

Substance Label (1) Label References 3c

Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

288 - 290

Solvent (Melting Point)

acetic acid

Comment (Melting Point)

Decomposition

Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- dimethylsulfoxide scopy) Temperature (NMR Spectroscopy) [°C]

Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

188/249

2016-07-13 00:31:19

Comment (IR Spectroscopy)

1520 - 1337 cm**(-1)

Dallacker, Franz; Coerver, Wim; Zeitschrift fuer Naturforschung, Teil B: Anorganische Chemie, Organische Chemie; vol. 38; nb. 3; (1983); p. 383 - 391, View in Reaxys

Reaxys ID 6553403 View in Reaxys

113/183 Chemical Name: benzyl N-(4,5-methylenedioxybenzocyclobuten-1-yl)-N-<5,6-methylenedioxy-2-<(E)-2-nitrovinyl>benzyl>carbamate; benzyl N-(4,5-methylenedioxybenzocyclobuten-1-yl)N-[5,6-methylenedioxy-2-((E)-2-nitrovinyl)benzyl]carbamate Linear Structure Formula: C27H22N2O8 Molecular Formula: C27H22N2O8 Molecular Weight: 502.48 Type of Substance: heterocyclic InChI Key: GMSQFQCUZPPUOC-UVIRAJKCSA-N Note:

O O

N O O

O E

Substance Label (1) Label References 29

Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys 2 of 2

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

CH2Cl2

Comment (IR Spectroscopy)

2905 - 915 cm**(-1)

Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum

Oppolzer; Robbiani; Helvetica Chimica Acta; vol. 66; nb. 4; (1983); p. 1119 - 1128, View in Reaxys

Reaxys ID 6823502 View in Reaxys

114/183

189/249

2016-07-13 00:31:19

Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 Type of Substance: heterocyclic InChI Key: KXZILZHHXSZSJP-WLRTZDKTSA-N Note:

O O

O O E

N O

Substance Label (1) Label References 4e

Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

142

Solvent (Melting Point)

petroleum ether; ethyl acetate

Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

CHCl3

Comment (IR Spectroscopy)

1650 - 1240 cm**(-1)

Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys Pharmacological Data (3) 1 of 3

Comment (Pharmacological Data)

Bioactivities present

Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys 2 of 3

Comment (Pharmacological Data)

activity against yeasts: Salmonella typhosa and Saccharomyces cervesciae

Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys 3 of 3

Comment (Pharmacological Data)

antimicrobial activity against gram positive bacteria: Streptomyces aureus, Bacillus subtilis and against gram negative bacteria: Escherischia coli and Salmonella typhosa; no activity against Sarcina lutea

Kodukulla; Trivedi; Vora; Mathur; Synthetic Communications; vol. 24; nb. 6; (1994); p. 819 - 832, View in Reaxys

Reaxys ID 7253689 View in Reaxys

115/183 Chemical Name: (E)-6,7-(Methylenedioxy)-4-(nitromethylene)-3,4-dihydro-1H-2-benzopyran Linear Structure Formula: C11H9NO5 Molecular Formula: C11H9NO5 Molecular Weight: 235.196 Type of Substance: heterocyclic InChI Key: DFSFYDOYEHECIY-BAQGIRSFSA-N Note:

O O

N E

O O

190/249

2016-07-13 00:31:19

Substance Label (1) Label References (E)-2

Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys 2 of 2

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys

Reaxys ID 7253690 View in Reaxys

116/183 Chemical Name: (Z)-6,7-(Methylenedioxy)-4-(nitromethylene)-3,4-dihydro-1H-2-benzopyran Linear Structure Formula: C11H9NO5 Molecular Formula: C11H9NO5 Molecular Weight: 235.196 Type of Substance: heterocyclic InChI Key: DFSFYDOYEHECIY-FPYGCLRLSA-N Note:

O N Z

O O

Substance Label (1) Label References (Z)-2

Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

161 - 162

Solvent (Melting Point)

ethyl acetate

Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy)

191/249

2016-07-13 00:31:19

Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CD2Cl2 scopy) Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys 3 of 3

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

CHCl3

Comment (IR Spectroscopy)

3023 - 1322 cm**(-1)

Denmark, Scott E.; Schnute, Mark E.; Journal of Organic Chemistry; vol. 60; nb. 4; (1995); p. 1013 - 1019, View in Reaxys

Reaxys ID 7926964 View in Reaxys

117/183 Chemical Name: 4-methyl-5-(2-nitro-1-propenyl)-1,3-benzodioxole Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: SJYNAAUNZLNCRC-FNORWQNLSA-N Note:

O O

Melting Point (1) 1 of 1

Melting Point [°C]

91 - 92

Solvent (Melting Point)

methanol

Parker, Matthew A.; Marona-Lewicka, Danuta; Kurrasch, Deborah; Shulgin, Alexander T.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 41; nb. 6; (1998); p. 1001 - 1005, View in Reaxys NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Parker, Matthew A.; Marona-Lewicka, Danuta; Kurrasch, Deborah; Shulgin, Alexander T.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 41; nb. 6; (1998); p. 1001 - 1005, View in Reaxys 2 of 2

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy)

192/249

2016-07-13 00:31:19

Comment (NMR Spectroscopy)

1H-1H

Parker, Matthew A.; Marona-Lewicka, Danuta; Kurrasch, Deborah; Shulgin, Alexander T.; Nichols, David E.; Journal of Medicinal Chemistry; vol. 41; nb. 6; (1998); p. 1001 - 1005, View in Reaxys

Reaxys ID 7927054 View in Reaxys

118/183 Chemical Name: 4-methyl-6-(2-nitro-1-propenyl)-1,3-benzodioxole Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 Type of Substance: heterocyclic InChI Key: SNWYNMRQQXBEPF-XBXARRHUSA-N Note:

O E

Melting Point (1) 1 of 1

Melting Point [°C]

97 - 98

Solvent (Melting Point)

methanol

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Reaxys ID 7998370 View in Reaxys

S O

119/183 CAS Registry Number: 212332-76-8 Linear Structure Formula: C10H9NO4S Molecular Formula: C10H9NO4S Molecular Weight: 239.252 Type of Substance: heterocyclic InChI Key: MDQKUHJOTDHHII-SNAWJCMRSA-N Note:

O E

Melting Point (1) 1 of 1

Melting Point [°C]

119 - 120

Solvent (Melting Point)

ethanol

Schlosser, Manfred; Simig, Gyula; Geneste, Herve; Tetrahedron; vol. 54; nb. 31; (1998); p. 9023 - 9032, View in Reaxys NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy)

193/249

2016-07-13 00:31:19

Schlosser, Manfred; Simig, Gyula; Geneste, Herve; Tetrahedron; vol. 54; nb. 31; (1998); p. 9023 - 9032, View in Reaxys 2 of 2

Description (NMR Spec- Spin-spin coupling constants troscopy) Solvents (NMR Spectro- CDCl3 scopy) Comment (NMR Spectroscopy)

1H-1H

Schlosser, Manfred; Simig, Gyula; Geneste, Herve; Tetrahedron; vol. 54; nb. 31; (1998); p. 9023 - 9032, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum; electron impact (EI)

Schlosser, Manfred; Simig, Gyula; Geneste, Herve; Tetrahedron; vol. 54; nb. 31; (1998); p. 9023 - 9032, View in Reaxys

Reaxys ID 8985761 View in Reaxys

120/183 Linear Structure Formula: C10H8INO4 Molecular Formula: C10H8INO4 Molecular Weight: 333.082 Type of Substance: heterocyclic InChI Key: IPRMBQGMMQIULQ-KXFIGUGUSA-N Note:

O O

N Z

O O

Reaxys ID 8985762 View in Reaxys

121/183 Linear Structure Formula: C10H8INO4 Molecular Formula: C10H8INO4 Molecular Weight: 333.082 Type of Substance: heterocyclic InChI Key: QKEGOTGIVGLTFW-XQRVVYSFSA-N Note:

I Z

O O

Reaxys ID 8997478 View in Reaxys

122/183 Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 Type of Substance: heterocyclic InChI Key: GLIVYAMKDCGTAE-RIYZIHGNSA-N Note:

O N

O O

Reaxys ID 9127240 View in Reaxys

123/183 Chemical Name: 2-(3,4-methylenedioxyphenyl)-3-nitropyridine Linear Structure Formula: C12H8N2O4 Molecular Formula: C12H8N2O4 Molecular Weight: 244.207 Type of Substance: heterocyclic

N O O

194/249

2016-07-13 00:31:19

InChI Key: MEDDHFQVDSUOKX-UHFFFAOYSA-N Note: Melting Point (1) 1 of 1

Melting Point [°C]

99 - 101

Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys

NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys 2 of 3

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys 3 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

solid

Liebeskind, Lanny S; Srogl, Jiri; Organic letters; vol. 4; nb. 6; (2002); p. 979 - 981, View in Reaxys

Reaxys ID 9429632 View in Reaxys O

124/183 CAS Registry Number: 566872-48-8 Chemical Name: 6-(4,5-methylenedioxy-2-nitrophenyl)-3-methoxy-5-nitronaphthalene Linear Structure Formula: C18H12N2O7 Molecular Formula: C18H12N2O7 Molecular Weight: 368.302 Type of Substance: heterocyclic

O O

195/249

2016-07-13 00:31:19

InChI Key: QPKZGCLWAKNWFI-UHFFFAOYSA-N Note: Substance Label (1) Label References 53

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

187 - 189

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys NMR Spectroscopy (3) 1 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 3 of 3

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys

Reaxys ID 9435428 View in Reaxys

125/183

196/249

2016-07-13 00:31:19

CAS Registry Number: 566872-50-2 Chemical Name: 2-(4,5-methylenedioxy-2-nitrophenyl)-7-acetoxy-1-nitronaphthalene Linear Structure Formula: C19H12N2O8 Molecular Formula: C19H12N2O8 Molecular Weight: 396.313 Type of Substance: heterocyclic InChI Key: BBITYAAGEIRHRV-UHFFFAOYSA-N Note:

O O O

O O

Substance Label (1) Label References 55

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

166 - 167

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 3 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys

Reaxys ID 9442002 View in Reaxys

126/183

197/249

2016-07-13 00:31:19

CAS Registry Number: 566872-49-9 Chemical Name: 2-(4,5-methylenedioxy-2-nitrophenyl)-7-benzyloxy-1-nitronaphthalene Linear Structure Formula: C24H16N2O7 Molecular Formula: C24H16N2O7 Molecular Weight: 444.4 Type of Substance: heterocyclic InChI Key: JUDMWHINUWZQAN-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 54

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

151 - 152

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 2 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys 3 of 3

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

Yu, Younong; Singh, Sudhir K.; Liu, Angela; Li, Tsai-Kun; Liu, Leroy F.; LaVoie, Edmond J.; Bioorganic and Medicinal Chemistry; vol. 11; nb. 7; (2003); p. 1475 - 1491, View in Reaxys

Reaxys ID 9485333 View in Reaxys

127/183

198/249

2016-07-13 00:31:19

Chemical Name: 3,4-methylenedioxybenzylidene-1-nitro-2propanone Linear Structure Formula: C11H9NO5 Molecular Formula: C11H9NO5 Molecular Weight: 235.196 Type of Substance: heterocyclic InChI Key: LIQFNOIFKPNYFO-WTKPLQERSA-N Note:

O Z

O O

Substance Label (1) Label References 1c

Kravchenko; Pirozhenko; Vdovenko; Sorochinsky; Remennikov; Chemistry of Heterocyclic Compounds; vol. 39; nb. 2; (2003); p. 188 - 194, View in Reaxys

Reaxys ID 9763037 View in Reaxys

128/183 CAS Registry Number: 743430-92-4 Chemical Name: 5-fluoro-6-(2-nitrovinyl)-benzo[1,3]dioxole Linear Structure Formula: C9H6FNO4 Molecular Formula: C9H6FNO4 Molecular Weight: 211.149 Type of Substance: heterocyclic InChI Key: AJTOAZCXDVAPKC-UHFFFAOYSA-N Note:

O N

O O

Substance Label (1) Label References 12

Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

143 - 144

Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys

NMR Spectroscopy (4) 1 of 4

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys 2 of 4

Nucleus (NMR Spectroscopy)

13C

Coupling Nuclei

19F

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

199/249

2016-07-13 00:31:19

Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys 3 of 4

Nucleus (NMR Spectroscopy)

Coupling Nuclei

19F; 1H

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys 4 of 4

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Moreau, Anne; Couture, Axel; Deniau, Eric; Grandclaudon, Pierre; Lebrun, Stephane; Tetrahedron; vol. 60; nb. 29; (2004); p. 6169 - 6176, View in Reaxys

Reaxys ID 9859679 View in Reaxys

129/183 Chemical Name: 6-(2-nitrobiphenyl)benzo[1,3]dioxole-5-carboxylic acid methyl ester Linear Structure Formula: C15H11NO6 Molecular Formula: C15H11NO6 Molecular Weight: 301.255 Type of Substance: heterocyclic InChI Key: GVHDCXHYKJUYND-UHFFFAOYSA-N Note:

Substance Label (1) Label References 58

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

133 - 134

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys

NMR Spectroscopy (4) 1 of 4

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

200/249

2016-07-13 00:31:19

Frequency (NMR Spectroscopy) [MHz]

300

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 2 of 4

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

300

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 3 of 4

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

300

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys 4 of 4

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

125

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Banwell, Martin G.; Lupton, David W.; Ma, Xinghua; Renner, Jens; Sydnes, Magne O.; Organic Letters; vol. 6; nb. 16; (2004); p. 2741 - 2744, View in Reaxys

201/249

2016-07-13 00:31:19

Reaxys ID 10101572 View in Reaxys

130/183 CAS Registry Number: 669769-61-3 Chemical Name: 4-nitro-3-(6-nitrobenzo[1,3]-dioxol-5-yl)quinoline Linear Structure Formula: C16H9N3O6 Molecular Formula: C16H9N3O6 Molecular Weight: 339.264 Type of Substance: heterocyclic InChI Key: UGDKSLLNRWSVQV-UHFFFAOYSA-N Note:

Substance Label (1) Label References 26

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys 2 of 2

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

Reaxys ID 10102380 View in Reaxys

131/183 CAS Registry Number: 669769-52-2 Chemical Name: 5-nitro-6-(6-nitrobenzo[1,3]dioxol-5-yl)quinoline Linear Structure Formula: C16H9N3O6 Molecular Formula: C16H9N3O6 Molecular Weight: 339.264 Type of Substance: heterocyclic InChI Key: PDUGQMLWNPCXMK-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 11

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

148 - 149

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

202/249

2016-07-13 00:31:19

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

Reaxys ID 10102407 View in Reaxys

132/183 CAS Registry Number: 669769-56-6 Chemical Name: 4-nitro-3-(6-nitrobenzo[1,3]dioxol-5-yl)isoquinoline Linear Structure Formula: C16H9N3O6 Molecular Formula: C16H9N3O6 Molecular Weight: 339.264 Type of Substance: heterocyclic InChI Key: CYFWCRURMGSAPR-UHFFFAOYSA-N Note:

Substance Label (1) Label References 18

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

183 - 184

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

203/249

2016-07-13 00:31:19

Reaxys ID 10111071 View in Reaxys

133/183 CAS Registry Number: 669769-57-7 Chemical Name: 6,7-dimethoxy-4-nitro-3-(6-nitrobenzo[1,3]dioxol-5-yl)isoquinoline Linear Structure Formula: C18H13N3O8 Molecular Formula: C18H13N3O8 Molecular Weight: 399.317 Type of Substance: heterocyclic InChI Key: CDYYTMREEYIDKY-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 19

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

238 - 239

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

Reaxys ID 10112710 View in Reaxys

134/183 CAS Registry Number: 669769-62-4 Chemical Name: 6,7-dimethoxy-4-nitro-3-(6-nitrobenzo[1,3]-dioxol-5-yl)quinoline Linear Structure Formula: C18H13N3O8 Molecular Formula: C18H13N3O8 Molecular Weight: 399.317 Type of Substance: heterocyclic InChI Key: GRWXRGAIBNTVTB-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 27

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

200

204/249

2016-07-13 00:31:19

Singh, Sudhir K.; Ruchelman, Alexander L.; Zhou, Nai; Li, Tsai-Kun; Liu, Angela; Liu, Leroy F.; LaVoie, Edmond J.; Medicinal Chemistry Research; vol. 12; nb. 1; (2003); p. 1 - 12, View in Reaxys

Reaxys ID 10549314 View in Reaxys

135/183 CAS Registry Number: 916245-17-5 Linear Structure Formula: C11H11NO6 Molecular Formula: C11H11NO6 Molecular Weight: 253.211 Type of Substance: heterocyclic InChI Key: DPUBWQOCTWSMJR-UHFFFAOYSA-N Note:

O N

O O

HO O

Substance Label (1) Label References 5c

Ortiz, Juan Carlos; Ozores, Lidia; Cagide-Fagin, Fernando; Alonso, Ricardo; Chemical Communications; nb. 40; (2006); p. 4239 - 4241, View in Reaxys

Reaxys ID 10710827 View in Reaxys

136/183 CAS Registry Number: 916487-02-0 Chemical Name: 6,7-methylenedioxy-4-(2-[1,3]dioxolan-2-ylphenyl)-3-nitro-2H-chromene Linear Structure Formula: C19H15NO7 Molecular Formula: C19H15NO7 Molecular Weight: 369.331 Type of Substance: heterocyclic InChI Key: HELQUDNQTZEGAJ-UHFFFAOYSA-N Note:

O O O

O O

N O O

Substance Label (1) Label References 14

Melting Point (1) 1 of 1

Melting Point [°C]

129 - 131

Solvent (Melting Point)

methanol

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

205/249

2016-07-13 00:31:19

2 of 2

Nucleus (NMR Spectroscopy)

Coupling Nuclei

Solvents (NMR Spectro- CDCl3 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Reaxys ID 11090863 View in Reaxys

137/183 Chemical Name: (E)-diisopropyl 1-(2-(benzo[d][1,3]dioxol-5yl)-1-nitrovinyl)hydrazine-1,2-dicarboxylate Linear Structure Formula: C17H21N3O8 Molecular Formula: C17H21N3O8 Molecular Weight: 395.369 InChI Key: WKMLJKPXCIPXFV-OVCLIPMQSA-N Note:

O N

O O

HN O

O O

Substance Label (1) Label References 3h

Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

98 - 99

Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys

NMR Spectroscopy (5) 1 of 5

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys 2 of 5

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys 3 of 5

Description (NMR Spec- Spectrum troscopy) Nucleus (NMR Spectroscopy)

Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys 4 of 5

Description (NMR Spec- Chemical shifts troscopy)

206/249

2016-07-13 00:31:19

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys 5 of 5

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- CDCl3 scopy) Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

KBr

Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) spectrum

Dadwal, Mamta; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Organic and Biomolecular Chemistry; vol. 4; nb. 13; (2006); p. 2525 - 2528, View in Reaxys

Reaxys ID 13676601 View in Reaxys

138/183 Chemical Name: 1-(1,3-benzodioxol-5-yl)-2-nitro-1-pentene Linear Structure Formula: C12H13NO4 Molecular Formula: C12H13NO4 Molecular Weight: 235.24 InChI Key: BDRAJGDAPYLXOK-POHAHGRESA-N Note:

O O

Reaxys ID 14550839 View in Reaxys

139/183 CAS Registry Number: 885067-87-8 Chemical Name: 2,2-difluoro-5-(-2-nitro-vinyl)-benzo[1,3]dioxole Linear Structure Formula: C9H5F2NO4 Molecular Formula: C9H5F2NO4 Molecular Weight: 229.14 InChI Key: QDPFQTZFVOZJEL-UHFFFAOYSA-N Note:

O F F

Substance Label (1) Label References 61

Patent; AVENTIS PHARMACEUTICALS INC.; WO2006/44732; (2006); (A2) English, View in Reaxys

207/249

2016-07-13 00:31:19

Reaxys ID 14647126 View in Reaxys

140/183 CAS Registry Number: 338948-54-2 Chemical Name: 6-(4,5-Methylenedioxy-2-nitrophenyl)-2,3-dimethoxy-5-nitronaphthalene Linear Structure Formula: C19H14N2O8 Molecular Formula: C19H14N2O8 Molecular Weight: 398.329 InChI Key: DJGMTAZCKLNFDR-UHFFFAOYSA-N Note:

O N

Melting Point (1) 1 of 1

Melting Point [°C]

187 - 189

Patent; LaVoie, Edmond J.; Liu, Leroy Fong; Yu, Younong; US2003/100560; (2003); (A1) English, View in Reaxys NMR Spectroscopy (2) 1 of 2

Nucleus (NMR Spectroscopy)

Original Text (NMR Spectroscopy)

1H NMR (CDCl3) δ 3.92 (3H, s), 6.19 (2H, d), 6.76 (1H, s), 7.12 (1H, d, J=2.5), 7.18 (1H, d, J=8.3), 7.28 (1H, dd, J1=9.0, J2=2.3), 7.70 (1H, s), 7.85 (1H, d, J=9.2), 7.93 (1H, d, J=8.4)

Comment (NMR Spectroscopy)

Signals given

Signals [ppm]

3.92; 6.19; 6.76; 7.12; 7.18; 7.28; 7.7; 7.85; 7.93

Kind of signal

3H, s; 2H, d; 1H, s; 1H, d, J=2.5; 1H, d, J=8.3; 1H, dd, J&1%=9.0, J&2%=2.3; 1H, s; 1H, d, J=9.2; 1H, d, J=8.4

Patent; LaVoie, Edmond J.; Liu, Leroy Fong; Yu, Younong; US2003/100560; (2003); (A1) English, View in Reaxys 2 of 2

Nucleus (NMR Spectroscopy)

13C

Original Text (NMR Spectroscopy)

13C NMR δ 56.08, 100.59, 103.93, 106.31, 110.70, 121.54, 124.07, 126.47, 128.71, 129.55, 130.33, 130.99, 131.23, 142.83, 148.92, 152.07, 160.68

Comment (NMR Spectroscopy)

Signals given

Signals [ppm]

56.08; 100.59; 103.93; 106.31; 110.7; 121.54; 124.07; 126.47; 128.71; 129.55; 130.33; 130.99; 131.23; 142.83; 148.92; 152.07; 160.68

Patent; LaVoie, Edmond J.; Liu, Leroy Fong; Yu, Younong; US2003/100560; (2003); (A1) English, View in Reaxys IR Spectroscopy (1) 1 of 1

Solvent (IR Spectroscopy)

KBr

Original Text (IR Spectroscopy)

IR (KBr) 2925, 1628, 1526, 1487, 1364, 1332, 1265, 1230 cm-1;

Signals [cm-1]

2925; 1628; 1526; 1487; 1364; 1332; 1265; 1230

Patent; LaVoie, Edmond J.; Liu, Leroy Fong; Yu, Younong; US2003/100560; (2003); (A1) English, View in Reaxys

Reaxys ID 15703124 View in Reaxys

141/183 Chemical Name: 3-(3,4-Methylenedioxyphenyl) amino-4-nitrophenol Linear Structure Formula: C13H10N2O5 Molecular Formula: C13H10N2O5 Molecular Weight: 274.233 InChI Key: DPDHNXUPRUYRDN-UHFFFAOYSA-N

OH H 2N O O

208/249

2016-07-13 00:31:19

Note: NMR Spectroscopy (1) 1 of 1

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- d6-DMSO scopy) Original Text (NMR Spectroscopy)

1H-NMR

Comment (NMR Spectroscopy)

Signals given

Signals [ppm]

(D6-DMSO): δ=6

Patent; Schering AG; US2002/6948; (2002); (A1) English, View in Reaxys

Reaxys ID 19047826 View in Reaxys

142/183 CAS Registry Number: 1155287-34-5 Chemical Name: 4-Benzo[1,3]dioxol-5-yl-6-chloro-2-(4-fluorobenzyl)-5-nitro-pyrimidine; 4-benzo[1,3]dioxol-5-yl-6-chloro-2(4-fluorobenzyl)-5-nitropyrimidine Linear Structure Formula: C18H11ClFN3O4 Molecular Formula: C18H11ClFN3O4 Molecular Weight: 387.754 InChI Key: OYIKBGVGIKOMHL-UHFFFAOYSA-N Note:

N Cl

Substance Label (1) Label References 29

Patent; DECODE GENETICS EHF; US2009/130076; (2009); (A1) English, View in Reaxys

Reaxys ID 19510434 View in Reaxys

143/183 CAS Registry Number: 49571-79-1 Chemical Name: methyl (E)-3-(1,3-benzodioxol-5-yl)-2-nitroacrylate Linear Structure Formula: C11H9NO6 Molecular Formula: C11H9NO6 Molecular Weight: 251.196 InChI Key: IGDFMGQGZSISDX-XBXARRHUSA-N Note:

O E

O O

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

24.84

Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Blanco-Ania, Daniel; Hermkens, Pedro H.H.; Sliedregt, Leo A.J.M.; Scheeren, Hans W.; Rutjes, Floris P.J.T.; Tetrahedron; vol. 65; nb. 27; (2009); p. 5393 - 5401, View in Reaxys

209/249

2016-07-13 00:31:19

2 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

24.84

Frequency (NMR Spectroscopy) [MHz]

Location

supporting information

Blanco-Ania, Daniel; Hermkens, Pedro H.H.; Sliedregt, Leo A.J.M.; Scheeren, Hans W.; Rutjes, Floris P.J.T.; Tetrahedron; vol. 65; nb. 27; (2009); p. 5393 - 5401, View in Reaxys

Reaxys ID 19954700 View in Reaxys

144/183 CAS Registry Number: 1211909-49-7 Chemical Name: (E)-4-(3-(benzo[d][1,3]dioxol-5-yl)-2-nitroallyl)morpholine Linear Structure Formula: C14H16N2O5 Molecular Formula: C14H16N2O5 Molecular Weight: 292.291 InChI Key: KWCSMXONLVLGBA-KPKJPENVSA-N Note:

O O

N O

Melting Point (1) 1 of 1

Melting Point [°C]

127 - 130

Location

supporting information

Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys Crystal Property Description (1) Colour & Other Location Properties yellow

supporting information

References Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy)

210/249

2016-07-13 00:31:19

Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Location

supporting information

Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys Mass Spectrometry (2) Description (Mass Location Spectrometry)

References

ESI (Electrospray ionisation); Spectrum

supporting information

Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys

ESI (Electrospray supporting inforionisation); HRMS mation (High resolution mass spectrometry); Spectrum

Rajesh, Kunjanpillai; Shanbhag, Pramod; Raghavendra, Manjoji; Bhardwaj, Pallavi; Namboothiri, Irishi N.N.; Tetrahedron Letters; vol. 51; nb. 5; (2010); p. 846 - 849, View in Reaxys

Reaxys ID 20065431 View in Reaxys F

145/183

CAS Registry Number: 1206795-06-3 Linear Structure Formula: C14H7F3N2O6 Molecular Formula: C14H7F3N2O6 Molecular Weight: 356.215 InChI Key: OUWXMQXYKGQGNE-UHFFFAOYSA-N Note:

O N

O O

Patent-Specific Data (1) References Patent; MURDOCH UNIVERSITY; BEST, Wayne Morris; SIMS, Colette Gloria; SCAFFIDI, Adrian; GIUSEPPE, Luna; THOMPSON, Richard Christopher Andrew; ARMSTRONG, Tanya; WO2010/9508; (2010); (A1) English, View in Reaxys Melting Point (1) 1 of 1

Melting Point [°C]

147 - 149

Patent; MURDOCH UNIVERSITY; BEST, Wayne Morris; SIMS, Colette Gloria; SCAFFIDI, Adrian; GIUSEPPE, Luna; THOMPSON, Richard Christopher Andrew; ARMSTRONG, Tanya; WO2010/9508; (2010); (A1) English, View in Reaxys Pharmacological Data (3) 1 of 3

Comment (Pharmacological Data)

Bioactivities present

Effect (Pharmacological Data)

antiparasitic

Species or Test-System (Pharmacological Data)

Trypanosoma brucei rhodesiense

Method (Pharmacological Data)

B. Dose response curves against Trypanosomes.As with screening, dose response curves against Trypanosomes are performed in 96 well plates with 3 curves per plate. Ini-

211/249

2016-07-13 00:31:19

tial curves start at 10μM and decrease to 0.01 μM.1. Using a haemocytometer count a 10 ml culture of Trypanosomes at optimum growth (i.e. high in numbers without any short and stumpy forms apparent). Calculate the dilution factor needed to achieve a concentration of organisms at about 1X105/ml. The Trypanosomes will be diluted a further 1 :2 during plate set up, so that the final concentration of organisms should be about 5X104AnI.2. Drugs are pre-diluted in a 48 well plate. As with the screening plates, a volume sufficient to allow 50μl to be dispensed to each test and drug blank well is prepared. Dilute Diminazene stock to give 10ng/ml3. Add 100μl of warm media to the Media only and Media + aB wells. 4. Add 50μl of warm media to the Drug + Media blank wells, Trypanosome only and Diminazene Control wells.5. Add 50μl of drug dilution to the appropriate test wells and drug blank wells on the DRC plate.6. Add 50μl of Trypanosome suspension to all wells excluding Drug + Media blanks. The addition of Trypanosomes completes the dilution of the drugs. Incubate plate at 37 0C and 5percent CO2 for 48 hours.7. After about 48 hours alamarBlue (aB) should be added to the plate as follows. Add 10μl of aB to all of the drug screening wells, the Trypanosome only wells, the Diminazene control wells and the Media + aB wells (DONOT add the aB to the Drug + Media blank wells or the Media only wells). 8. Return to the incubator for a further 24 hrs.9. Once a total of 72 hours has elapsed, read the plate on a Biorad microplate reader at 570nm and 630nm.ResultsThe results are set out in Figures 1 to 6. Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

0.22 μmol/l

Location

Page/Page column 51-52

Effect (Pharmacological Data)

antiparasitic

Species or Test-System (Pharmacological Data)

Trypanosoma cruzi

Method (Pharmacological Data)

B. Dose response curves against Trypanosomes.As with screening, dose response curves against Trypanosomes are performed in 96 well plates with 3 curves per plate. Initial curves start at 10μM and decrease to 0.01 μM.1. Using a haemocytometer count a 10 ml culture of Trypanosomes at optimum growth (i.e. high in numbers without any short and stumpy forms apparent). Calculate the dilution factor needed to achieve a concentration of organisms at about 1X105/ml. The Trypanosomes will be diluted a further 1 :2 during plate set up, so that the final concentration of organisms should be about 5X104AnI.2. Drugs are pre-diluted in a 48 well plate. As with the screening plates, a volume sufficient to allow 50μl to be dispensed to each test and drug blank well is prepared. Dilute Diminazene stock to give 10ng/ml3. Add 100μl of warm media to the Media only and Media + aB wells. 4. Add 50μl of warm media to the Drug + Media blank wells, Trypanosome only and Diminazene Control wells.5. Add 50μl of drug dilution to the appropriate test wells and drug blank wells on the DRC plate.6. Add 50μl of Trypanosome suspension to all wells excluding Drug + Media blanks. The addition of Trypanosomes completes the dilution of the drugs. Incubate plate at 37 0C and 5percent CO2 for 48 hours.7. After about 48 hours alamarBlue (aB) should be added to the plate as follows. Add 10μl of aB to all of the drug screening wells, the Trypanosome only wells, the Diminazene control wells and the Media + aB wells (DONOT add the aB to the Drug + Media blank wells or the Media only wells). 8. Return to the incubator for a further 24 hrs.9. Once a total of 72 hours has elapsed, read the plate on a Biorad microplate reader at 570nm and 630nm.ResultsThe results are set out in Figures 1 to 6.

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

0.07 μmol/l

Location

Page/Page column 51-52

212/249

2016-07-13 00:31:19

Reaxys ID 20299549 View in Reaxys

O O

146/183

O N NH

O O

N O

Related Structure (1) Related Structure Location The tautomers given are discussed.

CAS Registry Number: 1220140-26-0 Chemical Name: diethyl 4-(benzo[d][1,3]dioxol-5-yl)-5-nitro-1Hpyrazol-3-yl-3-phosphonate Linear Structure Formula: C14H16N3O7P Molecular Formula: C14H16N3O7P Molecular Weight: 369.271 InChI Key: GMOWBANHPFOOML-UHFFFAOYSA-N Note:

supporting information

Referenced Com- References pound C14H16N3O7P

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

177

Location

supporting information

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys Crystal Property Description (1) Colour & Other Location Properties yellow

supporting information

References Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys

NMR Spectroscopy (5) 1 of 5

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

31P

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

24.84

Frequency (NMR Spectroscopy) [MHz]

161.8

Location

supporting information

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys 2 of 5

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

31P

Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Temperature (NMR Spectroscopy) [°C]

24.84

Frequency (NMR Spectroscopy) [MHz]

121.4

Location

supporting information

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys 3 of 5

Description (NMR Spec- Chemical shifts; Spectrum troscopy)

213/249

2016-07-13 00:31:19

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys 4 of 5

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- dimethylsulfoxide-d6 scopy) Frequency (NMR Spectroscopy) [MHz]

300

Location

supporting information

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys 5 of 5

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

Location

supporting information

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Intensity of IR bands; Bands

Solvent (IR Spectroscopy)

potassium bromide

Location

supporting information

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 2205, View in Reaxys Mass Spectrometry (2) Description (Mass Location Spectrometry)

References

ESI (Electrospray ionisation); Spectrum

supporting information

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys

HRMS (High resolution mass spectrometry); ESI (Electrospray ionisation); TOFMS (Time of flight mass spectrum); Spectrum

supporting information

Muruganantham, Rajendran; Namboothiri, Irishi; Journal of Organic Chemistry; vol. 75; nb. 7; (2010); p. 2197 - 2205, View in Reaxys

214/249

2016-07-13 00:31:19

Reaxys ID 20370727 View in Reaxys

147/183 Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 InChI Key: FUERCDRQIMGLOO-UHFFFAOYSA-N Note:

O N

O O

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys Mass Spectrometry (1) Description (Mass Location Spectrometry) HRMS (High resolution mass spectrometry); ESI (Electrospray ionisation); Spectrum

References

supporting information

Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys

Reaxys ID 20370729 View in Reaxys

148/183 Linear Structure Formula: C12H11NO6 Molecular Formula: C12H11NO6 Molecular Weight: 265.222 InChI Key: AAJUSLUYUIWOGN-UHFFFAOYSA-N Note:

O N

O O

Reaxys ID 20370731 View in Reaxys

149/183

215/249

2016-07-13 00:31:19

O N

Linear Structure Formula: C14H13NO6 Molecular Formula: C14H13NO6 Molecular Weight: 291.26 InChI Key: XMOVPTJQKQJLHB-UHFFFAOYSA-N Note:

O O O

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

References

supporting information

Tan, Bin; Zhu, Di; Zhang, Lihong; Chua, Pei Juan; Zeng, Xiaofei; Zhong, Guofu; Chemistry - A European Journal; vol. 16; nb. 12; (2010); p. 3842 - 3848, View in Reaxys

Reaxys ID 21166825 View in Reaxys

150/183 CAS Registry Number: 1276028-83-1 Chemical Name: 5-(3''-chloropropyl)-7-methoxy-3-nitro-2-(3',4'methylenedioxyphenyl)benzofuran Linear Structure Formula: C19H16ClNO6 Molecular Formula: C19H16ClNO6 Molecular Weight: 389.792 InChI Key: CEVOCNZOYXPUDA-UHFFFAOYSA-N Note:

O O O Cl O

N O

Melting Point (1) 1 of 1

Melting Point [°C]

137.3 - 138.3

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys NMR Spectroscopy (2)

216/249

2016-07-13 00:31:19

1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

dichloromethane

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) LCMS (Liquid Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. chromatography 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys mass spectrometry); APCI (atmospheric pressure chemical ionization); Spectrum UV/VIS Spectroscopy (1) 1 of 1

Solvent (UV/VIS Spectroscopy)

dichloromethane

Absorption Maxima (UV/ 228; 268; 381 VIS) [nm] Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys Pharmacological Data (5) 1 of 5

Comment (Pharmacological Data)

Bioactivities present

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Staphylococcus aureus ATCC 29213

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

217/249

2016-07-13 00:31:19

Further Details (Pharmacological Data)

Mueller-Hilton broth method

Results

no effect

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 3 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Bacillus subtilis ATCC 6633

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Further Details (Pharmacological Data)

Mueller-Hilton broth method

Results

no effect

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 4 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Escherichia coli ATCC 8739

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Further Details (Pharmacological Data)

Mueller-Hilton broth method; minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

800 μg/ml

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 5 of 5

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Candida albicans ATCC 10231

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Further Details (Pharmacological Data)

Mueller-Hilton broth method; minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

25 μg/ml

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys

Reaxys ID 21166831 View in Reaxys

151/183

218/249

2016-07-13 00:31:19

CAS Registry Number: 1276028-81-9 Chemical Name: 5-[3''-hydroxypropyl]-7-methoxy-3,6-dinitro-2(3',4'-methylenedioxyphenyl)benzofuran Linear Structure Formula: C19H16N2O9 Molecular Formula: C19H16N2O9 Molecular Weight: 416.344 InChI Key: MLUOXHJNDYDFBU-UHFFFAOYSA-N Note:

O O

Melting Point (1) 1 of 1

Melting Point [°C]

188.7 - 189

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

dichloromethane

Solvent (UV/VIS Spectroscopy)

dichloromethane

Absorption Maxima (UV/ 229; 269; 384 VIS) [nm]

219/249

2016-07-13 00:31:19

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys Pharmacological Data (5) 1 of 5

Comment (Pharmacological Data)

Bioactivities present

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 2 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Staphylococcus aureus ATCC 29213

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Further Details (Pharmacological Data)

Mueller-Hilton broth method; minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

800 μg/ml

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 3 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Bacillus subtilis ATCC 6633

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Further Details (Pharmacological Data)

Mueller-Hilton broth method; minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

400 μg/ml

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 4 of 5

Effect (Pharmacological Data)

antibacterial

Species or Test-System (Pharmacological Data)

Escherichia coli ATCC 8739

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Further Details (Pharmacological Data)

Mueller-Hilton broth method; minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

400 μg/ml

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys 5 of 5

Effect (Pharmacological Data)

antifungal

Species or Test-System (Pharmacological Data)

Candida albicans ATCC 10231

220/249

2016-07-13 00:31:19

Kind of Dosing (Pharmacological Data)

title comp. dissolved in DMSO

Further Details (Pharmacological Data)

Mueller-Hilton broth method; minimal inhibitory concentration (MIC)

Type (Pharmacological Data)

MIC

Value of Type (Pharmacological Data)

400 μg/ml

Emirda-Oeztuerk, Safiye; Karayildirim, Tamer; Anil, Hueseyin; Bioorganic and Medicinal Chemistry; vol. 19; nb. 3; (2011); p. 1179 - 1188, View in Reaxys

Reaxys ID 21381198 View in Reaxys

152/183 O N

O O

Linear Structure Formula: C9H6N4O4 Molecular Formula: C9H6N4O4 Molecular Weight: 234.171 InChI Key: JLCGSEIOFIYIPQ-UHFFFAOYSA-N Note:

N N N

Use (2) Laboratory Use and Handling

Location

References

supporting information

Stokes, Benjamin J.; Liu, Sheng; Driver, Tom G.; Journal of the American Chemical Society; vol. 133; nb. 13; (2011); p. 4702 - 4705, View in Reaxys

avoid contact with supporting inforskin mation

Stokes, Benjamin J.; Liu, Sheng; Driver, Tom G.; Journal of the American Chemical Society; vol. 133; nb. 13; (2011); p. 4702 - 4705, View in Reaxys

irritant

Reaxys ID 21676860 View in Reaxys

153/183 Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 InChI Key: FGLGFTKHOBZXNU-UHFFFAOYSA-N Note:

O N

Reaxys ID 22032763 View in Reaxys

154/183 CAS Registry Number: 1227182-21-9 Chemical Name: (E)-5-(1,3-dioxolan-2-yl)-6-(2-nitrovinyl)benzo[d][1,3]dioxole Linear Structure Formula: C12H11NO6 Molecular Formula: C12H11NO6 Molecular Weight: 265.222 InChI Key: AAJUSLUYUIWOGN-OWOJBTEDSA-N Note:

O N

O O

Melting Point (1) 1 of 1

Melting Point [°C]

179 - 180

Solvent (Melting Point)

hexane; ethyl acetate

Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys Crystal Property Description (1)

221/249

2016-07-13 00:31:19

Colour & Other Properties

References

yellow

Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

500

Location

supporting information

Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

125

Location

supporting information

Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Kise, Naoki; Isemoto, Shinsaku; Sakurai, Toshihiko; Journal of Organic Chemistry; vol. 76; nb. 23; (2011); p. 9856 - 9860, View in Reaxys

Reaxys ID 22268559 View in Reaxys

155/183 CAS Registry Number: 1357912-38-9 Chemical Name: 3-nitro-2H-6,7-methylenedioxythiochromene Linear Structure Formula: C10H7NO4S Molecular Formula: C10H7NO4S Molecular Weight: 237.236 InChI Key: KFMIWMXUFVSCMD-UHFFFAOYSA-N Note:

O N

O O

Melting Point (1) 1 of 1

Melting Point [°C]

128 - 131

Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys

222/249

2016-07-13 00:31:19

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys

HRMS (High resolution mass spectrometry); EI (Electron impact); Spectrum

Cueva, Juan Pablo; Chemel, Benjamin R.; Juncosa Jr., Jose I.; Lill, Markus A.; Watts, Val J.; Nichols, David E.; European Journal of Medicinal Chemistry; vol. 48; (2012); p. 97 - 107, View in Reaxys

Reaxys ID 22769065 View in Reaxys

156/183 CAS Registry Number: 1393750-61-2 Chemical Name: 2-(benzo-[1,3]-dioxol-5-yl)-1-(3,4,5-trimethoxybenzyl)-1-nitroethene Linear Structure Formula: C19H19NO7 Molecular Formula: C19H19NO7 Molecular Weight: 373.362 InChI Key: RQXWTKIJIMMSQE-UHFFFAOYSA-N Note:

O O

Pharmacological Data (5) 1 of 5

Comment (Pharmacological Data)

Bioactivities present

Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys 2 of 5

Effect (Pharmacological Data)

cell morphology; effect on

Species or Test-System (Pharmacological Data)

EAhy 926 endothelial cells of human

Further Details (Pharmacological Data)

EAhy 926 cells derived from the fusion of human umbilical vein endothelial cells (HUVEC) with the permanent human cell line A549; minimal active concentration (MAC)

Type (Pharmacological Data)

MAC

Value of Type (Pharmacological Data)

0.4 μmol/l

Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys 3 of 5

Effect (Pharmacological Data)

cytotoxic

Species or Test-System (Pharmacological Data)

murine B16 melanoma cells

Further Details (Pharmacological Data)

MTT assay; inhibitory concentration (IC)

223/249

2016-07-13 00:31:19

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

3 μmol/l

Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys 4 of 5

Effect (Pharmacological Data)

tubulin polymerization; inhibition of

Species or Test-System (Pharmacological Data)

tubulin

Further Details (Pharmacological Data)

inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

10.5 μmol/l

Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys 5 of 5

Effect (Pharmacological Data)

tubulin polymerization; inhibition of

Species or Test-System (Pharmacological Data)

tubulin

Results

molecular target: tubulin

Mur Blanch, Nuria; Chabot, Guy G.; Quentin, Lionel; Scherman, Daniel; Bourg, Stephane; Dauzonne, Daniel; European Journal of Medicinal Chemistry; vol. 54; (2012); p. 22 - 32, View in Reaxys

Reaxys ID 22800695 View in Reaxys

157/183

CAS Registry Number: 1427306-76-0 Chemical Name: 13-nitro-8-thiocoptisine Linear Structure Formula: C19H12N2O6S Molecular Formula: C19H12N2O6S Molecular Weight: 396.38 InChI Key: OZSIXFAEWRAKHP-UHFFFAOYSA-N Note:

O N

Melting Point (1) 1 of 1

Melting Point [°C]

244 - 252

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Crystal Property Description (1) Colour & Other References Properties orange

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

224/249

2016-07-13 00:31:19

IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) ESI (Electrospray ionisation); Spectrum

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

Pharmacological Data (3) 1 of 3

Comment (Pharmacological Data)

Bioactivities present

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 2 of 3

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Type (Pharmacological Data)

growth inhibition rate

Value of Type (Pharmacological Data)

2.69 percent

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 3 of 3

Effect (Pharmacological Data)

multidrug resistance reversal activity

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Type (Pharmacological Data)

reversion rate

Value of Type (Pharmacological Data)

5.55 percent

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

Reaxys ID 22800696 View in Reaxys

158/183

O O

CAS Registry Number: 1427306-71-5 Chemical Name: 13-nitro-8-oxocoptisine Linear Structure Formula: C19H12N2O7 Molecular Formula: C19H12N2O7 Molecular Weight: 380.313 InChI Key: VYOHNIHCLNYDFJ-UHFFFAOYSA-N Note:

O N

Crystal Property Description (1)

225/249

2016-07-13 00:31:19

Colour & Other Properties

References

orange

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

Pharmacological Data (4) 1 of 4

Comment (Pharmacological Data)

Bioactivities present

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 2 of 4

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Further Details (Pharmacological Data)

inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

2.74 μmol/l

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 3 of 4

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Type (Pharmacological Data)

growth inhibition rate

226/249

2016-07-13 00:31:19

Value of Type (Pharmacological Data)

12.05 percent

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 4 of 4

Effect (Pharmacological Data)

multidrug resistance reversal activity

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Type (Pharmacological Data)

reversion rate

Value of Type (Pharmacological Data)

46.99 percent

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

Reaxys ID 22800699 View in Reaxys O

159/183 CAS Registry Number: 1427306-72-6 Chemical Name: 12,13-dinitro-8-oxocoptisine Linear Structure Formula: C19H11N3O9 Molecular Formula: C19H11N3O9 Molecular Weight: 425.311 InChI Key: RIFNSPGEPTYXJJ-UHFFFAOYSA-N Note:

O O

N OO

Melting Point (1) 1 of 1

Melting Point [°C]

266 - 269

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys Mass Spectrometry (1)

227/249

2016-07-13 00:31:19

Description (Mass References Spectrometry) ESI (Electrospray ionisation); Spectrum

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

Pharmacological Data (4) 1 of 4

Comment (Pharmacological Data)

Bioactivities present

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 2 of 4

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Further Details (Pharmacological Data)

inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

1.3 μmol/l

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 3 of 4

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Type (Pharmacological Data)

growth inhibition rate

Value of Type (Pharmacological Data)

9.52 percent

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 4 of 4

Effect (Pharmacological Data)

multidrug resistance reversal activity

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Type (Pharmacological Data)

reversion rate

Value of Type (Pharmacological Data)

52.96 percent

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

Reaxys ID 22800700 View in Reaxys

160/183

228/249

2016-07-13 00:31:19

CAS Registry Number: 1427306-77-1 Chemical Name: 12,13-dinitro-8-thiocoptisine Linear Structure Formula: C19H11N3O8S Molecular Formula: C19H11N3O8S Molecular Weight: 441.378 InChI Key: URABDJWSBYEDQM-UHFFFAOYSA-N Note:

O O

N O O

Melting Point (1) 1 of 1

Melting Point [°C]

184 - 190

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

Pharmacological Data (4) 1 of 4

Comment (Pharmacological Data)

Bioactivities present

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 2 of 4

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Further Details (Pharmacological Data)

inhibitory concentration (IC)

Type (Pharmacological Data)

IC50

Value of Type (Pharmacological Data)

2.37 μmol/l

229/249

2016-07-13 00:31:19

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 3 of 4

Effect (Pharmacological Data)

cell growth; inhibition of

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Type (Pharmacological Data)

growth inhibition rate

Value of Type (Pharmacological Data)

13.89 percent

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys 4 of 4

Effect (Pharmacological Data)

multidrug resistance reversal activity

Species or Test-System (Pharmacological Data)

breast cancer MDF-7 cells of human; genetically modified/infected with: adriamycin-selected P-gp

Concentration (Pharmacological Data)

10 μmol/l

Type (Pharmacological Data)

reversion rate

Value of Type (Pharmacological Data)

42.8 percent

Wu, Jian Bo; Lei, Fan; Cui, Xiang Juan; He, Yun; Hai, Li; Zhang, Juan; Wu, Yong; Medicinal Chemistry; vol. 8; nb. 4; (2012); p. 742 - 748, View in Reaxys

Reaxys ID 23598406 View in Reaxys

161/183 CAS Registry Number: 1182199-91-2 Chemical Name: 5-(2-nitrobut-1-enyl)benzo[1,3]dioxole Linear Structure Formula: C11H11NO4 Molecular Formula: C11H11NO4 Molecular Weight: 221.213 InChI Key: LHWIZYOSZOQHOY-WEVVVXLNSA-N Note:

O O

Substance Label (1) Label References 6a

Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 3198, View in Reaxys

Crystal Property Description (1) Colour & Other Location Properties yellow

supporting information

References Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy)

230/249

2016-07-13 00:31:19

Temperature (NMR Spectroscopy) [°C]

Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys Mass Spectrometry (1) Description (Mass Location Spectrometry) high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum

References

supporting information

Chang, Meng-Yang; Lin, Chung-Han; Tai, Hang-Yi; Tetrahedron Letters; vol. 54; nb. 24; (2013); p. 3194 - 3198, View in Reaxys

Reaxys ID 23604579 View in Reaxys

162/183 CAS Registry Number: 1431708-82-5 Chemical Name: (E)-5-(2-nitro-4,4-bis(phenylsulfonyl)but-1-enyl)benzo[d]-[1,3]dioxole Linear Structure Formula: C23H19NO8S2 Molecular Formula: C23H19NO8S2 Molecular Weight: 501.538 InChI Key: KCPWWVKTMQIJNN-QGOAFFKASA-N Note:

O E

N OO S

O O

Substance Label (1) Label References 3c

Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

184 - 186

Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy)

231/249

2016-07-13 00:31:19

Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

20.94

Frequency (NMR Spectroscopy) [MHz]

400.1

Location

supporting information

Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

20.44

Frequency (NMR Spectroscopy) [MHz]

100.6

Location

supporting information

Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Intensity of IR bands; Bands

Solvent (IR Spectroscopy)

potassium bromide

Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys Mass Spectrometry (2) Description (Mass References Spectrometry) electrospray ionisation (ESI); spectrum

Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys

high resolution Kumar, Rahul; Kumar, Tarun; Mobin, Shaikh M.; Nambothiri, Irishi N.N.; Journal of Organic Chemistry; mass spectrome- vol. 78; nb. 10; (2013); p. 5073 - 5077, View in Reaxys try (HRMS); electrospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum

Reaxys ID 23690159 View in Reaxys

163/183 Linear Structure Formula: C13H13NO4 Molecular Formula: C13H13NO4 Molecular Weight: 247.251 InChI Key: ITXGMBLZKYGZRG-UHFFFAOYSA-N Note:

232/249

2016-07-13 00:31:19

Substance Label (1) Label References 3be

Creech, Gardner S.; Kwon, Ohyun; Chemical Science; vol. 4; nb. 6; (2013); p. 2670 - 2674, View in Reaxys

Reaxys ID 24868020 View in Reaxys

164/183 Linear Structure Formula: C14H15NO6 Molecular Formula: C14H15NO6 Molecular Weight: 293.276 InChI Key: JVSXIXYPFPDPBY-GHXNOFRVSA-N Note:

O Z

O O

O N

Pharmacological Data (1) 1 of 1

Comment (Pharmacological Data)

Bioactivities present

Zee-Cheng; Cheng; Journal of medicinal chemistry; vol. 12; nb. 1; (1969); p. 157 - 161, View in Reaxys

Reaxys ID 25080877 View in Reaxys

165/183 Linear Structure Formula: C23H20N2O6S Molecular Formula: C23H20N2O6S Molecular Weight: 452.488 InChI Key: AVEBWBBNAUKMDJ-MOSHPQCFSA-N Note:

O Z

O O

N H

S O

Pharmacological Data (1) 1 of 1

Comment (Pharmacological Data)

Bioactivities present

Rastogi, Namrata; Mohan, Renu; Panda, Dulal; Mobin, Shaikh M.; Namboothiri, Irishi N.N.; Organic and Biomolecular Chemistry; vol. 4; nb. 17; (2006); p. 3211 - 3214, View in Reaxys

Reaxys ID 25806756 View in Reaxys

166/183 Linear Structure Formula: C17H13NO6 Molecular Formula: C17H13NO6 Molecular Weight: 327.293 InChI Key: KXZILZHHXSZSJP-ACAGNQJTSA-N Note:

Z O

O O

Pharmacological Data (1) 1 of 1

Comment (Pharmacological Data)

Bioactivities present

Reaxys ID 25868978 View in Reaxys

167/183

233/249

2016-07-13 00:31:19

O O

Linear Structure Formula: C10H9NO5 Molecular Formula: C10H9NO5 Molecular Weight: 223.185 InChI Key: WGMJOSLIKRMTQU-BAQGIRSFSA-N Note:

OH N

Pharmacological Data (1) 1 of 1

Comment (Pharmacological Data)

Bioactivities present

Mohan, Renu; Rastogi, Namrata; Namboothiri, Irishi N.N.; Mobin, Shaikh M.; Panda, Dulal; Bioorganic and Medicinal Chemistry; vol. 14; nb. 23; (2006); p. 8073 - 8085, View in Reaxys

Reaxys ID 26495905 View in Reaxys

168/183

O N E O

CAS Registry Number: 1526944-24-0 Chemical Name: (E)-2,2'-dinitrovinyl-4',5'-methylenedioxy-4,5,6-trimethoxybiphenyl Linear Structure Formula: C20H18N2O9 Molecular Formula: C20H18N2O9 Molecular Weight: 430.371 Note:

O O

E O

N O

Substance Label (1) Label References 9d

Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

114 - 115

Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Chromatographic Data (1) Chromatographic Location data HPLC (High performance liquid chromatography)

supporting information

References Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys

Crystal Property Description (1) Colour & Other References Properties yellow

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

234/249

2016-07-13 00:31:19

Original Text (NMR Spectroscopy)

NMR δ ppm 8.04 (1H, s, ArH), 7.24 (2H, d, J = 12.8 Hz, =CH), 6.83 (2H, d, J = 12.8 Hz, =CH), 6.05 and 6.00 (each 1H, s, ArH), 4.28 (2H, m, OCH2O), 4.05, 3.96, and 3.51 (each 3H, s, OMe)

Signals [ppm]

8.04; 7.24; 6.83; 6.05; 6; 4.28; 4.05; 3.96; 3.51

Kind of signal

1H, s, ArH; 2H, d, J = 12.8 Hz, =CH; 2H, d, J = 12.8 Hz, =CH; each 1H, s, ArH; 2H, m, OCH&2%O; each 3H, s, OMe

Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Mass Spectrometry (1) Description (Mass Peak Spectrometry) electrospray ionisation (ESI); spectrum

431.1 m/z; 453.2 m/z; 370.0 m/z

Intensity [%]

References

10; 50; 100

Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, Chin-Yu; Yu, Le; MorrisNatschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 333, View in Reaxys

Pharmacological Data (2) 1 of 2

Comment (Pharmacological Data)

Bioactivities present

Comment (Pharmacological Data)

physiological behaviour discussed

Reaxys ID 26495907 View in Reaxys

169/183 O N

CAS Registry Number: 1526944-28-4 Chemical Name: (E)-2,2'-di(2-methylnitrovinyl)-6-methoxy-4,5methylenedioxybiphenyl Linear Structure Formula: C20H18N2O7 Molecular Formula: C20H18N2O7 Molecular Weight: 398.372 Note:

O O O O

E N O

Substance Label (1) Label References 11a

Chromatographic Data (1) Chromatographic Location data HPLC (High performance liquid chromatography)

supporting information

Crystal Property Description (1) Colour & Other References Properties

235/249

2016-07-13 00:31:19

yellow

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Original Text (NMR Spectroscopy)

Signals [ppm]

7.74; 7.21 - 7.46; 6.69; 6.02; 4.62; 3.79; 2.36; 1.97

Kind of signal

1H, s, =CH; 4H, m, ArH; 1H, s, =CH; 1H, s, ArH; 2H, s, OCH&2%O; 3H, s, OCH&3%; 3H, s, CH&3%; 3H, s, CH&3%

NMR δ ppm 7.74 (1H, s, =CH), 7.46-7.21 (4H, m, ArH), 6.69 (1H, s, =CH), 6.02 (1H, s, ArH), 4.62 (2H, s, OCH2O), 3.79 (3H, s, OCH3), 2.36 (3H, s, CH3), 1.97 (3H, s, CH3)

Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Mass Spectrometry (1) Description (Mass Peak Spectrometry) electrospray ionisation (ESI); spectrum

399.2 m/z

Intensity [%]

References

Pharmacological Data (2) 1 of 2

Comment (Pharmacological Data)

Bioactivities present

Comment (Pharmacological Data)

physiological behaviour discussed

Reaxys ID 26495908 View in Reaxys

N O

170/183

CAS Registry Number: 1526944-29-5 Chemical Name: (E)-2,2'-di(2-methylnitrovinyl)-4-methoxy-5,6methylenedioxybiphenyl Linear Structure Formula: C20H18N2O7 Molecular Formula: C20H18N2O7 Molecular Weight: 398.372 Note:

O E

O O

Substance Label (1) Label References 11b

236/249

2016-07-13 00:31:19

Chromatographic Data (1) Chromatographic Location data HPLC (High performance liquid chromatography)

supporting information

Crystal Property Description (1) Colour & Other References Properties yellow

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Original Text (NMR Spectroscopy)

Signals [ppm]

7.68; 7.36 - 7.51; 6.61; 6.07; 5.98; 3.98; 2.3; 2.26

Kind of signal

1H, s, =CH; 4H, m, ArH; 1H, s, =CH; 1H, s, ArH; 2H, s, OCH&2%O; 3H, s, OCH&3%; 3H, s, CH&3%; 3H, s, CH&3%

NMR δ ppm 7.68 (1H, s, =CH), 7.51-7.36 (4H, m, ArH), 6.61 (1H, s, =CH), 6.07 (1H, s, ArH), 5.98 (2H, s, OCH2O), 3.98 (3H, s, OCH3), 2.30 (3H, s, CH3), 2.26 (3H, s, CH3)

Yu, Fang-Lin; He, Xiao-Yang; Gu, Chunping; Ohkoshi, Emika; Wang, Li-Ting; Wang, Sheng-Biao; Lai, ChinYu; Yu, Le; Morris-Natschke, Susan L.; Lee, Kuo-Hsiung; Liu, Shuwen; Xie, Lan; Bioorganic and Medicinal Chemistry; vol. 22; nb. 1; (2014); p. 325 - 333, View in Reaxys Mass Spectrometry (1) Description (Mass Peak Spectrometry) electrospray ionisation (ESI); spectrum

399.2 m/z

Intensity [%]

References

Pharmacological Data (2) 1 of 2

Comment (Pharmacological Data)

Bioactivities present

Comment (Pharmacological Data)

physiological behaviour discussed

Reaxys ID 26495914 View in Reaxys

171/183

237/249

2016-07-13 00:31:19

O N E O

CAS Registry Number: 1526944-21-7 Chemical Name: (E)-2,2'-di(2-methylnitrovinnyl)-4',5'-methylenedioxy-4,5,6-trimethoxybiphenyl Linear Structure Formula: C22H22N2O9 Molecular Formula: C22H22N2O9 Molecular Weight: 458.425 Note:

O O

N O

Substance Label (1) Label References 9a

Melting Point (1) 1 of 1

Melting Point [°C]

98 - 99

supporting information

Conformation (1) Object of Investi- References gation Conformation

Crystal Property Description (1) Colour & Other References Properties yellow

NMR Spectroscopy (1) 1 of 1

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Original Text (NMR Spectroscopy)

Signals [ppm]

8.05; 7.47; 6.87; 6.75; 6.66; 6.13; 3.9 - 3.95; 2.5; 2.29

Kind of signal

1H, s, CH=; 1H, s, CH=; 1H, s, ArH; 1H, s, ArH; 1H, s, ArH; 2H, s, OCH&2%O; 9H, ms, OCH&3%; 3H, s, CH&3%; 3H, s, CH&3%

NMR δ ppm 8.05 (1H, s, CH=), 7.47 (1H, s, CH=), 6.87 (1H, s, ArH), 6.75 (1H, s, ArH), 6.66 (1H, s, ArH), 6.13 (2H, s, OCH2O), 3.95-3.90 (9H, ms, OCH3), 2.50 (3H, s, CH3), 2.29 (3H, s, CH3)

238/249

2016-07-13 00:31:19

Description (Mass Peak Spectrometry)

Intensity [%]

References

electrospray ionisation (ESI); spectrum

95; 100

459.2 m/z; 384.2 m/z

Pharmacological Data (2) 1 of 2

Comment (Pharmacological Data)

Bioactivities present

Comment (Pharmacological Data)

physiological behaviour discussed

Reaxys ID 26932918 View in Reaxys

172/183 CAS Registry Number: 77834-77-6 Linear Structure Formula: C12H11NO6 Molecular Formula: C12H11NO6 Molecular Weight: 265.222 InChI Key: SNNITTBVYNHLRY-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 2h

Nair, Divya K.; Menna-Barreto, Rubem F. S.; Da Silva Junior, Eufranio N.; Mobin, Shaikh M.; Namboothiri, Irishi N. N.; Chemical Communications; vol. 50; nb. 53; (2014); p. 6973 - 6976, View in Reaxys

Reaxys ID 27037810 View in Reaxys

173/183 CAS Registry Number: 1616871-69-2 Chemical Name: 5-(5-methyl-2-nitrophenyl)benzo[d][1,3]dioxole Linear Structure Formula: C14H11NO4 Molecular Formula: C14H11NO4 Molecular Weight: 257.246 InChI Key: GHLZASOGGUQWHS-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 46

Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys

Chromatographic Data (1) Chromatographic Location data TLC (Thin layer chromatography)

supporting information

References Weber, Anna K.; Schachtner, Josef; Fichtler, Robert; Leermann, Timo M.; Neudoerfl, Joerg M.; Jacobi Von Wangelin, Axel; Organic and Biomolecular Chemistry; vol. 12; nb. 28; (2014); p. 5267 - 5277, View in Reaxys

NMR Spectroscopy (2)

239/249

2016-07-13 00:31:19

1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

24.84

Frequency (NMR Spectroscopy) [MHz]

300

Location

supporting information

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

24.84

Frequency (NMR Spectroscopy) [MHz]

Location

supporting information

Description (IR Spectroscopy)

ATR (attenuated total reflectance); Intensity of IR bands; Bands

Location

supporting information

References

electron impact (EI); spectrum

supporting information

high resolution mass spectrometry (HRMS); electron impact (EI); spectrum

supporting information

Reaxys ID 27610376 View in Reaxys

174/183

O O

Chemical Name: 1-nitro-6-tosyl-5,6-dihydro-[1,3]dioxolo[4,5-b]phenanthridine Linear Structure Formula: C21H16N2O6S Molecular Formula: C21H16N2O6S Molecular Weight: 424.434 InChI Key: HCLZRFZBLYJRQE-UHFFFAOYSA-N Note:

O O

O S

240/249

2016-07-13 00:31:19

Substance Label (1) Label References 44

Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

220 - 222

Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Location

supporting information

Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Location

supporting information

Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys IR Spectroscopy (1) 1 of 1

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; (2014); p. 10899 - 10907, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) high resolution Laha, Joydev K.; Dayal, Neetu; Jain, Roli; Patel, Ketul; Journal of Organic Chemistry; vol. 79; nb. 22; mass spectrome- (2014); p. 10899 - 10907, View in Reaxys try (HRMS); electrospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum

Reaxys ID 27615393 View in Reaxys

175/183

241/249

2016-07-13 00:31:19

Chemical Name: 3-(benzo[d][1,3]dioxol-5-yl)-2-nitroimidazo[1,2-a]pyridine Linear Structure Formula: C14H9N3O4 Molecular Formula: C14H9N3O4 Molecular Weight: 283.243 InChI Key: BSPGAICHZAMPLO-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 3ae

Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

25.14

Frequency (NMR Spectroscopy) [MHz]

400.2

Location

supporting information

Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Temperature (NMR Spectroscopy) [°C]

16.34

Frequency (NMR Spectroscopy) [MHz]

100.6

Location

supporting information

Monir, Kamarul; Bagdi, Avik Kumar; Ghosh, Monoranjan; Hajra, Alakananda; Organic Letters; vol. 16; nb. 17; (2014); p. 4630 - 4633, View in Reaxys

Reaxys ID 27969998 View in Reaxys

176/183 Linear Structure Formula: C10H7NO5 Molecular Formula: C10H7NO5 Molecular Weight: 221.169 InChI Key: FUERCDRQIMGLOO-OWOJBTEDSA-N Note:

O E

O O

Substance Label (1) Label References 2b

Mahajan, Suruchi; Chauhan, Pankaj; Loh, Charles C. J.; Uzungelis, Server; Raabe, Gerhard; Enders, Dieter; Synthesis (Germany); vol. 47; nb. 7; (2015); p. 1024 - 1031, View in Reaxys

242/249

2016-07-13 00:31:19

Reaxys ID 28680347 View in Reaxys

177/183 Chemical Name: 5-(benzo[d][1,3]dioxol-5-yl)-2,2-dimethyl-6-nitro-2H-chromene Linear Structure Formula: C18H15NO5 Molecular Formula: C18H15NO5 Molecular Weight: 325.321 InChI Key: KOXDQHGVQKUORZ-UHFFFAOYSA-N Note:

O O

Substance Label (1) Label References 4s

Melting Point (1) 1 of 1

Melting Point [°C]

112 - 114

Ranjith Reddy; Siva Reddy; Dhaked, Devendra K.; Rasheed; Pathania, Anup Singh; Shankar, Ravi; Malik, Fayaz; Das, Parthasarathi; Organic and Biomolecular Chemistry; vol. 13; nb. 35; (2015); p. 9285 - 9293, View in Reaxys Crystal Property Description (1) Colour & Other References Properties yellow

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

125

Location

supporting information

Ranjith Reddy; Siva Reddy; Dhaked, Devendra K.; Rasheed; Pathania, Anup Singh; Shankar, Ravi; Malik, Fayaz; Das, Parthasarathi; Organic and Biomolecular Chemistry; vol. 13; nb. 35; (2015); p. 9285 - 9293, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); time-

243/249

2016-07-13 00:31:19

of-flight mass spectra (TOFMS); liquid chromatography mass spectrometry (LCMS); spectrum

Reaxys ID 28704132 View in Reaxys

178/183 Chemical Name: 6-nitro-8-methoxy-7, 8-dihydronitidine; 2,3methylenedioxy-6-nitro-8,10,11-trimethoxy-7-methylbenzo[c]phenanthridine Linear Structure Formula: C22H20N2O7 Molecular Formula: C22H20N2O7 Molecular Weight: 424.41 InChI Key: NLSNOQANCKDUCM-UHFFFAOYSA-N Note:

O N

O O

O N

O O

Substance Label (1) Label References 2

Crystal Property Description (1) Colour & Other References Properties yellow

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- d(4)-methanol scopy) Frequency (NMR Spectroscopy) [MHz]

500

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- d(4)-methanol scopy) Frequency (NMR Spectroscopy) [MHz]

125

Description (IR Spectroscopy)

Bands

Solvent (IR Spectroscopy)

potassium bromide

244/249

2016-07-13 00:31:19

Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Dominique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys Mass Spectrometry (2) Description (Mass References Spectrometry) electrospray ioni- Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Domisation (ESI); time- nique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; of-flight mass Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys spectra (TOFMS); spectrum high resolution Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Domimass spectrome- nique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; try (HRMS); elec- Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys trospray ionisation (ESI); timeof-flight mass spectra (TOFMS); spectrum UV/VIS Spectroscopy (1) 1 of 1

Solvent (UV/VIS Spectroscopy)

methanol

Absorption Maxima (UV/ 271; 293; 307; 328 VIS) [nm] Akoua Yao-Kouassi, Philomne; Caron, Catherine; Ramiarantsoa, Harisolo; Prost, lise; Harakat, Dominique; Le Magrex-Debar, lisabeth; Gangloff, Sophie C.; Coffy, Antoine Ahibo; Zches-Hanrot, Monique; Comptes Rendus Chimie; vol. 18; nb. 8; (2015); p. 891 - 897, View in Reaxys Pharmacological Data (1) 1 of 1

Comment (Pharmacological Data)

physiological behaviour discussed

Reaxys ID 28768227 View in Reaxys

179/183 Linear Structure Formula: C17H14N2O6 Molecular Formula: C17H14N2O6 Molecular Weight: 342.308 InChI Key: JXGDTDGTJUXEHA-VOTSOKGWSA-N Note:

O N E

O O

NH O

Substance Label (1) Label References 1j

Ramachary, Dhevalapally B.; Shruthi, Kodambahalli S.; Madhavachary; European Journal of Organic Chemistry; vol. 2015; nb. 29; (2015); p. 6413 - 6418, View in Reaxys

245/249

2016-07-13 00:31:19

Reaxys ID 29049931 View in Reaxys

180/183 Chemical Name: (E)-5-ethinyl-6-(2-nitrovinyl)benzo[d][1,3]dioxole Linear Structure Formula: C11H7NO4 Molecular Formula: C11H7NO4 Molecular Weight: 217.181 InChI Key: NCCOHRSLHCBPFY-ONEGZZNKSA-N Note:

O O

Substance Label (1) Label References 1d

Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 - 1800; Angew. Chem.; (2015), View in Reaxys

Melting Point (1) 1 of 1

Melting Point [°C]

178 - 183

Location

supporting information

Crystal Property Description (1) Colour & Other Location Properties yellow

supporting information

References Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 1800; Angew. Chem.; (2015), View in Reaxys References Hack, Daniel; Dürr, Alexander B.; Deckers, Kristina; Chauhan, Pankaj; Seling, Nico; Rübenach, Lukas; Mertens, Lucas; Raabe, Gerhard; Schoenebeck, Franziska; Enders, Dieter; Angewandte Chemie - International Edition; vol. 55; nb. 5; (2016); p. 1797 1800; Angew. Chem.; (2015), View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

600

Location

supporting information

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

151

Location

supporting information

246/249

2016-07-13 00:31:19

Description (IR Spectroscopy)

ATR (attenuated total reflectance); Bands

Location

supporting information

References

electron impact supporting infor(EI); fragmentamation tion pattern; spectrum

high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum

supporting information

CI (Chemical ioni- supporting inforzation); fragmen- mation tation pattern; spectrum

Reaxys ID 29131193 View in Reaxys

181/183 O N

O O

Linear Structure Formula: C12H11NO6 Molecular Formula: C12H11NO6 Molecular Weight: 265.222 InChI Key: SNNITTBVYNHLRY-ONNFQVAWSA-N Note:

O O

Substance Label (1) Label References 2

Shu, Tao; Ni, Qijian; Song, Xiaoxiao; Zhao, Kun; Wu, Tianyu; Puttreddy, Rakesh; Rissanen, Kari; Enders, Dieter; Chemical Communications; vol. 52; nb. 12; (2016); p. 2609 - 2611, View in Reaxys

Reaxys ID 29359752 View in Reaxys

182/183 Chemical Name: (E)-5-(1-nitroprop-1-en-2-yl)benzo[d][1,3]dioxole Linear Structure Formula: C10H9NO4 Molecular Formula: C10H9NO4 Molecular Weight: 207.186 InChI Key: FGLGFTKHOBZXNU-FNORWQNLSA-N Note:

O N E

O O

Substance Label (1) Label References 1m

Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys

Melting Point (1)

247/249

2016-07-13 00:31:19

1 of 1

Melting Point [°C]

124 - 126

Location

supporting information

Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys Crystal Property Description (1) Colour & Other Location Properties yellow

References

supporting information

Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Location

supporting information

Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys 2 of 2

Description (NMR Spec- Chemical shifts; Spectrum troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

Location

supporting information

Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys Mass Spectrometry (1) Description (Mass Location Spectrometry) high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum

References

supporting information

Yu, Yan-Bo; Cheng, Lei; Li, Yi-Pan; Fu, Yue; Zhu, Shou-Fei; Zhou, Qi-Lin; Chemical Communications; vol. 52; nb. 26; (2016); p. 4812 - 4815, View in Reaxys

Reaxys ID 29392875 View in Reaxys O

183/183 Chemical Name: 2-(benzo[d][1,3]dioxol-5-yl)-8-methyl-3-nitroimidazo[1,2-a]pyridine Linear Structure Formula: C15H11N3O4 Molecular Formula: C15H11N3O4 Molecular Weight: 297.27 InChI Key: ZNPRITICMDSRSJ-UHFFFAOYSA-N Note:

N N N

Substance Label (1) Label References

248/249

2016-07-13 00:31:19

NMR Spectroscopy (2) 1 of 2

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

400

Description (NMR Spec- Chemical shifts troscopy) Nucleus (NMR Spectroscopy)

13C

Solvents (NMR Spectro- chloroform-d1 scopy) Frequency (NMR Spectroscopy) [MHz]

100

An, Litao; Sun, Xiaojun; Lv, Meng; Zhou, Jianfeng; Zhu, Fengxia; Zhong, Hui; Zeitschrift fur Naturforschung Section B Journal of Chemical Sciences; vol. 71; nb. 2; (2016); p. 141 - 147, View in Reaxys Mass Spectrometry (1) Description (Mass References Spectrometry) high resolution mass spectrometry (HRMS); electrospray ionisation (ESI); spectrum

249/249

2016-07-13 00:31:19