Reaxys
PubChem
eMolecules
Reactions (1167)
Substances (1)
Structure
Citations (3772)
Structure/Compound Data Chemical Name: 4-amino-n-butyric acid Reaxys Registry Number: 906818
CAS Registry Number: 56-12-2 Type of Substance: acyclic Molecular Formula: C4H9NO2
Linear Structure Formula: H2N(CH2)3CO2H Molecular Weight: 103.121 InChI Key: BTCSSZJGUNDROE-UHFFFAOYSA-N
1
N° of preparations All Preps | All Reactions 102 prep out of 1167 reactions.
Available Data
N° of ref.
Identification Physical Data (228) Spectra (128) Bioactivity (1019) Other Data (244)
3772
Synthesize | Hide Details Find similar Chemical Names and Synonyms 4-amino-n-butyric acid Identification Substance Label (108) Label
Reference
10
Rossello, Armando; Nuti, Elisa; Catalani, Maria Pia; Carelli, Paolo; Orlandini, Elisabetta; Rapposelli, Simona; Tuccinardi, Tiziano; Atkinson, Susan J.; Murphy, Gillian; Balsamo, Aldo
Bioorganic and Medicinal Chemistry Letters, 2005 , vol. 15, # 9 p. 2311 - 2314 Title/Abstract Full Text View citing articles Show Details
BA lint, Erika; Fazekas, Eszter; KA ti, JA nos; Keglevich, GyA rgy
Heteroatom Chemistry, 2015 , vol. 26, # 1 p. 106 - 115 Title/Abstract Full Text View citing articles Show Details
Yu, Xinyu; Luo, Jia; Chen, Lijun; Zhang, Chengxiang; Zhang, Rutan; Hu, Qi; Qiao, Shanlei; Li, Lei
RSC Advances, 2015 , vol. 5, # 85 p. 69800 - 69812 Title/Abstract Full Text View citing articles Show Details
Skowron, Pierre-Thomas; Dumartin, Melissa; Jeamet, Emeric; Perret, Florent; Gourlaouen, Christophe; Baudouin, Anne; Fenet, Bernard; Naubron, Jean-Valère; Fotiadu, Frédéric; Vial, Laurent; Leclaire, Julien
Journal of Organic Chemistry, 2016 , vol. 81, # 2 p. 654 - 661 Title/Abstract Full Text View citing articles Show Details
Lee, Gyu Min; Suh, Dong Ho; Jung, Eun Sung; Lee, Choong Hwan
Molecules, 2016 , vol. 21, # 7 art. no. 921 Title/Abstract Full Text View citing articles Show Details
4
Sanvicens, Nuria; Pichon, Valerie; Hennion, Marie-Claire; Marco, M.-Pilar
Journal of Agricultural and Food Chemistry, 2003 , vol. 51, # 1 p. 156 - 164 Title/Abstract Full Text View citing articles Show Details
Kottani, Rudresha; Majjigapu, Janaki R. R.; Kurchan, Alexei; Majjigapu, Kavitha; Gustafson, Tiffany P.; Kutateladze, Andrei G.
Journal of the American Chemical Society, 2006 , vol. 128, # 46 p. 14794 - 14795 Title/Abstract Full Text View citing articles Show Details
Mirk, Daniela; Luftmann, Heinrich; Waldvogel, Siegfried R.
Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences, 2005 , vol. 60, # 10 p. 1077 - 1082 Title/Abstract Full Text View citing articles Show Details
Ma, Zhao; Liu, Zhenzhen; Jiang, Tianyu; Zhang, Tianchao; Zhang, Huateng; Du, Lupei; Li, Minyong
ACS Medicinal Chemistry Letters, 2016 , vol. 7, # 10 p. 967 - 971 Title/Abstract Full Text Show Details
1
Zhao, Long-Xuan; Park, Jae Gyu; Moon, Yoon-Soo; Basnet, Arjun; Choi, Jongwon; Kim, Eun-Kyung; Jeong, Tae Cheon; Jahng, Yurngdong; Lee, Eung-Seok
Farmaco, 2004 , vol. 59, # 5 p. 381 - 388 Title/Abstract Full Text View citing articles Show Details
Chebib, Mary; Vandenberg, Robert J.; Johnston, Graham A. R.
British Journal of Pharmacology, 1997 , vol. 122, # 8 p. 1551 - 1560 Title/Abstract Full Text View citing articles Show Details
Fujimoto, Kenzo; Yoshimura, Yoshinaga; Ihara, Makoto; Matsuda, Kazuhiko; Takeuchi, Yuko; Aoki, Takaaki; Ide, Toru
Bioorganic and Medicinal Chemistry Letters, 2008 , vol. 18, # 3 p. 1106 - 1109 Title/Abstract Full Text View citing articles Show Details
Duval, Sylvain; Dumur, Frederic; Guenee, Laure; Marrot, Jerome; Simonnet-Jegat, Corine; Cadot, Emmanuel
European Journal of Inorganic Chemistry, 2013 , # 7 p. 1149 - 1156 Title/Abstract Full Text View citing articles Show Details
Ceruso, Mariangela; Del Prete, Sonia; Alothman, Zeid; Osman, Sameh M.; Scozzafava, Andrea; Capasso, Clemente; Supuran, Claudiu T.
Bioorganic and Medicinal Chemistry Letters, 2014 , vol. 24, # 16 p. 4006 - 4010 Title/Abstract Full Text View citing articles Show Details
Nuyts, Koen; Ceulemans, Matthias; Parac-Vogt, Tatjana N.; Bultynck, Geert; De Borggraeve, Wim M.
Tetrahedron Letters, 2015 , vol. 56, # 13 p. 1687 - 1690 Title/Abstract Full Text View citing articles Show Details
Schmitt, Sebastian; Höfner, Georg; Wanner, Klaus T.
ChemMedChem, 2015 , vol. 10, # 9 p. 1498 - 1510 Title/Abstract Full Text View citing articles Show Details
Damgaard, Maria; Al-Khawaja, Anas; Vogensen, Stine B.; Jurik, Andreas; Sijm, Maarten; Lie, Maria E. K.; Baek, Mathias I.; Rosenthal, Emil; Jensen, Anders A.; Ecker, Gerhard F.; Frolund, Bente; Wellendorph, Petrine; Clausen, Rasmus P.
ACS Chemical Neuroscience, 2015 , vol. 6, # 9 p. 1591 - 1599 Title/Abstract Full Text View citing articles Show Details
Kimura, Hiroyuki; Sampei, Sotaro; Matsuoka, Daiko; Harada, Naoya; Watanabe, Hiroyuki; Arimitsu, Kenji; Ono, Masahiro; Saji, Hideo
Bioorganic and Medicinal Chemistry, 2016 , vol. 24, # 10 p. 2251 - 2256 Title/Abstract Full Text View citing articles Show Details
GABA
Hadingham, Karen L.; Garrett, Elizabeth M.; Wafford, Keith A.; Bain, Corinna; Heavens, Robert P.; Sirinathsinghji, Dalip J. S.; Whiting, Paul J.
Molecular Pharmacology, 1996 , vol. 49, # 2 p. 253 - 259 Title/Abstract Full Text View citing articles Show Details
Sanna, Enrico; Garau, Franca; Harris, R. Adron
Molecular Pharmacology, 1995 , vol. 47, # 2 p. 213 - 217 Title/Abstract Full Text View citing articles Show Details
Korpi, Esa R.; Kuner, Thomas; Seeburg, Peter H.; Lueddens, Hartmut
Molecular Pharmacology, 1995 , vol. 47, # 2 p. 283 - 289 Title/Abstract Full Text View citing articles Show Details
Zhang, Hai-Guang; Lee, Hwa-Jung; Rocheleau, Thomas; Ffrench-Constant, Richard H.; Jackson, Meyer B.
Molecular Pharmacology, 1995 , vol. 48, # 5 p. 835 - 840 Title/Abstract Full Text View citing articles Show Details
Maksay, Gabor; Molnar, Peter; Gruber, Lajos
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 288, # 1 p. 61 - 68 Title/Abstract Full Text Show Details
Feigenspan, Andreas; Bormann, Joachim
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 288, # 1 p. 97 - 104 Title/Abstract Full Text Show Details
Granger, Patrick; Biton, Bruno; Faure, Cecile; Vige, Xavier; Depoortere, Henri; Graham, David; Langer, Salomon Z.; Scatton, Bernard; Avenet, Patrick
Molecular Pharmacology, 1995 , vol. 47, # 6 p. 1189 - 1196 Title/Abstract Full Text View citing articles Show Details
Holland, Katherine D.; Mathews, Gregory C.; Bolos-Sy, Annabel M.; Tucker, Joseph B.; Reddy, P. Amruta; Covey, Douglas F.; Ferrendelli, James A.; Rothman, Steven M.
Molecular Pharmacology, 1995 , vol. 47, # 6 p. 1217 - 1223 Title/Abstract Full Text View citing articles Show Details
Stevenson; Wingrove; Whiting; Wafford
Molecular Pharmacology, 1995 , vol. 48, # 6 p. 965 - 969 Title/Abstract Full Text View citing articles Show Details
Nakazawa; Inoue; Ito; Koizumi
Naunyn-Schmiedeberg's Archives of Pharmacology, 1995 , vol. 351, # 2 p. 202 - 208 Title/Abstract Full Text View citing articles Show Details
Huh, Kyung-Hye; Delorey, Timothy M.; Endo, Shuichi; Olsen, Richard W.
Molecular Pharmacology, 1995 , vol. 48, # 4 p. 666 - 675 Title/Abstract Full Text View citing articles Show Details
Valenzuela; Kazlauskas; Brozowski; Weiner; Demali; McDonald; Moss; Dunwiddie; Harris
Molecular Pharmacology, 1995 , vol. 48, # 6 p. 1099 - 1107 Title/Abstract Full Text View citing articles Show Details
Priller, Josef; Briley, Eileen M.; Mansouri, Jaleh; Devane, William A.; Mackie, Ken; Felder, Christian C.
Molecular Pharmacology, 1995 , vol. 48, # 2 p. 288 - 292 Title/Abstract Full Text View citing articles Show Details
Kristiansen; Barker; Serafini
Molecular Pharmacology, 1995 , vol. 48, # 2 p. 268 - 279 Title/Abstract Full Text View citing articles Show Details
Slany; Zezula; Tretter; Sieghart
Molecular Pharmacology, 1995 , vol. 48, # 3 p. 385 - 391 Title/Abstract Full Text View citing articles Show Details
Thompson; Whiting; Wafford
British Journal of Pharmacology, 1996 , vol. 117, # 3 p. 521 - 527 Title/Abstract Full Text View citing articles Show Details
Li; Guyenet
American Journal of Physiology - Regulatory Integrative and Comparative Physiology, 1995 , vol. 268, # 2 37-2 p. R428-R437 Title/Abstract Full Text View citing articles Show Details
Cheng, Li-Ling; Wang, Su-Jane; Tsai, Jing-Jane; Gean, Po-Wu
Pharmacology, 1997 , vol. 55, # 5 p. 228 - 234 Title/Abstract Full Text View citing articles Show Details
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 212 Title/Abstract Full Text View citing articles Show Details
Wood, Nicholas J.; Sorensen, Jan
FEMS Microbiology Ecology, 1998 , vol. 27, # 2 p. 175 - 183 Title/Abstract Full Text View citing articles Show Details
Poras, Herve; Kunesch, Gerhard; Barriere, Jean-Claude; Berthaud, Nadine; Andremont, Antoine
Journal of Antibiotics, 1998 , vol. 51, # 8 p. 786 - 794 Title/Abstract Full Text View citing articles Show Details
Gracheva; Orekhova; Kopelevich; Tyurenkov; Kleshchitskii; Shvets
Pharmaceutical Chemistry Journal, 1996 , vol. 30, # 7 p. 453 - 457 Title/Abstract Full Text View citing articles Show Details
Ozoe; Niina; Matsumoto; Ikeda; Mochida; Ogawa; Matsuno; Miki; Yanagi
Bioorganic and medicinal chemistry, 1998 , vol. 6, # 1 p. 73 - 83 Title/Abstract Full Text View citing articles Show Details
Kim, Jae Hak; Mullin, Christopher A.
Journal of Chemical Ecology, 1998 , vol. 24, # 9 p. 1499 - 1511 Title/Abstract Full Text View citing articles Show Details
Sliedregt, Leo A. J. M.; Rensen, Patrick C. N.; Rump, Erik T.; Van Santbrink, Peter J.; Bijsterbosch, Martin K.; Valentijn, A. Rob P. M.; Van Der Marel, Gijs A.; Van Boom, Jacques H.; Van Berkel, Theo J. C.; Biessen, Erik A. L.
Journal of Medicinal Chemistry, 1999 , vol. 42, # 4 p. 609 - 618 Title/Abstract Full Text View citing articles Show Details
Gentilini; Franchi-Micheli; Mugnai; Bindi; Zilletti
British Journal of Pharmacology, 1995 , vol. 115, # 3 p. 389 - 394 Title/Abstract Full Text View citing articles Show Details
Buhr; Baur; Malherbe; Sigel
Molecular Pharmacology, 1996 , vol. 49, # 6 p. 1080 - 1084 Title/Abstract Full Text View citing articles Show Details
Mergl, Zsuzsanna; Acs, Zsuzsanna; Makara, G. B.
Life Sciences, 1995 , vol. 56, # 8 p. 579 - 586 Title/Abstract Full Text View citing articles Show Details
Hauser, Charlotte A. E.; Chesnoy-Marchais, Dominique; Robel, Paul; Baulieu, Etienne E.
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 289, # 2 p. 249 - 258 Title/Abstract Full Text View citing articles Show Details
Cole, Loretta M.; Roush, Richard T.; Casida, John E.
Life Sciences, 1995 , vol. 56, # 10 p. 757 - 766 Title/Abstract Full Text View citing articles Show Details
Fleischmann; Makman; Etgen
Life Sciences, 1995 , vol. 56, # 20 p. 1665 - 1678 Title/Abstract Full Text View citing articles Show Details
Kabuto; Yokoi; Iwaya; Mori
Life Sciences, 1995 , vol. 56, # 20 p. 1741 - 1748 Title/Abstract Full Text View citing articles Show Details
Korpi; Herb; Luddens
Pharmacology and Toxicology, 1995 , vol. 77, # 2 p. 87 - 90 Title/Abstract Full Text View citing articles Show Details
Quirk; Whiting; Ragan; McKernan
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 290, # 3 p. 175 - 181 Title/Abstract Full Text View citing articles Show Details
Pierobon, Paola; Concas, Alessandra; Santoro, Giovanna; Marino, Giuseppe; Minei, Rosario; et al.
Life Sciences, 1995 , vol. 56, # 18 p. 1485 - 1498 Title/Abstract Full Text View citing articles Show Details
Fuchs; Zezula; Slany; Sieghart
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 289, # 1 p. 87 - 95 Title/Abstract Full Text View citing articles Show Details
Nielsen; Witt; Ebert; Krogsgaard-Larsen
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 289, # 1 p. 109 - 112 Title/Abstract Full Text View citing articles Show Details
Zhao, Tai-Jun; Ming; Chiu, Ted H.; Rosenberg, Howard C.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 287, # 2 p. 752 - 759 Title/Abstract Full Text View citing articles Show Details
Banerjee, Pradeep K.; Olsen, Richard W.; Tillakaratne, Niranjala J. K.; Brailowsky, Simon; Tobin, Allan J.; Snead III, O. Carter
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 287, # 2 p. 766 - 772 Title/Abstract Full Text View citing articles Show Details
Chyb, Sylwester; Eichenseer, Herbert; Hollister, Benedict; Mullin, Christopher A.; Frazier, James L.
Journal of Chemical Ecology, 1995 , vol. 21, # 3 p. 313 - 330
Title/Abstract Full Text View citing articles Show Details
Wu, Guang
Journal of Applied Toxicology, 1996 , vol. 16, # 2 p. 95 - 102 Title/Abstract Full Text View citing articles Show Details
Odagaki; Dasgupta; Fuxe
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 291, # 3 p. 245 - 253 Title/Abstract Full Text View citing articles Show Details
Jones; Harrison; Pritchett; Hales
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 2 p. 962 - 968 Title/Abstract Full Text View citing articles Show Details
Slany; Zezula; Fuchs; Sieghart
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 291, # 2 p. 99 - 105 Title/Abstract Full Text View citing articles Show Details
Perusquia, Mercedes; Villalon, Carlos M.
Life Sciences, 1996 , vol. 58, # 11 p. 913 - 926 Title/Abstract Full Text View citing articles Show Details
Klein; Mascia; Harkness; Hadingham; Whiting; Harris
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 3 p. 1484 - 1492 Title/Abstract Full Text View citing articles Show Details
Ichida, Tatsuya; Takeda, Kazuo; Sasaki, Susumu; Nakagawa, Masao; Hashimoto, Tsuneichi; Kuriyama, Kinya
Life Sciences, 1995 , vol. 58, # 3 p. 209 - 215 Title/Abstract Full Text View citing articles Show Details
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Hosie, Alastair M.; Sattelle, David B.
British Journal of Pharmacology, 1996 , vol. 117, # 6 p. 1229 - 1237 Title/Abstract Full Text View citing articles Show Details
Marszalec, William; Song, Jin-Ho; Narahashi, Toshio
British Journal of Pharmacology, 1996 , vol. 119, # 1 p. 126 - 132 Title/Abstract Full Text View citing articles Show Details
Shafer, Timothy J.; Ward, Thomas R.; Meacham, Connie A.; Cooper, Ralph L.
Toxicology, 1999 , vol. 142, # 1 p. 57 - 68 Title/Abstract Full Text View citing articles Show Details
Stuhr-Hansen, Nicolai; Ebert, Bjarke; Krogsgaard-Larsen, Povl; Kehler, Jan
Organic Letters, 2000 , vol. 2, # 1 p. 6 - 10 Title/Abstract Full Text Show Details
Le Corronc; Hue
Pesticide Science, 1999 , vol. 55, # 10 p. 1007 - 1011 Title/Abstract Full Text View citing articles Show Details
Baldocchi Pizzo, Andrea; Karklin Fontana, Andreia Cristina; Coutinho-Netto, Joaquim; Ferreira dos Santos, Wagner
Journal of Biochemical and Molecular Toxicology, 2000 , vol. 14, # 2 p. 88 - 94 Title/Abstract Full Text Show Details
Chen; Lee
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 273, # 2 p. 895 - 901 Title/Abstract Full Text View citing articles Show Details
Hossain; Weiner
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 1 p. 237 - 244 Title/Abstract Full Text View citing articles Show Details
Burgard, Edward C.; Tietz, Elizabeth I.; Neelands, Torben R.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 119 - 127 Title/Abstract Full Text View citing articles Show Details
Lin, Yu-Fung; Angelotti, Timothy P.; Dudek, Ellen M.; Browning, Michael D.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 185 - 195 Title/Abstract Full Text View citing articles Show Details
Qiu, Jian; Pingsterhaus, Joyce M.; Silverman, Richard B.
Journal of Medicinal Chemistry, 1999 , vol. 42, # 22 p. 4725 - 4728 Title/Abstract Full Text View citing articles Show Details
Im; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 3 p. 1390 - 1395 Title/Abstract Full Text View citing articles Show Details
Yiu, Man-Kit; Kwan, Yiu Wa; Ngan, Man-Piu
European Journal of Pharmacology, 1996 , vol. 302, # 1-3 p. 99 - 108 Title/Abstract Full Text View citing articles Show Details
Kume; Greenfield L.J.; Macdonald; Albin
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 3 p. 1784 - 1792 Title/Abstract Full Text View citing articles Show Details
Sanna; Mascia; Klein; Whiting; Biggio; Harris
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 1 p. 353 - 360 Title/Abstract Full Text View citing articles Show Details
Wafford; Thompson; Thomas; Sikela; Wilcox; Whiting
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 670 - 678 Title/Abstract Full Text View citing articles Show Details
Varro; Athanassopolous; Dockray
Experimental Physiology, 1996 , vol. 81, # 1 p. 151 - 154 Title/Abstract Full Text View citing articles Show Details
Noel; Mendonca-Silva; Quintas
Arzneimittel-Forschung/Drug Research, 2001 , vol. 51, # 2 p. 169 - 173 Title/Abstract Full Text View citing articles Show Details
Kapur, Jaideep; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 458 - 466 Title/Abstract Full Text View citing articles Show Details
Mihic; Harris
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 1 p. 411 - 416 Title/Abstract Full Text View citing articles Show Details
Zheng; Caruncho; Wei Jian Zhu; Vicini; Ikonomovic; Grayson; Costa
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 1 p. 525 - 533 Title/Abstract Full Text View citing articles Show Details
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Mariussen, Espen; Fonnum, Frode
Toxicology, 2001 , vol. 159, # 1-2 p. 11 - 21 Title/Abstract Full Text View citing articles Show Details
Gederaas, Odrun A.; Holroyd, Andrew; Brown, Stanley B.; Vernon, David; Moan, Johan; Berg, Kristian
Photochemistry and Photobiology, 2001 , vol. 73, # 2 p. 164 - 169 Title/Abstract Full Text View citing articles Show Details
Brown, Maria J.; Bristow, David R.
British Journal of Pharmacology, 1996 , vol. 118, # 5 p. 1103 - 1110 Title/Abstract Full Text View citing articles Show Details
Teoh, Hwee; Malcangio, Marzia; Bowery, Norman G.
British Journal of Pharmacology, 1996 , vol. 118, # 5 p. 1153 - 1160 Title/Abstract Full Text View citing articles Show Details
Ghiani, Cristina A.; Tuligi, Graziella; Maciocco, Elisabetta; Serra, Mariangela; Sanna, Enrico; Biggio, Giovanni
Biochemical Pharmacology, 1996 , vol. 51, # 11 p. 1527 - 1534 Title/Abstract Full Text View citing articles Show Details
Casini; Scozzafava; Mincione; Menabuoni; Ilies; Supuran
Journal of Medicinal Chemistry, 2000 , vol. 43, # 25 p. 4884 - 4892 Title/Abstract Full Text View citing articles Show Details
Delmas, Florence; Beloeil, Jean-Claude; Van der Sanden, Boudewijn P. J.; Nicolay, Klaas; Gillet, Brigitte
Journal of Magnetic Resonance, 2001 , vol. 149, # 1 p. 119 - 125 Title/Abstract Full Text View citing articles Show Details
Nguyen-Duong
Journal of Toxicology and Environmental Health - Part A, 2001 , vol. 62, # 8 p. 643 - 653 Title/Abstract Full Text View citing articles Show Details
Tamai; Senmaru; Terasaki; Tsuji
Biochemical Pharmacology, 1995 , vol. 50, # 11 p. 1783 - 1793 Title/Abstract Full Text View citing articles Show Details
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Vale, Carmen; Pomes, Anna; Rodriguez-Farre, Eduard; Sunol, Cristina
European Journal of Pharmacology, 1997 , vol. 319, # 2-3 p. 343 - 353 Title/Abstract Full Text View citing articles Show Details
Hawkinson, Jon E.; Acosta-Burruel, Manuel; Kimbrough, Catherine L.; Goodnough, Dayan B.; Wood, Paul L.
European Journal of Pharmacology, 1996 , vol. 304, # 1-3 p. 141 - 146 Title/Abstract Full Text View citing articles Show Details
De Graaf, Robin A.; Rothman, Douglas L.
Journal of Magnetic Resonance, 2001 , vol. 152, # 1 p. 124 - 131 Title/Abstract Full Text View citing articles Show Details
Davies, Paul A.; Kirkness, Ewen F.; Hales, Tim G.
British Journal of Pharmacology, 1997 , vol. 120, # 5 p. 899 - 909 Title/Abstract Full Text View citing articles Show Details
Grobaski, Kenneth C.; Ping, Hanxian; DaSilva, Helena M.A.; Bowery, Norman G.; Connelly, Stephen T.; Shepard, Paul D.
British Journal of Pharmacology, 1997 , vol. 120, # 4 p. 575 - 580 Title/Abstract Full Text View citing articles Show Details
Monasterolo, Liliana A.; Trumper, Laura; Elias, M. Monica
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 2 p. 602 - 607 Title/Abstract Full Text View citing articles Show Details
Masonis, A. E. Tory; McCarthy, Michael P.
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 1 p. 186 - 193 Title/Abstract Full Text View citing articles Show Details
Billinton, Andrew; Baird, Virginia H.; Thom, Maria; Duncan, John S.; Upton, Neil; Bowery, Norman G.
British Journal of Pharmacology, 2001 , vol. 132, # 2 p. 475 - 480 Title/Abstract Full Text View citing articles Show Details
Martinez; Gervasini; Agundez; Carrillo; Ramos; Garcia-Gamito; Gallardo; Benitez
European Journal of Clinical Pharmacology, 2000 , vol. 56, # 2 p. 145 - 151 Title/Abstract Full Text View citing articles Show Details
Kazaryan; Grigoryan; Paronikyan; Agaronyan; Gevondyan; Samvelyan
Pharmaceutical Chemistry Journal, 2001 , vol. 35, # 9 p. 485 - 487 Title/Abstract Full Text View citing articles Show Details
Onali, Pierluigi; Olianas, Maria C
Biochemical Pharmacology, 2001 , vol. 62, # 2 p. 183 - 190 Title/Abstract Full Text View citing articles Show Details
Konishi, Yutaka; Hagiwara, Keiko; Shimizu, Makoto
Bioscience, biotechnology, and biochemistry, 2002 , vol. 66, # 11 p. 2449 - 2457 Title/Abstract Full Text View citing articles Show Details
Vrudhula, Vivekananda M.; Kerr, David E.; Siemers, Nathan O.; Dubowchik, Gene M.; Senter, Peter D.
Bioorganic and Medicinal Chemistry Letters, 2003 , vol. 13, # 3 p. 539 - 542 Title/Abstract Full Text View citing articles Show Details
Faber, Cornelius; Pracht, Eberhard; Haase, Axel
Journal of magnetic resonance (San Diego, Calif. : 1997), 2003 , vol. 161, # 2 p. 265 - 274 Title/Abstract Full Text View citing articles Show Details
Gorostidi, Gerardo R. Echevarria; Castellanos, M. Gabriela; Perez, Piedad Martin; Santos, Jose G.; Blanco, Francisco Garcia
Bulletin of the Chemical Society of Japan, 2003 , vol. 76, # 3 p. 523 - 528 Title/Abstract Full Text Show Details
Takemoto
Experimental Physiology, 2000 , vol. 85, # 5 p. 479 - 485 Title/Abstract Full Text View citing articles Show Details
Kato, Yuki; Kato, Yoko; Furukawa, Keiji; Hara, Shodo
Bioscience, Biotechnology and Biochemistry, 2002 , vol. 66, # 12 p. 2600 - 2605 Title/Abstract Full Text View citing articles Show Details
Fisher, Janet L.; Zhang, Jie; Macdonald, Robert L.
Molecular Pharmacology, 1997 , vol. 52, # 4 p. 714 - 724 Title/Abstract Full Text View citing articles Show Details
Ichida, Tatsuya; Kuriyama, Kinya
Life Sciences, 1996 , vol. 59, # 25-26 p. 2173 - 2179 Title/Abstract Full Text View citing articles Show Details
Begg, Malcolm; Molleman, Areles; Parsons, Mike
European Journal of Pharmacology, 2002 , vol. 434, # 1-2 p. 87 - 94 Title/Abstract Full Text View citing articles Show Details
Aoki, Hideyuki; Furuya, Yuji; Endo, Yasushi; Fujimoto, Kenshiro
Bioscience, Biotechnology and Biochemistry, 2003 , vol. 67, # 8 p. 1806 - 1808 Title/Abstract Full Text View citing articles Show Details
Fakova, Helena; Pour, Milan; Kunes, Jiri; Senel, Petr
Tetrahedron Letters, 2005 , vol. 46, # 47 p. 8137 - 8140 Title/Abstract Full Text View citing articles Show Details
Jorgensen, Malene R.; Jaroszewski, Jerzy W.; Witt, Matthias; Franzyk, Henrik
Synthesis, 2005 , # 16 art. no. P05305SS, p. 2687 - 2694 Title/Abstract Full Text View citing articles Show Details
Kauppila; Nikkola; Ketola; Kostiainen
Journal of Mass Spectrometry, 2006 , vol. 41, # 6 p. 781 - 789 Title/Abstract Full Text View citing articles Show Details
Yamashita, Megumi; Marszalec, William; Yeh, Jay Z.; Narahashi, Toshio
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 319, # 1 p. 431 - 438 Title/Abstract Full Text View citing articles Show Details
Sharma, Gangavaram V. M.; Jayaprakash, Pagadala; Narsimulu, Kongari; Ravi Sankar, Ampapathi; Ravinder Reddy, Kondreddy; Radha Krishna, Palakodety; Kunwar, Ajit C.
Angewandte Chemie - International Edition, 2006 , vol. 45, # 18 p. 2944 - 2947 Title/Abstract Full Text View citing articles Show Details
Choi, In-Young; Lee, Sang-Pil; Shen, Jun
Journal of Magnetic Resonance, 2005 , vol. 172, # 1 p. 9 - 16 Title/Abstract Full Text View citing articles Show Details
Shokol; Semenyuchenko; Shilin; Turov; Ogorodniichuk; Khilya
Chemistry of Natural Compounds, 2005 , vol. 41, # 5 p. 533 - 538 Title/Abstract Full Text View citing articles Show Details
Cuerten, Beate; Kullmann, Paul H. M.; Bier, Mark E.; Kandler, Karl; Schmidt, Brigitte F.
Photochemistry and Photobiology, 2005 , vol. 81, # 3 p. 641 - 648 Title/Abstract Full Text View citing articles Show Details
Ichimura, Toshiaki; Yamanaka, Akiko; Ichiba, Toshio; Toyokawa, Tetsuya; Kamada, Yasuhiro; Tamamura, Takako; Maruyama, Susumu
Bioscience, Biotechnology and Biochemistry, 2006 , vol. 70, # 3 p. 718 - 721 Title/Abstract Full Text View citing articles Show Details
Bezuglov; Gretskaya; Blazhenova; Andrianova; Akimov; Bobrov; Nazimov; Kisel'; Sharko; Novikov; Krasnov; Shevchenko; V'Yunova; Myasoedov
Russian Journal of Bioorganic Chemistry, 2006 , vol. 32, # 3 p. 231 - 239 Title/Abstract Full Text View citing articles Show Details
Yang, YongXia; Chen, Lei; Gao, HongChang; Zeng, DanLin; Yue, Yong; Liu, MaiLi; Lei, Hao; Deng, Feng; Ye, ChaoHui
Magnetic Resonance in Chemistry, 2006 , vol. 44, # 3 SPEC. ISS. p. 263 - 268 Title/Abstract Full Text View citing articles Show Details
Yanai, Kazuhiro; Sato, Kazumasa; Masuda, Shuichi; Ikeda, Masahiko; Kinae, Naohide
Bioscience, Biotechnology and Biochemistry, 2006 , vol. 70, # 10 p. 2501 - 2507 Title/Abstract Full Text View citing articles Show Details
Yamakoshi, Jun; Fukuda, Satoshi; Satoh, Takuya; Tsuji, Ryouhei; Saito, Makoto; Obata, Akio; Matsuyama, Asahi; Kikuchi, Mamoru; Kawasaki, Terukazu
Bioscience, Biotechnology and Biochemistry, 2007 , vol. 71, # 1 p. 165 - 173 Title/Abstract Full Text View citing articles Show Details
Yang, Jehoon; Shen, Jun
Journal of Magnetic Resonance, 2007 , vol. 184, # 2 p. 344 - 349 Title/Abstract Full Text View citing articles Show Details
Komatsuzaki, Noriko; Nakamura, Toshihide; Kimura, Toshinori; Shima, Jun
Bioscience, Biotechnology and Biochemistry, 2008 , vol. 72, # 2 p. 278 - 285 Title/Abstract Full Text View citing articles Show Details
Kane, Brian E.; Grant, Marianne K.O.; El-Fakahany, Esam E.; Ferguson, David M.
Bioorganic and Medicinal Chemistry, 2008 , vol. 16, # 3 p. 1376 - 1392 Title/Abstract Full Text View citing articles Show Details
Schnackerz; Andersen; Dobritzsch; Piskur
Nucleosides, Nucleotides and Nucleic Acids, 2008 , vol. 27, # 6-7 p. 794 - 799 Title/Abstract Full Text View citing articles Show Details
Buchini, Sabrina; Buschiazzo, Alejandro; Withers, Stephen G.
Angewandte Chemie - International Edition, 2008 , vol. 47, # 14 p. 2700 - 2703 Title/Abstract Full Text View citing articles Show Details
Lamanna, Raffaele; Piscioneri, Ilario; Romanelli, Valeria; Sharma, Neeta
Magnetic Resonance in Chemistry, 2008 , vol. 46, # 9 p. 828 - 831 Title/Abstract Full Text View citing articles Show Details
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
UCL BUSINESS PLC; Williams, Robin Simon Brooke; Walker, Matthew
Patent: US2013/303616 A1, 2013 ; Title/Abstract Full Text Show Details
Yahara, Tohru; Tachikawa, Masanori; Akanuma, Shin-Ichi; Kubo, Yoshiyuki; Hosoya, Ken-Ichi
Biological and Pharmaceutical Bulletin, 2014 , vol. 37, # 5 p. 817 - 825 Title/Abstract Full Text View citing articles Show Details
Hu, Xiang-Guo; Thomas, Donald S.; Griffith, Renate; Hunter, Luke
Angewandte Chemie - International Edition, 2014 , vol. 53, # 24 p. 6176 - 6179 Angew. Chem., 2014 , vol. 126, # 24 p. 6290 - 6293 Title/Abstract Full Text View citing articles Show Details
Kowalczyk, Paula; Sałat, Kinga; Höfner, Georg C.; Mucha, Marta; Rapacz, Anna; Podkowa, Adrian; Filipek, Barbara; Wanner, Klaus T.; Kulig, Katarzyna
European Journal of Medicinal Chemistry, 2014 , vol. 83, p. 256 - 273 Title/Abstract Full Text View citing articles Show Details
Manier, M. Lisa; Spraggins, Jeffrey M.; Reyzer, Michelle L.; Norris, Jeremy L.; Caprioli, Richard M.
Journal of Mass Spectrometry, 2014 , vol. 49, # 8 p. 665 - 673 Title/Abstract Full Text View citing articles Show Details
Priyadarshani, Nilusha; Ginovska, Bojana; Bays, J. Timothy; Linehan, John C.; Shaw, Wendy J.
Dalton Transactions, 2015 , vol. 44, # 33 p. 14854 - 14864 Title/Abstract Full Text View citing articles Show Details
UMECRINE COGNITION AB; DOVERSKOG, Magnus; MÖHLER, Hanns; FELIPO, Vicente; BÄCKSTRÖM, Torbjörn
Patent: WO2015/114308 A1, 2015 ; Title/Abstract Full Text Show Details
THE GENERAL HOSPITAL CORPORATION; ANNOVATION BIOPHARMA, LLC; Raines, Douglas E.; Husain, Syed Shaukat; Randle, John C. R.
Patent: US9156825 B2, 2015 ; Title/Abstract Full Text Show Details
Oukhatar, Fatima; Meudal, Herv; Landon, Cline; Logothetis, Nikos K.; Platas-Iglesias, Carlos; Angelovski, Goran; Tth, va
Chemistry - A European Journal, 2015 , vol. 21, # 31 p. 11226 - 11237 Title/Abstract Full Text View citing articles Show Details
Waszkielewicz; Gunia-Krzyzak; Powroźnik; Słoczyńska; Pękala; Walczak; Bednarski; Zesławska; Nitek; Marona
Bioorganic and Medicinal Chemistry, 2016 , vol. 24, # 8 p. 1793 - 1810 Title/Abstract Full Text View citing articles Show Details
Lee; Absalom; Hanrahan; Van Nieuwenhuijzen; Ahring; Chebib
Brain Research, 2016 , vol. 1644, p. 222 - 230 Title/Abstract Full Text View citing articles Show Details
Aseervatham, G. Smilin Bell; Suryakala; Doulethunisha; Sundaram; Bose, P. Chandra; Sivasudha
Biomedicine and Pharmacotherapy, 2016 , vol. 82, p. 54 - 64 Title/Abstract Full Text View citing articles Show Details
Bergh, Marianne Skov-Skov; Bogen, Inger Lise; Lundanes, Elsa; Øiestad, Åse Marit Leere
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2016 , vol. 1028, p. 120 - 129 Title/Abstract Full Text View citing articles Show Details
Huckvale, Rosemary; Mortensen, Martin; Pryde, David; Smart, Trevor G.; Baker, James R.
Organic and Biomolecular Chemistry, 2016 , vol. 14, # 28 p. 6676 - 6678 Title/Abstract Full Text View citing articles Show Details
24
Man, Shuli; Li, Yuanyuan; Fan, Wei; Gao, Wenyuan; Liu, Zhen; Li, Nan; Zhang, Yao; Liu, ChangXiao
International Journal of Pharmaceutics, 2013 , vol. 454, # 1 p. 296 - 301 Title/Abstract Full Text View citing articles Show Details
Wilkening, Ina; Gazzola, Silvia; Riva, Elena; Parascandolo, James S.; Song, Lijiang; Tosin, Manuela
Chemical Communications, 2016 , vol. 52, # 68 p. 10392 - 10395 Title/Abstract Full Text View citing articles Show Details
6
Oppici, Elisa; Montioli, Riccardo; Dindo, Mirco; MacCari, Laura; Porcari, Valentina; Lorenzetto, Antonio; Chellini, Sara; Voltattorni, Carla Borri; Cellini, Barbara
ACS Chemical Biology, 2015 , vol. 10, # 10 p. 2227 - 2236 Title/Abstract Full Text View citing articles Show Details
Wetzl, Dennis; Bolsinger, Jennifer; Nestl, Bettina M.; Hauer, Bernhard
ChemCatChem, 2016 , vol. 8, # 7 p. 1361 - 1366 Title/Abstract Full Text View citing articles Show Details
21
Servillo, Luigi; Giovane, Alfonso; Casale, Rosario; Balestrieri, Maria Luisa; Cautela, Domenico; Paolucci, Marina; Siano, Francesco; Volpe, Maria Grazia; Castaldo, Domenico
Food Chemistry, 2016 , vol. 196, p. 1301 - 1309 Title/Abstract Full Text View citing articles Show Details
4a
Gurak, John A.; Yang, Kin S.; Liu, Zhen; Engle, Keary M.
Journal of the American Chemical Society, 2016 , vol. 138, # 18 p. 5805 - 5808 Title/Abstract Full Text View citing articles Show Details
Kumari, Santosh; Shakoor, S.M. Abdul; Bajaj, Kiran; Nanjegowda; Mallu; Sakhuja, Rajeev
Tetrahedron Letters, 2016 , vol. 57, # 25 p. 2732 - 2736 Title/Abstract Full Text View citing articles Show Details
HL±
Lytkin; Chernikov; Krutova; Skvortsov; Korchagina
Russian Journal of Physical Chemistry A, 2016 , vol. 90, # 9 p. 1782 - 1784 Zh. Fiz. Khim., 2016 , vol. 90, # 9 p. 1350 - 1353,4 Title/Abstract Full Text View citing articles Show Details
13c
Jiang, Yuqi; Li, Xiaoyang; Wang, Xue; Wang, Zhonglan; Wu, Jingde; Xu, Wenfang; Zhang, Jian
Chemical Biology and Drug Design, 2016 , p. 542 - 555 Title/Abstract Full Text Show Details
12b
Southeast University; Cai, Lin; Chen, Guoqing; Ji, Min; Li, Yong; Guo, Minliang; Xu, Hua; Liu, Wenjing
Patent: , 2016 ; Title/Abstract Full Text Show Details
1c
Ma, Huan; Li, Qingeng; Liu, Yan; Chen, Gang; Wang, Tao
Chemical Biology and Drug Design, 2016 , p. 363 - 369 Title/Abstract Full Text Show Details
13
Supuran, Claudiu T.; Dinculescu, Antonie; Manole, Gheorghe; Savan, Florina; Puscas, Ioan; Balaban, Alexandru T.
Revue Roumaine de Chimie, 1991 , vol. 36, # 8 p. 937 - 946
Title/Abstract Full Text Show Details
Ceruso, Mariangela; Del Prete, Sonia; Alothman, Zeid; Capasso, Clemente; Supuran, Claudiu T.
ACS Medicinal Chemistry Letters, 2014 , vol. 5, # 7 p. 826 - 830 Title/Abstract Full Text View citing articles Show Details
O'Brien, Kevin T.; Noto, Joseph G.; Nichols-O'Neill, Luke; Perez, Lark J.
ACS Medicinal Chemistry Letters, 2015 , vol. 6, # 2 p. 162 - 167 Title/Abstract Full Text View citing articles Show Details
2
De Figueiredo, Renata Marcia; Froehlich, Roland; Christmann, Mathias
Angewandte Chemie - International Edition, 2007 , vol. 46, # 16 p. 2883 - 2886 Title/Abstract Full Text View citing articles Show Details
Yadav, Naveen; Malhotra, Manav; Monga, Vikramdeep; Sharma, Sagun; Jain, Jainendra; Samad, Abdul; Deep, Aakash
Medicinal Chemistry Research, 2012 , vol. 21, # 9 p. 2208 - 2216 Title/Abstract Full Text View citing articles Show Details
Hosseinkhani, Batool; Islami, Mohammad Reza; Hosseinkhani, Saman
Synlett, 2015 , vol. 26, # 16 art. no. ST-2015-D0387-L, p. 2277 - 2279 Title/Abstract Full Text View citing articles Show Details
3
Graefe, Kerstin A.; Hoffmann
Pharmazie, 2000 , vol. 55, # 4 p. 286 - 292 Title/Abstract Full Text View citing articles Show Details
Trofimov, Boris A.; Mal'kina, Anastasiya G.; Shemyakina, Olesya A.; Borisova, Angela P.; Nosyreva, Valentina V.; Dyachenko, Oleg A.; Kazheva, Olga N.; Alexandrov, Gennadii G.
Synthesis, 2007 , # 17 p. 2641 - 2646 Title/Abstract Full Text View citing articles Show Details
Mart, Almudena; Costero, Ana M.; Gavia, Pablo; Parra, Margarita
European Journal of Organic Chemistry, 2015 , vol. 2015, # 30 p. 6597 - 6601 Title/Abstract Full Text View citing articles Show Details
Sakhautdinov; Gumerov; Gibadullina; Zakir'Yanova; Yunusov
Chemistry of Natural Compounds, 2015 , vol. 51, # 2 p. 383 - 384 Khim. Prir. Soedin., 2015 , # 2 p. 332 - 333,2 Title/Abstract Full Text View citing articles Show Details
6a
Liu, Qi; Lu, Wenhua; Ma, Mingzhe; Liao, Jianwei; Ganesan; Hu, Yumin; Wen, Shijun; Huang, Peng
RSC Advances, 2015 , vol. 5, # 2 p. 1109 - 1112 Title/Abstract Full Text View citing articles Show Details
8
THE CALIFORNIA INSTITUTE FOR BIOMEDICAL RESEARCH; SCHULTZ, Peter G.; CHATTERJEE, Arnab K.; KUMAR, Manoj; WELZEL, Gustav
Patent: WO2015/3083 A1, 2015 ; Title/Abstract Full Text Show Details
14
Liang, Tingfu; Wei, Feifei; Lu, Yi; Kodani, Yoshinori; Nakada, Mitsuhiko; Miyakawa, Takuya; Tanokura, Masaru
Journal of Agricultural and Food Chemistry, 2015 , vol. 63, # 2 p. 683 - 691 Title/Abstract Full Text View citing articles Show Details
12a
Jörg, Manuela; May, Lauren T.; Mak, Frankie S.; Lee, Kiew Ching K.; Miller, Neil D.; Scammells, Peter J.; Capuano, Ben
Journal of Medicinal Chemistry, 2015 , vol. 58, # 2 p. 718 - 738 Title/Abstract Full Text View citing articles Show Details
26
Cadaha, Estrella; De Simn, Brgida Fernndez; Aranda, Ismael; Sanz, Miriam; Snchez-Gmez, David; Pinto, Ernani
Phytochemical Analysis, 2015 , vol. 26, # 2 p. 171 - 182 Title/Abstract Full Text View citing articles Show Details
Show next 20
Hide facts
Label
Reference
3h
Sharma, Krishna K.; Sharma, Swagat; Kudwal, Anurag; Jain, Rahul
Organic and Biomolecular Chemistry, 2015 , vol. 13, # 16 p. 4637 - 4641 Title/Abstract Full Text View citing articles Show Details
7
Grün, Alajos; Kovcs, Rita; Garadnay, Sndor; Greiner, Istvn; Keglevich, György
Letters in Drug Design and Discovery, 2015 , vol. 12, # 4 p. 253 - 258 Title/Abstract Full Text View citing articles Show Details
II
Vagapova; Fakhertdinova; Burilov; Pudovik
Russian Journal of General Chemistry, 2015 , vol. 85, # 7 p. 1783 - 1785 Zh. Obshch. Khim., 2015 , vol. 85, # 7 p. 1221 - 1223,3 Title/Abstract Full Text View citing articles Show Details
L3&C%
Warminski, Marcin; Warminska, Zofia; Kowalska, Joanna; Jemielity, Jacek
European Journal of Organic Chemistry, 2015 , vol. 2015, # 28 p. 6153 - 6159 Title/Abstract Full Text View citing articles Show Details
4-ABA
Tang, Yi-Jin; Liu, Hong-Yan; An, Jing-Yi; Han, Rei
Photochemistry and Photobiology, 2001 , vol. 74, # 2 p. 201 - 205 Title/Abstract Full Text View citing articles Show Details
Pal, Amrita; Dey, Joykrishna
Journal of Physical Chemistry B, 2014 , vol. 118, # 42 p. 12112 - 12120 Title/Abstract Full Text View citing articles Show Details
III
Voronkov; Belousova; Trukhina; Vlasova
Russian Journal of Organic Chemistry, 2006 , vol. 42, # 2 p. 172 - 174 Title/Abstract Full Text View citing articles Show Details
Dikusar; Potkin; Pyatkevich
Russian Journal of General Chemistry, 2014 , vol. 84, # 9 p. 1701 - 1705 Zh. Obshch. Khim., 2014 , vol. 84, # 9 p. 1461 - 1465,5 Title/Abstract Full Text View citing articles Show Details
5
Kawakita, Youichi; Seto, Masaki; Ohashi, Tomohiro; Tamura, Toshiya; Yusa, Tadashi; Miki, Hiroshi; Iwata, Hidehisa; Kamiguchi, Hidenori; Tanaka, Toshimasa; Sogabe, Satoshi; Ohta, Yoshikazu; Ishikawa, Tomoyasu
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 8 p. 2250 - 2261 Title/Abstract Full Text View citing articles Show Details
Pan, Yilin; Li, Jin; Li, Xiang; Chen, Jianwei; Bai, Ganggang
Bulletin of the Korean Chemical Society, 2014 , vol. 35, # 1 p. 197 - 203 Title/Abstract Full Text View citing articles Show Details
Vaid, Radhe K.; Boini, Sathish K.; Alt, Charles A.; Spitler, Jeremy T.; Hadden, Chad E.; Frank, Scott A.; Moher, Eric D.
Synthesis, 2014 , vol. 46, # 18 art. no. SS2014M0164OP, p. 2463 - 2470,8 Title/Abstract Full Text View citing articles Show Details
Asamitsu, Sefan; Kawamoto, Yusuke; Hashiya, Fumitaka; Hashiya, Kaori; Yamamoto, Makoto; Kizaki, Seiichiro; Bando, Toshikazu; Sugiyama, Hiroshi
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 17 p. 4646 - 4657 Title/Abstract Full Text View citing articles Show Details
Vaid, Radhe K.; Boini, Sathish K.; Alt, Charles A.; Spitler, Jeremy T.; Hadden, Chad E.; Frank, Scott A.; Moher, Eric D.
Synthesis (Germany), 2014 , vol. 46, # 18 art. no. SS-2014-M0164-OP, p. 2463 - 2470 Title/Abstract Full Text Show Details
A03
of Nevada, Las Vegas; The Regents of the Nevada System of Higher Education on behalf of the University; Abel-Santos, Ernesto; Howerton, Amber
Patent: US2014/45808 A1, 2014 ; Title/Abstract Full Text Show Details
16
Yuen, Tsz-Ying; Eaton, Samantha E.; Woods, Tom M.; Furkert, Daniel P.; Choi, Ka Wai; Brimble, Margaret A.
European Journal of Organic Chemistry, 2014 , vol. 2014, # 7 p. 1431 - 1437 Title/Abstract Full Text View citing articles Show Details
Yuen, Tsz-Ying; Eaton, Samantha E.; Woods, Tom M.; Furkert, Daniel P.; Choi, Ka Wai; Brimble, Margaret A.
European Journal of Organic Chemistry, 2014 , vol. 2014, # 7 p. 1431 - 1437 Title/Abstract Full Text Show Details
5a
Merk, Daniel; Gabler, Matthias; Gomez, Roberto Carrasco; Flesch, Daniel; Hanke, Thomas; Kaiser, Astrid; Lamers, Christina; Werz, Oliver; Schneider, Gisbert; Schubert-Zsilavecz, Manfred
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 8 p. 2447 - 2460 Title/Abstract Full Text View citing articles Show Details
31
Tars, Kaspars; Leitans, Janis; Kazaks, Andris; Zelencova, Diana; Liepinsh, Edgars; Kuka, Janis; Makrecka, Marina; Lola, Daina; Andrianovs, Viktors; Gustina, Daina; Grinberga, Solveiga; Liepinsh, Edvards; Kalvinsh, Ivars; Dambrova, Maija; Loza, Einars; Pugovics, Osvalds
Journal of Medicinal Chemistry, 2014 , vol. 57, # 6 p. 2213 - 2236 Title/Abstract Full Text View citing articles Show Details
10h
Sinha, Manish; Dola, Vasanth R.; Agarwal, Pooja; Srivastava, Kumkum; Haq, Wahajul; Puri, Sunil K.; Katti, Seturam B.
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 14 p. 3573 - 3586 Title/Abstract Full Text View citing articles Show Details
1b
Su, Yu-Chih; Lo, Yu-Lun; Hwang, Chi-Ching; Wang, Li-Fang; Wu, Min Hui; Wang, Eng-Chi; Wang, Yun-Ming; Wang, Tzu-Pin
Organic and Biomolecular Chemistry, 2014 , vol. 12, # 34 p. 6624 - 6633 Title/Abstract Full Text View citing articles Show Details
15
Coxon, Fraser; Joachimiak, Łukasz; Najumudeen, Arafath Kaja; Breen, George; Gmach, Joanna; Oetken-Lindholm, Christina; Way, Rebecca; Dunford, James; Abankwa, Daniel; Błazewska, Katarzyna M.
European Journal of Medicinal Chemistry, 2014 , vol. 84, p. 77 - 89 Title/Abstract Full Text View citing articles Show Details
49
Riva, Elena; Wilkening, Ina; Gazzola, Silvia; Li, W. M. Ariel; Smith, Luke; Leadlay, Peter F.; Tosin, Manuela
Angewandte Chemie - International Edition, 2014 , vol. 53, # 44 p. 11944 - 11949 Title/Abstract Full Text View citing articles Show Details
c&4%
He, Dian; Ma, Jing; Shi, Xiuxiao; Zhao, Chunyan; Hou, Meng; Guo, Qingxin; Ma, Shangxian; Li, Xiaojun; Zhao, Peicheng; Liu, Wenhu; Yang, Zhuqing; Mou, Jianping; Song, Pengfei; Zhang, Yang; Li, Jing
Chemical and Pharmaceutical Bulletin, 2014 , vol. 62, # 10 p. 967 - 978 Title/Abstract Full Text View citing articles Show Details
2d
Ha, Khanh; Monbaliu, Jean-Christophe M.; Williams, Byron C.; Pillai, Girinath G.; Ocampo, Charles E.; Zeller, Matthias; Stevens, Christian V.; Katritzky, Alan R.
Organic and Biomolecular Chemistry, 2012 , vol. 10, # 40 p. 8055 - 8058 Title/Abstract Full Text View citing articles Show Details
Serkov; Chugunova; Burilov; Bachurin
Doklady Chemistry, 2013 , vol. 450, # 2 p. 149 - 151 Dokl. Akad. Nauk, 2013 , vol. 450, # 4 p. 417 - 419,3 Title/Abstract Full Text View citing articles Show Details
2g
Sashidhara, Koneni V.; Palnati, Gopala Reddy; Dodda, Ranga Prasad; Avula, Srinivasa Rao; Swami, Priyanka
Synlett, 2013 , vol. 24, # 1 p. 105 - 113 Title/Abstract Full Text View citing articles Show Details
8a
Koh, Minsoo; Lee, Jong-Cheol; Min, Changhee; Moon, Aree
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 8 p. 2305 - 2313 Title/Abstract Full Text View citing articles Show Details
1d
Lenin, Racha; Raju, Rallabandi Madusudan; Rao, Divvela V. N. Srinivasa; Ray, Uttam Kumar
Medicinal Chemistry Research, 2013 , vol. 22, # 4 p. 1624 - 1629 Title/Abstract Full Text View citing articles Show Details
2j
Patra, Malay; Hess, Jeannine; Konatschnig, Sandro; Spingler, Bernhard; Gasser, Gilles
Organometallics, 2013 , vol. 32, # 20 p. 6098 - 6105 Title/Abstract Full Text View citing articles Show Details
2f
Araujo, Rui Filipe; Silva, Carlos Jorge R.; Paiva, Maria Conceicao; Franco, Manuel Melle; Proenca, Maria Fernanda
RSC Advances, 2013 , vol. 3, # 46 p. 24535 - 24542 Title/Abstract Full Text View citing articles Show Details
12
Trotter, Nicholas S.; Brimble, Margaret A.; Harris, Paul W.R.; Callis, David J.; Sieg, Frank
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 2 p. 501 - 517 Title/Abstract Full Text View citing articles Show Details
Sondhi, Sham M.; Goyal, Rajendra N.; Lahoti, Anand M.; Singh, Nirupma; Shukla, Rakesh; Raghubir, Ram
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 9 p. 3185 - 3195 Title/Abstract Full Text View citing articles Show Details
Bol'shakov, Oleg; Kovacs, Judit; Chahar, Mamta; Ha, Khanh; Khelashvili, Levan; Katritzky, Alan R.
Journal of Peptide Science, 2012 , vol. 18, # 11 p. 704 - 709,6 Title/Abstract Full Text Show Details
Bol'shakov, Oleg; Kovacs, Judit; Chahar, Mamta; Ha, Khanh; Khelashvili, Levan; Katritzky, Alan R.
Journal of Peptide Science, 2012 , vol. 18, # 11 p. 704 - 709 Title/Abstract Full Text View citing articles Show Details
23
THE UNIVERSITY OF NOTTINGHAM; MISTRY, Shailesh; DARAS, Etienne; FROMONT, Christophe; JADHAV, Gopal; FISCHER, Peter Martin; KELLAM, Barrie; HILL, Stephen John; BAKER, Jillian Glenda
Patent: WO2012/4549 A1, 2012 ; Title/Abstract Full Text Show Details
110
IMTM GMBH
Patent: US2012/28995 A1, 2012 ; Title/Abstract Full Text Show Details
2l
Shen, Sida; Xu, Xingyu; Lei, Min; Hu, Lihong
Synthesis (Germany), 2012 , vol. 44, # 22 art. no. SS-2012-F0613-OP, p. 3543 - 3549 Title/Abstract Full Text View citing articles Show Details
3-OH
Cardenal, Carmen; Vollrath, Sidonie B. L.; Schepers, Ute; Bräse, Stefan
Helvetica Chimica Acta, 2012 , vol. 95, # 11 p. 2237 - 2248 Title/Abstract Full Text View citing articles Show Details
9
Abu Thaher, Bassam A.; Zahra, Jalal A.; El-Abadelah, Mustafa M.; Voelter
Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences, 2004 , vol. 59, # 8 p. 930 - 933 Title/Abstract Full Text View citing articles Show Details
Yan, Ren-Yi; Wang, Hong-Qing; Liu, Chao; Chen, Ruo-Yun; Yu, De-Quan
Fitoterapia, 2011 , vol. 82, # 2 p. 247 - 250 Title/Abstract Full Text View citing articles Show Details
40
TARGANTA THERAPEUTICS, INC.
Patent: US2011/263534 A1, 2011 ; Title/Abstract Full Text Show Details
3-1
MERCK and CO., INC.
Patent: WO2009/102537 A1, 2009 ; Title/Abstract Full Text Show Details
c; 3
Haldar, Debasish
Tetrahedron, 2008 , vol. 64, # 1 p. 186 - 190 Title/Abstract Full Text View citing articles Show Details
amine f
Asadulina, Ekaterina M.; Bastrakov, Maxim A.; Kachala, Vadim V.; Starosotnikov, Aleksei M.; Shevelev, Svyatoslav A.
Mendeleev Communications, 2008 , vol. 18, # 4 p. 213 - 214 Title/Abstract Full Text View citing articles Show Details
1, n = 2
De Figueiredo, Renata Marcia; Oczipka, Philipp; Froehlich, Roland; Christmann, Mathias
Synthesis, 2008 , # 8 p. 1316 - 1318 Title/Abstract Full Text View citing articles Show Details
1a
Rao, T.Sudhakar; Nampalli, Satyam; Sekher, Padmanabhan; Kumar, Shiv
Tetrahedron Letters, 2002 , vol. 43, # 43 p. 7793 - 7795 Title/Abstract Full Text View citing articles Show Details
Zareef, Muhammad; Iqbal, Rashid; Al-Masoudi, Najim A.; Zaidi, Javid H.; Arfan, Muhammad; Shahzad, Sohail A.
Phosphorus, Sulfur and Silicon and the Related Elements, 2007 , vol. 182, # 2 p. 281 - 298 Title/Abstract Full Text View citing articles Show Details
carb. acid for H4ale
Kubicek, Vojtech; Kotek, Jan; Hermann, Petr; Lukes, Ivan
European Journal of Inorganic Chemistry, 2007 , # 2 p. 333 - 344 Title/Abstract Full Text View citing articles Show Details
3, n=3
Liberatore, Anne-Marie; Schulz, Jocelyne; Favre-Guilmard, Christine; Pommier, Jacques; Lannoy, Jacques; Pawlowski, Emilia; Barthelemy, Marie-Anne; Huchet, Marion; Auguet, Michel; Chabrier, Pierre-Etienne; Bigg, Dennis
Bioorganic and Medicinal Chemistry Letters, 2007 , vol. 17, # 6 p. 1746 - 1749 Title/Abstract Full Text View citing articles Show Details
educt of 10b
Guenin, Erwann; Monteil, Maelle; Bouchemal, Nadia; Prange, Thierry; Lecouvey, Marc
European Journal of Organic Chemistry, 2007 , # 20 p. 3380 - 3391 Title/Abstract Full Text View citing articles Show Details
7c
Schmuck, Carsten; Rehm, Thomas; Geiger, Lars; Schaefer, Mathias
Journal of Organic Chemistry, 2007 , vol. 72, # 16 p. 6162 - 6170 Title/Abstract Full Text View citing articles Show Details
starting to 1c
Brennauer, Albert; Keller, Max; Freund, Matthias; Bernhardt, Guenther; Buschauer, Armin
Tetrahedron Letters, 2007 , vol. 48, # 39 p. 6996 - 6999 Title/Abstract Full Text View citing articles Show Details
22a
Fedi, Valentina; Altamura, Maria; Catalioto, Rose-Marie; Giannotti, Danilo; Giolitti, Alessandro; Giuliani, Sandro; Guidi, Antonio; Harmat, Nicholas J. S.; Lecci, Alessandro; Meini, Stefania; Nannicini, Rossano; Pasqui, Franco; Tramontana, Manuela; Triolo, Antonio; Maggi, Carlo Alberto
Journal of Medicinal Chemistry, 2007 , vol. 50, # 20 p. 4793 - 4807 Title/Abstract Full Text View citing articles Show Details
1f
Rao, Divvela V. N. Srinivasa; Dandala, Ramesh; Narayanan, Garimella K. A. S. S.; Lenin, Racha; Sivakumaran; Naidu, Andra
Synthetic Communications, 2007 , vol. 37, # 24 p. 4359 - 4365 Title/Abstract Full Text View citing articles Show Details
1; GABA
Dekebo, Aman; Kashiwagi, Takehiro; Tebayashi, Shin-Ich; Kim, Chul-Sa
Bioscience, Biotechnology and Biochemistry, 2007 , vol. 71, # 2 p. 421 - 426 Title/Abstract Full Text View citing articles Show Details
Formula XIII
Mandava, Venkata Naga Brahmeswara Rao; Singam Setty, Radha Krishna; Manne, Nagaraju
Patent: US2007/142636 A1, 2007 ; Title/Abstract Full Text Show Details
1r
Brotzel, Frank; Mayr, Herbert
Organic and Biomolecular Chemistry, 2007 , vol. 5, # 23 p. 3814 - 3820 Title/Abstract Full Text View citing articles Show Details
5l
Ramesh, Ramapanicker; Rajasekaran, Sakthidevi; Gupta, Rohit; Chandrasekaran, Srinivasan
Organic Letters, 2006 , vol. 8, # 9 p. 1933 - 1936 Title/Abstract Full Text View citing articles Show Details
b
Li, Heting; Jiang, Zhiqin; Wang, Xin; Zheng, Chao
Synthetic Communications, 2006 , vol. 36, # 14 p. 1933 - 1940 Title/Abstract Full Text View citing articles Show Details
A-4
Saito, Hikaru; Hirano, Hiroyuki; Nakagawa, Hiroshi; Fukami, Takeaki; Oosumi, Keisuke; Murakami, Kaori; Kimura, Hiroko; Kouchi, Takayuki; Konomi, Mami; Tao, Eriko; Tsujikawa, Noboru; Tarui, Shigeki; Nagakura, Makoto; Osumi, Masako; Ishikawa, Toshihisa
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 317, # 3 p. 1114 - 1124 Title/Abstract Full Text View citing articles Show Details
6e
Dorogov, Mikhail V.; Ivanovsky, Sergey A.; Khakhina, Maria Y.; Kravchenko, Dmitry V.; Tkachenko, Sergey E.; Ivachtchenko, Alexandre V.
Synthetic Communications, 2006 , vol. 36, # 23 p. 3525 - 3535 Title/Abstract Full Text View citing articles Show Details
5c
Gros, Ludovic; Lorente, Silvia Orenes; Jimenez, Carmen; Yardley, Vanessa; Rattray, Lauren; Wharton, Hayley; Little, Susan; Croft, Simon L.; Ruiz-Perez, Luis M.; Gonzalez-Pacanowska, Dolores; Gilbert, Ian H.
Journal of Medicinal Chemistry, 2006 , vol. 49, # 20 p. 6094 - 6103 Title/Abstract Full Text View citing articles Show Details
8b
Anandan, Sampath-Kumar; Ward, John S.; Brokx, Richard D.; Bray, Mark R.; Patel, Dinesh V.; Xiao, Xiao-Xi
Bioorganic and Medicinal Chemistry Letters, 2005 , vol. 15, # 8 p. 1969 - 1972 Title/Abstract Full Text View citing articles Show Details
20
Carbone, Vincenzo; Ishikura, Syuhei; Hara, Akira; El-Kabbani, Ossama
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 2 p. 301 - 312 Title/Abstract Full Text View citing articles Show Details
ABA
Klimova; Babushkina; Khvostova
Russian Chemical Bulletin, 2005 , vol. 54, # 10 p. 2452 - 2455 Title/Abstract Full Text View citing articles Show Details
2b
Yang, Ting; Lin, Changxue; Fu, Hua; Jiang, Yuyang; Zhao, Yufen
Organic Letters, 2005 , vol. 7, # 21 p. 4781 - 4784 Title/Abstract Full Text View citing articles Show Details
GAB
Sobolev, Anatoli P.; Brosio, Elvino; Gianferri, Raffaella; Segre, Anna L.
Magnetic Resonance in Chemistry, 2005 , vol. 43, # 8 p. 625 - 638 Title/Abstract Full Text View citing articles Show Details
2a
Szczecinski, Przemyslaw; Bartusik, Dorota
Journal of Chemical Research - Part S, 2002 , # 2 p. 84 - 85 Title/Abstract Full Text View citing articles Show Details
Ukhin; Kuz'mina
Russian Chemical Bulletin, 2004 , vol. 53, # 10 p. 2262 - 2268 Title/Abstract Full Text View citing articles Show Details
HOOC-(CH2)3NH2
De Luca, Lidia; Giacomelli, Giampaolo
Synlett, 2004 , # 12 p. 2180 - 2184 Title/Abstract Full Text View citing articles Show Details
AA=Abu
Zhang, Zhongsheng; Liu, Jiyun; Verlinde, Christophe L. M. J.; Hol, Wim G. J.; Fan, Erkang
Journal of Organic Chemistry, 2004 , vol. 69, # 22 p. 7737 - 7740 Title/Abstract Full Text View citing articles Show Details
NuH, Nu for comp. 35
Wipf, Peter; Minion, Daniel J.; Halter, Robert J.; Berggren, Margareta I.; Ho, Caroline B.; Chiang, Gary G.; Kirkpatrick, Lynn; Abraham, Robert; Powis, Garth
Organic and Biomolecular Chemistry, 2004 , vol. 2, # 13 p. 1911 - 1920 Title/Abstract Full Text View citing articles Show Details
Scheme 1, H2N(CH2)2CO2H
Suresh, Surisetti; Periasamy, Mariappan
Tetrahedron Letters, 2004 , vol. 45, # 33 p. 6291 - 6293 Title/Abstract Full Text View citing articles Show Details
educt to 5
Shi, Yun; Kuzuya, Akinori; Machida, Kenzo; Komiyama, Makoto
Tetrahedron Letters, 2004 , vol. 45, # 19 p. 3703 - 3706 Title/Abstract Full Text View citing articles Show Details
18
Ikemoto, Tomomi; Ito, Tatsuya; Nishiguchi, Atsuko; Tomimatsu, Kiminori
Tetrahedron Letters, 2004 , vol. 45, # 51 p. 9335 - 9339 Title/Abstract Full Text View citing articles Show Details
4c; GABA
Tsubaki, Kazunori; Tanaka, Hiroyuki; Morikawa, Hiroshi; Fuji, Kaoru
Tetrahedron, 2003 , vol. 59, # 18 p. 3195 - 3199 Title/Abstract Full Text View citing articles Show Details
11
Laval, Gilles; Golding, Bernard T.
Synlett, 2003 , # 4 p. 542 - 546 Title/Abstract Full Text View citing articles Show Details
H2N-(CH2)3COOH
Golovko; Solov'eva; Anisimova; Granik
Chemistry of Heterocyclic Compounds, 2003 , vol. 39, # 3 p. 344 - 353 Title/Abstract Full Text View citing articles Show Details
H2N(CH2)3COOH
Petrenko; Petukhova; Shakirov; Shul'ts; Tolstikov
Russian Journal of Organic Chemistry, 2000 , vol. 36, # 7 p. 982 - 995 Title/Abstract Full Text View citing articles Show Details
Orzeszko, Andrzej; Kaminska, Beata; Starociak, Bohdan J.
Farmaco, 2002 , vol. 57, # 8 p. 619 - 624 Title/Abstract Full Text View citing articles Show Details
A-NH2 (c)
Anikinal; Vikharev; Safinl; Gorbunov; Shklyaev; Karmanov
Pharmaceutical Chemistry Journal, 2002 , vol. 36, # 2 p. 72 - 76 Title/Abstract Full Text View citing articles Show Details
22
Lee, Jae Koo; Ahn, Ki Chang; Park, Oee Sook; Ko, Yong Kwan; Kim, Dae-Whang
Journal of agricultural and food chemistry, 2002 , vol. 50, # 7 p. 1791 - 1803 Title/Abstract Full Text View citing articles Show Details
H2N(CH2)3COOH
Choi, Jin Seok; Lee, Hwa-Sun; Lee, Younjoo; Jeong, Nakcheol; Kim, Hack-Joo; Kim, Young-Deug; Han, Hogyu
Tetrahedron Letters, 2002 , vol. 43, # 24 p. 4295 - 4300 Title/Abstract Full Text Show Details
V; GABA
Zav'yalov; Dorofeeva; Rumyantseva; Kulikova; Ezhova; Kravchenko; Zavozin
Pharmaceutical Chemistry Journal, 2002 , vol. 36, # 8 p. 440 - 442 Title/Abstract Full Text View citing articles Show Details
γ-Amb
Del Pilar Garcia-Santos; Gonzalez-Mancebo, Samuel; Hernandez-Benito, Jesus; Calle, Emilio; Casado, Julio
Journal of the American Chemical Society, 2002 , vol. 124, # 10 p. 2177 - 2182 Title/Abstract Full Text View citing articles Show Details
3, GABA
Kurchan, Alexei N.; Kutateladze, Andrei G.
Organic Letters, 2002 , vol. 4, # 23 p. 4129 - 4131 Title/Abstract Full Text View citing articles Show Details
γ-Aba
Kumar
Canadian Journal of Chemistry, 1999 , vol. 77, # 7 p. 1288 - 1294 Title/Abstract Full Text View citing articles Show Details
Vassis, Stratos; Karigiannis, George; Balayiannis, George; Militsopoulou, Maria; Mamos, Petros; Francis, George W.; Papaioannou, Dionissios
Tetrahedron Letters, 2001 , vol. 42, # 8 p. 1579 - 1582 Title/Abstract Full Text View citing articles Show Details
n=2, R1=H, R2=H
Tietze, Lutz F.
Angewandte Chemie - International Edition, 2001 , vol. 40, # 5 p. 903 - 905 Title/Abstract Full Text View citing articles Show Details
84, n=2, X=CH2, R=H
Vaillancourt; Larsen; Tanis; Burr; Connell; Cudahy; Evans; Fisher; May; Meglasson; Robinson; Stevens; Tucker; Vidmar; Yu
Journal of Medicinal Chemistry, 2001 , vol. 44, # 8 p. 1231 - 1248 Title/Abstract Full Text View citing articles Show Details
7a
Royer; Felpin; Doris
Journal of Organic Chemistry, 2001 , vol. 66, # 19 p. 6487 - 6489 Title/Abstract Full Text View citing articles Show Details
12&3%
Salmon-Chemin; Buisine; Yardley; Kohler; Debreu; Landry; Sergheraert; Croft; Krauth-Siegel; Davioud-Charvet
Journal of Medicinal Chemistry, 2001 , vol. 44, # 4 p. 548 - 565 Title/Abstract Full Text View citing articles Show Details
7, n=3
Barczynski; Dega-Szafran; Dulewicz; Petryna; Szafran
Polish Journal of Chemistry, 2000 , vol. 74, # 8 p. 1149 - 1161 Title/Abstract Full Text View citing articles Show Details
1, n=3
Leone-Bay; Freeman; O'Toole; Rosario-Gray; Salo-Kostmayer; Tai; Mercogliano; Baughman
Journal of Medicinal Chemistry, 2000 , vol. 43, # 19 p. 3573 - 3576 Title/Abstract Full Text View citing articles Show Details
50
Guenther, Robert; Stein, Anja; Bordusa, Frank
Journal of Organic Chemistry, 2000 , vol. 65, # 6 p. 1672 - 1679 Title/Abstract Full Text View citing articles Show Details
GABA, R=H
Conrad II, Peter G.; Givens, Richard S.; Weber, Joerg F. W.; Kandler, Karl
Organic Letters, 2000 , vol. 2, # 11 p. 1545 - 1547 Title/Abstract Full Text View citing articles Show Details
NH2(CH2)3COOH
Bruno, Olga; Schenone, Silvia; Ranise, Angelo; Bondavalli, Francesco; Filippelli, Walter; Falcone, Giuseppe; Motola, Giulia; Mazzeo, Filomena
Farmaco, 1999 , vol. 54, # 1-2 p. 95 - 100 Title/Abstract Full Text View citing articles Show Details
GABA, Merck-450
Rothlin; Katz; Verbitsky; Elgoyhen
Molecular pharmacology, 1999 , vol. 55, # 2 p. 248 - 254 Title/Abstract Full Text View citing articles Show Details
Id
Avetisyan; Kocharov; Azaryan; Dzhagatspanyan; Melikyan
Pharmaceutical Chemistry Journal, 1998 , vol. 32, # 2 p. 55 - 58 Title/Abstract Full Text View citing articles Show Details
4aba
Nair, M. Sivasankaran; Arasu, P. Thillai; Neelakantan; Pillai, M. Sankaranarayana
Indian Journal of Chemistry - Section A Inorganic, Physical, Theoretical and Analytical Chemistry, 1998 , vol. 37, # 6 p. 512 - 516 Title/Abstract Full Text View citing articles Show Details
2. educt to MS210
Koyama, Yutaka; Awaya, Akira; Ishikawa, Nobue; Fujita, Shigeki; Tomino, Ikuo; Yokoyama, Keiichi; Araki, Shintaro; Takesue, Mitsuyuki; Kato, Koji; Ishiguro, Masaharu; Kitahara, Takumi; Kihara, Noriaki; Baba, Akemichi
Biological and Pharmaceutical Bulletin, 1997 , vol. 20, # 2 p. 138 - 141 Title/Abstract Full Text View citing articles Show Details
RBI cat./ G-012
Yoshimura; Yoshida; Taniyama
Life Sciences, 1995 , vol. 57, # 26 p. 2397 - 2401 Title/Abstract Full Text View citing articles Show Details
Merck:450 (Tab.2,run 1)
Noyer, Michel; Gillard, Michel; Matagne, Alain; Henichart, Jean-Pierre; Wuelfert, Ernst
European Journal of Pharmacology, 1995 , vol. 286, # 2 p. 137 - 146 Title/Abstract Full Text View citing articles Show Details
(3H)GABA
Yu; Ticku
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 3 p. 1442 - 1446 Title/Abstract Full Text View citing articles Show Details
Patent-Specific Data (22) Prophetic Compound
Related Markush Structure (RN)
Location in Patent
30092163
Reference Southeast University; Cai, Lin; Chen, Guoqing; Ji, Min; Li, Yong; Guo, Minliang; Xu, Hua; Liu, Wenjing
Patent: , 2016 ; Title/Abstract Full Text Show Details
Page/Page column
LEIBNIZ-INSTITUT FUR PFLANZENBIOCHEMIE; Wessjohann, Ludger A.; Henze, Michael; Kreye, Oliver; Rivera, Daniel Garcia
Patent: US2013/203960 A1, 2013 ; Title/Abstract Full Text Show Details
THE UNIVERSITY OF TOKYO; Ito, Taichi; Suzuki, Yukimitsu; Takahashi, Akira; Shimizu, Atsushi
Patent: US2014/256831 A1, 2014 ; Title/Abstract Full Text Show Details
Garad, Sudhakar; Jain, Akash; Hwang, You Seok
Patent: US2015/111864 A1, 2015 ; Title/Abstract Full Text Show Details
Gref, Ruxandra; Agostoni, Valentina; Daoud-Mahammed, Samia; Rodriguez-Ruiz, Violeta; Malanga, Milo; Jicsinszky, Laszlo; Horcajada-Cortes, Patricia; Serre, Christian
Patent: US2015/150981 A1, 2015 ; Title/Abstract Full Text Show Details
prophetic product
24641182
Page/Page column
Biogen Idec Hemophilia Inc.; Mezo, Adam R.; McDonnell, Kevin A.
Patent: US8906844 B2, 2014 ;
UCL BUSINESS PLC; Williams, Robin Simon Brooke; Walker, Matthew
Patent: US2013/303616 A1, 2013 ;
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
20340414
THE UNIVERSITY OF MELBOURNE; DONNELLY, Paul, Stephen; PATERSON, Brett, Michael
Patent: WO2010/66010 A1, 2010 ; Title/Abstract Full Text Show Details
19453001
Gore, Vinayak G.; Shukla, Vinay Kumar; Ghadge, Manoj M.; Avadhut, Rekha M.
Patent: US2009/198062 A1, 2009 ; Title/Abstract Full Text Show Details
19857389
Pandey, Satish Chandra; Haider, Hussain; Saxena, Sudhanshu; Singh, Manoj Kumar; Thaper, Rajesh Kumar; Dubey, Sushil Kumar
Patent: US2009/312551 A1, 2009 ; Title/Abstract Full Text Show Details
11341463
GENERICS [UK] LIMITED; MERCK DEVELOPMENT CENTRE PRIVATE LIMITED
Patent: WO2008/4000 A1, 2008 ; Title/Abstract Full Text Show Details
18529646
ORCHID CHEMICALS AND PHARMACEUTICALS LIMITED
Patent: WO2008/35131 A1, 2008 ;
Title/Abstract Full Text Show Details
11337980
ORCHID CHEMICALS and PHARMACEUTICALS LTD.
Patent: US2007/66569 A1, 2007 ; Title/Abstract Full Text Show Details
11338909
Mandava, Venkata Naga Brahmeswara Rao; Singam Setty, Radha Krishna; Manne, Nagaraju
Patent: US2007/142636 A1, 2007 ; Title/Abstract Full Text Show Details
11339456
Danda, Subba Reddy; Garimella, Narayan K.A.S.S.; Divvela, Srinivasa Rao V.N; Dandala, Ramesh; Meenakshisunderam, Sivakumaran
Patent: US2007/173645 A1, 2007 ; Title/Abstract Full Text Show Details
11332696
DOW GLOBAL TECHNOLOGIES INC.
Patent: WO2006/20234 A1, 2006 ; Title/Abstract Full Text Show Details
11335808
ALEMBIC LIMITED
Patent: US2006/258625 A1, 2006 ; Title/Abstract Full Text Show Details
11336857
JUBILANT ORGANOSYS LIMITED
Patent: WO2006/134603 A1, 2006 ; Title/Abstract Full Text Show Details
11329785
SUN PHARMACEUTICAL INDUSTRIES LIMITED
Patent: WO2005/44831 A2, 2005 ; Title/Abstract Full Text Show Details
11329988
Goldschmidt GmbH
Patent: EP1566375 A1, 2005 ; Title/Abstract Full Text Show Details
11324652
RICHTER GEDEON VEGYESZETI GYAR RT.
Patent: WO2004/67541 A1, 2004 ; Title/Abstract Full Text Show Details
prophetic product
Claim
Astra Aktiebolag
Patent: US6117908 A1, 2000 ; Title/Abstract Full Text Show Details
Tufts University
Patent: US2003/162754 A1, 2003 ; Title/Abstract Full Text Show Details
prophetic product
TOKUYAMA CORPORATION
Patent: EP1178043 A1, 2002 ; Title/Abstract Full Text Show Details
Syntex (U.S.A.) Inc.
Patent: US4657893 A1, 1987 ; Title/Abstract Full Text Show Details
Nippon Kayaku Kabushiki Kaisha; Takara Shuzo Kabushiki Kaisha
Patent: US5061787 A1, 1991 ; Title/Abstract Full Text Show Details
Schmitz, Robert A.
Patent: US6299892 B1, 2001 ; Title/Abstract Full Text Show Details
Bayer Aktiengesellschaft
Patent: US5580965 A1, 1996 ; Title/Abstract Full Text Show Details
Lion Bioscience AG
Patent: US6458789 B1, 2002 ;
Title/Abstract Full Text Show Details
Chesebrough-Pond's USA Co. Division of Conopco, Inc.
Patent: US5559092 A1, 1996 ; Title/Abstract Full Text Show Details
Hoechst Aktiengesellschaft
Patent: US5622934 A1, 1997 ; Title/Abstract Full Text Show Details
Hide facts Prophetic Compound
Related Markush Structure (RN)
Reference
prophetic product
11329901
Emisiphere Technologies, Inc.
Patent: US6348207 B1, 2002 ; Title/Abstract Full Text Show Details
Aventis Pharma Limited
Patent: US6352977 B1, 2002 ;
19816371
Title/Abstract Full Text Show Details
Derivative (18) Comment (Derivative)
Reference
Hydrochlorid: pK; Stabilitaetskonstante des Komplexes mit Cu(II)
Latosh et al.
J. Gen. Chem. USSR (Engl. Transl.), 1978 , vol. 48, p. 2287,2076 Full Text Show Details
NH4+-Salz: ΔF(cp)
Cabani et al.
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1977 , vol. 73, p. 476,478 Full Text Show Details
Hydrochlorid: ΔF(cp)
Cabani et al.
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1977 , vol. 73, p. 476,478 Full Text Show Details
protonierte Form: Rk. mit Propanal (K)
Bordat,C. et al.
Comptes Rendus des Seances de l'Academie des Sciences, Serie C: Sciences Chimiques, 1975 , vol. 281, p. 579 - 582 Full Text View citing articles Show Details
Hydrochlorid: aus 4-Phthalimidobuttersaeure u. verd. Salzsaeure, F:132grad
Kukalenko et al.
Zhurnal Organicheskoi Khimii, 1973 , vol. 9, p. 1401,1430 Full Text Show Details
Hydrochlorid: C4H9NO2*HCl; Roe.-Krist.-Strukt. (Verfeiner.); Elementarzelle, Bindungslaengen, winkel
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2825,2826 Full Text Show Details
Hydrochlorid: F: 130-131.5grad (aus A.+Ae.) S.201,202
Woronkina et al.
Biol. Akt. Soedin., 1965 , p. 199,202 Full Text Show Details
Pikranolat: F:218-219grad
Schuette et al.
Justus Liebigs Annalen der Chemie, 1964 , vol. 680, p. 93,102 Full Text Show Details
CaCl2-Addukt: F: 217-220grad
Mangyo
Seikagaku, 1964 , vol. 36, p. 756 Chem.Abstr., 1965 , vol. 62, # 11680d Full Text View citing articles Show Details
Lactam: Rk. mit COF2 (75grad und 125grad je 1h) -> N-Fluorformyl-α,α-difluortetramethylenimin, N-Fluorformyl-butyrolactam
Fawcett,F.S. et al.
Journal of the American Chemical Society, 1962 , vol. 84, p. 4275 - 4285 Full Text View citing articles Show Details
Lactam: siehe System-Nr. 3179/C4/(5/0)
Kolasow et al.
Zhurnal Fizicheskoi Khimii, 1962 , vol. 36, p. 770,775 p. 400 Full Text Show Details
Polyamid: B:Pyrrolidon-(2), Katalysatoren bei 20grad
Sekiguchi
Bulletin de la Societe Chimique de France, 1960 , p. 1838 Full Text Show Details
Polyamid: physikalische und mechanische Eigenschaften
Sekiguchi
Bulletin de la Societe Chimique de France, 1960 , p. 1838 Full Text Show Details
Iodid: Trennung durch Hochspannungs-Papierelektrophorese
Heilbronn; Carlsson
Journal of Chromatography, 1960 , vol. 4, p. 257,258, 259 Chem.Abstr., 1961 , # 5634 Full Text View citing articles Show Details
Ammoniumsalz: papierchromatogr. Isol. und Identifizierung
Howe
Journal of Chromatography, 1960 , vol. 3, p. 389,390-405 Chem.Abstr., 1961 , vol. 55, # 7267 Full Text Show Details
Polyamid: Kinetik der Bildung durch katalytische Polymersation von Pyrrolidon-(2)
Sekiguchi
Bulletin de la Societe Chimique de France, 1960 , p. 1838 Full Text Show Details
Polyamid: Rk.-mech. der Bildung durch katalytische Polymerisation von Pyrrolidon-(2)
Sekiguchi
Bulletin de la Societe Chimique de France, 1960 , p. 1838 Full Text Show Details
platinum (II)-salt Further Data see Handbook (Solubility)
Wolschtein; Mogilewkina
Doklady Akademii Nauk SSSR, 1956 , vol. 110, p. 83,84 Pr.Acad.Sci.U.S.S.R., 106-111<1956>531 Full Text Show Details
Purification (1) Reference Zamorani et al.
Gazzetta Chimica Italiana, 1968 , vol. 98, p. 468 Full Text Show Details
Parmentier; Vanderhaeghe
Journal of Chromatography, 1960 , vol. 4, p. 228,229-232 Chem.Abstr., 1961 , vol. 55, # 3305 Full Text Show Details
Biserte et al.
Journal of Chromatography, 1960 , vol. 3, p. 25,26-47 Chem.Abstr., 1960 , vol. 54, # 18651 Full Text Show Details
Physical Data Melting Point (24) Melting Point
Solvent (Melting Point)
Comment (Melting Point)
Reference
203 °C
Goud, N. Rajesh; Suresh, Kuthuru; Nangia, Ashwini
Crystal Growth and Design, 2013 , vol. 13, # 4 p. 1590 - 1601 Title/Abstract Full Text View citing articles Show Details
201.3 - 204.2 °C
Dichi, Emma; Sghaier, Mehrez; Fraisse, Bernard; Bonhomme, Francois
Chemical and Pharmaceutical Bulletin, 2011 , vol. 59, # 6 p. 703 - 709 Title/Abstract Full Text View citing articles Show Details
192 °C
aq. ethanol
Mulla; Gurubasavaraj; Nandibewoor
Polish Journal of Chemistry, 2003 , vol. 77, # 12 p. 1833 - 1840 Title/Abstract Full Text View citing articles Show Details
Seregar; Hiremath; Nandibewoor
Zeitschrift fur Physikalische Chemie, 2006 , vol. 220, # 5 p. 615 - 629 Title/Abstract Full Text View citing articles Show Details
202 °C
Decomposition
Satzinger
Arzneimittel-Forschung/Drug Research, 1994 , vol. 44, # 3 p. 261 - 266 Title/Abstract Full Text View citing articles Show Details
202 °C
Sasaki; Mori; Nakamura; Shibasaki
Journal of Medicinal Chemistry, 1991 , vol. 34, # 2 p. 628 - 633 Title/Abstract Full Text View citing articles Show Details
203 - 205 °C
H2O ethanol
Kohama; Matsumoto; Mimura; Tanabe; Inada; Nakanishi
Chemical and Pharmaceutical Bulletin, 1987 , vol. 35, # 6 p. 2484 - 2489 Title/Abstract Full Text View citing articles Show Details
205 - 208 °C
H2O ethanol
Decomposition
Haeusler, Johannes
Monatshefte fuer Chemie, 1987 , vol. 118, p. 865 - 870 Title/Abstract Full Text View citing articles Show Details
203 °C
ethanol H2O
Decomposition
Daigo; Inamori; Takemoto
Chemical and Pharmaceutical Bulletin, 1986 , vol. 34, # 5 p. 2243 - 2246 Title/Abstract Full Text View citing articles Show Details
200 - 201 °C
Yanushyavichyute, R. P.; Paulyukonis, A. B.; Kazlauskas, D. A.
Chemistry of Natural Compounds, 1983 , vol. 19, # 3 p. 246 Khimiya Prirodnykh Soedinenii, 1983 , # 2 p. 246 - 247 Title/Abstract Full Text View citing articles Show Details
200 - 201 °C
H2O ethanol diethyl ether
Takemoto; Takagi; Nakajima; Koike
Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan, 1975 , vol. 95, # 2 p. 176 - 179 Title/Abstract Full Text View citing articles Show Details
203 °C
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2038 Full Text Show Details
193 °C
Ley
Chemische Berichte, 1909 , vol. 42, p. 367 Full Text Show Details
Meiya et al.
J. Appl. Chem. USSR (Engl. Transl.), 1972 , vol. 45, p. 692,707 Full Text Show Details
134 - 136 °C
ethanol
Kojima et al.
Yakugaku Zasshi, 1972 , vol. 92, p. 465,469 Chem.Abstr., 1972 , vol. 77, # 34230 Full Text Show Details
216 °C
Grobbelaar; Steward
Phytochemistry (Elsevier), 1969 , vol. 8, p. 553,557 Full Text Show Details
193 - 194 °C
aq. ethanol
Sato
Nippon Kagaku Zasshi, 1969 , vol. 90, p. 404,405,408 Full Text Show Details
183 - 185 °C
Jokobiec
Acta Poloniae Pharmaceutica, 1966 , vol. 23, p. 114,118, 119 Full Text Show Details
194 - 195 °C
Ito; Hashimoto
Agricultural and Biological Chemistry, 1965 , vol. 29, p. 832,835 Full Text Show Details
193 - 194 °C
Arendaruk et al.
Meditsinskaya Promyshlennost SSSR, 1963 , vol. 17, p. 6 Chem.Abstr., 1963 , vol. 59, # 11234d Full Text View citing articles Show Details
192 - 197 °C
Durand et al.
Journal of Pharmacy and Pharmacology, 1962 , vol. 14, p. 562,564 Full Text Show Details
200 - 202 °C
Colonge,J.; Pouchol,J.-M.
Bulletin de la Societe Chimique de France, 1962 , p. 598 - 603 Full Text View citing articles Show Details
Hide facts Melting Point
Solvent (Melting Point)
Comment (Melting Point)
Reference
196 °C
bei langsamem Erhitzen.
Karrer; Widmer
Helvetica Chimica Acta, 1926 , vol. 9, p. 890 Full Text Show Details
200 °C
bei raschem Erhitzen.
Karrer; Widmer
Helvetica Chimica Acta, 1926 , vol. 9, p. 890 Full Text Show Details
203 °C
aq. ethanol
Decomp.
Abderhalden; Kautzsch
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1912 , vol. 81, p. 297 Full Text Show Details
202 °C
Decomp.
Tafel; Stern
Chemische Berichte, 1900 , vol. 33, p. 2235 Full Text Show Details
Density (2) Density
Type (Density)
Reference
1.253 g·cm-3
crystallographic
Dobson; Gerkin
Acta Crystallographica, Section C: Crystal Structure Communications, 1996 , vol. 52, # pt 12 p. [d]3075-3078 Title/Abstract Full Text View citing articles Show Details
1.21 g·cm-3
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2038 Full Text Show Details
Adsorption (MCS) (2) Partner (Adsorption (MCS))
Solvent (Adsorption (MCS))
Temperature (Adsorption (MCS))
Further physical properties of the adsorbed molecule
silica gel
H2O
19 °C
Basiuk, V. A.; Gromovoy, T. Yu.; Khil'chevskaya, E. G.
Polish Journal of Chemistry, 1994 , vol. 68, # 4 p. 777 782 Title/Abstract Full Text Show Details
Adsorption isotherm
KU-2 resin, KB-4P-2 resin
H2O
Murav'ev, D. H.; Obrezkov, O. N.
Russian Journal of Physical Chemistry, 1986 , vol. 60, # 2 p. 232 - 235 Zhurnal Fizicheskoi Khimii, 1986 , vol. 60, p. 396 - 401 Title/Abstract Full Text Show Details
Description (Adsorption (MCS))
Reference
Association (MCS) (24) Description (Association (MCS))
Partner (Association (MCS))
Solvent (Association (MCS))
Temperature (Association (MCS))
Location
Comment (Association (MCS))
Association with compound
C53H79GdN9O9(1+)
aq. buffer
37 °C
Oukhatar, Fatima; Mme, Sandra; Mme, William; Szeremeta, Frdric; Logothetis, Nikos K.; Angelovski, Goran; Tth, va
ACS Chemical Neuroscience, 2015 , vol. 6, # 2 p. 219 - 225 Title/Abstract Full Text View citing articles Show Details
Association with compound
C25H22N2O7S; C25H21N2O7S(1); C25H20N2O7S(2-)
dimethyl sulfoxide
supporting information
Mart, Almudena; Costero, Ana M.; Gavia, Pablo; Parra, Margarita
European Journal of Organic Chemistry, 2015 , vol. 2015, # 30 p. 6597 - 6601 Title/Abstract Full Text View citing articles Show Details
NMR spectrum of the complex
C38H41BO9
dimethylsulfoxide-d6
22 °C
Tsubaki, Kazunori; Tanaka, Hiroyuki; Morikawa, Hiroshi; Fuji, Kaoru
Tetrahedron, 2003 , vol. 59, # 18 p. 3195 3199 Title/Abstract Full Text View citing articles Show Details
UV/VIS spectrum of the complex
C38H38N4O11
dimethylsulfoxide
20 °C
Tsubaki, Kazunori; Tanaka, Hiroyuki; Morikawa, Hiroshi; Fuji, Kaoru
Tetrahedron, 2003 , vol. 59, # 18 p. 3195 3199 Title/Abstract Full Text View citing articles Show Details
Stability constant of the complex with ...
1H-imidazole
H2O
37 °C
Nair, M. Sivasankaran; Arasu, P. Thillai; Neelakantan; Pillai, M. Sankaranarayana
Indian Journal of Chemistry - Section A Inorganic, Physical, Theoretical and Analytical
Reference
Chemistry, 1998 , vol. 37, # 6 p. 512 - 516 Title/Abstract Full Text View citing articles Show Details
Stability constant of the complex with ...
benzoimidazole
H2O
37 °C
Nair, M. Sivasankaran; Arasu, P. Thillai; Neelakantan; Pillai, M. Sankaranarayana
Indian Journal of Chemistry - Section A Inorganic, Physical, Theoretical and Analytical Chemistry, 1998 , vol. 37, # 6 p. 512 - 516 Title/Abstract Full Text View citing articles Show Details
Stability constant of the complex with ...
dibenzo-18-crown-6
H2O
25 °C
Buschmann, Hans-Juergen; Cleve, Ernst; Mutihac, Lucia; Schollmeyer, Eckhard
Revue Roumaine de Chimie, 1998 , vol. 43, # 10 p. 941 - 944 Title/Abstract Full Text View citing articles Show Details
Stability constant of the complex with ...
[6-(6,7,9,10,12,13,15,16,18,19-Decahydro5,8,11,14,17,20-hexaoxa-benzocyclooctadecen-2-yl)pyridin-2-ylmethyl]-bis-pyridin-2-ylmethyl-amine
H2O acetonitrile
Ratio of solvents: 50percent
Dos Santos, Osvaldo; Lajmi, Ajay R.; Canary, James W.
Tetrahedron Letters, 1997 , vol. 38, # 25 p. 4383 - 4386 Title/Abstract Full Text View citing articles Show Details
Spectrum of the complex
N-[10-(1,4,7,10,13-Pentaoxa-16-aza-cyclooctadec16-ylmethyl)-anthracen-9-ylmethyl]-guanidine; compound with nitric acid
CDCl3 tetradeuteriomethanol
NMR spectrum Ratio of solvents: 3:2, v/v
De Silva, A. Prasanna; Gunaratne, H. Q. Nimal; McVeigh, Catherine; Maguire, Glenn E. M.; Maxwell, Pamela R. S.; O'Hanlon, Emma
Chemical Communications, 1996 , # 18 p. 2191 - 2192 Title/Abstract Full Text View citing articles Show Details
Stability constant of the complex with ...
N-[10-(1,4,7,10,13-Pentaoxa-16-aza-cyclooctadec16-ylmethyl)-anthracen-9-ylmethyl]-guanidine; compound with nitric acid
methanol H2O
Ratio of solvents: 3:2, v/v
De Silva, A. Prasanna; Gunaratne, H. Q. Nimal; McVeigh, Catherine; Maguire, Glenn E. M.; Maxwell, Pamela R. S.; O'Hanlon, Emma
Chemical Communications, 1996 , # 18 p. 2191 - 2192 Title/Abstract Full Text View citing articles Show Details
Further physical properties of the complex
NaCl
H2O
25 °C
Gallardo, Maria A.; Lilley, Terence H.; Linsdell, Helen; Lu, Yan; Otin, Santos; Ward, Allison J.
Journal of the Chemical Society - Faraday Transactions, 1996 , vol. 92, # 24 p. 4983 4986 Title/Abstract Full Text View citing articles Show Details
Stability constant of the complex with ...
C57H72N12O18
Askew, Benny C.
Tetrahedron Letters, 1990 , vol. 31, # 30 p. 4245 - 4248 Title/Abstract Full Text View citing articles Show Details
Further physical properties of the complex
o-phthalic dicarboxaldehyde; Fluorescence: 360 nm (exitation), 440 nm (emision);
acetonitrile H2O
Ratio of solvents: KH2PO4 buffer,pH=2.8
Sunol, Cristina; Artigas, Francesc; Tusell, Josep M.; Gelpi, Emilio
Analytical Chemistry, 1988 , vol. 60, p. 649 - 651 Title/Abstract Full Text View citing articles Show Details
Stability constant of the complex with ...
Amazac
methanol H2O
25 °C
Ratio of solvents: 90percentv/v
Schmidtchen, F. P.
Journal of Organic Chemistry, 1986 , vol. 51, # 26 p. 5161 - 5168 Title/Abstract Full Text View citing articles Show Details
Stability constant of the complex with ...
C61H119N7O3(4+)*7BF4(1-)*3H(1+)
methanol H2O
25 °C
Ratio of solvents: 90percentv/v
Schmidtchen, F. P.
Journal of Organic Chemistry, 1986 , vol. 51, # 26 p. 5161 - 5168 Title/Abstract Full Text View citing articles Show Details
Association with compound
1-(6,7,9,10,12,13,15,16-Octahydro-5,8,11,14,17pentaoxa-benzocyclopentadecen-2ylmethyl)-1,4,7,10,13,16-hexaaza-
25 °C
Kimura, Eiichi; Fujioka, Haruto; Kodama, Mutsuo
Journal of the Chemical Society, Chemical
cyclooctadecane; H2O, NaClO4
Communications, 1986 , # 15 p. 1158 - 1159 Title/Abstract Full Text View citing articles Show Details
Further physical properties of the complex
CuCl2
-213.1 26.9 °C
Emori, Shuji; Noguchi, Toshihiko; Muto, Yoneichiro
Bulletin of the Chemical Society of Japan, 1985 , vol. 58, # 9 p. 2733 - 2734 Title/Abstract Full Text Show Details
IR spectrum of the complex
CuCl2
Emori, Shuji; Noguchi, Toshihiko; Muto, Yoneichiro
Bulletin of the Chemical Society of Japan, 1985 , vol. 58, # 9 p. 2733 - 2734 Title/Abstract Full Text Show Details
IR spectrum of the complex
CuBr2
Emori, Shuji; Noguchi, Toshihiko; Muto, Yoneichiro
Bulletin of the Chemical Society of Japan, 1985 , vol. 58, # 9 p. 2733 - 2734 Title/Abstract Full Text Show Details
Further physical properties of the complex
CuBr2
20 °C
Emori, Shuji; Noguchi, Toshihiko; Muto, Yoneichiro
Bulletin of the Chemical Society of Japan, 1985 , vol. 58, # 9 p. 2733 - 2734 Title/Abstract Full Text Show Details
Hide facts Description (Association (MCS))
Partner (Association (MCS))
Solvent (Association (MCS))
Temperature (Association (MCS))
NMR spectrum of the complex
cadmium perchlorate
H2O
26 - 29 °C
Wang; Gilpin
Analytical Chemistry, 1983 , vol. 55, # 3 p. 493 - 497 Title/Abstract Full Text View citing articles Show Details
Further physical properties of the complex
haloperidol
H2O
Srivastava, R. C.; Bhise, S. B.
Journal of the Indian Chemical Society, 1983 , vol. 60, p. 1135 - 1141 Title/Abstract Full Text Show Details
Further physical properties of the complex
chlorpromazine hydrochloride
H2O
Srivastava, R. C.; Bhise, S. B.
Journal of the Indian Chemical Society, 1983 , vol. 60, p. 1135 - 1141 Title/Abstract Full Text Show Details
Stability constant of the complex with ...
Alner et al.
Journal of the Chemical Society [Section] A: Inorganic, Physical, Theoretical, 1968 , p. 417,420 Full Text Show Details
Reference
Chromatographic Data (8) Chromatographic data
Original string
Location
Reference
GC (Gas chromatography)
Man, Shuli; Li, Yuanyuan; Fan, Wei; Gao, Wenyuan; Liu, Zhen; Li, Nan; Zhang, Yao; Liu, ChangXiao
International Journal of Pharmaceutics, 2013 , vol. 454, # 1 p. 296 - 301 Title/Abstract Full Text View citing articles Show Details
Yu, Xinyu; Luo, Jia; Chen, Lijun; Zhang, Chengxiang; Zhang, Rutan; Hu, Qi; Qiao, Shanlei; Li, Lei
RSC Advances, 2015 , vol. 5, # 85 p. 69800 69812 Title/Abstract Full Text View citing articles Show Details
Wu, Yu; Fu, Yuying; Rao, Chenglong; Li, Wenwen; Liang, Zihong; Zhou, Chanjuan; Shen, Peng; Cheng, Pengfei; Zeng, Li; Zhu, Dan; Zhao, Libo; Xie, Peng
Behavioural Brain Research, 2016 , vol. 308, p. 115 - 127 Title/Abstract Full Text View citing articles Show Details
HPLC (High
Al-Sammak, Maitham Ahmed; Hoagland,
Kyle D.; Snow, Daniel D.; Cassada, David
Toxicon, 2013 , vol. 76, p. 316 - 325 Title/Abstract Full Text View citing articles Show Details
Ordez; Sainz; Callejn; Troncoso; Torija; Garca-Parrilla
Food Chemistry, 2015 , vol. 178, p. 221 - 228 Title/Abstract Full Text View citing articles Show Details
Song, Qingqing; Song, Yuelin; Zhang, Na; Li, Jun; Jiang, Yong; Zhang, Kerong; Zhang, Qian; Tu, Pengfei
RSC Advances, 2015 , vol. 5, # 71 p. 57372 57382 Title/Abstract Full Text View citing articles Show Details
Servillo, Luigi; Giovane, Alfonso; Casale, Rosario; Balestrieri, Maria Luisa; Cautela, Domenico; Paolucci, Marina; Siano, Francesco; Volpe, Maria Grazia; Castaldo, Domenico
Food Chemistry, 2016 , vol. 196, p. 1301 - 1309 Title/Abstract Full Text View citing articles Show Details
Li, Lei; Yu, Xinyu; Qiao, Shanlei; Wang, Di; Dai, Jiayong; Wang, Jun; Zhang, Rutan; Wang, Li
RSC Advances, 2016 , vol. 6, # 31 p. 25751 25765 Title/Abstract Full Text View citing articles Show Details
Bergh, Marianne Skov-Skov; Bogen, Inger Lise; Lundanes, Elsa; Øiestad, Åse Marit Leere
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2016 , vol. 1028, p. 120 - 129 Title/Abstract Full Text View citing articles Show Details
Herrera, Andrea; Muñoz, Patricia; Paris, Irmgard; Díaz-Veliz, Gabriela; Mora, Sergio; Inzunza, Jose; Hultenby, Kjell; Cardenas, Cesar; Jaña, Fabián; Raisman-Vozari, Rita; Gysling, Katia; Abarca, Jorge; Steinbusch, Harry W. M.; Segura-Aguilar, Juan
Cellular and Molecular Life Sciences, 2016 , vol. 73, # 18 p. 3583 - 3597 Title/Abstract Full Text View citing articles Show Details
Wojnicz, Aneta; Avendaño-Ortiz, José; de Pascual, Ricardo; Ruiz-Pascual, Lucía; García, Antonio G.; Ruiz-Nuño, Ana
Journal of Mass Spectrometry, 2016 , vol. 51, # 8 p. 651 - 664 Title/Abstract Full Text Show Details
performance liquid chromatography)
GC (Gas chromatography)
R.T. 24.104
Page/Page column 27; 28
The Samuel Roberts Noble Foundation, Inc.; Li, Wensheng; Uppalapati, Srinivasa Rao; Mysore, Kirankumar S.; Dixon, Richard A.; Sumner, Lloyd W.
Patent: US9238821 B2, 2016 ; Title/Abstract Full Text Show Details
HPLC (High performance liquid chromatography)
Paragraph 0032
Shanghai Pharmaceutical on the first biochemical Pharmaceutical Co; Yuan, Yonglei; Ding, Jinguo; Huang, Zhenghui; Li, Yingfei
Patent: CN105669480 A, 2016 ; Title/Abstract Full Text Show Details
GC (Gas chromatography)
supporting information
Lee, Gyu Min; Suh, Dong Ho; Jung, Eun Sung; Lee, Choong Hwan
Molecules, 2016 , vol. 21, # 7 art. no. 921 Title/Abstract Full Text View citing articles Show Details
HPLC (High performance liquid chromatography)
As the HPLC column, a XTerra column (Waters: RP 18 5 m, 4.6 mm×150 mm) was used. As mobile phases, 0.05M sodium acetate (pH 7.2) was used as a solvent A, and a mixture (pH 7.2) in which 0.1M sodium acetate, acetonitrile (HPLC grade) and methanol (HPLC grade) were mixed in a ratio of 46:44:10 (v/v/v) was used as a solvent B. Concentration gradients of the mobile phases were as follows: starting the analysis with the solvent A being 100percent, the solvent B was made to be 100percent after 30 minutes, the solvent B was made to be 100percent until after 40 minutes, the solvent A was made to be 100percent again until
Paragraph 0101; 0102
PARK, Chang-Seo; NAM, Sang-June; CHOI, Wang-Keun; PYUN, Yu-Ryang; CHO, HyungYong; CHO, Seok-Cheol; KOOK, Moo-Chang; LEE, Chang-Woo; CHUNG, So-Young
Patent: US2015/44313 A1, 2015 ;
after 45 minutes and the solvent A was made to be 100percent until after 60 minutes. The flow rate of the mobile phase was fixed to be 1 ml/min. and the GABA was detected with a U.V. detector. Under these conditions, the holding time of GABA and glutamate were 21.01 and 9.89 minutes, respectively and a limit concentration of the detection was 0.1 mM. In addition, if the concentration of the GABA exceeds 10 mM, since it exceeds the upper limit of the detector, it was diluted to correspond to it and then measured. At this time, 99percent GABA from Sigma which was commercialized for reagent was used as a standard material.
Title/Abstract Full Text Show Details
HPLC (High performance liquid chromatography) UPLC (Ultra performance liquid chromatography)
Wagner, Michel; Ohlund, Leanne B.; Shiao, Tze Chieh; Vzina, Amlie; Annabi, Borhane; Roy, Ren; Sleno, Lekha
Rapid Communications in Mass Spectrometry, 2015 , vol. 29, # 18 p. 1632 1640 Title/Abstract Full Text View citing articles Show Details
UPLC (Ultra performance liquid chromatography)
He, Bosai; Bi, Kaishun; Jia, Ying; Wang, Jiahong; Lv, Chunxiao; Liu, Ran; Zhao, Longshan; Xu, Huarong; Chen, Xiaohui; Li, Qing
Journal of Mass Spectrometry, 2013 , vol. 48, # 8 p. 969 - 978 Title/Abstract Full Text View citing articles Show Details
Rangiah, Kannan; Palakodeti, Dasaradhi
Rapid Communications in Mass Spectrometry, 2013 , vol. 27, # 21 p. 2439 2452 Title/Abstract Full Text View citing articles Show Details
Pan, Yilin; Li, Jin; Li, Xiang; Chen, Jianwei; Bai, Ganggang
Bulletin of the Korean Chemical Society, 2014 , vol. 35, # 1 p. 197 - 203 Title/Abstract Full Text View citing articles Show Details
Compressibility (1) Description (Compressibility)
Comment (Compressibility)
Reference
Adiabatic compressibility
temperature dependence
Likhodi, Olga; Chalikian, Tigran V.
Journal of the American Chemical Society, 2000 , vol. 122, # 33 p. 7860 - 7868 Title/Abstract Full Text View citing articles Show Details
Conformation (1) Object of Investigation
Reference
Conformation
Dobson; Gerkin
Acta Crystallographica, Section C: Crystal Structure Communications, 1996 , vol. 52, # pt 12 p. [d]3075-3078 Title/Abstract Full Text View citing articles Show Details
De Vries, Elise J. C.; Levendis, Demetrius C.; Reece, Hayley A.
CrystEngComm, 2011 , vol. 13, # 10 p. 3334 - 3337 Title/Abstract Full Text View citing articles Show Details
Crystal Phase (8) Description (Crystal Phase)
Comment (Crystal Phase)
Reference
Crystal structure determination
a=11.96 Angstroem, c=15.28 Angstroem, n=16. Temperature: 296 K. Method of determination: Single Crystal X-ray Diffraction
Dobson; Gerkin
Acta Crystallographica, Section C: Crystal Structure Communications, 1996 , vol. 52, # pt 12 p. [d]3075-3078 Title/Abstract Full Text View citing articles Show Details
Crystal structure determination
β=110.6 grad, a=8.21 Angstroem, b=10 Angstroem, c=7.21 Angstroem. Temperature: 122 K. Method of determination: Neutron Diffraction
Weber, Hans-Peter; Craven, B. M.; McMullan, R. K.; Nowell, I. W.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 360 - 366 Title/Abstract Full Text Show Details
Crystal structure determination
β=110.6 grad, a=8.22 Angstroem, b=10.01 Angstroem, c=7.21 Angstroem, n=4. Temperature: 122 C. Method of determination: X-ray Diffraction
Craven, B.M.; Weber, H.-P.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 743 - 748 Title/Abstract Full Text Show Details
Interplanar spacing
Weber, Hans-Peter; Craven, B. M.; McMullan, R. K.; Nowell, I. W.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 360 - 366 Title/Abstract Full Text Show Details
Solid state structure properties
Warner; Steward
Journal of Molecular Structure, 1975 , vol. 25, p. 403,407 Full Text Show Details
Crystal structure determination
.
Crowfoot-Hodkin;Cowan; zit. bei Synge
Biochemical Journal, 1951 , vol. 48, p. 429,432 Full Text Show Details
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2038 Full Text Show Details
Crystal structure determination
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2038 Full Text Show Details
Tomita et al.
Bulletin of the Chemical Society of Japan, 1973 , vol. 46, p. 2199,2203 Full Text Show Details
Crystal structure determination
dimorph.
Crowfoot-Hodkin;Cowan; zit. bei Synge
Biochemical Journal, 1951 , vol. 48, p. 429,432 Full Text Show Details
Crystal Property Description (2) Colour & Other Properties
Reference
white
Cook, Matthew C.; Witherell, Ross D.; White, Robert L.
Letters in Drug Design and Discovery, 2010 , vol. 7, # 1 p. 9 - 13 Title/Abstract Full Text View citing articles Show Details
Ma, Shutao; Jiao, Bo; Ju, Yongjing; Zheng, Manjie; Ma, Ruixin; Liu, Lin; Zhang, Ling; Shen, Xuecui; Ma, Chenchen; Meng, Ya; Wang, Hui; Qi, Yunkun; Ma, Xiaodong; Cui, Wenping
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 2 p. 556 - 566 Title/Abstract Full Text View citing articles Show Details
Prismen
Abderhalden; Kautzsch
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1912 , vol. 81, p. 297 Full Text Show Details
Crystal System (2) Crystal System
Reference
tetragonal
Crowfoot-Hodkin;Cowan; zit. bei Synge
Biochemical Journal, 1951 , vol. 48, p. 429,432 Full Text Show Details
Dobson; Gerkin
Acta Crystallographica, Section C: Crystal Structure Communications, 1996 , vol. 52, # pt 12 p. [d]3075-3078 Title/Abstract Full Text View citing articles Show Details
monoclinic
Crowfoot-Hodkin;Cowan; zit. bei Synge
Biochemical Journal, 1951 , vol. 48, p. 429,432 Full Text Show Details
Weber, Hans-Peter; Craven, B. M.; McMullan, R. K.; Nowell, I. W.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 360 - 366 Title/Abstract Full Text Show Details
Craven, B.M.; Weber, H.-P.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 743 - 748 Title/Abstract Full Text Show Details
Decomposition (1) Reference Takeuchi,S.; Yonehara,H.
Journal of Antibiotics, Series A, 1961 , vol. XIV, # 1 p. 44 - 53 Full Text View citing articles Show Details
Dielectric Constant (1) Reference Pottel et al.
Berichte der Bunsen-Gesellschaft, 1975 , vol. 79, p. 278,279,281,282,284 Full Text Show Details
Edward; Farrell; Job
Journal of the American Chemical Society, 1974 , vol. 96, # 3 p. 902 - 906 Title/Abstract Full Text View citing articles Show Details
Edward et al.
Journal of Physical Chemistry, 1973 , vol. 77, p. 2191,2194 Full Text Show Details
Dissociation Exponent (50) Dissociation Exponent (pK)
Dissociation Group
Temperature (Dissociation Exponent)
Solvent (Dissociation Exponent)
Method (Dissociation Exponent)
Type (Dissociation Exponent)
Location
Comment (Dissociation Exponent)
Reference
-4.69
25.04 °C
water methanol
potentiometric
b2/apparent
supporting information
DE
Bernier, Nicolas; Esteves, Catarina V.; Delgado, Rita
Tetrahedron, 2012 , vol. 68, # 24 p. 4860 4868 Title/Abstract Full Text View citing articles Show Details
-9.93
25.04 °C
water methanol
potentiometric
b1/apparent
supporting information
DE
Bernier, Nicolas; Esteves, Catarina V.; Delgado, Rita
Tetrahedron, 2012 , vol. 68, # 24 p. 4860 4868 Title/Abstract Full Text View citing articles Show Details
4.44
-COOH
H2O
a1/apparent
Garcia-Acosta, Beatriz; Martinez-Manez, Ramon; Ros-Lis, Jose V.; Sancenon, Felix; Soto, Juan
Tetrahedron Letters, 2008 , vol. 49, # 12 p. 1997 - 2001 Title/Abstract Full Text View citing articles Show Details
-1.02776 -1.00647
N(1+)-H
10 - 37 °C
potentiometric
a1/apparent
Gorostidi, Gerardo R. Echevarria; Castellanos, M. Gabriela; Perez, Piedad Martin; Santos, Jose G.; Blanco, Francisco Garcia
Bulletin of the Chemical Society of Japan, 2003 , vol. 76, # 3 p. 523 - 528 Title/Abstract Full Text Show Details
10.47
35 °C
H2O
a1/apparent
Jelinska, Anna; Zaja, Marianna
Pharmazie, 1996 , vol. 51, # 3 p. 162 - 164 Title/Abstract Full Text View citing articles Show Details
-0.61 - -0.62
COO-H
50 - 125 °C
H2O
b1/apparent
Wang, Peiming; Oscarson, John L.; Gillespie, Sue E.; Izatt, Reed M.; Cao, Hongjie
Journal of Solution Chemistry, 1996 , vol. 25, # 3 p. 243 - 266 Title/Abstract Full Text View citing articles Show Details
10.37
NH2
24.9 °C
H2O
potentiometric
a2/apparent
Mossine; Glinsky; Feather
Carbohydrate Research, 1994 , vol. 262, # 2 p. 257 - 270 Title/Abstract Full Text View citing articles Show Details
4.07
COOH
24.9 °C
H2O
potentiometric
a1/apparent
Mossine; Glinsky; Feather
Carbohydrate Research, 1994 , vol. 262, # 2 p. 257 - 270 Title/Abstract Full Text View citing articles Show Details
4.09 - 4.24
25 °C
H2O various solvent(s)
potentiometric
a1/apparent
Brandariz, I.; Fiol, S.; Herrero, R.; Vilarino, T.; Vicente, M. Sastre de
Journal of Chemical & Engineering Data, 1993 , vol. 38, # 4 p. 531 - 533 Title/Abstract Full Text View citing articles Show Details
10.36 - 10.38
25 °C
H2O various solvent(s)
potentiometric
a2/apparent
Brandariz, I.; Fiol, S.; Herrero, R.; Vilarino, T.; Vicente, M. Sastre de
Journal of Chemical & Engineering Data, 1993 , vol. 38, # 4 p. 531 - 533 Title/Abstract Full Text View citing articles
Show Details
-0.61
COOH
25 °C
H2O
potentiometric
a1/apparent
Fini; De Maria; Guarnieri; Varoli
Journal of Pharmaceutical Sciences, 1987 , vol. 76, # 1 p. 48 - 52 Title/Abstract Full Text View citing articles Show Details
-0.85
COOH
25 °C
dimethylsulfoxide H2O
potentiometric
a1/apparent
Ratio of solvents: 80percent w/w
Fini; De Maria; Guarnieri; Varoli
Journal of Pharmaceutical Sciences, 1987 , vol. 76, # 1 p. 48 - 52 Title/Abstract Full Text View citing articles Show Details
4.25
-NH3(1+)
25 °C
a1/apparent
Bismondo, Arturo; Rizzo, Luigi; Di Bernardo, Plinio; Zanonato, Pier Luigi
Journal of the Chemical Society, Dalton Transactions: Inorganic Chemistry (19721999), 1987 , p. 695 - 698 Title/Abstract Full Text View citing articles Show Details
11.2
N-H
25 °C
dimethylsulfoxide
spectrophotometric
a2/apparent
Hughes, David L.; Bergan, James J.; Grabowski, Edward J. J.
Journal of Organic Chemistry, 1986 , vol. 51, # 13 p. 2579 - 2585 Title/Abstract Full Text View citing articles Show Details
9.9
COO-H
25 °C
dimethylsulfoxide
spectrophotometric
a1/apparent
Hughes, David L.; Bergan, James J.; Grabowski, Edward J. J.
Journal of Organic Chemistry, 1986 , vol. 51, # 13 p. 2579 - 2585 Title/Abstract Full Text View citing articles Show Details
9.7
25 °C
methanol H2O
a1/apparent
Ratio of solvents: 90percent
Schmidtchen, F. P.
Journal of Organic Chemistry, 1986 , vol. 51, # 26 p. 5161 - 5168 Title/Abstract Full Text View citing articles Show Details
a1/thermodynamic
Jacobsen; Labouta; Schaumburg; Falch; Krogsgaard-Larsen
Journal of Medicinal Chemistry, 1982 , vol. 25, # 10 p. 1157 - 1162 Title/Abstract Full Text View citing articles Show Details
a2/thermodynamic
Jacobsen; Labouta; Schaumburg; Falch; Krogsgaard-Larsen
Journal of Medicinal Chemistry, 1982 , vol. 25, # 10 p. 1157 - 1162 Title/Abstract Full Text View citing articles Show Details
4.09
COOH
37 °C
H2O
potentiometric
a1/apparent
Nair, M. Sivasankaran; Santappa, M.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1981 , vol. 20, # 10 p. 990 - 993 Title/Abstract Full Text Show Details
10.15
NH3(+)
37 °C
H2O
potentiometric
a2/apparent
Nair, M. Sivasankaran; Santappa, M.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1981 , vol. 20, # 10 p. 990 - 993 Title/Abstract Full Text Show Details
Show next 20
Hide facts
Dissociation Exponent (pK)
Dissociation Group
Temperature (Dissociation Exponent)
Solvent (Dissociation Exponent)
Method (Dissociation Exponent)
Type (Dissociation Exponent)
4.04
COOH
30 °C
H2O
potentiometric
a1/apparent
Comment (Dissociation Exponent)
Reference Ramanujam, V. V.; Rengaraj, K.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1980 , vol. 19, # 4 p. 382 - 384 Title/Abstract Full Text Show Details
10.26
NH3(+)
30 °C
H2O
potentiometric
a2/apparent
Ramanujam, V. V.; Rengaraj, K.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1980 , vol. 19, # 4 p. 382 - 384 Title/Abstract Full Text Show Details
(pk')p(K1),p(K2) in Wasser und DMSO (Tab.I); Δp(K) : Substitutionseffekt auf pK (Tab.II); p(K)(COOH) bei versch. Wasser/DMSO Mischungen (Fig.1)
Edward et al.
Journal of Organic Chemistry, 1979 , vol. 44, p. 615 Full Text View citing articles Show Details
(pk')pK(dis.)
Zaionts
Pharmaceutical Chemistry Journal, 1979 , vol. 13, # 11 p. 1112,1114,1117 Khimiko-Farmatsevticheskii Zhurnal, 1979 , vol. 13, # 11 p. 10 Full Text View citing articles Show Details
4
20 °C
H2O
potentiometric
a1/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
4.01
30 °C
H2O
potentiometric
a1/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
4.01
40 °C
H2O
potentiometric
a1/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
4.03
10 °C
H2O
potentiometric
a1/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
4.04
25 °C
H2O
potentiometric
a1/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
10.19
40 °C
H2O
potentiometric
a2/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
10.45
30 °C
H2O
potentiometric
a2/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
10.62
25 °C
H2O
potentiometric
a2/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
10.78
20 °C
H2O
potentiometric
a2/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
11.07
10 °C
H2O
potentiometric
a2/apparent
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
(k')in Methanol, Wasser
Chattopadhyay; Lahiri
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical and Analytical, 1977 , vol. 15, p. 930 Full Text Show Details
(k')in Ethanol, Wasser
Chattopadhyay; Lahiri
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical and Analytical, 1977 ,
vol. 15, p. 930 Full Text Show Details
(pk')pK(1), pK(2) berechnet aus NMR
Kostromina et al.
Theoretical and Experimental Chemistry, 1975 , vol. 11, p. 469,471 Full Text Show Details
(k')pK(a)
Means et al.
Biochemistry, 1972 , vol. 11, p. 3564,3566 Full Text Show Details
(pk')pK(a)
Yalkowsky; Zografi
Journal of pharmaceutical sciences, 1970 , vol. 59, # 6 p. 798 - 802 Title/Abstract Full Text View citing articles Show Details
Fujiwara et al.
Bulletin of the Chemical Society of Japan, 1971 , vol. 44, p. 1984 Full Text Show Details
(pk')pK
Alner et al.
Journal of the Chemical Society [Section] A: Inorganic, Physical, Theoretical, 1968 , p. 417,420 Full Text Show Details
(pk')pK(A') 4.14
Smirnova,A.A. et al.
Zhurnal Organicheskoi Khimii, 1968 , vol. 4, p. 2245 - 2255,2166 - 2174 Full Text View citing articles Show Details
(pk')pK(A'') 10.55
Smirnova,A.A. et al.
Zhurnal Organicheskoi Khimii, 1968 , vol. 4, p. 2245 - 2255,2166 - 2174 Full Text View citing articles Show Details
(pk')pK(A)
Stark
Biochemistry, 1965 , vol. 4, p. 1030 Full Text View citing articles Show Details
(k')Basendissoziationskonstante
Sieskind
Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences, 1960 , vol. 250, p. 2228,2230 Full Text Show Details
4.06
10 °C
H2O
potentiometric
a1/thermodynamic
King
Journal of the American Chemical Society, 1954 , vol. 76, p. 1006 Full Text View citing articles Show Details
11.03
10 °C
H2O
potentiometric
a2/thermodynamic
King
Journal of the American Chemical Society, 1954 , vol. 76, p. 1006 Full Text View citing articles Show Details
4.03
50 °C
H2O
potentiometric
a1/thermodynamic
King
Journal of the American Chemical Society, 1954 , vol. 76, p. 1006 Full Text View citing articles Show Details
9.87
50 °C
H2O
potentiometric
a2/thermodynamic
King
Journal of the American Chemical Society, 1954 , vol. 76, p. 1006 Full Text View citing articles Show Details
4.23
CO2H
25 °C
H2O
potentiometric
apparent
Neuberger
Biochemical Journal, 1936 , vol. 30, p. 2091 Proceedings of the Royal Society of London, Series A: Mathematical, Physical and Engineering Sciences, vol. 158, p. 93 Full Text Show Details
10.43
NH3+
25 °C
H2O
potentiometric
apparent
Neuberger
Biochemical Journal, 1936 , vol. 30, p. 2091 Proceedings of the Royal Society of London, Series A: Mathematical, Physical and Engineering
Sciences, vol. 158, p. 93 Full Text Show Details
Electrical Data (2) Description (Electrical Data)
Reference
Dielectric anisotropy
Lertes et al.
Zeitschrift fuer Naturforschung, Teil A: Astrophysik, Physik und Physikalische Chemie, 1966 , vol. 21, p. 1315 Full Text Show Details
Electrical conductivity
Ley
Chemische Berichte, 1909 , vol. 42, p. 367 Full Text Show Details
Electrical Moment (4) Description (Electrical Moment)
Moment (Electrical Moment)
Dipole moment
Method (Electrical Moment)
Solvent (Electrical Moment)
Comment (Electrical Moment)
13 D
Craven, B.M.; Weber, H.-P.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 743 - 748 Title/Abstract Full Text Show Details
Dipole moment
Warner; Steward
Journal of Molecular Structure, 1975 , vol. 25, p. 403,407 Full Text Show Details
Hartmann et al.
Zeitschrift fuer Naturforschung, Teil A: Astrophysik, Physik und Physikalische Chemie, 1967 , vol. 22, p. 2118 Full Text Show Details
Dipole moment
in H2O/ NaCl (Loesung) (Tab. IV)
Schrier; Robinson
The Journal of biological chemistry, 1971 , vol. 246, # 9 p. 2870 - 2874 Title/Abstract Full Text View citing articles Show Details
Dipole moment
17.6 D
Dielectric constant (ε)
H2O
Jatkar; Iyengar
Journal of the Indian Institute of Science, Section A, 1949 , vol. 31, p. 15,21 Full Text Show Details
Reference
Electrochemical Behaviour (8) Description (Electrochemical Behaviour) Electrolytic dissociation / protonation equilibrium
Comment (Electrochemical Behaviour)
Reference Katz; Miller
Journal of Physical Chemistry, 1972 , vol. 76, p. 2778 Full Text View citing articles Show Details
Schmidtchen, F. P.
Journal of Organic Chemistry, 1986 , vol. 51, # 26 p. 5161 - 5168 Title/Abstract Full Text View citing articles Show Details
Bismondo, Arturo; Rizzo, Luigi; Di Bernardo, Plinio; Zanonato, Pier Luigi
Journal of the Chemical Society, Dalton Transactions: Inorganic Chemistry (1972-1999), 1987 , p. 695 - 698 Title/Abstract Full Text View citing articles Show Details
Jacobsen; Labouta; Schaumburg; Falch; Krogsgaard-Larsen
Journal of Medicinal Chemistry, 1982 , vol. 25, # 10 p. 1157 - 1162 Title/Abstract Full Text View citing articles Show Details
Nair, M. Sivasankaran; Santappa, M.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1981 , vol. 20, # 10 p. 990 - 993 Title/Abstract Full Text Show Details
Kimura, Eiichi; Fujioka, Haruto; Kodama, Mutsuo
Journal of the Chemical Society, Chemical Communications, 1986 , # 15 p. 1158 - 1159 Title/Abstract Full Text View citing articles Show Details
Satzinger
Arzneimittel-Forschung/Drug Research, 1994 , vol. 44, # 3 p. 261 - 266 Title/Abstract Full Text View citing articles Show Details
Ramanujam, V. V.; Rengaraj, K.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1980 , vol. 19, # 4 p. 382 - 384 Title/Abstract Full Text Show Details
Jelinska, Anna; Zaja, Marianna
Pharmazie, 1996 , vol. 51, # 3 p. 162 - 164 Title/Abstract Full Text View citing articles Show Details
Barczynski; Dega-Szafran; Dulewicz; Petryna; Szafran
Polish Journal of Chemistry, 2000 , vol. 74, # 8 p. 1149 - 1161
Title/Abstract Full Text View citing articles Show Details
Enthalpy of dissociation (electrolytic) / protonation
Wang, Peiming; Oscarson, John L.; Gillespie, Sue E.; Izatt, Reed M.; Cao, Hongjie
Journal of Solution Chemistry, 1996 , vol. 25, # 3 p. 243 - 266 Title/Abstract Full Text View citing articles Show Details
Volume change on dissociation
Lepori, Luciano; Mollica, Vincenzo
Zeitschrift fuer Physikalische Chemie (Muenchen, Germany), 1980 , vol. 123, p. 51 - 66 Title/Abstract Full Text Show Details
Electrochemical properties
Kelley; Lilley
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1978 , vol. 74, p. 2771,2773-2775 Full Text Show Details
Polarography
Fujiwara et al.
Bulletin of the Chemical Society of Japan, 1971 , vol. 44, p. 1984 Full Text Show Details
Thermodynamic parameters for dissociation / protonation
Christensen et al.
Journal of the American Chemical Society, 1968 , vol. 90, p. 5949 Full Text View citing articles Show Details
Electrolytic dissociation / protonation equilibrium
(H2SO4).
O'Brien; Niemann
Journal of the American Chemical Society, 1951 , vol. 73, p. 4264,4266 Full Text Show Details
Enthalpy of neutralization
Devoto
Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti, 1934 , vol. <6> 19, p. 50 Full Text Show Details
Energy Data (MCS) (4) Description (Energy Data (MCS))
Partner (Energy Data (MCS))
Temperature (Energy Data (MCS))
Enthalpy of dilution
H2O
25 °C
Castronuovo, Giuseppina; Elia, Vittorio; Velleca, Filomena
Journal of the Chemical Society - Faraday Transactions, 1996 , vol. 92, # 17 p. 3093 - 3096 Title/Abstract Full Text View citing articles Show Details
Thermodynamic properties of system with
Larson et al.
Journal of Physical Chemistry, 1977 , vol. 81, p. 2074 Full Text View citing articles Show Details
Enthalpy of solution
Prasad; Ahluwalia
Journal of Solution Chemistry, 1976 , vol. 5, p. 491,494, 496 Full Text View citing articles Show Details
Heat capacity of mixtures
Prasad; Ahluwalia
Journal of Solution Chemistry, 1976 , vol. 5, p. 491,494, 496 Full Text View citing articles Show Details
Reference
Enthalpy of Combustion (1) Enthalpy of Combustion
Temperature (Enthalpy of Combustion)
Reference
-2.28181E+06 Jmol-1
25 °C
Contineanu, Iulia; Marchidan, Dumitru I.
Revue Roumaine de Chimie, 1994 , vol. 39, # 12 p. 1391 - 1395 Title/Abstract Full Text Show Details
Enthalpy of Formation (2) Enthalpy of Formation
Temperature (Enthalpy of Formation)
Comment (Enthalpy of Formation)
Reference
Enthalpy of formation given
Lytkin; Chernikov; Krutova; Skvortsov; Korchagina
Russian Journal of Physical Chemistry A, 2016 , vol. 90, # 9 p. 1782 - 1784 Zh. Fiz. Khim., 2016 , vol. 90, # 9 p. 1350 - 1353,4 Title/Abstract Full Text View citing articles Show Details
134000 Jmol-1
25 °C
Contineanu, Iulia; Marchidan, Dumitru I.
Revue Roumaine de Chimie, 1994 , vol. 39, # 12 p. 1391 - 1395 Title/Abstract Full Text Show Details
Enthalpy of Fusion (1) Comment (Enthalpy of Fusion)
Reference
Enthalpy of melting given
Dichi, Emma; Sghaier, Mehrez; Fraisse, Bernard; Bonhomme, Francois
Chemical and Pharmaceutical Bulletin, 2011 , vol. 59, # 6 p. 703 - 709 Title/Abstract Full Text View citing articles Show Details
Further Information (25) Description (Further Information)
Reference
Further information
Honore; Hjeds
European Journal of Medicinal Chemistry, 1979 , vol. 14, # 3 p. 285 - 287 Title/Abstract Full Text View citing articles Show Details
Further information
Weinkam,R.J.
Journal of Organic Chemistry, 1978 , vol. 43, p. 2581 - 2586 Full Text View citing articles Show Details
Further information
Latosh et al.
J. Gen. Chem. USSR (Engl. Transl.), 1978 , vol. 48, p. 2287,2076 Full Text Show Details
Further information
Ahluwalia et al.
Canadian Journal of Chemistry, 1977 , vol. 55, p. 3364 Full Text Show Details
Further information
Peters et al.
Phytochemistry (Elsevier), 1974 , vol. 13, p. 2383,2385 Full Text Show Details
Further information
Kukalenko et al.
Zhurnal Organicheskoi Khimii, 1973 , vol. 9, p. 1401,1430 Full Text Show Details
Further information
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2825,2826 Full Text Show Details
Further information
Kitaoka; Nakano
Journal of Biochemistry (Tokyo, Japan), 1969 , vol. 66, p. 87,91 Full Text Show Details
Further information
Muenze et al.
Zeitschrift fuer Physikalische Chemie (Leipzig), 1969 , vol. 241, p. 240 Full Text Show Details
Further information
Kozak et al.
Journal of Chemical Physics, 1968 , vol. 48, p. 675,686 Full Text Show Details
Further information
Kornhauser; Keglevic
Croatica Chemica Acta, 1967 , vol. 39, p. 285,287 Full Text Show Details
Further information
Hartmann et al.
Zeitschrift fuer Naturforschung, Teil A: Astrophysik, Physik und Physikalische Chemie, 1967 , vol. 22, p. 2118 Full Text Show Details
Further information
Mangyo
Seikagaku, 1964 , vol. 36, p. 756 Chem.Abstr., 1965 , vol. 62, # 11680d Full Text View citing articles Show Details
Further information
Zacharius; Talley
Analytical Chemistry, 1962 , vol. 34, p. 1551 Full Text View citing articles Show Details
Further information
Kolasow et al.
Zhurnal Fizicheskoi Khimii, 1962 , vol. 36, p. 770,775 p. 400 Full Text Show Details
Further information
Kirchenmayer; Kuffner
Monatshefte fuer Chemie, 1962 , vol. 93, p. 1237,1241 Full Text Show Details
Further information
Wright et al.
Chemistry and Industry (London, United Kingdom), 1961 , p. 1491 Full Text Show Details
Further information
Weiss et al.
Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences, 1960 , vol. 250, p. 1322 Full Text Show Details
Further information
Sekiguchi
Bulletin de la Societe Chimique de France, 1960 , p. 1838 Full Text Show Details
Further information
Werum et al.
Journal of Chromatography, 1960 , vol. 3, p. 125,139 Chem.Abstr., 1960 , # 19089 Full Text Show Details
Hide facts Description (Further Information)
Reference
Further information
Heilbronn; Carlsson
Journal of Chromatography, 1960 , vol. 4, p. 257,258, 259 Chem.Abstr., 1961 , # 5634 Full Text View citing articles Show Details
Further information
Bergner; Petri
Zeitschrift fuer Lebensmittel-Untersuchung und -Forschung, 1960 , vol. 111, p. 319 Chem.Abstr., 1960 , vol. 54, # 13534 Full Text Show Details
Further information
Bergner; Petri
Zeitschrift fuer Lebensmittel-Untersuchung und -Forschung, 1960 , vol. 111, p. 494 Chem.Abstr., 1960 , vol. 54, # 13534 Full Text Show Details
Further information
Linko
Suomen Kemistilehti B, 1960 , vol. 33, p. 145 Full Text Show Details
Further information
Howe
Journal of Chromatography, 1960 , vol. 3, p. 389,390-405 Chem.Abstr., 1961 , vol. 55, # 7267 Full Text Show Details
Heat Capacity Cp (3) Heat Capacity Cp
Temperature (Heat Capacity Cp)
Reference
1.93043 Jmol-1K-1
99.84 °C
Dichi, Emma; Sghaier, Mehrez; Fraisse, Bernard; Bonhomme, Francois
Chemical and Pharmaceutical Bulletin, 2011 , vol. 59, # 6 p. 703 - 709 Title/Abstract Full Text View citing articles Show Details
193.1 Jmol-1K-1
99.84 °C
Dichi, Emma; Sghaier, Mehrez; Fraisse, Bernard; Bonhomme, Francois
Chemical and Pharmaceutical Bulletin, 2011 , vol. 59, # 6 p. 703 - 709 Title/Abstract Full Text View citing articles Show Details
Ahluwalia et al.
Canadian Journal of Chemistry, 1977 , vol. 55, p. 3364 Full Text Show Details
Interatomic Distances and Angles (1) Description
Reference
Interatomic distances and angles
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2038 Full Text Show Details
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2825,2826 Full Text Show Details
Weber, Hans-Peter; Craven, B. M.; McMullan, R. K.; Nowell, I. W.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 360 - 366
Title/Abstract Full Text Show Details
Dobson; Gerkin
Acta Crystallographica, Section C: Crystal Structure Communications, 1996 , vol. 52, # pt 12 p. [d]3075-3078 Title/Abstract Full Text View citing articles Show Details
Isoelectric Point pH (1) Isoelectric Point pH
Reference
7.33
Tsai, Ruey-Shiuan; Testa, Bernard; Tayar, Nabil El; Carrupt, Pierre-Alain
Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999), 1991 , # 11 p. 1797 - 1802 Title/Abstract Full Text View citing articles Show Details
Liquid Phase (1) Description (Liquid Phase)
Reference
Self-association in solution
Zaionts
Pharmaceutical Chemistry Journal, 1979 , vol. 13, # 11 p. 1112,1114,1117 Khimiko-Farmatsevticheskii Zhurnal, 1979 , vol. 13, # 11 p. 10 Full Text View citing articles Show Details
Liquid/Liquid Systems (MCS) (3) Description (Liquid/Liquid Systems (MCS))
Partner (Liquid/Liquid Systems (MCS))
Solvent (Liquid/Liquid Systems (MCS))
Temperature (Liquid/Liquid Systems (MCS))
Solution equilibrium
aq. Na2SO4
concentration dependence. Object(s) of Study: temperature dependence
Ramasami
Journal of Chemical and Engineering Data, 2002 , vol. 47, # 5 p. 1164 - 1166 Title/Abstract Full Text View citing articles Show Details
Distribution between solvent 1 + 2
octanol
various solvent(s)
25 °C
Tsai, Ruey-Shiuan; Testa, Bernard; Tayar, Nabil El; Carrupt, Pierre-Alain
Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999), 1991 , # 11 p. 1797 - 1802 Title/Abstract Full Text View citing articles Show Details
Distribution between solvent 1 + 2
octanol,water
Jacob; Shashoua; Campbell; Baldessarini
Journal of Medicinal Chemistry, 1985 , vol. 28, # 1 p. 106 110 Title/Abstract Full Text View citing articles Show Details
Comment (Liquid/Liquid Systems (MCS))
Reference
Liquid/Vapour Systems (MCS) (2) Description (Liquid/Vapour Systems (MCS))
Solvent (Liquid/Vapour Systems (MCS))
Temperature (Liquid/Vapour Systems (MCS))
Comment (Liquid/Vapour Systems (MCS))
Reference
Activity coefficients of the components in the mixture
Schrier; Robinson
The Journal of biological chemistry, 1971 , vol. 246, # 9 p. 2870 - 2874 Title/Abstract Full Text View citing articles Show Details
Activity coefficients of the components in the mixture
H2O
25 °C
Aus Dampfdruckmessungen berechnete osmotische Koeffizienten und Aktivitaetskoeffizienten.
Smith; Smith
Journal of Biological Chemistry, 1940 , vol. 132, p. 52 Full Text Show Details
Magnetic Susceptibility (1) Magnetic Susceptibility
Reference
-58.3 10-6cm3mol-1
Takahashi; Sakai; Tsuchida
Bulletin of the Chemical Society of Japan, 1993 , vol. 66, # 12 p. 3589 - 3592 Title/Abstract Full Text View citing articles Show Details
Mechanical & Physical Properties (MCS) (21)
Description (Mechanical & Physical Properties (MCS))
Partner (Mechanical & Physical Properties (MCS))
Solvent (Mechanical & Physical Properties (MCS))
Temperature (Mechanical & Physical Properties (MCS))
Comment (Mechanical & Physical Properties (MCS))
Partial molal volume
H2O
14.99 °C
temperature dependence
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Partial molal volume
H2O
24.99 °C
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Partial molal volume
H2O
34.99 °C
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Partial molal volume
aq. Na2SO4
14.99 °C
temperature dependence
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Partial molal volume
aq. Na2SO4
24.99 °C
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Partial molal volume
aq. Na2SO4
34.99 °C
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Adiabatic compressibility
H2O
14.99 °C
temperature dependence
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Adiabatic compressibility
H2O
24.99 °C
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Adiabatic compressibility
H2O
34.99 °C
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Adiabatic compressibility
aq. Na2SO4
14.99 °C
temperature dependence
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Adiabatic compressibility
aq. Na2SO4
24.99 °C
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Adiabatic compressibility
aq. Na2SO4
34.99 °C
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Partial molal volume
guanidine hydrochloride
H2O
15 - 25 °C
Kumar
Journal of the Indian Chemical Society, 1997 , vol. 74, # 8 p. 610 - 612
Reference
Title/Abstract Full Text View citing articles Show Details
Partial molal volume
H2O
25 °C
Chalikian, Tigran V.; Sarvazyan, Armen P.; Breslauer, Kenneth J.
Journal of Physical Chemistry, 1993 , vol. 97, # 49 p. 13017 - 13026 Title/Abstract Full Text View citing articles Show Details
Adiabatic compressibility
H2O
25 °C
Chalikian, Tigran V.; Sarvazyan, Armen P.; Breslauer, Kenneth J.
Journal of Physical Chemistry, 1993 , vol. 97, # 49 p. 13017 - 13026 Title/Abstract Full Text View citing articles Show Details
Partial molal volume
water; ammonium chloride
25 °C
Natarajan; Wadi; Gaur
Journal of Chemical and Engineering Data, 1990 , vol. 35, # 1 p. 87 - 93 Title/Abstract Full Text View citing articles Show Details
Partial molal volume
H2O
30 - 40 °C
Bhattacharya, M. M.; Sengupta, M.
Journal of the Indian Chemical Society, 1985 , vol. 62, p. 959 - 964 Title/Abstract Full Text Show Details
Partial molal volume
H2O, NaOH
30 - 40 °C
Bhattacharya, M. M.; Sengupta, M.
Journal of the Indian Chemical Society, 1985 , vol. 62, p. 959 - 964 Title/Abstract Full Text Show Details
Partial molal volume
H2O, HCl
30 - 40 °C
Bhattacharya, M. M.; Sengupta, M.
Journal of the Indian Chemical Society, 1985 , vol. 62, p. 959 - 964 Title/Abstract Full Text Show Details
Virial coefficients
water, or NaOH, or HCl
30 - 40 °C
Bhattacharyya, M. M.; Sengupta, M.
Zeitschrift fuer Physikalische Chemie (Muenchen, Germany), 1982 , vol. 133, p. 79 - 92 Title/Abstract Full Text Show Details
Hide facts Description (Mechanical & Physical Properties (MCS))
Reference
Partial molal volume
Shahidi; Farrell
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1978 , vol. 74, p. 858,860 Full Text Show Details
Mechanical Properties (4) Description (Mechanical Properties)
Comment (Mechanical Properties)
Reference
Molar volume
temperature dependence
Likhodi, Olga; Chalikian, Tigran V.
Journal of the American Chemical Society, 2000 , vol. 122, # 33 p. 7860 - 7868 Title/Abstract Full Text View citing articles Show Details
Molar volume
solvent dependence. Object(s) of Study: temperature dependence. Object(s) of Study: concentration dependence
Kumar
Canadian Journal of Chemistry, 1999 , vol. 77, # 7 p. 1288 - 1294 Title/Abstract Full Text View citing articles Show Details
Viscosity
Devine; Lowe
Journal of the Chemical Society [Section] A: Inorganic, Physical, Theoretical, 1971 , p. 2113 Full Text Show Details
Molar volume
Hargreaves; Kresheck
Journal of Physical Chemistry, 1969 , vol. 73, p. 3249 Full Text View citing articles Show Details
Optics (1)
Description (Optics)
Comment (Optics)
Reference
Diffraction
X-ray diffraction
Wenger, Mazal; Bernstein, Joel
Angewandte Chemie - International Edition, 2006 , vol. 45, # 47 p. 7966 - 7969 Title/Abstract Full Text View citing articles Show Details
Other Thermochemical Data (4) Description (Other Thermochemical Data)
Comment (Other Thermochemical Data)
Heat capacity
Cabani et al.
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1977 , vol. 73, p. 476,478 Full Text Show Details
Thermodynamic properties
Abraham; Grellier
Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999), 1975 , p. 1856 Full Text Show Details
Entropy
King
Journal of the American Chemical Society, 1954 , vol. 76, p. 1006 Full Text View citing articles Show Details
Enthalpy
der Dissoziation bei 25grad.
King
Journal of the American Chemical Society, 1954 , vol. 76, p. 1006 Full Text View citing articles Show Details
Reference
Solubility (MCS) (4) Temperature (Solubility (MCS))
Solvent (Solubility (MCS))
Comment (Solubility (MCS))
Reference
in pure solvent
15 °C
H2O
Solubility: 91.29 p(g/100g solution)
Ramasami
Journal of Chemical and Engineering Data, 2002 , vol. 47, # 5 p. 1164 1166 Title/Abstract Full Text View citing articles Show Details
in pure solvent
25 °C
H2O
Solubility: 97.08 p(g/100g solution)
Ramasami
Journal of Chemical and Engineering Data, 2002 , vol. 47, # 5 p. 1164 1166 Title/Abstract Full Text View citing articles Show Details
in pure solvent
35 °C
H2O
Solubility: 106.19 p(g/100g solution)
Ramasami
Journal of Chemical and Engineering Data, 2002 , vol. 47, # 5 p. 1164 1166 Title/Abstract Full Text View citing articles Show Details
25 °C
H2O
1 g solvent dissolves. 1.3 g Substance.
Mason
Journal of the American Chemical Society, 1947 , vol. 69, p. 3001 Full Text Show Details
Saturation
Sound Properties (1) Description (Sound Properties)
Reference
Ultrasonic properties
Applegate; Slutsky; Parker
Journal of the American Chemical Society, 1968 , vol. 90, # 25 p. 6909 - 6913 Title/Abstract Full Text View citing articles Show Details
Space Group (2) Space Group
Reference
110
Dobson; Gerkin
Acta Crystallographica, Section C: Crystal Structure Communications, 1996 , vol. 52, # pt 12 p. [d]3075-3078 Title/Abstract Full Text View citing articles Show Details
4
Craven, B.M.; Weber, H.-P.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 743 - 748 Title/Abstract Full Text Show Details
Transport Phenomena (MCS) (6)
Description (Transport Phenomena (MCS))
Partner (Transport Phenomena (MCS))
Solvent (Transport Phenomena (MCS))
Temperature (Transport Phenomena (MCS))
Viscosity
water
35 °C
Wadi, Ramesh K.; Goyal, Rma Kant
Journal of Solution Chemistry, 1992 , vol. 21, # 2 p. 163 170 Title/Abstract Full Text View citing articles Show Details
Viscosity
potassium thiocyanate
H2O
15 - 35 °C
Wadi, Ramesh K.; Goyal, Rma Kant
Journal of Solution Chemistry, 1992 , vol. 21, # 2 p. 163 170 Title/Abstract Full Text View citing articles Show Details
Viscosity
water; ammonium chloride
25 °C
Natarajan; Wadi; Gaur
Journal of Chemical and Engineering Data, 1990 , vol. 35, # 1 p. 87 - 93 Title/Abstract Full Text View citing articles Show Details
Viscosity
water, or NaOH, or HCl
30 - 40 °C
Bhattacharyya, M. M.; Sengupta, M.
Zeitschrift fuer Physikalische Chemie (Muenchen, Germany), 1982 , vol. 133, p. 79 - 92 Title/Abstract Full Text Show Details
Viscosity
H2O ethanol
21 °C
Parts
Publ.tech.Univ.Tallinn<A>Chem.Abstr., 1939 , # 8 p. 9 Publ.tech.Univ.Tallinn<A>Chem.Abstr., 1940 , p. 4952 Full Text Show Details
Viscosity
H2O
21 °C
Fricke; Parts
Journal of Physical Chemistry, 1938 , vol. 42, p. 1180 Full Text Show Details
Reference
Spectra NMR Spectroscopy (82) Description (NMR Spectroscopy)
Temperature (NMR Spectroscopy)
Frequency (NMR Spectroscopy)
dimethylsulfoxided6 water-d2
1H
water-d2
13C
Chemical shifts
1H
Chemical shifts
HSQC (Heteronuclear Single Quantum Coherence) Spectrum
Nucleus (NMR Spectroscopy)
Coupling Nuclei
Solvents (NMR Spectroscopy)
Chemical shifts Spectrum
1H
Chemical shifts
1H
Chemical shifts
Location
Reference
supporting information
Skowron, Pierre-Thomas; Dumartin, Melissa; Jeamet, Emeric; Perret, Florent; Gourlaouen, Christophe; Baudouin, Anne; Fenet, Bernard; Naubron, Jean-Valère; Fotiadu, Frédéric; Vial, Laurent; Leclaire, Julien
Journal of Organic Chemistry, 2016 , vol. 81, # 2 p. 654 - 661 Title/Abstract Full Text View citing articles Show Details
20 °C
Ryu, Shoraku; Furihata, Kazuo; Koda, Masanori; Wei, Feifei; Miyakawa, Takuya; Tanokura, Masaru
Magnetic Resonance in Chemistry, 2016 , vol. 54, # 3 p. 213 - 221 Title/Abstract Full Text View citing articles Show Details
water-d2
20 °C
Ryu, Shoraku; Furihata, Kazuo; Koda, Masanori; Wei, Feifei; Miyakawa, Takuya; Tanokura, Masaru
Magnetic Resonance in Chemistry, 2016 , vol. 54, # 3 p. 213 - 221 Title/Abstract Full Text View citing articles Show Details
d(4)-methanol
600 MHz
Maraschin, Marcelo; Somensi-Zeggio, Amlia; Oliveira, Simone K.; Kuhnen, Shirley; Tomazzoli, Mara M.; Raguzzoni, Josiane C.; Zeri, Ana C. M.; Carreira, Rafael; Correia, Sara; Costa, Christopher; Rocha, Miguel
Journal of Natural Products, 2016 , vol. 79, # 1 p. 13 - 23 Title/Abstract Full Text View citing articles Show Details
13C
chloroform-d1
150.8 MHz
Maraschin, Marcelo; Somensi-Zeggio, Amlia; Oliveira, Simone K.; Kuhnen, Shirley; Tomazzoli, Mara M.; Raguzzoni, Josiane C.; Zeri, Ana C. M.; Carreira, Rafael; Correia, Sara; Costa, Christopher; Rocha, Miguel
Journal of Natural Products, 2016 , vol. 79, # 1 p. 13 - 23 Title/Abstract Full Text View citing articles Show Details
13C 1H
supporting information
Komatsu, Takanori; Ohishi, Risa; Shino, Amiu; Kikuchi, Jun
Angewandte Chemie - International Edition, 2016 , vol. 55, # 20 p. 6000 - 6003 Angew. Chem., 2016 , vol. 128, p. 6104 - 6107,4 Title/Abstract Full Text View citing articles Show Details
HSQC (Heteronuclear Single Quantum Coherence) Spectrum
13C 1H
water-d2
supporting information
Komatsu, Takanori; Ohishi, Risa; Shino, Amiu; Kikuchi, Jun
Angewandte Chemie - International Edition, 2016 , vol. 55, # 20 p. 6000 - 6003 Angew. Chem., 2016 , vol. 128, p. 6104 - 6107,4 Title/Abstract Full Text View citing articles Show Details
Chemical shifts Spectrum
1H
Paragraph 0033
Shanghai Pharmaceutical on the first biochemical Pharmaceutical Co; Yuan, Yonglei; Ding, Jinguo; Huang, Zhenghui; Li, Yingfei
Patent: CN105669480 A, 2016 ; Title/Abstract Full Text Show Details
Chemical shifts Spectrum
13C
Paragraph 0034
Shanghai Pharmaceutical on the first biochemical Pharmaceutical Co; Yuan, Yonglei; Ding, Jinguo; Huang, Zhenghui; Li, Yingfei
Patent: CN105669480 A, 2016 ; Title/Abstract Full Text Show Details
Spectrum
1H
water-d2 dimethylsulfoxided6
20 °C
600 MHz
Liang, Tingfu; Wei, Feifei; Lu, Yi; Kodani, Yoshinori; Nakada, Mitsuhiko; Miyakawa, Takuya; Tanokura, Masaru
Journal of Agricultural and Food Chemistry, 2015 , vol. 63, # 2 p. 683 - 691 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
1H
d(4)-methanol water-d2
25 °C
600.1 MHz
Zahmanov, Georgi; Alipieva, Kalina; Simova, Svetlana; Georgiev, Milen I.
Phytochemistry Letters, 2015 , vol. 11, p. 404 - 409 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
298 °C
Shumilina, Elena; Ciampa, Alessandra; Capozzi, Francesco; Rustad, Turid; Dikiy, Alexander
Food Chemistry, 2015 , vol. 184, p. 12 - 22 Title/Abstract Full Text View citing articles Show Details
TOCSY (Total Correlation Spectroscopy)
1H 1H
298 °C
Shumilina, Elena; Ciampa, Alessandra; Capozzi, Francesco; Rustad, Turid; Dikiy, Alexander
Food Chemistry, 2015 , vol. 184, p. 12 - 22 Title/Abstract Full Text View citing articles Show Details
HSQC (Heteronuclear Single Quantum Coherence)
1H 13C
water-d2
Alves Filho, Elenilson G.; Sartori, Luci; Silva, Lorena M. A.; Silva, Bianca F.; Fadini, Pedro S.; Soong, Ronald; Simpson, Andre; Ferreira, Antonio G.
Magnetic Resonance in Chemistry, 2015 , vol. 53, # 9 p. 704 - 710 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
25 °C
Chauhan, Anjali; Sharma, Uma; Jagannathan, Naranamangalam R.; Gupta, Yogendra Kumar
European Journal of Pharmacology, 2015 , vol. 757, p. 28 - 33 Title/Abstract Full Text View citing articles Show Details
MAS (Magic-Angle Spinning) Spectrum
1H
700 MHz
Cicero, Nicola; Corsaro, Carmelo; Salvo, Andrea; Vasi, Sebastiano; Giofr, Salvatore V.; Ferrantelli, Vincenzo; Di Stefano, Vita; Mallamace, Domenico; Dugo, Giacomo
Natural Product Research, 2015 , vol. 29, # 20 p. 1894 - 1902 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
d(4)-methanol
25 °C
300 MHz
Scognamiglio, Monica; Fiumano, Vittorio; D'Abrosca, Brigida; Esposito, Assunta; Fiorentino, Antonio; Choi, Young Hae; Verpoorte, Robert
Phytochemistry (Elsevier), 2014 , vol. 106, p. 69 - 85,17 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
water-d2
Rizzuti, Antonino; Aguilera-Sez, Luis Manuel; Gallo, Vito; Cafagna, Isabella; Mastrorilli, Piero; Latronico, Mario; Pacifico, Andrea; Matarrese, Angela Maria Stella; Ferrara, Giuseppe
Food Chemistry, 2014 , vol. 171, p. 341 - 350 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
25 °C
300 MHz
D'Abrosca, Brigida; Scognamiglio, Monica; Fiumano, Vittorio; Esposito, Assunta; Choi, Young Hae; Verpoorte, Robert; Fiorentino, Antonio
Phytochemistry, 2013 , vol. 93, p. 27 - 40 Title/Abstract Full Text View citing articles Show Details
HMBC
1H
25 °C
D'Abrosca, Brigida; Scognamiglio, Monica; Fiumano, Vittorio;
(Heteronuclear Multiple Bond Coherence) Spectrum Show next 20
13C
Esposito, Assunta; Choi, Young Hae; Verpoorte, Robert; Fiorentino, Antonio
Phytochemistry, 2013 , vol. 93, p. 27 - 40 Title/Abstract Full Text View citing articles Show Details
Hide facts
Description (NMR Spectroscopy)
Nucleus (NMR Spectroscopy)
Coupling Nuclei
Solvents (NMR Spectroscopy)
Chemical shifts
13C
Chemical shifts Spectrum
1H
Chemical shifts
Temperature (NMR Spectroscopy)
Frequency (NMR Spectroscopy)
Location
Comment (NMR Spectroscopy)
25 °C
75.5 MHz
D'Abrosca, Brigida; Scognamiglio, Monica; Fiumano, Vittorio; Esposito, Assunta; Choi, Young Hae; Verpoorte, Robert; Fiorentino, Antonio
Phytochemistry, 2013 , vol. 93, p. 27 - 40 Title/Abstract Full Text View citing articles Show Details
26.84 °C
Bhatia, Anil; Bharti, Santosh K.; Tewari, Shri K.; Sidhu, Om P.; Roy, Raja
Phytochemistry, 2013 , vol. 93, p. 105 - 115 Title/Abstract Full Text View citing articles Show Details
1H
24.84 °C
600.1 MHz
Lopez-Rituerto, Eva; Savorani, Francesco; Avenoza, Alberto; Busto, Jesus H.; Peregrina, Jesus M.; Engelsen, Soren Balling
Journal of Agricultural and Food Chemistry, 2012 , vol. 60, # 13 p. 3452 - 3461 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
water-d2
25 °C
Srivastava, Shatakshi; Bisht, Hema; Sidhu; Srivastava, Ashish; Singh; Pandey; Raj; Roy, Raja; Nautiyal
Phytochemistry, 2012 , vol. 80, p. 8 - 16 Title/Abstract Full Text View citing articles Show Details
Spectrum
1H
water-d2
20.34 °C
400 MHz
supporting information
Norcliffe, Jennifer L.; Conway, Louis P.; Hodgson, David R.W.
Tetrahedron Letters, 2011 , vol. 52, # 21 p. 2730 - 2732 Title/Abstract Full Text View citing articles Show Details
Chemical shifts Spectrum
13C
water-d2
21.44 °C
100.6 MHz
supporting information
Norcliffe, Jennifer L.; Conway, Louis P.; Hodgson, David R.W.
Tetrahedron Letters, 2011 , vol. 52, # 21 p. 2730 - 2732 Title/Abstract Full Text View citing articles Show Details
MAS (MagicAngle Spinning) Chemical shifts Spectrum
1H
water-d2
19.84 °C
Bharti; Bhatia, Anil; Tewari; Sidhu; Roy, Raja
Chemical shifts
1H
d(4)-methanol
25 °C
500 MHz
Ali, Kashif; Maltese, Federica; Toepfer, Reinhard; Choi, Young Hae; Verpoorte, Robert
Journal of Biomolecular NMR, 2011 , vol. 49, # 3-4 p. 255 - 266 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
25 °C
600.1 MHz
Namdeo, Ajay G.; Sharma, Ajay; Yadav, Kavita N.; Gawande, Rupali; Mahadik, Kakasaheb R.; Lopez-Gresa, Maria Pilar; Kim, Hye Kyong; Choi, Young Hae; Verpoorte, Robert
Planta Medica, 2011 , vol. 77, # 17 p. 1958 1964 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
chloroform-d1
300 MHz
Malode, Shweta J.; Abbar, Jyothi C.;
Reference
Magnetic Resonance in Chemistry, 2011 , vol. 49, # 10 p. 659 - 667 Title/Abstract Full Text View citing articles Show Details
Nandibewoor, Sharanappa T.
Synthesis and Reactivity in Inorganic, MetalOrganic and Nano-Metal Chemistry, 2010 , vol. 40, # 4 p. 246 - 256 Title/Abstract Full Text View citing articles Show Details
Spectrum
1H
400.5 MHz
Van Eijsden, Pieter; Behar, Kevin L.; Mason, Graeme F.; Braun, Kees P. J.; De Graaf, Robin A.
Journal of Neurochemistry, 2010 , vol. 112, # 1 p. 24 - 33 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
water-d2
250.1 MHz
Cook, Matthew C.; Witherell, Ross D.; White, Robert L.
Letters in Drug Design and Discovery, 2010 , vol. 7, # 1 p. 9 - 13 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
13C
water-d2
62.9 MHz
Cook, Matthew C.; Witherell, Ross D.; White, Robert L.
Letters in Drug Design and Discovery, 2010 , vol. 7, # 1 p. 9 - 13 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
chloroform-d1
Malode, Shweta J.; Abbar, Jyothi C.; Nandibewoor, Sharanappa T.
Inorganica Chimica Acta, 2010 , vol. 363, # 11 p. 2430 - 2442 Title/Abstract Full Text View citing articles Show Details
Chemical shifts Spectrum
1H
400 MHz
Chatterjee, Sandipan; Srivastava, Shatakshi; Khalid, Asna; Singh, Niharika; Sangwan, Rajender Singh; Sidhu, Om Prakash; Roy, Raja; Khetrapal; Tuli, Rakesh
Phytochemistry, 2010 , vol. 71, # 10 p. 1085 1094 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
13C
Yang, Jehoon; Shen, Jun
Journal of Magnetic Resonance, 2007 , vol. 184, # 2 p. 344 - 349 Title/Abstract Full Text View citing articles Show Details
Chatterjee, Sandipan; Srivastava, Shatakshi; Khalid, Asna; Singh, Niharika; Sangwan, Rajender Singh; Sidhu, Om Prakash; Roy, Raja; Khetrapal; Tuli, Rakesh
Phytochemistry, 2010 , vol. 71, # 10 p. 1085 1094 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
20 °C
500 MHz
Wei, Feifei; Furihata, Kazuo; Hu, Fangyu; Miyakawa, Takuya; Tanokura, Masaru
Magnetic Resonance in Chemistry, 2010 , vol. 48, # 11 p. 857 - 865 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
13C
20 °C
125.7 MHz
Wei, Feifei; Furihata, Kazuo; Hu, Fangyu; Miyakawa, Takuya; Tanokura, Masaru
Magnetic Resonance in Chemistry, 2010 , vol. 48, # 11 p. 857 - 865 Title/Abstract Full Text View citing articles Show Details
HSQC (Heteronuclear Single Quantum Coherence) Chemical shifts
1H 13C
20 °C
Wei, Feifei; Furihata, Kazuo; Hu, Fangyu; Miyakawa, Takuya; Tanokura, Masaru
Magnetic Resonance in Chemistry, 2010 , vol. 48, # 11 p. 857 - 865 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
aq. buffer water-d2 d(4)-methanol
25 °C
600.1 MHz
Lopez-Gresa, M. Pilar; Maltese, Federica; Belles, Jose Maria; Conejero, Vicente; Kim, Hye Kyong; Choi, Young Hae; Verpoorte, Robert
Phytochemical Analysis, 2010 , vol. 21, # 1 p. 89 - 94 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
aq. buffer d(4)-methanol water-d2
26.84 °C
500.1 MHz
Broyart, Caroline; Fontaine, Jean-Xavier; Molinie, Roland; Cailleu, Dominique; TerceLaforgue, Therese; Dubois, Frederic; Hirel, Bertrand; Mesnard, Francois
Phytochemical Analysis, 2010 , vol. 21, # 1 p. 102 - 109 Title/Abstract Full Text View citing articles Show Details
MAS (MagicAngle Spinning) Chemical shifts
1H
water-d2
500 MHz
Perez, Estela Maria Sanchez; Iglesias, Maria Jose; Ortiz, Fernando Lopez; Perez, Isidro Sanchez; Galera, Maria Martinez
Food Chemistry, 2010 , vol. 122, # 3 p. 877 887 Title/Abstract Full Text View citing articles Show Details
MAS (MagicAngle Spinning) Chemical shifts
13C
water-d2
125.8 MHz
Perez, Estela Maria Sanchez; Iglesias, Maria Jose; Ortiz, Fernando Lopez; Perez, Isidro Sanchez; Galera, Maria Martinez
Food Chemistry, 2010 , vol. 122, # 3 p. 877 887 Title/Abstract Full Text View citing articles Show Details
Spectrum
1H
water-d2
24.04 °C
400.1 MHz
supporting information
Stensrud, Kenneth; Noh, Jihyun; Kandler, Karl; Wirz, Jakob; Heger, Dominik; Givens, Richard S.
Journal of Organic Chemistry, 2009 , vol. 74, # 15 p. 5219 - 5227 Title/Abstract Full Text View citing articles Show Details
Spectrum
1H
dimethylsulfoxide-d6
24.84 °C
400 MHz
Haldar, Debasish
Tetrahedron, 2008 , vol. 64, # 1 p. 186 - 190 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
D2O
26.84 °C
600.13 MHz
Lamanna, Raffaele; Piscioneri, Ilario; Romanelli, Valeria; Sharma, Neeta
Magnetic Resonance in Chemistry, 2008 , vol. 46, # 9 p. 828 - 831 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
tetradeuteriomethanol
400 MHz
Dekebo, Aman; Kashiwagi, Takehiro; Tebayashi, Shin-Ich; Kim, Chul-Sa
Bioscience, Biotechnology and Biochemistry, 2007 , vol. 71, # 2 p. 421 - 426 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
13C
tetradeuteriomethanol
Dekebo, Aman; Kashiwagi, Takehiro; Tebayashi, Shin-Ich; Kim, Chul-Sa
Bioscience, Biotechnology and Biochemistry, 2007 , vol. 71, # 2 p. 421 - 426 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
D2O tetradeuteriomethanol
25 °C
500.13 MHz
in the presence of inorganic compounds
Abdel-Farid, Ibrahim Bayoumi; Hye, Kyong Kim; Young, Hae Choi; Verpoorte, Robert
Journal of Agricultural and Food Chemistry, 2007 , vol. 55, # 19 p. 7936 - 7943 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
D2O
27 °C
500 MHz
acidic solution
Cazor, Anne; Deborde, Catherine; Moing, Annick; Rolin, Dominique; This, Herve
Journal of Agricultural and Food Chemistry, 2006 , vol. 54, # 13 p. 4681 - 4686 Title/Abstract Full Text View citing articles
Show Details
Chemical shifts
1H
CDCl3
Seregar; Hiremath; Nandibewoor
Zeitschrift fur Physikalische Chemie, 2006 , vol. 220, # 5 p. 615 - 629 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
13C
1 °C
75.38 MHz
in the presence of organic compounds
Yang, YongXia; Chen, Lei; Gao, HongChang; Zeng, DanLin; Yue, Yong; Liu, MaiLi; Lei, Hao; Deng, Feng; Ye, ChaoHui
Magnetic Resonance in Chemistry, 2006 , vol. 44, # 3 SPEC. ISS. p. 263 - 268 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
D2O
26.85 °C
600.13 MHz
in the presence of organic compounds
Sobolev, Anatoli P.; Brosio, Elvino; Gianferri, Raffaella; Segre, Anna L.
Magnetic Resonance in Chemistry, 2005 , vol. 43, # 8 p. 625 - 638 Title/Abstract Full Text View citing articles Show Details
1H
1H
D2O
26.85 °C
600.13 MHz
in the presence of organic compounds
Sobolev, Anatoli P.; Brosio, Elvino; Gianferri, Raffaella; Segre, Anna L.
Magnetic Resonance in Chemistry, 2005 , vol. 43, # 8 p. 625 - 638 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
13C
D2O
26.85 °C
in the presence of organic compounds
Sobolev, Anatoli P.; Brosio, Elvino; Gianferri, Raffaella; Segre, Anna L.
Magnetic Resonance in Chemistry, 2005 , vol. 43, # 8 p. 625 - 638 Title/Abstract Full Text View citing articles Show Details
Spectrum
1H
De Graaf, Robin A.; Rothman, Douglas L.
Journal of Magnetic Resonance, 2001 , vol. 152, # 1 p. 124 - 131 Title/Abstract Full Text View citing articles Show Details
Choi, In-Young; Lee, Sang-Pil; Shen, Jun
Journal of Magnetic Resonance, 2005 , vol. 172, # 1 p. 9 - 16 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
Boberg; Kurz; Ploschke; Schmitt; Scholl; Schuller; Wunsche
Arzneimittel-Forschung/Drug Research, 1990 , vol. 40, # 5 p. 555 - 563 Title/Abstract Full Text View citing articles Show Details
Belton; Delgadillo; Gil; Roma; Casuscelli; Colquhoun; Dennis; Spraul
Magnetic Resonance in Chemistry, 1997 , vol. 35, # SPEC. ISS. p. S52-S60 Title/Abstract Full Text View citing articles Show Details
Delmas, Florence; Beloeil, Jean-Claude; Van der Sanden, Boudewijn P. J.; Nicolay, Klaas; Gillet, Brigitte
Journal of Magnetic Resonance, 2001 , vol. 149, # 1 p. 119 - 125 Title/Abstract Full Text View citing articles Show Details
De Graaf, Robin A.; Rothman, Douglas L.
Journal of Magnetic Resonance, 2001 , vol. 152, # 1 p. 124 - 131 Title/Abstract Full Text View citing articles Show Details
Choi, In-Young; Lee, Sang-Pil; Shen, Jun
Journal of Magnetic Resonance, 2005 , vol. 172, # 1 p. 9 - 16 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
D2O various solvent(s)
30 °C
500 MHz
Nilsson, Mathias; Duarte, Iola F.; Almeida, Claudia; Delgadillo, Ivonne; Goodfellow, Brian J.; Gil, Ana M.; Morris, Gareth A.
Journal of Agricultural and Food Chemistry, 2004 , vol. 52, # 12 p. 3736 - 3743 Title/Abstract Full Text View citing articles Show Details
Spin-lattice relaxation time (T1)
13C
in the presence of electrolytes. Object(s) of Study: pH dependence. Object(s) of Study: in the presence of organic compounds
Tian, Jinping; Yin, Yingwu
Magnetic Resonance in Chemistry, 2004 , vol. 42, # 7 p. 641 - 647 Title/Abstract Full Text View citing articles Show Details
2D-NMR
1H
Second Nucleus: 1H
Delmas, Florence; Beloeil, Jean-Claude; Van der Sanden, Boudewijn P. J.; Nicolay, Klaas; Gillet, Brigitte
Journal of Magnetic Resonance, 2001 , vol. 149, # 1 p. 119 - 125 Title/Abstract Full Text View citing articles Show Details
Faber, Cornelius; Pracht, Eberhard; Haase, Axel
Journal of magnetic resonance (San Diego, Calif. : 1997), 2003 , vol. 161, # 2 p. 265 - 274 Title/Abstract Full Text View citing articles Show Details
Spectrum
1H
dimethylsulfoxide-d6
22 °C
Tsubaki, Kazunori; Tanaka, Hiroyuki; Morikawa, Hiroshi; Fuji, Kaoru
Tetrahedron, 2003 , vol. 59, # 18 p. 3195 3199 Title/Abstract Full Text View citing articles Show Details
1H
1H
De Graaf, Robin A.; Rothman, Douglas L.
Journal of Magnetic Resonance, 2001 , vol. 152, # 1 p. 124 - 131 Title/Abstract Full Text View citing articles Show Details
Spectrum
1H
D2O
23.84 °C
300.137 MHz
Royer; Felpin; Doris
Journal of Organic Chemistry, 2001 , vol. 66, # 19 p. 6487 - 6489 Title/Abstract Full Text View citing articles Show Details
Spectrum
13C
Royer; Felpin; Doris
Journal of Organic Chemistry, 2001 , vol. 66, # 19 p. 6487 - 6489 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
D2O
300 MHz
Royer; Felpin; Doris
Journal of Organic Chemistry, 2001 , vol. 66, # 19 p. 6487 - 6489 Title/Abstract Full Text View citing articles Show Details
1H
1H
D2O
300 MHz
Royer; Felpin; Doris
Journal of Organic Chemistry, 2001 , vol. 66, # 19 p. 6487 - 6489 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
13C
D2O
75 MHz
Royer; Felpin; Doris
Journal of Organic Chemistry, 2001 , vol. 66, # 19 p. 6487 - 6489 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
H2O various solvent(s)
37 °C
400 MHz
Pfeuffer; Tkac; Provencher; Gruetter
Journal of magnetic resonance (San Diego, Calif. : 1997), 1999 , vol. 141, # 1 p. 104 - 120 Title/Abstract Full Text View citing articles Show Details
Spectrum
1H
37 °C
400 MHz
Pfeuffer; Tkac; Provencher; Gruetter
Spin-spin coupling constants
Chemical shifts
1H
Spectrum
Journal of magnetic resonance (San Diego, Calif. : 1997), 1999 , vol. 141, # 1 p. 104 - 120 Title/Abstract Full Text View citing articles Show Details
1H-1H
Belton; Delgadillo; Gil; Roma; Casuscelli; Colquhoun; Dennis; Spraul
Magnetic Resonance in Chemistry, 1997 , vol. 35, # SPEC. ISS. p. S52-S60 Title/Abstract Full Text View citing articles Show Details
CDCl3 tetradeuteriomethanol
De Silva, A. Prasanna; Gunaratne, H. Q. Nimal; McVeigh, Catherine; Maguire, Glenn E. M.; Maxwell, Pamela R. S.; O'Hanlon, Emma
Chemical Communications, 1996 , # 18 p. 2191 - 2192 Title/Abstract Full Text View citing articles Show Details
1H
D2O
Kienlin, Markus von; Moonen, Chrit T. W.; Toorn, Annette van der; Zul, Peter C. M. van
Journal of Magnetic Resonance (19691992), 1991 , vol. 93, # 2 p. 423 - 429 Title/Abstract Full Text View citing articles Show Details
2D-NMR
Kienlin, Markus von; Moonen, Chrit T. W.; Toorn, Annette van der; Zul, Peter C. M. van
Journal of Magnetic Resonance (19691992), 1991 , vol. 93, # 2 p. 423 - 429 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
D2O
Kohama; Matsumoto; Mimura; Tanabe; Inada; Nakanishi
Chemical and Pharmaceutical Bulletin, 1987 , vol. 35, # 6 p. 2484 - 2489 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
1H
various solvent(s)
Ienaga; Higashiura; Kimura
Chemical and pharmaceutical bulletin, 1987 , vol. 35, # 3 p. 1249 - 1254 Title/Abstract Full Text View citing articles Show Details
Spin-spin coupling constants
D2O
1H-1H
Kohama; Matsumoto; Mimura; Tanabe; Inada; Nakanishi
Chemical and Pharmaceutical Bulletin, 1987 , vol. 35, # 6 p. 2484 - 2489 Title/Abstract Full Text View citing articles Show Details
Spin-spin coupling constants
1H-1H. Solvent(s): further solvent(s)
Ienaga; Higashiura; Kimura
Chemical and pharmaceutical bulletin, 1987 , vol. 35, # 3 p. 1249 - 1254 Title/Abstract Full Text View citing articles Show Details
Chemical shifts
13C
D2O
Balaban, Alexandru T.; Dinculescu, Antonie; Elguero, Jose; Faure, Robert
Magnetic Resonance in Chemistry, 1985 , vol. 23, # 7 p. 553 - 558 Title/Abstract Full Text Show Details
Chemical shifts
13C
H2O
26 - 29 °C
Wang; Gilpin
Analytical Chemistry, 1983 , vol. 55, # 3 p. 493 - 497 Title/Abstract Full Text View citing articles Show Details
NMR
Kricheldorf
Organic Magnetic Resonance, 1979 , vol. 12, p. 414,415 Full Text Show Details
Taddei; Pratt
Journal of the Chemical Society, 1964 , p. 1553,1554, 1556, 1558
Full Text Show Details
Eley et al.
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1973 , vol. 69, p. 399,401, 402, 409, 410 Full Text View citing articles Show Details
Armitage et al.
Proceedings of the National Academy of Sciences of the United States of America, 1974 , vol. 71, p. 2096,2097 Full Text Show Details
Jones et al.
Molecular Physics, 1971 , vol. 22, p. 547 Full Text Show Details
Tanaka et al.
Bulletin of the Chemical Society of Japan, 1978 , vol. 51, p. 2654,2656, 2657 Full Text View citing articles Show Details
Schilling; Kricheldorf
Makromolekulare Chemie, 1975 , vol. 176, p. 3341,3345 Full Text Show Details
Hart et al.
Tetrahedron Letters, 1971 , p. 3389 Full Text View citing articles Show Details
Kostromina et al.
Theoretical and Experimental Chemistry, 1975 , vol. 11, p. 469,471 Full Text Show Details
London et al.
Journal of the American Chemical Society, 1978 , vol. 100, p. 3723,3724,3725 Full Text View citing articles Show Details
Hikino et al.
Planta Medica, 1976 , vol. 30, p. 297,301 Full Text Show Details
NMR with shift reagents
Pennington; Cavanaugh
Organic Magnetic Resonance, 1978 , vol. 29, p. 483,489 Full Text Show Details
Chemical shifts
13C chemical shifts (Table 5)
Rabenstein; Sayer
Journal of Magnetic Resonance (19691992), 1976 , vol. 24, p. 27 Full Text View citing articles Show Details
IR Spectroscopy (8) Description (IR Spectroscopy)
Solvent (IR Spectroscopy)
Temperature (IR Spectroscopy)
Comment (IR Spectroscopy)
Bands
Watson
Spectrochimica Acta, 1960 , vol. 16, p. 1322,1323 Full Text Show Details
Hikino et al.
Planta Medica, 1976 , vol. 30, p. 297,301 Full Text Show Details
Mulla; Gurubasavaraj; Nandibewoor
Polish Journal of Chemistry, 2003 , vol. 77, # 12 p. 1833 - 1840 Title/Abstract Full Text View citing articles Show Details
Seregar; Hiremath; Nandibewoor
Zeitschrift fur Physikalische Chemie, 2006 , vol. 220, # 5 p. 615 - 629 Title/Abstract Full Text View citing articles Show Details
Malode, Shweta J.; Abbar, Jyothi C.; Nandibewoor, Sharanappa T.
Synthesis and Reactivity in Inorganic, Metal-Organic and Nano-Metal Chemistry, 2010 , vol. 40, # 4 p. 246 - 256 Title/Abstract Full Text View citing articles Show Details
Malode, Shweta J.; Abbar, Jyothi C.; Nandibewoor, Sharanappa T.
Inorganica Chimica Acta, 2010 , vol. 363, # 11 p. 2430 - 2442 Title/Abstract Full Text View citing articles Show Details
Spectrum
H2O
24.84 °C
Haldar, Debasish
Tetrahedron, 2008 , vol. 64, # 1 p. 186 - 190 Title/Abstract Full Text View citing articles Show Details
Reflection spectrum
Haldar, Debasish
Tetrahedron, 2008 , vol. 64, # 1 p. 186 - 190 Title/Abstract Full Text View citing articles Show Details
Bands
KBr
3040 - 1410 cm**(-1)
Fridman, Ya. D.; Kebets, N. M.; Nanaeva, M. T.; Zurdinov, A. Z.; Sabirova, T. S.; Atarskaya, L. I.
Reference
Pharmaceutical Chemistry Journal, 1989 , vol. 23, # 11 p. 879 - 883 Khimiko-Farmatsevticheskii Zhurnal, 1989 , vol. 23, # 11 p. 1310 - 1313 Title/Abstract Full Text View citing articles Show Details
Bands
KBr
1660 - 1380 cm**(-1)
Kohama; Matsumoto; Mimura; Tanabe; Inada; Nakanishi
Chemical and Pharmaceutical Bulletin, 1987 , vol. 35, # 6 p. 2484 - 2489 Title/Abstract Full Text View citing articles Show Details
Spectrum
Pearson,J.F.; Slifkin,M.A.
Spectrochimica Acta, Part A: Molecular and Biomolecular Spectroscopy, 1972 , vol. 28, p. 2403 - 2417 Full Text View citing articles Show Details
Parker; Kirschenbaum
Spectrochimica Acta, 1960 , vol. 16, p. 910,912 Full Text Show Details
Muecke et al.
Journal fuer Praktische Chemie (Leipzig), 1961 , vol. 12, p. 161,162,167 Full Text Show Details
Huong; Cornut
Journal of Chemical Physics, 1976 , vol. 65, p. 4748 Full Text View citing articles Show Details
IR
Mikhailov et al.
Doklady Physical Chemistry, 1966 , vol. 166-171, p. 689 vol. 170, p. 1364 Full Text Show Details
Moiseev et al.
Russian Journal of Physical Chemistry, 1963 , vol. 37, p. 293,294 p. 570 Full Text Show Details
Takeuchi; Yonehara
Journal of Antibiotics, Series A, 1961 , vol. 14, p. 44,46,51 Full Text Show Details
Huong
Journal de Chimie Physique et de Physico-Chimie Biologique, 1975 , vol. 72, p. 415 Full Text Show Details
Groenewegen; Sachtler
Journal of Catalysis, 1974 , vol. 33, p. 176,178 Full Text Show Details
Spectrum
KBr
3333 - 667 cm**(-1)
Leifer; Lippincott
Journal of the American Chemical Society, 1957 , vol. 79, p. 5098 Full Text View citing articles Show Details
Mass Spectrometry (30) Description (Mass Spectrometry)
Location
Reference
liquid chromatography mass spectrometry (LCMS) spectrum
Cadaha, Estrella; De Simn, Brgida Fernndez; Aranda, Ismael; Sanz, Miriam; Snchez-Gmez, David; Pinto, Ernani
Phytochemical Analysis, 2015 , vol. 26, # 2 p. 171 - 182 Title/Abstract Full Text View citing articles Show Details
Li, Lei; Yu, Xinyu; Qiao, Shanlei; Wang, Di; Dai, Jiayong; Wang, Jun; Zhang, Rutan; Wang, Li
RSC Advances, 2016 , vol. 6, # 31 p. 25751 - 25765 Title/Abstract Full Text View citing articles Show Details
electrospray ionisation (ESI) tandem mass spectrometry liquid chromatography mass spectrometry (LCMS) spectrum
Servillo, Luigi; Giovane, Alfonso; Casale, Rosario; Balestrieri, Maria Luisa; Cautela, Domenico; Paolucci, Marina; Siano, Francesco; Volpe, Maria Grazia; Castaldo, Domenico
Food Chemistry, 2016 , vol. 196, p. 1301 - 1309 Title/Abstract Full Text View citing articles Show Details
electron impact (EI) spectrum
Page/Page column 27; 28
The Samuel Roberts Noble Foundation, Inc.; Li, Wensheng; Uppalapati, Srinivasa Rao; Mysore, Kirankumar S.; Dixon, Richard A.; Sumner, Lloyd W.
Patent: US9238821 B2, 2016 ;
liquid chromatography mass spectrometry (LCMS) tandem mass spectrometry spectrum
Bergh, Marianne Skov-Skov; Bogen, Inger Lise; Lundanes, Elsa; Øiestad, Åse Marit Leere
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2016 , vol. 1028, p. 120 - 129 Title/Abstract Full Text View citing articles Show Details
gas chromatography mass spectrometry
supporting information
Lee, Gyu Min; Suh, Dong Ho; Jung, Eun Sung; Lee, Choong Hwan
Molecules, 2016 , vol. 21, # 7 art. no. 921
Title/Abstract Full Text Show Details
(GCMS) time-of-flight mass spectra (TOFMS) spectrum
Title/Abstract Full Text View citing articles Show Details
electrospray ionisation (ESI) liquid chromatography mass spectrometry (LCMS) tandem mass spectrometry spectrum
Wojnicz, Aneta; Avendaño-Ortiz, José; de Pascual, Ricardo; Ruiz-Pascual, Lucía; García, Antonio G.; Ruiz-Nuño, Ana
Journal of Mass Spectrometry, 2016 , vol. 51, # 8 p. 651 - 664 Title/Abstract Full Text Show Details
electrospray ionisation (ESI) spectrum
Pan, Yilin; Li, Jin; Li, Xiang; Chen, Jianwei; Bai, Ganggang
Bulletin of the Korean Chemical Society, 2014 , vol. 35, # 1 p. 197 - 203 Title/Abstract Full Text View citing articles Show Details
He, Jingjing; Luo, Zhigang; Huang, Lan; He, Jiuming; Chen, Yi; Rong, Xianfang; Jia, Shaobo; Tang, Fei; Wang, Xiaohao; Zhang, Ruiping; Zhang, Jianjun; Shi, Jiangong; Abliz, Zeper
Analytical Chemistry, 2015 , vol. 87, # 10 p. 5372 - 5379 Title/Abstract Full Text View citing articles Show Details
electrospray ionisation (ESI) time-of-flight mass spectra (TOFMS) spectrum
Bingol, Kerem; Bruschweiler-Li, Lei; Yu, Cao; Somogyi, Arpad; Zhang, Fengli; Brüschweiler, Rafael
Analytical Chemistry, 2015 , vol. 87, # 7 p. 3864 - 3870 Title/Abstract Full Text View citing articles Show Details
liquid chromatography mass spectrometry (LCMS) electrospray ionisation (ESI) spectrum
Song, Qingqing; Song, Yuelin; Zhang, Na; Li, Jun; Jiang, Yong; Zhang, Kerong; Zhang, Qian; Tu, Pengfei
RSC Advances, 2015 , vol. 5, # 71 p. 57372 - 57382 Title/Abstract Full Text View citing articles Show Details
tandem mass spectrometry spectrum
Yu, Xinyu; Luo, Jia; Chen, Lijun; Zhang, Chengxiang; Zhang, Rutan; Hu, Qi; Qiao, Shanlei; Li, Lei
RSC Advances, 2015 , vol. 5, # 85 p. 69800 - 69812 Title/Abstract Full Text View citing articles Show Details
CID (collision-induced dissociation) time-of-flight mass spectra (TOFMS) electrospray ionisation (ESI) tandem mass spectrometry spectrum
Naresh Chary; Sudarshana Reddy; Kumar, Ch. Dinesh; Srinivas; Prabhakar
Journal of Mass Spectrometry, 2015 , vol. 50, # 5 p. 771 - 781 Title/Abstract Full Text View citing articles Show Details
liquid chromatography mass spectrometry (LCMS) tandem mass spectrometry time-of-flight mass spectra (TOFMS) high resolution mass spectrometry (HRMS) electrospray ionisation (ESI) spectrum
Wagner, Michel; Ohlund, Leanne B.; Shiao, Tze Chieh; Vzina, Amlie; Annabi, Borhane; Roy, Ren; Sleno, Lekha
Rapid Communications in Mass Spectrometry, 2015 , vol. 29, # 18 p. 1632 - 1640 Title/Abstract Full Text View citing articles Show Details
MALDI (Matrix assisted laser desorption ionization) spectrum
Manier, M. Lisa; Spraggins, Jeffrey M.; Reyzer, Michelle L.; Norris, Jeremy L.; Caprioli, Richard M.
Journal of Mass Spectrometry, 2014 , vol. 49, # 8 p. 665 - 673 Title/Abstract Full Text View citing articles Show Details
gas chromatography mass spectrometry (GCMS) spectrum
Ali, Hatem Salama Mohamed; Alhaj, Omar Amin; Al-Khalifa, Abdulrahman Saleh; Brueckner, Hans
Amino Acids, 2014 , vol. 46, # 9 p. 2241 - 2257 Title/Abstract Full Text View citing articles Show Details
liquid chromatography mass spectrometry (LCMS) APCI (atmospheric pressure chemical ionization) spectrum
supporting information
Raster, Peter; Spaeth, Andreas; Bultakova, Svetlana; Gorostiza, Pau; Koenig, Burkhard; Bregestovski, Piotr
Beilstein Journal of Organic Chemistry, 2013 , vol. 9, p. 406 - 410 Title/Abstract Full Text View citing articles Show Details
liquid chromatography mass spectrometry (LCMS) electrospray ionisation (ESI) fragmentation pattern spectrum
He, Bosai; Bi, Kaishun; Jia, Ying; Wang, Jiahong; Lv, Chunxiao; Liu, Ran; Zhao, Longshan; Xu, Huarong; Chen, Xiaohui; Li, Qing
Journal of Mass Spectrometry, 2013 , vol. 48, # 8 p. 969 - 978 Title/Abstract Full Text View citing articles Show Details
tandem mass spectrometry CID (collision-induced dissociation) electrospray ionisation (ESI) liquid chromatography mass spectrometry (LCMS) spectrum
Rangiah, Kannan; Palakodeti, Dasaradhi
Rapid Communications in Mass Spectrometry, 2013 , vol. 27, # 21 p. 2439 - 2452 Title/Abstract Full Text View citing articles Show Details
TOFMS (Time of flight mass spectrum) Spectrum
Capron, Michael; Diaz-Tendero, Sergio; MacLot, Sylvain; Domaracka, Alicja; Lattouf, Elie; Lawicki, Arkadiusz; Maisonny, Remi; Chesnel, Jean-Yves; Mery, Alain; Poully, Jean-Christophe; Rangama, Jimmy; Adoui, Lamri; Martin, Fernando; Alcami, Manuel; Rousseau, Patrick; Huber, Bernd A.
Chemistry - A European Journal, 2012 , vol. 18, # 30 p. 9321 - 9332 Title/Abstract Full Text View citing articles Show Details
ESI (Electrospray ionisation) Spectrum
Cook, Matthew C.; Witherell, Ross D.; White, Robert L.
Letters in Drug Design and Discovery, 2010 , vol. 7, # 1 p. 9 - 13 Title/Abstract Full Text View citing articles Show Details
CID (collision-induced dissociation) Spectrum
Cook, Matthew C.; Witherell, Ross D.; White, Robert L.
Letters in Drug Design and Discovery, 2010 , vol. 7, # 1 p. 9 - 13 Title/Abstract Full Text View citing articles Show Details
Hide facts Description (Mass Spectrometry)
Comment (Mass Spectrometry)
Reference
LCMS (Liquid chromatography mass spectrometry) ESI (Electrospray ionisation) Negative ion spectroscopy TOFMS (Time of flight mass spectrum) Spectrum
Gomez-Romero, Maria; Segura-Carretero, Antonio; Fernandez-Gutierrez, Alberto
Phytochemistry, 2010 , vol. 71, # 16 p. 1848 - 1864 Title/Abstract Full Text View citing articles Show Details
GCMS (Gas chromatography mass spectrometry) Spectrum
Malode, Shweta J.; Abbar, Jyothi C.; Nandibewoor, Sharanappa T.
Synthesis and Reactivity in Inorganic, Metal-Organic and Nano-Metal Chemistry, 2010 , vol. 40, # 4 p. 246 256 Title/Abstract Full Text View citing articles Show Details
Abbar, Jyothi C.; Malode, Shweta J.; Nandibewoor, Sharanappa T.
Zeitschrift fur Physikalische Chemie, 2010 , vol. 224, # 6 p. 865 - 882 Title/Abstract Full Text View citing articles Show Details
Malode, Shweta J.; Abbar, Jyothi C.; Nandibewoor, Sharanappa T.
Inorganica Chimica Acta, 2010 , vol. 363, # 11 p. 2430 - 2442 Title/Abstract Full Text View citing articles Show Details
spectrum fragmentation pattern photoionization
Kauppila; Nikkola; Ketola; Kostiainen
Journal of Mass Spectrometry, 2006 , vol. 41, # 6 p. 781 - 789 Title/Abstract Full Text View citing articles Show Details
chemical ionization (CI)
Kauppila; Nikkola; Ketola; Kostiainen
Journal of Mass Spectrometry, 2006 , vol. 41, # 6 p. 781 - 789 Title/Abstract Full Text View citing articles Show Details
spectrum
Kohama; Matsumoto; Mimura; Tanabe; Inada; Nakanishi
Chemical and Pharmaceutical Bulletin, 1987 , vol. 35, # 6 p. 2484 - 2489 Title/Abstract Full Text View citing articles Show Details
Parker, Cass D.; Hercules, David M.
Analytical Chemistry, 1985 , vol. 57, # 3 p. 698 - 704 Title/Abstract Full Text View citing articles Show Details
fragmentation pattern electron impact (EI) spectrum
Ermakov, A. I.; Pleshkova, A. P.; Sorokin, A. A.; Skachilova, S. Ya.; Pleshakov, M. G.; Zuev, A. P.
Journal of Organic Chemistry USSR (English Translation), 1985 , vol. 21, # 9 p. 1819 - 1825 Zhurnal Organicheskoi Khimii, 1985 , vol. 21, # 9 p. 1986 - 1993 Title/Abstract Full Text Show Details
laser desorption
Parker, Cass D.; Hercules, David M.
Analytical Chemistry, 1985 , vol. 57, # 3 p. 698 - 704 Title/Abstract Full Text View citing articles Show Details
fragmentation pattern spectrum
laser desorption
Parker, Cass D.; Hercules, David M.
Analytical Chemistry, 1985 , vol. 57, # 3 p. 698 - 704 Title/Abstract Full Text View citing articles Show Details
negative ion spectroscopy
Parker, Cass D.; Hercules, David M.
Analytical Chemistry, 1985 , vol. 57, # 3 p. 698 - 704 Title/Abstract Full Text View citing articles Show Details
Weinkam,R.J.
Journal of Organic Chemistry, 1978 , vol. 43, p. 2581 - 2586 Full Text View citing articles Show Details
Peters et al.
Phytochemistry (Elsevier), 1974 , vol. 13, p. 2383,2385 Full Text Show Details
Tsang; Harrison
Journal of the American Chemical Society, 1976 , vol. 98, p. 1301,1303, 1304, 1307 Full Text View citing articles Show Details
UV/VIS Spectroscopy (2) Description (UV/VIS Spectroscopy)
Solvent (UV/VIS Spectroscopy)
Absorption Maxima (UV/VIS)
Spectrum
aq. buffer
Li, Sheng Yun; Guo, Qiao Lin; Yuan, Wen; Hou, Yu Cui; Du, Li Ming
Bulletin of the Chemical Society of Ethiopia, 2010 , vol. 24, # 1 p. 21 - 30 Title/Abstract Full Text View citing articles Show Details
220 nm 264 nm
Gomez-Romero, Maria; Segura-Carretero, Antonio; Fernandez-Gutierrez, Alberto
Phytochemistry, 2010 , vol. 71, # 16 p. 1848 - 1864 Title/Abstract Full Text View citing articles Show Details
Reference
NQR Spectroscopy (1) Description (NQR Spectroscopy)
Reference
Nuclear quadrupole coupling constants
Hunt; Mackay
Journal of Magnetic Resonance (1969-1992), 1976 , vol. 22, p. 295 Full Text View citing articles Show Details
Raman Spectroscopy (2) Description (Raman Spectroscopy)
Reference
Spectrum
Tanaka et al.
Bulletin of the Chemical Society of Japan, 1978 , vol. 51, p. 2654,2656, 2657 Full Text View citing articles Show Details
Faurshov; Nielsen
Chemical Physics Letters, 1979 , vol. 66, p. 350 Full Text View citing articles Show Details
Raman
Simons et al.
Commentationes Physico-Mathematicae, 1972 , vol. 42, p. 125,141, 142 Chem.Abstr., vol. 77, # 165071b Full Text Show Details
Fluorescence Spectroscopy (1) Description (Fluorescence Spectroscopy)
Reference
Fluorescence
Medici, Rosario; De Maria, Pablo Dominguez; Otten, Linda G.; Straathof, Adrie J. J.
Advanced Synthesis and Catalysis, 2011 , vol. 353, # 13 p. 2369 - 2376 Title/Abstract Full Text View citing articles Show Details
Other Spectroscopic Methods (2) Description (Other Spectroscopic Methods)
Reference
Photoelectron spectrum
Cannington; Ham
Journal of Electron Spectroscopy and Related Phenomena, 1979 , vol. 15, p. 79,82 Chem.Abstr., vol. 90, # 168954 Full Text Show Details
ESCA
Yoshida; Sawada
Bulletin of the Chemical Society of Japan, 1974 , vol. 47, p. 50
Full Text Show Details
Bioactivity Pharmacological Data (992) 1 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Emishpere Technologies, Inc.
Patent: US6346242 B1, 2002 ; Title/Abstract Full Text Show Details
TOKUYAMA CORPORATION
Patent: EP1178043 A1, 2002 ; Title/Abstract Full Text Show Details
ISTITUTO CHIMICO INTERNAZIONALE, DR. GIUSEPPE RENDE S.R.L.
Patent: EP354881 A1, 1990 ; Title/Abstract Full Text Show Details
Veith,H.J. et al.
Helvetica Chimica Acta, 1971 , vol. 54, p. 653 - 680 Full Text View citing articles Show Details
BRITISH TECHNOLOGY GROUP LTD
Patent: EP494754 A1, 1992 ; Title/Abstract Full Text Show Details
Takahashi,H. et al.
Chemical and Pharmaceutical Bulletin, 1979 , vol. 27, # 5 p. 1137 - 1142 Full Text View citing articles Show Details
Edward,J.T. et al.
Canadian Journal of Chemistry, 1978 , vol. 56, p. 1122 - 1129 Full Text View citing articles Show Details
Rosochacka,J.
Roczniki Chemii, 1970 , vol. 44, p. 321 - 327 Full Text View citing articles Show Details
Abbott Laboratories
Patent: US4221706 A1, 1980 ; Title/Abstract Full Text Show Details
Ciba-Geigy Corporation
Patent: US4238481 A1, 1980 ; Title/Abstract Full Text Show Details
Koller,W.; Schlack,P.
Chemische Berichte, 1963 , vol. 96, p. 93 - 113 Full Text View citing articles Show Details
Grigat,E.; Puetter,R.
Chemische Berichte, 1964 , vol. 97, p. 3027 - 3035 Full Text View citing articles Show Details
Ciba-Geigy Corporation
Patent: US4331676 A1, 1982 ; Title/Abstract Full Text Show Details
Kricheldorf,H.R.
Chemische Berichte, 1971 , vol. 104, p. 3146 - 3155 Full Text View citing articles Show Details
Otsuka Pharmaceutical Company, Limited
Patent: US4372953 A1, 1983 ; Title/Abstract Full Text Show Details
Byk Gulden Lomberg Chemische Fabrik GmbH
Patent: US4243678 A1, 1981 ; Title/Abstract Full Text Show Details
Slyusarenko,I.S. et al.
Chemistry of Heterocyclic Compounds (New York, NY, United States), 1973 , vol. 9, p. 441 - 446 Khimiya Geterotsiklicheskikh Soedinenii, 1973 , vol. 9, p. 479 - 485 Full Text View citing articles Show Details
Ono Pharmaceutical Co., Ltd.
Patent: US4446143 A1, 1984 ; Title/Abstract Full Text Show Details
Fawcett,F.S. et al.
Journal of the American Chemical Society, 1962 , vol. 84, p. 4275 - 4285 Full Text View citing articles Show Details
Bruice,T.C.; Benkovic,S.J.
Journal of the American Chemical Society, 1963 , vol. 85, p. 1 - 8 Full Text View citing articles Show Details
2 of 992
Comment
Bioactivities present
(Pharmacological Data) Reference
Abbott Laboratories
Patent: US4476229 A1, 1984 ; Title/Abstract Full Text Show Details
Synthelabo
Patent: US4588748 A1, 1986 ; Title/Abstract Full Text Show Details
Applied Research Systems ARS Holding N.V.
Patent: EP1088822 A1, 2001 ; Title/Abstract Full Text Show Details
Chugai Seiyaku Kabushiki Kaisha
Patent: US5354753 A1, 1994 ; Title/Abstract Full Text Show Details
Ciba-Geigy Corporation
Patent: US4649212 A1, 1987 ; Title/Abstract Full Text Show Details
Syntex (U.S.A.) Inc.
Patent: US4657893 A1, 1987 ; Title/Abstract Full Text Show Details
Koester,R.; Rothgery,E.
Justus Liebigs Annalen der Chemie, 1974 , p. 112 - 119 Full Text View citing articles Show Details
Riker Laboratories, Inc.
Patent: US4698348 A1, 1987 ; Title/Abstract Full Text Show Details
Schnabel,E.
Justus Liebigs Annalen der Chemie, 1967 , vol. 702, p. 188 - 196 Full Text View citing articles Show Details
Takeda Chemical Industries, Ltd.
Patent: EP1211239 A1, 2002 ; Title/Abstract Full Text Show Details Kricheldorf,H.R.
Justus Liebigs Annalen der Chemie, 1971 , vol. 748, p. 101 - 108 Full Text View citing articles Show Details
Nippon Shinyaku Co., Ltd.
Patent: EP1275657 A1, 2003 ; Title/Abstract Full Text Show Details
Kricheldorf,H.R.
Justus Liebigs Annalen der Chemie, 1972 , vol. 763, p. 17 - 38 Full Text View citing articles Show Details
Baker,B.R. et al.
J. Med. Chem., 1964 , vol. 7, p. 24 - 30 Title/Abstract Full Text View citing articles Show Details
Fu,S.-C.J. et al.
Journal of Medicinal Chemistry, 1966 , vol. 9, p. 214 - 216 Full Text View citing articles Show Details
Rich,D.H. et al.
Journal of Medicinal Chemistry, 1975 , vol. 18, p. 1004 - 1010 Title/Abstract Full Text View citing articles Show Details
Rauls; Baker
Journal of Medicinal Chemistry, 1979 , vol. 22, # 1 p. 81 - 86 Title/Abstract Full Text View citing articles Show Details
Alles,G.A. et al.
Journal of Medicinal and Pharmaceutical Chemistry, 1961 , vol. 3, p. 323 - 352 Full Text View citing articles Show Details
E. R. Squibb and Sons, Inc.
Patent: US4722810 A1, 1988 ; Title/Abstract Full Text Show Details
McNeilab, Inc.
Patent: US4742068 A1, 1988 ; Title/Abstract Full Text Show Details
3 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Fujisawa Pharmaceutical Co., Ltd.
Patent: US4767768 A1, 1988 ; Title/Abstract Full Text Show Details
Larsen,P.O.
Acta Chemica Scandinavica (1947-1973), 1962 , vol. 16, p. 1511 - 1518 Full Text View citing articles Show Details
Larsen,P.O.
Acta Chemica Scandinavica (1947-1973), 1965 , vol. 19, p. 1071 - 1078 Full Text View citing articles Show Details
Larsen,P.O.
Acta Chemica Scandinavica (1947-1973), 1967 , vol. 21, p. 1592 - 1604 Full Text View citing articles Show Details
Lectec Corporation
Patent: US5776956 A1, 1998 ; Title/Abstract Full Text Show Details
Synaptic Pharmaceutical Corporation
Patent: US2001/23289 A1, 2001 ; Title/Abstract Full Text Show Details
Yoshikawa,S.; Kim,O.-K.
Bulletin of the Chemical Society of Japan, 1966 , vol. 39, p. 1729 - 1733 Full Text View citing articles Show Details
AJINOMOTO CO., INC.
Patent: US2001/51618 A1, 2001 ; Title/Abstract Full Text Show Details
Kinoshita; Awamura
Bulletin of the Chemical Society of Japan, 1978 , vol. 51, # 3 p. 869 - 871 Title/Abstract Full Text View citing articles Show Details
SANOFI
Patent: US4980349 A1, 1990 ; Title/Abstract Full Text Show Details
Zambon Group S.p.A.
Patent: US4985428 A1, 1991 ; Title/Abstract Full Text Show Details
Roussel Uclaf
Patent: US4990531 A1, 1991 ; Title/Abstract Full Text Show Details
Colonge,J.; Pouchol,J.-M.
Bulletin de la Societe Chimique de France, 1962 , p. 598 - 603 Full Text View citing articles Show Details
The McLean Hospital Corporation
Patent: US5051448 A1, 1991 ; Title/Abstract Full Text Show Details
Nippon Kayaku Kabushiki Kaisha; Takara Shuzo Kabushiki Kaisha
Patent: US5061787 A1, 1991 ; Title/Abstract Full Text Show Details
Schmitz, Robert A.
Patent: US6299892 B1, 2001 ; Title/Abstract Full Text Show Details
Fuji Photo Film Co., Ltd.
Patent: US5436221 A1, 1995 ; Title/Abstract Full Text Show Details
Bordat,C. et al.
Comptes Rendus des Seances de l'Academie des Sciences, Serie C: Sciences Chimiques, 1975 , vol. 281, p. 579 - 582 Full Text View citing articles Show Details
Brown,E. et al.
Comptes Rendus des Seances de l'Academie des Sciences, Serie C: Sciences Chimiques, 1978 , vol. 287, p. 125 - 128 Full Text View citing articles Show Details
The Dow Chemical Company
Patent: US5505931 A1, 1996 ; Title/Abstract Full Text Show Details
4 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Merck and Co., Inc.
Patent: US5527703 A1, 1996 ; Title/Abstract Full Text Show Details
Humphlett,W.J.
Carbohydrate Research, 1968 , vol. 7, p. 431 - 441 Full Text View citing articles Show Details
Daiichi Pharmaceutical Co., Ltd.
Patent: US5559224 A1, 1996 ; Title/Abstract Full Text Show Details
Bayer Aktiengesellschaft
Patent: US5580965 A1, 1996 ; Title/Abstract Full Text Show Details
Krogsgaard-Larsen; Roldskov-Christiansen
European Journal of Medicinal Chemistry, 1979 , vol. 14, # 2 p. 157 - 164 Title/Abstract Full Text View citing articles Show Details
Honore; Hjeds
European Journal of Medicinal Chemistry, 1979 , vol. 14, # 3 p. 285 - 287 Title/Abstract Full Text View citing articles Show Details
Solvay Pharmaceuticals GmbH
Patent: US6040303 A1, 2000 ; Title/Abstract Full Text Show Details
Wako Pure Chemical Industries, Ltd.
Patent: US6049003 A1, 2000 ; Title/Abstract Full Text Show Details
Mehta,R.V. et al.
Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry, 1978 , vol. 16, p. 118 - 123 Full Text View citing articles Show Details
Astra Aktiebolag
Patent: US6117908 A1, 2000 ; Title/Abstract Full Text Show Details
Merck and Co., Inc.
Patent: US5874403 A1, 1999 ; Title/Abstract Full Text Show Details
Austin,A.T.; Howard,J.
Journal of the Chemical Society, 1961 , p. 3284 - 3289 Full Text View citing articles Show Details
Fosker; Law
Journal of the Chemical Society. Perkin transactions 1, 1965 , p. 7305 - 7312 Title/Abstract Full Text View citing articles Show Details
Lamon,R.W.; Humphlett,W.J.
Journal of Heterocyclic Chemistry, 1967 , vol. 4, p. 605 - 609 Full Text View citing articles Show Details
Raasch,M.S.
Journal of Organic Chemistry, 1962 , vol. 27, p. 1406 - 1409 Full Text View citing articles Show Details
Webb,R.G. et al.
Journal of Organic Chemistry, 1969 , vol. 34, # 3 p. 576 - 580 Full Text View citing articles Show Details
Freidlina; Rakhil Khatskelevna; Vasilieva; Tamara Trofimovna; Velichko; Felix Kazimirovich; Terentiev; Alexandr Borisovich
Patent: US4029700 A1, 1977 ; Title/Abstract Full Text Show Details
University of Southern California
Patent: US5232917 A1, 1993 ; Title/Abstract Full Text Show Details
Weinkam,R.J.
Journal of Organic Chemistry, 1978 , vol. 43, p. 2581 - 2586 Full Text View citing articles Show Details
Frankel,M.; Sheradsky,T.
Journal of the Chemical Society [Section] C: Organic, 1967 , p. 2698 - 2699 Full Text View citing articles Show Details
5 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Davies,J.A. et al.
Journal of the Chemical Society [Section] C: Organic, 1969 , p. 1358 - 1363 Full Text View citing articles Show Details
Lion Bioscience AG
Patent: US6458789 B1, 2002 ; Title/Abstract Full Text Show Details
Queen's University at Kingston
Patent: US6468990 B1, 2002 ; Title/Abstract Full Text Show Details
Queen's University at Kingston
Patent: US6492380 B1, 2002 ; Title/Abstract Full Text Show Details
Warner-Lambert Company
Patent: US5620997 A1, 1997 ; Title/Abstract Full Text Show Details
The University of Toledo
Patent: US5639775 A1, 1997 ; Title/Abstract Full Text Show Details
Ito,Y. et al.
Synthetic Communications, 1974 , vol. 4, p. 289 - 295 Full Text View citing articles Show Details
Kricheldorf,H.R.
Synthesis, 1970 , p. 592 - 593
Full Text View citing articles Show Details
Kricheldorf,H.R.; Leppert,E.
Synthesis, 1976 , p. 43 - 45 Full Text View citing articles Show Details
Taisho Pharmaceutical Co., Ltd.
Patent: US5672712 A1, 1997 ; Title/Abstract Full Text Show Details
G. D. Searle and Co.
Patent: US5681820 A1, 1997 ; Title/Abstract Full Text Show Details
Ikemoto, Tomomi; Ito, Tatsuya; Tomimatsu, Kiminori
Patent: US2003/40632 A1, 2003 ; Title/Abstract Full Text Show Details
Alsters, Paul; Bouttemy, Sabine; Schmieder-Van De Vondervoort, Elisabeth; Padron Carillo, Jose
Patent: US2003/45751 A1, 2003 ; Title/Abstract Full Text Show Details
Vianello, Paola; Bandiera, Tiziano; Varasi, Mario
Patent: US2003/69236 A1, 2003 ; Title/Abstract Full Text Show Details
Wise, Alan; Brown, Andrew James
Patent: US2003/113810 A1, 2003 ; Title/Abstract Full Text Show Details
SLIL Biomedical Corporation
Patent: US2003/130356 A1, 2003 ; Title/Abstract Full Text Show Details
PROLIGO, LLC
Patent: US2003/143591 A1, 2003 ; Title/Abstract Full Text Show Details
Amersham plc
Patent: US6534488 B1, 2003 ; Title/Abstract Full Text Show Details
Tufts University
Patent: US2003/162754 A1, 2003 ; Title/Abstract Full Text Show Details
Schorr; Duerckheimer; Klatt; Laemmler; Nesemann; Schrinner
Arzneimittel-Forschung, 1969 , vol. 19, # 11 p. 1807 - 1819 Title/Abstract Full Text View citing articles Show Details
6 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Paulyukonis,A.A.B. et al.
Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation), 1970 , p. 154 - 156 Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya, 1970 , p. 161 - 162 Full Text View citing articles Show Details
Kabachnik,M.I. et al.
Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation), 1978 , vol. 27, p. 374 - 377 Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya, 1978 , vol. 27, p. 433 - 437 Full Text View citing articles Show Details
Fujisawa Pharmaceutical Co., Ltd.
Patent: US6355640 B1, 2002 ; Title/Abstract Full Text Show Details
SHISEIDO COMPANY, LTD.
Patent: WO2003/99327 A1, 2003 ; Title/Abstract Full Text Show Details
The Regents of the University of CA; University of Utah Research Foundation
Patent: US6660846 B1, 2003 ; Title/Abstract Full Text Show Details
Monzani; Di Bella; Ferrari; et al.
Farmaco, Edizione Scientifica, 1979 , vol. 34, # 10 p. 876 - 883 Title/Abstract Full Text View citing articles Show Details
Schneider,F.; Geyer,H.-U.
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1963 , vol. 330, p. 189 - 192 Full Text View citing articles Show Details
Pant,E.
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1964 , vol. 335, p. 272 - 274 Full Text View citing articles Show Details
Weitzel; Renner; Guglielmi
Hoppe-Seyler's Zeitschrift fuer physiologische Chemie, 1971 , vol. 352, # 12 p. 1617 - 1630 Title/Abstract Full Text View citing articles Show Details
Kopelevich,V.M. et al.
J. Gen. Chem. USSR (Engl. Transl.), 1974 , vol. 44, p. 1174 - 1176,1130 - 1132
Full Text View citing articles Show Details
Smirnova,A.A. et al.
Zhurnal Organicheskoi Khimii, 1968 , vol. 4, p. 2245 - 2255,2166 - 2174 Full Text View citing articles Show Details
Ginsburg,V.A.; Vasil'eva,M.N.
Journal of Organic Chemistry USSR (English Translation), 1973 , vol. 9, p. 2045 - 2048 Zhurnal Organicheskoi Khimii, 1973 , vol. 9, p. 2028 - 2031 Full Text View citing articles Show Details
Fominova,O.S. et al.
Zhurnal Organicheskoi Khimii, 1977 , vol. 13, # 9 p. 1922 - 1926,1783 - 1786 Full Text View citing articles Show Details
GEE, Kelvin, Wellman; LAN, Nancy, Tsai-Yun
Patent: WO1991/17438 A1, 1991 ; Title/Abstract Full Text Show Details
SYNAPTIC PHARMACEUTICAL CORPORATION
Patent: WO1993/10228 A1, 1993 ; Title/Abstract Full Text Show Details
Reinisch,G. et al.
Journal fuer Praktische Chemie (Leipzig), 1968 , vol. 37, p. 278 - 282 Full Text View citing articles Show Details
Yalkowsky; Zografi
Journal of pharmaceutical sciences, 1970 , vol. 59, # 6 p. 798 - 802 Title/Abstract Full Text View citing articles Show Details
Kholodov,L.E. et al.
Pharmaceutical Chemistry Journal, 1968 , # 5 p. 235 - 238 Khimiko-Farmatsevticheskii Zhurnal, 1968 , # 5 p. 3 - 7 Full Text View citing articles Show Details
Kopelevich,V.M. et al.
Pharmaceutical Chemistry Journal, 1971 , vol. 5, # 9 p. 534 - 536 Khimiko-Farmatsevticheskii Zhurnal, 1971 , vol. 5, # 9 p. 21 - 22 Full Text View citing articles Show Details
Tsybina,N.M. et al.
Pharmaceutical Chemistry Journal, 1974 , vol. 8, # 9 p. 528 - 530 Khimiko-Farmatsevticheskii Zhurnal, 1974 , vol. 8, # 9 p. 10 - 13 Full Text View citing articles Show Details
7 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
THE REGENTS OF THE UNIVERSITY OF CALIFORNIA; UNIVERSITY OF UTAH RESEARCH FOUNDATION
Patent: WO1999/20645 A1, 1999 ; Title/Abstract Full Text Show Details
CARVAJAL SANDOVAL, Guillermo; MEZA TOLEDO, Sergio Enrique
Patent: WO1999/41229 A1, 1999 ; Title/Abstract Full Text Show Details
UNIVERSITY COLLEGE LONDON
Patent: WO1999/64861 A3, 1999 ; Title/Abstract Full Text Show Details
Takeuchi,S.; Yonehara,H.
Journal of Antibiotics, Series A, 1961 , vol. XIV, # 1 p. 44 - 53 Full Text View citing articles Show Details
Pearson,J.F.; Slifkin,M.A.
Spectrochimica Acta, Part A: Molecular and Biomolecular Spectroscopy, 1972 , vol. 28, p. 2403 - 2417 Full Text View citing articles Show Details
RAMOT AT TEL AVIV UNIVERSITY LTD.; BAR ILAN UNIVERSITY
Patent: WO2003/26563 A2, 2003 ; Title/Abstract Full Text Show Details
UMECRINE AB
Patent: WO2003/59357 A1, 2003 ; Title/Abstract Full Text Show Details
RICHTER GEDEON VEGYESZETI GYAR RT.
Patent: WO2004/67541 A1, 2004 ; Title/Abstract Full Text Show Details
Hatakeda, Kiyotaka; Sato, Osamu; Kanakubo, Mitsuhiro; Ikushima, Yutaka; Torii, Kazuo
Patent: US2004/162434 A1, 2004 ; Title/Abstract Full Text Show Details
CRC FOR ASTHMA LIMITED
Patent: WO2004/84890 A1, 2004 ; Title/Abstract Full Text Show Details
VASOPHARM BIOTECH GMBH
Patent: WO2004/84906 A1, 2004 ; Title/Abstract Full Text Show Details
SLOWAVE, INC.
Patent: WO2004/46315 A3, 2004 ;
Title/Abstract Full Text Show Details
POSTECH FOUNDATION; POSCO
Patent: WO2005/16869 A1, 2005 ; Title/Abstract Full Text Show Details
JANSSEN PHARMACEUTICA N.V.
Patent: WO2005/26208 A2, 2005 ; Title/Abstract Full Text Show Details
NOVARTIS AG; NOVARTIS PHARMA GMBH
Patent: WO2005/39594 A1, 2005 ; Title/Abstract Full Text Show Details
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
SUN PHARMACEUTICAL INDUSTRIES LIMITED
Patent: WO2005/44831 A2, 2005 ; Title/Abstract Full Text Show Details
SHISEIDO COMPANY LIMITED
Patent: EP1550459 A1, 2005 ; Title/Abstract Full Text Show Details
The Regents of the University of California
Patent: US2005/164951 A1, 2005 ; Title/Abstract Full Text Show Details
Goldschmidt GmbH
Patent: EP1566375 A1, 2005 ; Title/Abstract Full Text Show Details
8 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
BIOVITRUM AB
Patent: WO2005/75471 A2, 2005 ; Title/Abstract Full Text Show Details
Han, Chien-Hsuan; Hsu, Ann F.; Hsu, Larry; Hsiao, Charles; Teng, Ching-Ling Diana
Patent: US2005/220863 A1, 2005 ; Title/Abstract Full Text Show Details
Han, Chien-Hsuan; Hsu, Ann F.; Hsu, Larry; Hsiao, Charles; Teng, Ching-Ling Diana
Patent: US2005/220864 A1, 2005 ; Title/Abstract Full Text Show Details
Lee, Steve S.; Hynson, Richard B.; Zhang, Ke-Qin; Li, Wu-Zhou; Zhou, Jing Shi
Patent: US2005/233013 A1, 2005 ; Title/Abstract Full Text Show Details
THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
Patent: WO2005/108347 A2, 2005 ; Title/Abstract Full Text Show Details
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
THE UNIVERSITY COURT OF THE UNIVERSITY OF ABERDEEN
Patent: WO2005/118528 A2, 2005 ; Title/Abstract Full Text Show Details
Ganapathy, Vadivel; Miyauchi, Seiji
Patent: US2006/19241 A1, 2006 ; Title/Abstract Full Text Show Details
DOW GLOBAL TECHNOLOGIES INC.
Patent: WO2006/20234 A1, 2006 ; Title/Abstract Full Text Show Details
CAMBRIDGE UNIVERSITY TECHNICAL SERVICES LIMITED
Patent: WO2006/24815 A1, 2006 ; Title/Abstract Full Text Show Details
YALE UNIVERSITY
Patent: WO2006/42143 A2, 2006 ; Title/Abstract Full Text Show Details
Malherbe, Parichehr; Masciadri, Raffaello; Norcross, Roger David; Ratni, Hasane; Thomas, Andrew William
Patent: US2006/94754 A1, 2006 ;
Title/Abstract Full Text Show Details
Thomae
Patent: DE2234399 , 1974 ; Chem.Abstr., 1974 , vol. 80, # 108853 Full Text Show Details
Synthelabo
Patent: DE2634288 , 1977 ; Chem.Abstr., 1977 , vol. 86, # 189530 Full Text Show Details
Byk Gulden Lomberg
Patent: DE2856722 , 1979 ; Chem.Abstr., 1979 , vol. 91, # 157284 Full Text Show Details
Byk Gulden Lomberg
Patent: DE2856753 , 1979 ; Chem.Abstr., 1979 , vol. 91, # 175033 Full Text Show Details
Synthelabo
Patent: DE2907379 , 1979 ; Chem.Abstr., 1980 , vol. 92, # 6279 Full Text Show Details
UMECRINE AB
Patent: WO2006/54938 A1, 2006 ; Title/Abstract Full Text Show Details
KAO CORPORATION
Patent: US2006/115517 A1, 2006 ; Title/Abstract Full Text Show Details
F.HOFFMANN-LA ROCHE AG
Patent: WO2006/63732 A1, 2006 ; Title/Abstract Full Text Show Details
9 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
WARNER-LAMBERT COMPANY LLC
Patent: WO2006/67565 A2, 2006 ; Title/Abstract Full Text Show Details
DE Sangosse SA; Centre National De La Recherche Scientifique
Patent: US2006/148710 A1, 2006 ; Title/Abstract Full Text Show Details
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
The Research Foundation of the City University of New York; New York University
Patent: US7112319 B2, 2006 ; Title/Abstract Full Text Show Details
ALEMBIC LIMITED
Patent: US2006/258625 A1, 2006 ; Title/Abstract Full Text Show Details
Ophthalmic Research Associates, Inc.
Patent: US2006/270592 A1, 2006 ; Title/Abstract Full Text Show Details
ZAMBON GROUP S.p.A.
Patent: EP317588 B1, 1991 ; Title/Abstract Full Text Show Details
JUBILANT ORGANOSYS LIMITED
Patent: WO2006/134603 A1, 2006 ; Title/Abstract Full Text Show Details
Taiyokagaku Co., Ltd.
Patent: EP1743633 A1, 2007 ; Title/Abstract Full Text Show Details
ANTROMED INC
Patent: US2007/21508 A1, 2007 ; Title/Abstract Full Text Show Details
LUPIN LIMITED
Patent: WO2007/10556 A1, 2007 ; Title/Abstract Full Text Show Details
DOOSAN CORPORATION; BIOVAN CO., LTD.
Patent: WO2007/7989 A1, 2007 ; Title/Abstract Full Text Show Details
ORCHID CHEMICALS and PHARMACEUTICALS LTD.
Patent: US2007/66569 A1, 2007 ; Title/Abstract Full Text Show Details
XenoPort, Inc.
Patent: US2007/86950 A1, 2007 ; Title/Abstract Full Text Show Details
BrainCells, Inc.
Patent: US2007/112017 A1, 2007 ; Title/Abstract Full Text Show Details
Jani, Dharmendra M.; Kwok, Kai; McIntire, Gregory L.; Pfeffer, Bruce A.; Shafiee, Afshin; Shi, Ruiwen; Venkatesh, Srini; Wang, Hongna; Huang, Yan; Davio, Stephen R.
Patent: US2007/134231 A1, 2007 ; Title/Abstract Full Text Show Details
XenoPort, Inc.
Patent: US2007/141638 A1, 2007 ; Title/Abstract Full Text Show Details
Mandava, Venkata Naga Brahmeswara Rao; Singam Setty, Radha Krishna; Manne, Nagaraju
Patent: US2007/142636 A1, 2007 ; Title/Abstract Full Text Show Details
Danda, Subba Reddy; Garimella, Narayan K.A.S.S.; Divvela, Srinivasa Rao V.N; Dandala, Ramesh; Meenakshisunderam, Sivakumaran
Patent: US2007/173645 A1, 2007 ; Title/Abstract Full Text Show Details
10 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
UNIVERSITY OF MARYLAND, BALTIMORE; BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM
Patent: US2007/197650 A1, 2007 ; Title/Abstract Full Text Show Details
Bartels, Stephen P.
Patent: US2007/212358 A1, 2007 ; Title/Abstract Full Text Show Details
Sharma, Deepak; Edelstein, Jenette Suh
Patent: US2007/231276 A1, 2007 ; Title/Abstract Full Text Show Details
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
NOVO NORDISK A/S
Patent: WO2007/128817 A2, 2007 ; Title/Abstract Full Text Show Details
GENERICS [UK] LIMITED; MERCK DEVELOPMENT CENTRE PRIVATE LIMITED
Patent: WO2008/4000 A1, 2008 ; Title/Abstract Full Text Show Details
RAMOT AT TEL AVIV UNIVERSITY LTD.; BAR-ILAN UNIVERSITY; BIOLINERX LTD.
Patent: WO2008/10222 A2, 2008 ; Title/Abstract Full Text Show Details
Bruinstroop, Jan Kees Piet
Patent: EP1889612 A2, 2008 ; Title/Abstract Full Text Show Details
MOLECULAR INSIGHT PHARMACEUTICALS, INC.
Patent: WO2008/28000 A2, 2008 ; Title/Abstract Full Text Show Details
Reppe et al.
Justus Liebigs Annalen der Chemie, 1955 , vol. 596, p. 1,211 Full Text View citing articles Show Details
Murakoshi
Yakugaku Zasshi, 1957 , vol. 77, p. 1062 Chem.Abstr., 1958 , p. 5376 Full Text View citing articles Show Details
Garmaise et al.
Canadian Journal of Chemistry, 1956 , vol. 34, p. 743,744,745 Full Text Show Details
Yamagishi
Yakugaku Zasshi, 1958 , vol. 78, p. 1133,1137
Chem.Abstr., 1959 , p. 5160 Full Text Show Details
Todd; Teich
Journal of the American Chemical Society, 1953 , vol. 75, p. 1895,1897 Full Text Show Details
Petersen; Tietze
Justus Liebigs Annalen der Chemie, 1959 , vol. 623, p. 166,175 Full Text Show Details
Schotten
Chemische Berichte, 1883 , vol. 16, p. 644 Full Text Show Details
Ley
Chemische Berichte, 1909 , vol. 42, p. 367 Full Text Show Details
Aschan
Chemische Berichte, 1891 , vol. 24, p. 2448 Full Text Show Details
Abderhalden; Kautzsch
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1912 , vol. 81, p. 297 Full Text Show Details
Karrer; Widmer
Helvetica Chimica Acta, 1926 , vol. 9, p. 890 Full Text Show Details
11 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Spaeth; Breusch
Monatshefte fuer Chemie, 1928 , vol. 50, p. 352 Full Text Show Details
Bragg; Hough
Journal of the Chemical Society, 1958 , p. 4050,4053 Full Text Show Details
Tafel; Stern
Chemische Berichte, 1900 , vol. 33, p. 2235 Full Text Show Details
Emmert
Zeitschrift fuer Physikalische Chemie, Stoechiometrie und Verwandtschaftslehre, 1906 , vol. 54, p. 433 Full Text Show Details
Tafel; Naumann
Zeitschrift fuer Physikalische Chemie, Stoechiometrie und Verwandtschaftslehre, 1905 , vol. 50, p. 728 Full Text Show Details
Spaeth; Becke
Chemische Berichte, 1935 , vol. 68, p. 501,504 Monatshefte fuer Chemie, 1935 , vol. 66, p. 327,333 Full Text Show Details
Reppe et al.
Justus Liebigs Annalen der Chemie, 1955 , vol. 596, p. 1,213 Full Text Show Details
BASF
Patent: DE850747 , 1943 ; Full Text Show Details
Kuschinsky et al.
Biochemische Zeitschrift, 1955 , vol. 327, p. 314,316 Full Text Show Details
Talbot et al.
Canadian Journal of Chemistry, 1958 , vol. 36, p. 593,594 Full Text Show Details
Reppe et al.
Justus Liebigs Annalen der Chemie, 1955 , vol. 596, p. 1,214 Full Text Show Details
Murahashi et al.
Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences, 1959 , vol. 248, p. 1521 Full Text Show Details
Matsuo
Journal of the American Chemical Society, 1957 , vol. 79, p. 2016,2017 Full Text Show Details
Burchfield; Storrs
Contributions from Boyce Thompson Institute, 1957 , vol. 19, p. 169,175 Contributions from Boyce Thompson Institute, 1956 , vol. 18, p. 395,404 Full Text Show Details
Takayama
Bulletin of the Chemical Society of Japan, 1936 , vol. 11, p. 138,139 Full Text Show Details
Giri et al.
Naturwissenschaften, 1953 , vol. 40, p. 440,441 Full Text Show Details
Rao; Sober
Journal of the American Chemical Society, 1954 , vol. 76, p. 1328,1330 Full Text Show Details
Devoto
Atti della Accademia Nazionale dei Lincei, Classe di Scienze Fisiche, Matematiche e Naturali, Rendiconti, 1934 , vol. <6> 19, p. 50 Full Text Show Details
Winterstein et al.
Helvetica Chimica Acta, 1956 , vol. 39, p. 229,243 Full Text Show Details
Sadykow; Nuriddinow
Doklady Akademii Nauk SSSR, 1955 , vol. 102, p. 755,756 Chem.Abstr., 1956 , p. 4995 Full Text Show Details
12 of 992
13 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Kato et al.
Nippon Nogei Kagaku Kaishi, 1953 , vol. 27, p. 500 Chem.Abstr., 1955 , p. 3006 Full Text Show Details
Loeb
Biochemische Zeitschrift, 1914 , vol. 60, p. 165 Full Text Show Details
Dakin
Biochemical Journal, 1917 , vol. 11, p. 84 Full Text Show Details
Hirata; Nakanishi
Bulletin of the Chemical Society of Japan, 1949 , vol. 22, p. 125 Chem.Abstr., 1950 , p. 6478 Full Text Show Details
Dose; Ettre
Zeitschrift fuer Naturforschung, 1958 , vol. 13b, p. 784,786 Full Text Show Details
Miki
Nippon Nogei Kagaku Kaishi, 1956 , vol. 30, p. 778 Chem.Abstr., 1958 , p. 9960 Full Text Show Details
Willstaetter
Chemische Berichte, 1902 , vol. 35, p. 602 Full Text Show Details
Gabriel
Chemische Berichte, 1889 , vol. 22, p. 3337 Chemische Berichte, 1890 , vol. 23, p. 1772 Full Text Show Details
Aschan,W.
Chemische Berichte, 1891 , vol. 24, p. 2450 Full Text Show Details
Krimberg
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1907 , vol. 53, p. 514 Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1908 , vol. 55, p. 466 Full Text Show Details
Ackermann
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1910 , vol. 69, p. 276 Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1910 , vol. 64, p. 92 Full Text Show Details
Thomas
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1913 , vol. 88, p. 471 Full Text Show Details
Abderhalden; Fromme; Hirsch
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1913 , vol. 85, p. 132 Full Text Show Details
Thomas; Goerne
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1919 , vol. 104, p. 85 Full Text Show Details
Engeland; Kutscher
Chemische Berichte, 1910 , vol. 43, p. 2882 Full Text Show Details
Keil; Linneweh; Poller
Zeitschrift fuer Biologie (Munich), vol. 86, p. 195 Chem. Zentralbl., 1927 , vol. 98, # II p. 1483 Full Text Show Details
deWitt
Organic Syntheses, 1937 , vol. 17, p. 4 Full Text Show Details
Abderhalden; Pieper; Tateyama
Fermentforschung, vol. 8, p. 580 Chem. Zentralbl., 1926 , vol. 97, # II p. 779 Full Text Show Details
Abderhalden; Pieper; Tateyama
Fermentforschung, vol. 8, p. 581 Chem. Zentralbl., 1926 , vol. 97, # II p. 779 Full Text Show Details
Voss; Guttmann
Chemische Berichte, 1930 , vol. 63, p. 1731 Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Kobayashi
Journal of Biochemistry (Tokyo, Japan), 1938 , vol. 27, p. 112 Full Text Show Details
Mason
Journal of the American Chemical Society, 1947 , vol. 69, p. 3001 Full Text Show Details
Fricke; Parts
Journal of Physical Chemistry, 1938 , vol. 42, p. 1180 Full Text Show Details
Work
Biochimica et Biophysica Acta, 1949 , vol. 3, p. 406 Full Text Show Details
Gordon
Biochemical Journal, 1949 , vol. 45, p. 101 Full Text Show Details
Holden,J.T.
Amino Acid Pools <Amsterdam 1962> Full Text Show Details
Smith; Smith
Journal of Biological Chemistry, 1940 , vol. 132, p. 52 Full Text Show Details
Joslyn; Stepka
Food Research, 1949 , vol. 14, p. 459 Full Text View citing articles Show Details
Takayama
Bulletin of the Chemical Society of Japan, 1936 , vol. 11, p. 141 Full Text Show Details
Parts
Publ.tech.Univ.Tallinn<A>Chem.Abstr., 1939 , # 8 p. 9 Publ.tech.Univ.Tallinn<A>Chem.Abstr., 1940 , p. 4952 Full Text Show Details
Loomis in W.Ruhland
Handbuch der Pflanzenphysiologie, Bd.8<Berlin 1958>S.231 Full Text Show Details
Sherman
Biochemical Preparations, 1955 , vol. 4, p. 91 Full Text Show Details
Merck,E.
Patent: DE597305 , 1931 ; Fortschr. Teerfarbenfabr. Verw. Industriezweige, vol. 19, p. 1501 Full Text Show Details
Greenstein,J.P.; Winitz,M.
Chemistry of the Amino Acids <New York 1961>S.36,1412-1414 Full Text Show Details
Steward; Thompson; Dent
Science (Washington, DC, United States), 1949 , vol. 110, p. 439 Full Text Show Details
Neuberger
Biochemical Journal, 1936 , vol. 30, p. 2091 Proceedings of the Royal Society of London, Series A: Mathematical, Physical and Engineering Sciences, vol. 158, p. 93 Full Text Show Details
Hoffmann-La Roche
Patent: CH244527 , 1940 ; Full Text Show Details
Taylor; Gale
Biochemical Journal, 1945 , vol. 39, p. 53 Full Text Show Details
Gale
Biochemical Journal, 1940 , vol. 34, p. 401,405 Biochemical Journal, 1941 , vol. 35, p. 68,76 Full Text Show Details
Virtanen; Rintala; Laine
Nature (London, United Kingdom), 1938 , vol. 142, p. 674 Enzymol., 1940 , vol. 9, p. 56 Full Text View citing articles Show Details
14 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Colowick,S.P.; Kaplan,N.O.
Methods in Enzymology, Bd. 2 <New York 1955> S. 190 Full Text Show Details
Schales; Schales
Archives of Biochemistry, 1946 , vol. 11, p. 155 Full Text Show Details
Schales; Mims; Schales
Archives of Biochemistry, 1946 , vol. 10, p. 456 Full Text Show Details
Okunuki
Acta Phytochimica, 1943 , vol. 13, p. 156 Full Text Show Details
Hughes
Biochemical Journal, 1949 , vol. 45, p. 326 Full Text Show Details
Gale
Adv.Enzymol., 1946 , vol. 6, p. 1 Full Text Show Details
Gale
Biochemical Journal, 1941 , vol. 35, p. 68,77 Biochemical Journal, 1945 , vol. 39, p. 48 Full Text Show Details
Colowick,S.P.; Kaplan,N.O.
Methods in Enzymology, Bd. 2 <New York 1955> S. 186 Full Text Show Details
Umbreit; Gunsalus
Journal of Biological Chemistry, 1945 , vol. 159, p. 338 Full Text Show Details
Mourgue; Baret
Bulletin de la Societe Chimique de France, 1955 , p. 1224 Full Text Show Details
O'Brien; Niemann
Journal of the American Chemical Society, 1951 , vol. 73, p. 4264,4266 Full Text Show Details
Leifer; Lippincott
Journal of the American Chemical Society, 1957 , vol. 79, p. 5098 Full Text View citing articles Show Details
Jatkar; Iyengar
Journal of the Indian Institute of Science, Section A, 1949 , vol. 31, p. 15,21 Full Text Show Details
Wolschtein; Mogilewkina
Doklady Akademii Nauk SSSR, 1956 , vol. 110, p. 83,84 Pr.Acad.Sci.U.S.S.R., 106-111<1956>531 Full Text Show Details
Frankel et al.
Bl.Res.Coun.Israel <A>, 1957 , vol. 7, p. 173,177 Full Text Show Details
Kalyankar
Experientia, 1955 , vol. 11, p. 348 Full Text View citing articles Show Details
King
Journal of the American Chemical Society, 1954 , vol. 76, p. 1006 Full Text View citing articles Show Details
Crowfoot-Hodkin;Cowan; zit. bei Synge
Biochemical Journal, 1951 , vol. 48, p. 429,432 Full Text Show Details
Ruhrchemie A.G.
Patent: DE929191 , 1952 ; Full Text Show Details
Musashi
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1954 , vol. 297, p. 71 Full Text View citing articles Show Details
15 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Mizuno; Ishikawa
Bl.Nagoya Inst.Technol.Chem.Abstr., 1955 , vol. 7, p. 277,279 Bl.Nagoya Inst.Technol.Chem.Abstr., 1956 , p. 9181 Full Text Show Details
Sorm; Beranek
Chemicke Listy, 1953 , vol. 47, p. 1241 Chem.Abstr., 1955 , p. 860 Full Text Show Details
Thoai et al.
Biochimica et Biophysica Acta, 1956 , vol. 22, p. 116,119 Full Text Show Details
Evans; Irreverre
Journal of Organic Chemistry, 1959 , vol. 24, p. 863 Full Text View citing articles Show Details
Fowden
Biochemical Journal, 1956 , vol. 64, p. 323,330 Full Text Show Details
Christensen; Riggs
Journal of Biological Chemistry, 1956 , vol. 220, p. 265,267 Full Text Show Details
McKay et al.
Journal of the American Chemical Society, 1958 , vol. 80, p. 1510,1512,1515 Full Text View citing articles Show Details
Effenberger; Drauz
Angewandte Chemie, 1979 , vol. 91, p. 504 Full Text Show Details
McKay et al.
Journal of the American Chemical Society, 1959 , vol. 81, p. 4328,4330,4333 Full Text View citing articles Show Details
Mori
Journal of Biochemistry (Tokyo, Japan), 1959 , vol. 46, p. 59,60 Full Text Show Details
Baxter; Roberts
Journal of Biological Chemistry, 1958 , vol. 233, p. 1135 Full Text View citing articles Show Details
Scott; Jakoby
Journal of Biological Chemistry, 1959 , vol. 234, p. 932 Full Text Show Details
Noguchi et al.
Nippon Kagaku Zasshi, 1956 , vol. 77, p. 463,464 Chem.Abstr., 1958 , p. 8960 Full Text Show Details
Goerdeler; Holst
Angewandte Chemie, 1959 , vol. 71, p. 775 Full Text Show Details
Thomas; Schotte
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1919 , vol. 104, p. 148 Full Text Show Details
Petersen; Mueller
Chemische Berichte, 1948 , vol. 81, p. 31,37 Full Text Show Details
Curtius; Mueller
Journal fuer Praktische Chemie (Leipzig), 1904 , vol. <2> 70, p. 226 Full Text Show Details
Peters
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1926 , vol. 159, p. 312 Full Text Show Details
Kanewskaja
Chemische Berichte, 1936 , vol. 69, p. 266,270 Full Text Show Details
Heyns; Breuer
Chemische Berichte, 1958 , vol. 91, p. 2750,2759 Full Text Show Details
16 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Wang; Gilpin
Analytical Chemistry, 1983 , vol. 55, # 3 p. 493 - 497 Title/Abstract Full Text View citing articles Show Details
Kricheldorf
Organic Magnetic Resonance, 1979 , vol. 12, p. 414,415 Full Text Show Details
Chattopadhyay; Lahiri
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical and Analytical, 1977 , vol. 15, p. 930 Full Text Show Details
Wright et al.
Chemistry and Industry (London, United Kingdom), 1961 , p. 1491 Full Text Show Details
Braams
Radiation Research, 1966 , vol. 27, p. 319,321 Full Text Show Details
Madan
Planta Medica, 1967 , vol. 15, p. 118,119 Full Text Show Details
Kojima et al.
Yakugaku Zasshi, 1972 , vol. 92, p. 465,469 Chem.Abstr., 1972 , vol. 77, # 34230 Full Text Show Details
Prasad; Ahluwalia
Journal of Solution Chemistry, 1976 , vol. 5, p. 491,494, 496 Full Text View citing articles Show Details
Kirsten et al.
Planta Medica, 1966 , vol. 14, p. 241,242 Full Text Show Details
Lacoste
Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences, 1960 , vol. 250, p. 2773 Full Text Show Details
Cannington; Ham
Journal of Electron Spectroscopy and Related Phenomena, 1979 , vol. 15, p. 79,82 Chem.Abstr., vol. 90, # 168954 Full Text Show Details
Pande; Harkiss
Planta Medica, 1976 , vol. 30, p. 317,318 Full Text Show Details
Means et al.
Biochemistry, 1972 , vol. 11, p. 3564,3566 Full Text Show Details
Zacharius; Talley
Analytical Chemistry, 1962 , vol. 34, p. 1551 Full Text View citing articles Show Details
Zaionts
Pharmaceutical Chemistry Journal, 1979 , vol. 13, # 11 p. 1112,1114,1117 Khimiko-Farmatsevticheskii Zhurnal, 1979 , vol. 13, # 11 p. 10 Full Text View citing articles Show Details
Horak et al.
Collection of Czechoslovak Chemical Communications, 1973 , vol. 38, p. 3532,3534, 3535, 3537 Full Text View citing articles Show Details
Knauff et al.
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1960 , vol. 318, p. 73,77 Full Text Show Details
Stegemann
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1960 , vol. 319, p. 102,105 Full Text Show Details
Kitaoka; Nakano
Journal of Biochemistry (Tokyo, Japan), 1969 , vol. 66, p. 87,91 Full Text Show Details
Diak
Planta Medica, 1977 , vol. 32, p. 181,186 Full Text Show Details
17 of 992
18 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Solberg
Z. Naturforsch., B: Anorg. Chem., Org. Chem., Biochem., Biophys.,, 1969 , vol. 24, p. 447 Full Text Show Details
Winterfeld; Berusmann
Archiv der Pharmazie und Berichte der Deutschen Pharmazeutischen Gesellschaft, 1960 , vol. 293, p. 991,994 Full Text Show Details
Larsen; Kjaer
Biochimica et Biophysica Acta, 1960 , vol. 38, p. 158 Chem.Abstr., 1960 , vol. 54, # 14332 Full Text Show Details
Okuda et al.
Chemical and Pharmaceutical Bulletin, 1965 , vol. 13, p. 491,494 Full Text Show Details
Weiss et al.
Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences, 1960 , vol. 250, p. 1322 Full Text Show Details
McKillican
Canadian Journal of Chemistry, 1960 , vol. 38, p. 244,246 Full Text Show Details
Taddei; Pratt
Journal of the Chemical Society, 1964 , p. 1553,1554, 1556, 1558 Full Text Show Details
Schuette et al.
Justus Liebigs Annalen der Chemie, 1964 , vol. 680, p. 93,102 Full Text Show Details
Hunt; Mackay
Journal of Magnetic Resonance (1969-1992), 1976 , vol. 22, p. 295 Full Text View citing articles Show Details
Nyilasi; Orsos
Acta Chimica Academiae Scientiarum Hungaricae, 1972 , vol. 75, p. 405,406,407 Full Text Show Details
Hay; Morris
Journal of the Chemical Society [Section] B: Physical Organic, 1970 , p. 1577 Full Text View citing articles Show Details
Falle et al.
Journal of the Chemical Society, Faraday Transactions 2: Molecular and Chemical Physics, 1976 , vol. 72, p. 2019,2020 Full Text Show Details
Shivaram; Wallenfels
Indian Journal of Biochemistry, 1969 , vol. 6, p. 77,79 Full Text Show Details
Latosh et al.
J. Gen. Chem. USSR (Engl. Transl.), 1978 , vol. 48, p. 2287,2076 Full Text Show Details
Sekiguchi
Bulletin de la Societe Chimique de France, 1960 , p. 1838 Full Text Show Details
Gaux; Henaff
Bulletin de la Societe Chimique de France, 1972 , p. 2501,2508 Full Text Show Details
Takemoto; Takagi; Nakajima; Koike
Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan, 1975 , vol. 95, # 2 p. 176 - 179 Title/Abstract Full Text View citing articles Show Details
Gaux; Henaff
Comptes Rendus des Seances de l'Academie des Sciences, Serie C: Sciences Chimiques, 1970 , vol. 271, p. 1093 Full Text Show Details
Kozak et al.
Journal of Chemical Physics, 1968 , vol. 48, p. 675,686 Full Text Show Details
Woronkina et al.
Biol. Akt. Soedin., 1965 , p. 199,202 Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Anjaneyulu; Govindachari
Tetrahedron letters, 1969 , vol. 33, p. 2847 - 2848
Title/Abstract Full Text View citing articles Show Details
Meiya et al.
J. Appl. Chem. USSR (Engl. Transl.), 1972 , vol. 45, p. 692,707 Full Text Show Details
Ratcliff et al.
Journal of Organic Chemistry, 1974 , vol. 39, p. 1481,1486 Full Text Show Details
Mikhailov et al.
Doklady Physical Chemistry, 1966 , vol. 166-171, p. 689 vol. 170, p. 1364 Full Text Show Details
Moiseev et al.
Russian Journal of Physical Chemistry, 1963 , vol. 37, p. 293,294 p. 570 Full Text Show Details
Macholan et al.
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1965 , vol. 340, p. 97,101 Full Text Show Details
Dickinson; Lang
Tetrahedron Letters, 1967 , p. 3035 Full Text View citing articles Show Details
Muramatsu et al.
Chemistry Letters, 1977 , p. 1253,1254,1255 Full Text Show Details
Kolasow et al.
Zhurnal Fizicheskoi Khimii, 1962 , vol. 36, p. 770,775 p. 400 Full Text Show Details
Sato
Nippon Kagaku Zasshi, 1969 , vol. 90, p. 404,405,408 Full Text Show Details
Koehler; Ockenfels; Meise
Die Pharmazie, 1973 , vol. 28, # 10 p. 680 - 681 Title/Abstract Full Text View citing articles Show Details
Kukalenko et al.
Zhurnal Organicheskoi Khimii, 1973 , vol. 9, p. 1401,1430 Full Text Show Details
Arendaruk et al.
Meditsinskaya Promyshlennost SSSR, 1963 , vol. 17, p. 6 Chem.Abstr., 1963 , vol. 59, # 11234d Full Text View citing articles Show Details
Love; Moore
Journal of Organic Chemistry, 1968 , vol. 33, # 6 p. 2361 Full Text View citing articles Show Details
Zamorani et al.
Gazzetta Chimica Italiana, 1968 , vol. 98, p. 468 Full Text Show Details
Takeuchi; Yonehara
Journal of Antibiotics, Series A, 1961 , vol. 14, p. 44,46,51 Full Text Show Details
Scholes; Willson
Transactions of the Faraday Society, 1967 , vol. 63, p. 2983,2989 Full Text Show Details
Ayscough; Simpson
Australian Journal of Chemistry, 1971 , vol. 24, p. 2649 Full Text Show Details
Kirchenmayer; Kuffner
Monatshefte fuer Chemie, 1962 , vol. 93, p. 1237,1241 Full Text Show Details
Werum et al.
Journal of Chromatography, 1960 , vol. 3, p. 125,139 Chem.Abstr., 1960 , # 19089 Full Text Show Details
19 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Dose; Risi
Z. Naturforsch., B: Anorg. Chem., Org. Chem., Biochem., Biophys.,, 1968 , vol. 23, p. 581 Full Text Show Details
Orlow et al.
Journal of Structural Chemistry, 1966 , vol. 7, p. 738 Zhurnal Strukturnoi Khimii, 1966 , vol. 7, p. 796 Full Text View citing articles Show Details
Friedman
Journal of the American Chemical Society, 1967 , vol. 89, p. 4709,4710 Full Text Show Details
Ayres
Journal of the Chemical Society, Chemical Communications, 1975 , p. 440 Full Text View citing articles Show Details
Ito; Hashimoto
Agricultural and Biological Chemistry, 1965 , vol. 29, p. 832,835 Full Text Show Details
Boulanger; Osteux
Bulletin de la Societe de Pharmacie de Lille, 1960 , p. 27,28
Chem.Abstr., 1961 , # 723 Full Text Show Details
Aoyama
Okayama Igakkai Zasshi, 1959 , vol. 71, p. 5513,5514-5517 Chem.Abstr., 1960 , # 24970 Full Text Show Details
Watson
Spectrochimica Acta, 1960 , vol. 16, p. 1322,1323 Full Text Show Details
Peters et al.
Phytochemistry (Elsevier), 1974 , vol. 13, p. 2383,2385 Full Text Show Details
Rabenstein; Sayer
Journal of Magnetic Resonance (1969-1992), 1976 , vol. 24, p. 27 Full Text View citing articles Show Details
Grobbelaar; Steward
Phytochemistry (Elsevier), 1969 , vol. 8, p. 553,557 Full Text Show Details
Moger et al.
Magyar Kemiai Folyoirat, 1973 , vol. 79, p. 476,477 Full Text Show Details
Eley et al.
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1973 , vol. 69, p. 399,401, 402, 409, 410 Full Text View citing articles Show Details
Yoshida; Sawada
Bulletin of the Chemical Society of Japan, 1974 , vol. 47, p. 50 Full Text Show Details
Hatano
Bulletin of the Institute for Chemical Research, Kyoto University, 1961 , vol. 39, p. 120,121,123 Full Text Show Details
Warner; Steward
Journal of Molecular Structure, 1975 , vol. 25, p. 403,407 Full Text Show Details
Edward et al.
Journal of Organic Chemistry, 1979 , vol. 44, p. 615 Full Text View citing articles Show Details
Abraham; Grellier
Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999), 1975 , p. 1856 Full Text Show Details
Armitage et al.
Proceedings of the National Academy of Sciences of the United States of America, 1974 , vol. 71, p. 2096,2097 Full Text Show Details
Freidlina et al.
Patent: SU545635 , 1977 ; Ref. Zh., Khim., 1977 , vol. 18, # O9P Full Text Show Details
20 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Larson et al.
Journal of Physical Chemistry, 1977 , vol. 81, p. 2074 Full Text View citing articles Show Details
Freidlina et al.
Patent: US4029700GB1500633 , 19771978 ; Chem.Abstr., vol. 89, # 129057 Full Text Show Details
Jones et al.
Molecular Physics, 1971 , vol. 22, p. 547 Full Text Show Details
Durand et al.
Journal of Pharmacy and Pharmacology, 1962 , vol. 14, p. 562,564 Full Text Show Details
Stark
Biochemistry, 1965 , vol. 4, p. 1030 Full Text View citing articles Show Details
Shahidi; Farrell
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1978 , vol. 74, p. 858,860 Full Text Show Details
Simionescu et al.
Comptes Rendus des Seances de l'Academie des Sciences, Serie C: Sciences Chimiques, 1976 , vol. 282, p. 679 Full Text Show Details
Simons et al.
Commentationes Physico-Mathematicae, 1972 , vol. 42, p. 125,141, 142 Chem.Abstr., vol. 77, # 165071b Full Text Show Details
Pennington; Cavanaugh
Organic Magnetic Resonance, 1978 , vol. 29, p. 483,489 Full Text Show Details
Riva et al.
Annali di Chimica (Rome, Italy), 1973 , vol. 63, p. 7,11 Full Text Show Details
Huong
Journal de Chimie Physique et de Physico-Chimie Biologique, 1975 , vol. 72, p. 415 Full Text Show Details
Tanaka et al.
Bulletin of the Chemical Society of Japan, 1978 , vol. 51, p. 2654,2656, 2657 Full Text View citing articles Show Details
Mangyo
Seikagaku, 1964 , vol. 36, p. 756 Chem.Abstr., 1965 , vol. 62, # 11680d Full Text View citing articles Show Details
Fujiwara et al.
Bulletin of the Chemical Society of Japan, 1971 , vol. 44, p. 1984 Full Text Show Details
Schilling; Kricheldorf
Makromolekulare Chemie, 1975 , vol. 176, p. 3341,3345 Full Text Show Details
Hart et al.
Tetrahedron Letters, 1971 , p. 3389 Full Text View citing articles Show Details
Kostromina et al.
Theoretical and Experimental Chemistry, 1975 , vol. 11, p. 469,471 Full Text Show Details
Lertes et al.
Zeitschrift fuer Naturforschung, Teil A: Astrophysik, Physik und Physikalische Chemie, 1966 , vol. 21, p. 1315 Full Text Show Details
Hargreaves; Kresheck
Journal of Physical Chemistry, 1969 , vol. 73, p. 3249 Full Text View citing articles Show Details
Katz; Miller
Journal of Physical Chemistry, 1972 , vol. 76, p. 2778 Full Text View citing articles Show Details
Hide facts
21 of 992
Show next 200 Comment (Pharmacological Data)
Bioactivities present
Reference
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2038 Full Text Show Details
Rabenstein et al.
Journal of Coordination Chemistry, 1973 , vol. 3, p. 263,267 Full Text Show Details
Braibanti et al.
Journal of the Chemical Society, Dalton Transactions: Inorganic Chemistry (1972-1999), 1975 , p. 1319 Full Text Show Details
Tomita et al.
Bulletin of the Chemical Society of Japan, 1973 , vol. 46, p. 2199,2203 Full Text Show Details
Groenewegen; Sachtler
Journal of Catalysis, 1974 , vol. 33, p. 176,178 Full Text Show Details
Steward et al.
Acta Crystallographica, Section B: Structural Crystallography and Crystal Chemistry, 1973 , vol. 29, p. 2825,2826 Full Text Show Details
Faurshov; Nielsen
Chemical Physics Letters, 1979 , vol. 66, p. 350 Full Text View citing articles Show Details
Tsang; Harrison
Journal of the American Chemical Society, 1976 , vol. 98, p. 1301,1303, 1304, 1307 Full Text View citing articles Show Details
Devine; Lowe
Journal of the Chemical Society [Section] A: Inorganic, Physical, Theoretical, 1971 , p. 2113 Full Text Show Details
Heilbronn; Carlsson
Journal of Chromatography, 1960 , vol. 4, p. 257,258, 259 Chem.Abstr., 1961 , # 5634 Full Text View citing articles Show Details
Pottel et al.
Berichte der Bunsen-Gesellschaft, 1975 , vol. 79, p. 278,279,281,282,284 Full Text Show Details
Edward; Farrell; Job
Journal of the American Chemical Society, 1974 , vol. 96, # 3 p. 902 - 906 Title/Abstract Full Text View citing articles Show Details
Sieskind
Comptes Rendus Hebdomadaires des Seances de l'Academie des Sciences, 1960 , vol. 250, p. 2228,2230 Full Text Show Details
Morgunova et al.
Doklady Biochemistry, 1964 , vol. 156, p. 162,163 p. 467 Full Text Show Details
Muenze et al.
Zeitschrift fuer Physikalische Chemie (Leipzig), 1969 , vol. 241, p. 240 Full Text Show Details
Alner et al.
Journal of the Chemical Society [Section] A: Inorganic, Physical, Theoretical, 1968 , p. 417,420 Full Text Show Details
Cultrera et al.
Gazzetta Chimica Italiana, 1962 , vol. 92, p. 519
Full Text Show Details
Ferrari; Cultrera
Gazzetta Chimica Italiana, 1960 , vol. 90, p. 1637,1643 Full Text Show Details
Schermeister et al.
Journal of the American Pharmaceutical Association, Scientific Edition, 1960 , vol. 49, p. 698 Full Text Show Details
Parker; Kirschenbaum
Spectrochimica Acta, 1960 , vol. 16, p. 910,912 Full Text Show Details
22 of 992
23 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Buzkus et al.
J. Gen. Chem. USSR (Engl. Transl.), 1962 , vol. 32, p. 738,735 Chem.Abstr., 1963 , vol. 58, # 5546 Full Text Show Details
Komamine
Suomen Kemistilehti B, 1960 , vol. 33, p. 185 Full Text Show Details
Bergner; Petri
Zeitschrift fuer Lebensmittel-Untersuchung und -Forschung, 1960 , vol. 111, p. 319 Chem.Abstr., 1960 , vol. 54, # 13534 Full Text Show Details
Bergner; Petri
Zeitschrift fuer Lebensmittel-Untersuchung und -Forschung, 1960 , vol. 111, p. 494 Chem.Abstr., 1960 , vol. 54, # 13534 Full Text Show Details
Ahluwalia et al.
Canadian Journal of Chemistry, 1977 , vol. 55, p. 3364 Full Text Show Details
Riva; Cultera
Annali di Chimica (Rome, Italy), 1971 , vol. 61, p. 624,626 Full Text Show Details
Kornhauser; Keglevic
Croatica Chemica Acta, 1967 , vol. 39, p. 285,287 Full Text Show Details
London et al.
Journal of the American Chemical Society, 1978 , vol. 100, p. 3723,3724,3725 Full Text View citing articles Show Details
Schuette et al.
Archiv der Pharmazie und Berichte der Deutschen Pharmazeutischen Gesellschaft, 1961 , vol. 294, p. 610,612,615 Full Text View citing articles Show Details
Kita; Kamiya
Chemical and Pharmaceutical Bulletin, 1962 , vol. 10, p. 1065,1069 Full Text Show Details
Hodgson et al.
Archives of Biochemistry, 1960 , vol. 87, p. 48 Chem.Abstr., 1960 , # 13472 Full Text View citing articles Show Details
Seiler et al.
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1967 , vol. 348, p. 675,678 Full Text Show Details
Muecke et al.
Journal fuer Praktische Chemie (Leipzig), 1961 , vol. 12, p. 161,162,167 Full Text Show Details
Linko
Suomen Kemistilehti B, 1960 , vol. 33, p. 145 Full Text Show Details
Ferrari; Cultrera
Gazzetta Chimica Italiana, 1960 , vol. 90, p. 1712,1714, 1715, 1718 Full Text Show Details
Pavolini et al.
Gazzetta Chimica Italiana, 1961 , vol. 91, p. 706,710, 714 Full Text Show Details
Parmentier; Vanderhaeghe
Journal of Chromatography, 1960 , vol. 4, p. 228,229-232 Chem.Abstr., 1961 , vol. 55, # 3305 Full Text Show Details
Howe
Journal of Chromatography, 1960 , vol. 3, p. 389,390-405 Chem.Abstr., 1961 , vol. 55, # 7267 Full Text Show Details
Biserte et al.
Journal of Chromatography, 1960 , vol. 3, p. 25,26-47 Chem.Abstr., 1960 , vol. 54, # 18651 Full Text Show Details
Miehl; Bachmayer
Monatshefte fuer Chemie, 1964 , vol. 95, p. 480,482 Chem.Abstr., 1962 , vol. 56, # 5380 Full Text Show Details
Comment
Bioactivities present
(Pharmacological Data)
24 of 992
Reference
Schrier; Robinson
The Journal of biological chemistry, 1971 , vol. 246, # 9 p. 2870 - 2874 Title/Abstract Full Text View citing articles Show Details
Hartmann et al.
Zeitschrift fuer Naturforschung, Teil A: Astrophysik, Physik und Physikalische Chemie, 1967 , vol. 22, p. 2118 Full Text Show Details
Cabani et al.
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1977 , vol. 73, p. 476,478 Full Text Show Details
Tsvetkov; Almanov
High Energy Chemistry, 1971 , vol. 5, p. 477 p. 537 Full Text Show Details
Jokobiec
Acta Poloniae Pharmaceutica, 1966 , vol. 23, p. 114,118, 119 Full Text Show Details
Moger; Nemesch
Acta Chimica Academiae Scientiarum Hungaricae, 1974 , vol. 80, p. 307,310 Full Text Show Details
Hikino et al.
Planta Medica, 1976 , vol. 30, p. 297,301 Full Text Show Details
Edward et al.
Journal of Physical Chemistry, 1973 , vol. 77, p. 2191,2194 Full Text Show Details
Kelley; Lilley
Journal of the Chemical Society, Faraday Transactions 1: Physical Chemistry in Condensed Phases, 1978 , vol. 74, p. 2771,2773-2775 Full Text Show Details
Huong; Cornut
Journal of Chemical Physics, 1976 , vol. 65, p. 4748 Full Text View citing articles Show Details
Lauria et al.
Justus Liebigs Annalen der Chemie, 1967 , vol. 706, p. 237 Full Text View citing articles Show Details
Christensen et al.
Journal of the American Chemical Society, 1968 , vol. 90, p. 5949 Full Text View citing articles Show Details
Applegate; Slutsky; Parker
Journal of the American Chemical Society, 1968 , vol. 90, # 25 p. 6909 - 6913 Title/Abstract Full Text View citing articles Show Details
Bernardelli et al.
Justus Liebigs Annalen der Chemie, 1967 , vol. 706, p. 243 Full Text View citing articles Show Details
Vanderbilt; Gaby; Rodwell
Journal of Biological Chemistry, 1975 , vol. 250, # 14 p. 5322 - 5329 Title/Abstract Full Text View citing articles Show Details
Jacob; Hesse; Shashoua
Journal of Medicinal Chemistry, 1990 , vol. 33, # 2 p. 733 - 736 Title/Abstract Full Text View citing articles Show Details
Hirota, Takashi; Sasaki, Kenji; Ohtomo, Hiromi; Uehara, Ayako; Nakayama, Taiji
Heterocycles, 1990 , vol. 31, # 1 p. 153 - 161 Title/Abstract Full Text View citing articles Show Details
Kukla; Breslin; Gill
Journal of Medicinal Chemistry, 1990 , vol. 33, # 1 p. 223 - 228 Title/Abstract Full Text View citing articles Show Details
Natarajan; Wadi; Gaur
Journal of Chemical and Engineering Data, 1990 , vol. 35, # 1 p. 87 - 93 Title/Abstract Full Text View citing articles Show Details
Pathak, Tanmaya; Thomas, Noel F.; Akhtar, Mahmoud; Gani, David
Tetrahedron, 1990 , vol. 46, # 5 p. 1733 - 1744 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Staubli, Andrea; Ron, Eyal; Langer, Robert
Journal of the American Chemical Society, 1990 , vol. 112, # 11 p. 4419 - 4424 Title/Abstract Full Text View citing articles Show Details
Denny, William A.; Atwell, Graham J.; Anderson, Robert F.; Wilson, William R.
Journal of Medicinal Chemistry, 1990 , vol. 33, # 5 p. 1288 - 1295 Title/Abstract Full Text View citing articles Show Details
Boberg; Kurz; Ploschke; Schmitt; Scholl; Schuller; Wunsche
Arzneimittel-Forschung/Drug Research, 1990 , vol. 40, # 5 p. 555 - 563 Title/Abstract Full Text View citing articles Show Details
Kolasa, Teodozyj; Miller, Marvin J.
Journal of Organic Chemistry, 1990 , vol. 55, # 14 p. 4246 - 4255 Title/Abstract Full Text View citing articles Show Details
Nacci; Fiorini; Garofalo; Cagnotto
Farmaco, 1990 , vol. 45, # 5 p. 545 - 557 Title/Abstract Full Text View citing articles Show Details
Ashirova, V. E.; Alekseev, S. M.; Evstigneeva, R. P.; Sarycheva, I. K.; Morozov, I. S.; et al.
Pharmaceutical Chemistry Journal, 1989 , vol. 23, # 7 p. 567 - 570
Khimiko-Farmatsevticheskii Zhurnal, 1989 , vol. 23, # 7 p. 817 - 819 Title/Abstract Full Text View citing articles Show Details
Sluka, James P.; Griffin, John H.; Mack, David P.; Dervan, Peter B.
Journal of the American Chemical Society, 1990 , vol. 112, # 17 p. 6369 - 6374 Title/Abstract Full Text View citing articles Show Details
Arnoldi, Anna; Bonsignori, Alberto; Melloni, Piero; Merlini, Lucio; Quadri, Maria Luisa; et al.
Journal of Medicinal Chemistry, 1990 , vol. 33, # 10 p. 2865 - 2869 Title/Abstract Full Text View citing articles Show Details
Kuznetsova; Voronina; Khromova; Garibova; Tosina; Stolyarova; Troitskaya; Smirnov
Pharmaceutical Chemistry Journal, 1990 , vol. 23, # 12 p. 943 - 949 Title/Abstract Full Text View citing articles Show Details
Askew, Benny C.
Tetrahedron Letters, 1990 , vol. 31, # 30 p. 4245 - 4248 Title/Abstract Full Text View citing articles Show Details
Mera, Ann E.; Griffith, James R.; Baum, Kurt
Journal of Fluorine Chemistry, 1990 , vol. 49, # 3 p. 313 - 320 Title/Abstract Full Text View citing articles Show Details
Ricci, Donata; Maggiali, Cesare A.; Morini, Giovanni; Ronchini, Ferdinando
Phytochemistry (Elsevier), 1990 , vol. 29, # 9 p. 2787 - 2791 Title/Abstract Full Text View citing articles Show Details
Oganesyan, E. T.; Gushchin, I. S.; Pershkov, S. R.; Saraf, A. S.
Pharmaceutical Chemistry Journal, 1989 , vol. 23, # 10 p. 852 - 856 Khimiko-Farmatsevticheskii Zhurnal, 1989 , vol. 23, # 10 p. 1238 - 1241 Title/Abstract Full Text View citing articles Show Details
Sasaki; Mori; Nakamura; Shibasaki
Journal of Medicinal Chemistry, 1991 , vol. 34, # 2 p. 628 - 633 Title/Abstract Full Text View citing articles Show Details
Tolstikov, V. V.; Kozlova, N. V.; Yartseva, I. V.; Dobrynin, Ya. V.; Sinyagina, E. A.; et al.
Pharmaceutical Chemistry Journal, 1990 , vol. 24, # 2 p. 128 - 131 Khimiko-Farmatsevticheskii Zhurnal, 1990 , vol. 24, # 2 p. 130 - 132 Title/Abstract Full Text View citing articles Show Details
Pisarskii, Yu. B.; Vvedenskii, V. Yu.; Voronkov, M. G.; Kazimirovskaya, V. B.; Kishkina, I. M.; et al.
Pharmaceutical Chemistry Journal, 1990 , vol. 24, # 1 p. 26 - 30 Khimiko-Farmatsevticheskii Zhurnal, 1990 , vol. 24, # 1 p. 23 - 26 Title/Abstract Full Text View citing articles Show Details
Fridman, Ya. D.; Kebets, N. M.; Nanaeva, M. T.; Zurdinov, A. Z.; Sabirova, T. S.; Atarskaya, L. I.
Pharmaceutical Chemistry Journal, 1989 , vol. 23, # 11 p. 879 - 883 Khimiko-Farmatsevticheskii Zhurnal, 1989 , vol. 23, # 11 p. 1310 - 1313 Title/Abstract Full Text View citing articles Show Details
Wang, Gary T.; Matayoshi, Edmund; Huffaker, H. Jan; Krafft, Grant A.
Tetrahedron Letters, 1990 , vol. 31, # 45 p. 6493 - 6496 Title/Abstract Full Text View citing articles Show Details
Tolstikov, G. A.; Galin, F. Z.; Lakeev, S. N.; Khalilov, L. M.; Sultanova, V. S.
Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation), 1990 , vol. 39, # 3.2 p. 535 - 541 Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya, 1990 , # 3 p. 612 - 620 Title/Abstract Full Text View citing articles Show Details
Mann; Boulanger; Brandau; Durant; Evrard; Heaulme; Desaulles; Wermuth
Journal of Medicinal Chemistry, 1991 , vol. 34, # 4 p. 1307 - 1313 Title/Abstract Full Text View citing articles Show Details
25 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Takasuka, Mamoru; Yamakawa, Masumi; Ohtani, Mitsuaki
Journal of Medicinal Chemistry, 1991 , vol. 34, # 6 p. 1885 - 1891 Title/Abstract Full Text View citing articles Show Details
Falch; Krogsgaard-Larsen
European Journal of Medicinal Chemistry, 1991 , vol. 26, # 1 p. 69 - 77 Title/Abstract Full Text View citing articles Show Details
Sundaramoorthi, Rajeswari; Marazano, Christian; Fourrey, Jean-Louis; Das, C. Bhupesh
Tetrahedron Letters, 1984 , vol. 25, # 30 p. 3191 - 3194 Title/Abstract Full Text View citing articles Show Details
Kathawala, F. G.; Schuster, H. F.; Shapiro, M. J.
Tetrahedron Letters, 1981 , vol. 22, # 38 p. 3703 - 3706 Title/Abstract Full Text View citing articles Show Details
Blade-Font, Artur
Tetrahedron Letters, 1980 , vol. 21, p. 2443 - 2446 Title/Abstract Full Text View citing articles Show Details
Leeper, Finian J.; Smith, David H.C.
Tetrahedron Letters, 1988 , vol. 29, # 11 p. 1325 - 1328 Title/Abstract Full Text View citing articles Show Details
Stevenson, David E.; Akhtar, Mahmoud; Gani, David
Tetrahedron Letters, 1986 , vol. 27, # 46 p. 5661 - 5664 Title/Abstract Full Text View citing articles Show Details
Mader, Mary; Helquist, Paul
Tetrahedron Letters, 1988 , vol. 29, # 25 p. 3049 - 3052 Title/Abstract Full Text View citing articles Show Details
Vinograd, L. Kh.; Suvorov, N. N.
Chemistry of Heterocyclic Compounds (New York, NY, United States), 1984 , vol. 20, # 9 p. 984 - 988 Khimiya Geterotsiklicheskikh Soedinenii, 1984 , vol. 20, # 9 p. 1206 - 1210 Title/Abstract Full Text View citing articles Show Details
Poritere, S. E.; Paegle, R. A.; Lidak, M. Yu.
Chemistry of Heterocyclic Compounds (New York, NY, United States), 1985 , vol. 21, # 1 p. 104 - 107 Khimiya Geterotsiklicheskikh Soedinenii, 1985 , vol. 21, # 1 p. 126 - 130 Title/Abstract Full Text View citing articles Show Details
Sloan; Koch
Journal of Heterocyclic Chemistry, 1985 , vol. 22, # 2 p. 429 - 432 Title/Abstract Full Text View citing articles Show Details
Madhav; Snyder; Southwick
Journal of Heterocyclic Chemistry, 1980 , vol. 17, # 6 p. 1231 - 1235 Title/Abstract Full Text View citing articles Show Details
Cordopatis, Paul; Belte, Urania; Theodoropoulos, Dimitrios; Bosse, Roger; Escher, Emanuel
Collection of Czechoslovak Chemical Communications, 1988 , vol. 53, # 11A p. 2599 - 2603 Title/Abstract Full Text Show Details
Langlois, Michel; Guilloneau, Claude; Van, Tri Vo; Jolly, Raymond; Maillard, Jacques
Journal of Heterocyclic Chemistry, 1983 , vol. 20, p. 393 - 398 Title/Abstract Full Text Show Details
Jeffrey, Paul D.; McCombie, Stuart W.
Journal of Organic Chemistry, 1982 , vol. 47, # 3 p. 587 - 590 Title/Abstract Full Text View citing articles Show Details
Arrieta, A.; Palomo, C.
Synthesis, 1982 , # 12 p. 1050 - 1052 Title/Abstract Full Text Show Details
Miller, Audrey E.; Bischoff, Judith J.
Synthesis, 1986 , # 9 p. 777 - 779 Title/Abstract Full Text Show Details
Joshi, Balawant S.; David, Joy; Gawad, Dilip H.
Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry, 1983 , vol. 22, # 2 p. 131 - 135 Title/Abstract Full Text Show Details
Nordlander, J. Eric; Payne, Mark J.; Balk, Michael A.; Gress, Julia L.; Harris, Frederick D.; et al.
Journal of Organic Chemistry, 1984 , vol. 49, p. 133 - 138 Title/Abstract Full Text View citing articles Show Details
Blankespoor, Ronald L.; Lau, Aldrich N. K.; Miller, Larry L.
Journal of Organic Chemistry, 1984 , vol. 49, # 23 p. 4441 - 4446 Title/Abstract Full Text View citing articles Show Details
26 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Marquez, Victor E.; Kelley, James A.; Driscoll, John S.
Journal of Organic Chemistry, 1980 , vol. 45, # 26 p. 5308 - 5312 Title/Abstract Full Text View citing articles Show Details
Kienlin, Markus von; Moonen, Chrit T. W.; Toorn, Annette van der; Zul, Peter C. M. van
Journal of Magnetic Resonance (1969-1992), 1991 , vol. 93, # 2 p. 423 - 429 Title/Abstract Full Text View citing articles Show Details
Berthelot; Vaccher; Flouquet; Debaert; Luyckx; Brunet
Journal of Medicinal Chemistry, 1991 , vol. 34, # 8 p. 2557 - 2560 Title/Abstract Full Text View citing articles Show Details
Berthelot; Vaccher; Flouquet; Luyckx; Brunet; Boulanger; Frippiat; Vercauteren; Debaert; Evrard; Durant
European Journal of Medicinal Chemistry, 1991 , vol. 26, # 4 p. 395 - 402 Title/Abstract Full Text View citing articles Show Details
Rahal, Said; Badache, Leila
Tetrahedron Letters, 1991 , vol. 32, # 31 p. 3847 - 3848 Title/Abstract Full Text View citing articles Show Details
Arnoldi; Merlini; Quadri; Bonsignori; Melloni; Varasi
Farmaco, 1991 , vol. 46, # 5 p. 629 - 638 Title/Abstract Full Text View citing articles Show Details
Caujolle, R; Payard, M; Loiseau, PR; Amarouch, H; Linas, MD; et al.
European Journal of Medicinal Chemistry, 1991 , vol. 26, # 7 p. 723 - 727 Title/Abstract Full Text View citing articles Show Details
Kovalev, G. V.; Vasil'eva, S. A.; Sazhin, V. A.; Kuleshova, I. P.; Batalina, I. N.
Pharmaceutical Chemistry Journal, 1991 , vol. 25, # 2 p. 86 - 89 Khimiko-Farmatsevticheskii Zhurnal, 1991 , vol. 25, # 2 p. 17 - 19 Title/Abstract Full Text View citing articles Show Details
Barton, D. H. R.; Hesse, R. H.; O'Sullivan, A. C.; Pechet, M. M.
Journal of Organic Chemistry, 1991 , vol. 56, # 23 p. 6697 - 6702 Title/Abstract Full Text View citing articles Show Details
Toja; Bonetti; Butti; Hunt; Fortin; Barzaghi; Formento; Maggioni; Nencioni; Galliani
European Journal of Medicinal Chemistry, 1991 , vol. 26, # 9 p. 853 - 868 Title/Abstract Full Text View citing articles Show Details
Nudelman, Abraham; Ruse, Margaretta; Aviram, Adina; Rabizadeh, Ester; Shaklai, Matityahu; et al.
Journal of Medicinal Chemistry, 1992 , vol. 35, # 4 p. 687 - 694 Title/Abstract Full Text View citing articles Show Details
Tsai, Ruey-Shiuan; Testa, Bernard; Tayar, Nabil El; Carrupt, Pierre-Alain
Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999), 1991 , # 11 p. 1797 - 1802 Title/Abstract Full Text View citing articles Show Details
Weber, Edwin; Finge, Stephan; Csoeregh, Ingeborg
Journal of Organic Chemistry, 1991 , vol. 56, # 26 p. 7281 - 7288 Title/Abstract Full Text View citing articles Show Details
Desideri; Galli; Sestili; Stein
Archiv der Pharmazie, 1992 , vol. 325, # 1 p. 29 - 33 Title/Abstract Full Text View citing articles Show Details
Falch; Krogsgaard-Larsen; Jacobsen; et al.
European Journal of Medicinal Chemistry, 1985 , vol. 20, # 5 p. 447 - 453 Title/Abstract Full Text View citing articles Show Details
Abdallah, Jassim M.; Moodie, Roy B.
Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999), 1983 , p. 1243 - 1250 Title/Abstract Full Text Show Details
Kirk, David N.; Miller, Barry W.
Journal of the Chemical Society, Perkin Transactions 1: Organic and Bio-Organic Chemistry (1972-1999), 1988 , p. 2979 - 2982
Title/Abstract Full Text View citing articles Show Details
Weber, Hans-Peter; Craven, B. M.; McMullan, R. K.; Nowell, I. W.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 360 - 366 Title/Abstract Full Text Show Details
Craven, B.M.; Weber, H.-P.
Acta Crystallographica, Section B: Structural Science, 1983 , vol. 39, p. 743 - 748 Title/Abstract Full Text Show Details
Wakamiya, T.; Kobayashi, Y.; Shiba, T.; Setogawa, K.; Matsutani, H.
Tetrahedron, 1984 , vol. 40, # 1 p. 235 - 240 Title/Abstract Full Text View citing articles Show Details
27 of 992
28 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Taylor, John S.; Schultz, Peter G.; Dervan, Peter B.
Tetrahedron, 1984 , vol. 40, # 3 p. 457 - 465 Title/Abstract Full Text View citing articles Show Details
Harada, Kaoru; Terasawa, Jun-ichi
Chemistry Letters, 1980 , p. 441 - 444 Title/Abstract Full Text Show Details
Terasawa, Jun-ichi; Harada, Kaoru
Chemistry Letters, 1980 , p. 73 - 76 Title/Abstract Full Text Show Details
Bartmann; Beck; Knolle; Rupp
Angewandte Chemie, 1980 , vol. 92, # 10 p. 850 - 855 Title/Abstract Full Text View citing articles Show Details
Steliou, Kosta; Szczygielska-Nowosielska, A.; Favre, A.; Poupart, M.A.; Hanessian, Stephen
Journal of the American Chemical Society, 1980 , vol. 102, # 25 p. 7578 - 7579 Title/Abstract Full Text View citing articles Show Details
Plouvier; Houssin; Bailly; Henichart
Journal of Heterocyclic Chemistry, 1989 , vol. 26, # 6 p. 1643 - 1647 Title/Abstract Full Text View citing articles Show Details
Hirayama; Kawase; Kimachi; Tanaka; Yoneda
Journal of Heterocyclic Chemistry, 1989 , vol. 26, # 5 p. 1255 - 1259 Title/Abstract Full Text View citing articles Show Details
Sundaramoorthi, Rajeswari; Fourrey, Jean-Louis; Das, Bhupesh C.
Journal of the Chemical Society, Perkin Transactions 1: Organic and Bio-Organic Chemistry (1972-1999), 1984 , p. 2759 - 2763 Title/Abstract Full Text View citing articles Show Details
Capraro, Hans-Georg; Lang, Marc; Schneider, Peter
Heterocycles, 1989 , vol. 28, # 2 p. 643 - 652 Title/Abstract Full Text View citing articles Show Details
Allison, Laura A.; Mayer, Ginny S.; Shoup, Ronald E.
Analytical Chemistry, 1984 , vol. 56, # 7 p. 1089 - 1096 Title/Abstract Full Text View citing articles Show Details
Dzhemilev, U. M.; Fakhretdinov, R. N.; Telin, A. G.
Journal of Organic Chemistry USSR (English Translation), 1986 , vol. 22, # 8 p. 1447 - 1456 Zhurnal Organicheskoi Khimii, 1986 , vol. 22, # 8 p. 1610 - 1619 Title/Abstract Full Text Show Details
Karpenko, E. P.; Mitsner, B. I.; Zvonkova, E. N.; Evstigneeva, R. P.
Journal of Organic Chemistry USSR (English Translation), 1984 , p. 1669 - 1673 Zhurnal Organicheskoi Khimii, 1984 , vol. 20, # 8 p. 1831 - 1835 Title/Abstract Full Text Show Details
Ermakov, A. I.; Pleshkova, A. P.; Sorokin, A. A.; Skachilova, S. Ya.; Pleshakov, M. G.; Zuev, A. P.
Journal of Organic Chemistry USSR (English Translation), 1985 , vol. 21, # 9 p. 1819 - 1825 Zhurnal Organicheskoi Khimii, 1985 , vol. 21, # 9 p. 1986 - 1993 Title/Abstract Full Text Show Details
Andreichikov, Yu. S.; Krylova, I. V.
Journal of Organic Chemistry USSR (English Translation), 1988 , vol. 24, # 10 p. 1995 - 1998 Zhurnal Organicheskoi Khimii, 1988 , vol. 24, # 10 p. 2212 - 2216 Title/Abstract Full Text Show Details
Lutsenko, V. V.; Klimavichyus, K.-A. V.
Journal of Organic Chemistry USSR (English Translation), 1985 , vol. 21, p. 1905 - 1908 Zhurnal Organicheskoi Khimii, 1985 , vol. 21, # 10 p. 2081 - 2085 Title/Abstract Full Text Show Details
Lever Jr.; Vestal
Journal of Heterocyclic Chemistry, 1986 , vol. 23, # 3 p. 901 - 903 Title/Abstract Full Text View citing articles Show Details
Witiak; Tomita; Patch; Enna
Journal of Medicinal Chemistry, 1981 , vol. 24, # 7 p. 788 - 794 Title/Abstract Full Text View citing articles Show Details
Allan; Johnston; Twitchin
Australian Journal of Chemistry, 1980 , vol. 33, # 5 p. 1115 - 1122 Title/Abstract Full Text View citing articles Show Details
Magnan, Sanne D. J.; Shirota, Frances N.; Nagasawa, Herbert T.
Journal of Medicinal Chemistry, 1982 , vol. 25, # 9 p. 1018 - 1021 Title/Abstract Full Text View citing articles Show Details
Erhardt; Woo; Gorczynski; Anderson
Journal of Medicinal Chemistry, 1982 , vol. 25, # 12 p. 1402 - 1407 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
29 of 992
Reference
Houssin, Raymond; Bernier, Jean-Luc; Henichart, Jean-Pierre
Synthesis, 1988 , # 3 p. 259 - 261 Title/Abstract Full Text Show Details
Barton, Henryk J.; Paluchowska, Maria H.; Mokrosz, Jerzy L.; Szneler, Edward
Synthesis, 1987 , # 2 p. 156 - 158 Title/Abstract Full Text Show Details
Zhmurenko, L. A.; Borisenko, S. A.; Glozman, O. M.; Ostrovskaya, R. U.; Burov, Yu. V.; Zagorevskii, V. A.
Pharmaceutical Chemistry Journal, 1980 , vol. 14, # 9 p. 612 - 617 Khimiko-Farmatsevticheskii Zhurnal, 1980 , vol. 14, # 9 p. 49 - 55 Title/Abstract Full Text View citing articles Show Details
Lavrova, L. N.; Shalyminova, Yu. A.; Klimova, N. V.; Artsimovich, N. G.
Pharmaceutical Chemistry Journal, 1982 , vol. 16, # 10 p. 757 - 760 Khimiko-Farmatsevticheskii Zhurnal, 1982 , vol. 16, # 10 p. 1197 - 1201 Title/Abstract Full Text View citing articles Show Details
Nagarajan, Kuppuswamy; Talwalker, Purnachard K.; Goud, A. Nagana; Shah, Rashmi K.; Shenoy, Sharada J.; Desai, Narasimha D.
Indian Journal of Chemistry, Section B: Organic Chemistry Including Medicinal Chemistry, 1988 , vol. 27, # 1-12 p. 1113 - 1123 Title/Abstract Full Text Show Details
Nielsen; Buchardt
Synthesis, 1991 , # 10 p. 819 - 821 Title/Abstract Full Text View citing articles Show Details
Ishizumi; Kojima; Antoku
Chemical and Pharmaceutical Bulletin, 1991 , vol. 39, # 9 p. 2288 - 2300 Title/Abstract Full Text View citing articles Show Details
Wadi, Ramesh K.; Goyal, Rma Kant
Journal of Solution Chemistry, 1992 , vol. 21, # 2 p. 163 - 170 Title/Abstract Full Text View citing articles Show Details
Huang; Dredar; Manneh; Blankenship; Fries
Journal of medicinal chemistry, 1992 , vol. 35, # 13 p. 2414 - 2418 Title/Abstract Full Text View citing articles Show Details
Zajac; Jelinska; Siwek
Pharmazie, 1992 , vol. 47, # 4 p. 264 - 265 Title/Abstract Full Text View citing articles Show Details
Brzezinski, Bogumil; Olejnik, Jerzy; Zundel, Georg
Journal of Molecular Structure, 1992 , vol. 270, p. 11 - 18 Title/Abstract Full Text View citing articles Show Details
Caswell; Guevara; Corley; Martinez; Hollis; Largess; Thornley
Synthesis, 1992 , # 9 p. 823 - 825 Title/Abstract Full Text View citing articles Show Details
Okamoto; Ohta
Chemical and Pharmaceutical Bulletin, 1980 , vol. 28, # 4 p. 1071 - 1076 Title/Abstract Full Text View citing articles Show Details
Daigo; Inamori; Takemoto
Chemical and Pharmaceutical Bulletin, 1986 , vol. 34, # 5 p. 2243 - 2246 Title/Abstract Full Text View citing articles Show Details
Itoh; Kori; Inada; Nishikawa; Kawamatsu; Sugihara
Chemical and Pharmaceutical Bulletin, 1986 , vol. 34, # 5 p. 2078 - 2089 Title/Abstract Full Text View citing articles Show Details
Nomoto, Shinya; Harada, Kaoru
Chemistry Letters, 1985 , p. 145 - 148 Title/Abstract Full Text Show Details
Ruys; Schacht
Bulletin des Societes Chimiques Belges, 1984 , vol. 93, # 6 p. 483 - 488 Title/Abstract Full Text View citing articles Show Details
Yamamoto, Yoshinori; Furuta, Toshiaki
Chemistry Letters, 1989 , p. 797 - 800 Title/Abstract Full Text Show Details
Kohama; Matsumoto; Mimura; Tanabe; Inada; Nakanishi
Chemical and Pharmaceutical Bulletin, 1987 , vol. 35, # 6 p. 2484 - 2489 Title/Abstract Full Text View citing articles Show Details
Kobayashi, Kensei; Oshima, Tairo; Yanagawa, Hiroshi
Chemistry Letters, 1989 , p. 1527 - 1530 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Wan, Peter; Modro, Tomasz A.; Yates, Keith
Canadian Journal of Chemistry, 1980 , vol. 58, p. 2423 - 2432 Title/Abstract Full Text Show Details
Krogsgaard-Larsen; Jacobsen; Brehm; et al.
European Journal of Medicinal Chemistry, 1980 , vol. 15, # 6 p. 529 - 535 Title/Abstract Full Text View citing articles Show Details
Gouesnard, Jean-Paul
Bulletin de la Societe Chimique de France, 1989 , # 1 p. 88 - 94 Title/Abstract Full Text Show Details
Ballatore; Beckner; Caprioli; Hoffman; Liehr
Steroids, 1983 , vol. 41, # 2 p. 197 - 206 Title/Abstract Full Text View citing articles Show Details
Chaboud; Debourcieu; Raynaud
Pharmazie, 1986 , vol. 41, # 1 p. 72 - 74 Title/Abstract Full Text View citing articles Show Details
Bhattacharyya, M. M.; Sengupta, M.
Zeitschrift fuer Physikalische Chemie (Muenchen, Germany), 1982 , vol. 133, p. 79 - 92 Title/Abstract Full Text Show Details
Luly; Rapoport
Journal of the American Chemical Society, 1983 , vol. 105, # 9 p. 2859 - 2866 Title/Abstract Full Text View citing articles Show Details
Steliou; Poupart
Journal of the American Chemical Society, 1983 , vol. 105, # 24 p. 7130 - 7138 Title/Abstract Full Text View citing articles Show Details
Schultz; Taylor; Dervan
Journal of the American Chemical Society, 1982 , vol. 104, # 24 p. 6861 - 6863 Title/Abstract Full Text View citing articles Show Details
Parker, Cass D.; Hercules, David M.
Analytical Chemistry, 1985 , vol. 57, # 3 p. 698 - 704 Title/Abstract Full Text View citing articles Show Details
Glozman, O. M.; Zhmurenko, L. A.; Shavyrina, V. V.; Sterligov, D. O.; Tsybina, N. M.; Vasil'ev, A. E.
J. Gen. Chem. USSR (Engl. Transl.), 1980 , vol. 50, # 7 p. 1640 - 1648,1339 - 1345 Title/Abstract Full Text Show Details
Kozyukov, V. P.; Mironova, N. V.
J. Gen. Chem. USSR (Engl. Transl.), 1980 , vol. 50, # 3 p. 620 - 626,504 - 509 Title/Abstract Full Text Show Details
Yanushyavichyute, R. P.; Paulyukonis, A. B.; Kazlauskas, D. A.
Chemistry of Natural Compounds, 1983 , vol. 19, # 3 p. 246 Khimiya Prirodnykh Soedinenii, 1983 , # 2 p. 246 - 247 Title/Abstract Full Text View citing articles Show Details
Schmidtchen, F. P.
Journal of Organic Chemistry, 1986 , vol. 51, # 26 p. 5161 - 5168 Title/Abstract Full Text View citing articles Show Details
Andrews; Craik; Martin
Journal of Medicinal Chemistry, 1984 , vol. 27, # 12 p. 1648 - 1657 Title/Abstract Full Text View citing articles Show Details
Mann; Humblet; Chambon; Schlichter; Desarmenien; Feltz; Wermuth
Journal of Medicinal Chemistry, 1985 , vol. 28, # 10 p. 1440 - 1446 Title/Abstract Full Text View citing articles Show Details
Hughes, David L.; Bergan, James J.; Grabowski, Edward J. J.
Journal of Organic Chemistry, 1986 , vol. 51, # 13 p. 2579 - 2585 Title/Abstract Full Text View citing articles Show Details
O'Donnell, John P.; Johnson, David A.; Azzaro, Albert J.
Journal of Medicinal Chemistry, 1980 , vol. 23, # 10 p. 1142 - 1144 Title/Abstract Full Text View citing articles Show Details
Ali, Fadia E.; Bondinell, William E.; Dandridge, Penelope A.; Frazee, James S.; Garvey, Eleanor; et al.
Journal of Medicinal Chemistry, 1985 , vol. 28, # 5 p. 653 - 660 Title/Abstract Full Text View citing articles Show Details
Blasko, Gabor; Kardos, Julianna; Baitz-Gacs, Eszter; Simonyi, Miklos; Szantay, Csaba
Heterocycles, 1986 , vol. 24, # 10 p. 2887 - 2900 Title/Abstract Full Text View citing articles Show Details
30 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Grinev, A. N.; Zotova, S. A.; Gololobova, T. M.
Pharmaceutical Chemistry Journal, 1985 , vol. 19, # 4 p. 261 - 264 Khimiko-Farmatsevticheskii Zhurnal, 1985 , vol. 19, # 4 p. 427 - 429 Title/Abstract Full Text View citing articles Show Details
Zakharova, E. I.; Lukinova, M. M.; Sarycheva, I. K.; Evstigneeva, R. P.; Shmuilovich, L. M.; et al.
Pharmaceutical Chemistry Journal, 1985 , vol. 19, # 9 p. 614 - 616 Khimiko-Farmatsevticheskii Zhurnal, 1985 , vol. 19, # 9 p. 1072 - 1074 Title/Abstract Full Text View citing articles Show Details
Ozerinina, T. V.; L'vova, M. Sh.; Kozlov, E. I.
Pharmaceutical Chemistry Journal, 1984 , vol. 18, # 7 p. 505 - 511 Khimiko-Farmatsevticheskii Zhurnal, 1984 , vol. 18, # 7 p. 865 - 870 Title/Abstract Full Text View citing articles Show Details
Fridman, Ya. D.; Sarbaev, Dzh. S.; Kebets, N. M.; Kopelevich, V. M.; Bulanova, L. N.; et al.
Pharmaceutical Chemistry Journal, 1983 , vol. 17, # 1 p. 32 - 36 Khimiko-Farmatsevticheskii Zhurnal, 1983 , vol. 17, # 1 p. 46 - 50 Title/Abstract Full Text View citing articles Show Details
Leonova; Nadeyskaya; Yashunskii
Pharmaceutical Chemistry Journal, 1988 , vol. 21, # 6 p. 430 - 434 Title/Abstract Full Text View citing articles Show Details
Melik-Ogandzhanyan, R. G.; Manukyan, A. G.; Mirzoyan, V. S.; Arsenyan, F. G.; Stepanyan, G. M.; Garibdzhanyan, B. T.
Pharmaceutical Chemistry Journal, 1985 , vol. 19, # 6 p. 398 - 401 Khimiko-Farmatsevticheskii Zhurnal, 1985 , vol. 19, # 6 p. 685 - 689 Title/Abstract Full Text View citing articles Show Details
Kovler, M. A.; Karaev, A. L.; Kopelevich, V. M.; Bulanova, L. N.; Rozanov, V. A.; et al.
Pharmaceutical Chemistry Journal, 1987 , vol. 21, # 9 p. 616 - 619 Khimiko-Farmatsevticheskii Zhurnal, 1987 , vol. 21, # 9 p. 1051 - 1054 Title/Abstract Full Text View citing articles Show Details
Petyunin, G. P.; Zaks, A. S.; Petyunina, V. N.; Dmitrievskaya, Zh. V.; Kapitonenko, T. A.
Pharmaceutical Chemistry Journal, 1988 , vol. 22, # 11 p. 838 - 840 Khimiko-Farmatsevticheskii Zhurnal, 1988 , vol. 22, # 11 p. 1329 - 1332 Title/Abstract Full Text View citing articles Show Details
Lebedev, A. A.; Mironova, L. I.; Pleshakov, M. G.; Matveeva, A. K.; Timokhina, I. A.
Pharmaceutical Chemistry Journal, 1985 , vol. 19, # 10 p. 697 - 700 Khimiko-Farmatsevticheskii Zhurnal, 1985 , vol. 19, # 10 p. 1205 - 1208 Title/Abstract Full Text View citing articles Show Details
Modnikova, G. A.; Titkova, R. M.; Glushkov, R. G.; Sokolova, A. S.; Silin, V. A.; Chernov, V. A.
Pharmaceutical Chemistry Journal, 1988 , vol. 22, # 2 p. 135 - 141 Khimiko-Farmatsevticheskii Zhurnal, 1988 , vol. 22, # 2 p. 185 - 191 Title/Abstract Full Text View citing articles Show Details
Golubev, A. A.; Shlykov, Yu. V.; Mandrugin, A. A.; Semenenko, M. N.; Fedoseev, V. M.; et al.
Pharmaceutical Chemistry Journal, 1986 , vol. 20, # 3 p. 189 - 190 Khimiko-Farmatsevticheskii Zhurnal, 1986 , vol. 20, # 3 p. 304 - 305 Title/Abstract Full Text View citing articles Show Details
Stezhko, T. V.; Granik, V. G.; Glushkov, R. G.; Roshchina, L. F.; Polezhaeva, A. I.; Mashkovskii, M. D.
Pharmaceutical Chemistry Journal, 1984 , vol. 18, # 3 p. 154 - 161 Khimiko-Farmatsevticheskii Zhurnal, 1984 , vol. 18, # 3 p. 290 - 297 Title/Abstract Full Text View citing articles Show Details
Nemeryuk, M. P.; Tolokontseva, L. A.; Yadrovskaya, V. A.; Polezhaeva, A. I.; Petrova, G. A.; et al.
Pharmaceutical Chemistry Journal, 1985 , vol. 19, # 7 p. 459 - 462 Khimiko-Farmatsevticheskii Zhurnal, 1985 , vol. 19, # 7 p. 810 - 814 Title/Abstract Full Text View citing articles Show Details
Kozlov, E. I.; L'vova, M. Sh.; Garber, N. I.
Pharmaceutical Chemistry Journal, 1988 , vol. 22, # 4 p. 328 - 333 Khimiko-Farmatsevticheskii Zhurnal, 1988 , vol. 22, # 4 p. 463 - 468 Title/Abstract Full Text View citing articles Show Details
Mazurov, A. A.; Andronati, S. A.; Korotenko, T. I.; Galatin, A. F.; Petrov, A. N.; Georgianova, E. K.
Pharmaceutical Chemistry Journal, 1987 , vol. 21, # 11 p. 760 - 764 Khimiko-Farmatsevticheskii Zhurnal, 1987 , vol. 21, # 11 p. 1310 - 1313 Title/Abstract Full Text View citing articles Show Details
Melikian; Schlewer; Chambon; Wermuth
Journal of Medicinal Chemistry, 1992 , vol. 35, # 22 p. 4092 - 4097 Title/Abstract Full Text View citing articles Show Details
Pavia, Michael R.; Lobbestael, Sandra J.; Nugiel, David; Mayhugh, Daniel R.; Gregor, Vlad E.; et al.
Journal of Medicinal Chemistry, 1992 , vol. 35, # 22 p. 4238 - 4248 Title/Abstract Full Text View citing articles Show Details
Ninomiya, Masaki; Matsuzaki, Toshiake; Shigematsu, Hitoshi
Bioscience, Biotechnology, and Biochemistry, 1992 , vol. 56, # 5 p. 806 - 807 Title/Abstract Full Text Show Details
Kinney; Lee; Garrison; Podlesny Jr.; Simmonds; Bramlett; Notvest; Kowal; Tasse
Journal of Medicinal Chemistry, 1992 , vol. 35, # 25 p. 4720 - 4726 Title/Abstract Full Text View citing articles Show Details
Sorokina, I. K.; Parshin, V. A.; Asnina, V. V.; Parimbetova, R. B.; Granik, V. G.
Pharmaceutical Chemistry Journal, 1992 , vol. 26, # 1 p. 53 - 57 Khimiko-Farmatsevticheskii Zhurnal, 1992 , vol. 26, # 1 p. 41 - 44 Title/Abstract Full Text View citing articles Show Details
31 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Bystryakova, I. D.; Losev, G. A.; Safonova, T. S.
Pharmaceutical Chemistry Journal, 1992 , vol. 26, # 1 p. 63 - 67 Khimiko-Farmatsevticheskii Zhurnal, 1992 , vol. 26, # 1 p. 48 - 51 Title/Abstract Full Text View citing articles Show Details
Selleri; Bruni; Costanzo; Guerrini; Malmberg Aiello; Iavarone; Martini
European Journal of Medicinal Chemistry, 1992 , vol. 27, # 9 p. 985 - 990 Title/Abstract Full Text View citing articles Show Details
Toong, Y. C.; Tai, S. P.; Pun, M. C.; Hynes, Rosemary C.; Khoo, L. E.; Smith, F. E.
Canadian Journal of Chemistry, 1992 , vol. 70, # 10 p. 2683 - 2687 Title/Abstract Full Text Show Details
Golebiewski; Spenser
Canadian Journal of Chemistry, 1988 , vol. 66, # 7 p. 1734 - 1748 Title/Abstract Full Text View citing articles Show Details
Ienaga; Higashiura; Kimura
Chemical and pharmaceutical bulletin, 1987 , vol. 35, # 3 p. 1249 - 1254 Title/Abstract Full Text View citing articles Show Details
Bismondo, Arturo; Rizzo, Luigi; Di Bernardo, Plinio; Zanonato, Pier Luigi
Journal of the Chemical Society, Dalton Transactions: Inorganic Chemistry (1972-1999), 1987 , p. 695 - 698 Title/Abstract Full Text View citing articles Show Details
Matsuyama; Yamashita; Noda; Goto; Ichimaru; Gomita
Chemical and Pharmaceutical Bulletin, 1984 , vol. 32, # 10 p. 4089 - 4095 Title/Abstract Full Text View citing articles Show Details
Lepori, Luciano; Mollica, Vincenzo
Zeitschrift fuer Physikalische Chemie (Muenchen, Germany), 1980 , vol. 123, p. 51 - 66 Title/Abstract Full Text Show Details
Sunol, Cristina; Artigas, Francesc; Tusell, Josep M.; Gelpi, Emilio
Analytical Chemistry, 1988 , vol. 60, p. 649 - 651 Title/Abstract Full Text View citing articles Show Details
Silverman; Durkee; Invergo
Journal of Medicinal Chemistry, 1986 , vol. 29, # 5 p. 764 - 770 Title/Abstract Full Text View citing articles Show Details
Allan; Dickenson; Johnston; et al.
Australian Journal of Chemistry, 1985 , vol. 38, # 11 p. 1651 - 1656 Title/Abstract Full Text View citing articles Show Details
Jacob; Shashoua; Campbell; Baldessarini
Journal of Medicinal Chemistry, 1985 , vol. 28, # 1 p. 106 - 110 Title/Abstract Full Text View citing articles Show Details
Krogsgaard-Larsen; Mikkelsen; Jacobsen; Falch; Curtis; Peet; Leah
Journal of Medicinal Chemistry, 1983 , vol. 26, # 6 p. 895 - 900 Title/Abstract Full Text View citing articles Show Details
Witiak, Donald T.; Patch, Raymond J.; Enna, S. J.; Fung, Yiu K.
Journal of Medicinal Chemistry, 1986 , vol. 29, # 1 p. 1 - 8 Title/Abstract Full Text View citing articles Show Details
Jacob; Hesse; Shashoua
Journal of Medicinal Chemistry, 1987 , vol. 30, # 9 p. 1573 - 1576
Title/Abstract Full Text View citing articles Show Details
Cates; Li; Yakshe; et al.
Journal of Medicinal Chemistry, 1984 , vol. 27, # 5 p. 654 - 659 Title/Abstract Full Text View citing articles Show Details
Shahsoua, Victor E.; Jacob, James N.; Ridge, Richard; Campbell, Alexander; Baldessarini, Ross J.
Journal of Medicinal Chemistry, 1984 , vol. 27, # 5 p. 659 - 664 Title/Abstract Full Text View citing articles Show Details
Farina; Pellegata; Pinza; Pifferi
Archiv der Pharmazie, 1981 , vol. 314, # 2 p. 108 - 117 Title/Abstract Full Text View citing articles Show Details
Sorba; Di Stilo; Gasco; Gili; Orsetti
Farmaco, 1992 , vol. 47, # 12 p. 1445 - 1455 Title/Abstract Full Text View citing articles Show Details
Hoefler; Kizilbash; Wamser
Synthetic Communications, 1993 , vol. 23, # 9 p. 1339 - 1349 Title/Abstract Full Text View citing articles Show Details
32 of 992
33 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Shinkai, Sheiji; Ishikawa, Yuichi; Shinkai, Hiroko; Tsuno, Takaharu; Makishima, Hiroki; et al.
Journal of the American Chemical Society, 1984 , vol. 106, # 6 p. 1801 - 1808 Title/Abstract Full Text View citing articles Show Details
Low, G. K.-C.; Duffield, A. M.
Organic Mass Spectrometry, 1985 , vol. 20, # 10 p. 595 - 599 Title/Abstract Full Text Show Details
Opitz; Schwiertz; Raddatz; Imberge
Arzneimittel-Forschung/Drug Research, 1981 , vol. 31, # 3 p. 402 - 403 Title/Abstract Full Text View citing articles Show Details
Haeusler, Johannes
Monatshefte fuer Chemie, 1987 , vol. 118, p. 865 - 870 Title/Abstract Full Text View citing articles Show Details
Krogsgaard-Larsen; Brehm; Schaumburg
1981 , vol. 35, # 5 B p. 311 - 324 Title/Abstract Full Text View citing articles Show Details
Berthelot; Vaccher; Musadad; Flouquet; Debaert; Luyckx
Journal of Medicinal Chemistry, 1987 , vol. 30, # 4 p. 743 - 746 Title/Abstract Full Text View citing articles Show Details
Appleton, Trevor G.; Hall, John R.; Ralph, Stephen F.
Australian Journal of Chemistry, 1986 , vol. 39, # 9 p. 1347 - 1362 Title/Abstract Full Text Show Details
Muller-Uri; Singer; Fleischhacker
Journal of Medicinal Chemistry, 1986 , vol. 29, # 1 p. 125 - 132 Title/Abstract Full Text View citing articles Show Details
Bergeron; Kline; Stolowich; et al.
Journal of Organic Chemistry, 1981 , vol. 46, # 22 p. 4524 - 4529 Title/Abstract Full Text View citing articles Show Details
Susse; Johne
Helvetica Chimica Acta, 1985 , vol. 68, # 4 p. 892 - 899 Title/Abstract Full Text View citing articles Show Details
Monig, Jorg; Chapman, Rita; Asmus, Klaus-Dieter
Journal of Physical Chemistry, 1985 , vol. 89, # 14 p. 3139 - 3144 Title/Abstract Full Text View citing articles Show Details
Mishra, Awadhesh K.; Ahluwalia, Jagdish C.
Journal of Physical Chemistry, 1984 , vol. 88, # 1 p. 86 - 92 Title/Abstract Full Text View citing articles Show Details
Hosseini, Mir Wais; Comarmond, Jacques; Lehn, Jean-Marie
Helvetica Chimica Acta, 1989 , vol. 72, p. 1066 - 1077 Title/Abstract Full Text Show Details
Rabiller, Claude; Danho, Doubou
Helvetica Chimica Acta, 1984 , vol. 67, p. 1254 - 1273 Title/Abstract Full Text Show Details
Bering; Muller
Arzneimittel-Forschung/Drug Research, 1985 , vol. 35, # 9 p. 1350 - 1372 Title/Abstract Full Text View citing articles Show Details
Otomo; Araki; Mori; Kurihara
Arzneimittel-Forschung/Drug Research, 1981 , vol. 31, # 9 p. 1511 - 1523 Title/Abstract Full Text View citing articles Show Details
Elz, Sigurd; Schunack, Walter
Zeitschrift fuer Naturforschung, B: Chemical Sciences, 1987 , vol. 42, # 2 p. 238 - 242 Title/Abstract Full Text Show Details
Lau, Aldrich N. K.; Miller, Larry L.; Zinger, Baruch
Journal of the American Chemical Society, 1983 , vol. 105, # 16 p. 5278 - 5284 Title/Abstract Full Text View citing articles Show Details
Vinnik, M. I.; Moiseev, Yu. V.
Bulletin of the Academy of Sciences of the USSR, Division of Chemical Science (English Translation), 1983 , vol. 32, # 4 p. 708 - 716 Izvestiya Akademii Nauk SSSR, Seriya Khimicheskaya, 1983 , # 4 p. 777 - 786 Title/Abstract Full Text View citing articles Show Details
Bourguignon; Schoenfelder; Schmitt; Wermuth; Hechler; Charlier; Maitre
Journal of Medicinal Chemistry, 1988 , vol. 31, # 5 p. 893 - 897 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological
Bioactivities present
Data)
34 of 992
Reference
Emori, Shuji; Noguchi, Toshihiko; Muto, Yoneichiro
Bulletin of the Chemical Society of Japan, 1985 , vol. 58, # 9 p. 2733 - 2734 Title/Abstract Full Text Show Details
Kawai, Masao; Kuwabara, Kyoko; Kimura, Ritsuko; Sekido, Sachiko
Bulletin of the Chemical Society of Japan, 1983 , vol. 56, # 1 p. 347 - 348 Title/Abstract Full Text Show Details
Bey, Philippe; Bolkenius, Frank N.; Seiler, Nikolaus; Casara, Patrick
Journal of Medicinal Chemistry, 1985 , vol. 28, # 1 p. 1 - 2 Title/Abstract Full Text View citing articles Show Details
Moran; Colman; Forsch; Rosowsky
Journal of Medicinal Chemistry, 1984 , vol. 27, # 10 p. 1263 - 1267 Title/Abstract Full Text View citing articles Show Details
Ogura, Haruo; Takeda, Kazuyoshi
Heterocycles, 1981 , vol. 15, # 1 p. 467 - 468 Title/Abstract Full Text Show Details
Jacobsen; Labouta; Schaumburg; Falch; Krogsgaard-Larsen
Journal of Medicinal Chemistry, 1982 , vol. 25, # 10 p. 1157 - 1162 Title/Abstract Full Text View citing articles Show Details
Dhumal; Gulati; Bhavsar
Journal of Pharmacy and Pharmacology, 1980 , vol. 32, # 10 p. 724 - 725 Title/Abstract Full Text View citing articles Show Details
Grigg, Ronald; Gunaratne, H. Q. Nimal; Sridharan, Visuvanathar
Journal of the Chemical Society, Chemical Communications, 1985 , # 17 p. 1183 - 1184 Title/Abstract Full Text View citing articles Show Details
Alfer'ev, I.S.; Mikhalin, N. V.
Bull. Russ. Acad. Sci. Div. Chem. Sci. (Engl. Transl.), 1992 , vol. 41, # 9 p. 2180 - 2183,1709 - 1711 Title/Abstract Full Text View citing articles Show Details
Covey; Hu; Bouley; Holland; Rodgers-Neame; Isenberg; Zorumski
Journal of medicinal chemistry, 1993 , vol. 36, # 5 p. 627 - 630 Title/Abstract Full Text View citing articles Show Details
Stauber, Margaret J.; Debiak-Krook, Therese; Miller, Marvin J.
Heterocycles, 1993 , vol. 35, # 2 p. 1205 - 1235 Title/Abstract Full Text View citing articles Show Details
Dobbin; Hider; Hall; Taylor; Sarpong; Porter; Xiao; Van der Helm
Journal of Medicinal Chemistry, 1993 , vol. 36, # 17 p. 2448 - 2458 Title/Abstract Full Text View citing articles Show Details
Topuzyan, V. O.; Nesunts, N. C.; Mndzhoyan, O. L.; Akopyan, A. Z.; Durgaryan, L. K.; et al.
Pharmaceutical Chemistry Journal, 1992 , vol. 26, # 7 p. 579 - 582 Khimiko-Farmatsevticheskii Zhurnal, 1992 , vol. 26, # 7-8 p. 31 - 34 Title/Abstract Full Text View citing articles Show Details
Zhao, G.-X.; Rieser, M. J.; Hui, Y.-H.; Miesbauer, L. R.; Smith, D. L.; McLaughlin, J. L.
Phytochemistry (Elsevier), 1993 , vol. 33, # 5 p. 1065 - 1074 Title/Abstract Full Text View citing articles Show Details
Kruper, William J.; Rudolf, Philip R.; Langhoff, Charles A.
Journal of Organic Chemistry, 1993 , vol. 58, # 15 p. 3869 - 3876 Title/Abstract Full Text View citing articles Show Details
Balaban, Alexandru T.; Dinculescu, Antonie; Elguero, Jose; Faure, Robert
Magnetic Resonance in Chemistry, 1985 , vol. 23, # 7 p. 553 - 558 Title/Abstract Full Text Show Details
Smith, Terence A.; Marshall, Jacqueline H. A.
Phytochemistry (Elsevier), 1988 , vol. 27, # 3 p. 703 - 710 Title/Abstract Full Text View citing articles Show Details
Seebach, Dieter; Renaud, Philippe
Helvetica Chimica Acta, 1985 , vol. 68, p. 2342 - 2349 Title/Abstract Full Text Show Details
Ramanujam, V. V.; Sivasankar, B.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1981 , vol. 20, # 7 p. 749 - 751 Title/Abstract Full Text Show Details
Nair, M. Sivasankaran; Santappa, M.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1981 , vol. 20, # 10 p. 990 - 993 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Janiri; Salera; Tempesta
Arzneimittel-Forschung/Drug Research, 1986 , vol. 36, # 12 p. 1721 - 1726 Title/Abstract Full Text View citing articles Show Details
Schlicker; Reimann; Gothert
Arzneimittel-Forschung/Drug Research, 1985 , vol. 35, # 9 p. 1347 - 1349 Title/Abstract Full Text View citing articles Show Details
Kardos; Blasko; Simonyi; Szantay Cs.
Arzneimittel-Forschung/Drug Research, 1984 , vol. 34, # 12 p. 1758 - 1759 Title/Abstract Full Text View citing articles Show Details
Il'ina, A. V.; Davidovich, Yu. A.; Ragozhin, S. V.
J. Gen. Chem. USSR (Engl. Transl.), 1984 , vol. 54, # 10 p. 2385 - 2389,2132 - 2134 Title/Abstract Full Text Show Details
Krogsgaard-Larsen, Povl; Nielsen, Lone; Falch, Erik; Curtis, David R.
Journal of Medicinal Chemistry, 1985 , vol. 28, # 11 p. 1612 - 1617 Title/Abstract Full Text View citing articles Show Details
Kimura, Eiichi; Fujioka, Haruto; Kodama, Mutsuo
Journal of the Chemical Society, Chemical Communications, 1986 , # 15 p. 1158 - 1159 Title/Abstract Full Text View citing articles Show Details
Ksander, Gary M.; Diefenbacher, Clive G.; Yuan, Andrew M.; Clark, F.; Sakane, Yumi; Ghai, R. D.
Journal of Medicinal Chemistry, 1989 , vol. 32, # 12 p. 2519 - 2526 Title/Abstract Full Text View citing articles Show Details
Holroyd, Stephen E.; Groves, Patrick; Searle, Mark S.; Gerhard, Ute; Williams, Dudley H.
Tetrahedron, 1993 , vol. 49, # 41 p. 9171 - 9182 Title/Abstract Full Text View citing articles Show Details
Chalikian, Tigran V.; Sarvazyan, Armen P.; Breslauer, Kenneth J.
Journal of Physical Chemistry, 1993 , vol. 97, # 49 p. 13017 - 13026 Title/Abstract Full Text View citing articles Show Details
Valerio, Christine; Labarre, Marie-Christine; Labarre, Jean-Francois
Journal of Molecular Structure, 1993 , vol. 299, p. 171 - 176 Title/Abstract Full Text View citing articles Show Details
Boswell, Henry D.; Watson, Allan B.; Walton, Nicholas J.; Robins, David J.
Phytochemistry (Elsevier), 1993 , vol. 34, # 1 p. 153 - 156 Title/Abstract Full Text View citing articles Show Details
Bond, Timothy J.; Jenkins, Robert; Ridley, Andrew C.; Taylor, Paul C.
Journal of the Chemical Society, Perkin Transactions 1: Organic and Bio-Organic Chemistry (1972-1999), 1993 , # 19 p. 2241 - 2242 Title/Abstract Full Text View citing articles Show Details
Hamdi, Maamar; Granier, Patrick; Sakellariou, Reine; Speziale Vincent
Journal of Heterocyclic Chemistry, 1993 , vol. 30, # 4 p. 1155 - 1158 Title/Abstract Full Text Show Details
Satzinger
Arzneimittel-Forschung/Drug Research, 1994 , vol. 44, # 3 p. 261 - 266 Title/Abstract Full Text View citing articles Show Details
Takahashi; Sakai; Tsuchida
Bulletin of the Chemical Society of Japan, 1993 , vol. 66, # 12 p. 3589 - 3592 Title/Abstract Full Text View citing articles Show Details
Dado; Gellman
Journal of the American Chemical Society, 1994 , vol. 116, # 3 p. 1054 - 1062 Title/Abstract Full Text View citing articles Show Details
Brandariz, I.; Fiol, S.; Herrero, R.; Vilarino, T.; Vicente, M. Sastre de
Journal of Chemical & Engineering Data, 1993 , vol. 38, # 4 p. 531 - 533 Title/Abstract Full Text View citing articles Show Details
Ramanujam, V. V.; Sivasankar, B.
Journal of the Indian Chemical Society, 1981 , vol. 58, p. 1152 - 1153 Title/Abstract Full Text Show Details
Maggiali; Mingiardi; Branca; Ricci
Farmaco, Edizione Scientifica, 1983 , vol. 38, # 12 p. 935 - 939 Title/Abstract Full Text View citing articles Show Details
Lal, Kasturi; Koley, Panna Lal; Ray, Suprabhat
Journal of the Indian Chemical Society, 1986 , vol. 63, p. 432 - 434 Title/Abstract Full Text Show Details
35 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Ramanujam, V. V.; Sivasankar, B.
Journal of the Indian Chemical Society, 1985 , vol. 62, # 10 p. 734 - 735 Title/Abstract Full Text Show Details
Bhattacharya, M. M.; Sengupta, M.
Journal of the Indian Chemical Society, 1985 , vol. 62, p. 959 - 964 Title/Abstract Full Text Show Details
Ramanujam, V. V.; Rengaraj, K.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1980 , vol. 19, # 4 p. 382 - 384 Title/Abstract Full Text Show Details
Chekhlov, A. N.; Tatarinov, A. S.; Rapkin, A. I.; Studnev, Yu. N.; Martynov, I. V.; Fokin, A. V.
Doklady Chemistry, 1987 , vol. 294, p. 285 - 288 Dokl. Akad. Nauk SSSR Ser. Khim., 1987 , vol. 294, # 5 p. 1140 - 1143 Title/Abstract Full Text Show Details
Nagase; Kuwahara; Tominaga; Sugawara
Agricultural and Biological Chemistry, 1982 , vol. 46, # 1 p. 167 - 172 Title/Abstract Full Text View citing articles Show Details
Mori, Michiko; Shiio, Isamu
Agricultural and Biological Chemistry, 1983 , vol. 47, # 5 p. 983 - 990 Title/Abstract Full Text Show Details
Tashiro; Sugita; Iwasa; Sawada
Agricultural and Biological Chemistry, 1984 , vol. 48, # 4 p. 881 - 885 Title/Abstract Full Text View citing articles Show Details
Bhattacharya; Sarkar
Journal of Pharmacy and Pharmacology, 1986 , vol. 38, # 2 p. 144 - 146 Title/Abstract Full Text View citing articles Show Details
Borea; Bonora; Baraldi; Simoni
Farmaco, Edizione Scientifica, 1983 , vol. 38, # 6 p. 411 - 417 Title/Abstract Full Text View citing articles Show Details
Deverre; Loiseau; Couvreur; Letourneux; Gayral; Benoit
Journal of Pharmacy and Pharmacology, 1989 , vol. 41, # 3 p. 191 - 193 Title/Abstract Full Text View citing articles Show Details
Ikura, Yoko; Horikoshi, Koki
Agricultural and Biological Chemistry, 1987 , vol. 51, # 11 p. 3143 - 3146 Title/Abstract Full Text Show Details
Minano; Sancibrian; Serrano
Journal of Pharmacy and Pharmacology, 1987 , vol. 39, # 9 p. 721 - 726 Title/Abstract Full Text View citing articles Show Details
Desmaison, A. M.; Marcher, M. H.; Tixier, M.
Phytochemistry (Elsevier), 1984 , vol. 23, # 11 p. 2453 - 2456
Title/Abstract Full Text View citing articles Show Details
Ishibashi, Norio; Kouge, Katsushige; Shinoda,Ichizo; Kanehisa, Hidenori; Okai, Hideo
Agricultural and Biological Chemistry, 1988 , vol. 52, # 3 p. 819 - 828 Title/Abstract Full Text Show Details
Minano; Serrano; Duran; Sancibrian
Journal of Pharmacy and Pharmacology, 1985 , vol. 37, # 9 p. 675 - 677 Title/Abstract Full Text View citing articles Show Details
Kaplan; Raizon; Desarmenien; Feltz; Headley; Worms; Lloyd; Bartholini
Journal of Medicinal Chemistry, 1980 , vol. 23, # 6 p. 702 - 704 Title/Abstract Full Text View citing articles Show Details
Toja; Parini; Bonetti; Hunt; Fortin; Barzaghi; Cesana; Maggioni; Nencioni; Galliani
Arzneimittel-Forschung/Drug Research, 1994 , vol. 44, # 4 p. 501 - 509 Title/Abstract Full Text View citing articles Show Details
Van Vranken, David L.; Panomitros, Demetra; Schultz, Peter G.
Tetrahedron Letters, 1994 , vol. 35, # 23 p. 3873 - 3876 Title/Abstract Full Text View citing articles Show Details
Fabre, Jean; Paul, Francois; Monsan, Pierre; Blonski, Casimir; Perie, Jacques
Tetrahedron Letters, 1994 , vol. 35, # 21 p. 3535 - 3536 Title/Abstract Full Text View citing articles Show Details
Unangst, Paul C.; Connor, David T.; Cetenko, Wiaczeslaw A.; Sorenson, Roderick J.; Kostlan, Catherine R.; et al.
Journal of Medicinal Chemistry, 1994 , vol. 37, # 2 p. 322 - 328 Title/Abstract Full Text View citing articles Show Details
36 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Basiuk, V. A.; Gromovoy, T. Yu.; Khil'chevskaya, E. G.
Polish Journal of Chemistry, 1994 , vol. 68, # 4 p. 777 - 782 Title/Abstract Full Text Show Details
Toyokuni; Dean; Cai; Boivin; Hakomori; Singhal
Journal of the American Chemical Society, 1994 , vol. 116, # 1 p. 395 - 396 Title/Abstract Full Text View citing articles Show Details
Colotta; Cecchi; Catarzi; Filacchioni; Galli; Mori
European Journal of Medicinal Chemistry, 1994 , vol. 29, # 2 p. 95 - 105 Title/Abstract Full Text View citing articles Show Details
Huang; Quada Jr.; Lown
Tetrahedron Letters, 1994 , vol. 35, # 30 p. 5323 - 5326 Title/Abstract Full Text View citing articles Show Details
Ramachandran; Eswaramoorthy; Sureshkumar
Tetrahedron, 1994 , vol. 50, # 31 p. 9495 - 9504 Title/Abstract Full Text View citing articles Show Details
Rehse; Seidel
Archiv der Pharmazie, 1994 , vol. 327, # 6 p. 399 - 404 Title/Abstract Full Text View citing articles Show Details
Tsuzuki; Hama; Kawada; Hasui; Konishi; Shiwa; Ochi; Futaki; Kitagawa
Journal of Pharmaceutical Sciences, 1994 , vol. 83, # 4 p. 481 - 484 Title/Abstract Full Text View citing articles Show Details
Dhar; Borden; Tyagarajan; Smith; Branchek; Weinshank; Gluchowski
Journal of Medicinal Chemistry, 1994 , vol. 37, # 15 p. 2334 - 2342 Title/Abstract Full Text View citing articles Show Details
Martin, David P.; Bibart, Richard T.; Drueckhammer, Dale G.
Journal of the American Chemical Society, 1994 , vol. 116, # 11 p. 4660 - 4668 Title/Abstract Full Text View citing articles Show Details
De Vos; Slegers
Journal of Labelled Compounds and Radiopharmaceuticals, 1994 , vol. 34, # 7 p. 643 - 652 Title/Abstract Full Text View citing articles Show Details
Gastaldi, G.; Focher, B.; Guerrini, M.; Alonso, D.
Journal of Carbohydrate Chemistry, 1994 , vol. 13, # 7 p. 1009 - 1024 Title/Abstract Full Text Show Details
Sakamoto, Masatomi; Ishimori, Tomitaro; Okawa, Hisashi
Bulletin of the Chemical Society of Japan, 1988 , vol. 61, p. 3319 - 3320 Title/Abstract Full Text Show Details
Varasi; Tarzia; Luzzani; Gallico; Barone
Farmaco, Edizione Scientifica, 1987 , vol. 42, # 6 p. 425 - 435 Title/Abstract Full Text View citing articles Show Details
Spencer; Lynch; Bliss
The Journal of pharmacy and pharmacology, 1986 , vol. 38, # 5 p. 393 - 395 Title/Abstract Full Text View citing articles Show Details
Srivastava, R. C.; Bhise, S. B.
Journal of the Indian Chemical Society, 1983 , vol. 60, p. 1135 - 1141 Title/Abstract Full Text Show Details
Singh, Bharat; Singh, Ashok Kumar; Singh, Jitendra Pratap
Journal of the Indian Chemical Society, 1983 , vol. 60, p. 704 - 705 Full Text Show Details
Molina, Pedro; Obon, Rosario; Conesa, Carlota; Arques, Antonio; Desamparados Velasco, M. de los; et al.
Chemische Berichte, 1994 , vol. 127, # 9 p. 1641 - 1652 Title/Abstract Full Text Show Details
Sokolova, N. Yu.; Kuznetsov, V. A.; Petrovskaya, O. G.; Garabadzhiu, A. V.; Ginak, A. I.
Russian Journal of Organic Chemistry, 1993 , vol. 29, # 7.2 p. 1211 - 1217 Zhurnal Organicheskoi Khimii, 1993 , vol. 29, # 7 p. 1456 - 1464 Title/Abstract Full Text Show Details
Barnes; Costall; Naylor
The Journal of pharmacy and pharmacology, 1988 , vol. 40, # 8 p. 548 - 551 Title/Abstract Full Text View citing articles Show Details
Murav'ev, D. H.; Obrezkov, O. N.
Russian Journal of Physical Chemistry, 1986 , vol. 60, # 2 p. 232 - 235 Zhurnal Fizicheskoi Khimii, 1986 , vol. 60, p. 396 - 401 Title/Abstract Full Text Show Details
37 of 992
38 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Paglietti, Giuseppe; Loriga, Mario
Journal of Chemical Research, Miniprint, 1986 , # 8 p. 2471 - 2491 Title/Abstract Full Text Show Details
Misra, Sudhindra N.; Joshi, G. K.; Bhutra, M. P.
Indian Journal of Chemistry, Section A: Inorganic, Physical, Theoretical & Analytical, 1982 , vol. 21, # 3 p. 275 - 278 Title/Abstract Full Text Show Details
Bismondo, A.; Casellato, U.; Forsellini, E.; Graziani, R.
Journal of Crystallographic and Spectroscopic Research, 1985 , vol. 15, # 3 p. 257 - 262 Title/Abstract Full Text View citing articles Show Details
Fini; De Maria; Guarnieri; Varoli
Journal of Pharmaceutical Sciences, 1987 , vol. 76, # 1 p. 48 - 52 Title/Abstract Full Text View citing articles Show Details
Yorifuji, Takamitsu; Kato, Masashi; Kobayashi, Tohru; Ozaki, Sinzo; Ueno, Shigenori
Agricultural and Biological Chemistry, 1980 , vol. 44, # 5 p. 1127 - 1134 Title/Abstract Full Text Show Details
Fargeas; Fioramonti; Bueno
Journal of Pharmacy and Pharmacology, 1984 , vol. 36, # 2 p. 130 - 132 Title/Abstract Full Text View citing articles Show Details
Yorifuji, Takamitsu; Sugai, Ichiro; Matsumoto, Hideki; Tabuchi, Akira
Agricultural and Biological Chemistry, 1982 , vol. 46, # 5 p. 1361 - 1368 Title/Abstract Full Text Show Details
Oriowo
Journal of Pharmacy and Pharmacology, 1983 , vol. 35, # 8 p. 511 - 515 Title/Abstract Full Text View citing articles Show Details
Girdhar; Dhumal; Gulati; Bhavsar; Hemavathi
Journal of Pharmacy and Pharmacology, 1981 , vol. 33, # 9 p. 614 - 615 Title/Abstract Full Text View citing articles Show Details
Santicioli; Maggi; Meli
Journal of Pharmacy and Pharmacology, 1984 , vol. 36, # 6 p. 378 - 381 Title/Abstract Full Text View citing articles Show Details
Burleigh
Journal of Pharmacy and Pharmacology, 1983 , vol. 35, # 4 p. 258 - 260 Title/Abstract Full Text View citing articles Show Details
Zoh, Kyung Duk; Lee, Sang Ho; Suh, Junghun
Bioorganic Chemistry, 1994 , vol. 22, # 3 p. 242 - 252 Title/Abstract Full Text View citing articles Show Details
Ponpipom, Mitree M.; Girotra, Narindar N.; Bugianesi, Robert L.; Roberts, Cathleen D.; Berger, Gregory D.; et al.
Journal of Medicinal Chemistry, 1994 , vol. 37, # 23 p. 4031 - 4051 Title/Abstract Full Text View citing articles Show Details
Bunting, John W.; Mason, Jacqueline M.; Heo, Christina K. M.
Journal of the Chemical Society, Perkin Transactions 2: Physical Organic Chemistry (1972-1999), 1994 , # 11 p. 2291 - 2300 Title/Abstract Full Text View citing articles Show Details
Tressl, Roland; Wondrak, Georg; Kersten, Evelyn; Rewicki, Dieter
Journal of Agricultural and Food Chemistry, 1994 , vol. 42, # 12 p. 2692 - 2697 Title/Abstract Full Text View citing articles Show Details
Kochergin, P. M.; Lifanov, V. A.
Chemistry of Heterocyclic Compounds (New York, NY, United States), 1994 , vol. 30, # 4 p. 429 - 433 Khimiya Geterotsiklicheskikh Soedinenii, 1994 , # 4 p. 490 - 494 Title/Abstract Full Text View citing articles Show Details
Murayama, Toshiyuki; Kobayashi, Toyohiko; Miura, Takashi
Tetrahedron Letters, 1995 , vol. 36, # 21 p. 3703 - 3706 Title/Abstract Full Text View citing articles Show Details
Leeper, Finian J.; Smith, David H. C.
Journal of the Chemical Society, Perkin Transactions 1: Organic and Bio-Organic Chemistry (1972-1999), 1995 , # 7 p. 861 - 874 Title/Abstract Full Text View citing articles Show Details
Contineanu, Iulia; Marchidan, Dumitru I.
Revue Roumaine de Chimie, 1994 , vol. 39, # 12 p. 1391 - 1395 Title/Abstract Full Text Show Details
Hall, Roger G.; Kane, Peter D.; Bittiger, Helmut; Froestl, Wolfgang
Journal of Labelled Compounds and Radiopharmaceuticals, 1995 , vol. 36, # 2 p. 129 - 136 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Leydet, A.; Barthelemy, Ph.; Boyer, B.; Lamaty, G.; Rogue, J. P.; et al.
Journal of Medicinal Chemistry, 1995 , vol. 38, # 13 p. 2433 - 2440 Title/Abstract Full Text View citing articles Show Details
Mossine; Glinsky; Feather
Carbohydrate Research, 1994 , vol. 262, # 2 p. 257 - 270 Title/Abstract Full Text View citing articles Show Details
Okada, Shigeto; Yamashita, Senichi; Furuta, Toshiaki; Iwamura, Michiko
Photochemistry and Photobiology, 1995 , vol. 61, # 5 p. 431 - 434 Title/Abstract Full Text Show Details
Lurie, E. Yu.; Kaplun, A. P.; Kulakov, V. N.; Shvets, V. I.
Russian Journal of Bioorganic Chemistry, 1995 , vol. 21, # 4 p. 264 - 268
Bioorganicheskaya Khimiya, 1995 , vol. 21, # 4 p. 308 - 312 Title/Abstract Full Text Show Details
Froelund, Bente; Kristiansen, Uffe; Brehm, Lotte; Hansen, Annette B.; Krogsgaard-Larsen, Povl; Falch, Erik
Journal of Medicinal Chemistry, 1995 , vol. 38, # 17 p. 3287 - 3296 Title/Abstract Full Text View citing articles Show Details
Froestl; Mickel; Hall; Von Sprecher; Strub; Baumann; Brugger; Gentsch; Jaekel; Olpe; Rihs; Vassout; Waldmeier; Bittiger
Journal of Medicinal Chemistry, 1995 , vol. 38, # 17 p. 3297 - 3312 Title/Abstract Full Text View citing articles Show Details
Ektova, L.V.; Yartseva, I.V.; Khorosheva, E.V.; Ivanova, T.P.; Yavorskaya, N.P.; Melnik, S.Ya.
Russian Journal of Bioorganic Chemistry, 1995 , vol. 21, # 8 p. 540 - 546 Bioorganicheskaya Khimiya, 1995 , vol. 21, # 8 p. 625 - 631 Title/Abstract Full Text Show Details
Cinotti; Le Bars; Garcia-Larrea; Peyron; Gregoire; Lavenne; Krogsgaard-Larsen; Comar; Mauguiere
Journal de Chimie Physique et de Physico-Chimie Biologique, 1996 , vol. 93, # 1 p. 48 - 52 Title/Abstract Full Text View citing articles Show Details
Jelinska, Anna; Zaja, Marianna
Pharmazie, 1996 , vol. 51, # 3 p. 162 - 164 Title/Abstract Full Text View citing articles Show Details
Gee, Kyle R.; Kueper III, L. William; Barnes, Jeffrey; Dudley, Gregory; Givens, Richard S.
Journal of Organic Chemistry, 1996 , vol. 61, # 4 p. 1228 - 1233 Title/Abstract Full Text View citing articles Show Details
Kieczykowski; Jobson; Melillo; Reinhold; Grenda; Shinkai
Journal of Organic Chemistry, 1995 , vol. 60, # 25 p. 8310 - 8312 Title/Abstract Full Text View citing articles Show Details
Ishizumi; Kojima; Antoku; Saji; Yoshigi
Chemical and Pharmaceutical Bulletin, 1995 , vol. 43, # 12 p. 2139 - 2151 Title/Abstract Full Text View citing articles Show Details
Han; Hu; Zorumski; Covey
Journal of Medicinal Chemistry, 1995 , vol. 38, # 22 p. 4548 - 4556 Title/Abstract Full Text View citing articles Show Details
Lurie, E. Yu.; Mosina, E. M.; Efremova, A. A.; Kaplun, A. P.; Shvets, V. I.
Russian Journal of Bioorganic Chemistry, 1995 , vol. 21, # 8 p. 520 - 523 Bioorganicheskaya Khimiya, 1995 , vol. 21, # 8 p. 604 - 607 Title/Abstract Full Text Show Details
Cottam, Howard B.; Shih, Hsiencheng; Tehrani, Lida R.; Wasson, D. Bruce; Carson, Dennis A.
Journal of Medicinal Chemistry, 1996 , vol. 39, # 1 p. 2 - 9 Title/Abstract Full Text View citing articles Show Details
Shah; Izenwasser; Geter-Douglass; Witkin; Newman
Journal of medicinal chemistry, 1995 , vol. 38, # 21 p. 4284 - 4293 Title/Abstract Full Text View citing articles Show Details
Makovec, Francesco; Peris, Walter; Frigerio, Sandra; Giovanetti, Roberto; Letari, Ornella; Mennuni, Laura; Revel, Laura
Journal of Medicinal Chemistry, 1996 , vol. 39, # 1 p. 135 - 142 Title/Abstract Full Text View citing articles Show Details
Stute; Furman; Schell; Evans
Journal of Pharmaceutical Sciences, 1995 , vol. 84, # 7 p. 824 - 828 Title/Abstract Full Text View citing articles Show Details
Lal, Bansi; Gangopadhyay
Tetrahedron Letters, 1996 , vol. 37, # 14 p. 2483 - 2486 Title/Abstract Full Text View citing articles Show Details
Porcelli, Fernando; Scibona, Gianearlo; Boire, Francesco; Lorenti, Giampiero; Mazzel, Franco; Botre, Claudio
Berichte der Bunsengesellschaft/Physical Chemistry Chemical Physics, 1996 , vol. 100, # 5 p. 671 - 679 Title/Abstract Full Text View citing articles Show Details
39 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Gillespie, S. E.; Oscarson, J. L.; Izatt, R. M.; Wang, P.; Renuncio, J. A. R.; Pando, C.
Journal of Solution Chemistry, 1995 , vol. 24, # 12 p. 1219 - 1248 Title/Abstract Full Text View citing articles Show Details
Narasimhan, Chakravarthy; Lai, Ching-San; Joseph, Joy
Bioorganic Chemistry, 1996 , vol. 24, # 1 p. 50 - 58 Title/Abstract Full Text View citing articles Show Details
Soler, Francoise; Poujade, Christele; Evers, Michel; Carry, Jean-Christophe; Henin, Yvette; Bousseau, Anne; Huet, Thierry; Pauwels, Rudi; De Clercq, Erik; Mayaux, Jean-Francois; Le Pecq, Jean-Bernard; Dereu, Norbert
Journal of Medicinal Chemistry, 1996 , vol. 39, # 5 p. 1069 - 1083 Title/Abstract Full Text View citing articles Show Details
Topuzyan, V. O.; Akopyan, A. Z.; Durgaryan, L. K.; Vlasenko, E. V.; Paronikyan, R. G.; et al.
Pharmaceutical Chemistry Journal, 1995 , vol. 29, # 3 p. 200 - 202 Khimiko-Farmatsevticheskii Zhurnal, 1995 , vol. 29, # 3 p. 42 - 44 Title/Abstract Full Text Show Details
Isakovich, I. P.; Azimov, V. A.; Ryabova, S. Yu.; Alekseeva, L. M.; Parshin, V. P.; et al.
Pharmaceutical Chemistry Journal, 1995 , vol. 29, # 2 p. 100 - 105 Khimiko-Farmatsevticheskii Zhurnal, 1995 , vol. 29, # 2 p. 22 - 26 Title/Abstract Full Text Show Details
Castronuovo, Giuseppina; Elia, Vittorio; Velleca, Filomena
Journal of the Chemical Society - Faraday Transactions, 1996 , vol. 92, # 17 p. 3093 - 3096 Title/Abstract Full Text View citing articles Show Details
Rekatas, George V.; Tani, Ekaterini; Demopoulos, Vassilis J.; Kourounakis, Panos N.
Archiv der Pharmazie, 1996 , vol. 329, # 8-9 p. 393 - 398 Title/Abstract Full Text View citing articles Show Details
Coe, Seth; Kane, John J.; Nguyen, Tam Luong; Toledo, Leticia M.; Wininger, Eric; Fowler, Frank W.; Lauher, Joseph W.
Journal of the American Chemical Society, 1997 , vol. 119, # 1 p. 86 - 93 Title/Abstract Full Text View citing articles Show Details
Moll-Navarro; Merino; Casabo; Nacher; Polache
Journal of Pharmaceutical Sciences, 1996 , vol. 85, # 11 p. 1248 - 1254
Title/Abstract Full Text View citing articles Show Details
Wang, Peiming; Oscarson, John L.; Gillespie, Sue E.; Izatt, Reed M.; Cao, Hongjie
Journal of Solution Chemistry, 1996 , vol. 25, # 3 p. 243 - 266 Title/Abstract Full Text View citing articles Show Details
Han, Mingcheng; Zorumski, Charles F.; Covey, Douglas F.
Journal of Medicinal Chemistry, 1996 , vol. 39, # 21 p. 4218 - 4232 Title/Abstract Full Text View citing articles Show Details
Supuran; Barboiu; Luca; Pop; Brewster; Dinculescu
European Journal of Medicinal Chemistry, 1996 , vol. 31, # 7-8 p. 597 - 606 Title/Abstract Full Text View citing articles Show Details
Ansar; Al Akoum Ebrik; Mouhoub; Berthelot; Vaccher; Flouquet; Caignard; Renard; Pirard; Rettori; Evrard; Durant; Debaert
European Journal of Medicinal Chemistry, 1996 , vol. 31, # 6 p. 449 - 460 Title/Abstract Full Text View citing articles Show Details
De Silva, A. Prasanna; Gunaratne, H. Q. Nimal; McVeigh, Catherine; Maguire, Glenn E. M.; Maxwell, Pamela R. S.; O'Hanlon, Emma
Chemical Communications, 1996 , # 18 p. 2191 - 2192 Title/Abstract Full Text View citing articles Show Details
Fukui, Keijiro; Iwane, Kazunori; Shimidzu, Takeo; Tanaka, Kazuyoshi
Tetrahedron Letters, 1996 , vol. 37, # 28 p. 4983 - 4986 Title/Abstract Full Text View citing articles Show Details
Contino, Christiane; Ollier, Monique; Maurizis, Jean Claude; Lacombe, Jean Michel; Pucci, Bernard
Tetrahedron Letters, 1996 , vol. 37, # 50 p. 9049 - 9052 Title/Abstract Full Text View citing articles Show Details
Gallardo, Maria A.; Lilley, Terence H.; Linsdell, Helen; Lu, Yan; Otin, Santos; Ward, Allison J.
Journal of the Chemical Society - Faraday Transactions, 1996 , vol. 92, # 24 p. 4983 - 4986 Title/Abstract Full Text View citing articles Show Details
Sahai, Mahendra; Srivastava, Anjani; Jamal, Parveen; Sinha, Subhash C.; Singh, Ajay P.; Fujimoto, Yoshinori
Indian Journal of Chemistry - Section B Organic and Medicinal Chemistry, 1996 , vol. 35, # 5 p. 510 - 511 Title/Abstract Full Text View citing articles Show Details
Reddy, P. Amruta; Woodward, Karen E.; McIlheran, Sarah M.; Hsiang, Bonnie C. H.; Latifi, Tammy N.; Hill, Matthew W.; Rothman, Steven M.; Ferrendelli, James A.; Covey, Douglas F.
Journal of Medicinal Chemistry, 1997 , vol. 40, # 1 p. 44 - 49 Title/Abstract Full Text View citing articles Show Details
Pan, Meide; Mabry, Tom J.; Beale, John M.; Mamiya, Blain M.
Phytochemistry, 1997 , vol. 45, # 3 p. 517 - 519 Title/Abstract Full Text View citing articles Show Details
40 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Dos Santos, Osvaldo; Lajmi, Ajay R.; Canary, James W.
Tetrahedron Letters, 1997 , vol. 38, # 25 p. 4383 - 4386 Title/Abstract Full Text View citing articles Show Details
Lyakhov; Suveyzdis; Bykhovskaya; Isko; Andronati; Litvinova
Pharmazie, 1997 , vol. 52, # 7 p. 560 - 561 Title/Abstract Full Text View citing articles Show Details
Chen; Okabe; Osano; Tajima
Bioscience, Biotechnology and Biochemistry, 1997 , vol. 61, # 2 p. 384 - 386 Title/Abstract Full Text View citing articles Show Details
Bartkowska, Beata; Bohnen, Frank M.; Krueger, Carl; Maier, Wilhelm F.
Acta Crystallographica Section C: Crystal Structure Communications, 1997 , vol. 53, # 4 p. 521 - 522 Title/Abstract Full Text View citing articles Show Details
Laduron, Frederic; Nyns, Claire; Janousek, Zdenek; Viehe, Heinz G.
Advanced Synthesis and Catalysis, 1997 , vol. 339, # 8 p. 697 - 707 Title/Abstract Full Text View citing articles Show Details
Mueller, Manfred; Knieps, Sebastian; Gessele, Karin; Dove, Stefan; Bernhardt, Guenther; Buschauer, Armin
Archiv der Pharmazie, 1997 , vol. 330, # 11 p. 333 - 342 Title/Abstract Full Text View citing articles Show Details
Kochergin; Persanova; Aleksandrova
Chemistry of Heterocyclic Compounds, 1996 , vol. 32, # 3 p. 342 - 345 Title/Abstract Full Text View citing articles Show Details
Gibson; Binyamin; Haj; Ringel; Ramu; Katzhendler
European Journal of Medicinal Chemistry, 1997 , vol. 32, # 10 p. 823 - 831 Title/Abstract Full Text View citing articles Show Details
Zniber, Rachid; Hakam, Asmaa; Essassi, El Mokhtar; Achour, Redouane; Hajji, Ahmed Jalal El; et al.
Bulletin des Societes Chimiques Belges, 1997 , vol. 106, # 5 p. 289 - 292 Title/Abstract Full Text Show Details
Thompson, Andrew M.; Murray, Donna K.; Elliott, William L.; Fry, David W.; Nelson, James A.; Showalter, H.D. Hollis; Roberts, Bill J.; Vincent, Patrick W.; Denny, William A.
Journal of Medicinal Chemistry, 1997 , vol. 40, # 24 p. 3915 - 3925 Title/Abstract Full Text View citing articles Show Details
DeVita, Robert J.; Frontier, Alison J.; Schoen, William R.; Wyvratt, Matthew J.; Fisher, Michael H.; Cheng, Kang; Chan, Wanda W.-S.; Butler, Bridget S.; Smith, Roy G.
Helvetica Chimica Acta, 1997 , vol. 80, # 4 p. 1244 - 1259 Title/Abstract Full Text View citing articles Show Details
Griesbeck, Axel G.; Henz, Andreas; Kramer, Wolfgang; Lex, Johann; Nerowski, Frank; Oelgemoeller, Michael; Peters, Karl; Peters, EvaMaria
Helvetica Chimica Acta, 1997 , vol. 80, # 3 p. 912 - 933 Title/Abstract Full Text View citing articles Show Details
Kardos; Blandl; Luyen; Doernyei; Gacs-Baitz; Simonyi; Cash; Blasko; Szantay
European Journal of Medicinal Chemistry, 1996 , vol. 31, # 10 p. 761 - 765 Title/Abstract Full Text View citing articles Show Details
Lescrinier, Theo; Hendrix, Chris; Kerremans, Luc; Rozenski, Jef; Link, Andreas; Samyn, Bart; Van Aerschot, Arthur; Lescrinier, Eveline; Eritja, Ramon; Van Beeumen, Jozef; Herdewijn, Piet
Chemistry - A European Journal, 1998 , vol. 4, # 3 p. 425 - 433 Title/Abstract Full Text View citing articles Show Details
Dobson; Gerkin
Acta Crystallographica, Section C: Crystal Structure Communications, 1996 , vol. 52, # pt 12 p. [d]3075-3078 Title/Abstract Full Text View citing articles Show Details
Belton; Delgadillo; Gil; Roma; Casuscelli; Colquhoun; Dennis; Spraul
Magnetic Resonance in Chemistry, 1997 , vol. 35, # SPEC. ISS. p. S52-S60 Title/Abstract Full Text View citing articles Show Details
Nudelman, Ayelet; Bechor, Yosi; Falb, Eliezer; Fischer, Bilha; Wexler, Barry A.; Nudelman, Abraham
Synthetic Communications, 1998 , vol. 28, # 3 p. 471 - 474 Title/Abstract Full Text View citing articles Show Details
Miranda, Les P.; Jones, Alun; Meutermans, Wim D. F.; Alewood, Paul F.
Journal of the American Chemical Society, 1998 , vol. 120, # 7 p. 1410 - 1420 Title/Abstract Full Text View citing articles Show Details
Leone-Bay, Andrea; Paton, Duncan R.; Freeman, John; Lercara, Christine; O'Toole, Doris; Gschneidner, David; Wang, Eric; Harris, Elizabeth; Rosado, Connie; Rivera, Theresa; DeVincent, Aldonna; Tai, Monica; Mercogliano, Frank; Agarwal, Rajesh; Leipold, Harry; Baughman, Robert A.
Journal of Medicinal Chemistry, 1998 , vol. 41, # 7 p. 1163 - 1171 Title/Abstract Full Text View citing articles Show Details
Contino, Christiane; Maurizis, Jean-Claude; Ollier, Monique; Rapp, Maryse; Lacombe, Jean-Michel; Pucci, Bernard
European Journal of Medicinal Chemistry, 1998 , vol. 33, # 10 p. 809 - 816 Title/Abstract Full Text View citing articles Show Details
Hide facts
41 of 992
Show next 200 Comment (Pharmacological Data)
Bioactivities present
Reference
Nilsson, Kent R.; Zorumski, Charles F.; Covey, Douglas F.
Journal of Medicinal Chemistry, 1998 , vol. 41, # 14 p. 2604 - 2613 Title/Abstract Full Text View citing articles Show Details
Meza-Toledo, Sergio E.; Martinez-Munoz, Dalila; Carvajal-Sandoval, Guillermo
Arzneimittel-Forschung/Drug Research, 1998 , vol. 48, # 11 p. 1051 - 1057 Title/Abstract Full Text View citing articles Show Details
Langhals, Heinz; Jona, Wolfgang
European Journal of Organic Chemistry, 1998 , # 5 p. 847 - 851 Title/Abstract Full Text View citing articles Show Details
Karigiannis, George; Mamos, Petros; Balayiannis, George; Katsoulis, Ioannis; Papaioannou, Dionissios
Tetrahedron Letters, 1998 , vol. 39, # 28 p. 5117 - 5120 Title/Abstract Full Text View citing articles Show Details
Ballesteros, Berta; Barcelo, Damia; Sanchez-Baeza, Francisco; Camps, Francisco; Marco, Maria-Pilar
Analytical Chemistry, 1998 , vol. 70, # 19 p. 4004 - 4014 Title/Abstract Full Text View citing articles Show Details
Abad, Antonio; Moreno, Maria Jose; Montoya, Angel
Journal of Agricultural and Food Chemistry, 1998 , vol. 46, # 6 p. 2417 - 2426 Title/Abstract Full Text View citing articles Show Details
Rai, Bijaya L.; Dekhordi, Lotfollah S.; Khodr, Hicham; Jin, Yi; Liu, Zudong; Hider, Robert C.
Journal of Medicinal Chemistry, 1998 , vol. 41, # 18 p. 3347 - 3359 Title/Abstract Full Text View citing articles Show Details
Shuto, Satoshi; Ono, Shizuka; Imoto, Hiroaki; Yoshii, Kiyonori; Matsuda, Akira
Journal of Medicinal Chemistry, 1998 , vol. 41, # 18 p. 3507 - 3514 Title/Abstract Full Text View citing articles Show Details
Badiger; Lele; Bhalerao; Varghese; Mashelkar
Journal of Chemical Physics, 1998 , vol. 109, # 3 p. 1175 - 1184 Title/Abstract Full Text View citing articles Show Details
Beasley, Helen L.; Phongkham, Thipsavanh; Daunt, Margaret H.; Guihot, Simone L.; Skerritt, John H.
Journal of Agricultural and Food Chemistry, 1998 , vol. 46, # 8 p. 3339 - 3352 Title/Abstract Full Text View citing articles Show Details
Hadingham, Karen L.; Garrett, Elizabeth M.; Wafford, Keith A.; Bain, Corinna; Heavens, Robert P.; Sirinathsinghji, Dalip J. S.; Whiting, Paul J.
Molecular Pharmacology, 1996 , vol. 49, # 2 p. 253 - 259 Title/Abstract Full Text View citing articles Show Details
Sanna, Enrico; Garau, Franca; Harris, R. Adron
Molecular Pharmacology, 1995 , vol. 47, # 2 p. 213 - 217 Title/Abstract Full Text View citing articles Show Details
Korpi, Esa R.; Kuner, Thomas; Seeburg, Peter H.; Lueddens, Hartmut
Molecular Pharmacology, 1995 , vol. 47, # 2 p. 283 - 289 Title/Abstract Full Text View citing articles Show Details
Zhang, Hai-Guang; Lee, Hwa-Jung; Rocheleau, Thomas; Ffrench-Constant, Richard H.; Jackson, Meyer B.
Molecular Pharmacology, 1995 , vol. 48, # 5 p. 835 - 840 Title/Abstract Full Text View citing articles Show Details
Maksay, Gabor; Molnar, Peter; Gruber, Lajos
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 288, # 1 p. 61 - 68 Title/Abstract Full Text Show Details
Feigenspan, Andreas; Bormann, Joachim
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 288, # 1 p. 97 - 104 Title/Abstract Full Text Show Details
Granger, Patrick; Biton, Bruno; Faure, Cecile; Vige, Xavier; Depoortere, Henri; Graham, David; Langer, Salomon Z.; Scatton, Bernard; Avenet, Patrick
Molecular Pharmacology, 1995 , vol. 47, # 6 p. 1189 - 1196 Title/Abstract Full Text View citing articles Show Details
Holland, Katherine D.; Mathews, Gregory C.; Bolos-Sy, Annabel M.; Tucker, Joseph B.; Reddy, P. Amruta; Covey, Douglas F.; Ferrendelli, James A.; Rothman, Steven M.
Molecular Pharmacology, 1995 , vol. 47, # 6 p. 1217 - 1223 Title/Abstract Full Text View citing articles Show Details
Stevenson; Wingrove; Whiting; Wafford
Molecular Pharmacology, 1995 , vol. 48, # 6 p. 965 - 969 Title/Abstract Full Text View citing articles Show Details
Nakazawa; Inoue; Ito; Koizumi
Naunyn-Schmiedeberg's Archives of Pharmacology, 1995 , vol. 351, # 2 p. 202 - 208 Title/Abstract Full Text View citing articles Show Details
42 of 992
43 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Huh, Kyung-Hye; Delorey, Timothy M.; Endo, Shuichi; Olsen, Richard W.
Molecular Pharmacology, 1995 , vol. 48, # 4 p. 666 - 675 Title/Abstract Full Text View citing articles Show Details
Valenzuela; Kazlauskas; Brozowski; Weiner; Demali; McDonald; Moss; Dunwiddie; Harris
Molecular Pharmacology, 1995 , vol. 48, # 6 p. 1099 - 1107 Title/Abstract Full Text View citing articles Show Details
Sigel, Erwin; Schaerer, Martin T.; Buhr, Andreas; Baur, Roland
Molecular Pharmacology, 1998 , vol. 54, # 6 p. 1097 - 1105 Title/Abstract Full Text View citing articles Show Details
Priller, Josef; Briley, Eileen M.; Mansouri, Jaleh; Devane, William A.; Mackie, Ken; Felder, Christian C.
Molecular Pharmacology, 1995 , vol. 48, # 2 p. 288 - 292 Title/Abstract Full Text View citing articles Show Details
Kristiansen; Barker; Serafini
Molecular Pharmacology, 1995 , vol. 48, # 2 p. 268 - 279 Title/Abstract Full Text View citing articles Show Details
Slany; Zezula; Tretter; Sieghart
Molecular Pharmacology, 1995 , vol. 48, # 3 p. 385 - 391 Title/Abstract Full Text View citing articles Show Details
Thompson; Whiting; Wafford
British Journal of Pharmacology, 1996 , vol. 117, # 3 p. 521 - 527 Title/Abstract Full Text View citing articles Show Details
Li; Guyenet
American Journal of Physiology - Regulatory Integrative and Comparative Physiology, 1995 , vol. 268, # 2 37-2 p. R428-R437 Title/Abstract Full Text View citing articles Show Details
Cheng, Li-Ling; Wang, Su-Jane; Tsai, Jing-Jane; Gean, Po-Wu
Pharmacology, 1997 , vol. 55, # 5 p. 228 - 234 Title/Abstract Full Text View citing articles Show Details
Carnovale; Monti; Favre; Scapini; Carrillo
Life Sciences, 1995 , vol. 57, # 9 p. 903 - 910 Title/Abstract Full Text View citing articles Show Details
Avetisyan; Kocharov; Azaryan; Dzhagatspanyan; Melikyan
Pharmaceutical Chemistry Journal, 1998 , vol. 32, # 2 p. 55 - 58 Title/Abstract Full Text View citing articles Show Details
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 212 Title/Abstract Full Text View citing articles Show Details
Wood, Nicholas J.; Sorensen, Jan
FEMS Microbiology Ecology, 1998 , vol. 27, # 2 p. 175 - 183 Title/Abstract Full Text View citing articles Show Details
Poras, Herve; Kunesch, Gerhard; Barriere, Jean-Claude; Berthaud, Nadine; Andremont, Antoine
Journal of Antibiotics, 1998 , vol. 51, # 8 p. 786 - 794 Title/Abstract Full Text View citing articles Show Details
Ivanyuk; Kadushkin; Solov'eva; Granik
Pharmaceutical Chemistry Journal, 1996 , vol. 30, # 6 p. 404 - 408 Title/Abstract Full Text View citing articles Show Details
Gracheva; Orekhova; Kopelevich; Tyurenkov; Kleshchitskii; Shvets
Pharmaceutical Chemistry Journal, 1996 , vol. 30, # 7 p. 453 - 457 Title/Abstract Full Text View citing articles Show Details
Ozoe; Niina; Matsumoto; Ikeda; Mochida; Ogawa; Matsuno; Miki; Yanagi
Bioorganic and medicinal chemistry, 1998 , vol. 6, # 1 p. 73 - 83 Title/Abstract Full Text View citing articles Show Details
Kim, Jae Hak; Mullin, Christopher A.
Journal of Chemical Ecology, 1998 , vol. 24, # 9 p. 1499 - 1511 Title/Abstract Full Text View citing articles Show Details
Heitsch, Holger; Wagner, Adalbert; Schoelkens, Bernward A.; Wirth, Klaus
Bioorganic and Medicinal Chemistry Letters, 1999 , vol. 9, # 3 p. 327 - 332 Title/Abstract Full Text View citing articles Show Details
Cox, Robin A.
Canadian Journal of Chemistry, 1998 , vol. 76, # 6 p. 649 - 656 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Auberson, Yves P.; Acklin, Pierre; Bischoff, Serge; Moretti, Robert; Ofner, Silvio; Schmutz, Markus; Veenstra, Siem J.
Bioorganic and Medicinal Chemistry Letters, 1999 , vol. 9, # 2 p. 249 - 254 Title/Abstract Full Text View citing articles Show Details
Popova; Studentsov
Russian Journal of Organic Chemistry, 1998 , vol. 34, # 5 p. 699 - 706 Title/Abstract Full Text View citing articles Show Details
Malawska, Barbara; Kulig, Katarzyna; Antkiewicz-Michaluk, Lucyna; Porter, Richard; Misra, Ani; Cliffe, Ian A.
Archiv der Pharmazie, 1999 , vol. 332, # 5 p. 167 - 174 Title/Abstract Full Text View citing articles Show Details
Ostrowska, Katarzyna; Ciechanowicz-Rutkowska, Maryla; Pilati, Tulio; Zuchowski, Grzegorz
Monatshefte fur Chemie, 1999 , vol. 130, # 4 p. 555 - 562 Title/Abstract Full Text View citing articles Show Details
Qiu, Jian; Stevenson, Scott H.; O'Beirne, Michael J.; Silverman, Richard B.
Journal of Medicinal Chemistry, 1999 , vol. 42, # 2 p. 329 - 332 Title/Abstract Full Text View citing articles Show Details
Nair, M. Sivasankaran; Arasu, P. Thillai; Neelakantan; Pillai, M. Sankaranarayana
Indian Journal of Chemistry - Section A Inorganic, Physical, Theoretical and Analytical Chemistry, 1998 , vol. 37, # 6 p. 512 - 516 Title/Abstract Full Text View citing articles Show Details
Mercader, Josep V.; Montoya, Angel
Journal of Agricultural and Food Chemistry, 1999 , vol. 47, # 3 p. 1276 - 1284 Title/Abstract Full Text View citing articles Show Details
Sliedregt, Leo A. J. M.; Rensen, Patrick C. N.; Rump, Erik T.; Van Santbrink, Peter J.; Bijsterbosch, Martin K.; Valentijn, A. Rob P. M.; Van Der Marel, Gijs A.; Van Boom, Jacques H.; Van Berkel, Theo J. C.; Biessen, Erik A. L.
Journal of Medicinal Chemistry, 1999 , vol. 42, # 4 p. 609 - 618 Title/Abstract Full Text View citing articles Show Details
Kumar
Journal of the Indian Chemical Society, 1997 , vol. 74, # 8 p. 610 - 612 Title/Abstract Full Text View citing articles Show Details
Buschmann, Hans-Juergen; Cleve, Ernst; Mutihac, Lucia; Schollmeyer, Eckhard
Revue Roumaine de Chimie, 1998 , vol. 43, # 10 p. 941 - 944 Title/Abstract Full Text View citing articles Show Details
Barker, C. Vivienne; Korn, Stewart R.; Monteith, Michael; Page, Michael I.
Chemical Communications, 1999 , # 8 p. 721 - 722 Title/Abstract Full Text View citing articles Show Details
Gentilini; Franchi-Micheli; Mugnai; Bindi; Zilletti
British Journal of Pharmacology, 1995 , vol. 115, # 3 p. 389 - 394 Title/Abstract Full Text View citing articles Show Details
Buhr; Baur; Malherbe; Sigel
Molecular Pharmacology, 1996 , vol. 49, # 6 p. 1080 - 1084 Title/Abstract Full Text View citing articles Show Details
Mergl, Zsuzsanna; Acs, Zsuzsanna; Makara, G. B.
Life Sciences, 1995 , vol. 56, # 8 p. 579 - 586 Title/Abstract Full Text View citing articles Show Details
Hauser, Charlotte A. E.; Chesnoy-Marchais, Dominique; Robel, Paul; Baulieu, Etienne E.
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 289, # 2 p. 249 - 258 Title/Abstract Full Text View citing articles Show Details
Hawkinson; Drewe; Kimbrough; Chen; Hogenkamp; Lan; Gee; Shen; Whittemore; Woodward
Molecular Pharmacology, 1996 , vol. 49, # 5 p. 897 - 906 Title/Abstract Full Text View citing articles Show Details
Cole, Loretta M.; Roush, Richard T.; Casida, John E.
Life Sciences, 1995 , vol. 56, # 10 p. 757 - 766 Title/Abstract Full Text View citing articles Show Details
Krishek; Moss; Smart
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 494 - 504 Title/Abstract Full Text View citing articles Show Details
Saxena, Nina C.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 567 - 579 Title/Abstract Full Text View citing articles Show Details
Fleischmann; Makman; Etgen
Life Sciences, 1995 , vol. 56, # 20 p. 1665 - 1678 Title/Abstract Full Text View citing articles Show Details
44 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Kabuto; Yokoi; Iwaya; Mori
Life Sciences, 1995 , vol. 56, # 20 p. 1741 - 1748 Title/Abstract Full Text View citing articles Show Details
Korpi; Herb; Luddens
Pharmacology and Toxicology, 1995 , vol. 77, # 2 p. 87 - 90 Title/Abstract Full Text View citing articles Show Details
Klunk, William E.; Debnath, Manik L.; McClure, Richard J.; Pettegrew, Jay W.
Life Sciences, 1995 , vol. 56, # 26 p. 2377 - 2384 Title/Abstract Full Text View citing articles Show Details
Quirk; Whiting; Ragan; McKernan
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 290, # 3 p. 175 - 181 Title/Abstract Full Text View citing articles Show Details
Yoshimura; Yoshida; Taniyama
Life Sciences, 1995 , vol. 57, # 26 p. 2397 - 2401 Title/Abstract Full Text View citing articles Show Details
Pierobon, Paola; Concas, Alessandra; Santoro, Giovanna; Marino, Giuseppe; Minei, Rosario; et al.
Life Sciences, 1995 , vol. 56, # 18 p. 1485 - 1498 Title/Abstract Full Text View citing articles Show Details
Fuchs; Zezula; Slany; Sieghart
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 289, # 1 p. 87 - 95 Title/Abstract Full Text View citing articles Show Details
Nielsen; Witt; Ebert; Krogsgaard-Larsen
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 289, # 1 p. 109 - 112 Title/Abstract Full Text View citing articles Show Details
Barasch, Dinorah; Zipori, Omer; Ringel, Israel; Ginsburg, Isaac; Samuni, Amram; Katzhendler, Jehoshua
European Journal of Medicinal Chemistry, 1999 , vol. 34, # 7-8 p. 597 - 615 Title/Abstract Full Text View citing articles Show Details
Zhao, Tai-Jun; Ming; Chiu, Ted H.; Rosenberg, Howard C.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 287, # 2 p. 752 - 759 Title/Abstract Full Text View citing articles Show Details
Banerjee, Pradeep K.; Olsen, Richard W.; Tillakaratne, Niranjala J. K.; Brailowsky, Simon; Tobin, Allan J.; Snead III, O. Carter
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 287, # 2 p. 766 - 772
Title/Abstract Full Text View citing articles Show Details
Wu; Mercuri; Johnson
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 273, # 2 p. 576 - 581 Title/Abstract Full Text View citing articles Show Details
Bruno, Olga; Schenone, Silvia; Ranise, Angelo; Bondavalli, Francesco; Filippelli, Walter; Falcone, Giuseppe; Motola, Giulia; Mazzeo, Filomena
Farmaco, 1999 , vol. 54, # 1-2 p. 95 - 100 Title/Abstract Full Text View citing articles Show Details
Chandrasekhar; Padmaja; Raza
Synlett, 1999 , # 10 p. 1597 - 1599 Title/Abstract Full Text View citing articles Show Details
Chyb, Sylwester; Eichenseer, Herbert; Hollister, Benedict; Mullin, Christopher A.; Frazier, James L.
Journal of Chemical Ecology, 1995 , vol. 21, # 3 p. 313 - 330 Title/Abstract Full Text View citing articles Show Details
Wu, Guang
Journal of Applied Toxicology, 1996 , vol. 16, # 2 p. 95 - 102 Title/Abstract Full Text View citing articles Show Details
Supuran, Claudiu T.; Dinculescu, Antonie; Manole, Gheorghe; Savan, Florina; Puscas, Ioan; Balaban, Alexandru T.
Revue Roumaine de Chimie, 1991 , vol. 36, # 8 p. 937 - 946 Title/Abstract Full Text Show Details
Odagaki; Dasgupta; Fuxe
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 291, # 3 p. 245 - 253 Title/Abstract Full Text View citing articles Show Details
Noyer, Michel; Gillard, Michel; Matagne, Alain; Henichart, Jean-Pierre; Wuelfert, Ernst
European Journal of Pharmacology, 1995 , vol. 286, # 2 p. 137 - 146 Title/Abstract Full Text View citing articles Show Details
Jones; Harrison; Pritchett; Hales
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 2 p. 962 - 968 Title/Abstract Full Text View citing articles Show Details
45 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Slany; Zezula; Fuchs; Sieghart
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 291, # 2 p. 99 - 105 Title/Abstract Full Text View citing articles Show Details
Rothlin; Katz; Verbitsky; Elgoyhen
Molecular pharmacology, 1999 , vol. 55, # 2 p. 248 - 254 Title/Abstract Full Text View citing articles Show Details
Perusquia, Mercedes; Villalon, Carlos M.
Life Sciences, 1996 , vol. 58, # 11 p. 913 - 926 Title/Abstract Full Text View citing articles Show Details
Klein; Mascia; Harkness; Hadingham; Whiting; Harris
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 3 p. 1484 - 1492 Title/Abstract Full Text View citing articles Show Details
Ichida, Tatsuya; Takeda, Kazuo; Sasaki, Susumu; Nakagawa, Masao; Hashimoto, Tsuneichi; Kuriyama, Kinya
Life Sciences, 1995 , vol. 58, # 3 p. 209 - 215 Title/Abstract Full Text View citing articles Show Details
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Garazd; Ogorodniichuk; Shilin; Zhivolup; Turov; Khilya
Chemistry of Natural Compounds, 1998 , vol. 34, # 5 p. 577 - 581 Title/Abstract Full Text View citing articles Show Details
Johnson, Theodore R.; Silverman, Richard B.
Bioorganic and Medicinal Chemistry, 1999 , vol. 7, # 8 p. 1625 - 1636 Title/Abstract Full Text View citing articles Show Details
Kochergin; Reznichenko; Gireva; Aleksandrova
Chemistry of Heterocyclic Compounds, 1999 , vol. 35, # 1 p. 45 - 50 Title/Abstract Full Text View citing articles Show Details
Yokogawa, Koichi; Miya, Kazuhiro; Tamai, Ikumi; Higashi, Yasuhiko; Nomura, Masaaki; Miyamoto, Ken-Ichi; Tsuji, Akira
Journal of Pharmacy and Pharmacology, 1999 , vol. 51, # 8 p. 935 - 940 Title/Abstract Full Text View citing articles Show Details
Thurlow, Richard J.; Hill, David R.; Woodruff
British Journal of Pharmacology, 1996 , vol. 118, # 3 p. 449 - 456 Title/Abstract Full Text View citing articles Show Details
Belelli, Delia; Callachan, Helen; Hill-Venning, Claire; Peters, John A.; Lambert, Jeremy J.
British Journal of Pharmacology, 1996 , vol. 118, # 3 p. 563 - 576 Title/Abstract Full Text View citing articles Show Details
Del Castillo, M. Dolores; Corzo, Nieves; Gonzalez, Leandro; Olano, Agustin
Journal of Agricultural and Food Chemistry, 1999 , vol. 47, # 10 p. 4137 - 4139 Title/Abstract Full Text View citing articles Show Details
Petegnief, Valerie; Lleu, Pierre-Louis; Gupta, Ramesh C.; Bourguignon, Jean-Jacques; Rebel, Gerard
Biochemical Pharmacology, 1995 , vol. 49, # 3 p. 399 - 410 Title/Abstract Full Text View citing articles Show Details
Hosie, Alastair M.; Sattelle, David B.
British Journal of Pharmacology, 1996 , vol. 117, # 6 p. 1229 - 1237 Title/Abstract Full Text View citing articles Show Details
Chowdhury; Kawashima; Konishi; Niwa; Matsunami
European Journal of Pharmacology, 1995 , vol. 285, # 1 p. 99 - 102 Title/Abstract Full Text View citing articles Show Details
Marszalec, William; Song, Jin-Ho; Narahashi, Toshio
British Journal of Pharmacology, 1996 , vol. 119, # 1 p. 126 - 132 Title/Abstract Full Text View citing articles Show Details
Shafer, Timothy J.; Ward, Thomas R.; Meacham, Connie A.; Cooper, Ralph L.
Toxicology, 1999 , vol. 142, # 1 p. 57 - 68 Title/Abstract Full Text View citing articles Show Details
Silvestroni, Leopoldo; Rossi, Fabio; Magnanti, Massimo; Lubrano, Carla; Santiemma, Vittorio; Palleschi, Simonetta
Reproductive Toxicology, 1999 , vol. 13, # 6 p. 431 - 441 Title/Abstract Full Text View citing articles Show Details
Belley, Michel; Sullivan, Richard; Reeves, Austin; Evans, Jilly; O'Neill, Gary; Ng, Gordon Y.K.
Bioorganic and Medicinal Chemistry, 1999 , vol. 7, # 12 p. 2697 - 2704 Title/Abstract Full Text View citing articles Show Details
46 of 992
47 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Guenther, Robert; Stein, Anja; Bordusa, Frank
Journal of Organic Chemistry, 2000 , vol. 65, # 6 p. 1672 - 1679 Title/Abstract Full Text View citing articles Show Details
Stuhr-Hansen, Nicolai; Ebert, Bjarke; Krogsgaard-Larsen, Povl; Kehler, Jan
Organic Letters, 2000 , vol. 2, # 1 p. 6 - 10 Title/Abstract Full Text Show Details
Likhosherstov, L. M.; Novikova, O. S.; Shibaev, V. N.
Russian Chemical Bulletin, 1999 , vol. 48, # 7 p. 1365 - 1368 Izvestiya Akademi Nauk, Seriya Khimicheskaya, 1999 , # 7 p. 1377 - 1380 Title/Abstract Full Text View citing articles Show Details
Le Corronc; Hue
Pesticide Science, 1999 , vol. 55, # 10 p. 1007 - 1011 Title/Abstract Full Text View citing articles Show Details
Baldocchi Pizzo, Andrea; Karklin Fontana, Andreia Cristina; Coutinho-Netto, Joaquim; Ferreira dos Santos, Wagner
Journal of Biochemical and Molecular Toxicology, 2000 , vol. 14, # 2 p. 88 - 94 Title/Abstract Full Text Show Details
Kwan, Yiu Wa; Ngan, Man-Piu; Tsang, Kay-Yan; Lee, Ha-Man; Chu, Lai-Ah
British Journal of Pharmacology, 1996 , vol. 118, # 3 p. 755 - 761 Title/Abstract Full Text View citing articles Show Details
Kumar
Canadian Journal of Chemistry, 1999 , vol. 77, # 7 p. 1288 - 1294 Title/Abstract Full Text View citing articles Show Details
Chebib, Mary; Johnston, Graham A.R.; Mattsson, Jan P.; Rydstroem, Karin; Nilsson, Karolina; Qiu, Jian; Stevenson, Scott H.; Silverman, Richard B.
Bioorganic and Medicinal Chemistry Letters, 1999 , vol. 9, # 21 p. 3093 - 3098 Title/Abstract Full Text View citing articles Show Details
Chen; Lee
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 273, # 2 p. 895 - 901 Title/Abstract Full Text View citing articles Show Details
Hadad; Bialer
Pharmaceutical Research, 1995 , vol. 12, # 6 p. 905 - 910 Title/Abstract Full Text View citing articles Show Details
Takebayashi; Kagaya; Hayashi; Motohashi; Yamawaki
European Journal of Pharmacology, 1996 , vol. 297, # 1-2 p. 137 - 143 Title/Abstract Full Text View citing articles Show Details
Hossain; Weiner
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 1 p. 237 - 244 Title/Abstract Full Text View citing articles Show Details
Burgard, Edward C.; Tietz, Elizabeth I.; Neelands, Torben R.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 119 - 127 Title/Abstract Full Text View citing articles Show Details
Lin, Yu-Fung; Angelotti, Timothy P.; Dudek, Ellen M.; Browning, Michael D.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 185 - 195 Title/Abstract Full Text View citing articles Show Details
Zhou Shi-Yi; Gilbey
The American journal of physiology, 1995 , vol. 268, # 52 p. R1230-R1235 Title/Abstract Full Text View citing articles Show Details
Coleman; Dampney
American Journal of Physiology - Regulatory Integrative and Comparative Physiology, 1995 , vol. 268, # 5 37-5 p. R1295-R1302 Title/Abstract Full Text View citing articles Show Details
Smith; Sibbald; Khanna; Day
The American journal of physiology, 1995 , vol. 268, # 52 p. R1336-R1342 Title/Abstract Full Text View citing articles Show Details
Guizzetti, Marina; Costa, Paola; Peters, Janet; Costa, Lucio G.
European Journal of Pharmacology, 1996 , vol. 297, # 3 p. 265 - 273 Title/Abstract Full Text View citing articles Show Details
Vincens; Dartois; Moyse; Haour; Fillion
Naunyn-Schmiedeberg's Archives of Pharmacology, 1995 , vol. 351, # 4 p. 356 - 362 Title/Abstract Full Text View citing articles Show Details
Brown; Wood; Coldwell; Bristow
British journal of pharmacology, 1997 , vol. 121, # 1 p. 71 - 76 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Conrad II, Peter G.; Givens, Richard S.; Weber, Joerg F. W.; Kandler, Karl
Organic Letters, 2000 , vol. 2, # 11 p. 1545 - 1547 Title/Abstract Full Text View citing articles Show Details
Qiu, Jian; Pingsterhaus, Joyce M.; Silverman, Richard B.
Journal of Medicinal Chemistry, 1999 , vol. 42, # 22 p. 4725 - 4728
Title/Abstract Full Text View citing articles Show Details
Pfeuffer; Tkac; Provencher; Gruetter
Journal of magnetic resonance (San Diego, Calif. : 1997), 1999 , vol. 141, # 1 p. 104 - 120 Title/Abstract Full Text View citing articles Show Details
Riga, Ekaterini; Perry, Roland N.; Barrett, John; Johnston, Mike R. L.
Journal of Chemical Ecology, 1997 , vol. 23, # 2 p. 417 - 428 Title/Abstract Full Text View citing articles Show Details
Said, Mourad; Battaglia, Eric; Elass, Abdelaziz; Cano, Virginie; Ziegler, Jean-Claude; Cartier, Alain; Livertoux, Marie-Helene; Vergoten, Gerard; Fournel-Gigleux, Sylvie; Magdalou, Jacques
Journal of Biochemical and Molecular Toxicology, 1998 , vol. 12, # 1 p. 19 - 27 Title/Abstract Full Text View citing articles Show Details
Im; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 3 p. 1390 - 1395 Title/Abstract Full Text View citing articles Show Details
Yu; Ticku
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 3 p. 1442 - 1446 Title/Abstract Full Text View citing articles Show Details
Graefe, Kerstin A.; Hoffmann
Pharmazie, 2000 , vol. 55, # 4 p. 286 - 292 Title/Abstract Full Text View citing articles Show Details
Bousquet, Ennio; Spadaro, Angelo; Pappalardo, Maria S.; Bernardini, Renato; Romeo, Rosalba; Panza, Luigi; Ronsisvalle, Giuseppe
Journal of Carbohydrate Chemistry, 2000 , vol. 19, # 4-5 p. 527 - 541 Title/Abstract Full Text View citing articles Show Details
Barczynski; Dega-Szafran; Dulewicz; Petryna; Szafran
Polish Journal of Chemistry, 2000 , vol. 74, # 8 p. 1149 - 1161 Title/Abstract Full Text View citing articles Show Details
Chebib, Mary; Johnston, Graham A. R.
Journal of Medicinal Chemistry, 2000 , vol. 43, # 8 p. 1427 - 1447 Title/Abstract Full Text View citing articles Show Details
Knudsen, Lotte B.; Nielsen, Per F.; Huusfeldt, Per O.; Johansen, Nils L.; Madsen, Kjeld; Pedersen, Freddy Z.; Thogersen, Henning; Wilken, Michael; Agerso, Henrik
Journal of Medicinal Chemistry, 2000 , vol. 43, # 9 p. 1664 - 1669 Title/Abstract Full Text View citing articles Show Details
Zezula, Juergen; Slany, Astrid; Sieghart, Werner
European Journal of Pharmacology, 1996 , vol. 301, # 1-3 p. 207 - 214 Title/Abstract Full Text View citing articles Show Details
Koyama, Yutaka; Awaya, Akira; Ishikawa, Nobue; Fujita, Shigeki; Tomino, Ikuo; Yokoyama, Keiichi; Araki, Shintaro; Takesue, Mitsuyuki; Kato, Koji; Ishiguro, Masaharu; Kitahara, Takumi; Kihara, Noriaki; Baba, Akemichi
Biological and Pharmaceutical Bulletin, 1997 , vol. 20, # 2 p. 138 - 141 Title/Abstract Full Text View citing articles Show Details
Yiu, Man-Kit; Kwan, Yiu Wa; Ngan, Man-Piu
European Journal of Pharmacology, 1996 , vol. 302, # 1-3 p. 99 - 108 Title/Abstract Full Text View citing articles Show Details
Blanche, Francis; Cameron, Beatrice; Bernard, Francois-Xavier; Maton, Laurent; Manse, Benedicte; Ferrero, Lucy; Ratet, Nathalie; Lecoq, Claudine; Goniot, Anne; Bisch, Didier; Crouzet, Joel
Antimicrobial Agents and Chemotherapy, 1996 , vol. 40, # 12 p. 2714 - 2720 Title/Abstract Full Text View citing articles Show Details
Kume; Greenfield L.J.; Macdonald; Albin
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 3 p. 1784 - 1792 Title/Abstract Full Text View citing articles Show Details
Sanna; Mascia; Klein; Whiting; Biggio; Harris
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 1 p. 353 - 360 Title/Abstract Full Text View citing articles Show Details
Wafford; Thompson; Thomas; Sikela; Wilcox; Whiting
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 670 - 678 Title/Abstract Full Text View citing articles Show Details
Varro; Athanassopolous; Dockray
Experimental Physiology, 1996 , vol. 81, # 1 p. 151 - 154 Title/Abstract Full Text View citing articles Show Details
48 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Griesbeck, Axel G.; Gudipati, Murthy S.; Hirt, Joachim; Lex, Johann; Oelgemoeller, Michael; Schmickler, Hans; Schouren, Frank
Journal of Organic Chemistry, 2000 , vol. 65, # 21 p. 7151 - 7157 Title/Abstract Full Text View citing articles Show Details
Morozov; Val'dman; Voronina; Nerobkova; Klimova; Lavrova; Avdyunina; Pyatin
Pharmaceutical Chemistry Journal, 2000 , vol. 34, # 4 p. 189 - 192 Title/Abstract Full Text View citing articles Show Details
Leone-Bay; Freeman; O'Toole; Rosario-Gray; Salo-Kostmayer; Tai; Mercogliano; Baughman
Journal of Medicinal Chemistry, 2000 , vol. 43, # 19 p. 3573 - 3576 Title/Abstract Full Text View citing articles Show Details
Orzeszko, Andrzej; Kaminska, Beata; Orzeszko, Grayna; Starociak, Bohdan J.
Farmaco, 2000 , vol. 55, # 9-10 p. 619 - 623 Title/Abstract Full Text View citing articles Show Details
Vassis, Stratos; Karigiannis, George; Balayiannis, George; Militsopoulou, Maria; Mamos, Petros; Francis, George W.; Papaioannou, Dionissios
Tetrahedron Letters, 2001 , vol. 42, # 8 p. 1579 - 1582 Title/Abstract Full Text View citing articles Show Details
Noel; Mendonca-Silva; Quintas
Arzneimittel-Forschung/Drug Research, 2001 , vol. 51, # 2 p. 169 - 173 Title/Abstract Full Text View citing articles Show Details
Nadeson; Guo; Porter; Gent; Goodchild
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 278, # 2 p. 620 - 626 Title/Abstract Full Text View citing articles Show Details
Matthes, Hans; Seward, Elizabeth P.; Kieffer, Brigitte; North, R. Alan
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 447 - 450 Title/Abstract Full Text View citing articles Show Details
Kapur, Jaideep; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 458 - 466 Title/Abstract Full Text View citing articles Show Details
Mihic; Harris
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 1 p. 411 - 416 Title/Abstract Full Text View citing articles Show Details
Zheng; Caruncho; Wei Jian Zhu; Vicini; Ikonomovic; Grayson; Costa
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 1 p. 525 - 533 Title/Abstract Full Text View citing articles Show Details
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Olianas, Maria C.; Onali, Pierluigi
British Journal of Pharmacology, 1999 , vol. 126, # 3 p. 657 - 664 Title/Abstract Full Text View citing articles Show Details
Tietze, Lutz F.
Angewandte Chemie - International Edition, 2001 , vol. 40, # 5 p. 903 - 905 Title/Abstract Full Text View citing articles Show Details
Mariussen, Espen; Fonnum, Frode
Toxicology, 2001 , vol. 159, # 1-2 p. 11 - 21 Title/Abstract Full Text View citing articles Show Details
Gederaas, Odrun A.; Holroyd, Andrew; Brown, Stanley B.; Vernon, David; Moan, Johan; Berg, Kristian
Photochemistry and Photobiology, 2001 , vol. 73, # 2 p. 164 - 169 Title/Abstract Full Text View citing articles Show Details
Brown, Maria J.; Bristow, David R.
British Journal of Pharmacology, 1996 , vol. 118, # 5 p. 1103 - 1110 Title/Abstract Full Text View citing articles Show Details
Teoh, Hwee; Malcangio, Marzia; Bowery, Norman G.
British Journal of Pharmacology, 1996 , vol. 118, # 5 p. 1153 - 1160 Title/Abstract Full Text View citing articles Show Details
Ghiani, Cristina A.; Tuligi, Graziella; Maciocco, Elisabetta; Serra, Mariangela; Sanna, Enrico; Biggio, Giovanni
Biochemical Pharmacology, 1996 , vol. 51, # 11 p. 1527 - 1534 Title/Abstract Full Text View citing articles Show Details
Casini; Scozzafava; Mincione; Menabuoni; Ilies; Supuran
Journal of Medicinal Chemistry, 2000 , vol. 43, # 25 p. 4884 - 4892 Title/Abstract Full Text View citing articles Show Details
49 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Likhodi, Olga; Chalikian, Tigran V.
Journal of the American Chemical Society, 2000 , vol. 122, # 33 p. 7860 - 7868 Title/Abstract Full Text View citing articles Show Details
Moon, Sung-Ju; Jeon, Joong Won; Kim, Heesuk; Suh, Myunghyun Paik; Sun, Junghun
Journal of the American Chemical Society, 2000 , vol. 122, # 32 p. 7742 - 7749 Title/Abstract Full Text View citing articles Show Details
Petrenko; Petukhova; Shakirov; Shul'ts; Tolstikov
Russian Journal of Organic Chemistry, 2000 , vol. 36, # 7 p. 982 - 995 Title/Abstract Full Text View citing articles Show Details
Varghese, Shyni; Lele, Ashish K.; Srinivas; Mashelkar, Raghunath A.
Journal of Physical Chemistry B, 2001 , vol. 105, # 23 p. 5368 - 5373 Title/Abstract Full Text View citing articles Show Details
Scozzafava, Andrea; Supuran, Claudiu T.
European Journal of Pharmaceutical Sciences, 2000 , vol. 10, # 1 p. 29 - 41 Title/Abstract Full Text View citing articles Show Details
Uchida, Ichiro; Cestari, Ismar N.; Yang, Jay
European Journal of Pharmacology, 1996 , vol. 307, # 1 p. 89 - 96 Title/Abstract Full Text View citing articles Show Details
Gorshkov, N. I.; Katzenellenbogen, J. A.; Luyt, L. G.; Lumpov, A. A.; Miroslavov, A. E.; Suglobov, D. N.
Journal of Labelled Compounds and Radiopharmaceuticals, 2001 , vol. 44, p. S486 - S488 Title/Abstract Full Text Show Details
Delmas, Florence; Beloeil, Jean-Claude; Van der Sanden, Boudewijn P. J.; Nicolay, Klaas; Gillet, Brigitte
Journal of Magnetic Resonance, 2001 , vol. 149, # 1 p. 119 - 125 Title/Abstract Full Text View citing articles Show Details
Nguyen-Duong
Journal of Toxicology and Environmental Health - Part A, 2001 , vol. 62, # 8 p. 643 - 653 Title/Abstract Full Text View citing articles Show Details
Wildman; King; Burnstock
British Journal of Pharmacology, 1997 , vol. 120, # 2 p. 221 - 224 Title/Abstract Full Text View citing articles Show Details
Peng; Xie; Otterness; Cogswell; McConnell; Carter; Powis; Abraham; Zalkow
Journal of Medicinal Chemistry, 2001 , vol. 44, # 5 p. 834 - 848 Title/Abstract Full Text View citing articles Show Details
Salmon-Chemin; Buisine; Yardley; Kohler; Debreu; Landry; Sergheraert; Croft; Krauth-Siegel; Davioud-Charvet
Journal of Medicinal Chemistry, 2001 , vol. 44, # 4 p. 548 - 565 Title/Abstract Full Text View citing articles Show Details
Vaillancourt; Larsen; Tanis; Burr; Connell; Cudahy; Evans; Fisher; May; Meglasson; Robinson; Stevens; Tucker; Vidmar; Yu
Journal of Medicinal Chemistry, 2001 , vol. 44, # 8 p. 1231 - 1248 Title/Abstract Full Text View citing articles Show Details
Tamai; Senmaru; Terasaki; Tsuji
Biochemical Pharmacology, 1995 , vol. 50, # 11 p. 1783 - 1793 Title/Abstract Full Text View citing articles Show Details
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Vale, Carmen; Pomes, Anna; Rodriguez-Farre, Eduard; Sunol, Cristina
European Journal of Pharmacology, 1997 , vol. 319, # 2-3 p. 343 - 353 Title/Abstract Full Text View citing articles Show Details
Dillon; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 2 p. 597 - 603 Title/Abstract Full Text View citing articles Show Details
Hawkinson, Jon E.; Acosta-Burruel, Manuel; Kimbrough, Catherine L.; Goodnough, Dayan B.; Wood, Paul L.
European Journal of Pharmacology, 1996 , vol. 304, # 1-3 p. 141 - 146 Title/Abstract Full Text View citing articles Show Details
Kiec-Kononowicz, Katarzyna; Karolak-Wojciechowska, Janina; Mueller, Christa E.; Schumacher, Britta; Pekala, Elzbieta; Szymanska, Ewa
European Journal of Medicinal Chemistry, 2001 , vol. 36, # 5 p. 407 - 419 Title/Abstract Full Text View citing articles Show Details
Tang, Yi-Jin; Liu, Hong-Yan; An, Jing-Yi; Han, Rei
Photochemistry and Photobiology, 2001 , vol. 74, # 2 p. 201 - 205 Title/Abstract Full Text View citing articles Show Details
50 of 992
51 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
De Graaf, Robin A.; Rothman, Douglas L.
Journal of Magnetic Resonance, 2001 , vol. 152, # 1 p. 124 - 131 Title/Abstract Full Text View citing articles Show Details
Holden-Dye; Brownlee; Walker
British Journal of Pharmacology, 1997 , vol. 120, # 3 p. 379 - 386 Title/Abstract Full Text View citing articles Show Details
Covey; Han; Sampath Kumar; De la Cruz; Meadows; Hu; Tonnies; Nathan; Coleman; Benz; Evers; Zorumski; Mennerick
Journal of Medicinal Chemistry, 2000 , vol. 43, # 17 p. 3201 - 3204 Title/Abstract Full Text View citing articles Show Details
Zheng, Xiang-jun; Zhuang, Jin-you; Jin, Lin-pei; Wang, Zhe-ming; Yan, Chun-hua; Zhu, Long-gen; Mei, Yu-hua
Journal of Molecular Structure, 2001 , vol. 1-3595, p. 201 - 208 Title/Abstract Full Text Show Details
Jursic, Branko S; Neumann, Donna M
Tetrahedron Letters, 2001 , vol. 42, # 48 p. 8435 - 8439 Title/Abstract Full Text View citing articles Show Details
Davies, Paul A.; Kirkness, Ewen F.; Hales, Tim G.
British Journal of Pharmacology, 1997 , vol. 120, # 5 p. 899 - 909 Title/Abstract Full Text View citing articles Show Details
Im, Wha Bin; Pregenzer, Jeffrey F.; Binder, Jay A.; Alberts, Glen L.; Im, Haesook K.
British Journal of Pharmacology, 1997 , vol. 120, # 4 p. 559 - 564 Title/Abstract Full Text View citing articles Show Details
Grobaski, Kenneth C.; Ping, Hanxian; DaSilva, Helena M.A.; Bowery, Norman G.; Connelly, Stephen T.; Shepard, Paul D.
British Journal of Pharmacology, 1997 , vol. 120, # 4 p. 575 - 580 Title/Abstract Full Text View citing articles Show Details
Usifoh, Cyril O.; Lambert, Didier M.; Wouters, Johan; Scriba, Gerhard K.E.
Archiv der Pharmazie, 2001 , vol. 334, # 10 p. 323 - 331 Title/Abstract Full Text View citing articles Show Details
Royer; Felpin; Doris
Journal of Organic Chemistry, 2001 , vol. 66, # 19 p. 6487 - 6489 Title/Abstract Full Text View citing articles Show Details
Martin; Grimley; Lewis; Heath III; Bailey; Kendrick; Yardley; Caldera; Lira; Urbina; Moreno; Docampo; Croft; Oldfield
Journal of Medicinal Chemistry, 2001 , vol. 44, # 6 p. 909 - 916 Title/Abstract Full Text View citing articles Show Details
Ebert, Bjarke; Mortensen, Martin; Thompson, Sally A.; Kehler, Jan; Wafford, Keith A.; Krogsgaard-Larsen, Povl
Bioorganic and Medicinal Chemistry Letters, 2001 , vol. 11, # 12 p. 1573 - 1577 Title/Abstract Full Text View citing articles Show Details
Garcia-Santos; Calle; Casado
Journal of the American Chemical Society, 2001 , vol. 123, # 31 p. 7506 - 7510 Title/Abstract Full Text View citing articles Show Details
Dijols; Perollier; Lefevre-Groboillot; Pethe; Attias; Boucher; Stuehr; Mansuy
Journal of Medicinal Chemistry, 2001 , vol. 44, # 20 p. 3199 - 3202 Title/Abstract Full Text View citing articles Show Details
Clark; Hodgson; Goldsmith; Street
Journal of the Chemical Society. Perkin Transactions 1, 2001 , # 24 p. 3312 - 3324 Title/Abstract Full Text View citing articles Show Details
Kovacs, Ildiko; Yamamura, Henry I.; Waite, Sue L.; Varga, Eva V.; Roeske, William R.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 2 p. 500 - 507 Title/Abstract Full Text View citing articles Show Details
Xu, Guozhang; Liu, Yahua; Kansal, Mayank M.; Sayre, Lawrence M.
Chemical Research in Toxicology, 1999 , vol. 12, # 9 p. 855 - 861 Title/Abstract Full Text View citing articles Show Details
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Behrends, Jan C.
British Journal of Pharmacology, 2000 , vol. 129, # 2 p. 402 - 408 Title/Abstract Full Text View citing articles Show Details
Frolovskii; Garibova; Voronina; Studnev; Rozantsev
Pharmaceutical Chemistry Journal, 2001 , vol. 35, # 5 p. 239 - 242 Title/Abstract Full Text View citing articles Show Details
Comment
Bioactivities present
(Pharmacological Data)
52 of 992
Reference
Kumar Maji, Samir; Banerjee, Rahul; Velmurugan; Razak; Fun; Banerjee, Arindam
Journal of Organic Chemistry, 2002 , vol. 67, # 3 p. 633 - 639 Title/Abstract Full Text View citing articles Show Details
Porter, David J. T.; Harrington, Joan A.; Almond, Merrick R.; Chestnut, William G.; Tanoury, Gerald; Spector, Thomas
Biochemical Pharmacology, 1995 , vol. 50, # 9 p. 1475 - 1484 Title/Abstract Full Text View citing articles Show Details
Thwaites, David T.; Stevens, Beverley C.
Experimental Physiology, 1999 , vol. 84, # 2 p. 275 - 284 Title/Abstract Full Text View citing articles Show Details
Krasowski, Matthew D.; Finn, Suzanne E.; Ye, Qing; Harrison, Neil L.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 3 p. 934 - 942 Title/Abstract Full Text View citing articles Show Details
Baron, Bruce M.; Siegel, Barry W.; Harrison, Boyd L.; Gross, Raymond S.; Hawes, Calvin; Towers, Pat
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 1 p. 62 - 68 Title/Abstract Full Text View citing articles Show Details
Monasterolo, Liliana A.; Trumper, Laura; Elias, M. Monica
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 2 p. 602 - 607 Title/Abstract Full Text View citing articles Show Details
Masonis, A. E. Tory; McCarthy, Michael P.
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 1 p. 186 - 193 Title/Abstract Full Text View citing articles Show Details
Shin, Jong-Shik; Kim, Byung-Gee
Journal of Organic Chemistry, 2002 , vol. 67, # 9 p. 2848 - 2853 Title/Abstract Full Text View citing articles Show Details
Horoszok, Lucy; Raymond, Valerie; Sattelle, David B; Wolstenholme, Adrian J
British Journal of Pharmacology, 2001 , vol. 132, # 6 p. 1247 - 1254 Title/Abstract Full Text View citing articles Show Details
Stolze, Karen; Holmes, Stephen C.; Earnshaw, David J.; Singh, Mohinder; Stetsenko, Dmitry; Williams, Donna; Gait, Michael J.
Bioorganic and Medicinal Chemistry Letters, 2001 , vol. 11, # 23 p. 3007 - 3010 Title/Abstract Full Text View citing articles Show Details
Del Pilar Garcia-Santos; Gonzalez-Mancebo, Samuel; Hernandez-Benito, Jesus; Calle, Emilio; Casado, Julio
Journal of the American Chemical Society, 2002 , vol. 124, # 10 p. 2177 - 2182 Title/Abstract Full Text View citing articles Show Details
Carlier, Paul R; Chow, Ella S-H; Barlow, Rebecca L; Bloomquist, Jeffrey R
Bioorganic and medicinal chemistry letters, 2002 , vol. 12, # 15 p. 1985 - 1988 Title/Abstract Full Text View citing articles Show Details
Billinton, Andrew; Baird, Virginia H.; Thom, Maria; Duncan, John S.; Upton, Neil; Bowery, Norman G.
British Journal of Pharmacology, 2001 , vol. 132, # 2 p. 475 - 480 Title/Abstract Full Text View citing articles Show Details
Martinez; Gervasini; Agundez; Carrillo; Ramos; Garcia-Gamito; Gallardo; Benitez
European Journal of Clinical Pharmacology, 2000 , vol. 56, # 2 p. 145 - 151 Title/Abstract Full Text View citing articles Show Details
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Hansen, Suzanne L.; Fjalland, Bjarne; Jackson, Meyer B.
Molecular Pharmacology, 1999 , vol. 55, # 3 p. 489 - 496 Title/Abstract Full Text View citing articles Show Details
Anikinal; Vikharev; Safinl; Gorbunov; Shklyaev; Karmanov
Pharmaceutical Chemistry Journal, 2002 , vol. 36, # 2 p. 72 - 76 Title/Abstract Full Text View citing articles Show Details
Pitts, William J; Guo, Junqing; Dhar, T G Murali; Shen, Zhongqi; Gu, Henry H; Watterson, Scott H; Bednarz, Mark S; Chen, Bang Chi; Barrish, Joel C; Bassolino, Donna; Cheney, Daniel; Fleener, Catherine A; Rouleau, Katherine A; Hollenbaugh, Diane L; Iwanowicz, Edwin J
Bioorganic and medicinal chemistry letters, 2002 , vol. 12, # 16 p. 2137 - 2140 Title/Abstract Full Text View citing articles Show Details
Widler, Leo; Jaeggi, Knut A.; Glatt, Markus; Mueller, Klaus; Bachmann, Rolf; Bisping, Michael; Born, Anne-Ruth; Cortesi, Reto; Guiglia, Gabriela; Jeker, Heidi; Klein, Remy; Ramseier, Ueli; Schmid, Johann; Schreiber, Gerard; Seltenmeyer, Yves; Green, Jonathan R.
Journal of Medicinal Chemistry, 2002 , vol. 45, # 17 p. 3721 - 3738 Title/Abstract Full Text View citing articles Show Details
Orzeszko, Andrzej; Kaminska, Beata; Starociak, Bohdan J.
Farmaco, 2002 , vol. 57, # 8 p. 619 - 624 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Kazaryan; Grigoryan; Paronikyan; Agaronyan; Gevondyan; Samvelyan
Pharmaceutical Chemistry Journal, 2001 , vol. 35, # 9 p. 485 - 487 Title/Abstract Full Text View citing articles Show Details
Nadtochii; Melent'eva
Pharmaceutical Chemistry Journal, 2001 , vol. 35, # 9 p. 518 - 519 Title/Abstract Full Text View citing articles Show Details
Kapur, Jaideep; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 3 p. 444 - 452 Title/Abstract Full Text View citing articles Show Details
Kilbinger; Ginap; Erbelding
Naunyn-Schmiedeberg's Archives of Pharmacology, 1999 , vol. 359, # 6 p. 500 - 504 Title/Abstract Full Text View citing articles Show Details
An, Lin-Kun; Bu, Xian-Zhang; Wu, Hai-Qiang; Guo, Xin-Dong; Ma, Lin; Gu, Lian-Quan
Tetrahedron, 2002 , vol. 58, # 52 p. 10315 - 10321 Title/Abstract Full Text View citing articles Show Details
Perron-Sierra, Francoise; Saint Dizier, Dominique; Bertrand, Marc; Genton, Annie; Tucker, Gordon C; Casara, Patrick
Bioorganic and medicinal chemistry letters, 2002 , vol. 12, # 22 p. 3291 - 3296 Title/Abstract Full Text View citing articles Show Details
Lee, Jae Koo; Ahn, Ki Chang; Park, Oee Sook; Ko, Yong Kwan; Kim, Dae-Whang
Journal of agricultural and food chemistry, 2002 , vol. 50, # 7 p. 1791 - 1803 Title/Abstract Full Text View citing articles Show Details
Ramasami
Journal of Chemical and Engineering Data, 2002 , vol. 47, # 5 p. 1164 - 1166 Title/Abstract Full Text View citing articles Show Details
Thomas, James B.; Atkinson, Robert N.; Namdev, Nivedita; Rothman, Richard B.; Gigstad, Kenneth M.; Fix, Scott E.; Mascarella, S. Wayne; Burgess, Jason P.; Vinson, N. Ariane; Xu, Heng; Dersch, Christina M.; Cantrell, Buddy E.; Zimmerman, Dennis M.; Carroll, F. Ivy
Journal of Medicinal Chemistry, 2002 , vol. 45, # 16 p. 3524 - 3530 Title/Abstract Full Text View citing articles Show Details
Szczecinski, Przemyslaw; Bartusik, Dorota
Journal of Chemical Research - Part S, 2002 , # 2 p. 84 - 85 Title/Abstract Full Text View citing articles Show Details
Onali, Pierluigi; Olianas, Maria C
Biochemical Pharmacology, 2001 , vol. 62, # 2 p. 183 - 190 Title/Abstract Full Text View citing articles Show Details
Krasowski, Matthew D.; Koltchine, Vladimir V.; Rick, Caroline E.; Ye, Qing; Finn, Suzanne E.; Harrison, Neil L.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 530 - 538 Title/Abstract Full Text View citing articles Show Details
Konishi, Yutaka; Hagiwara, Keiko; Shimizu, Makoto
Bioscience, biotechnology, and biochemistry, 2002 , vol. 66, # 11 p. 2449 - 2457 Title/Abstract Full Text View citing articles Show Details
Brinner, Kristin M; Mi Kim, Jin; Habashita, Hiromu; Gluzman, Ilya Y; Goldberg, Daniel E; Ellman, Jonathan A
Bioorganic and Medicinal Chemistry, 2002 , vol. 10, # 11 p. 3649 - 3661 Title/Abstract Full Text View citing articles Show Details
Kurchan, Alexei N.; Kutateladze, Andrei G.
Organic Letters, 2002 , vol. 4, # 23 p. 4129 - 4131 Title/Abstract Full Text View citing articles Show Details
Castonguay, Roselyne; Lherbet, Christian; Keillor, Jeffrey W.
Bioorganic and Medicinal Chemistry, 2002 , vol. 10, # 12 p. 4185 - 4191 Title/Abstract Full Text View citing articles Show Details
Shaukat Husain; Ziebell, Michael R.; Ruesch, Dirk; Hong, Filbert; Arevalo, Enrique; Kosterlitz, Jonathan A.; Olsen, Richard W.; Forman, Stuart A.; Cohen, Jonathan B.; Miller, Keith W.
Journal of Medicinal Chemistry, 2003 , vol. 46, # 7 p. 1257 - 1265 Title/Abstract Full Text View citing articles Show Details
Park, Soobong; Hayes, Brittany L.; Marankan, Fatima; Mulhearn, Debbie C.; Wanna, Linda; Mesecar, Andrew D.; Santarsiero, Bernard D.; Johnson, Michael E.; Venton, Duane L.
Journal of Medicinal Chemistry, 2003 , vol. 46, # 6 p. 936 - 953 Title/Abstract Full Text View citing articles Show Details
Vrudhula, Vivekananda M.; Kerr, David E.; Siemers, Nathan O.; Dubowchik, Gene M.; Senter, Peter D.
Bioorganic and Medicinal Chemistry Letters, 2003 , vol. 13, # 3 p. 539 - 542 Title/Abstract Full Text View citing articles Show Details
Li, Liantao; Kracht, Julia; Peng, Shiqi; Bernhardt, Guenther; Buschauer, Armin
Bioorganic and Medicinal Chemistry Letters, 2003 , vol. 13, # 7 p. 1245 - 1248 Title/Abstract Full Text View citing articles Show Details
53 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Rao, T.Sudhakar; Nampalli, Satyam; Sekher, Padmanabhan; Kumar, Shiv
Tetrahedron Letters, 2002 , vol. 43, # 43 p. 7793 - 7795 Title/Abstract Full Text View citing articles Show Details
Choi, Jin Seok; Lee, Hwa-Sun; Lee, Younjoo; Jeong, Nakcheol; Kim, Hack-Joo; Kim, Young-Deug; Han, Hogyu
Tetrahedron Letters, 2002 , vol. 43, # 24 p. 4295 - 4300 Title/Abstract Full Text Show Details
Szczecinski; Bartusik
Polish Journal of Chemistry, 2003 , vol. 77, # 3 p. 321 - 328 Title/Abstract Full Text View citing articles Show Details
Kravchenko; Maksareva; Belyakov; Sigachev; Chegaev; Lyssenko; Lebedev; Makhova
Russian Chemical Bulletin, 2003 , vol. 52, # 1 p. 192 - 197 Title/Abstract Full Text View citing articles Show Details
Tsubaki, Kazunori; Tanaka, Hiroyuki; Morikawa, Hiroshi; Fuji, Kaoru
Tetrahedron, 2003 , vol. 59, # 18 p. 3195 - 3199 Title/Abstract Full Text View citing articles Show Details
Faber, Cornelius; Pracht, Eberhard; Haase, Axel
Journal of magnetic resonance (San Diego, Calif. : 1997), 2003 , vol. 161, # 2 p. 265 - 274 Title/Abstract Full Text View citing articles Show Details
Gorostidi, Gerardo R. Echevarria; Castellanos, M. Gabriela; Perez, Piedad Martin; Santos, Jose G.; Blanco, Francisco Garcia
Bulletin of the Chemical Society of Japan, 2003 , vol. 76, # 3 p. 523 - 528 Title/Abstract Full Text Show Details
Nam, Nguyen-Hai; Kim, Yong; You, Young-Jae; Hong, Dong-Ho; Kim, Hwan-Mook; Ahn, Byung-Zun
Bioorganic and Medicinal Chemistry, 2003 , vol. 11, # 6 p. 1021 - 1029 Title/Abstract Full Text View citing articles Show Details
Kim, Kwang-Ok; Kim, Yoo Jung; Lee, Yong Tae; Hammock, Bruce D.; Lee, Hye-Sung
Journal of Agricultural and Food Chemistry, 2002 , vol. 50, # 23 p. 6675 - 6682 Title/Abstract Full Text View citing articles Show Details
Takemoto
Experimental Physiology, 2000 , vol. 85, # 5 p. 479 - 485 Title/Abstract Full Text View citing articles Show Details
Weingarten, Saskia; Thiem, Joachim
Synlett, 2003 , # 7 p. 1052 - 1054 Title/Abstract Full Text View citing articles Show Details
Laval, Gilles; Golding, Bernard T.
Synlett, 2003 , # 4 p. 542 - 546 Title/Abstract Full Text View citing articles Show Details
Zheng, Xiang-Jun; Jin, Lin-Pei
Journal of Molecular Structure, 2003 , vol. 655, # 1 p. 7 - 15 Title/Abstract Full Text View citing articles Show Details
Garazd; Shilin; Khilya
Chemistry of Natural Compounds, 2002 , vol. 38, # 5 p. 416 - 423 Title/Abstract Full Text View citing articles Show Details
Orain, David; Koch, Guido; Giger, Rudolf
Chimia, 2003 , vol. 57, # 5 p. 255 - 261 Title/Abstract Full Text View citing articles Show Details
Aoki, Katsumasa; Ishikawa, Yoshinobu; Oyama, Miyuki; Tomisugi, Yoshikazu; Uno, Tadayuki
Chemical and pharmaceutical bulletin, 2003 , vol. 51, # 8 p. 899 - 903 Title/Abstract Full Text View citing articles Show Details
Sanvicens, Nuria; Pichon, Valerie; Hennion, Marie-Claire; Marco, M.-Pilar
Journal of Agricultural and Food Chemistry, 2003 , vol. 51, # 1 p. 156 - 164 Title/Abstract Full Text View citing articles Show Details
Carelli, Vincenzo; Liberatore, Felice; Scipione, Luigi; Giorgioni, Gianfabio; Di Stefano, Antonio; Impicciatore, Mariannina; Ballabeni, Vigilio; Calcina, Francesco; Magnanini, Francesca; Barocelli, Elisabetta
Bioorganic and Medicinal Chemistry Letters, 2003 , vol. 13, # 21 p. 3765 - 3769 Title/Abstract Full Text View citing articles Show Details
Ghosh, Subhash; Chan, Julian M. W.; Lea, Christopher R.; Meints, Gary A.; Lewis, Jared C.; Tovian, Zev S.; Flessner, Ryan M.; Loftus, Timothy C.; Bruchhaus, Iris; Kendrick, Howard; Croft, Simon L.; Kemp, Robert G.; Kobayashi, Seike; Nozaki, Tomoyoshi; Oldfield, Eric
Journal of Medicinal Chemistry, 2004 , vol. 47, # 1 p. 175 - 187 Title/Abstract Full Text View citing articles Show Details
Nieuwenhuizen, Willem F.; Dekker, Henk L.; De Koning, Leo J.; Groeneveld, Toos; De Koster, Chris G.; De Jong, Govardus A. H.
Journal of Agricultural and Food Chemistry, 2003 , vol. 51, # 24 p. 7132 - 7139 Title/Abstract Full Text View citing articles Show Details
54 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Zav'yalov; Dorofeeva; Rumyantseva; Kulikova; Ezhova; Kravchenko; Zavozin
Pharmaceutical Chemistry Journal, 2002 , vol. 36, # 8 p. 440 - 442 Title/Abstract Full Text View citing articles Show Details
Rigo, J-M; Hans; Nguyen; Rocher; Belachew; Malgrange; Leprince; Moonen; Selak; Matagne; Klitgaard
British journal of pharmacology, 2002 , vol. 136, # 5 p. 659 - 672 Title/Abstract Full Text View citing articles Show Details
Shi, Qi; Savage, Jason E.; Hufeisen, Sandra J.; Rauser, Laura; Grajkowska, Ewa; Ernsberger, Paul; Wroblewski, Jarda T.; Nadeau, Joseph H.; Roth, Bryan L.
Journal of Pharmacology and Experimental Therapeutics, 2003 , vol. 305, # 1 p. 131 - 142 Title/Abstract Full Text View citing articles Show Details
Veselovskaya; Shilin; Garazd; Khilya
Chemistry of Natural Compounds, 2003 , vol. 39, # 2 p. 177 - 181 Title/Abstract Full Text View citing articles Show Details
Katiyar; Tiwari; Tripathi; Srivastava; Chaturvedi
Bioorganic and Medicinal Chemistry, 2003 , vol. 11, # 20 p. 4369 - 4375 Title/Abstract Full Text View citing articles Show Details
Kato, Yuki; Kato, Yoko; Furukawa, Keiji; Hara, Shodo
Bioscience, Biotechnology and Biochemistry, 2002 , vol. 66, # 12 p. 2600 - 2605 Title/Abstract Full Text View citing articles Show Details
Hom, Roy K.; Gailunas, Andrea F.; Mamo, Shumeye; Fang, Larry Y.; Tung, Jay S.; Walker, Donald E.; Davis, David; Thorsett, Eugene D.; Jewett, Nancy E.; Moon, Joseph B.; John, Varghese
Journal of Medicinal Chemistry, 2004 , vol. 47, # 1 p. 158 - 164 Title/Abstract Full Text View citing articles Show Details
Kim, In-Hae; Morisseau, Christophe; Watanabe, Takaho; Hammock, Bruce D.
Journal of Medicinal Chemistry, 2004 , vol. 47, # 8 p. 2110 - 2122 Title/Abstract Full Text View citing articles Show Details
Vianello, Paola; Cozzi, Paolo; Galvani, Arturo; Meroni, Maurizio; Varasi, Mario; Volpi, Daniele; Bandiera, Tiziano
Bioorganic and Medicinal Chemistry Letters, 2004 , vol. 14, # 3 p. 657 - 661 Title/Abstract Full Text View citing articles Show Details
Tan, Christopher; Wei, Lianhu; Ottensmeyer, F. Peter; Goldfine, Ira; Maddux, Betty A.; Yip, Cecil C.; Batey, Robert A.; Kotra, Lakshmi P.
Bioorganic and Medicinal Chemistry Letters, 2004 , vol. 14, # 6 p. 1407 - 1410 Title/Abstract Full Text View citing articles Show Details
Shi, Yun; Kuzuya, Akinori; Machida, Kenzo; Komiyama, Makoto
Tetrahedron Letters, 2004 , vol. 45, # 19 p. 3703 - 3706 Title/Abstract Full Text View citing articles Show Details
Mulla; Gurubasavaraj; Nandibewoor
Polish Journal of Chemistry, 2003 , vol. 77, # 12 p. 1833 - 1840 Title/Abstract Full Text View citing articles Show Details
Kokotos, George; Six, David A.; Loukas, Vassilios; Smith, Timothy; Constantinou-Kokotou, Violetta; Hadjipavlou-Litina, Dimitra; Kotsovolou, Stavroula; Chiou, Antonia; Beltzner, Christopher C.; Dennis, Edward A.
Journal of Medicinal Chemistry, 2004 , vol. 47, # 14 p. 3615 - 3628 Title/Abstract Full Text View citing articles Show Details
Golovko; Solov'eva; Anisimova; Granik
Chemistry of Heterocyclic Compounds, 2003 , vol. 39, # 3 p. 344 - 353 Title/Abstract Full Text View citing articles Show Details
Suresh, Surisetti; Periasamy, Mariappan
Tetrahedron Letters, 2004 , vol. 45, # 33 p. 6291 - 6293 Title/Abstract Full Text View citing articles Show Details
Buhr, Andreas; Schaerer, Martin T.; Baur, Roland; Sigel, Erwin
Molecular Pharmacology, 1997 , vol. 52, # 4 p. 676 - 682 Title/Abstract Full Text View citing articles Show Details
Fisher, Janet L.; Zhang, Jie; Macdonald, Robert L.
Molecular Pharmacology, 1997 , vol. 52, # 4 p. 714 - 724
Title/Abstract Full Text View citing articles Show Details
Urwyler, Stephan; Pozza, Mario F; Lingenhoehl, Kurt; Mosbacher, Johannes; Lampert, Christina; Froestl, Wolfgang; Koller, Manuel; Kaupmann, Klemens
The Journal of pharmacology and experimental therapeutics, 2003 , vol. 307, # 1 p. 322 - 330 Title/Abstract Full Text View citing articles Show Details
McCormick; Tunnicliff
Pharmacology, 1998 , vol. 57, # 3 p. 124 - 131 Title/Abstract Full Text View citing articles Show Details
Van Rijn, Clementina M.; Willems-van Bree, Elly
European Journal of Pharmacology, 2003 , vol. 464, # 2-3 p. 95 - 100 Title/Abstract Full Text View citing articles Show Details
55 of 992
56 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Hale, Jeffrey J.; Doherty, George; Toth, Leslie; Li, Zhen; Mills, Sander G.; Hajdu, Richard; Keohane, Carol Ann; Rosenbach, Mark; Milligan, James; Shei, Gan-Ju; Chrebet, Gary; Bergstrom, James; Card, Deborah; Rosen, Hugh; Mandala, Suzanne
Bioorganic and Medicinal Chemistry Letters, 2004 , vol. 14, # 13 p. 3495 - 3499 Title/Abstract Full Text View citing articles Show Details
Nilsson, Mathias; Duarte, Iola F.; Almeida, Claudia; Delgadillo, Ivonne; Goodfellow, Brian J.; Gil, Ana M.; Morris, Gareth A.
Journal of Agricultural and Food Chemistry, 2004 , vol. 52, # 12 p. 3736 - 3743 Title/Abstract Full Text View citing articles Show Details
Zhao, Long-Xuan; Park, Jae Gyu; Moon, Yoon-Soo; Basnet, Arjun; Choi, Jongwon; Kim, Eun-Kyung; Jeong, Tae Cheon; Jahng, Yurngdong; Lee, Eung-Seok
Farmaco, 2004 , vol. 59, # 5 p. 381 - 388 Title/Abstract Full Text View citing articles Show Details
Mercier, Nicolas; Riou, Amedee
Chemical Communications, 2004 , # 7 p. 844 - 845 Title/Abstract Full Text View citing articles Show Details
Schousboe, Arne; Sarup, Alan; Larsson, Orla M.; White, H. Steve
Biochemical Pharmacology, 2004 , vol. 68, # 8 p. 1557 - 1563 Title/Abstract Full Text View citing articles Show Details
Van Rijn, Clementina M.; Willems-Van Bree, Elly
European Journal of Pharmacology, 2004 , vol. 485, # 1-3 p. 43 - 51 Title/Abstract Full Text View citing articles Show Details
Skander, Myriem; Humbert, Nicolas; Collot, Jerome; Gradinaru, Julieta; Klein, Gerard; Loosli, Andreas; Sauser, Jerome; Zocchi, Andrea; Gilardoni, Francois; Ward, Thomas R.
Journal of the American Chemical Society, 2004 , vol. 126, # 44 p. 14411 - 14418 Title/Abstract Full Text View citing articles Show Details
Kraemer, Petra M.; Goodrow, Marvin H.; Kremmer, Elisabeth
Journal of Agricultural and Food Chemistry, 2004 , vol. 52, # 9 p. 2462 - 2471 Title/Abstract Full Text View citing articles Show Details
De Luca, Lidia; Giacomelli, Giampaolo
Synlett, 2004 , # 12 p. 2180 - 2184 Title/Abstract Full Text View citing articles Show Details
Ikemoto, Tomomi; Ito, Tatsuya; Nishiguchi, Atsuko; Tomimatsu, Kiminori
Tetrahedron Letters, 2004 , vol. 45, # 51 p. 9335 - 9339 Title/Abstract Full Text View citing articles Show Details
Ichida, Tatsuya; Kuriyama, Kinya
Life Sciences, 1996 , vol. 59, # 25-26 p. 2173 - 2179 Title/Abstract Full Text View citing articles Show Details
Apelt; Grassmann; Ligneau; Pertz; Ganellin; Arrang; Schwartz; Schunack; Stark, Holger
Pharmazie, 2005 , vol. 60, # 2 p. 97 - 106 Title/Abstract Full Text View citing articles Show Details
Zhang, Zhongsheng; Liu, Jiyun; Verlinde, Christophe L. M. J.; Hol, Wim G. J.; Fan, Erkang
Journal of Organic Chemistry, 2004 , vol. 69, # 22 p. 7737 - 7740 Title/Abstract Full Text View citing articles Show Details
Zhou, Cong-Ying; Yu, Wing-Yiu; Chan, Philip Wai Hong; Che, Chi-Ming
Journal of Organic Chemistry, 2004 , vol. 69, # 21 p. 7072 - 7082 Title/Abstract Full Text View citing articles Show Details
Tian, Jinping; Yin, Yingwu
Magnetic Resonance in Chemistry, 2004 , vol. 42, # 7 p. 641 - 647 Title/Abstract Full Text View citing articles Show Details
Rueckle, Thomas; Biamonte, Marco; Grippi-Vallotton, Tania; Arkinstall, Steve; Cambet, Yves; Camps, Montserrat; Chabert, Christian; Church, Dennis J.; Halazy, Serge; Jiang, Xuliang; Martinou, Isabelle; Nichols, Anthony; Sauer, Wolfgang; Gotteland, Jean-Pierre
Journal of Medicinal Chemistry, 2004 , vol. 47, # 27 p. 6921 - 6934 Title/Abstract Full Text View citing articles Show Details
Howard, Michael H.; Cenizal, Teodorica; Gutteridge, Steven; Hanna, Wayne S.; Tao, Yong; Totrov, Maxim; Wittenbach, Vernon A.; Zheng, Ya-Jun
Journal of Medicinal Chemistry, 2004 , vol. 47, # 27 p. 6669 - 6672 Title/Abstract Full Text View citing articles Show Details
Enander, Karin; Dolphin, Gunnar T.; Liedberg, Bo; Lundstroem, Ingemar; Baltzer, Lars
Chemistry - A European Journal, 2004 , vol. 10, # 10 p. 2375 - 2385 Title/Abstract Full Text View citing articles Show Details
Wipf, Peter; Minion, Daniel J.; Halter, Robert J.; Berggren, Margareta I.; Ho, Caroline B.; Chiang, Gary G.; Kirkpatrick, Lynn; Abraham, Robert; Powis, Garth
Organic and Biomolecular Chemistry, 2004 , vol. 2, # 13 p. 1911 - 1920 Title/Abstract Full Text View citing articles Show Details
Begg, Malcolm; Molleman, Areles; Parsons, Mike
European Journal of Pharmacology, 2002 , vol. 434, # 1-2 p. 87 - 94 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological
Bioactivities present
Data)
57 of 992
Reference
Aspinwall; Bermudez; King; Wafford
Journal of Pharmacology and Experimental Therapeutics, 1997 , vol. 282, # 3 p. 1557 - 1564 Title/Abstract Full Text View citing articles Show Details
Ejim, Linda; Mirza, I. Ahmad; Capone, Christina; Nazi, Ishac; Jenkins, Steve; Chee, Gaik-Lean; Berghuis, Albert M.; Wright, Gerard D.
Bioorganic and Medicinal Chemistry, 2004 , vol. 12, # 14 p. 3825 - 3830 Title/Abstract Full Text View citing articles Show Details
Gschneidner, David; Corvino, JoAnne; Freeman, John; O'Toole, Doris; Shields, Lynn; Wang, Eric
Synthetic Communications, 2005 , vol. 35, # 12 p. 1567 - 1575 Title/Abstract Full Text View citing articles Show Details
Anandan, Sampath-Kumar; Ward, John S.; Brokx, Richard D.; Bray, Mark R.; Patel, Dinesh V.; Xiao, Xiao-Xi
Bioorganic and Medicinal Chemistry Letters, 2005 , vol. 15, # 8 p. 1969 - 1972 Title/Abstract Full Text View citing articles Show Details
Rossello, Armando; Nuti, Elisa; Catalani, Maria Pia; Carelli, Paolo; Orlandini, Elisabetta; Rapposelli, Simona; Tuccinardi, Tiziano; Atkinson, Susan J.; Murphy, Gillian; Balsamo, Aldo
Bioorganic and Medicinal Chemistry Letters, 2005 , vol. 15, # 9 p. 2311 - 2314 Title/Abstract Full Text View citing articles Show Details
Pontillo, Joseph; Tran, Joseph A.; Markison, Stacy; Joppa, Margaret; Fleck, Beth A.; Marinkovic, Dragan; Arellano, Melissa; Tucci, Fabio C.; Lanier, Marion; Nelson, Jodie; Saunders, John; Hoare, Sam R.J.; Foster, Alan C.; Chen, Chen
Bioorganic and Medicinal Chemistry Letters, 2005 , vol. 15, # 10 p. 2541 - 2546 Title/Abstract Full Text View citing articles Show Details
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Carbone, Vincenzo; Ishikura, Syuhei; Hara, Akira; El-Kabbani, Ossama
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 2 p. 301 - 312 Title/Abstract Full Text View citing articles Show Details
Trotter, Nicholas S.; Brimble, Margaret A.; Harris, Paul W.R.; Callis, David J.; Sieg, Frank
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 2 p. 501 - 517 Title/Abstract Full Text View citing articles Show Details
Clausen, Rasmus P.; Moltzen, Ejner K.; Perregaard, Jens; Lenz, Sibylle M.; Sanchez, Connie; Falch, Erik; Frolund, Bente; Bolvig, Tina; Sarup, Alan; Larsson, Orla M.; Schousboe, Arne; Krogsgaard-Larsen, Povl
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 3 p. 895 - 908 Title/Abstract Full Text View citing articles Show Details
Allegretti, Marcello; Bertini, Riccardo; Cesta, Maria Candida; Bizzarri, Cinzia; Di Bitondo, Rosa; Di Cioccio, Vito; Galliera, Emanuela; Berdini, Valerio; Topai, Alessandra; Zampella, Giuseppe; Russo, Vincenzo; Di Bello, Nicoletta; Nano, Giuseppe; Nicolini, Luca; Locati, Massimo; Fantucci, Piercarlo; Florio, Saverio; Colotta, Francesco
Journal of Medicinal Chemistry, 2005 , vol. 48, # 13 p. 4312 - 4331 Title/Abstract Full Text View citing articles Show Details
Xie, Yuli; Ding, Huasheng; Qian, Lihui; Yan, Xueming; Yang, Chunhao; Xie, Yuyuan
Bioorganic and Medicinal Chemistry Letters, 2005 , vol. 15, # 13 p. 3267 - 3270 Title/Abstract Full Text View citing articles Show Details
Chebib, Mary; Vandenberg, Robert J.; Johnston, Graham A. R.
British Journal of Pharmacology, 1997 , vol. 122, # 8 p. 1551 - 1560 Title/Abstract Full Text View citing articles Show Details
Lilley, Elliot; Gibson, Alan
British Journal of Pharmacology, 1997 , vol. 122, # 8 p. 1746 - 1752 Title/Abstract Full Text View citing articles Show Details
Wellendorph, Petrine; Hog, Signe; Greenwood, Jeremy R.; De Lichtenberg, Anne; Nielsen, Birgitte; Frolund, Bente; Brehm, Lotte; Clausen, Rasmus P.; Braeuner-Osborne, Hans
Journal of Pharmacology and Experimental Therapeutics, 2005 , vol. 315, # 1 p. 346 - 351 Title/Abstract Full Text View citing articles Show Details
Chebib; Vandenberg; Froestl; Johnston
European Journal of Pharmacology, 1997 , vol. 329, # 2-3 p. 223 - 229 Title/Abstract Full Text View citing articles Show Details
Westh-Hansen; Rasmussen; Hastrup; Nabekura; Noguchi; Akaike; Witt; Nielsen
European Journal of Pharmacology, 1997 , vol. 329, # 2-3 p. 253 - 257 Title/Abstract Full Text View citing articles Show Details
Piqueras, Laura; Martinez, Vicente
British journal of pharmacology, 2004 , vol. 142, # 6 p. 1038 - 1048 Title/Abstract Full Text View citing articles Show Details
Takahashi, Kanji; Ikura, Masahiro; Habashita, Hiromu; Nishizaki, Minoru; Sugiura, Tsuneyuki; Yamamoto, Shingo; Nakatani, Shingo; Ogawa, Koji; Ohno, Hiroyuki; Nakai, Hisao; Toda, Masaaki
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 14 p. 4527 - 4543 Title/Abstract Full Text View citing articles Show Details
Aoki, Hideyuki; Furuya, Yuji; Endo, Yasushi; Fujimoto, Kenshiro
Bioscience, Biotechnology and Biochemistry, 2003 , vol. 67, # 8 p. 1806 - 1808 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Leung-Toung, Regis; Tam, Tim F.; Zhao, Yanqing; Simpson, Craig D.; Li, Wanren; Desilets, Denis; Karimian, Khashayar
Journal of Organic Chemistry, 2005 , vol. 70, # 16 p. 6230 - 6241 Title/Abstract Full Text View citing articles Show Details
Sondhi, Sham M.; Goyal, Rajendra N.; Lahoti, Anand M.; Singh, Nirupma; Shukla, Rakesh; Raghubir, Ram
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 9 p. 3185 - 3195 Title/Abstract Full Text View citing articles Show Details
Ukhin; Kuz'mina
Russian Chemical Bulletin, 2004 , vol. 53, # 10 p. 2262 - 2268 Title/Abstract Full Text View citing articles Show Details
Voronkov; Belousova; Trukhina; Vlasova
Russian Journal of Organic Chemistry, 2006 , vol. 42, # 2 p. 172 - 174 Title/Abstract Full Text View citing articles Show Details
Fakova, Helena; Pour, Milan; Kunes, Jiri; Senel, Petr
Tetrahedron Letters, 2005 , vol. 46, # 47 p. 8137 - 8140 Title/Abstract Full Text View citing articles Show Details
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Goutman, Juan D.; Escobar, Ariel L.; Calvo, Daniel J.
British Journal of Pharmacology, 2005 , vol. 146, # 7 p. 1000 - 1009 Title/Abstract Full Text View citing articles Show Details
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Crittenden, Deborah L.; Park, Anna; Qiu, Jian; Silverman, Richard B.; Duke, Rujee K.; Johnston, Graham A.R.; Jordan, Meredith J.T.; Chebib, Mary
Bioorganic and Medicinal Chemistry, 2006 , vol. 14, # 2 p. 447 - 455 Title/Abstract Full Text View citing articles Show Details
Coro, Julieta; Perez, Rolando; Rodriguez, Hortensia; Suarez, Margarita; Vega, Celeste; Rolon, Miriam; Montero, David; Nogal, Juan Jose; Gomez-Barrio, Alicia
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 10 p. 3413 - 3421 Title/Abstract Full Text View citing articles Show Details
Soldo, Tomislav; Hofmann, Thomas
Journal of Agricultural and Food Chemistry, 2005 , vol. 53, # 23 p. 9165 - 9171 Title/Abstract Full Text View citing articles Show Details
Jorgensen, Malene R.; Jaroszewski, Jerzy W.; Witt, Matthias; Franzyk, Henrik
Synthesis, 2005 , # 16 art. no. P05305SS, p. 2687 - 2694 Title/Abstract Full Text View citing articles Show Details
Ray, Sudipta; Drew, Michael G.B.; Das, Apurba K.; Haldar, Debasish; Banerjee, Arindam
Tetrahedron Letters, 2006 , vol. 47, # 16 p. 2771 - 2774 Title/Abstract Full Text View citing articles Show Details
Abuhamdah; Fuerstner; Lees; Chazot
Biochemical Pharmacology, 2005 , vol. 70, # 9 p. 1382 - 1388 Title/Abstract Full Text View citing articles Show Details
Kawamura, Akane; Graham, James; Mushtaq, Adeel; Tsiftsoglou, Stefanos A.; Vath, Gregory M.; Hanna, Patrick E.; Wagner, Carston R.; Sim, Edith
Biochemical Pharmacology, 2005 , vol. 69, # 2 p. 347 - 359 Title/Abstract Full Text View citing articles Show Details
Pericic, Danka; Strac, Dubravka Svob; Jembrek, Maja Jazvinscak; Rajcan, Ivana
European Journal of Pharmacology, 2003 , vol. 482, # 1-3 p. 117 - 125 Title/Abstract Full Text View citing articles Show Details
Kaminski, Rafal M.; Marini, Herbert; Ortinski, Pavel I.; Vicini, Stefano; Rogawski, Michael A.
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 317, # 2 p. 694 - 703 Title/Abstract Full Text View citing articles Show Details
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Morris, Kendall D.W.; Moorefield, Charles N.; Amin, Jahanshah
Molecular Pharmacology, 1999 , vol. 56, # 4 p. 752 - 759 Title/Abstract Full Text View citing articles Show Details
Malitschek, Barbara; Schweizer, Claude; Keir, Miranda; Heid, Jakob; Froestl, Wolfgang; Mosbacher, Johannes; Kuhn, Rainer; Henley, Jeremy; Joly, Cecile; Pin, Jean-Phillippe; Kaupmann, Klemens; Bettler, Bernhard
Molecular Pharmacology, 1999 , vol. 56, # 2 p. 448 - 454 Title/Abstract Full Text View citing articles Show Details
58 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Ramesh, Ramapanicker; Rajasekaran, Sakthidevi; Gupta, Rohit; Chandrasekaran, Srinivasan
Organic Letters, 2006 , vol. 8, # 9 p. 1933 - 1936 Title/Abstract Full Text View citing articles Show Details
Virga, Kristopher G.; Zhang, Yong-Mei; Leonardi, Roberta; Ivey, Robert A.; Hevener, Kirk; Park, Hee-Won; Jackowski, Suzanne; Rock, Charles O.; Lee, Richard E.
Bioorganic and Medicinal Chemistry, 2006 , vol. 14, # 4 p. 1007 - 1020 Title/Abstract Full Text View citing articles Show Details
Klimova; Babushkina; Khvostova
Russian Chemical Bulletin, 2005 , vol. 54, # 10 p. 2452 - 2455 Title/Abstract Full Text View citing articles Show Details
Yuan, Hai; Silverman, Richard B.
Bioorganic and Medicinal Chemistry, 2006 , vol. 14, # 5 p. 1331 - 1338 Title/Abstract Full Text View citing articles Show Details
Yang, Ting; Lin, Changxue; Fu, Hua; Jiang, Yuyang; Zhao, Yufen
Organic Letters, 2005 , vol. 7, # 21 p. 4781 - 4784 Title/Abstract Full Text View citing articles Show Details
Li, Heting; Jiang, Zhiqin; Wang, Xin; Zheng, Chao
Synthetic Communications, 2006 , vol. 36, # 14 p. 1933 - 1940 Title/Abstract Full Text View citing articles Show Details
Kauppila; Nikkola; Ketola; Kostiainen
Journal of Mass Spectrometry, 2006 , vol. 41, # 6 p. 781 - 789 Title/Abstract Full Text View citing articles Show Details
Fort, Sebastien; Birikaki, Lemonia; Dubois, Marie-Pierre; Antoine, Tatiana; Samain, Eric; Driguez, Hugues
Chemical Communications, 2005 , # 20 p. 2558 - 2560 Title/Abstract Full Text View citing articles Show Details
Kharitonov; Shul'ts; Shakirov; Tolstikov
Russian Journal of Organic Chemistry, 2006 , vol. 42, # 5 p. 707 - 718 Title/Abstract Full Text View citing articles Show Details
Fujimori, Sayumi; Osawa, Masato; Iemata, Mika; Hinoi, Eiichi; Yoneda, Yukio
Biological and Pharmaceutical Bulletin, 2006 , vol. 29, # 2 p. 297 - 301 Title/Abstract Full Text View citing articles Show Details
Huang, Ren-Qi; Bell-Horner, Cathy L.; Dibas, Mohammed I.; Covey, Douglas F.; Drewe, John A.; Dillon, Glenn H.
Journal of Pharmacology and Experimental Therapeutics, 2001 , vol. 298, # 3 p. 986 - 995 Title/Abstract Full Text View citing articles Show Details
Nelson, Rachael M; Green; Hainsworth, Atticus H
European Journal of Pharmacology, 2002 , vol. 452, # 3 p. 255 - 262 Title/Abstract Full Text View citing articles Show Details
Lambert; Belelli
British Journal of Pharmacology, 2002 , vol. 136, # 7 p. 957 - 959 Title/Abstract Full Text View citing articles Show Details
Koltchine, Vladimir V.; Finn, Suzanne E.; Jenkins, Andrew; Nikolaeva, Natalia; Lin, Audrey; Harrison, Neil L.
Molecular Pharmacology, 1999 , vol. 56, # 5 p. 1087 - 1093 Title/Abstract Full Text View citing articles Show Details
Saito, Hikaru; Hirano, Hiroyuki; Nakagawa, Hiroshi; Fukami, Takeaki; Oosumi, Keisuke; Murakami, Kaori; Kimura, Hiroko; Kouchi, Takayuki; Konomi, Mami; Tao, Eriko; Tsujikawa, Noboru; Tarui, Shigeki; Nagakura, Makoto; Osumi, Masako; Ishikawa, Toshihisa
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 317, # 3 p. 1114 - 1124 Title/Abstract Full Text View citing articles Show Details
Shafir, Alexandr; Buchwald, Stephen L.
Journal of the American Chemical Society, 2006 , vol. 128, # 27 p. 8742 - 8743 Title/Abstract Full Text View citing articles Show Details
Kubicek, Vojtech; Kotek, Jan; Hermann, Petr; Lukes, Ivan
European Journal of Inorganic Chemistry, 2007 , # 2 p. 333 - 344 Title/Abstract Full Text View citing articles Show Details
Huen, Michael S.Y.; Hui, Kwok-Min; Leung, Justin W.C.; Sigel, Erwin; Baur, Roland; Wong, J. Tze-Fei; Xue, Hong
Biochemical Pharmacology, 2003 , vol. 66, # 12 p. 2397 - 2407 Title/Abstract Full Text View citing articles Show Details
Mehta, Ashok K.; Muschaweck, Nicole M.; Maeda, Dean Y.; Coop, Andrew; Ticku, Maharaj K.
Journal of Pharmacology and Experimental Therapeutics, 2001 , vol. 299, # 3 p. 1148 - 1153 Title/Abstract Full Text View citing articles Show Details
Piyapolrungroj; Li; Bockbrader; Liu; Fleisher
Pharmaceutical Research, 2001 , vol. 18, # 8 p. 1126 - 1130 Title/Abstract Full Text View citing articles Show Details
59 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Yamashita, Megumi; Marszalec, William; Yeh, Jay Z.; Narahashi, Toshio
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 319, # 1 p. 431 - 438 Title/Abstract Full Text View citing articles Show Details
Chang, Yong; Covey, Douglas F.; Weiss, David S.
Molecular Pharmacology, 2000 , vol. 58, # 6 p. 1375 - 1380 Title/Abstract Full Text View citing articles Show Details
Burghardt, Stephan; Hirsch, Andreas; Schade, Boris; Ludwig, Kai; Boettcher, Christoph
Angewandte Chemie - International Edition, 2005 , vol. 44, # 19 p. 2976 - 2979 Title/Abstract Full Text View citing articles Show Details
Sharma, Gangavaram V. M.; Jayaprakash, Pagadala; Narsimulu, Kongari; Ravi Sankar, Ampapathi; Ravinder Reddy, Kondreddy; Radha Krishna, Palakodety; Kunwar, Ajit C.
Angewandte Chemie - International Edition, 2006 , vol. 45, # 18 p. 2944 - 2947 Title/Abstract Full Text View citing articles Show Details
Ikura, Masahiro; Nakatani, Shingo; Yamamoto, Shingo; Habashita, Hiromu; Sugiura, Tsuneyuki; Takahashi, Kanji; Ogawa, Koji; Ohno, Hiroyuki; Nakai, Hisao; Toda, Masaaki
Bioorganic and Medicinal Chemistry, 2006 , vol. 14, # 12 p. 4241 - 4252 Title/Abstract Full Text View citing articles Show Details
Nakatani, Shingo; Ikura, Masahiro; Yamamoto, Shingo; Nishita, Yoshitaka; Itadani, Satoshi; Habashita, Hiromu; Sugiura, Tsuneyuki; Ogawa, Koji; Ohno, Hiroyuki; Takahashi, Kanji; Nakai, Hisao; Toda, Masaaki
Bioorganic and Medicinal Chemistry, 2006 , vol. 14, # 15 p. 5402 - 5422 Title/Abstract Full Text View citing articles Show Details
Gelmi, Maria Luisa; Pocar, Donato; Pontremoli, Guido; Pellegrino, Sara; Bombardelli, Ezio; Fontana, Gabriele; Riva, Antonella; Balduini, Walter; Carloni, Silvia; Cimino, Mauro; Johnson, Francis
Journal of Medicinal Chemistry, 2006 , vol. 49, # 18 p. 5571 - 5577 Title/Abstract Full Text View citing articles Show Details
Lolli, Marco L.; Hansen, Suzanne L.; Rolando, Barbara; Nielsen, Birgitte; Wellendorph, Petrine; Madsen, Karsten; Larsen, Orla Miller; Kristiansen, Uffe; Fruttero, Roberta; Gasco, Alberto; Johansen, Tommy N.
Journal of Medicinal Chemistry, 2006 , vol. 49, # 14 p. 4442 - 4446 Title/Abstract Full Text View citing articles Show Details
Husain, S. Shaukat; Nirthanan, Selvanayagam; Ruesch, Dirk; Solt, Ken; Cheng, Qi; Li, Guo-Dong; Arevalo, Enrique; Olsen, Richard W.; Raines, Douglas E.; Forman, Stuart A.; Cohen, Jonathan B.; Miller, Keith W.
Journal of Medicinal Chemistry, 2006 , vol. 49, # 16 p. 4818 - 4825 Title/Abstract Full Text View citing articles Show Details
Zhang, Hongyan; Duan, Zhenjuan; Wang, Lei; Zhang, Yan; Wang, Shuo
Journal of Agricultural and Food Chemistry, 2006 , vol. 54, # 13 p. 4499 - 4505 Title/Abstract Full Text View citing articles Show Details
Abu Thaher, Bassam A.; Zahra, Jalal A.; El-Abadelah, Mustafa M.; Voelter
Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences, 2004 , vol. 59, # 8 p. 930 - 933 Title/Abstract Full Text View citing articles Show Details
Dorogov, Mikhail V.; Ivanovsky, Sergey A.; Khakhina, Maria Y.; Kravchenko, Dmitry V.; Tkachenko, Sergey E.; Ivachtchenko, Alexandre V.
Synthetic Communications, 2006 , vol. 36, # 23 p. 3525 - 3535 Title/Abstract Full Text View citing articles Show Details
Norlen; Bernsand; Konagaya; Hakanson
British Journal of Pharmacology, 2001 , vol. 134, # 8 p. 1767 - 1777 Title/Abstract Full Text View citing articles Show Details
Yokogawa, Tomonori; Kim, Seung U.; Krieger, Charles; Puil, Ernest
British Journal of Pharmacology, 2001 , vol. 134, # 1 p. 98 - 107 Title/Abstract Full Text View citing articles Show Details
Abbot, Emily L.; Grenade, Danielle S.; Kennedy, David J.; Gatfield, Kelly M.; Thwaites, David T.
British Journal of Pharmacology, 2006 , vol. 147, # 3 p. 298 - 306 Title/Abstract Full Text View citing articles Show Details
Odagaki, Yuji; Nishi, Nobuyuki; Nakagawa, Shin; Koyama, Tsukasa
Journal of Pharmacology and Experimental Therapeutics, 1999 , vol. 291, # 3 p. 1250 - 1256 Title/Abstract Full Text View citing articles Show Details
Hayakawa, Kazuhito; Kimura, Masayuki; Kamata, Katsuo
European Journal of Pharmacology, 2002 , vol. 438, # 1-2 p. 107 - 113 Title/Abstract Full Text View citing articles Show Details
Mortensen, Martin; Frolund, Bente; Jorgensen, Anne T.; Liljefors, Tommy; Krogsgaard-Larsen, Povl; Ebert, Bjarke
European Journal of Pharmacology, 2002 , vol. 451, # 2 p. 125 - 132 Title/Abstract Full Text View citing articles Show Details
Krasowski; Jenkins; Flood; Kung; Hopfinger; Harrison
Journal of Pharmacology and Experimental Therapeutics, 2001 , vol. 297, # 1 p. 338 - 351 Title/Abstract Full Text View citing articles Show Details
Kakemoto, Eiji; Okuyama, Emi; Nagata, Keiichi; Ozoe, Yoshihisa
Biochemical Pharmacology, 1999 , vol. 58, # 4 p. 617 - 621 Title/Abstract Full Text View citing articles Show Details
60 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Wenger, Mazal; Bernstein, Joel
Angewandte Chemie - International Edition, 2006 , vol. 45, # 47 p. 7966 - 7969 Title/Abstract Full Text View citing articles Show Details
Hossain, Sheikh Julfikar; Aoshima, Hitoshi; Koda, Hirofumi; Kiso, Yoshinobu
Bioscience, Biotechnology and Biochemistry, 2004 , vol. 68, # 9 p. 1842 - 1848 Title/Abstract Full Text View citing articles Show Details
Sobolev, Anatoli P.; Brosio, Elvino; Gianferri, Raffaella; Segre, Anna L.
Magnetic Resonance in Chemistry, 2005 , vol. 43, # 8 p. 625 - 638 Title/Abstract Full Text View citing articles Show Details
Van Wyk, Marianne; Strauss, Erick
Chemical Communications, 2007 , # 4 p. 398 - 400 Title/Abstract Full Text View citing articles Show Details
Fattori, Daniela; Rossi, Cristina; Fincham, Christopher I.; Caciagli, Valerio; Catrambone, Fernando; D'Andrea, Piero; Felicetti, Patrizia; Gensini, Martina; Marastoni, Elena; Nannicini, Rossano; Paris, Marielle; Terracciano, Rosa; Bressan, Alessandro; Giuliani, Sandro; Maggi, Carlo A.; Meini, Stefania; Valenti, Claudio; Quartara, Laura
Journal of Medicinal Chemistry, 2007 , vol. 50, # 3 p. 550 - 565 Title/Abstract Full Text View citing articles Show Details
Gros, Ludovic; Lorente, Silvia Orenes; Jimenez, Carmen; Yardley, Vanessa; Rattray, Lauren; Wharton, Hayley; Little, Susan; Croft, Simon L.; Ruiz-Perez, Luis M.; Gonzalez-Pacanowska, Dolores; Gilbert, Ian H.
Journal of Medicinal Chemistry, 2006 , vol. 49, # 20 p. 6094 - 6103 Title/Abstract Full Text View citing articles Show Details
Zareef, Muhammad; Iqbal, Rashid; Al-Masoudi, Najim A.; Zaidi, Javid H.; Arfan, Muhammad; Shahzad, Sohail A.
Phosphorus, Sulfur and Silicon and the Related Elements, 2007 , vol. 182, # 2 p. 281 - 298 Title/Abstract Full Text View citing articles Show Details
Cazor, Anne; Deborde, Catherine; Moing, Annick; Rolin, Dominique; This, Herve
Journal of Agricultural and Food Chemistry, 2006 , vol. 54, # 13 p. 4681 - 4686 Title/Abstract Full Text View citing articles Show Details
Dinsmore, Andrew; Mandy, Karen; Michael, Joseph P.
Organic and Biomolecular Chemistry, 2006 , vol. 4, # 6 p. 1032 - 1037 Title/Abstract Full Text View citing articles Show Details
Tegoni, Matteo; Ferretti, Luca; Sansone, Francesco; Remelli, Maurizio; Bertolasi, Valerio; Dallavalle, Francesco
Chemistry - A European Journal, 2007 , vol. 13, # 4 p. 1300 - 1308 Title/Abstract Full Text View citing articles Show Details
Storer; Akerman; Goadsby
British Journal of Pharmacology, 2001 , vol. 134, # 4 p. 896 - 904 Title/Abstract Full Text View citing articles Show Details
Sasaki, Sumiyo; Tohda, Chihiro; Kim, Mujo; Yokozawa, Takako
Biological and Pharmaceutical Bulletin, 2007 , vol. 30, # 4 p. 687 - 691 Title/Abstract Full Text View citing articles Show Details
Wardell, Bryan; Marik, Purba S.; Piper, David; Rutar, Tina; Jorgensen, Erik M.; Bamber, Bruce A.
British Journal of Pharmacology, 2006 , vol. 148, # 2 p. 162 - 172 Title/Abstract Full Text View citing articles Show Details
Al-Awadi; Pavlik; Al-Sarraf
Life Sciences, 2006 , vol. 79, # 9 p. 847 - 853 Title/Abstract Full Text View citing articles Show Details
Galvez, Thierry; Urwyler, Stephan; Prezeau, Laurent; Mosbacher, Johannes; Joly, Cecile; Malitschek, Barbara; Heid, Jakob; Brabet, Isabelle; Froestl, Wolfgang; Bettler, Bernhard; Kaupmann, Klemens; Pin, Jean-Philippe
Molecular Pharmacology, 2000 , vol. 57, # 3 p. 419 - 426 Title/Abstract Full Text View citing articles Show Details
Ryu, Eui-Hyun; Yan, Jie; Zhong, Zhenqi; Zhao, Yan
Journal of Organic Chemistry, 2006 , vol. 71, # 19 p. 7205 - 7213 Title/Abstract Full Text View citing articles Show Details
Choi, In-Young; Lee, Sang-Pil; Shen, Jun
Journal of Magnetic Resonance, 2005 , vol. 172, # 1 p. 9 - 16 Title/Abstract Full Text View citing articles Show Details
Gelmi, Maria Luisa; Fontana, Gabriele; Pocar, Donato; Pontremoli, Guido; Pellegrino, Sara; Bombardelli, Ezio; Riva, Antonella; Balduini, Walter; Carloni, Silvia; Cimino, Mauro
Journal of Medicinal Chemistry, 2007 , vol. 50, # 9 p. 2245 - 2248 Title/Abstract Full Text View citing articles Show Details
Kim, Jong-Man; Lee, Ji-Seok; Choi, Hyun; Sohn, Daewon; Ahn, Dong June
Macromolecules, 2005 , vol. 38, # 22 p. 9366 - 9376 Title/Abstract Full Text View citing articles Show Details
Veselovskaya; Ogorodniichuk; Garazd; Khilya
Chemistry of Natural Compounds, 2005 , vol. 41, # 5 p. 516 - 522 Title/Abstract Full Text View citing articles Show Details
Hide facts
61 of 992
62 of 992
Show next 200 Comment (Pharmacological Data)
Bioactivities present
Reference
Shokol; Semenyuchenko; Shilin; Turov; Ogorodniichuk; Khilya
Chemistry of Natural Compounds, 2005 , vol. 41, # 5 p. 533 - 538 Title/Abstract Full Text View citing articles Show Details
Yogeeswari, Perumal; Ragavendran, Jegadeesan Vaigunda; Sriram, Dharmarajan; Nageswari, Yarravarapu; Kavya, Ramkumar; Sreevatsan, Narayanan; Vanitha, Kaliappan; Stables, James
Journal of Medicinal Chemistry, 2007 , vol. 50, # 10 p. 2459 - 2467 Title/Abstract Full Text View citing articles Show Details
Cuerten, Beate; Kullmann, Paul H. M.; Bier, Mark E.; Kandler, Karl; Schmidt, Brigitte F.
Photochemistry and Photobiology, 2005 , vol. 81, # 3 p. 641 - 648 Title/Abstract Full Text View citing articles Show Details
Herrick, Richard S.; Dupont, Julie; Wrona, Iwona; Pilloni, Julia; Beaver, Matthew; Benotti, Mark; Powers, Frank; Ziegler, Christopher J.
Journal of Organometallic Chemistry, 2007 , vol. 692, # 6 SPEC. ISS. p. 1226 - 1233 Title/Abstract Full Text View citing articles Show Details
Kottani, Rudresha; Majjigapu, Janaki R. R.; Kurchan, Alexei; Majjigapu, Kavitha; Gustafson, Tiffany P.; Kutateladze, Andrei G.
Journal of the American Chemical Society, 2006 , vol. 128, # 46 p. 14794 - 14795 Title/Abstract Full Text View citing articles Show Details
Ichimura, Toshiaki; Yamanaka, Akiko; Ichiba, Toshio; Toyokawa, Tetsuya; Kamada, Yasuhiro; Tamamura, Takako; Maruyama, Susumu
Bioscience, Biotechnology and Biochemistry, 2006 , vol. 70, # 3 p. 718 - 721 Title/Abstract Full Text View citing articles Show Details
Mirk, Daniela; Luftmann, Heinrich; Waldvogel, Siegfried R.
Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences, 2005 , vol. 60, # 10 p. 1077 - 1082 Title/Abstract Full Text View citing articles Show Details
Guetzoyan, Lucie; Ramiandrasoa, Florence; Dorizon, Helene; Desprez, Christine; Bridoux, Alexandre; Rogier, Christophe; Pradines, Bruno; Perree-Fauvet, Martine
Bioorganic and Medicinal Chemistry, 2007 , vol. 15, # 9 p. 3278 - 3289 Title/Abstract Full Text View citing articles Show Details
Liberatore, Anne-Marie; Schulz, Jocelyne; Favre-Guilmard, Christine; Pommier, Jacques; Lannoy, Jacques; Pawlowski, Emilia; Barthelemy, Marie-Anne; Huchet, Marion; Auguet, Michel; Chabrier, Pierre-Etienne; Bigg, Dennis
Bioorganic and Medicinal Chemistry Letters, 2007 , vol. 17, # 6 p. 1746 - 1749 Title/Abstract Full Text View citing articles Show Details
Seregar; Hiremath; Nandibewoor
Zeitschrift fur Physikalische Chemie, 2006 , vol. 220, # 5 p. 615 - 629 Title/Abstract Full Text View citing articles Show Details
Mirzaei, Hamid; Regnier, Fred
Analytical Chemistry, 2006 , vol. 78, # 12 p. 4175 - 4183 Title/Abstract Full Text View citing articles Show Details
Karimipour, Gholam Reza; Shadegan, Hamid Asadpour; Ahmadpour, Roxana
Journal of Chemical Research, 2007 , # 4 p. 252 - 256 Title/Abstract Full Text View citing articles Show Details
Yogeeswari, Perumal; Sriram, Dharmarajan; Sahitya, Puppala; Ragavendran, Jegadeesan Vaigunda; Ranganadh, Velagaleti
Bioorganic and Medicinal Chemistry Letters, 2007 , vol. 17, # 13 p. 3712 - 3715 Title/Abstract Full Text View citing articles Show Details
Maksay; Fodor; Biro; Avlonitis; Calogeropoulou
British Journal of Pharmacology, 2007 , vol. 151, # 7 p. 1078 - 1086 Title/Abstract Full Text View citing articles Show Details
Guenin, Erwann; Monteil, Maelle; Bouchemal, Nadia; Prange, Thierry; Lecouvey, Marc
European Journal of Organic Chemistry, 2007 , # 20 p. 3380 - 3391 Title/Abstract Full Text View citing articles Show Details
Ramasami, Ponnadurai; Kakkar, Rita
Journal of Chemical Thermodynamics, 2006 , vol. 38, # 11 p. 1385 - 1395 Title/Abstract Full Text View citing articles Show Details
Schmuck, Carsten; Rehm, Thomas; Geiger, Lars; Schaefer, Mathias
Journal of Organic Chemistry, 2007 , vol. 72, # 16 p. 6162 - 6170 Title/Abstract Full Text View citing articles Show Details
Bezuglov; Gretskaya; Blazhenova; Andrianova; Akimov; Bobrov; Nazimov; Kisel'; Sharko; Novikov; Krasnov; Shevchenko; V'Yunova; Myasoedov
Russian Journal of Bioorganic Chemistry, 2006 , vol. 32, # 3 p. 231 - 239 Title/Abstract Full Text View citing articles Show Details
Yang, YongXia; Chen, Lei; Gao, HongChang; Zeng, DanLin; Yue, Yong; Liu, MaiLi; Lei, Hao; Deng, Feng; Ye, ChaoHui
Magnetic Resonance in Chemistry, 2006 , vol. 44, # 3 SPEC. ISS. p. 263 - 268 Title/Abstract Full Text View citing articles Show Details
Yanai, Kazuhiro; Sato, Kazumasa; Masuda, Shuichi; Ikeda, Masahiko; Kinae, Naohide
Bioscience, Biotechnology and Biochemistry, 2006 , vol. 70, # 10 p. 2501 - 2507 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
De Figueiredo, Renata Marcia; Froehlich, Roland; Christmann, Mathias
Angewandte Chemie - International Edition, 2007 , vol. 46, # 16 p. 2883 - 2886 Title/Abstract Full Text View citing articles Show Details
Goddard-Borger, Ethan D.; Stick, Robert V.
Organic Letters, 2007 , vol. 9, # 19 p. 3797 - 3800 Title/Abstract Full Text View citing articles Show Details
Madsen, Christian; Jensen, Anders A.; Liljefors, Tommy; Kristiansen, Uffe; Nielsen, Birgitte; Hansen, Camilla P.; Larsen, Mogens; Ebert, Bjarke; Bang-Andersen, Benny; Krogsgaard-Larsen, Povl; Frolund, Bente
Journal of Medicinal Chemistry, 2007 , vol. 50, # 17 p. 4147 - 4161 Title/Abstract Full Text View citing articles Show Details
Jensen, Anders A.; Zlotos, Darius P.; Liljefors, Tommy
Journal of Medicinal Chemistry, 2007 , vol. 50, # 19 p. 4616 - 4629 Title/Abstract Full Text View citing articles Show Details
Trofimov, Boris A.; Mal'kina, Anastasiya G.; Shemyakina, Olesya A.; Borisova, Angela P.; Nosyreva, Valentina V.; Dyachenko, Oleg A.; Kazheva, Olga N.; Alexandrov, Gennadii G.
Synthesis, 2007 , # 17 p. 2641 - 2646 Title/Abstract Full Text View citing articles Show Details
Brennauer, Albert; Keller, Max; Freund, Matthias; Bernhardt, Guenther; Buschauer, Armin
Tetrahedron Letters, 2007 , vol. 48, # 39 p. 6996 - 6999 Title/Abstract Full Text View citing articles Show Details
Fedi, Valentina; Altamura, Maria; Catalioto, Rose-Marie; Giannotti, Danilo; Giolitti, Alessandro; Giuliani, Sandro; Guidi, Antonio; Harmat, Nicholas J. S.; Lecci, Alessandro; Meini, Stefania; Nannicini, Rossano; Pasqui, Franco; Tramontana, Manuela; Triolo, Antonio; Maggi, Carlo Alberto
Journal of Medicinal Chemistry, 2007 , vol. 50, # 20 p. 4793 - 4807 Title/Abstract Full Text View citing articles Show Details
Nakao, Kazunari; Murase, Akio; Ohshiro, Hiroyuki; Okumura, Takako; Taniguchi, Kana; Murata, Yoko; Masuda, Masatoshi; Kato, Tomoki; Okumura, Yoshiyuki; Takada, Junji
Journal of Pharmacology and Experimental Therapeutics, 2007 , vol. 322, # 2 p. 686 - 694 Title/Abstract Full Text View citing articles Show Details
Yamakoshi, Jun; Fukuda, Satoshi; Satoh, Takuya; Tsuji, Ryouhei; Saito, Makoto; Obata, Akio; Matsuyama, Asahi; Kikuchi, Mamoru; Kawasaki, Terukazu
Bioscience, Biotechnology and Biochemistry, 2007 , vol. 71, # 1 p. 165 - 173 Title/Abstract Full Text View citing articles Show Details
Alvarez, Celedonio M.; Garcia-Rodriguez, Raul; Miguel, Daniel
Journal of Organometallic Chemistry, 2007 , vol. 692, # 26 p. 5717 - 5726 Title/Abstract Full Text View citing articles Show Details
Rao, Divvela V. N. Srinivasa; Dandala, Ramesh; Narayanan, Garimella K. A. S. S.; Lenin, Racha; Sivakumaran; Naidu, Andra
Synthetic Communications, 2007 , vol. 37, # 24 p. 4359 - 4365 Title/Abstract Full Text View citing articles Show Details
Dekebo, Aman; Kashiwagi, Takehiro; Tebayashi, Shin-Ich; Kim, Chul-Sa
Bioscience, Biotechnology and Biochemistry, 2007 , vol. 71, # 2 p. 421 - 426 Title/Abstract Full Text View citing articles Show Details
Guo, Kevin; Ji, Chengjie; Li, Liang
Analytical Chemistry, 2007 , vol. 79, # 22 p. 8631 - 8638 Title/Abstract Full Text View citing articles Show Details
Haldar, Debasish
Tetrahedron, 2008 , vol. 64, # 1 p. 186 - 190 Title/Abstract Full Text View citing articles Show Details
Hill, Timothy A.; Stewart, Scott G.; Ackland, Stephen P.; Gilbert, Jayne; Sauer, Benjamin; Sakoff, Jennette A.; McCluskey, Adam
Bioorganic and Medicinal Chemistry, 2007 , vol. 15, # 18 p. 6126 - 6134 Title/Abstract Full Text View citing articles Show Details
Yang, Jehoon; Shen, Jun
Journal of Magnetic Resonance, 2007 , vol. 184, # 2 p. 344 - 349 Title/Abstract Full Text View citing articles Show Details
E. R. Squibb and Sons, Inc.
Patent: US4382081 A1, 1983 ; Title/Abstract Full Text Show Details
Emisiphere Technologies, Inc.
Patent: US6348207 B1, 2002 ; Title/Abstract Full Text Show Details
Emory University; Duke University
Patent: US5759788 A1, 1998 ; Title/Abstract Full Text Show Details
Synaptic Pharmaceutical Corporation
Patent: US5712148 A1, 1998 ; Title/Abstract Full Text Show Details
63 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
American Home Products Corporation
Patent: US5168103 A1, 1992 ; Title/Abstract Full Text Show Details
Apotex Inc.
Patent: US5908959 A1, 1999 ; Title/Abstract Full Text Show Details
Chesebrough-Pond's USA Co. Division of Conopco, Inc.
Patent: US5559092 A1, 1996 ; Title/Abstract Full Text Show Details
Ciba-Geigy Corporation
Patent: US4939261 A1, 1990 ; Title/Abstract Full Text Show Details
Eli Lilly and Company
Patent: US5159081 A1, 1992 ;
Title/Abstract Full Text Show Details
Hoechst Aktiengesellschaft
Patent: US5061807 A1, 1991 ; Title/Abstract Full Text Show Details
Instituto Chimico Internazionale Dr. Giuseppe Rende S.r.l.
Patent: US5010204 A1, 1991 ; Title/Abstract Full Text Show Details
Instituto Farmacologico Lombardo-IFLO, S.a.S.
Patent: US5552428 A1, 1996 ; Title/Abstract Full Text Show Details
Kaupmann, Klemens; Bettler, Bernhard; Bittiger, Helmut; Frostl, Wolfgang; Mickel, Stuart J.
Patent: US2002/91250 A1, 2002 ; Title/Abstract Full Text Show Details
Merck and Co., Inc.
Patent: US5039819 A1, 1991 ; Title/Abstract Full Text Show Details
Merck and Co., Inc.
Patent: US5159108 A1, 1992 ; Title/Abstract Full Text Show Details
Takeda Chemical Industries, Ltd.
Patent: US5834463 A1, 1998 ; Title/Abstract Full Text Show Details
The Regents of the University of California
Patent: US2002/165202 A1, 2002 ; Title/Abstract Full Text Show Details
The Regents of the University of California
Patent: US5843943 A1, 1998 ; Title/Abstract Full Text Show Details
The Regents of the University of California
Patent: US6323201 B1, 2001 ; Title/Abstract Full Text Show Details
The Regents of the University of California
Patent: US6410249 B1, 2002 ; Title/Abstract Full Text Show Details
G. D. Searle and Co.
Patent: US5639765 A1, 1997 ; Title/Abstract Full Text Show Details
Hoechst Aktiengesellschaft
Patent: US5622934 A1, 1997 ; Title/Abstract Full Text Show Details
Synaptic Pharmaceutical Corporation
Patent: US2003/143729 A1, 2003 ; Title/Abstract Full Text Show Details
The University of Sydney; Polychip Pharmaceuticals Pty. Ltd.
Patent: US6632806 B1, 2003 ; Title/Abstract Full Text Show Details
64 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Kao Corporation
Patent: US2006/105065 A1, 2006 ; Title/Abstract Full Text Show Details
MERCK and CO., INC.; MERCK FROSST CANADA and CO.; UNIVERSITY OF TEXAS HEALTH SCIENCE CENTER AT SAN ANTONIO; NATIONAL INSTITUTES OF HEALTH
Patent: WO1999/40114 A1, 1999 ; Title/Abstract Full Text Show Details
Mihara, Takuma; Mihara, Kayoko; Yarimizu, Junko; Mitani, Yasuyuki; Matsuda, Ritsuko; Yamamoto, Hiroko; Aoki, Satoshi; Akahane, Atsushi; Iwashita, Akinori; Matsuoka, Nobuya
Journal of Pharmacology and Experimental Therapeutics, 2007 , vol. 323, # 2 p. 708 - 719 Title/Abstract Full Text View citing articles Show Details
Jennings, Lee D.; Cole, Derek C.; Stock, Joseph R.; Sukhdeo, Mohani N.; Ellingboe, John W.; Cowling, Rebecca; Jin, Guixian; Manas, Eric S.; Fan, Kristi Y.; Malamas, Michael S.; Harrison, Boyd L.; Jacobsen, Steve; Chopra, Rajiv; Lohse, Peter A.; Moore, William J.; O'Donnell, MaryMargaret; Hu, Yun; Robichaud, Albert J.; Turner, M. James; Wagner, Erik; Bard, Jonathan
Bioorganic and Medicinal Chemistry Letters, 2008 , vol. 18, # 2 p. 767 - 771 Title/Abstract Full Text View citing articles Show Details
Meza-Toledo, Sergio E.; Bowery, Norman G.
Arzneimittel-Forschung/Drug Research, 2008 , vol. 58, # 2 p. 53 - 61
Title/Abstract Full Text View citing articles Show Details
Wisen, Susanne; Androsavich, John; Evans, Christopher G.; Chang, Lyra; Gestwicki, Jason E.
Bioorganic and Medicinal Chemistry Letters, 2008 , vol. 18, # 1 p. 60 - 65 Title/Abstract Full Text View citing articles Show Details
Eremenko; Romanova; Ivanova; Malygina; Barinova; Lagodzinskaya; Lodygina; Aleksandrov
Russian Chemical Bulletin, 2007 , vol. 56, # 7 p. 1408 - 1422 Title/Abstract Full Text View citing articles Show Details
Komatsuzaki, Noriko; Nakamura, Toshihide; Kimura, Toshinori; Shima, Jun
Bioscience, Biotechnology and Biochemistry, 2008 , vol. 72, # 2 p. 278 - 285 Title/Abstract Full Text View citing articles Show Details
Goebel, Tim; Ulmer, Daniela; Projahn, Holger; Kloeckner, Jessica; Heller, Eberhard; Glaser, Melanie; Ponte-Sucre, Alicia; Specht, Sabine; Sarite, Salem Ramadan; Hoerauf, Achim; Kaiser, Annette; Hauber, Ilona; Hauber, Joachim; Holzgrabe, Ulrike
Journal of Medicinal Chemistry, 2008 , vol. 51, # 2 p. 238 - 250 Title/Abstract Full Text View citing articles Show Details
Bley, Filiz; Schaper, Klaus; Goerner, Helmut
Photochemistry and Photobiology, 2008 , vol. 84, # 1 p. 162 - 171 Title/Abstract Full Text View citing articles Show Details
Kane, Brian E.; Grant, Marianne K.O.; El-Fakahany, Esam E.; Ferguson, David M.
Bioorganic and Medicinal Chemistry, 2008 , vol. 16, # 3 p. 1376 - 1392 Title/Abstract Full Text View citing articles Show Details
Fujimoto, Kenzo; Yoshimura, Yoshinaga; Ihara, Makoto; Matsuda, Kazuhiko; Takeuchi, Yuko; Aoki, Takaaki; Ide, Toru
Bioorganic and Medicinal Chemistry Letters, 2008 , vol. 18, # 3 p. 1106 - 1109 Title/Abstract Full Text View citing articles Show Details
Garcia-Acosta, Beatriz; Martinez-Manez, Ramon; Ros-Lis, Jose V.; Sancenon, Felix; Soto, Juan
Tetrahedron Letters, 2008 , vol. 49, # 12 p. 1997 - 2001 Title/Abstract Full Text View citing articles Show Details
Yang, Jinyi; Wang, Hong; Jiang, Yueming; Sun, Yuanming; Pan, Ke; Lei, Hongtao; Wu, Qing; Shen, Yudong; Xiao, Zhili; Xu, Zhenlin
Molecules, 2008 , vol. 13, # 4 p. 871 - 881 Title/Abstract Full Text View citing articles Show Details
Karskela, Tuomas; Loennberg, Harri
Organic and Biomolecular Chemistry, 2006 , vol. 4, # 24 p. 4506 - 4513 Title/Abstract Full Text View citing articles Show Details
Yuan, Dongwu; Brown, Robert G.; Hepworth, John D.; Alexiou, Michael S.; Tyman, John H. P.
Journal of Heterocyclic Chemistry, 2008 , vol. 45, # 2 p. 397 - 404 Title/Abstract Full Text View citing articles Show Details
Scaglione, Jamie B.; Jastrzebska, Izabella; Krishnan, Kathiresan; Li, Ping; Akk, Gustav; Manion, Brad D.; Benz, Ann; Taylor, Amanda; Rath, Nigam P.; Evers, Alex S.; Zorumski, Charles F.; Mennerick, Steven; Covey, Douglas F.
Journal of Medicinal Chemistry, 2008 , vol. 51, # 5 p. 1309 - 1318 Title/Abstract Full Text View citing articles Show Details
Malherbe; Masciadri; Norcross; Knoflach; Kratzeisen; Zenner; Kolb; Marcuz; Huwyler; Nakagawa; Porter; Thomas; Wettstein; Sleight; Spooren; Prinssen
British Journal of Pharmacology, 2008 , vol. 154, # 4 p. 797 - 811 Title/Abstract Full Text View citing articles Show Details
Li, Jiabo; Sha, Yaowu
Molecules, 2008 , vol. 13, # 5 p. 1111 - 1119 Title/Abstract Full Text View citing articles Show Details
Thompson; Lummis
British Journal of Pharmacology, 2008 , vol. 153, # 8 p. 1686 - 1696 Title/Abstract Full Text View citing articles Show Details
65 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Goud, Thirumani Venkateshwar; Aubertin, Anne-Marie; Biellmann, Jean-Francois
Nucleosides, Nucleotides and Nucleic Acids, 2008 , vol. 27, # 5 p. 495 - 505 Title/Abstract Full Text View citing articles Show Details
Abdel-Farid, Ibrahim Bayoumi; Hye, Kyong Kim; Young, Hae Choi; Verpoorte, Robert
Journal of Agricultural and Food Chemistry, 2007 , vol. 55, # 19 p. 7936 - 7943 Title/Abstract Full Text View citing articles Show Details
Nakahara, A.; Hidaka, J.; Tsuchida, R.
Bulletin of the Chemical Society of Japan, 1956 , vol. 29, p. 925 - 928 Full Text Show Details
Gmelin Handbook: Cu: MVol.B4, 95, page 1644 - 1646 Full Text Show Details
Bukanova, A. E.; Prokof'eva, I. V.; Salyn', Ya. V.; Shubochkin, L. K.
Soviet J. Coord. Chem., 1977 , vol. 3, p. 1365 - 1368 Koord. Khim., 1977 , vol. 3, p. 1739 - 1742 Full Text Show Details
Williams, R. S.; Subbramanian, R. V.
Polymer, 1981 , vol. 22, p. 934 - 941 Full Text View citing articles Show Details
Gmelin Handbook: Rh: SVol.B2, 1.1.5.2, page 63 - 64 Full Text Show Details
Gmelin Handbook: Sn: Org.Comp.12, 1.4.1.1.1.5.4.4, page 147 - 166 Full Text Show Details
Appleton, Trevor G.; Bailey, Alicia J.; Bedgood, Danny R. Jr.; Hall, John R.
Inorganic Chemistry, 1994 , vol. 33, p. 217 - 226 Full Text View citing articles Show Details
Bismondo, A.; Casellato, U.; Sitran, S.; Graziani, R.
Inorganica Chimica Acta, 1985 , vol. 110, p. 205 - 210 Full Text View citing articles Show Details
Kohata, Susumu; Sagara, Kazuhiro; Takada, Hitoshi; Ohyoshi, Akira
Polyhedron, 1985 , vol. 4, # 6 p. 1059 - 1066 Title/Abstract Full Text View citing articles Show Details
Fridman, Ya. D.; Usubaliev, D. U.; Kebets, N. M.
Russian Journal of Inorganic Chemistry (Translation of Zhurnal Neorganicheskoi Khimii), 1987 , vol. 32, p. 1282 - 1284 Zhurnal Neorganicheskoi Khimii, 1987 , vol. 32, p. 2189 - 2192 Full Text Show Details
Sabirov, V. Kh.; Kebets, N. M.; Porai-Koshits, M. A.; Struchkov, Yu. T.
Russian Journal of Coordination Chemistry, 1994 , vol. 20, p. 439 - 444 Koordinatsionnaya Khimiya, 1994 , vol. 20, p. 466 - 471 Full Text Show Details
Srinivasan, Vangalur S.; Singh, A. N.; Radlowski, C. A.; Gould, Edwin S.
Inorganic Chemistry, 1982 , vol. 21, p. 1240 - 1242 Full Text View citing articles Show Details
Colacio, Enrique; Ghazi, Mustapha; Kivekaes, Raikko; Moreno, Jose Maria
Inorganic Chemistry, 2000 , vol. 39, # 13 p. 2882 - 2890 Title/Abstract Full Text View citing articles Show Details
Ando, Ryuji; Inden, Hashira; Sugino, Miho; Ono, Hiroyuki; Sakaeda, Daisuke; Yagyu, Takeyoshi; Maeda, Masunobu
Inorganica Chimica Acta, 2004 , vol. 357, # 5 p. 1337 - 1344 Title/Abstract Full Text View citing articles Show Details
Zheng, Xiangjun; Jin, Linpei; Lu, Shaozhe; Zheng, Yueqing
Zeitschrift fur Anorganische und Allgemeine Chemie, 2003 , vol. 629, # 14 p. 2577 - 2584 Title/Abstract Full Text View citing articles Show Details
Lu, Tong-Bu; Ou, Guang-Chuan; Jiang, Long; Feng, Xiao-Long; Ji, Liang-Nian
Inorganica Chimica Acta, 2005 , vol. 358, # 11 p. 3241 - 3245 Title/Abstract Full Text View citing articles Show Details
Ou, Guang-Chuan; Su, Cheng-Yong; Yao, Jun-Hua; Lu, Tong-Bu
Inorganic Chemistry Communications, 2005 , vol. 8, # 5 p. 421 - 424 Title/Abstract Full Text View citing articles Show Details
Brotzel, Frank; Mayr, Herbert
Organic and Biomolecular Chemistry, 2007 , vol. 5, # 23 p. 3814 - 3820 Title/Abstract Full Text View citing articles Show Details
66 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
JANSSEN PHARMACEUTICA NV
Patent: WO2008/49806 A1, 2008 ; Title/Abstract Full Text Show Details
FLYNN, Gary, A.; YOOL, Andrea, J.; MIGLIATI, Elton, Rodrigues; RITTER, Leslie, S.
Patent: WO2008/52190 A2, 2008 ; Title/Abstract Full Text Show Details
SERENEX, INC.
Patent: US2008/119457 A1, 2008 ; Title/Abstract Full Text Show Details
GENETIC TECHNOLOGIES LIMITED; MEAT and LIVESTOCK AUSTRALIA LIMITED
Patent: WO2008/58342 A1, 2008 ; Title/Abstract Full Text Show Details
JANSSEN PHARMACEUTICA N.V.
Patent: WO2008/63321 A2, 2008 ; Title/Abstract Full Text Show Details
Rose, Abe
Patent: US2008/139510 A1, 2008 ; Title/Abstract Full Text Show Details
ABBOTT LABORATORIES
Patent: WO2008/76356 A1, 2008 ; Title/Abstract Full Text Show Details
The Jordanian Pharmaceutical Manufacturing Co.
Patent: EP1955693 A1, 2008 ; Title/Abstract Full Text Show Details
The Jordanian Pharmaceutical Manufacturing Co.
Patent: EP1955710 A1, 2008 ; Title/Abstract Full Text Show Details
The Jordanian Pharmaceutical Manufacturing Co.
Patent: EP1955711 A1, 2008 ; Title/Abstract Full Text Show Details
ACTIVETRAD (PROPRIETARY) LIMITED
Patent: WO2008/110984 A1, 2008 ; Title/Abstract Full Text Show Details
ORCHID CHEMICALS AND PHARMACEUTICALS LIMITED
Patent: WO2008/35131 A1, 2008 ; Title/Abstract Full Text Show Details
Larsen, Mie; Larsen, Birger Brodin; Frolund, Bente; Nielsen, Carsten Uhd
European Journal of Pharmaceutical Sciences, 2008 , vol. 35, # 1-2 p. 86 - 95 Title/Abstract Full Text View citing articles Show Details
Hiraga, Kazumi; Ueno, Yoshie; Oda, Kohei
Bioscience, Biotechnology and Biochemistry, 2008 , vol. 72, # 5 p. 1299 - 1306
Title/Abstract Full Text View citing articles Show Details
Ohkubo, Akihiro; Kasuya, Rintaro; Aoki, Katsufumi; Kobori, Akio; Taguchi, Haruhiko; Seio, Kohji; Sekine, Mitsuo
Bioorganic and Medicinal Chemistry, 2008 , vol. 16, # 9 p. 5345 - 5351 Title/Abstract Full Text View citing articles Show Details
Schnackerz; Andersen; Dobritzsch; Piskur
Nucleosides, Nucleotides and Nucleic Acids, 2008 , vol. 27, # 6-7 p. 794 - 799 Title/Abstract Full Text View citing articles Show Details
Asadulina, Ekaterina M.; Bastrakov, Maxim A.; Kachala, Vadim V.; Starosotnikov, Aleksei M.; Shevelev, Svyatoslav A.
Mendeleev Communications, 2008 , vol. 18, # 4 p. 213 - 214 Title/Abstract Full Text View citing articles Show Details
Ahnaou, Abdellah; Drinkenburg, Wilhelmus H.I.M.; Bouwknecht, J. Adriaan; Alcazar, Jesus; Steckler, Thomas; Dautzenberg, Frank M.
European Journal of Pharmacology, 2008 , vol. 579, # 1-3 p. 177 - 188 Title/Abstract Full Text View citing articles Show Details
De Figueiredo, Renata Marcia; Oczipka, Philipp; Froehlich, Roland; Christmann, Mathias
Synthesis, 2008 , # 8 p. 1316 - 1318 Title/Abstract Full Text View citing articles Show Details
Clift, Michael D.; Silverman, Richard B.
Bioorganic and Medicinal Chemistry Letters, 2008 , vol. 18, # 10 p. 3122 - 3125 Title/Abstract Full Text View citing articles Show Details
67 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Patterson, Andrew W.; Peltier, Hillary M.; Sasse, Florenz; Ellman, Jonathan A.
Chemistry - A European Journal, 2007 , vol. 13, # 34 p. 9534 - 9541 Title/Abstract Full Text View citing articles Show Details
Buchini, Sabrina; Buschiazzo, Alejandro; Withers, Stephen G.
Angewandte Chemie - International Edition, 2008 , vol. 47, # 14 p. 2700 - 2703 Title/Abstract Full Text View citing articles Show Details
Lamanna, Raffaele; Piscioneri, Ilario; Romanelli, Valeria; Sharma, Neeta
Magnetic Resonance in Chemistry, 2008 , vol. 46, # 9 p. 828 - 831 Title/Abstract Full Text View citing articles Show Details
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
Vaz, Belen; Brunsveld, Luc
Organic and Biomolecular Chemistry, 2008 , vol. 6, # 16 p. 2988 - 2994 Title/Abstract Full Text View citing articles Show Details
Van Wyk, Marianne; Strauss, Erick
Organic and Biomolecular Chemistry, 2008 , vol. 6, # 23 p. 4348 - 4355 Title/Abstract Full Text View citing articles Show Details
HELMHOLTZ-ZENTRUM FUeR INFEKTIONSFORSCHUNG GMBH
Patent: WO2009/12958 A2, 2009 ; Title/Abstract Full Text Show Details
SYNOSIA THERAPEUTICS
Patent: WO2009/15236 A1, 2009 ; Title/Abstract Full Text Show Details
Min, Cheol Yang; Sang, Un Choi; Wahn, Soo Choi; Sun, Yeou Kim; Kang, Ro Lee
Journal of Natural Products, 2008 , vol. 71, # 4 p. 678 - 683 Title/Abstract Full Text View citing articles Show Details
Eckstein, James A.; Ammerman, Gina M.; Reveles, Jessica M.; Ackermann, Bradley L.
Journal of Mass Spectrometry, 2008 , vol. 43, # 6 p. 782 - 790 Title/Abstract Full Text View citing articles Show Details
Baruah, Hemanta; Puthenveetil, Sujiet; Choi, Yoon-Aa; Shah, Samit; Ting, Alice Y.
Angewandte Chemie - International Edition, 2008 , vol. 47, # 37 p. 7018 - 7021 Title/Abstract Full Text View citing articles Show Details
Kumar, Rohan J.; Chebib, Mary; Hibbs, David E.; Kim, Hye-Lim; Johnston, Graham A. R.; Salam, Noeris K.; Hanrahan, Jane R.
Journal of Medicinal Chemistry, 2008 , vol. 51, # 13 p. 3825 - 3840 Title/Abstract Full Text View citing articles Show Details
Veselovskaya; Garazd; Ogorodniichuk; Khilya
Chemistry of Natural Compounds, 2008 , vol. 44, # 6 p. 704 - 711 Title/Abstract Full Text View citing articles Show Details
Ragavendran, Jegadeesan Vaigunda; Sriram, Dharmarajan; Kotapati, Srikanth; Stables, James; Yogeeswari, Perumal
European Journal of Medicinal Chemistry, 2008 , vol. 43, # 12 p. 2650 - 2655 Title/Abstract Full Text View citing articles Show Details
KALYPSYS, INC.
Patent: US2009/62253 A1, 2009 ; Title/Abstract Full Text Show Details
PainCeptor Pharma Corporation
Patent: US2009/82368 A1, 2009 ; Title/Abstract Full Text Show Details
Wang, Tingting; Muthuswamy, Jit
Analytical Chemistry, 2008 , vol. 80, # 22 p. 8576 - 8582 Title/Abstract Full Text View citing articles Show Details
Baliani, Alessandro; Peal, Valerie; Gros, Ludovic; Brun, Reto; Kaiser, Marcel; Barrett, Michael P.; Gilbert, Ian H.
Organic and Biomolecular Chemistry, 2009 , vol. 7, # 6 p. 1154 - 1166 Title/Abstract Full Text View citing articles Show Details
Shanks, David; Preus, Soren; Qvortrup, Katrine; Hassenkam, Tue; Nielsen, Mogens Brondsted; Kilsa, Kristine
New Journal of Chemistry, 2009 , vol. 33, # 3 p. 507 - 516 Title/Abstract Full Text View citing articles Show Details
Buller, Fabian; Mannocci, Luca; Zhang, Yixin; Dumelin, Christoph E.; Scheuermann, Joerg; Neri, Dario
Bioorganic and Medicinal Chemistry Letters, 2008 , vol. 18, # 22 p. 5926 - 5931 Title/Abstract Full Text View citing articles Show Details
68 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Khan, Suroor A.; Siddiqui, Nadeem; Kamal, Mehnaz; Alam, Ozair; Jawaid, Talha
Acta Poloniae Pharmaceutica - Drug Research, 2009 , vol. 66, # 1 p. 65 - 68 Title/Abstract Full Text View citing articles Show Details
Jansen, Michaela; Rabe, Holger; Strehle, Axelle; Dieler, Sandra; Debus, Fabian; Dannhardt, Gerd; Akabas, Myles H.; Lueddens, Hartmut
Journal of Medicinal Chemistry, 2008 , vol. 51, # 15 p. 4430 - 4448 Title/Abstract Full Text View citing articles Show Details
Kim, Han-Woo; Kashima, Yasuhiro; Ishikawa, Kazuhiko; Yamano, Naoko
Bioscience, Biotechnology and Biochemistry, 2009 , vol. 73, # 1 p. 224 - 227 Title/Abstract Full Text View citing articles Show Details
Ko, Kwang-Seuk; Park, Gisun; Yu, Yang; Pohl, Nicola L.
Organic Letters, 2008 , vol. 10, # 23 p. 5381 - 5384 Title/Abstract Full Text View citing articles Show Details
CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE; INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE M; RHODIA UK LIMITED
Patent: US2009/142316 A1, 2009 ; Title/Abstract Full Text Show Details
Morano, Cain; Zhang, Xin; Fricker, Lloyd D.
Analytical Chemistry, 2008 , vol. 80, # 23 p. 9298 - 9309 Title/Abstract Full Text View citing articles Show Details
AJINOMOTO CO. INC
Patent: US2009/170942 A1, 2009 ; Title/Abstract Full Text Show Details
Mercader, Josep V.; Suarez-Pantaleon, Celia; Agullo, Consuelo; Abad-Somovilla, Antonio; Abad-Fuentes, Antonio
Journal of Agricultural and Food Chemistry, 2008 , vol. 56, # 5 p. 1545 - 1552 Title/Abstract Full Text View citing articles Show Details
Wu, Haitao; Kaur, Gurpreet; Griffiths, Gary L.
Tetrahedron Letters, 2009 , vol. 50, # 18 p. 2100 - 2102 Title/Abstract Full Text View citing articles Show Details
Gracia, Stephanie; Cazorla, Clement; Metay, Estelle; Pellet-Rostaing, Stephane; Lemaire, Marc
Journal of Organic Chemistry, 2009 , vol. 74, # 8 p. 3160 - 3163 Title/Abstract Full Text View citing articles Show Details
Rezayat; Boushehri; Salmanian; Omidvari; Tarighat; Esmaeili; Sarkar; Amirshahi; Alyautdin; Orlova; Trushkov; Buchachenko; Liu; Kuznetsov
European Journal of Medicinal Chemistry, 2009 , vol. 44, # 4 p. 1554 - 1569 Title/Abstract Full Text View citing articles Show Details
Mariano, Sandrine; Roos, Annette K.; Mowbray, Sherry L.; Salmon, Laurent
Carbohydrate Research, 2009 , vol. 344, # 7 p. 869 - 880 Title/Abstract Full Text View citing articles Show Details
Katritzky, Alan R.; Sakhuja, Rajeev; Khelashvili, Levan; Shanab, Karem
Journal of Organic Chemistry, 2009 , vol. 74, # 8 p. 3062 - 3065 Title/Abstract Full Text View citing articles Show Details
Ge, Yiyu; Wu, Xinghua; Zhang, Dazhi; Hu, Longqin
Bioorganic and Medicinal Chemistry Letters, 2009 , vol. 19, # 3 p. 941 - 944 Title/Abstract Full Text View citing articles Show Details
Gore, Vinayak G.; Shukla, Vinay Kumar; Ghadge, Manoj M.; Avadhut, Rekha M.
Patent: US2009/198062 A1, 2009 ; Title/Abstract Full Text Show Details
Lassiani, Lucia; Pavan, Michela V.; Berti, Federico; Kokotos, George; Markidis, Theodoros; Mennuni, Laura; Makovec, Francesco; Varnavas, Antonio
Bioorganic and Medicinal Chemistry, 2009 , vol. 17, # 6 p. 2336 - 2350 Title/Abstract Full Text View citing articles Show Details
Senda, Naoko; Momotake, Atsuya; Arai, Tatsuo
Bulletin of the Chemical Society of Japan, 2007 , vol. 80, # 12 p. 2384 - 2388 Title/Abstract Full Text View citing articles Show Details
Hachisako, Hiroshi; Ryu, Naoya; Hashimoto, Hiromi; Murakami, Ryoichi
Organic and Biomolecular Chemistry, 2009 , vol. 7, # 11 p. 2338 - 2346 Title/Abstract Full Text View citing articles Show Details
Hachisako, Hiroshi; Ryu, Naoya; Murakami, Ryoichi
Organic and Biomolecular Chemistry, 2009 , vol. 7, # 11 p. 2327 - 2337 Title/Abstract Full Text View citing articles Show Details
Gomez-Alonso, Sergio; Hermosin-Gutierrez, Isidro; Garcia-Romero, Esteban
Journal of Agricultural and Food Chemistry, 2007 , vol. 55, # 3 p. 608 - 613 Title/Abstract Full Text View citing articles Show Details
69 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
FLUOFARMA; UNIVERSITE BORDEAUX 1; CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE
Patent: US2009/247472 A1, 2009 ; Title/Abstract Full Text Show Details
MERCK and CO., INC.
Patent: WO2009/102537 A1, 2009 ;
Title/Abstract Full Text Show Details
METHYLGENE INC.
Patent: WO2009/109035 A1, 2009 ; Title/Abstract Full Text Show Details
Sinclair, Andrew J.; Del Amo, Vicente; Philp, Douglas
Organic and Biomolecular Chemistry, 2009 , vol. 7, # 16 p. 3308 - 3318 Title/Abstract Full Text View citing articles Show Details
Cheedarala, Ravi Kumar; Sunkara, Vijaya; Park, Joon Won
Synthetic Communications, 2009 , vol. 39, # 11 p. 1966 - 1980 Title/Abstract Full Text View citing articles Show Details
Bora-Tatar, Gamze; Dayangac-Erden, Didem; Demir, Ayhan S.; Dalkara, Sevim; Yelekci, Kemal; Erdem-Yurter, Hayat
Bioorganic and Medicinal Chemistry, 2009 , vol. 17, # 14 p. 5219 - 5228 Title/Abstract Full Text View citing articles Show Details
Shtemenko, Alexander V.; Collery, Philippe; Shtemenko, Natalia I.; Domasevitch, Konstantin V.; Zabitskaya, Elena D.; Golichenko, Alexander A.
Dalton Transactions, 2009 , # 26 p. 5132 - 5136 Title/Abstract Full Text View citing articles Show Details
Humljan, Jan; Kotnik, Miha; Contreras-Martel, Carlos; Blanot, Didier; Urleb, Uros; Dessen, Andrea; Solmajer, Tom; Gobec, Stanislav
Journal of Medicinal Chemistry, 2008 , vol. 51, # 23 p. 7486 - 7494 Title/Abstract Full Text View citing articles Show Details
Veselovskaya; Garazd, Ya. L.; Garazd; Ogorodniichuk
Chemistry of Natural Compounds, 2009 , vol. 45, # 2 p. 169 - 173 Title/Abstract Full Text View citing articles Show Details
Kiakhani, Moosa Sadeghi; Gharanjig, Kamaladin; Arami, Mokhtar; Mokhtari, Javad; Mahmoodi, Niyaz Mohammad
Journal of the Chinese Chemical Society, 2008 , vol. 55, # 6 p. 1300 - 1307 Title/Abstract Full Text View citing articles Show Details
Shiseido Company, Ltd.
Patent: EP2123253 A1, 2009 ; Title/Abstract Full Text Show Details
Stensrud, Kenneth; Noh, Jihyun; Kandler, Karl; Wirz, Jakob; Heger, Dominik; Givens, Richard S.
Journal of Organic Chemistry, 2009 , vol. 74, # 15 p. 5219 - 5227 Title/Abstract Full Text View citing articles Show Details
Gigante, Federica; Kaiser, Marcel; Brun, Reto; Gilbert, Ian H.
Bioorganic and Medicinal Chemistry, 2009 , vol. 17, # 16 p. 5950 - 5961 Title/Abstract Full Text View citing articles Show Details
Pandey, Satish Chandra; Haider, Hussain; Saxena, Sudhanshu; Singh, Manoj Kumar; Thaper, Rajesh Kumar; Dubey, Sushil Kumar
Patent: US2009/312551 A1, 2009 ; Title/Abstract Full Text Show Details
Song, Hong Y.; Ngai, Mun H.; Song, Zhen Y.; MacAry, Paul A.; Hobley, Jonathan; Lear, Martin J.
Organic and Biomolecular Chemistry, 2009 , vol. 7, # 17 p. 3400 - 3406 Title/Abstract Full Text View citing articles Show Details
Aventis Pharma Limited
Patent: US6352977 B1, 2002 ; Title/Abstract Full Text Show Details
THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
Patent: EP1193257 A2, 2002 ; Title/Abstract Full Text Show Details
Angiogene Pharmaceuticals Ltd
Patent: EP1140745 B1, 2003 ; Title/Abstract Full Text Show Details
Dart, Michael J.; Searle, Xenia B.; Tietje, Karin; Toupence, Richard B.
Patent: US2004/44029 A1, 2004 ; Title/Abstract Full Text Show Details
GARST, Michael, E.; SACHS, George; SHIN, Jai, Moo
Patent: WO2004/9583 A2, 2004 ; Title/Abstract Full Text Show Details
70 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
SCHERING AG
Patent: WO2004/12735 A2, 2004 ; Title/Abstract Full Text Show Details
Medical Research Council
Patent: US6765014 B1, 2004 ; Title/Abstract Full Text Show Details
LI-COR, Inc.
Patent: US2004/171827 A1, 2004 ; Title/Abstract Full Text Show Details
Lippard, Stephen J.; Barnes, Carmen M.; Haskel, Ariel; Barnes, Katie R.
Patent: US2004/235712 A1, 2004 ; Title/Abstract Full Text Show Details
Pfizer Inc
Patent: US2005/65117 A1, 2005 ; Title/Abstract Full Text Show Details
SPEEDEL EXPERIMENTA AG
Patent: WO2005/70877 A1, 2005 ; Title/Abstract Full Text Show Details
F. HOFFMANN-LA ROCHE AG
Patent: WO2005/94828 A1, 2005 ; Title/Abstract Full Text Show Details
JANSSEN PHARMACEUTICA N.V.
Patent: WO2005/108361 A1, 2005 ; Title/Abstract Full Text Show Details
Carmo-Silva, Ana E.; Keys, Alfred J.; Beale, Michael H.; Ward, Jane L.; Baker, John M.; Hawkins, Nathaniel D.; Arrabaca, Maria Celeste; Parry, Martin A.J.
Phytochemistry, 2009 , vol. 70, # 5 p. 664 - 671 Title/Abstract Full Text View citing articles Show Details
Glotova, Tatyana E.; Dvorko, Marina Yu.; Ushakov, Igor A.; Chipanina, Nina N.; Kazheva, Olga N.; Chekhlov, Anatolii N.; Dyachenko, Oleg A.; Gusarova, Nina K.; Trofimov, Boris A.
Tetrahedron, 2009 , vol. 65, # 47 p. 9814 - 9818 Title/Abstract Full Text View citing articles Show Details
Wu, Xiang-long; Tian, Min; He, Huai-zhen; Sun, Wei; Li, Jian-li; Shi, Zhen
Bioorganic and Medicinal Chemistry Letters, 2009 , vol. 19, # 11 p. 2957 - 2959 Title/Abstract Full Text View citing articles Show Details
Chiesl, Thomas N.; Chu, Wai K.; Stockton, Amanda M.; Amashukeli, Xenia; Grunthaner, Frank; Mathies, Richard A.
Analytical Chemistry, 2009 , vol. 81, # 7 p. 2537 - 2544 Title/Abstract Full Text View citing articles Show Details
Shul'Ts; Andreev; Shakirov; Bagryanskaya; Tolstikov
Russian Journal of Organic Chemistry, 2009 , vol. 45, # 10 p. 1546 - 1554 Title/Abstract Full Text View citing articles Show Details
Hada, Noriyasu; Shida, Yukihiko; Negishi, Natsuko; Schweizer, Frank; Takeda, Tadahiro
Chemical and Pharmaceutical Bulletin, 2009 , vol. 57, # 10 p. 1081 - 1088 Title/Abstract Full Text View citing articles Show Details
Wang, Haofan; Byun, Youngjoo; Barinka, Cyril; Pullambhatla, Mrudula; Bhang, Hyo-eun C.; Fox, James J.; Lubkowski, Jacek; Mease, Ronnie C.; Pomper, Martin G.
Bioorganic and Medicinal Chemistry Letters, 2010 , vol. 20, # 1 p. 392 - 397 Title/Abstract Full Text View citing articles Show Details
Kiyose, Kazuki; Aizawa, Sakiko; Sasaki, Eita; Kojima, Hirotatsu; Hanaoka, Kenjiro; Terai, Takuya; Urano, Yasuteru; Nagano, Tetsuo
Chemistry - A European Journal, 2009 , vol. 15, # 36 p. 9191 - 9200 Title/Abstract Full Text View citing articles Show Details
Nakamura, Kazuhiko; Uemura, Daisuke; Tachikawa, Yu
Beilstein Journal of Organic Chemistry, 2009 , vol. 5, art. no. 12 Title/Abstract Full Text Show Details
Tamiaki, Hitoshi; Ogawa, Keishiro; Enomoto, Keisuke; Taki, Kazutaka; Hotta, Atsushi; Toma, Kazunori
Tetrahedron, 2010 , vol. 66, # 9 p. 1661 - 1666 Title/Abstract Full Text View citing articles Show Details
Hokazono, Hideki; Omori, Toshiro; Ono, Kazuhisa
Bioscience, Biotechnology and Biochemistry, 2010 , vol. 74, # 1 p. 135 - 139 Title/Abstract Full Text View citing articles Show Details
Tin, Wai Wai Thet; Hayashi, Hisayoshi; Otomatsu, Toshihiko; Hirose, Katsutoshi; Hasegawa, Koji; Shigemori, Hideyuki
Heterocycles, 2009 , vol. 78, # 10 p. 2439 - 2442 Title/Abstract Full Text View citing articles Show Details
71 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
UNIVERSITA' DEGLI STUDI DI MILANO; VEROTTA, Luisella; MONTI, Diego
Patent: WO2010/34512 A1, 2010 ; Title/Abstract Full Text Show Details
Achermann, Guido; Ballard, Theresa M.; Blasco, Francesca; Broutin, Pierre-Emmanuel; Buettelmann, Bernd; Fischer, Holger; Graf, Martin; Hernandez, Maria-Clemencia; Hilty, Peter; Knoflach, Frederic; Koblet, Andreas; Knust, Henner; Kurt, Anke; Martin, James R.; Masciadri, Raffaello; Porter, Richard H.P.; Stadler, Heinz; Thomas, Andrew W.; Trube, Gerhard; Wichmann, Juergen
Bioorganic and Medicinal Chemistry Letters, 2009 , vol. 19, # 19 p. 5746 - 5752 Title/Abstract Full Text View citing articles Show Details
Brett M. Paterson; John A. Karas; Denis B. Scanlon; Jonathan M. White; Donnelly, Paul S.
Inorganic Chemistry, 2010 , vol. 49, # 4 p. 1884 - 1893 Title/Abstract Full Text View citing articles Show Details
Knust, Henner; Achermann, Guido; Ballard, Theresa; Buettelmann, Bernd; Gasser, Rodolfo; Fischer, Holger; Hernandez, Maria-Clemencia; Knoflach, Frederic; Koblet, Andreas; Stadler, Heinz; Thomas, Andrew W.; Trube, Gerhard; Waldmeier, Pius
Bioorganic and Medicinal Chemistry Letters, 2009 , vol. 19, # 20 p. 5940 - 5944 Title/Abstract Full Text View citing articles Show Details
Lukac, Milos; Mrva, Martin; Fischer-Fodor, Eva; Lacko, Ivan; Bukovsky, Marian; Miklasova, Natalia; Ondriska, Frantisek; Devinsky, Ferdinand
Bioorganic and Medicinal Chemistry Letters, 2009 , vol. 19, # 22 p. 6346 - 6349 Title/Abstract Full Text View citing articles Show Details
Zhang, Xiao-Bing; Waibel, Michael; Hasserodt, Jens
Chemistry - A European Journal, 2010 , vol. 16, # 3 p. 792 - 795 Title/Abstract Full Text View citing articles Show Details
Tsiakitzis, Karyophyllis C.; Rekka, Eleni A.; Kourounakis, Angeliki P.; Kourounakis, Panos N.
Journal of Medicinal Chemistry, 2009 , vol. 52, # 22 p. 7315 - 7318 Title/Abstract Full Text View citing articles Show Details
Lammens, Tijs M.; De Biase, Daniela; Franssen, Maurice C. R.; Scott, Elinor L.; Sanders, Johan P. M.
Green Chemistry, 2009 , vol. 11, # 10 p. 1562 - 1567 Title/Abstract Full Text View citing articles Show Details
Zareef, Muhammad; Iqbal, Rashid; Khan, Khalid M.; Zaidi, Javid H.; Zia-Ullah; Arfan, Muhammad
Natural Product Research, 2009 , vol. 23, # 5 p. 485 - 488 Title/Abstract Full Text View citing articles Show Details
Evelyn, Chris R.; Bell, Jessica L.; Ryu, Jenny G.; Wade, Susan M.; Kocab, Andrew; Harzdorf, Nicole L.; Hollis Showalter; Neubig, Richard R.; Larsen, Scott D.
Bioorganic and Medicinal Chemistry Letters, 2010 , vol. 20, # 2 p. 665 - 672 Title/Abstract Full Text View citing articles Show Details
THE UNIVERSITY OF MELBOURNE; DONNELLY, Paul, Stephen; PATERSON, Brett, Michael
Patent: WO2010/66010 A1, 2010 ; Title/Abstract Full Text Show Details
Karakurt, Arzu; Oezalp, Meral; Isik, Samil; Stables, James P.; Dalkara, Sevim
Bioorganic and Medicinal Chemistry, 2010 , vol. 18, # 8 p. 2902 - 2911 Title/Abstract Full Text View citing articles Show Details
Brookhaven Science Associates, LLC
Patent: US2010/160300 A1, 2010 ; Title/Abstract Full Text Show Details
Cal, Dariusz
Phosphorus, Sulfur and Silicon and the Related Elements, 2010 , vol. 185, # 4 p. 816 - 824 Title/Abstract Full Text View citing articles Show Details
Asadulina; Bastrakov; Starosotnikov; Kachala; Shevelev
Russian Chemical Bulletin, 2009 , vol. 58, # 2 p. 421 - 425 Title/Abstract Full Text View citing articles Show Details
Anandan, Sampath-Kumar; Gless, Richard D.
Bioorganic and Medicinal Chemistry Letters, 2010 , vol. 20, # 9 p. 2740 - 2744 Title/Abstract Full Text View citing articles Show Details
Novotny, Michal; Hrabalek, Alexandr; Janusova, Barbora; Novotny, Jakub; Vavrova, Katerina
Bioorganic and Medicinal Chemistry Letters, 2010 , vol. 20, # 9 p. 2726 - 2728 Title/Abstract Full Text View citing articles Show Details
Singh, Darshan; Narula, Anudeep Kumar
Journal of Thermal Analysis and Calorimetry, 2010 , vol. 100, # 1 p. 199 - 205 Title/Abstract Full Text View citing articles Show Details
Yang, Ya-Jun; Zhao, Jing-Hua; Pan, Xian-Dao; Zhang, Pei-Cheng
Chemical and Pharmaceutical Bulletin, 2010 , vol. 58, # 2 p. 208 - 211 Title/Abstract Full Text View citing articles Show Details
Wang, Haishan; Lim, Ze-Yi; Zhou, Yan; Ng, Melvin; Lu, Ting; Lee, Ken; Sangthongpitag, Kanda; Goh, Kee Chuan; Wang, Xukun; Wu, Xiaofeng; Khng, Hwee Hoon; Goh, Siok Kun; Ong, Wai Chung; Bonday, Zahid; Sun, Eric T.
Bioorganic and Medicinal Chemistry Letters, 2010 , vol. 20, # 11 p. 3314 - 3321 Title/Abstract Full Text View citing articles Show Details
72 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
SMARTCELLS, INC.; ZION, Todd, C.; LANCASTER, Thomas, M.
Patent: WO2010/88261 A1, 2010 ; Title/Abstract Full Text Show Details
Malode, Shweta J.; Abbar, Jyothi C.; Nandibewoor, Sharanappa T.
Synthesis and Reactivity in Inorganic, Metal-Organic and Nano-Metal Chemistry, 2010 , vol. 40, # 4 p. 246 - 256 Title/Abstract Full Text View citing articles Show Details
Schaetzle, Sebastian; Hoehne, Matthias; Robins, Karen; Bornscheuer, Uwe T.
Analytical Chemistry, 2010 , vol. 82, # 5 p. 2082 - 2086 Title/Abstract Full Text View citing articles Show Details
Gutierrez-Abad, Raquel; Illa, Ona; Ortuno, Rosa M.
Organic Letters, 2010 , vol. 12, # 14 p. 3148 - 3151 Title/Abstract Full Text View citing articles Show Details
Miura, Masanori; Muranaka, Norihito; Abe, Ryoji; Hohsaka, Takahiro
Bulletin of the Chemical Society of Japan, 2010 , vol. 83, # 5 p. 546 - 553 Title/Abstract Full Text View citing articles Show Details
Niewiadomski, Sven; Beebeejaun, Zeenat; Denton, Helen; Smith, Terry K.; Morris, Richard J.; Wagner, Gerd K.
Organic and Biomolecular Chemistry, 2010 , vol. 8, # 15 p. 3488 - 3499 Title/Abstract Full Text View citing articles Show Details
Buettelmann, Bernd; Ballard, Theresa M.; Gasser, Rodolfo; Fischer, Holger; Hernandez, Maria-Clemencia; Knoflach, Frederic; Knust, Henner; Stadler, Heinz; Thomas, Andrew W.; Trube, Gerhard
Bioorganic and Medicinal Chemistry Letters, 2009 , vol. 19, # 20 p. 5958 - 5961 Title/Abstract Full Text View citing articles Show Details
Dreiocker, Frank; Mueller, Mathias Q.; Sinz, Andrea; Schaefer, Mathias
Journal of Mass Spectrometry, 2010 , vol. 45, # 2 p. 178 - 189 Title/Abstract Full Text View citing articles Show Details
Lammens, Tijs M.; Franssen, Maurice C. R.; Scott, Elinor L.; Sanders, Johan P. M.
Green Chemistry, 2010 , vol. 12, # 8 p. 1430 - 1436 Title/Abstract Full Text View citing articles Show Details
Baldridge, Anthony; Kowalik, Janusz; Tolbert, Laren M.
Synthesis, 2010 , # 14 art. no. M06809SS, p. 2424 - 2436 Title/Abstract Full Text View citing articles Show Details
Nickel; Klein; Weitz; Daniel
Amino Acids, 2010 , vol. 38, # 3 p. 753 - 761 Title/Abstract Full Text View citing articles Show Details
Malakoutikhah, Morteza; Pradesh, Roger; Teixido, Meritxell; Giralt, Ernest
Journal of Medicinal Chemistry, 2010 , vol. 53, # 6 p. 2354 - 2363 Title/Abstract Full Text View citing articles Show Details
Russell, Alexander G.; Ragoussi, Maria-Eleni; Ramalho, Rui; Wharton, Christopher W.; Carteau, David; Bassani, Dario M.; Snaith, John S.
Journal of Organic Chemistry, 2010 , vol. 75, # 13 p. 4648 - 4651 Title/Abstract Full Text View citing articles Show Details
Liu, Fei; Musadji, Neil Y.; Lecornue, Frederic; Jouannetaud, Marie-Paule; Thibaudeau, Sebastien
Tetrahedron, 2010 , vol. 66, # 35 p. 7112 - 7118 Title/Abstract Full Text View citing articles Show Details
Klee, Nina; Wong, Pui Ee; Baragana, Beatriz; Mazouni, Farah El; Phillips, Margaret A.; Barrett, Michael P.; Gilbert, Ian H.
Bioorganic and Medicinal Chemistry Letters, 2010 , vol. 20, # 15 p. 4364 - 4366 Title/Abstract Full Text View citing articles Show Details
BASE SE
Patent: US2010/249434 A1, 2010 ; Title/Abstract Full Text Show Details
Kim, Tae Hyeon; Kwon, Na Young; Lee, Taek Seung
Tetrahedron Letters, 2010 , vol. 51, # 42 p. 5596 - 5600 Title/Abstract Full Text View citing articles Show Details
Van Eijsden, Pieter; Behar, Kevin L.; Mason, Graeme F.; Braun, Kees P. J.; De Graaf, Robin A.
Journal of Neurochemistry, 2010 , vol. 112, # 1 p. 24 - 33 Title/Abstract Full Text View citing articles Show Details
THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
Patent: WO2006/45119 A2, 2006 ; Title/Abstract Full Text Show Details
Menati; Saiahy
Asian Journal of Chemistry, 2010 , vol. 22, # 6 p. 4533 - 4536 Title/Abstract Full Text View citing articles Show Details
73 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Japan Science and Technology Agency
Patent: EP1721907 A1, 2006 ; Title/Abstract Full Text Show Details
ASTRAZENECA AB
Patent: WO2006/137795 A1, 2006 ; Title/Abstract Full Text Show Details
NORTHWESTERN UNIVERSITY
Patent: WO2007/35964 A2, 2007 ; Title/Abstract Full Text Show Details
PAINCEPTOR PHARMA CORPORATION
Patent: WO2007/71055 A1, 2007 ; Title/Abstract Full Text Show Details
TAKEDA PHARMACEUTICAL COMPANY LIMITED
Patent: WO2007/97470 A2, 2007 ; Title/Abstract Full Text Show Details
Krepski, Larry R.; Dellaria Jr., Joseph F.; Duffy, Daniel E.; Amos, David T.; Zimmermann, Bernhard M.; Moser, William H.
Patent: US2007/219196 A1, 2007 ; Title/Abstract Full Text Show Details
ONCONOVA THERAPEUTICS, INC.
Patent: WO2008/33475 A2, 2008 ; Title/Abstract Full Text Show Details
Institute Of Medicinal Biotechnology, Chinese Academy of Medical Sciences
Patent: EP2253621 A1, 2010 ; Title/Abstract Full Text Show Details
Li, Sheng Yun; Guo, Qiao Lin; Yuan, Wen; Hou, Yu Cui; Du, Li Ming
Bulletin of the Chemical Society of Ethiopia, 2010 , vol. 24, # 1 p. 21 - 30 Title/Abstract Full Text View citing articles Show Details
Cook, Matthew C.; Witherell, Ross D.; White, Robert L.
Letters in Drug Design and Discovery, 2010 , vol. 7, # 1 p. 9 - 13 Title/Abstract Full Text View citing articles Show Details
Yin, Wenyuan; Majumder, Samarpan; Clayton, Terry; Petrou, Steven; Vanlinn, Michael L.; Namjoshi, Ojas A.; Ma, Chunrong; Cromer, Brett A.; Roth, Bryan L.; Platt, Donna M.; Cook, James M.
Bioorganic and Medicinal Chemistry, 2010 , vol. 18, # 21 p. 7548 - 7564 Title/Abstract Full Text View citing articles Show Details
Hayashi, Shigeo; Nakata, Eriko; Morita, Asato; Mizuno, Kunihiko; Yamamura, Kenzo; Kato, Aki; Ohashi, Katsuyo
Bioorganic and Medicinal Chemistry, 2010 , vol. 18, # 21 p. 7675 - 7699 Title/Abstract Full Text View citing articles Show Details
Tosin, Manuela; Betancor, Lorena; Stephens, Elaine; Li, W. M. Ariel; Spencer, Jonathan B.; Leadlay, Peter F.
ChemBioChem, 2010 , vol. 11, # 4 p. 539 - 546 Title/Abstract Full Text View citing articles Show Details
Abbar, Jyothi C.; Malode, Shweta J.; Nandibewoor, Sharanappa T.
Zeitschrift fur Physikalische Chemie, 2010 , vol. 224, # 6 p. 865 - 882 Title/Abstract Full Text View citing articles Show Details
Uslu, Aylin; Guevenaltin
Dalton Transactions, 2010 , vol. 39, # 44 p. 10685 - 10691 Title/Abstract Full Text View citing articles Show Details
Malode, Shweta J.; Abbar, Jyothi C.; Nandibewoor, Sharanappa T.
Inorganica Chimica Acta, 2010 , vol. 363, # 11 p. 2430 - 2442
Title/Abstract Full Text View citing articles Show Details
Rodrigues Jr., Manoel T.; Gomes, Juliana C.; Smith, Joel; Coelho, Fernando
Tetrahedron Letters, 2010 , vol. 51, # 38 p. 4988 - 4990 Title/Abstract Full Text View citing articles Show Details
Ye, Long; Zhang, Hongyan; Xu, Hong; Zou, Qi; Cheng, Chao; Dong, Dexian; Xu, Yuquan; Li, Rongxiu
Bioorganic and Medicinal Chemistry Letters, 2010 , vol. 20, # 24 p. 7369 - 7371 Title/Abstract Full Text View citing articles Show Details
BIOGEN IDEC MA INC.; THOMAS, Jermaine; LIU, Xiaogao; LIN, Edward, Yin-Shiang; ZHENG, Guo, Zhu; MA, Bin; CALDWELL, Richard, D.; GUCKIAN, Kevin, M.; KUMARAVEL, Gnanasambandam; TAVERAS, Arthur, G.
Patent: WO2011/17561 A1, 2011 ; Title/Abstract Full Text Show Details
Li, Chao; Du, Chao; Tian, Hua; Jiang, Chao; Du, Min; Liu, Yan; Qiao, Ren-Zhong; Jia, Yan-Xing; Zhao, Yu-Fen
Chemistry - A European Journal, 2010 , vol. 16, # 43 p. 12935 - 12940 Title/Abstract Full Text View citing articles Show Details
74 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
McGonigle, Ian; Lummis, Sarah C. R.
Biochemistry, 2010 , vol. 49, # 13 p. 2897 - 2902 Title/Abstract Full Text View citing articles Show Details
Sun, Chuanwen; Zhu, Jun; Wang, Haifeng; Jin, Jia; Xing, Jiahua; Yang, Dingrong
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 1 p. 11 - 20 Title/Abstract Full Text View citing articles Show Details
Evans, Christopher G.; Jinwal, Umesh K.; Makley, Leah N.; Dickey, Chad A.; Gestwicki, Jason E.
Chemical Communications, 2011 , vol. 47, # 1 p. 529 - 531 Title/Abstract Full Text View citing articles Show Details
Bugdahn, Nikolas; Peuckert, Florian; Albrecht, Alexander G.; Miethke, Marcus; Marahiel, Mohamed A.; Oberthuer, Markus
Angewandte Chemie - International Edition, 2010 , vol. 49, # 52 p. 10210 - 10213 Title/Abstract Full Text View citing articles Show Details
Gomez-Romero, Maria; Segura-Carretero, Antonio; Fernandez-Gutierrez, Alberto
Phytochemistry, 2010 , vol. 71, # 16 p. 1848 - 1864 Title/Abstract Full Text View citing articles Show Details
Ma, Shutao; Jiao, Bo; Ju, Yongjing; Zheng, Manjie; Ma, Ruixin; Liu, Lin; Zhang, Ling; Shen, Xuecui; Ma, Chenchen; Meng, Ya; Wang, Hui; Qi, Yunkun; Ma, Xiaodong; Cui, Wenping
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 2 p. 556 - 566 Title/Abstract Full Text View citing articles Show Details
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Ozoe, Yoshihisa; Asahi, Miho; Ozoe, Fumiyo; Nakahira, Kunimitsu; Mita, Takeshi
Biochemical and Biophysical Research Communications, 2010 , vol. 391, # 1 p. 744 - 749 Title/Abstract Full Text View citing articles Show Details
Frolund; Marquez; Larsen; Brodin; Nielsen
British Journal of Pharmacology, 2010 , vol. 159, # 6 p. 1339 - 1353 Title/Abstract Full Text View citing articles Show Details
Chatterjee, Sandipan; Srivastava, Shatakshi; Khalid, Asna; Singh, Niharika; Sangwan, Rajender Singh; Sidhu, Om Prakash; Roy, Raja; Khetrapal; Tuli, Rakesh
Phytochemistry, 2010 , vol. 71, # 10 p. 1085 - 1094 Title/Abstract Full Text View citing articles Show Details
Ho, W-Sv; Patel; Thompson; Roberts; Stuhr; Hillard
British Journal of Pharmacology, 2010 , vol. 160, # 3 p. 736 - 746 Title/Abstract Full Text View citing articles Show Details
Babaev; Ermolat'ev
Russian Journal of General Chemistry, 2010 , vol. 80, # 12 p. 2572 - 2589 Title/Abstract Full Text View citing articles Show Details
Tylichova, Martina; Kopecny, David; Morera, Solange; Briozzo, Pierre; Lenobel, Rene; Snegaroff, Jacques; Sebela, Marek
Journal of Molecular Biology, 2010 , vol. 396, # 4 p. 870 - 882 Title/Abstract Full Text View citing articles Show Details
Rexahn Pharmaceuticals, Inc.
Patent: US2011/86111 A1, 2011 ; Title/Abstract Full Text Show Details
Kimura, Tomohiro; Ishikawa, Kensuke; Sakasegawa, Yuji; Teruya, Kenta; Sata, Tetsutaro; Schaetzl, Hermann; Doh-ura, Katsumi
FEBS Letters, 2010 , vol. 584, # 6 p. 1193 - 1198 Title/Abstract Full Text View citing articles Show Details
Riva, Renata; Banfi, Luca; Basso, Andrea; Zito, Paola
Organic and Biomolecular Chemistry, 2011 , vol. 9, # 7 p. 2107 - 2122 Title/Abstract Full Text View citing articles Show Details
Hack, Silke; Woerlein, Babette; Hoefner, Georg; Pabel, Joerg; Wanner, Klaus T.
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 5 p. 1483 - 1498 Title/Abstract Full Text View citing articles Show Details
Mustafa, Dana A.; Kashemirov, Boris A.; McKenna, Charles E.
Tetrahedron Letters, 2011 , vol. 52, # 18 p. 2285 - 2287 Title/Abstract Full Text View citing articles Show Details
Nguyen, Jeffrey-Tri; Kato, Keiko; Hidaka, Koushi; Kumada, Henri-Obadja; Kimura, Tooru; Kiso, Yoshiaki
Bioorganic and Medicinal Chemistry Letters, 2011 , vol. 21, # 8 p. 2425 - 2429 Title/Abstract Full Text View citing articles Show Details
Meanwell, Nicholas A.
Journal of Medicinal Chemistry, 2011 , vol. 54, # 8 p. 2529 - 2591 Title/Abstract Full Text View citing articles Show Details
75 of 992
Comment
Bioactivities present
(Pharmacological Data) Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Norcliffe, Jennifer L.; Conway, Louis P.; Hodgson, David R.W.
Tetrahedron Letters, 2011 , vol. 52, # 21 p. 2730 - 2732 Title/Abstract Full Text View citing articles Show Details
Mueller, Mathias Q.; Dreiocker, Frank; Ihling, Christian H.; Schaefer, Mathias; Sinz, Andrea
Journal of Mass Spectrometry, 2010 , vol. 45, # 8 p. 880 - 891 Title/Abstract Full Text View citing articles Show Details
Le Notre, Jerome; Scott, Elinor L.; Franssen, Maurice C. R.; Sanders, Johan P. M.
Green Chemistry, 2011 , vol. 13, # 4 p. 807 - 809 Title/Abstract Full Text View citing articles Show Details
ABBOTT LABORATORIES; CUSACK, Kevin, P.; BREINLINGER, Eric, C.; FIX-STENZEL, Shannon, R.; STOFFEL, Robert, H.; WOLLER, Kevin, R.
Patent: WO2011/71570 A1, 2011 ; Title/Abstract Full Text Show Details
Mehlich, Jan; Ravoo, Bart Jan
Organic and Biomolecular Chemistry, 2011 , vol. 9, # 11 p. 4108 - 4115 Title/Abstract Full Text View citing articles Show Details
Campbell, Bronwyn E.; Tarleton, Mark; Gordon, Christopher P.; Sakoff, Jennette A.; Gilbert, Jayne; McCluskey, Adam; Gasser, Robin B.
Bioorganic and Medicinal Chemistry Letters, 2011 , vol. 21, # 11 p. 3277 - 3281 Title/Abstract Full Text View citing articles Show Details
Dichi, Emma; Sghaier, Mehrez; Fraisse, Bernard; Bonhomme, Francois
Chemical and Pharmaceutical Bulletin, 2011 , vol. 59, # 6 p. 703 - 709 Title/Abstract Full Text View citing articles Show Details
Prishchenko, Andrey A.; Livantsov, Mikhail V.; Novikova, Olga P.; Livantsova, Ludmila I.; Petrosyan, Valery S.
Heteroatom Chemistry, 2010 , vol. 21, # 6 p. 430 - 440 Title/Abstract Full Text View citing articles Show Details
Amir, Mohammad; Ali, Israr
Synthetic Communications, 2011 , vol. 41, # 14 p. 2086 - 2095 Title/Abstract Full Text View citing articles Show Details
SUZHOU NEUPHARMA CO., LTD.; QIAN, Xiangping
Patent: WO2011/85641 A1, 2011 ; Title/Abstract Full Text Show Details
Semreen, Mohammad H.; El-Shorbagi, Abdel-Nasser; Al-Tel, Taleb H.; Alsalahat, Izzeddin M.M.
Medicinal Chemistry, 2010 , vol. 6, # 3 p. 144 - 149 Title/Abstract Full Text View citing articles Show Details
Bignan, Gilles; Gaul, Micheal; Xu, Guozhang; Zhao, Bao-Ping
Patent: US2011/200587 A1, 2011 ; Title/Abstract Full Text Show Details
Sekiguchi, Hiroshi; Ozeki, Yoshihiro; Sasaki, Nobuhiro
Journal of Agricultural and Food Chemistry, 2010 , vol. 58, # 23 p. 12504 - 12509 Title/Abstract Full Text View citing articles Show Details
Wei, Feifei; Furihata, Kazuo; Hu, Fangyu; Miyakawa, Takuya; Tanokura, Masaru
Magnetic Resonance in Chemistry, 2010 , vol. 48, # 11 p. 857 - 865 Title/Abstract Full Text View citing articles Show Details
Wang, Jyh-Jye; Wang, Hui-Yun; Shih, Cheng-Dean
Journal of Agricultural and Food Chemistry, 2010 , vol. 58, # 13 p. 7940 - 7948 Title/Abstract Full Text View citing articles Show Details
Gomez-Biagi, Rodolfo F.; Nitz, Mark
Chemical Communications, 2011 , vol. 47, # 30 p. 8614 - 8616 Title/Abstract Full Text View citing articles Show Details
Rousseau, Guillaume; Oms, Olivier; Dolbecq, Anne; Marrot, Jerome; Mialane, Pierre
Inorganic Chemistry, 2011 , vol. 50, # 16 p. 7376 - 7378 Title/Abstract Full Text View citing articles Show Details
Lopez-Gresa, M. Pilar; Maltese, Federica; Belles, Jose Maria; Conejero, Vicente; Kim, Hye Kyong; Choi, Young Hae; Verpoorte, Robert
Phytochemical Analysis, 2010 , vol. 21, # 1 p. 89 - 94 Title/Abstract Full Text View citing articles Show Details
Roberts, Tucker C.; Schallenberger, Mark A.; Liu, Jian; Smith, Peter A.; Romesberg, Floyd E.
Journal of Medicinal Chemistry, 2011 , vol. 54, # 14 p. 4954 - 4963 Title/Abstract Full Text View citing articles Show Details
76 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Yang, Yajun; Feng, Ziming; Jiang, Jianshuang; Yang, Yanan; Pan, Xiandao; Zhang, Peicheng
Chemical and Pharmaceutical Bulletin, 2011 , vol. 59, # 8 p. 1016 - 1019 Title/Abstract Full Text View citing articles Show Details
Andres, Jose-Ignacio; De Angelis, Meri; Alcazar, Jesus; Iturrino, Laura; Langlois, Xavier; Dedeurwaerdere, Stefanie; Lenaerts, Ilse; Vanhoof, Greet; Celen, Sofie; Bormans, Guy
Journal of Medicinal Chemistry, 2011 , vol. 54, # 16 p. 5820 - 5835 Title/Abstract Full Text View citing articles Show Details
Broyart, Caroline; Fontaine, Jean-Xavier; Molinie, Roland; Cailleu, Dominique; Terce-Laforgue, Therese; Dubois, Frederic; Hirel, Bertrand; Mesnard, Francois
Phytochemical Analysis, 2010 , vol. 21, # 1 p. 102 - 109 Title/Abstract Full Text View citing articles Show Details
De, Swati; Koley, Debasis; Ramakrishnan
Macromolecules, 2010 , vol. 43, # 7 p. 3183 - 3192 Title/Abstract Full Text View citing articles Show Details
Medici, Rosario; De Maria, Pablo Dominguez; Otten, Linda G.; Straathof, Adrie J. J.
Advanced Synthesis and Catalysis, 2011 , vol. 353, # 13 p. 2369 - 2376 Title/Abstract Full Text View citing articles Show Details
Ma, Chenchen; Liu, Zhaopeng; Song, Hualong; Jiang, Rentao; He, Fawen; Ma, Shutao
Journal of Antibiotics, 2010 , vol. 63, # 1 p. 3 - 8 Title/Abstract Full Text View citing articles Show Details
Bonaiuto, Emanuela; Lunelli, Michele; Scarpa, Marina; Vettor, Roberto; Milan, Gabriella; Di Paolo, Maria Luisa
Biochimie, 2010 , vol. 92, # 7 p. 858 - 868 Title/Abstract Full Text View citing articles Show Details
Abu-Hashem; Gouda
Archiv der Pharmazie, 2011 , vol. 344, # 8 p. 543 - 551 Title/Abstract Full Text View citing articles Show Details
Pierce Biotechnology, Inc.
Patent: US8039648 B2, 2011 ; Title/Abstract Full Text Show Details
Raeppel, Stëphane; Raeppel, Franck; Claridge, Stephen William; Zhan, Lijie; Gaudette, Frëdëric; Mannion, Michael; Sato, Norifumi; Yuki, Yohei; Kishida, Masashi; Vaisburg, Arkadii
Patent: US2011/257100 A1, 2011 ; Title/Abstract Full Text Show Details
Planamente, Sara; Vigouroux, Armelle; Mondy, Samuel; Nicaise, Magali; Faure, Denis; Morera, Solange
Journal of Biological Chemistry, 2010 , vol. 285, # 39 p. 30294 - 30303 Title/Abstract Full Text View citing articles Show Details
Zoda, Mohammad Safa; Zacharias, Martin; Reissmann, Siegmund
Journal of Peptide Science, 2010 , vol. 16, # 8 p. 403 - 413 Title/Abstract Full Text View citing articles Show Details
Qu, Zhibo; Chen, Xiaolan; Qu, Chen; Qu, Lingbo; Yuan, Jinwei; Wei, Donghui; Li, Huina; Huang, Xiaoying; Jiang, Yuqin; Zhao, Yufen
International Journal of Mass Spectrometry, 2010 , vol. 295, # 1-2 p. 85 - 93 Title/Abstract Full Text View citing articles Show Details
TARGANTA THERAPEUTICS, INC.
Patent: US2011/263534 A1, 2011 ; Title/Abstract Full Text Show Details
Bartholomae, Mark D.; Vortherms, Anthony R.; Hillier, Shawn; Ploier, Birgit; Joyal, John; Babich, John; Doyle, Robert P.; Zubieta, Jon
ChemMedChem, 2010 , vol. 5, # 9 p. 1513 - 1529 Title/Abstract Full Text View citing articles Show Details
Perez, Estela Maria Sanchez; Iglesias, Maria Jose; Ortiz, Fernando Lopez; Perez, Isidro Sanchez; Galera, Maria Martinez
Food Chemistry, 2010 , vol. 122, # 3 p. 877 - 887 Title/Abstract Full Text View citing articles Show Details
Zhang, Yingjie; Feng, Jinhong; Jia, Yuping; Xu, Yingying; Liu, Chunxi; Fang, Hao; Xu, Wenfang
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 11 p. 5387 - 5397 Title/Abstract Full Text View citing articles Show Details
Thondorf, Iris; Voigt, Valerie; Schaefer, Sarah; Gebauer, Sabine; Zebisch, Katja; Laug, Linda; Brandsch, Matthias
Bioorganic and Medicinal Chemistry, 2011 , vol. 19, # 21 p. 6409 - 6418 Title/Abstract Full Text View citing articles Show Details
Ma, Fangfang; Xie, Xiaomin; Ding, Lina; Gao, Jinsheng; Zhang, Zhaoguo
Tetrahedron, 2011 , vol. 67, # 48 p. 9405 - 9410 Title/Abstract Full Text View citing articles Show Details
Rotstein, Benjamin H.; Mourtada, Rida; Kelley, Shana O.; Yudin, Andrei K.
Chemistry - A European Journal, 2011 , vol. 17, # 44 p. 12257 - 12261 Title/Abstract Full Text View citing articles Show Details
77 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Dodd, Joanna R.; Birch, Nigel P.; Waldvogel, Henry J.; Christie, David L.
Journal of Neurochemistry, 2010 , vol. 115, # 3 p. 684 - 693 Title/Abstract Full Text View citing articles Show Details
Wellendorph, Petrine; Hog, Signe; Sabbatini, Paola; Pedersen, Martin H. F.; Martiny, Lars; Knudsen, Gitte M.; Frolund, Bente; Clausen, Rasmus P.; Braeuner-Osborne, Hans
Journal of Pharmacology and Experimental Therapeutics, 2010 , vol. 335, # 2 p. 458 - 464 Title/Abstract Full Text View citing articles Show Details
Bharti; Bhatia, Anil; Tewari; Sidhu; Roy, Raja
Magnetic Resonance in Chemistry, 2011 , vol. 49, # 10 p. 659 - 667 Title/Abstract Full Text View citing articles Show Details
Kamal, Mehnaz; Khan, Suroor A.; Jawaid, Talha
Indian Journal of Heterocyclic Chemistry, 2010 , vol. 19, # 4 p. 321 - 324 Title/Abstract Full Text View citing articles Show Details
Sun, Aiming; Moore, Terry W.; Gunther, Jillian R.; Kim, Mi-Sun; Rhoden, Eric; Du, Yuhong; Fu, Haian; Snyder, James P.; Katzenellenbogen, John A.
ChemMedChem, 2011 , vol. 6, # 4 p. 654 - 666 Title/Abstract Full Text View citing articles Show Details
Egorov, Maxim; Aoun, Sameh; Padrines, Marc; Redini, Francoise; Heymann, Dominique; Lebreton, Jacques; Mathe-Allainmat, Monique
European Journal of Organic Chemistry, 2011 , # 35 p. 7148 - 7154 Title/Abstract Full Text View citing articles Show Details
Neves Filho, Ricardo A. W.; Westermann, Bernhard; Wessjohann, Ludger A.
Beilstein Journal of Organic Chemistry, 2011 , vol. 7, art. no. 7, p. 1504 - 1507 Title/Abstract Full Text Show Details
Li, Guoliang; Cui, Yanyan; You, Jinmao; Zhao, Xianen; Sun, Zhiwei; Xia, Lian; Suo, Yourui; Wang, Xiao
Amino Acids, 2011 , vol. 40, # 4 p. 1185 - 1193 Title/Abstract Full Text View citing articles Show Details
THE UNIVERSITY OF NOTTINGHAM; MISTRY, Shailesh; DARAS, Etienne; FROMONT, Christophe; JADHAV, Gopal; FISCHER, Peter Martin; KELLAM, Barrie; HILL, Stephen John; BAKER, Jillian Glenda
Patent: WO2012/4549 A1, 2012 ;
Title/Abstract Full Text Show Details
Ojo, Babatunde; Chowdhury, Bejoy K.
Synthetic Communications, 2012 , vol. 42, # 7 p. 1002 - 1009 Title/Abstract Full Text View citing articles Show Details
Stanton-Humphreys, Megan N.; Taylor, Ruth D. T.; McDougall, Craig; Hart, Mike L.; Brown, C. Tom A.; Emptage, Nigel J.; Conway, Stuart J.
Chemical Communications, 2012 , vol. 48, # 5 p. 657 - 659 Title/Abstract Full Text View citing articles Show Details
Celis, Sergio; Gorrea, Esther; Nolis, Pau; Illa, Ona; Ortuno, Rosa M.
Organic and Biomolecular Chemistry, 2012 , vol. 10, # 4 p. 861 - 868 Title/Abstract Full Text View citing articles Show Details
Paramonov, Sergey; Fedorov, Yury; Lokshin, Vladimir; Tulyakova, Elena; Vermeersch, Gaston; Delbaere, Stéphanie; Fedorova, Olga
Organic and Biomolecular Chemistry, 2012 , vol. 10, # 3 p. 671 - 682 Title/Abstract Full Text View citing articles Show Details
IMTM GMBH
Patent: US2012/28995 A1, 2012 ; Title/Abstract Full Text Show Details
Leydier, Antoine; Lin, Yi; Arrachart, Guilhem; Turgis, Raphael; Lecercle, Delphine; Favre-Reguillon, Alain; Taran, Frederic; Lemaire, Marc; Pellet-Rostaing, Stephane
Tetrahedron, 2012 , vol. 68, # 4 p. 1163 - 1170 Title/Abstract Full Text View citing articles Show Details
Lellouche, Jean-Paul; Pomerantz, Zvika; Ghosh, Subrata
Tetrahedron Letters, 2011 , vol. 52, # 51 p. 6903 - 6907 Title/Abstract Full Text View citing articles Show Details
De Vries, Elise J. C.; Levendis, Demetrius C.; Reece, Hayley A.
CrystEngComm, 2011 , vol. 13, # 10 p. 3334 - 3337 Title/Abstract Full Text View citing articles Show Details
Liu, Daniel S.; Tangpeerachaikul, Anupong; Selvaraj, Ramajeyam; Taylor, Michael T.; Fox, Joseph M.; Ting, Alice Y.
Journal of the American Chemical Society, 2012 , vol. 134, # 2 p. 792 - 795 Title/Abstract Full Text View citing articles Show Details
Wang, Ze-Jun; Sun, Liqin; Jackson, Patrice L.; Scott, Kenneth R.; Heinbockel, Thomas
Journal of Pharmacology and Experimental Therapeutics, 2011 , vol. 336, # 3 p. 916 - 924 Title/Abstract Full Text View citing articles Show Details
Song, Peng; Mabrouk, Omar S.; Hershey, Neil D.; Kennedy, Robert T.
Analytical Chemistry, 2012 , vol. 84, # 1 p. 412 - 419 Title/Abstract Full Text View citing articles Show Details
78 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Reger, Daniel L.; Debreczeni, Agota; Horger, Jacob J.; Smith, Mark D.
Crystal Growth and Design, 2011 , vol. 11, # 9 p. 4068 - 4079 Title/Abstract Full Text View citing articles Show Details
Tahira, Khizra; Ali, Saqib; Shahzadi, Saira; Sharma, Saroj K.; Qanungo, Kushal
Journal of Coordination Chemistry, 2011 , vol. 64, # 11 p. 1871 - 1884 Title/Abstract Full Text View citing articles Show Details
Jiang, Ruotian; Miyamoto, Akiko; Martz, Adeline; Specht, Alexandre; Ishibashi, Hitoshi; Kueny-Stotz, Marie; Chassaing, Stefan; Brouillard, Raymond; De Carvalho, Lia Prado; Goeldner, Maurice; Nabekura, Junichi; Nielsen, Mogens; Grutter, Thomas
British Journal of Pharmacology, 2011 , vol. 162, # 6 p. 1326 - 1339 Title/Abstract Full Text View citing articles Show Details
Pan, Yue; Gerasimov, Madina R.; Kvist, Trine; Wellendorph, Petrine; Madsen, Karsten K.; Pera, Elena; Lee, Hyunbeom; Schousboe, Arne; Chebib, Mary; Braeuner-Osborne, Hans; Craft, Cheryl M.; Brodie, Jonathan D.; Schiffer, Wynne K.; Dewey, Stephen L.; Miller, Steven R.; Silverman, Richard B.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 1 p. 357 - 366 Title/Abstract Full Text View citing articles Show Details
Kovganko; Sokolov; Chernov
Chemistry of Natural Compounds, 2011 , vol. 47, # 5 p. 781 - 782 Title/Abstract Full Text View citing articles Show Details
Reed, Anthony B.; Lanman, Brian A.; Neira, Susana; Harrington, Paul E.; Sham, Kelvin K.C.; Frohn, Mike; Pickrell, Alexander J.; Tasker, Andrew S.; Gore, Anu; Fiorino, Mike; Itano, Andrea; McElvain, Michele; Middleton, Scot; Morrison, Henry; Xu, Han; Xu, Yang; Wong, Min; Cee, Victor J.
Bioorganic and Medicinal Chemistry Letters, 2012 , vol. 22, # 4 p. 1779 - 1783 Title/Abstract Full Text View citing articles Show Details
Donato, Loic; Mourot, Alexandre; Davenport, Christopher M.; Herbivo, Cyril; Warther, David; Leonard, Jeremie; Bolze, Frederic; Nicoud, Jean-Francois; Kramer, Richard H.; Goeldner, Maurice; Specht, Alexandre
Angewandte Chemie - International Edition, 2012 , vol. 51, # 8 p. 1840 - 1843 Title/Abstract Full Text View citing articles Show Details
RANBAXY LABORATORIES LIMITED; KHERA, Manoj Kumar; PALLE, Venkata P.; SATTIGERI, Viswajanani; SATTIGERI, Jitendra; SONI, Ajay; RAUF, Abdul Rehman Abdul; SIVAKUMAR, R.; REDDY, Ranadheer R.; MUSIB, Arpita; CLIFFE, Ian A.; BHATNAGAR, Pradip Kumar; RAY, Abhijit; SRIVASTAVA, Punit; DASTIDAR, Sunanda Ghosh
Patent: WO2012/38944 A1, 2012 ; Title/Abstract Full Text Show Details
Kong, Hyesik; Kim, Hyunjeong; Do, Heejeong; Lee, Yonghyun; Hong, Sungchae; Yoon, Jeong-Hyun; Jung, Yunjin; Kim, Young Mi
Biopharmaceutics and Drug Disposition, 2011 , vol. 32, # 6 p. 343 - 354 Title/Abstract Full Text View citing articles Show Details
Universität Innsbruck; Universität Wien
Patent: EP2438921 A1, 2012 ; Title/Abstract Full Text Show Details
Martinez, Luis; Sampedro, Angel; Sanna, Elena; Costa, Antoni; Rotger, Carmen
Organic and Biomolecular Chemistry, 2012 , vol. 10, # 9 p. 1914 - 1921 Title/Abstract Full Text View citing articles Show Details
Baud, Matthias G. J.; Leiser, Thomas; Haus, Patricia; Samlal, Sharon; Wong, Ai Ching; Wood, Robert J.; Petrucci, Vanessa; Gunaratnam, Mekala; Hughes, Siobhan M.; Buluwela, Lakjaya; Turlais, Fabrice; Neidle, Stephen; Meyer-Almes, Franz-Josef; White, Andrew J. P.; Fuchter,
Matthew J.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 4 p. 1731 - 1750 Title/Abstract Full Text View citing articles Show Details
Ali, Kashif; Maltese, Federica; Toepfer, Reinhard; Choi, Young Hae; Verpoorte, Robert
Journal of Biomolecular NMR, 2011 , vol. 49, # 3-4 p. 255 - 266 Title/Abstract Full Text View citing articles Show Details
Naresh Chary; Dinesh Kumar, Ch.; Vairamani; Prabhakar
Journal of Mass Spectrometry, 2012 , vol. 47, # 1 p. 79 - 88 Title/Abstract Full Text View citing articles Show Details
Tan, Yue-He; Li, Jian-Xiao; Xue, Fu-Ling; Qi, Ji; Wang, Zhao-Yang
Tetrahedron, 2012 , vol. 68, # 13 p. 2827 - 2843 Title/Abstract Full Text View citing articles Show Details
Kreye, Oliver; Tueruenc, Oguz; Sehlinger, Ansgar; Rackwitz, Jenny; Meier, Michael A. R.
Chemistry - A European Journal, 2012 , vol. 18, # 18 p. 5767 - 5776 Title/Abstract Full Text View citing articles Show Details
Sasmal, Sanjita; Balasubrahmanyam; Kanna Reddy, Hariprasada R.; Balaji, Gade; Srinivas, Gujjary; Cheera, Srisailam; Abbineni, Chandrasekhar; Sasmal, Pradip K.; Khanna, Ish; Sebastian; Jadhav, Vikram P.; Singh, Manvendra P.; Talwar, Rashmi; Suresh; Shashikumar, Dhanya; Harinder Reddy; Sihorkar; Frimurer, Thomas M.; Rist, ystein; Elster, Lisbeth; Hoegberg, Thomas
Bioorganic and Medicinal Chemistry Letters, 2012 , vol. 22, # 9 p. 3163 - 3167 Title/Abstract Full Text View citing articles Show Details
Ha, Khanh; Chahar, Mamta; Monbaliu, Jean-Christophe M.; Todadze, Ekaterina; Hansen, Finn K.; Oliferenko, Alexander A.; Ocampo, Charles E.; Leino, David; Lillicotch, Aaron; Stevens, Christian V.; Katritzky, Alan R.
Journal of Organic Chemistry, 2012 , vol. 77, # 6 p. 2637 - 2648 Title/Abstract Full Text View citing articles Show Details
Namdeo, Ajay G.; Sharma, Ajay; Yadav, Kavita N.; Gawande, Rupali; Mahadik, Kakasaheb R.; Lopez-Gresa, Maria Pilar; Kim, Hye Kyong; Choi, Young Hae; Verpoorte, Robert
Planta Medica, 2011 , vol. 77, # 17 p. 1958 - 1964 Title/Abstract Full Text View citing articles Show Details
ROYAL HOLLOWAY AND BEDFORD NEW COLLEGE; WILLIAMS, Robin Simon Brooke; WALKER, Matthew
Patent: WO2012/69790 A1, 2012 ; Title/Abstract Full Text Show Details
79 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Luitpold Pharmaceuticals, Inc.
Patent: US2012/148595 A1, 2012 ; Title/Abstract Full Text Show Details
Specht, Alexandre; Bolze, Frederic; Donato, Loic; Herbivo, Cyril; Charon, Sebastien; Warther, David; Gug, Sylvestre; Nicoud, Jean-Franois; Goeldner, Maurice
Photochemical and Photobiological Sciences, 2012 , vol. 11, # 3 p. 578 - 586 Title/Abstract Full Text View citing articles Show Details
Diao, Lei; Polli, James E.
Journal of Pharmaceutical Sciences, 2011 , vol. 100, # 9 p. 3802 - 3816 Title/Abstract Full Text View citing articles Show Details
Minyan, Song; Ramsh; Fundamensky; Solov'eva; Zakharov
Russian Journal of General Chemistry, 2012 , vol. 82, # 2 p. 236 - 246 Title/Abstract Full Text View citing articles Show Details
Radwan, Awwad A.; Al-Dhfyan, Abdullah; Abdel-Hamid, Mohammed K.; Al-Badr, Abdullah A.; Aboul-Fadl, Tarek
Archives of Pharmacal Research, 2012 , vol. 35, # 1 p. 35 - 49 Title/Abstract Full Text View citing articles Show Details
Pandurangan, Komala; Murnaghan, Kevin D.; Walshe, Aurora; Mueller-Bunz, Helge; Paradisi, Francesca; Morgan, Grace G.
Chemical Biology and Drug Design, 2011 , vol. 78, # 5 p. 787 - 799 Title/Abstract Full Text View citing articles Show Details
Lopez-Rituerto, Eva; Savorani, Francesco; Avenoza, Alberto; Busto, Jesus H.; Peregrina, Jesus M.; Engelsen, Soren Balling
Journal of Agricultural and Food Chemistry, 2012 , vol. 60, # 13 p. 3452 - 3461 Title/Abstract Full Text View citing articles Show Details
Rajak, Harish; Kumar, Pramod; Parmar, Poonam; Thakur, Bhupendra Singh; Veerasamy, Ravichandran; Sharma, Prabodh Chander; Sharma, Ajay Kumar; Gupta, Arun Kumar; Dangi, Jawahar Singh
European Journal of Medicinal Chemistry, 2012 , vol. 53, p. 390 - 397 Title/Abstract Full Text View citing articles Show Details
Tan, Yue-He; Wang, Zhao-Yang; Qi, Ji; Xiong, Jin-Feng; Lv, Mei-Xiang
Research on Chemical Intermediates, 2012 , vol. 38, # 3-5 p. 925 - 936 Title/Abstract Full Text View citing articles Show Details
Karuehanon, Weeranuch; Fanfuenha, Watcharee; Rujiwatra, Apinpus; Pattarawarapan, Mookda
Tetrahedron Letters, 2012 , vol. 53, # 27 p. 3486 - 3489 Title/Abstract Full Text View citing articles Show Details
Yanvarev; Korovina; Usanov; Kochetkov
Russian Journal of Bioorganic Chemistry, 2012 , vol. 38, # 2 p. 224 - 229 Title/Abstract Full Text View citing articles Show Details
FIBROGEN, INC.; NG, Danny; AREND, Michael P.; FLIPPIN, Lee A.
Patent: WO2012/106472 A1, 2012 ; Title/Abstract Full Text Show Details
Bernier, Nicolas; Esteves, Catarina V.; Delgado, Rita
Tetrahedron, 2012 , vol. 68, # 24 p. 4860 - 4868 Title/Abstract Full Text View citing articles Show Details
Srivastava, Shatakshi; Bisht, Hema; Sidhu; Srivastava, Ashish; Singh; Pandey; Raj; Roy, Raja; Nautiyal
Phytochemistry, 2012 , vol. 80, p. 8 - 16 Title/Abstract Full Text View citing articles Show Details
Sobenina, Lyubov N.; Tomilin, Denis N.; Ushakov, Igor A.; Mikhaleva, Albina I.; Trofimov, Boris A.
Synthesis (Germany), 2012 , vol. 44, # 13 art. no. SS-2012-Z0223-OP, p. 2084 - 2090 Title/Abstract Full Text View citing articles Show Details
Blair, Adele; Stevenson, Louise; Sutherland, Andrew
Tetrahedron Letters, 2012 , vol. 53, # 32 p. 4084 - 4086 Title/Abstract Full Text View citing articles Show Details
Magoulas, George E.; Garnelis, Thomas; Athanassopoulos, Constantinos M.; Papaioannou, Dionissios; Mattheolabakis, George; Avgoustakis, Konstantinos; Hadjipavlou-Litina, Dimitra
Tetrahedron, 2012 , vol. 68, # 35 p. 7041 - 7049 Title/Abstract Full Text View citing articles Show Details
Capron, Michael; Diaz-Tendero, Sergio; MacLot, Sylvain; Domaracka, Alicja; Lattouf, Elie; Lawicki, Arkadiusz; Maisonny, Remi; Chesnel, Jean-Yves; Mery, Alain; Poully, Jean-Christophe; Rangama, Jimmy; Adoui, Lamri; Martin, Fernando; Alcami, Manuel; Rousseau, Patrick; Huber, Bernd A.
Chemistry - A European Journal, 2012 , vol. 18, # 30 p. 9321 - 9332 Title/Abstract Full Text View citing articles Show Details
Savechenkov, Pavel Y.; Zhang, Xi; Chiara, David C.; Stewart, Deirdre S.; Ge, Rile; Zhou, Xiaojuan; Raines, Douglas E.; Cohen, Jonathan B.; Forman, Stuart A.; Miller, Keith W.; Bruzik, Karol S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 14 p. 6554 - 6565 Title/Abstract Full Text View citing articles Show Details
Husain, Asif; Rashid, Mohd; Mishra, Ravinesh; Parveen, Shama; Shin, Dong-Soo; Kumar, Deepak
Bioorganic and Medicinal Chemistry Letters, 2012 , vol. 22, # 17 p. 5438 - 5444 Title/Abstract Full Text View citing articles Show Details
80 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Thompson, Andrew J.; Alqazzaz, Mona; Ulens, Chris; Lummis, Sarah C.R.
Neuropharmacology, 2012 , vol. 63, # 4 p. 761 - 767 Title/Abstract Full Text View citing articles Show Details
LALEZARI, IRAJ; FABRICANT, JILL
Patent: US2012/232120 A1, 2012 ; Title/Abstract Full Text Show Details
Rahman, Mohammad Mostafizur; Akiyoshi, Yuki; Furutani, Shogo; Matsuda, Kazuhiko; Furuta, Kenjiro; Ikeda, Izumi; Ozoe, Yoshihisa
Bioorganic and Medicinal Chemistry, 2012 , vol. 20, # 19 p. 5957 - 5964 Title/Abstract Full Text View citing articles Show Details
Yadav, Naveen; Malhotra, Manav; Monga, Vikramdeep; Sharma, Sagun; Jain, Jainendra; Samad, Abdul; Deep, Aakash
Medicinal Chemistry Research, 2012 , vol. 21, # 9 p. 2208 - 2216 Title/Abstract Full Text View citing articles Show Details
Hawker, Dustin D.; Silverman, Richard B.
Bioorganic and Medicinal Chemistry, 2012 , vol. 20, # 19 p. 5763 - 5773 Title/Abstract Full Text View citing articles Show Details
Ha, Khanh; Monbaliu, Jean-Christophe M.; Williams, Byron C.; Pillai, Girinath G.; Ocampo, Charles E.; Zeller, Matthias; Stevens, Christian V.; Katritzky, Alan R.
Organic and Biomolecular Chemistry, 2012 , vol. 10, # 40 p. 8055 - 8058 Title/Abstract Full Text View citing articles Show Details
Csuk, Rene; Schwarz, Stefan; Siewert, Bianka; Kluge, Ralph; Stroehl, Dieter
Zeitschrift fur Naturforschung - Section B Journal of Chemical Sciences, 2012 , vol. 67, # 7 p. 731 - 746 Title/Abstract Full Text View citing articles Show Details
Sindelar, Miriam; Wanner, Klaus T.
ChemMedChem, 2012 , vol. 7, # 9 p. 1678 - 1690 Title/Abstract Full Text View citing articles Show Details
Naturale, Guillaume; Lamblin, Marc; Commandeur, Claude; Dessolin, Jean; Felpin, Francois-Xavier
European Journal of Organic Chemistry, 2012 , # 29 p. 5774 - 5788,15 Title/Abstract Full Text Show Details
Kim, In-Hae; Nishi, Kosuke; Kasagami, Takeo; Morisseau, Christophe; Liu, Jun-Yan; Tsai, Hsing-Ju; Hammock, Bruce D.
Bioorganic and Medicinal Chemistry Letters, 2012 , vol. 22, # 18 p. 5889 - 5892,4 Title/Abstract Full Text Show Details
Bol'shakov, Oleg; Kovacs, Judit; Chahar, Mamta; Ha, Khanh; Khelashvili, Levan; Katritzky, Alan R.
Journal of Peptide Science, 2012 , vol. 18, # 11 p. 704 - 709,6 Title/Abstract Full Text Show Details
Alanne, Aino-Liisa; Ylisirnioe, Markku; Turhanen, Petri; Peraeniemi, Sirpa; Vepsaelaeinen, Jouko; Hyvoenen, Helena; Lahtinen, Manu; Kolehmainen, Erkki
Molecules, 2012 , vol. 17, # 9 p. 10928 - 10945,18 Title/Abstract Full Text Show Details
Song, Il Keun; Kang, Young Kee
Journal of Molecular Structure, 2012 , vol. 1024, p. 163 - 169,7 Title/Abstract Full Text Show Details
Hubbs, Jed L.; Fuller, Nathan O.; Austin, Wesley F.; Shen, Ruichao; Creaser, Steffen P.; McKee, Timothy D.; Loureiro, Robyn M. B.; Tate, Barbara; Xia, Weiming; Ives, Jeffrey; Bronk, Brian S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 21 p. 9270 - 9282,13 Title/Abstract Full Text Show Details
Garcia, Daniel A.; Bujons, Jordi; Vale, Carmen; Sunol, Cristina
Neuropharmacology, 2006 , vol. 50, # 1 p. 25 - 35 Title/Abstract Full Text View citing articles Show Details
Zepperitz, Christine; Hoefner, Georg; Wanner, Klaus T.
ChemMedChem, 2006 , vol. 1, # 2 p. 208 - 217 Title/Abstract Full Text View citing articles Show Details
Errington, Adam C.; Coyne, Leanne; Stoehr, Thomas; Selve, Norma; Lees, George
Neuropharmacology, 2006 , vol. 50, # 8 p. 1016 - 1029 Title/Abstract Full Text View citing articles Show Details
Hirano, Hiroyuki; Kurata, Atsuo; Onishi, Yuko; Sakurai, Aki; Saito, Hikaru; Nakagawa, Hiroshi; Nagakura, Makoto; Tarui, Shigeki; Kanamori, Yoichi; Kitajima, Masato; Ishikawa, Toshihisa
Molecular Pharmaceutics, 2006 , vol. 3, # 3 p. 252 - 265 Title/Abstract Full Text View citing articles Show Details
Hog, Signe; Greenwood, Jeremy R.; Madsen, Karsten B.; Larsson, Orla M.; Frolund, Bente; Schousboe, Arne; Krogsgaard-Larsen, Povl; Clausen, Rasmus P.
Current Topics in Medicinal Chemistry, 2006 , vol. 6, # 17 p. 1861 - 1882
Title/Abstract Full Text View citing articles Show Details
Campo-Soria, Claudia; Chang, Yongchang; Weiss, David S
British journal of pharmacology, 2006 , vol. 148, # 7 p. 984 - 990 Title/Abstract Full Text Show Details
Hide facts
81 of 992
82 of 992
Show next 200 Comment (Pharmacological Data)
Bioactivities present
Reference
Mateeva; Winfield; Redda, Kinfe K.
Current Medicinal Chemistry, 2005 , vol. 12, # 5 p. 551 - 571 Title/Abstract Full Text View citing articles Show Details
Foltz, Martin; Mertl, Manuela; Dietz, Veronika; Boll, Michael; Kottra, Gabor; Daniel, Hannelore
Biochemical Journal, 2005 , vol. 386, # 3 p. 607 - 616 Title/Abstract Full Text View citing articles Show Details
Chebib, Mary; Hanrahan, Jane R.; Kumar, Rohan J.; Mewett, Kenneth N.; Morriss, Gwendolyn; Wooller, Soraya; Johnston, Graham A.R.
Neuropharmacology, 2007 , vol. 52, # 3 p. 779 - 787 Title/Abstract Full Text View citing articles Show Details
Murray; FitzGerald
Current Pharmaceutical Design, 2007 , vol. 13, # 8 p. 773 - 791 Title/Abstract Full Text View citing articles Show Details
Saito; Hirano; Ishikawa
Mini-Reviews in Medicinal Chemistry, 2007 , vol. 7, # 10 p. 1009 - 1018 Title/Abstract Full Text View citing articles Show Details
Birnir, Bryndis; Korpi, Esa R.
Current Pharmaceutical Design, 2007 , vol. 13, # 31 p. 3169 - 3177 Title/Abstract Full Text View citing articles Show Details
Richardson, Heather N.; Zhao, Yu; Fekete, Eva M.; Funk, Cindy K.; Wirsching, Peter; Janda, Kim D.; Zorrilla, Eric P.; Koob, George F.
Pharmacology Biochemistry and Behavior, 2008 , vol. 88, # 4 p. 497 - 510 Title/Abstract Full Text View citing articles Show Details
Fischer, Wiebke; Praetor, Katrin; Metzner, Linda; Neubert, Reinhard H.H.; Brandsch, Matthias
European Journal of Pharmaceutics and Biopharmaceutics, 2008 , vol. 70, # 2 p. 486 - 492 Title/Abstract Full Text View citing articles Show Details
Mapes, Christopher M.; Mani, Neelakandha S.
Organic Process Research and Development, 2007 , vol. 11, # 3 p. 482 - 486 Title/Abstract Full Text View citing articles Show Details
Chang, Shuang; Bray, Steven M.; Li, Zigang; Zarnescu, Daniela C.; He, Chuan; Jin, Peng; Warren, Stephen T.
Nature Chemical Biology, 2008 , vol. 4, # 4 p. 256 - 263 Title/Abstract Full Text View citing articles Show Details
Zheleznova; Sedelnikova; Weiss
British journal of pharmacology, 2008 , vol. 153, # 5 p. 1062 - 1071 Title/Abstract Full Text Show Details
Jansen, Michaela; Rabe, Holger; Strehle, Axelle; Dieler, Sandra; Debus, Fabian; Dannhardt, Gerd; Akabas, Myles H; Lueddens, Hartmut
Journal of medicinal chemistry, 2008 , vol. 51, # 15 p. 4430 - 4448 Title/Abstract Full Text Show Details
Xia, Rong; Mei, Zhu-Zhong; Milligan, Carol; Jiang, Lin-Hua
Biochemical and biophysical research communications, 2008 , vol. 375, # 1 p. 38 - 43 Title/Abstract Full Text Show Details
Deniau, Gildas; Slawin, Alexandra M.Z.; Lebl, Tomas; Chorki, Fatima; Issberner, Jon P.; van Mourik, Tanja; Heygate, Judith M.; Lambert, Jeremy J.; Etherington, Lori-An; Sillar, Keith T.; O'Hagan, David
ChemBioChem, 2007 , vol. 8, # 18 p. 2265 - 2274 Title/Abstract Full Text View citing articles Show Details
Kulig, Katarzyna; Szwaczkiewicz, Marta
Mini-Reviews in Medicinal Chemistry, 2008 , vol. 8, # 12 p. 1214 - 1223 Title/Abstract Full Text View citing articles Show Details
Takazoe, Masakazu; Matsui, Toshiyuki; Motoya, Satoshi; Matsumoto, Takayuki; Hibi, Toshifumi; Watanabe, Mamoru
Journal of Gastroenterology, 2009 , vol. 44, # 6 p. 535 - 543 Title/Abstract Full Text View citing articles Show Details
Crawford, Jason B.; Chen, Gang; Gauthier, David; Wilson, Trevor; Carpenter, Bryon; Baird, Ian R.; McEachern, Ernie; Kaller, Alan; Harwig, Curtis; Atsma, Bem; Skerlj, Renato T.; Bridger, Gary J.
Organic Process Research and Development, 2008 , vol. 12, # 5 p. 823 - 830 Title/Abstract Full Text View citing articles Show Details
Fischer, Wiebke; Neubert, Reinhard H.H.; Brandsch, Matthias
European Journal of Pharmaceutics and Biopharmaceutics, 2010 , vol. 74, # 2 p. 281 - 289 Title/Abstract Full Text View citing articles Show Details
Ueda, Kyoko; Tsuji, Fumio; Hirata, Tomoko; Ueda, Kenji; Murai, Masaaki; Aono, Hiroyuki; Takaoka, Masanori; Matsumura, Yasuo
Journal of Pharmacology and Experimental Therapeutics, 2009 , vol. 329, # 1 p. 202 - 209 Title/Abstract Full Text View citing articles Show Details
Hoefner, Georg; Merkel, Dietrich; Wanner, Klaus Theodor
ChemMedChem, 2009 , vol. 4, # 9 p. 1523 - 1528 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Lehmann, Anders; Antonsson, Madeleine; Holmberg, Ann Aurell; Blackshaw, L. Ashley; Braenden, Lena; Braeuner-Osborne, Hans; Christiansen, Bolette; Dent, John; Elebring, Thomas; Jacobson, Britt-Marie; Jensen, Joergen; Mattsson, Jan P.; Nilsson, Karolina; Oja, Simo S.; Page, Amanda J.; Saransaari, Pirjo; Von Unge, Sverker
Journal of Pharmacology and Experimental Therapeutics, 2009 , vol. 331, # 2 p. 504 - 512 Title/Abstract Full Text View citing articles Show Details
Atack, John R.; Maubach, Karen A.; Wafford, Keith A.; O'Connor, Desmond; Rodrigues, A. David; Evans, David C.; Tattersall, F. David; Chambers, Mark S.; MacLeod, Angus M.; Eng, Wai-Si; Ryan, Christine; Hostetler, Eric; Sanabria, Sandra M.; Gibson, Raymond E.; Krause, Stephen; Burns, H. Donald; Hargreaves, Richard J.; Agrawal, Nancy G. B.; McKernan, Ruth M.; Murphy, M. Gail; Gingrich, Kevin; Dawson,
Gerard R.; Musson, Donald G.; Petty, Kevin J.
Journal of Pharmacology and Experimental Therapeutics, 2009 , vol. 331, # 2 p. 470 - 484 Title/Abstract Full Text View citing articles Show Details
Maksay, Gabor; Fodor, Laszlo
European Journal of Pharmacology, 2011 , vol. 650, # 1 p. 94 - 101 Title/Abstract Full Text View citing articles Show Details
Kardos; Pallo; Bencsura; Simon
Current Medicinal Chemistry, 2010 , vol. 17, # 20 p. 2203 - 2213 Title/Abstract Full Text View citing articles Show Details
Reddy, Doodipala Samba; Jian, Kuihuan
Journal of Pharmacology and Experimental Therapeutics, 2010 , vol. 334, # 3 p. 1031 - 1041 Title/Abstract Full Text View citing articles Show Details
Krawczyk, Aleksandra; Jaworska-Adamu, Jadwiga
Folia Histochemica et Cytobiologica, 2010 , vol. 48, # 2 p. 173 - 177 Title/Abstract Full Text View citing articles Show Details
Hodgetts, Kevin J.; Combs, Kerry J.; Elder, Amy M.; Harriman, Geraldine C.
Annual Reports in Medicinal Chemistry, 2010 , vol. 45, # C p. 429 - 448 Title/Abstract Full Text View citing articles Show Details
Hendriks, Hester S.; Antunes Fernandes, Elsa C.; Bergman, Ake; van den Berg, Martin; Westerink, Remco H. S.
Toxicological Sciences, 2010 , vol. 118, # 2 art. no. KFQ284, p. 635 - 642 Title/Abstract Full Text View citing articles Show Details
McCracken, Mandy L.; Borghese, Cecilia M.; Trudell, James R.; Harris, R. Adron
Journal of Pharmacology and Experimental Therapeutics, 2010 , vol. 335, # 3 p. 600 - 606 Title/Abstract Full Text View citing articles Show Details
Yan, Ren-Yi; Wang, Hong-Qing; Liu, Chao; Chen, Ruo-Yun; Yu, De-Quan
Fitoterapia, 2011 , vol. 82, # 2 p. 247 - 250 Title/Abstract Full Text View citing articles Show Details
Werner; Swihart; Rau; Jia; Borghese; McCracken; Iyer; Fanselow; Oh; Sonner; Eger II; Harrison; Harris; Homanics
Journal of Pharmacology and Experimental Therapeutics, 2011 , vol. 336, # 1 p. 134 - 144 Title/Abstract Full Text View citing articles Show Details
Dinklo, Theo; Shaban, Hamdy; Thuring, Jan Willem; Lavreysen, Hilde; Stevens, Karen E.; Zheng, Lijun; Mackie, Claire; Grantham, Christopher; Vandenberk, Ine; Meulders, Greet; Peeters, Luc; Verachtert, Hanne; De Prins, Erik; Lesage, Anne S. J.
Journal of Pharmacology and Experimental Therapeutics, 2011 , vol. 336, # 2 p. 560 - 574 Title/Abstract Full Text View citing articles Show Details
Li, Xue-Mei; Shen, Xing-Hai; Duan, Zhen-Wen; Guo, Shu-Ren
Chinese Journal of Natural Medicines, 2011 , vol. 9, # 3 p. 161 - 166 Title/Abstract Full Text View citing articles Show Details
Takeuchi, Kazuya; Sugiura, Tomoko; Umeda, Saki; Matsubara, Kazuki; Horikawa, Masato; Nakamichi, Noritaka; Silver, David L.; Ishiwata, Norihisa; Kato, Yukio
Drug Metabolism and Disposition, 2011 , vol. 39, # 6 p. 1088 - 1096 Title/Abstract Full Text View citing articles Show Details
Morlock, Elaine V.; Czajkowski, Cynthia
Molecular Pharmacology, 2011 , vol. 80, # 1 p. 14 - 22 Title/Abstract Full Text View citing articles Show Details
Watt, Marla L.; Schober, Douglas A.; Hitchcock, Stephen; Liu, Bin; Chesterfield, Amy K.; McKinzie, David; Felder, Christian C.
Journal of Pharmacology and Experimental Therapeutics, 2011 , vol. 338, # 2 p. 622 - 632 Title/Abstract Full Text View citing articles Show Details
O'Toole, Kate K.; Jenkins, Andrew
Journal of Biological Chemistry, 2011 , vol. 286, # 44 p. 37990 - 37999 Title/Abstract Full Text View citing articles Show Details
Xie, An; Yan, Jun; Yue, Lan; Feng, Feng; Mir, Fozia; Abdel-Halim, Heba; Chebib, Mary; Le Breton, Guy C.; Standaert, Robert F.; Qian, Haohua; Pepperberg, David R.
Molecular Pharmacology, 2011 , vol. 80, # 6 p. 965 - 978 Title/Abstract Full Text View citing articles Show Details
Yamamoto, Izumi; Carland, Jane E.; Locock, Katherine; Gavande, Navnath; Absalom, Nathan; Hanrahan, Jane R.; Allan, Robin D.; Johnston, Graham A. R.; Chebib, Mary
ACS Chemical Neuroscience, 2012 , vol. 3, # 4 p. 293 - 301 Title/Abstract Full Text View citing articles Show Details
Billen, Bert; Spurny, Radovan; Brams, Marijke; Van Elk, Rene; Valera-Kummer, Soledad; Yakel, Jerrel L.; Voets, Thomas; Bertrand, Daniel; Smit, August B.; Ulens, Chris
Proceedings of the National Academy of Sciences of the United States of America, 2012 , vol. 109, # 23 p. 9173 - 9178 Title/Abstract Full Text View citing articles Show Details
83 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Knutson, Sarah K.; Wigle, Tim J.; Warholic, Natalie M.; Sneeringer, Christopher J.; Allain, Christina J.; Klaus, Christine R.; Sacks, Joelle D.; Raimondi, Alejandra; Majer, Christina R.; Song, Jeffrey; Scott, Margaret Porter; Jin, Lei; Smith, Jesse J.; Olhava, Edward J.; Chesworth, Richard; Moyer, Mikel P.; Richon, Victoria M.; Copeland, Robert A.; Keilhack, Heike; Pollock, Roy M.; Kuntz, Kevin W.
Nature Chemical Biology, 2012 , vol. 8, # 11 p. 890 - 896 Title/Abstract Full Text View citing articles Show Details
Naturale, Guillaume; Lamblin, Marc; Commandeur, Claude; Felpin, Francois-Xavier; Dessolin, Jean
European Journal of Organic Chemistry, 2012 , # 29 p. 5774 - 5788 Title/Abstract Full Text View citing articles Show Details
Rasia-Filho; Haas; de Oliveira; de Castilhos; Frey; Stein; Lazzari; Back; Pires; Pavesi; Winkelmann-Duarte; Giovenardi
Mini-Reviews in Medicinal Chemistry, 2012 , vol. 12, # 11 p. 1090 - 1106 Title/Abstract Full Text View citing articles Show Details
Fernandez, Sebastian P.; Karim, Nasiara; Mewett, Kenneth N.; Chebib, Mary; Johnston, Graham A.R.; Hanrahan, Jane R.
British Journal of Pharmacology, 2012 , vol. 165, # 4 p. 965 - 977 Title/Abstract Full Text View citing articles Show Details
Ochoa-De La Paz, Lenin D.; Estrada-Mondragon, Argel; Limon, Agenor; Miledi, Ricardo; Martinez-Torres, Ataulfo
ACS Chemical Neuroscience, 2012 , vol. 3, # 2 p. 96 - 104 Title/Abstract Full Text View citing articles Show Details
Bol'shakov, Oleg; Kovacs, Judit; Chahar, Mamta; Ha, Khanh; Khelashvili, Levan; Katritzky, Alan R.
Journal of Peptide Science, 2012 , vol. 18, # 11 p. 704 - 709
Title/Abstract Full Text View citing articles Show Details
Shen, Sida; Xu, Xingyu; Lei, Min; Hu, Lihong
Synthesis (Germany), 2012 , vol. 44, # 22 art. no. SS-2012-F0613-OP, p. 3543 - 3549 Title/Abstract Full Text View citing articles Show Details
Cardenal, Carmen; Vollrath, Sidonie B. L.; Schepers, Ute; Bräse, Stefan
Helvetica Chimica Acta, 2012 , vol. 95, # 11 p. 2237 - 2248 Title/Abstract Full Text View citing articles Show Details
Hibi, Shigeki; Ueno, Koshi; Nagato, Satoshi; Kawano, Koki; Ito, Koichi; Norimine, Yoshihiko; Takenaka, Osamu; Hanada, Takahisa; Yonaga, Masahiro
Journal of Medicinal Chemistry, 2012 , vol. 55, # 23 p. 10584 - 10600 Title/Abstract Full Text View citing articles Show Details
Sashidhara, Koneni V.; Palnati, Gopala Reddy; Dodda, Ranga Prasad; Avula, Srinivasa Rao; Swami, Priyanka
Synlett, 2013 , vol. 24, # 1 p. 105 - 113 Title/Abstract Full Text View citing articles Show Details
Falvo, Francesco; Fiebig, Lukas; Dreiocker, Frank; Wang, Ran; Armentrout; Schaefer, Mathias
International Journal of Mass Spectrometry, 2012 , vol. 330-332, p. 124 - 133 Title/Abstract Full Text View citing articles Show Details
Stavila; Loos
Tetrahedron Letters, 2013 , vol. 54, # 5 p. 370 - 372 Title/Abstract Full Text View citing articles Show Details
Gehrke, Sebastian S.; Pinto, Erika G.; Steverding, Dietmar; Pleban, Karin; Tempone, Andre G.; Hider, Robert C.; Wagner, Gerd K.
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 3 p. 805 - 813 Title/Abstract Full Text View citing articles Show Details
Waseda University
Patent: US8338643 B2, 2012 ; Title/Abstract Full Text Show Details
Steffen-Munsberg, Fabian; Vickers, Clare; Thontowi, Ahmad; Schaetzle, Sebastian; Tumlirsch, Tony; SvedendahlHumble, Maria; Land, Henrik; Berglund, Per; Bornscheuer, Uwe T.; Hoehne, Matthias
ChemCatChem, 2013 , vol. 5, # 1 p. 150 - 153 Title/Abstract Full Text View citing articles Show Details
Bansal; Sinha; Khosa
Medicinal Chemistry Research, 2013 , vol. 22, # 1 p. 134 - 146 Title/Abstract Full Text View citing articles Show Details
MOSKOWITZ, Michael; GOLDEN, Maria, Depolo; GORDON, Dana
Patent: WO2013/2749 A1, 2013 ; Title/Abstract Full Text Show Details
BAR-ILAN UNIVERSITY; Lellouche, Jean-Paul; Goldman, Diana
Patent: US2013/40049 A1, 2013 ; Title/Abstract Full Text Show Details
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Duval, Sylvain; Dumur, Frederic; Guenee, Laure; Marrot, Jerome; Simonnet-Jegat, Corine; Cadot, Emmanuel
European Journal of Inorganic Chemistry, 2013 , # 7 p. 1149 - 1156 Title/Abstract Full Text View citing articles Show Details
84 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Sindelar, Miriam; Lutz, Toni A.; Petrera, Marilena; Wanner, Klaus T.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 1323 - 1340 Title/Abstract Full Text View citing articles Show Details
Germain, Andrew R.; Carmody, Leigh C.; Nag, Partha P.; Morgan, Barbara; Verplank, Lynn; Fernandez, Cristina; Donckele, Etienne; Feng, Yuxiong; Perez, Jose R.; Dandapani, Sivaraman; Palmer, Michelle; Lander, Eric S.; Gupta, Piyush B.; Schreiber, Stuart L.; Munoz, Benito
Bioorganic and Medicinal Chemistry Letters, 2013 , vol. 23, # 6 p. 1834 - 1838 Title/Abstract Full Text View citing articles Show Details
Bruno, Michela; Trucchi, Beatrice; Burlando, Bruno; Ranzato, Elia; Martinotti, Simona; Akkol, Esra Kuepeli; Suentar, Ipek; Keles, Hikmet; Verotta, Luisella
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 7 p. 1834 - 1843 Title/Abstract Full Text View citing articles Show Details
Vogensen, Stine B.; Jorgensen, Lars; Madsen, Karsten K.; Borkar, Nrupa; Wellendorph, Petrine; Skovgaard-Petersen, Jonas; Schousboe, Arne; White, H. Steve; Krogsgaard-Larsen, Povl; Clausen, Rasmus P.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 5 p. 2160 - 2164 Title/Abstract Full Text View citing articles Show Details
Marzaro, Giovanni; Guiotto, Adriano; Borgatti, Monica; Finotti, Alessia; Gambari, Roberto; Breveglieri, Giulia; Chilin, Adriana
Journal of Medicinal Chemistry, 2013 , vol. 56, # 5 p. 1830 - 1842 Title/Abstract Full Text View citing articles Show Details
Kawakita, Youichi; Seto, Masaki; Ohashi, Tomohiro; Tamura, Toshiya; Yusa, Tadashi; Miki, Hiroshi; Iwata, Hidehisa; Kamiguchi, Hidenori; Tanaka, Toshimasa; Sogabe, Satoshi; Ohta, Yoshikazu; Ishikawa, Tomoyasu
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 8 p. 2250 - 2261 Title/Abstract Full Text View citing articles Show Details
Husain, Asif; Rashid, Mohd; Shaharyar; Siddiqui, Anees A.; Mishra, Ravinesh
European Journal of Medicinal Chemistry, 2013 , vol. 62, p. 785 - 798 Title/Abstract Full Text View citing articles Show Details
Koh, Minsoo; Lee, Jong-Cheol; Min, Changhee; Moon, Aree
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 8 p. 2305 - 2313 Title/Abstract Full Text View citing articles Show Details
Han, Changho; Salyer, Amy E.; Kim, Eun Hoo; Jiang, Xinyi; Jarrard, Rachel E.; Powers, Matthew S.; Kirchhoff, Aaron M.; Salvador, Tolani K.; Chester, Julia A.; Hockerman, Gregory H.; Colby, David A.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 6 p. 2456 - 2465 Title/Abstract Full Text View citing articles Show Details
Goud, N. Rajesh; Suresh, Kuthuru; Nangia, Ashwini
Crystal Growth and Design, 2013 , vol. 13, # 4 p. 1590 - 1601 Title/Abstract Full Text View citing articles Show Details
Veselovskaya; Shilin; Khilya
Chemistry of Natural Compounds, 2012 , vol. 48, # 5 p. 757 - 760 Khim. Prir. Soedin., 2012 , vol. 48, # 5 p. 679 - 681,3 Title/Abstract Full Text View citing articles Show Details
Luo, Shi-He; Xiong, Jin-Feng; Wang, Zhao-Yang; Mo, Guang-Zhen
Research on Chemical Intermediates, 2013 , vol. 39, # 4 p. 1865 - 1876 Title/Abstract Full Text View citing articles Show Details
Gavande, Navnath; Kim, Hye-Lim; Doddareddy, Munikumar R.; Johnston, Graham A. R.; Chebib, Mary; Hanrahan, Jane R.
ACS Medicinal Chemistry Letters, 2013 , vol. 4, # 4 p. 402 - 407 Title/Abstract Full Text View citing articles Show Details
Nunes, Andreia; Marques, Sérgio M.; Quintanova, Catarina; Silva, Diana F.; Cardoso, Sandra M.; Chaves, Sílvia; Santos, M. Amélia
Dalton Transactions, 2013 , vol. 42, # 17 p. 6058 - 6073 Title/Abstract Full Text View citing articles Show Details
Raster, Peter; Spaeth, Andreas; Bultakova, Svetlana; Gorostiza, Pau; Koenig, Burkhard; Bregestovski, Piotr
Beilstein Journal of Organic Chemistry, 2013 , vol. 9, p. 406 - 410 Title/Abstract Full Text View citing articles Show Details
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Veinberg, Grigory; Vorona, Maxim; Zvejniece, Liga; Vilskersts, Reinis; Vavers, Edijs; Liepinsh, Edvards; Kazoka, Helena; Belyakov, Sergey; Mishnev, Anatoly; Kuznecovs, Jevgenijs; Vikainis, Sergejs; Orlova, Natalja; Lebedev, Anton; Ponomaryov, Yuri; Dambrova, Maija
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 10 p. 2764 - 2771 Title/Abstract Full Text View citing articles Show Details
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Elsegood, Mark R. J.; Noble, Thomas A.; Talib, Salem; Smith, Martin B.
Phosphorus, Sulfur and Silicon and the Related Elements, 2013 , vol. 188, # 1-3 p. 121 - 127 Title/Abstract Full Text View citing articles Show Details
Xie, Yuanchao; Huang, Bing; Yu, Kexiang; Shi, Fangyuan; Xu, Wenfang
Medicinal Chemistry Research, 2013 , vol. 22, # 7 p. 3485 - 3496 Title/Abstract Full Text View citing articles Show Details
85 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Locock, Katherine E. S.; Yamamoto, Izumi; Tran, Priscilla; Hanrahan, Jane R.; Chebib, Mary; Johnston, Graham A. R.; Allan, Robin D.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 13 p. 5626 - 5630 Title/Abstract Full Text View citing articles Show Details
Lenin, Racha; Raju, Rallabandi Madusudan; Rao, Divvela V. N. Srinivasa; Ray, Uttam Kumar
Medicinal Chemistry Research, 2013 , vol. 22, # 4 p. 1624 - 1629 Title/Abstract Full Text View citing articles Show Details
Keri, Rangappa S.; Quintanova, Catarina; Marques, Sergio M.; Esteves, A. Raquel; Cardoso, Sandra M.; Santos, M. Amelia
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 15 p. 4559 - 4569 Title/Abstract Full Text View citing articles Show Details
Luo, Shi-He; Wang, Qun-Fang; Wang, Zhao-Yang; Peng, Pai
Research on Chemical Intermediates, 2013 , vol. 39, # 6 p. 2513 - 2526 Title/Abstract Full Text View citing articles Show Details
Khilya; Milokhov; Postupalenko, V. Yu.; Turov; Volovenko
Monatshefte fur Chemie, 2013 , vol. 144, # 7 p. 1071 - 1079 Title/Abstract Full Text View citing articles Show Details
Liu, Pingyang; Torrens-Spence, Michael P.; Ding, Haizhen; Christensen, Bruce M.; Li, Jianyong
Amino Acids, 2013 , vol. 44, # 2 p. 391 - 404 Title/Abstract Full Text View citing articles Show Details
Cornish; Geake; Barth
Biochemical pharmacology, 1965 , vol. 14, # 12 p. 1901 - 1904 Title/Abstract Full Text Show Details
Valzelli; Giacalone; Garattini
European journal of pharmacology, 1967 , vol. 2, # 2 p. 144 - 146 Title/Abstract Full Text Show Details
Stewart, Deirdre S.; Hotta, Mayo; Desai, Rooma; Forman, Stuart A.
Molecular Pharmacology, 2013 , vol. 83, # 6 p. 1200 - 1208 Title/Abstract Full Text View citing articles Show Details
Zukin; Young; Snyder
Proceedings of the National Academy of Sciences of the United States of America, 1974 , vol. 71, # 12 p. 4802 - 4807 Title/Abstract Full Text View citing articles Show Details
Young; Snyder
Molecular Pharmacology, 1974 , vol. 10, # 5 p. 790 - 809 Title/Abstract Full Text View citing articles Show Details
Simon; Contrera; Kuhar
Journal of neurochemistry, 1976 , vol. 26, # 1 p. 141 - 147 Title/Abstract Full Text Show Details
Olsen; Lee; Ban
Molecular Pharmacology, 1975 , vol. 11, # 5 p. 566 - 577 Title/Abstract Full Text View citing articles Show Details
Enna; Snyder
Brain Research, 1975 , vol. 100, # 1 p. 81 - 97 Title/Abstract Full Text Show Details
Alexander; Davis; Lefkowitz
Nature, 1975 , vol. 258, # 5534 p. 437 - 440
Title/Abstract Full Text Show Details
Bennett Jr; Snyder
Molecular Pharmacology, 1976 , vol. 12, # 3 p. 373 - 389 Title/Abstract Full Text View citing articles Show Details
Greenberg; U'Prichard; Snyder
Life Sciences, 1976 , vol. 19, # 1 p. 69 - 76 Title/Abstract Full Text Show Details
Ticku; Ban; Olsen
Molecular pharmacology, 1978 , vol. 14, # 3 p. 391 - 402 Title/Abstract Full Text Show Details
Hyttel
Biochemical pharmacology, 1978 , vol. 27, # 7 p. 1063 - 1068 Title/Abstract Full Text Show Details
Krogsgaard-Larsen; Johnston
Journal of Neurochemistry, 1978 , vol. 30, # 6 p. 1377 - 1382 Title/Abstract Full Text Show Details
86 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Speth; Wastek; Johnson; Yamamura
Life Sciences, 1978 , vol. 22, # 10 p. 859 - 866 Title/Abstract Full Text Show Details
Mohler; Okada; Heitz Ph.; Ulrich
Life Sciences, 1978 , vol. 22, # 11 p. 985 - 996 Title/Abstract Full Text Show Details
Olsen; Ticku; Miller
Molecular Pharmacology, 1978 , vol. 14, # 3 p. 381 - 390 Title/Abstract Full Text View citing articles Show Details
Leysen; Gommeren; Laduron
Biochemical Pharmacology, 1978 , vol. 27, # 3 p. 307 - 316 Title/Abstract Full Text Show Details
Pizzo; Fontana; Coutinho-Netto; dos Santos
Journal of biochemical and molecular toxicology, 2000 , vol. 14, # 2 p. 88 - 94 Title/Abstract Full Text Show Details
Serkov; Chugunova; Burilov; Bachurin
Doklady Chemistry, 2013 , vol. 450, # 2 p. 149 - 151 Dokl. Akad. Nauk, 2013 , vol. 450, # 4 p. 417 - 419,3 Title/Abstract Full Text View citing articles Show Details
CATALYST PHARMACEUTICAL PARTNERS; NEW YORK UNIVERSITY; THE FEINSTEIN INSTITUTE FOR MEDICAL RESEARCH; MILLER, Steven; BRODIE, Jonathan, D.; DEWEY, Stephen
Patent: WO2013/112363 A1, 2013 ; Title/Abstract Full Text Show Details
LEIBNIZ-INSTITUT FUR PFLANZENBIOCHEMIE; Wessjohann, Ludger A.; Henze, Michael; Kreye, Oliver; Rivera, Daniel Garcia
Patent: US2013/203960 A1, 2013 ; Title/Abstract Full Text Show Details
He, Bosai; Bi, Kaishun; Jia, Ying; Wang, Jiahong; Lv, Chunxiao; Liu, Ran; Zhao, Longshan; Xu, Huarong; Chen, Xiaohui; Li, Qing
Journal of Mass Spectrometry, 2013 , vol. 48, # 8 p. 969 - 978 Title/Abstract Full Text View citing articles Show Details
Wang, Yang; Zhao, Fei; Zhou, Yi; Chi, Yue; Wang, Zitao; Zhang, Wen-Xiong; Xi, Zhenfeng
Chemistry - A European Journal, 2013 , vol. 19, # 32 p. 10643 - 10654 Title/Abstract Full Text View citing articles Show Details
Ballatore, Carlo; Huryn, Donna M.; Smith III, Amos B.
ChemMedChem, 2013 , vol. 8, # 3 p. 385 - 395 Title/Abstract Full Text View citing articles Show Details
Piqueras, Laura; Martinez, Vicente
British Journal of Pharmacology, 2004 , vol. 142, # 6 p. 1038 - 1048 Title/Abstract Full Text View citing articles Show Details
May; Fleischer; Kletke; Haas; Sergeeva
British Journal of Pharmacology, 2013 , vol. 170, # 1 p. 222 - 232 Title/Abstract Full Text View citing articles Show Details
Kniazeff, Julie; Saintot, Pierre-Philippe; Goudet, Cyril; Liu, Jianfeng; Charnet, Annie; Guillon, Gilles; Pin, Jean-Philippe
Journal of Neuroscience, 2004 , vol. 24, # 2 p. 370 - 377 Title/Abstract Full Text View citing articles Show Details
Wu, Shu-Pei; Shyu, Ming-Kwang; Liou, Horng-Huei; Gau, Churn-Shiouh; Lin, Chun-Jung
Epilepsia, 2004 , vol. 45, # 3 p. 204 - 210 Title/Abstract Full Text View citing articles Show Details
Liu, Jianfeng; Maurel, Damien; Etzol, Sebastien; Brabet, Isabelle; Ansanay, Herve; Pin, Jean-Philippe; Rondard, Philippe
Journal of Biological Chemistry, 2004 , vol. 279, # 16 p. 15824 - 15830 Title/Abstract Full Text View citing articles Show Details
Shinohara, Tokuyuki; Harada, Masataka; Ogi, Kazuhiro; Maruyama, Minoru; Fujii, Ryo; Tanaka, Hideyuki; Fukusumi, Shoji; Komatsu, Hidetoshi; Hosoya, Masaki; Noguchi, Yuko; Watanabe, Takuya; Moriya, Takeo; Itoh, Yasuaki; Hinuma, Shuji
Journal of Biological Chemistry, 2004 , vol. 279, # 22 p. 23559 - 23564 Title/Abstract Full Text View citing articles Show Details
Newell, J Glen; Czajkowski, Cynthia
The Journal of biological chemistry, 2003 , vol. 278, # 15 p. 13166 - 13172 Title/Abstract Full Text Show Details
Sarup, Alan; Larsson, Orla Miller; Schousboe, Arne
Current drug targets. CNS and neurological disorders, 2003 , vol. 2, # 4 p. 269 - 277 Title/Abstract Full Text View citing articles Show Details
Aoki, Hideyuki; Furuya, Yuji; Endo, Yasushi; Fujimoto, Kenshiro
Bioscience, biotechnology, and biochemistry, 2003 , vol. 67, # 8 p. 1806 - 1808 Title/Abstract Full Text Show Details
87 of 992
88 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Torres, Viviana I.; Weiss, David S.
Journal of Biological Chemistry, 2002 , vol. 277, # 46 p. 43741 - 43748 Title/Abstract Full Text View citing articles Show Details
Kash, Thomas L.; Jenkins, Andrew; Harrison, Neil L.
Brain Research, 2003 , vol. 960, # 1-2 p. 36 - 41 Title/Abstract Full Text View citing articles Show Details
Vale; Fonfria; Bujons; Messeguer; Rodriguez-Farre; Sunol
Neuroscience, 2003 , vol. 117, # 2 p. 397 - 403 Title/Abstract Full Text View citing articles Show Details
Dibas, Mohammed I.; Gonzales, Eric B.; Das, Paromita; Bell-Horner, Cathy L.; Dillon, Glenn H.
Journal of Biological Chemistry, 2002 , vol. 277, # 11 p. 9112 - 9117 Title/Abstract Full Text View citing articles Show Details
Boileau, Andrew J.; Glen Newell; Czajkowski, Cynthia
Journal of Biological Chemistry, 2002 , vol. 277, # 4 p. 2931 - 2937 Title/Abstract Full Text View citing articles Show Details
Maus, Marion; Glowinski, Jacques; Premont, Joel
Journal of Neurochemistry, 2002 , vol. 82, # 4 p. 763 - 773 Title/Abstract Full Text View citing articles Show Details
Jenkins, Andrew; Andreasen, Alyson; Trudell, James R.; Harrison, Neil L.
Neuropharmacology, 2002 , vol. 43, # 4 p. 669 - 678 Title/Abstract Full Text View citing articles Show Details
Bera, Amal K.; Chatav, Maya; Akabas, Myles H.
Journal of Biological Chemistry, 2002 , vol. 277, # 45 p. 43002 - 43010 Title/Abstract Full Text View citing articles Show Details
Frolund, Bente; Ebert, Bjarke; Kristiansen, Uffe; Liljefors, Tommy; Krogsgaard-Larsen, Povl
Current topics in medicinal chemistry, 2002 , vol. 2, # 8 p. 817 - 832 Title/Abstract Full Text View citing articles Show Details
Krasowski; Nishikawa; Nikolaeva; Lin; Harrison
Neuropharmacology, 2001 , vol. 41, # 8 p. 952 - 964 Title/Abstract Full Text View citing articles Show Details
Vien, Jimmy; Duke, Rujee K.; Mewett, Kenneth N.; Johnston, Graham A.R.; Shingai, Ryuzo; Chebib, Mary
British Journal of Pharmacology, 2002 , vol. 135, # 4 p. 883 - 890 Title/Abstract Full Text View citing articles Show Details
Ratra, Gurpreet S.; Erkkila, Brian E.; Weiss, David S.; Casida, John E.
Toxicology Letters, 2002 , vol. 129, # 1-2 p. 47 - 53 Title/Abstract Full Text View citing articles Show Details
Kelly; Smith; Banks; Wingrove; Whiting; Atack; Seabrook; Maubach
British Journal of Pharmacology, 2002 , vol. 135, # 1 p. 248 - 256 Title/Abstract Full Text View citing articles Show Details
Davies, Martin; Newell, J. Glen; Dunn, Susan M. J.
Journal of Neurochemistry, 2001 , vol. 79, # 1 p. 55 - 62 Title/Abstract Full Text View citing articles Show Details
Chebib, Mary; Duke, Rujee K.; Allan, Robin D.; Johnston, Graham A.R.
European Journal of Pharmacology, 2001 , vol. 430, # 2-3 p. 185 - 192 Title/Abstract Full Text View citing articles Show Details
Yamaguchi, Hiroaki; Yano, Ikuko; Saito, Hideyuki; Inui, Ken-ichi
European Journal of Pharmacology, 2001 , vol. 431, # 3 p. 297 - 303 Title/Abstract Full Text View citing articles Show Details
Kristev, Atanas D.; Getova, Damianka P.; Spassov, Vassil A.; Turiiski, Valentin I.
European Journal of Pharmacology, 2001 , vol. 431, # 3 p. 339 - 344 Title/Abstract Full Text View citing articles Show Details
Miyasaka; Kaminogawa; Shimizu; Hisatsune; Reinach; Miyamoto
Protein expression and purification, 2001 , vol. 23, # 3 p. 389 - 397 Title/Abstract Full Text Show Details
Frolund; Kristiansen; Brehm; Hansen; Krogsgaard-Larsen; Falch
Journal of medicinal chemistry, 1995 , vol. 38, # 17 p. 3287 - 3296 Title/Abstract Full Text Show Details
Galvez, Thierry; Prezeau, Laurent; Milioti, Gerald; Franek, Miloslav; Joly, Cecile; Froestl, Wolfgang; Bettler, Bernhard; Bertrand, HuguesOlivier; Blahos, Jaroslav; Pin, Jean-Philippe
Journal of Biological Chemistry, 2000 , vol. 275, # 52 p. 41166 - 41174 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Gervasini; Martinez; Agundez; Garcia-Gamito; Benitez
Pharmacogenetics, 2001 , vol. 11, # 1 p. 29 - 37 Title/Abstract Full Text View citing articles Show Details
Anna Casula; Bromidge, Frances A.; Pillai, Gopalan V.; Wingrove, Peter B.; Martin, Karine; Maubach, Karen; Seabrook, Guy R.; Whiting, Paul J.; Hadingham, Karen L.
Journal of Neurochemistry, 2001 , vol. 77, # 2 p. 445 - 451 Title/Abstract Full Text View citing articles Show Details
Galvez, Thierry; Duthey, Beatrice; Kniazeff, Julie; Blahos, Jaroslav; Rovelli, Giorgio; Bettler, Bernhard; Prezeau, Laurent; Pin, Jean-Philippe
EMBO Journal, 2001 , vol. 20, # 9 p. 2152 - 2159 Title/Abstract Full Text View citing articles Show Details
Mohammadi, Bahram; Haeseler, Gertrud; Leuwer, Martin; Dengler, Reinhard; Krampfl, Klaus; Bufler, Johannes
European Journal of Pharmacology, 2001 , vol. 421, # 2 p. 85 - 91 Title/Abstract Full Text View citing articles Show Details
Buhr; Wagner; Fuchs; Sieghart; Sigel
The Journal of biological chemistry, 2001 , vol. 276, # 11 p. 7775 - 7781 Title/Abstract Full Text Show Details
Armer, Richard E.
Current Medicinal Chemistry, 2000 , vol. 7, # 2 p. 199 - 209 Title/Abstract Full Text View citing articles Show Details
Hartvig, Line; Luekensmejer, Birthe; Liljefors, Tommy; Dekermendjian, Kim
Journal of Neurochemistry, 2000 , vol. 75, # 4 p. 1746 - 1753 Title/Abstract Full Text View citing articles Show Details
O'Shea, Sean M.; Harrison, Neil L.
Journal of Biological Chemistry, 2000 , vol. 275, # 30 p. 22764 - 22768 Title/Abstract Full Text View citing articles Show Details
Soudijn; Van Wijngaarden
Current Medicinal Chemistry, 2000 , vol. 7, # 10 p. 1063 - 1079 Title/Abstract Full Text View citing articles Show Details
Newell, J. Glen; Davies, Martin; Bateson, Alan N.; Dunn, Susan M. J.
Journal of Biological Chemistry, 2000 , vol. 275, # 19 p. 14198 - 14204 Title/Abstract Full Text View citing articles Show Details
Cordato; Chebib; Mather; Herkes; Johnston
British Journal of Pharmacology, 1999 , vol. 128, # 1 p. 77 - 82 Title/Abstract Full Text View citing articles Show Details
Scaglia, Fernando; Wang, Yuhuan; Longo, Nicola
Archives of Biochemistry and Biophysics, 1999 , vol. 364, # 1 p. 99 - 106 Title/Abstract Full Text View citing articles Show Details
Chang, Yongchang; Weiss, David S.
Biophysical Journal, 1999 , vol. 77, # 5 p. 2542 - 2551 Title/Abstract Full Text View citing articles Show Details
Speca, David J.; Lin, David M; Sorensen, Peter W.; Isacoff, Ehud Y.; Ngai, John; Dittman, Andrew H.
Neuron, 1999 , vol. 23, # 3 p. 487 - 498 Title/Abstract Full Text View citing articles Show Details
Perret, Philippe; Sarda, Xavier; Wolff, Mark; Wu, Tai-Teh; Bushey, Dean; Goeldner, Maurice
Journal of Biological Chemistry, 1999 , vol. 274, # 36 p. 25350 - 25354 Title/Abstract Full Text View citing articles Show Details
Meza-Toledo; Martinez-Munoz; Carvajal-Sandoval
Arzneimittel-Forschung, 1998 , vol. 48, # 11 p. 1051 - 1057 Title/Abstract Full Text Show Details
Rothlin, Carla V.; Katz, Eleonora; Verbitsky, Miguel; Belen Elgoyhen
Molecular Pharmacology, 1999 , vol. 55, # 2 p. 248 - 254 Title/Abstract Full Text View citing articles Show Details
Zhao, Tai-Jun; Li, Ming; Chiu, Ted H.; Rosenberg, Howard C.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 287, # 2 p. 752 - 759 Title/Abstract Full Text View citing articles Show Details
Ueno, Susumu; Wick, Marilee J.; Ye, Qing; Harrison, Neil L.; Harris, R. Adron
British Journal of Pharmacology, 1999 , vol. 127, # 2 p. 377 - 382 Title/Abstract Full Text View citing articles Show Details
Chebib, Mary; Mewett, Kenneth N.; Johnston, Graham A.r.
European Journal of Pharmacology, 1998 , vol. 357, # 2-3 p. 227 - 234 Title/Abstract Full Text View citing articles Show Details
89 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Hawkinson; Acosta-Burruel; Yang; Hogenkamp; Chen; Lan; Drewe; Whittemore; Woodward; Carter; Upasani
The Journal of pharmacology and experimental therapeutics, 1998 , vol. 287, # 1 p. 198 - 207 Title/Abstract Full Text Show Details
Belelli; Lambert; Peters; Wafford; Whiting
Proceedings of the National Academy of Sciences of the United States of America, 1997 , vol. 94, # 20 p. 11031 - 11036 Title/Abstract Full Text View citing articles Show Details
Fisher; Zhang; Macdonald
Molecular pharmacology, 1997 , vol. 52, # 4 p. 714 - 724 Title/Abstract Full Text Show Details
Moriyoshi; Masu; Ishii; Shigemoto; Mizuno; Nakanishi
Nature, 1991 , vol. 354, # 6348 p. 31 - 37 Title/Abstract Full Text Show Details
Shi, Dan; Padgett, William L.; Hutchinson, Kira D.; Moore, Stacey P.; Daly, John W.
Drug Development Research, 1997 , vol. 42, # 1 p. 41 - 56 Title/Abstract Full Text View citing articles Show Details
Chapell, Richard; Martin, Joseph; MacHu, Tina K.; Leidenheimer, Nancy J.
European Journal of Pharmacology, 1998 , vol. 349, # 1 p. 115 - 121 Title/Abstract Full Text View citing articles Show Details
Benson, Jack A.; Loew, Karin; Keist, Ruth; Mohler, Hanns; Rudolph, Uwe
FEBS Letters, 1998 , vol. 431, # 3 p. 400 - 404 Title/Abstract Full Text View citing articles Show Details
Belelli; Lambert; Peters; Gee; Lan
Neuropharmacology, 1996 , vol. 35, # 9-10 p. 1223 - 1231 Title/Abstract Full Text View citing articles Show Details
Frizler, Maxim; Yampolsky, Ilia V.; Baranov, Mikhail S.; Stirnberg, Marit; Gütschow, Michael
Organic and Biomolecular Chemistry, 2013 , vol. 11, # 35 p. 5913 - 5921 Title/Abstract Full Text View citing articles Show Details
Filevich, Oscar; Etchenique, Roberto
Photochemical and Photobiological Sciences, 2013 , vol. 12, # 9 p. 1565 - 1570 Title/Abstract Full Text View citing articles Show Details
Masonis; McCarthy
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 1 p. 186 - 193 Title/Abstract Full Text Show Details
Menniti, Frank; Chenard, Bertrand; Collins, Mary; Ducat, Mary; Shalaby, Ismail; White, Frost
European Journal of Pharmacology, 1997 , vol. 331, # 2-3 p. 117 - 126 Title/Abstract Full Text View citing articles Show Details
Brown, Maria J.; Wood, Martyn D.; Coldwell, Martyn C.; Bristow, David R.
British Journal of Pharmacology, 1997 , vol. 121, # 1 p. 71 - 76 Title/Abstract Full Text View citing articles Show Details
Buhr, Andreas; Baur, Roland; Sigel, Erwin
Journal of Biological Chemistry, 1997 , vol. 272, # 18 p. 11799 - 11804 Title/Abstract Full Text View citing articles Show Details
Varro; Athanassopolous; Dockray
Experimental physiology, 1996 , vol. 81, # 1 p. 151 - 154 Title/Abstract Full Text Show Details
Baron; Siegel; Harrison; Gross; Hawes; Towers
The Journal of pharmacology and experimental therapeutics, 1996 , vol. 279, # 1 p. 62 - 68 Title/Abstract Full Text Show Details
Ichida, Tatsuya; Takeda, Kazuo; Sasaki, Susumu; Nakagawa, Masao; Hashimoto, Tsuneichi; Kuriyama, Kinya
Life Sciences, 1996 , vol. 58, # 3 p. 209 - 215 Title/Abstract Full Text View citing articles Show Details
Tamai; Senmaru; Terasaki; Tsuji
Biochemical Pharmacology, 1995 , vol. 50, # 11 p. 1783 - 1793 Title/Abstract Full Text Show Details
Wang, Tian-Li; Hackam, Abigail S.; Guggino, William B.; Cuttining, Garry R.
Proceedings of the National Academy of Sciences of the United States of America, 1995 , vol. 92, # 25 p. 11751 - 11755 Title/Abstract Full Text View citing articles Show Details
Frydenvang, Karla; Kristiansen, Uffe; Frolund, Bente; Herdeis, Claus; Krogsgaard-Larsen, Povl
Chirality, 1995 , vol. 7, # 7 p. 526 - 533 Title/Abstract Full Text View citing articles Show Details
90 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Takebayashi; Kagaya; Hayashi; Motohashi; Yamawaki
European Journal of Pharmacology, 1996 , vol. 297, # 1-2 p. 137 - 143 Title/Abstract Full Text Show Details
Saxena; Macdonald
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 567 - 579 Title/Abstract Full Text Show Details
Ghiani; Tuligi; Maciocco; Serra; Sanna; Biggio
Biochemical Pharmacology, 1996 , vol. 51, # 11 p. 1527 - 1534 Title/Abstract Full Text Show Details
Zezula; Slany; Sieghart
European Journal of Pharmacology, 1996 , vol. 301, # 1-3 p. 207 - 214 Title/Abstract Full Text Show Details
Maksay; Molnar; Gruber
European Journal of Pharmacology - Molecular Pharmacology Section, 1994 , vol. 288, # 1 p. 61 - 68 Title/Abstract Full Text Show Details
Feigenspan; Bormann
European Journal of Pharmacology - Molecular Pharmacology Section, 1994 , vol. 288, # 1 p. 97 - 104 Title/Abstract Full Text Show Details
Dimpfel; Chatterjee; Noldner; Ticku
Epilepsia, 1995 , vol. 36, # 10 p. 983 - 989 Title/Abstract Full Text View citing articles Show Details
Chowdhury; Kawashima; Konishi; Niwa; Matsunami
European Journal of Pharmacology, 1995 , vol. 285, # 1 p. 99 - 102 Title/Abstract Full Text Show Details
Huh; Delorey; Endo; Olsen
Molecular Pharmacology, 1995 , vol. 48, # 4 p. 666 - 675 Title/Abstract Full Text Show Details
Noyer; Gillard; Matagne; Henichart; Wulfert
European Journal of Pharmacology, 1995 , vol. 286, # 2 p. 137 - 146 Title/Abstract Full Text Show Details
Ducic; Caruncho; Wei Jian Zhu; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Mergl, Zsuzsanna; Acs, Zsuzsanna; Makara
Life Sciences, 1995 , vol. 56, # 8 p. 579 - 585 Title/Abstract Full Text Show Details
Petegnief, Valerie; Lleu, Pierre-Louis; Gupta, Ramesh C.; Bourguignon, Jean-Jacques; Rebel, Gerard
Biochemical Pharmacology, 1995 , vol. 49, # 3 p. 399 - 410 Title/Abstract Full Text Show Details
Cole, Loretta M.; Roush, Richard T.; Casida, John E.
Life Sciences, 1995 , vol. 56, # 10 p. 757 - 765 Title/Abstract Full Text Show Details
Pierobon, Paola; Concas, Alessandra; Santoro, Giovanna; Marino, Giuseppe; Minei, Rosario; Pannaccione, Anna; Mostallino, Maria Cristina; Biggio, Giovanni
Life Sciences, 1995 , vol. 56, # 18 p. 1485 - 1497 Title/Abstract Full Text Show Details
Fleischmann; Makman; Etgen
Life Sciences, 1995 , vol. 56, # 20 p. 1665 - 1678 Title/Abstract Full Text Show Details
Sanna; Garau; Harris
Molecular Pharmacology, 1995 , vol. 47, # 2 p. 213 - 217 Title/Abstract Full Text Show Details
Korpi; Kuner; Seeburg; Luddens
Molecular Pharmacology, 1995 , vol. 47, # 2 p. 283 - 289 Title/Abstract Full Text View citing articles Show Details
Hauser; Chesnoy-Marchais; Robel; Baulieu
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 289, # 2 p. 249 - 257 Title/Abstract Full Text Show Details
Quirk; Whiting; Ragan; McKernan
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 290, # 3 p. 175 - 181 Title/Abstract Full Text Show Details
91 of 992
92 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 211 Title/Abstract Full Text Show Details
Jones; Harrison; Pritchett; Hales
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 2 p. 962 - 968 Title/Abstract Full Text View citing articles Show Details
Klunk, William E.; Debnath, Manik L.; McClure, Richard J.; Pettegrew, Jay W.
Life Sciences, 1995 , vol. 56, # 26 p. 2377 - 2383 Title/Abstract Full Text Show Details
Kokate; Svensson; Rogawski
Journal of Pharmacology and Experimental Therapeutics, 1994 , vol. 270, # 3 p. 1223 - 1229 Title/Abstract Full Text View citing articles Show Details
Peterson; Xu; Holland; McKeon; Rothman; Ferrendelli; Covey
Journal of Medicinal Chemistry, 1994 , vol. 37, # 2 p. 275 - 286 Title/Abstract Full Text Show Details
Amin, Jahanshah; Dickerson, Ian M.; Weiss, David S.
Molecular Pharmacology, 1994 , vol. 45, # 2 p. 317 - 323 Title/Abstract Full Text View citing articles Show Details
Krogsgaard-Larsen; Frolund; Jorgensen; Schousboe
Journal of medicinal chemistry, 1994 , vol. 37, # 16 p. 2489 - 2505 Title/Abstract Full Text View citing articles Show Details
Shannon; Bymaster; Calligaro; Greenwood; Mitch; Sawyer; Ward; Wong; Olesen; Sheardown; Swedberg; Suzdak; Sauerberg
Journal of Pharmacology and Experimental Therapeutics, 1994 , vol. 269, # 1 p. 271 - 281 Title/Abstract Full Text View citing articles Show Details
Amin; Weiss
Nature, 1993 , vol. 366, # 6455 p. 565 - 569 Title/Abstract Full Text Show Details
Nock; Giordano; Moore; Cicero
Journal of Pharmacology and Experimental Therapeutics, 1993 , vol. 264, # 1 p. 349 - 359 Title/Abstract Full Text View citing articles Show Details
Wafford; Whiting; Kemp
Molecular Pharmacology, 1993 , vol. 43, # 2 p. 240 - 244 Title/Abstract Full Text Show Details
Howson; Mistry; Broekman; Hills
Bioorganic and Medicinal Chemistry Letters, 1993 , vol. 3, # 4 p. 515 - 518 Title/Abstract Full Text Show Details
Woodward; Polenzani; Miledi
Molecular Pharmacology, 1993 , vol. 43, # 4 p. 609 - 625 Title/Abstract Full Text Show Details
Sweetnam; Caldwell; Lancaster; Bauer Jnr.; McMillan; Kinnier; Price
Journal of Natural Products (Lloydia), 1993 , vol. 56, # 4 p. 441 - 455 Title/Abstract Full Text Show Details
Wafford; Bain; Whiting; Kemp
Molecular Pharmacology, 1993 , vol. 44, # 2 p. 437 - 442 Title/Abstract Full Text Show Details
Horne; Hadingham; Macaulay; Whiting; Kemp
British journal of pharmacology, 1992 , vol. 107, # 3 p. 732 - 737 Title/Abstract Full Text Show Details
Suman-Chauhan; Webdale; Hill; Woodruff
European journal of pharmacology, 1993 , vol. 244, # 3 p. 293 - 301 Title/Abstract Full Text Show Details
Pavia; Lobbestael; Nugiel; Mayhugh; Gregor; Taylor; Schwarz; Brahce; Vartanian
Journal of Medicinal Chemistry, 1992 , vol. 35, # 22 p. 4238 - 4248 Title/Abstract Full Text Show Details
Nudelman; Ruse; Aviram; Rabizadeh; Shaklai; Zimrah; Rephaeli
Journal of Medicinal Chemistry, 1992 , vol. 35, # 4 p. 687 - 694 Title/Abstract Full Text Show Details
Hadingham; Harkness; McKernan; Quirk; Le Bourdelles; Horne; Kemp; Barnard; Ragan; Whiting
Proceedings of the National Academy of Sciences of the United States of America, 1992 , vol. 89, # 14 p. 6378 - 6382 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Huang; Dredar; Manneh; Blankenship; Fries
Journal of Medicinal Chemistry, 1992 , vol. 35, # 13 p. 2414 - 2418 Title/Abstract Full Text Show Details
Kehne; Kane; Miller; Ketteler; Braun; Senyah; Chaney; Abdallah; Dudley; Ogden; Palfreyman
British Journal of Pharmacology, 1992 , vol. 106, # 4 p. 910 - 916 Title/Abstract Full Text View citing articles Show Details
De Amici; Frolund; Hjeds; Krogsgaard-Larsen
European Journal of Medicinal Chemistry, 1991 , vol. 26, # 6 p. 625 - 631 Title/Abstract Full Text Show Details
Kristiansen; Fjalland
Pharmacology and Toxicology, 1991 , vol. 68, # 5 p. 332 - 339 Title/Abstract Full Text View citing articles Show Details
Nielsen; Brehm; Krogsgaard-Larsen
Journal of Medicinal Chemistry, 1990 , vol. 33, # 1 p. 71 - 77 Title/Abstract Full Text Show Details
Yamasaki; Goto
Japanese Journal of Pharmacology, 1990 , vol. 52, # 2 p. 255 - 262 Title/Abstract Full Text View citing articles Show Details
Holland; Mckeon; Covey; Ferrendelli
Journal of Pharmacology and Experimental Therapeutics, 1990 , vol. 254, # 2 p. 578 - 583 Title/Abstract Full Text View citing articles Show Details
Leader; Koe; Weissman
Journal of clinical pharmacology, 1981 , vol. 21, # 8-9 Suppl p. 262S-270S Title/Abstract Full Text View citing articles Show Details
Nelson; Thomas
Biochemical pharmacology, 1989 , vol. 38, # 10 p. 1693 - 1695 Title/Abstract Full Text Show Details
Snell; Morter; Johnson
European Journal of Pharmacology, 1988 , vol. 156, # 1 p. 105 - 110 Title/Abstract Full Text Show Details
Barnes; Costall; Naylor
Journal of Pharmacy and Pharmacology, 1988 , vol. 40, # 8 p. 548 - 551 Title/Abstract Full Text View citing articles Show Details
Holden-Dye; Walker
British Journal of Pharmacology, 1988 , vol. 95, # 1 p. 3 - 5 Title/Abstract Full Text View citing articles Show Details
Wermuth; Chambon; Heaulme; Melikian; Schlewer; Leyris; Biziere
European Journal of Pharmacology, 1987 , vol. 144, # 3 p. 375 - 378 Title/Abstract Full Text Show Details
Lapuyade; Schlewer; N'Goka; Vernieres; Chambon; Lagrange; Wermuth
European Journal of Medicinal Chemistry, 1987 , vol. 22, # 5 p. 383 - 391 Title/Abstract Full Text Show Details
Van Der Weide; De Vries; Tepper; Horn
European Journal of Pharmacology, 1987 , vol. 134, # 2 p. 211 - 219 Title/Abstract Full Text Show Details
Torrens; Beaujouan; Saffroy; Daguet de Montety; Bergstroem; Glowinski
Proceedings of the National Academy of Sciences of the United States of America, 1986 , vol. 83, # 23 p. 9216 - 9220 Title/Abstract Full Text View citing articles Show Details
Murphy; Schneider; Boehm; Lehmann; Williams
The Journal of pharmacology and experimental therapeutics, 1987 , vol. 240, # 3 p. 778 - 784 Title/Abstract Full Text Show Details
Heaulme; Chambon; Leyris; Wermuth; Biziere
Journal of neurochemistry, 1987 , vol. 48, # 6 p. 1677 - 1686 Title/Abstract Full Text Show Details
McCormack; Beitz; Larson
Journal of Neuroscience, 1986 , vol. 6, # 1 p. 94 - 101 Title/Abstract Full Text View citing articles Show Details
Witiak; Patch; Enna; Fung
Journal of Medicinal Chemistry, 1986 , vol. 29, # 1 p. 1 - 8 Title/Abstract Full Text View citing articles Show Details
93 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Spencer; Lynch; Bliss
Journal of Pharmacy and Pharmacology, 1986 , vol. 38, # 5 p. 393 - 395 Title/Abstract Full Text View citing articles Show Details
Nilvebrant; Sparf
European Journal of Pharmacology, 1986 , vol. 123, # 1 p. 133 - 143 Title/Abstract Full Text Show Details
Falch; Hedegaard; Nielsen; Jensen; Hjeds; Krogsgaard-Larsen
Journal of Neurochemistry, 1986 , vol. 47, # 3 p. 898 - 903 Title/Abstract Full Text View citing articles Show Details
Silverman; Invergo; Mathew
Journal of Medicinal Chemistry, 1986 , vol. 29, # 10 p. 1840 - 1846 Title/Abstract Full Text Show Details
Allan; Dickenson; Fong
European Journal of Pharmacology, 1986 , vol. 122, # 3 p. 339 - 348 Title/Abstract Full Text Show Details
Krogsgaard-Larsen; Nielsen; Falch; Curtis
Journal of Medicinal Chemistry, 1985 , vol. 28, # 11 p. 1612 - 1617 Title/Abstract Full Text View citing articles Show Details
Habert; Graham; Tahraoui; Claustre; Langer
European journal of pharmacology, 1985 , vol. 118, # 1-2 p. 107 - 114 Title/Abstract Full Text Show Details
Dompert; Glaser; Traber
Naunyn-Schmiedeberg's archives of pharmacology, 1985 , vol. 328, # 4 p. 467 - 470 Title/Abstract Full Text Show Details
Ali; Bondinell; Dandridge; Frazee; Garvey; Girard; Kaiser; Ku; Lafferty; Moonsammy
Journal of Medicinal Chemistry, 1985 , vol. 28, # 5 p. 653 - 660 Title/Abstract Full Text Show Details
Wojcik; Cavalla; Neff
Journal of Pharmacology and Experimental Therapeutics, 1985 , vol. 232, # 1 p. 62 - 66 Title/Abstract Full Text View citing articles Show Details
Shashoua; Jacob; Ridge; Campbell; Baldessarini
Journal of Medicinal Chemistry, 1984 , vol. 27, # 5 p. 659 - 664 Title/Abstract Full Text Show Details
Largent; Gundlach; Snyder
Proceedings of the National Academy of Sciences of the United States of America, 1984 , vol. 81, # 15 I p. 4983 - 4987 Title/Abstract Full Text View citing articles Show Details
Vickroy; Roeske; Yamamura
Journal of Pharmacology and Experimental Therapeutics, 1984 , vol. 229, # 3 p. 747 - 755 Title/Abstract Full Text View citing articles Show Details
Lohse; Lenschow; Schwabe
Naunyn-Schmiedeberg's Archives of Pharmacology, 1984 , vol. 326, # 1 p. 69 - 74 Title/Abstract Full Text Show Details
Butcher; Collins; Roberts
British Journal of Pharmacology, 1983 , vol. 80, # 2 p. 355 - 364 Title/Abstract Full Text Show Details
Gallagher; Nakamura; Shinnick Gallagher
Journal of Pharmacology and Experimental Therapeutics, 1983 , vol. 226, # 3 p. 876 - 884 Title/Abstract Full Text View citing articles Show Details
Cascio; Kellar
European journal of pharmacology, 1983 , vol. 95, # 1-2 p. 31 - 39 Title/Abstract Full Text Show Details
Billard; Ruperto; Crosby; Iorio; Barnett
Life sciences, 1984 , vol. 35, # 18 p. 1885 - 1893 Title/Abstract Full Text Show Details
Girard; Atkinson; Haubrich; Williams; Yarbrough
Journal of Medicinal Chemistry, 1982 , vol. 25, # 2 p. 113 - 116 Title/Abstract Full Text Show Details
Falch; Krogsgaard-Larsen
Journal of Neurochemistry, 1982 , vol. 38, # 4 p. 1123 - 1129 Title/Abstract Full Text View citing articles Show Details
94 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Kishimoto; Simon; Aprison
Journal of Neurochemistry, 1981 , vol. 37, # 4 p. 1015 - 1024 Title/Abstract Full Text View citing articles Show Details
Krogsgaard-Larsen
Journal of Medicinal Chemistry, 1981 , vol. 24, # 12 p. 1377 - 1383 Title/Abstract Full Text Show Details
Greengrass; Bremner
European journal of pharmacology, 1979 , vol. 55, # 3 p. 323 - 326 Title/Abstract Full Text Show Details
Man, Shuli; Li, Yuanyuan; Fan, Wei; Gao, Wenyuan; Liu, Zhen; Li, Nan; Zhang, Yao; Liu, ChangXiao
International Journal of Pharmaceutics, 2013 , vol. 454, # 1 p. 296 - 301 Title/Abstract Full Text View citing articles Show Details
Aguiam, Nadia R.; Castro, Vania I.; Ribeiro, Ana I.F.; Fernandes, Rui D.V.; Carvalho, Carina M.; Costa, Susana P.G.; Pereira-Lima, Silvia M.M.A.
Tetrahedron, 2013 , vol. 69, # 43 p. 9161 - 9165 Title/Abstract Full Text View citing articles Show Details
Arana; Baldessarini; Harding
Biochemical pharmacology, 1981 , vol. 30, # 23 p. 3171 - 3179 Title/Abstract Full Text Show Details
Breckenridge; Nicholson; Nicol; Suckling; Leigh; Iversen
Journal of neurochemistry, 1981 , vol. 37, # 4 p. 837 - 844 Title/Abstract Full Text Show Details
Honore; Lauridsen; Krogsgaard-Larsen
Journal of neurochemistry, 1982 , vol. 38, # 1 p. 173 - 178 Title/Abstract Full Text Show Details
Leysen; Gommeren
Journal of neurochemistry, 1981 , vol. 36, # 1 p. 201 - 219 Title/Abstract Full Text Show Details
Raisman; Briley; Langer
European Journal of Pharmacology, 1980 , vol. 61, # 4 p. 373 - 380 Title/Abstract Full Text Show Details
Ticku; Huang; Barker
Molecular Pharmacology, 1980 , vol. 17, # 3 p. 285 - 289 Title/Abstract Full Text View citing articles Show Details
O'Donnell; Johnson; Azzaro
Journal of medicinal chemistry, 1980 , vol. 23, # 10 p. 1142 - 1144 Title/Abstract Full Text Show Details
Baudry; Martres; Schwartz
Naunyn-Schmiedeberg's archives of pharmacology, 1979 , vol. 308, # 3 p. 231 - 237 Title/Abstract Full Text Show Details
Zukin
Proceedings of the National Academy of Sciences of the United States of America, 1979 , vol. 76, # 10 p. 5372 - 5376 Title/Abstract Full Text Show Details
Baldessarini; Kula; Walton
European Journal of Pharmacology, 1979 , vol. 56, # 1-2 p. 167 - 171 Title/Abstract Full Text Show Details
Herschel; Baldessarini
Life Sciences, 1979 , vol. 24, # 20 p. 1849 - 1854 Title/Abstract Full Text Show Details
Nicholson; Suckling; Iversen
Journal of Neurochemistry, 1979 , vol. 32, # 1 p. 249 - 252
Title/Abstract Full Text Show Details
Taylor; Pert
Proceedings of the National Academy of Sciences of the United States of America, 1979 , vol. 76, # 2 p. 660 - 664 Title/Abstract Full Text View citing articles Show Details
Krogsgaard-Larsen; Hjeds; Curtis; Lodge; Johnston
Journal of Neurochemistry, 1979 , vol. 32, # 6 p. 1717 - 1724 Title/Abstract Full Text Show Details
Pert; Snyder
Proceedings of the National Academy of Sciences of the United States of America, 1973 , vol. 70, # 8 p. 2243 - 2247 Title/Abstract Full Text View citing articles Show Details
95 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Young; Snyder
Proceedings of the National Academy of Sciences of the United States of America, 1973 , vol. 70, # 10 p. 2832 - 2836 Title/Abstract Full Text View citing articles Show Details
FIBROGEN, INC.; HO, Wen-Bin; ZHAO, Hongda; DENG, Shaojiang; NG, Danny; WRIGHT, Lee R.; WU, Min; ZHOU, Xiaoti; AREND, Michael P.; FLIPPIN, Lee A.
Patent: WO2013/134660 A1, 2013 ; Title/Abstract Full Text Show Details
Fujii; Tanaka; Tsuchiya; Cook
Journal of medicinal chemistry, 1971 , vol. 14, # 4 p. 354 - 357 Title/Abstract Full Text Show Details
Ligon, Brooke
Patent: US2013/252886 A1, 2013 ; Title/Abstract Full Text Show Details
Bhatia, Anil; Bharti, Santosh K.; Tewari, Shri K.; Sidhu, Om P.; Roy, Raja
Phytochemistry, 2013 , vol. 93, p. 105 - 115 Title/Abstract Full Text View citing articles Show Details
D'Abrosca, Brigida; Scognamiglio, Monica; Fiumano, Vittorio; Esposito, Assunta; Choi, Young Hae; Verpoorte, Robert; Fiorentino, Antonio
Phytochemistry, 2013 , vol. 93, p. 27 - 40 Title/Abstract Full Text View citing articles Show Details
BRATTSTROEM, Axel
Patent: WO2013/143843 A1, 2013 ; Title/Abstract Full Text Show Details
CUBIST PHARMACEUTICALS, INC.; GU, Yu, Gui; HE, Yong; YIN, Ning; ALEXANDER, Dylan, C.; CROSS, Jason, B.; METCALF, Chester, A.; BUSCH, Robert
Patent: WO2013/149121 A1, 2013 ; Title/Abstract Full Text Show Details
Hoestgaard-Jensen; O'Connor; Dalby; Simonsen; Finger; Golubeva; Hammer; Bergmann; Kristiansen; Krogsgaard-Larsen; BraeunerOsborne; Ebert; Frolund; Cryan; Jensen
British Journal of Pharmacology, 2013 , vol. 170, # 4 p. 919 - 932 Title/Abstract Full Text View citing articles Show Details
Rangiah, Kannan; Palakodeti, Dasaradhi
Rapid Communications in Mass Spectrometry, 2013 , vol. 27, # 21 p. 2439 - 2452 Title/Abstract Full Text View citing articles Show Details
Puterova-Tokarva; Mrazova; Boca
Polyhedron, 2013 , vol. 61, p. 87 - 93 Title/Abstract Full Text View citing articles Show Details
Xiang, Zhang
Journal of Molecular Structure, 2013 , vol. 1049, p. 149 - 156 Title/Abstract Full Text View citing articles Show Details
Harada, Naoya; Kimura, Hiroyuki; Ono, Masahiro; Saji, Hideo
Journal of Medicinal Chemistry, 2013 , vol. 56, # 20 p. 7890 - 7901 Title/Abstract Full Text View citing articles Show Details
Vogensen, Stine B.; Marek, Ales; Bay, Tina; Wellendorph, Petrine; Kehler, Jan; Bundgaard, Christoffer; Frolund, Bente; Pedersen, Martin H. F.; Clausen, Rasmus P.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 20 p. 8201 - 8205 Title/Abstract Full Text View citing articles Show Details
Svoboda, Jan; Zima, Vitezslav; Melanova, Klara; Benes, Ludvik; Trchova, Miroslava
Journal of Solid State Chemistry, 2013 , vol. 208, p. 58 - 64 Title/Abstract Full Text View citing articles Show Details
YALE UNIVERSITY; SPIEGAL, David; PARKER, Christopher
Patent: WO2013/162757 A1, 2013 ; Title/Abstract Full Text Show Details
UCL BUSINESS PLC; Williams, Robin Simon Brooke; Walker, Matthew
Patent: US2013/303616 A1, 2013 ; Title/Abstract Full Text Show Details
Patra, Malay; Hess, Jeannine; Konatschnig, Sandro; Spingler, Bernhard; Gasser, Gilles
Organometallics, 2013 , vol. 32, # 20 p. 6098 - 6105 Title/Abstract Full Text View citing articles Show Details
Araujo, Rui Filipe; Silva, Carlos Jorge R.; Paiva, Maria Conceicao; Franco, Manuel Melle; Proenca, Maria Fernanda
RSC Advances, 2013 , vol. 3, # 46 p. 24535 - 24542 Title/Abstract Full Text View citing articles Show Details
MERCK SHARP and DOHME CORP.; LYCERA CORPORATION; AICHER, Thomas; BARR, Kenneth; LAPOINTE, Blair; SIMOV, Vladimir; STEIN, Karin; THOMAS, William; TOOGOOD, Peter; VAN HUIS, Chad; WHITE, Catherine
Patent: WO2013/169704 A2, 2013 ;
Title/Abstract Full Text Show Details
96 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
ABBVIE INC.; SWEIS, Ramzi F.; CURTIN, Michael L.; PLIUSHCHEV, Marina A.; HANSEN, Todd M.; LONGENECKER, Kenton
Patent: WO2013/170118 A1, 2013 ; Title/Abstract Full Text Show Details
Al-Sammak, Maitham Ahmed; Hoagland, Kyle D.; Snow, Daniel D.; Cassada, David
Toxicon, 2013 , vol. 76, p. 316 - 325 Title/Abstract Full Text View citing articles Show Details
Erim, F. Bedia
TrAC - Trends in Analytical Chemistry, 2013 , vol. 52, p. 239 - 247 Title/Abstract Full Text View citing articles Show Details
Han C; Salyer AE; Kim EH; Jiang X; Jarrard RE; Powers MS; Kirchhoff AM; Salvador TK; Chester JA; Hockerman GH; Colby DA
Journal of medicinal chemistry, 2013 , vol. 56, # 6 p. 2456 - 2465 Title/Abstract Full Text Show Details
Rariy, Roman V.; Heffernan, Michael; Buchwald, Stephen L.; Swager, Timothy M.
Patent: US2004/142904 A1, 2004 ; Title/Abstract Full Text Show Details
Ajit SK; Pausch MH; Kennedy JD; Kaftan EJ
Journal of biomedicine & biotechnology, 2010 , vol. 2010, p. 326020 Title/Abstract Full Text Show Details
Ligon, Brooke
Patent: US2003/162754 A1, 2003 ; Title/Abstract Full Text Show Details
Bonnert; Timothy Peter; Whiting; Paul John
Patent: US6555341 , 2003 ; Title/Abstract Full Text Show Details
Zerangue; Noa
Patent: US7700300 , 2010 ; Title/Abstract Full Text Show Details
Type: Review, Lab: EFF_071212, Owner: EFFECT, Number: 000, Revision: 07.12.2012 00:00:00 2012 Full Text Show Details
Kaupmann, Klemens; Bettler, Bernhard; Bittiger, Helmut; Frostl, Wolfgang; Mickel, Stuart J.
Patent: US2002/91250 A1, 2002 ; Title/Abstract Full Text Show Details
Pavlik, Christopher M.; Wong, Christina Y. B.; Ononye, Sophia; Lopez, Dioxelis D.; Engene, Niclas; McPhail, Kerry L.; Gerwick, William H.; Balunas, Marcy J.
Journal of Natural Products, 2013 , vol. 76, # 11 p. 2026 - 2033 Title/Abstract Full Text View citing articles Show Details
Shang, Yuan-Hong; Tian, Jin-Feng; Hou, Min; Xu, Xiao-Yu
Chinese Journal of Natural Medicines, 2013 , vol. 11, # 6 p. 588 - 595 Title/Abstract Full Text View citing articles Show Details
ST. JUDE CHILDREN'S RESEARCH HOSPITAL; SINGH, Harpreet; WILLIAMS, Richard, T.; GUY, Kiplin, R.
Patent: WO2013/177420 A2, 2013 ; Title/Abstract Full Text Show Details
UNIVERSITA' DEGLI STUDI DI MILANO; VEROTTA, Luisella; BRUNO, Michela; TRUCCHI, Beatrice; RANZATO, Elia; MARTINOTTI, Simona; BONETTA, Silvia; BONETTA, Sara; CARRARO, Elisabetta; BURLANDO, Bruno; KUPELI, Akkol Esra; SUNTAR, Ipek; KELES, Hikmet
Patent: WO2013/189950 A1, 2013 ; Title/Abstract Full Text Show Details
El-Faham, Ayman; Al Marhoon, Zainab; Abdel-Megeed, Ahmed; Albericio, Fernando
Molecules, 2013 , vol. 18, # 12 p. 14747 - 14759 Title/Abstract Full Text View citing articles Show Details
Vandevrede, Lawren; Tavassoli, Ehsan; Luo, Jia; Qin, Zhihui; Yue, Lan; Pepperberg, David R.; Thatcher, Gregory R.
British Journal of Pharmacology, 2014 , vol. 171, # 2 p. 389 - 402 Title/Abstract Full Text View citing articles Show Details
Chang, Chun-Ping; Wu, Chien-Huang; Song, Jen-Shin; Chou, Ming-Chen; Wong, Ying-Chieh; Lin, Yinchiu; Yeh, Teng-Kuang; Sadani, Amit A.; Ou, Ming-Hung; Chen, Kun-Hung; Chen, Pei-Hsuan; Kuo, Po-Chu; Tseng, Chen-Tso; Chang, Kuei-Hua; Tseng, Shi-Liang; Chao, Yu-Sheng; Hung, Ming-Shiu; Shia, Kak-Shan
Journal of Medicinal Chemistry, 2013 , vol. 56, # 24 p. 9920 - 9933 Title/Abstract Full Text View citing articles Show Details
Kar, Haridas; Ghosh, Suhrit
Chemical Communications, 2014 , vol. 50, # 9 p. 1064 - 1066 Title/Abstract Full Text View citing articles Show Details
Romanenko; Pakhomova; Vasyuk; Borodina
Chemistry of Natural Compounds, 2013 , vol. 49, # 5 p. 907 - 909 Khim. Prir. Soedin., 2013 , # 5 p. 779 - 781,3 Title/Abstract Full Text View citing articles Show Details
97 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Mitani, Yasuyuki; Akashiba, Hiroki; Saita, Kyoko; Yarimizu, Junko; Uchino, Hiroshi; Okabe, Mayuko; Asai, Makoto; Yamasaki, Shingo; Nozawa, Takashi; Ishikawa, Noritoshi; Shitaka, Yoshitsugu; Ni, Keni; Matsuoka, Nobuya
Neuropharmacology, 2014 , vol. 79, p. 412 - 419 Title/Abstract Full Text View citing articles Show Details
Molla, Mijanur Rahaman; Gehrig, Dominik; Roy, Lisa; Kamm, Valentin; Paul, Ankan; Laquai, Frederic; Ghosh, Suhrit
Chemistry - A European Journal, 2014 , vol. 20, # 3 p. 760 - 771 Title/Abstract Full Text View citing articles Show Details
Michael Williams; David C.U Prichard
Annual reports in medicinal chemistry, 1984 , vol. 19, p. 283 - 292 Title/Abstract Full Text Show Details
Joseph P. Yevich; James S. New; Michael S. Eison
Annual reports in medicinal chemistry, 1983 , vol. 18, p. 11 - 20 Title/Abstract Full Text Show Details
P. Krogsgaard-Larsen; A. V. Christensen
Annual reports in medicinal chemistry, 1980 , vol. 15, p. 41 - 50 Title/Abstract Full Text Show Details
Jeffrey K. Saelens; Fredric J. Vinick
Annual reports in medicinal chemistry, 1978 , vol. 13, p. 31 - 40 Title/Abstract Full Text Show Details
Gabriele Quandt; Georg Hofner; Klaus T. Wanner
Bioorganic & medicinal chemistry, 2013 , vol. 21, # 11 p. 3363 - 3378 Title/Abstract Full Text Show Details
SIEROSLAWSKA J
Archivum immunologiae et therapiae experimentalis, 1965 , vol. 13, p. 70 - 126 Title/Abstract Full Text View citing articles Show Details
SMYTH HF Jr; CARPENTER CP; WEIL CS; POZZANI UC
Bitamin., 1962 , vol. 25, p. 297 Full Text Show Details
LIGHTOWLER JE; MACLEAN JA.
Arch Int Pharmacodyn Ther (1899-1996), 1963 , vol. 145, p. 233 - 242 Title/Abstract Full Text View citing articles Show Details
Mamoru Tasaki; Miki Kobayashi; Yoshiyuki Tenda; Susumu Tsujimoto; Shoko Nakazato; Mako Numazaki; Yasuno Hirano; Hiroshi Matsuda; Tadashi Terasaka; Yasuhiro Miyao; Yasuaki Shimizu; Yoshitaka Hirayama
European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences, 2013 , vol. 49, # 3 p. 434 - 440 Title/Abstract Full Text Show Details
Andrea Cappelli; Monica Manini; Salvatore Valenti; Federica Castriconi; Germano Giuliani; Maurizio Anzini; Simone Brogi; Stefania Butini; Sandra Gemma; Giuseppe Campiani; Gianluca Giorgi; Laura Mennuni; Marco Lanza; Antonio Giordani; Gianfranco Caselli; Ornella Letari; Francesco Makovec
European journal of medicinal chemistry, 2013 , vol. 63, p. 85 - 94 Title/Abstract Full Text Show Details
Comparative biochemistry and physiology. C, Comparative pharmacology and toxicology, 1984 , vol. 47, p. 205 Full Text Show Details
W. E. SPLITTSTOESSER; L. FOWDEN
Phytochemistry, 1973 , vol. 12, # 4 p. 785 - 790 Title/Abstract Full Text Show Details
MICHAEL MEHERIUK; MARY SPENCER
Phytochemistry, 1967 , vol. 6, # 4 p. 535 - 543 Title/Abstract Full Text Show Details
Oshima Y; Kasahara A; Shibata M; Mogi M
Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan, 1965 , vol. 85, # 5 p. 463 - 468 Title/Abstract Full Text View citing articles Show Details
William Howson; Jaystree Mistry; Marianne Broekman; Judith M. Hills
Bioorganic & medicinal chemistry letters, 1993 , vol. 3, # 4 p. 515 - 518 Title/Abstract Full Text Show Details
Robert T. Fremeau Jr.; Marc G. Caron; Randy D. Blakely
Patent: US5580775 A, 1996 ; Title/Abstract Full Text Show Details
Kelli E. Smith; Richard L. Weinshank
Patent: US5559021 A, 1996 ; Title/Abstract Full Text Show Details
HAROLD J. STRECKER
The Journal of biological chemistry, 1960 , vol. 235, # 11 p. 3218 - 3223 Title/Abstract Full Text Show Details
98 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
B Pirard; G Baudoux; F Durant
European journal of medicinal chemistry, 1994 , vol. 29, p. 513 - 517 Title/Abstract Full Text Show Details
E Falch; P Krogsgaard-Larsen
European journal of medicinal chemistry, 1991 , vol. 26, p. 69 - 78 Title/Abstract Full Text Show Details
P Berthelot; C Vaccher; N Flouquet; M Luyckx; C Brunet; T Boulanger; JP Frippiat; DP Vercauteren; M Debaert; G Evrard; F Durant
European journal of medicinal chemistry, 1991 , vol. 26, p. 395 - 402 Title/Abstract Full Text Show Details
Frommer, Wolf-Bernd
Patent: EP924300 A2, 1999 ; Title/Abstract Full Text Show Details
ZERANGUE Noa
Patent: WO2007/16178 A2, 2007 ; Title/Abstract Full Text Show Details
Laurence A. Borden; Kelli E. Smith; Richard L. Weinshank
Patent: US5766848 A, 1998 ; Title/Abstract Full Text Show Details
Kelli E. Smith; Laurence A. Borden; Theresa Branchek; Paul R. Hartig; Richard L. Weinshank
Patent: US5756348 A, 1998 ; Title/Abstract Full Text Show Details
M Ansar; S Al Akoum Ebrik; R Mouhoub; P Berthelot; C Vaccher; MP Vaccher; N Flouquet; DH Caignard; P Renard; B Pirard; MC Rettori; G Evrard; F Dutant; M Debaert
European journal of medicinal chemistry, 1996 , vol. 31, p. 449 - 460 Title/Abstract Full Text Show Details
J Kardos; T Blandl; ND Luyen; G Dornyei; E Gacs-Baitz; M Simonyi; DJ Cash; G Blasko; Cs Szantay
European journal of medicinal chemistry, 1996 , vol. 31, p. 761 - 765 Title/Abstract Full Text Show Details
http://www.rxlist.com/cgi/generic/sargramostim_cp.htm Full Text Show Details
Kelli E. Smith; Laurence A. Borden; Theresa Branchek; Paul R. Hartig; Richard L. Weinshank
Patent: US6127131 A, 2000 ; Title/Abstract Full Text Show Details
Wolf-Bernd Frommer
Patent: US2003/51271 A1, 2003 ; Title/Abstract Full Text Show Details
Muriel E. Farquharson; J. A. R. Maclean
Journal of medicinal chemistry, 1961 , vol. 4, # 1 p. 31 - 40 Title/Abstract Full Text Show Details
SMITH Kelli E.; BORDEN Laurence A.; HARTIG Paul R.; WEINSHANK Richard L.
Patent: WO1993/18143 A1, 1993 ; Title/Abstract Full Text Show Details
Comparative biochemistry and physiology. C, Comparative pharmacology and toxicology, 1984 , vol. 47, p. 205 Title/Abstract Full Text Show Details
CORNELIU GIURGEA
Patent: US3380887 A, 1968 ; vol. #3380887 Full Text Show Details
Patel; Mortensen; Smart
British Journal of Pharmacology, 2014 , vol. 171, # 4 p. 985 - 994 Title/Abstract Full Text View citing articles Show Details
Zvejniece; Vavers; Svalbe; Vilskersts; Domracheva; Vorona; Veinberg; Misane; Stonans; Kalvinsh; Dambrova
British Journal of Pharmacology, 2014 , vol. 171, # 3 p. 761 - 771 Title/Abstract Full Text View citing articles Show Details
Feng; Jounaidi; Haburcak; Yang; Forman
British Journal of Pharmacology, 2014 , vol. 171, # 3 p. 789 - 798 Title/Abstract Full Text View citing articles Show Details
Pan, Yilin; Li, Jin; Li, Xiang; Chen, Jianwei; Bai, Ganggang
Bulletin of the Korean Chemical Society, 2014 , vol. 35, # 1 p. 197 - 203 Title/Abstract Full Text View citing articles Show Details
99 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Kattan Readi; Rolevink; Nijmeijer
Journal of Chemical Technology and Biotechnology, 2014 , vol. 89, # 3 p. 425 - 435 Title/Abstract Full Text View citing articles Show Details
Raj, Raghu; Biot, Christophe; Carrere-Kremer, Severine; Kremer, Laurent; Guerardel, Yann; Gut, Jiri; Rosenthal, Philip J.; Kumar, Vipan
Chemical Biology and Drug Design, 2014 , vol. 83, # 2 p. 191 - 197 Title/Abstract Full Text View citing articles Show Details
UNIVERSITY OF CONNECTICUT; BALUNAS, Marcy J.; PAVLIK, Christopher M.; GERWICK, William H.
Patent: WO2014/18913 A2, 2014 ; Title/Abstract Full Text Show Details
Shi, Diana D.; Trigo, Federico F.; Semmelhack, Martin F.; Wang, Samuel S.-H.
Journal of the American Chemical Society, 2014 , vol. 136, # 5 p. 1976 - 1981 Title/Abstract Full Text View citing articles Show Details
Zhao, Yingjie; Beuchat, Cesar; Domoto, Yuya; Gajewy, Jadwiga; Wilson, Adam; Mareda, Jiri; Sakai, Naomi; Matile, Stefan
Journal of the American Chemical Society, 2014 , vol. 136, # 5 p. 2101 - 2111 Title/Abstract Full Text View citing articles Show Details
Migianu-Griffoni, Evelyne; Chebbi, Imene; Kachbi, Souad; Monteil, Maelle; Sainte-Catherine, Odile; Chaubet, Frederic; Oudar, Olivier; Lecouvey, Marc
Bioconjugate Chemistry, 2014 , vol. 25, # 2 p. 224 - 230 Title/Abstract Full Text View citing articles Show Details
Gao, Congfen; Chen, Yu; Dong, Yaoxue; Su, Jianya
Journal of Entomological Science, 2014 , vol. 49, # 1 p. 1 - 10 Title/Abstract Full Text View citing articles Show Details
Olmo, Francisco; Rotger, Carmen; Ramirez-Macias, Inmaculada; Martinez, Luis; Marin, Clotilde; Carreras, Lucas; Urbanova, Kristina; Vega, Manel; Chaves-Lemaur, Guillermo; Sampedro, Angel; Rosales, Maria Jose; Sanchez-Moreno, Manuel; Costa, Antonio
Journal of Medicinal Chemistry, 2014 , vol. 57, # 3 p. 987 - 999 Title/Abstract Full Text View citing articles Show Details
Yuen, Tsz-Ying; Eaton, Samantha E.; Woods, Tom M.; Furkert, Daniel P.; Choi, Ka Wai; Brimble, Margaret A.
European Journal of Organic Chemistry, 2014 , vol. 2014, # 7 p. 1431 - 1437 Title/Abstract Full Text View citing articles Show Details
of Nevada, Las Vegas; The Regents of the Nevada System of Higher Education on behalf of the University; Abel-Santos, Ernesto; Howerton, Amber
Patent: US2014/45808 A1, 2014 ; Title/Abstract Full Text Show Details
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
Kaohsiung Medical University; Chen, Hui-Ting; Chang, Hsin-Fang; Wang, Yan-Hsiung; Kao, Chai-Lin
Patent: US8614194 B1, 2013 ; Title/Abstract Full Text Show Details
Tars, Kaspars; Leitans, Janis; Kazaks, Andris; Zelencova, Diana; Liepinsh, Edgars; Kuka, Janis; Makrecka, Marina; Lola, Daina; Andrianovs, Viktors; Gustina, Daina; Grinberga, Solveiga; Liepinsh, Edvards; Kalvinsh, Ivars; Dambrova, Maija; Loza, Einars; Pugovics, Osvalds
Journal of Medicinal Chemistry, 2014 , vol. 57, # 6 p. 2213 - 2236 Title/Abstract Full Text View citing articles Show Details
Xu, Lihuan; Yang, Fang; Su, Chang; Ji, Lvlv; Zhang, Cheng
Electrochimica Acta, 2014 , vol. 130, p. 148 - 155 Title/Abstract Full Text View citing articles Show Details
Chabenne, Anthony; Moon, Carrolyn; Ojo, Comfort; Khogali, Azza; Nepal, Bal; Sharma, Sushil
Biomarkers and Genomic Medicine, 2014 , vol. 6, # 1 p. 12 - 22 Title/Abstract Full Text View citing articles Show Details
Merk, Daniel; Gabler, Matthias; Gomez, Roberto Carrasco; Flesch, Daniel; Hanke, Thomas; Kaiser, Astrid; Lamers, Christina; Werz, Oliver; Schneider, Gisbert; Schubert-Zsilavecz, Manfred
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 8 p. 2447 - 2460 Title/Abstract Full Text View citing articles Show Details
Drozak, Jakub; Veiga-Da-Cunha, Maria; Kadziolka, Beata; Van Schaftingen, Emile
FEBS Journal, 2014 , vol. 281, # 6 p. 1585 - 1597 Title/Abstract Full Text View citing articles Show Details
ARIZONA BOARD OF REGENTS, A BODY CORPORATE OF THE STATE OF ARIZONA, ACTING FOR AN ON BEHALF OF ARIZONA STATE UNIVERSITY; MADATHIL, Manikandadas, Mathilakathu; KHDOUR, Omar; HECHT, Sidney
Patent: WO2014/59158 A1, 2014 ; Title/Abstract Full Text Show Details
Carrette, Lieselot L. G.; Morii, Takashi; Madder, Annemieke
European Journal of Organic Chemistry, 2014 , vol. 2014, # 14 p. 2883 - 2891 Title/Abstract Full Text View citing articles Show Details
Yahara, Tohru; Tachikawa, Masanori; Akanuma, Shin-Ichi; Kubo, Yoshiyuki; Hosoya, Ken-Ichi
Biological and Pharmaceutical Bulletin, 2014 , vol. 37, # 5 p. 817 - 825 Title/Abstract Full Text View citing articles Show Details
100 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
REDWOOD BIOSCIENCE, INC.; KUDIRKA, Romas Alvydas; ALBERS, Aaron Edward; RABUKA, David
Patent: WO2014/74218 A1, 2014 ; Title/Abstract Full Text Show Details
Tamura, Masazumi; Tamura, Riku; Takeda, Yasuyuki; Nakagawa, Yoshinao; Tomishige, Keiichi
Chemical Communications, 2014 , vol. 50, # 50 p. 6656 - 6659 Title/Abstract Full Text View citing articles Show Details
Petushkov, Valentin N.; Dubinnyi, Maxim A.; Tsarkova, Aleksandra S.; Rodionova, Natalja S.; Baranov, Mikhail S.; Kublitski, Vadim S.; Shimomura, Osamu; Yampolsky, Ilia V.
Angewandte Chemie - International Edition, 2014 , vol. 53, # 22 p. 5566 - 5568 Angew. Chem., 2014 , vol. 126, # 22 p. 5672 - 5674,3 Title/Abstract Full Text View citing articles Show Details
Hu, Xiang-Guo; Thomas, Donald S.; Griffith, Renate; Hunter, Luke
Angewandte Chemie - International Edition, 2014 , vol. 53, # 24 p. 6176 - 6179 Angew. Chem., 2014 , vol. 126, # 24 p. 6290 - 6293 Title/Abstract Full Text View citing articles Show Details
Troshkova; Goryunov; Shteingarts; Zakharova; Ovchinnikova; Nevinsky
Journal of Fluorine Chemistry, 2014 , vol. 164, p. 18 - 26 Title/Abstract Full Text View citing articles Show Details
Guengoer, Oezlem; Guerkan, Perihan
Journal of Molecular Structure, 2014 , vol. 1074, p. 62 - 70 Title/Abstract Full Text View citing articles Show Details
Sinha, Manish; Dola, Vasanth R.; Agarwal, Pooja; Srivastava, Kumkum; Haq, Wahajul; Puri, Sunil K.; Katti, Seturam B.
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 14 p. 3573 - 3586 Title/Abstract Full Text View citing articles Show Details
Gotor, Raul; Costero, Ana M.; Gil, Salvador; Gavina, Pablo; Rurack, Knut
European Journal of Organic Chemistry, 2014 , vol. 2014, # 19 p. 4005 - 4013 Title/Abstract Full Text View citing articles Show Details
Kowalczyk, Paula; Sałat, Kinga; Höfner, Georg C.; Mucha, Marta; Rapacz, Anna; Podkowa, Adrian; Filipek, Barbara; Wanner, Klaus T.; Kulig, Katarzyna
European Journal of Medicinal Chemistry, 2014 , vol. 83, p. 256 - 273 Title/Abstract Full Text View citing articles Show Details
Stolyarova; Baltina; Kondratenko; Fedorova; Orshanskaya; Zarubaev
Chemistry of Natural Compounds, 2014 , vol. 50, # 2 p. 317 - 320 Khim. Prir. Soedin., 2014 , vol. 2, p. 278 - 281,4 Title/Abstract Full Text View citing articles Show Details
Nassiri-Asl, Marjan; Naserpour Farivar, Taghi; Abbasi, Esmail; Sadeghnia, Hamid Reza; Sheikhi, Mehdi; Lotfizadeh, Mina; Bazahang, Parisa Journal of Integrative Medicine, 2013 , vol. 11, # 5 p. 337 - 342 Title/Abstract Full Text Show Details
Romeo, Giuseppe; Salerno, Loredana; Pittala, Valeria; Modica, Maria N.; Siracusa, Maria A.; Materia, Luisa; Buccioni, Michela; Marucci, Gabriella; Minneman, Kenneth P.
European Journal of Medicinal Chemistry, 2014 , vol. 83, p. 419 - 432 Title/Abstract Full Text View citing articles Show Details
Coxon, Fraser; Joachimiak, Łukasz; Najumudeen, Arafath Kaja; Breen, George; Gmach, Joanna; Oetken-Lindholm, Christina; Way, Rebecca; Dunford, James; Abankwa, Daniel; Błazewska, Katarzyna M.
European Journal of Medicinal Chemistry, 2014 , vol. 84, p. 77 - 89 Title/Abstract Full Text View citing articles Show Details
Wu, Xianglong; Tian, Min; Fan, Wutu; Pan, Yalei; Zhai, Yuankun; Niu, Yinbo; Li, Chenrui; Lu, Tingli; Mei, Qibing
Journal of Fluorescence, 2014 , vol. 24, # 3 p. 775 - 786 Title/Abstract Full Text View citing articles Show Details
Ceruso, Mariangela; Del Prete, Sonia; Alothman, Zeid; Capasso, Clemente; Supuran, Claudiu T.
ACS Medicinal Chemistry Letters, 2014 , vol. 5, # 7 p. 826 - 830 Title/Abstract Full Text View citing articles Show Details
Manier, M. Lisa; Spraggins, Jeffrey M.; Reyzer, Michelle L.; Norris, Jeremy L.; Caprioli, Richard M.
Journal of Mass Spectrometry, 2014 , vol. 49, # 8 p. 665 - 673 Title/Abstract Full Text View citing articles Show Details
Petersen, Jette G.; Sørensen, Troels; Damgaard, Maria; Nielsen, Birgitte; Jensen, Anders A.; Balle, Thomas; Bergmann, Rikke; Frølund, Bente
European Journal of Medicinal Chemistry, 2014 , vol. 84, p. 404 - 416 Title/Abstract Full Text View citing articles Show Details
Dinh, Thu Huong; Ho, Ngoc Anh Thu; Kang, Taek Jin; Mcdonald, Karen A.; Won, Keehoon
Journal of Chemical Technology and Biotechnology, 2014 , vol. 89, # 9 p. 1432 - 1436 Title/Abstract Full Text View citing articles Show Details
Sanchez-Borzone, Mariela; Delgado-Marin, Leticia; Garcia, Daniel A.
Chirality, 2014 , vol. 26, # 8 p. 368 - 372 Title/Abstract Full Text View citing articles Show Details
Maeda, Kenji; Sugino, Haruhiko; Akazawa, Hitomi; Amada, Naoki; Shimada, Jun; Futamura, Takashi; Yamashita, Hiroshi; Ito, Nobuaki; McQuade, Robert D.; Mork, Arne; Pehrson, Alan L.; Hentzer, Morten; Nielsen, Vibeke; Bundgaard, Christoffer; Arnt, Jorn; Stensbol, Tine Bryan; Kikuchi, Tetsuro
Journal of Pharmacology and Experimental Therapeutics, 2014 , vol. 350, # 3 p. 589 - 604 Title/Abstract Full Text View citing articles Show Details
Hide facts
101 of 992
Show next 200 Comment (Pharmacological Data)
Bioactivities present
Reference
Gniazdowska, Ewa; Koźmiński, Przemysław; Bańkowski, Krzysztof; Ochman, Paweł
Journal of Medicinal Chemistry, 2014 , vol. 57, # 14 p. 5986 - 5994 Title/Abstract Full Text View citing articles Show Details
Su, Yu-Chih; Lo, Yu-Lun; Hwang, Chi-Ching; Wang, Li-Fang; Wu, Min Hui; Wang, Eng-Chi; Wang, Yun-Ming; Wang, Tzu-Pin
Organic and Biomolecular Chemistry, 2014 , vol. 12, # 34 p. 6624 - 6633 Title/Abstract Full Text View citing articles Show Details
BIOGEN IDEC MA INC.; GUCKIAN, Kevin; KUMARAVEL, Gnanasambandam; LIU, Xiaogao; MA, Bin; PENG, Hairuo
Patent: WO2014/120764 A1, 2014 ; Title/Abstract Full Text Show Details
Ceruso, Mariangela; Del Prete, Sonia; Alothman, Zeid; Osman, Sameh M.; Scozzafava, Andrea; Capasso, Clemente; Supuran, Claudiu T.
Bioorganic and Medicinal Chemistry Letters, 2014 , vol. 24, # 16 p. 4006 - 4010 Title/Abstract Full Text View citing articles Show Details
BIOLOG, INC.; BOCHNER, Barry; LEI, Xiang-He
Patent: WO2014/130655 A2, 2014 ; Title/Abstract Full Text Show Details
THE UNIVERSITY OF TOKYO; Ito, Taichi; Suzuki, Yukimitsu; Takahashi, Akira; Shimizu, Atsushi
Patent: US2014/256831 A1, 2014 ; Title/Abstract Full Text Show Details
NAKAI, Takashi; MOORE, Joel; PERL, Nicholas Robert; IYENGAR, Rajesh R.; MERMERIAN, Ara; IM, G-Yoon Jamie; LEE, Thomas Wai-Ho; HUDSON, Colleen; RENNIE, Glen Robert; JIA, James; RENHOWE, Paul Allen; BARDEN, Timothy Claude; YU, Xiang Y; SHEPPECK, James Edward; IYER, Karthik; JUNG, Joon
Patent: WO2014/144100 A2, 2014 ; Title/Abstract Full Text Show Details
Broetz, Elke; Herrmann, Jennifer; Wiese, Jutta; Zinecker, Heidi; Maier, Armin; Kelter, Gerhardt; Imhoff, Johannes F.; Mueller, Rolf; Paululat, Thomas
European Journal of Organic Chemistry, 2014 , vol. 2014, # 24 p. 5318 - 5330 Title/Abstract Full Text View citing articles Show Details
Polindara-Garcia, Luis A.; Vazquez, Alfredo
Organic and Biomolecular Chemistry, 2014 , vol. 12, # 36 p. 7068 - 7082 Title/Abstract Full Text View citing articles Show Details
Khudina; Ivanova; Burgart, Ya. V.; Saloutin
Chemistry of Heterocyclic Compounds, 2014 , vol. 50, # 6 p. 901 - 906 Khim. Geterotsikl. Soedin., 2014 , vol. 50, # 6 p. 976 - 982,7 Title/Abstract Full Text View citing articles Show Details
Washington University; Covey, Douglas; Kudcva, Eva
Patent: US2014/309443 A1, 2014 ; Title/Abstract Full Text Show Details
Scognamiglio, Monica; Fiumano, Vittorio; D'Abrosca, Brigida; Esposito, Assunta; Fiorentino, Antonio; Choi, Young Hae; Verpoorte, Robert
Phytochemistry (Elsevier), 2014 , vol. 106, p. 69 - 85,17 Title/Abstract Full Text View citing articles Show Details
Bunel, Valérian; Hamel, Marie; Duez, Pierre; Stévigny, Caroline
Phytochemistry Letters, 2014 , vol. 10, # 1 p. 101 - 106 Title/Abstract Full Text View citing articles Show Details
Zhang, Rongzhen; Yang, Taowei; Rao, Zhiming; Sun, Hongmei; Xu, Meijuan; Zhang, Xian; Xu, Zhenghong; Yang, Shangtian
Green Chemistry, 2014 , vol. 16, # 9 p. 4190 - 4197
Title/Abstract Full Text View citing articles Show Details
Vaid, Radhe K.; Boini, Sathish K.; Alt, Charles A.; Spitler, Jeremy T.; Hadden, Chad E.; Frank, Scott A.; Moher, Eric D.
Synthesis, 2014 , vol. 46, # 18 art. no. SS2014M0164OP, p. 2463 - 2470,8 Title/Abstract Full Text View citing articles Show Details
Haedler, Andreas T.; Beyer, Sebastian R.; Hammer, Natalie; Hildner, Richard; Kivala, Milan; Koehler, Juergen; Schmidt, Hans-Werner
Chemistry - A European Journal, 2014 , vol. 20, # 37 p. 11708 - 11718 Title/Abstract Full Text View citing articles Show Details
Asamitsu, Sefan; Kawamoto, Yusuke; Hashiya, Fumitaka; Hashiya, Kaori; Yamamoto, Makoto; Kizaki, Seiichiro; Bando, Toshikazu; Sugiyama, Hiroshi
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 17 p. 4646 - 4657 Title/Abstract Full Text View citing articles Show Details
Shirotake, Shoichi
Patent: EP2805617 A1, 2014 ; Title/Abstract Full Text Show Details
Ali, Hatem Salama Mohamed; Alhaj, Omar Amin; Al-Khalifa, Abdulrahman Saleh; Brueckner, Hans
Amino Acids, 2014 , vol. 46, # 9 p. 2241 - 2257 Title/Abstract Full Text View citing articles Show Details
Bunel, Valrian; Hamel, Marie; Duez, Pierre; Stvigny, Caroline
2014 , vol. 10, p. 101 - 106 Title/Abstract Full Text Show Details
102 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Schroeder, Chad E.; Yao, Tuanli; Sotsky, Julie; Smith, Robert A.; Roy, Sudeshna; Chu, Yong-Kyu; Guo, Haixun; Tower, Nichole A.; Noah, James W.; McKellip, Sara; Sosa, Melinda; Rasmussen, Lynn; Smith, Layton H.; White, E. Lucile; Aub, Jeffrey; Jonsson, Colleen B.; Chung, Donghoon; Golden, Jennifer E.
Journal of Medicinal Chemistry, 2014 , vol. 57, # 20 p. 8608 - 8621 Title/Abstract Full Text View citing articles Show Details
Biogen Idec Hemophilia Inc.; Mezo, Adam R.; McDonnell, Kevin A.
Patent: US8906844 B2, 2014 ; Title/Abstract Full Text Show Details
Jones, Rachel A.; Thillier, Yann; Panda, Siva S.; Rivera Rosario, Nicole; Hall, C. Dennis; Katritzky, Alan R.
Organic and Biomolecular Chemistry, 2014 , vol. 12, # 41 p. 8325 - 8335 Title/Abstract Full Text View citing articles Show Details
Pydi, Sai P.; Sobotkiewicz, Tyler; Billakanti, Rohini; Bhullar, Rajinder P.; Loewen, Michele C.; Chelikani, Prashen
Journal of Biological Chemistry, 2014 , vol. 289, # 36 p. 25054 - 25066 Title/Abstract Full Text View citing articles Show Details
Martini, Elisabetta; Merola, Giovanni; Tomassetti, Mauro; Campanella, Luigi
Food Chemistry, 2014 , vol. 169, p. 358 - 365 Title/Abstract Full Text Show Details
Fallows, Andrew J.; Singh, Ishwar; Dondi, Ruggero; Cullis, Paul M.; Burley, Glenn A.
Organic Letters, 2014 , vol. 16, # 17 p. 4654 - 4657 Title/Abstract Full Text View citing articles Show Details
Eaton, Megan M.; Bracamontes, John; Shu, Hong-Jin; Li, Ping; Mennerick, Steven; Steinbach, Joe Henry; Akk, Gustav
Molecular Pharmacology, 2014 , vol. 86, # 6 p. 647 - 656 Title/Abstract Full Text View citing articles Show Details
Meiselbach, Heike; Vogel, Nico; Langlhofer, Georg; Stangl, Sabine; Schleyer, Barbara; Bahnassawy, Lamia'a; Sticht, Heinrich; Breitinger, Hans-Georg; Becker, Cord-Michael; Villmann, Carmen
Journal of Biological Chemistry, 2014 , vol. 289, # 42 p. 29135 - 29147 Title/Abstract Full Text View citing articles Show Details
Touchy, Abeda Sultana; Hakim Siddiki; Kon, Kenichi; Shimizu, Ken-Ichi
ACS Catalysis, 2014 , vol. 4, # 9 p. 3045 - 3050 Title/Abstract Full Text View citing articles Show Details
Dikusar; Potkin; Pyatkevich
Russian Journal of General Chemistry, 2014 , vol. 84, # 9 p. 1701 - 1705 Zh. Obshch. Khim., 2014 , vol. 84, # 9 p. 1461 - 1465,5 Title/Abstract Full Text View citing articles Show Details
Romei, Cristina; Sabolla, Chiara; Raiteri, Luca
Neuropharmacology, 2015 , vol. 88, p. 164 - 170 Title/Abstract Full Text View citing articles Show Details
Rajalu, Mathieu; Fritzius, Thorsten; Adelfinger, Lisa; Jacquier, Valerie; Besseyrias, Valerie; Gassmann, Martin; Bettler, Bernhard
Neuropharmacology, 2015 , vol. 88, p. 145 - 154 Title/Abstract Full Text View citing articles Show Details
Dillon, Nicholas A.; Peterson, Nicholas D.; Rosen, Bron C.; Baughn, Anthony D.
Antimicrobial Agents and Chemotherapy, 2014 , vol. 58, # 12 p. 7258 - 7263 Title/Abstract Full Text View citing articles Show Details
Ceruso, Mariangela; Antel, Sabrina; Vullo, Daniela; Scozzafava, Andrea; Supuran, Claudiu T.
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 24 p. 6768 - 6775 Title/Abstract Full Text View citing articles Show Details
Zhao, Hai-Yan; Ma, Jing-Jun; Han, Zhan-Gang; Yang, Xiao-Dong; Yang, Min-Li
Synthesis and Reactivity in Inorganic, Metal-Organic and Nano-Metal Chemistry, 2015 , vol. 45, # 4 p. 621 - 627 Title/Abstract Full Text View citing articles Show Details
Wang, Zhanhui; Sheng, Yajie; Duan, Hongxia; Yu, Qing; Shi, Weimin; Zhang, Suxia
RSC Advances, 2014 , vol. 4, # 96 p. 53788 - 53794 Title/Abstract Full Text View citing articles Show Details
BAYER PHARMA AKTIENGESELLSCHAFT; SCHULZE, Volker; LERCHEN, Hans-Georg; BIERER, Donald; WENGNER, Antje Margret; SIEMEISTER, Gerhard; LIENAU, Philip; KRENZ, Ursula; KOSEMUND, Dirk; STÖCKIGT, Detlef; BRÜNING, Michael; LÜCKING, Ulrich; TEREBESI, Ildikó
Patent: WO2014/198647 A2, 2014 ; Title/Abstract Full Text Show Details
Naito, Anna; Muchhala, Karan H.; Asatryan, Liana; Trudell, James R.; Homanics, Gregg E.; Perkins, Daya I.; Davies, Daryl L.; Alkana,
Ronald L.
Molecular Pharmacology, 2014 , vol. 86, # 6 p. 635 - 646 Title/Abstract Full Text View citing articles Show Details
THE CALIFORNIA INSTITUTE FOR BIOMEDICAL RESEARCH; SCHULTZ, Peter G.; CHATTERJEE, Arnab K.; KUMAR, Manoj; WELZEL, Gustav
Patent: WO2015/3083 A1, 2015 ; Title/Abstract Full Text Show Details
Liang, Tingfu; Wei, Feifei; Lu, Yi; Kodani, Yoshinori; Nakada, Mitsuhiko; Miyakawa, Takuya; Tanokura, Masaru
Journal of Agricultural and Food Chemistry, 2015 , vol. 63, # 2 p. 683 - 691 Title/Abstract Full Text View citing articles Show Details
103 of 992
104 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Jörg, Manuela; May, Lauren T.; Mak, Frankie S.; Lee, Kiew Ching K.; Miller, Neil D.; Scammells, Peter J.; Capuano, Ben
Journal of Medicinal Chemistry, 2015 , vol. 58, # 2 p. 718 - 738 Title/Abstract Full Text View citing articles Show Details
Thompson, Andrew J.; Verheij, Mark H.P.; Verbeek, Joost; Windhorst, Albert D.; De Esch, Iwan J.P.; Lummis, Sarah C.R.
Neuropharmacology, 2014 , vol. 86, p. 378 - 388 Title/Abstract Full Text View citing articles Show Details
Radwan; Aboul-Fadl; Al-Dhfyan; Abdel-Mageeda
Asian Journal of Chemistry, 2014 , vol. 26, # 23 p. 8145 - 8150 Title/Abstract Full Text View citing articles Show Details
Wicher, Grzegorz; Norlin, Maria
Journal of Steroid Biochemistry and Molecular Biology, 2015 , vol. 145, p. 21 - 27 Title/Abstract Full Text View citing articles Show Details
Fuchs, Alexander; Baur, Roland; Schoeder, Clara; Sigel, Erwin; Müller, Christa E.
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 24 p. 6908 - 6917 Title/Abstract Full Text View citing articles Show Details
Shtro, Anna A.; Zarubaev, Vladimir V.; Luzina, Olga A.; Sokolov, Dmitry N.; Kiselev, Oleg I.; Salakhutdinov, Nariman F.
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 24 p. 6826 - 6836 Title/Abstract Full Text View citing articles Show Details
Arkhipova, Maria; Eichel, Svetlana; Maas, Gerhard
RSC Advances, 2014 , vol. 4, # 99 p. 56506 - 56517 Title/Abstract Full Text View citing articles Show Details
Liu, Qi; Lu, Wenhua; Ma, Mingzhe; Liao, Jianwei; Ganesan; Hu, Yumin; Wen, Shijun; Huang, Peng
RSC Advances, 2015 , vol. 5, # 2 p. 1109 - 1112 Title/Abstract Full Text View citing articles Show Details
Tamura, Masazumi; Tamura, Riku; Takeda, Yasuyuki; Nakagawa, Yoshinao; Tomishige, Keiichi
Chemistry - A European Journal, 2015 , vol. 21, # 7 p. 3097 - 3107 Title/Abstract Full Text View citing articles Show Details
Shannon, Richard J.; Timofeev, Ivan; Nortje, Jürgens; Hutchinson, Peter J.; Carpenter, Keri L. H.
British Journal of Clinical Pharmacology, 2014 , vol. 78, # 5 p. 981 - 995 Title/Abstract Full Text View citing articles Show Details
Riva, Elena; Wilkening, Ina; Gazzola, Silvia; Li, W. M. Ariel; Smith, Luke; Leadlay, Peter F.; Tosin, Manuela
Angewandte Chemie - International Edition, 2014 , vol. 53, # 44 p. 11944 - 11949 Title/Abstract Full Text View citing articles Show Details
Matharu, Daljit S.; Flaherty, Daniel P.; Simpson, Denise S.; Schroeder, Chad E.; Chung, Donghoon; Yan, Dan; Noah, James W.; Jonsson, Colleen B.; White, E. Lucile; Aub, Jeffrey; Plemper, Richard K.; Severson, William E.; Golden, Jennifer E.
Journal of Medicinal Chemistry, 2014 , vol. 57, # 24 p. 10314 - 10328 Title/Abstract Full Text View citing articles Show Details
Blankenburg; Balfanz; Hayashi; Shigenobu; Miura; Baumann; Blenau
Neuropharmacology, 2015 , vol. 88, p. 134 - 144 Title/Abstract Full Text View citing articles Show Details
Atack, John R.; Shook, Brian C.; Rassnick, Stefanie; Jackson, Paul F.; Rhodes, Kenneth; Drinkenburg, Wilhelmus H.; Ahnaou, Abdallah; Te Riele, Paula; Langlois, Xavier; Hrupka, Brian; De Haes, Patrick; Hendrickx, Herman; Aerts, Nancy; Hens, Koen; Wellens, Annemie; Vermeire, Jef; Megens, Anton A. H. P.
ACS Chemical Neuroscience, 2014 , vol. 5, # 10 p. 1005 - 1019 Title/Abstract Full Text View citing articles Show Details
Kuriyama, Chiaki; Xu, Jun Zhi; Lee, Seunghun Paul; Qi, Jenson; Kimata, Hirotaka; Kakimoto, Tetsuhiro; Nakayama, Keiko; Watanabe, Yoshinori; Taniuchi, Nobuhiko; Hikida, Kumiko; Matsushita, Yasuaki; Arakawa, Kenji; Saito, Akira; Ueta, Kiichiro; Shiotani, Masaharu
Journal of Pharmacology and Experimental Therapeutics, 2014 , vol. 351, # 2 p. 423 - 431 Title/Abstract Full Text View citing articles Show Details
Nakornriab, Muntana
International Journal of Applied Chemistry, 2013 , vol. 9, # 2 p. 197 - 205 Title/Abstract Full Text View citing articles Show Details
Plech, Tomasz; Kapro, Barbara; Luszczki, Jarogniew J.; Paneth, Agata; Siwek, Agata; Kolaczkowski, Marcin; Zolnierek, Maria; Nowak, Gabriel
European Journal of Medicinal Chemistry, 2014 , vol. 86, p. 690 - 699 Title/Abstract Full Text View citing articles Show Details
He, Dian; Ma, Jing; Shi, Xiuxiao; Zhao, Chunyan; Hou, Meng; Guo, Qingxin; Ma, Shangxian; Li, Xiaojun; Zhao, Peicheng; Liu, Wenhu; Yang, Zhuqing; Mou, Jianping; Song, Pengfei; Zhang, Yang; Li, Jing
Chemical and Pharmaceutical Bulletin, 2014 , vol. 62, # 10 p. 967 - 978 Title/Abstract Full Text View citing articles Show Details
Carta, Valentina; Pangerl, Michael; Baur, Roland; Puthenkalam, Roshan; Ernst, Margot; Trauner, Dirk; Sigel, Erwin
PLoS ONE, 2014 , vol. 9, # 9 art. no. E106691 Title/Abstract Full Text View citing articles Show Details
Pal, Amrita; Dey, Joykrishna
Journal of Physical Chemistry B, 2014 , vol. 118, # 42 p. 12112 - 12120 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Kang, Hye Jin; Menlove, Kit; Ma, Jianpeng; Wilkins, Angela; Lichtarge, Olivier; Wensel, Theodore G.
Journal of Biological Chemistry, 2014 , vol. 289, # 43 p. 29961 - 29974 Title/Abstract Full Text View citing articles Show Details
Rasmussen, Allan D.; Truchot, Nathalie; Pickersgill, Nigel; Thale, Zia Irene; Rosolen, Serge G.; Botteron, Catherine
Experimental and Toxicologic Pathology, 2015 , vol. 67, # 1 p. 13 - 20 Title/Abstract Full Text View citing articles Show Details
Maggio, Marcello; De Vita, Francesca; Fisichella, Alberto; Colizzi, Elena; Provenzano, Sandra; Lauretani, Fulvio; Luci, Michele; Ceresini, Graziano; Dall'Aglio, Elisabetta; Caffarra, Paolo; Valenti, Giorgio; Ceda, Gian Paolo
Journal of Steroid Biochemistry and Molecular Biology, 2015 , vol. 145, p. 281 - 292 Title/Abstract Full Text View citing articles Show Details
Hill; Dušková; Stárka
Journal of Steroid Biochemistry and Molecular Biology, 2015 , vol. 145, p. 293 - 314 Title/Abstract Full Text View citing articles Show Details
Yamamoto, Rie; Okada, Youhei; Hirose, Jun; Koshika, Tadatsura; Kawato, Yuka; Maeda, Masashi; Saito, Rika; Hattori, Kazuyuki; Harada, Hironori; Nagasaka, Yasuhisa; Morokata, Tatsuaki
PLoS ONE, 2014 , vol. 9, # 10 art. no. E110819 Title/Abstract Full Text View citing articles Show Details
Potter, David E.; Choudhury, Mahua
Drug Discovery Today, 2015 , vol. 19, # 12 p. 1848 - 1854 Title/Abstract Full Text View citing articles Show Details
Jiang, Jianbing; Chen, Chih-Yuan; Zhang, Nuonuo; Vairaprakash, Pothiappan; Lindsey, Jonathan S.
New Journal of Chemistry, 2015 , vol. 39, # 1 p. 403 - 419 Title/Abstract Full Text View citing articles Show Details
Lima, Viner Sousa; Lemos, Sebastio S.; Casagrande, Gleison Antnio
Polyhedron, 2015 , vol. 89, p. 85 - 90 Title/Abstract Full Text View citing articles Show Details
Ordez; Sainz; Callejn; Troncoso; Torija; Garca-Parrilla
Food Chemistry, 2015 , vol. 178, p. 221 - 228 Title/Abstract Full Text View citing articles Show Details
McShane, Adam J.; Shen, Yuanyuan; Castillo, Mary Joan; Yao, Xudong
Journal of the American Society for Mass Spectrometry, 2014 , vol. 25, # 10 p. 1694 - 1704 Title/Abstract Full Text View citing articles Show Details
PARK, Chang-Seo; NAM, Sang-June; CHOI, Wang-Keun; PYUN, Yu-Ryang; CHO, Hyung-Yong; CHO, Seok-Cheol; KOOK, Moo-Chang; LEE, Chang-Woo; CHUNG, So-Young
Patent: US2015/44313 A1, 2015 ; Title/Abstract Full Text Show Details
BA lint, Erika; Fazekas, Eszter; KA ti, JA nos; Keglevich, GyA rgy
Heteroatom Chemistry, 2015 , vol. 26, # 1 p. 106 - 115 Title/Abstract Full Text View citing articles Show Details
Rizzuti, Antonino; Aguilera-Sez, Luis Manuel; Gallo, Vito; Cafagna, Isabella; Mastrorilli, Piero; Latronico, Mario; Pacifico, Andrea; Matarrese, Angela Maria Stella; Ferrara, Giuseppe
Food Chemistry, 2014 , vol. 171, p. 341 - 350 Title/Abstract Full Text View citing articles Show Details
Yoo, Seung-Hyun; Kim, Young-Wun; Shin, Jihoon; Kim, Nam-Kyun; Kim, Joon-Seop
Bulletin of the Korean Chemical Society, 2015 , vol. 36, # 1 p. 346 - 355 Title/Abstract Full Text View citing articles Show Details
O'Brien, Kevin T.; Noto, Joseph G.; Nichols-O'Neill, Luke; Perez, Lark J.
ACS Medicinal Chemistry Letters, 2015 , vol. 6, # 2 p. 162 - 167 Title/Abstract Full Text View citing articles Show Details
Zahmanov, Georgi; Alipieva, Kalina; Simova, Svetlana; Georgiev, Milen I.
Phytochemistry Letters, 2015 , vol. 11, p. 404 - 409 Title/Abstract Full Text View citing articles Show Details
Oukhatar, Fatima; Mme, Sandra; Mme, William; Szeremeta, Frdric; Logothetis, Nikos K.; Angelovski, Goran; Tth, va
ACS Chemical Neuroscience, 2015 , vol. 6, # 2 p. 219 - 225 Title/Abstract Full Text View citing articles Show Details
Cadaha, Estrella; De Simn, Brgida Fernndez; Aranda, Ismael; Sanz, Miriam; Snchez-Gmez, David; Pinto, Ernani
Phytochemical Analysis, 2015 , vol. 26, # 2 p. 171 - 182 Title/Abstract Full Text View citing articles Show Details
Cicero, Nicola; Corsaro, Carmelo; Salvo, Andrea; Vasi, Sebastiano; Giofr, Salvatore V.; Ferrantelli, Vincenzo; Di Stefano, Vita; Mallamace, Domenico; Dugo, Giacomo
Natural Product Research, 2015 , vol. 29, # 20 p. 1894 - 1902 Title/Abstract Full Text View citing articles Show Details
Babateen, Omar; Jin, Zhe; Bhandage, Amolk.; Korol, Sergiy V.; Westermark, Bengt; Forsberg Nilsson, Karin; Uhrbom, Lene; Smits, Anja; Birnir, Bryndis
European Journal of Pharmacology, 2015 , vol. 748, p. 101 - 107 Title/Abstract Full Text View citing articles Show Details
105 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Dionisio, Leonardo; BergA©, Ignacio; Bravo, MatA as; Del Carmen Esandi, MarA a; Bouzat, Cecilia
Molecular Pharmacology, 2015 , vol. 87, # 3 p. 391 - 400 Title/Abstract Full Text View citing articles Show Details
Hillier, Michael C.; Gong, Hai-Hua; Clyne, Dean S.; Babcock, Martin J.
Tetrahedron, 2014 , vol. 70, # 49 p. 9413 - 9420 Title/Abstract Full Text View citing articles Show Details
Lim, See Meng; Goh, Yong Meng; Kuan, Wen Bin; Loh, Su Peng
Lipids in Health and Disease, 2014 , vol. 13, # 1 art. no. 169 Title/Abstract Full Text View citing articles Show Details
FLUROSOL INDUSTRIES PTY LTD; FALBER, Alexander
Patent: WO2015/24064 A1, 2015 ; Title/Abstract Full Text Show Details
Huynh, Thuan G.; Cuny, Hartmut; Slesinger, Paul A.; Adams, David J.
Molecular Pharmacology, 2015 , vol. 87, # 2 p. 240 - 250 Title/Abstract Full Text View citing articles Show Details
Journigan, V. Blair; Msangeau, Christophe; Vyas, Neha; Eans, Shainnel O.; Cutler, Stephen J.; McLaughlin, Jay P.; Mollereau, Catherine; McCurdy, Christopher R.
Journal of Medicinal Chemistry, 2014 , vol. 57, # 21 p. 8903 - 8927 Title/Abstract Full Text View citing articles Show Details
Nuyts, Koen; Ceulemans, Matthias; Parac-Vogt, Tatjana N.; Bultynck, Geert; De Borggraeve, Wim M.
Tetrahedron Letters, 2015 , vol. 56, # 13 p. 1687 - 1690 Title/Abstract Full Text View citing articles Show Details
Misra, Sweta; Singh, Lav Kumar; Priyanka; Gupta, Jyoti; Misra-Bhattacharya, Shailja; Katiyar, Diksha
European Journal of Medicinal Chemistry, 2015 , vol. 94, art. no. 7725, p. 211 - 217 Title/Abstract Full Text View citing articles Show Details
You, Hyun; Yoon, Hyo-Eun; Jeong, Pyeong-Hwa; Ko, Hyojin; Yoon, Jung-Hoon; Kim, Yong-Chul
Bioorganic and Medicinal Chemistry, 2015 , vol. 23, # 7 p. 1453 - 1462 Title/Abstract Full Text View citing articles Show Details
Korzycka, Karolina A.; Bennett, Philip M.; Cueto-Diaz, Eduardo Jose; Wicks, Geoffrey; Drobizhev, Mikhail; Blanchard-Desce, Mireille; Rebane, Aleksander; Anderson, Harry L.
Chemical Science, 2015 , vol. 6, # 4 p. 2419 - 2426 Title/Abstract Full Text View citing articles Show Details
Burton, Aaron S.; Mclain, Hannah; Glavin, Daniel P.; Elsila, Jamie E.; Davidson, Jemma; Miller, Kelly E.; Andronikov, Alexander V.; Lauretta, Dante; Dworkin, Jason P.
Meteoritics and Planetary Science, 2015 , vol. 50, # 3 p. 470 - 482 Title/Abstract Full Text View citing articles Show Details
Soyka; Lieb
Pharmacopsychiatry, 2015 , vol. 48, # 4-5 p. 123 - 135 Title/Abstract Full Text View citing articles Show Details
Singh, Lav Kumar; Priyanka; Singh, Vineeta; Katiyar, Diksha
Medicinal Chemistry, 2015 , vol. 11, # 2 p. 128 - 134 Title/Abstract Full Text View citing articles Show Details
Li; Bracamontes; Manion; Mennerick; Steinbach; Evers; Akk
British Journal of Pharmacology, 2014 , vol. 171, # 23 p. 5446 - 5457 Title/Abstract Full Text View citing articles Show Details
Shumilina, Elena; Ciampa, Alessandra; Capozzi, Francesco; Rustad, Turid; Dikiy, Alexander
Food Chemistry, 2015 , vol. 184, p. 12 - 22 Title/Abstract Full Text View citing articles Show Details
Taherzadeh; Esmaeili; Rabbani
Journal of Babol University of Medical Sciences, 2014 , vol. 16, # 8 p. 46 - 56 Title/Abstract Full Text View citing articles Show Details
Hammer, Harriet; Ebert, Bjarke; Jensen, Henrik Sindal; Jensen, Anders A.
PLoS ONE, 2015 , vol. 10, # 3 art. no. E0120239 Title/Abstract Full Text View citing articles Show Details
Rodpun, Kiattipoom; Blackman, Allan G.; Gardiner, Michael G.; Tan, Eng Wui; Meledandri, Carla J.; Lucas, Nigel T.
CrystEngComm, 2015 , vol. 17, # 15 p. 2974 - 2988 Title/Abstract Full Text View citing articles Show Details
Grün, Alajos; Kovcs, Rita; Garadnay, Sndor; Greiner, Istvn; Keglevich, György
Letters in Drug Design and Discovery, 2015 , vol. 12, # 4 p. 253 - 258 Title/Abstract Full Text View citing articles Show Details
Ma, Chunying; Chen, Huan; Li, Chao; Zhang, Jin; Qiao, Renzhong
Organic and Biomolecular Chemistry, 2015 , vol. 13, # 15 p. 4524 - 4531 Title/Abstract Full Text View citing articles Show Details
106 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Chauhan, Anjali; Sharma, Uma; Jagannathan, Naranamangalam R.; Gupta, Yogendra Kumar
European Journal of Pharmacology, 2015 , vol. 757, p. 28 - 33 Title/Abstract Full Text View citing articles Show Details
Burton, Aaron S.; Glavin, Daniel P.; Elsila, Jamie E.; Dworkin, Jason P.; Jenniskens, Peter; Yin, Qing-Zhu
Meteoritics and Planetary Science, 2014 , vol. 49, # 11 p. 2074 - 2086 Title/Abstract Full Text View citing articles Show Details
Bingol, Kerem; Bruschweiler-Li, Lei; Yu, Cao; Somogyi, Arpad; Zhang, Fengli; Brüschweiler, Rafael
Analytical Chemistry, 2015 , vol. 87, # 7 p. 3864 - 3870 Title/Abstract Full Text View citing articles Show Details
Dockendorff, Chris; Faloon, Patrick W.; Yu, Miao; Youngsaye, Willmen; Penman, Marsha; Nieland, Thomas J. F.; Nag, Partha P.; Lewis, Timothy A.; Pu, Jun; Bennion, Melissa; Negri, Joseph; Paterson, Conor; Lam, Garrett; Dandapani, Sivaraman; Perez, Jos R.; Munoz, Benito; Palmer, Michelle A.; Schreiber, Stuart L.; Krieger, Monty
ACS Medicinal Chemistry Letters, 2015 , vol. 6, # 4 p. 375 - 380 Title/Abstract Full Text View citing articles Show Details
Sharma, Krishna K.; Sharma, Swagat; Kudwal, Anurag; Jain, Rahul
Organic and Biomolecular Chemistry, 2015 , vol. 13, # 16 p. 4637 - 4641 Title/Abstract Full Text View citing articles Show Details
Garad, Sudhakar; Jain, Akash; Hwang, You Seok
Patent: US2015/111864 A1, 2015 ; Title/Abstract Full Text Show Details
Fekete, Christopher D.; Chiou, Tzu-Ting; Miralles, Celia P.; Harris, Rachel S.; Fiondella, Christopher G.; Loturco, Joseph J.; De Blas, Angel L. Journal of Comparative Neurology, 2015 , vol. 523, # 9 p. 1359 - 1378 Title/Abstract Full Text View citing articles Show Details
Zhang, Rui; Liu, Kechang; Cui, Yongliang; Zhang, Wei; He, Lishan; Guo, Suoqin; Chen, Yuanyuan; Li, Qing X.; Liu, Shangzhong; Wang, Baomin
RSC Advances, 2015 , vol. 5, # 45 p. 35874 - 35881 Title/Abstract Full Text View citing articles Show Details
Miao, Wangen; Yang, Dong; Liu, Minghua
Chemistry - A European Journal, 2015 , vol. 21, # 20 p. 7562 - 7570 Title/Abstract Full Text View citing articles Show Details
He, Jingjing; Luo, Zhigang; Huang, Lan; He, Jiuming; Chen, Yi; Rong, Xianfang; Jia, Shaobo; Tang, Fei; Wang, Xiaohao; Zhang, Ruiping; Zhang, Jianjun; Shi, Jiangong; Abliz, Zeper
Analytical Chemistry, 2015 , vol. 87, # 10 p. 5372 - 5379 Title/Abstract Full Text View citing articles Show Details
Ferl, Sandra; Wunderlich, Gerd; Smits, Ren; Hoepping, Alexander; Naumann, Anne; Kotzerke, Jörg
MedChemComm, 2015 , vol. 6, # 5 p. 887 - 897 Title/Abstract Full Text View citing articles Show Details
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
Gref, Ruxandra; Agostoni, Valentina; Daoud-Mahammed, Samia; Rodriguez-Ruiz, Violeta; Malanga, Milo; Jicsinszky, Laszlo; HorcajadaCortes, Patricia; Serre, Christian
Patent: US2015/150981 A1, 2015 ; Title/Abstract Full Text Show Details
Hirano, Minoru
Patent: US2015/164762 A1, 2015 ; Title/Abstract Full Text Show Details
Liu, Tai-Ti; Tseng, Yi-Wei; Yang, Tsung-Shi
Food Chemistry, 2015 , vol. 190, p. 1102 - 1108 Title/Abstract Full Text View citing articles Show Details
Ekeanyanwu, Raphael Chukwuma; Njoku, Obioma Uzoma
Chinese Journal of Natural Medicines, 2015 , vol. 13, # 3 p. 183 - 191 Title/Abstract Full Text View citing articles Show Details
Hörner; Uth; Avrutina; Frauendorf; Wiessler; Kolmar
Chemical Communications, 2015 , vol. 51, # 55 p. 11130 - 11133 Title/Abstract Full Text View citing articles Show Details
Yang, Runqiang; Wang, Shufang; Yin, Yongqi; Gu, Zhenxin
Chilean Journal of Agricultural Research, 2015 , vol. 75, # 2 p. 184 - 191 Title/Abstract Full Text View citing articles Show Details
Song, Qingqing; Song, Yuelin; Zhang, Na; Li, Jun; Jiang, Yong; Zhang, Kerong; Zhang, Qian; Tu, Pengfei
RSC Advances, 2015 , vol. 5, # 71 p. 57372 - 57382 Title/Abstract Full Text View citing articles Show Details
Cano, Mercedes; Calonge, Mara L.; Ilundin, Anunciacin A.
Biochimica et Biophysica Acta - Biomembranes, 2015 , vol. 1848, # 10 p. 2172 - 2179 Title/Abstract Full Text View citing articles Show Details
107 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Lee, Sunmin; Seo, Min-Ho; Oh, Deok-Kun; Lee, Choong Hwan
Bioscience, Biotechnology and Biochemistry, 2014 , vol. 78, # 1 p. 167 - 174 Title/Abstract Full Text View citing articles Show Details
Oda, Kohei; Imanishi, Takanori; Yamane, Yoshito; Ueno, Yoshie; Mori, Yoshiharu
Bioscience, Biotechnology and Biochemistry, 2014 , vol. 78, # 5 p. 882 - 890 Title/Abstract Full Text View citing articles Show Details
Borisova; Pozdnyakova; Shaitanova; Gerus; Dudarenko; Mironets; Haufe; Kukhar
Bioorganic and Medicinal Chemistry, 2015 , vol. 23, # 15 p. 4316 - 4323 Title/Abstract Full Text View citing articles Show Details
Waszkielewicz, Anna M.; Cegla, Marek; Zeslawska, Ewa; Nitek, Wojciech; Sloczyska, Karolina; Marona, Henryk
Bioorganic and Medicinal Chemistry, 2015 , vol. 23, # 15 p. 4197 - 4217 Title/Abstract Full Text View citing articles Show Details
Kaji, Mark D; Kwaka, Ariel; Callanan, Micah K; Nusrat, Humza; Desaulniers, Jean-Paul; Forrester, Sean G
British Journal of Pharmacology, 2015 , vol. 172, # 15 p. 3737 - 3747 Title/Abstract Full Text View citing articles Show Details
Liu, Genyan; Ozoe, Fumiyo; Furuta, Kenjiro; Ozoe, Yoshihisa
Journal of Agricultural and Food Chemistry, 2015 , vol. 63, # 28 p. 6304 - 6312 Title/Abstract Full Text View citing articles Show Details
EGIS GYÓGYSZERGYÁR ZRT.; KENÉZ, Ágnes; BERTHA, Ferenc; BARKÓCZY, József; ANTONI, Ferenc; GACSÁLYI, István; MIHALIK, Balázs; GIGLER, Gábor; MÓRICZ, Krisztina; NÉMETH, Gábor; ANGYALNÉ PATAKI, Ágnes; KAPUS, Gábor László; PÁLVÖLGYI, Adrienn; LING, István; PETHŐ, János; SIMIG, Gyula; VOLK, Balázs; KOVÁNYINÉ, Lax Györgyi; DANCSÓ, András
Patent: WO2015/110848 A1, 2015 ; Title/Abstract Full Text Show Details
Adhikary, Nirmal Das; Kwon, Sunjeong; Chung, Wook-Jin; Koo, Sangho
Journal of Organic Chemistry, 2015 , vol. 80, # 15 p. 7693 - 7701 Title/Abstract Full Text View citing articles Show Details
Haldar, Saubhik; Karmakar, Koninika
RSC Advances, 2015 , vol. 5, # 81 p. 66339 - 66354 Title/Abstract Full Text View citing articles Show Details
Naresh Chary; Sudarshana Reddy; Kumar, Ch. Dinesh; Srinivas; Prabhakar
Journal of Mass Spectrometry, 2015 , vol. 50, # 5 p. 771 - 781 Title/Abstract Full Text View citing articles Show Details
Trailovi, Saa M.; Marjanovi, Djordje S.; Nedeljkovi Trailovi, Jelena; Robertson, Alan P.; Martin, Richard J.
Parasitology Research, 2015 , vol. 114, # 8 p. 3059 - 3068 Title/Abstract Full Text View citing articles Show Details
Priyadarshani, Nilusha; Ginovska, Bojana; Bays, J. Timothy; Linehan, John C.; Shaw, Wendy J.
Dalton Transactions, 2015 , vol. 44, # 33 p. 14854 - 14864 Title/Abstract Full Text View citing articles Show Details
Alves Filho, Elenilson G.; Sartori, Luci; Silva, Lorena M. A.; Silva, Bianca F.; Fadini, Pedro S.; Soong, Ronald; Simpson, Andre; Ferreira, Antonio G.
Magnetic Resonance in Chemistry, 2015 , vol. 53, # 9 p. 704 - 710 Title/Abstract Full Text View citing articles Show Details
Vagapova; Fakhertdinova; Burilov; Pudovik
Russian Journal of General Chemistry, 2015 , vol. 85, # 7 p. 1783 - 1785 Zh. Obshch. Khim., 2015 , vol. 85, # 7 p. 1221 - 1223,3 Title/Abstract Full Text View citing articles Show Details
Yu, Xinyu; Luo, Jia; Chen, Lijun; Zhang, Chengxiang; Zhang, Rutan; Hu, Qi; Qiao, Shanlei; Li, Lei
RSC Advances, 2015 , vol. 5, # 85 p. 69800 - 69812 Title/Abstract Full Text View citing articles Show Details
Hammer, Harriet; Bader, Benjamin M.; Ehnert, Corina; Bundgaard, Christoffer; Bunch, Lennart; Hoestgaard-Jensen, Kirsten; Schroeder, Olaf H.-U.; Bastlund, Jesper F.; Gramowski-Voss, Alexandra; Jensen, Anders A.
Molecular Pharmacology, 2015 , vol. 88, # 2 p. 401 - 420 Title/Abstract Full Text View citing articles Show Details
Li, Ping; Akk, Gustav
Molecular Pharmacology, 2015 , vol. 87, # 5 p. 776 - 781 Title/Abstract Full Text View citing articles Show Details
Schmitt, Sebastian; Höfner, Georg; Wanner, Klaus T.
ChemMedChem, 2015 , vol. 10, # 9 p. 1498 - 1510 Title/Abstract Full Text View citing articles Show Details
Benyettou; Rezgui; Ravaux; Jaber; Blumer; Jouiad; Motte; Olsen; Platas-Iglesias; Magzoub; Trabolsi
Journal of Materials Chemistry B, 2015 , vol. 3, # 36 p. 7237 - 7245 Title/Abstract Full Text View citing articles Show Details
Snell, Heather D.; Gonzales, Eric B.
Journal of Pharmacology and Experimental Therapeutics, 2015 , vol. 353, # 3 p. 551 - 559 Title/Abstract Full Text View citing articles Show Details
108 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Kudryavtsev, Denis S.; Shelukhina, Irina V.; Son, Lina V.; Ojomoko, Lucy O.; Kryukova, Elena V.; Lyukmanova, Ekaterina N.; Zhmak, Maxim N.; Dolgikh, Dmitry A.; Ivanov, Igor A.; Kasheverov, Igor E.; Starkov, Vladislav G.; Ramerstorfer, Joachim; Sieghart, Werner; Tsetlin, Victor I.; Utkin, Yuri N.
Journal of Biological Chemistry, 2015 , vol. 290, # 37 p. 22747 - 22758 Title/Abstract Full Text View citing articles Show Details
KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY; Lee, Changjoon Justin; Lee, Soo-Jung; Yoon, Bo-Eun
Patent: US9095535 B2, 2015 ; Title/Abstract Full Text Show Details
Kandula, Mahesh
Patent: US9096537 B1, 2015 ; Title/Abstract Full Text Show Details
PROMEGA CORPORATION; MUSTAFA, Dana; ZHOU, Wenhui; MEISENHERMIER, Poncho; DUELLMAN, Sarah; MA, Dongping; CALI, James, J.
Patent: WO2015/116867 A1, 2015 ; Title/Abstract Full Text Show Details
UMECRINE COGNITION AB; DOVERSKOG, Magnus; MÖHLER, Hanns; FELIPO, Vicente; BÄCKSTRÖM, Torbjörn
Patent: WO2015/114308 A1, 2015 ; Title/Abstract Full Text Show Details
Khudina; Ivanova; Burgart; Saloutin
Chemistry of Heterocyclic Compounds, 2014 , vol. 50, # 6 p. 901 - 906 Khim. Geterotsikl. Soedin., 2014 , vol. 50, # 6 p. 976 - 982,7 Title/Abstract Full Text Show Details
Hosseinkhani, Batool; Islami, Mohammad Reza; Hosseinkhani, Saman
Synlett, 2015 , vol. 26, # 16 art. no. ST-2015-D0387-L, p. 2277 - 2279 Title/Abstract Full Text View citing articles Show Details
Damgaard, Maria; Al-Khawaja, Anas; Vogensen, Stine B.; Jurik, Andreas; Sijm, Maarten; Lie, Maria E. K.; Baek, Mathias I.; Rosenthal, Emil; Jensen, Anders A.; Ecker, Gerhard F.; Frolund, Bente; Wellendorph, Petrine; Clausen, Rasmus P.
ACS Chemical Neuroscience, 2015 , vol. 6, # 9 p. 1591 - 1599 Title/Abstract Full Text View citing articles Show Details
Tone, Junichi; Yoshimura, Ayumi; Manabe, Kunio; Murao, Nami; Sekito, Takayuki; Kawano-Kawada, Miyuki; Kakinuma, Yoshimi
Bioscience, Biotechnology and Biochemistry, 2015 , vol. 79, # 5 p. 782 - 789 Title/Abstract Full Text View citing articles Show Details
Yuen, Tsz-Ying; Eaton, Samantha E.; Woods, Tom M.; Furkert, Daniel P.; Choi, Ka Wai; Brimble, Margaret A.
European Journal of Organic Chemistry, 2014 , vol. 2014, # 7 p. 1431 - 1437 Title/Abstract Full Text Show Details
Evrogen Joint Stock Company; Yampolsky, Ilia Victorovich; Lukyanov, Konstantin Anatolyevich; Baranov, Mikhail Sergeyevich
Patent: US9133220 B2, 2015 ; Title/Abstract Full Text Show Details
Aloysius, Herve; Hu, Longqin
Chemical Biology and Drug Design, 2015 , vol. 86, # 4 p. 837 - 848 Title/Abstract Full Text View citing articles Show Details
Warminski, Marcin; Warminska, Zofia; Kowalska, Joanna; Jemielity, Jacek
European Journal of Organic Chemistry, 2015 , vol. 2015, # 28 p. 6153 - 6159 Title/Abstract Full Text View citing articles Show Details
Hoggard, Logan R.; Zhang, Yongqiang; Zhang, Min; Panic, Vanja; Wisniewski, John A.; Ji, Haitao
Journal of the American Chemical Society, 2015 , vol. 137, # 38 p. 12249 - 12260 Title/Abstract Full Text View citing articles Show Details
Hu, Xiao-Xiao; Su, Yue-Ting; Ma, Yun-Wei; Zhan, Xin-Qi; Zheng, Hong; Jiang, Yun-Bao
Chemical Communications, 2015 , vol. 51, # 82 p. 15118 - 15121 Title/Abstract Full Text View citing articles Show Details
Jayakar, Selwyn S.; Zhou, Xiaojuan; Savechenkov, Pavel Y.; Chiara, David C.; Desai, Rooma; Bruzik, Karol S.; Miller, Keith W.; Cohen, Jonathan B.
Journal of Biological Chemistry, 2015 , vol. 290, # 38 p. 23432 - 23446 Title/Abstract Full Text View citing articles Show Details
Bernaskova, Marketa; Schoeffmann, Angela; Schuehly, Wolfgang; Hufner, Antje; Baburin, Igor; Hering, Steffen
Bioorganic and Medicinal Chemistry, 2015 , vol. 23, # 20 p. 6757 - 6762 Title/Abstract Full Text View citing articles Show Details
Han, Jin; Wan, Hai-Tong; Yang, Jie-Hong; Zhang, Yu-Yan; Ge, Li-Jun; Bie, Xiao-Dong
Journal of Asian Natural Products Research, 2014 , vol. 16, # 11 p. 1060 - 1067 Title/Abstract Full Text View citing articles Show Details
Radley, Jason J.; Sawchenko, Paul E.
Journal of Comparative Neurology, 2015 , vol. 523, # 18 p. 2769 - 2787 Title/Abstract Full Text View citing articles Show Details
Choy Buentello, David; Bishop, Deborah C.; Oliver, Douglas L.
Journal of Comparative Neurology, 2015 , vol. 523, # 18 p. 2683 - 2697 Title/Abstract Full Text View citing articles Show Details
109 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Mart, Almudena; Costero, Ana M.; Gavia, Pablo; Parra, Margarita
European Journal of Organic Chemistry, 2015 , vol. 2015, # 30 p. 6597 - 6601 Title/Abstract Full Text View citing articles Show Details
Brel; Lisina; Budaeva, Yu. N.; Popov
Russian Journal of General Chemistry, 2015 , vol. 85, # 9 p. 2200 - 2202 Zh. Obshch. Khim., 2015 , vol. 85, # 9 p. 1561 - 1563 Title/Abstract Full Text View citing articles Show Details
HOFFMANN-LA ROCHE INC.; Guo, Lei; Hu, Taishan; Kou, Buyu; Lin, Xianfeng; Shen, Hong; Shi, Houguang; Yan, Shixiang; Zhang, Weixing; Zhang, Zhisen; Zhou, Mingwei; Zhu, Wei
Patent: US2015/252057 A1, 2015 ; Title/Abstract Full Text Show Details
Oppici, Elisa; Montioli, Riccardo; Dindo, Mirco; MacCari, Laura; Porcari, Valentina; Lorenzetto, Antonio; Chellini, Sara; Voltattorni, Carla Borri; Cellini, Barbara
ACS Chemical Biology, 2015 , vol. 10, # 10 p. 2227 - 2236 Title/Abstract Full Text View citing articles Show Details
Takeda Pharmaceutical Company Limited; ASAMI, Taiji; NISHIZAWA, Naoki; NIIDA, Ayumu; ADACHI, Yusuke
Patent: EP2450374 B1, 2015 ; Title/Abstract Full Text Show Details
The Trustees of Princeton University; Shi, Diana; Wang, Samuel; Semmelhack, Martin
Patent: US2015/266809 A1, 2015 ; Title/Abstract Full Text Show Details
Servillo, Luigi; Giovane, Alfonso; Casale, Rosario; Balestrieri, Maria Luisa; Cautela, Domenico; Paolucci, Marina; Siano, Francesco; Volpe, Maria Grazia; Castaldo, Domenico
Food Chemistry, 2016 , vol. 196, p. 1301 - 1309 Title/Abstract Full Text View citing articles Show Details
Klinger, Felicia; Bajric, Mirnes; Salzer, Isabella; Dorostkar, Mario M.; Khan, Deeba; Pollak, Daniela D.; Kubista, Helmut; Boehm, Stefan; Koenig, Xaver
British Journal of Pharmacology, 2015 , vol. 172, # 20 p. 4946 - 4958 Title/Abstract Full Text View citing articles Show Details
THE GENERAL HOSPITAL CORPORATION; ANNOVATION BIOPHARMA, LLC; Raines, Douglas E.; Husain, Syed Shaukat; Randle, John C. R.
Patent: US9156825 B2, 2015 ; Title/Abstract Full Text Show Details
Oukhatar, Fatima; Meudal, Herv; Landon, Cline; Logothetis, Nikos K.; Platas-Iglesias, Carlos; Angelovski, Goran; Tth, va
Chemistry - A European Journal, 2015 , vol. 21, # 31 p. 11226 - 11237 Title/Abstract Full Text View citing articles Show Details
Taylor-Wells, Jennina; Brooke, Basil D.; Bermudez, Isabel; Jones, Andrew K.
Journal of Neurochemistry, 2015 , vol. 135, # 4 p. 705 - 713 Title/Abstract Full Text View citing articles Show Details
Wagner, Michel; Ohlund, Leanne B.; Shiao, Tze Chieh; Vzina, Amlie; Annabi, Borhane; Roy, Ren; Sleno, Lekha
Rapid Communications in Mass Spectrometry, 2015 , vol. 29, # 18 p. 1632 - 1640 Title/Abstract Full Text View citing articles Show Details
Scafuri, Antonio; Vivani, Riccardo; Carniato, Fabio; Tei, Lorenzo; Botta, Mauro; Taddei, Marco; Costantino, Ferdinando
Dalton Transactions, 2015 , vol. 44, # 44 p. 19072 - 19075 Title/Abstract Full Text View citing articles Show Details
Güngör, Özlem Özdemir Nee; Gürkan, Perihan; Özelik, Berrin; Oyardi, Özlem
Journal of Molecular Structure, 2016 , vol. 1106, p. 181 - 191 Title/Abstract Full Text View citing articles Show Details
Zhang, Ai-Hui; Ji, Xiao-Jun; Wu, Wen-Jia; Ren, Lu-Jing; Yu, Ya-Dong; Huang, He
Journal of Agricultural and Food Chemistry, 2015 , vol. 63, # 44 p. 9812 - 9819 Title/Abstract Full Text View citing articles Show Details
Global Blood Therapeutics, Inc.; Li, Zhe; Xu, Qing; Yu, Chul; Yee, Calvin; Gwaltney,, II, Stephen L.; Metcalf, Brian W.; Richards, Steven; Lardy, Matthew A.; Setti, Lina; Sham, Hing
Patent: US2015/315198 A1, 2015 ; Title/Abstract Full Text Show Details
Dai, Zi-Ru; Ge, Guang-Bo; Feng, Lei; Ning, Jing; Hu, Liang-Hai; Jin, Qiang; Wang, Dan-Dan; Lv, Xia; Dou, Tong-Yi; Cui, Jing-Nan; Yang, Ling
Journal of the American Chemical Society, 2015 , vol. 137, # 45 p. 14488 - 14495 Title/Abstract Full Text View citing articles Show Details
Yoneyama, Fuminori; Yamamoto, Mayumi; Hashimoto, Wataru; Murata, Kousaku
Bioengineered, 2015 , vol. 6, # 4 p. 209 - 217 Title/Abstract Full Text View citing articles Show Details
Weingarten, Adam S.; Kazantsev, Roman V.; Palmer, Liam C.; Fairfield, Daniel J.; Koltonow, Andrew R.; Stupp, Samuel I.
Journal of the American Chemical Society, 2015 , vol. 137, # 48 p. 15241 - 15246 Title/Abstract Full Text View citing articles Show Details
Chua, Han Chow; Absalom, Nathan L.; Hanrahan, Jane R.; Viswas, Raja; Chebib, Mary
PLoS ONE, 2015 , vol. 10, # 10 art. no. E0141359 Title/Abstract Full Text View citing articles Show Details
110 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Vaid, Radhe K.; Boini, Sathish K.; Alt, Charles A.; Spitler, Jeremy T.; Hadden, Chad E.; Frank, Scott A.; Moher, Eric D.
Synthesis (Germany), 2014 , vol. 46, # 18 art. no. SS-2014-M0164-OP, p. 2463 - 2470 Title/Abstract Full Text Show Details
Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V.; WALDMANN, Herbert, Prof. Dr.
Patent: EP2955182 A1, 2015 ; Title/Abstract Full Text Show Details
Weingarten, Carol P.; Sundman, Mark H.; Hickey, Patrick; Chen, Nan-kuei
Neuroscience and Biobehavioral Reviews, 2015 , vol. 59, p. 16 - 52 Title/Abstract Full Text View citing articles Show Details
Hu, Xiu-Ti
Current Drug Targets, 2016 , vol. 17, # 1 p. 4 - 14 Title/Abstract Full Text View citing articles Show Details
Sharma, Seema; Saxena, Dharmesh C.; Riar, Charanjit S.
Food Bioscience, 2016 , vol. 13, p. 60 - 68 Title/Abstract Full Text View citing articles Show Details
Collier, Zachary A.; Gust, Kurt A.; Gonzalez-Morales, Benette; Gong, Ping; Wilbanks, Mitchell S.; Linkov, Igor; Perkins, Edward J.
Regulatory Toxicology and Pharmacology, 2016 , vol. 75, p. 46 - 57 Title/Abstract Full Text View citing articles Show Details
Zaccara, Gaetano; Schmidt, Dieter
Pharmacological Research, 2016 , vol. 104, p. 38 - 48 Title/Abstract Full Text View citing articles Show Details
Shan, Timin; Jin, Peng; Zhang, Yu; Huang, Yuping; Wang, Xiaoli; Zheng, Yonghua
Postharvest Biology and Technology, 2016 , vol. 114, p. 104 - 110 Title/Abstract Full Text View citing articles Show Details
Butt; Ashraf; Porter; Zhang
Neuroscience, 2016 , vol. 316, p. 41 - 52 Title/Abstract Full Text View citing articles Show Details
Alkuraishy, Hayder M.; Algareeb, Ali I.; Albuhadilly, Ali K.; Almgoter, Basim M.
Current Psychopharmacology, 2014 , vol. 3, # 2 p. 87 - 92 Title/Abstract Full Text Show Details
Kanceva; Stárka; Kancheva; Hill; Veliková; Havrdová
Physiological Research, 2015 , vol. 64, p. S247 - S254 Title/Abstract Full Text View citing articles Show Details
Bedse, Gaurav; Romano, Adele; Tempesta, Bianca; Lavecchia, Michele A.; Pace, Lorenzo; Bellomo, Antonello; Duranti, Andrea; Micioni Di Bonaventura, Maria V.ittoria; Cifani, Carlo; Cassano, Tommaso; Gaetani, Silvana
Journal of neuroscience research, 2015 , vol. 93, # 5 p. 777 - 787 Title/Abstract Full Text Show Details
Brooks, Justin M.; Carrillo, Gabriela L.; Su, Jianmin; Lindsay, David S.; Fox, Michael A.; Blader, Ira J.
mBio, 2015 , vol. 6, # 6 art. no. E01428-15 Title/Abstract Full Text View citing articles Show Details
Gao, Chunxu; Major, Angela; Rendon, David; Lugo, Monica; Jackson, Vanessa; Shi, Zhongcheng; Mori-Akiyama, Yuko; Versalovic, James
mBio, 2015 , vol. 6, # 6 art. no. E01358-15 Title/Abstract Full Text View citing articles Show Details
Ohashi, Masayuki; Hirano, Toru; Watanabe, Kei; Katsumi, Keiichi; Ohashi, Nobuko; Baba, Hiroshi; Endo, Naoto; Kohno, Tatsuro
Journal of Physiology, 2016 , vol. 594, # 1 p. 115 - 134 Title/Abstract Full Text View citing articles Show Details
Chung, Namhyeok; Jo, Yunhee; Gao, Yaping; Gu, Song-Yi; Jeong, Yong-Jin; Kwon, Joong-Ho
Journal of the Korean Society of Food Science and Nutrition, 2015 , vol. 44, # 12 p. 1799 - 1805 Title/Abstract Full Text View citing articles Show Details
Pérez-Míguez, Raquel; Marina, María Luisa; Castro-Puyana, María
Journal of Chromatography A, 2016 , vol. 1428, p. 97 - 114 Title/Abstract Full Text View citing articles Show Details
Lemos; Rial; Gonçalves; Pires; Silva; Matheus; da Silva; Marques; Rodrigues; Jarak; Prediger; Reis; Carvalho; Pereira; Cunha
Neuroscience, 2016 , vol. 315, p. 196 - 205 Title/Abstract Full Text View citing articles Show Details
Enoch, Mary-Anne; Hodgkinson, Colin A.; Shen, Pei-Hong; Gorodetsky, Elena; Marietta, Cheryl A.; Roy, Alec; Goldman, David
Alcoholism: Clinical and Experimental Research, 2016 , vol. 40, # 1 p. 93 - 101 Title/Abstract Full Text View citing articles Show Details
Le Feuvre; Fricker; Leresche
Journal of Physiology, 1997 , vol. 502, # 1 p. 91 - 104 Title/Abstract Full Text Show Details
111 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Sakhautdinov; Gumerov; Gibadullina; Zakir'Yanova; Yunusov
Chemistry of Natural Compounds, 2015 , vol. 51, # 2 p. 383 - 384 Khim. Prir. Soedin., 2015 , # 2 p. 332 - 333,2 Title/Abstract Full Text View citing articles Show Details
Santana-Gómez, César E.; Alcántara-González, David; Luna-Munguia, Hiram; Bañuelos-Cabrera, Ivette; Magdaleno-Madrigal, Victor; Tamayo, Michael; Rocha, Luisa L.; Besio, Walter G.
Proceedings of the Annual International Conference of the IEEE Engineering in Medicine and Biology Society, EMBS, 2015 , vol. 2015-November, art. no. 7319902, p. 6586 - 6589
Title/Abstract Full Text View citing articles Show Details
Jackson, Benjamin F.; Beck, Leigh A.rden; Losek, Joseph D.
The Journal of emergency medicine, 2015 , vol. 48, # 3 p. e67 - e72 Title/Abstract Full Text Show Details
Büget, Bahar; Türkmen, Asll Zengin; Allahverdiyev, Oruc; Enginar, Nurhan
Naunyn-Schmiedeberg's Archives of Pharmacology, 2016 , vol. 389, # 1 p. 57 - 62 Title/Abstract Full Text View citing articles Show Details
Thi, Tham Pham; Decuyper, Lena; Quang, Tan Luc; The, Chinh Pham; Dang Thi, Tuyet Anh; Nguyen, Ha Thanh; Le Nhat, Thuy Giang; Thanh, Tra Nguyen; Thi, Phuong Hoang; D'Hooghe, Matthias; Van Nguyen, Tuyen
Tetrahedron Letters, 2016 , vol. 57, # 4 p. 466 - 471 Title/Abstract Full Text View citing articles Show Details
Farzi, Farnoush; Nabi, Bahram Naderi; Mirmansouri, Ali; Fakoor, Fereshteh; Roshan, Zahra Atrkar; Biazar, Gelareh; Zarei, Tayyebeh
Anesthesiology and Pain Medicine, 2016 , vol. 6, # 1 art. no. E32360 Title/Abstract Full Text View citing articles Show Details
Qin, Mei; Huang, Tianjian; Kader, Michael; Krych, Leland; Xia, Zengyan; Burlin, Thomas; Zeidler, Zachary; Zhao, Tingrui; Smith, Carolyn B.
International Journal of Neuropsychopharmacology, 2015 , vol. 18, # 9 p. 1 - 13 Title/Abstract Full Text View citing articles Show Details
Rauf, Abdur; Ali, Jawad; Khan, Haroon; Mubarak, Mohammad S.; Patel, Seema
3 Biotech, 2016 , vol. 6, # 1 art. no. 11, p. 1 - 10 Title/Abstract Full Text Show Details
Chagraoui; Thibaut; Skiba; Thuillez; Bourin
Progress in Neuro-Psychopharmacology and Biological Psychiatry, 2016 , vol. 66, p. 120 - 135 Title/Abstract Full Text View citing articles Show Details
Pal, Priyanka; Kaur, Parmeet; Singh, Narpinder; Kaur, Amrit Pal; Misra; Tiwari, Brijesh Kumar; Cullen, Patrick Joseph; Virdi, Amardeep Singh
Food Research International, 2016 , vol. 81, p. 50 - 57 Title/Abstract Full Text View citing articles Show Details
António, Carla; Päpke, Carola; Rocha, Marcio; Diab, Houssein; Limami, Anis M.; Obata, Toshihiro; Fernie, Alisdair R.; van Dongen, Joost T.
Plant Physiology, 2016 , vol. 170, # 1 p. 43 - 56 Title/Abstract Full Text View citing articles Show Details
Nepomuceno, Rachel; Sun, Dandan
Neural Regeneration Research, 2015 , vol. 10, # 12 p. 1924 - 1925 Title/Abstract Full Text View citing articles Show Details
Kadam; Dudek
Neuroscience, 2016 , vol. 316, p. 232 - 248 Title/Abstract Full Text View citing articles Show Details
Bai, Xue; Edden, Richard A. E; Gao, Fei; Wang, Guangbin; Wu, Lebin; Zhao, Bin; Wang, Minzhong; Chan, Queenie; Chen, Weibo; Barker, Peter B.
Journal of magnetic resonance imaging : JMRI, 2015 , vol. 41, # 5 p. 1326 - 1331 Title/Abstract Full Text Show Details
Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun
Microbial Cell Factories, 2015 , vol. 14, # 1 art. no. 207 Title/Abstract Full Text View citing articles Show Details
Santos, Milaine F.; Campos, Mateus R.; Bravim, Jéssica N.; Oliveira, Eugenio E.; Guedes, Raul Narciso C.
Crop Protection, 2016 , vol. 82, p. 10 - 16 Title/Abstract Full Text View citing articles Show Details
Villegas, Josefina M.; Brown, Lucía; Savoy de Giori, Graciela; Hebert, Elvira M.
LWT - Food Science and Technology, 2016 , vol. 67, p. 22 - 26 Title/Abstract Full Text View citing articles Show Details
Chen, Lin; Zhao, Haizhen; Zhang, Chong; Lu, Yingjian; Zhu, Xiaoyu; Lu, Zhaoxin
Journal of Functional Foods, 2016 , vol. 20, p. 267 - 275 Title/Abstract Full Text View citing articles Show Details
Li, Xiyuan; Ding, Yuan; Liu, Yupeng; Zhang, Yao; Song, Jinqing; Wang, Qiao; Li, Mengqiu; Qin, Yaping; Huang, Shangzhi; Yang, Yanling
Gene, 2015 , vol. 574, # 1 p. 41 - 47 Title/Abstract Full Text Show Details
Chen, Hengwen; He, Xuanhui; Liu, Yan; Li, Jun; He, Qingyong; Zhang, Cuiying; Wei, Benjun; Zhang, Ye; Wang, Jie
Scientific Reports, 2016 , vol. 6, art. no. 18933 Title/Abstract Full Text View citing articles Show Details
112 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Talarek, Sylwia; Orzelska-Gorka, Jolanta; Listos, Joanna; Serefko, Anna; Poleszak, Ewa; Fidecka, Sylwia
Pharmacology Biochemistry and Behavior, 2016 , vol. 142, p. 42 - 47 Title/Abstract Full Text View citing articles Show Details
Stern, Shani; Segal, Menahem; Moses, Elisha
EBioMedicine, 2015 , vol. 2, # 9 p. 1048 - 1062 Title/Abstract Full Text View citing articles Show Details
Senoo, Masato; Furukawa, Ayana; Hata, Takeshi; Urabe, Hirokazu
Chemistry - A European Journal, 2016 , vol. 22, # 3 p. 890 - 895 Title/Abstract Full Text View citing articles Show Details
Jirapa; Jarae; Phanee; Jirasak
International Food Research Journal, 2016 , vol. 23, # 1 p. 229 - 236 Title/Abstract Full Text View citing articles Show Details
Phattayakorn; Pajanyor; Wongtecha; Prommakool; Saveboworn
International Food Research Journal, 2016 , vol. 23, # 1 p. 406 - 409 Title/Abstract Full Text View citing articles Show Details
Kim, Haeng Hoon; Bong, Sun Ju; Kim, Hyun Ho; Han, Seung-Ho; Uddin, Md. Romij; Park, Sang Un
Asian Journal of Chemistry, 2016 , vol. 28, # 1 p. 167 - 169 Title/Abstract Full Text View citing articles Show Details
De Castro Fonseca, Matheus; Aguiar, Carla J.; Da Rocha Franco, Joao Antônio; Gingold, Rafael N.; Leite, M. Fatima
Cell Communication and Signaling, 2016 , vol. 14, # 1 art. no. 3 Title/Abstract Full Text View citing articles Show Details
Salminen, Antero; Jouhten, Paula; Sarajärvi, Timo; Haapasalo, Annakaisa; Hiltunen, Mikko
Neurochemistry International, 2016 , vol. 92, p. 13 - 24
Title/Abstract Full Text View citing articles Show Details
Chalermchaiwat, Parisut; Jangchud, Kamolwan; Jangchud, Anuvat; Charunuch, Chulaluck; Prinyawiwatkul, Witoon
LWT - Food Science and Technology, 2015 , vol. 64, # 1 p. 490 - 496 Title/Abstract Full Text View citing articles Show Details
Wunjuntuk, Kansuda; Kettawan, Aikkarach; Charoenkiatkul, Somsri; Rungruang, Thanaporn
Journal of Medicinal Food, 2016 , vol. 19, # 1 p. 15 - 23 Title/Abstract Full Text View citing articles Show Details
Li, Qianjin; Zhou, Feng; Zhu, Meiyun; Xing, Yuan; Li, Jin; Ren, Wanpeng
Journal of Chinese Institute of Food Science and Technology, 2015 , vol. 15, # 10 p. 197 - 205 Title/Abstract Full Text View citing articles Show Details
Nikan, Marjan; Nabavi, Seyed Mohammad; Manayi, Azadeh
Life Sciences, 2016 , vol. 146, p. 124 - 130 Title/Abstract Full Text View citing articles Show Details
Schoenrock; Tarantino
Genes, Brain and Behavior, 2016 , vol. 15, # 1 p. 45 - 61 Title/Abstract Full Text View citing articles Show Details
Beheshti, Farimah; Khazaei, Majid; Hosseini, Mahmoud
Avicenna Journal of Phytomedicine, 2016 , vol. 6, # 1 p. 124 - 141 Title/Abstract Full Text Show Details
Gonzalez-Burgos, Guillermo; Miyamae, Takeaki; Pafundo, Diego E.; Yoshino, Hiroki; Rotaru, Diana C.; Hoftman, Gil; Datta, Dibyadeep; Zhang, Yun; Hammond, Mahjub; Sampson, Allan R.; Fish, Kenneth N.; Ermentrout, G. Bard; Lewis, David A.
Cerebral Cortex, 2015 , vol. 25, # 11 p. 4076 - 4093 Title/Abstract Full Text View citing articles Show Details
Dvorzhak, Anton; Myakhar, Olga; Unichenko, Petr; Kirmse, Knut; Kirischuk, Sergei
Journal of Physiology, 2010 , vol. 588, # 13 p. 2351 - 2360 Title/Abstract Full Text Show Details
Spiller; Wiles; Russell; Casavant
Human and Experimental Toxicology, 2016 , vol. 35, # 2 p. 109 - 113 Title/Abstract Full Text View citing articles Show Details
Bönnighausen, Jakob; Gebhard, Daniel; Kröger, Cathrin; Hadeler, Birgit; Tumforde, Thomas; Lieberei, Reinhard; Bergemann, Jörg; Schäfer, Wilhelm; Bormann, Jörg
Molecular Microbiology, 2015 , vol. 98, # 6 p. 1115 - 1132 Title/Abstract Full Text View citing articles Show Details
Lee, Ji Hoon; Oh, Misook; Kim, Hyun Soo; Lee, Huisun; Im, Wonpil; Lim, Hyun-Suk
ACS Combinatorial Science, 2016 , vol. 18, # 1 p. 36 - 42 Title/Abstract Full Text View citing articles Show Details
Yang, Haoyue; Xing, Ronge; Liu, Song; Yu, Huahua; Li, Pengcheng
Life Sciences, 2016 , vol. 146, p. 1 - 7 Title/Abstract Full Text View citing articles Show Details
113 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Khanegheini; Nasehi; Zarrindast
Neuroscience, 2015 , vol. 305, p. 157 - 168 Title/Abstract Full Text View citing articles Show Details
Skowron, Pierre-Thomas; Dumartin, Melissa; Jeamet, Emeric; Perret, Florent; Gourlaouen, Christophe; Baudouin, Anne; Fenet, Bernard; Naubron, Jean-Valère; Fotiadu, Frédéric; Vial, Laurent; Leclaire, Julien
Journal of Organic Chemistry, 2016 , vol. 81, # 2 p. 654 - 661 Title/Abstract Full Text View citing articles Show Details
Diana, Marina; Rafecas, Magdalena; Arco, Cristina; Quílez, Joan
Journal of Food Composition and Analysis, 2014 , vol. 35, # 2 p. 94 - 100 Title/Abstract Full Text View citing articles Show Details
MEDICAL RESEARCH COUNCIL; CHOUCHANI, Edward; KRIEG, Thomas; SAEB-PARSY, Kourosh; THE UNIVERSITY COURT OF THE UNIVERSITY OF GLASGOW; MURPHY, Michael Patrick; WORK, Lorraine; FREZZA, Christian
Patent: WO2016/1686 A1, 2016 ; Title/Abstract Full Text Show Details
Culley, Georgia; Dósa, Zita; Radi, Shayma; Strand, Karin; Fröjd, Victoria; Hanse, Eric
European Journal of Neuroscience, 2016 , vol. 43, # 2 p. 169 - 178 Title/Abstract Full Text View citing articles Show Details
León, Silvia; Barroso, Alexia; Vázquez, María J.; García-Galiano, David; Manfredi-Lozano, María; Ruiz-Pino, Francisco; Heras, Violeta; Romero-Ruiz, Antonio; Roa, Juan; Schutz, Günther; Kirilov, Milen; Gaytan, Francisco; Pinilla, Leonor; Tena-Sempere, Manuel
Scientific Reports, 2016 , vol. 6, art. no. 19206 Title/Abstract Full Text View citing articles Show Details
Huang, Ying; Zhang, Qiong; Song, Ning-Ning; Zhang, Lei; Sun, Yu-Ling; Hu, Ling; Chen, Jia-Ying; Zhu, Weidong; Li, Jue; Ding, Yu-Qiang
Molecular Brain, 2016 , vol. 9, # 1 art. no. 183 Title/Abstract Full Text View citing articles Show Details
Shavrukov, Yuri; Hirai, Yoshihiko
Journal of Experimental Botany, 2016 , vol. 67, # 1 p. 15 - 30 Title/Abstract Full Text View citing articles Show Details
Gallo, Vittorio; Haydar, Tarik
Journal of Physiology, 2003 , vol. 550, # 3 p. 665 - 665 Title/Abstract Full Text Show Details
Wang; Krueger; Bordey
Journal of Physiology, 2003 , vol. 550, # 3 p. 785 - 800 Title/Abstract Full Text Show Details
Fearon, Ian M.; Zhang, Min; Vollmer, Cathy; Nurse, Colin A.
Journal of Physiology, 2003 , vol. 553, # 1 p. 83 - 94 Title/Abstract Full Text Show Details
Kubota, Hisahiko; Katsurabayashi, Shutaro; Moorhouse, Andrew J.; Murakami, Nobuya; Koga, Hitoshi; Akaike, Norio
Journal of Physiology, 2003 , vol. 551, # 1 p. 263 - 276 Title/Abstract Full Text Show Details
Malomouzh, Artem I.; Petrov, Konstantin A.; Nurullin, Leniz F.; Nikolsky, Evgeny E.
Journal of Neurochemistry, 2015 , vol. 135, # 6 p. 1149 - 1160
Title/Abstract Full Text View citing articles Show Details
Li, Hai-Juan; Peng, Rui-Yun; Wang, Chang-Zhen; Qiao, Si-Mo; Yong, Zou; Gao, Ya-Bing; Xu, Xin-Ping; Wang, Shao-Xia; Dong, Ji; Zuo, Hong-Yan; Li, Zhao; Zhou, Hong-Mei; Wang, Li-Feng; Hu, Xiang-Jun
Physiology and Behavior, 2015 , vol. 140, p. 236 - 246 Title/Abstract Full Text View citing articles Show Details
Gasulla, Javier; Calvo, Daniel J.
Neuroscience Letters, 2015 , vol. 590, p. 29 - 34 Title/Abstract Full Text View citing articles Show Details
Yang, Zong-Lin; Li, Hui; Wang, Bing; Liu, Shu-Ying
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2016 , vol. 1012-1013, p. 79 - 88 Title/Abstract Full Text View citing articles Show Details
Singh; Li; Hall; Chen; Sukur; Lu; Caputo; Meredith; Stefani; Toro
Neuroscience, 2016 , vol. 317, p. 76 - 107 Title/Abstract Full Text View citing articles Show Details
Takei, Yuichi; Fujihara, Kazuyuki; Tagawa, Minami; Hironaga, Naruhito; Near, Jamie; Kasagi, Masato; Takahashi, Yumiko; Motegi, Tomokazu; Suzuki, Yusuke; Aoyama, Yoshiyuki; Sakurai, Noriko; Yamaguchi, Miho; Tobimatsu, Shozo; Ujita, Koichi; Tsushima, Yoshito; Narita, Kosuke; Fukuda, Masato
NeuroImage, 2016 , vol. 128, p. 302 - 315 Title/Abstract Full Text View citing articles Show Details
Tao, Yang; Wang, Ping; Wang, Yilin; Kadam, Shekhar U.; Han, Yongbin; Wang, Jiandong; Zhou, Jianzhong
Ultrasonics Sonochemistry, 2016 , vol. 31, p. 310 - 318 Title/Abstract Full Text View citing articles Show Details
Wang, Renjun; Huang, Qian; Zhou, Rui; Dong, Zengxiang; Qi, Yunfeng; Li, Hua; Wei, Xiaowei; Wu, Hui; Wang, Huiping; Wilcox, Christopher S.; Hultström, Michael; Zhou, Xiaofu; Lai, En Yin
Circulation: Heart Failure, 2016 , vol. 9, # 1 Title/Abstract Full Text View citing articles Show Details
114 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
DURANT Graham J.; KHAN Amin M.; TEDFORD Clark E.; S. Russell
Patent: WO1995/11894 A1, 1995 ; Title/Abstract Full Text Show Details
Lehmann Anders; Andrews Paul L.R.
Patent: EP1344524 A1, 2003 ; Title/Abstract Full Text Show Details
Paul L. R. Andrews; Anders Lehmann
Patent: US6664069 B1, 2003 ; Title/Abstract Full Text Show Details
Hao, Jianxiong; Wu, Tongjiao; Li, Huiying; Wang, Wei; Liu, Haijie
Food Chemistry, 2016 , vol. 201, p. 87 - 93 Title/Abstract Full Text View citing articles Show Details
Maldifassi, Maria C.; Baur, Roland; Sigel, Erwin
Neuropharmacology, 2016 , vol. 105, p. 207 - 214 Title/Abstract Full Text View citing articles Show Details
Li, Bin; Dunham, Sage J.B.; Dong, Yonghui; Yoon, Sohee; Zeng, Maomao; Sweedler, Jonathan V.
Trends in Food Science and Technology, 2016 , vol. 47, p. 50 - 63 Title/Abstract Full Text View citing articles Show Details
Hensch, Takao K.
Scientific American, 2016 , vol. 314, # 2 p. 64 - 69 Title/Abstract Full Text View citing articles Show Details
GANAPATHY Vadivel; MIYAUCHI Seiji
Patent: WO2005/114217 A2, 2005 ; Title/Abstract Full Text Show Details
SMITH Kelli E.; BORDEN Laurence A.; WEINSHANK Richard L.
Patent: WO1994/15618 A1, 1994 ; Title/Abstract Full Text Show Details
BETTLER Bernhard; BITTIGER Helmut; FROSTL Wolfgang; MICKEL Stuart John; KAUPMANN Klemens
Patent: WO1997/46675 A1, 1997 ; Title/Abstract Full Text Show Details
Karine Alfonsine Astrid Smans; Henricus Jacobus Maria Gijsen
Patent: US2006/216749 A1, 2006 ; Title/Abstract Full Text Show Details
Roman V. Rariy; Michael Heffernan; Stephen L. Buchwald; Timothy M. Swager
Patent: US2004/142904 A1, 2004 ; Title/Abstract Full Text Show Details
Roohbakhsh, Ali; Shamsizadeh, Ali; Arababadi, Mohammad Kazemi; Ayoobi, Fateme; Fatemi, Iman; Allahtavakoli, Mohammad; Mohammad-Zadeh, Mohammad
Life Sciences, 2016 , vol. 147, p. 1 - 8 Title/Abstract Full Text View citing articles Show Details
Ratajczak, Piotr; Kus, Krzysztof; Giermaziak, Wojciech; Nowakowska, Elzbieta
Pharmacological Reports, 2016 , vol. 68, # 2 p. 415 - 422 Title/Abstract Full Text View citing articles Show Details
Mustafa, Dana; Ma, Dongping; Zhou, Wenhui; Meisenheimer, Poncho; Cali, James J.
Bioconjugate Chemistry, 2016 , vol. 27, # 1 p. 87 - 101 Title/Abstract Full Text View citing articles Show Details
Billups, Daniela; Attwell, David
Journal of Physiology, 2002 , vol. 545, # 1 p. 183 - 198 Title/Abstract Full Text Show Details
Qiao, Xiao; Yang, Jun; Fei, Su-Juan; Zhu, Jin-Zhou; Zhu, Sheng-Ping; Liu, Zhang-Bo; Li, Ting-Ting; Zhang, Jian-Fu
Brain Research, 2015 , vol. 1629, p. 351 - 360 Title/Abstract Full Text View citing articles Show Details
Cohen Kadosh, Kathrin; Krause, Beatrix; King, Andrew J.; Near, Jamie; Cohen Kadosh, Roi
Human Brain Mapping, 2015 , vol. 36, # 11 p. 4334 - 4345 Title/Abstract Full Text View citing articles Show Details
Al-Dhabi, Naif Abdullah; Valan Arasu, Mariadhas
Evidence-based Complementary and Alternative Medicine, 2016 , vol. 2016, art. no. 7631864 Title/Abstract Full Text View citing articles Show Details
Ghasemi, Mehdi; Phillips, Cristy; Trillo, Ludwig; De Miguel, Zurine; Das, Devsmita; Salehi, Ahmad
Neuroscience and Biobehavioral Reviews, 2014 , vol. 47, p. 336 - 358 Title/Abstract Full Text View citing articles Show Details
115 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Posluszny, Anna; Liguz-Lecznar, Monika; Turzynska, Danuta; Zakrzewska, Renata; Bielecki, Maksymilian; Kossut, Malgorzata
PLoS ONE, 2015 , vol. 10, # 12 art. no. 0144415 Title/Abstract Full Text View citing articles Show Details
Nam, Kyong-Hee; Shin, Hee Jae; Pack, In-Soon; Park, Jung-Ho; Kim, Ho Bang; Kim, Chang-Gi
Journal of the Science of Food and Agriculture, 2016 , vol. 96, # 3 p. 807 - 814 Title/Abstract Full Text View citing articles Show Details
Zeller, Maximilian; Held, Martina; Bender, Julia; Berz, Annuska; Heinloth, Tanja; Hellfritz, Timm; Pfeiffer, Keram
PLoS ONE, 2015 , vol. 10, # 12 art. no. E0143244 Title/Abstract Full Text View citing articles Show Details
Borghese, Cecilia M.; Ruiz, Carlos I.; Lee, Ui S.; Cullins, Madeline A.; Bertaccini, Edward J.; Trudell, James R.; Harris, R. Adron
ACS Chemical Neuroscience, 2016 , vol. 7, # 1 p. 100 - 108 Title/Abstract Full Text View citing articles Show Details
Kim, Helena Kyunghee; Nunes, Paula Villela; Oliveira, Katia C.; Young, L. Trevor; Lafer, Beny
Progress in Neuro-Psychopharmacology and Biological Psychiatry, 2016 , vol. 67, p. 51 - 57 Title/Abstract Full Text View citing articles Show Details
Mekonnen, Dereje Worku; Flügge, Ulf-Ingo; Ludewig, Frank
Plant Science, 2016 , vol. 245, p. 25 - 34 Title/Abstract Full Text View citing articles Show Details
Roveri, Flávia Lopes; Paranhos, Beatriz Aparecida Passos Bismara; Yonamine, Mauricio
Forensic Science International, 2016 , vol. 265, p. 75 - 80 Title/Abstract Full Text View citing articles Show Details
Basbaum, Allan I.; Bráz, João M.
Pain, 2015 , vol. 157, p. S42 - S47 Title/Abstract Full Text View citing articles Show Details
Saszik, Shannon M.; Robson, John G.; Frishman, Laura J.
Journal of Physiology, 2002 , vol. 543, # 3 p. 899 - 916 Title/Abstract Full Text Show Details
Braun, Matthias; Wendt, Anna; Buschard, Karsten; Salehi, Albert; Sewing, Sabine; Gromada, Jesper; Rorsman, Patrik
Journal of Physiology, 2004 , vol. 559, # 2 p. 397 - 409 Title/Abstract Full Text Show Details
Akosile, Wole; Klan, Matthew
Drug and Alcohol Review, 2016 , vol. 35, # 1 p. 115 - 116 Title/Abstract Full Text View citing articles Show Details
Valenzuela-Muñoz; Gallardo-Escárate
Marine Genomics, 2016 , vol. 25, p. 103 - 113 Title/Abstract Full Text View citing articles Show Details
Chan, Chun-Hung; Yeh, Hermes H.
Journal of Physiology, 2003 , vol. 550, # 1 p. 103 - 111 Title/Abstract Full Text Show Details
Maraschin, Marcelo; Somensi-Zeggio, Amlia; Oliveira, Simone K.; Kuhnen, Shirley; Tomazzoli, Mara M.; Raguzzoni, Josiane C.; Zeri, Ana C. M.; Carreira, Rafael; Correia, Sara; Costa, Christopher; Rocha, Miguel
Journal of Natural Products, 2016 , vol. 79, # 1 p. 13 - 23 Title/Abstract Full Text View citing articles Show Details
Li, Zhou; Peng, Yan; Huang, Bingru
Journal of the American Society for Horticultural Science, 2016 , vol. 141, # 1 p. 76 - 84 Title/Abstract Full Text View citing articles Show Details
The Samuel Roberts Noble Foundation, Inc.; Li, Wensheng; Uppalapati, Srinivasa Rao; Mysore, Kirankumar S.; Dixon, Richard A.; Sumner, Lloyd W.
Patent: US9238821 B2, 2016 ; Title/Abstract Full Text Show Details
Sunny BioDiscovery, Inc.; Bojanowski, Krzysztof; Zhao, Hui
Patent: US9238153 B2, 2016 ; Title/Abstract Full Text Show Details
Chen, Zi-Wei; Wang, Cunde; Krishnan, Kathiresan; Manion, Brad D.; Hastings, Randy; Bracamontes, John; Taylor, Amanda; Eaton, Megan M.; Zorumski, Charles F.; Steinbach, Joseph H.; Akk, Gustav; Mennerick, Steven; Covey, Douglas F.; Evers, Alex S.
Psychopharmacology, 2014 , vol. 231, # 17 p. 3479 - 3491 Title/Abstract Full Text View citing articles Show Details
Pariente, Antoine; De Gage, Sophie Billioti; Moore, Nicholas; Bégaud, Bernard
CNS Drugs, 2016 , vol. 30, # 1 p. 1 - 7 Title/Abstract Full Text View citing articles Show Details
Sikder, Amrita; Ghosh, Boyli; Chakraborty, Saptarshi; Paul, Ankan; Ghosh, Suhrit
Chemistry - A European Journal, 2016 , vol. 22, # 6 p. 1908 - 1913 Title/Abstract Full Text View citing articles Show Details
116 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Ayati, Adile; Emami, Saeed; Foroumadi, Alireza
European Journal of Medicinal Chemistry, 2016 , vol. 109, p. 380 - 392 Title/Abstract Full Text View citing articles Show Details
Bollmann; Ghisleni; Poil; Martin; Ball; Eich-Höchli; Edden; Klaver; Michels; Brandeis; O'Gorman
Translational Psychiatry, 2015 , vol. 5, # 6 art. no. E589 Title/Abstract Full Text View citing articles Show Details
Wu, Juan-Li; Yu, Si-Yang; Wu, Shi-Hua; Bao, Ai-Min
Neuroscience Letters, 2016 , vol. 616, p. 32 - 37 Title/Abstract Full Text View citing articles Show Details
Chen, Zi-Wei; Wang, Cunde; Krishnan, Kathiresan; Manion, Brad D.; Hastings, Randy; Bracamontes, John; Taylor, Amanda; Eaton, Megan M.; Zorumski, Charles F.; Steinbach, Joseph H.; Akk, Gustav; Mennerick, Steven; Covey, Douglas F.; Evers, Alex S.
Psychopharmacology, 2014 , vol. 231, # 17 p. 3479 - 3491 Title/Abstract Full Text Show Details
Comenencia-Ortiz, Eydith; Moss, Stephen J.; Davies, Paul A.
Psychopharmacology, 2014 , vol. 231, # 17 p. 3453 - 3465 Title/Abstract Full Text Show Details
Walker, Matthew C.
Journal of Physiology, 2008 , vol. 586, # 4 p. 921 - 922 Title/Abstract Full Text Show Details
Herd, Murray B.; Haythornthwaite, Alison R.; Rosahl, Thomas W.; Wafford, Keith A.; Homanics, Gregg E.; Lambert, Jeremy J.; Belelli, Delia
Journal of Physiology, 2008 , vol. 586, # 4 p. 989 - 1004 Title/Abstract Full Text Show Details
Macaulay, Nanna; Zeuthen, Thomas; Gether, Ulrik
Journal of Physiology, 2002 , vol. 544, # 2 p. 447 - 458 Title/Abstract Full Text Show Details
Gu, Xinglong; Zhou, Liang; Lu, Wei
Cell Reports, 2016 , vol. 14, # 3 p. 471 - 478 Title/Abstract Full Text View citing articles Show Details
Crowley, Shannon K.; Girdler, Susan S.
Psychopharmacology, 2014 , vol. 231, # 17 p. 3619 - 3634 Title/Abstract Full Text Show Details
Inoue, Ritsuko; Suzuki, Takeo; Nishimura, Kinya; Miura, Masami
Neuropharmacology, 2016 , vol. 105, p. 318 - 328 Title/Abstract Full Text View citing articles Show Details
Šuklje, Katja; Zhang, Xinyi; Antalick, Guillaume; Clark, Andrew C.; Deloire, Alain; Schmidtke, Leigh M.
Journal of Agricultural and Food Chemistry, 2016 , vol. 64, # 4 p. 870 - 880 Title/Abstract Full Text View citing articles Show Details
Zhang, Wei; Zhu, Shuyun; Luque, Rafael; Han, Shuang; Hu, Lianzhe; Xu, Guobao
Chemical Society Reviews, 2016 , vol. 45, # 3 p. 715 - 752 Title/Abstract Full Text View citing articles Show Details
Hadley, Stephen H.; Amin, Jahanshah
Journal of Physiology, 2007 , vol. 581, # 3 p. 1001 - 1018 Title/Abstract Full Text Show Details
Carter, Jenna M.; Landin, Justine D.; Gigante, Eduardo D.; Rieger, Samuel P.; Diaz, Marvin R.; Werner, David F.
Alcoholism: Clinical and Experimental Research, 2016 , vol. 40, # 2 p. 301 - 308 Title/Abstract Full Text View citing articles Show Details
Kanjhan, Refik; Noakes, Peter G.; Bellingham, Mark C.
Neural Plasticity, 2016 , vol. 2016, art. no. 3423267 Title/Abstract Full Text View citing articles Show Details
Brown, Adam R.; Mitchell, Scott J.; Peden, Dianne R.; Herd, Murray B.; Seifi, Mohsen; Swinny, Jerome D.; Belelli, Delia; Lambert, Jeremy J. Neuropharmacology, 2016 , vol. 103, p. 163 - 173 Title/Abstract Full Text View citing articles Show Details
Heaney, Chelcie F.; Kinney, Jefferson W.
Neuroscience and Biobehavioral Reviews, 2016 , vol. 63, p. 1 - 28 Title/Abstract Full Text View citing articles Show Details
Egekwu; Sonenshine; Garman; Barshis; Cox; Bissinger; Zhu; Roe
Insect Molecular Biology, 2016 , vol. 25, # 1 p. 72 - 92 Title/Abstract Full Text View citing articles Show Details
Xiao, Cheng; Zhou, Chunyi; Li, Keyong; Ye, Jiang-Hong
Journal of Physiology, 2007 , vol. 580, # 3 p. 731 - 743 Title/Abstract Full Text Show Details
117 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Alves, Thales B.; Totola, Leonardo T.; Takakura, Ana C.; Colombari, Eduardo; Moreira, Thiago S.
Autonomic Neuroscience: Basic and Clinical, 2016 , vol. 194, p. 1 - 7 Title/Abstract Full Text View citing articles Show Details
Vivithanaporn, Pornpun; Asahchop, Eugene L.; Acharjee, Shaona; Baker, Glen B.; Power, Christopher
AIDS, 2016 , vol. 30, # 4 p. 543 - 552 Title/Abstract Full Text View citing articles Show Details
Weber, Tina; Selzer, Paul M.
ChemMedChem, 2016 , vol. 11, # 3 p. 270 - 276 Title/Abstract Full Text View citing articles Show Details
Salman, Ibrahim M.
Current Hypertension Reports, 2016 , vol. 18, # 3 art. no. 18, p. 1 - 18 Title/Abstract Full Text View citing articles Show Details
Lobo Vicente, Joana; Chassaigne, Hubert; Holland, Margaret V.; Reniero, Fabiano; Kolář, Kamil; Tirendi, Salvatore; Vandecasteele, Ine; Vinckier, Inge; Guillou, Claude
Forensic Science International, 2016 , vol. 265, p. 107 - 115
Title/Abstract Full Text View citing articles Show Details
Zhao, Jieyu; Zhao, Yanni; Hu, Chunxiu; Zhao, Chunxia; Zhang, Junjie; Li, Lili; Zeng, Jun; Peng, Xiaojun; Lu, Xin; Xu, Guowang
Journal of Proteome Research, 2016 , vol. 15, # 2 p. 468 - 476 Title/Abstract Full Text View citing articles Show Details
McGinn, Kaitlin Ann; Bishop, Laura; Sarwal, Aarti
Clinical Neuropharmacology, 2016 , vol. 39, # 1 p. 62 - 65 Title/Abstract Full Text View citing articles Show Details
Louis, Elan D.; Hernandez, Nora; Dyke, Jonathan P.; Ma, Ruoyun; Dydak, Ulrike
Clinical Neuropharmacology, 2016 , vol. 39, # 1 p. 24 - 28 Title/Abstract Full Text View citing articles Show Details
Lingeshwar, Poorella; Kaur, Gurpreet; Singh, Neetu; Singh, Seema; Mishra, Akanksha; Shukla, Shubha; Ramakrishna, Rachumallu; Laxman, Tulsankar Sachin; Bhatta, Rabi Sankar; Siddiqui, Hefazat H.; Hanif, Kashif
Pulmonary Pharmacology and Therapeutics, 2016 , vol. 36, p. 10 - 21 Title/Abstract Full Text View citing articles Show Details
Peineau, Stéphane; Potier, Brigitte; Petit, Florence; Dournaud, Pascal; Epelbaum, Jacques; Gardette, Robert
Journal of Physiology, 2003 , vol. 546, # 1 p. 101 - 117 Title/Abstract Full Text Show Details
Vorslova, Svetlana; Golushko, Jelena; Galushko, Sergey; Viksna, Arturs
Proceedings of the Estonian Academy of Sciences, 2016 , vol. 65, # 1 p. 37 - 49 Title/Abstract Full Text View citing articles Show Details
Saeedi Saravi, Seyed Soheil; Dehpour, Ahmad Reza
Life Sciences, 2016 , vol. 145, p. 255 - 264 Title/Abstract Full Text View citing articles Show Details
Garazd, Ya. L.; Garazd; Kartsev
Chemistry of Natural Compounds, 2015 , vol. 51, # 6 p. 1138 - 1141 Khim. Prir. Soedin., 2015 , # 6 p. 979 - 981,3 Title/Abstract Full Text View citing articles Show Details
Bahado-Singh, Ray O.; Graham, Stewart F.; Turkoglu, Onur; Beauchamp, Kathryn; Bjorndahl, Trent C.; Han, BeomSoo; Mandal, Rupasri; Pantane, Jenee; Kowalenko, Terry; Wishart, David S.; Stahel, Philip F.
Metabolomics, 2016 , vol. 12, # 3 art. no. 42, p. 1 - 13 Title/Abstract Full Text View citing articles Show Details
Jinnarak, Amornrassamee; Teerasong, Saowapak
Sensors and Actuators, B: Chemical, 2016 , vol. 229, p. 315 - 320 Title/Abstract Full Text View citing articles Show Details
Xie, Wen-Jing; Dong, Ming; Liu, Qun; Meng, Hong-Mei
Translational Neuroscience, 2016 , vol. 7, # 1 p. 1 - 5 Title/Abstract Full Text View citing articles Show Details
Navarro-Mtz, Ana Karin; Pérez-Guevara, Fermín
AMB Express, 2014 , vol. 4, # 1 art. no. 79, p. 1 - 10 Title/Abstract Full Text View citing articles Show Details
Han, Ashley; Arijaje, Emily O.; Jinn, Jia-Rong; Mauromoustakos, Andy; Wang, Ya-Jane
Cereal Chemistry, 2016 , vol. 93, # 1 p. 39 - 46 Title/Abstract Full Text View citing articles Show Details
Han, Ashley; Jinn, Jia-Rong; Mauromoustakos, Andy; Wang, Ya-Jane
Cereal Chemistry, 2016 , vol. 93, # 1 p. 47 - 52 Title/Abstract Full Text View citing articles Show Details
Kim, Hang-Gu; Gu, Ya-Nan; Lee, Kyoung-Pil; Lee, Ji-Gun; Kim, Chan-Wook; Lee, Ji-Won; Jeong, Tae-Hee; Jeong, Young-Wun; Jeon, Chang-Jin
Histology and Histopathology, 2016 , vol. 31, # 3 p. 317 - 327 Title/Abstract Full Text View citing articles Show Details
118 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Paiva, Marcelo H.S.; Lovin, Diane D.; Mori, Akio; Melo-Santos, Maria A.V.; Severson, David W.; Ayres, Constância F.J.
Genomics, 2016 , vol. 107, # 1 p. 40 - 48 Title/Abstract Full Text View citing articles Show Details
Golas, Monika M.; Sander, Bjoern
Experimental Neurology, 2016 , vol. 278, p. 76 - 90 Title/Abstract Full Text View citing articles Show Details
Smile, Sharon
Paediatrics and Child Health (Canada), 2016 , vol. 21, # 1 p. 13 - 14 Title/Abstract Full Text View citing articles Show Details
Salvatierra, Ariel; Pimentel, Paula; Almada, Rubén; Hinrichsen, Patricio
Environmental and Experimental Botany, 2016 , vol. 125, p. 52 - 66 Title/Abstract Full Text View citing articles Show Details
Gaspard, Nicolas
CONTINUUM Lifelong Learning in Neurology, 2016 , vol. 22, p. 227 - 245 Title/Abstract Full Text View citing articles Show Details
Hulka, Lea M.; Scheidegger, Milan; Vonmoos, Matthias; Preller, Katrin H.; Baumgartner, Markus R.; Herdener, Marcus; Seifritz, Erich; Henning, Anke; Quednow, Boris B.
Addiction Biology, 2016 , vol. 21, # 1 p. 205 - 217 Title/Abstract Full Text View citing articles Show Details
Loheswaran, Genane; Barr, Mera S.; Rajji, Tarek K.; Zomorrodi, Reza; Le Foll, Bernard; Daskalakis, Zafiris J.
Biological Psychiatry: Cognitive Neuroscience and Neuroimaging, 2016 , vol. 1, # 1 p. 5 - 13 Title/Abstract Full Text View citing articles Show Details
Mintzopoulos, Dionyssios; Gillis, Timothy E.; Robertson, Holly R.; Dalia, Triana; Feng, Guoping; Rauch, Scott L.; Kaufman, Marc J.
Biological Psychiatry: Cognitive Neuroscience and Neuroimaging, 2016 , vol. 1, # 1 p. 39 - 48 Title/Abstract Full Text View citing articles Show Details
Nakamura, Yoji; Hirano, Tomoo
Biochemical and Biophysical Research Communications, 2016 , vol. 469, # 4 p. 803 - 808 Title/Abstract Full Text View citing articles Show Details
van Dijk, Bart J.; Vergouwen, Mervyn D.I.; Kelfkens, Myrna M.; Rinkel, Gabriel J.E.; Hol, Elly M.
Biochimica et Biophysica Acta - Molecular Basis of Disease, 2016 , vol. 1862, # 3 p. 492 - 505 Title/Abstract Full Text View citing articles Show Details
Mabuchi, Hikaru; Ong, Hongyao; Watanabe, Kazunori; Yoshida, Sachiko; Hozumi, Naohiro
IEEJ Transactions on Fundamentals and Materials, 2016 , vol. 136, # 2 p. 99 - 104 Title/Abstract Full Text View citing articles Show Details
Kant, Kamal; Arora, Ajay; Singh
Indian Journal of Plant Physiology, 2016 , vol. 21, # 1 p. 50 - 55 Title/Abstract Full Text View citing articles Show Details
Gumireddy, Kiranmai; Li, Anping; Kossenkov, Andrew V.; Sakurai, Masayuki; Yan, Jinchun; Li, Yan; Xu, Hua; Wang, Jian; Zhang, Paul J.; Zhang, Lin; Showe, Louise C.; Nishikura, Kazuko; Huang, Qihong
Nature Communications, 2016 , vol. 7, art. no. 10715 Title/Abstract Full Text View citing articles Show Details
Sallam, Marwa Y.; El-Gowilly, Sahar M.; Abdel-Galil, Abdel-Galil A.; El-Mas, Mahmoud M.
Naunyn-Schmiedeberg's Archives of Pharmacology, 2016 , vol. 389, # 3 p. 279 - 288 Title/Abstract Full Text View citing articles Show Details
Jin, Xin; Li, Shanshan; Bondy, Brian; Zhong, Weiwei; Oginsky, Max F.; Wu, Yang; Johnson, Christopher M.; Zhang, Shuang; Cui, Ningren; Jiang, Chun
PLoS ONE, 2016 , vol. 11, # 1 art. no. E0146470 Title/Abstract Full Text View citing articles Show Details
Gaspard, Nicolas
CONTINUUM Lifelong Learning in Neurology, 2016 , vol. 22, # 1 Epilepsy p. 227 - 245 Title/Abstract Full Text Show Details
Otter, Silke; Lammert, Eckhard
Trends in Endocrinology and Metabolism, 2016 , vol. 27, # 3 p. 177 - 188 Title/Abstract Full Text View citing articles Show Details
Cassella, Sarah N.; Hemmerle, Ann M.; Lundgren, Kerstin H.; Kyser, Tara L.; Ahlbrand, Rebecca; Bronson, Stefanie L.; Richtand, Neil M.; Seroogy, Kim B.
Schizophrenia Research, 2016 , vol. 171, # 1-3 p. 195 - 199 Title/Abstract Full Text View citing articles Show Details
Bridgman, Alanna C.; Barr, Mera S.; Goodman, Michelle S.; Chen, Robert; Rajji, Tarek K.; Daskalakis, Zafiris J.; George, Tony P.
Schizophrenia Research, 2016 , vol. 171, # 1-3 p. 125 - 130 Title/Abstract Full Text View citing articles Show Details
Arellano, Rogelio O.; Sánchez-Gómez, María Victoria; Alberdi, Elena; Canedo-Antelo, Manuel; Chara, Juan Carlos; Palomino, Aitor; PérezSamartín, Alberto; Matute, Carlos
Molecular Pharmacology, 2016 , vol. 89, # 1 p. 63 - 74 Title/Abstract Full Text View citing articles Show Details
119 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Gerber, Kyle J.; Squires, Katherine E.; Hepler, John R.
Molecular Pharmacology, 2016 , vol. 89, # 2 p. 273 - 286 Title/Abstract Full Text View citing articles Show Details
Tolbert, Dwain; Bekersky, Ihor; Chu, Hui-May; Ette, Ene I.
Journal of Clinical Pharmacology, 2016 , vol. 56, # 3 p. 365 - 374 Title/Abstract Full Text View citing articles Show Details
Alpuerto, Jasper Benedict; Hussain, Rana Muhammad Fraz; Fukao, Takeshi
Plant Cell and Environment, 2016 , vol. 39, # 3 p. 672 - 684 Title/Abstract Full Text View citing articles Show Details
Choi, Eul-Su; Sukweenadhi, Johan; Kim, Yeon-Ju; Jung, Ki Hong; Koh, Sung-Cheol; Hoang, Van-An; Yang, Deok-Chun
Field Crops Research, 2016 , vol. 188, p. 121 - 132 Title/Abstract Full Text View citing articles Show Details
Ding, Junzhou; Yang, Tewu; Feng, Hao; Dong, Mengyi; Slavin, Margaret; Xiong, Shanbai; Zhao, Siming
Journal of Agricultural and Food Chemistry, 2016 , vol. 64, # 5 p. 1094 - 1102 Title/Abstract Full Text View citing articles Show Details
Seo, Dong-Ho; Kim, Mi-Seon; Choi, Hyun-Wook; Sung, Jung-Min; Park, Jong-Dae; Kum, Jun-Seok
Food Science and Biotechnology, 2016 , vol. 25, # 1 p. 111 - 114 Title/Abstract Full Text View citing articles Show Details
Zhao, Lijuan; Huang, Yuxiong; Hu, Jerry; Zhou, Hongjun; Adeleye, Adeyemi S.; Keller, Arturo A.
Environmental Science and Technology, 2016 , vol. 50, # 4 p. 2000 - 2010 Title/Abstract Full Text View citing articles Show Details
Liu, Zhenjiang; Zhang, Zhen; Zhu, Gangbing; Sun, Jianfan; Zou, Bin; Li, Ming; Wang, Jiagao
Science of the Total Environment, 2016 , vol. 551-552, p. 484 - 488 Title/Abstract Full Text View citing articles Show Details
Jiao; Liu; Long; Du; Ju; Zan; Zhao
Neuroscience, 2016 , vol. 320, p. 230 - 238 Title/Abstract Full Text View citing articles Show Details
Katsuno, Nakako; Sakamoto, Chie; Yabe, Tomio; Yamauchi, Ryo; Nishizu, Takahisa; Kato, Koji
Food Science and Technology Research, 2015 , vol. 21, # 6 p. 787 - 791 Title/Abstract Full Text View citing articles Show Details
Mele, Maria; Iachetta, Giuseppina; Alò, Raffaella; Avolio, Ennio; Fazzari, Gilda; Carelli, Antonio; Laforgia, Vincenza; Canonaco, Marcello
Physiology and Behavior, 2016 , vol. 157, p. 225 - 230 Title/Abstract Full Text View citing articles Show Details
Tian, Yuting; Huang, Jiamei; Xie, Tingting; Huang, Luqiang; Zhuang, Weijin; Zheng, Yafeng; Zheng, Baodong
Food Chemistry, 2016 , vol. 203, p. 456 - 464 Title/Abstract Full Text View citing articles Show Details
Zhang, Jing-Xian; Li, Shang-Rong; Yao, Shuai; Bi, Qi-Rui; Hou, Jin-Jun; Cai, Lu-Ying; Han, Su-Mei; Wu, Wan-Ying; Guo, De-An
Journal of Ethnopharmacology, 2016 , vol. 181, p. 229 - 235 Title/Abstract Full Text View citing articles Show Details
Khakpoor, Mitra; Nasehi, Mohammad; Vahdati, Akbar; Hoseyni, Seyed-Ebrahim; Zarrindast, Mohammad-Reza
Pharmacology Biochemistry and Behavior, 2016 , vol. 143, p. 57 - 64 Title/Abstract Full Text View citing articles Show Details
Ryu, Shoraku; Furihata, Kazuo; Koda, Masanori; Wei, Feifei; Miyakawa, Takuya; Tanokura, Masaru
Magnetic Resonance in Chemistry, 2016 , vol. 54, # 3 p. 213 - 221 Title/Abstract Full Text View citing articles Show Details
Mersfelder, Tracey L.; Nichols, William H.
Annals of Pharmacotherapy, 2016 , vol. 50, # 3 p. 229 - 233
Title/Abstract Full Text View citing articles Show Details
Overturf; Huggett
Comparative Biochemistry and Physiology Part - C: Toxicology and Pharmacology, 2016 , vol. 183-184, p. 46 - 52 Title/Abstract Full Text View citing articles Show Details
Ali, Shahin S.; Nugent, Brian; Mullins, Ewen; Doohan, Fiona M.
AMB Express, 2016 , vol. 6, # 1 art. no. 13, p. 1 - 13 Title/Abstract Full Text View citing articles Show Details
Porcelli, Vito; Longo, Antonella; Palmieri, Luigi; Closs, Ellen I.; Palmieri, Ferdinando
Amino Acids, 2016 , vol. 48, # 2 p. 427 - 436 Title/Abstract Full Text View citing articles Show Details
Gutilla; Buyukozturk; Steward
Experimental Neurology, 2016 , vol. 279, p. 27 - 39 Title/Abstract Full Text View citing articles Show Details
120 of 992
Hide facts
121 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Newman; Blum; Wong; Scott; Prain; Wilson; Gillis
Internal Medicine Journal, 2016 , vol. 46, # 2 p. 148 - 157 Title/Abstract Full Text View citing articles Show Details
Tian, Ming; Li, Zhi; Wang, Gao; Pan, Weizhong; Li, Kezhong
Experimental and Therapeutic Medicine, 2016 , vol. 11, # 4 p. 1493 - 1498 Title/Abstract Full Text View citing articles Show Details
Xu, Chuang; Sun, Ling-Wei; Xia, Cheng; Zhang, Hong-You; Zheng, Jia-San; Wang, Jun-Song
Asian-Australasian Journal of Animal Sciences, 2016 , vol. 29, # 2 p. 219 - 229 Title/Abstract Full Text View citing articles Show Details
Hassani, Faezeh Vahdati; Hashemzaei, Mahmoud; Akbari, Edris; Imenshahidi, Mohsen; Hosseinzadeh, Hossein
Avicenna Journal of Phytomedicine, 2016 , vol. 6, # 2 p. 198 - 204 Title/Abstract Full Text Show Details
Anaeigoudari, Akbar; Hosseini, Mahmoud; Karami, Reza; Vafaee, Farzaneh; Mohammadpour, Toktam; Ghorbani, Ahmad; Sadeghnia, Hamid Reza
Avicenna Journal of Phytomedicine, 2016 , vol. 6, # 2 p. 223 - 235 Title/Abstract Full Text Show Details
Jiang, Yijing; Yang, Shanli; Tao, Jing; Lin, Zhicheng; Ye, Xiaoqian; You, Yongmei; Peng, Jun; Hong, Zhenfeng; Chen, Lidian
Molecular Medicine Reports, 2016 , vol. 13, # 3 p. 2060 - 2070 Title/Abstract Full Text View citing articles Show Details
Eom, Hyeon Soo; Park, Hae Ran; Jo, Sung Kee; Kim, Young Sang; Moon, Changjong; Kim, Sung-Ho; Jung, Uhee
PLoS ONE, 2016 , vol. 11, # 2 art. no. E0147538 Title/Abstract Full Text View citing articles Show Details
Alves Filho, Elenilson G.; Almeida, Francisca D.L.; Cavalcante, Rosane S.; De Brito, Edy S.; Cullen, Patrick J.; Frias, Jesus M.; Bourke, Paula; Fernandes, Fabiano A.N.; Rodrigues, Sueli
Food Chemistry, 2016 , vol. 204, p. 102 - 107 Title/Abstract Full Text View citing articles Show Details
Tapal, Arun; Vegarud, Gerd E.; Sreedhara, Ashoka; Hegde, Prajna; Inamdar, Shashikala; Tiku, Purnima Kaul
RSC Advances, 2016 , vol. 6, # 24 p. 20219 - 20229 Title/Abstract Full Text View citing articles Show Details
Soleimani Aghdam, Morteza; Jannatizadeh, Abbasali; Sheikh-Assadi, Morteza; Malekzadeh, Parviz
Scientia Horticulturae, 2016 , vol. 202, p. 70 - 76 Title/Abstract Full Text View citing articles Show Details
Shergis, Johannah Linda; Ni, Xiaojia; Jackson, Melinda L.; Zhang, Anthony Lin; Guo, Xinfeng; Li, Yan; Lu, Chuanjian; Xue, Charlie Changli
Complementary Therapies in Medicine, 2016 , vol. 26, p. 11 - 20 Title/Abstract Full Text View citing articles Show Details
Hong, Sa-Ik; Kwon, Seung-Hwan; Hwang, Ji-Young; Ma, Shi-Xun; Seo, Jee-Yeon; Ko, Yong-Hyun; Kim, Hyoung-Chun; Lee, Seok-Yong; Jang, Choon-Gon
Biomolecules and Therapeutics, 2016 , vol. 24, # 2 p. 115 - 122 Title/Abstract Full Text View citing articles Show Details
Nishimura, Mie; Yoshida, Shin-Ichi; Haramoto, Masafumi; Mizuno, Hidenori; Fukuda, Tomohiko; Kagami-Katsuyama, Hiroyo; Tanaka, Aiko; Ohkawara, Tatsuya; Sato, Yuji; Nishihira, Jun
Journal of Traditional and Complementary Medicine, 2016 , vol. 6, # 1 p. 66 - 71 Title/Abstract Full Text View citing articles Show Details
Allitt, Benjamin J.; Johnstone, Victoria P.A.; Richards, Katrina; Yan, Edwin B.; Rajan, Ramesh
Journal of Neurotrauma, 2016 , vol. 33, # 4 p. 375 - 389 Title/Abstract Full Text View citing articles Show Details
Adamu, Hadiza Altine; Imam, Mustapha Umar; Ooi, Der-Jiun; Esa, Norhaizan Mohd; Rosli, Rozita; Ismail, Maznah
Food and Nutrition Research, 2016 , vol. 60, art. no. 30209 Title/Abstract Full Text View citing articles Show Details
Wang, Xin; Qi, Qiaozhen; Huang, Caifei; Chomiak, Taylor; Luo, Feng
Hearing Research, 2016 , vol. 332, p. 160 - 169 Title/Abstract Full Text View citing articles Show Details
Zhang, Lin; Li, Hua; Hong, Peiwei; Zou, Xiaoyi
Epilepsy Research, 2016 , vol. 121, p. 33 - 38 Title/Abstract Full Text View citing articles Show Details
Srivastava, Shruti; Ghorpade, Ramrao; Sathe, Manisha
Journal of Immunoassay and Immunochemistry, 2016 , vol. 37, # 2 p. 167 - 188 Title/Abstract Full Text View citing articles Show Details
Parashar, Arun; Udayabanu, Malairaman
European Neuropsychopharmacology, 2016 , vol. 26, # 1 p. 78 - 91 Title/Abstract Full Text View citing articles Show Details
Chen, Chen; Xu, Guang-Hong; Li, Yuan-Hai; Tang, Wei-Xiang; Wang, Kai
Journal of the Neurological Sciences, 2016 , vol. 363, p. 126 - 131 Title/Abstract Full Text View citing articles Show Details
Show next 200 Comment
Bioactivities present
(Pharmacological Data)
122 of 992
Reference
Ochiai, Koji; Kuppusamy, Sankar; Yasui, Yusuke; Okano, Tsubasa; Matsumoto, Yasunobu; Gupta, Nishant R.; Takahashi, Yohei; Kubota, Takaaki; Kobayashi, Jun'ichi; Hayashi, Yujiro
Chemistry - A European Journal, 2016 , vol. 22, # 10 p. 3282 - 3286 Title/Abstract Full Text View citing articles Show Details
Juan De Solis, Alain; Baquero, Arian F.; Bennett, Camdin M.; Grove, Kevin L.; Zeltser, Lori M.
Molecular Metabolism, 2016 , vol. 5, # 3 p. 198 - 209 Title/Abstract Full Text View citing articles Show Details
Ahn, James; Ahn, Hyung Seok; Cheong, Jae Hoon; Dela Peña, Ike
Neural Plasticity, 2016 , vol. 2016, art. no. 1320423 Title/Abstract Full Text View citing articles Show Details
Nichols, David E.
Pharmacological Reviews, 2016 , vol. 68, # 2 p. 264 - 355 Title/Abstract Full Text View citing articles Show Details
Ochoa, Juan G.; Kilgo, William A.
Current Treatment Options in Neurology, 2016 , vol. 18, # 4 art. no. 18, p. 1 - 11 Title/Abstract Full Text View citing articles Show Details
Enrico; Migliore; Spiga; Mulas; Caboni; Diana
Neuroscience, 2016 , vol. 322, p. 195 - 207 Title/Abstract Full Text View citing articles Show Details
Lax, Nichola Z.; Grady, John; Laude, Alex; Chan, Felix; Hepplewhite, Philippa D.; Gorman, Grainne; Whittaker, Roger G.; Ng, Yi; Cunningham, Mark O.; Turnbull, Doug M.
Neuropathology and Applied Neurobiology, 2016 , vol. 42, # 2 p. 180 - 193 Title/Abstract Full Text View citing articles Show Details
Kumar, Rahul; Jiwani, Gitanjali; Pareek, Amit; Sravankumar, Thula; Khurana, Ashima; Sharma, Arun K.
Plant Genome, 2016 , vol. 9, # 1 p. 15 Title/Abstract Full Text View citing articles Show Details
Davis, Kasey N.; Tao, Ran; Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C.; Lipska, Barbara K.; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R.; Kleinman, Joel E.; Hyde, Thomas M.
PLoS ONE, 2016 , vol. 11, # 2 art. no. E0148558 Title/Abstract Full Text View citing articles Show Details
O'Connor, Cormac; Hanna, Jina; Nichol, Alistair
Anaesthesia and Intensive Care Medicine, 2016 , vol. 17, # 1 p. 27 - 30 Title/Abstract Full Text View citing articles Show Details
Izumi, Yukitoshi; Zorumski, Charles F.
PLoS ONE, 2016 , vol. 11, # 2 art. no. E0149034 Title/Abstract Full Text View citing articles Show Details
Ducasse, Déborah; Jaussent, Isabelle; Olié, Emilie; Guillaume, Sébastien; Lopez-Castroman, Jorge; Courtet, Philippe
PLoS ONE, 2016 , vol. 11, # 2 art. no. E0148653 Title/Abstract Full Text View citing articles Show Details
Pathmanathan, Nim; McClure, Jason
Anaesthesia and Intensive Care Medicine, 2016 , vol. 17, # 1 p. 17 - 23 Title/Abstract Full Text View citing articles Show Details
Nguyen, Linda; Thomas, Kelan L.; Lucke-Wold, Brandon P.; Cavendish, John Z.; Crowe, Molly S.; Matsumoto, Rae R.
Pharmacology and Therapeutics, 2016 , vol. 159, p. 1 - 22 Title/Abstract Full Text View citing articles Show Details
Prisciandaro, James J.; Schacht, Joseph P.; Prescot, Andrew P.; Renshaw, Perry F.; Brown, Truman R.; Anton, Raymond F.
Alcoholism: Clinical and Experimental Research, 2016 , vol. 40, # 3 p. 491 - 496 Title/Abstract Full Text View citing articles Show Details
Gigout; Deisz; Dehnicke; Turak; Devaux; Pumain; Louvel
Brain Research, 2016 , vol. 1637, p. 14 - 21 Title/Abstract Full Text View citing articles Show Details
Farsi, Zohreh; Preobraschenski, Julia; Van Den Bogaart, Geert; Riedel, Dietmar; Jahn, Reinhard; Woehler, Andrew
Science, 2016 , vol. 351, # 6276 p. 981 - 984 Title/Abstract Full Text View citing articles Show Details
De Oliveira, Rithiele Cristina; De Oliveira, Ricardo; Biagioni, Audrey Francisco; Falconi-Sobrinho, Luiz Luciano; Coimbra, Norberto Cysne
Brain Research, 2016 , vol. 1631, p. 80 - 91 Title/Abstract Full Text View citing articles Show Details
Zhao, Yue
Journal of Oncology, 2016 , vol. 2016, art. no. 9650481 Title/Abstract Full Text View citing articles Show Details
Wu, Fengfeng; Yang, Na; Touré, Alhassane; Jin, Zhengyu; Xu, Xueming
Critical Reviews in Food Science and Nutrition, 2013 , vol. 53, # 5 p. 451 - 463 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Schlenker, Evelyn H.
Respiratory Physiology and Neurobiology, 2016 , vol. 227, p. 34 - 40 Title/Abstract Full Text View citing articles Show Details
Merner, Nancy D.; Mercado, Adriana; Khanna, Arjun R.; Hodgkinson, Alan; Bruat, Vanessa; Awadalla, Philip; Gamba, Gerardo; Rouleau, Guy A.; Kahle, Kristopher T.
Journal of Psychiatric Research, 2016 , vol. 77, p. 22 - 26 Title/Abstract Full Text View citing articles Show Details
Brennan, Brian P.; Jensen, J. Eric; Perriello, Christine; Pope Jr., Harrison G.; Jenike, Michael A.; Hudson, James I.; Rauch, Scott L.; Kaufman, Marc J.
Biological Psychiatry: Cognitive Neuroscience and Neuroimaging, 2016 , vol. 1, # 2 p. 116 - 124 Title/Abstract Full Text View citing articles Show Details
Datusalia, Ashok Kumar; Sharma, Shyam Sunder
Current Neurovascular Research, 2016 , vol. 13, # 1 p. 22 - 32 Title/Abstract Full Text View citing articles Show Details
Mayengbam, Shyamchand; Raposo, Sara; Aliani, Michel; House, James D.
Journal of Nutrition, 2016 , vol. 146, # 1 p. 14 - 20 Title/Abstract Full Text View citing articles Show Details
Liu, Meng; Blanco-Centurion, Carlos; Konadhode, Roda Rani; Luan, Liju; Shiromani, Priyattam J.
European Journal of Neuroscience, 2016 , vol. 43, # 5 p. 681 - 688 Title/Abstract Full Text View citing articles Show Details
Garde-Cerdán, Teresa; Portu, Javier; López, Rosa; Santamaría, Pilar
Food Chemistry, 2016 , vol. 203, p. 536 - 539 Title/Abstract Full Text View citing articles Show Details
Hashimoto; Bruno; Nierenberg; Marmar; Zetterberg; Blennow; Pomara
Translational Psychiatry, 2016 , vol. 6, art. no. E744 Title/Abstract Full Text View citing articles Show Details
Trebichalskỳ, Pavol; Tóth, Tomáš; Bajcan, Daniel; Vollmannová, Alena; Kavalcová, Petra
Potravinarstvo, 2016 , vol. 10, # 1 p. 114 - 119 Title/Abstract Full Text View citing articles Show Details
Robertson, Caroline E.; Ratai, Eva-Maria; Kanwisher, Nancy
Current Biology, 2016 , vol. 26, # 1 p. 80 - 85 Title/Abstract Full Text View citing articles Show Details
Jom, Kriskamol Na; Lorjaroenphon, Yaowapa; Udompijitkul, Pathima
Food Science and Technology Research, 2016 , vol. 22, # 1 p. 65 - 73 Title/Abstract Full Text View citing articles Show Details
Aggarwal, Amitesh; Bansal, Nitin; Aggarwal, Raghav
Journal of Emergency Medicine, 2016 , vol. 50, # 3 p. e133 - e134 Title/Abstract Full Text View citing articles Show Details
Hill, Simon L.; Thomas, Simon H.L.
Medicine (United Kingdom), 2016 , vol. 44, # 3 p. 160 - 169 Title/Abstract Full Text View citing articles Show Details
Pidatala, Venkataramana R.; Li, Kefeng; Sarkar, Dibyendu; Ramakrishna, Wusirika; Datta, Rupali
Environmental Science and Technology, 2016 , vol. 50, # 5 p. 2530 - 2537 Title/Abstract Full Text View citing articles Show Details
Chowński, Szymon; Adamski, Zbigniew; Marciniak, Paweł; Rosiński, Grzegorz; Büyükgüzel, Ender; Büyükgüzel, Kemal; Falabella, Patrizia; Scrano, Laura; Ventrella, Emanuela; Lelario, Filomena; Bufo, Sabino A.
Toxins, 2016 , vol. 8, # 3 art. no. 60 Title/Abstract Full Text View citing articles Show Details
Tsukaya, Hirokazu; Sawada, Yuji; Oikawa, Akira; Shiratake, Katsuhiro; Isuzugawa, Kanji; Saito, Kazuki; Hirai, Masami Yokota
New Negatives in Plant Science, 2015 , vol. 1-2, p. 53 - 61 Title/Abstract Full Text View citing articles Show Details
Caputo, Fabio; Vignoli, Teo; Tarli, Claudia; Domenicali, Marco; Zoli, Giorgio; Bernardi, Mauro; Addolorato, Giovanni
International Journal of Environmental Research and Public Health, 2016 , vol. 13, # 3 art. no. 290 Title/Abstract Full Text View citing articles Show Details
Bojanowska, Ewa; Ciosek, Joanna
Current Neuropharmacology, 2016 , vol. 14, # 2 p. 118 - 142 Title/Abstract Full Text View citing articles Show Details
Taylor, George T.; Taylor, George T; Manzella, Francesca
Current Neuropharmacology, 2016 , vol. 14, # 2 p. 165 - 176 Title/Abstract Full Text View citing articles Show Details
Nahar, Limon Khatun; Cordero, Rosa Elena; Nutt, David; Lingford-Hughes, Anne; Turton, Samuel; Durant, Claire; Wilson, Sue; Paterson, Sue
Journal of Analytical Toxicology, 2016 , vol. 40, # 2 art. no. BKV125, p. 117 - 123 Title/Abstract Full Text View citing articles Show Details
123 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Liu, Lanxiang; Zhou, Xinyu; Zhang, Yuqing; Liu, Yiyun; Yang, Lining; Pu, Juncai; Zhu, Dan; Zhou, Chanjuan; Xie, Peng
Behavioural Brain Research, 2016 , vol. 305, p. 148 - 156 Title/Abstract Full Text View citing articles Show Details
Pallin, Anton; Agback, Peter; Jonsson, Hans; Roos, Stefan
Food Microbiology, 2016 , vol. 57, p. 159 - 171 Title/Abstract Full Text View citing articles Show Details
Johanningsmeier, Suzanne D.; Harris, G. Keith; Klevorn, Claire M.
Annual Review of Food Science and Technology, 2016 , vol. 7, p. 413 - 438 Title/Abstract Full Text View citing articles Show Details
Cacabelos, Ramón; Torrellas, Clara; Carrera, Iván; Cacabelos, Pablo; Corzo, Lola; Fernández-Novoa, Lucía; Tellado, Iván; Carril, Juan Carlos; Aliev, Gjumrakch
CNS and Neurological Disorders - Drug Targets, 2016 , vol. 15, # 2 p. 141 - 241 Title/Abstract Full Text View citing articles Show Details
Horňák, Karel; Schmidheiny, Helen; Pernthaler, Jakob
Journal of Chromatography A, 2016 , vol. 1440, p. 85 - 93 Title/Abstract Full Text View citing articles Show Details
Myrgorodska, Iuliia; Meinert, Cornelia; Martins, Zita; Le Sergeant d'Hendecourt, Louis; Meierhenrich, Uwe J.
Journal of Chromatography A, 2016 , vol. 1433, p. 131 - 136 Title/Abstract Full Text View citing articles Show Details
Liu, Renshuai; Wang, Junhua; Tang, Weiping; Fang, Hao
Bioorganic and Medicinal Chemistry, 2016 , vol. 24, # 7 p. 1446 - 1454 Title/Abstract Full Text View citing articles Show Details
Williams, Kevin Jon; Wu, Xiangdong
Atherosclerosis, 2016 , vol. 247, p. 225 - 282 Title/Abstract Full Text View citing articles Show Details
Meeploy, Maneerat; Deewatthanawong, Rujira
Journal of Chromatographic Science, 2016 , vol. 54, # 3 p. 445 - 452 Title/Abstract Full Text View citing articles Show Details
Fei, Fan; Lee, Keith M.; McCarry, Brian E.; Bowdish, Dawn M. E.
Scientific Reports, 2016 , vol. 6, art. no. 22637 Title/Abstract Full Text View citing articles Show Details
Lenardão, Eder J.; Savegnago, Lucielli; Jacob, Raquel G.; Victoria, Francine N.; Martinez, Débora M.
Journal of the Brazilian Chemical Society, 2016 , vol. 27, # 3 p. 435 - 474 Title/Abstract Full Text View citing articles Show Details
Michalak, Agnieszka; BiaŁa, Grazyna
Acta Poloniae Pharmaceutica - Drug Research, 2016 , vol. 73, # 1 p. 3 - 12 Title/Abstract Full Text View citing articles Show Details
Chen, Zhong; Zhou, Yong-Wei; Liang, Chen; Jiang, Ying-Ya; Xie, Li-Jin
Archives Animal Breeding, 2016 , vol. 59, # 1 p. 97 - 105 Title/Abstract Full Text View citing articles Show Details
Zhao, Panfeng; Pan, Qifang; Yu, Wengjuan; Zhao, Lingxia
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2016 , vol. 1017-1018, p. 153 - 162 Title/Abstract Full Text View citing articles Show Details
Włodarczyk, Agnieszka; Szymańska, Agata; Skłodowska, Aleksandra; Matlakowska, Renata
Chemosphere, 2016 , vol. 148, p. 416 - 425 Title/Abstract Full Text View citing articles Show Details
Pennucci, Roberta; Talpo, Francesca; Astro, Veronica; Montinaro, Valentina; Morè, Lorenzo; Cursi, Marco; Castoldi, Valerio; Chiaretti, Sara; Bianchi, Veronica; Marenna, Silvia; Cambiaghi, Marco; Tonoli, DIletta; Leocani, Letizia; Biella, Gerardo; D'Adamo, Patrizia; De Curtis, Ivan
Cerebral Cortex, 2016 , vol. 26, # 2 p. 873 - 890 Title/Abstract Full Text View citing articles Show Details
Anstötz, Max; Huang, Hao; Marchionni, Ivan; Haumann, Iris; MacCaferri, Gianmaria; Lübke, Joachim H.R.
Cerebral Cortex, 2016 , vol. 26, # 2 p. 855 - 872 Title/Abstract Full Text View citing articles Show Details
Trinka, Eugen; Brigo, Francesco; Shorvon, Simon
Current Opinion in Neurology, 2016 , vol. 29, # 2 p. 189 - 198 Title/Abstract Full Text View citing articles Show Details
Kantachote, Duangporn; Ratanaburee, Anussara; Sukhoom, Ampaitip; Sumpradit, Tawatchai; Asavaroungpipop, Narongrid
LWT - Food Science and Technology, 2016 , vol. 70, p. 171 - 177 Title/Abstract Full Text View citing articles Show Details
Huang, Youyi; Liu, Cong; Xiao, Xiudan
International Journal of Food Properties, 2016 , vol. 19, # 6 p. 1194 - 1206 Title/Abstract Full Text View citing articles Show Details
124 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Köksal, Zeynep; Kalin, Ramazan; Gülçin, Ilhami; Özdemir, Hasan; Atasever, Ali
International Journal of Food Properties, 2016 , vol. 19, # 6 p. 1207 - 1216 Title/Abstract Full Text View citing articles Show Details
Mocking, Roel J. T.; Figueroa, Caroline A.; Rive, Maria M.; Geugies, Hanneke; Servaas, Michelle N.; Assies, Johanna; Koeter, Maarten W. J.; Vaz, Frédéric M.; Wichers, Marieke; Van Straalen, Jan P.; De Raedt, Rudi; Bockting, Claudi L. H.; Harmer, Catherine J.; Schene, Aart H.; Ruhé, Henricus G.
BMJ Open, 2016 , vol. 6, # 3 art. no. E009510 Title/Abstract Full Text View citing articles Show Details
López-Granero, Caridad; Ruiz-Muñoz, Ana M.; Nieto-Escámez, Francisco A.; Colomina, María T.; Aschner, Michael; Sánchez-Santed, Fernando
NeuroToxicology, 2016 , vol. 53, p. 85 - 92 Title/Abstract Full Text View citing articles Show Details
Wojnicz, Aneta; Avendaño Ortiz, José; Casas, Ana I.; Freitas, Andiara E.; G. López, Manuela; Ruiz-Nuño, Ana
Clinica Chimica Acta, 2016 , vol. 453, p. 174 - 181 Title/Abstract Full Text View citing articles Show Details
Konadhode, Roda Rani; Pelluru, Dheeraj; Shiromani, Priyattam J.
Sleep, 2016 , vol. 39, # 3 p. 491 - 494 Title/Abstract Full Text View citing articles Show Details
Tannenbaum, Pamela L.; Tye, Spencer J.; Stevens, Joanne; Gotter, Anthony L.; Fox, Steven V.; Savitz, Alan T.; Coleman, Paul J.; Uslaner, Jason M.; Kuduk, Scott D.; Hargreaves, Richard; Winrow, Christopher J.; Renger, John J.
Sleep, 2016 , vol. 39, # 3 p. 603 - 612 Title/Abstract Full Text View citing articles Show Details
CALIFORNIA INSTITUTE OF TECHNOLOGY; HSIAO, Elaine; YANO, Jessica
Patent: WO2016/36615 A1, 2016 ; Title/Abstract Full Text Show Details
Shi, Man-Man; Piao, Jin-Hua; Xu, Xi-Lin; Zhu, Liang; Yang, Li; Lin, Fu-Lan; Chen, Jian; Jiang, Jian-Guo
Sleep Medicine Reviews, 2016 , vol. 29, p. 108 - 118 Title/Abstract Full Text View citing articles Show Details
Yang, Phillip; Leu, David; Ye, Keqiang; Srinivasan, Chandra; Fike, John R.; Huang, Ting-Ting
Experimental Neurology, 2016 , vol. 279, p. 178 - 186 Title/Abstract Full Text View citing articles Show Details
Shaikh, Aasef G.; Wilmot, George
Journal of the Neurological Sciences, 2016 , vol. 362, p. 169 - 173 Title/Abstract Full Text View citing articles Show Details
Krystal, John H.; Anticevic, Alan
Biological Psychiatry, 2015 , vol. 78, # 11 p. 738 - 740 Title/Abstract Full Text View citing articles Show Details
On-Nom; Nualkaekul; Chalermchaiwat; Nitithamyoung; Murtaza
International Food Research Journal, 2016 , vol. 23, # 2 p. 475 - 481 Title/Abstract Full Text View citing articles Show Details
Nogoceke, Francianne P.; Barcaro, Inara M.R.; de Sousa, Damião P.; Andreatini, Roberto
Neuroscience Letters, 2016 , vol. 619, p. 43 - 48 Title/Abstract Full Text View citing articles Show Details
Zhao, Kaifei; Lin, Lanlan; Li, Cong; Du, Shichao; Huang, Cui; Qin, Yujia; Yang, Peng; Li, Kangli; Gong, Junbo
Journal of Chemical and Engineering Data, 2016 , vol. 61, # 3 p. 1210 - 1220 Title/Abstract Full Text View citing articles Show Details
Ihara, Fumiaki; Nishimura, Maki; Muroi, Yoshikage; Furuoka, Hidefumi; Yokoyama, Naoaki; Nishikawa, Yoshifumi
Scientific Reports, 2016 , vol. 6, art. no. 23052 Title/Abstract Full Text View citing articles Show Details
Walter, Susanna A; Forsgren, Mikael; Lundengard, Karin; Simon, Rozalyn; Nilsson, Maritha Torkildsen; Söderfeldt, Birgitta; Lundberg,
Peter; Engström, Maria
PLoS ONE, 2016 , vol. 11, # 3 art. no. E0148737 Title/Abstract Full Text View citing articles Show Details
Li, Lei; Yu, Xinyu; Qiao, Shanlei; Wang, Di; Dai, Jiayong; Wang, Jun; Zhang, Rutan; Wang, Li
RSC Advances, 2016 , vol. 6, # 31 p. 25751 - 25765 Title/Abstract Full Text View citing articles Show Details
Yin, Honglei; Pantazatos, Spiro P.; Galfalvy, Hanga; Huang, Yung-yu; Rosoklija, Gorazd B.; Dwork, Andrew J.; Burke, Ainsley; Arango, Victoria; Oquendo, Maria A.; Mann, Joseph John
American Journal of Medical Genetics, Part B: Neuropsychiatric Genetics, 2016 , vol. 171, # 3 p. 414 - 426 Title/Abstract Full Text View citing articles Show Details
Devor, Marshall; Zalkind, Vladimir; Fishman, Yelena; Minert, Anne
European Journal of Neuroscience, 2016 , vol. 43, # 6 p. 846 - 858 Title/Abstract Full Text View citing articles Show Details
Apaire-Marchais, Véronique; Ogliastro, Mylène; Chandre, Fabrice; Pennetier, Cédric; Raymond, Valérie; Lapied, Bruno
Environmental Microbiology Reports, 2016 , vol. 8, # 2 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
125 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Bagnato, Francesca; Good, Janine
Headache, 2016 , vol. 56, # 3 p. 603 - 615 Title/Abstract Full Text View citing articles Show Details
Han, Lei; Mu, Shuhua; He, Zhendan; Wang, Zhiwei; Qu, Junle; Ye, Wencai; Zhang, Jian
Brain Research, 2016 , vol. 1637, p. 71 - 80 Title/Abstract Full Text View citing articles Show Details
Lile, Joshua A.; Wesley, Michael J.; Kelly, Thomas H.; Hays, Lon R.
Behavioural Pharmacology, 2016 , vol. 27, # 2-3 p. 215 - 224 Title/Abstract Full Text View citing articles Show Details
Jayarajan, Pradeep; Nirogi, Ramakrishna; Shinde, Anil; Benade, Vijay; Muddana, Nageswara Rao
Behavioural Pharmacology, 2016 , vol. 27, # 2-3 p. 225 - 235 Title/Abstract Full Text View citing articles Show Details
Davenport, Matthew H.; Schaefer, Tori L.; Friedmann, Katherine J.; Fitzpatrick, Sarah E.; Erickson, Craig A.
Drugs, 2016 , vol. 76, # 4 p. 431 - 445 Title/Abstract Full Text View citing articles Show Details
Winkler, David A.; Thornton, Aaron; Farjot, Géraldine; Katz, Ira
Pharmacology and Therapeutics, 2016 , vol. 160, p. 44 - 64 Title/Abstract Full Text View citing articles Show Details
Klein, Anders B.; Nittegaard-Nielsen, Mia; Christensen, Julie T.; Al-Khawaja, Anas; Wellendorph, Petrine
MedChemComm, 2016 , vol. 7, # 3 p. 426 - 432 Title/Abstract Full Text View citing articles Show Details
GIULIANI S.P.A.; GIULIANI, Giammaria; BENEDUSI, Anna; MARZANI, Barbara; BARONI, Sergio; PINI, Elena
Patent: WO2016/20350 A1, 2016 ; Title/Abstract Full Text Show Details
Zhang, Rong; Zhang, Tong; Ali, Ali Muhsen; Al Washih, Mohammed; Pickard, Benjamin; Watson, David G.
Computational and Structural Biotechnology Journal, 2016 , vol. 14, p. 106 - 116 Title/Abstract Full Text View citing articles Show Details
Ostrynska, Olga V.; Balanda, Anatoliy O.; Bdzhola, Volodymyr G.; Golub, Andriy G.; Kotey, Igor M.; Kukharenko, Olexander P.; Gryshchenko, Andrii A.; Briukhovetska, Nadiia V.; Yarmoluk, Sergiy M.
European Journal of Medicinal Chemistry, 2016 , vol. 115, p. 148 - 160 Title/Abstract Full Text View citing articles Show Details
Mifflin, Katherine A.; Benson, Curtis; Thorburn, Kevin C.; Baker, Glen B.; Kerr, Bradley J.
Journal of Pain, 2016 , vol. 17, # 4 p. 483 - 498 Title/Abstract Full Text View citing articles Show Details
Ng, Chiu Chin; Duke, Rujee K.; Hinton, Tina; Johnston, Graham A.R.
European Journal of Pharmacology, 2016 , vol. 777, p. 136 - 146 Title/Abstract Full Text View citing articles Show Details
Waszkielewicz; Gunia-Krzyzak; Powroźnik; Słoczyńska; Pękala; Walczak; Bednarski; Zesławska; Nitek; Marona
Bioorganic and Medicinal Chemistry, 2016 , vol. 24, # 8 p. 1793 - 1810 Title/Abstract Full Text View citing articles Show Details
Boychuk, Jeffery A.; Butler, Corwin R.; Halmos, Katalin Cs.; Smith, Bret N.
Experimental Neurology, 2016 , vol. 277, p. 178 - 189 Title/Abstract Full Text View citing articles Show Details
Kumar, Manoj; Kuzhiumparambil, Unnikrishnan; Pernice, Mathieu; Jiang, Zhijian; Ralph, Peter J.
Algal Research, 2016 , vol. 16, p. 76 - 92 Title/Abstract Full Text View citing articles Show Details
IRONWOOD PHARMACEUTICALS, INC.; BARDEN, Timothy Claude; SHEPPECK, James Edward; RENNIE, Glen Robert; RENHOWE, Paul Allan; PERL, Nicholas; NAKAI, Takashi; MERMERIAN, Ara; LEE, Thomas Wai-Ho; JUNG, Joon; JIA, James; IYER, Karthik; IYENGAR, Rajesh R.; IM, G-Yoon Jamie
Patent: WO2016/44447 A1, 2016 ; Title/Abstract Full Text Show Details
Mirzoyan; Gan’shina; Topchyan; Khailov; Kurdyumov; Kovalev; Zimin; Firstova, Yu. Yu.; Vasil’eva; Gretskaya; Bezuglov
Pharmaceutical Chemistry Journal, 2016 , vol. 49, # 10 p. 661 - 666 Title/Abstract Full Text View citing articles Show Details
Kałuzna-Czaplińska, Joanna; Jóźwik-Pruska, Jagoda
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2016 , vol. 1019, p. 4 - 14 Title/Abstract Full Text View citing articles Show Details
THE REGENTS OF THE UNIVERSITY OF CALIFORNIA; Kaufman, Daniel; Tian, Jide
Patent: US2016/81956 A1, 2016 ; Title/Abstract Full Text Show Details
Rodrigues, Karina T.; Mekahli, Djalila; Tavares, Marina F. M.; van Schepdael, Ann
Electrophoresis, 2016 , vol. 37, # 7-8 p. 1039 - 1047
Title/Abstract Full Text View citing articles Show Details
126 of 992
127 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Apáti, Ágota; Berecz, Tünde; Sarkadi, Balázs
Cell Calcium, 2016 , vol. 59, # 2-3 p. 117 - 123 Title/Abstract Full Text View citing articles Show Details
Schmidt, Dieter
Neurologic Clinics, 2016 , vol. 34, # 2 p. 363 - 381 Title/Abstract Full Text View citing articles Show Details
Wetzl, Dennis; Bolsinger, Jennifer; Nestl, Bettina M.; Hauer, Bernhard
ChemCatChem, 2016 , vol. 8, # 7 p. 1361 - 1366 Title/Abstract Full Text View citing articles Show Details
Souza, Sarah C. R.; Mazzafera, Paulo; Sodek, Ladaslav
Amino Acids, 2016 , vol. 48, # 5 p. 1285 - 1295 Title/Abstract Full Text View citing articles Show Details
Kimura, Hiroyuki; Sampei, Sotaro; Matsuoka, Daiko; Harada, Naoya; Watanabe, Hiroyuki; Arimitsu, Kenji; Ono, Masahiro; Saji, Hideo
Bioorganic and Medicinal Chemistry, 2016 , vol. 24, # 10 p. 2251 - 2256 Title/Abstract Full Text View citing articles Show Details
Tejchman, Waldemar; Skórska-Stania, Agnieszka; Żesławska, Ewa
Journal of Chemical Crystallography, 2016 , vol. 46, # 4 p. 181 - 187 Title/Abstract Full Text View citing articles Show Details
Sadeghi-Kiakhani, Mousa; Safapour, Siyamak
Luminescence, 2016 , vol. 31, # 4 p. 1005 - 1012 Title/Abstract Full Text View citing articles Show Details
Zanettini, Claudio; Pressly, Jeffrey D.; Ibarra, Miguel H.; Smith, Kelsey R.; Gerak, Lisa R.
Psychopharmacology, 2016 , vol. 233, # 10 p. 2005 - 2013 Title/Abstract Full Text View citing articles Show Details
Patterson, Elain E.; Ryan, Paul M.; Cryan, John F.; Dinan, Timothy G.; Paul Ross; Fitzgerald, Gerald F.; Stanton, Cath Erine
Postgraduate Medical Journal, 2016 , vol. 92, # 1087 p. 286 - 300 Title/Abstract Full Text View citing articles Show Details
Wu, Yu; Fu, Yuying; Rao, Chenglong; Li, Wenwen; Liang, Zihong; Zhou, Chanjuan; Shen, Peng; Cheng, Pengfei; Zeng, Li; Zhu, Dan; Zhao, Libo; Xie, Peng
Behavioural Brain Research, 2016 , vol. 308, p. 115 - 127 Title/Abstract Full Text View citing articles Show Details
Rousseaux, Colin G.; Greene, Stephanie F.
Journal of Receptors and Signal Transduction, 2016 , vol. 36, # 4 p. 327 - 388 Title/Abstract Full Text View citing articles Show Details
Rydholm, Hans; Von Corswant, Christian; Denison, Hans; Jensen, Jörgen M.; Lehmann, Anders; Ruth, Magnus; Söderlind, Erik; AurellHolmberg, Ann
Clinical Therapeutics, 2016 , vol. 38, # 4 p. 946 - 960 Title/Abstract Full Text View citing articles Show Details
Tarozzi, Andrea; Marchetti, Chiara; Nicolini, Benedetta; D'Amico, Massimo; Ticchi, Nicole; Pruccoli, Letizia; Tumiatti, Vincenzo; Simoni, Elena; Lodola, Alessio; Mor, Marco; Milelli, Andrea; Minarini, Anna
European Journal of Medicinal Chemistry, 2016 , vol. 117, p. 283 - 291 Title/Abstract Full Text View citing articles Show Details
Colino-Oliveira, Mariana; Rombo, Diogo M.; Dias, Raquel B.; Ribeiro, Joaquim A.; Sebastião, Ana M.
Purinergic Signalling, 2016 , vol. 12, # 2 p. 283 - 294 Title/Abstract Full Text View citing articles Show Details
Dell, Leigh-Anne; Patzke, Nina; Spocter, Muhammad A.; Bertelsen, Mads F.; Siegel, Jerome M.; Manger, Paul R.
Journal of Comparative Neurology, 2016 , vol. 524, # 10 p. 2036 - 2058 Title/Abstract Full Text View citing articles Show Details
Dell, Leigh-Anne; Patzke, Nina; Spocter, Muhammad A.; Siegel, Jerome M.; Manger, Paul R.
Journal of Comparative Neurology, 2016 , vol. 524, # 10 p. 1999 - 2017 Title/Abstract Full Text View citing articles Show Details
Fajemiroye, James O.; da Silva, Dayane M.; de Oliveira, Danillo R.; Costa, Elson A.
Fundamental and Clinical Pharmacology, 2016 , vol. 30, # 3 p. 198 - 215 Title/Abstract Full Text View citing articles Show Details
Komatsu, Takanori; Ohishi, Risa; Shino, Amiu; Kikuchi, Jun
Angewandte Chemie - International Edition, 2016 , vol. 55, # 20 p. 6000 - 6003 Angew. Chem., 2016 , vol. 128, p. 6104 - 6107,4 Title/Abstract Full Text View citing articles Show Details
Hondebrink; Verboven; Drega; Schmeink; de Groot; van Kleef; Wijnolts; Meulenbelt; Westerink
NeuroToxicology, 2016 , vol. 55, p. 1 - 9 Title/Abstract Full Text View citing articles Show Details
Hasunuma, Tomohisa; Matsuda, Mami; Kondo, Akihiko
Metabolic Engineering Communications, 2016 , vol. 3, p. 130 - 141 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Boadas-Vaello; Castany; Homs; Álvarez-Pérez; Deulofeu; Verdú
Spinal Cord, 2016 , vol. 54, # 5 p. 330 - 340 Title/Abstract Full Text View citing articles Show Details
Pires, Marcel V.; Pereira Júnior, Adilson A.; Medeiros, David B.; Daloso, Danilo M.; Pham, Phuong Anh; Barros, Kallyne A.; Engqvist, Martin K. M.; Florian, Alexandra; Krahnert, Ina; Maurino, Veronica G.; Araújo, Wagner L.; Fernie, Alisdair R.
Plant Cell and Environment, 2016 , vol. 39, # 6 p. 1304 - 1319 Title/Abstract Full Text View citing articles Show Details
Delli Pizzi, Stefano; Padulo, Caterina; Brancucci, Alfredo; Bubbico, Giovanna; Edden, Richard A.; Ferretti, Antonio; Franciotti, Raffaella; Manippa, Valerio; Marzoli, Daniele; Onofrj, Marco; Sepede, Gianna; Tartaro, Armando; Tommasi, Luca; Puglisi-Allegra, Stefano; Bonanni, Laura
Social Cognitive and Affective Neuroscience, 2015 , vol. 11, # 5 p. 758 - 766 Title/Abstract Full Text View citing articles Show Details
SUZHOU M-CONJ BIOTECH CO., LTD.; HANGZHOU DAC BIOTECH CO, LTD; ZHAO, Robert Yongxin; YANG, Qingliang; HUANG, Yuanyuan; GAI, Shun; ZHAO, Linyao; YE, Hangbo; GUO, Huihui; TONG, qianqian; CAO, Minjun; JIA, Junxiang; YANG, Chengyu; LI, Wenjun; ZHOU, Xiaomai; XIE, Hongsheng; LIN, Chen; GUO, Zhixiang; YE, Zhicang
Patent: WO2016/59622 A2, 2016 ; Title/Abstract Full Text Show Details
Cuellar-Baena, Sandra; Landeck, Natalie; Sonnay, Sarah; Buck, Kerstin; Mlynarik, Vladimir; In 'T Zandt, René; Kirik, Deniz
Journal of Neurochemistry, 2016 , vol. 137, # 5 p. 806 - 819 Title/Abstract Full Text View citing articles Show Details
ISTITUTO ORTOPEDICO RIZZOLI; UNIVERSITA' DI PISA; LISIGNOLI, Gina; GRASSI, Francesco; CALDERONE, Vincenzo; RAPPOSELLI, Simona
Patent: WO2016/71863 A1, 2016 ; Title/Abstract Full Text Show Details
Altena, Ellemarije; Micoulaud-Franchi, Jean-Arthur; Geoffroy, Pierre-Alexis; Sanz-Arigita, Ernesto; Bioulac, Stephanie; Philip, Pierre
Behavioral Neuroscience, 2016 , vol. 130, # 3 p. 336 - 350 Title/Abstract Full Text View citing articles Show Details
Wang, Xiaona; Li, Peng; Liu, Jingsheng; Jin, Xunbo; Li, Lianjun; Zhang, Dong; Sun, Peng
Neurochemical Research, 2016 , vol. 41, # 6 p. 1401 - 1409 Title/Abstract Full Text View citing articles Show Details
Timby, Erika; Bäckström, Torbjörn; Nyberg, Sigrid; Stenlund, Hans; Wihlbäck, Anna-Carin N.; Bixo, Marie
Psychopharmacology, 2016 , vol. 233, # 11 p. 2109 - 2117 Title/Abstract Full Text View citing articles Show Details
BRISTOL-MYERS SQUIBB COMPANY; GILLMAN, Kevin W.; GOODRICH, Jason; BOY, Kenneth M.; ZHANG, Yunhui; MAPELLI, Claudio; POSS, Michael A.; SUN, Li-Qiang; ZHAO, Qian; MULL, Eric; GILLIS, Eric P.; SCOLA, Paul Michael; LANGLEY, David, R.
Patent: WO2016/77518 A1, 2016 ; Title/Abstract Full Text Show Details
Lee; Absalom; Hanrahan; Van Nieuwenhuijzen; Ahring; Chebib
Brain Research, 2016 , vol. 1644, p. 222 - 230 Title/Abstract Full Text View citing articles Show Details
Gurak, John A.; Yang, Kin S.; Liu, Zhen; Engle, Keary M.
Journal of the American Chemical Society, 2016 , vol. 138, # 18 p. 5805 - 5808 Title/Abstract Full Text View citing articles Show Details
Kumari, Santosh; Shakoor, S.M. Abdul; Bajaj, Kiran; Nanjegowda; Mallu; Sakhuja, Rajeev
Tetrahedron Letters, 2016 , vol. 57, # 25 p. 2732 - 2736 Title/Abstract Full Text View citing articles Show Details
Aseervatham, G. Smilin Bell; Suryakala; Doulethunisha; Sundaram; Bose, P. Chandra; Sivasudha
Biomedicine and Pharmacotherapy, 2016 , vol. 82, p. 54 - 64 Title/Abstract Full Text View citing articles Show Details
Padmanabhan, Balasundaram; Mathur, Shruti; Manjula, Ramu; Tripathi, Shailesh
Journal of Biosciences, 2016 , vol. 41, # 2 p. 295 - 311 Title/Abstract Full Text View citing articles Show Details
Richards, John R.; Garber, Dariush; Laurin, Erik G.; Albertson, Timothy E.; Derlet, Robert W.; Amsterdam, Ezra A.; Olson, Kent R.; Ramoska, Edward A.; Lange, Richard A.
Clinical Toxicology, 2016 , vol. 54, # 5 p. 345 - 364 Title/Abstract Full Text View citing articles Show Details
McTier, Tom L.; Chubb, Nathan; Curtis, Michael P.; Hedges, Laura; Inskeep, Gregory A.; Knauer, Christopher S.; Menon, Sanjay; Mills, Brian; Pullins, Aleah; Zinser, Erich; Woods, Debra J.; Meeus, Patrick
Veterinary Parasitology, 2016 , vol. 222, p. 3 - 11 Title/Abstract Full Text View citing articles Show Details
Villalpando-Vargas, Fridha; Medina-Ceja, Laura
Seizure, 2016 , vol. 39, p. 49 - 55 Title/Abstract Full Text View citing articles Show Details
Naffaa, Moawiah M.; Absalom, Nathan; Raja Solomon; Chebib, Mary; Hibbs, David E.; Hanrahan, Jane R.
PLoS ONE, 2016 , vol. 11, # 5 art. no. E0156618 Title/Abstract Full Text View citing articles Show Details
Giordano, Antonio; Frontini, Andrea; Cinti, Saverio
Nature Reviews Drug Discovery, 2016 , vol. 15, # 6 p. 405 - 424 Title/Abstract Full Text View citing articles Show Details
128 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Goyal, Vinay; Laisram, Nonica; Wadhwa, Ranjan Kumar; Kothari, Shashank Yashwant
Journal of Clinical and Diagnostic Research, 2016 , vol. 10, # 6 p. RC05 Title/Abstract Full Text View citing articles Show Details
Hiremathad, Asha; Chand, Karam; Esteves, A. Raquel; Cardoso, Sandra M.; Ramsay, Rona R.; Chaves, Slvia; Keri, Rangappa S.; Santos, M. Amlia
RSC Advances, 2016 , vol. 6, # 58 p. 53519 - 53532 Title/Abstract Full Text View citing articles Show Details
BSIM2 – BIOMOLECULAR SIMULATIONS LDA; PONTES MEIRELES FERREIRA DE BRITO, Rui Manuel; VIEIRA SIMÕES, Carlos Jose; DE VASCONCELOS DIAS DE PINHO MELO, Teresa Margarida; DA SILVA VICTOR, Bruno Lourenço; LOURENÇO DE ALMEIDA, Zaida Catarina; CABRAL LOPES, Ana Lucia; OLIVEIRA NASCIMENTO, Bruno Filipe
Patent: WO2016/80853 A1, 2016 ; Title/Abstract Full Text Show Details
Shrestha, Shikshya; Offer, Steven M.
Medical Epigenetics, 2016 , vol. 4, # 1 p. 1 - 19 Title/Abstract Full Text Show Details
Shams, Waqqas M.; Sanio, Christian; Quinlan, Matthew G.; Brake, Wayne G.
Neuroscience, 2016 , vol. 330, p. 162 - 170 Title/Abstract Full Text View citing articles Show Details
Patassini, Stefano; Begley, Paul; Xu, Jingshu; Church, Stephanie J.; Reid, Suzanne J.; Kim, Eric H.; Curtis, Maurice A.; Dragunow, Mike; Waldvogel, Henry J.; Snell, Russell G.; Unwin, Richard D.; Faull, Richard L.M.; Cooper, Garth J.S.
Biochimica et Biophysica Acta - Molecular Basis of Disease, 2016 , vol. 1862, # 9 p. 1650 - 1662 Title/Abstract Full Text View citing articles Show Details
Mesquita, Laura Tavares; Abreu, Aline Rezende; de Abreu, Alessandra Rezende; de Souza, Aline Arlindo; de Noronha, Sylvana Rendeiro; Silva, Fernanda Cacilda; Campos, Glenda Siqueira Viggiano; Chianca, Deoclecio Alves; de Menezes, Rodrigo Cunha
Neuroscience, 2016 , vol. 330, p. 181 - 190 Title/Abstract Full Text View citing articles Show Details
Serafini, Anna; Lukas, Rimas V.; VanHaerents, Stephen; Warnke, Peter; Tao, James X.; Rose, Sandra; Wu, Shasha
Epilepsy and Behavior, 2016 , vol. 61, p. 51 - 58 Title/Abstract Full Text View citing articles Show Details
LOHOCLA RESEARCH CORPORATION; TABAKOFF, Boris
Patent: WO2015/195943 A1, 2015 ; Title/Abstract Full Text Show Details
Fernández-Ruiz, Javier; Moro, María A.; Martínez-Orgado, José
Neurotherapeutics, 2015 , vol. 12, # 4 p. 793 - 806 Title/Abstract Full Text View citing articles Show Details
Cardinali, Daniel P.; Golombek, Diego A.; Rosenstein, Ruth E.; Brusco, Luis I.; Vigo, Daniel E.
Pharmacological Research, 2016 , vol. 109, p. 12 - 23 Title/Abstract Full Text View citing articles Show Details
Gravielle, María Clara
Pharmacological Research, 2016 , vol. 109, p. 92 - 100 Title/Abstract Full Text View citing articles Show Details
Tyurenkov; Borodkina; Bagmetova; Berestovitskaya; Vasil’eva
Bulletin of Experimental Biology and Medicine, 2016 , vol. 160, # 4 p. 465 - 469 Title/Abstract Full Text View citing articles Show Details
Hollins, Sharon L.; Zavitsanou, Katerina; Walker, Frederick Rohan; Cairns, Murray J.
Brain, Behavior, and Immunity, 2016 , vol. 56, p. 187 - 196 Title/Abstract Full Text View citing articles Show Details
Mikkelsen, Mark; Singh, Krish D.; Sumner, Petroc; Evans, C. John
Magnetic Resonance in Medicine, 2016 , vol. 75, # 3 p. 946 - 953 Title/Abstract Full Text View citing articles Show Details
Li, Shizhe; An, Li; Yu, Shao; Ferraris Araneta, Maria; Johnson, Christopher S.; Wang, Shumin; Shen, Jun
Magnetic Resonance in Medicine, 2016 , vol. 75, # 3 p. 954 - 961 Title/Abstract Full Text View citing articles Show Details
Bisagno, Veronica; González, Betina; Urbano, Francisco J.
Pharmacological Research, 2016 , vol. 109, p. 108 - 118 Title/Abstract Full Text View citing articles Show Details
Wei, Wen-Long; Zeng, Rui; Gu, Cai-Mei; Qu, Yan; Huang, Lin-Fang
Journal of Ethnopharmacology, 2016 , vol. 190, p. 116 - 141 Title/Abstract Full Text View citing articles Show Details
Shariatgorji, Mohammadreza; Strittmatter, Nicole; Nilsson, Anna; Källback, Patrik; Alvarsson, Alexandra; Zhang, Xiaoqun; Vallianatou, Theodosia; Svenningsson, Per; Goodwin, Richard J.A.; Andren, Per E.
NeuroImage, 2016 , vol. 136, p. 129 - 138 Title/Abstract Full Text View citing articles Show Details
Nakamura, Yasuyuki; Ishii, Jun; Kondo, Akihiko
Current Medicinal Chemistry, 2016 , vol. 23, # 16 p. 1638 - 1656 Title/Abstract Full Text View citing articles Show Details
129 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Forkuo, Gloria S.; Guthrie, Margaret L.; Yuan, Nina Y.; Nieman, Amanda N.; Kodali, Revathi; Jahan, Rajwana; Stephen, Michael R.; Yocum, Gene T.; Treven, Marco; Poe, Michael M.; Li, Guanguan; Yu, Olivia B.; Hartzler, Benjamin D.; Zahn, Nicolas M.; Ernst, Margot; Emala, Charles W.; Stafford, Douglas C.; Cook, James M.; Arnold, Leggy A.
Molecular Pharmaceutics, 2016 , vol. 13, # 6 p. 2026 - 2038 Title/Abstract Full Text View citing articles Show Details
Butini; Nikolic; Kassel; Brückmann; Filipic; Agbaba; Gemma; Brogi; Brindisi; Campiani; Stark
Progress in Neurobiology, 2016 , vol. 142, p. 68 - 103 Title/Abstract Full Text View citing articles Show Details
Nakamura, Yasuko; Morrow, Danielle H.; Modgil, Amit; Huyghe, Deborah; Deeb, Tarek Z.; Lumb, Michael J.; Davies, Paul A.; Moss, Stephen J.
Journal of Biological Chemistry, 2016 , vol. 291, # 23 p. 12394 - 12407 Title/Abstract Full Text View citing articles Show Details
Reznik, Michael E.; Berger, Karen; Claassen, Jan
Journal of Clinical Medicine, 2016 , vol. 5, # 5 art. no. 54 Title/Abstract Full Text Show Details
Potter, Liam E.; Paylor, John W.; Suh, Jee Su; Tenorio, Gustavo; Caliaperumal, Jayalakshmi; Colbourne, Fred; Baker, Glen; Winship, Ian; Kerr, Bradley J.
Journal of Neuroinflammation, 2016 , vol. 13, # 1 art. no. 142 Title/Abstract Full Text View citing articles Show Details
Hwang; Lee; Oh; Kang; Um; Park; Kim; Shin; Darnell; Chung
Cell Death and Disease, 2016 , vol. 7, # 6 art. no. E2240 Title/Abstract Full Text View citing articles Show Details
Tavakoli, Yasaman; Esmaeili, Abolghasem; Saber, Hossein
Computational Biology and Chemistry, 2016 , vol. 64, p. 74 - 81 Title/Abstract Full Text View citing articles Show Details
Arjmand, Shokouh; Vaziri, Zohreh; Behzadi, Mina; Abbassian, Hassan; Stephens, Gary J.; Shabani, Mohammad
Neurotherapeutics, 2015 , vol. 12, # 4 p. 778 - 787 Title/Abstract Full Text View citing articles Show Details
Jawale, Akshay; Datusalia, Ashok Kumar; Bishnoi, Mahendra; Sharma, Shyam S.
Phytomedicine, 2016 , vol. 23, # 9 p. 923 - 930 Title/Abstract Full Text View citing articles Show Details
Rosenberg, Evan C.; Tsien, Richard W.; Whalley, Benjamin J.; Devinsky, Orrin
Neurotherapeutics, 2015 , vol. 12, # 4 p. 747 - 768 Title/Abstract Full Text View citing articles Show Details
Hughes, Steven; Rodgers, Jessica; Hickey, Doron; Foster, Russell G.; Peirson, Stuart N.; Hankins, Mark W.
Scientific Reports, 2016 , vol. 6, art. no. 28086 Title/Abstract Full Text View citing articles Show Details
Zestos, Alexander G.; Mikelman, Sarah R.; Kennedy, Robert T.; Gnegy, Margaret E.
ACS Chemical Neuroscience, 2016 , vol. 7, # 6 p. 757 - 766 Title/Abstract Full Text View citing articles Show Details
Gonçalves; Abreu; Coqueiro; Gaspar; Borges; Choi; Pires; Simões
RSC Advances, 2016 , vol. 6, # 61 p. 56091 - 56100 Title/Abstract Full Text View citing articles Show Details
Pitman, Kimberley A.; Young, Kaylene M.
International Journal of Biochemistry and Cell Biology, 2016 , vol. 77, p. 30 - 34 Title/Abstract Full Text View citing articles Show Details
Hung, Hsin-Yi; Wu, Tian-Shung
Journal of Food and Drug Analysis, 2016 , vol. 24, # 2 p. 221 - 238 Title/Abstract Full Text View citing articles Show Details
Kohtala, Samuel; Theilmann, Wiebke; Suomi, Tomi; Wigren, Henna-Kaisa; Porkka-Heiskanen, Tarja; Elo, Laura L.; Rokka, Anne; Rantamäki, Tomi
ACS Chemical Neuroscience, 2016 , vol. 7, # 6 p. 749 - 756 Title/Abstract Full Text View citing articles Show Details
Nyporko, A. Yu.; Naumenko; Golius; Tsymbaliuk; Shapoval; Davidovska
Neurophysiology, 2015 , vol. 47, # 5 p. 364 - 375 Title/Abstract Full Text View citing articles Show Details
Zikopoulos, Basilis; John, Yohan J.; García-Cabezas, Miguel Ángel; Bunce, Jamie G.; Barbas, Helen
Neuroscience, 2016 , vol. 330, p. 267 - 290 Title/Abstract Full Text View citing articles Show Details
Mostaid, Md Shaki; Lloyd, David; Liberg, Benny; Sundram, Suresh; Pereira, Avril; Pantelis, Christos; Karl, Tim; Weickert, Cynthia Shannon; Everall, Ian P.; Bousman, Chad A.
Neuroscience and Biobehavioral Reviews, 2016 , vol. 68, p. 387 - 409 Title/Abstract Full Text View citing articles Show Details
Li, Meijia; Wang, Lingling; Qiu, Limei; Wang, Weilin; Xin, Lusheng; Xu, Jiachao; Wang, Hao; Song, Linsheng
Developmental and Comparative Immunology, 2016 , vol. 63, p. 56 - 65 Title/Abstract Full Text View citing articles Show Details
130 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Greenhouse, Ian; Noah, Sean; Maddock, Richard J.; Ivry, Richard B.
NeuroImage, 2016 , vol. 139, p. 1 - 7 Title/Abstract Full Text View citing articles Show Details
Forouzanfar, Fatemeh; Ghorbani, Ahmad; Hosseini, Mahmoud; Rakhshandeh, Hassan
Avicenna Journal of Phytomedicine, 2016 , vol. 6, # 4 p. 449 - 457 Title/Abstract Full Text Show Details
Nesterkina, Mariia; Kravchenko, Iryna
Pharmaceuticals, 2016 , vol. 9, # 2 art. no. 32 Title/Abstract Full Text View citing articles Show Details
Watanabe, Kazuki; Fujii, Katsuhiko
Algal Research, 2016 , vol. 18, p. 135 - 143 Title/Abstract Full Text View citing articles Show Details
Kubyshkin, Vladimir; Durkin, Patrick; Budisa, Nediljko
New Journal of Chemistry, 2016 , vol. 40, # 6 p. 5209 - 5220 Title/Abstract Full Text View citing articles Show Details
du Jardin, Kristian Gaarn; Müller, Heidi Kaastrup; Elfving, Betina; Dale, Elena; Wegener, Gregers; Sanchez, Connie
Progress in Neuro-Psychopharmacology and Biological Psychiatry, 2016 , vol. 71, p. 27 - 38 Title/Abstract Full Text View citing articles Show Details
Cho, Young-Ah; Kim, Duck-Su; Song, Miyeoun; Bae, Won-Jung; Lee, Soojung; Kim, Eun-Cheol
Journal of Endodontics, 2016 , vol. 42, # 7 p. 1055 - 1061 Title/Abstract Full Text View citing articles Show Details
Liu, Liping; Yang, Chenglin; Shen, Jianfei; Huang, Liyan; Lin, Weixuan; Tang, Hailing; Liang, Wenhua; Shao, Wenlong; Zhang, Haibo; He, Jianxing
Oncotarget, 2016 , vol. 7, # 22 p. 32341 - 32350 Title/Abstract Full Text View citing articles Show Details
Palotai, Miklos; Telegdy, Gyula
Peptides, 2016 , vol. 82, p. 20 - 25 Title/Abstract Full Text View citing articles Show Details
Lindsley, Craig W.; Emmitte, Kyle A.; Hopkins, Corey R.; Bridges, Thomas M.; Gregory, Karen J.; Niswender, Colleen M.; Conn, P. Jeffrey
Chemical Reviews, 2016 , vol. 116, # 11 p. 6707 - 6741 Title/Abstract Full Text View citing articles Show Details
Mao, Xiao-Yuan; Tokay, Tursonjan; Zhou, Hong-Hao; Jin, Wei-Lin
Oncotarget, 2016 , vol. 7, # 22 p. 33451 - 33460 Title/Abstract Full Text View citing articles Show Details
Supasuteekul, Chonlakan; Nonthitipong, Wanroong; Tadtong, Sarin; Likhitwitayawuid, Kittisak; Tengamnuay, Parkpoom; Sritularak, Boonchoo
Brazilian Journal of Pharmacognosy, 2016 , vol. 26, # 3 p. 312 - 320 Title/Abstract Full Text View citing articles Show Details
Palleja, Albert; Kashani, Alireza; Allin, Kristine H.; Nielsen, Trine; Zhang, Chenchen; Li, Yin; Brach, Thorsten; Liang, Suisha; Feng, Qiang; Jørgensen, Nils Bruun; Bojsen-Møller, Kirstine N.; Dirksen, Carsten; Burgdorf, Kristoffer S.; Holst, Jens J.; Madsbad, Sten; Wang, Jun; Pedersen, Oluf; Hansen, Torben; Arumugam, Manimozhiyan
Genome Medicine, 2016 , vol. 8, # 1 art. no. 67 Title/Abstract Full Text View citing articles Show Details
Farzaei, Mohammad Hosein; Bahramsoltani, Roodabeh; Rahimi, Roja; Abbasabadi, Faezeh; Abdollahi, Mohammad
Current Topics in Medicinal Chemistry, 2016 , vol. 16, # 17 p. 1924 - 1942 Title/Abstract Full Text View citing articles Show Details
Zhang, Qiansen; Gao, Zhaobing; Yang, Huaiyu
Current Topics in Medicinal Chemistry, 2016 , vol. 16, # 16 p. 1819 - 1829 Title/Abstract Full Text View citing articles Show Details
Pathak, Ashish; Srivastava, Amit K.; Singour, Pradeep K.; Gouda, Panchanan
Central Nervous System Agents in Medicinal Chemistry, 2016 , vol. 16, # 2 p. 81 - 97 Title/Abstract Full Text View citing articles Show Details
Patil, Vaishali M.; Gupta, Satya P.
Current Topics in Medicinal Chemistry, 2016 , vol. 16, # 16 p. 1862 - 1876 Title/Abstract Full Text View citing articles Show Details
Bao, Lidao; Si, Lengge; Wang, Yuehong; Wuyun, Gerile; Bo, Agula
Experimental and Therapeutic Medicine, 2016 , vol. 12, # 2 p. 1075 - 1084 Title/Abstract Full Text View citing articles Show Details
Jiménez-Sánchez, Laura; Castañé, Anna; Pérez-Caballero, Laura; Grifoll-Escoda, Marc; López-Gil, Xavier; Campa, Leticia; Galofré, Mireia; Berrocoso, Esther; Adell, Albert
Cerebral Cortex, 2016 , vol. 26, # 6 p. 2778 - 2789 Title/Abstract Full Text View citing articles Show Details
Vanderperre, Benoît; Herzig, Sébastien; Krznar, Petra; Hörl, Manuel; Ammar, Zeinab; Montessuit, Sylvie; Pierredon, Sandra; Zamboni, Nicola; Martinou, Jean-Claude
PLoS Genetics, 2016 , vol. 12, # 5 art. no. E1006056, p. 20 Title/Abstract Full Text View citing articles Show Details
131 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Margolis, Kara Gross; Li, Zhishan; Stevanovic, Korey; Saurman, Virginia; Israelyan, Narek; Anderson, George M.; Snyder, Isaac; VeenstraVanderWeele, Jeremy; Blakely, Randy D.; Gershon, Michael D.
Journal of Clinical Investigation, 2016 , vol. 126, # 6 p. 2221 - 2235 Title/Abstract Full Text View citing articles Show Details
Martinez-Hernandez, Eugenia; Ariño, Helena; McKeon, Andrew; Iizuka, Takahiro; Titulaer, Maarten J.; Simabukuro, Mateus M.; Lancaster, Eric; Petit-Pedrol, Mar; Planagumà, Jesú; Blanco, Yolanda; Harvey, Robert J.; Saiz, Albert; Graus, Francesc; Dalmau, Josep
JAMA Neurology, 2016 , vol. 73, # 6 p. 714 - 720 Title/Abstract Full Text View citing articles Show Details
Iizuka, Takahiro; Kaneko, Juntaro; Tominaga, Naomi; Someko, Hidehiro; Nakamura, Masaaki; Ishima, Daisuke; Kitamura, Eiji; Masuda, Ray; Oguni, Eiichi; Yanagisawa, Toshiyuki; Kanazawa, Naomi; Dalmau, Josep; Nishiyama, Kazutoshi
JAMA Neurology, 2016 , vol. 73, # 6 p. 706 - 713 Title/Abstract Full Text View citing articles Show Details
Hamed, Sherifa A.
Expert Review of Clinical Pharmacology, 2016 , vol. 9, # 6 p. 807 - 819 Title/Abstract Full Text View citing articles Show Details
Peng, Liang; Li, Baoman; Verkhratsky, Alexei
Expert Review of Neurotherapeutics, 2016 , vol. 16, # 6 p. 649 - 657 Title/Abstract Full Text View citing articles Show Details
Tavakol, Shima; Saber, Reza; Hoveizi, Elham; Aligholi, Hadi; Ai, Jafar; Rezayat, Seyed Mahdi
Molecular Neurobiology, 2016 , vol. 53, # 5 p. 3298 - 3308 Title/Abstract Full Text View citing articles Show Details
Taskin, Belgin Gocmen; Dogaroglu, Taylan; Kilic, Sercan; Dogac, Ersin; Taskin, Vatan
Pesticide Biochemistry and Physiology, 2016 , vol. 129, p. 14 - 27 Title/Abstract Full Text View citing articles Show Details
Li, Yan; Jakary, Angela; Gillung, Erin; Eisendrath, Stuart; Nelson, Sarah J.; Mukherjee, Pratik; Luks, Tracy
Magnetic Resonance Materials in Physics, Biology and Medicine, 2016 , vol. 29, # 3 p. 523 - 533 Title/Abstract Full Text View citing articles Show Details
Canetta; Bolkan; Padilla-Coreano; Song; Sahn; Harrison; Gordon; Brown; Kellendonk
Molecular Psychiatry, 2016 , vol. 21, # 7 p. 956 - 968 Title/Abstract Full Text View citing articles Show Details
Liu, Xinmin; Hernandez, Nora; Kisselev, Sergey; Floratos, Aris; Sawle, Ashley; Ionita-Laza, Iuliana; Ottman, Ruth; Louis, Elan D.; Clark, Lorraine N.
European Journal of Human Genetics, 2016 , vol. 24, # 7 p. 1009 - 1015 Title/Abstract Full Text View citing articles Show Details
Kwon, Oh-Ju; Lee, Jun-Seok; Kim, Hang-Gu; Jeon, Chang-Jin
Current Eye Research, 2016 , vol. 41, # 6 p. 832 - 843 Title/Abstract Full Text View citing articles Show Details
Zhong, Min; Yuan, Yinghui; Shu, Sheng; Sun, Jin; Guo, Shirong; Yuan, Ruonan; Tang, Yuanyuan
Plant Growth Regulation, 2016 , vol. 79, # 3 p. 319 - 330 Title/Abstract Full Text View citing articles Show Details
Khom, Sophia; Hintersteiner; Luger; Haider; Pototschnig; Mihovilovic; Schwarzer, Christoph; Hering
Journal of Pharmacology and Experimental Therapeutics, 2016 , vol. 357, # 3 p. 580 - 590 Title/Abstract Full Text View citing articles Show Details
Cohn, Joshua A.; Brown, Elizabeth T.; Reynolds, W. Stuart; Kaufman, Melissa R.; Dmochowski, Roger R.
Expert Opinion on Drug Metabolism and Toxicology, 2016 , vol. 12, # 6 p. 657 - 667 Title/Abstract Full Text View citing articles Show Details
Liu, Qingdai; Cheng, Haijiao; Ma, Xiaoqian; Xu, Ning; Liu, Jun; Ma, Yanhe
Biotechnology Letters, 2016 , vol. 38, # 7 p. 1107 - 1113 Title/Abstract Full Text View citing articles Show Details
Spiegelhalder, Kai; Regen, Wolfram; Nissen, Christoph; Feige, Bernd; Baglioni, Chiara; Riemann, Dieter; Hennig, Jürgen; Lange, Thomas
PLoS ONE, 2016 , vol. 11, # 6 art. no. E0156771. Title/Abstract Full Text View citing articles Show Details
Malaspina; Roullet; Pearl; Ainslie; Vogel; Gibson
Neurochemistry International, 2016 , vol. 99, p. 72 - 84 Title/Abstract Full Text View citing articles Show Details
Kim, So-Hyun; Lim, Sa Rang; Hong, Seong-Joo; Cho, Byung-Kwan; Lee, Hookeun; Lee, Choul-Gyun; Choi, Hyung-Kyoon
Journal of Agricultural and Food Chemistry, 2016 , vol. 64, # 23 p. 4807 - 4816 Title/Abstract Full Text View citing articles Show Details
Safavynia, Seyed A.; Keating, Glenda; Speigel, Iris; Fidler, Jonathan A.; Kreuzer, Matthias; Rye, David B.; Jenkins, Andrew; García, Paul S.
Anesthesiology, 2016 , vol. 125, # 1 p. 147 - 158 Title/Abstract Full Text View citing articles Show Details
Altarche-Xifro, Wassim; di Vicino, Umberto; Muñoz-Martin, Maria Isabel; Bortolozzi, Analía; Bové, Jordi; Vila, Miquel; Cosma, Maria Pia
EBioMedicine, 2016 , vol. 8, p. 83 - 95 Title/Abstract Full Text View citing articles Show Details
132 of 992
133 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Martinetz, Stefanie
Pflugers Archiv European Journal of Physiology, 2016 , vol. 468, # 6 p. 1061 - 1069 Title/Abstract Full Text View citing articles Show Details
Wang, Jin-Gang; Cai, Qing; Zheng, Jun; Dong, Yu-Shu; Li, Jin-Jiang; Li, Jing-Chen; Hao, Guang-Zhi; Wang, Chao; Wang, Ju-Lei
Neurochemical Research, 2016 , vol. 41, # 7 p. 1751 - 1760 Title/Abstract Full Text View citing articles Show Details
Voytenko; Lushnikova; Savotchenko; Isaeva; Skok; Lykhmus, O.Yu.; Patseva; Skibo
Brain Research, 2015 , vol. 1616, p. 134 - 145 Title/Abstract Full Text View citing articles Show Details
Krajnc, Natalija; Zidar, Janez
European Journal of Paediatric Neurology, 2016 , vol. 20, # 4 p. 597 - 603 Title/Abstract Full Text View citing articles Show Details
Wu, Jie; Gao, Ming; Rice, Stephen G.; Tsang, Candy; Beggs, John; Turner, Dharshaun; Li, Guohui; Yang, Bo; Xia, Kunkun; Gao, Fenfei; Qiu, Shenfeng; Liu, Qiang; Kerrigan, John F.
EBioMedicine, 2016 , vol. 8, p. 96 - 102 Title/Abstract Full Text View citing articles Show Details
Zhang, Xuan; Liu, Shuliang; Newport, Glenn D.; Paule, Merle G.; Callicott, Ralph; Thompson, James; Liu, Fang; Patterson, Tucker A.; Berridge, Marc S.; Apana, Scott M.; Brown, Christina C.; Maisha, Mackean P.; Hanig, Joseph P.; Slikker, William; Wang, Cheng
Anesthesiology, 2016 , vol. 125, # 1 p. 133 - 146 Title/Abstract Full Text View citing articles Show Details
Lee, Da Eun; Shin, Gi Ru; Lee, Sunmin; Jang, Eun Seok; Shin, Hye Won; Moon, Byoung Seok; Lee, Choong Hwan
Food Research International, 2016 , vol. 87, p. 10 - 17 Title/Abstract Full Text View citing articles Show Details
Bergh, Marianne Skov-Skov; Bogen, Inger Lise; Lundanes, Elsa; Øiestad, Åse Marit Leere
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2016 , vol. 1028, p. 120 - 129 Title/Abstract Full Text View citing articles Show Details
Sun, Bing; Chen, Linhai; Liu, Lei; Xia, Zhixiong; Pin, Jean-Philippe; Nan, Fajun; Liu, Jianfeng
Biochemical Journal, 2016 , vol. 473, # 6 p. 779 - 787 Title/Abstract Full Text View citing articles Show Details
Wang; Song; Huang; Gao
Genetics and Molecular Research, 2016 , vol. 15, # 2 art. no. GMR.15027340 Title/Abstract Full Text View citing articles Show Details
Min, Chang Ho; Min, Young Sil; Lee, Sang Joon; Sohn, Uy Dong
Archives of Pharmacal Research, 2016 , vol. 39, # 6 p. 863 - 870 Title/Abstract Full Text View citing articles Show Details
Shevelev; Seryapina; Markel; Moshkin
Russian Journal of Genetics: Applied Research, 2016 , vol. 6, # 4 p. 424 - 429 Title/Abstract Full Text View citing articles Show Details
Gulevich; Akulov; Shikhevich; Kozhemyakina
Russian Journal of Genetics: Applied Research, 2016 , vol. 6, # 4 p. 430 - 436 Title/Abstract Full Text View citing articles Show Details
Torres-Hernández, Bianca A.; Colón, Luis R.; Rosa-Falero, Coral; Torrado, Aranza; Miscalichi, Nahira; Ortíz, José G.; González-Sepúlveda, Lorena; Pérez-Ríos, Naydi; Suárez-Pérez, Erick; Bradsher, John N.; Behra, Martine
Psychopharmacology, 2016 , vol. 233, # 13 p. 2533 - 2547 Title/Abstract Full Text View citing articles Show Details
van Brederode, Johannes; Atak, Sinem; Kessler, Artur; Pischetsrieder, Monika; Villmann, Carmen; Alzheimer, Christian
Neuroscience Letters, 2016 , vol. 628, p. 91 - 97 Title/Abstract Full Text View citing articles Show Details
Dalton, Neal; Gordon, Christopher P.; Boyle, Timothy P.; Vandegraaf, Nicholas; Deadman, John; Rhodes, David I.; Coates, Jonathan A.; Pyne, Stephen G.; Keller, Paul A.; Bremner, John B.
Organic and Biomolecular Chemistry, 2016 , vol. 14, # 25 p. 6010 - 6023 Title/Abstract Full Text View citing articles Show Details
Katow, Hideki; Katow, Tomoko; Yoshida, Hiromi; Kiyomoto, Masato; Uemura, Isao
Frontiers in Zoology, 2016 , vol. 13, # 1 art. no. 27 Title/Abstract Full Text View citing articles Show Details
Wang, Wen-Tung; Lee, Phil; Dong, Yafeng; Yeh, Hung-Wen; Kim, Jieun; Weiner, Carl P.; Brooks, William M.; Choi, In-Young
Neurochemical Research, 2016 , vol. 41, # 7 p. 1831 - 1843 Title/Abstract Full Text View citing articles Show Details
Amirmohseni, Saeedeh; Wachsmuth, Lydia; Just, Nathalie; Faber, Cornelius
Magnetic Resonance Imaging, 2016 , vol. 34, # 8 p. 1155 - 1160 Title/Abstract Full Text View citing articles Show Details
Danilov, Andrei; Kurganova, Julia
Pain and Therapy, 2016 , vol. 5, # 1 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Thiyajai, Parunya; Saetang, Preecha; Kettawan, Aikkarach; Charoenkiatkul, Somsri; Srichamnong, Warangkana
LWT - Food Science and Technology, 2016 , vol. 73, p. 406 - 411 Title/Abstract Full Text View citing articles Show Details
Bhandari, Apoorva; Radhu, Natasha; Farzan, Faranak; Mulsant, Benoit H.; Rajji, Tarek K.; Daskalakis, Zafiris J.; Blumberger, Daniel M.
Clinical Neurophysiology, 2016 , vol. 127, # 8 p. 2834 - 2845 Title/Abstract Full Text View citing articles Show Details
Colavita, Michelangelo; Terral, Geoffrey; Lemercier, Clement E.; Drago, Filippo; Marsicano, Giovanni; Massa, Federico
Scientific Reports, 2016 , vol. 6, art. no. 28454 Title/Abstract Full Text View citing articles Show Details
Aroeira, Rita I.; Vaz, Sandra H.; Sebastião, Ana M.; Valente, Cláudia A.
Neurochemistry International, 2016 , vol. 99, p. 94 - 102 Title/Abstract Full Text View citing articles Show Details
Li, Qi; Gu, Wenbo; Ma, Xuan; Liu, Yuxin; Jiang, Lidan; Feng, Rennan; Liu, Liyan
Nutrients, 2016 , vol. 8, # 6 art. no. 379 Title/Abstract Full Text View citing articles Show Details
Gorkhali, Rakshya; Huang, Kenneth; Kirberger, Michael; Yang, Jenny J.
Metallomics, 2016 , vol. 8, # 6 p. 563 - 578 Title/Abstract Full Text View citing articles Show Details
Tajti, János; Szok, Délia; Majláth, Zsófia; Csáti, Anett; Petrovics-Balog, Anna; Vécsei, László
Expert Opinion on Drug Metabolism and Toxicology, 2016 , vol. 12, # 7 p. 753 - 764 Title/Abstract Full Text View citing articles Show Details
Armstrong, Terri S.; Grant, Robin; Gilbert, Mark R.; Lee, Jong Woo; Norden, Andrew D.
Neuro-Oncology, 2016 , vol. 18, # 6 p. 779 - 789 Title/Abstract Full Text View citing articles Show Details
Mariani, John J.; Malcolm, Robert J.; Mamczur, Agnieszka K.; Choi, Jean C.; Brady, Ronald; Nunes, Edward; Levin, Frances R.
American Journal of Drug and Alcohol Abuse, 2016 , vol. 42, # 3 p. 333 - 340 Title/Abstract Full Text View citing articles Show Details
Dahlberg, Daniel; Ivanovic, Jugoslav; Hassel, Bjørnar
Journal of Neurosurgery, 2016 , vol. 124, # 3 p. 854 - 860 Title/Abstract Full Text View citing articles Show Details
Kim, Jinhyung; Ryu, Sang Baek; Lee, Sung Eun; Shin, Jaewoo; Jung, Hyun Ho; Kim, Sung June; Kim, Kyung Hwan; Chang, Jin Woo
Journal of Neurosurgery, 2016 , vol. 124, # 3 p. 866 - 876 Title/Abstract Full Text View citing articles Show Details
Alqarawi, Abdulaziz Abdullah; Hashem, Abeer; Abd Allah, Elsayed Fathi; Al-Huqail, Asma A.; Alshahrani, Thobayet Safr; Alshalawi, Sa’ad Rukban; Egamberdieva, Dilfuza
Legume Research, 2016 , vol. 39, # 3 art. no. LR-254, p. 396 - 404 Title/Abstract Full Text View citing articles Show Details
Ullah, Mohammad F.; Bhat, Showket H.; Husain, Eram; Abu-Duhier, Faisel; Hadi; Sarkar, Fazlul H.; Ahmad, Aamir
Critical Reviews in Food Science and Nutrition, 2016 , vol. 56, # 9 p. 1501 - 1518 Title/Abstract Full Text View citing articles Show Details
Tarnal, Vijay; Vlisides, Phillip E.; Mashour, George A.
Journal of Neurosurgical Anesthesiology, 2016 , vol. 28, # 3 p. 250 - 255 Title/Abstract Full Text View citing articles Show Details
Lang, Julien; Faure, Denis
Plant Signaling and Behavior, 2016 , vol. 11, # 5 art. no. E1178440, p. 3 Title/Abstract Full Text View citing articles Show Details
Pendharkar, Arjun V.; Levy, Sabrina L.; Ho, Allen L.; Sussman, Eric S.; Cheng, Michelle Y.; Steinberg, Gary K.
Neurosurgical Focus, 2016 , vol. 40, # 5 art. no. E6 Title/Abstract Full Text View citing articles Show Details
Scaplen, Kristin M.; Kaun, Karla R.
Journal of Neurogenetics, 2016 , vol. 30, # 2 p. 133 - 148 Title/Abstract Full Text View citing articles Show Details
Sayar, Gokben Hizli; Cetin, Mesut
Klinik Psikofarmakoloji Bulteni, 2016 , vol. 26, # 2 p. 93 - 102 Title/Abstract Full Text View citing articles Show Details
Dzamba, David; Harantova, Lenka; Butenko, Olena; Anderova, Miroslava
Current Alzheimer Research, 2016 , vol. 13, # 8 p. 894 - 911 Title/Abstract Full Text View citing articles Show Details
Peterlik, Daniel; Flor, Peter J.; Uschold-Schmidt, Nicole
Current Neuropharmacology, 2016 , vol. 14, # 5 p. 514 - 539 Title/Abstract Full Text View citing articles Show Details
134 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Hu, Sheng; Huang, Jun; Ke, Pi-Yu; Zhao, Wei-Rui; Lü, Chang-Jiang; Wang, Jin-Bo; Shang, Long-An; Mei, Le-He
Gao Xiao Hua Xue Gong Cheng Xue Bao/Journal of Chemical Engineering of Chinese Universities, 2016 , vol. 30, # 3 p. 648 - 654 Title/Abstract Full Text View citing articles Show Details
Bao, Weichen; Mi, Zhihui; Xu, Haiyan; Zheng, Yi; Kwok, Lai Yu; Zhang, Heping; Zhang, Wenyi
Scientific Reports, 2016 , vol. 6, art. no. 28358 Title/Abstract Full Text View citing articles Show Details
Li, Ming-Hui; Xu, Hua-Dong; Liu, Yan; Chen, Ting; Jiang, Lei; Fu, Yong-Hong; Wang, Jun-Song
Toxicology Research, 2016 , vol. 5, # 4 p. 1039 - 1052 Title/Abstract Full Text View citing articles Show Details
Plested, Andrew J.R.
Nature Structural and Molecular Biology, 2016 , vol. 23, # 6 p. 494 - 502 Title/Abstract Full Text View citing articles Show Details
Tohid, Hassaan
Neurosciences, 2016 , vol. 21, # 3 p. 215 - 222 Title/Abstract Full Text View citing articles Show Details
Alvarez Lemus, Mayra A; Monroy, Hugo; López, Tessy; De la Cruz Hernández, Erick N; López-González, Rosendo
Journal of Chemical Technology and Biotechnology, 2016 , vol. 91, # 8 p. 2148 - 2155 Title/Abstract Full Text View citing articles Show Details
Low, Evonne; Stevenson, Nathan J.; Mathieson, Sean R.; Livingstone, Vicki; Ryan, Anthony C.; Rennie, Janet M.; Boylan, Geraldine B.
Neonatology, 2016 , vol. 110, # 1 p. 40 - 46 Title/Abstract Full Text View citing articles Show Details
Bao, Zhijie; Chi, Yujie
Current Microbiology, 2016 , vol. 73, # 2 p. 214 - 219 Title/Abstract Full Text View citing articles Show Details
Belkić, Dževad; Belkić, Karen
Journal of Mathematical Chemistry, 2016 , vol. 54, # 7 p. 1461 - 1513 Title/Abstract Full Text View citing articles Show Details
Travagli, R. Alberto; Anselmi, Laura
Nature Reviews Gastroenterology and Hepatology, 2016 , vol. 13, # 7 p. 389 - 401
Title/Abstract Full Text View citing articles Show Details
de Bruin; van Loevezijn; Wicke; de Haan; Venhorst; Lange; de Groote; van der Neut; Prickaerts; Andriambeloson; Foley; van Drimmelen; van der Wetering; Kruse
Neurobiology of Learning and Memory, 2016 , vol. 133, p. 100 - 117 Title/Abstract Full Text View citing articles Show Details
Cheng, Jianbo; Zheng, Nan; Sun, Xianzhi; Li, Songli; Wang, Jiaqi; Zhang, Yangdong
Journal of Thermal Biology, 2016 , vol. 60, p. 103 - 108 Title/Abstract Full Text View citing articles Show Details
Wang, Bo; Jeon, Young Sil; Park, Ho Seok; Kim, Ji-Heung
Materials Science and Engineering C, 2016 , vol. 69, p. 160 - 170 Title/Abstract Full Text View citing articles Show Details
Osanai, Hisayuki; Tateno, Takashi
Hearing Research, 2016 , vol. 339, p. 69 - 79 Title/Abstract Full Text View citing articles Show Details
Haroon, Saima; Vinthan, Anu; Negron, Leonardo; Das, Shantanu; Berenjian, Aydin
American Journal of Biochemistry and Biotechnology, 2016 , vol. 12, # 2 p. 102 - 109 Title/Abstract Full Text View citing articles Show Details
Cao, Shifeng; Song, Chunbo; Shao, Jiarong; Bian, Kun; Chen, Wei; Yang, Zhenfeng
Journal of Agricultural and Food Chemistry, 2016 , vol. 64, # 25 p. 5215 - 5222 Title/Abstract Full Text View citing articles Show Details
Bao, Haibo; Shao, Xusheng; Zhang, Yixi; Deng, Yayun; Xu, Xiaoyong; Liu, Zewen; Li, Zhong
Journal of Agricultural and Food Chemistry, 2016 , vol. 64, # 25 p. 5148 - 5155 Title/Abstract Full Text View citing articles Show Details
Spiegel, David R.; McCroskey, Aidan L.; Deyerle, Branden A.
Innovations in Clinical Neuroscience, 2016 , vol. 13, # 3-4 p. 32 - 41 Title/Abstract Full Text View citing articles Show Details
Li, Zhi-Xin; Yang, Wei-Jun; Ahammed, Golam Jalal; Shen, Chen; Yan, Peng; Li, Xin; Han, Wen-Yan
Plant Physiology and Biochemistry, 2016 , vol. 106, p. 327 - 335 Title/Abstract Full Text View citing articles Show Details
Brown, Laura E.; Nicholson, Martin W.; Arama, Jessica E.; Mercer, Audrey; Thomson, Alex M.; Jovanovic, Jasmina N.
Journal of Biological Chemistry, 2016 , vol. 291, # 27 p. 13926 - 13942 Title/Abstract Full Text View citing articles Show Details
135 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Balint, Bettina; Bhatia, Kailash P.
Current Opinion in Neurology, 2016 , vol. 29, # 4 p. 496 - 506 Title/Abstract Full Text View citing articles Show Details
Che Has, Ahmad Tarmizi; Absalom, Nathan; Van Nieuwenhuijzen, Petra S.; Clarkson, Andrew N.; Ahring, Philip K.; Chebib, Mary
Scientific Reports, 2016 , vol. 6, art. no. 28674 Title/Abstract Full Text View citing articles Show Details
Quan, Fu-Shi; Liu, Dian-Feng; Chen, Jian; Zhang, Jin-Yu; Ren, Wen-Zhi
International Journal of Clinical and Experimental Medicine, 2016 , vol. 9, # 6 p. 9073 - 9079 Title/Abstract Full Text View citing articles Show Details
Wang, Cheng; Zhu, Cheng-Lin; Huang, Zhao-Jun; Wang, Gang; Huang, Qiang; Liu, Chen-Hai; Xie, Fang; Wang, Wei
International Journal of Clinical and Experimental Medicine, 2016 , vol. 9, # 6 p. 9992 - 9998 Title/Abstract Full Text View citing articles Show Details
Lee, HeeSeung; Wang, Grace Y.; Curley, Louise E.; Kydd, Rob R.; Kirk, Ian J.; Russell, Bruce R.
Psychopharmacology, 2016 , vol. 233, # 15-16 p. 2869 - 2877 Title/Abstract Full Text View citing articles Show Details
Bagherian, Seyed Ali Akbar; Hamzehzarghani, Habiballah; Izadpanah, Keramatollah; Djavaheri, Mohammad
Journal of Plant Physiology, 2016 , vol. 201, p. 42 - 53 Title/Abstract Full Text View citing articles Show Details
Shen, Kuo-Ping; Hao, Chi-Long; Yen, Hsueh-Wei; Chen, Chun-Yen; Chen, Jia-Hao; Chen, Fu-Chih; Lin, Hui-Li
Journal of Clinical Biochemistry and Nutrition, 2016 , vol. 59, # 1 p. 39 - 44 Title/Abstract Full Text View citing articles Show Details
Weidle, Ulrich H.; Birzele, Fabian; Kollmorgen, Gwendlyn; Rüger, Rüdiger
Cancer Genomics and Proteomics, 2016 , vol. 13, # 4 p. 245 - 258 Title/Abstract Full Text View citing articles Show Details
Kim, Min-Ju; Lim, Jong-Soon; Yang, Seun-Ah
Journal of the Korean Society of Food Science and Nutrition, 2016 , vol. 45, # 6 p. 828 - 834 Title/Abstract Full Text View citing articles Show Details
Seong, Gi-Un; Hwang, In-Wook; Chung, Shin-Kyo
Journal of the Korean Society of Food Science and Nutrition, 2016 , vol. 45, # 6 p. 923 - 928 Title/Abstract Full Text View citing articles Show Details
Tanaka, Takeshi; Abe, Hajime; Kimura, Masayuki; Onda, Nobuhiko; Mizukami, Sayaka; Yoshida, Toshinori; Shibutani, Makoto
Archives of Toxicology, 2016 , vol. 90, # 8 p. 2009 - 2024 Title/Abstract Full Text View citing articles Show Details
Antkowiak, Bernd; Rudolph, Uwe
Current Opinion in Anaesthesiology, 2016 , vol. 29, # 4 p. 447 - 453 Title/Abstract Full Text View citing articles Show Details
Pérez-Isidoro, Rosendo; Ruiz-Suárez
Biochimica et Biophysica Acta - Biomembranes, 2016 , vol. 1858, # 9 p. 2215 - 2222 Title/Abstract Full Text View citing articles Show Details
Louis, Elan D.; Hernandez, Nora; Dyke, Jonathan P.; Ma, Ruoyun; Dydak, Ulrike
Clinical Neuropharmacology, 2016 , vol. 39, # 1 p. 24 - 28 Title/Abstract Full Text Show Details
McGinn, Kaitlin Ann; Bishop, Laura; Sarwal, Aarti
Clinical Neuropharmacology, 2016 , vol. 39, # 1 p. 62 - 65 Title/Abstract Full Text Show Details
Barron; Vogels; Emir; Makin; O'Shea; Clare; Jbabdi; Dolan; Behrens
Neuron, 2016 , vol. 90, # 1 p. 191 - 203 Title/Abstract Full Text View citing articles Show Details
Liu, Xiangqian; Connaghan, Kaitlyn P.; Wei, Yufeng; Yang, Zhongli; Li, Ming D.; Chang, Sulie L.
Alcoholism: Clinical and Experimental Research, 2016 , vol. 40, # 7 p. 1489 - 1500 Title/Abstract Full Text View citing articles Show Details
Hwang, Insik; Hahm, Suk-Chan; Choi, Kyung-Ah; Park, Sung-Ho; Jeong, Hyesun; Yea, Ji-Hye; Kim, Junesun; Hong, Sunghoi
Cell Transplantation, 2016 , vol. 25, # 3 p. 593 - 607 Title/Abstract Full Text View citing articles Show Details
Wong, Shi-Bing; Hung, Wei-Chen; Min, Ming-Yuan
Chinese Journal of Physiology, 2016 , vol. 59, # 3 p. 156 - 164 Title/Abstract Full Text View citing articles Show Details
Westberry, Jenne M.; Meredith, Michael
Neuroscience, 2016 , vol. 331, p. 186 - 196 Title/Abstract Full Text View citing articles Show Details
136 of 992
137 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Li, Meijia; Qiu, Limei; Wang, Lingling; Wang, Weilin; Xin, Lusheng; Li, Yiqun; Liu, Zhaoqun; Song, Linsheng
Fish and Shellfish Immunology, 2016 , vol. 52, p. 16 - 22 Title/Abstract Full Text View citing articles Show Details
De Iuliis, Vincenzo; Gelormini, Raimondo; Flacco, Mariarosaria; Moriello, Giuseppe; Caruso, Marika; Barone, Eugenia; Golato, Maria; Toniato, Elena; Conti, Pio; Martinotti, Stefano
Drugs - Real World Outcomes, 2016 , vol. 3, # 1 p. 7 - 12 Title/Abstract Full Text Show Details
Olusina, Oyedeji K.; Aderibigbe
International Journal of Pharmaceutical Sciences Review and Research, 2016 , vol. 38, # 2 art. no. 03, p. 9 - 14 Title/Abstract Full Text View citing articles Show Details
Choi, Wook-chul; Reid, Storm N. S.; Ryu, Je-kwang; Kim, Yunsook; Jo, Young-Hong; Jeon, Byeong Hwan
Algae, 2016 , vol. 31, # 2 p. 175 - 187 Title/Abstract Full Text View citing articles Show Details
Xin, Hua; Wang, Wei-Qun; Yang, Zhi-Wei; Liu, Jun-Xing; Li, Sheng; Wang, Lin; Jiang, Qing-Lin; Jia, Lin-Lin
Translational Cancer Research, 2016 , vol. 5, # 3 p. 302 - 314 Title/Abstract Full Text View citing articles Show Details
Liu, Hu-Hu; Ji, Xiao-Jun; Huang, He
Biotechnology Advances, 2015 , vol. 33, # 8 p. 1522 - 1546 Title/Abstract Full Text Show Details
Mo, Zhaowen; Huang, Jinxia; Xiao, Di; Ashraf, Umair; Duan, Meiyang; Pan, Shenggang; Tian, Hua; Xiao, Lizhong; Zhong, Keyou; Tang, Xiangru
PLoS ONE, 2016 , vol. 11, # 2 art. no. E0149523 Title/Abstract Full Text View citing articles Show Details
Olsén, K.Håkan; Lundh, Torbjörn
Aquaculture Reports, 2016 , vol. 4, p. 66 - 73 Title/Abstract Full Text View citing articles Show Details
Yu, Jun; Unc, Adrian; Zhang, Xiaoke; Steinberger, Yosef
Applied Soil Ecology, 2016 , vol. 101, p. 124 - 131 Title/Abstract Full Text View citing articles Show Details
Wang, Yaoming; Zhang, Zenghui; Jiang, Chenxiao; Xu, Tongwen
Separation and Purification Technology, 2016 , vol. 170, p. 353 - 359 Title/Abstract Full Text View citing articles Show Details
Park, Seong-Eun; Yoo, Seon-A; Seo, Seung-Ho; Lee, Kyoung-In; Na, Chang-Su; Son, Hong-Seok
LWT - Food Science and Technology, 2016 , vol. 68, p. 313 - 321 Title/Abstract Full Text Show Details
Zeiger, William A.; Sun, Lisa R.; Bosemani, Thangamadhan; Pearl, Phillip L.; Stafstrom, Carl E.
Pediatric Neurology, 2016 , vol. 58, p. 113 - 115 Title/Abstract Full Text View citing articles Show Details
Gilliham, Matthew; Tyerman, Stephen D.
Trends in Plant Science, 2016 , vol. 21, # 4 p. 295 - 301 Title/Abstract Full Text View citing articles Show Details
Roces Dorronsoro, Elena; Lemus Vidal, Mónica; Montero Cruz, Sergio Adrián
Revista Cubana de Investigaciones Biomedicas, 2016 , vol. 35, # 2 p. 195 - 213 Title/Abstract Full Text View citing articles Show Details
Luo, Qiong; Chen, Yinghui
Clinical Interventions in Aging, 2016 , vol. 11, p. 867 - 872 Title/Abstract Full Text View citing articles Show Details
Tsuji, Masaharu
Royal Society Open Science, 2016 , vol. 3, # 7 art. no. 160106, p. 13 Title/Abstract Full Text View citing articles Show Details
Griffin, Emily; Brown, Jamie N.
Annals of Pharmacotherapy, 2016 , vol. 50, # 7 p. 586 - 591 Title/Abstract Full Text View citing articles Show Details
Jawaro, Tara; Yang, Anna; Dixit, Deepali; Bridgeman, Mary Barna
Annals of Pharmacotherapy, 2016 , vol. 50, # 7 p. 569 - 577 Title/Abstract Full Text View citing articles Show Details
Costa, João T.; Mele, Miranda; Baptista, Márcio S.; Gomes, João R.; Ruscher, Karsten; Nobre, Rui J.; de Almeida, Luís Pereira; Wieloch, Tadeusz; Duarte, Carlos B.
Molecular Neurobiology, 2016 , vol. 53, # 6 p. 3513 - 3527 Title/Abstract Full Text View citing articles Show Details
Peña-Contreras, Zulma; Miranda-Contreras, Leticia; Morales-Ovalles, Yasmin; Colmenares-Sulbarán, Melisa; Dávila-Vera, Delsy; BalzaQuintero, Alirio; Salmen, Siham; Mendoza-Briceño, Rosa Virginia
Toxicological and Environmental Chemistry, 2016 , vol. 98, # 8 p. 959 - 976 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
138 of 992
Reference
Ermine, Charlotte M.; Wright, Jordan L.; Parish, Clare L.; Stanic, Davor; Thompson, Lachlan H.
Frontiers in Biology, 2016 , vol. 11, # 3 p. 246 - 255 Title/Abstract Full Text View citing articles Show Details
Ohashi, Masayuki; Hirano, Toru; Watanabe, Kei; Shoji, Hirokazu; Ohashi, Nobuko; Baba, Hiroshi; Endo, Naoto; Kohno, Tatsuro
Neuroscience, 2016 , vol. 331, p. 206 - 220 Title/Abstract Full Text View citing articles Show Details
Patel, Ryan; Dickenson, Anthony H.
Pharmacology Research and Perspectives, 2016 , vol. 4, # 2 art. no. E00205 Title/Abstract Full Text Show Details
Olexová, Lucia; Štefánik, Peter; Kršková, Lucia
Neuroscience Letters, 2016 , vol. 629, p. 9 - 14 Title/Abstract Full Text View citing articles Show Details
Aponte, José C.; McLain, Hannah L.; Dworkin, Jason P.; Elsila, Jamie E.
Geochimica et Cosmochimica Acta, 2016 , vol. 189, p. 296 - 311 Title/Abstract Full Text View citing articles Show Details
Veryser, Lieselotte; Taevernier, Lien; Joshi, Tanmayee; Tatke, Pratima; Wynendaele, Evelien; Bracke, Nathalie; Stalmans, Sofie; Peremans, Kathelijne; Burvenich, Christian; Risseeuw, Martijn; De Spiegeleer, Bart
BMC Complementary and Alternative Medicine, 2016 , vol. 16, # 1 art. no. 177 Title/Abstract Full Text View citing articles Show Details
Singh, Tanveer; Goel, Rajesh Kumar
Epilepsy and Behavior, 2016 , vol. 61, p. 248 - 257 Title/Abstract Full Text View citing articles Show Details
Girish; Vikram Reddy; Pandit, Lakshmi V.; Pundarikaksha; Vijendra; Vasundara; Manjunatha; Nagraj, Moulya; Shruthi
Biomedical Journal, 2016 , vol. 39, # 1 p. 72 - 80 Title/Abstract Full Text View citing articles Show Details
Tiansawang, Kasarin; Luangpituksa, Pairoj; Varanyanond, Warunee; Hansawasdi, Chanida
Food Science and Technology, 2016 , vol. 36, # 2 p. 313 - 321 Title/Abstract Full Text View citing articles Show Details
Gkioka, Eleana; Korou, Laskarina Maria; Daskalopoulou, Afrodite; Misitzi, Angelica; Batsidis, Eleni; Bakoyiannis, Ioannis; Pergialiotis, Vasilios
Reviews in the Neurosciences, 2016 , vol. 27, # 5 p. 523 - 534 Title/Abstract Full Text View citing articles Show Details
Zekeridou, Anastasia; McKeon, Andrew; Lennon, Vanda A.
JAMA Neurology, 2016 , vol. 73, # 7 p. 853 - 859 Title/Abstract Full Text View citing articles Show Details
Kozioł, Ewelina; Skalicka-Woźniak, Krystyna
Phytochemistry Reviews, 2016 , vol. 15, # 4 p. 627 - 649 Title/Abstract Full Text View citing articles Show Details
Elsheikha, Hany M.; Büsselberg, Dietrich; Zhu, Xing-Quan
Metabolic Brain Disease, 2016 , vol. 31, # 4 p. 749 - 759 Title/Abstract Full Text View citing articles Show Details
Bassi, Gabriel S.; do C. Malvar, David; Cunha, Thiago M.; Cunha, Fernando Q.; Kanashiro, Alexandre
Naunyn-Schmiedeberg's Archives of Pharmacology, 2016 , vol. 389, # 8 p. 851 - 861 Title/Abstract Full Text View citing articles Show Details
Deletre, Emilie; Schatz, Bertrand; Bourguet, Denis; Chandre, Fabrice; Williams, Livy; Ratnadass, Alain; Martin, Thibaud
Chemoecology, 2016 , vol. 26, # 4 p. 127 - 142 Title/Abstract Full Text View citing articles Show Details
Li, Hua; Li, Renhui; Rossi, Federico; Li, Dunhai; De Philippis, Roberto; Hu, Chunxiang; Liu, Yongding
Catena, 2016 , vol. 147, p. 138 - 145 Title/Abstract Full Text View citing articles Show Details
Moe, Aung Aung Kywe; Scott, James G.; Burne, Thomas H.J.; Eyles, Darryl W.
Journal of Psychopharmacology, 2016 , vol. 30, # 8 p. 771 - 794 Title/Abstract Full Text View citing articles Show Details
Kim, Jae Kwang; Bong, Sun Ju; Park, Sang Un
Asian Journal of Chemistry, 2016 , vol. 28, # 10 p. 2322 - 2324 Title/Abstract Full Text View citing articles Show Details
Bhatnagar, Saurabha; Iaccarino, Mary Alexis; Zafonte, Ross
Brain Research, 2016 , vol. 1640, p. 164 - 179 Title/Abstract Full Text View citing articles Show Details
Yalçınkaya, Nazlı; Akcan, Uğur; Örçen, Arda; Küçükali, Cemİsmail; Türkoğlu, Recai; Kürtüncü, Murat; Tüzün, Erdem
Multiple Sclerosis and Related Disorders, 2016 , vol. 9, p. 60 - 61 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Comitani, Federico; Limongelli, Vittorio; Molteni, Carla
Journal of Chemical Theory and Computation, 2016 , vol. 12, # 7 p. 3398 - 3406 Title/Abstract Full Text View citing articles Show Details
Rosa, Priscila B.; Neis, Vivian B.; Ribeiro, Camille M.; Moretti, Morgana; Rodrigues, Ana Lúcia S.
Pharmacological Reports, 2016 , vol. 68, # 5 p. 996 - 1001 Title/Abstract Full Text View citing articles Show Details
Audusseau, Hélène; De La Paz Celorio-Mancera, Maria; Janz, Niklas; Nylin, Sören
BMC Evolutionary Biology, 2016 , vol. 16, # 1 art. no. 144 Title/Abstract Full Text View citing articles Show Details
Arabpour; Esmaeili; Rabbani
Journal of Babol University of Medical Sciences, 2016 , vol. 18, # 6 p. 66 - 72 Title/Abstract Full Text View citing articles Show Details
Herbison, Allan E.
Nature Reviews Endocrinology, 2016 , vol. 12, # 8 p. 452 - 466 Title/Abstract Full Text View citing articles Show Details
Naffaa, Moawiah M.; Samad, Abdul
Computational Biology and Chemistry, 2016 , vol. 64, p. 202 - 209 Title/Abstract Full Text View citing articles Show Details
Kim, Hye Ihn; Baek, Min Ryul; Cho, Kyoo Ho; Cho, Yang-Je; Heo, Kyoung
Seizure, 2016 , vol. 41, p. 6 - 8 Title/Abstract Full Text View citing articles Show Details
Jinnarak, Amornrassamee; Anantavichian, Pattarapon; Intanin, Apichai; Fungladda, Suchada; Choengchan, Nathawut; Wilairat, Prapin; Nacapricha, Duangjai; Teerasong, Saowapak
Journal of Food Composition and Analysis, 2016 , vol. 51, p. 69 - 75 Title/Abstract Full Text View citing articles Show Details
Guo, Ling-Xia; Shi, Cai-Yun; Liu, Xiao; Ning, Dong-Yuan; Jing, Long-Fei; Yang, Huan; Liu, Yong-Zhong
Scientific Reports, 2016 , vol. 6, art. no. 29343 Title/Abstract Full Text View citing articles Show Details
Huckvale, Rosemary; Mortensen, Martin; Pryde, David; Smart, Trevor G.; Baker, James R.
Organic and Biomolecular Chemistry, 2016 , vol. 14, # 28 p. 6676 - 6678 Title/Abstract Full Text View citing articles Show Details
Shakya, Ashok K.; Kamal, Mehnaz; Balaramnavar, Vishal M.; Bardaweel, Sanna K.; Naik, Rajashri R.; Saxena, Anil K.; Siddiqui
Acta Pharmaceutica, 2016 , vol. 66, # 3 p. 353 - 372 Title/Abstract Full Text View citing articles Show Details
Lang, Li; Jiang, Li-Hua; Qiu, Yong-Jun; Zhou, Jia-Chun; Zhao, Li-Ming
Guocheng Gongcheng Xuebao/The Chinese Journal of Process Engineering, 2016 , vol. 16, # 3 p. 418 - 423 Title/Abstract Full Text View citing articles Show Details
Lett, Tristram A.; Kennedy, James L.; Radhu, Natasha; Dominguez, Luis G.; Chakravarty, M. Mallar; Nazeri, Arash; Farzan, Faranak; Walter, Henrik; Heinz, Andreas; Mulsant, Benoit H.; Daskalakis, Zafiris J.; Voineskos, Aristotle N.
Neuropsychopharmacology, 2016 , vol. 41, # 9 p. 2224 - 2231 Title/Abstract Full Text View citing articles Show Details
Godinho, Antonio Francisco; Chagas, Ana Carolina Souza; Carvalho, Caio Cristóvão; Horta, Daniel França; De Fraia, Daniel; Anselmo, Fabio; Chaguri, João Leandro; Faria, Caique Aparecido
Physiology and Behavior, 2016 , vol. 165, p. 28 - 34 Title/Abstract Full Text View citing articles Show Details
Vadakkan, Kunjumon I.
Biomedicine and Pharmacotherapy, 2016 , vol. 83, p. 412 - 430 Title/Abstract Full Text View citing articles Show Details
Kim, Jae Kwang; Bong, Sun J.U.; Park, Sang U.N.
Asian Journal of Chemistry, 2016 , vol. 28, # 10 p. 2228 - 2230 Title/Abstract Full Text View citing articles Show Details
Chen, Licheng; Zheng, Hao; Zhang, Shimeng
Neuropsychiatric Disease and Treatment, 2016 , vol. 12, p. 1731 - 1737 Title/Abstract Full Text View citing articles Show Details
Suraweera, Duminda; Sundaram, Vinay; Saab, Sammy
Gut and Liver, 2016 , vol. 10, # 4 p. 509 - 519 Title/Abstract Full Text View citing articles Show Details
Bakpa, Ochuko D.; Reuber, Markus; Irani, Sarosh R.
Seizure, 2016 , vol. 41, p. 26 - 41 Title/Abstract Full Text View citing articles Show Details
Yang, Linjie; Xu, Ting; Zhang, Ke; Wei, Zhisheng; Li, Xuran; Huang, Mingfa; Rose, Gregory M.; Cai, Xiang
Behavioural Brain Research, 2016 , vol. 313, p. 135 - 143 Title/Abstract Full Text View citing articles Show Details
139 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Poveda; Molina; Gómez-Alonso
Journal of Food Composition and Analysis, 2016 , vol. 51, p. 85 - 92 Title/Abstract Full Text View citing articles Show Details
Dogra, Shalini; Sona, Chandan; Kumar, Ajeet; Yadav, Prem N.
International Journal of Biochemistry and Cell Biology, 2016 , vol. 77, p. 226 - 239 Title/Abstract Full Text View citing articles Show Details
Ruffolo, Gabriele; Iyer, Anand; Cifelli, Pierangelo; Roseti, Cristina; Mühlebner, Angelika; van Scheppingen, Jackelien; Scholl, Theresa; Hainfellner, Johannes A.; Feucht, Martha; Krsek, Pavel; Zamecnik, Josef; Jansen, Floor E.; Spliet, Wim G.M.; Limatola, Cristina; Aronica, Eleonora; Palma, Eleonora
Neurobiology of Disease, 2016 , vol. 95, p. 93 - 101 Title/Abstract Full Text View citing articles Show Details
Sadowski, Renee N.; Stebbings, Kevin A.; Slater, Bernard J.; Bandara, Suren B.; Llano, Daniel A.; Schantz, Susan L.
NeuroToxicology, 2016 , vol. 56, p. 86 - 93 Title/Abstract Full Text View citing articles Show Details
Menschikov; Semenova; Ublinskiy; Akhadov; Keshishyan; Lebedeva; Omelchenko; Kaleda; Varfolomeev
Doklady Biochemistry and Biophysics, 2016 , vol. 468, # 1 p. 168 - 172 Title/Abstract Full Text View citing articles Show Details
Widyarani; Bowden, Nathan A.; Kolfschoten, Ruben C.; Sanders, Johan P. M.; Bruins, Marieke E.
Industrial and Engineering Chemistry Research, 2016 , vol. 55, # 27 p. 7462 - 7472 Title/Abstract Full Text View citing articles Show Details
Monakhova; Mushtakova
Journal of Analytical Chemistry, 2016 , vol. 71, # 8 p. 759 - 767 Title/Abstract Full Text View citing articles Show Details
Livadas, Sarantis; Chrousos, George P.
Current Opinion in Pediatrics, 2016 , vol. 28, # 4 p. 551 - 558 Title/Abstract Full Text View citing articles Show Details
Banerjee, Jheelam; Papu John, Arokya M.S.; Al-Wadei, Mohammed H.; Schuller, Hildegard M.
Oncotarget, 2016 , vol. 7, # 28 p. 44430 - 44441 Title/Abstract Full Text View citing articles Show Details
Wang, Kevin Y.; Barker, Peter B.; Lin, Doris D. M.
Child's Nervous System, 2016 , vol. 32, # 7 p. 1305 - 1309 Title/Abstract Full Text View citing articles Show Details
Szpetnar, Maria; Luchowska-Kocot, Dorota; Boguszewska-Czubara, Anna; Kurzepa, Jacek
Neurochemical Research, 2016 , vol. 41, # 8 p. 2129 - 2139 Title/Abstract Full Text View citing articles Show Details
Xia, Qiang; Wang, Liping; Xu, Congcong; Mei, Jun; Li, Yunfei
Food Chemistry, 2017 , vol. 214, p. 533 - 542
Title/Abstract Full Text View citing articles Show Details
Zhao, Kaifei; Yang, Peng; Du, Shichao; Li, Kangli; Li, Xiaona; Li, Zhenfang; Liu, Yumin; Lin, Lanlan; Hou, Baohong; Gong, Junbo
Journal of Chemical Thermodynamics, 2016 , vol. 102, p. 276 - 286 Title/Abstract Full Text Show Details
Zhao, Kaifei; Yang, Peng; Du, Shichao; Li, Kangli; Li, Xiaona; Li, Zhenfang; Liu, Yumin; Lin, Lanlan; Hou, Baohong; Gong, Junbo
Journal of Chemical Thermodynamics, 2016 , vol. 102, p. 276 - 286 Title/Abstract Full Text View citing articles Show Details
Huang, Xin; Sontag-Strohm, Tuula; Stoddard, Frederick L.; Kato, Yoji
Food Chemistry, 2017 , vol. 214, p. 597 - 605 Title/Abstract Full Text View citing articles Show Details
Pal, Uttam; Pramanik, Sumit Kumar; Bhattacharya, Baisali; Banerji, Biswadip; C. Maiti, Nakul
SpringerPlus, 2016 , vol. 5, # 1 art. no. 1121 Title/Abstract Full Text View citing articles Show Details
Testino, Gianni; Leone, Silvia; Borro, Paolo
Minerva Medica, 2016 , vol. 107, # 4 p. 223 - 238 Title/Abstract Full Text View citing articles Show Details
Lu, Junjie; Zhang, Qian; Tan, Dongmei; Luo, Wenping; Zhao, Hai; Ma, Jing; Liang, Hao; Tan, Yi
International Journal of Molecular Medicine, 2016 , vol. 38, # 1 p. 105 - 112 Title/Abstract Full Text View citing articles Show Details
Ma, Jing; Zhang, Yan; Wang, Jun; Zhao, Tianyu; Ji, Ping; Song, Jinlin; Zhang, Hongmei; Luo, Wenping
International Journal of Molecular Medicine, 2016 , vol. 38, # 1 p. 305 - 311 Title/Abstract Full Text View citing articles Show Details
University of South Florida; ZAWOROTKO, Michael J.; SHYTLE, Roland D.; ONG, Tien Teng; KAVURU, Padmini; CANTWELL, Ryan N.; NGUYEN, Tranhha; SMITH, Adam John
Patent: EP2688575 B1, 2016 ; Title/Abstract Full Text Show Details
140 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
NOVO NORDISK A/S; INSERM (INSTITUT NATIONAL DE LA SANTÉ ET DE LA RECHERCHE MÉDICALE); CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE; UNIVERSITE DE NICE SOPHIA ANTIPOLIS-GRAND CHÂTEAU; HECKSHER-SØRENSEN, Jacob; COLLOMBAT, Patrick
Patent: WO2016/102657 A1, 2016 ; Title/Abstract Full Text Show Details
Huang, Yan; Su, Lingqia; Wu, Jing
PLoS ONE, 2016 , vol. 11, # 7 art. no. E0157466 Title/Abstract Full Text View citing articles Show Details
Lee, Gyu Min; Suh, Dong Ho; Jung, Eun Sung; Lee, Choong Hwan
Molecules, 2016 , vol. 21, # 7 art. no. 921 Title/Abstract Full Text View citing articles Show Details
Bauquier, Sebastien H.; Jiang, Jonathan L.; Lai, Alan; Cook, Mark J.
Comparative Medicine, 2016 , vol. 66, # 3 p. 220 - 224 Title/Abstract Full Text View citing articles Show Details
Kim, Hoon; Kim, Oui-Woung; Ha, Ae Wha; Park, Soojin
Preventive Nutrition and Food Science, 2016 , vol. 21, # 2 p. 97 - 103 Title/Abstract Full Text View citing articles Show Details
Atli; Demir-Ozkay; Ilgin; Aydin; Akbulut; Sener
Human and Experimental Toxicology, 2016 , vol. 35, # 8 p. 866 - 876 Title/Abstract Full Text View citing articles Show Details
Horvath, Gabriella-Ana; Hukin, Juliette; Stockler-Ipsiroglu, Sylvia G.; Aroichane, Maryam
Neuropediatrics, 2016 , vol. 47, # 4 p. 263 - 267 Title/Abstract Full Text View citing articles Show Details
Bunzeck, Nico; Thiel, Christiane
Cortex, 2015 , vol. 80, p. 161 - 173 Title/Abstract Full Text View citing articles Show Details
Jaggupilli, Appalaraju; Howard, Ryan; Upadhyaya, Jasbir D.; Bhullar, Rajinder P.; Chelikani, Prashen
International Journal of Biochemistry and Cell Biology, 2016 , vol. 77, p. 184 - 196 Title/Abstract Full Text View citing articles Show Details
Ippolito, Joseph E.; Brandenburg, Matthew W.; Ge, Xia; Crowley, Jan R.; Kirmess, Kristopher M.; Som, Avik; D'Avignon, D. Andre; Arbeit, Jeffrey M.; Achilefu, Samuel; Yarasheski, Kevin E.; Milbrandt, Jeffrey
PLoS ONE, 2016 , vol. 11, # 7 art. no. E0159675 Title/Abstract Full Text View citing articles Show Details
Caccamo; Pisani; Mazzocchetti; Ientile; Calabresi; Costa
Neurochemical Research, 2016 , vol. 41, # 1-2 p. 340 - 352 Title/Abstract Full Text View citing articles Show Details
Kashem, Mohammed Abul; Ahmed, Selina; Sultana, Nilufa; Ahmed, Eakhlas U.; Pickford, Russell; Rae, Caroline; Šerý, Omar; McGregor, Iain S.; Balcar, Vladimir J.
Neurochemical Research, 2016 , vol. 41, # 1-2 p. 385 - 397 Title/Abstract Full Text View citing articles Show Details
Diaz-Gil, Daniel; Haerter, Friederike; Falcinelli, Shane; Ganapati, Shweta; Hettiarachchi, Gaya K.; Simons, Jeroen C. P.; Zhang, Ben; Grabitz, Stephanie D.; Duarte, Ingrid Moreno; Cotten, Joseph F.; Eikermann-Haerter, Katharina; Deng, Hao; Chamberlin, Nancy L.; Isaacs, Lyle; Briken, Volker; Eikermann, Matthias
Anesthesiology, 2016 , vol. 125, # 2 p. 333 - 345 Title/Abstract Full Text View citing articles Show Details
Benarroch, Eduardo E.
Neurology, 2016 , vol. 87, # 3 p. 324 - 330 Title/Abstract Full Text View citing articles Show Details
Padulo, Caterina; Delli Pizzi, Stefano; Bonanni, Laura; Edden, Richard A.E.; Ferretti, Antonio; Marzoli, Daniele; Franciotti, Raffaella; Manippa, Valerio; Onofrj, Marco; Sepede, Gianna; Tartaro, Armando; Tommasi, Luca; Puglisi-Allegra, Stefano; Brancucci, Alfredo
Neuroscience, 2016 , vol. 333, p. 114 - 122 Title/Abstract Full Text View citing articles Show Details
DiCenzo, George C.; Checcucci, Alice; Bazzicalupo, Marco; Mengoni, Alessio; Viti, Carlo; Dziewit, Lukasz; Finan, Turlough M.; Galardini,
Marco; Fondi, Marco
Nature Communications, 2016 , vol. 7, art. no. 12219 Title/Abstract Full Text View citing articles Show Details
Soyka, Michael; Mutschler, Jochen
Progress in Neuro-Psychopharmacology and Biological Psychiatry, 2016 , vol. 70, p. 148 - 161 Title/Abstract Full Text View citing articles Show Details
Zhan, Hong-Dan; Zhou, Hai-Yu; Sui, Yun-Peng; Du, Xin-Liang; Wang, Wei-hao; Dai, Li; Sui, Feng; Huo, Hai-Ru; Jiang, Ting-Liang
Journal of Ethnopharmacology, 2016 , vol. 189, p. 361 - 385 Title/Abstract Full Text View citing articles Show Details
Lee, Sueun; Yang, Miyoung; Kim, Jinwook; Kang, Sohi; Kim, Juhwan; Kim, Jong-Choon; Jung, Chaeyong; Shin, Taekyun; Kim, Sung-Ho; Moon, Changjong
Brain Research Bulletin, 2016 , vol. 125, p. 187 - 199 Title/Abstract Full Text View citing articles Show Details
Siriarchavatana, Parkpoom; Ayers, Jessica D; Kendall, Lon V
Journal of the American Association for Laboratory Animal Science, 2016 , vol. 55, # 4 p. 426 - 430 Title/Abstract Full Text View citing articles Show Details
Hide facts
141 of 992
Show next 200 Comment (Pharmacological Data)
Bioactivities present
Reference
Mussap, Michele; Noto, Antonio; Fanos, Vassilios
Expert Review of Molecular Diagnostics, 2016 , vol. 16, # 8 p. 869 - 881 Title/Abstract Full Text View citing articles Show Details
Yuki, Koichi; Eckenhoff, Roderic G.
Anesthesia and Analgesia, 2016 , vol. 123, # 2 p. 326 - 335 Title/Abstract Full Text View citing articles Show Details
Almey, Anne; Milner, Teresa A; Brake, Wayne G
Neuroscience Letters, 2016 , vol. 622, p. 118 - 123 Title/Abstract Full Text View citing articles Show Details
Dolma, Sonam; Selvadurai, Hayden J.; Lan, Xiaoyang; Lee, Lilian; Kushida, Michelle; Voisin, Veronique; Whetstone, Heather; So, Milly; Aviv, Tzvi; Park, Nicole; Zhu, Xueming; Xu, ChangJiang; Head, Renee; Rowland, Katherine J.; Bernstein, Mark; Clarke, Ian D.; Bader, Gary; Harrington, Lea; Brumell, John H.; Tyers, Mike; Dirks, Peter B.
Cancer Cell, 2016 , vol. 29, # 6 p. 859 - 873 Title/Abstract Full Text View citing articles Show Details
Zhang, Jing; Yang, Dongshuang; Li, Mingxia; Shi, Lianxuan
PLoS ONE, 2016 , vol. 11, # 7 art. no. E0159622 Title/Abstract Full Text View citing articles Show Details
Aubrey, Karin R.
Neurochemistry International, 2016 , vol. 98, p. 94 - 102 Title/Abstract Full Text View citing articles Show Details
Ahring, Philip K.; Bang, Line H.; Jensen, Marianne L.; Strøbæk, Dorte; Hartiadi, Leonny Y.; Chebib, Mary; Absalom, Nathan
Pharmacological Research, 2016 , vol. 111, p. 563 - 576 Title/Abstract Full Text View citing articles Show Details
Vandenberg, Robert J.; Mostyn, Shannon N.; Carland, Jane E.; Ryan, Renae M.
Neurochemistry International, 2016 , vol. 98, p. 89 - 93 Title/Abstract Full Text View citing articles Show Details
Koek, Ralph J.; Schwartz, Holly N.; Scully, Stephenie; Langevin, Jean-Philippe; Spangler, Shana; Korotinsky, Arkady; Jou, Kevin; Leuchter, Andrew
Progress in Neuro-Psychopharmacology and Biological Psychiatry, 2016 , vol. 70, p. 170 - 218 Title/Abstract Full Text View citing articles Show Details
Robinson, Michael B.; Jackson, Joshua G.
Neurochemistry International, 2016 , vol. 98, p. 56 - 71 Title/Abstract Full Text View citing articles Show Details
Flores-Méndez, Marco; Mendez-Flores, Orquidia G.; Ortega, Arturo
Neurochemistry International, 2016 , vol. 98, p. 46 - 55 Title/Abstract Full Text View citing articles Show Details
Bjørn-Yoshimoto, Walden E.; Underhill, Suzanne M.
Neurochemistry International, 2016 , vol. 98, p. 4 - 18 Title/Abstract Full Text View citing articles Show Details
Zhang, Juen; Tan, Lubin; Ren, Yuqi; Liang, Jingwen; Lin, Rui; Feng, Qiru; Zhou, Jingfeng; Hu, Fei; Ren, Jing; Wei, Chao; Yu, Tao; Zhuang, Yinghua; Bettler, Bernhard; Wang, Fengchao; Luo, Minmin
Cell, 2016 , vol. 166, # 3 p. 716 - 728 Title/Abstract Full Text View citing articles Show Details
An; Han; Li; Ma; Shi; Xu; Yuan; Sun; Zhao; Sheng; Wang; Du
Genetics and Molecular Research, 2016 , vol. 15, # 3 art. no. GMR.15038804 Title/Abstract Full Text View citing articles Show Details
Li, Zhou; Yu, Jingjin; Peng, Yan; Huang, Bingru
Scientific Reports, 2016 , vol. 6, art. no. 30338 Title/Abstract Full Text View citing articles Show Details
Gao, Hong-Li; Yu, Xiao-Jing; Qi, Jie; Yi, Qiu-Yue; Jing, Wang-Hui; Sun, Wen-Yan; Cui, Wei; Mu, Jian-Jun; Yuan, Zu-Yi; Zhao, Xiu-Fang; Liu, Kai-Li; Zhu, Guo-Qing; Shi, Xiao-Lian; Liu, Jin-Jun; Kang, Yu-Ming
Scientific Reports, 2016 , vol. 6, art. no. 30301 Title/Abstract Full Text View citing articles Show Details
Xu, Yaqian; Wu, Sixia; Di, Guoqing; Ling, Ping; Jiang, Jianhua; Bao, Hailong
Bioengineered, 2016 , vol. 7, # 4 p. 241 - 245 Title/Abstract Full Text View citing articles Show Details
Jeong, Myeong-Kyo; Jeong, Ji-Hee; Kim, Kwang-Yup
Korean Journal of Food Science and Technology, 2016 , vol. 48, # 3 p. 214 - 222 Title/Abstract Full Text View citing articles Show Details
Kim, Eun Hee; Lee, Yoon Jeong; Jang, Gwi Yeong; Kim, Min Young; Yoon, Nara; Ji, Yeong Mi; Lee, Mi Ja; Lee, Junsoo; Jeong, Heon Sang
Korean Journal of Food Science and Technology, 2016 , vol. 48, # 3 p. 256 - 261 Title/Abstract Full Text View citing articles Show Details
Misra, Usha Kant; Kalita, Jayantee
International Journal of Neuroscience, 2016 , vol. 126, # 11 p. 1013 - 1019
Title/Abstract Full Text View citing articles Show Details
142 of 992
143 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Fürer, Karin; Simões-Wüst, Ana Paula; Von Mandach, Ursula; Hamburger, Matthias; Potterat, Olivier
Planta Medica, 2016 , vol. 82, # 11-12 p. 930 - 941 Title/Abstract Full Text View citing articles Show Details
Manohar, Senthilvelan; Dahar, Kimberly; Adler, Henry J.; Dalian, Ding; Salvi, Richard
Molecular and Cellular Neuroscience, 2016 , vol. 75, p. 101 - 112 Title/Abstract Full Text View citing articles Show Details
Yamashita, Haruhiro; Hoenerhoff, Mark J.; Peddada, Shyamal D.; Sills, Robert C.; Pandiri, Arun R.
Toxicologic Pathology, 2016 , vol. 44, # 6 p. 892 - 903 Title/Abstract Full Text View citing articles Show Details
Coelho; Sousa; Pires; Papke; Vieira; De Souza; Leal; Schunck; Picada; Pereira
Human and Experimental Toxicology, 2016 , vol. 35, # 9 p. 958 - 965 Title/Abstract Full Text View citing articles Show Details
Askari, Vahid Reza; Rahimi, Vafa Baradaran; Ghorbani, Ahmad; Rakhshandeh, Hassan
Iranian Red Crescent Medical Journal, 2016 , vol. 18, # 7 art. no. E24261, p. 6 Title/Abstract Full Text View citing articles Show Details
Dubey, Divyanshu; Blackburn, Kyle; Greenberg, Benjamin; Stuve, Olaf; Vernino, Steven
Expert Review of Neurotherapeutics, 2016 , vol. 16, # 8 p. 937 - 949 Title/Abstract Full Text View citing articles Show Details
Supuran, Claudiu T.
Expert Review of Neurotherapeutics, 2016 , vol. 16, # 8 p. 961 - 968 Title/Abstract Full Text View citing articles Show Details
Fung, Lawrence K.; Reiss, Allan L.
Biological Psychiatry, 2016 , vol. 80, # 2 p. 100 - 111 Title/Abstract Full Text View citing articles Show Details
Lange, Yvonne; Steck, Theodore L.
Chemistry and Physics of Lipids, 2016 , vol. 199, p. 74 - 93 Title/Abstract Full Text View citing articles Show Details
Takahashi, Makoto; Nomura, Masahiko; Tanaka, Junichi
Neuroscience Letters, 2016 , vol. 630, p. 114 - 119 Title/Abstract Full Text View citing articles Show Details
Kołosowska, Karolina; Maciejak, Piotr; Szyndler, Janusz; Turzyńska, Danuta; Sobolewska, Alicja; Płaźnik, Adam
Journal of Neuroimmunology, 2016 , vol. 298, p. 146 - 152 Title/Abstract Full Text View citing articles Show Details
Grone, Brian P.; Maruska, Karen P.
Scientific Reports, 2016 , vol. 6, art. no. 30507 Title/Abstract Full Text View citing articles Show Details
Veeraraghavan, Priyadharishini; Dekanic, Ana; Nistri, Andrea
Neuroscience, 2016 , vol. 333, p. 214 - 228 Title/Abstract Full Text View citing articles Show Details
Berghuis, Kelly M.M.; De Rond, Veerle; Zijdewind, Inge; Koch, Giacomo; Veldman, Menno P.; Hortobágyi, Tibor
Neurobiology of Aging, 2016 , vol. 46, p. 149 - 159 Title/Abstract Full Text View citing articles Show Details
Duarte-Neves, Joana; Pereira de Almeida, Luís; Cavadas, Cláudia
Neurobiology of Disease, 2016 , vol. 95, p. 210 - 214 Title/Abstract Full Text View citing articles Show Details
Ceylan, Mustafa; Yalcin, Ahmet; Bayraktutan, Omer Faruk; Karabulut, Ibrahim; Sonkaya, Ali Rıza
Seizure, 2016 , vol. 41, p. 70 - 74 Title/Abstract Full Text View citing articles Show Details
Wilcox, Christie
Scientific American, 2016 , vol. 315, # 2 p. 70 - 73 Title/Abstract Full Text View citing articles Show Details
Somorin, Yinka; Abram, Florence; Brennan, Fiona; O'Byrne, Conor
Applied and Environmental Microbiology, 2016 , vol. 82, # 15 p. 4628 - 4640 Title/Abstract Full Text View citing articles Show Details
Rasmussen, Bastian Barker; Grotkjær, Torben; D'Alvise, Paul W.; Yin, Guangliang; Zhang, Faxing; Bunk, Boyke; Spröer, Cathrin; BentzonTilia, Mikkel; Gram, Lone
Applied and Environmental Microbiology, 2016 , vol. 82, # 15 p. 4802 - 4810 Title/Abstract Full Text View citing articles Show Details
Sakai, Kazuya; Crochet, Sylvain
Sleep and Biological Rhythms, 2003 , vol. 1, # 1 p. 29 - 42 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Qiang, Liyuan; Cheng, Jinping; Yi, Jun; Rotchell, Jeanette M.; Zhu, Xiaotong; Zhou, Junliang
Ecotoxicology, 2016 , vol. 25, # 7 p. 1426 - 1437 Title/Abstract Full Text View citing articles Show Details
Yan; Tang; Wang; Hao; He; Sun; Ting; Deng
Oncogene, 2016 , vol. 35, # 30 p. 3995 - 4008 Title/Abstract Full Text View citing articles Show Details
Atif, Muhammad; Ali, Iftikhar; Hussain, Ajaz; Hyder, Syed Viqar; Khan, Farhan Ahmed; Maalik, Aneela; Farooq, Umar
Acta Poloniae Pharmaceutica - Drug Research, 2016 , vol. 73, # 3 p. 565 - 578 Title/Abstract Full Text View citing articles Show Details
Gross, Garrett G; Straub, Christoph; Perez-Sanchez, Jimena; Dempsey, William P; Junge, Jason A; Roberts, Richard W; Trinh, Le A; Fraser, Scott E; De Koninck, Yves; De Koninck, Paul; Sabatini, Bernardo L; Arnold, Don B.
Nature Methods, 2016 , vol. 13, # 8 p. 673 - 678 Title/Abstract Full Text View citing articles Show Details
Yoon, Young-Eun; Kuppusamy, Saranya; Cho, Kye Man; Kim, Pil Joo; Kwack, Yong-Bum; Lee, Yong Bok
Food Chemistry, 2017 , vol. 215, p. 185 - 192 Title/Abstract Full Text View citing articles Show Details
Kumar, Amit; Dixit, Garima; Singh, Amit Pal; Dwivedi, Sanjay; Srivastava, Sudhakar; Mishra, Kumkum; Tripathi, Rudra Deo
Ecotoxicology and Environmental Safety, 2016 , vol. 133, p. 350 - 359 Title/Abstract Full Text View citing articles Show Details
Knoflach, Frédéric; Hernandez, Maria-Clemencia; Bertrand, Daniel
Biochemical Pharmacology, 2016 , vol. 115, p. 10 - 17 Title/Abstract Full Text View citing articles Show Details
Bobille, Hélène; Limami, Anis M.; Robins, Richard J.; Cukier, Caroline; Le Floch, Gaëtan; Fustec, Joëlle
Soil Biology and Biochemistry, 2016 , vol. 101, p. 226 - 236 Title/Abstract Full Text View citing articles Show Details
Csuma, Ana; Cristina, Romeo T.; Dumitrescu, Eugenia; Muselin, Florin; Alexa, Ersilia C.; Butnariu, Monica; Gergen, Iosif
Open Chemistry, 2015 , vol. 13, # 1 p. 769 - 779 Title/Abstract Full Text View citing articles Show Details
Xu, Xiao-Jun; Roberts, Diane; Zhu, Guo-Nian; Chang, Yong-Chang
Acta Pharmacologica Sinica, 2016 , vol. 37, # 8 p. 1020 - 1030 Title/Abstract Full Text View citing articles Show Details
Kaur, Ravinder; Kaur, Sarabjit
Pharmacognosy Journal, 2015 , vol. 7, # 4 p. 236 - 241 Title/Abstract Full Text View citing articles Show Details
Supawat, Araya; Srisuwan, Supawadee; Sattayasai, Jintana
Tropical Journal of Pharmaceutical Research, 2016 , vol. 15, # 7 p. 1493 - 1498 Title/Abstract Full Text View citing articles Show Details
He, Xin; Huang, Lu; Lu, Yang; Dou, Mengmeng; Zhang, Zhihao; Zhang, Jie; Zhao, Xiaoyan
Latin American Journal of Pharmacy, 2016 , vol. 35, p. 1241 - 1247 Title/Abstract Full Text View citing articles Show Details
Liang, Zihong; Bai, Shunjie; Shen, Peng; Hu, Qingchuan; Wang, Xingfa; Dong, Meixue; Wang, Wei; Li, Juan; Cheng, Ke; Zhang, Shuxiao; Zou, Dezhi; Han, Yu; Wang, Haiyang; Xie, Peng
Behavioural Brain Research, 2016 , vol. 314, p. 116 - 124 Title/Abstract Full Text View citing articles Show Details
Rumondor, Alfred C.F.; Dhareshwar, Sundeep S.; Kesisoglou, Filippos
Journal of Pharmaceutical Sciences, 2016 , vol. 105, # 9 p. 2498 - 2508 Title/Abstract Full Text View citing articles Show Details
Jang, Hye-Lim; Yoo, Min; Nam, Jin-Sik
Journal of the Korean Society of Food Science and Nutrition, 2016 , vol. 45, # 7 p. 980 - 989 Title/Abstract Full Text View citing articles Show Details
Bandelow, Borwin; Baldwin, David; Abelli, Marianna; Altamura, Carlo; Dell’Osso, Bernardo; Domschke, Katharina; Fineberg, Naomi A.; Grünblatt, Edna; Jarema, Marek; Maron, Eduard; Nutt, David; Pini, Stefano; Vaghi, Matilde M.; Wichniak, Adam; Zai, Gwyneth; Riederer, Peter
World Journal of Biological Psychiatry, 2016 , vol. 17, # 5 p. 321 - 365 Title/Abstract Full Text View citing articles Show Details
Li, Meng; Shu, Xiangbing; Xu, Hanchen; Zhang, Chunlei; Yang, Lili; Zhang, Li; Ji, Guang
Journal of Translational Medicine, 2016 , vol. 14, # 1 art. no. 237 Title/Abstract Full Text View citing articles Show Details
Ostojic, Sergej M.
Amino Acids, 2016 , vol. 48, # 8 p. 1867 - 1875 Title/Abstract Full Text View citing articles Show Details
Xie; Zhou; Liang; Jiang; Chen
Revista Brasileira de Ciencia Avicola, 2016 , vol. 18, # 2 p. 277 - 282 Title/Abstract Full Text View citing articles Show Details
144 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Verimli, Ural; Sehirli, Umit S.
Anatomical Science International, 2016 , vol. 91, # 4 p. 398 - 406 Title/Abstract Full Text View citing articles Show Details
Tang, Zhen-Bo; Chen, Yao-Zhang; Zhao, Jie; Guan, Xiao-Wen; Bo, Yong-Xin; Chen, Shi-Wu; Hui, Ling
European Journal of Medicinal Chemistry, 2016 , vol. 123, p. 568 - 576 Title/Abstract Full Text View citing articles Show Details
Lemos, Maria Augusta Travassos; Matos, Camila Alves; de Resende, Michele Fabri; Prado, Rachel Bardy; Donagemma, Raquel Andrade; Netto, Annibal Duarte Pereira
Ecotoxicology and Environmental Safety, 2016 , vol. 133, p. 424 - 432 Title/Abstract Full Text View citing articles Show Details
Sheikhi, Mehdi; Shirzadian, Armin; Dehdashtian, Amir; Amiri, Shayan; Ostadhadi, Sattar; Ghasemi, Mehdi; Dehpour, Ahmad Reza
Epilepsy and Behavior, 2016 , vol. 62, p. 291 - 296 Title/Abstract Full Text View citing articles Show Details
Dickinson, Abigail; Jones, Myles; Milne, Elizabeth
Brain Research, 2016 , vol. 1648, p. 277 - 289 Title/Abstract Full Text View citing articles Show Details
Fan, Hueng-Chuen; Lee, Herng-Shen; Chang, Kai-Ping; Lee, Yi-Yen; Lai, Hsin-Chuan; Hung, Pi-Lien; Lee, Hsiu-Fen; Chi, Ching-Shiang
International Journal of Molecular Sciences, 2016 , vol. 17, # 8 art. no. 1242 Title/Abstract Full Text View citing articles Show Details
Moela, Pontsho; Motadi, Lesetja Raymond
OncoTargets and Therapy, 2016 , vol. 9, p. 4721 - 4735 Title/Abstract Full Text View citing articles Show Details
Galtrey, Clare M.; Mula, Marco; Cock, Hannah R.
Practical Neurology, 2016 , vol. 16, # 4 p. 270 - 278 Title/Abstract Full Text View citing articles Show Details
Casu, Francesca; Pinu, Farhana R.; Fedrizzi, Bruno; Greenwood, David R.; Villas-Boas, Sils G.
FEMS Yeast Research, 2016 , vol. 16, # 5 art. no. FOW050 Title/Abstract Full Text View citing articles Show Details
Bravim, Fernanda; Mota, Mainã M.; Fernandes, A. Alberto R.; Fernandes, Patricia M. B.
FEMS Yeast Research, 2016 , vol. 16, # 5 art. no. FOW052
Title/Abstract Full Text View citing articles Show Details
Cheng, Meng-Chun; Leu, Yann-Lii; Tsai, Tsung-Yu; Pan, Tzu-Ming
Journal of Functional Foods, 2016 , vol. 26, p. 238 - 248 Title/Abstract Full Text View citing articles Show Details
Watanabe, Kazunori; Takahashi, Nobuto; Hozumi, Naohiro; Yoshida, Sachiko
Sensors and Materials, 2015 , vol. 27, # 10 p. 1035 - 1044 Title/Abstract Full Text View citing articles Show Details
Kida, Hiroyuki; Tsuda, Yasumasa; Ito, Nana; Yamamoto, Yui; Owada, Yuji; Kamiya, Yoshinori; Mitsushima, Dai
Cerebral Cortex, 2016 , vol. 26, # 8 p. 3494 - 3507 Title/Abstract Full Text View citing articles Show Details
Kang, Jing-Qiong; MacDonald, Robert L.
JAMA Neurology, 2016 , vol. 73, # 8 p. 1009 - 1016 Title/Abstract Full Text View citing articles Show Details
Luppi, Pierre-Hervé; Fort, Patrice
Sleep and Biological Rhythms, 2011 , vol. 9, # 1 p. 59 - 64 Title/Abstract Full Text Show Details
Zhang, Jiaqiang; Xu, Changqing; Puentes, Dyanet L.; Seubert, Christoph N.; Gravenstein, Nikolaus; Martynyuk, Anatoly E.
Neuroendocrinology, 2016 , vol. 103, # 5 p. 440 - 451 Title/Abstract Full Text View citing articles Show Details
de la Peña, June Bryan; Cheong, Jae Hoon
Drug Testing and Analysis, 2016 , vol. 8, # 8 p. 760 - 767 Title/Abstract Full Text View citing articles Show Details
Wei, Ran; Li, Qi; Lam, Sylvia; Leung, Jana; Cheung, Charlton; Zhang, Xiaofan; Sham, Pak Chung; Chua, Siew Eng; McAlonan, Grainne Mary
Behavioural Brain Research, 2016 , vol. 314, p. 190 - 198 Title/Abstract Full Text View citing articles Show Details
Lanning, Rachel K.; Zai, Clement C.; Müller, Daniel J.
Pharmacogenomics, 2016 , vol. 17, # 12 p. 1339 - 1351 Title/Abstract Full Text View citing articles Show Details
KØBENHAVNS UNIVERSITET; SØRENSEN, Thomas Just; LAURSEN, Bo V.; SANTELLA, Marco
Patent: WO2016/116111 A1, 2016 ; Title/Abstract Full Text Show Details
145 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Chromocell Corporation; SHEKDAR, Kambiz
Patent: EP3009513 A1, 2016 ; Title/Abstract Full Text Show Details
Hertle, Daniel N.; Beynon, Christopher; Neumann, Jan O.; Santos, Edgar; Sánchez-Porras, Renan; Unterberg, Andreas W.; Sakowitz, Oliver W.
Journal of Clinical Anesthesia, 2016 , vol. 35, p. 118 - 122 Title/Abstract Full Text View citing articles Show Details
Yang, Bingxian; Wang, Xin; Gao, Cuixia; Chen, Meng; Guan, Qijie; Tian, Jingkui; Komatsu, Setsuko
Journal of Proteome Research, 2016 , vol. 15, # 8 p. 2643 - 2657 Title/Abstract Full Text View citing articles Show Details
Chagraoui; Skiba; Thuillez; Thibaut
Progress in Neuro-Psychopharmacology and Biological Psychiatry, 2016 , vol. 71, p. 189 - 202 Title/Abstract Full Text View citing articles Show Details
Rubio-Osornio, Carmen; Eguiluz-Meléndez, Aldo; Trejo-Solís, Cristina; Custodio, Veronica; Rubio-Osornio, Moises; Rosiles-Abonce, Artemio; Martínez-Lazcano, Juan C.; González, Edith; Paz, Carlos
CNS and Neurological Disorders - Drug Targets, 2016 , vol. 15, # 6 p. 723 - 729 Title/Abstract Full Text View citing articles Show Details
Ago, Yukio; Hasebe, Shigeru; Hiramatsu, Naoki; Mori, Kazuya; Watabe, Yuji; Onaka, Yusuke; Hashimoto, Hitoshi; Takuma, Kazuhiro; Matsuda, Toshio
Psychopharmacology, 2016 , vol. 233, # 17 p. 3125 - 3134 Title/Abstract Full Text View citing articles Show Details
Hervig, Mona E.; Thomsen, Morten S.; Kalló, Imre; Mikkelsen, Jens D.
Neuroscience, 2016 , vol. 334, p. 13 - 25 Title/Abstract Full Text View citing articles Show Details
Ho, Seok-Man; Topol, Aaron; Brennand, Kristen J.
Biomarker Insights, 2015 , vol. 2015, p. 31 - 41 Title/Abstract Full Text View citing articles Show Details
Herrera, Andrea; Muñoz, Patricia; Paris, Irmgard; Díaz-Veliz, Gabriela; Mora, Sergio; Inzunza, Jose; Hultenby, Kjell; Cardenas, Cesar; Jaña, Fabián; Raisman-Vozari, Rita; Gysling, Katia; Abarca, Jorge; Steinbusch, Harry W. M.; Segura-Aguilar, Juan
Cellular and Molecular Life Sciences, 2016 , vol. 73, # 18 p. 3583 - 3597 Title/Abstract Full Text View citing articles Show Details
Liebig; Grasshoff; Hentschke
Anaesthesist, 2016 , vol. 65, # 8 p. 609 - 614 Title/Abstract Full Text View citing articles Show Details
Suvorova, Inna A.; Rodionov, Dmitry A.
Microbial Genomics, 2016 , vol. 2, # 1 Title/Abstract Full Text Show Details
Sheng, Ling; Shen, Dandan; Luo, Yi; Sun, Xiaohua; Wang, Jinqiu; Luo, Tao; Zeng, Yunliu; Xu, Juan; Deng, Xiuxin; Cheng, Yunjiang
Food Chemistry, 2017 , vol. 216, p. 138 - 145 Title/Abstract Full Text View citing articles Show Details
Nakamura, Tsutomu; Arima-Yoshida, Fumiko; Sakaue, Fumika; Nasu-Nishimura, Yukiko; Takeda, Yasuko; Matsuura, Ken; Akshoomoff, Natacha; Mattson, Sarah N.; Grossfeld, Paul D.; Manabe, Toshiya; Akiyama, Tetsu
Nature Communications, 2016 , vol. 7, art. no. 10861 Title/Abstract Full Text View citing articles Show Details
Salzer, Isabella; Gantumur, Enkhbileg; Yousuf, Arsalan; Boehm, Stefan
Neuropharmacology, 2016 , vol. 110, p. 277 - 286 Title/Abstract Full Text View citing articles Show Details
Schiavone, Stefania; Neri, Margherita; Mhillaj, Emanuela; Pomara, Cristoforo; Trabace, Luigia; Turillazzi, Emanuela
Toxicology Letters, 2016 , vol. 258, p. 29 - 35 Title/Abstract Full Text View citing articles Show Details
Juarez, Barbara; Han, Ming-Hu
Neuropsychopharmacology, 2016 , vol. 41, # 10 p. 2424 - 2446 Title/Abstract Full Text View citing articles Show Details
Li, Zhong; Xu, Jing; Jiang, Tongtong; Ge, Yongsheng; Liu, Pan; Zhang, Manman; Su, Zhiguo; Gao, Chao; Ma, Cuiqing; Xu, Ping
Scientific Reports, 2016 , vol. 6, art. no. 30884 Title/Abstract Full Text View citing articles Show Details
Schrider, Daniel R.; Kern, Andrew D.
Genome Biology and Evolution, 2015 , vol. 7, # 12 p. 3511 - 3528 Title/Abstract Full Text View citing articles Show Details
Dubey, Divyanshu; Farzal, Zehra; Hays, Ryan; Brown, L Steven; Vernino, Steven
Therapeutic Advances in Neurological Disorders, 2016 , vol. 9, # 5 p. 369 - 377 Title/Abstract Full Text View citing articles Show Details
Vaz, Gisele C.; Sharma, Neeru M.; Zheng, Hong; Zimmerman, Matthew C.; Santos, Robson S.; Frezard, Frederic; Fontes, Marco A.P.; Patel, Kaushik P.
Journal of Neuroscience Methods, 2016 , vol. 273, p. 55 - 63 Title/Abstract Full Text View citing articles Show Details
146 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Wunjuntuk, Kansuda; Kettawan, Aikkarach; Rungruang, Thanaporn; Charoenkiatkul, Somsri
Journal of Functional Foods, 2016 , vol. 26, p. 363 - 372 Title/Abstract Full Text View citing articles Show Details
Heberling, Colin; Dhurjati, Prasad
International Journal of Molecular Sciences, 2015 , vol. 16, # 4 p. 8949 - 8967 Title/Abstract Full Text View citing articles Show Details
Taiwe; Moto; Pale; Kandeda; Dawe, Amadou; Kouemou; Ayissi; Ngoupaye; Njapdounke; Nkantchoua; Omam; Pahaye; Ngo Bum
Epilepsy Research, 2016 , vol. 127, p. 30 - 39 Title/Abstract Full Text View citing articles Show Details
Lytkin; Chernikov; Krutova; Skvortsov; Korchagina
Russian Journal of Physical Chemistry A, 2016 , vol. 90, # 9 p. 1782 - 1784 Zh. Fiz. Khim., 2016 , vol. 90, # 9 p. 1350 - 1353,4 Title/Abstract Full Text View citing articles Show Details
Wang, Lu; Wang, Yan; Zhou, Shimeng; Yang, Liukun; Shi, Qixin; Li, Yujiao; Zhang, Kun; Yang, Le; Zhao, Minggao; Yang, Qi
Genes, 2016 , vol. 7, # 8 art. no. 45 Title/Abstract Full Text View citing articles Show Details
Creeley, Catherine E.
Brain Sciences, 2016 , vol. 6, # 3 art. no. 13 Title/Abstract Full Text Show Details
Persson, Tomas; Van Nguyen, Thanh; Alloisio, Nicole; Pujic, Petar; Berry, Alison M.; Normand, Philippe; Pawlowski, Katharina
Symbiosis, 2016 , vol. 70, # 1-3 p. 149 - 157 Title/Abstract Full Text View citing articles Show Details
Wu, Zi-Chen; Yang, Zhuan-Ying; Li, Jian-Guo; Chen, Hou-Bin; Huang, Xu-Ming; Wang, Hui-Cong
International Journal of Food Sciences and Nutrition, 2016 , vol. 67, # 7 p. 762 - 772 Title/Abstract Full Text View citing articles Show Details
Chompoopong, Supin; Jarungjitaree, Sunit; Punbanlaem, Tideeporn; Rungruang, Thanaporn; Chongthammakun, Sukumal; Kettawan, Aikkarach; Taechowisan, Thongchai
NeuroMolecular Medicine, 2016 , vol. 18, # 3 p. 334 - 346 Title/Abstract Full Text View citing articles Show Details
Nakai, Tomoya; Okanoya, Kazuo
NeuroReport, 2016 , vol. 27, # 13 p. 987 - 991 Title/Abstract Full Text View citing articles Show Details
Ferdousy, Sakia; Rahman, Md Atiar; Al-Amin, Md Mamun; Aklima, Jannatul; Chowdhury, J. M. Kamirul Hasan
Clinical Phytoscience, 2017 , vol. 2, # 1 art. no. 17 Title/Abstract Full Text Show Details
Kaufmann, Dan; Bates, Emily A.; Yagen, Boris; Bialer, Meir; Saunders, Gerald H.; Wilcox, Karen; White, H Steve; Brennan
Cephalalgia, 2016 , vol. 36, # 10 p. 924 - 935 Title/Abstract Full Text View citing articles Show Details
Benarroch, Eduardo E.
Neurology, 2016 , vol. 87, # 7 p. 726 - 735 Title/Abstract Full Text View citing articles Show Details
Mossa, Abdel-Tawab H.
Journal of Environmental Science and Technology, 2016 , vol. 9, # 5 p. 354 - 378 Title/Abstract Full Text View citing articles Show Details
Rodríguez-Traver, Eva; Solís, Oscar; Díaz-Guerra, Eva; Ortiz, Óscar; Vergaño-Vera, Eva; Méndez-Gómez, Héctor R.; García-Sanz, Patricia; Moratalla, Rosario; Vicario-Abejón, Carlos
Neurotoxicity Research, 2016 , vol. 30, # 1 p. 14 - 31 Title/Abstract Full Text View citing articles Show Details
Wu, Chang-wen; Wu, Xiaojun; Wen, Chao; Peng, Bo; Peng, Xuan-xian; Chen, Xinhua; Li, Hui
Protein and Cell, 2016 , vol. 7, # 7 p. 527 - 532 Title/Abstract Full Text View citing articles Show Details
Rafii, Michael S.
CNS Drugs, 2016 , vol. 30, # 7 p. 567 - 573 Title/Abstract Full Text View citing articles Show Details
Kaushal; Taylor; Jamal; Zhang; Ma; Donahue; Westlund
Neuroscience, 2016 , vol. 334, p. 148 - 159 Title/Abstract Full Text View citing articles Show Details
Wilkening, Ina; Gazzola, Silvia; Riva, Elena; Parascandolo, James S.; Song, Lijiang; Tosin, Manuela
Chemical Communications, 2016 , vol. 52, # 68 p. 10392 - 10395 Title/Abstract Full Text View citing articles Show Details
Jonsson, Amanda; Inal, Sahika; Uguz, Llke; Williamson, Adam J.; Kergoat, Loïg; Rivnay, Jonathan; Khodagholy, Dion; Berggren, Magnus; Bernard, Christophe; Malliaras, George G.; Simon, Daniel T.
Proceedings of the National Academy of Sciences of the United States of America, 2016 , vol. 113, # 34 p. 9440 - 9445
Title/Abstract Full Text View citing articles Show Details
147 of 992
148 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Feng, Jinhui; He, Fuyan; Yang, Zhizhou; Yao, Jinshui
Green Processing and Synthesis, 2016 , vol. 5, # 4 p. 419 - 425 Title/Abstract Full Text View citing articles Show Details
Oda, Kohei; Nagai, Takeshi; Ueno, Yoshie; Mori, Yoshiharu
Bioscience, Biotechnology and Biochemistry, 2015 , vol. 79, # 2 p. 307 - 313 Title/Abstract Full Text View citing articles Show Details
Golovko, Tatiana; Min, Rogier; Lozovaya, Natalia; Falconer, Caroline; Yatsenko, Natalia; Tsintsadze, Timur; Tsintsadze, Vera; Ledent, Catherine; Harvey, Robert J.; Belelli, Delia; Lambert, Jeremy J.; Rozov, Andrei; Burnashev, Nail
Cerebral Cortex, 2015 , vol. 25, # 9 p. 2440 - 2455 Title/Abstract Full Text View citing articles Show Details
Hammad, Mohamed; Schmidt, Stephen L.; Zhang, Xuying; Bray, Ryan; Frohlich, Flavio; Ghashghaei, H. Troy
Cerebral Cortex, 2015 , vol. 25, # 9 p. 2970 - 2979 Title/Abstract Full Text View citing articles Show Details
Gonzales-Arimborgo, Carla; Yupanqui, Irma; Montero, Elsa; Alarcón-Yaquetto, Dulce E.; Zevallos-Concha, Alisson; Caballero, Lidia; Gasco, Manuel; Zhao, Jianping; Khan, Ikhlas A.; Gonzales, Gustavo F.
Pharmaceuticals, 2016 , vol. 9, # 3 art. no. 49 Title/Abstract Full Text View citing articles Show Details
Brandes, Ralf P.
Circulation Research, 2016 , vol. 119, # 5 p. 577 - 579 Title/Abstract Full Text View citing articles Show Details
Tsuruga, Kenkichi; Hashimoto, Toshikazu; Kato, Ryoko; Kato, Rui; Uchida, Yousuke; Hase, Tetsutaro; Morimoto, Yuji
Biomedical Research (Japan), 2016 , vol. 37, # 4 p. 243 - 249 Title/Abstract Full Text View citing articles Show Details
Washio, Jumpei; Ogawa, Tamaki; Suzuki, Keisuke; Tsukiboshi, Yosuke; Watanabe, Motohiro; Takahashi, Nobuhiro
Biomedical Research (Japan), 2016 , vol. 37, # 4 p. 251 - 257 Title/Abstract Full Text View citing articles Show Details
Jacob, Merlin K.; Prabha, Sneha; Abraham, Liyamol B.; Hemalatha; Sivakumar
International Journal of Pharmaceutical Sciences Review and Research, 2016 , vol. 39, # 2 art. no. 29, p. 157 - 158 Title/Abstract Full Text View citing articles Show Details
Rubio-Casillas, Alberto; Fernández-Guasti, Alonso
Reviews in the Neurosciences, 2016 , vol. 27, # 6 p. 599 - 622 Title/Abstract Full Text View citing articles Show Details
Sen, Suvajit; Roy, Sohini; Bandyopadhyay, Gautam; Scott, Bari; Xiao, Daliao; Ramadoss, Sivakumar; Mahata, Sushil K.; Chaudhuri, Gautam
Circulation Research, 2016 , vol. 119, # 5 p. 621 - 634 Title/Abstract Full Text View citing articles Show Details
Fuse, Toshinori; Kita, Tomo; Nakata, Yunosuke; Ozoe, Fumiyo; Ozoe, Yoshihisa
Insect Biochemistry and Molecular Biology, 2016 , vol. 77, p. 78 - 86 Title/Abstract Full Text View citing articles Show Details
Atherton, Laura A.; Burnell, Erica S.; Mellor, Jack R.
PLoS ONE, 2016 , vol. 11, # 8 art. no. E0160900 Title/Abstract Full Text View citing articles Show Details
Redruello, Begoña; Ladero, Victor; del Rio, Beatriz; Fernández, María; Martin; Alvarez, Miguel A.
Food Chemistry, 2017 , vol. 217, p. 117 - 124 Title/Abstract Full Text Show Details
Gökcan, Hatice; Monard, Gerald; Sungur Konuklar, F. Aylin
Proteins: Structure, Function and Bioinformatics, 2016 , vol. 84, # 7 p. 875 - 891 Title/Abstract Full Text Show Details
Sakhautdinov; Gumerov; Malikova; Fatykhov; Yunusov
Chemistry of Natural Compounds, 2016 , vol. 52, # 4 p. 651 - 655 Khim. Prir. Soedin., 2016 , vol. 4, p. 562 - 565,4 Title/Abstract Full Text Show Details
Al-Quraan, Nisreen A.; Al-Smadi, Mousa L.; Swaleh, Aaya F.
Journal of Plant Interactions, 2015 , vol. 10, # 1 p. 185 - 194 Title/Abstract Full Text Show Details
Zuluaga, Martha; Melchor, Jhon Jairo; Tabares-Villa, Fredy Alexander; Taborda, Gonzalo; Sepúlveda-Arias, Juan Carlos
Chromatographia, 2016 , vol. 79, # 17-18 p. 1061 - 1068 Title/Abstract Full Text Show Details
Arens, Ann; Smollin, Craig
Journal of Medical Toxicology, 2016 , vol. 12, # 3 p. 309 - 314 Title/Abstract Full Text Show Details
Peltoniemi, Marko A.; Hagelberg, Nora M.; Olkkola, Klaus T.; Saari, Teijo I.
Clinical Pharmacokinetics, 2016 , vol. 55, # 9 p. 1059 - 1077 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Sharma, Seema; Saxena, Dharmesh C.; Riar, Charanjit S.
Plant Foods for Human Nutrition, 2016 , vol. 71, # 3 p. 231 - 238 Title/Abstract Full Text Show Details
Fang, Fang; Sun, Hongwei; Wang, Zuowei; Ren, Ming; Calabrese, Joseph R.; Gao, Keming
CNS Drugs, 2016 , vol. 30, # 9 p. 845 - 867 Title/Abstract Full Text Show Details
Roshan, Mohsin H.K.; Tambo, Amos; Pace, Nikolai P.
Open Neurology Journal, 2016 , vol. 10, p. 42 - 58 Title/Abstract Full Text Show Details
Zhang, Yixi; Meng, Xiangkun; Yang, Yuanxue; Li, Hong; Wang, Xin; Yang, Baojun; Zhang, Jianhua; Li, Chunrui; Millar, Neil S.; Liu, Zewen
Scientific Reports, 2016 , vol. 6, art. no. 32335 Title/Abstract Full Text Show Details
Chevalier, Marlene; Sakarovitch, Charlotte; Precheur, Isabelle; Lamure, Julie; Pouyssegur-Rougier, Valerie
Acta Odontologica Scandinavica, 2015 , vol. 73, # 4 p. 267 - 273 Title/Abstract Full Text Show Details
Andolina, Diego; Maran, Dario; Viscomi, Maria Teresa; Puglisi-Allegra, Stefano
International Journal of Neuropsychopharmacology, 2015 , vol. 18, # 3 art. no. 074 Title/Abstract Full Text Show Details
Zhou, Molin; Ndeurumio, Kessy H.; Zhao, Lei; Hu, Zhuoyan
Journal of Agricultural and Food Chemistry, 2016 , vol. 64, # 33 p. 6443 - 6450 Title/Abstract Full Text Show Details
Wei, Feifei; Furihata, Kazuo; Zhang, Mimin; Miyakawa, Takuya; Tanokura, Masaru
Journal of Agricultural and Food Chemistry, 2016 , vol. 64, # 33 p. 6459 - 6465 Title/Abstract Full Text Show Details
Zhao, Anqi; Hu, Xiaoqing; Li, Ye; Chen, Cheng; Wang, Xiaoyuan
AMB Express, 2016 , vol. 6, # 1 art. no. 55 Title/Abstract Full Text Show Details
Carr; Mills; Mandernack
Marine Chemistry, 2016 , vol. 186, p. 72 - 82 Title/Abstract Full Text Show Details
Simon-O'Brien, Emmanuelle; Gauthier, Delphine; Riban, Véronique; Verleye, Marc
Journal of Neuroinflammation, 2016 , vol. 13, # 1 art. no. 203 Title/Abstract Full Text Show Details
Grolez; Moreau; Danel-Brunaud; Delmaire; Lopes; Pradat; El Mendili; Defebvre; Devos
BMC Neurology, 2016 , vol. 16, # 1 art. no. 155 Title/Abstract Full Text Show Details
Gentile, Antonietta; Musella, Alessandra; Bullitta, Silvia; Fresegna, Diego; De Vito, Francesca; Fantozzi, Roberta; Piras, Eleonora; Gargano, Francesca; Borsellino, Giovanna; Battistini, Luca; Schubart, Anna; Mandolesi, Georgia; Centonze, Diego
Journal of Neuroinflammation, 2016 , vol. 13, # 1 art. no. 207 Title/Abstract Full Text Show Details
de la Mora, Miguel Pérez; Pérez-Carrera, Diana; Crespo-Ramírez, Minerva; Tarakanov, Alexander; Fuxe, Kjell; Borroto-Escuela, Dasiel O.
Biochimica et Biophysica Acta - Molecular Basis of Disease, 2016 , vol. 1862, # 11 p. 2075 - 2085 Title/Abstract Full Text Show Details
Sadek, Bassem; Khan, Nadia; Darras, Fouad H.; Pockes, Steffen; Decker, Michael
Physiology and Behavior, 2016 , vol. 165, p. 383 - 391 Title/Abstract Full Text Show Details
Khadrawy, Yasser A.; Noor, Neveen A.; Mourad, Iman M.; Ezz, Heba S. Aboul
Toxicology and Industrial Health, 2016 , vol. 32, # 9 p. 1711 - 1719 Title/Abstract Full Text Show Details
Cheng, Gui-Lin; Wang, Hui; Lin, Xian-Fu; Wu, Qi
Current Organic Synthesis, 2016 , vol. 13, # 4 p. 514 - 543 Title/Abstract Full Text Show Details
Escribano, Begoña M.; Santamaría, Abel; de Lima, María E.; Medina-Fernández, Francisco J.; Bashir, Shahid; Túnez, Isaac
CNS and Neurological Disorders - Drug Targets, 2016 , vol. 15, # 7 p. 845 - 856 Title/Abstract Full Text Show Details
Sayyari, Mohammad; Aghdam, Morteza Soleimani; Salehi, Fakhreddin; Ghanbari, Fardin
Scientia Horticulturae, 2016 , vol. 211, p. 110 - 117 Title/Abstract Full Text Show Details
Klüver, Nils; Vogs, Carolina; Altenburger, Rolf; Escher, Beate I.; Scholz, Stefan
Chemosphere, 2016 , vol. 164, p. 164 - 173 Title/Abstract Full Text Show Details
149 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Klüver, Nils; Vogs, Carolina; Altenburger, Rolf; Escher, Beate I.; Scholz, Stefan
Chemosphere, 2016 , vol. 164, p. 164 - 173 Title/Abstract Full Text Show Details
Kanost, Michael R.; Arrese, Estela L.; Cao, Xiaolong; Chen, Yun-Ru; Chellapilla, Sanjay; Goldsmith, Marian R.; Grosse-Wilde, Ewald; Heckel, David G.; Herndon, Nicolae; Jiang, Haobo; Papanicolaou, Alexie; Qu, Jiaxin; Soulages, Jose L.; Vogel, Heiko; Walters, James; Waterhouse, Robert M.; Ahn, Seung-Joon; Almeida, Francisca C.; An, Chunju; Aqrawi, Peshtewani; Bretschneider, Anne; Bryant, William B.; Bucks, Sascha; Chao, Hsu; Chevignon, Germain; Christen, Jayne M.; Clarke, David F.; Dittmer, Neal T.; Ferguson, Laura C.F.; Garavelou, Spyridoula; Gordon, Karl H.J.; Gunaratna, Ramesh T.; Han, Yi; Hauser, Frank; He, Yan; Heidel-Fischer, Hanna; Hirsh, Ariana; Hu, Yingxia; Jiang, Hongbo; Kalra, Divya; Klinner, Christian; König, Christopher; Kovar, Christie; Kroll, Ashley R.; Kuwar, Suyog S.; Lee, Sandy L.; Lehman, Rüdiger; Li, Kai; Li, Zhaofei; Liang, Hanquan; Lovelace, Shanna; Lu, Zhiqiang; Mansfield, Jennifer H.; McCulloch, Kyle J.; Mathew, Tittu; Morton, Brian; Muzny, Donna M.; Neunemann, David; Ongeri, Fiona; Pauchet, Yannick; Pu, Ling-Ling; Pyrousis, Ioannis; Rao, XiangJun; Redding, Amanda; Roesel, Charles; Sanchez-Gracia, Alejandro; Schaack, Sarah; Shukla, Aditi; Tetreau, Guillaume; Wang, Yang; Xiong, Guang-Hua; Traut, Walther; Walsh, Tom K.; Worley, Kim C.; Wu, Di; Wu, Wenbi; Wu, Yuan-Qing; Zhang, Xiufeng; Zou, Zhen; Zucker, Hannah; Briscoe, Adriana D.; Burmester, Thorsten; Clem, Rollie J.; Feyereisen, René; Grimmelikhuijzen, Cornelis J.P.; Hamodrakas, Stavros J.; Hansson, Bill S.; Huguet, Elisabeth; Jermiin, Lars S.; Lan, Que; Lehman, Herman K.; Lorenzen, Marce; Merzendorfer, Hans; Michalopoulos, Ioannis; Morton, David B.; Muthukrishnan, Subbaratnam; Oakeshott, John G.; Palmer, Will; Park, Yoonseong; Passarelli, A. Lorena; Rozas, Julio; Schwartz, Lawrence M.; Smith, Wendy; Southgate, Agnes; Vilcinskas, Andreas; Vogt, Richard; Wang, Ping; Werren, John; Yu, Xiao-Qiang; Zhou, Jing-Jiang; Brown, Susan J.; Scherer, Steven E.; Richards, Stephen; Blissard, Gary W.
Insect Biochemistry and Molecular Biology, 2016 , vol. 76, p. 118 - 147 Title/Abstract Full Text Show Details
Long, Ye; Bordt, Andrea S.; Liu, Weiley S.; Davis, Elizabeth P.; Lee, Stephen J.; Tseng, Luke; Chuang, Alice Z.; Whitaker, Christopher M.; Massey, Stephen C.; Sherman, Michael B.; Marshak, David W.
Peptides, 2016 , vol. 84, p. 22 - 35 Title/Abstract Full Text Show Details
Li, Yangping; Zhang, Lingling; Sun, Yan; Ma, Xiaoli; Wang, Jing; Li, Ruojiao; Zhang, Meiwei; Wang, Shi; Hu, Xiaoli; Bao, Zhenmin
Marine Biotechnology, 2016 , vol. 18, # 4 p. 453 - 465 Title/Abstract Full Text Show Details
Cohen-Gilbert, Julia E.; Sneider, Jennifer T.; Crowley, David J.; Rosso, Isabelle M.; Jensen, J. Eric; Silveri, Marisa M.
Developmental Cognitive Neuroscience, 2015 , vol. 16, p. 147 - 154
Title/Abstract Full Text Show Details
Porcu, Alessandra; Lobina, Carla; Giunta, Daniela; Solinas, Maurizio; Mugnaini, Claudia; Castelli, M. Paola
European Journal of Pharmacology, 2016 , vol. 791, p. 115 - 123 Title/Abstract Full Text Show Details
Tremblay, Melanie; Winstanley, Catharine A.
Behavioural Brain Research, 2016 , vol. 314, p. 143 - 151 Title/Abstract Full Text Show Details
Camargo, Gabriela; Elizalde, Alejandro; Trujillo, Xochitl; Montoya-Pérez, Rocío; Mendoza-Magaña, María Luisa; Hernandez-Chavez, Abel; Hernandez, Leonardo
Cell Stress and Chaperones, 2016 , vol. 21, # 5 p. 763 - 772 Title/Abstract Full Text Show Details
Sung, Jwakyung; Sonn, Yeonkyu; Lee, Yejin; Kang, Seongsoo; Ha, Sangkeun; Krishnan, Hari B.; Oh, Taek-Keun
Journal of Plant Nutrition and Soil Science, 2015 , vol. 178, # 5 p. 792 - 797 Title/Abstract Full Text Show Details
Rochford, Kevin; Chen, Feng; Waguespack, Yan; Figliozzi, Robert W.; Kharel, Madan K.; Zhang, Qiaojuan; Martin-Caraballo, Miguel; Hsia, S. Victor
PLoS ONE, 2016 , vol. 11, # 8 art. no. E0161119 Title/Abstract Full Text Show Details
Vijayakumari; Jisha; Puthur, Jos T.
Acta Physiologiae Plantarum, 2016 , vol. 38, # 9 art. no. 230 Title/Abstract Full Text Show Details
Kusminski, Christine M.; Bickel, Perry E.; Scherer, Philipp E.
Nature Reviews Drug Discovery, 2016 , vol. 15, # 9 p. 639 - 660 Title/Abstract Full Text Show Details
Martin, Cédric B.P.; Martin, Vincent S.; Trigo, José M.; Chevarin, Caroline; Maldonado, Rafael; Fink, Latham H.; Cunningham, Kathryn A.; Hamon, Michel; Lanfumey, Laurence; Mongeau, Raymond
International Journal of Neuropsychopharmacology, 2015 , vol. 18, # 3 Title/Abstract Full Text Show Details
Defrancesco, Michaela; Marksteiner, Josef; Wolfgang Fleischhacker; Blasko, Imrich
International Journal of Neuropsychopharmacology, 2015 , vol. 18, # 10 Title/Abstract Full Text Show Details
Magrinelli, Francesca; Picelli, Alessandro; Tocco, Pierluigi; Federico, Angela; Roncari, Laura; Smania, Nicola; Zanette, Giampietro; Tamburin, Stefano
Parkinson's Disease, 2016 , vol. 2016, art. no. 9832839 Title/Abstract Full Text Show Details
Liao, Zhijun; Huang, Yong; Yue, Xiaodong; Lu, Huijuan; Xuan, Ping; Ju, Ying
BioMed Research International, 2016 , vol. 2016, art. no. 2375268 Title/Abstract Full Text Show Details
Wongsamitkul, Nisa; Baur, Roland; Sigel, Erwin
Journal of Biological Chemistry, 2016 , vol. 291, # 35 p. 18474 - 18483 Title/Abstract Full Text Show Details
Kumar, Vinay; Sharma, Sandeep Kumar; Nagarajan; Dixit, Praveen Kumar
Iranian Journal of Medical Sciences, 2016 , vol. 41, # 5 p. 430 - 436 Title/Abstract Full Text Show Details
Kipanyula, Maulilio John; Kimaro, Wahabu Hamisi; Etet, Paul F. Seke
Journal of Aging Research, 2016 , vol. 2016, art. no. 5081021 Title/Abstract Full Text Show Details
Eamarjharn, Apinya; Theerakulkait, Chockchai; Thanachasai, Saipin
Agriculture and Natural Resources, 2016 , vol. 50, # 1 p. 80 - 84 Title/Abstract Full Text Show Details
150 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Schneider, Brandy L.; Ghoddoussi, Farhad; Charlton, Jennifer L.; Kohler, Robert J.; Galloway, Matthew P.; Perrine, Shane A.; Conti, Alana C.
Journal of Neurotrauma, 2016 , vol. 33, # 17 p. 1614 - 1624 Title/Abstract Full Text Show Details
Lenk, Kerstin; Priwitzer, Barbara; Ylä-Outinen, Laura; Tietz, Lukas H.B.; Narkilahti, Susanna; Hyttinen, Jari A.K.
BioMedical Engineering Online, 2016 , vol. 15, # 1 art. no. 105 Title/Abstract Full Text Show Details
Lim, Miranda M.; Szymusiak, Ronald
Current Sleep Medicine Reports, 2015 , vol. 1, # 2 p. 91 - 100 Title/Abstract Full Text Show Details
Wuttke, Wolfgang; Seidlová-Wuttke, Dana
Clinical Phytoscience, 2015 , vol. 1, # 1 art. no. 12 Title/Abstract Full Text Show Details
Hokazono, Hideki; Uehara, Eriko
Nippon Shokuhin Kagaku Kogaku Kaishi, 2016 , vol. 63, # 7 p. 306 - 311 Title/Abstract Full Text Show Details
Jung, Bok-Mi; Shin, Tai-Sun
Journal of the Korean Society of Food Science and Nutrition, 2016 , vol. 45, # 8 p. 1114 - 1121 Title/Abstract Full Text Show Details
Park, Ji-Young; Ham, Hyeonmi; Han, Sang-Ik; Oh, Sung-Hwan; Song, You Chun; Cho, Jun Hyeon; Hur, Yeon-Jae; Lee, Yu-Young; Lee, Byung-Won; Choi, Yong Hwan
Journal of the Korean Society of Food Science and Nutrition, 2016 , vol. 45, # 8 p. 1214 - 1220 Title/Abstract Full Text Show Details
Violante, Inês R.; Patricio, Miguel; Bernardino, Inês; Rebola, José; Abrunhosa, Antero J.; Ferreira, Nuno; Castelo-Branco, Miguel
Neurology, 2016 , vol. 87, # 9 p. 897 - 904 Title/Abstract Full Text Show Details
Oh, Won Chan; Lutzu, Stefano; Castillo, Pablo E.; Kwon, Hyung-Bae
Science, 2016 , vol. 353, # 6303 p. 1037 - 1040 Title/Abstract Full Text Show Details
Balmus, Ioana Miruna; Ciobica, Alin; Antioch, Iulia; Dobrin, Romeo; Timofte, Daniel
Oxidative Medicine and Cellular Longevity, 2016 , vol. 2016, art. no. 3975101
Title/Abstract Full Text Show Details
Kim, Hyeonjin; Kim, Sungjin; Lee, Hyeong Hun; Heo, Hwon
Korean Journal of Radiology, 2016 , vol. 17, # 5 p. 620 - 632 Title/Abstract Full Text Show Details
Lo, Yu-Chang; Chien, Shih-Chang; Mishchuk, Darya O.; Slupsky, Carolyn M.; Mau, Jeng-Leun
International Journal of Medicinal Mushrooms, 2016 , vol. 18, # 5 p. 413 - 424 Title/Abstract Full Text Show Details
Stead, David Francis; Mason, Carolyn Ruth
South African Medical Journal, 2016 , vol. 106, # 9 p. 891 - 892 Title/Abstract Full Text Show Details
Paul, Melanie Verena; Iyer, Srignanakshi; Amerhauser, Carmen; Lehmann, Martin; van Dongen, Joost T.; Geigenberger, Peter
Plant Physiology, 2016 , vol. 172, # 1 p. 141 - 153 Title/Abstract Full Text Show Details
Fedotova, Julia; Soultanov, Vagif; Nikitina, Tamara; Roschin, Victor; Ordyan, Natalia; Hritcu, Lucian
Biomedicine and Pharmacotherapy, 2016 , vol. 83, p. 1444 - 1455 Title/Abstract Full Text Show Details
Subaraja, Mamangam; Vanisree
Environmental Science and Pollution Research, 2016 , vol. 23, # 17 p. 17123 - 17131 Title/Abstract Full Text Show Details
Toyo'oka, Toshimasa
Biological and Pharmaceutical Bulletin, 2016 , vol. 39, # 9 p. 1397 - 1411 Title/Abstract Full Text Show Details
Blecharz-Klin, Kamilla; Joniec-Maciejak, Ilona; Jawna-Zboińska, Katarzyna; Pyrzanowska, Justyna; Piechal, Agnieszka; Wawer, Adriana; Widy-Tyszkiewicz, Ewa
Pharmacological Reports, 2016 , vol. 68, # 6 p. 1159 - 1164 Title/Abstract Full Text Show Details
Hansen, Susanne K.; Stummann, Tina C.; Borland, Helena; Hasholt, Lis F.; Tümer, Zeynep; Nielsen, Jørgen E.; Rasmussen, Mikkel A.; Nielsen, Troels T.; Daechsel, Justus C.A.; Fog, Karina; Hyttel, Poul
Stem Cell Research, 2016 , vol. 17, # 2 p. 306 - 317 Title/Abstract Full Text Show Details
Qi, Zhen; Yu, Gina P.; Tretter, Felix; Pogarell, Oliver; Grace, Anthony A.; Voit, Eberhard O.
Biochimica et Biophysica Acta - General Subjects, 2016 , vol. 1860, # 11 p. 2696 - 2705 Title/Abstract Full Text Show Details
151 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Grasso; Li Volsi; Cataldo; Manzoni; Barresi
Neuroscience, 2016 , vol. 335, p. 122 - 133 Title/Abstract Full Text Show Details
Romei, Cristina; Bonifacino, Tiziana; Milanese, Marco; Usai, Cesare; Raiteri, Luca
Brain Research Bulletin, 2016 , vol. 127, p. 100 - 110 Title/Abstract Full Text Show Details
Hussner, Andreas; Mettler-Altmann, Tabea; Weber, Andreas P. M.; Sand-Jensen, Kaj
Freshwater Biology, 2016 , vol. 61, # 10 p. 1720 - 1732 Title/Abstract Full Text Show Details
Gibon, Julien; Kang, Min Su; Aliaga, Arturo; Sharif, Behrang; Rosa-Neto, Pedro; Séguéla, Philippe; Barker, Philip A.; Kostikov, Alexey
Bioorganic and Medicinal Chemistry, 2016 , vol. 24, # 19 p. 4759 - 4765 Title/Abstract Full Text Show Details
Ferri, Sarah L.; Kreibich, Arati S.; Torre, Matthew; Piccoli, Cara T.; Dow, Holly; Pallathra, Ashley A.; Li, Hongzhe; Bilker, Warren B.; Gur, Ruben C.; Abel, Ted; Brodkin, Edward S.
Neuroscience, 2016 , vol. 335, p. 184 - 194 Title/Abstract Full Text Show Details
Wearne, Travis A.; Parker, Lindsay M.; Franklin, Jane L.; Goodchild, Ann K.; Cornish, Jennifer L.
Neuropharmacology, 2016 , vol. 111, p. 107 - 118 Title/Abstract Full Text Show Details
Lee, Kyung-Min; Oh, Taek-Joo; Kim, So-Hyun; Kim, Hye-Youn; Chung, Hyunmi; Min, Daniel Seungwook; Auh, Joong-Hyuck; Lee, Hong Jin; Lee, Jaehwi; Choi, Hyung-Kyoon
Food Science and Biotechnology, 2016 , vol. 25, # 4 p. 1035 - 1041 Title/Abstract Full Text Show Details
Killiny, Nabil
Plant Physiology and Biochemistry, 2016 , vol. 109, p. 28 - 35 Title/Abstract Full Text Show Details
Haerian, Batoul Sadat; Baum, Larry; Kwan, Patrick; Cherny, Stacey S.; Shin, Jae-Gook; Kim, Sung Eun; Han, Bok-Ghee; Tan, Hui Jan; Raymond, Azman Ali; Tan, Chong Tin; Mohamed, Zahurin
Molecular Neurobiology, 2016 , vol. 53, # 8 p. 5457 - 5467 Title/Abstract Full Text Show Details
Schipper; Aalbers; Rijkers; Swijsen; Rigo; Hoogland; Vles
Molecular Neurobiology, 2016 , vol. 53, # 8 p. 5252 - 5265 Title/Abstract Full Text Show Details
Hiran, Pasjanant; Kerdchoechuen, Orapin; Laohakunjit, Natta
Journal of Cereal Science, 2016 , vol. 71, p. 207 - 216 Title/Abstract Full Text Show Details
Iyer, Anand; Appleton, Richard
Pediatric Drugs, 2016 , vol. 18, # 5 p. 357 - 366 Title/Abstract Full Text Show Details
Convertino, Irma; Sansone, Alice Capogrosso; Marino, Alessandra; Galiulo, Maria T.; Mantarro, Stefania; Antonioli, Luca; Fornai, Matteo; Blandizzi, Corrado; Tuccori, Marco
Drug Safety, 2016 , vol. 39, # 10 p. 903 - 924 Title/Abstract Full Text Show Details
Ncube, Somandla; Poliwoda, Anna; Tutu, Hlanganani; Wieczorek, Piotr; Chimuka, Luke
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2016 , vol. 1033-1034, p. 372 - 381 Title/Abstract Full Text Show Details
Safavi, Maliheh; Sabourian, Reyhaneh; Abdollahi, Mohammad
Expert Opinion on Drug Discovery, 2016 , vol. 11, # 10 p. 939 - 956
Title/Abstract Full Text Show Details
Reyes-Parada, Miguel; Iturriaga-Vasquez, Patricio
Expert Opinion on Drug Discovery, 2016 , vol. 11, # 10 p. 969 - 981 Title/Abstract Full Text Show Details
Dai, Wen; Pi, Yan-Ling; Ni, Zhen; Tan, Xiao-Ying; Zhang, Jian; Wu, Yin
Neuroscience, 2016 , vol. 336, p. 114 - 122 Title/Abstract Full Text Show Details
Kantachote, Duangporn; Nunkaew, Tomorn; Ratanaburee, Anussara; Klongdee, Nikkajit
Journal of Food Processing and Preservation, 2016 , vol. 40, # 4 p. 733 - 742 Title/Abstract Full Text Show Details
Ab Kadir, Safuan; Wan-Mohtar, Wan Abd Al Qadr Imad; Mohammad, Rosfarizan; Abdul Halim Lim, Sarina; Sabo Mohammed, Abdulkarim; Saari, Nazamid
Journal of Industrial Microbiology and Biotechnology, 2016 , vol. 43, # 10 p. 1387 - 1395 Title/Abstract Full Text Show Details
He, Xuanzi; Koo, Bang-Bon; Killiany, Ronald J.
BioMed Research International, 2016 , vol. 2016, art. no. 6523909 Title/Abstract Full Text Show Details
152 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Lagard, Camille; Chevillard, Lucie; Malissin, Isabelle; Risède, Patricia; Callebert, Jacques; Labat, Laurence; Launay, Jean-Marie; Laplanche, Jean-Louis; Mégarbane, Bruno
Toxicology and Applied Pharmacology, 2016 , vol. 310, p. 108 - 119 Title/Abstract Full Text Show Details
Picone, Gianfranco; Savorani, Francesco; Trimigno, Alessia; Mezzetti, Bruno; Capozzi, Francesco; Engelsen, Søren Balling
Metabolomics, 2016 , vol. 12, # 10 art. no. 150 Title/Abstract Full Text Show Details
Chen, Ting; Liu, Yan; Li, Ming-Hui; Xu, Hua-Dong; Sheng, Ji-Yang; Zhang, Li; Wang, Jun-Song
Environmental Chemistry, 2016 , vol. 13, # 5 p. 792 - 803 Title/Abstract Full Text Show Details
Huang, Yung-Jen; Lee, Kuan H.; Murphy, Lauren; Garraway, Sandra M.; Grau, James W.
Experimental Neurology, 2016 , vol. 285, p. 82 - 95 Title/Abstract Full Text Show Details
Carmona-Aparicio, Liliana; Zavala-Tecuapetla, Cecilia; González-Trujano, María Eva; Sampieri, Aristides; Montesinos-Correa, Hortencia; Granados-Rojas, Leticia; Floriano-Sánchez, Esaú; Coballase-Urrutía, Elvia; Cárdenas-Rodríguez, Noemí
Experimental and Therapeutic Medicine, 2016 , vol. 12, # 4 p. 1957 - 1962 Title/Abstract Full Text Show Details
Giachino, Claudio
Neurogenesis, 2014 , vol. 1, # 1 art. no. E29354, p. e29354-4 Title/Abstract Full Text Show Details
Sandberg, Kristian; Blicher, Jakob Udby; Del Pin, Simon Hviid; Andersen, Lau Møller; Rees, Geraint; Kanai, Ryota
Cortex, 2016 , vol. 83, p. 292 - 305 Title/Abstract Full Text Show Details
Zhang, Yan; Pi, Zifeng; Song, Fengrui; Liu, Zhiqiang
Journal of Ethnopharmacology, 2016 , vol. 194, p. 188 - 195 Title/Abstract Full Text Show Details
Bradl, Monika; Kanamori, Yoko; Nakashima, Ichiro; Misu, Tatsuro; Fujihara, Kazuo; Lassmann, Hans; Sandkühler, Jürgen
Nature Reviews Neurology, 2014 , vol. 10, # 9 p. 529 - 536 Title/Abstract Full Text Show Details
Puralewski, Rachel; Vasilakis, Georgia; Seney, Marianne L.
Biology of Sex Differences, 2016 , vol. 7, # 1 art. no. 50 Title/Abstract Full Text Show Details
Zhang, Zhongyi; Tian, Jing; Xiao, Hongwei; Zheng, Nengjian; Gao, Xiaofei; Zhu, Renguo; Xiao, Huayun
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2016 , vol. 1033-1034, p. 382 - 389 Title/Abstract Full Text Show Details
Akamatsu, Fumikazu; Hashiguchi, Tomokazu; Hisatsune, Yuri; Oe, Takaaki; Kawao, Takafumi; Fujii, Tsutomu
Food Chemistry, 2017 , vol. 217, p. 112 - 116 Title/Abstract Full Text Show Details
Naim-Feil, Jodie; Bradshaw, John L.; Rogasch, Nigel C.; Daskalakis, Zafiris J.; Sheppard, Dianne M.; Lubman, Dan I.; Fitzgerald, Paul B.
World Journal of Biological Psychiatry, 2016 , vol. 17, # 7 p. 547 - 556 Title/Abstract Full Text Show Details
Liu, Guanghai; Zhu, Tiangui; Zhang, Aihua; Li, Feng; Qian, Weidong; Qian, Bin
Journal of Anesthesia, 2016 , vol. 30, # 5 p. 834 - 841 Title/Abstract Full Text Show Details
Drexler, Berthold; Balk, Monika; Antkowiak, Bernd
Anesthesia and Analgesia, 2016 , vol. 123, # 4 p. 877 - 883 Title/Abstract Full Text Show Details
Nashawi, Houda; Masocha, Willias; Edafiogho, Ivan O.; Kombian, Samuel B.
Medical Principles and Practice, 2016 , vol. 25, # 5 p. 423 - 428 Title/Abstract Full Text Show Details
Menezes, Charlene; Leitemperger, Jossiele; Murussi, Camila; de Souza Viera, Mariela; Adaime, Martha B.; Zanella, Renato; Loro, Vania Lucia
Fish Physiology and Biochemistry, 2016 , vol. 42, # 5 p. 1357 - 1368 Title/Abstract Full Text Show Details
Chai, Tingting; Cui, Feng; Yin, Zhiqiang; Yang, Yang; Qiu, Jing; Wang, Chengju
Scientific Reports, 2016 , vol. 6, art. no. 33481 Title/Abstract Full Text Show Details
Roshan, Mohsin H. K.; Tambo, Amos; Pace, Nikolai P.
Open Neurology Journal, 2016 , vol. 10, p. 42 - 58 Title/Abstract Full Text Show Details
Ku, Seockmo; Park, Myeong Soo; Ji, Geun Eog; You, Hyun Ju
International Journal of Molecular Sciences, 2016 , vol. 17, # 9 art. no. 1544 Title/Abstract Full Text Show Details
153 of 992
154 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Taiwe, Germain Sotoing; Dabole, Bernard; Tchoya, Thierry Bang; Menanga, Joseph Renaud; Dzeufiet, Paul Désiré Djomeni; De Waard, Michel
BMC Complementary and Alternative Medicine, 2016 , vol. 16, # 1 art. no. 285 Title/Abstract Full Text Show Details
de Freitas, Renato Leonardo; Medeiros, Priscila; da Silva, Juliana Almeida; de Oliveira, Rithiele Cristina; de Oliveira, Ricardo; Ullah, Farhad; Khan, Asmat Ullah; Coimbra, Norberto Cysne
Neuroscience, 2016 , vol. 336, p. 133 - 145 Title/Abstract Full Text Show Details
Nazari, Seyedeh Khadijeh; Nikoui, Vahid; Ostadhadi, Sattar; Chegini, Zahra Hadi; Oryan, Shahrbanoo; Bakhtiarian, Azam
Pharmacological Reports, 2016 , vol. 68, # 6 p. 1214 - 1220 Title/Abstract Full Text Show Details
Cervenka, Mackenzie C.; Kaplan, Peter W.
Seminars in Neurology, 2016 , vol. 36, # 4 p. 342 - 349 Title/Abstract Full Text Show Details
Davis, Daniel J.; Doerr, Holly M.; Grzelak, Agata K.; Busi, Susheel B.; Jasarevic, Eldin; Ericsson, Aaron C.; Bryda, Elizabeth C.
Scientific Reports, 2016 , vol. 6, art. no. 33726 Title/Abstract Full Text Show Details
Lai, Bi-Qin; Che, Ming-Tian; Du, Bao-Ling; Zeng, Xiang; Ma, Yuan-Huan; Feng, Bo; Qiu, Xue-Chen; Zhang, Ke; Liu, Shu; Shen, Hui-Yong; Wu, Jin-Lang; Ling, Eng-Ang; Zeng, Yuan-Shan
Biomaterials, 2016 , vol. 109, p. 40 - 54 Title/Abstract Full Text Show Details
Xu, Ming; Huo, Fangjun; Yin, Caixia
Sensors and Actuators, B: Chemical, 2017 , vol. 240, p. 1245 - 1250 Title/Abstract Full Text Show Details
Stamenić, Tamara Timić; Poe, Michael M.; Rehman, Sabah; Santrač, Anja; Divović, Branka; Scholze, Petra; Ernst, Margot; Cook, James M.; Savić, Miroslav M.
European Journal of Pharmacology, 2016 , vol. 791, p. 433 - 443 Title/Abstract Full Text Show Details
Xu, Ming; Huo, Fangjun; Yin, Caixia
Sensors and Actuators, B: Chemical, 2017 , vol. 240, p. 1245 - 1250 Title/Abstract Full Text Show Details
Van Bussel, Frank C.G.; Backes, Walter H.; Hofman, Paul A.M.; Puts, Nicolaas A.J.; Edden, Richard A.E.; Van Boxtel, Martin P.J.; Schram, Miranda T.; Stehouwer, Coen D.A.; Wildberger, Joachim E.; Jansen, Jacobus F.A.
Medicine (United States), 2016 , vol. 95, # 36 art. no. E4803 Title/Abstract Full Text Show Details
Benarroch, Eduardo E.
Neurology, 2016 , vol. 87, # 12 p. 1281 - 1288 Title/Abstract Full Text Show Details
Ryu, Yun Kyoung; Mathena, Reilley P.; Lim, Sanghee; Kwak, Minhye; Xu, Michael; Mintz, Cyrus D.
Journal of Neurosurgical Anesthesiology, 2016 , vol. 28, # 4 p. 405 - 412 Title/Abstract Full Text Show Details
Kirkpatrick, Daniel R.; McEntire, Dan M.; Smith, Tyler A.; Dueck, Nicholas P.; Kerfeld, Mitchell J.; Hambsch, Zakary J.; Nelson, Taylor J.; Reisbig, Mark D.; Agrawal, Devendra K.
Expert Review of Clinical Pharmacology, 2016 , vol. 9, # 10 p. 1363 - 1387 Title/Abstract Full Text Show Details
Wojnicz, Aneta; Avendaño-Ortiz, José; de Pascual, Ricardo; Ruiz-Pascual, Lucía; García, Antonio G.; Ruiz-Nuño, Ana
Journal of Mass Spectrometry, 2016 , vol. 51, # 8 p. 651 - 664 Title/Abstract Full Text Show Details
Patil, Vaishali M.; Gupta, Satya P.
Current Topics in Medicinal Chemistry, 2016 , vol. 16, # 16 p. 1862 - 1876 Title/Abstract Full Text Show Details
Camargo, José Augusto; Bertolucci, Paulo Henrique Ferreira
Open Neurology Journal, 2015 , vol. 9, # 1 p. 15 - 20 Title/Abstract Full Text Show Details
Wu, Lin-Huan; Lu, Zhen-Ming; Zhang, Xiao-Juan; Wang, Zong-Min; Yu, Yong-Jian; Shi, Jin-Song; Xu, Zheng-Hong
Food Microbiology, 2017 , vol. 62, p. 23 - 31 Title/Abstract Full Text Show Details
Rodrigo; Esteso; Barros; Verissimo; Romero; Suarez; Ramos; Valente; Burrows; Ribeiro
Journal of Chemical Thermodynamics, 2017 , vol. 104, p. 110 - 117 Title/Abstract Full Text Show Details
El-Ansary, Afaf; Al-Ayadhi, Laila
Journal of Neuroinflammation, 2014 , vol. 11, # 1 art. no. 189 Title/Abstract Full Text Show Details
Giroud, Fabien; Sawada, Koichi; Taya, Masahito; Cosnier, Serge
Biosensors and Bioelectronics, 2017 , vol. 87, p. 957 - 963 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Yamaura, Kei; Kiyonaka, Shigeki; Numata, Tomohiro; Inoue, Ryuji; Hamachi, Itaru
Nature Chemical Biology, 2016 , vol. 12, # 10 p. 822 - 830 Title/Abstract Full Text Show Details
Cheng, Ling; Li, Peng; Tjen-A-Looi, Stephanie Cheeyee; Longhurst, John Charles
Chinese Medicine (United Kingdom), 2015 , vol. 10, # 1 art. no. 36 Title/Abstract Full Text Show Details
Beard, Emma; Shahab, Lion; Cummings, Damian M.; Michie, Susan; West, Robert
CNS Drugs, 2016 , vol. 30, # 10 p. 951 - 983 Title/Abstract Full Text Show Details
Malhi, Gin S.; Outhred, Tim
CNS Drugs, 2016 , vol. 30, # 10 p. 931 - 949 Title/Abstract Full Text Show Details
Rodrigo; Esteso; Barros; Verissimo; Romero; Suarez; Ramos; Valente; Burrows; Ribeiro
Journal of Chemical Thermodynamics, 2017 , vol. 104, p. 110 - 117 Title/Abstract Full Text Show Details
Li, Yuwen; Wu, Yin; Li, Ruili; Wang, Chao; Jia, Na; Zhao, Chao; Wen, Aidong; Xiong, Lize
Anesthesia and Analgesia, 2015 , vol. 121, # 5 p. 1176 - 1183 Title/Abstract Full Text Show Details
Concu, Riccardo; Ornelas, Mariana; Azenha, Manuel
Current Topics in Medicinal Chemistry, 2015 , vol. 15, # 3 p. 199 - 222 Title/Abstract Full Text Show Details
Bustamante, Marta F.; Morcillo-Suárez, Carlos; Malhotra, Sunny; Rio, Jordi; Leyva, Laura; Fernández, Oscar; Zettl, Uwe K.; Killestein, Joep; Brassat, David; García-Merino, Juan Antonio; Sánchez, Antonio J.; Urcelay, Elena; Alvarez-Lafuente, Roberto; Villar, Lusia M.; AlvarezCermeño, Jose Carlos; Farré, Xavier; Lechner-Scott, Jeannette; Vandenbroeck, Koen; Rodríguez-Antigüedad, Alfredo; Drulovic, Jelena S.; Boneschi, Filippo Martinelli; Chan, Andrew; Oksenberg, Jorge; Navarro, Arcadi; Montalban, Xavier; Comabella, Manuel
Neurology: Neuroimmunology and NeuroInflammation, 2015 , vol. 2, # 5 p. e154 - e154 Title/Abstract Full Text Show Details
Ramos, Raddy L.; Toia, Alyssa R.; Pasternack, Daniel M.; Dotzler, Timothy P.; Cuoco, Joshua A.; Esposito, Anthony W.; Le, Megan M.; Parker, Alexander K.; Goodman, Jeffrey H.; Sarkisian, Matthew R.
Neuroscience, 2016 , vol. 337, p. 48 - 65 Title/Abstract Full Text Show Details
Liu, Xuejiao; Wu, Dousheng; Zhang, Yongqiang; Zhou, Hong; Lai, Ting; Ding, Wei
BioMed Research International, 2016 , vol. 2016, art. no. 2796260 Title/Abstract Full Text Show Details
Drenthen, Gerhard S.; Barendse, Evelien M.; Aldenkamp, Albert P.; van Veenendaal, Tamar M.; Puts, Nicolaas A.J.; Edden, Richard A.E.; Zinger, Svitlana; Thoonen, Geert; Hendriks, Marc P.H.; Kessels, Roy P.C.; Jansen, Jacobus F.A.
Psychiatry Research - Neuroimaging, 2016 , vol. 256, p. 44 - 49 Title/Abstract Full Text Show Details
Grant, Ryan; Gruenbaum, Shaun E.; Gerrard, Jason
Current Opinion in Anaesthesiology, 2015 , vol. 28, # 5 p. 505 - 510 Title/Abstract Full Text Show Details
Im, Seon-Yeong; Jang, Ka-Hee; Farooq, Muhammad; Lee, Dong-Jin
Journal of Herbs, Spices and Medicinal Plants, 2016 , vol. 22, # 4 p. 327 - 336 Title/Abstract Full Text Show Details
Joshi, Krutika; Shen, Lily; Michaeli, Avner; Salter, Michael; Thibault-Messier, Gabrielle; Hashmi, Sumaiya; Eubanks, James H.; Cortez, Miguel A.; Snead, O. Carter
Annals of Neurology, 2016 , vol. 80, # 4 p. 511 - 521 Title/Abstract Full Text Show Details
Brosnan, Robert J.; Pham, Trung L.
BMC Pharmacology and Toxicology, 2014 , vol. 15, # 1 art. no. 62 Title/Abstract Full Text Show Details
Salazar-González, Claudia; Díaz-Moreno, Consuelo
Journal of Apicultural Research, 2016 , vol. 55, # 2 p. 161 - 175 Title/Abstract Full Text Show Details
Beleggia, Romina; Rau, Domenico; Laido, Giovanni; Platani, Cristiano; Nigro, Franca; Fragasso, Mariagiovanna; De Vita, Pasquale; Scossa, Federico; Fernie, Alisdair R.; Nikoloski, Zoran; Papa, Roberto
Molecular Biology and Evolution, 2016 , vol. 33, # 7 p. 1740 - 1753 Title/Abstract Full Text Show Details
Li, Shao-Jun; Luo, Yi-Ni; Li, Yong; Chen, Jing-Wen; Mo, Yu-Huan; Yuan, Zong-Xiang; Ou, Shi-Yan; Ou, Chao-Yan; Jiang, Yue-Ming; Deng, Xiang-Fa
Journal of Toxicological Sciences, 2016 , vol. 41, # 5 p. 573 - 581 Title/Abstract Full Text Show Details
Contreras-Rosales; Schefuß; Meyer; Palamenghi; Lückge; Jennerjahn
Global and Planetary Change, 2016 , vol. 146, p. 53 - 66 Title/Abstract Full Text Show Details
Russo, Emilio; Citraro, Rita; Constanti, Andrew; Leo, Antonio; Lüttjohann, Annika; van Luijtelaar, Gilles; De Sarro, Giovambattista
Neuroscience and Biobehavioral Reviews, 2016 , vol. 71, p. 388 - 408 Title/Abstract Full Text Show Details
155 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Buck, Leslie T.; Bond, Hilary C.; Malik, Aqsa
Comparative Biochemistry and Physiology -Part A : Molecular and Integrative Physiology, 2017 , vol. 203, p. 193 - 200 Title/Abstract Full Text Show Details
Biedermann, Sarah V.; Auer, Matthias K.; Bindila, Laura; Ende, Gabriele; Lutz, Beat; Weber-Fahr, Wolfgang; Gass, Peter; Fuss, Johannes
Hormones and Behavior, 2016 , vol. 86, p. 45 - 54 Title/Abstract Full Text Show Details
Kitagishi, Yasuko; Nakanishi, Atsuko; Minami, Akari; Asai, Yurina; Yasui, Mai; Iwaizako, Akiko; Suzuki, Miho; Ono, Yuna; Ogura, Yasunori; Matsuda, Satoru
Open Biochemistry Journal, 2014 , vol. 8, # 1 p. 74 - 82 Title/Abstract Full Text Show Details
Shiraki, Ayako; Tanaka, Takeshi; Watanabe, Yousuke; Saito, Fumiyo; Akahori, Yumi; Imatanaka, Nobuya; Yoshida, Toshinori; Shibutani, Makoto
Toxicology Letters, 2016 , vol. 261, p. 59 - 71 Title/Abstract Full Text Show Details
Pavela, Roman; Stepanycheva, Elena; Shchenikova, Anna; Chermenskaya, Taisiya; Petrova, Mariya
Industrial Crops and Products, 2016 , vol. 94, p. 755 - 761 Title/Abstract Full Text Show Details
Randox Laboratories Limited; Benchikh, Elouard; McConnell, Ivan; Fitzgerald, Peter; Lowry, Philip
Patent: US2016/266153 A1, 2016 ; Title/Abstract Full Text Show Details
Jaworska, Edyta; Kozlowska, Emilia; Switonski, Pawel M.; Krzyzosiak, Wlodzimierz J.
Cellular and Molecular Life Sciences, 2016 , vol. 73, # 21 p. 4085 - 4100
Title/Abstract Full Text Show Details
Zunhammer, Matthias; Schweizer, Lauren M.; Witte, Vanessa; Harris, Richard E.; Bingel, Ulrike; Schmidt-Wilcke, Tobias
Pain, 2016 , vol. 157, # 10 p. 2248 - 2256 Title/Abstract Full Text Show Details
Płonka-Półtorak, Elżbieta; Zagrodzki, Paweł; Kryczyk-Kozioł, Jadwiga; Westermarck, Tuomas; Kaipainen, Pekka; Kaski, Markus; Atroshi, Faik
Pharmacological Reports, 2016 , vol. 68, # 6 p. 1339 - 1344 Title/Abstract Full Text Show Details
Kaufmann, Walter E.; Stallworth, Jennifer L.; Everman, David B.; Skinner, Steven A.
Expert Opinion on Orphan Drugs, 2016 , vol. 4, # 10 p. 1043 - 1055 Title/Abstract Full Text Show Details
Villumsen, Inge S.; Wellendorph, Petrine; Smart, Trevor G.
BMC Neuroscience, 2015 , vol. 16, # 1 art. no. 8 Title/Abstract Full Text Show Details
Johannesen, Katrine; Marini, Carla; Pfeffer, Siona; Møller, Rikke S.; Dorn, Thomas; Niturad, Christina; Gardella, Elena; Weber, Yvonne; Søndergård, Marianne; Hjalgrim, Helle; Nikanorova, Mariana; Becker, Felicitas; Larsen, Line H.G.; Dahl, Hans A.; Maier, Oliver; Mei, Davide; Biskup, Saskia; Klein, Karl M.; Reif, Philipp S.; Rosenow, Felix; Elias, Abdallah F.; Hudson, Cindy; Helbig, Katherine L.; SchubertBast, Susanne; Scordo, Maria R.; Craiu, Dana; Djémié, Tania; Hoffman-Zacharska, Dorota; Caglayan, Hande; Helbig, Ingo; Serratosa, Jose; Striano, Pasquale; De Jonghe, Peter; Weckhuysen, Sarah; Suls, Arvid; Muru, Kai; Talvik, Inga; Talvik, Tiina; Muhle, Hiltrud; Borggraefe, Ingo; Rost, Imma; Guerrini, Renzo; Lerche, Holger; Lemke, Johannes R.; Rubboli, Guido; Maljevic, Snezana
Neurology, 2016 , vol. 87, # 11 p. 1140 - 1151 Title/Abstract Full Text Show Details
Charpentier, Corie L.; Cohen, Jonathan H.
Royal Society Open Science, 2016 , vol. 3, # 9 art. no. 160311 Title/Abstract Full Text Show Details
Botzolakis, Emmanuel J.; Gurba, Katharine N.; Lagrange, Andre H.; Feng, Hua-Jun; Stanic, Aleksandar K.; Hu, Ningning; Macdonald, Robert L.
Journal of Biological Chemistry, 2016 , vol. 291, # 39 p. 20440 - 20461 Title/Abstract Full Text Show Details
Rufino, Marcos Natal; Cereda, Marney Pascoli; Barreto, Wanessa Teixeira Gomes; da Silva, Alanderson Rodrigues; de Andrade, Gisele Braziliano; Herrera, Heitor Miraglia
Ciencia e Agrotecnologia, 2016 , vol. 40, # 5 p. 577 - 584 Title/Abstract Full Text Show Details
Hao, Ren; Ting, Zhang; Yuping, Qi; Donghua, Jiang
Research Journal of Biotechnology, 2016 , vol. 11, # 10 p. 1 - 8 Title/Abstract Full Text Show Details
Pickrell, William Owen; Smith, Phil E.M.
Clinical Medicine, Journal of the Royal College of Physicians of London, 2014 , vol. 14, p. S1 - S6 Title/Abstract Full Text Show Details
Sharma, Ashish; Soe, Myat Han; Singh, Jagdeep; Newsome, Scott D.
Journal of the National Medical Association, 2016 , vol. 108, # 3 p. 169 - 172 Title/Abstract Full Text Show Details
Tcheremissine, Oleg V.; Bestha, Durga Prasad
Innovations in Clinical Neuroscience, 2016 , vol. 13, # 7-8 p. 13 - 14 Title/Abstract Full Text Show Details
Chien, Rao-Chi; Ulziijargal, Enkhjargal; Mau, Jeng-Leun
Food Technology and Biotechnology, 2016 , vol. 54, # 2 p. 180 - 188 Title/Abstract Full Text Show Details
156 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Huang, Guocheng; Cai, Weixi; Xu, Baojun
LWT - Food Science and Technology, 2017 , vol. 75, p. 488 - 496 Title/Abstract Full Text Show Details
Saito, Ryota; Suzuki, Saori; Sasaki, Kaname
Bioorganic and Medicinal Chemistry Letters, 2016 , vol. 26, # 20 p. 4870 - 4874 Title/Abstract Full Text Show Details
Müller, Thomas
Neurodegenerative Disease Management, 2016 , vol. 6, # 5 p. 385 - 398 Title/Abstract Full Text Show Details
Kirschner, Gyöngyi; Balla, Bernadett; Horváth, Péter; Kövesdi, Andrea; Lakatos, Gergely; Takács, István; Nagy, Zsolt; Tóbiás, Bálint; Árvai, Kristóf; Pál Kósa, János; Lakatos, Péter
Molecular Medicine Reports, 2016 , vol. 14, # 3 p. 2025 - 2037 Title/Abstract Full Text Show Details
Zhang, Guoping; Quan, Xiaoyan; Qian, Qiufeng; Ye, Zhilan; Zeng, Jianbin; Han, Zhigang
Journal of Plant Physiology, 2016 , vol. 206, p. 59 - 67 Title/Abstract Full Text Show Details
Yang, Liuqing; Ge, Yali; Lin, Shunyan; Fang, Xiangzhi; Zhou, Loujing; Gao, Ju
Molecular Medicine Reports, 2016 , vol. 14, # 3 p. 2119 - 2126 Title/Abstract Full Text Show Details
Pandhare, Akash; Pappu, Aneesh Satya; Wilms, Henrik; Blanton, Michael Paul; Jansen, Michaela
Neuropharmacology, 2017 , vol. 113, p. 89 - 99 Title/Abstract Full Text Show Details
Auger, Meagan L; Floresco, Stan B
Neuropharmacology, 2017 , vol. 113, p. 10 - 20 Title/Abstract Full Text Show Details
Liu, Yu; Lin, Deyong; Wu, Boliang; Zhou, Wenhua
Brain Research Bulletin, 2016 , vol. 126, p. 68 - 73 Title/Abstract Full Text Show Details
Philippu, Athineos
Current Medicinal Chemistry, 2016 , vol. 23, # 24 p. 2643 - 2652 Title/Abstract Full Text Show Details
Pitsikas, Nikolaos
Current Medicinal Chemistry, 2016 , vol. 23, # 24 p. 2692 - 2705
Title/Abstract Full Text Show Details
Aissa, Manel Ben; Lee, Sue H.; Bennett, Brian M.; Thatcher, Gregory R.J.
Current Medicinal Chemistry, 2016 , vol. 23, # 24 p. 2770 - 2783 Title/Abstract Full Text Show Details
Guerra, Gustavo Petri; Rubin, Maribel Antonello; Mello, Carlos Fernando
Pharmacological Research, 2016 , vol. 112, p. 99 - 118 Title/Abstract Full Text Show Details
Nelp, Taylor B.; McGovern, Robert A.; McKhann, Guy M.
Neurosurgery, 2014 , vol. 75, # 6 p. N10 - N11 Title/Abstract Full Text Show Details
Root, David H.; Mejias-Aponte, Carlos A.; Zhang, Shiliang; Wang, Hui-Ling; Hoffman, Alexander F.; Lupica, Carl R.; Morales, Marisela
Nature neuroscience, 2014 , vol. 17, # 11 p. 1543 - 1551 Title/Abstract Full Text Show Details
Jiang, Yuqi; Li, Xiaoyang; Wang, Xue; Wang, Zhonglan; Wu, Jingde; Xu, Wenfang; Zhang, Jian
Chemical Biology and Drug Design, 2016 , p. 542 - 555 Title/Abstract Full Text Show Details
Gano, Lindsey B.; Patel, Manisha; Rho, Jong M.
Journal of Lipid Research, 2014 , vol. 55, # 11 p. 2211 - 2228 Title/Abstract Full Text Show Details
Masters, Philip A.; Cotton, Deborah; Rao, Jaya K.; Taichman, Darren; Williams, Sankey
Annals of Internal Medicine, 2014 , vol. 161, # 7 p. ITC16 Title/Abstract Full Text Show Details
Peterlik, Daniel; Flor, Peter J.; Uschold-Schmidt, Nicole
Current Neuropharmacology, 2016 , vol. 14, # 5 p. 514 - 539 Title/Abstract Full Text Show Details
Schneider, Bradley B.; Nazarov, Erkinjon G.; Londry, Frank; Vouros, Paul; Covey, Thomas R.
Mass Spectrometry Reviews, 2016 , vol. 35, # 6 p. 687 - 737 Title/Abstract Full Text Show Details
157 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Oh, Tae Seok; Jeon, Yoonjeong; Kim, Seolsong; Kim, Eun-Kyoung
CNS and Neurological Disorders - Drug Targets, 2016 , vol. 15, # 8 p. 896 - 909 Title/Abstract Full Text Show Details
Liew, Hyunjeong; Kim, Yun-Mi; Choi, Hee Soon; Jang, Ah Ram; Churchill, David; Lee, Sang Hyung; Suh, Yoo-Hun
CNS and Neurological Disorders - Drug Targets, 2016 , vol. 15, # 8 p. 918 - 926 Title/Abstract Full Text Show Details
Mehrzadi, Saeed; Shojaii, Asie; Pur, Sogol Attari; Motevalian, Manijeh
Journal of Evidence-Based Complementary and Alternative Medicine, 2015 , vol. 21, # 4 p. NP35 Title/Abstract Full Text Show Details
Chen, Ken
Patent: CN105367433 A, 2016 ; Title/Abstract Full Text Show Details
Wuhan University; Wang, Wei; Lu, Yuzhi; Zhou, Haibing; Huang, Jian
Patent: CN105503627 A, 2016 ; Title/Abstract Full Text Show Details
Pulike Biological Engineering, Inc.; Liu, Xingjin; Zhang, Xuke
Patent: CN105669798 A, 2016 ; Title/Abstract Full Text Show Details
Kosonsiriluk, Sunantha; Chaiworakul, Voravasa; Thayananuphat, Aree; Mauro, Laura J.; El Halawani, Mohamed E.
Neuroendocrinology, 2016 , vol. 103, # 6 p. 678 - 692 Title/Abstract Full Text Show Details
Konermann, Anna; Kantarci, Alpdogan; Wilbert, Steven; Van Dyke, Thomas; Jäger, Andreas
Cellular and Molecular Neurobiology, 2016 , vol. 36, # 8 p. 1353 - 1363 Title/Abstract Full Text Show Details
Wingo, Taylor; Nesil, Tanseli; Chang, Sulie L.; Li, Ming D.
Alcoholism: Clinical and Experimental Research, 2016 , vol. 40, # 10 p. 2102 - 2113 Title/Abstract Full Text Show Details
Aird, Steven D.; Briones, Alejandro Villar; Roy, Michael C.; Mikheyev, Alexander S.
Toxins, 2016 , vol. 8, # 10 art. no. 279 Title/Abstract Full Text Show Details
Hu, Wenyi; Cheng, Xiaojie; Ye, Xinjian; Zhao, Liangcai; Huang, Yanan; Zhu, Huanle; Yan, Zhihan; Wang, Xuebao; Wang, Xiaojie; Bai, Guanghui; Gao, Hongchang
Molecular Brain, 2014 , vol. 7, # 1 art. no. 87 Title/Abstract Full Text Show Details
Trifonov, Stefan; Yamashita, Yuji; Kase, Masahiko; Maruyama, Masato; Sugimoto, Tetsuo
BMC Neuroscience, 2014 , vol. 15, # 1 art. no. 114 Title/Abstract Full Text Show Details
Pfeiffer, Rebecca L.; Marc, Robert E.; Kondo, Mineo; Terasaki, Hiroko; Jones, Bryan W.
Experimental Eye Research, 2016 , vol. 150, p. 62 - 70 Title/Abstract Full Text Show Details
Kaur, Jaspreet; Flores Gutiérrez, Javier; Nistri, Andrea
European Journal of Neuroscience, 2016 , vol. 44, # 7 p. 2418 - 2430 Title/Abstract Full Text Show Details
Chowen, Julie A.; Argente-Arizón, Pilar; Freire-Regatillo, Alejandra; Frago, Laura M.; Horvath, Tamas L.; Argente, Jesús
Progress in Neurobiology, 2016 , vol. 144, p. 68 - 87 Title/Abstract Full Text Show Details
Michalke, Bernhard
Journal of Trace Elements in Medicine and Biology, 2016 , vol. 37, p. 50 - 61 Title/Abstract Full Text Show Details
Osborn, Lana M.; Kamphuis, Willem; Wadman, Wytse J.; Hol, Elly M.
Progress in Neurobiology, 2016 , vol. 144, p. 121 - 141 Title/Abstract Full Text Show Details
Van Schoors, Jolien; Viaene, Johan; Van Wanseele, Yannick; Smolders, Ilse; Dejaegher, Bieke; Vander Heyden, Yvan; Van Eeckhaut, Ann
Journal of Pharmaceutical and Biomedical Analysis, 2016 , vol. 127, p. 136 - 146 Title/Abstract Full Text Show Details
Jones; Pfeiffer; Ferrell; Watt; Marmor; Marc
Experimental Eye Research, 2016 , vol. 150, p. 149 - 165 Title/Abstract Full Text Show Details
Selten, Martijn M.; Meyer, Francisca; Ba, Wei; Vallès, Astrid; Maas, Dorien A.; Negwer, Moritz; Eijsink, Vivian D.; Van Vugt, Ruben W.M.; Van Hulten, Josephus A.; Van Bakel, Nick H.M.; Roosen, Joey; Van Der Linden, Robert J.; Schubert, Dirk; Verheij, Michel M.M.; Kasri, Nael Nadif; Martens, Gerard J.M.
Scientific Reports, 2016 , vol. 6, art. no. 34240 Title/Abstract Full Text Show Details
158 of 992
159 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Stahl, Stephen M.
Journal of Fluid Mechanics, 2016 , vol. 806, p. 355 - 359 Title/Abstract Full Text Show Details
Groll, Nicola; Petrikat, Tamara; Vetter, Silvia; Wenz, Christine; Dengjel, Joern; Gretzmeier, Christine; Weiss, Frederik; Poetz, Oliver; Joos, Thomas O.; Schwarz, Michael; Braeuning, Albert
Toxicology, 2016 , vol. 370, p. 94 - 105 Title/Abstract Full Text Show Details
Yuan, Nina Y.; Poe, Michael M.; Witzigmann, Christopher; Cook, James M.; Stafford, Douglas; Arnold, Leggy A.
Journal of Pharmacological and Toxicological Methods, 2016 , vol. 82, p. 109 - 114 Title/Abstract Full Text Show Details
Li, Hongde; Tang, Huiru; Wang, Yulan
Current Metabolomics, 2013 , vol. 1, # 4 p. 318 - 334 Title/Abstract Full Text Show Details
Gandhi, Sonia; Khushu, Subash; Tripathi, Rajendra P.
Current Metabolomics, 2013 , vol. 1, # 4 p. 335 - 352 Title/Abstract Full Text Show Details
Chau, Davor Kin-Fan; Choi, Angus Yiu-Ting; Yang, Wen; Leung, Wing Nang; Chan, Chun Wai
Behavioural Brain Research, 2017 , vol. 316, p. 255 - 260 Title/Abstract Full Text Show Details
Azilawati; Dzulkifly; Jamilah; Shuhaimi; Amin
Journal of Pharmaceutical and Biomedical Analysis, 2016 , vol. 129, p. 389 - 397 Title/Abstract Full Text Show Details
McMahen, Rebecca L.; Strynar, Mark J.; McMillan, Larry; DeRose, Eugene; Lindstrom, Andrew B.
Science of the Total Environment, 2016 , vol. 569-570, p. 880 - 887 Title/Abstract Full Text Show Details
Elmaci, Ilhan; Altinoz, Meric A.
Biomedicine and Pharmacotherapy, 2016 , vol. 83, p. 635 - 640 Title/Abstract Full Text Show Details
Stahl, Stephen M.
CNS Spectrums, 2016 , vol. 21, # 5 p. 355 - 359 Title/Abstract Full Text Show Details
Cocco, Mattia; Miglio, Gianluca; Giorgis, Marta; Garella, Davide; Marini, Elisabetta; Costale, Annalisa; Bertinaria, Massimo; Regazzoni, Luca; Vistoli, Giulio; Orioli, Marica; Massulaha-Ahmed, Raïhane; Détraz-Durieux, Isabelle; Groslambert, Marine; Py, Bénédicte F.
ChemMedChem, 2016 , p. 1790 - 1803 Title/Abstract Full Text Show Details
Ishaq, Sidra; Rasheed, Muhammad Adil; Ashraf, Muhammad; Altaf, Imran; Rehmat, Saima; Fatima, Ghulam
Pakistan Journal of Pharmaceutical Sciences, 2016 , vol. 29, # 5 p. 1625 - 1632 Title/Abstract Full Text Show Details
Choi, Kyuhyun; Lee, Youngin; Lee, Changwoo; Hong, Seokheon; Lee, Soonje; Kang, Shin Jung; Shin, Ki Soon
Scientific Reports, 2016 , vol. 6, art. no. 34800 Title/Abstract Full Text Show Details
Sukhbaatar, Unurjargal; Mijiddorj, Tselmeg; Oride, Aki; Kanasaki, Haruhiko
Endocrine, 2015 , vol. 49, # 1 p. 222 - 230 Title/Abstract Full Text Show Details
Wang, Xinkun; Yang, Runqiang; Zhou, Yulin; Gu, Zhenxin
Journal of Proteomics, 2016 , vol. 143, p. 161 - 172 Title/Abstract Full Text Show Details
Schreiner, Simon J.; Kirchner, Thomas; Wyss, Michael; Van Bergen, Jiri M.G.; Quevenco, Frances C.; Steininger, Stefanie C.; Griffith, Erica Y.; Meier, Irene; Michels, Lars; Gietl, Anton F.; Leh, Sandra E.; Brickman, Adam M.; Hock, Christoph; Nitsch, Roger M.; Pruessmann, Klaas P.; Henning, Anke; Unschuld, Paul G.
Neurobiology of Aging, 2016 , vol. 48, p. 195 - 203 Title/Abstract Full Text Show Details
Di Paolo, Matias; Bossi, Mariano L.; Baggio, Ricardo; Suarez, Sebastián A.
Acta Crystallographica Section B: Structural Science, Crystal Engineering and Materials, 2016 , vol. 72, p. 684 - 692 Title/Abstract Full Text Show Details
Bündig, Christin; Jozefowicz, Anna Maria; Mock, Hans-Peter; Winkelmann, Traud
Journal of Proteomics, 2016 , vol. 143, p. 227 - 241 Title/Abstract Full Text Show Details
Paredes, Mercedes F.; James, David; Gil-Perotin, Sara; Kim, Hosung; Cotter, Jennifer A.; Ng, Carissa; Sandoval, Kadellyn; Rowitch, David H.; Xu, Duan; McQuillen, Patrick S.; Garcia-Verdugo, Jose-Manuel; Huang, Eric J.; Alvarez-Buylla, Arturo
Science, 2016 , vol. 354, # 6308 art. no. AAF7073 Title/Abstract Full Text Show Details
Saikusa, Takayo; Cai, Yimin; Higuchi, Kouji; Ishikawa, Tetsuya; Ishida, Motohiko
Nippon Shokuhin Kagaku Kogaku Kaishi, 2016 , vol. 63, # 8 p. 339 - 346 Title/Abstract Full Text Show Details
Comment
Bioactivities present
(Pharmacological Data) Reference
Chaiworakul, Voravasa; Kosonsiriluk, Sunantha; Mauro, Laura J.; El Halawani, Mohamed E.
General and Comparative Endocrinology, 2017 , vol. 240, p. 84 - 90 Title/Abstract Full Text Show Details
Murrough, James W.
Biological Psychiatry, 2016 , vol. 80, # 6 p. 416 - 418 Title/Abstract Full Text Show Details
Shin, Jae Ho; Park, Seok Hyun; Oh, Young Hoon; Choi, Jae Woong; Lee, Moon Hee; Cho, Jae Sung; Jeong, Ki Jun; Joo, Jeong Chan; Yu, James; Park, Si Jae; Lee, Sang Yup
Microbial Cell Factories, 2016 , vol. 15, # 1 art. no. 174 Title/Abstract Full Text Show Details
Alegría, Ángel; González, Pablo; Delgado, Susana; Flórez, Ana Belén; Hernández-Barranco, Ana María; Rodríguez, Ana; Mayo, Baltasar
International Journal of Dairy Technology, 2016 , vol. 69, # 4 p. 507 - 519 Title/Abstract Full Text Show Details
Hone-Blanchet, Antoine; Edden, Richard A.; Fecteau, Shirley
Biological Psychiatry, 2016 , vol. 80, # 6 p. 432 - 438 Title/Abstract Full Text Show Details
Rubio-Aliaga, Isabel; Wagner, Carsten A.
Channels, 2016 , vol. 10, # 6 p. 440 - 452 Title/Abstract Full Text Show Details
Snell, Heather D.; Gonzales, Eric B.
Channels, 2016 , vol. 10, # 6 p. 498 - 506 Title/Abstract Full Text Show Details
Ren, Zhen; Pribiag, Horia; Jefferson, Sarah J.; Shorey, Matthew; Fuchs, Thomas; Stellwagen, David; Luscher, Bernhard
Biological Psychiatry, 2016 , vol. 80, # 6 p. 457 - 468 Title/Abstract Full Text Show Details
Wang, Wei; Guo, Hua; Zhang, Shu-Xiao; Li, Juan; Cheng, Ke; Bai, Shun-Jie; Yang, De-Yu; Wang, Hai-Yang; Liang, Zi-Hong; Liao, Li; Sun, Lin; Xie, Peng
Journal of Proteome Research, 2016 , vol. 15, # 10 p. 3784 - 3792 Title/Abstract Full Text Show Details
Southeast University; Cai, Lin; Chen, Guoqing; Ji, Min; Li, Yong; Guo, Minliang; Xu, Hua; Liu, Wenjing
Patent: , 2016 ; Title/Abstract Full Text Show Details
Boettcher; Muravyea; Kuo; Drexler; Pagel
International Journal of Obstetric Anesthesia, 2016 , vol. 27, p. 85 - 88 Title/Abstract Full Text Show Details
Zemoura, Khaled; Trümpler, Claudia; Benke, Dietmar
Journal of Biological Chemistry, 2016 , vol. 291, # 41 p. 21682 - 21693 Title/Abstract Full Text Show Details
Ando, Akira; Nakamura, Toshihide
Journal of Bioscience and Bioengineering, 2016 , vol. 122, # 4 p. 441 - 445 Title/Abstract Full Text Show Details
Tuite, Paul
Translational Research, 2016 , vol. 175, p. 4 - 16 Title/Abstract Full Text Show Details
Desalegn; Turetschek; Kaul; Wienkoop
Journal of Proteomics, 2016 , vol. 143, p. 173 - 187 Title/Abstract Full Text Show Details
Gao, Yanqiong; Yan, Hua; Jin, Ruirui; Lei, Peng
Pharmaceutical Biology, 2016 , vol. 54, # 11 p. 2528 - 2535 Title/Abstract Full Text Show Details
Petropoulos, Ioannis N.; Javed, Saad; Azmi, Shazli; Khan, Adnan; Ponirakis, Georgios; Malik, Rayaz A.
Journal of Taibah University Medical Sciences, 2016 , vol. 11, # 4 p. 284 - 294 Title/Abstract Full Text Show Details
Shireen, Erum
Journal of Experimental Pharmacology, 2016 , vol. 8, p. 1 - 10 Title/Abstract Full Text Show Details
Wang, Zhensong; Zhang, Aiying; Zhao, Bin; Gan, Jie; Wang, Guangbin; Gao, Fei; Liu, Bo; Gong, Tao; Liu, Wen; Edden, Richard A. E.
Medicine (United States), 2016 , vol. 95, # 39 Title/Abstract Full Text Show Details
Ligsay, Andrew; Hagerman, Randi J.
Intractable and Rare Diseases Research, 2016 , vol. 5, # 3 p. 158 - 167 Title/Abstract Full Text Show Details
160 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Hirata, Koichi
Journal of Pesticide Science, 2016 , vol. 41, # 3 p. 87 - 94 Title/Abstract Full Text Show Details
Zhang, Xiaoyu; Shen, Fengyan; Xu, Daojie; Zhao, Xuan
International Journal of Developmental Neuroscience, 2016 , vol. 54, p. 62 - 69 Title/Abstract Full Text Show Details
Cani, Patrice D.; Knauf, Claude
Molecular Metabolism, 2016 , vol. 5, # 9 p. 743 - 752 Title/Abstract Full Text Show Details
Varley, James A.; Irani, Sarosh R.
Medicine (United Kingdom), 2016 , vol. 44, # 9 p. 563 - 569 Title/Abstract Full Text Show Details
Li, Wei; Zhou, Mengzhou; Xu, Ning; Hu, Yong; Wang, Chao; Li, Deyuan; Liu, Liegang; Li, Dongsheng
Bioengineered, 2016 , vol. 7, # 5 p. 334 - 341 Title/Abstract Full Text Show Details
Wang, Lingxia; Pan, Dezhuo; Lv, Xiaojie; Cheng, Chi-Lien; Li, Jian; Liang, Wenyu; Xing, Jianhong; Chen, Wei
Plant Cell and Environment, 2016 , vol. 39, # 11 p. 2486 - 2497 Title/Abstract Full Text Show Details
Ma, Huan; Li, Qingeng; Liu, Yan; Chen, Gang; Wang, Tao
Chemical Biology and Drug Design, 2016 , p. 363 - 369 Title/Abstract Full Text Show Details
Wodtke, Robert; Schramm, Georg; Pietzsch, Jens; Löser, Reik; Pietsch, Markus
ChemBioChem, 2016 , p. 1263 - 1281 Title/Abstract Full Text Show Details
Ocmen, Elvan; Erdost, Hale Aksu; Duru, Leyla S.; Akan, Pinar; Cimrin, Dilek; Gokmen, Ali N.
Kaohsiung Journal of Medical Sciences, 2016 , vol. 32, # 6 p. 302 - 305 Title/Abstract Full Text Show Details
Macegoniuk, Katarzyna; Grela, Ewa; Palus, Jerzy; Rudzińska, Ewa; Grabowiecka, Agnieszka; Biernat, Monika; Berlicki, Łukasz
Journal of Medicinal Chemistry, 2016 , vol. 59, # 17 p. 8125 - 8133 Title/Abstract Full Text Show Details
Ramírez-Bahena, Martha Helena; Flores-Félix, José David; Chahboune, Rajaa; Toro, Marcia; Velázquez, Encarna; Peix, Alvaro
Systematic and Applied Microbiology, 2016 , vol. 39, # 6 p. 378 - 383 Title/Abstract Full Text Show Details
Guangzhou first feed additives limited; Peng, Xianfeng
Patent: CN105884637 A, 2016 ; Title/Abstract Full Text Show Details
Cathomas, Flurin; Sigrist, Hannes; Schmid, Luca; Seifritz, Erich; Gassmann, Martin; Bettler, Bernhard; Pryce, Christopher R.
Behavioural Brain Research, 2017 , vol. 317, p. 393 - 400 Title/Abstract Full Text Show Details
Papadimitriou, Konstantinos; Alegría, Ángel; Bron, Peter A.; De Angelis, Maria; Gobbetti, Marco; Kleerebezem, Michiel; Lemos, José A.; Linares, Daniel M.; Ross, Paul; Stanton, Catherine; Turroni, Francesca; Van Sinderen, Douwe; Varmanen, Pekka; Ventura, Marco; Zúñiga, Manuel; Tsakalidou, Effie; Kok, Jan
Microbiology and Molecular Biology Reviews, 2016 , vol. 80, # 3 p. 837 - 890 Title/Abstract Full Text Show Details
Mysoet, Julien; Canu, Marie-Hélène; Gillet, Christophe; Fourneau, Julie; Garnier, Cyril; Bastide, Bruno; Dupont, Erwan
Behavioural Brain Research, 2017 , vol. 317, p. 434 - 443 Title/Abstract Full Text Show Details
Terpolilli, Jason J.; Masakapalli, Shyam K.; Karunakaran, Ramakrishnan; Webb, Isabel U.C.; Green, Rob; Watmough, Nicholas J.; Kruger, Nicholas J.; Ratcliffe, R. George; Poole, Philip S.
Journal of Bacteriology, 2016 , vol. 198, # 20 p. 2864 - 2875 Title/Abstract Full Text Show Details
Figueiredo, Ítalo Leite; Frota, Priscila B.; da Cunha, Davi G.; da Silva Raposo, Ramon; Canuto, Kildere M.; de Andrade, Geanne M.; Sousa, Nuno; Moore, Sean R.; Anstead, Gregory M.; Alvarez-Leite, Jacqueline I.; Guerrant, Richard L.; Oriá, Reinaldo B.
Nutrition, 2016 , vol. 32, # 9 p. 1019 - 1027 Title/Abstract Full Text Show Details
Huang, Yuejun; Shen, Zhiwei; Hu, Liu; Xia, Fang; Li, Yuewa; Zhuang, Jingwen; Chen, Peishan; Huang, Qingjun
Psychiatry Research, 2016 , vol. 246, p. 236 - 245 Title/Abstract Full Text Show Details
Boshta, Nader M.; El-Essawy, Farag A.; Ammar, Ramy M.; Ismail, Abd El-Hamid; Wahba, Nancy E.
Monatshefte fur Chemie, 2016 , vol. 147, # 11 p. 2031 - 2042 Title/Abstract Full Text Show Details
Vogel, Kara R.; Ainslie, Garrett R.; Gibson, K. Michael
Journal of Inherited Metabolic Disease, 2016 , vol. 39, # 6 p. 877 - 886 Title/Abstract Full Text Show Details
Hide facts
161 of 992
Show next 200 Comment (Pharmacological Data)
Bioactivities present
Reference
Jansen; Vogel; Salomons; Pearl; Roullet; Gibson
Journal of Inherited Metabolic Disease, 2016 , vol. 39, # 6 p. 795 - 800 Title/Abstract Full Text Show Details
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
International Journal of Molecular Sciences, 2016 , vol. 17, # 10 art. no. 1675 Title/Abstract Full Text Show Details
Andrews, Stephen P.; Aves, Sarah J.; Christopher, John A.; Nonoo, Rebecca
Current Topics in Medicinal Chemistry, 2016 , vol. 16 Title/Abstract Full Text Show Details
Di Paolo, Matias; Bossi, Mariano L.; Baggio, Ricardo; Suarez, Sebastián A.
Acta Crystallographica Section B: Structural Science, Crystal Engineering and Materials, 2016 , vol. 72, # 5 p. 684 - 692 Title/Abstract Full Text Show Details
Phillips, Joseph R.; Eissa, Abeer M.; Hewedi, Doaa H.; Jahanshahi, Marjan; El-Gamal, Mohamed; Keri, Szabolcs; Moustafa, Ahmed A.
Reviews in the Neurosciences, 2016 , vol. 27, # 7 p. 729 - 738 Title/Abstract Full Text Show Details
Yamano, Emi; Sugimoto, Masahiro; Hirayama, Akiyoshi; Kume, Satoshi; Yamato, Masanori; Jin, Guanghua; Tajima, Seiki; Goda, Nobuhito; Iwai, Kazuhiro; Fukuda, Sanae; Yamaguti, Kouzi; Kuratsune, Hirohiko; Soga, Tomoyoshi; Watanabe, Yasuyoshi; Kataoka, Yosky
Scientific Reports, 2016 , vol. 6, art. no. 34990 Title/Abstract Full Text Show Details
Ye, Guozhu; Chen, Yajie; Wang, Hong-Ou; Ye, Ting; Lin, Yi; Huang, Qiansheng; Chi, Yulang; Dong, Sijun
Scientific Reports, 2016 , vol. 6, art. no. 35257 Title/Abstract Full Text Show Details
Martin, Vincent T.; Vij, Brinder
Headache, 2016 , vol. 56, # 9 p. 1553 - 1562 Title/Abstract Full Text Show Details
Jagmann, Nina; Bleicher, Vera; Busche, Tobias; Kalinowski, Jörn; Philipp, Bodo
Environmental Microbiology, 2016 , vol. 18, # 10 p. 3550 - 3564 Title/Abstract Full Text Show Details
Wolfand, Jordyn M.; Lefevre, Gregory H.; Luthy, Richard G.
Environmental Science: Processes and Impacts, 2016 , vol. 18, # 10 p. 1256 - 1265
Title/Abstract Full Text Show Details
Shanghai Pharmaceutical on the first biochemical Pharmaceutical Co; Yuan, Yonglei; Ding, Jinguo; Huang, Zhenghui; Li, Yingfei
Patent: CN105669480 A, 2016 ; Title/Abstract Full Text Show Details
Gromek, Samantha M.; deMayo, James A.; Maxwell, Andrew T.; West, Ashley M.; Pavlik, Christopher M.; Zhao, Ziyan; Li, Jin; Wiemer, Andrew J.; Zweifach, Adam; Balunas, Marcy J.
Bioorganic and Medicinal Chemistry, 2016 , vol. 24, # 21 p. 5183 - 5196 Title/Abstract Full Text Show Details
Park, Jong Seok
Biosciences Biotechnology Research Asia, 2016 , vol. 13, # 3 p. 1285 - 1289 Title/Abstract Full Text Show Details
Fijałkowski, Łukasz; Sałat, Kinga; Podkowa, Adrian; Zaręba, Paula; Nowaczyk, Alicja
European Journal of Pharmaceutical Sciences, 2017 , vol. 96, p. 362 - 372 Title/Abstract Full Text Show Details
Watson, Nathaniel F.
Journal of Clinical Sleep Medicine, 2016 , vol. 12, # 10 p. 1321 - 1322 Title/Abstract Full Text Show Details
Trotti, Lynn Marie; Saini, Prabhjyot; Koola, Catherine; LaBarbera, Vincent; Bliwise, Donald L.; Rye, David B.
Journal of Clinical Sleep Medicine, 2016 , vol. 12, # 10 p. 1389 - 1394 Title/Abstract Full Text Show Details
Bown, Alan W.; Shelp, Barry J.
Trends in Plant Science, 2016 , vol. 21, # 10 p. 811 - 813 Title/Abstract Full Text Show Details
Selvaraj, Gurudeeban; Kaliamurthi, Satyavani; Cakmak, Zeynep E.; Cakmak, Turgay
Phycological Research, 2016 , vol. 64, # 4 p. 291 - 299 Title/Abstract Full Text Show Details
Liao, Chenghong; Han, Qian; Ma, Yuanye; Su, Bing
Gene, 2016 , vol. 590, # 2 p. 227 - 233 Title/Abstract Full Text Show Details
Robaa, Dina; Wagner, Tobias; Luise, Chiara; Carlino, Luca; McMillan, Joel; Flaig, Ralf; Schüle, Roland; Jung, Manfred; Sippl, Wolfgang
ChemMedChem, 2016 , vol. 11, # 20 p. 2327 - 2338 Title/Abstract Full Text Show Details
162 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Rocco, Brad R; Lewis, David A; Fish, Kenneth N
Biological Psychiatry, 2016 , vol. 79, # 12 p. 1006 - 1015 Title/Abstract Full Text Show Details
Umeda, Kentaro; Iritani, Shuji; Fujishiro, Hiroshige; Sekiguchi, Hirotaka; Torii, Youta; Habuchi, Chikako; Kuroda, Keisuke; Kaibuchi, Kozo; Ozaki, Norio
Synapse, 2016 , vol. 70, # 12 p. 508 - 518 Title/Abstract Full Text Show Details
Mikkelsen, Mark; Singh, Krish D.; Brealy, Jennifer A.; Linden, David E.J.; Evans, C. John
NMR in Biomedicine, 2016 , vol. 29, # 11 p. 1644 - 1655 Title/Abstract Full Text Show Details
Ma, Zhao; Liu, Zhenzhen; Jiang, Tianyu; Zhang, Tianchao; Zhang, Huateng; Du, Lupei; Li, Minyong
ACS Medicinal Chemistry Letters, 2016 , vol. 7, # 10 p. 967 - 971 Title/Abstract Full Text Show Details
Hnilicová, Petra; Považan, Michal; Strasser, Bernhard; Andronesi, Ovidiu C.; Gajdošík, Martin; Dydak, Ulrike; Ukropec, Jozef; Dobrota, Dušan; Trattnig, Siegfried; Bogner, Wolfgang
NMR in Biomedicine, 2016 , vol. 29, # 11 p. 1656 - 1665 Title/Abstract Full Text Show Details
Alenazi, Noof A.; Manthorpe, Jeffrey M.; Lai, Edward P. C.
Sensors (Switzerland), 2016 , vol. 16, # 10 art. no. 1697 Title/Abstract Full Text Show Details
Brand, Bodo; Scheinhardt, Markus O.; Friedrich, Juliane; Zimmer, Daisy; Reinsch, Norbert; Ponsuksili, Siriluck; Schwerin, Manfred; Ziegler, Andreas
BMC Genetics, 2016 , vol. 17, # 1 art. no. 135 Title/Abstract Full Text Show Details
Rémond, Emmanuelle; Martin, Charlotte; Martinez, Jean; Cavelier, Florine
Chemical Reviews, 2016 , vol. 116, # 19 p. 11654 - 11684 Title/Abstract Full Text Show Details
van Veenendaal, Tamar M.; IJff, Dominique M.; Aldenkamp, Albert P.; Lazeron, Richard H.C.; Puts, Nicolaas A.J.; Edden, Richard A.E.; Hofman, Paul A.M.; de Louw, Anton J.A.; Backes, Walter H.; Jansen, Jacobus F.A.
Epilepsy and Behavior, 2016 , vol. 64, p. 200 - 205 Title/Abstract Full Text Show Details
Hu, Yuan; Wang, Yu-Nin; Zhang, Gang-Qiang; Dong, Xian-Zhe; Liu, Wan-Wan; Liu, Ping
Experimental and Therapeutic Medicine, 2016 , vol. 12, # 5 p. 3087 - 3092 Title/Abstract Full Text Show Details
Calandre, Elena P.; Rico-Villademoros, Fernando; Slim, Mahmoud
Expert Review of Neurotherapeutics, 2016 , vol. 16, # 11 p. 1263 - 1277 Title/Abstract Full Text Show Details
Krall, Jacob; Brygger, Benjamin M.; Sigurðardóttir, Sara B.; Ng, Clarissa K. L.; Bundgaard, Christoffer; Kehler, Jan; Nielsen, Birgitte; Bek, Toke; Jensen, Anders A.; Frølund, Bente
ChemMedChem, 2016 , vol. 11, # 20 p. 2299 - 2310 Title/Abstract Full Text Show Details
Garella, Davide; Borretto, Emily; Cocco, Mattia; Giorgis, Marta; Costale, Annalisa; Stevanato, Livio; Miglio, Gianluca; Bertinaria, Massimo; Atlante, Sandra; Cencioni, Chiara; Spallotta, Francesco; Gaetano, Carlo; Fernández-de Gortari, Eli; Medina-Franco, José L.
Chemical Biology and Drug Design, 2016 , p. 664 - 676 Title/Abstract Full Text Show Details
Spear, Linda Patia
Neuroscience and Biobehavioral Reviews, 2016 , vol. 70, p. 228 - 243 Title/Abstract Full Text Show Details
Taiwe, Germain Sotoing; Tchoya, Thierry Bang; Menanga, Joseph Renaud; Dabole, Bernard; De Waard, Michel
Journal of Ethnopharmacology, 2016 , vol. 194, p. 421 - 433 Title/Abstract Full Text Show Details
Borella, Junior; Oliveira, Halley Caixeta; de Oliveira, Denise dos Santos Colares; Braga, Eugenia Jacira Bolacel; de Oliveira, Ana Claudia Barneche; Sodek, Ladaslav; do Amarante, Luciano
Environmental and Experimental Botany, 2017 , vol. 133, p. 118 - 127 Title/Abstract Full Text Show Details
Okuyama, Satoshi; Semba, Tomoki; Toyoda, Nobuki; Epifano, Francesco; Genovese, Salvatore; Fiorito, Serena; Taddeo, Vito Alessandro; Sawamoto, Atsushi; Nakajima, Mitsunari; Furukawa, Yoshiko
International Journal of Molecular Sciences, 2016 , vol. 17, # 10 art. no. 1716 Title/Abstract Full Text Show Details
Therrien, Mikaela; Vohnoutka, Rishel; Boumil, Edward; Guaraldi, Mary; Lee, Sangmook; Shea, Thomas B.
International Journal of Developmental Neuroscience, 2016 , vol. 55, p. 66 - 71 Title/Abstract Full Text Show Details
Mashour, George A.
Anesthesiology, 2016 , vol. 125, # 5 p. 830 - 831 Title/Abstract Full Text Show Details
Bonhomme, Vincent; Vanhaudenhuyse, Audrey; Demertzi, Athena; Bruno, Marie-Aurélie; Jaquet, Oceane; Bahri, Mohamed Ali; Plenevaux, Alain; Boly, Melanie; Boveroux, Pierre; Soddu, Andrea; Brichant, Jean François; Maquet, Pierre; Laureys, Steven
Anesthesiology, 2016 , vol. 125, # 5 p. 873 - 888 Title/Abstract Full Text Show Details
163 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Peng, Dapeng; Wang, Yulian; Feng, Liang; Cao, Guangcai; Tao, Yanfei; Liu, Zhenli; Yuan, Zonghui
Food Analytical Methods, 2016 , vol. 9, # 12 p. 3520 - 3531 Title/Abstract Full Text Show Details
Schnorr, Stephanie L.; Bachner, Harriet A.
Yale Journal of Biology and Medicine, 2016 , vol. 89, # 3 p. 397 - 422 Title/Abstract Full Text Show Details
Li, Xiao-Yan; Du, Shen-Dao; Sun, Lian
Journal of International Pharmaceutical Research, 2016 , vol. 43, # 5 p. 994 - 997 Title/Abstract Full Text Show Details
Lin, Meiyu; Zhang, Weidong; Su, Juan
Journal of Ethnopharmacology, 2016 , vol. 193, p. 566 - 573 Title/Abstract Full Text Show Details
Lyu, Changjiang; Hu, Sheng; Huang, Jun; Luo, Maiqi; Lu, Tao; Mei, Lehe; Yao, Shanjing
International Journal of Food Microbiology, 2016 , vol. 238, p. 302 - 310 Title/Abstract Full Text Show Details
Ma, Chun-Lian; Ma, Xiao-Tang; Wang, Jin-Ju; Liu, Hua; Chen, Yan-Fang; Yang, Yi
Behavioural Brain Research, 2017 , vol. 317, p. 332 - 339 Title/Abstract Full Text Show Details
Kim, Min-Ji; Lee, Su-Jin; Choi, Young-Hee; Son, Dong-Hwa; Chung, Hyun-Jung
Journal of the Korean Society of Food Science and Nutrition, 2016 , vol. 45, # 9 p. 1310 - 1315 Title/Abstract Full Text Show Details
Hartmann; Martino; Murphy
Revue Neurologique, 2016 , vol. 172, # 8-9 p. 446 - 454 Title/Abstract Full Text Show Details
Zuo, Wanhong; Wang, Liwei; Chen, Lixin; Krnjević, Krešimir; Fu, Rao; Feng, Xia; He, Wen; Kang, Seungwoo; Shah, Avi; Bekker, Alex; Ye, Jiang-Hong
Neuropharmacology, 2017 , vol. 113, p. 178 - 187 Title/Abstract Full Text Show Details
Kamyar, Marzyeh; Razavi, Bibi Marjan; Vahdati Hasani, Faezeh; Mehri, Soghra; Foroutanfar, Amir; Hosseinzadeh, Hossein
Iranian Journal of Basic Medical Sciences, 2016 , vol. 19, # 10 p. 1070 - 1079 Title/Abstract Full Text Show Details
Jorge, João M. P.; Leggewie, Christian; Wendisch, Volker F.
Amino Acids, 2016 , vol. 48, # 11 p. 2519 - 2531 Title/Abstract Full Text Show Details
Dadsetan, Sherry; Balzano, Tiziano; Forteza, Jerónimo; Agusti, Ana; Cabrera-Pastor, Andrea; Taoro-Gonzalez, Lucas; Hernandez-Rabaza, Vicente; Gomez-Gimenez, Belen; ElMlili, Nisrin; Llansola, Marta; Felipo, Vicente
Journal of Neuroinflammation, 2016 , vol. 13, # 1 art. no. 245 Title/Abstract Full Text Show Details
Higashi, Tatsuya; Ogawa, Shoujiro
Journal of Pharmaceutical and Biomedical Analysis, 2016 , vol. 130, p. 181 - 193 Title/Abstract Full Text Show Details
Andrés, Marta; Seifert, Marvin; Spalthoff, Christian; Warren, Ben; Weiss, Lukas; Giraldo, Diego; Winkler, Margret; Pauls, Stephanie; Göpfert, Martin C.
Current Biology, 2016 , vol. 26, # 15 p. 2028 - 2036 Title/Abstract Full Text Show Details
Aguila, Maria-Eliza R.; Rebbeck, Trudy; Leaver, Andrew M.; Lagopoulos, Jim; Brennan, Patrick C.; Hübscher, Markus; Refshauge, Kathryn M.
Journal of Pain, 2016 , vol. 17, # 10 p. 1058 - 1067 Title/Abstract Full Text Show Details
Hou, Baochao; Wang, Hui; Yan, Tianwen; Shan, Yi; Zhou, Wenqi; Zhang, Lidong; Man, Chaoxin; Deng, Yu; Jiang, Yujun
Food Science and Technology Research, 2016 , vol. 22, # 4 p. 519 - 527 Title/Abstract Full Text Show Details
Pereira, Vanda; Santos, Magda; Cacho, Juan; Marques, José C.
LWT - Food Science and Technology, 2017 , vol. 75, p. 719 - 726 Title/Abstract Full Text Show Details
Loots, Du Toit; Swanepoel, Conrad C.; Newton-Foot, Mae; Gey van Pittius, Nicolaas C.
Microbial Pathogenesis, 2016 , vol. 100, p. 268 - 275 Title/Abstract Full Text Show Details
Forman, Stuart A.; Miller, Keith W.
Anesthesia and Analgesia, 2016 , vol. 123, # 5 p. 1263 - 1273
Title/Abstract Full Text Show Details
Vien, Thuy N.; Moss, Stephen J.; Davies, Paul A.
Anesthesia and Analgesia, 2016 , vol. 123, # 5 p. 1220 - 1227 Title/Abstract Full Text Show Details
164 of 992
165 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Amlong, Corey A.; Perkins, Mark G.; Houle, Timothy T.; Miller, Keith W.; Pearce, Robert A.
Anesthesia and Analgesia, 2016 , vol. 123, # 5 p. 1241 - 1246 Title/Abstract Full Text Show Details
Whissell, Paul D.; Avramescu, Sinziana; Wang, Dian-Shi; Orser, Beverley A.
Anesthesia and Analgesia, 2016 , vol. 123, # 5 p. 1247 - 1252 Title/Abstract Full Text Show Details
Born, Todd A.
Pharmaceutical Manufacturing and Packing Sourcer, 2014 , # November p. 64 - 69 Title/Abstract Full Text Show Details
Storozhuk, Maksim; Kondratskaya, Elena; Nikolaenko, Lyudmila; Krishtal, Oleg
Molecular Brain, 2016 , vol. 9, # 1 art. no. 90 Title/Abstract Full Text Show Details
Andersen, Jacob; Ladefoged, Lucy Kate; Kristensen, Trine N. Bjerre; Munro, Lachlan; Grouleff, Julie; Stuhr-Hansen, Nicolai; Kristensen, Anders S.; Schiøtt, Birgit; Strømgaard, Kristian
ACS Chemical Neuroscience, 2016 , vol. 7, # 10 p. 1406 - 1417 Title/Abstract Full Text Show Details
Khang; Vasiljevic; Xuan
International Food Research Journal, 2016 , vol. 23, # 5 p. 1980 - 1987 Title/Abstract Full Text Show Details
Zhao, Weirui; Hu, Sheng; Huang, Jun; Ke, Piyu; Yao, Shanjing; Lei, Yinlin; Mei, Lehe; Wang, Jinbo
Chinese Journal of Chemical Engineering, 2016 , vol. 24, # 7 p. 909 - 913 Title/Abstract Full Text Show Details
Zhu, Hongyan; Zhang, Lina; Wang, Guoli; He, Zhongmei; Zhao, Yan; Xu, Yonghua; Gao, Yugang; Zhang, Lianxue
Journal of Food and Drug Analysis, 2016 , vol. 24, # 4 p. 831 - 838 Title/Abstract Full Text Show Details
Ridenour, John B.; Smith, Jonathon E.; Bluhm, Burton H.
Journal of Food Protection, 2016 , vol. 79, # 9 p. 1498 - 1507 Title/Abstract Full Text Show Details
Lindberg, Påvel G.; Térémetz, Maxime; Charron, Sylvain; Kebir, Oussama; Saby, Agathe; Bendjemaa, Narjes; Lion, Stéphanie; Crépon, Benoît; Gaillard, Raphaël; Oppenheim, Catherine; Krebs, Marie-Odile; Amado, Isabelle
Cortex, 2016 , vol. 85, p. 1 - 12 Title/Abstract Full Text Show Details
Hebbes, Christopher
Anaesthesia and Intensive Care Medicine, 2016 , vol. 17, # 9 p. 469 - 472 Title/Abstract Full Text Show Details
Khoujah, Danya; Abraham, Michael K.
Emergency Medicine Clinics of North America, 2016 , vol. 34, # 4 p. 759 - 776 Title/Abstract Full Text Show Details
Iura; Takahashi; Hakata; Mashimo; Fujino
European Journal of Pain (United Kingdom), 2016 , vol. 20, # 10 p. 1678 - 1688 Title/Abstract Full Text Show Details
Crane; Redden; van Emon; Neville; Reynolds; Caton; Schauer
Journal of Animal Science, 2016 , vol. 94, # 8 p. 3540 - 3549 Title/Abstract Full Text Show Details
Risley, Monica G.; Kelly, Stephanie P.; Jia, Kailiang; Grill, Brock; Dawson-Scully, Ken
PLoS ONE, 2016 , vol. 11, # 9 art. no. E0163786 Title/Abstract Full Text Show Details
Bagga, Puneet; Crescenzi, Rachelle; Krishnamoorthy, Guruprasad; Verma, Gaurav; Nanga, Ravi Prakash Reddy; Reddy, Damodar; Greenberg, Joel; Detre, John A.; Hariharan, Hari; Reddy, Ravinder
Journal of Neurochemistry, 2016 , vol. 139, # 3 p. 432 - 439 Title/Abstract Full Text Show Details
Cumming, Paul; Gallinat, Jürgen
Journal of Neurochemistry, 2016 , vol. 139, # 3 p. 346 - 348 Title/Abstract Full Text Show Details
Löscher, Wolfgang; Gillard, Michel; Sands, Zara A.; Kaminski, Rafal M.; Klitgaard, Henrik
CNS Drugs, 2016 , vol. 30, # 11 p. 1055 - 1077 Title/Abstract Full Text Show Details
Kaneko, Yuji; Pappas, Colleen; Tajiri, Naoki; Borlongan, Cesar V.
Scientific Reports, 2016 , vol. 6, art. no. 35659 Title/Abstract Full Text Show Details
Marty, Loïc; Vigouroux, Armelle; Aumont-Nicaise, Magali; Dessaux, Yves; Faure, Denis; Moréra, Solange
Journal of Biological Chemistry, 2016 , vol. 291, # 43 p. 22638 - 22649 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Kailasa, Suresh Kumar; Wu, Hui-Fen
Current Neuropharmacology, 2013 , vol. 11, # 4 p. 436 - 464 Title/Abstract Full Text Show Details
Arya, Ashwani; Sindhwani, Gulshan
International Journal of Pharmaceutical Sciences and Research, 2016 , vol. 7, # 9 p. 3567 - 3575 Title/Abstract Full Text Show Details
Gidal, Barry E.; Wechsler, Robert T.; Sankar, Raman; Montouris, Georgia D.; White, H. Steve; Cloyd, James C.; Kane, Mary Clare; Peng, Guangbin; Tworek, David M.; Shen, Vivienne; Isojarvi, Jouko
Neurology, 2016 , vol. 87, # 17 p. 1806 - 1812 Title/Abstract Full Text Show Details
Gorman, Gráinne S.; Chinnery, Patrick F.; DiMauro, Salvatore; Hirano, Michio; Koga, Yasutoshi; McFarland, Robert; Suomalainen, Anu; Thorburn, David R.; Zeviani, Massimo; Turnbull, Douglass M.
Nature Reviews Disease Primers, 2016 , vol. 2, art. no. 16080 Title/Abstract Full Text Show Details
Sakata, Katsumi; Saito, Toshiyuki; Ohyanagi, Hajime; Okumura, Jun; Ishige, Kentaro; Suzuki, Harukazu; Nakamura, Takuji; Komatsu, Setsuko
Scientific Reports, 2016 , vol. 6, art. no. 35946 Title/Abstract Full Text Show Details
Bartalné-Berceli; Izsó; Gergely; Jednákovits; Szilbereky; Salgó
Quality Assurance and Safety of Crops and Foods, 2016 , vol. 8, # 4 p. 519 - 538 Title/Abstract Full Text Show Details
Song, Mingxia; Xiao, Feng; Yu, Haihong; Liu, Bing; Deng, Xianqing
Latin American Journal of Pharmacy, 2016 , vol. 35, # 9 p. 1959 - 1965 Title/Abstract Full Text Show Details
Abbasnia, Vahideh Sadat; Aeinfar, Hoseyn
International Journal of Pharmacy and Technology, 2016 , vol. 8, # 3 p. 15974 - 15979 Title/Abstract Full Text Show Details
Shen, Mei-Lin; Wang, Chen-Hung; Lin, Ching-Huei; Zhou, Ning; Kao, Shung-Te; Wu, Dong Chuan
Scientific Reports, 2016 , vol. 6, art. no. 32756 Title/Abstract Full Text Show Details
Sankar, Raman; Rho, Jong M.
Journal of Child Neurology, 2007 , vol. 22, # 5_suppl p. S21 - S29 Title/Abstract Full Text Show Details
Yin, Fei; Sancheti, Harsh; Patil, Ishan; Cadenas, Enrique
Free Radical Biology and Medicine, 2016 , vol. 100, p. 108 - 122 Title/Abstract Full Text Show Details
Chen, Chin-Chu; Li, I-Chen; Lin, Ting-Wei; Chang, Hsiao-Ling; Lin, Wen-Hsin; Shen, You-Cheng
European Journal of Integrative Medicine, 2016 , vol. 8, # 5 p. 654 - 660 Title/Abstract Full Text Show Details
Sherwin, Eoin; Sandhu, Kiran V.; Dinan, Timothy G.; Cryan, John F.
CNS Drugs, 2016 , vol. 30, # 11 p. 1019 - 1041 Title/Abstract Full Text Show Details
Antinucci, Paride; Suleyman, Oniz; Monfries, Clinton; Hindges, Robert
Current Biology, 2016 , vol. 26, # 14 p. 1802 - 1815 Title/Abstract Full Text Show Details
Rind, F. Claire; Wernitznig, Stefan; Pölt, Peter; Zankel, Armin; Gütl, Daniel; Sztarker, Julieta; Leitinger, Gerd
Scientific Reports, 2016 , vol. 6, art. no. 35525 Title/Abstract Full Text Show Details
Nasehi, Mohammad; Morteza-zadeh, Parastoo; Khakpai, Fatemeh; Zarrindast, Mohammad-Reza
Neuroscience, 2016 , vol. 339, p. 287 - 295 Title/Abstract Full Text Show Details
Kubová, Hana; Moshé, Solomon L.
Journal of Child Neurology, 1994 , vol. 9, # 1_suppl p. S3 - S11 Title/Abstract Full Text Show Details
Salzillo, Travis C.; Hu, Jingzhe; Nguyen, Linda; Whiting, Nicholas; Lee, Jaehyuk; Weygand, Joseph; Dutta, Prasanta; Pudakalakatti, Shivanand; Millward, Niki Zacharias; Gammon, Seth T.; Lang, Frederick F.; Heimberger, Amy B.; Bhattacharya, Pratip K.
Magnetic Resonance Imaging Clinics of North America, 2016 , vol. 24, # 4 p. 687 - 703 Title/Abstract Full Text Show Details
Matsuda, Satoru; Ichimura, Mayuko; Ogino, Mako; Nakano, Noriko; Minami, Akari; Murai, Toshiyuki; Kitagishi, Yasuko
International Journal of Oncology, 2016 , vol. 49, # 5 p. 1785 - 1790 Title/Abstract Full Text Show Details
Richens, Alan
Journal of Child Neurology, 1991 , vol. 6, # 2_suppl p. 2S10 Title/Abstract Full Text Show Details
166 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Herranz; Arteaga; Farr; Valdizan; Beaumont; Armijo
Journal of Child Neurology, 1991 , vol. 6, # 2_suppl p. 2S51 Title/Abstract Full Text Show Details
Klotz, Jenna; Porter, Brenda E.; Colas, Claire; Schlessinger, Avner; Pajor, Ana M.
Molecular Medicine, 2016 , vol. 22, p. 310 - 321 Title/Abstract Full Text Show Details
Lee, Ji Ye; Park, Na Hyun; Lee, Wonwoong; Kim, Eun Hye; Jin, Young Ho; Seo, Eun Kyung; Hong, Jongki
Journal of Chromatography A, 2016 , vol. 1471, p. 164 - 177 Title/Abstract Full Text Show Details
Palmer, Samantha; Towne, Meghan C.; Pearl, Phillip L.; Pelletier, Renee C.; Genetti, Casie A.; Shi, Jiahai; Beggs, Alan H.; Agrawal, Pankaj B.; Brownstein, Catherine A.
Pediatric Neurology, 2016 , vol. 64, p. 77 - 79 Title/Abstract Full Text Show Details
Ren, Min; Li, Kunyi; Wang, Dan; Guo, Jiamei; Li, Jing; Yang, Guang; Long, Xianghua; Shen, Wenjing; Hu, Rong; Wang, Xuefeng; Zeng, Kebin
Molecular Neurobiology, 2016 , vol. 53, # 9 p. 6069 - 6077 Title/Abstract Full Text Show Details
Chen, Lei; Zhang, Yu-Hang; Zheng, Mingyue; Huang, Tao; Cai, Yu-Dong
Molecular Genetics and Genomics, 2016 , vol. 291, # 6 p. 2065 - 2079 Title/Abstract Full Text Show Details
Liu, Henry C.; Jamshidi, Neema; Chen, Yuchen; Eraly, Satish A.; Cho, Sai Yee; Bhatnagar, Vibha; Wu, Wei; Bush, Kevin T.; Abagyan, Ruben; Palsson, Bernhard O.; Nigam, Sanjay K.
Journal of Biological Chemistry, 2016 , vol. 291, # 37 p. 19474 - 19486 Title/Abstract Full Text Show Details
Liu, Celina S.; Ruthirakuhan, Myuri; Chau, Sarah A.; Herrmann, Nathan; Carvalho, André F.; Lanctôt, Krista L.
Current Alzheimer Research, 2016 , vol. 13, # 10 p. 1134 - 1144 Title/Abstract Full Text Show Details
Kim, Jae Kwang; Bong, Sun Ju; Park, Sang Un
Asian Journal of Chemistry, 2016 , vol. 28, # 11 p. 2421 - 2423 Title/Abstract Full Text Show Details
Sassarini, Dr Jenifer
Maturitas, 2016 , vol. 94, p. 149 - 154 Title/Abstract Full Text Show Details
Akbar, Shehla; Subhan, Fazal; Karim, Nasiara; Shahid, Muhammad; Ahmad, Nisar; Ali, Gowhar; Mahmood, Wajahat; Fawad, Khwaja
Biomedicine and Pharmacotherapy, 2016 , vol. 84, p. 962 - 971 Title/Abstract Full Text Show Details
Vemula, Harika; Kitase, Yukiko; Ayon, Navid J.; Bonewald, Lynda; Gutheil, William G.
Analytical Biochemistry, 2017 , vol. 516, p. 75 - 85 Title/Abstract Full Text Show Details
Rivera-Ramírez, Nayeli; Montejo-López, Wilber; López-Méndez, María-Cristina; Guerrero-Hernández, Agustín; Molina-Hernández, Anayansi; García-Hernández, Ubaldo; Arias-Montaño, José-Antonio
Neurochemistry International, 2016 , vol. 101, p. 38 - 47 Title/Abstract Full Text Show Details
Silveira, Alberto Thalison; Albuquerque, Ana Carolina Campos; Lepera, José Salvador; Martins, Isarita
Environmental Toxicology and Pharmacology, 2016 , vol. 48, p. 191 - 196 Title/Abstract Full Text Show Details
Saleh, Muhammad G.; Oeltzschner, Georg; Chan, Kimberly L.; Puts, Nicolaas A.J.; Mikkelsen, Mark; Schär, Michael; Harris, Ashley D.; Edden, Richard A.E.
NeuroImage, 2016 , vol. 142, p. 576 - 582 Title/Abstract Full Text Show Details
Alqazzaz, Mona A.; Price, Kerry L.; Lummis, Sarah C. R.
Biochemistry, 2016 , vol. 55, # 42 p. 5947 - 5951 Title/Abstract Full Text Show Details
Chowdhry, Vivek; Biswal, Suvakanta; Mohanty, Bipin B.; Bhuyan, Pradyut
Annals of Cardiac Anaesthesia, 2016 , vol. 19, # 4 p. 758 - 759 Title/Abstract Full Text Show Details
Beijing Union Pharmaceutical Factory; Institute of Materia Medica, Chinese Academy ofMedical Sciences; Pan, Xiandao; Zhang, Peicheng; Yang, Yajun; Zhao, Limin
Patent: CN102786464 B, 2016 ; Title/Abstract Full Text Show Details
Vigil, Pilar; del Río, Juan Pablo; Carrera, Ba´rbara; Ara´nguiz, Florencia C.; Rioseco, Hernán; Cortés, Manuel E.
Linacre Quarterly, 2016 , vol. 83, # 3 p. 308 - 329 Title/Abstract Full Text Show Details
Llorca-Torralba, Meritxell; Borges, Gisela; Neto, Fani; Mico, Juan Antonio; Berrocoso, Esther
Neuroscience, 2016 , vol. 338, p. 93 - 113 Title/Abstract Full Text Show Details
167 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Adams, Daniel L.; Economides, John R.; Horton, Jonathan C.
Visual Neuroscience, 2015 , vol. 32, art. no. E026 Title/Abstract Full Text Show Details
Nasuchon, Nopparat; Hirasaka, Katsuya; Yamaguchi, Kenichi; Okada, Jiro; Ishimatsu, Atsushi
Comparative Biochemistry and Physiology - Part D: Genomics and Proteomics, 2017 , vol. 21, p. 10 - 16 Title/Abstract Full Text Show Details
Matošić, Ana; Marušić, Srdan; Vidrih, Branka; Kovak-Mufić, Ana; Čičin-Šain, Lipa
Acta Clinica Croatica, 2016 , vol. 55, # 1 p. 134 - 150 Title/Abstract Full Text Show Details
Sawynok
Neuroscience, 2016 , vol. 338, p. 1 - 18 Title/Abstract Full Text Show Details
Ganelin-Cohen, Esther; Modan-Moses, Dalit; Hemi, Rina; Kanety, Hannah; Ben-zeev, Bruria; Hampe, Christiane S.
Pediatric Diabetes, 2016 , vol. 17, # 8 p. 617 - 622 Title/Abstract Full Text Show Details
Ueno, Hiroaki; Nakazato, Masamitsu
Journal of Diabetes Investigation, 2016 , vol. 7, # 6 p. 812 - 818 Title/Abstract Full Text Show Details
Sarma, Manoj K.; Macey, Paul M.; Nagarajan, Rajakumar; Aysola, Ravi; Harper, Ronald M.; Thomas, M. Albert
Scientific Reports, 2016 , vol. 6, art. no. 31747 Title/Abstract Full Text Show Details
Stachowicz, Marta; Lebiedzińska, Anna
European Food Research and Technology, 2016 , vol. 242, # 12 p. 2001 - 2009 Title/Abstract Full Text Show Details
Rivera-González, Natalia; Chauhan, Saurabh; Watson, David F.
Langmuir, 2016 , vol. 32, # 36 p. 9206 - 9215 Title/Abstract Full Text Show Details
Kremer, Mélanie; Salvat, Eric; Muller, André; Yalcin, Ipek; Barrot, Michel
Neuroscience, 2016 , vol. 338, p. 183 - 206 Title/Abstract Full Text Show Details
Mishra, Awanish; Goel, Rajesh Kumar
Neuroscience, 2016 , vol. 339, p. 319 - 328 Title/Abstract Full Text Show Details
Jurnak, Frances
Nutrition and Metabolic Insights, 2016 , vol. 8, p. 57 - 77 Title/Abstract Full Text Show Details
Locci, Andrea; Porcu, Patrizia; Talani, Giuseppe; Santoru, Francesca; Berretti, Roberta; Giunti, Elisa; Licheri, Valentina; Sanna, Enrico; Concas, Alessandra
Hormones and Behavior, 2017 , vol. 87, p. 35 - 46
Title/Abstract Full Text Show Details
Peres, Tanara V.; Schettinger, Maria Rosa C.; Chen, Pan; Carvalho, Fabiano; Avila, Daiana S.; Bowman, Aaron B.; Aschner, Michael
BMC Pharmacology and Toxicology, 2016 , vol. 17, # 1 art. no. 57 Title/Abstract Full Text Show Details
AlAyadhi, Laila Y.; Hashmi, Jamil A.; Iqbal, Muhammad; Albalawi, Alia M.; Samman, Mohammad I.; Elamin, Nadra E.; Bashir, Shahid; Basit, Sulman
Neuroscience, 2016 , vol. 339, p. 561 - 570 Title/Abstract Full Text Show Details
Marshak, David W.; Chuang, Alice Z.; Dolino, Drew M.; Jacoby, Roy A.; Liu, Weiley S.; Long, Ye; Sherman, Michael B.; Suh, Jae M.; Vila, Alejandro; Mills, Stephen L.
Visual Neuroscience, 2015 , vol. 32, art. no. E006 Title/Abstract Full Text Show Details
Zhang, Junmin; Yao, Juan; Peng, Shoujiao; Li, Xinming; Fang, Jianguo
Biochimica et Biophysica Acta - Molecular Basis of Disease, 2017 , vol. 1863, # 1 p. 129 - 138 Title/Abstract Full Text Show Details
Lim, Chae-Seok; Kim, Hyopil; Yu, Nam-Kyung; Kang, Sukjae Joshua; Kim, TaeHyun; Ko, Hyoung-Gon; Lee, Jaehyun; Yang, Jung-eun; Ryu, Hyun-Hee; Park, Taesung; Gim, Jungsoo; Nam, Hye Jin; Baek, Sung Hee; Wegener, Stephanie; Schmitz, Dietmar; Boeckers, Tobias M.; Lee, Min Goo; Kim, Eunjoon; Lee, Jae-Hyung; Lee, Yong-Seok; Kaang, Bong-Kiun
Neuropharmacology, 2017 , vol. 112, p. 104 - 112 Title/Abstract Full Text Show Details
Northcutt, Adam J.; Lett, Kawasi M.; Garcia, Virginia B.; Diester, Clare M.; Lane, Brian J.; Marder, Eve; Schulz, David J.
BMC Genomics, 2016 , vol. 17, # 1 art. no. 868 Title/Abstract Full Text Show Details
Song, You; Rundberget, Jan Thomas; Evenseth, Linn Mari; Xie, Li; Gomes, Tânia; Høgåsen, Tore; Iguchi, Taisen; Tollefsen, Knut Erik
Environmental Science and Technology, 2016 , vol. 50, # 21 p. 11994 - 12003 Title/Abstract Full Text Show Details
168 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Dolgodilina, Elena; Imobersteg, Stefan; Laczko, Endre; Welt, Tobias; Verrey, Francois; Makrides, Victoria
Journal of Cerebral Blood Flow and Metabolism, 2016 , vol. 36, # 11 p. 1929 - 1941 Title/Abstract Full Text Show Details
Kajimoto, Masaki; Ledee, Dolena R.; Olson, Aaron K.; Isern, Nancy G.; Robillard-Frayne, Isabelle; Des Rosiers, Christine; Portman, Michael A.
Journal of Cerebral Blood Flow and Metabolism, 2016 , vol. 36, # 11 p. 1992 - 2004 Title/Abstract Full Text Show Details
Doyle, Hillary H.; Murphy, Anne Z.
Journal of Neuroscience Research, 2017 , vol. 95, # 1-2 p. 487 - 499 Title/Abstract Full Text Show Details
Ichida, Jennifer M.; Mavity-Hudson, Julia A.; Casagrande, Vivien A.
Eye and Brain, 2014 , vol. 6, p. 57 - 73 Title/Abstract Full Text Show Details
Berry, John P.; Roy, Upasana; Jaja-Chimedza, Asha; Sanchez, Kristel; Matysik, Joerg; Alia
Zebrafish, 2016 , vol. 13, # 5 p. 456 - 465 Title/Abstract Full Text Show Details
Eaton, Megan M.; Germann, Allison L.; Arora, Ruby; Cao, Lily Q.; Gao, Xiaoyi; Shin, Daniel J.; Wu, Albert; Chiara, David C.; Cohen, Jonathan B.; Steinbach, Joe Henry; Evers, Alex S.; Akk, Gustav
Current Neuropharmacology, 2016 , vol. 14, # 7 p. 772 - 780 Title/Abstract Full Text Show Details
Jomduang, Somchai
Chiang Mai University Journal of Natural Sciences, 2014 , vol. 13, # 1 p. 449 - 457 Title/Abstract Full Text Show Details
Vogel; Ainslie; Jansen; Salomons; Gibson
Biochimica et Biophysica Acta - Molecular Basis of Disease, 2017 , vol. 1863, # 1 p. 33 - 42 Title/Abstract Full Text Show Details
Zhao, Lijuan; Huang, Yuxiong; Hannah-Bick, Cameron; Fulton, Aaron N.; Keller, Arturo A.
NanoImpact, 2016 , vol. 3-4, p. 58 - 66 Title/Abstract Full Text Show Details
Tokyo University of Agriculture and Technology; Central Research Institute of Electric Power Industry; Kitano, Katsukazu; Nogata, Yasuyuki
Patent: JP2015/42622 A, 2015 ; Title/Abstract Full Text Show Details
Chaikham, Pittaya; Apichartsrangkoon, Arunee; Worametrachanon, Srivilai; Van De Wiele, Tom
International Journal of Food Engineering, 2016 , vol. 12, # 7 p. 637 - 646 Title/Abstract Full Text Show Details
Chi, Liankai; Fan, Beibei; Zhang, Kunshan; Du, Yanhua; Liu, Zhongliang; Fang, Yujiang; Chen, Zhenyu; Ren, Xudong; Xu, Xiangjie; Jiang, Cizhong; Li, Siguang; Ma, Lin; Gao, Liang; Liu, Ling; Zhang, Xiaoqing
Stem Cell Reports, 2016 , vol. 7, # 5 p. 941 - 954 Title/Abstract Full Text Show Details
Zhang, Chi; Nobles, Regina D.; McCall, Maureen A.
Visual Neuroscience, 2015 , vol. 32, art. no. E026 Title/Abstract Full Text Show Details
Zheng, Hong; Zheng, Yongquan; Zhao, Liangcai; Chen, Minjiang; Bai, Guanghui; Hu, Yongsheng; Hu, Wenyi; Yan, Zhihan; Gao, Hongchang
Biochimica et Biophysica Acta - Molecular Basis of Disease, 2017 , vol. 1863, # 1 p. 266 - 273 Title/Abstract Full Text Show Details
Lazcano-Pérez, Fernando; Arellano, Rogelio O.; Garay, Edith; Arreguín-Espinosa, Roberto; Sánchez-Rodríguez, Judith
Comparative Biochemistry and Physiology Part - C: Toxicology and Pharmacology, 2017 , vol. 191, p. 177 - 182 Title/Abstract Full Text Show Details
Koistinen, Hannu; Wallén, Erik; Ylikangas, Henna; Meinander, Kristian; Lahtela-Kakkonen, Maija; Närvänen, Ale; Stenman, Ulf-Håkan
Biological Chemistry, 2016 , vol. 397, # 12 p. 1229 - 1235 Title/Abstract Full Text Show Details
Huang, Yung-Jen; Lee, Kuan H.; Grau, James W.
Experimental Neurology, 2017 , vol. 288, p. 38 - 50
Title/Abstract Full Text Show Details
Harmatys, Kara M.; Musso, Anthony J.; Clear, Kasey J.; Smith, Bradley D.
Photochemical and Photobiological Sciences, 2016 , vol. 15, # 11 p. 1408 - 1416 Title/Abstract Full Text Show Details
Mack, Josiel Mileno; Schamne, Marissa Giovanna; Sampaio, Tuane Bazanella; Pértile, Renata Aparecida Nedel; Fernandes, Pedro Augusto Carlos Magno; Markus, Regina P.; Prediger, Rui Daniel
Oxidative Medicine and Cellular Longevity, 2016 , vol. 2016, art. no. 3472032 Title/Abstract Full Text Show Details
Papazian, Stefano; Khaling, Eliezer; Bonnet, Christelle; Lassueur, Steve; Reymond, Philippe; Moritz, Thomas; Blande, James D.; Albrectsen, Benedicte R.
Plant Physiology, 2016 , vol. 172, # 3 p. 2057 - 2078 Title/Abstract Full Text Show Details
169 of 992
170 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Tsai, Kuen-Jin; Lin, Chih-Yu; Ting, Chen-Yun; Shih, Ming-Che
Plant Physiology, 2016 , vol. 172, # 3 p. 1548 - 1562 Title/Abstract Full Text Show Details
Sadowsky, Andres; Mettler-Altmann, Tabea; Ott, Sieglinde
Phycologia, 2016 , vol. 55, # 6 p. 703 - 714 Title/Abstract Full Text Show Details
Shekh, Satyamitra L.; Dave, Jayantilal M.; Vyas, Bharatkumar Rajiv Manuel
LWT - Food Science and Technology, 2016 , vol. 74, p. 234 - 241 Title/Abstract Full Text Show Details
Erstad, Brian L.; Patanwala, Asad E.
Journal of Critical Care, 2016 , vol. 35, p. 145 - 149 Title/Abstract Full Text Show Details
Zhang, Jia-Qiang; Xu, Wan-Ying; Xu, Chang-Qing
Chinese Medical Journal, 2016 , vol. 129, # 22 p. 2714 - 2724 Title/Abstract Full Text Show Details
Jevtovic-Todorovic, Vesna
Anesthesiology Clinics, 2016 , vol. 34, # 3 p. 439 - 451 Title/Abstract Full Text Show Details
Quillinan, Nidia; Herson, Paco S.; Traystman, Richard J.
Anesthesiology Clinics, 2016 , vol. 34, # 3 p. 453 - 464 Title/Abstract Full Text Show Details
Eid, Lara; Parent, Martin
Brain Structure and Function, 2016 , vol. 221, # 9 p. 4291 - 4317 Title/Abstract Full Text Show Details
Steiner, Johann; Brisch, Ralf; Schiltz, Kolja; Dobrowolny, Henrik; Mawrin, Christian; Krzyżanowska, Marta; Bernstein, Hans-Gert; Jankowski, Zbigniew; Braun, Katharina; Schmitt, Andrea; Bogerts, Bernhard; Gos, Tomasz
Schizophrenia Research, 2016 , vol. 177, # 1-3 p. 10 - 17 Title/Abstract Full Text Show Details
Victoria, Nicole C.; Marron Fernandez de Velasco, Ezequiel; Ostrovskaya, Olga; Metzger, Stefania; Xia, Zhilian; Kotecki, Lydia; Benneyworth, Michael A.; Zink, Anastasia N.; Martemyanov, Kirill A.; Wickman, Kevin
Biological Psychiatry, 2016 , vol. 80, # 10 p. 796 - 806 Title/Abstract Full Text Show Details
McKlveen, Jessica M.; Morano, Rachel L.; Fitzgerald, Maureen; Zoubovsky, Sandra; Cassella, Sarah N.; Scheimann, Jessie R.; Ghosal, Sriparna; Mahbod, Parinaz; Packard, Benjamin A.; Myers, Brent; Baccei, Mark L.; Herman, James P.
Biological Psychiatry, 2016 , vol. 80, # 10 p. 754 - 764 Title/Abstract Full Text Show Details
Ain, Qurrat U.; Owen, Robert M.; Omoto, Kiyoyuki; Torella, Rubben; Bulusu, Krishna C.; Pryde, David C.; Glen, Robert C.; Fuchs, Julian E.; Bender, Andreas
Molecular Pharmaceutics, 2016 , vol. 13, # 11 p. 4001 - 4012 Title/Abstract Full Text Show Details
Maingret, Vincent; Barthet, Gaël; Deforges, Séverine; Jiang, Nan; Mulle, Christophe; Amédée, Thierry
Neurobiology of Aging, 2017 , vol. 50, p. 13 - 24 Title/Abstract Full Text Show Details
Simon, Daniel T.; Gabrielsson, Erik O.; Tybrandt, Klas; Berggren, Magnus
Chemical Reviews, 2016 , vol. 116, # 21 p. 13009 - 13041 Title/Abstract Full Text Show Details
Pistollato, Francesca; Cano, Sandra Sumalla; Elio, Iñaki; Vergara, Manuel Masias; Giampieri, Francesca; Battino, Maurizio
Nutrition Reviews, 2016 , vol. 74, # 10 art. no. NUW023, p. 624 - 634 Title/Abstract Full Text Show Details
Gonçalves, J. Tiago; Schafer, Simon T.; Gage, Fred H.
Cell, 2016 , vol. 167, # 4 p. 897 - 914 Title/Abstract Full Text Show Details
McGregor; Hemmings; Erdman; Calmarza-Font; Stein; Lochner
Psychiatry Research, 2016 , vol. 246, p. 527 - 532 Title/Abstract Full Text Show Details
Zheng, Hong; Zhao, Liangcai; Xia, Huanhuan; Xu, Cuicui; Wang, Dan; Liu, Kun; Lin, Li; Li, Xiaokun; Yan, Zhihan; Gao, Hongchang
Molecular Neurobiology, 2016 , vol. 53, # 10 p. 6690 - 6697 Title/Abstract Full Text Show Details
Palner, Mikael; Beinat, Corinne; Banister, Sam; Zanderigo, Francesca; Park, Jun Hyung; Shen, Bin; Hjoernevik, Trine; Jung, Jae Ho; Lee, Byung Chul; Kim, Sang Eun; Fung, Lawrence; Chin, Frederick T.
EJNMMI Research, 2016 , vol. 6, # 1 art. no. 80 Title/Abstract Full Text Show Details
Archi, Fahima Faroque; Islam, Salma; Babu, Md. Ahsan Habib Khan; Ullah, Ahsan; Azam, Shofiul; Chowdhury, Amin; Rahman, Mahfujur; Karim, Md. Salimul; Goswami, Sukdeb
Biomedical Research and Therapy, 2016 , vol. 3, # 10 art. no. 50 Title/Abstract Full Text Show Details
Comment
Bioactivities present
(Pharmacological Data)
171 of 992
Reference
Yamazaki, Kazuto; Fukushima, Kazuyuki; Sugawara, Michiko; Tabata, Yoshikuni; Imaizumi, Yoichi; Ishihara, Yasuharu; Ito, Masashi; Tsukahara, Kappei; Kohyama, Jun; Okano, Hideyuki
Journal of Biomolecular Screening, 2016 , vol. 21, # 10 p. 1054 - 1064 Title/Abstract Full Text Show Details
Lin, Yanqin; Lin, Liangjie; Wei, Zhiliang; Zhong, Jianhui; Chen, Zhong
Magnetic Resonance in Medicine, 2016 , vol. 76, # 6 p. 1661 - 1667 Title/Abstract Full Text Show Details
Kasper, James M.; McCue, David L.; Milton, Adrianna J.; Szwed, Angelia; Sampson, Catherine M.; Huang, Mei; Carlton, Susan; Meltzer, Herbert Y.; Cunningham, Kathryn A.; Hommel, Jonathan D.
Biological Psychiatry, 2016 , vol. 80, # 11 p. 878 - 887 Title/Abstract Full Text Show Details
Edden, Richard A.E.; Oeltzschner, Georg; Harris, Ashley D.; Puts, Nicolaas A.J.; Chan, Kimberly L.; Boer, Vincent O.; Schär, Michael; Barker, Peter B.
Journal of Magnetic Resonance Imaging, 2016 , vol. 44, # 6 p. 1474 - 1482 Title/Abstract Full Text Show Details
Grewal, Monika; Dabas, Aroma; Saharan, Sumiti; Barker, Peter B.; Edden, Richard A.E.; Mandal, Pravat K.
Journal of Magnetic Resonance Imaging, 2016 , vol. 44, # 6 p. 1619 - 1623 Title/Abstract Full Text Show Details
Qiu, Xiao-Wei; Gong, Hai-Qing; Zhang, Pu-Ming; Liang, Pei-Ji
Cognitive Neurodynamics, 2016 , vol. 10, # 6 p. 481 - 493 Title/Abstract Full Text Show Details
Cadena, John C.; Romero, Carmen M.
Journal of Thermal Analysis and Calorimetry, 2016 , vol. 126, # 3 p. 1615 - 1619 Title/Abstract Full Text Show Details
Kaiser, Lana G.; Hirokazu, Kawaguchi; Fukunaga, Masaki; Matson, Gerald B.
Magnetic Resonance in Medicine, 2016 , vol. 76, # 6 p. 1653 - 1660 Title/Abstract Full Text Show Details
Yun, Sanghee; Reynolds, Ryan P.; Masiulis, Irene; Eisch, Amelia J.
Nature Medicine, 2016 , vol. 22, # 11 p. 1239 - 1247 Title/Abstract Full Text Show Details
Marín, Oscar
Nature Medicine, 2016 , vol. 22, # 11 p. 1229 - 1238 Title/Abstract Full Text Show Details
Yunes; Poluektova; Dyachkova; Klimina; Kovtun; Averina; Orlova; Danilenko
Anaerobe, 2016 , vol. 42, p. 197 - 204 Title/Abstract Full Text Show Details
Cao, Zhengyu; Xu, Jian; Hulsizer, Susan; Cui, Yanjun; Dong, Yao; Pessah, Isaac N.
NeuroToxicology, 2017 , vol. 58, p. 11 - 22 Title/Abstract Full Text Show Details
Millan, Mark J.; Rivet, Jean-Michel; Gobert, Alain
Journal of Psychopharmacology, 2016 , vol. 30, # 11 p. 1099 - 1128 Title/Abstract Full Text Show Details
Sarkar, Amar; Lehto, Soili M.; Harty, Siobhán; Dinan, Timothy G.; Cryan, John F.; Burnet, Philip W.J.
Trends in Neurosciences, 2016 , vol. 39, # 11 p. 763 - 781 Title/Abstract Full Text Show Details
Pal, Priyanka; Singh, Narpinder; Kaur, Parmeet; Kaur, Amritpal; Virdi, Amardeep Singh; Parmar, Naincy
Cereal Chemistry, 2016 , vol. 93, # 6 p. 584 - 592 Title/Abstract Full Text Show Details
Ohm, Jae-Bom; Lee, Chiwon W.; Cho, Kyongshin
Cereal Chemistry, 2016 , vol. 93, # 6 p. 612 - 617 Title/Abstract Full Text Show Details
Garzón, Antonela Guadalupe; Torres, Roberto Luis; Drago, Silvina Rosa
Starch/Staerke, 2016 , vol. 68, # 11-12 p. 1048 - 1054 Title/Abstract Full Text Show Details
Duan, Dong-Mei; Tu, Ya; Liu, Ping; Jiao, Shuang
Neural Regeneration Research, 2016 , vol. 11, # 10 p. 1595 - 1602 Title/Abstract Full Text Show Details
Oh, Jisun; Kim, Jong-Sang
Food and Function, 2016 , vol. 7, # 11 p. 4506 - 4515 Title/Abstract Full Text Show Details
Bonatsou, Stamatoula; Iliopoulos, Vasilis; Mallouchos, Athanasios; Gogou, Eleni; Oikonomopoulou, Vasiliki; Krokida, Magdalini; Taoukis, Petros; Panagou, Efstathios Z.
Food Microbiology, 2017 , vol. 63, p. 72 - 83 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Wei, Weili; Liu, Ruilin; Tong, Yangzi Zhang; Qiu, Zhongmin
Journal of Thoracic Disease, 2016 , vol. 8, # 10 p. 2942 - 2951 Title/Abstract Full Text Show Details
Rice, Lauren J.; Lagopoulos, Jim; Brammer, Michael; Einfeld, Stewart L.
American Journal of Medical Genetics, Part B: Neuropsychiatric Genetics, 2016 , vol. 171, # 8 p. 1041 - 1048 Title/Abstract Full Text Show Details
Giray, Esra; Şanal Toprak, Canan; Saçaklidir, Rekib; Gündüz, Osman Hakan
Journal of Clinical Psychopharmacology, 2016 , vol. 36, # 6 p. 740 - 742 Title/Abstract Full Text Show Details
Ma, Xiaoling; Zhu, Changhua; Yang, Na; Gan, Lijun; Xia, Kai
Physiologia Plantarum, 2016 , vol. 158, # 4 p. 389 - 401 Title/Abstract Full Text Show Details
Yuan, Qiang; Yang, Feng; Xiao, Yixin; Tan, Shawn; Husain, Nilofer; Ren, Ming; Hu, Zhonghua; Martinowich, Keri; Ng, Julia S; Kim, Paul J; Han, Weiping; Nagata, Koh-ichi; Weinberger, Daniel R; Je, H. Shawn
Biological Psychiatry, 2016 , vol. 80, # 4 p. 312 - 322 Title/Abstract Full Text Show Details
Muramatsu, Ikunobu; Yoshiki, Hatsumi; Uwada, Junsuke; Masuoka, Takayoshi; Sada, Kiyonao; Taniguchi, Takanobu; Nishio, Matomo
Journal of Neurochemistry, 2016 , vol. 139, # 4 p. 566 - 575 Title/Abstract Full Text Show Details
Schroeck, Jennifer L.; Ford, James; Conway, Erin L.; Kurtzhalts, Kari E.; Gee, Megan E.; Vollmer, Krista A.; Mergenhagen, Kari A.
Clinical Therapeutics, 2016 , vol. 38, # 11 p. 2340 - 2372 Title/Abstract Full Text Show Details
Robson, Siân E.; Brookes, Matthew J.; Hall, Emma L.; Palaniyappan, Lena; Kumar, Jyothika; Skelton, Michael; Christodoulou, Nikolaos G.; Qureshi, Ayaz; Jan, Fiesal; Katshu, Mohammad Z.; Liddle, Elizabeth B.; Liddle, Peter F.; Morris, Peter G.
NeuroImage: Clinical, 2016 , vol. 12, p. 869 - 878 Title/Abstract Full Text Show Details
Kori, Medi; Aydln, Busra; Unal, Semra; Arga, Kazim Yalcin; Kazan, Dilek
OMICS A Journal of Integrative Biology, 2016 , vol. 20, # 11 p. 645 - 661 Title/Abstract Full Text Show Details
Kr, Pandey; Jangra, Manoj; Yadav, Ashutosh
International Journal of Nutrition, Pharmacology, Neurological Diseases, 2014 , vol. 4, # 1 p. 43 - 52 Title/Abstract Full Text Show Details
Adkar, Prafulla P.; Jadhav, Pranita P.; Ambavade, Shirishkumar D.; Shelke, Tushar T.; Bhaskar, Vaidhun H.
International Journal of Nutrition, Pharmacology, Neurological Diseases, 2014 , vol. 4, # 2 p. 81 - 87 Title/Abstract Full Text Show Details
Bruxel, Estela M.; Akutagava-Martins, Glaucia C.; Salatino-Oliveira, Angélica; Genro, Julia P.; Zeni, Cristian P.; Polanczyk, Guilherme V.; Chazan, Rodrigo; Schmitz, Marcelo; Rohde, Luis A.; Hutz, Mara H.
American Journal of Medical Genetics, Part B: Neuropsychiatric Genetics, 2016 , vol. 171, # 8 p. 1099 - 1104 Title/Abstract Full Text Show Details
Yang, Jing-Yun; Lai, Yong-Qin; Li, Yu-Xing; Yang, Si-Yuan; Li, Xue-Ru; Huang, Xin-He
Chinese Traditional and Herbal Drugs, 2016 , vol. 47, # 12 p. 2100 - 2107 Title/Abstract Full Text Show Details
Lee; Kim
Clinical Radiology, 2016 , vol. 71, # 12 p. 1240 - 1247 Title/Abstract Full Text Show Details
Huang, Chun-Ta; Chen, Seu-Hwa; Lue, June-Horng; Chang, Chi-Fen; Wen, Wen-Hsin; Tsai, Yi-Ju
Anesthesiology, 2016 , vol. 125, # 6 p. 1202 - 1218 Title/Abstract Full Text Show Details
Nourmahnad, Anahita; Stern, Alex T.; Hotta, Mayo; Stewart, Deirdre S.; Ziemba, Alexis M.; Szabo, Andrea; Forman, Stuart A.
Anesthesiology, 2016 , vol. 125, # 6 p. 1144 - 1158 Title/Abstract Full Text Show Details
Dellarosa, Nicolò; Tappi, Silvia; Ragni, Luigi; Laghi, Luca; Rocculi, Pietro; Dalla Rosa, Marco
Innovative Food Science and Emerging Technologies, 2016 , vol. 38, p. 356 - 364 Title/Abstract Full Text Show Details
Nakawah, Mohammad Obadah; Lai, Eugene C.; Appel, Stanely H.
Neuropsychiatric Disease and Treatment, 2016 , vol. 12, p. 2885 - 2893 Title/Abstract Full Text Show Details
Wu, Hui-Fan; Han, Rong-Bi; Jin, Chun-Zi; Piao, Feng-Yu
CNS and Neurological Disorders - Drug Targets, 2016 , vol. 15, # 10 p. 1333 - 1343 Title/Abstract Full Text Show Details
Goel, Richa; Luxami, Vijay; Paul, Kamaldeep
Current Topics in Medicinal Chemistry, 2016 , vol. 16, # 30 p. 3590 - 3616 Title/Abstract Full Text Show Details
172 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Bluth, Martin H.; Pincus, Matthew R.
Clinics in Laboratory Medicine, 2016 , vol. 36, # 4 p. 603 - 634 Title/Abstract Full Text Show Details
Turton, Samuel; Lingford-Hughes, Anne
Medicine (United Kingdom), 2016 , vol. 44, # 12 p. 693 - 696 Title/Abstract Full Text Show Details
Holtyn, August F.; Tiruveedhula, V.V.N. Phani Babu; Stephen, Michael Rajesh; Cook, James M.; Weerts, Elise M.
Drug and Alcohol Dependence, 2017 , vol. 170, p. 25 - 31 Title/Abstract Full Text Show Details
Mazid, Sanoara; Hall, Baila S.; Odell, Shannon C.; Stafford, Khalifa; Dyer, Andreina D.; Van Kempen, Tracey A.; Selegean, Jane; McEwen, Bruce S.; Waters, Elizabeth M.; Milner, Teresa A.
Neurobiology of Stress, 2016 , vol. 5, p. 37 - 53 Title/Abstract Full Text Show Details
Andrews, Stephen P.; Aves, Sarah J.; Christopher, John A.; Nonoo, Rebecca
Current Topics in Medicinal Chemistry, 2016 , vol. 16, # 29 p. 3438 - 3469 Title/Abstract Full Text Show Details
Xu, Chun; Krabbe, Sabine; Gründemann, Jan; Botta, Paolo; Fadok, Jonathan P.; Osakada, Fumitaka; Saur, Dieter; Grewe, Benjamin F.; Schnitzer, Mark J.; Callaway, Edward M.; Lüthi, Andreas
Cell, 2016 , vol. 167, # 4 p. 961 - 16,972 Title/Abstract Full Text Show Details
Varma, Seema
Medicine (United Kingdom), 2016 , vol. 44, # 12 p. 764 - 767 Title/Abstract Full Text Show Details
Sinclair, Julia
Medicine (United Kingdom), 2016 , vol. 44, # 12 p. 761 - 763 Title/Abstract Full Text Show Details
Sadigh-Eteghad, Saeed; Majdi, Alireza; Mahmoudi, Javad; Golzari, Samad E. J.; Talebi, Mahnaz
Journal of Neural Transmission, 2016 , vol. 123, # 12 p. 1359 - 1367 Title/Abstract Full Text Show Details
Simonyan; Avetisyan; Chavushyan
Pathophysiology, 2016 , vol. 23, # 3 p. 169 - 179 Title/Abstract Full Text Show Details
Chand, Naila; Muhammad, Sher; Khan, Rifat Ullah; Alhidary, Ibrahim Abdullah; Rehman, Zia ur
Environmental Science and Pollution Research, 2016 , vol. 23, # 23 p. 23930 - 23935 Title/Abstract Full Text Show Details
Adefegha, Stephen A.; Oboh, Ganiyu; Adefegha, Omowunmi M.; Henle, Thomas
Pathophysiology, 2016 , vol. 23, # 3 p. 191 - 202 Title/Abstract Full Text Show Details
Clark, Glenn T.; Ram, Saravanan
Oral and Maxillofacial Surgery Clinics of North America, 2016 , vol. 28, # 3 p. 397 - 407 Title/Abstract Full Text Show Details
Shuaib, Waqas; Beatrice, Cristina; Abazid, Ahmad G.
American Journal of Therapeutics, 2016 , vol. 23, # 6 p. e1956 - e1957 Title/Abstract Full Text Show Details
Jacob, Shery; Nair, Anroop B.
Drugs in R and D, 2016 , vol. 16, # 4 p. 303 - 316 Title/Abstract Full Text Show Details
Diaz-Ruiz, Araceli; Montes, Sergio; Salgado-Ceballos, Hermelinda; Maldonado, Valente; Rivera-Espinosa, Liliana; Ríos, Camilo
NeuroReport, 2016 , vol. 27, # 18 p. 1317 - 1322 Title/Abstract Full Text Show Details
Fu, Xin; Wang, QiuHong; Wang, ZhiBin; Kuang, HaiXue; Jiang, Pinghui
Aging and Disease, 2016 , vol. 7, # 4 p. 502 - 513 Title/Abstract Full Text Show Details
Abou-Donia, Mohamed B.; Siracuse, Briana; Gupta, Natasha; Sobel Sokol, Ashly
Critical Reviews in Toxicology, 2016 , vol. 46, # 10 p. 845 - 875 Title/Abstract Full Text Show Details
Wang, Xu; Martínez, María Aránzazu; Wu, Qinghua; Ares, Irma; Martínez-Larrañaga, María Rosa; Anadón, Arturo; Yuan, Zonghui
Critical Reviews in Toxicology, 2016 , vol. 46, # 10 p. 876 - 899 Title/Abstract Full Text Show Details
Chandra, Sadanandavalli; Issac, Thomas; Deepak, Sai; Teja, Ravi; Kuruthukulangara, Seby
Journal of Pediatric Neurosciences, 2016 , vol. 11, # 3 p. 188 - 192 Title/Abstract Full Text Show Details
173 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Meral; Esrefoglu; Dar; Ustunova; Aydin; Demirtas; Arifoglu
Biotechnic and Histochemistry, 2016 , vol. 91, # 8 p. 493 - 500 Title/Abstract Full Text Show Details
Wang, Xi-Feng; Luo, Xiao-Ling; Liu, Wei-Cheng; Hou, Ben-Chao; Huang, Jian; Zhan, Yan-Ping; Chen, Shi-Biao
Medicine (United States), 2016 , vol. 95, # 43 art. no. E4781 Title/Abstract Full Text Show Details
Fujimoto, Moe; Fukuda, Satoru; Sakamoto, Hidetoshi; Takata, Junko; Sawamura, Shigehito
Peptides, 2017 , vol. 87, p. 28 - 33 Title/Abstract Full Text Show Details
Zhang, Hui; Li, Bin
Gummi, Fasern, Kunststoffe, 2016 , vol. 69, # 15 p. 1750 - 1755 Title/Abstract Full Text Show Details
Borrow, Amanda P.; Cameron, Nicole M.
Psychoneuroendocrinology, 2017 , vol. 76, p. 29 - 37 Title/Abstract Full Text Show Details
Yin, Yongqi; Wang, Shuwen; Song, Wuyu; Gao, Lu; Rao, Shengqi; Yang, Zhenquan; Fang, Weiming
Shipin Kexue/Food Science, 2016 , vol. 37, # 21 p. 26 - 30 Title/Abstract Full Text Show Details
Heravi, Majid M.; Zadsirjan, Vahideh
Current Organic Synthesis, 2016 , vol. 13, # 6 p. 780 - 833 Title/Abstract Full Text Show Details
Takahashi, Naomi; Katoh, Ko; Watanabe, Hidehiro; Nakayama, Yuta; Iwasaki, Masazumi; Mizunami, Makoto; Nishino, Hiroshi
Journal of Comparative Neurology, 2017 , vol. 525, # 1 p. 204 - 230 Title/Abstract Full Text Show Details
Wu, Mengqian; Hao, Nanya; Zhou, Dong
Clinical Neuropharmacology, 2016 , vol. 39, # 6 p. 325 - 326 Title/Abstract Full Text Show Details
Striano, Pasquale; Belcastro, Vincenzo; Coppola, Antonietta; Minetti, Carlo; Striano, Salvatore
Clinical Neuropharmacology, 2016 , vol. 39, # 6 p. 281 - 287 Title/Abstract Full Text Show Details
Sahin, Sümeyye; Eulenburg, Volker; Kreis, Wolfgang; Villmann, Carmen; Pischetsrieder, Monika
Plant Foods for Human Nutrition, 2016 , vol. 71, # 4 p. 355 - 360 Title/Abstract Full Text Show Details
Cohen, Yigal; Vaknin, Moshe; Mauch-Mani, Brigitte
Phytoparasitica, 2016 , vol. 44, # 4 p. 513 - 538 Title/Abstract Full Text Show Details
El Ayoubi, Nabil; Sawaya, Raja
Clinical Neuropharmacology, 2016 , vol. 39, # 6 p. 335 - 336 Title/Abstract Full Text Show Details
Wang; Jiang; Lin; Zhang; Zhao
Genes, Brain and Behavior, 2016 , vol. 15, # 8 p. 702 - 710 Title/Abstract Full Text Show Details
Erland, Lauren A E; Turi, Christina E; Saxena, Praveen K.
Biotechnology Advances, 2016 , vol. 34, # 8 p. 1347 - 1361 Title/Abstract Full Text Show Details
Vega, Hector; Agellon, Luis B.; Michalak, Marek
IUBMB Life, 2016 , vol. 68, # 12 p. 943 - 954 Title/Abstract Full Text Show Details
Piyabhan, Pritsana; Wannasiri, Supaporn; Naowaboot, Jarinyaporn
Clinical and Experimental Pharmacology and Physiology, 2016 , vol. 43, # 12 p. 1234 - 1242 Title/Abstract Full Text Show Details
Gripp, Hortênsia S.; Freitas, Juliane S.; Almeida, Eduardo A.; Bisinoti, Márcia C.; Moreira, Altair B.
Ecotoxicology and Environmental Safety, 2017 , vol. 136, p. 173 - 179 Title/Abstract Full Text Show Details
Killiny, Nabil
Physiological and Molecular Plant Pathology, 2017 , vol. 97, p. 20 - 29 Title/Abstract Full Text Show Details
Yakovlev, Aleksey V.; Kurmasheva, Evgeniya D.; Giniatullin, Rashid; Khalilov, Ilgam; Sitdikova, Guzel F.
Neuroscience, 2017 , vol. 340, p. 153 - 165 Title/Abstract Full Text Show Details
174 of 992
175 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Hernandez, Sergio; Valdes, Jorge; Salama, Moises
AANA Journal, 2016 , vol. 84, # 3 p. 167 - 172 Title/Abstract Full Text Show Details
Hylan, Kristi; Vu Nguyen, An-Duyen; Stammen, Katherine
AANA Journal, 2016 , vol. 84, # 3 p. 181 - 187 Title/Abstract Full Text Show Details
Brasca, Milena; Hogenboom, Johannes A.; Morandi, Stefano; Rosi, Veronica; D'Incecco, Paolo; Silvetti, Tiziana; Pellegrino, Luisa
Journal of Agricultural and Food Chemistry, 2016 , vol. 64, # 45 p. 8604 - 8614 Title/Abstract Full Text Show Details
Denoroy, Luc; Parrot, Sandrine
Separation and Purification Reviews, 2017 , vol. 46, # 2 p. 108 - 151 Title/Abstract Full Text Show Details
Furlong, Teri M.; Duncan, Jhodie R.; Corbit, Laura H.; Rae, Caroline D.; Rowlands, Benjamin D.; Maher, Anthony D.; Nasrallah, Fatima A.; Milligan, Carol J.; Petrou, Steven; Lawrence, Andrew J.; Balleine, Bernard W.
Journal of Neurochemistry, 2016 , vol. 139, # 5 p. 806 - 822 Title/Abstract Full Text Show Details
Liu, Tao; Li, Hongyu; Hong, Wanjin; Han, Weiping
Journal of Neurochemistry, 2016 , vol. 139, # 5 p. 748 - 756 Title/Abstract Full Text Show Details
Feng, Weixing; Mei, Shenghui; Zhu, Leting; Yu, Yazhen; Yang, Weili; Gao, Baoqin; Wu, Xiaojuan; Zhao, Zhigang; Fang, Fang
Therapeutic Drug Monitoring, 2016 , vol. 38, # 6 p. 738 - 743 Title/Abstract Full Text Show Details
Zhang, Juan; Chen, Shuangquan; Zhang, Dongming; Shi, Zixiao; Li, Hong; Zhao, Tongbiao; Hu, Baoyang; Zhou, Qi; Jiao, Jianwei
Cell Reports, 2016 , vol. 17, # 9 p. 2326 - 2339 Title/Abstract Full Text Show Details
Deguchi, Yuichi; Harada, Masaya; Shinohara, Ryota; Lazarus, Michael; Cherasse, Yoan; Urade, Yoshihiro; Yamada, Daisuke; Sekiguchi, Masayuki; Watanabe, Dai; Furuyashiki, Tomoyuki; Narumiya, Shuh
Cell Reports, 2016 , vol. 17, # 9 p. 2405 - 2417 Title/Abstract Full Text Show Details
Prousky, Jonathan E.
Journal of Orthomolecular Medicine, 2014 , vol. 29, # 4 p. 167 - 175 Title/Abstract Full Text Show Details
Prousky, Jonathan E.
Journal of Orthomolecular Medicine, 2014 , vol. 29, # 3 p. 109 - 114 Title/Abstract Full Text Show Details
Ding, Guoyu; Hou, Yuanyuan; Peng, Jiamin; Shen, Yunbing; Jiang, Min; Bai, Gang
Journal of Pharmaceutical Analysis, 2016 , vol. 6, # 3 p. 171 - 178 Title/Abstract Full Text Show Details
Yurtdaş Kırımlıoğlu, Gülsel; Menceloğlu, Yusuf; Erol, Kevser; Yazan, Yasemin
Journal of Microencapsulation, 2016 , vol. 33, # 7 p. 625 - 635 Title/Abstract Full Text Show Details
Nolan, Craig; De Angelis, Lisa M.
Current Opinion in Neurology, 2016 , vol. 29, # 6 p. 789 - 796 Title/Abstract Full Text Show Details
McHugh, Stephen M.; Ibinson, James W.; Murty, Vishnu P.
Anesthesia and Analgesia, 2016 , vol. 123, # 6 p. 1638 - 1639 Title/Abstract Full Text Show Details
Singh-Bains, Malvindar K.; Waldvogel, Henry J.; Faull, Richard L. M.
Brain Pathology, 2016 , vol. 26, # 6 p. 741 - 751 Title/Abstract Full Text Show Details
Lange, Thomas; Ko, Cheng-Wen; Lai, Ping-Hong; Dacko, Michael; Tsai, Shang-Yueh; Buechert, Martin
NMR in Biomedicine, 2016 , vol. 29, # 12 p. 1739 - 1747 Title/Abstract Full Text Show Details
Kennedy; Cryan; Dinan; Clarke
Neuropharmacology, 2017 , vol. 112, p. 399 - 412 Title/Abstract Full Text Show Details
Freitag, Jenny; Berod, Luciana; Kamradt, Thomas; Sparwasser, Tim
Immunology and Cell Biology, 2016 , vol. 94, # 10 p. 925 - 934 Title/Abstract Full Text Show Details
Fuss, Taylor L.; Cheng, Leo L.
Topics in Magnetic Resonance Imaging, 2016 , vol. 25, # 5 p. 223 - 235 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Saleh, Muhammad G.; Near, Jamie; Alhamud, Alqadafi; Robertson, Frances; van der Kouwe, André J. W.; Meintjes, Ernesta M.
Magnetic Resonance Materials in Physics, Biology and Medicine, 2016 , vol. 29, # 6 p. 863 - 874 Title/Abstract Full Text Show Details
van Karnebeek, Clara D.M.; Bowden, Kristin; Berry-Kravis, Elizabeth
Pediatric Neurology, 2016 , vol. 65, p. 1 - 13 Title/Abstract Full Text Show Details
Sainz; Mas; Torija
International Journal of Food Microbiology, 2017 , vol. 242, p. 45 - 52 Title/Abstract Full Text Show Details
Barbosa, Humberto M.; Do Nascimento, Jailson N.; Araújo, Thiago A. S.; Duarte, Filipe S.; Albuquerque, Ulysses P.; Vieira, Jeymesson R. C.; De Santana, Edson R. B.; Yara, Ricardo; Lima, Cláudia S. A.; Gomes, Dayane A.; Lira, Eduardo Carvalho.
Anais da Academia Brasileira de Ciencias, 2016 , vol. 88, # 3 p. 1993 - 2004 Title/Abstract Full Text Show Details
Freed, Rachel D.; Coffey, Barbara J.; Mao, Xiangling; Weiduschat, Nora; Kang, Guoxin; Shungu, Dikoma C.; Gabbay, Vilma
Pediatric Neurology, 2016 , vol. 65, p. 64 - 70 Title/Abstract Full Text Show Details
Song, Mingke; Yu, Shan Ping; Mohamad, Osama; Cao, Wenyuan; Wei, Zheng Zachory; Gu, Xiaohuan; Jiang, Michael Qize; Wei, Ling
Neurobiology of Disease, 2017 , vol. 98, p. 9 - 24 Title/Abstract Full Text Show Details
Nguyen, Julia; Ita, Kevin B.; Morra, Matthew J.; Popova, Inna E.
Pharmaceutics, 2016 , vol. 8, # 4 art. no. 33 Title/Abstract Full Text Show Details
Ninomiya, Aya; Matsuura, Nobuyuki; Ichinohe, Tatsuya
Journal of Oral and Maxillofacial Surgery, 2016 , vol. 74, # 10 p. 1932 - 1936 Title/Abstract Full Text Show Details
Zarean, Maryam; Keikha, Mojtaba; Poursafa, Parinaz; Khalighinejad, Pooyan; Amin, Mohammadmehdi; Kelishadi, Roya
Environmental Science and Pollution Research, 2016 , vol. 23, # 24 p. 24642 - 24693 Title/Abstract Full Text Show Details
Barros-Barbosa, Aurora R.; Ferreirinha, Fátima; Oliveira, Ângela; Mendes, Marina; Lobo, M. Graça; Santos, Agostinho; Rangel, Rui; Pelletier, Julie; Sévigny, Jean; Cordeiro, J. Miguel; Correia-de-Sá, Paulo
Purinergic Signalling, 2016 , vol. 12, # 4 p. 719 - 734 Title/Abstract Full Text Show Details
Muceniece, Ruta; Namniece, Jana; Nakurte, Ilva; Jekabsons, Kaspars; Riekstina, Una; Jansone, Baiba
Pharmacological Research, 2016 , vol. 113, p. 760 - 770 Title/Abstract Full Text Show Details
Baracz, Sarah J.; Cornish, Jennifer L.
Frontiers in Neuroendocrinology, 2016 , vol. 43, p. 1 - 18 Title/Abstract Full Text Show Details
Clark, Allison; Mach, Núria
Journal of the International Society of Sports Nutrition, 2016 , vol. 13, # 1 art. no. 43 Title/Abstract Full Text Show Details
Chuhma, Nao; Mingote, Susana; Kalmbach, Abigail; Yetnikoff, Leora; Rayport, Stephen
Biological Psychiatry, 2017 , vol. 81, # 1 p. 43 - 51 Title/Abstract Full Text Show Details
Urs, Nikhil M.; Peterson, Sean M.; Caron, Marc G.
Biological Psychiatry, 2017 , vol. 81, # 1 p. 78 - 85 Title/Abstract Full Text Show Details
Walker, Ashley E.; Spring, Jerrod D.; Travis, Michael J.
Biological Psychiatry, 2017 , vol. 81, # 1 p. e1 - e3 Title/Abstract Full Text Show Details
Zhao, Xianjing; Xu, Maosheng; Jorgenson, Kristen; Kong, Jian
NeuroImage: Clinical, 2017 , vol. 13, p. 33 - 38 Title/Abstract Full Text Show Details
Song, Lihua; Du, Aiying; Xiong, Ying; Jiang, Jing; Zhang, Yao; Tian, Zhaofeng; Yan, Hongli
Tumor Biology, 2016 , vol. 37, # 11 p. 14885 - 14894 Title/Abstract Full Text Show Details
Pina, Melanie M.; Cunningham, Christopher L.
Neurobiology of Learning and Memory, 2017 , vol. 137, p. 83 - 91 Title/Abstract Full Text Show Details
Sun, Alfred Xuyang; Yuan, Qiang; Tan, Shawn; Xiao, Yixin; Wang, Danlei; Khoo, Audrey Tze Ting; Sani, Levena; Tran, Hoang-Dai; Kim, Paul; Chiew, Yong Seng; Lee, Kea Joo; Yen, Yi-Chun; Ng, Huck Hui; Lim, Bing; Je, Hyunsoo Shawn
Cell Reports, 2016 , vol. 16, # 7 p. 1929 - 1941 Title/Abstract Full Text Show Details
176 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
El-Alfy, Abir T.; Joseph, Sharon; Brahmbhatt, Akshar; Akati, Setor; Abourashed, Ehab A.
Pharmaceutical Biology, 2016 , vol. 54, # 12 p. 2933 - 2938 Title/Abstract Full Text Show Details
Gazal, Giath; Fareed, Wamiq Musheer; Zafar, Muhammad Sohail; Al-Samadani, Khalid H.
Saudi Pharmaceutical Journal, 2016 , vol. 24, # 4 p. 379 - 385 Title/Abstract Full Text Show Details
Akiyama, Tomoyuki; Osaka, Hitoshi; Shimbo, Hiroko; Kuhara, Tomiko; Shibata, Takashi; Kobayashi, Katsuhiro; Kurosawa, Kenji; Yoshinaga, Harumi
Brain and Development, 2016 , vol. 38, # 9 p. 871 - 874 Title/Abstract Full Text Show Details
Horino, Asako; Kawawaki, Hisashi; Fukuoka, Masataka; Tsuji, Hitomi; Hattori, Yuka; Inoue, Takeshi; Nukui, Megumi; Kuki, Ichiro; Okazaki, Shin; Tomiwa, Kiyotaka; Hirose, Shinichi
Brain and Development, 2016 , vol. 38, # 9 p. 866 - 870 Title/Abstract Full Text Show Details
Boddum, Kim; Jensen, Thomas P.; Magloire, Vincent; Kristiansen, Uffe; Rusakov, Dmitri A.; Pavlov, Ivan; Walker, Matthew C.
Nature Communications, 2016 , vol. 7, art. no. 13572 Title/Abstract Full Text Show Details
Lefebvre, Stéphanie; Dricot, Laurence; Laloux, Patrice; Desfontaines, Philippe; Evrard, Frédéric; Peeters, André; Jamart, Jacques; Vandermeeren, Yves
Neuroscience, 2017 , vol. 340, p. 424 - 435 Title/Abstract Full Text Show Details
Lim, Eun Yeong; Kim, Yun Tai
BioMed Research International, 2016 , vol. 2016, art. no. 7917528 Title/Abstract Full Text Show Details
Kitano, Takaya; Kinoshita, Makoto; Shimazu, Kohki; Fushimi, Hiroaki; Omori, Kenichi; Hazama, Takanori
Clinical Neurology, 2016 , vol. 56, # 11 p. 764 - 768 Title/Abstract Full Text Show Details
Cieślak, Marek; Wojtczak, Andrzej; Komoszyński, Michał
Pharmacological Reports, 2017 , vol. 69, # 1 p. 130 - 138 Title/Abstract Full Text Show Details
Pinzari, Flavia; Ceci, Andrea; Abu-Samra, Nadir; Canfora, Loredana; Maggi, Oriana; Persiani, Annamaria
Research in Microbiology, 2016 , vol. 167, # 9-10 p. 710 - 722 Title/Abstract Full Text Show Details
Gan, Ren-You; Lui, Wing-Yee; Wu, Kao; Chan, Chak-Lun; Dai, Shu-Hong; Sui, Zhong-Quan; Corke, Harold
Trends in Food Science and Technology, 2017 , vol. 59, p. 1 - 14 Title/Abstract Full Text Show Details
Freitas, Andiara E.; Neis, Vivian B.; Rodrigues, Ana Lúcia S.
European Neuropsychopharmacology, 2016 , vol. 26, # 12 p. 1885 - 1899 Title/Abstract Full Text Show Details
Jia, Fuguo; Jiang, Longwei; Zhang, Yaxiong; Cao, Bin; Zeng, Yong
Nongye Gongcheng Xuebao/Transactions of the Chinese Society of Agricultural Engineering, 2016 , vol. 32, # 22 p. 289 - 295 Title/Abstract Full Text Show Details
Kato, Eiko; Matsuzawa, Rie; Kobayashi, Shunsaku; Fukushima, Teruyuki; Maekawa, Masao; Hori, Yuuichi
Neuroscience Letters, 2017 , vol. 636, p. 270 - 275 Title/Abstract Full Text Show Details
Kennedy, Paul J.; Murphy, Amy B.; Cryan, John F.; Ross, Paul R.; Dinan, Timothy G.; Stanton, Catherine
Trends in Food Science and Technology, 2016 , vol. 57, p. 289 - 301 Title/Abstract Full Text Show Details
Kalinichev, Mikhail; Girard, Françoise; Haddouk, Hasnaà; Rouillier, Mélanie; Riguet, Eric; Royer-Urios, Isabelle; Mutel, Vincent; Lütjens, Robert; Poli, Sonia
Neuropharmacology, 2017 , vol. 114, p. 34 - 47 Title/Abstract Full Text Show Details
Ali, Mubarak; Ramirez, Patricio; Duznovic, Ivana; Nasir, Saima; Mafe, Salvador; Ensinger, Wolfgang
Colloids and Surfaces B: Biointerfaces, 2017 , vol. 150, p. 201 - 208 Title/Abstract Full Text Show Details
Wu, Fan; Liu, Mengmei; Chen, Chen; Chen, Jiaojiao; Tan, Qingsong
Journal of the World Aquaculture Society, 2016 , vol. 47, # 6 p. 820 - 829 Title/Abstract Full Text Show Details
Fichtner, Maximilian; Voigt, Kerstin; Schuster, Stefan
Biochimica et Biophysica Acta - General Subjects, 2017 , vol. 1861, # 1 p. 3258 - 3269 Title/Abstract Full Text Show Details
Kim, Michelle M.; Parolia, Abhijit; Dunphy, Mark P.; Venneti, Sriram
Nature Reviews Clinical Oncology, 2016 , vol. 13, # 12 p. 725 - 739 Title/Abstract Full Text Show Details
177 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Tsuneki, Hiroshi; Sasaoka, Toshiyasu; Sakurai, Takeshi
Trends in Endocrinology and Metabolism, 2016 , vol. 27, # 9 p. 633 - 642 Title/Abstract Full Text Show Details
Kamat, Pradip K.; Mallonee, Carissa J.; George, Akash K.; Tyagi, Suresh C.; Tyagi, Neetu
Alcoholism: Clinical and Experimental Research, 2016 , vol. 40, # 12 p. 2474 - 2481 Title/Abstract Full Text Show Details
Hur, Wooyoung; Rosen, Hugh; Gray, Nathanael S.
Bioorganic and Medicinal Chemistry Letters, 2017 , vol. 27, # 1 p. 1 - 5 Title/Abstract Full Text Show Details
Ribeiro, Fabiola M.; Vieira, Luciene B.; Pires, Rita G.W.; Olmo, Roenick P.; Ferguson, Stephen S.G.
Pharmacological Research, 2017 , vol. 115, p. 179 - 191 Title/Abstract Full Text Show Details
Niehaus, Matthew T.; Elliott, Nicole C.; Katz, Kenneth D.
Journal of Medical Toxicology, 2016 , vol. 12, # 4 p. 406 - 407 Title/Abstract Full Text Show Details
Dinan, Timothy G.; Cryan, John F.
Neuropsychopharmacology, 2017 , vol. 42, # 1 p. 178 - 192 Title/Abstract Full Text Show Details
Lacagnina, Michael J.; Rivera, Phillip D.; Bilbo, Staci D.
Neuropsychopharmacology, 2017 , vol. 42, # 1 p. 156 - 177 Title/Abstract Full Text Show Details
Blum, Kenneth; Febo, Marcelo; Badgaiyan, Rajendra D.; Braverman, Eric R.; Dushaj, Kristina; Li, Mona; Demetrovics, Zsolt
Scientific Reports, 2016 , vol. 22, # 999 p. 1 - 18 Title/Abstract Full Text Show Details
Ainslie, Garrett R.; Gibson, K. Michael; Vogel, Kara R.
Pharmacology Research and Perspectives, 2016 , vol. 4, # 6 art. no. E00265 Title/Abstract Full Text Show Details
Eshel, Neir
Science, 2016 , vol. 354, # 6316 p. 1108 - 1109 Title/Abstract Full Text Show Details
Lo; Tan
BMC Neurology, 2016 , vol. 16, # 1 art. no. 249 Title/Abstract Full Text Show Details
Pin, Jean-Philippe; Bettler, Bernhard
Nature, 2016 , vol. 540, # 7631 p. 60 - 68 Title/Abstract Full Text Show Details
Agarwal, Arun; Sharma, Samiksha; Bansal, Ritu; Meena, Meghraj; Airun, Mala
Journal of Association of Physicians of India, 2016 , vol. 64, # DECEMBER p. 88 - 89 Title/Abstract Full Text Show Details
Becker, Lillian C.; Bergfeld, Wilma F.; Belsito, Donald V.; Hill, Ronald A.; Klaassen, Curtis D.; Liebler, Daniel C.; Marks, James G.; Shank, Ronald C.; Slaga, Thomas J.; Snyder, Paul W.; Andersen, F. Alan; Gill, Lillian J.
International Journal of Toxicology, 2016 , vol. 35, # 3_suppl p. S5 - S15 Title/Abstract Full Text Show Details
Öz, Pınar; Saybaşılı, Hale
Neuroscience Letters, 2017 , vol. 636, p. 196 - 204 Title/Abstract Full Text Show Details
Guo, Fang; Wu, Shuo; Julander, Justin; Ma, Julia; Zhang, Xuexiang; Kulp, John; Cuconati, Andrea; Block, Timothy M.; Du, Yanming; Guo, Ju-Tao; Chang, Jinhong
Journal of Virology, 2016 , vol. 90, # 23 p. 10774 - 10788 Title/Abstract Full Text Show Details
Kavitha; Durga, Padmaja; Ramachandran, Gopinath
Trends in Anaesthesia and Critical Care, 2016 , vol. 11, p. 14 - 18 Title/Abstract Full Text Show Details
Ruggiero, Marco; Corradetti, Renato; Chiarugi, Vincenzo; Pepeu, Giancarlo
EMBO Journal, 1987 , vol. 6, # 6 p. 1595 - 1598 Title/Abstract Full Text Show Details
Amidani, Davide; Tramonti, Angela; Canosa, Andrea Valeria; Campanini, Barbara; Maggi, Stefano; Milano, Teresa; di Salvo, Martino L.; Pascarella, Stefano; Contestabile, Roberto; Bettati, Stefano; Rivetti, Claudio
Biochimica et Biophysica Acta - General Subjects, 2017 , vol. 1861, # 1 p. 3474 - 3489 Title/Abstract Full Text Show Details
Wu, Sixia; Xu, Yaqian; Ling, Ping; Xin, Liang; Di, Guoqing
Gaodianya Jishu/High Voltage Engineering, 2016 , vol. 42, # 11 p. 3689 - 3696 Title/Abstract Full Text Show Details
178 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Kami, Katsuya; Tajima, Fumihiro; Senba, Emiko
Anatomical Science International, 2017 , vol. 92, # 1 p. 79 - 90 Title/Abstract Full Text Show Details
Jesse; Bråthen; Ferrara; Keindl; Ben-Menachem; Tanasescu; Brodtkorb; Hillbom; Leone; Ludolph
Acta Neurologica Scandinavica, 2017 , vol. 135, # 1 p. 4 - 16 Title/Abstract Full Text Show Details
Malawska, Katarzyna; Rak, Aleksandra; Gryzło, Beata; Sałat, Kinga; Michałowska, Małgorzata; Żmudzka, Elżbieta; Lodarski, Krzysztof; Malawska, Barbara; Kulig, Katarzyna
Pharmacological Reports, 2017 , vol. 69, # 1 p. 105 - 111 Title/Abstract Full Text Show Details
Geng, Shanshan; Zhu, Yun; Zhang, Jingping; Cai, Yunqing
International Journal of Clinical and Experimental Medicine, 2016 , vol. 9, # 11 art. no. IJCEM0033332, p. 22317 - 22323 Title/Abstract Full Text Show Details
Van Aken, Olivier; Ford, Ethan; Lister, Ryan; Huang, Shaobai; Millar, A.Harvey
Plant Journal, 2016 , vol. 88, # 4 p. 542 - 558 Title/Abstract Full Text Show Details
Cao, Feifei; Zhang, Limin; Tian, Yang
Journal of Electroanalytical Chemistry, 2016 , vol. 781, p. 278 - 283 Title/Abstract Full Text Show Details
Rackayova, Veronika; Braissant, Olivier; McLin, Valérie A.; Berset, Corina; Lanz, Bernard; Cudalbu, Cristina
Metabolic Brain Disease, 2016 , vol. 31, # 6 p. 1303 - 1314 Title/Abstract Full Text Show Details
Aoki, Chiye; Chowdhury, Tara G.; Wable, Gauri S.; Chen, Yi-Wen
Brain Research, 2017 , vol. 1654, p. 102 - 115 Title/Abstract Full Text Show Details
Dai, Huangguan; Hao, Cuifang; Huang, Xin; Liu, Zhenteng; Lian, Huayu; Liu, Chang
Gynecological Endocrinology, 2016 , vol. 32, # 12 p. 1009 - 1013 Title/Abstract Full Text Show Details
Funck, Thomas; Al-Kuwaiti, Mohammed; Lepage, Claude; Zepper, Peter; Minuk, Jeffrey; Schipper, Hyman M.; Evans, Alan C.; Thiel, Alexander
Human Brain Mapping, 2017 , vol. 38, # 1 p. 326 - 338 Title/Abstract Full Text Show Details
Bawa, Priya; Pradeep, Priyamvada; Kumar, Pradeep; Choonara, Yahya E.; Modi, Girish; Pillay, Viness
Drug Discovery Today, 2016 , vol. 21, # 12 p. 1886 - 1914 Title/Abstract Full Text Show Details
Forte, Nicola; Medrihan, Lucian; Cappetti, Beatrice; Baldelli, Pietro; Benfenati, Fabio
Epilepsia, 2016 , vol. 57, # 12 p. 1987 - 2000 Title/Abstract Full Text Show Details
Liu, Xu; Pfaff, Donald W.; Calderon, Diany P.; Tabansky, Inna; Wang, Xin; Wang, Yun; Kow, Lee-Ming
Developmental Neuroscience, 2016 , vol. 38, # 4 p. 295 - 310 Title/Abstract Full Text Show Details
Xia, Qiang; Mei, Jun; Yu, Wenjuan; Li, Yunfei
Food Research International, 2017 , vol. 91, p. 103 - 114 Title/Abstract Full Text Show Details
Larsson, Martin; Lietzau, Grazyna; Nathanson, David; Östenson, Claes-Göran; Mallard, Carina; Johansson, Maria E.; Nyström, Thomas; Patrone, Cesare; Darsalia, Vladimer
Bioscience Reports, 2016 , vol. 36, # 6 art. no. E00421 Title/Abstract Full Text Show Details
Wang, Lu; Wang, Jing; Yang, Le; Zhou, Shi-meng; Guan, Shao-yu; Yang, Liu-kun; Shi, Qi-xin; Zhao, Ming-Gao; Yang, Qi
Biomedicine and Pharmacotherapy, 2017 , vol. 86, p. 81 - 87 Title/Abstract Full Text Show Details
Perez, Sam D.; Du, Kristy; Rendeiro, Catarina; Wang, Lin; Wu, Qian; Rubakhin, Stanislav S.; Vazhappilly, Rema; Baxter, Jeffrey H.; Sweedler, Jonathan V.; Rhodes, Justin S.
Behavioural Brain Research, 2017 , vol. 320, p. 97 - 112 Title/Abstract Full Text Show Details
Zhang, Ke-Min; Zhao, Guo-Yan; Zhang, Bin-Bin; Xu, Qi; Chu, Chun-Ping; Jin, Hua; Qiu, De-Lai
Neuroscience Letters, 2017 , vol. 638, p. 5 - 11
Title/Abstract Full Text Show Details
Dalmau, Josep
Neurology, 2016 , vol. 87, # 23 p. 2471 - 2482 Title/Abstract Full Text Show Details
Liang; Xie; Zhou; Jiang; Chen
Czech Journal of Animal Science, 2016 , vol. 61, # 12 p. 539 - 550 Title/Abstract Full Text Show Details
179 of 992
180 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Park, Ho; Ryu, Kyoungho; Kim, Yun-Hong; Choi, Won-Jun; Ko, Dongchan
Korean Journal of Anesthesiology, 2016 , vol. 69, # 6 p. 614 - 618 Title/Abstract Full Text Show Details
Li, Xi; Zhang, Jun; Wu, Xi; Yan, Han; Zhang, Yin; He, Ruo-Hui; Tang, Yong-Jun; He, Yi-Jing; Tan, Dan; Mao, Xiao-Yuan; Yin, Ji-Ye; Liu, Zhao-Qian; Zhou, Hong-Hao; Liu, Jie
Pharmacogenomics, 2016 , vol. 17, # 18 p. 2007 - 2014 Title/Abstract Full Text Show Details
Sutera, Flavia Maria; De Caro, Viviana; Giannola, Libero Italo
Expert Opinion on Drug Delivery, 2017 , vol. 14, # 1 p. 93 - 107 Title/Abstract Full Text Show Details
Wakte, Kantilal; Zanan, Rahul; Hinge, Vidya; Khandagale, Kiran; Nadaf, Altafhusain; Henry, Robert
Journal of the Science of Food and Agriculture, 2017 , vol. 97, # 2 p. 384 - 395 Title/Abstract Full Text Show Details
Chen, Hsin-Hung; Cheng, Pei-Wen; Ho, Wen-Yu; Lu, Pei-Jung; Lai, Chi-Cheng; Tseng, Yang-Ming; Fang, Hua-Chang; Sun, Gwo-Ching; Hsiao, Michael; Liu, Chun-Peng; Tseng, Ching-Jiunn
Scientific Reports, 2016 , vol. 6, art. no. 38447 Title/Abstract Full Text Show Details
Lu, Yuzhi; Wu, Shuangchan; Yue, Yuan; He, Si; Li, Jun; Tang, Jun; Wang, Wei; Zhou, Hai-Bing
ACS Medicinal Chemistry Letters, 2016 , vol. 7, # 12 p. 1185 - 1190 Title/Abstract Full Text Show Details
Ansen-Wilson, Lydia J.; Lipinski, Robert J.
NeuroToxicology, 2017 , vol. 58, p. 120 - 129 Title/Abstract Full Text Show Details
Oliveira, Letícia C.; Saraiva, Tessália D.L.; Soares, Siomar C.; Ramos, Rommel T.J.; Sá, Pablo H.C.G.; Carneiro, Adriana R.; Miranda, Fábio; Freire, Matheus; Renan, Wendel; Júnior, Alberto F.O.; Santos, Anderson R.; Pinto, Anne C.; Souza, Bianca M.; Castro, Camila P.; Diniz, Carlos A.A.; Rocha, Clarissa S.; Mariano, Diego C.B.; de Aguiar, Edgar L.; Folador, Edson L.; Barbosa, Eudes G.V.; Aburjaile, Flavia F.; Gonçalves, Lucas A.; Guimarães, Luís C.; Azevedo, Marcela; Agresti, Pamela C.M.; Silva, Renata F.; Tiwari, Sandeep; Almeida, Sintia S.; Hassan, Syed S.; Pereira, Vanessa B.; Abreu, Vinicius A.C.; Pereira, Ulisses P.; Dorella, Fernanda A.; Carvalho, Alex F.; Pereira, Felipe L.; Leal, Carlos A.G.; Figueiredo, Henrique C.P.; Silva, Artur; Miyoshi, Anderson; Azevedo, Vasco
Genome Announcements, 2014 , vol. 2, # 5 art. no. E00980-14 Title/Abstract Full Text Show Details
Mascolo; Sessa; Scavone; De Angelis; Vitale; Berrino; Rossi; Rosano; Capuano
International Journal of Cardiology, 2017 , vol. 227, p. 734 - 742 Title/Abstract Full Text Show Details
Yang, Runqiang; Geng, Chengxin; Gu, Zhenxin
Journal of Food Processing and Preservation, 2016 , vol. 40, # 6 p. 1364 - 1369 Title/Abstract Full Text Show Details
Paucar-Menacho, Luz María; Peñas, Elena; Dueñas, Montserrat; Frias, Juana; Martínez-Villaluenga, Cristina
LWT - Food Science and Technology, 2017 , vol. 76, p. 245 - 252 Title/Abstract Full Text Show Details
Paucar-Menacho, Luz María; Martínez-Villaluenga, Cristina; Dueñas, Montserrat; Frias, Juana; Peñas, Elena
LWT - Food Science and Technology, 2017 , vol. 76, p. 236 - 244 Title/Abstract Full Text Show Details
Tomiyasu, Moyoko; Aida, Noriko; Shibasaki, Jun; Umeda, Masahiro; Murata, Katsutoshi; Heberlein, Keith; Brown, Mark A.; Shimizu, Eiji; Tsuji, Hiroshi; Obata, Takayuki
NMR in Biomedicine, 2017 , vol. 30, # 1 art. no. E3666 Title/Abstract Full Text Show Details
Gunn, Roger N.; Rabiner, Eugenii A.
Seminars in Nuclear Medicine, 2017 , vol. 47, # 1 p. 89 - 98 Title/Abstract Full Text Show Details
Rangel-Huerta, Oscar Daniel; Gil, Angel
International Journal of Molecular Sciences, 2016 , vol. 17, # 12 art. no. 2072 Title/Abstract Full Text Show Details
Gagnon, David J.; Fontaine, Gabriel V.; Smith, Kathryn E.; Riker, Richard R.; Miller, Russell R.; Lerwick, Patricia A.; Lucas; Dziodzio, John T.; Sihler, Kristen C.; Fraser, Gilles L.
Journal of Critical Care, 2017 , vol. 37, p. 119 - 125 Title/Abstract Full Text Show Details
Zhang; Wu; Weng; Li; Yu; Xu
Neuroscience Letters, 2017 , vol. 638, p. 60 - 68 Title/Abstract Full Text Show Details
Kubo, Yoshiyuki; Akanuma, Shin-Ichi; Hosoya, Ken-Ichi
Biological and Pharmaceutical Bulletin, 2016 , vol. 39, # 12 p. 1903 - 1911 Title/Abstract Full Text Show Details
Wang, Guo-Ying; van Eijk, Julia; Demirakca, Traute; Sack, Markus; Krause-Utz, Annegret; Cackowski, Sylvia; Schmahl, Christian; Ende, Gabriele
NeuroImage, 2017 , vol. 147, p. 164 - 174 Title/Abstract Full Text Show Details
Zhang, Ke; Xu, Ting; Yuan, Zhongmin; Wei, Zhisheng; Yamaki, Vitor Nagai; Huang, Mingfa; Huganir, Richard L; Cai, Xiang
Science Signaling, 2016 , vol. 9, # 458 art. no. RA123 Title/Abstract Full Text Show Details
Comment (Pharmacological
Bioactivities present
Data) Reference
Hide facts
181 of 992
Kwok, Chun Lin
Asia Pacific Journal of Medical Toxicology, 2016 , vol. 5, # 2 p. 70 - 71 Title/Abstract Full Text Show Details
Bauomy, Amira A.
CNS and neurological disorders drug targets, 2014 , vol. 13, # 9 p. 1513 - 1519 Title/Abstract Full Text Show Details
Prinsen, Hetty; de Graaf, Robin A.; Mason, Graeme F.; Pelletier, Daniel; Juchem, Christoph
Journal of Magnetic Resonance Imaging, 2017 , vol. 45, # 1 p. 187 - 198 Title/Abstract Full Text Show Details
Chakroborty, Neloy Kumar; Menzel, Randolf; Schubert, Marco; Galizia, Giovanni
European Journal of Neuroscience, 2016 , vol. 44, # 12 p. 3080 - 3093 Title/Abstract Full Text Show Details
Qi, Wanshu; Guan, Qing; Sun, Tuanqi; Cao, Yanjing; Zhang, Li; Guo, Yinlong
Analytica chimica acta, 2015 , vol. 870, p. 75 - 82 Title/Abstract Full Text Show Details
Tsukahara, Takao; Masuhara, Masaaki; Iwai, Haruki; Sonomura, Takahiro; Sato, Tomoaki
Biochemical and biophysical research communications, 2015 , vol. 465, # 1 p. 145 - 151 Title/Abstract Full Text Show Details
Yoo, Ji Hoon; Zell, Vivien; Gutierrez-Reed, Navarre; Wu, Johnathan; Ressler, Reed; Shenasa, Mohammad Ali; Johnson, Alexander B.; Fife, Kathryn H.; Faget, Lauren; Hnasko, Thomas S.
Nature Communications, 2016 , vol. 7, art. no. 13697 Title/Abstract Full Text Show Details
Kumari, Puja; Saha, Lekha; Neha; Vijayanti, Sheekha; Bhatia, Alka; Banerjee, Dibyajyoti; Chakrabarti, Amitava
International Journal of Epilepsy, 2016 , vol. 3, # 2 p. 68 - 74 Title/Abstract Full Text Show Details
Chiara, David C.; Jounaidi, Youssef; Zhou, Xiaojuan; Savechenkov, Pavel Y.; Bruzik, Karol S.; Miller, Keith W.; Cohen, Jonathan B.
Journal of Biological Chemistry, 2016 , vol. 291, # 51 p. 26529 - 26539 Title/Abstract Full Text Show Details
Wei, Yulei; Pandian, Ganesh N.; Zou, Tingting; Taniguchi, Junichi; Sato, Shinsuke; Kashiwazaki, Gengo; Vaijayanthi, Thangavel; Hidaka, Takuya; Bando, Toshikazu; Sugiyama, Hiroshi
ChemistryOpen, 2016 , vol. 5, # 6 p. 517 - 521 Title/Abstract Full Text Show Details
Llorens, Eugenio; García-Agustín, Pilar; Lapeña, Leonor
Scientia Agricola, 2017 , vol. 74, # 1 p. 90 - 100 Title/Abstract Full Text Show Details
Esmaeili, Abolghasem; Dehghani, Maliheh
Research in Molecular Medicine, 2015 , vol. 3, # 2 p. 50 - 54 Title/Abstract Full Text Show Details
Moghaddam, Shokoufe Nikpour; Qujeq, Durdi; Efahani, Ali Asghar Rastegari
Research in Molecular Medicine, 2015 , vol. 3, # 1 p. 22 - 25 Title/Abstract Full Text Show Details
ffrench-Constant, Richard H.; Williamson, Martin S.; Davies, T. G. Emyr; Bass, Chris
Journal of Neurogenetics, 2016 , vol. 30, # 3-4 p. 163 - 177 Title/Abstract Full Text Show Details
Larsson, Max
Neuroscience Letters, 2017 , vol. 638, p. 96 - 101 Title/Abstract Full Text Show Details
Knox, Logan T.; Jing, Yu; Bawazier-Edgecombe, Jamal; Collie, Nicola D.; Zhang, Hu; Liu, Ping
Pharmacology Biochemistry and Behavior, 2017 , vol. 153, p. 45 - 59 Title/Abstract Full Text Show Details
Hsieh, Yi-Chun; Puche, Adam C
Developmental Neurobiology, 2015 , vol. 75, # 8 p. 791 - 804 Title/Abstract Full Text Show Details
Rosental, Leah; Perelman, Adi; Nevo, Noa; Toubiana, David; Samani, Talya; Batushansky, Albert; Sikron, Noga; Saranga, Yehoshua; Fait, Aaron
BMC Genomics, 2016 , vol. 17, # 1 art. no. 1047 Title/Abstract Full Text Show Details
Indrowati, Meti; Pratiwi, Rarastoeti; Rumiyati; Astuti, Pudji
Pakistan Journal of Biological Sciences, 2017 , vol. 20, # 1 p. 28 - 35 Title/Abstract Full Text Show Details
Abdel-Rafei, Mkh; Amin; Hasan
Human and Experimental Toxicology, 2017 , vol. 36, # 1 p. 62 - 81 Title/Abstract Full Text Show Details
Show next 200 Comment (Pharmacological Data)
Bioactivities present
Reference
Rombo, Diogo M.; Ribeiro, Joaquim A.; Sebastião, Ana M.
Journal of Neurochemistry, 2016 , vol. 139, # 6 p. 1056 - 1070 Title/Abstract Full Text Show Details
Zheng, Hong; Zheng, Yongquan; Wang, Dan; Cai, Aimin; Lin, Qiuting; Zhao, Liangcai; Chen, Minjiang; Deng, Mingjie; Ye, Xinjian; Gao, Hongchang
Journal of Cerebral Blood Flow and Metabolism, 2017 , vol. 37, # 1 p. 332 - 343 Title/Abstract Full Text Show Details
Vishnoi, Shruti; Raisuddin, Sheikh; Parvez, Suhel
Journal of Environmental Pathology, Toxicology and Oncology, 2016 , vol. 35, # 4 p. 365 - 374 Title/Abstract Full Text Show Details
Precious, Sophie V.; Kelly, Claire M.; Allen, Nicholas D.; Rosser, Anne E.
Neurogenesis, 2016 , vol. 3, # 1 p. 14 Title/Abstract Full Text Show Details
Hamamoto, Masakazu; Kiyokage, Emi; Sohn, Jaerin; Hioki, Hiroyuki; Harada, Tamotsu; Toida, Kazunori
Journal of Comparative Neurology, 2017 , vol. 525, # 3 p. 574 - 591
Title/Abstract Full Text Show Details
Thevenet, Damien; Pastor, Victoria; Baccelli, Ivan; Balmer, Andrea; Vallat, Armelle; Neier, Reinhard; Glauser, Gaétan; Mauch-Mani, Brigitte
New Phytologist, 2017 , vol. 213, # 2 p. 552 - 559 Title/Abstract Full Text Show Details
Ramirez, Jorge E.; Stell, Brandon M.
Cell Reports, 2016 , vol. 17, # 12 p. 3125 - 3132 Title/Abstract Full Text Show Details
Mikkelsen, Kathleen; Stojanovska, Lily; Apostolopoulos, Vasso
Current Medicinal Chemistry, 2016 , vol. 23, # 38 p. 4317 - 4337 Title/Abstract Full Text Show Details
Chowdhury; Zhang; Thomas; Banasr; Ma; Pittman; Bristow; Schaeffer; Duman; Rothman; Behar; Sanacora
Molecular Psychiatry, 2017 , vol. 22, # 1 p. 120 - 126 Title/Abstract Full Text Show Details
Aghdam, Morteza Soleimani; Fard, Javad Rezapour
Food Chemistry, 2017 , vol. 221, p. 1650 - 1657 Title/Abstract Full Text Show Details
Dixit, Aparna Banerjee; Tripathi, Manjari; Chandra, P. Sarat; Banerjee, Jyotirmoy
International Journal of Surgery, 2016 , vol. 36, p. 483 - 491 Title/Abstract Full Text Show Details
Stedehouder; Kushner
Molecular Psychiatry, 2017 , vol. 22, # 1 p. 4 - 12 Title/Abstract Full Text Show Details
Rangel-Barajas, Claudia; Rebec, George V.
Journal of Huntington's Disease, 2016 , vol. 5, # 4 p. 303 - 331 Title/Abstract Full Text Show Details
Nagappa, Madhu; Bindu, Parayil Sankaran; Chiplunkar, Shwetha; Govindaraj, Periasamy; Narayanappa, Gayathri; Krishnan, Ayyappan; Bharath, M.M. Srinivas; Swaminathan, Aarthi; Saini, Jitender; Arvinda, Hanumanthapura R.; Sinha, Sanjib; Mathuranath, Pavagada S.; Taly, Arun B.
Brain and Development, 2017 , vol. 39, # 2 p. 161 - 165 Title/Abstract Full Text Show Details
Lippi, Giordano; Fernandes, Catarina C.; Ewell, Laura A.; John, Danielle; Romoli, Benedetto; Curia, Giulia; Taylor, Seth R.; Frady, E. Paxon; Jensen, Anne B.; Liu, Jerry C.; Chaabane, Melanie M.; Belal, Cherine; Nathanson, Jason L.; Zoli, Michele; Leutgeb, Jill K.; Biagini, Giuseppe; Yeo, Gene W.; Berg, Darwin K.
Neuron, 2016 , vol. 92, # 6 p. 1337 - 1351 Title/Abstract Full Text Show Details
Yang, Wu-Zhou; Liu, Ting-Ting; Cao, Jun-Wei; Chen, Xuan-Fu; Liu, Xiao; Wang, Min; Su, Xin; Zhang, Shu-Qing; Qiu, Bin-Long; Hu, WenXiang; Liu, Lin-Yun; Ma, Lan; Yu, Yong-Chun
Neuron, 2016 , vol. 92, # 6 p. 1352 - 1367 Title/Abstract Full Text Show Details
Cáceres, Patricio J.; Peñas, Elena; Martinez-Villaluenga, Cristina; Amigo, Lourdes; Frias, Juana
Journal of Cereal Science, 2017 , vol. 73, p. 1 - 9 Title/Abstract Full Text Show Details
Kim, Tae Yeon; Niimi, Kimie; Takahashi, Eiki
Brain Research, 2017 , vol. 1655, p. 138 - 144 Title/Abstract Full Text Show Details
Papale, Alessandro; d'Isa, Raffaele; Menna, Elisabetta; Cerovic, Milica; Solari, Nicola; Hardingham, Neil; Cambiaghi, Marco; Cursi, Marco; Barbacid, Mariano; Leocani, Letizia; Fasano, Stefania; Matteoli, Michela; Brambilla, Riccardo
Biological Psychiatry, 2017 , vol. 81, # 3 p. 179 - 192 Title/Abstract Full Text Show Details
Morris, Sidney M.
Journal of Nutrition, 2016 , vol. 146, # 12 p. S2579 - S2586 Title/Abstract Full Text Show Details
182 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Konya, Yutaka; Taniguchi, Moyu; Fukusaki, Eiichiro
Journal of Bioscience and Bioengineering, 2017 , vol. 123, # 1 p. 126 - 133 Title/Abstract Full Text Show Details
Sagara, Tatsuya; Fiechter, Gregor; Pachner, Martin; Mayer, Helmut K.; Vollmann, Johann
Journal of Food Composition and Analysis, 2017 , vol. 56, p. 11 - 17 Title/Abstract Full Text Show Details
Weidacker, Kathrin; Weidemann, Christoph T.; Boy, Frederic; Johnston, Stephen J.
Clinical Neurophysiology, 2016 , vol. 127, # 9 p. 3102 - 3109 Title/Abstract Full Text Show Details
Pal, Sikander; Zhao, Jiangsan; Khan, Asif; Yadav, Narendra Singh; Batushansky, Albert; Barak, Simon; Rewald, Boris; Fait, Aaron; Lazarovitch, Naftali; Rachmilevitch, Shimon
Scientific Reports, 2016 , vol. 6, art. no. 39321 Title/Abstract Full Text Show Details
Simpson, Robin; Devenyi, Gabriel A.; Jezzard, Peter; Hennessy, T. Jay; Near, Jamie
Magnetic Resonance in Medicine, 2017 , vol. 77, # 1 p. 23 - 33 Title/Abstract Full Text Show Details
Pokusaeva; Johnson; Luk; Uribe; Fu; Oezguen; Matsunami; Lugo; Major; Mori-Akiyama; Hollister; Dann; Shi; Engler; Savidge; Versalovic
Neurogastroenterology and Motility, 2017 , vol. 29, # 1 art. no. E12904 Title/Abstract Full Text Show Details
Oeltzschner, Georg; Puts, Nicolaas A.J.; Chan, Kimberly L.; Boer, Vincent O.; Barker, Peter B.; Edden, Richard A.E.
Magnetic Resonance in Medicine, 2017 , vol. 77, # 1 p. 16 - 22 Title/Abstract Full Text Show Details
Carson, Mariah; Kerrigan, Sarah
Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences, 2017 , vol. 1040, p. 289 - 294 Title/Abstract Full Text Show Details
Abdellatif, Abbaoui; Omar, E.L. Hiba; Halima, Gamrani
Acta Histochemica, 2017 , vol. 119, # 1 p. 10 - 17 Title/Abstract Full Text Show Details
Borisova; Pozdnyakova; Shaitanova; Gerus; Dudarenko; Haufe; Kukhar
Bioorganic and Medicinal Chemistry, 2017 , vol. 25, # 2 p. 759 - 764 Title/Abstract Full Text Show Details
Liao, Caizhi; Zhang, Meng; Yao, Mei Yu; Hua, Tao; Li, Li; Yan, Feng
Advanced Materials, 2015 , vol. 27, # 46 p. 7493 - 7527 Title/Abstract Full Text Show Details
Kunisawa, Kazuo; Kido, Kiwamu; Nakashima, Natsuki; Matsukura, Takuya; Nabeshima, Toshitaka; Hiramatsu, Masayuki
European Journal of Pharmacology, 2017 , vol. 796, p. 122 - 130 Title/Abstract Full Text Show Details
Tomšič, Martin; Bajrović, Fajko
Pflugers Archiv European Journal of Physiology, 2000 , vol. 440, # 1 p. R107 - R108 Title/Abstract Full Text Show Details
Singracha, Pannarat; Niamsiri, Nuttawee; Visessanguan, Wonnop; Lertsiri, Sittiwat; Assavanig, Apinya
LWT - Food Science and Technology, 2017 , vol. 78, p. 181 - 188 Title/Abstract Full Text Show Details
Didriksen, Michael; Fejgin, Kim; Nilsson, Simon R. O.; Birknow, Michelle R.; Grayton, Hannah M.; Larsen, Peter H.; Lauridsen, Jes B.; Nielsen, Vibeke; Celada, Pau; Santana, Noemi; Kallunki, Pekka; Christensen, Kenneth V.; Werge, Thomas M.; Stensbøl, Tine B.; Egebjerg, Jan; Gastambide, Francois; Artigas, Francesc; Bastlund, Jesper F.; Nielsen, Jacob
Journal of Psychiatry and Neuroscience, 2017 , vol. 42, # 1 p. 48 - 58 Title/Abstract Full Text Show Details
Kaptan, Zülal; Üzüm, Gülay
Turk Noroloji Dergisi, 2016 , vol. 22, # 4 p. 149 - 155 Title/Abstract Full Text Show Details
Zhong, Weixia; Picca, Andrew J.; Lee, Albert S.; Darmani, Nissar A.
Autonomic Neuroscience: Basic and Clinical, 2017 , vol. 202, p. 18 - 27 Title/Abstract Full Text Show Details
Habibi, Mitra; Ahmad, Saba; Sinsioco, Claudine
Journal of Pediatric Epilepsy, 2016 , vol. 5, # 4 p. 159 - 167 Title/Abstract Full Text Show Details
Nôga, Diana Aline Morais Ferreira; Brandão, Luiz Eduardo Mateus; Cagni, Fernanda Carvalho; Silva, Delano; De Azevedo, Dina Lilia Oliveira; Araújo, Arrilton; Dos Santos, Wagner Ferreira; Miranda, Antonio; Da Silva, Regina Helena; Ribeiro, Alessandra Mussi
Toxins, 2017 , vol. 9, # 1 art. no. 5 Title/Abstract Full Text Show Details
Liu, Shicheng; Jia, Feiyong; Xia, Tianliang; Xu, Naijun; Zhang, Ying; Jiang, Huiyi
International Journal of Clinical and Experimental Medicine, 2016 , vol. 9, # 12 art. no. IJCEM0030906, p. 23363 - 23374 Title/Abstract Full Text Show Details
183 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Rodriguez; Mendoza-Trejo; Hernandez-Plata; Giordano
NeuroToxicology, 2017 , vol. 58, p. 161 - 170 Title/Abstract Full Text Show Details
Yoo, Chi-Hyeon; Song, Kyu-Ho; Lim, Song-I; Lee, Do-Wan; Woo, Dong-Cheol; Choe, Bo-Young
Neuroscience Letters, 2017 , vol. 637, p. 57 - 63 Title/Abstract Full Text Show Details
Atagün, Murat İlhan; Soykan, Çağlar; Serdar Süleyman, Can; Çayköylü, Ali; Ulusoy-Kaymak, Semra; Şıkoğlu, Elif Muazzez; Moore, Constance Mary; Algın, Oktay; Phillips, Mary Louise; Öngür, Dost
Neuroscience Letters, 2017 , vol. 637, p. 70 - 74 Title/Abstract Full Text Show Details
Zhao, Xian-En; He, Yongrui; Li, Meng; Chen, Guang; Wei, Na; Wang, Xiao; Sun, Jing; Zhu, Shuyun; You, Jinmao
Journal of Pharmaceutical and Biomedical Analysis, 2017 , vol. 135, p. 186 - 198 Title/Abstract Full Text Show Details
Hayes, Bryan D.; Nelson, Lewis S.
Journal of Intensive Care Medicine, 2016 , vol. 31, # 5 p. 353 - 354 Title/Abstract Full Text Show Details
Goufo, Piebiep; Trindade, Henrique
Critical Reviews in Food Science and Nutrition, 2017 , vol. 57, # 5 p. 893 - 922 Title/Abstract Full Text Show Details
Choi, Eunkyung; Kim, Donggyeong; Jeon, Younghoon
Medicine (United States), 2016 , vol. 95, # 51 p. e5153 - e5153 Title/Abstract Full Text Show Details
Chung, Man-Kyo; Park, Jennifer; Asgar, Jamila; Ro, Jin Y.
Molecular Pain, 2016 , vol. 12 Title/Abstract Full Text Show Details
Kami, Katsuya; Taguchi, Satoru; Tajima, Fumihiro; Senba, Emiko
Molecular Pain, 2016 , vol. 12 Title/Abstract Full Text Show Details
Reckziegel, Diane; Raschke, Felix; Cottam, William J; Auer, Dorothee P
Molecular Pain, 2016 , vol. 12 Title/Abstract Full Text Show Details
Fedoseeva, Larisa A.; Klimov, Leonid O.; Ershov, Nikita I.; Alexandrovich, Yury V.; Efimov, Vadim M.; Markel, Arcady L.; Redina, Olga E.
BMC Genomics, 2016 , vol. 17, art. no. 989 Title/Abstract Full Text Show Details
Vogel, Kara R.; Ainslie, Garrett R.; Schmidt, Michelle A.; Wisor, Jonathan P.; Gibson, K. Michael
Pediatric Neurology, 2017 , vol. 66, p. 44 - 1,52 Title/Abstract Full Text Show Details
Rastogi, Bhawana; Arora, Ankush; Gupta, Kumkum; Jain, Manish; Singh, Vijendra Pal; Rastogi, Avinash
Open Anesthesiology Journal, 2016 , vol. 10, p. 27 - 33 Title/Abstract Full Text Show Details
Häge, Alexander; Banaschewski, Tobias; Buitelaar, Jan K.; Dijkhuizen, Rick M.; Franke, Barbara; Lythgoe, David J.; Mechler, Konstantin; R. Williams, Steven C.; Dittmann, Ralf W.
Trials, 2016 , vol. 17, # 1 art. no. 141 Title/Abstract Full Text Show Details
Yunes, Roman A.; Klimina, Ksenia M.; Emelyanov, Kirill V.; Zakharevich, Natalia V.; Poluektova, Elena U.; Danilenko, Valery N.
Genome Announcements, 2016 , vol. 3, # 2 art. no. E00261-15 Title/Abstract Full Text Show Details
Barad, Shiri; Sela, Noa; Kumar, Dilip; Kumar-Dubey, Amit; Glam-Matana, Nofar; Sherman, Amir; Prusky, Dov
BMC Genomics, 2016 , vol. 17, # 1 art. no. 330 Title/Abstract Full Text Show Details
Zheng, Yongquan; Yang, Yunjun; Dong, Baijun; Zheng, Hong; Lin, Xiaodong; Du, Yao; Li, Xiaokun; Zhao, Liangcai; Gao, Hongchang
Molecular Brain, 2016 , vol. 9, # 1 art. no. 40 Title/Abstract Full Text Show Details
Van Horn, John Darrell; Bhattrai, Avnish; Irimia, Andrei
Trends in Neurosciences, 2017 , vol. 40, # 1 p. 39 - 59 Title/Abstract Full Text Show Details
Sai, Na; Sun, Wenjing; Wu, Yuntang; Sun, Zhong; Huang, Guowei
Journal of the Iranian Chemical Society, 2017 , vol. 14, # 1 p. 257 - 268 Title/Abstract Full Text Show Details
Nait Mouloud; Ouennoughi; Yaiche; Kaidi; Iguer-ouada
Theriogenology, 2017 , vol. 91, p. 44 - 54 Title/Abstract Full Text Show Details
184 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Grzęda, Emilia; Schlicker, Eberhard; Toczek, Marek; Zalewska, Iwona; Baranowska-Kuczko, Marta; Malinowska, Barbara
Naunyn-Schmiedeberg's Archives of Pharmacology, 2017 , vol. 390, # 1 p. 25 - 35 Title/Abstract Full Text Show Details
Carta, Anna R.; Mulas, Giovanna; Bortolanza, Mariza; Duarte, Terence; Pillai, Elisabetta; Fisone, Gilberto; Vozari, Rita Raisman; Del-Bel, Elaine; Bolam, Paul
European Journal of Neuroscience, 2017 , vol. 45, # 1 p. 73 - 91 Title/Abstract Full Text Show Details
Palus; Chrobok; Kepczynski; Lewandowski
Neuroscience, 2017 , vol. 343, p. 10 - 20 Title/Abstract Full Text Show Details
Zhou, Xinyu; Liu, Lanxiang; Zhang, Yuqing; Pu, Juncai; Yang, Lining; Zhou, Chanjuan; Yuan, Shuai; Zhang, Hanping; Xie, Peng
Neuroscience, 2017 , vol. 343, p. 1 - 9 Title/Abstract Full Text Show Details
Kilpatrick, Casey L.; Murakami, Shoko; Feng, Mengyang; Wu, Xia; Lal, Rachnanjali; Chen, Gong; Du, Keyong; Luscher, Bernhard
Journal of Biological Chemistry, 2016 , vol. 291, # 53 p. 27371 - 27386 Title/Abstract Full Text Show Details
Bolbat, Andrey; Schultz, Carsten
Biology of the Cell, 2017 , vol. 109, # 1 p. 1 - 23 Title/Abstract Full Text Show Details
Grewal, Jasneet; Khare
Bioprocess and Biosystems Engineering, 2017 , vol. 40, # 1 p. 145 - 152 Title/Abstract Full Text Show Details
Chew, Bee Lynn; Fisk, Ian D.; Fray, Rupert; Tucker, Gregory A.; Bodi, Zsuzsanna; Ferguson, Alison; Xia, Wei; Seymour, Graham B.
Plant Cell Reports, 2017 , vol. 36, # 1 p. 81 - 87 Title/Abstract Full Text Show Details
Takayama, Mariko; Matsukura, Chiaki; Ariizumi, Tohru; Ezura, Hiroshi
Plant Cell Reports, 2017 , vol. 36, # 1 p. 103 - 116 Title/Abstract Full Text Show Details
Panrod, Kritchapol; Tansirikongkol, Anyarporn; Panapisal, Vipaporn
Thai Journal of Pharmaceutical Sciences, 2016 , vol. 40, # 4 p. 203 - 208 Title/Abstract Full Text Show Details
Xu, Yu; Xiao, Huayun
Environmental Pollution, 2017 , vol. 221, p. 180 - 190 Title/Abstract Full Text Show Details
Cui, Li; Rui, Changhui; Yang, Daibin; Wang, Zhenying; Yuan, Huizhu
BMC Genomics, 2017 , vol. 18, # 1 art. no. 20 Title/Abstract Full Text Show Details
Biedroń, Izabela; Traczewska, Teodora; Konieczny, Tomasz; Plłaza, Grazyna
Journal of Ecological Engineering, 2017 , vol. 18, # 1 p. 284 - 293 Title/Abstract Full Text Show Details
Zhou, Zheng; Vailati-Riboni, Mario; Luchini, Daniel N.; Loor, Juan J.
Nutrients, 2017 , vol. 9, # 1 art. no. 10 Title/Abstract Full Text Show Details
Miranda-Páez, Abraham; Zamudio, Sergio R.; Vázquez-León, Priscila; Sandoval-Herrera, Vicente; Villanueva-Becerril, Ivan; Carli, Giancarlo Hormones and Behavior, 2017 , vol. 89, p. 23 - 29 Title/Abstract Full Text Show Details
Watanabe, Yousuke; Murakami, Tomoaki; Kawashima, Masashi; Hasegawa-Baba, Yasuko; Mizukami, Sayaka; Imatanaka, Nobuya; Akahori, Yumi; Yoshida, Toshinori; Shibutani, Makoto
Neurotoxicity Research, 2017 , vol. 31, # 1 p. 46 - 62 Title/Abstract Full Text Show Details
Babij, Rachel; De Marco Garcia, Natalia
Frontiers in Biology, 2016 , vol. 11, # 6 p. 459 - 470 Title/Abstract Full Text Show Details
Chrobok, Lukasz; Palus, Katarzyna; Jeczmien-Lazur, Jagoda Stanislawa; Chrzanowska, Anna; Kepczynski, Mariusz; Lewandowski, Marian Henryk
Experimental Neurology, 2017 , vol. 289, p. 103 - 116 Title/Abstract Full Text Show Details
Sabanov, Victor; Braat, Sien; D'Andrea, Laura; Willemsen, Rob; Zeidler, Shimriet; Rooms, Liesbeth; Bagni, Claudia; Kooy, R. Frank; Balschun, Detlef
Neuropharmacology, 2017 , vol. 116, p. 71 - 81 Title/Abstract Full Text Show Details
Zunhammer, Matthias; Schweizer, Lauren M.; Witte, Vanessa; Harris, Richard E.; Bingel, Ulrike; Schmidt-Wilcke, Tobias
Pain, 2016 , vol. 157, # 10 p. 2248 - 2256
Title/Abstract Full Text Show Details
185 of 992
186 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Moog; Entringer; Heim; Wadhwa; Kathmann; Buss
Neuroscience, 2017 , vol. 342, p. 68 - 100 Title/Abstract Full Text Show Details
Hung, Kevin; Condakes, Matthew L.; Morikawa, Takahiro; Maimone, Thomas J.
Journal of the American Chemical Society, 2016 , vol. 138, # 51 p. 16616 - 16619 Title/Abstract Full Text Show Details
Albers, H. Elliott; Walton, James C.; Gamble, Karen L.; McNeill, John K.; Hummer, Daniel L.
Frontiers in Neuroendocrinology, 2017 , vol. 44, p. 35 - 82 Title/Abstract Full Text Show Details
Wang, Ying; Wang, Yu; Lang, Chong; Wei, Dongzhi; Xu, Ping; Xie, Jingli
Genome Announcements, 2015 , vol. 3, # 3 art. no. E00552-15 Title/Abstract Full Text Show Details
Lee, Yi-Ying; Chao, Tung-Bo; Sheu, Ming-Jen; Tian, Yu-Feng; Chen, Tzu-Ju; Lee, Sung-Wei; He, Hong-Lin; Chang, I-Wei; Hsing, Chung-Hsi; Lin, Ching-Yih; Li, Chien-Feng
Journal of Cancer, 2016 , vol. 7, # 12 p. 1716 - 1723 Title/Abstract Full Text Show Details
Dyachkova, Marina S.; Klimina, Ksenia M.; Kovtun, Alexey S.; Zakharevich, Natalia V.; Nezametdinova, Venera Z.; Averina, Olga V.; Danilenko, Valery N.
Genome Announcements, 2015 , vol. 3, # 4 art. no. E00709-15 Title/Abstract Full Text Show Details
Bhosale, Uma A.; Yegnanarayan, Radha; Gupta, Ankush; Shah, Priyank; Sardesai, Shalini
Journal of Basic and Clinical Physiology and Pharmacology, 2017 , vol. 28, # 1 p. 59 - 66 Title/Abstract Full Text Show Details
Freels, Timothy G.; Cook, Melloni N.
Psychology and Neuroscience, 2016 , vol. 9, # 4 p. 465 - 489 Title/Abstract Full Text Show Details
Eggermont, Jos J.
Hearing Research, 2017 , vol. 343, p. 176 - 190 Title/Abstract Full Text Show Details
Yan, Jun; Yan, Hui; Liu, Li Xue; Chen, Wen Feng; Zhang, Xiao Xia; Verástegui-Valdés, Myrthala M.; Wang, En Tao; Han, Xiao Zeng
Archives of Microbiology, 2017 , vol. 199, # 1 p. 97 - 104 Title/Abstract Full Text Show Details
Rackwitz; Gäbel
Journal of Animal Physiology and Animal Nutrition, 2017 , vol. 101, # 1 p. 38 - 45 Title/Abstract Full Text Show Details
Premoli, Isabella; Biondi, Andrea; Carlesso, Sara; Rivolta, Davide; Richardson, Mark P.
Epilepsia, 2017 , vol. 58, # 1 p. 42 - 50 Title/Abstract Full Text Show Details
Webb, Benjamin A.; Karl Compton; Castañeda Saldaña, Rafael; Arapov, Timofey D.; Keith Ray; Helm, Richard F.; Scharf, Birgit E.
Molecular Microbiology, 2017 , vol. 103, # 2 p. 333 - 346 Title/Abstract Full Text Show Details
Rabiei, Zahra
Asian Pacific Journal of Tropical Biomedicine, 2017 , vol. 7, # 2 p. 166 - 172 Title/Abstract Full Text Show Details
Somasundaram, Sivachandiran; Tran, Kim-Ngan T.; Ravikumar, Sambandam; Hong, Soon Ho
Biochemical Engineering Journal, 2017 , vol. 120, p. 1 - 6 Title/Abstract Full Text Show Details
Rahayu, Yen Yen Sally; Yoshizaki, Yumiko; Yamaguchi, Keiko; Okutsu, Kayu; Futagami, Taiki; Tamaki, Hisanori; Sameshima, Yoshihiro; Takamine, Kazunori
Food Chemistry, 2017 , vol. 224, p. 398 - 406 Title/Abstract Full Text Show Details
Dereziński, Paweł; Klupczynska, Agnieszka; Sawicki, Wojciech; Pałka, Jerzy A.; Kokot, Zenon J.
International Journal of Medical Sciences, 2017 , vol. 14, # 1 p. 1 - 12 Title/Abstract Full Text Show Details
Chaiyasut, Chaiyavat; Sivamaruthi, Bhagavathi Sundaram; Pengkumsri, Noppawat; Keapai, Waranya; Kesika, Periyanaina; Saelee, Manee; Tojing, Parichart; Sirilun, Sasithorn; Chaiyasut, Khontaros; Peerajan, Sartjin; Lailerd, Narissara
Pharmaceuticals, 2017 , vol. 10, # 1 art. no. 3 Title/Abstract Full Text Show Details
Al-Quraan; Al-Omari
Plant Biosystems, 2017 , vol. 151, # 1 p. 148 - 157 Title/Abstract Full Text Show Details
Fakhoury, Marc
Molecular Neurobiology, 2017 , vol. 54, # 1 p. 768 - 778 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
Bioactivities present
Reference
Maludzińska, Ewa; Rudzińska, Monika; Stępień, Artur; Szczudlik, Andrzej
Neurologia i Neurochirurgia Polska, 2016 , vol. 50, # 1 p. 59 - 62 Title/Abstract Full Text Show Details
Arashida, Naoko; Nishimoto, Rumi; Harada, Masashi; Shimbo, Kazutaka; Yamada, Naoyuki
Analytica Chimica Acta, 2017 , vol. 954, p. 77 - 87 Title/Abstract Full Text Show Details
Cocco, Arianna; Rönnberg, A.M. Carolina; Jin, Zhe; André, Gonçalo Igreja; Vossen, Laura E.; Bhandage, Amol K.; Thörnqvist, Per-Ove; Birnir, Bryndis; Winberg, Svante
Neuroscience, 2017 , vol. 343, p. 300 - 321 Title/Abstract Full Text Show Details
Roudbaraki; Nori-Shargh
Russian Chemical Bulletin, 2016 , vol. 65, # 4 p. 1148 - 1150 Title/Abstract Full Text Show Details
Lalchandani, Rupa R.; Vicini, Stefano
Physiological Reports, 2013 , vol. 1, # 6 art. no. E00164, p. 1 - 12 Title/Abstract Full Text Show Details
Kolesnikova, Tatiana O.; Khatsko, Sergey L.; Shevyrin, Vadim A.; Morzherin, Yuri Yu; Kalueff, Allan V.
Neurotoxicology and Teratology, 2017 , vol. 59, p. 62 - 67 Title/Abstract Full Text Show Details
Alva, Norma; Alva, Ronald; Carbonell, Teresa
Current Medicinal Chemistry, 2016 , vol. 23, # 39 p. 4396 - 4417 Title/Abstract Full Text Show Details
Sunagawa, Masanobu; Shimizu-Okabe, Chigusa; Kim, Jeongtae; Kobayashi, Shiori; Kosaka, Yoshinori; Yanagawa, Yuchio; Matsushita, Masayuki; Okabe, Akihito; Takayama, Chitoshi
Neuroscience, 2017 , vol. 343, p. 459 - 471 Title/Abstract Full Text Show Details
Luan, Yuan-Hang; Wang, Di; Yu, Qi; Chai, Xiao-Qing
Journal of Clinical Anesthesia, 2017 , vol. 37, p. 123 - 128 Title/Abstract Full Text Show Details
Capantini, Lorenza; von Twickel, Arndt; Robertson, Brita; Grillner, Sten
Journal of Comparative Neurology, 2017 , vol. 525, # 4 p. 753 - 772 Title/Abstract Full Text Show Details
Liu, Long; Guan, Ningzi; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian
Critical Reviews in Biotechnology, 2017 , vol. 37, # 2 p. 139 - 150 Title/Abstract Full Text Show Details
Martín-Aragón Baudel, Miguel A. S.; Poole, Amy V.; Darlison, Mark G.
Journal of Neurochemistry, 2017 , vol. 140, # 2 p. 195 - 209 Title/Abstract Full Text Show Details
Izumi, Yukitoshi; O'dell, Kazuko A.; Zorumski, Charles F.
Physiological Reports, 2013 , vol. 1, # 5 art. no. E00133 Title/Abstract Full Text Show Details
Ostojic, Sergej M.
Nutrition, 2017 , vol. 34, p. 55 - 57 Title/Abstract Full Text Show Details
Zhang, Yuansheng; Liu, Yongtao; Cao, Xupeng; Gao, Peng; Liu, Xinyu; Wang, Xiyue; Zhang, Junjie; Zhou, Jiannan; Xue, Song; Xu, Guowang; Tian, Jing
Algal Research, 2016 , vol. 13, p. 207 - 217 Title/Abstract Full Text Show Details
Xie; Li; Zhou; Tian; Zeng; Liu
Aquaculture Nutrition, 2017 , vol. 23, # 1 p. 54 - 62 Title/Abstract Full Text Show Details
Ma, Zhe; Niu, Binbin; Shi, Zhangyan; Li, Junlin; Wang, Jian; Zhang, Fuchang; Gao, Xiaocai; Zhang, Kejin
Cellular and Molecular Neurobiology, 2017 , vol. 37, # 1 p. 93 - 100 Title/Abstract Full Text Show Details
Sos, Katalin E.; Mayer, Márton I.; Cserép, Csaba; Takács, Flóra S.; Szőnyi, András; Freund, Tamás F.; Nyiri, Gábor
Brain Structure and Function, 2017 , vol. 222, # 1 p. 287 - 299 Title/Abstract Full Text Show Details
Ghafari, Maryam; Falsafi, Soheil Keihan; Szodorai, Edit; Kim, Eun-Jung; Li, Lin; Höger, Harald; Berger, Johannes; Fuchs, Karoline; Sieghart, Werner; Lubec, Gert
Brain Structure and Function, 2017 , vol. 222, # 1 p. 549 - 561 Title/Abstract Full Text Show Details
Rauf, Abdur; Uysal, Sengul; Hadda, Taibi Ben; Uddin, Ghias; Nawaz, Muhammad Asif; Khan, Haroon; Siddiqui, Bina S.; Raza, Muslim; Bawazeer, Saud; Zengin, Gokhan
Biomedicine and Pharmacotherapy, 2017 , vol. 87, p. 678 - 682 Title/Abstract Full Text Show Details
187 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Doufas, Anthony G.; Panagiotou, Orestis A.; Panousis, Periklis; Wong, Shane Shucheng; Ioannidis, John P.A.
Mayo Clinic Proceedings, 2017 , vol. 92, # 1 p. 72 - 87 Title/Abstract Full Text Show Details
Lupinsky, Derek; Moquin, Luc; Gratton, Alain
Psychopharmacology, 2017 , vol. 234, # 3 p. 353 - 363 Title/Abstract Full Text Show Details
Farahmandfar, Maryam; Akbarabadi, Ardeshir; Bakhtazad, Atefeh; Zarrindast, Mohammad-Reza
Neuroscience, 2017 , vol. 344, p. 48 - 55 Title/Abstract Full Text Show Details
Ouyang, Xiaoyu; Wang, Shaoyang; Yuan, Guanshen; Liu, Yaran; Gu, Pan; Zhang, Bolin; Zhu, Baoqing
International Journal of Food Science and Technology, 2017 , vol. 52, # 2 p. 448 - 456 Title/Abstract Full Text Show Details
Wilke, Skadi; List, Jonathan; Mekle, Ralf; Lindenberg, Robert; Bukowski, Martin; Ott, Stefanie; Schubert, Florian; Ittermann, Bernd; Flöel, Agnes
Journal of Neurotrauma, 2017 , vol. 34, # 2 p. 281 - 290 Title/Abstract Full Text Show Details
Koyama, Susumu; Kawaharada, Mari; Terai, Hiroki; Ohkurano, Masahiro; Mori, Masayoshi; Kanamaru, Syohei; Hirose, Shinichi
Physiological Reports, 2013 , vol. 1, # 5 art. no. E00126 Title/Abstract Full Text Show Details
Weir, Gordon C.; Bonner-Weir, Susan
Cell, 2017 , vol. 168, # 1-2 p. 7 - 9 Title/Abstract Full Text Show Details
Heyburn, Lanier; Moussa, Charbel E.-H.
Neural Regeneration Research, 2016 , vol. 11, # 12 p. 1910 - 1911 Title/Abstract Full Text Show Details
Ismail, Fatima Yousif; Fatemi, Ali; Johnston, Michael V.
European Journal of Paediatric Neurology, 2017 , vol. 21, # 1 p. 23 - 48 Title/Abstract Full Text Show Details
Ben-Othman, Nouha; Vieira, Andhira; Courtney, Monica; Record, Fabien; Gjernes, Elisabet; Avolio, Fabio; Hadzic, Biljana; Druelle, Noémie; Napolitano, Tiziana; Navarro-Sanz, Sergi; Silvano, Serena; Al-Hasani, Keith; Pfeifer, Anja; Lacas-Gervais, Sandra; Leuckx, Gunter; Marroquí, Laura; Thévenet, Julien; Madsen, Ole Dragsbaek; Eizirik, Decio Laks; Heimberg, Harry; Kerr-Conte, Julie; Pattou, François; Mansouri, Ahmed; Collombat, Patrick
Cell, 2017 , vol. 168, # 1-2 p. 73 - 11,85 Title/Abstract Full Text Show Details
Hamed, Sherifa A.; Abdellah, Mostafa M.
International Journal of Neuroscience, 2017 , vol. 127, # 3 p. 236 - 242 Title/Abstract Full Text Show Details
Fitian, Asem I.; Cabrera, Roniel
World Journal of Hepatology, 2017 , vol. 9, # 1 p. 1 - 17 Title/Abstract Full Text Show Details
Roboon; Nudmamud-Thanoi; Thanoi
Andrologia, 2017 , vol. 49, # 1 art. no. E12596 Title/Abstract Full Text Show Details
Carelli, Stephana; Giallongo, Toniella; Viaggi, Cristina; Gombalova, Zuzana; Latorre, Elisa; Mazza, Massimiliano; Vaglini, Francesca; Di Giulio, Anna Maria; Gorio, Alfredo
ASN Neuro, 2016 , vol. 8, # 5 Title/Abstract Full Text Show Details
Farajnia, Sahar; Meijer, Johanna H.; Michel, Stephan
ASN Neuro, 2016 , vol. 8, # 5 Title/Abstract Full Text Show Details
Fonseca, Raquel; Carvalho, Rui A.; Lemos, Cristina; Sequeira, Ana C.; Pita, Inês R.; Carvalho, Fábio; Silva, Carlos D.; Prediger, Rui D. S.; Jarak, Ivana; Cunha, Rodrigo A.; Fontes Ribeiro, Carlos A.; Köfalvi, Attila; Pereira, Frederico C.
CNS Neuroscience and Therapeutics, 2017 , vol. 23, # 2 p. 119 - 126 Title/Abstract Full Text Show Details
Jiva Pharma, Inc.; Goel, Om P.
Patent: US2016/376223 A1, 2016 ; Title/Abstract Full Text Show Details
Opie, George M.; Rogasch, Nigel C.; Goldsworthy, Mitchell R.; Ridding, Michael C.; Semmler, John G.
Brain Stimulation, 2017 , vol. 10, # 1 p. 65 - 74 Title/Abstract Full Text Show Details
Wang, Na; Wang, Haowei; Lu, Ye; Yuan, Hongbin; Sun, Haijing; Ji, Ruihua; Xu, Wenyun
International Journal of Clinical and Experimental Medicine, 2017 , vol. 10, # 1 art. no. IJCEM0042836, p. 1539 - 1545 Title/Abstract Full Text Show Details
Rauf, Abdur; Hadda, Taibi Ben; Uddin, Ghias; Cerón-Carrasco, José P.; Peña-García, Jorge; Pérez-Sánchez, Horacio; Khan, Haroon; Bawazeer, Saud; Patel, Seema; Mubarak, Mohammad S.; Abu-Izneid, Tareq; Mabkhot, Yahia Nasser
Biomedicine and Pharmacotherapy, 2017 , vol. 88, p. 109 - 113 Title/Abstract Full Text Show Details
188 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Chao, Jung; Dai, Yuntao; Cheng, Hao-Yuan; Lam, Wing; Cheng, Yung-Chi; Li, Ke; Peng, Wen-Huang; Pao, Li-Heng; Hsieh, Ming-Tsuen; Qin, Xue-Mei; Lee, Meng-Shiou
Scientific Reports, 2017 , vol. 7, art. no. 38763 Title/Abstract Full Text Show Details
Zhou, Mo-Lin; Hu, Zhuo-Yan; Zhao, Lei; Yu, Xiao-Lin; Zhou, Kai
Modern Food Science and Technology, 2016 , vol. 32, # 3 p. 189 - 196 Title/Abstract Full Text Show Details
Xu, Chuo-Wei; Zhang, Lu; Zhao, Si-Ming; Xiong, Shan-Bai; Xie, Meng-Meng; Zhang, Pei
Modern Food Science and Technology, 2016 , vol. 32, # 1 p. 256-260 and 135 Title/Abstract Full Text Show Details
Fan, Siyan; Cath, Danielle C.; van den Heuvel, Odile A.; van der Werf, Ysbrand D.; Schöls, Caroline; Veltman, Dick J.; Pouwels, Petra J.W.
Psychoneuroendocrinology, 2017 , vol. 77, p. 211 - 217 Title/Abstract Full Text Show Details
Luo, Li; Guo, Kaihua; Fan, Wenguo; Lu, Yinghong; Chen, Lizhi; Wang, Yang; Shao, Yijia; Wu, Gongxiong; Xu, Jie; Lü, Lanhai
Experimental and Therapeutic Medicine, 2017 , vol. 13, # 2 p. 645 - 650 Title/Abstract Full Text Show Details
Farran, Batoul
Pharmacological Research, 2017 , vol. 117, p. 303 - 327 Title/Abstract Full Text Show Details
Talarek, Sylwia; Listos, Joanna; Orzelska-Gorka, Jolanta; Jakobczuk, Malgorzata; Kotlinska, Jolanta; Biala, Grazyna
Neurotoxicity Research, 2017 , vol. 31, # 2 p. 309 - 316 Title/Abstract Full Text Show Details
Albrecht, Anne; Müller, Iris; Ardi, Ziv; Çalışkan, Gürsel; Gruber, David; Ivens, Sebastian; Segal, Menahem; Behr, Joachim; Heinemann, Uwe; Stork, Oliver; Richter-Levin, Gal
Neuroscience and Biobehavioral Reviews, 2017 , vol. 74, p. 21 - 43 Title/Abstract Full Text Show Details
Tauber, Simone C.; Eiffert, Helmut; Brück, Wolfgang; Nau, Roland
Expert Review of Anti-Infective Therapy, 2017 , vol. 15, # 2 p. 121 - 132 Title/Abstract Full Text Show Details
PROTEOSTASIS TEHRAPEUTICS, INC.; Bastos, Cecilia M.; Munoz, Benito; Tait, Bradley
Patent: US2017/1993 A1, 2017 ; Title/Abstract Full Text Show Details
Liu, Bo; Yang, Huan; Gao, Fei; Wang, Qing; Zhao, Bin; Gong, Tao; Wang, Zhensong; Chen, Weibo; Wang, Guangbin; Edden, Richard A.E.
Clinical Endocrinology, 2017 , vol. 86, # 2 p. 256 - 262 Title/Abstract Full Text Show Details
Mekle, Ralf; Kühn, Simone; Pfeiffer, Harald; Aydin, Semiha; Schubert, Florian; Ittermann, Bernd
NMR in Biomedicine, 2017 , vol. 30, # 2 art. no. E3672 Title/Abstract Full Text Show Details
Heo, Hwon; Ahn, Jae-Bum; Lee, Hyeong Hun; Kwon, Euna; Yun, Jun-Won; Kim, Hyeonjin; Kang, Byeong-Cheol
NMR in Biomedicine, 2017 , vol. 30, # 2 art. no. E3686 Title/Abstract Full Text Show Details
Bountress, Kaitlin E.; Wei, Wei; Sheerin, Christina; Chung, Dongjun; Amstadter, Ananda B.; Mandel, Howard; Wang, Zhewu
Brain Sciences, 2017 , vol. 7, # 1 art. no. 6 Title/Abstract Full Text Show Details
Kim, Mi-Hye; Ahn, Sung-Il; Lim, Chan-Mook; Jhoo, Jin-Woo; Kim, Gur-Yoo
Korean Journal for Food Science of Animal Resources, 2016 , vol. 36, # 4 p. 508 - 515 Title/Abstract Full Text Show Details
Sun, Hong-Liu; Zhu, Wei; Zhang, Yu-Rong; Pan, Xiao-Hong; Zhang, Jun-Ru; Chen, Xiang-Ming; Liu, Yu-Xia; Li, Shu-Cui; Wang, Qiao-Yun; Deng, Da-Ping
Epilepsy and Behavior, 2017 , vol. 68, p. 1 - 7 Title/Abstract Full Text Show Details
Palmer, Antony J.; Baker, Alison; Muench, Stephen P.
Biochemical Society Transactions, 2016 , vol. 44, # 3 p. 856 - 862 Title/Abstract Full Text Show Details
Huang, Yunyun; Ding, Mingfei; Guo, Tuan; Zhang, Ning; Tian, Zhuang; Sun, Li-Peng; Guan, Bai-Ou
Sensors and Actuators, B: Chemical, 2017 , vol. 244, p. 934 - 940 Title/Abstract Full Text Show Details
Porges, Eric C.; Woods, Adam J.; Edden, Richard A.E.; Puts, Nicolaas A.J.; Harris, Ashley D.; Chen, Huaihou; Garcia, Amanda M.; Seider, Talia R.; Lamb, Damon G.; Williamson, John B.; Cohen, Ronald A.
Biological Psychiatry: Cognitive Neuroscience and Neuroimaging, 2017 , vol. 2, # 1 p. 38 - 44 Title/Abstract Full Text Show Details
Raines, Douglas E.
Anesthesiology, 2017 , vol. 126, # 2 p. 350 - 351 Title/Abstract Full Text Show Details
189 of 992
Comment (Pharmacological Data)
Bioactivities present
Reference
Safavynia, Seyed A.; Keating, Glenda; Speigel, Iris; Fidler, Jonathan A.; Kreuzer, Matthias; Rye, David B.; Jenkins, Andrew; García, Paul S.
Anesthesiology, 2017 , vol. 126, # 2 p. 352 - 353 Title/Abstract Full Text Show Details
Singh, Digar; Lee, Sunmin; Lee, Choong Hwan
Trends in Food Science and Technology, 2017 , vol. 61, p. 103 - 115 Title/Abstract Full Text Show Details
Kumar, Ujendra; Heer, Michael; Somvanshi, Rishi K.
Neuroscience Letters, 2017 , vol. 640, p. 81 - 87 Title/Abstract Full Text Show Details
Patel, Sita Sharan; Tomar, Sunil; Sharma, Diksha; Mahindroo, Neeraj; Udayabanu, Malairaman
Neuroscience and Biobehavioral Reviews, 2017 , vol. 74, p. 76 - 97 Title/Abstract Full Text Show Details
Dionisio; Caldironi; de Rosa
International Journal of Pharmacology, 2017 , vol. 13, # 2 p. 205 - 211 Title/Abstract Full Text Show Details
Ferrarelli, Fabio; Tononi, Giulio
Schizophrenia Research, 2017 , vol. 180, p. 36 - 43 Title/Abstract Full Text Show Details
Dandash, Orwa; Pantelis, Christos; Fornito, Alex
Schizophrenia Research, 2017 , vol. 180, p. 48 - 57 Title/Abstract Full Text Show Details
Leggio, Lorenzo; Lee, Mary R.
American Journal of Medicine, 2017 , vol. 130, # 2 p. 124 - 134 Title/Abstract Full Text Show Details
Busardò, Francesco Paolo; Kyriakou, Chrystalla; Marchei, Emilia; Pacifici, Roberta; Pedersen, Daniel Sejer; Pichini, Simona
Journal of Pharmaceutical and Biomedical Analysis, 2017 , vol. 137, p. 123 - 131 Title/Abstract Full Text Show Details
Cohen, Erez James; Quarta, Eros; Bravi, Riccardo; Granato, Alberto; Minciacchi, Diego
Neuroscience, 2017 , vol. 344, p. 326 - 345 Title/Abstract Full Text Show Details
Shojaei, Amir; Anaraki, Afsaneh Kamali; Mirnajafi-Zadeh, Javad; Atapour, Nafiseh
International Journal of Developmental Neuroscience, 2017 , vol. 57, p. 56 - 61 Title/Abstract Full Text Show Details
shandong institute for food and drug control; Shi, Guosheng; Xu, Yuwen; Xie, Yuanchao; Wang, Xiaobing; Zheng, Jing; Nie, Yanjun
Patent: CN104649929 B, 2016 ; Title/Abstract Full Text Show Details
190 of 992
191 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Kalinichev, Mikhail; Girard, Françoise; Haddouk, Hasnaà; Rouillier, Mélanie; Riguet, Eric; Royer-Urios, Isabelle; Mutel, Vincent; Lütjens, Robert; Poli, Sonia
Neuropharmacology, 2017 , vol. 114, p. 34 - 47 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
MEDICAL RESEARCH COUNCIL; CHOUCHANI, Edward; KRIEG, Thomas; SAEB-PARSY, Kourosh; THE UNIVERSITY COURT OF THE UNIVERSITY OF GLASGOW; MURPHY, Michael Patrick; WORK, Lorraine; FREZZA, Christian
Patent: WO2016/1686 A1, 2016 ;
Title/Abstract Full Text Show Details
192 of 992
193 of 992
194 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Yang, Haoyue; Xing, Ronge; Liu, Song; Yu, Huahua; Li, Pengcheng
Life Sciences, 2016 , vol. 146, p. 1 - 7 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Xie, Wen-Jing; Dong, Ming; Liu, Qun; Meng, Hong-Mei
Translational Neuroscience, 2016 , vol. 7, # 1 p. 1 - 5 Title/Abstract Full Text View citing articles Show Details
Muramatsu, Ikunobu; Yoshiki, Hatsumi; Uwada, Junsuke; Masuoka, Takayoshi; Sada, Kiyonao; Taniguchi, Takanobu; Nishio, Matomo
Journal of Neurochemistry, 2016 , vol. 139, # 4 p. 566 - 575 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
GIULIANI S.P.A.; GIULIANI, Giammaria; BENEDUSI, Anna; MARZANI, Barbara; BARONI, Sergio; PINI, Elena
Patent: WO2016/20350 A1, 2016 ; Title/Abstract Full Text Show Details
195 of 992
196 of 992
197 of 992
198 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Klein, Anders B.; Nittegaard-Nielsen, Mia; Christensen, Julie T.; Al-Khawaja, Anas; Wellendorph, Petrine
MedChemComm, 2016 , vol. 7, # 3 p. 426 - 432 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Ng, Chiu Chin; Duke, Rujee K.; Hinton, Tina; Johnston, Graham A.R.
European Journal of Pharmacology, 2016 , vol. 777, p. 136 - 146 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Arellano, Rogelio O.; Sánchez-Gómez, María Victoria; Alberdi, Elena; Canedo-Antelo, Manuel; Chara, Juan Carlos; Palomino, Aitor; PérezSamartín, Alberto; Matute, Carlos
Molecular Pharmacology, 2016 , vol. 89, # 1 p. 63 - 74 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
THE REGENTS OF THE UNIVERSITY OF CALIFORNIA; Kaufman, Daniel; Tian, Jide
Patent: US2016/81956 A1, 2016 ; Title/Abstract Full Text Show Details
199 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
CALIFORNIA INSTITUTE OF TECHNOLOGY; HSIAO, Elaine; YANO, Jessica
Patent: WO2016/36615 A1, 2016 ; Title/Abstract Full Text Show Details
200 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Porcelli, Vito; Longo, Antonella; Palmieri, Luigi; Closs, Ellen I.; Palmieri, Ferdinando
Amino Acids, 2016 , vol. 48, # 2 p. 427 - 436 Title/Abstract Full Text View citing articles Show Details
Hide facts
201 of 992
202 of 992
203 of 992
204 of 992
205 of 992
206 of 992
207 of 992
208 of 992
209 of 992
Show next 200 Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Khom, Sophia; Hintersteiner; Luger; Haider; Pototschnig; Mihovilovic; Schwarzer, Christoph; Hering
Journal of Pharmacology and Experimental Therapeutics, 2016 , vol. 357, # 3 p. 580 - 590 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Lee; Absalom; Hanrahan; Van Nieuwenhuijzen; Ahring; Chebib
Brain Research, 2016 , vol. 1644, p. 222 - 230 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Naffaa, Moawiah M.; Absalom, Nathan; Raja Solomon; Chebib, Mary; Hibbs, David E.; Hanrahan, Jane R.
PLoS ONE, 2016 , vol. 11, # 5 art. no. E0156618 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Sun, Bing; Chen, Linhai; Liu, Lei; Xia, Zhixiong; Pin, Jean-Philippe; Nan, Fajun; Liu, Jianfeng
Biochemical Journal, 2016 , vol. 473, # 6 p. 779 - 787 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Ahring, Philip K.; Bang, Line H.; Jensen, Marianne L.; Strøbæk, Dorte; Hartiadi, Leonny Y.; Chebib, Mary; Absalom, Nathan
Pharmacological Research, 2016 , vol. 111, p. 563 - 576 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Porcu, Alessandra; Lobina, Carla; Giunta, Daniela; Solinas, Maurizio; Mugnaini, Claudia; Castelli, M. Paola
European Journal of Pharmacology, 2016 , vol. 791, p. 115 - 123 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Huckvale, Rosemary; Mortensen, Martin; Pryde, David; Smart, Trevor G.; Baker, James R.
Organic and Biomolecular Chemistry, 2016 , vol. 14, # 28 p. 6676 - 6678 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Hondebrink; Verboven; Drega; Schmeink; de Groot; van Kleef; Wijnolts; Meulenbelt; Westerink
NeuroToxicology, 2016 , vol. 55, p. 1 - 9 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Chromocell Corporation; SHEKDAR, Kambiz
Patent: EP3009513 A1, 2016 ; Title/Abstract Full Text Show Details
210 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Guangzhou first feed additives limited; Peng, Xianfeng
Patent: CN105884637 A, 2016 ;
Title/Abstract Full Text Show Details
211 of 992
212 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Krall, Jacob; Brygger, Benjamin M.; Sigurðardóttir, Sara B.; Ng, Clarissa K. L.; Bundgaard, Christoffer; Kehler, Jan; Nielsen, Birgitte; Bek, Toke; Jensen, Anders A.; Frølund, Bente
ChemMedChem, 2016 , vol. 11, # 20 p. 2299 - 2310 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Randox Laboratories Limited; Benchikh, Elouard; McConnell, Ivan; Fitzgerald, Peter; Lowry, Philip
Patent: US2016/266153 A1, 2016 ; Title/Abstract Full Text Show Details
213 of 992
214 of 992
215 of 992
216 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Botzolakis, Emmanuel J.; Gurba, Katharine N.; Lagrange, Andre H.; Feng, Hua-Jun; Stanic, Aleksandar K.; Hu, Ningning; Macdonald, Robert L.
Journal of Biological Chemistry, 2016 , vol. 291, # 39 p. 20440 - 20461 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Marty, Loïc; Vigouroux, Armelle; Aumont-Nicaise, Magali; Dessaux, Yves; Faure, Denis; Moréra, Solange
Journal of Biological Chemistry, 2016 , vol. 291, # 43 p. 22638 - 22649 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Alqazzaz, Mona A.; Price, Kerry L.; Lummis, Sarah C. R.
Biochemistry, 2016 , vol. 55, # 42 p. 5947 - 5951 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Jiva Pharma, Inc.; Goel, Om P.
Patent: US2016/376223 A1, 2016 ; Title/Abstract Full Text Show Details
217 of 992
218 of 992
219 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Stewart, Deirdre S.; Hotta, Mayo; Desai, Rooma; Forman, Stuart A.
Molecular Pharmacology, 2013 , vol. 83, # 6 p. 1200 - 1208 Title/Abstract Full Text View citing articles Show Details
Damgaard, Maria; Al-Khawaja, Anas; Vogensen, Stine B.; Jurik, Andreas; Sijm, Maarten; Lie, Maria E. K.; Baek, Mathias I.; Rosenthal, Emil; Jensen, Anders A.; Ecker, Gerhard F.; Frolund, Bente; Wellendorph, Petrine; Clausen, Rasmus P.
ACS Chemical Neuroscience, 2015 , vol. 6, # 9 p. 1591 - 1599 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Romei, Cristina; Sabolla, Chiara; Raiteri, Luca
Neuropharmacology, 2015 , vol. 88, p. 164 - 170 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Rajalu, Mathieu; Fritzius, Thorsten; Adelfinger, Lisa; Jacquier, Valerie; Besseyrias, Valerie; Gassmann, Martin; Bettler, Bernhard
Neuropharmacology, 2015 , vol. 88, p. 145 - 154 Title/Abstract Full Text View citing articles Show Details
220 of 992
Show next 20
221 of 992
222 of 992
223 of 992
224 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Blankenburg; Balfanz; Hayashi; Shigenobu; Miura; Baumann; Blenau
Neuropharmacology, 2015 , vol. 88, p. 134 - 144 Title/Abstract Full Text View citing articles Show Details
Hide facts Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Dionisio, Leonardo; BergA©, Ignacio; Bravo, MatA as; Del Carmen Esandi, MarA a; Bouzat, Cecilia
Molecular Pharmacology, 2015 , vol. 87, # 3 p. 391 - 400 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Dockendorff, Chris; Faloon, Patrick W.; Yu, Miao; Youngsaye, Willmen; Penman, Marsha; Nieland, Thomas J. F.; Nag, Partha P.; Lewis, Timothy A.; Pu, Jun; Bennion, Melissa; Negri, Joseph; Paterson, Conor; Lam, Garrett; Dandapani, Sivaraman; Perez, Jos R.; Munoz, Benito; Palmer, Michelle A.; Schreiber, Stuart L.; Krieger, Monty
ACS Medicinal Chemistry Letters, 2015 , vol. 6, # 4 p. 375 - 380 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Hammer, Harriet; Ebert, Bjarke; Jensen, Henrik Sindal; Jensen, Anders A.
PLoS ONE, 2015 , vol. 10, # 3 art. no. E0120239 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
225 of 992
226 of 992
227 of 992
228 of 992
229 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Cano, Mercedes; Calonge, Mara L.; Ilundin, Anunciacin A.
Biochimica et Biophysica Acta - Biomembranes, 2015 , vol. 1848, # 10 p. 2172 - 2179 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Kaji, Mark D; Kwaka, Ariel; Callanan, Micah K; Nusrat, Humza; Desaulniers, Jean-Paul; Forrester, Sean G
British Journal of Pharmacology, 2015 , vol. 172, # 15 p. 3737 - 3747 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Waszkielewicz, Anna M.; Cegla, Marek; Zeslawska, Ewa; Nitek, Wojciech; Sloczyska, Karolina; Marona, Henryk
Bioorganic and Medicinal Chemistry, 2015 , vol. 23, # 15 p. 4197 - 4217 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Borisova; Pozdnyakova; Shaitanova; Gerus; Dudarenko; Mironets; Haufe; Kukhar
Bioorganic and Medicinal Chemistry, 2015 , vol. 23, # 15 p. 4316 - 4323 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Liu, Genyan; Ozoe, Fumiyo; Furuta, Kenjiro; Ozoe, Yoshihisa
Journal of Agricultural and Food Chemistry, 2015 , vol. 63, # 28 p. 6304 - 6312 Title/Abstract Full Text View citing articles Show Details
230 of 992
231 of 992
232 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Schmitt, Sebastian; Höfner, Georg; Wanner, Klaus T.
ChemMedChem, 2015 , vol. 10, # 9 p. 1498 - 1510 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Chauhan, Anjali; Sharma, Uma; Jagannathan, Naranamangalam R.; Gupta, Yogendra Kumar
European Journal of Pharmacology, 2015 , vol. 757, p. 28 - 33 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
UMECRINE COGNITION AB; DOVERSKOG, Magnus; MÖHLER, Hanns; FELIPO, Vicente; BÄCKSTRÖM, Torbjörn
Patent: WO2015/114308 A1, 2015 ; Title/Abstract Full Text Show Details
233 of 992
234 of 992
235 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Li, Ping; Akk, Gustav
Molecular Pharmacology, 2015 , vol. 87, # 5 p. 776 - 781 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Hammer, Harriet; Bader, Benjamin M.; Ehnert, Corina; Bundgaard, Christoffer; Bunch, Lennart; Hoestgaard-Jensen, Kirsten; Schroeder, Olaf H.-U.; Bastlund, Jesper F.; Gramowski-Voss, Alexandra; Jensen, Anders A.
Molecular Pharmacology, 2015 , vol. 88, # 2 p. 401 - 420 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY; Lee, Changjoon Justin; Lee, Soo-Jung; Yoon, Bo-Eun
Patent: US9095535 B2, 2015 ; Title/Abstract Full Text Show Details
236 of 992
237 of 992
238 of 992
239 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Snell, Heather D.; Gonzales, Eric B.
Journal of Pharmacology and Experimental Therapeutics, 2015 , vol. 353, # 3 p. 551 - 559 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Bernaskova, Marketa; Schoeffmann, Angela; Schuehly, Wolfgang; Hufner, Antje; Baburin, Igor; Hering, Steffen
Bioorganic and Medicinal Chemistry, 2015 , vol. 23, # 20 p. 6757 - 6762 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Jayakar, Selwyn S.; Zhou, Xiaojuan; Savechenkov, Pavel Y.; Chiara, David C.; Desai, Rooma; Bruzik, Karol S.; Miller, Keith W.; Cohen, Jonathan B.
Journal of Biological Chemistry, 2015 , vol. 290, # 38 p. 23432 - 23446 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological
physiological behaviour discussed
Data)
240 of 992
241 of 992
242 of 992
243 of 992
Reference
Oppici, Elisa; Montioli, Riccardo; Dindo, Mirco; MacCari, Laura; Porcari, Valentina; Lorenzetto, Antonio; Chellini, Sara; Voltattorni, Carla Borri; Cellini, Barbara
ACS Chemical Biology, 2015 , vol. 10, # 10 p. 2227 - 2236 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Zhang, Ai-Hui; Ji, Xiao-Jun; Wu, Wen-Jia; Ren, Lu-Jing; Yu, Ya-Dong; Huang, He
Journal of Agricultural and Food Chemistry, 2015 , vol. 63, # 44 p. 9812 - 9819 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Wagner, Michel; Ohlund, Leanne B.; Shiao, Tze Chieh; Vzina, Amlie; Annabi, Borhane; Roy, Ren; Sleno, Lekha
Rapid Communications in Mass Spectrometry, 2015 , vol. 29, # 18 p. 1632 - 1640 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Malomouzh, Artem I.; Petrov, Konstantin A.; Nurullin, Leniz F.; Nikolsky, Evgeny E.
Journal of Neurochemistry, 2015 , vol. 135, # 6 p. 1149 - 1160 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
LOHOCLA RESEARCH CORPORATION; TABAKOFF, Boris
Patent: WO2015/195943 A1, 2015 ; Title/Abstract Full Text Show Details
244 of 992
245 of 992
246 of 992
247 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Vandevrede, Lawren; Tavassoli, Ehsan; Luo, Jia; Qin, Zhihui; Yue, Lan; Pepperberg, David R.; Thatcher, Gregory R.
British Journal of Pharmacology, 2014 , vol. 171, # 2 p. 389 - 402 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Patel; Mortensen; Smart
British Journal of Pharmacology, 2014 , vol. 171, # 4 p. 985 - 994 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Feng; Jounaidi; Haburcak; Yang; Forman
British Journal of Pharmacology, 2014 , vol. 171, # 3 p. 789 - 798 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
of Nevada, Las Vegas; The Regents of the Nevada System of Higher Education on behalf of the University; Abel-Santos, Ernesto; Howerton, Amber
Patent: US2014/45808 A1, 2014 ; Title/Abstract Full Text Show Details
248 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Zvejniece; Vavers; Svalbe; Vilskersts; Domracheva; Vorona; Veinberg; Misane; Stonans; Kalvinsh; Dambrova
British Journal of Pharmacology, 2014 , vol. 171, # 3 p. 761 - 771 Title/Abstract Full Text View citing articles Show Details
249 of 992
250 of 992
251 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Petersen, Jette G.; Sørensen, Troels; Damgaard, Maria; Nielsen, Birgitte; Jensen, Anders A.; Balle, Thomas; Bergmann, Rikke; Frølund, Bente
European Journal of Medicinal Chemistry, 2014 , vol. 84, p. 404 - 416 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Yahara, Tohru; Tachikawa, Masanori; Akanuma, Shin-Ichi; Kubo, Yoshiyuki; Hosoya, Ken-Ichi
Biological and Pharmaceutical Bulletin, 2014 , vol. 37, # 5 p. 817 - 825 Title/Abstract Full Text View citing articles Show Details
Location
Paragraph
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
BIOLOG, INC.; BOCHNER, Barry; LEI, Xiang-He
Patent: WO2014/130655 A2, 2014 ; Title/Abstract Full Text Show Details
252 of 992
253 of 992
254 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Sanchez-Borzone, Mariela; Delgado-Marin, Leticia; Garcia, Daniel A.
Chirality, 2014 , vol. 26, # 8 p. 368 - 372 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Maeda, Kenji; Sugino, Haruhiko; Akazawa, Hitomi; Amada, Naoki; Shimada, Jun; Futamura, Takashi; Yamashita, Hiroshi; Ito, Nobuaki; McQuade, Robert D.; Mork, Arne; Pehrson, Alan L.; Hentzer, Morten; Nielsen, Vibeke; Bundgaard, Christoffer; Arnt, Jorn; Stensbol, Tine Bryan; Kikuchi, Tetsuro
Journal of Pharmacology and Experimental Therapeutics, 2014 , vol. 350, # 3 p. 589 - 604 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Washington University; Covey, Douglas; Kudcva, Eva
Patent: US2014/309443 A1, 2014 ; Title/Abstract Full Text Show Details
255 of 992
256 of 992
257 of 992
258 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Pydi, Sai P.; Sobotkiewicz, Tyler; Billakanti, Rohini; Bhullar, Rajinder P.; Loewen, Michele C.; Chelikani, Prashen
Journal of Biological Chemistry, 2014 , vol. 289, # 36 p. 25054 - 25066 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Eaton, Megan M.; Bracamontes, John; Shu, Hong-Jin; Li, Ping; Mennerick, Steven; Steinbach, Joe Henry; Akk, Gustav
Molecular Pharmacology, 2014 , vol. 86, # 6 p. 647 - 656 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Meiselbach, Heike; Vogel, Nico; Langlhofer, Georg; Stangl, Sabine; Schleyer, Barbara; Bahnassawy, Lamia'a; Sticht, Heinrich; Breitinger, Hans-Georg; Becker, Cord-Michael; Villmann, Carmen
Journal of Biological Chemistry, 2014 , vol. 289, # 42 p. 29135 - 29147 Title/Abstract Full Text View citing articles Show Details
Comment
physiological behaviour discussed
(Pharmacological Data)
259 of 992
260 of 992
261 of 992
262 of 992
263 of 992
264 of 992
265 of 992
266 of 992
267 of 992
Reference
Dillon, Nicholas A.; Peterson, Nicholas D.; Rosen, Bron C.; Baughn, Anthony D.
Antimicrobial Agents and Chemotherapy, 2014 , vol. 58, # 12 p. 7258 - 7263 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Naito, Anna; Muchhala, Karan H.; Asatryan, Liana; Trudell, James R.; Homanics, Gregg E.; Perkins, Daya I.; Davies, Daryl L.; Alkana, Ronald L.
Molecular Pharmacology, 2014 , vol. 86, # 6 p. 635 - 646 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Thompson, Andrew J.; Verheij, Mark H.P.; Verbeek, Joost; Windhorst, Albert D.; De Esch, Iwan J.P.; Lummis, Sarah C.R.
Neuropharmacology, 2014 , vol. 86, p. 378 - 388 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Fuchs, Alexander; Baur, Roland; Schoeder, Clara; Sigel, Erwin; Müller, Christa E.
Bioorganic and Medicinal Chemistry, 2014 , vol. 22, # 24 p. 6908 - 6917 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Shannon, Richard J.; Timofeev, Ivan; Nortje, Jürgens; Hutchinson, Peter J.; Carpenter, Keri L. H.
British Journal of Clinical Pharmacology, 2014 , vol. 78, # 5 p. 981 - 995 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Matharu, Daljit S.; Flaherty, Daniel P.; Simpson, Denise S.; Schroeder, Chad E.; Chung, Donghoon; Yan, Dan; Noah, James W.; Jonsson, Colleen B.; White, E. Lucile; Aub, Jeffrey; Plemper, Richard K.; Severson, William E.; Golden, Jennifer E.
Journal of Medicinal Chemistry, 2014 , vol. 57, # 24 p. 10314 - 10328 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Plech, Tomasz; Kapro, Barbara; Luszczki, Jarogniew J.; Paneth, Agata; Siwek, Agata; Kolaczkowski, Marcin; Zolnierek, Maria; Nowak, Gabriel
European Journal of Medicinal Chemistry, 2014 , vol. 86, p. 690 - 699 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Li; Bracamontes; Manion; Mennerick; Steinbach; Evers; Akk
British Journal of Pharmacology, 2014 , vol. 171, # 23 p. 5446 - 5457 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Han, Jin; Wan, Hai-Tong; Yang, Jie-Hong; Zhang, Yu-Yan; Ge, Li-Jun; Bie, Xiao-Dong
Journal of Asian Natural Products Research, 2014 , vol. 16, # 11 p. 1060 - 1067 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Kuriyama, Chiaki; Xu, Jun Zhi; Lee, Seunghun Paul; Qi, Jenson; Kimata, Hirotaka; Kakimoto, Tetsuhiro; Nakayama, Keiko; Watanabe, Yoshinori; Taniuchi, Nobuhiko; Hikida, Kumiko; Matsushita, Yasuaki; Arakawa, Kenji; Saito, Akira; Ueta, Kiichiro; Shiotani, Masaharu
Journal of Pharmacology and Experimental Therapeutics, 2014 , vol. 351, # 2 p. 423 - 431 Title/Abstract Full Text View citing articles Show Details
268 of 992
269 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Chen, Zi-Wei; Wang, Cunde; Krishnan, Kathiresan; Manion, Brad D.; Hastings, Randy; Bracamontes, John; Taylor, Amanda; Eaton, Megan M.; Zorumski, Charles F.; Steinbach, Joseph H.; Akk, Gustav; Mennerick, Steven; Covey, Douglas F.; Evers, Alex S.
Psychopharmacology, 2014 , vol. 231, # 17 p. 3479 - 3491 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
analgesic
Species or TestSystem (Pharmacological Data)
human; pre-existing medical conditions: pain
Route of Application
epicutaneous / skin absorption
Concentration (Pharmacological Data)
20 percent (w/v)
Kind of Dosing (Pharmacological Data)
title comp. administerd as topical cream formulation containg ethylene glycol, LIPODERM® and VAN PEN®
Type (Pharmacological Data)
pain relief rate
Value of Type (Pharmacological Data)
100 percent
Results
concentration/time-dependent effect
Location
Paragraph 0062-0074
Reference
MOSKOWITZ, Michael; GOLDEN, Maria, Depolo; GORDON, Dana
Patent: WO2013/2749 A1, 2013 ; Title/Abstract Full Text Show Details
270 of 992
Effect (Pharmacological Data)
analgesic
Species or TestSystem (Pharmacological Data)
human; pre-existing medical conditions: pain
Route of Application
nasal
Kind of Dosing (Pharmacological Data)
title comp. administerd as nasal spray formulation containg sodium bisulfite, methyl paraben, propyl paraben and water
Type (Pharmacological Data)
pain relief rate
Value of Type (Pharmacological Data)
57 - 100 percent
Results
concentration/time-dependent effect
Location
Paragraph 0075-0086
Reference
MOSKOWITZ, Michael; GOLDEN, Maria, Depolo; GORDON, Dana
Patent: WO2013/2749 A1, 2013 ; Title/Abstract Full Text Show Details
271 of 992
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
brain synaptic membranes of Sprague-Dawley rat
272 of 992
273 of 992
274 of 992
Sex
male
Method (Pharmacological Data)
labelled ligand: [3H]muscimol; name of assay/method: FLIPR membrane potential blue assay
Further Details (Pharmacological Data)
Ki related to: GABAA receptor
Type (Pharmacological Data)
Ki
Value of Type (Pharmacological Data)
0.049 μmol/l
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
brain synaptic membranes of Sprague-Dawley rat
Sex
male
Method (Pharmacological Data)
labelled ligand: [3H]muscimol; name of assay/method: FLIPR membrane potential blue assay
Results
molecular target: GABAA receptor
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human α3β2γ2S GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
Further Details (Pharmacological Data)
EC50 related to: human α3β2γ2S
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.92 μmol/l
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human α3β2γ2S GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
275 of 992
276 of 992
277 of 992
Results
molecular target: α3β2γ2S GABAA receptor; species of target: human
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human α5β2γ2S GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
Further Details (Pharmacological Data)
EC50 related to: human α5β2γ2S
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.11 μmol/l
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human α5β2γ2S GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
Results
molecular target: α5β2γ2S GABAA receptor; species of target: human
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human α1β2γ2S GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
Further Details (Pharmacological Data)
EC50 related to: human α1β2γ2S
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.8 μmol/l
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
278 of 992
279 of 992
280 of 992
281 of 992
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human α1β2γ2S GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
Results
molecular target: α1β2γ2S GABAA receptor; species of target: human
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human α2β2γ2S GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
Further Details (Pharmacological Data)
EC50 related to: human α2β2γ2S
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.65 μmol/l
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human α2β2γ2S GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
Results
molecular target: α2β2γ2S GABAA receptor; species of target: human
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human ρ1 GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
Further Details (Pharmacological Data)
EC50 related to: human ρ1 GABAA receptor
282 of 992
283 of 992
284 of 992
285 of 992
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.8 μmol/l
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding affinity
Species or TestSystem (Pharmacological Data)
tsA201 cells; genetically modified/infected with: human ρ1 GABAA receptor
Method (Pharmacological Data)
name of assay/method: FLIPR membrane potential blue assay
Results
molecular target: ρ1 GABAA receptor; species of target: human
Reference
Petersen, Jette G.; Bergmann, Rikke; Møller, Henriette A.; Jørgensen, Charlotte G.; Nielsen, Birgitte; Kehler, Jan; Frydenvang, Karla; Kristensen, Jesper; Balle, Thomas; Jensen, Anders A.; Kristiansen, Uffe; Frølund, Bente
Journal of Medicinal Chemistry, 2013 , vol. 56, # 3 p. 993 - 1006 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
forskolin-stimulated cAMP accumulation; inhibition of
Species or TestSystem (Pharmacological Data)
embryonic kidney 293 /Cre-luc cells of human; genetically modified/infected with: human GABA-B1/B2/pIRES
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: GABAB receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.53 μmol/l
Reference
Han, Changho; Salyer, Amy E.; Kim, Eun Hoo; Jiang, Xinyi; Jarrard, Rachel E.; Powers, Matthew S.; Kirchhoff, Aaron M.; Salvador, Tolani K.; Chester, Julia A.; Hockerman, Gregory H.; Colby, David A.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 6 p. 2456 - 2465 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
forskolin-stimulated cAMP accumulation; inhibition of
Species or TestSystem (Pharmacological Data)
embryonic kidney 293 /Cre-luc cells of human; genetically modified/infected with: human GABA-B1/B2/pIRES
Results
molecular target: GABAB receptor; species of target: human
Reference
Han, Changho; Salyer, Amy E.; Kim, Eun Hoo; Jiang, Xinyi; Jarrard, Rachel E.; Powers, Matthew S.; Kirchhoff, Aaron M.; Salvador, Tolani K.; Chester, Julia A.; Hockerman, Gregory H.; Colby, David A.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 6 p. 2456 - 2465 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; inhibition of
Species or TestSystem (Pharmacological Data)
tsA201 cell of human; genetically modified/infected with: rat GABAA receptor subunits α1, β2, and γ2s
Method (Pharmacological
name of assay/method: whole-cell voltage-clamp method
Data)
286 of 992
287 of 992
288 of 992
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.3 μmol/l
Reference
Han, Changho; Salyer, Amy E.; Kim, Eun Hoo; Jiang, Xinyi; Jarrard, Rachel E.; Powers, Matthew S.; Kirchhoff, Aaron M.; Salvador, Tolani K.; Chester, Julia A.; Hockerman, Gregory H.; Colby, David A.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 6 p. 2456 - 2465 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; inhibition of
Species or TestSystem (Pharmacological Data)
tsA201 cell of human; genetically modified/infected with: rat GABAA receptor subunits α1, β2, and γ2s
Method (Pharmacological Data)
name of assay/method: whole-cell voltage-clamp method
Results
molecular target: GABAA receptor; species of target: rat
Reference
Han, Changho; Salyer, Amy E.; Kim, Eun Hoo; Jiang, Xinyi; Jarrard, Rachel E.; Powers, Matthew S.; Kirchhoff, Aaron M.; Salvador, Tolani K.; Chester, Julia A.; Hockerman, Gregory H.; Colby, David A.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 6 p. 2456 - 2465 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological Data)
CHO-K1 cells; genetically modified/infected with: GABAA receptor
Method (Pharmacological Data)
name of assay/method: whole-cell patch-clamp assay
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4 - 15 μmol/l
Location
supporting information
Reference
Raster, Peter; Spaeth, Andreas; Bultakova, Svetlana; Gorostiza, Pau; Koenig, Burkhard; Bregestovski, Piotr
Beilstein Journal of Organic Chemistry, 2013 , vol. 9, p. 406 - 410 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological Data)
CHO-K1 cells; genetically modified/infected with: GABAA receptor
Method (Pharmacological Data)
name of assay/method: whole-cell patch-clamp assay
Results
molecular target: GABAA receptor
Location
supporting information Raster, Peter; Spaeth, Andreas; Bultakova, Svetlana; Gorostiza, Pau; Koenig, Burkhard; Bregestovski, Piotr
Reference
289 of 992
290 of 992
291 of 992
Beilstein Journal of Organic Chemistry, 2013 , vol. 9, p. 406 - 410 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α1 DNA and β1 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α1β1 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
141 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α1 DNA and β2 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α1β2 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
22 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α1 DNA and γ2L DNA in pcDM8 and β3 DNA in pGEMHE
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α1β3γ2L GABAA receptors
Type (Pharmacological Data)
EC50
292 of 992
293 of 992
294 of 992
Value of Type (Pharmacological Data)
156 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α1 DNA pcDM8 and β3 DNA in pGEMHE
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α1β3 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
34.5 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α1 DNA, β1 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α1β1γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
259 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α1 DNA, β2 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological
effective concentration (EC); EC50 related to: human recombinant α1β2γ2L GABAA receptors
Data)
295 of 992
296 of 992
297 of 992
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
107 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α2 DNA and β1 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α2β1 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
45.4 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α2 DNA and β2 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α2β2 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
56 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α2 DNA and γ2L DNA in pcDM8 and β3 DNA in pGEMHE
name of assay/method: two-electrode voltage clamp
Method (Pharmacological Data)
298 of 992
299 of 992
300 of 992
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α2β3γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
157 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α2 DNA pcDM8 and β3 DNA in pGEMHE
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α2β3 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
89.7 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α2 DNA, β1 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α2β1γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
51.3 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
301 of 992
302 of 992
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α2 DNA, β2 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α2β2γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
131 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α3 DNA and β3 DNA in pGEMHE
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α3β3 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
90.7 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α3 DNA and β3 DNA in pGEMHE, γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α3β3γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
127 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
303 of 992
304 of 992
305 of 992
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α3 DNA in pGEMHE and β1 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α3β1 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
268 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α3 DNA in pGEMHE and β2 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α3β2 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
56.2 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α3 DNA in pGEMHE, β1 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α3β1γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
249 μmol/l
306 of 992
307 of 992
308 of 992
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α3 DNA in pGEMHE, β2 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α3β2γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
133 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α4 DNA in pcDNA1/Amp and β1 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α4β1 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.72 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α4 DNA in pcDNA1/Amp and β2 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α4β2 GABAA receptors
Type (Pharmacological
EC50
Data)
309 of 992
310 of 992
311 of 992
Value of Type (Pharmacological Data)
2.29 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α4 DNA in pcDNA1/Amp and β3 DNA in pGEMHE
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α4β3 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.41 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α4 DNA in pcDNA1/Amp, β1 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α4β1γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
80 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α4 DNA in pcDNA1/Amp, β2 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
effective concentration (EC); EC50 related to: human recombinant α4β2γ2L GABAA receptors
Further Details (Pharmacological Data)
312 of 992
313 of 992
314 of 992
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
103 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α4 DNA in pcDNA1/Amp, β3 DNA in pGEMHE and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α4β3γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
127 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α5 DNA in pcDNA3 and β1 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α5β1 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
41.8 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α5 DNA in pcDNA3 and β2 DNA in pcDM8
Data)
315 of 992
316 of 992
317 of 992
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α5β2 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
23.6 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α5 DNA in pcDNA3 and β3 DNA in pGEMHE
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α5β3 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
14.6 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α5 DNA in pcDNA3, β1 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α5β1γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
31.1 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect
agonist
(Pharmacological Data)
318 of 992
319 of 992
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α5 DNA in pcDNA3, β2 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α5β2γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
41.1 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α5 DNA in pcDNA3, β3 DNA in pGEMHE and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α5β3γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
33.3 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α6 DNA and β1 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α6β1 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
7.7 μmol/l
Results
concentration/time-dependent effect
320 of 992
321 of 992
322 of 992
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α6 DNA and β2 DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α6β2 GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α6 DNA and γ2L DNA in pcDM8 and β3 DNA in pGEMHE
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α6β3γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
23.3 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α6 DNA pcDM8 and β3 DNA in pGEMHE
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α6β3 GABAA receptors
Type (Pharmacological Data)
EC50
323 of 992
324 of 992
325 of 992
Value of Type (Pharmacological Data)
1.7 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α6 DNA, β1 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α6β1γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
18 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
stage V-VI oocytes of Xenopus; genetically modified/infected with: human α6 DNA, β2 DNA and γ2L DNA in pcDM8
Method (Pharmacological Data)
name of assay/method: two-electrode voltage clamp
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human recombinant α6β2γ2L GABAA receptors
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
25 μmol/l
Results
concentration/time-dependent effect
Reference
Karim, Nasiara; Wellendorph, Petrine; Absalom, Nathan; Johnston, Graham A. R.; Hanrahan, Jane R.; Chebib, Mary
Amino Acids, 2013 , vol. 44, # 4 p. 1139 - 1149 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
binding affinity
Species or TestSystem (Pharmacological Data)
not explicitly stated by authors
Method (Pharmacological Data)
name of assay/method: radioligand binding assay
Further Details (Pharmacological
IC50 related to: GABA (non selective) receptor
Data)
326 of 992
327 of 992
328 of 992
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
73 nmol/l
Reference
Veinberg, Grigory; Vorona, Maxim; Zvejniece, Liga; Vilskersts, Reinis; Vavers, Edijs; Liepinsh, Edvards; Kazoka, Helena; Belyakov, Sergey; Mishnev, Anatoly; Kuznecovs, Jevgenijs; Vikainis, Sergejs; Orlova, Natalja; Lebedev, Anton; Ponomaryov, Yuri; Dambrova, Maija
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 10 p. 2764 - 2771 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
binding affinity
Species or TestSystem (Pharmacological Data)
not explicitly stated by authors
Method (Pharmacological Data)
name of assay/method: radioligand binding assay
Results
molecular target: GABA (non selective) receptor
Reference
Veinberg, Grigory; Vorona, Maxim; Zvejniece, Liga; Vilskersts, Reinis; Vavers, Edijs; Liepinsh, Edvards; Kazoka, Helena; Belyakov, Sergey; Mishnev, Anatoly; Kuznecovs, Jevgenijs; Vikainis, Sergejs; Orlova, Natalja; Lebedev, Anton; Ponomaryov, Yuri; Dambrova, Maija
Bioorganic and Medicinal Chemistry, 2013 , vol. 21, # 10 p. 2764 - 2771 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of rat
Method (Pharmacological Data)
labelled ligand: [35S]GTPγS; name of assay/method: [35S]GTPγS binding assay
Further Details (Pharmacological Data)
activity determined in the presence of compound 10
Results
molecular target: GABAB receptor; species of target: rat; concentration/time-dependent effect
Reference
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of rat
Method (Pharmacological Data)
labelled ligand: [35S]GTPγS; name of assay/method: [35S]GTPγS binding assay
Further Details (Pharmacological Data)
activity determined in the presence of compound 10; effective concentration (EC); EC50 related to: GABAB receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.28 μmol/l
Results
concentration/time-dependent effect
329 of 992
330 of 992
331 of 992
Reference
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of rat
Method (Pharmacological Data)
labelled ligand: [35S]GTPγS; name of assay/method: [35S]GTPγS binding assay
Further Details (Pharmacological Data)
activity determined in the presence of compound 10; maximal stimulation (Emax); Emax related to: GABAB receptor
Type (Pharmacological Data)
Emax
Value of Type (Pharmacological Data)
60 percent
Results
concentration/time-dependent effect
Reference
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of rat
Method (Pharmacological Data)
labelled ligand: [35S]GTPγS; name of assay/method: [35S]GTPγS binding assay
Further Details (Pharmacological Data)
activity determined in the presence of compound 11
Results
molecular target: GABAB receptor; species of target: rat; concentration/time-dependent effect
Reference
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of rat
Method (Pharmacological Data)
labelled ligand: [35S]GTPγS; name of assay/method: [35S]GTPγS binding assay
Further Details (Pharmacological Data)
activity determined in the presence of compound 11; effective concentration (EC); EC50 related to: GABAB receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological
1.11 μmol/l
Data)
332 of 992
333 of 992
334 of 992
Results
concentration/time-dependent effect
Reference
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of rat
Method (Pharmacological Data)
labelled ligand: [35S]GTPγS; name of assay/method: [35S]GTPγS binding assay
Further Details (Pharmacological Data)
activity determined in the presence of compound 11; maximal stimulation (Emax); Emax related to: GABAB receptor
Type (Pharmacological Data)
Emax
Value of Type (Pharmacological Data)
51 percent
Results
concentration/time-dependent effect
Reference
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of rat
Method (Pharmacological Data)
labelled ligand: [35S]GTPγS; name of assay/method: [35S]GTPγS binding assay
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: GABAB receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
3.28 μmol/l
Results
concentration/time-dependent effect
Reference
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of rat
Method (Pharmacological
labelled ligand: [35S]GTPγS; name of assay/method: [35S]GTPγS binding assay
Data)
335 of 992
336 of 992
Further Details (Pharmacological Data)
maximal stimulation (Emax); Emax related to: GABAB receptor
Type (Pharmacological Data)
Emax
Value of Type (Pharmacological Data)
45 percent
Results
concentration/time-dependent effect
Reference
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of rat
Method (Pharmacological Data)
labelled ligand: [35S]GTPγS; name of assay/method: [35S]GTPγS binding assay
Results
molecular target: GABAB receptor; species of target: rat; concentration/time-dependent effect
Reference
Mugnaini, Claudia; Pedani, Valentina; Casu, Angelo; Lobina, Carla; Casti, Alberto; MacCioni, Paola; Porcu, Alessandra; Giunta, Daniela; Lamponi, Stefania; Solinas, Maurizio; Dragoni, Stefania; Valoti, Massimo; Colombo, Giancarlo; Castelli, Maria Paola; Gessa, Gian Luigi; Corelli, Federico
Journal of Medicinal Chemistry, 2013 , vol. 56, # 9 p. 3620 - 3635 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
CATALYST PHARMACEUTICAL PARTNERS; NEW YORK UNIVERSITY; THE FEINSTEIN INSTITUTE FOR MEDICAL RESEARCH; MILLER, Steven; BRODIE, Jonathan, D.; DEWEY, Stephen
Patent: WO2013/112363 A1, 2013 ; Title/Abstract Full Text Show Details
337 of 992
338 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Vogensen, Stine B.; Marek, Ales; Bay, Tina; Wellendorph, Petrine; Kehler, Jan; Bundgaard, Christoffer; Frolund, Bente; Pedersen, Martin H. F.; Clausen, Rasmus P.
Journal of Medicinal Chemistry, 2013 , vol. 56, # 20 p. 8201 - 8205 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
BRATTSTROEM, Axel
Patent: WO2013/143843 A1, 2013 ; Title/Abstract Full Text Show Details
339 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Ligon, Brooke
Patent: US2013/252886 A1, 2013 ; Title/Abstract Full Text Show Details
340 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
UCL BUSINESS PLC; Williams, Robin Simon Brooke; Walker, Matthew
Reference
Patent: US2013/303616 A1, 2013 ; Title/Abstract Full Text Show Details
341 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
ST. JUDE CHILDREN'S RESEARCH HOSPITAL; SINGH, Harpreet; WILLIAMS, Richard, T.; GUY, Kiplin, R.
Patent: WO2013/177420 A2, 2013 ; Title/Abstract Full Text Show Details
342 of 992
343 of 992
344 of 992
345 of 992
346 of 992
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Hoestgaard-Jensen; O'Connor; Dalby; Simonsen; Finger; Golubeva; Hammer; Bergmann; Kristiansen; Krogsgaard-Larsen; BraeunerOsborne; Ebert; Frolund; Cryan; Jensen
British Journal of Pharmacology, 2013 , vol. 170, # 4 p. 919 - 932 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
Chang, Chun-Ping; Wu, Chien-Huang; Song, Jen-Shin; Chou, Ming-Chen; Wong, Ying-Chieh; Lin, Yinchiu; Yeh, Teng-Kuang; Sadani, Amit A.; Ou, Ming-Hung; Chen, Kun-Hung; Chen, Pei-Hsuan; Kuo, Po-Chu; Tseng, Chen-Tso; Chang, Kuei-Hua; Tseng, Shi-Liang; Chao, YuSheng; Hung, Ming-Shiu; Shia, Kak-Shan
Journal of Medicinal Chemistry, 2013 , vol. 56, # 24 p. 9920 - 9933 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
physiological behaviour discussed
Reference
May; Fleischer; Kletke; Haas; Sergeeva
British Journal of Pharmacology, 2013 , vol. 170, # 1 p. 222 - 232 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: human α1β2γ2L GABAA receptor
Further Details (Pharmacological Data)
two-electrode voltage clamp assay
Results
molecular target: human α1β2γ2L GABAA receptor
Reference
Savechenkov, Pavel Y.; Zhang, Xi; Chiara, David C.; Stewart, Deirdre S.; Ge, Rile; Zhou, Xiaojuan; Raines, Douglas E.; Cohen, Jonathan B.; Forman, Stuart A.; Miller, Keith W.; Bruzik, Karol S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 14 p. 6554 - 6565 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: human α1β2γ2L GABAA receptor
Further Details (Pharmacological Data)
two-electrode voltage clamp assay; Hill coefficient (HC); HC related to: α1β2γ2L GABAA receptor
Type (Pharmacological Data)
HC
Value of Type (Pharmacological Data)
1.8
Reference
Savechenkov, Pavel Y.; Zhang, Xi; Chiara, David C.; Stewart, Deirdre S.; Ge, Rile; Zhou, Xiaojuan; Raines, Douglas E.; Cohen, Jonathan B.; Forman, Stuart A.; Miller, Keith W.; Bruzik, Karol S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 14 p. 6554 - 6565 Title/Abstract Full Text View citing articles Show Details
347 of 992
348 of 992
349 of 992
350 of 992
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: human α1β2γ2L GABAA receptor
Further Details (Pharmacological Data)
two-electrode voltage clamp assay; Imax related to: α1β2γ2L GABAA receptor
Type (Pharmacological Data)
Imax
Value of Type (Pharmacological Data)
0.9 percent
Reference
Savechenkov, Pavel Y.; Zhang, Xi; Chiara, David C.; Stewart, Deirdre S.; Ge, Rile; Zhou, Xiaojuan; Raines, Douglas E.; Cohen, Jonathan B.; Forman, Stuart A.; Miller, Keith W.; Bruzik, Karol S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 14 p. 6554 - 6565 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: human α1β2γ2L GABAA receptor
Further Details (Pharmacological Data)
two-electrode voltage clamp assay; effective concentration (EC); EC50 related to: α1β2γ2L GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
46 μmol/l
Reference
Savechenkov, Pavel Y.; Zhang, Xi; Chiara, David C.; Stewart, Deirdre S.; Ge, Rile; Zhou, Xiaojuan; Raines, Douglas E.; Cohen, Jonathan B.; Forman, Stuart A.; Miller, Keith W.; Bruzik, Karol S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 14 p. 6554 - 6565 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: human α1β2γ2L GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. incubated with 5-allyl-1-methyl-5-[3-(3-trifluoromethyl-3H-diazirin-3-yl)phenyl]pyrimidine-2,4,6-trione (8 μmol/l)
Further Details (Pharmacological Data)
two-electrode voltage clamp assay
Results
molecular target: human α1β2γ2L GABAA receptor
Reference
Savechenkov, Pavel Y.; Zhang, Xi; Chiara, David C.; Stewart, Deirdre S.; Ge, Rile; Zhou, Xiaojuan; Raines, Douglas E.; Cohen, Jonathan B.; Forman, Stuart A.; Miller, Keith W.; Bruzik, Karol S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 14 p. 6554 - 6565 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological
oocyte of Xenopus laevis; genetically modified/infected with: human α1β2γ2L GABAA receptor
Data)
351 of 992
352 of 992
353 of 992
Kind of Dosing (Pharmacological Data)
title comp. incubated with 5-allyl-1-methyl-5-[3-(3-trifluoromethyl-3H-diazirin-3-yl)phenyl]pyrimidine-2,4,6-trione (8 μmol/l)
Further Details (Pharmacological Data)
two-electrode voltage clamp assay; Hill coefficient (HC); HC related to: α1β2γ2L GABAA receptor
Type (Pharmacological Data)
HC
Value of Type (Pharmacological Data)
1
Reference
Savechenkov, Pavel Y.; Zhang, Xi; Chiara, David C.; Stewart, Deirdre S.; Ge, Rile; Zhou, Xiaojuan; Raines, Douglas E.; Cohen, Jonathan B.; Forman, Stuart A.; Miller, Keith W.; Bruzik, Karol S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 14 p. 6554 - 6565 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: human α1β2γ2L GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. incubated with 5-allyl-1-methyl-5-[3-(3-trifluoromethyl-3H-diazirin-3-yl)phenyl]pyrimidine-2,4,6-trione (8 μmol/l)
Further Details (Pharmacological Data)
two-electrode voltage clamp assay; Imax related to: α1β2γ2L GABAA receptor
Type (Pharmacological Data)
Imax
Value of Type (Pharmacological Data)
1.2 percent
Reference
Savechenkov, Pavel Y.; Zhang, Xi; Chiara, David C.; Stewart, Deirdre S.; Ge, Rile; Zhou, Xiaojuan; Raines, Douglas E.; Cohen, Jonathan B.; Forman, Stuart A.; Miller, Keith W.; Bruzik, Karol S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 14 p. 6554 - 6565 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; activation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: human α1β2γ2L GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. incubated with 5-allyl-1-methyl-5-[3-(3-trifluoromethyl-3H-diazirin-3-yl)phenyl]pyrimidine-2,4,6-trione (8 μmol/l)
Further Details (Pharmacological Data)
two-electrode voltage clamp assay; effective concentration (EC); EC50 related to: α1β2γ2L GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
3.1 μmol/l
Reference
Savechenkov, Pavel Y.; Zhang, Xi; Chiara, David C.; Stewart, Deirdre S.; Ge, Rile; Zhou, Xiaojuan; Raines, Douglas E.; Cohen, Jonathan B.; Forman, Stuart A.; Miller, Keith W.; Bruzik, Karol S.
Journal of Medicinal Chemistry, 2012 , vol. 55, # 14 p. 6554 - 6565 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; stimulation of
354 of 992
355 of 992
356 of 992
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: pGEMHE-Erwinia ligand-gated ion channel-human α7 nACh receptor signal sequence
Sex
female
Further Details (Pharmacological Data)
stage V - VI oocyte used; two-electrode voltage-clamp
Results
molecular target: Erwinia ligand-gated ion channel
Reference
Thompson, Andrew J.; Alqazzaz, Mona; Ulens, Chris; Lummis, Sarah C.R.
Neuropharmacology, 2012 , vol. 63, # 4 p. 761 - 767 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; stimulation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: pGEMHE-Erwinia ligand-gated ion channel-human α7 nACh receptor signal sequence
Sex
female
Further Details (Pharmacological Data)
stage V - VI oocyte used; two-electrode voltage-clamp; Hill coefficient (nH); nH related to: Erwinia ligand-gated ion channel
Type (Pharmacological Data)
nH
Value of Type (Pharmacological Data)
2.1
Reference
Thompson, Andrew J.; Alqazzaz, Mona; Ulens, Chris; Lummis, Sarah C.R.
Neuropharmacology, 2012 , vol. 63, # 4 p. 761 - 767 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; stimulation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: pGEMHE-Erwinia ligand-gated ion channel-human α7 nACh receptor signal sequence
Sex
female
Further Details (Pharmacological Data)
stage V - VI oocyte used; two-electrode voltage-clamp; effective concentration (EC); EC50 related to: Erwinia ligand-gated ion channel
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.6 mmol/l
Reference
Thompson, Andrew J.; Alqazzaz, Mona; Ulens, Chris; Lummis, Sarah C.R.
Neuropharmacology, 2012 , vol. 63, # 4 p. 761 - 767 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
sixth abdominal ganglion cells of Periplaneta americana Linnaeus, American cockroach
Sex
male
Method (Pharmacological Data)
name of assay/method: whole-cell patch-clamp analysis
Further Details
GABA: γ-aminobutyric acid
(Pharmacological Data)
357 of 992
358 of 992
359 of 992
Results
molecular target: GABA receptor
Reference
Rahman, Mohammad Mostafizur; Akiyoshi, Yuki; Furutani, Shogo; Matsuda, Kazuhiko; Furuta, Kenjiro; Ikeda, Izumi; Ozoe, Yoshihisa
Bioorganic and Medicinal Chemistry, 2012 , vol. 20, # 19 p. 5957 - 5964 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
sixth abdominal ganglion cells of Periplaneta americana Linnaeus, American cockroach
Sex
male
Method (Pharmacological Data)
name of assay/method: whole-cell patch-clamp analysis
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; EC50 related to: GABA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
49.2 μmol/l
Reference
Rahman, Mohammad Mostafizur; Akiyoshi, Yuki; Furutani, Shogo; Matsuda, Kazuhiko; Furuta, Kenjiro; Ikeda, Izumi; Ozoe, Yoshihisa
Bioorganic and Medicinal Chemistry, 2012 , vol. 20, # 19 p. 5957 - 5964 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
sixth abdominal ganglion cells of Periplaneta americana Linnaeus, American cockroach
Sex
male
Method (Pharmacological Data)
name of assay/method: whole-cell patch-clamp analysis
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; in the presence of 4-[6-imino-3-(3-thienyl)pyridazin-1-yl]butanoic acid hydrochloride
Results
molecular target: GABA receptor
Reference
Rahman, Mohammad Mostafizur; Akiyoshi, Yuki; Furutani, Shogo; Matsuda, Kazuhiko; Furuta, Kenjiro; Ikeda, Izumi; Ozoe, Yoshihisa
Bioorganic and Medicinal Chemistry, 2012 , vol. 20, # 19 p. 5957 - 5964 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
sixth abdominal ganglion cells of Periplaneta americana Linnaeus, American cockroach
Sex
male
Method (Pharmacological Data)
name of assay/method: whole-cell patch-clamp analysis
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; in the presence of 4-[6-imino-3-(3-thienyl)pyridazin-1-yl]butanoic acid hydrochloride; EC50 related to: GABA receptor
Type (Pharmacological Data)
EC50
360 of 992
361 of 992
362 of 992
363 of 992
Value of Type (Pharmacological Data)
496 μmol/l
Reference
Rahman, Mohammad Mostafizur; Akiyoshi, Yuki; Furutani, Shogo; Matsuda, Kazuhiko; Furuta, Kenjiro; Ikeda, Izumi; Ozoe, Yoshihisa
Bioorganic and Medicinal Chemistry, 2012 , vol. 20, # 19 p. 5957 - 5964 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
pharmacokinetics
Species or TestSystem (Pharmacological Data)
brain γ-aminobutyric acid aminotransferase of pig
Type (Pharmacological Data)
Kcat
Value of Type (Pharmacological Data)
49 mmol/l
Reference
Hawker, Dustin D.; Silverman, Richard B.
Bioorganic and Medicinal Chemistry, 2012 , vol. 20, # 19 p. 5763 - 5773 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
pharmacokinetics
Species or TestSystem (Pharmacological Data)
brain γ-aminobutyric acid aminotransferase of pig
Type (Pharmacological Data)
Km
Value of Type (Pharmacological Data)
1.3 mmol/l
Reference
Hawker, Dustin D.; Silverman, Richard B.
Bioorganic and Medicinal Chemistry, 2012 , vol. 20, # 19 p. 5763 - 5773 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
binding affinity
Species or TestSystem (Pharmacological Data)
not explicitly stated by authors
Method (Pharmacological Data)
labelled ligand: [3H]GABA
Further Details (Pharmacological Data)
Ki related to: GABA A receptor
Type (Pharmacological Data)
Ki
Value of Type (Pharmacological Data)
6.78E-9 mol/l
Reference
Hibi, Shigeki; Ueno, Koshi; Nagato, Satoshi; Kawano, Koki; Ito, Koichi; Norimine, Yoshihiko; Takenaka, Osamu; Hanada, Takahisa; Yonaga, Masahiro
Journal of Medicinal Chemistry, 2012 , vol. 55, # 23 p. 10584 - 10600 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
binding affinity
Species or TestSystem
not explicitly stated by authors
(Pharmacological Data)
364 of 992
365 of 992
366 of 992
Method (Pharmacological Data)
labelled ligand: [3H]GABA
Results
molecular target: GABA A receptor
Reference
Hibi, Shigeki; Ueno, Koshi; Nagato, Satoshi; Kawano, Koki; Ito, Koichi; Norimine, Yoshihiko; Takenaka, Osamu; Hanada, Takahisa; Yonaga, Masahiro
Journal of Medicinal Chemistry, 2012 , vol. 55, # 23 p. 10584 - 10600 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transporter binding affinity
Species or TestSystem (Pharmacological Data)
HEK cells; genetically modified/infected with: GABA transporter mGAT1 subtype
Concentration (Pharmacological Data)
100 μmol/l - 10 mmol/l
Further Details (Pharmacological Data)
radioligand: [3H]GABA; GABA: γ-aminobutyric acid; IC50 related to: GABA transporter mGAT1 subtype
Type (Pharmacological Data)
log IC50
Value of Type (Pharmacological Data)
-5.14
Reference
Hack, Silke; Woerlein, Babette; Hoefner, Georg; Pabel, Joerg; Wanner, Klaus T.
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 5 p. 1483 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transporter binding affinity
Species or TestSystem (Pharmacological Data)
HEK cells; genetically modified/infected with: GABA transporter mGAT1 subtype
Concentration (Pharmacological Data)
100 μmol/l - 10 mmol/l
Further Details (Pharmacological Data)
radioligand: [3H]GABA; GABA: γ-aminobutyric acid
Results
molecular target: GABA transporter mGAT1 subtype
Reference
Hack, Silke; Woerlein, Babette; Hoefner, Georg; Pabel, Joerg; Wanner, Klaus T.
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 5 p. 1483 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transporter binding affinity
Species or TestSystem (Pharmacological Data)
HEK cells; genetically modified/infected with: GABA transporter mGAT2 subtype
Concentration (Pharmacological Data)
100 μmol/l - 10 mmol/l
Further Details (Pharmacological Data)
radioligand: [3H]GABA; GABA: γ-aminobutyric acid; IC50 related to: GABA transporter mGAT2 subtype
Type (Pharmacological Data)
log IC50
367 of 992
368 of 992
369 of 992
370 of 992
Value of Type (Pharmacological Data)
-4.56
Reference
Hack, Silke; Woerlein, Babette; Hoefner, Georg; Pabel, Joerg; Wanner, Klaus T.
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 5 p. 1483 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transporter binding affinity
Species or TestSystem (Pharmacological Data)
HEK cells; genetically modified/infected with: GABA transporter mGAT2 subtype
Concentration (Pharmacological Data)
100 μmol/l - 10 mmol/l
Further Details (Pharmacological Data)
radioligand: [3H]GABA; GABA: γ-aminobutyric acid
Results
molecular target: GABA transporter mGAT2 subtype
Reference
Hack, Silke; Woerlein, Babette; Hoefner, Georg; Pabel, Joerg; Wanner, Klaus T.
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 5 p. 1483 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transporter binding affinity
Species or TestSystem (Pharmacological Data)
HEK cells; genetically modified/infected with: GABA transporter mGAT3 subtype
Concentration (Pharmacological Data)
100 μmol/l - 10 mmol/l
Further Details (Pharmacological Data)
radioligand: [3H]GABA; GABA: γ-aminobutyric acid; IC50 related to: GABA transporter mGAT3 subtype
Type (Pharmacological Data)
log IC50
Value of Type (Pharmacological Data)
-5.09
Reference
Hack, Silke; Woerlein, Babette; Hoefner, Georg; Pabel, Joerg; Wanner, Klaus T.
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 5 p. 1483 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transporter binding affinity
Species or TestSystem (Pharmacological Data)
HEK cells; genetically modified/infected with: GABA transporter mGAT3 subtype
Concentration (Pharmacological Data)
100 μmol/l - 10 mmol/l
Further Details (Pharmacological Data)
radioligand: [3H]GABA; GABA: γ-aminobutyric acid
Results
molecular target: GABA transporter mGAT3 subtype
Reference
Hack, Silke; Woerlein, Babette; Hoefner, Georg; Pabel, Joerg; Wanner, Klaus T.
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 5 p. 1483 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transporter binding affinity
371 of 992
372 of 992
373 of 992
Species or TestSystem (Pharmacological Data)
HEK cells; genetically modified/infected with: GABA transporter mGAT4 subtype
Concentration (Pharmacological Data)
100 μmol/l - 10 mmol/l
Further Details (Pharmacological Data)
radioligand: [3H]GABA; GABA: γ-aminobutyric acid; IC50 related to: GABA transporter mGAT4 subtype
Type (Pharmacological Data)
log IC50
Value of Type (Pharmacological Data)
-5.18
Reference
Hack, Silke; Woerlein, Babette; Hoefner, Georg; Pabel, Joerg; Wanner, Klaus T.
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 5 p. 1483 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transporter binding affinity
Species or TestSystem (Pharmacological Data)
HEK cells; genetically modified/infected with: GABA transporter mGAT4 subtype
Concentration (Pharmacological Data)
100 μmol/l - 10 mmol/l
Further Details (Pharmacological Data)
radioligand: [3H]GABA; GABA: γ-aminobutyric acid
Results
molecular target: GABA transporter mGAT4 subtype
Reference
Hack, Silke; Woerlein, Babette; Hoefner, Georg; Pabel, Joerg; Wanner, Klaus T.
European Journal of Medicinal Chemistry, 2011 , vol. 46, # 5 p. 1483 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
neuron firing rate; inhibition of
Species or TestSystem (Pharmacological Data)
main olfactory bulb slice of C57BL/6J mouse
Kind of Dosing (Pharmacological Data)
title comp. was applied by bath perfusion
Further Details (Pharmacological Data)
electrophysiology; whole cell patch-clamp recording; EC50 related to: mitral cell
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
28.8 μmol/l
Reference
Wang, Ze-Jun; Sun, Liqin; Jackson, Patrice L.; Scott, Kenneth R.; Heinbockel, Thomas
Journal of Pharmacology and Experimental Therapeutics, 2011 , vol. 336, # 3 p. 916 - 924 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
neuron firing rate; inhibition of
Species or TestSystem (Pharmacological Data)
main olfactory bulb slice of C57BL/6J mouse
Kind of Dosing
title comp. was applied by bath perfusion; KRS-5Me-4-OCF3 (5 and 20 μmol/l)
(Pharmacological Data)
374 of 992
375 of 992
376 of 992
Further Details (Pharmacological Data)
electrophysiology; whole cell patch-clamp recording; KRS-5Me-4-OCF3: 5-methyl-3-(4-trifluoromethoxy-phenylamino)-cyclohex-2-enone; EC50 related to: mitral cell
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
10.5 - 19.9 μmol/l
Reference
Wang, Ze-Jun; Sun, Liqin; Jackson, Patrice L.; Scott, Kenneth R.; Heinbockel, Thomas
Journal of Pharmacology and Experimental Therapeutics, 2011 , vol. 336, # 3 p. 916 - 924 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
hOCTN2 activity; inhibition of
Species or TestSystem (Pharmacological Data)
kidney cells of Madin-Darby dog; genetically modified/infected with: hOCTN2
Concentration (Pharmacological Data)
500 μmol/l
Further Details (Pharmacological Data)
hOCTN2: human organic cation/carnitine transporter; LC-MS/MS
Results
molecular target: hOCTN2
Reference
Diao, Lei; Polli, James E.
Journal of Pharmaceutical Sciences, 2011 , vol. 100, # 9 p. 3802 - 3816 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
hOCTN2 activity; inhibition of
Species or TestSystem (Pharmacological Data)
kidney cells of Madin-Darby dog; genetically modified/infected with: hOCTN2
Concentration (Pharmacological Data)
500 μmol/l
Further Details (Pharmacological Data)
hOCTN2: human organic cation/carnitine transporter; LC-MS/MS
Type (Pharmacological Data)
inhibition rate
Value of Type (Pharmacological Data)
92.1 percent
Reference
Diao, Lei; Polli, James E.
Journal of Pharmaceutical Sciences, 2011 , vol. 100, # 9 p. 3802 - 3816 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
atopic dermatitis; suppression of
Species or TestSystem (Pharmacological Data)
NC/Nga mouse; pre-existing medical conditions: atopic dermatitis
Sex
female
Kind of Dosing (Pharmacological Data)
concentrations of title comp. are 0.1percent or 0.25percent g/d in food consumption
Further Details
PDP value is time- and concentration-dependent
(Pharmacological Data)
377 of 992
Type (Pharmacological Data)
auricular thickness
Value of Type (Pharmacological Data)
0.1639 - 0.2456 mm
Reference
Hokazono, Hideki; Omori, Toshiro; Ono, Kazuhisa
Bioscience, Biotechnology and Biochemistry, 2010 , vol. 74, # 1 p. 135 - 139 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
brain tissue uptake
Species or TestSystem (Pharmacological Data)
brain slices from cortical tissue of rat from line showing a tendency toward helplessness
Kind of Dosing (Pharmacological Data)
buffer solution; title compound was radiolabeled
Method (Pharmacological Data)
EXAMPLE IThis example illustrates the correlation between reduced glutamate uptake and learned helplessness in rats.Brain slices from cortical tissue were removed from rats from a line showing a tendency toward helplessness (LH line) and rats from a line showing a tendency toward not becoming helpless (nLH line). N=5 in each line. The slices were placed on filters and exposed to a buffer with radioactive glutamate (GLU) or gamma amino butyric acid (GABA) at two temperatures, 0° C. and 37° C. The buffer solutions are pulled through the filters, and the counts for each filter are measured. The 0° counts represent non-specific binding and the 37° counts represent non-specific binding plus active transport, the difference between the two representing the amount of active transport. The data obtained is as follows:Glutamate nLH: GLU 580,855 cpm/mg LH: GLU 548,583 cpm/mg This shows nLH has 6percent more uptake or transport than the LH line suggesting that less glutamate uptake tends to be associated with helplessness. GABA: nLH: GABA 28,520 cpm/mg LH: GABA 30,621 cpm/mg This shows nLH has 7percent less GABA uptake and suggests a higher inhibitory tone is associated with helplessness.
Results
GABA counts (cpm/mg) = 30621
Location
Page/Page column 4-5
Reference
Brookhaven Science Associates, LLC
Patent: US2010/160300 A1, 2010 ; Title/Abstract Full Text Show Details
378 of 992
Effect (Pharmacological Data)
brain tissue uptake
Species or TestSystem (Pharmacological Data)
brain slices from cortical tissue of rat from line showing a tendency toward not becoming helpless
Kind of Dosing (Pharmacological Data)
buffer solution; title compound was radiolabeled
Method (Pharmacological Data)
EXAMPLE IThis example illustrates the correlation between reduced glutamate uptake and learned helplessness in rats.Brain slices from cortical tissue were removed from rats from a line showing a tendency toward helplessness (LH line) and rats from a line showing a tendency toward not becoming helpless (nLH line). N=5 in each line. The slices were placed on filters and exposed to a buffer with radioactive glutamate (GLU) or gamma amino butyric acid (GABA) at two temperatures, 0° C. and 37° C. The buffer solutions are pulled through the filters, and the counts for each filter are measured. The 0° counts represent non-specific binding and the 37° counts represent non-specific binding plus active transport, the difference between the two representing the amount of active transport. The data obtained is as follows:Glutamate nLH: GLU 580,855 cpm/mg LH: GLU 548,583 cpm/mg This shows nLH has 6percent more uptake or transport than the LH line suggesting that less glutamate uptake tends to be associated with helplessness. GABA: nLH: GABA 28,520 cpm/mg LH: GABA 30,621 cpm/mg This shows nLH has 7percent less GABA uptake and suggests a higher inhibitory tone is associated with helplessness.
Results
GABA counts (cpm/mg) = 28520
Location
Page/Page column 4-5
Reference
Brookhaven Science Associates, LLC
Patent: US2010/160300 A1, 2010 ; Title/Abstract Full Text Show Details
379 of 992
Effect (Pharmacological Data)
proline uptake; inhibition of
Species or TestSystem (Pharmacological Data)
renal epithelial kidney cells of opossum
Concentration
10 mmol/l
(Pharmacological Data)
380 of 992
381 of 992
382 of 992
Kind of Dosing (Pharmacological Data)
title comp. administered as salt
Further Details (Pharmacological Data)
L-proline uptake relative to [3H]-L-proline (100percent); confluent culture tested
Type (Pharmacological Data)
relative L-proline uptake
Value of Type (Pharmacological Data)
95 percent
Reference
Nickel; Klein; Weitz; Daniel
Amino Acids, 2010 , vol. 38, # 3 p. 753 - 761 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
inward current; effect on
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: RDL subunit cDNA subcloned into pRmHa3-RDL into oocyte expression vector pGEMHE
Further Details (Pharmacological Data)
RDL: resistance to dieldrin; effective concentration (EC); EC50 related to: RDL receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
19.3 μmol/l
Reference
McGonigle, Ian; Lummis, Sarah C. R.
Biochemistry, 2010 , vol. 49, # 13 p. 2897 - 2902 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
inward current; effect on
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: RDL subunit cDNA subcloned into pRmHa3-RDL into oocyte expression vector pGEMHE
Further Details (Pharmacological Data)
RDL: resistance to dieldrin; effective concentration (EC); EC50 related to: RDL receptor
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
- 4.72
Reference
McGonigle, Ian; Lummis, Sarah C. R.
Biochemistry, 2010 , vol. 49, # 13 p. 2897 - 2902 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
inward current; effect on
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: RDL subunit cDNA subcloned into pRmHa3-RDL into oocyte expression vector pGEMHE
Further Details (Pharmacological Data)
RDL: resistance to dieldrin; Hill coefficient (nH); nH related to: RDL receptor
Type
nH
(Pharmacological Data)
383 of 992
384 of 992
385 of 992
386 of 992
Value of Type (Pharmacological Data)
1.8
Reference
McGonigle, Ian; Lummis, Sarah C. R.
Biochemistry, 2010 , vol. 49, # 13 p. 2897 - 2902 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
inward current; effect on
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: RDL subunit cDNA subcloned into pRmHa3-RDL into oocyte expression vector pGEMHE
Further Details (Pharmacological Data)
RDL: resistance to dieldrin
Results
molecular target: RDL receptor
Reference
McGonigle, Ian; Lummis, Sarah C. R.
Biochemistry, 2010 , vol. 49, # 13 p. 2897 - 2902 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α1 subunit, human γ-aminobutyric acid type A receptor β2 subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human γ-aminobutyric acid type A receptor α1β2
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
7.4 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α1 subunit, human γ-aminobutyric acid type A receptor β2 subunit
Results
molecular target: human γ-aminobutyric acid type A receptor α1β2
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α1 subunit, human γ-aminobutyric acid type A receptor β2 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human γ-aminobutyric acid type A receptor α1β2γ2s
Type (Pharmacological Data)
EC50
387 of 992
388 of 992
389 of 992
390 of 992
Value of Type (Pharmacological Data)
42 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α1 subunit, human γ-aminobutyric acid type A receptor β2 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Results
molecular target: human γ-aminobutyric acid type A receptor α1β2γ2s
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α2 subunit, human γ-aminobutyric acid type A receptor β2 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human γ-aminobutyric acid type A receptor α2β2γ2s
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
7.2 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α2 subunit, human γ-aminobutyric acid type A receptor β2 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Results
molecular target: human γ-aminobutyric acid type A receptor α2β2γ2s
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α2 subunit, human γ-aminobutyric acid type A receptor β3 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human γ-aminobutyric acid type A receptor α2β3γ2s
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
3.5 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153
Title/Abstract Full Text View citing articles Show Details
391 of 992
392 of 992
393 of 992
394 of 992
395 of 992
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α2 subunit, human γ-aminobutyric acid type A receptor β3 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Results
molecular target: human γ-aminobutyric acid type A receptor α2β3γ2s
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α3 subunit, human γ-aminobutyric acid type A receptor β2 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human γ-aminobutyric acid type A receptor α3β2γ2s
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
9.7 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α3 subunit, human γ-aminobutyric acid type A receptor β2 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Results
molecular target: human γ-aminobutyric acid type A receptor α3β2γ2s
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α3 subunit, human γ-aminobutyric acid type A receptor β3 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human γ-aminobutyric acid type A receptor α3β3γ2s
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.6 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
396 of 992
397 of 992
398 of 992
399 of 992
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α3 subunit, human γ-aminobutyric acid type A receptor β3 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Results
molecular target: human γ-aminobutyric acid type A receptor α3β2γ2s
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α4 subunit, human γ-aminobutyric acid type A receptor β2 subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human γ-aminobutyric acid type A receptor α4β2
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.2 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α4 subunit, human γ-aminobutyric acid type A receptor β2 subunit
Results
molecular target: human γ-aminobutyric acid type A receptor α4β2
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α5 subunit, human γ-aminobutyric acid type A receptor β3 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human γ-aminobutyric acid type A receptor α5β2γ2s
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.72 - 1.4 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor α5 subunit, human γ-aminobutyric acid type A receptor β3 subunit, human γ-aminobutyric acid type A receptor γ2s subunit
Results
molecular target: human γ-aminobutyric acid type A receptor α5β2γ2s
400 of 992
401 of 992
402 of 992
403 of 992
404 of 992
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor ρ1
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: human γ-aminobutyric acid type A receptor ρ1
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.64 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: human γ-aminobutyric acid type A receptor ρ1
Results
molecular target: human γ-aminobutyric acid type A receptor ρ1
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 subunit, γ-aminobutyric acid type A receptor β2 subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: γ-aminobutyric acid type A receptor α5β2
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.7 μmol/l
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 subunit, γ-aminobutyric acid type A receptor β2 subunit
Results
molecular target: γ-aminobutyric acid type A receptor α5β2
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect
agonist
(Pharmacological Data)
405 of 992
406 of 992
407 of 992
408 of 992
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 T282A mutant subunit, γ-aminobutyric acid type A receptor β2 subunit, γ-aminobutyric acid type A receptor γ2s subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: γ-aminobutyric acid type A receptor α5 T282A mutant β2γ2s
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-5.49
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 T282A mutant subunit, γ-aminobutyric acid type A receptor β2 subunit, γ-aminobutyric acid type A receptor γ2s subunit
Results
molecular target: γ-aminobutyric acid type A receptor α5 T282A mutant β2γ2s
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 T282S mutant subunit, γ-aminobutyric acid type A receptor β2 subunit, γ-aminobutyric acid type A receptor γ2s subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: γ-aminobutyric acid type A receptor α5 T282S mutant β2γ2s
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-7.2
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 T282S mutant subunit, γ-aminobutyric acid type A receptor β2 subunit, γ-aminobutyric acid type A receptor γ2s subunit
Results
molecular target: γ-aminobutyric acid type A receptor α5 T282S mutant β2γ2s
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 T282F mutant subunit, γ-aminobutyric acid type A receptor β2 subunit, γ-aminobutyric acid type A receptor γ2s subunit
Data)
409 of 992
410 of 992
411 of 992
412 of 992
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: γ-aminobutyric acid type A receptor α5 T282F mutant β2γ2s
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-15
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 T282F mutant subunit, γ-aminobutyric acid type A receptor β2 subunit, γ-aminobutyric acid type A receptor γ2s subunit
Results
molecular target: γ-aminobutyric acid type A receptor α5 T282F mutant β2γ2s
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 subunit, γ-aminobutyric acid type A receptor β2 subunit, γaminobutyric acid type A receptor γ2s T282A mutant subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: γ-aminobutyric acid type A receptor α5β2γ2s T282A mutant
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-3.5
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 subunit, γ-aminobutyric acid type A receptor β2 subunit, γaminobutyric acid type A receptor γ2s T282A mutant subunit
Results
molecular target: γ-aminobutyric acid type A receptor α5β2γ2s T282A mutant
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 subunit, γ-aminobutyric acid type A receptor β2 subunit, γaminobutyric acid type A receptor γ2s T282S mutant subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: γ-aminobutyric acid type A receptor α5β2γ2s T282S mutant
log EC50
Type (Pharmacological Data)
413 of 992
414 of 992
415 of 992
416 of 992
Value of Type (Pharmacological Data)
-2.6
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 subunit, γ-aminobutyric acid type A receptor β2 subunit, γaminobutyric acid type A receptor γ2s T282S mutant subunit
Results
molecular target: γ-aminobutyric acid type A receptor α5β2γ2s T282S mutant
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 subunit, γ-aminobutyric acid type A receptor β2 subunit, γaminobutyric acid type A receptor γ2s T282F mutant subunit
Further Details (Pharmacological Data)
effective concentration (EC); EC50 related to: γ-aminobutyric acid type A receptor α5β2γ2s T282F mutant
Type (Pharmacological Data)
log EC50
Value of Type (Pharmacological Data)
-8.7
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
tsA-201 cells; genetically modified/infected with: γ-aminobutyric acid type A receptor α5 subunit, γ-aminobutyric acid type A receptor β2 subunit, γaminobutyric acid type A receptor γ2s T282F mutant subunit
Results
molecular target: γ-aminobutyric acid type A receptor α5β2γ2s T282F mutant
Reference
Jensen, Anders A.; Bergmann, Marianne L.; Sander, Tommy; Balle, Thomas
Journal of Biological Chemistry, 2010 , vol. 285, # 13 p. 10141 - 10153 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current; induction of
Species or TestSystem (Pharmacological Data)
Xenopus laevis, African clawed frog; genetically modified/infected with: pcDNA3-MdGBCl plasmid
Further Details (Pharmacological Data)
oocyte at stage V-VI tested; effective concentration (EC); EC50 related to: MdGBCl channel
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological
160 μmol/l
Data)
417 of 992
418 of 992
419 of 992
420 of 992
Reference
Ozoe, Yoshihisa; Asahi, Miho; Ozoe, Fumiyo; Nakahira, Kunimitsu; Mita, Takeshi
Biochemical and Biophysical Research Communications, 2010 , vol. 391, # 1 p. 744 - 749 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current; induction of
Species or TestSystem (Pharmacological Data)
Xenopus laevis, African clawed frog; genetically modified/infected with: pcDNA3-MdGBCl plasmid
Further Details (Pharmacological Data)
oocyte at stage V-VI tested
Results
molecular target: MdGBCl channel
Reference
Ozoe, Yoshihisa; Asahi, Miho; Ozoe, Fumiyo; Nakahira, Kunimitsu; Mita, Takeshi
Biochemical and Biophysical Research Communications, 2010 , vol. 391, # 1 p. 744 - 749 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current; induction of
Species or TestSystem (Pharmacological Data)
Xenopus laevis, African clawed frog; genetically modified/infected with: cDNA encoded 2'(S299S) mutant of MdGBCl subunit
Further Details (Pharmacological Data)
oocyte at stage V-VI tested; effective concentration (EC); EC50 related to: A2'S-MdGBCl mutant channel
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
269 μmol/l
Reference
Ozoe, Yoshihisa; Asahi, Miho; Ozoe, Fumiyo; Nakahira, Kunimitsu; Mita, Takeshi
Biochemical and Biophysical Research Communications, 2010 , vol. 391, # 1 p. 744 - 749 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current; induction of
Species or TestSystem (Pharmacological Data)
Xenopus laevis, African clawed frog; genetically modified/infected with: cDNA encoded 2'(S299S) mutant of MdGBCl subunit
Further Details (Pharmacological Data)
oocyte at stage V-VI tested
Results
molecular target: A2'S-MdGBCl mutant channel
Reference
Ozoe, Yoshihisa; Asahi, Miho; Ozoe, Fumiyo; Nakahira, Kunimitsu; Mita, Takeshi
Biochemical and Biophysical Research Communications, 2010 , vol. 391, # 1 p. 744 - 749 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
hPAT1-mediated peptide apical uptake; inhibition of
Species or TestSystem (Pharmacological Data)
Caco-2 cells
Concentration (Pharmacological Data)
30 mmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in Hanks's balanced salt solution buffer containing 0.05percent BSA, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid and 10 mM 2-(N-morpholino)ethanesulphonic acid, pH 6.0 radioligand: 13 nM L-[2,3,4,5-3H]-proline; hPAT1: human proton-coupled amino acid transporter 1 (SLC36A1)
Further Details (Pharmacological Data)
Show next 20
421 of 992
422 of 992
423 of 992
Results
molecular target: human proton-coupled amino acid transporter 1
Reference
Frolund; Marquez; Larsen; Brodin; Nielsen
British Journal of Pharmacology, 2010 , vol. 159, # 6 p. 1339 - 1353 Title/Abstract Full Text View citing articles Show Details
Hide facts Effect (Pharmacological Data)
hPEPT1-mediated peptide apical uptake; inhibition of
Species or TestSystem (Pharmacological Data)
Caco-2 cells
Concentration (Pharmacological Data)
10 mmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in Hanks's balanced salt solution buffer containing 0.05percent BSA, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid and 10 mM 2-(N-morpholino)ethanesulphonic acid, pH 6.0
Further Details (Pharmacological Data)
radioligand: 18 μM [glycine-1-14C]-glycylsarcosine; hPEPT1: human di/tri-peptide transporter 1 (SLC15A1)
Results
no effect; insignificant effect(s) discussed
Reference
Frolund; Marquez; Larsen; Brodin; Nielsen
British Journal of Pharmacology, 2010 , vol. 159, # 6 p. 1339 - 1353 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
hPAT1-mediated peptide uptake; inhibition of
Species or TestSystem (Pharmacological Data)
COS-7 cells; genetically modified/infected with: pSPORT1-hPAT1
Concentration (Pharmacological Data)
30 mmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in sodium-free Hanks's balanced salt solution buffer containing 0.05percent BSA, 10 mM 4-(2-hydroxyethyl)-1piperazineethanesulphonic acid and 10 mM 2-(N-morpholino)ethanesulphonic acid, pH 6.0
Further Details (Pharmacological Data)
radioligand: 9 μM 4-[14C]-δ-aminolevulinic acid hydrochloride; hPAT1: human proton-coupled amino acid transporter 1 (SLC36A1)
Results
molecular target: human proton-coupled amino acid transporter 1
Reference
Frolund; Marquez; Larsen; Brodin; Nielsen
British Journal of Pharmacology, 2010 , vol. 159, # 6 p. 1339 - 1353 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
basal cerebral blood flow; effect on
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat
Sex
male
Concentration (Pharmacological Data)
1 μmol/l
Further Details (Pharmacological Data)
tpu: tissue perfusion unit; blood flow value is time-dependent; blood flow value for control is 11 tpu; mass of species: 250 - 350 g
Type (Pharmacological Data)
blood flow
424 of 992
425 of 992
426 of 992
Value of Type (Pharmacological Data)
9 - 11 tpu
Reference
Ho, W-Sv; Patel; Thompson; Roberts; Stuhr; Hillard
British Journal of Pharmacology, 2010 , vol. 160, # 3 p. 736 - 746 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
basal cerebral blood flow; effect on
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat
Sex
male
Concentration (Pharmacological Data)
1 μmol/l
Further Details (Pharmacological Data)
tpu: tissue perfusion unit; blood flow value is time-dependent; blood flow value for control is 11 tpu; mass of species: 250 - 350 g
Results
molecular target: rat cannabinoid receptor type 1
Reference
Ho, W-Sv; Patel; Thompson; Roberts; Stuhr; Hillard
British Journal of Pharmacology, 2010 , vol. 160, # 3 p. 736 - 746 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
arterial blood pressure; effect on
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat
Sex
male
Concentration (Pharmacological Data)
1 μmol/l
Further Details (Pharmacological Data)
blood pressure value is time-dependent; blood pressure value for control is 93 mm Hg; mass of species: 250 - 350 g
Type (Pharmacological Data)
blood pressure
Value of Type (Pharmacological Data)
92 - 94 mm Hg
Reference
Ho, W-Sv; Patel; Thompson; Roberts; Stuhr; Hillard
British Journal of Pharmacology, 2010 , vol. 160, # 3 p. 736 - 746 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
arterial blood pressure; effect on
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat
Sex
male
Concentration (Pharmacological Data)
1 μmol/l
Further Details (Pharmacological Data)
blood pressure value is time-dependent; blood pressure value for control is 93 mm Hg; mass of species: 250 - 350 g
Results
molecular target: rat cannabinoid receptor type 1
Reference
Ho, W-Sv; Patel; Thompson; Roberts; Stuhr; Hillard
British Journal of Pharmacology, 2010 , vol. 160, # 3 p. 736 - 746 Title/Abstract Full Text View citing articles Show Details
427 of 992
428 of 992
429 of 992
430 of 992
Effect (Pharmacological Data)
PrPres formation; inhibition of
Species or TestSystem (Pharmacological Data)
neuroblastoma N2a cells of mouse; genetically modified/infected with: RML prion strain
Further Details (Pharmacological Data)
PrPres: partially protease-resistant abnormal isoform of prion protein
Results
no effect
Reference
Kimura, Tomohiro; Ishikawa, Kensuke; Sakasegawa, Yuji; Teruya, Kenta; Sata, Tetsutaro; Schaetzl, Hermann; Doh-ura, Katsumi
FEBS Letters, 2010 , vol. 584, # 6 p. 1193 - 1198 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1 subunit of GABAA receptor, β3 subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; effective concentration (EC); EC50 related to: α1/β3 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.6 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1 subunit of GABAA receptor, β3 subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; Hill coefficient related to: α1/β3 GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
1.1
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1 subunit of GABAA receptor, β3 subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp
Results
molecular target: α1/β3 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405
Title/Abstract Full Text View citing articles Show Details
431 of 992
432 of 992
433 of 992
434 of 992
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1subunit of GABAA receptor, β3 subunit of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; effective concentration (EC); EC50 related to: α1/β3/δ GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
8.5 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1subunit of GABAA receptor, β3 subunit of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; Hill coefficient related to: α1/β3/δ GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
1.1
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1subunit of GABAA receptor, β3 subunit of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp
Results
molecular target: α1/β3/δ GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6 subunit of GABAA receptor, β3 subunit of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; effective concentration (EC); EC50 related to: α6/β3/δ GABAA receptor
Type (Pharmacological
EC50
Data)
435 of 992
436 of 992
437 of 992
438 of 992
Value of Type (Pharmacological Data)
0.11 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6 subunit of GABAA receptor, β3 subunit of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; Hill coefficient related to: α6/β3/δ GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
0.9
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6 subunit of GABAA receptor, β3 subunit of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp
Results
molecular target: α6/β3/δ GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6 subunit of GABAA receptor, β3 subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; effective concentration (EC); EC50 related to: α6/β3 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.05 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological
oocyte of Xenopus; genetically modified/infected with: α6 subunit of GABAA receptor, β3 subunit of GABAA receptor
Data)
439 of 992
440 of 992
441 of 992
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; Hill coefficient related to: α6/β3 GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
1.2
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6 subunit of GABAA receptor, β3 subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp
Results
molecular target: α6/β3 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1 subunit of GABAA receptor, α6 subunit of GABAA receptor, β3 subunit of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; effective concentration (EC); EC50 related to: α1/α6/β3/δ GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1 subunit of GABAA receptor, α6 subunit of GABAA receptor, β3 subunit of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp; Hill coefficient related to: α1/α6/β3/δ GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
0.9
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
442 of 992
443 of 992
444 of 992
445 of 992
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1 subunit of GABAA receptor, α6 subunit of GABAA receptor, β3 subunit of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp
Results
molecular target: α1/α6/β3/δ GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: β3-α1-δ/α6-β3 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.36 - 0.65 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; Hill coefficient related to: β3-α1-δ/α6-β3 GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
0.69
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type
138 nA
(Pharmacological Data)
446 of 992
447 of 992
448 of 992
449 of 992
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence of THDOC
Value of Type (Pharmacological Data)
1094 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
molecular target: β3-α1-δ/α6-β3 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: β3-α6-δ/α1-β3 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
11.9 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Further Details
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; Hill coefficient related to:
450 of 992
451 of 992
452 of 992
453 of 992
(Pharmacological Data)
β3-α6-δ/α1-β3 GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
1.03
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
520 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence of THDOC
Value of Type (Pharmacological Data)
4500 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
molecular target: β3-α6-δ/α1-β3 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological
current amplitude; increase of
Data)
454 of 992
455 of 992
456 of 992
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1-β3-α6 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; rat δ subunit; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α1 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: α6-β3-α1/β3-δ GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
10.4 - 357 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α1 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; Hill coefficient related to: α6-β3-α1/β3-δ GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
0.89
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α1 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
457 of 992
458 of 992
459 of 992
460 of 992
Value of Type (Pharmacological Data)
1069 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α1 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence of THDOC
Value of Type (Pharmacological Data)
2975 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α1 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
molecular target: α6-β3-α1/β3-δ GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, β3-α6 concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: β3-α1-δ/β3-α6 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
51 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or Test-
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, β3-α6 concatenated subunits of GABAA receptor
System (Pharmacological Data)
461 of 992
462 of 992
463 of 992
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; Hill coefficient related to: β3-α1-δ/β3-α6 GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
1
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, β3-α6 concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
molecular target: β3-α1-δ/β3-α6 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, β3-α6 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-δ concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; rat δ subunit; two-electrode voltage clamp
464 of 992
465 of 992
466 of 992
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1-β3 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp; effective concentration (EC); EC50 related to: β3-α1 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
53 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp; Hill coefficient related to: β3-α1 GABAA receptor
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
1.01
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
467 of 992
468 of 992
469 of 992
470 of 992
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
542 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence THDOC
Value of Type (Pharmacological Data)
789 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Results
molecular target: β3-α1 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor
(Pharmacological Data)
471 of 992
472 of 992
473 of 992
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; rat δ subunit; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude
Value of Type (Pharmacological Data)
110 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp; effective concentration (EC)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.24 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3 concatenated subunits of GABAA receptor
474 of 992
475 of 992
476 of 992
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
0.71
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
7 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence THDOC
Value of Type (Pharmacological Data)
184 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6 concatenated subunits of GABAA receptor
477 of 992
478 of 992
479 of 992
480 of 992
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; rat δ subunit; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1-β3-α6 concatenated subunits of GABAA receptor, rat δ subunit of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α1 concatenated subunits of GABAA receptor, rat δ subunit of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
481 of 992
482 of 992
483 of 992
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
38 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
1.17
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
1929 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence of THDOC
484 of 992
485 of 992
486 of 992
487 of 992
Value of Type (Pharmacological Data)
4433 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ-β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
49 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ-β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
Hill coefficient
Value of Type (Pharmacological Data)
0.72
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ-β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
8 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
488 of 992
489 of 992
490 of 992
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ-β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence of THDOC
Value of Type (Pharmacological Data)
50 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: β3-α1-δ/α1-β3 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
9.1 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
190 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological
current amplitude for 1 mmol/l in presence of THDOC
Data)
491 of 992
492 of 992
493 of 992
Value of Type (Pharmacological Data)
250 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
molecular target: β3-α1-δ/α1-β3 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: β3-α6-δ/α6-β3 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.1 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
2090 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
494 of 992
495 of 992
496 of 992
497 of 992
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
molecular target: β3-α6-δ/α6-β3 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1-β3-α1 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: α1-β3-α1/β3-δ GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
8.3 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1-β3-α1 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence of THDOC
Value of Type (Pharmacological Data)
420 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1-β3-α1 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
molecular target: α1-β3-α1/β3-δ GABAA receptor
498 of 992
499 of 992
500 of 992
501 of 992
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α6 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: α6-β3-α6/β3-δ GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.27 - 410 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α6 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
450 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α6 concatenated subunits of GABAA receptor, β3-δ concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
molecular target: α6-β3-α6/β3-δ GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect
current amplitude; increase of
(Pharmacological Data)
502 of 992
503 of 992
504 of 992
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-δ-β3 concatenated subunits of GABAA receptor, α1-β3 concatenated subunits of GABAA receptor
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; rat δ subunit; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-δ-β3 concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: β3-δ-β3/α6-β3 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.08 - 510 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-δ-β3 concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
350 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological
oocyte of Xenopus; genetically modified/infected with: β3-δ-β3 concatenated subunits of GABAA receptor, α6-β3 concatenated subunits of GABAA receptor
Data)
505 of 992
506 of 992
507 of 992
508 of 992
Kind of Dosing (Pharmacological Data)
title comp. administered in combination with THDOC (1 μmol/l)
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
molecular target: β3-δ-β3/α6-β3 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-δ-β3 concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
600 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-δ-β3 concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence of THDOC
Value of Type (Pharmacological Data)
2000 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-δ-β3 concatenated subunits of GABAA receptor, β3-α6 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect
current amplitude; increase of
(Pharmacological Data)
509 of 992
510 of 992
511 of 992
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp; effective concentration (EC); EC50 related to: β3-α1-δ/β3-α1 GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
219 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
Value of Type (Pharmacological Data)
220 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence of THDOC
Value of Type (Pharmacological Data)
1100 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α1-δ concatenated subunits of GABAA receptor, β3-α1 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
512 of 992
513 of 992
514 of 992
515 of 992
Results
molecular target: β3-α1-δ/β3-α1 GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: β3-α6-δ concatenated subunits of GABAA receptor, β3-α6 concatenated subunits of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; rat δ subunit; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α1-β3-α1 concatenated subunits of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Results
no effect
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α6 concatenated subunits of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp; effective concentration (EC); EC50 related to: α6-β3-α6/δ GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.36 μmol/l
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α6 concatenated subunits of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l
516 of 992
517 of 992
518 of 992
Value of Type (Pharmacological Data)
160 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α6 concatenated subunits of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Type (Pharmacological Data)
current amplitude for 1 mmol/l in presence of THDOC
Value of Type (Pharmacological Data)
1340 nA
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current amplitude; increase of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus; genetically modified/infected with: α6-β3-α6 concatenated subunits of GABAA receptor, rat δ subunit of GABAA receptor
Further Details (Pharmacological Data)
GABAA: γ-aminobutyric acid, type A; THDOC: 3α,21-dihydroxy-5α-pregnan-20-one; two-electrode voltage clamp
Results
molecular target: α6-β3-α6/δ GABAA receptor
Reference
Baur, Roland; Kaur, Kuldeep H.; Sigel, Erwin
Journal of Biological Chemistry, 2010 , vol. 285, # 23 p. 17398 - 17405 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
cardiovascular parameters; effect on
Species or TestSystem (Pharmacological Data)
Wistar-Kyoto rat
Sex
male
Route of Application
intravenous
Concentration (Pharmacological Data)
0.48 - 0.8 mg/kg
Kind of Dosing (Pharmacological Data)
title comp. dissolved in isotonic normal saline
Further Details (Pharmacological Data)
for untreated rats: MSAP = 115 mm Hg, HR = 370 beats/min and dP/dtmax = 8401 mm Hg/s; mass of species: 250 - 300 g; mean systemic arterial pressure (MSAP)
Type (Pharmacological Data)
MSAP
Value of Type (Pharmacological Data)
99 - 105 mm Hg
Reference
Wang, Jyh-Jye; Wang, Hui-Yun; Shih, Cheng-Dean
Journal of Agricultural and Food Chemistry, 2010 , vol. 58, # 13 p. 7940 - 7948
Title/Abstract Full Text View citing articles Show Details
519 of 992
520 of 992
521 of 992
Effect (Pharmacological Data)
cardiovascular parameters; effect on
Species or TestSystem (Pharmacological Data)
Wistar-Kyoto rat
Sex
male
Route of Application
intravenous
Concentration (Pharmacological Data)
0.48 - 0.8 mg/kg
Kind of Dosing (Pharmacological Data)
title comp. dissolved in isotonic normal saline
Further Details (Pharmacological Data)
for untreated rats: MSAP = 115 mm Hg, HR = 370 beats/min and dP/dtmax = 8401 mm Hg/s; mass of species: 250 - 300 g; heart rate (HR)
Type (Pharmacological Data)
HR
Value of Type (Pharmacological Data)
353 - 361 beats/min
Reference
Wang, Jyh-Jye; Wang, Hui-Yun; Shih, Cheng-Dean
Journal of Agricultural and Food Chemistry, 2010 , vol. 58, # 13 p. 7940 - 7948 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
cardiovascular parameters; effect on
Species or TestSystem (Pharmacological Data)
Wistar-Kyoto rat
Sex
male
Route of Application
intravenous
Concentration (Pharmacological Data)
0.48 - 0.8 mg/kg
Kind of Dosing (Pharmacological Data)
title comp. dissolved in isotonic normal saline
Further Details (Pharmacological Data)
for untreated rats: MSAP = 115 mm Hg, HR = 370 beats/min and dP/dtmax = 8401 mm Hg/s; mass of species: 250 - 300 g
Type (Pharmacological Data)
dP/dtmax
Value of Type (Pharmacological Data)
8312 - 8327 mm Hg/s
Reference
Wang, Jyh-Jye; Wang, Hui-Yun; Shih, Cheng-Dean
Journal of Agricultural and Food Chemistry, 2010 , vol. 58, # 13 p. 7940 - 7948 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
cardiovascular parameters; effect on
Species or TestSystem (Pharmacological Data)
Wistar-Kyoto rat; pre-existing medical conditions: hypertensive
Sex
male
Route of Application
intravenous
522 of 992
523 of 992
Concentration (Pharmacological Data)
0.48 - 0.8 mg/kg
Kind of Dosing (Pharmacological Data)
title comp. dissolved in isotonic normal saline
Further Details (Pharmacological Data)
for untreated rats: MSAP = 167 mm Hg, HR = 357 beats/min and dP/dtmax = 11682 mm Hg/s; mass of species: 250 - 300 g; mean systemic arterial pressure (MSAP)
Type (Pharmacological Data)
MSAP
Value of Type (Pharmacological Data)
143 - 152 mm Hg
Reference
Wang, Jyh-Jye; Wang, Hui-Yun; Shih, Cheng-Dean
Journal of Agricultural and Food Chemistry, 2010 , vol. 58, # 13 p. 7940 - 7948 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
cardiovascular parameters; effect on
Species or TestSystem (Pharmacological Data)
Wistar-Kyoto rat; pre-existing medical conditions: hypertensive
Sex
male
Route of Application
intravenous
Concentration (Pharmacological Data)
0.48 - 0.8 mg/kg
Kind of Dosing (Pharmacological Data)
title comp. dissolved in isotonic normal saline
Further Details (Pharmacological Data)
for untreated rats: MSAP = 167 mm Hg, HR = 357 beats/min and dP/dtmax = 11682 mm Hg/s; mass of species: 250 - 300 g; heart rate (HR)
Type (Pharmacological Data)
HR
Value of Type (Pharmacological Data)
347 - 351 beats/min
Reference
Wang, Jyh-Jye; Wang, Hui-Yun; Shih, Cheng-Dean
Journal of Agricultural and Food Chemistry, 2010 , vol. 58, # 13 p. 7940 - 7948 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
cardiovascular parameters; effect on
Species or TestSystem (Pharmacological Data)
Wistar-Kyoto rat; pre-existing medical conditions: hypertensive
Sex
male
Route of Application
intravenous
Concentration (Pharmacological Data)
0.48 - 0.8 mg/kg
Kind of Dosing (Pharmacological Data)
title comp. dissolved in isotonic normal saline
Further Details (Pharmacological Data)
for untreated rats: MSAP = 167 mm Hg, HR = 357 beats/min and dP/dtmax = 11682 mm Hg/s; mass of species: 250 - 300 g
Type (Pharmacological
dP/dtmax
Data)
524 of 992
525 of 992
526 of 992
527 of 992
Value of Type (Pharmacological Data)
11581 - 11598 mm Hg/s
Reference
Wang, Jyh-Jye; Wang, Hui-Yun; Shih, Cheng-Dean
Journal of Agricultural and Food Chemistry, 2010 , vol. 58, # 13 p. 7940 - 7948 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
pharmacokinetics
Species or TestSystem (Pharmacological Data)
semicarbazide-sensitive amine oxidase/vascular adhesion protein-1 of human
Further Details (Pharmacological Data)
peroxidase coupled continuous assay
Type (Pharmacological Data)
Km
Value of Type (Pharmacological Data)
> 1000000 μmol/l
Reference
Bonaiuto, Emanuela; Lunelli, Michele; Scarpa, Marina; Vettor, Roberto; Milan, Gabriella; Di Paolo, Maria Luisa
Biochimie, 2010 , vol. 92, # 7 p. 858 - 868 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
protein binding
Species or TestSystem (Pharmacological Data)
Atu2422 periplasmic binding protein
Further Details (Pharmacological Data)
isothermal titration calorimetry; dissociation constant (Kd)
Type (Pharmacological Data)
Kd
Value of Type (Pharmacological Data)
2.4 μmol/l
Reference
Planamente, Sara; Vigouroux, Armelle; Mondy, Samuel; Nicaise, Magali; Faure, Denis; Morera, Solange
Journal of Biological Chemistry, 2010 , vol. 285, # 39 p. 30294 - 30303 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
protein binding
Species or TestSystem (Pharmacological Data)
Atu2422 periplasmic binding protein
Further Details (Pharmacological Data)
isothermal titration calorimetry
Results
molecular target: Atu2422 periplasmic binding protein
Reference
Planamente, Sara; Vigouroux, Armelle; Mondy, Samuel; Nicaise, Magali; Faure, Denis; Morera, Solange
Journal of Biological Chemistry, 2010 , vol. 285, # 39 p. 30294 - 30303 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
L-[3H]-proline uptake; inhibition of
Species or TestSystem (Pharmacological
Agrobacterium tumefaciens C58; genetically modified/infected with: Atu2422 periplasmic binding protein
Data)
528 of 992
529 of 992
530 of 992
Concentration (Pharmacological Data)
10 μmol/l
Further Details (Pharmacological Data)
rapid filtration method; defective mutant of species that does not produce wild-type Atu2422 periplasmic binding protein
Results
no effect
Reference
Planamente, Sara; Vigouroux, Armelle; Mondy, Samuel; Nicaise, Magali; Faure, Denis; Morera, Solange
Journal of Biological Chemistry, 2010 , vol. 285, # 39 p. 30294 - 30303 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
L-[3H]-proline uptake; inhibition of
Species or TestSystem (Pharmacological Data)
Agrobacterium tumefaciens C58; genetically modified/infected with: Atu2422-F77A periplasmic binding protein
Concentration (Pharmacological Data)
10 μmol/l
Further Details (Pharmacological Data)
rapid filtration method; defective mutant of species that does not produce wild-type Atu2422 periplasmic binding protein
Results
no effect
Reference
Planamente, Sara; Vigouroux, Armelle; Mondy, Samuel; Nicaise, Magali; Faure, Denis; Morera, Solange
Journal of Biological Chemistry, 2010 , vol. 285, # 39 p. 30294 - 30303 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
creatine uptake; effect on
Species or TestSystem (Pharmacological Data)
primary hippocampal neurons of Wistar rat
Concentration (Pharmacological Data)
1 mmol/l
Further Details (Pharmacological Data)
E18 embryos
Results
no effect; insignificant effect(s) discussed
Reference
Dodd, Joanna R.; Birch, Nigel P.; Waldvogel, Henry J.; Christie, David L.
Journal of Neurochemistry, 2010 , vol. 115, # 3 p. 684 - 693 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
[125I]BnOPh-GHB Binding; inhibition of
Species or TestSystem (Pharmacological Data)
cerebral cortical membranes of Sprague-Dawley rat
Sex
male
Further Details (Pharmacological Data)
GHB: γ-hydroxybutyric acid; inhibitory concentration (IC); IC50 related to: GHB binding site
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
> 1 mmol/l
Reference
Wellendorph, Petrine; Hog, Signe; Sabbatini, Paola; Pedersen, Martin H. F.; Martiny, Lars; Knudsen, Gitte M.; Frolund, Bente; Clausen, Rasmus P.; Braeuner-Osborne, Hans
Journal of Pharmacology and Experimental Therapeutics, 2010 , vol. 335, # 2 p. 458 - 464
Title/Abstract Full Text View citing articles Show Details
531 of 992
532 of 992
Effect (Pharmacological Data)
growth; inhibition of
Species or TestSystem (Pharmacological Data)
seeds of Lepidium sativum L., cress
Concentration (Pharmacological Data)
0.0001 - 0.01 mol/l
Further Details (Pharmacological Data)
cress radicle growth test (24 h, 25 °C, dark); volume administered: 500 μl
Results
no effect
Reference
Tin, Wai Wai Thet; Hayashi, Hisayoshi; Otomatsu, Toshihiko; Hirose, Katsutoshi; Hasegawa, Koji; Shigemori, Hideyuki
Heterocycles, 2009 , vol. 78, # 10 p. 2439 - 2442 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
osmotically-driven burst of oocytes; effect on
Species or TestSystem (Pharmacological Data)
aquaporin 4 (AQP4) expressing oocytes
Method (Pharmacological Data)
The composition of the library for initial AQP channel screening included various channel, transporter and receptor blocking compounds based on intuition and from clues regarding clinical side effects that involved water transporting tissues. In a simple screen (Fig. 5), control and AQP4-expressing oocytes were preincubated in isotonic saline (100 mM NaCl; 5 mM MgCl2; 5 mM HEPES, pH 7.3; -200 mOsm) containing the test compound for 10-15 min before each experiment; then the time to oocyte bursting (physical explosion) after transfer to 100 mOsm saline was monitored visually. In the absence of a blocking compound, osmotically-driven water influx led to rapid swelling and bursting. Block was evident in the increased time required for bursting in hypotonic saline. Control oocytes, adapted for a freshwater environment and lacking AQPs, show no detectable swelling at 10 min or more.Figure 5 shows the effects of agents on time-to-burst for AQP4 expressing oocytes. Of more than 30 compounds screened by the inventors, 100 μM bumetanide was one of four compounds that significantly delayed bursting time in AQP4- expressing oocytes. AQP4 (also known as the 'mercury-insensitive water channel') showed no effect of HgCl2 These data show that significant APQ4 block resulted from treatment with swelling results from direct interaction with the AQP4 channel. The direct action of bumetanide on AQP4 was unambiguously demonstrated through site-directed mutagenesis studies which impaired the ability of bumetanide to block the AQP4 mutant but for which the rate of water flux was not altered. Noteworthy in these mutagenesis sites is their location at or near the intracellular surface of AQP4.In addition to bumetanide, other classic loop diuretic drugs, such as furosemide and torsemide, were tested and found to vary significantly in their ability to block AQP4. In AQP4-expressing oocytes (Fig. 6 a-d), furosemide was less EPO effective then bumetanlde In blocking the swelling rate when administered in the normal extracellular fashion. Based on the site directed mutagenesis results, experiments were designed to test the proposed intracellular binding site for these agents. The observation that bumetanide and, in particular, furosemide exhibit improved block at lower concentrations, (Fig. 6 ef), support our hypothesis that the putative binding site for these agents is on or near the intracellular side of the AQP4 channel. Moreover, this result revealed
the importance of the 3-(sulfamoyl)benzoic acid scaffold, which is common to both furosemide and bumetanide, as a key pharmacophore element for AQP4 blocking agents.Consistent with this finding is the finding that torsemide, which is dissimilar to bumetanide and furosemide, had no blocking effect on swelling in AQP4- expressing oocytes at concentrations up to 1 niM. Moreover,
values reported for these loop diuretics against the Na-K-Cl cotransporter (NKCCl) in cells differs from the values and trends observed in these AQP4 experiments. For example, furosemide exhibits a half-maximal blocking concentration (IC50) of 23 μM and the IC50 for bumetanide is 0.33 μM measured in a mouse kidney collecting duct cell line (Glanville et al., 2001), while the IC50 for torsemide measured in perfused kidney ascending loops of Henle is 0.3μM, (Greger, 1988). Thus, the inventors concluded that the contribution of endogenous volume regulatory responses is small in oocytes heterologously expressing abundant AQP4.Fig. 6 presents a quantitative analyses of block in AQP4-expressing oocytes by bumetanide and related loop-diuretic compounds, (a) Dose-dependent block by extracellular bumetanide, and similar block at 100 μM by furosemide. (b) Absence of block by torsemide at concentrations up to 1 mM. (c) Corresponding summary histogram showing n values (below x-axis) and statistical significance, (d) Structures EPO of t IC&50
Location
Page/Page column 14; 35-37; 3/6
Comment (Pharmacological Data)
No effect
Reference
FLYNN, Gary, A.; YOOL, Andrea, J.; MIGLIATI, Elton, Rodrigues; RITTER, Leslie, S.
Patent: WO2008/52190 A2, 2008 ; Title/Abstract Full Text Show Details
533 of 992
Effect (Pharmacological Data)
protein binding affinity
Species or TestSystem (Pharmacological Data)
monoclonal mouse anti-GABA antibody
Concentration (Pharmacological Data)
5 μmol/l - 50 mmol/l
Kind of Dosing
Title compound dissolved in PBS containing 3percent BSA
(Pharmacological Data)
534 of 992
535 of 992
536 of 992
537 of 992
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; PBS: phosphate buffered saline; BSA: bovine serum albumin
Results
molecular target: monoclonal anti-GABA antibody
Reference
Wang, Tingting; Muthuswamy, Jit
Analytical Chemistry, 2008 , vol. 80, # 22 p. 8576 - 8582 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
oocyte current; stimulation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: rat α1β2 GABAA receptor
Sex
female
Further Details (Pharmacological Data)
EC50 related to: GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
10.0 μmol/l
Reference
Jansen, Michaela; Rabe, Holger; Strehle, Axelle; Dieler, Sandra; Debus, Fabian; Dannhardt, Gerd; Akabas, Myles H.; Lueddens, Hartmut
Journal of Medicinal Chemistry, 2008 , vol. 51, # 15 p. 4430 - 4448 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
oocyte current; stimulation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: rat α1β2 GABAA receptor
Sex
female
Results
molecular target: GABAA receptor
Reference
Jansen, Michaela; Rabe, Holger; Strehle, Axelle; Dieler, Sandra; Debus, Fabian; Dannhardt, Gerd; Akabas, Myles H.; Lueddens, Hartmut
Journal of Medicinal Chemistry, 2008 , vol. 51, # 15 p. 4430 - 4448 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
oocyte current; stimulation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: rat α1F64Cβ2 GABAA receptor mutant
Sex
female
Results
molecular target: GABAA receptor
Reference
Jansen, Michaela; Rabe, Holger; Strehle, Axelle; Dieler, Sandra; Debus, Fabian; Dannhardt, Gerd; Akabas, Myles H.; Lueddens, Hartmut
Journal of Medicinal Chemistry, 2008 , vol. 51, # 15 p. 4430 - 4448 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
oocyte current; stimulation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: rat α1S68Cβ2 GABAA receptor mutant
Sex
female
Results
molecular target: GABAA receptor
538 of 992
539 of 992
540 of 992
Reference
Jansen, Michaela; Rabe, Holger; Strehle, Axelle; Dieler, Sandra; Debus, Fabian; Dannhardt, Gerd; Akabas, Myles H.; Lueddens, Hartmut
Journal of Medicinal Chemistry, 2008 , vol. 51, # 15 p. 4430 - 4448 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
oocyte current; stimulation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: rat α1S68Cβ2 GABAA receptor mutant
Sex
female
Further Details (Pharmacological Data)
EC50 related to: GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
6.5 μmol/l
Reference
Jansen, Michaela; Rabe, Holger; Strehle, Axelle; Dieler, Sandra; Debus, Fabian; Dannhardt, Gerd; Akabas, Myles H.; Lueddens, Hartmut
Journal of Medicinal Chemistry, 2008 , vol. 51, # 15 p. 4430 - 4448 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
oocyte current; stimulation of
Species or TestSystem (Pharmacological Data)
oocyte of Xenopus laevis; genetically modified/infected with: rat α1F64Cβ2 GABAA receptor mutant
Sex
female
Further Details (Pharmacological Data)
EC50 related to: GABAA receptor
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
430 μmol/l
Reference
Jansen, Michaela; Rabe, Holger; Strehle, Axelle; Dieler, Sandra; Debus, Fabian; Dannhardt, Gerd; Akabas, Myles H.; Lueddens, Hartmut
Journal of Medicinal Chemistry, 2008 , vol. 51, # 15 p. 4430 - 4448 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
nephroprotective
Species or TestSystem (Pharmacological Data)
Wistar rat
Sex
male
Route of Application
intragastric
Concentration (Pharmacological Data)
100 - 500 mg/kg
Kind of Dosing (Pharmacological Data)
administered daily for 10 or 60 days
Method (Pharmacological Data)
nephrectomized rats received title comp.; body weight, water intake evaluated; serum urea nitrogen, Cr, Ccr determined; urinary protein excretion determined by sulfosalicylic acid method; kidneys subjected to histopathological analyses
Further Details (Pharmacological Data)
Cr: creatinine; Ccr: creatinine clearance
541 of 992
542 of 992
543 of 992
Results
title comp. sign. improved body weight; decreased serum urea nitrogen, Cr, urinary protein levels at 60 d; no effect on Ccr; sign. inhibited fibril formation in renal cortex at 10 d, glomerular atrophy at 10 and 60 d, tubular atrophy at 60 d (figures)
Reference
Sasaki, Sumiyo; Tohda, Chihiro; Kim, Mujo; Yokozawa, Takako
Biological and Pharmaceutical Bulletin, 2007 , vol. 30, # 4 p. 687 - 691 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
protein expression; inhibition of
Species or TestSystem (Pharmacological Data)
Wistar rat
Sex
male
Route of Application
intragastric
Concentration (Pharmacological Data)
100 - 500 mg/kg
Kind of Dosing (Pharmacological Data)
administered daily for 10 or 60 days
Method (Pharmacological Data)
nephrectomized rats received title comp.; kidney excised; frozen sections assessed for expression of TGF-β, fibronectin with immunohistochemical analysis
Further Details (Pharmacological Data)
TGF: transforming growth factor
Results
title comp. sign. inhibited TGF-β expression in tubuli, but not in glomeruli, at 10 d; dose-dependently inhibited fibronectin expression in tubuli, but not in glomeruli, at 60 d (figures)
Reference
Sasaki, Sumiyo; Tohda, Chihiro; Kim, Mujo; Yokozawa, Takako
Biological and Pharmaceutical Bulletin, 2007 , vol. 30, # 4 p. 687 - 691 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor binding; modulation of
Species or TestSystem (Pharmacological Data)
cerebellar membranes of Wistar rat
Sex
male
Concentration (Pharmacological Data)
30 nmol/l
Method (Pharmacological Data)
membranes incubated with 1 nM <3H>EBOB and HBAO or ALLO in presence of title comp. for 2 h at 25 deg C; after filtration, radioactivity counted by scintillation spectrometry
Further Details (Pharmacological Data)
EBOB: ethynylbicycloorthobenzoate; HBAO: (20R)-17β-(1-hydroxy-2,3-butadienyl)-5α-androstane-3α-ol; ALLO: allopregnanolone; for nonspecific binding, 50 μM picrotoxinin applied
Results
title comp. displaced <3H>EBOB binding to 79.0percent and resulted in biphasic displacement curve of HBAO shifted to right; fig.
Reference
Maksay; Fodor; Biro; Avlonitis; Calogeropoulou
British Journal of Pharmacology, 2007 , vol. 151, # 7 p. 1078 - 1086 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antihypertensive, other
Species or TestSystem (Pharmacological Data)
SHR/Izm rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
0.33 - 3.3 mg/kg
544 of 992
Kind of Dosing (Pharmacological Data)
title comp. dissolved in distilled water
Method (Pharmacological Data)
single dose of title comp. given to test animals after 14-h fasting; systolic blood pressure and heart rate measured by tail-cuff method at time intervals up to 24 h after administration
Further Details (Pharmacological Data)
control: distilled water
Results
title comp. decreased systolic blood pressure at 3-8 h following administration; fig.
Reference
Yamakoshi, Jun; Fukuda, Satoshi; Satoh, Takuya; Tsuji, Ryouhei; Saito, Makoto; Obata, Akio; Matsuyama, Asahi; Kikuchi, Mamoru; Kawasaki, Terukazu
Bioscience, Biotechnology and Biochemistry, 2007 , vol. 71, # 1 p. 165 - 173 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
H. pylori growth; inhibition of
Species or TestSystem (Pharmacological Data)
ATCC43504 (HP 43504) of Helicobacter pylori
Method (Pharmacological Data)
Effect of Short-Chain Fatty Acids on Inhibiting HP Growth Various concentrations of test compounds were used to examine their effect on the growth of HP 43504 and HP 238. The aqueous solutions of tested compounds used in this experiment comprised 4-phenylbutyrate (4-PB), 2-phenylbutyrate (2-PB), butyrate, gama-aminobutyric acid (GABA), 2-aminobutyric acid (2-AB),2, 4-diaminobutyric acid (2,4-DAB) and sodium valproate (Valproate). HP 43504 and the clinically isolated strain HP 238 were used for testing their susceptibility to various compounds in disc diffusion assays. After 2 days' pre-culture in CDC agar plates (Becton Dickinson, Cockeysville, Md., USA), HP 43504 or HP 238 was suspended in a Brucella broth (BBL, Cockeysville, Md., USA) containing 5percent sucrose to adjust its clone density at 1.x.108CFU/ml. Then 100 μl of the bacterial suspension was inoculated evenly onto a CDC agar (Becton Dickinson, Cockeysville, Md., USA) or Brucella agar plate (supplemented with 10percent horse serum) to allow growth to form bacterial lawns. The paper discs, 8 mm in diameter, (from Toyo Roshi Kaisha) containing 40 μl of each test compound were applied to the agar plates. The agar plates were later transferred to a microaerobic jar to incubate at 37° C. The diameter (mm) of each inhibition zone (disc diffusion zone) that indicates zones of bacterium nongrowth was measured 48 hours later, as indicated by the number for each compound in Table 1. The results are shown in Table 1. The median PB dose recommended for ornithine transcarbamylase-deficient patients is 352 mg/kg/day, and no side effects related to therapy were observed. Therefore, we chose biologically available and safe concentrations of 5 to 100 mg/ml for 4-PB and related compounds in the present experiments. The results indicate that 4-PB and 2-PB, compared to other compounds, have much larger disc diffusion diameters in both HP 43504 and HP 238 lawns, indicating that they have much better anti-HP activity. The paper discs treated with 4-PB solutions of 25 to 100 mg/ml showed anti-HP activity. Therefore, a gradient of concentration that is below 25 to 50 mg/ml might be still effective in inhibiting HP growth. In considering biological availability, for example, when a 60-kg subject takes 21,120 mg (352 mg/kg x 60 kg) of 4-PB in 100 ml distilled water by two divided fractions, the expected local concentration in the gastric lumen would be 50 to 200 mg/ml, which would be enough to inhibit HP proliferation based on the present findings. Butyric acid is also a member of the HDAC inhibitors, and is classified as the short-chain fatty acid class, and was shown to have a bactericidal effect on HP. Sodium butyrate was used in the present experiment. However, its disc diffusion capacity was much smaller than 4-PB or 2-PB for both HP strains in the present studies. The three other short-chain fatty acids (GABA, 2-AB, 2,4-DAB) that have a similar structural backbone to that of butyrate, 4-PB and 2-PB have no obvious anti-HP activity, since there is no clear zone outside the paper disc even at a higher concentration (100 mg/ml). Therefore, anti-HP activity does not seem to be a general phenomenon for shortchain fatty acids with butyric backbone. Valproate, an HDAC inhibitor, is the drug of choice for primary generalized epilepsy and partial seizures. However, Valproate has dose-related side effects including nausea, vomiting, tremor, sedation, confusion or irritability, hair loss or curling of hair, endocrine effects (insulin resistance, anovulatory cycles, amenorrhea, and polycystic ovary syndrome) and weight gain. Patients with an underlying urea cycle disorder may suffer from fatal encephalopathy from acute hyperammonemia. The most serious idiosyncratic effect is hepatotoxicity, mainly in patients younger than 2 years old and with polytherapy. Therefore, much consideration is required when prescribing Valproate, and its usual recommended dose is 2040 mg/kg/day. The tested
Results
Title compound concentration: 100 mg/ml. The diameter (mm) of each inhibition zone (disc diffusion zone) that indicates zones of bacterium non-growth was measured 48 hours later: 8 (CDC agar plate); 8 (Brucella agar plate).
Location
Page/Page column 4-5
Reference
ANTROMED INC
Patent: US2007/21508 A1, 2007 ; Title/Abstract Full Text Show Details
545 of 992
Effect (Pharmacological Data)
H. pylori growth; inhibition of
Species or TestSystem (Pharmacological Data)
HP 238 of Helicobacter pylori
Method (Pharmacological Data)
Effect of Short-Chain Fatty Acids on Inhibiting HP Growth Various concentrations of test compounds were used to examine their effect on the growth of HP 43504 and HP 238. The aqueous solutions of tested compounds used in this experiment comprised 4-phenylbutyrate (4-PB), 2-phenylbutyrate (2-PB), butyrate, gama-aminobutyric acid (GABA), 2-aminobutyric acid (2-AB),2, 4-diaminobutyric acid (2,4-DAB) and sodium valproate (Valproate). HP 43504 and the clinically isolated strain HP 238 were used for testing their susceptibility to various compounds in disc diffusion assays. After 2 days' pre-culture in CDC agar plates (Becton Dickinson, Cockeysville, Md., USA), HP 43504 or HP 238 was suspended in a Brucella broth (BBL, Cockeysville, Md., USA) containing 5percent sucrose to adjust its clone density at 1.x.108CFU/ml. Then 100 μl of the bacterial suspension was inoculated evenly onto a CDC agar (Becton Dickinson, Cockeysville, Md., USA) or Brucella agar plate (supplemented with 10percent horse serum) to allow growth to form bacterial lawns. The paper discs, 8 mm in diameter, (from Toyo Roshi Kaisha) containing 40 μl of each test compound were applied to the agar plates. The agar plates were later transferred to a microaerobic jar to incubate at 37° C. The diameter (mm) of each inhibition zone (disc diffusion zone) that indicates zones of bacterium nongrowth was measured 48 hours later, as indicated by the number for each compound in Table 1. The results are shown in Table 1. The median PB dose recommended for ornithine transcarbamylase-deficient patients is 352 mg/kg/day, and no side effects related to therapy were observed. Therefore, we chose biologically available and safe concentrations of 5 to 100 mg/ml for 4-PB and related compounds in the present experiments. The results indicate that
4-PB and 2-PB, compared to other compounds, have much larger disc diffusion diameters in both HP 43504 and HP 238 lawns, indicating that they have much better anti-HP activity. The paper discs treated with 4-PB solutions of 25 to 100 mg/ml showed anti-HP activity. Therefore, a gradient of concentration that is below 25 to 50 mg/ml might be still effective in inhibiting HP growth. In considering biological availability, for example, when a 60-kg subject takes 21,120 mg (352 mg/kg x 60 kg) of 4-PB in 100 ml distilled water by two divided fractions, the expected local concentration in the gastric lumen would be 50 to 200 mg/ml, which would be enough to inhibit HP proliferation based on the present findings. Butyric acid is also a member of the HDAC inhibitors, and is classified as the short-chain fatty acid class, and was shown to have a bactericidal effect on HP. Sodium butyrate was used in the present experiment. However, its disc diffusion capacity was much smaller than 4-PB or 2-PB for both HP strains in the present studies. The three other short-chain fatty acids (GABA, 2-AB, 2,4-DAB) that have a similar structural backbone to that of butyrate, 4-PB and 2-PB have no obvious anti-HP activity, since there is no clear zone outside the paper disc even at a higher concentration (100 mg/ml). Therefore, anti-HP activity does not seem to be a general phenomenon for shortchain fatty acids with butyric backbone. Valproate, an HDAC inhibitor, is the drug of choice for primary generalized epilepsy and partial seizures. However, Valproate has dose-related side effects including nausea, vomiting, tremor, sedation, confusion or irritability, hair loss or curling of hair, endocrine effects (insulin resistance, anovulatory cycles, amenorrhea, and polycystic ovary syndrome) and weight gain. Patients with an underlying urea cycle disorder may suffer from fatal encephalopathy from acute hyperammonemia. The most serious idiosyncratic effect is hepatotoxicity, mainly in patients younger than 2 years old and with polytherapy. Therefore, much consideration is required when prescribing Valproate, and its usual recommended dose is 2040 mg/kg/day. The tested Results
Title compound concentration: 100 mg/ml. The diameter (mm) of each inhibition zone (disc diffusion zone) that indicates zones of bacterium non-growth was measured 48 hours later: 8 (CDC agar plate); 8 (Brucella agar plate).
Location
Page/Page column 4-5
Reference
ANTROMED INC
Patent: US2007/21508 A1, 2007 ; Title/Abstract Full Text Show Details
546 of 992
Effect (Pharmacological Data)
interleukin-6 secretion in the skin keratinocyte after ultraviolet illumination; effect on
Species or TestSystem (Pharmacological Data)
ceratinocye cells
Method (Pharmacological Data)
effect on interleukin-6 secretion in the skin keratinocyte after ultraviolet illumination>In order to examine an effect of the lactic acid bacteria culture of mung bean containing mung bean extract and GABA, which was obtained in the embodiment 2, on secretion of interleukin-6 (IL-6) related to anti.not. inflammatory and hyperimmune reactions, a following test was conducted.First, 5 x 104 cells/well of ceratinocye (HaCaT, ATCC, USA) were seeded in the 24well plates. On the next day, the culture medium was2 removed, 500 μJL of PBS was added, 25 mJ/cm UVB was illuminated and then thePBS was removed. Then, the lactic acid bacteria culture of mung bean of the embodiment 2 was included in amounts of 0.01percent (pGB 0.01) and 0.1percent (pGB 0.1), respectively, and GABA was included as comparative material in amounts of 0.01percent (GB 0.01) and 0.1percent (GB 0.1), respectively. Then, they were put into the culture medium to which WY14643 200 μM whose anti-inflammatory effect was proved was added as a positive control group and then cultured for 24 EPO ΔΔhours.After that, in order to measure a decrease amount of IL-6, CytElisa Human IL-6 ELISA kit (USA) was used. The test was conducted as follows, according to a method provided from the maker. 100 μi of culture solution after the culturing for 24 hours was extracted and divided in 96-well plates. Then, 25 μi of anti-interleukin-6 was put in the plates which were then sealed with a plate sealer. Then, it was reacted at the room temperature for 3 hours and then washed with PBS five times. Then, goat anti-rabbit alkaline phosphatase was pun in each plate which was again sealed. Then, it was reacted at the room temperature for 45 minutes. After that, a color generating reagent was divided therein in an amount of 200 μi, respectively. Then, it was reacted at the room temperature until there occurred a color change. When there occurred the color change, a reaction terminating solution was divided in an amount of 50 μi, respectively. Then, the absorbency was measured at 490 nm to measure the content of IL-6. A result thereof is shown in Fig. 6. In Fig. 6, (-) is a group in which only vehicle was treated after the ultraviolet illumination, normal is a state before the ultraviolet illumination and the others are groups to which the materials were treated after the ultraviolet illumination, as described above.As shown in Fig. 6, when the lactic acid bacteria culture of mung bean of the embodiment 2 was treated, it was obtained an IL-6 decreasing effect higher than WY14643 which exhibits a typical anti-inflammatory effect in proportional to the concentration. In addition, it was obtained the IL-6 decreasing effect higher than the GABA standard material. Accordingly, it was confirmed the excellent anti-inflammatory effect of the lactic acid bacteria culture of mung bean containing the mung bean extract and GABA.
Results
it was obtained an IL-6 decreasing effect; figure is given
Location
Page/Page column 6; 21-22; 6/6
Reference
DOOSAN CORPORATION; BIOVAN CO., LTD.
Patent: WO2007/7989 A1, 2007 ; Title/Abstract Full Text Show Details
547 of 992
Effect (Pharmacological Data)
uptake into cells
Species or TestSystem (Pharmacological Data)
embryonic kidney HEK-TREx-GAT2 cells of human
Method (Pharmacological Data)
Example 9 GABA Competition Assay with HEK-TREx-GAT2 Cells FIG. 2 depicts the results of a competition experiment using HEK-TREx-GAT2 cells. 3H-GABA was used as the substrate and unlabeled GABA was used as the competitor. The competition experiment was performed as described above. Non-specific uptake was determined by measuring the uptake into cells not induced to express the transporter ("no tet"). FIG. 2 demonstrates that in cells induced to express GAT2, the uptake of labeled GABA decreased as the concentration of unlabeled GABA increased. In control cells, uptake of labeled GABA remained at background levels and was largely unaffected by an excess of unlabeled GABA.
Results
in cells induced to express GAT2, the uptake of labeled GABA decreased as the concentration of title compound increased; in control cells, uptake of labeled GABA remained at background levels and was largely unaffected by an excess of title compound; figure is given
Location
Page/Page column 3; 16; sheet 2/2
Reference
XenoPort, Inc.
Patent: US2007/86950 A1, 2007 ; Title/Abstract Full Text Show Details
548 of 992
Effect (Pharmacological Data)
hGAT2-expressing cells; affinity to
Species or TestSystem (Pharmacological Data)
embryonic kidney HEK-TREx-hGAT2 cells of human
Method (Pharmacological Data)
Example 10 Competition and Direct Uptake Assays with HEK-TREx-hGAT2 Cells Using GABA The competition and direct uptake assays described in Examples 7 and 8 were used to test hGAT2 substrates. For each substrate, a dose-response graph and specific uptake graph into HEK-TREx-GAT2 cells induced (+TET) or uninduced (no TET) to express hGAT2 was prepared. A summary of the affinity value for GABA to hGAT2-expressing cells is provided in Table 5; Example 7 hGAT2 Competition Uptake Assay A modified competition uptake assay can be developed to determine the ability of a test compound(s) to inhibit the uptake of radiolabeled substrates into HEK-TREx-hGAT2 cells induced to over-express hGAT2. The results can be stated as affinities (IC50). The competition uptake assay is prepared as follows: Compounds are prepared for assay by diluting a 100 mM stock concentration (in DMSO) to the appropriate working concentration. Typically, seven-point dose response curves are prepared starting at a final assay concentration of 1 mM and carrying out three-fold dilutions. These dilutions are prepared by making a working "compound" plate that contains a 2.x. solution of the desired starting concentration of each test compound in duplicate in row A of a v-bottom microtiter plate. Six 3-fold serial dilutions (from row B to G) are made into the HBSS assay buffer (9.8 g/L Hank's Balance Salts (Sigma; H-1387), 2.6 g/L HEPES (10 mM), (Sigma; H-3375), 0.35 g/L NaHCO3 (4.2 mM) (Sigma; S-6297)), pH to 7.4 with 5N NaOH) with the appropriate amount of DMSO so that the DMSO concentration remains constant at all dilutions. The resulting "compound" plate contains serial dilutions of six compounds in duplicate. The final row (H) of the assay plate is filled with HBSS buffer alone (H1-H6) or 10 mM unlabeled GABA in HBSS(H7H12) to measure the total or non-specific uptake, respectively. 3H-GABA is diluted into HBSS buffer to a final concentration of 4,000 cpm/μl. Sufficient solution is prepared to allow addition of 25 μl/well (the final concentration is 100,000 cpm/well). HEK-TREx-hGAT2 cells, plated in 96-well plates and treated with 2 mM butyrate and tetracycline (or the tet analog, deoxycycline), are removed from the CO2 incubator. Growth media is removed from the cells, and the cells are washed twice in room temperature HBSS (100 μl/well/wash) using a 96-well plate washer (Bio Tek ELX405). Alternatively, cells are washed manually with equivalent volumes using a multichannel pipettor. Immediately before beginning the assay, the final 100 μl wash solution is removed from the cells by aspiration. Using a 96-well pipettor, 25 μl from the "compound" plate is added to each well of the cell plate. The assay is started by adding 25 μl of the 3H-GABA working solution. The plate is incubated at room temperature for 15 minutes. The assay is stopped by washing the cells four times with ice-cold HBSS buffer using a ELX405 plate washer (100 μl buffer/well/wash) having an angled buffer dispenser. Scintillation fluid (200 μl) (Optiphase Supermix (Perkin Elmer) is added to each well, and the plate is covered with a 96-well adhesive plate cover and placed on a shaker for 10 minutes. The plates are counted on a 96-well plate scintillation counter for 60 sec/well. The data are analyzed using a sigmoidal dose response curve-fitting program (Prism, GraphPad, Inc, San Diego, Calif.; equation: one-site competition). Example 8 hGAT2 Direct Uptake Assay A modified direct uptake assay is developed to determine the ability of test compounds to be transported into HEK-TREx cells induced to over-express hGAT2. Four concentrations (bracketing the affinity as measured by competition assays) per compound are routinely tested. Non-specific uptake is determined by measuring the uptake into cells not induced to express the transporter ("no tet"). The direct uptake assays ar
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
13 μmol/l
Location
Page/Page column 15-16
Reference
XenoPort, Inc.
Patent: US2007/86950 A1, 2007 ; Title/Abstract Full Text Show Details
549 of 992
Effect (Pharmacological Data)
neuronal differentiation of cells; effect on
Species or TestSystem (Pharmacological Data)
neural stem cells (hNSCs) of human
Method (Pharmacological Data)
FIG. 1 is a dose-response curve of the effect of GABA (squares) on the differentiation of cultured human neural stem cells (hNSCs) along a neuronal lineage. Background media values are subtracted and data is normalized with respect to a neuronal positive control (circles). GABA promoted neuronal differentiation, with an EC50 value of 5.46 μM compared to an EC50 for the positive neuronal control of 5.97 μM.; Example 1; Effect on Neuronal and Astrocyte Differentiation of Human Neural Stem Sells; Human neural stem cells (hNSCs) were isolated and grown in monolayer culture, plated, treated with varying concentrations of the GABA modulators GABA and Baclofen and stained with TUJ-1 (neurons) and GFAP (astrocytes) antibodies, as described in U.S. Provisional Application No. 60/697,905 (incorporated by reference). Mitogen-free test media with a positive control for neuronal differentiation, mitogen-free test media with 50 ng/ml BMP-2, 50 ng/ml LIF and 0.5percent FBS served as a positive control for astrocyte differentiation, and basal media without growth factors served as a negative control. Immunohistochemistry was carried out as described in U.S. Provisional Application No. 60/697,905. GABA and Baclofen caused a significant enhancement in the differentiation of hNSCs along a neuronal lineage, as shown in FIGS. 1 (GABA) and 2 (baclofen), and did not exhibit a significant effect on astrocyte differentiation, as shown in FIGS. 3 (GABA) and 4 (baclofen).
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
5.46 μmol/l
Results
title compound promoted significant neuronal differentiation of hNSCs in a concentration-dependent manner; figure given
Location
Page/Page column 3; 42; sheet 1
Reference
BrainCells, Inc.
Patent: US2007/112017 A1, 2007 ;
Title/Abstract Full Text Show Details
550 of 992
Effect (Pharmacological Data)
astrocyte differentiation of cells; effect on
Species or TestSystem (Pharmacological Data)
neural stem cells (hNSCs) of human
Method (Pharmacological Data)
Example 1; Effect on Neuronal and Astrocyte Differentiation of Human Neural Stem Sells; Human neural stem cells (hNSCs) were isolated and grown in monolayer culture, plated, treated with varying concentrations of the GABA modulators GABA and Baclofen and stained with TUJ-1 (neurons) and GFAP (astrocytes) antibodies, as described in U.S. Provisional Application No. 60/697,905 (incorporated by reference). Mitogen-free test media with a positive control for neuronal differentiation, mitogen-free test media with 50 ng/ml BMP-2, 50 ng/ml LIF and 0.5percent FBS served as a positive control for astrocyte differentiation, and basal media without growth factors served as a negative control. Immunohistochemistry was carried out as described in U.S. Provisional Application No. 60/697,905. GABA and Baclofen caused a significant enhancement in the differentiation of hNSCs along a neuronal lineage, as shown in FIGS. 1 (GABA) and 2 (baclofen), and did not exhibit a significant effect on astrocyte differentiation, as shown in FIGS. 3 (GABA) and 4 (baclofen).
Location
Page/Page column 42; sheet 3
Comment (Pharmacological Data)
No effect
Reference
BrainCells, Inc.
Patent: US2007/112017 A1, 2007 ; Title/Abstract Full Text Show Details
551 of 992
Effect (Pharmacological Data)
cytotoxic
Species or TestSystem (Pharmacological Data)
neural stem cells (hNSCs) of human
Method (Pharmacological Data)
Example 2; Toxicity of GABA Modulators on Human Neural Stem Sells; Experiments were carried out as described in Example 1, except that the positive control contained basal media only, and cells were stained with nuclear dye (Hoechst 33342). GABA and baclofen did not exhibit significant toxicity on hNSCs at concentrations up to 100 μM. Results are shown in FIG. 5.
Location
Page/Page column 42; sheet 5
Comment (Pharmacological Data)
No effect
Reference
BrainCells, Inc.
Patent: US2007/112017 A1, 2007 ; Title/Abstract Full Text Show Details
552 of 992
Effect (Pharmacological Data)
cell proliferation; effect on
Species or TestSystem (Pharmacological Data)
neural stem cells (hNSCs) of human
Method (Pharmacological Data)
FIG. 6 is time-response curve showing the effect of 1 μM (diamonds), 10 μM (squares), and 30 μM (triangles) concentrations of GABA on the growth of individual neurospheres comprising human neural stem cells (hNSCs) as a function of time. Results are shown as a percent increase over the basal neurosphere size. Negative control (*) is basal media without compound, and positive control (X) is basal media with a known proliferative agent. GABA had a positive effect on cell proliferation.
Results
title compound (1 - 30 μmol/l) caused a positive effect on cell proliferation in a concentration-dependent manner; figure given
Location
Page/Page column 3; sheet 6
Reference
BrainCells, Inc.
Patent: US2007/112017 A1, 2007 ; Title/Abstract Full Text Show Details
553 of 992
Effect (Pharmacological Data)
plasmin activity; effect on
Species or TestSystem (Pharmacological Data)
plasmin of human
Method
EXAMPLE 3 Plasmin Activity in Additive-Containing Buffers In this study, the reconstituted acidified plasmin solution (10 mg/ml in 0.9percent NaCl solution)
(Pharmacological Data)
and the buffered plasmin compositions containing selected additives, formulated according to the procedure of Example 1, were used. An amount of 50 μl of each of the buffered plasmin compositions was added to a 1.5 ml sample of PBS buffer (pH of about 7.4). The sample was stored at 37° C. Aliquots of the sample were collected at time 0, 1, 3, and 5 hours following addition of plasmin, and analyzed for plasmin activity by chromogenic assay using the plasmin substrate S-2251. S-2251 is a short peptide substrate for plasmin (H-D-Val-L-Leu-L-Lys-p-nitroaniline dihydrochloride, available from ChromogenixInstrumentation Laboratory SpA, Milano, Italy). Plasmin hydrolyzes this substrate between the lysine residue and the p-nitroaniline moiety. The method determines the activity of plasmin based on the difference in absorbance (optical density) between the p-nitroaniline formed and the original substrate. The rate of p-nitroaniline formation; i.e., the increase in absorbance per second at wavelength of 405 nm, is proportional to the enzymatic activity of plasmin, and is conveniently measured with a photometer. The following list shows various additives and additive combinations tested: 40 mM tranexamic acid, 40 mM ε-aminocaproic acid ("ε-ACA"), 40 mM ε-ACA+0.1 M arginine, 40 mM ε-ACA+25percent (by weight) glycerine, 40 mM ε-ACA+0.5percent (by weight) gelatin, 40 mM ε-ACA+1percent (by weight) gelatin, 40 mM ε-ACA+0.4percent (by weight) HSA, 40 mM ε-ACA+4percent (by weight) HSA, 40 mM εACA+4percent (by weight) HSA+1percent (by weight) gelatin, 40 mM ε-ACA+0.05percent (by weight) polysorbate 80, 0.4 M γ-aminobutyric acid, 0.5 M Lornithine hydrochloride, and 0.5 M glycylglycine. The results (as represented by activity relative to initial activity), shown in FIGS. 2-5, indicate that plasmin activity decays more slowly when it was reconstituted in compositions containing additives. The results of the wide range of additives tested indicate that many other combinations of the disclosed additives can provide a similar positive effect. It should be noted that alternate chromogenic substrates for plasmin also may be used to determine its enzymatic activity, such as S-2390 (H-D-Val-L-Phe-L-Lys-p-nitroaniline dihydrochloride) or S-2403 (L-Pyroglutamyl-L-PheL-Lys-p-nitroaniline dihydrochloride); both are available from Chromogenix-Instrumentation Laboratory SpA, Milano, Italy.
Results
results indicate that plasmin activity decays more slowly when it was reconstituted in a composition containing 0.4 M title compound; the results of the wide range of additives tested indicate that many other combinations of the disclosed additives can provide a similar positive effect; figure is given
Location
Page/Page column 3; 10; Sheet 5
Reference
Jani, Dharmendra M.; Kwok, Kai; McIntire, Gregory L.; Pfeffer, Bruce A.; Shafiee, Afshin; Shi, Ruiwen; Venkatesh, Srini; Wang, Hongna; Huang, Yan; Davio, Stephen R.
Patent: US2007/134231 A1, 2007 ; Title/Abstract Full Text Show Details
554 of 992
Effect (Pharmacological Data)
pharmacokinetic
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acid aminotransferase (GABA-AT) from pig brain
Method (Pharmacological Data)
The substrate kinetic constants Km and kcat for the three tetrazoles (5-7) were determined by Hanes and Woolf plots, as known in the literature. (Woolf, B., cited by Haldane, J. B. S.; Stem, K. G. Algemeine Chemie der Enzyme; Steinkopf: Dresden, 1932; pp 119-120; Hanes, C. S. Biochem. J. 1932, 26, 14061421.) Compound 6, containing three methylene groups, has the highest kcai/Km value, indicating that 6 is the most efficient GABA-AT substrate with the optimal carbon chain length (Table 2).; Example 22Substrate activities of 2-7. Potential substrates 2-7 of varying concentrations (1-5 mM) were incubated with GABA-AT (17.1 μM, 5-7 IL) at 25 0C in 50 mM potassium pyrophosphate buffer, pH 8.5, containing 2 mM β-mercaptoethanol and 2.9 mM [5-14C]2ketoglutarate (0.1 mCi/mmol) in a total volume of 100 μL. After incubation (48 h for the preliminary test, 1 h for determination of kinetic constants), the mixture was quenched with trichloroacetic acid. The resulting [14C]glutamate was isolated by cation-exchange chromatography, and the DPM (disintegration per minute) value was measured. Controls consisted of the entire incubation mixture with substrates omitted. The substrate kinetic constants kcat and Km were determined by the method of Hanes and Woolf, as referenced above.
Results
kinetic constants Km = 2.4 mmol/l, kcat = 49 min-1; as reference
Location
Page/Page column 8; 19
Reference
NORTHWESTERN UNIVERSITY
Patent: WO2007/35964 A2, 2007 ; Title/Abstract Full Text Show Details
555 of 992
556 of 992
Effect (Pharmacological Data)
Accumulation
Species or TestSystem (Pharmacological Data)
Wistar neonatal rat primary cultured osteoblasts
Concentration (Pharmacological Data)
1 μmol/l
Method (Pharmacological Data)
osteoblasts cultured for up to 14 days in presence or absence of D-glucose or mannitol, then incubated with <3H>title comp. for 20 min at 37 deg C; radioactivity determined by liquid scintillation spectrometry
Results
title comp. accumulation significantly increased in presence of D-glucose, from day 7 to 14 accumulation not changed
Reference
Fujimori, Sayumi; Osawa, Masato; Iemata, Mika; Hinoi, Eiichi; Yoneda, Yukio
Biological and Pharmaceutical Bulletin, 2006 , vol. 29, # 2 p. 297 - 301 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport; inhibition of
Species or TestSystem (Pharmacological
human ATP-binding cassette ABCG2 transporter
Data)
557 of 992
558 of 992
Concentration (Pharmacological Data)
10 μmol/l
Method (Pharmacological Data)
Sf9 cells expressing human ABCG2; plasma membrane vesicles; incubation with 200 μmol/l <3',5',7'-3H>MTX, 1 mmol/l ATP and title comp. at 37 deg C for 20 min; inhibition of <3H>MTX incorporation into vesicles; radioactivity counting
Further Details (Pharmacological Data)
Sf: insect Spodoptera frugiperda; ABCG2: ATP-binding cassette transporter; MTX: methotrexate; assay buffer (mmol/l): 250 sucrose, 10 Tris-Hepes, pH 7.4, 10 MgCl2, 10 creatine phosphate, and 100 μg/ml creatine kinase
Comment (Pharmacological Data)
No effect
Reference
Saito, Hikaru; Hirano, Hiroyuki; Nakagawa, Hiroshi; Fukami, Takeaki; Oosumi, Keisuke; Murakami, Kaori; Kimura, Hiroko; Kouchi, Takayuki; Konomi, Mami; Tao, Eriko; Tsujikawa, Noboru; Tarui, Shigeki; Nagakura, Makoto; Osumi, Masako; Ishikawa, Toshihisa
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 317, # 3 p. 1114 - 1124 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current induction
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat cerebellar granule cells
Concentration (Pharmacological Data)
0.1 - 100 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in water
Method (Pharmacological Data)
in vitro; title comp. applied every 2 min to generate inward currents in cells; currents recorded at 7 d and 11 d at room temp.
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
3.1 - 12.2 μmol/l
Results
EC50 values for title comp. decreased from 12.2 μmol/l at 7 d to 3.1 μmol/l at 11 d
Reference
Yamashita, Megumi; Marszalec, William; Yeh, Jay Z.; Narahashi, Toshio
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 319, # 1 p. 431 - 438 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current induction
Species or TestSystem (Pharmacological Data)
CHO ells bearing α6β2δ GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. dissolved in water
Method (Pharmacological Data)
in vitro; title comp. applied every 2 min to generate inward currents in cells; currents recorded at room temp.
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.24 μmol/l
Reference
Yamashita, Megumi; Marszalec, William; Yeh, Jay Z.; Narahashi, Toshio
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 319, # 1 p. 431 - 438 Title/Abstract Full Text View citing articles Show Details
559 of 992
560 of 992
561 of 992
Effect (Pharmacological Data)
current induction
Species or TestSystem (Pharmacological Data)
CHO cells bearing α6β3δ GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. dissolved in water
Method (Pharmacological Data)
in vitro; title comp. applied every 2 min to generate inward currents in cells; currents recorded at room temp.
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.41 μmol/l
Reference
Yamashita, Megumi; Marszalec, William; Yeh, Jay Z.; Narahashi, Toshio
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 319, # 1 p. 431 - 438 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current induction
Species or TestSystem (Pharmacological Data)
CHO cells bearing δ4β2δ GABAA receptor
Kind of Dosing (Pharmacological Data)
title comp. dissolved in water
Method (Pharmacological Data)
in vitro; title comp. applied every 2 min to generate inward currents in cells; currents recorded at room temp.
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.67 μmol/l
Reference
Yamashita, Megumi; Marszalec, William; Yeh, Jay Z.; Narahashi, Toshio
Journal of Pharmacology and Experimental Therapeutics, 2006 , vol. 319, # 1 p. 431 - 438 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat brain
Sex
male and female
Concentration (Pharmacological Data)
50 nmol/l
Kind of Dosing (Pharmacological Data)
14C-labeled title comp. was used (0.4 μCi/ml)
Method (Pharmacological Data)
test system perfused with 14C-labeled title comp.; CSF, regional brain samples along with lateral ventricles choroids plexus sampled; radioactivity determined in a liquid scintillation β-counter; volume of distribution (Vd) determined
Further Details (Pharmacological Data)
results compared with normotensive Wistar Kyoto (WKY) rats; SHR: spontaneously hypertensive rats; CSF: cerebrospinal fluid; regional brain samples: cortex, diencephalon, cerebellum, and brain stem
Results
title comp. Vd was significantly greater in SHR compared to that in WKY rats, ranging from 3.4-fold increase in CSF, through 15.3-fold increase in cerebellum up to 19.4-fold increase in cerebral cortex and 6.2-fold in brain stem; diagrams
562 of 992
563 of 992
564 of 992
Reference
Al-Awadi; Pavlik; Al-Sarraf
Life Sciences, 2006 , vol. 79, # 9 p. 847 - 853 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat brain
Sex
male and female
Concentration (Pharmacological Data)
50 nmol/l
Kind of Dosing (Pharmacological Data)
14C-labeled title comp. was used (0.4 μCi/ml)
Method (Pharmacological Data)
test system perfused with 14C-labeled title comp.; venous outflows sampled; radioactivity determined in a liquid scintillation β-counter; t1/2 calculated
Further Details (Pharmacological Data)
results compared with normotensive Wistar Kyoto (WKY) rats; SHR: spontaneously hypertensive rats; reference: 14C-labelled sucrose
Results
early stage t1/2 of title comp. in SHR (5.35 min) was ca. 3 times faster than that in WKY rats (14.83 min); later stage t1/2 of title comp. in SHR (27.58 min) was not significantly different from that for WKY rats (29.14 min); diagrams
Reference
Al-Awadi; Pavlik; Al-Sarraf
Life Sciences, 2006 , vol. 79, # 9 p. 847 - 853 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Route of Application
intravenous
Concentration (Pharmacological Data)
0.004 - 5 mg/kg
Kind of Dosing (Pharmacological Data)
title comp. administered as infusion in borate buffer
Method (Pharmacological Data)
rats administered with various concentrations of title comp.; 5 min later, plasma and several brain region samples obtained; title comp. concentration determined using HPLC
Further Details (Pharmacological Data)
results compared with normotensive Wistar Kyoto rats; brain regions: choroid plexus, cerebral cortex, diencephalon, brainstem, cerebellum, and brain homogenate
Results
title comp. concentration was higher in cerebral cortex; no significant difference found between spontaneously hypertensive rats and Wistar Kyoto rats at all administered doses; table
Reference
Al-Awadi; Pavlik; Al-Sarraf
Life Sciences, 2006 , vol. 79, # 9 p. 847 - 853 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Route of Application
intravenous
Concentration (Pharmacological Data)
0.004 - 5 mg/kg
Kind of Dosing
title comp. administered as infusion in borate buffer
(Pharmacological Data)
565 of 992
Method (Pharmacological Data)
rats administered with various concentrations of title comp.; 5 min later, cerebrospinal fluid samples obtained; title comp. concentration determined using HPLC
Further Details (Pharmacological Data)
results compared with normotensive Wistar Kyoto rats
Results
title comp. concentration increased in CSF with increasing doses; no significant difference found between spontaneously hypertensive rats and Wistar Kyoto rats at all administered doses; table
Reference
Al-Awadi; Pavlik; Al-Sarraf
Life Sciences, 2006 , vol. 79, # 9 p. 847 - 853 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
pharmacokunetics
Species or TestSystem (Pharmacological Data)
human
Route of Application
peroral
Method (Pharmacological Data)
In Vivo Pharmacological Properties of Formulations Containing Batch B. Batch C, and Batch D[0084] The capsules of Example 6 and 7 can be predicted to have the properties shown in the following table when used in humans. The table also shows comparable properties for a 600 mg single dose of reference immediate-release (IR) gabapentin in humans. Delayed dissolution in laboratory experiments can be used to predict delayed dissolution in vivo. These simulated numbers reflect the physical properties demonstrated in dissolution studies shown in Example 5 and Figures 1 and 2. EPO Table 6. Pharmacokinetic Properties of Three Phase Sustained Release Formulation*Contribution to Cmax from IR component.Control data are actual data from clinical observations; other data are predicted (simulated) values, and are composites for the designated mixtures of IR, SR and DR in each case; simulations are for a 375 mg dose.
Results
Cmax = 4-5 mcg/ml, Tmax = 2-5 h
Location
Page/Page column 28-29
Reference
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
566 of 992
Effect (Pharmacological Data)
gcvT5'-UTR transcription termination; effect on
Species or TestSystem (Pharmacological Data)
gcvT5'-UTR of Bacillus subtilis
Method (Pharmacological Data)
Figure 9 shows single-round in vitro transcription of the gcvT 5'-UTR from B. subtilis in the presence of glycine, L-alanine, L-serine, and various glycine analogs. Figure 9A shows the effect of ribonucleoside triphosphate (rNTP) concentrations on the yields of terminated versus full length RNA transcripts in single-round transcription reactions. Transcription assays were performed using a method adapted from that described earlier (Edelstein, Annu. Rev. Biochem. 44, 209 (1975)). DNA templates were generated by PCR with a primer sequence f5'-CAGCCTATGC AAGAGATT AGAATCTTGATATAATTTATTACAAGATGAATAATATAAGAAAAATCTG: SEQ ID NO: 12) which carries a promoter sequence (underlined) from the xpt-pbuX operon from B. subtilis (Mandal et al., Cell 113, 577 (2003)). DNA templates encompassing nucleotides -406 to +7 relative to the translation start site for the gcvT operon in B. subtilis were used. Transcription assays included 20 mM Tris-HCl (pH 8.0 at 23°C), 20 mM NaCl, 14 mM MgCI2, 0.1 mM EDTA, 0.01 mg/niL BSA, and 1percent v/v glycerol. Each reaction (10 μL) contained 1 pmole of template DNA and 9 UE. coli RNA polymerase (Epicenter) and was conducted with the type and concentration of target molecule as indicated for each experiment. Transcription was initiated by the addition of the dinucleotide ApA (135 μM), GTP and UTP (2.5 μM each), ATP (1 μM), and [α-32P]-ATP (4 Ci). After 5 min incubation at 37°C, 50 μM of each NTP was added along with 0.1 mg/mL heparin to prevent re-initiation by RNA polymerase. Transcription products generated after a 10 minute incubation were separated by denaturing 6percent PAGE and visualized by using a Phosphorlmager. Figure 9B shows the effects of increasing glycine, L-alanine, and L-serine on transcription termination. Lines depicted for glycine and L-alanine reflect a curve with a Hill coefficient of 1.4, as was determined from the data in Figure 8B. Single-round transcription assays were conducted as described for Figure 9A. Figure 9C shows the specificity of the B. subtilis glycine riboswitch in the presence of 10 mM of test ligands (also see Figure 4A). Single- round transcription assays were conducted as described for Figure 9A with 50 μM rNTPs. Analogs of glycine were obtained from Sigma- Aldrich.
Results
10 mM title compound resulted in ~0.7 gcvT5'-UTR transcription termination; figure is given
Location
Page/Page column 11; 86-87; 14/16
Reference
YALE UNIVERSITY
Patent: WO2006/42143 A2, 2006 ; Title/Abstract Full Text Show Details
567 of 992
Effect (Pharmacological Data)
peroxydasic activity
Species or TestSystem
leaves of zucchini plant
(Pharmacological Data) Method (Pharmacological Data)
a) Measurement of the Peroxydasic Acttivity (Enzyme Endogenous to Plants) The peroxydases hold a predominant position in the resistance mechanisms of plants. They take part in the production of active species of oxygen toxic for pathogenic agents and are implicated in the formation of the hypersensitivity reaction. They intervene also in the modification of the cell wall. There results an increase of the synthesis of the lignin and/or of the suberine (mechanical barriers). Similarly, the covalent bonds between the proteins of the cellular wall are produced. They permit the oxidation of very toxic phenols and quinones and the incorporation of the flavonoids in the walls (chemical barrier). Given the primordial role of the peroxydases in the resistance of plants, we have used the peroxydasic activity as a marker of the resistance following treatments by elicitors. So as to measure the peroxydasic activities, leaves are crushed in a citrate-monohydrogeno-phosphate-disodium buffer. The extract is then placed in gaiacol and oxygenated water. A rapid reaction takes place: the gaiacol is transformed into tetragaiacol. The appearance of tetragaiacol in the medium permits us to calculate the peroxydasic activity. Measurements are carried out in this same buffer by using the gaiacol as substrate. The results are expressed in ΔDO/mn/g of fresh material.
Results
49.1 ΔDO/min/aMF activity; 14.11 percent of peroxydasic activity relative to the product
Location
Page/Page column 5-7
Comment (Pharmacological Data)
potential area of application: agro
Reference
DE Sangosse SA; Centre National De La Recherche Scientifique
Patent: US2006/148710 A1, 2006 ; Title/Abstract Full Text Show Details
568 of 992
569 of 992
570 of 992
Effect (Pharmacological Data)
enzyme; inhib. of
Species or TestSystem (Pharmacological Data)
human L-xylulose reductase (EC 1.1.1.10)
Method (Pharmacological Data)
L-xylulose reductase (EC 1.1.1.10) inhibitory assay by NADH oxidation monitoring; enzyme and title comp. incubated in aq. medium with NADPH, diacetyl and potassium phosphate at 25 deg C, pH 7.0; rate of NADH oxidation monitored spectrophotometrically
Comment (Pharmacological Data)
No effect
Reference
Carbone, Vincenzo; Ishikura, Syuhei; Hara, Akira; El-Kabbani, Ossama
Bioorganic and Medicinal Chemistry, 2005 , vol. 13, # 2 p. 301 - 312 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
appetite stimulant
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 27.6 mg/kg
Kind of Dosing (Pharmacological Data)
administered for 4 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
rat fed with AIN-93G diet containing 0.5 g/kg title comp. placed in metabolic cage for 24 h to estimate food consumption; water, food ad libitum
Comment (Pharmacological Data)
No effect
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
appetite stimulant
Species or TestSystem (Pharmacological
spontaneously hypertensive rat
Data)
571 of 992
572 of 992
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 9 mg
Kind of Dosing (Pharmacological Data)
administered for 3 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
renal sympathetic-denervated rats fed with AIN-93G diet containing 0.5 g/kg title comp. placed in metabolic cage for 24 h to estimate food consumption; water, food ad libitum; food intake per body weight calculated
Comment (Pharmacological Data)
No effect
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
water intake; increase of
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 27.6 mg/kg
Kind of Dosing (Pharmacological Data)
administered for 4 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
rat fed with AIN-93G diet containing 0.5 g/kg title comp. placed in metabolic cage for 24 h to estimate water intake; water, food ad libitum
Results
title comp. increased water intake at both 1st and 2d weeks of administration (29.0 and 28.1 versus 26.2 and 24.4 ml/24 h, resp.)
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
water intake; increase of
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 9 mg
Kind of Dosing (Pharmacological Data)
administered for 3 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
renal sympathetic-denervated or sham-operated rats fed with AIN-93G diet containing 0.5 g/kg title comp. placed in metabolic cage for 24 h to estimate water intake; water, food ad libitum; water intake volume per body weight calculated
Comment (Pharmacological Data)
No effect
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
573 of 992
574 of 992
575 of 992
Effect (Pharmacological Data)
kidney weight; decrease of
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 9 mg
Kind of Dosing (Pharmacological Data)
administered for 3 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
renal sympathetic-denervated or sham-operated rats fed with AIN-93G diet containing 0.5 g/kg title comp.; water, food ad libitum; after treatment kidney removed and weighed
Comment (Pharmacological Data)
No effect
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
diuretic
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 27.6 mg/kg
Kind of Dosing (Pharmacological Data)
administered for 4 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
rat fed with AIN-93G diet containing 0.5 g/kg title comp. (water, food ad libitum) placed in metabolic cage for 24 h every week to estimate urine volume
Comment (Pharmacological Data)
No effect
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
diuretic
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 27.6 mg/kg
Kind of Dosing (Pharmacological Data)
administered for 4 weeks; mentioned dose calculated as average dose per 24 h
576 of 992
577 of 992
578 of 992
Method (Pharmacological Data)
rat fed with AIN-93G diet containing 0.5 g/kg title comp. (water, food ad libitum) placed in metabolic cage for 24 h every week to collect urine; sodium and creatinine conc. measured by ion electrode method and by enzyme assay, resp.
Results
title comp. increased urinary sodium to creatinine ratio after 2d and after 4th weeks of administration; tended to increase urinary sodium conc. but effect was not sign.
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
enzyme; inhib. of
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 27.6 mg/kg
Kind of Dosing (Pharmacological Data)
administered for 4 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
rat fed with AIN-93G diet containing 0.5 g/kg title comp.; water, food ad libitum; blood collected after 2d and 4th weeks of administration; plasma separated by centrifugation; renin activity measured by radioimmunoassay
Results
title comp. decreased renin activity after 2d of administration and effect tended to be present after 4th week
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
enzyme; inhib. of
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 9 mg
Kind of Dosing (Pharmacological Data)
administered for 3 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
renal sympathetic-denervated or sham-operated rats fed with AIN-93G diet containing 0.5 g/kg title comp.; water, food ad libitum; blood collected at the end of treatment; plasma separated by centrifugation; PRA measured by radioimmunoassay
Further Details (Pharmacological Data)
PRA: plasma renin activity
Results
title comp. decreased PRA in sham-operated rats (9.5 versus 15.5 ng/ml/h); no effect in renal-denervated rats (9.5 versus 9.5 ng/ml/h)
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
growth inhibition
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
579 of 992
580 of 992
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 27.6 mg/kg
Kind of Dosing (Pharmacological Data)
administered for 4 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
rat fed with AIN-93G diet containing 0.5 g/kg title comp.; water, food ad libitum; weight measured every week during treatment
Comment (Pharmacological Data)
No effect
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
growth inhibition
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 9 mg
Kind of Dosing (Pharmacological Data)
administered for 3 weeks; mentioned dose calculated as average dose per 24 h
Method (Pharmacological Data)
renal sympathetic-denervated or sham-operated rats fed with AIN-93G diet containing 0.5 g/kg title comp.; water, food ad libitum; weight measured
Comment (Pharmacological Data)
No effect
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
hypotensive
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 27.6 mg/kg
Kind of Dosing (Pharmacological Data)
administered for 4 weeks; mentioned dose culculated as average dose per 24 h
Method (Pharmacological Data)
rat fed with AIN-93G diet containing 0.5 g/kg title comp.; water, food ad libitum; SBP, heart rate measured between 9.30 and 10.30 every week by tail-cuff method using electrosphygmomanometer
Further Details (Pharmacological Data)
SBP: systolic blood pressure
Results
title comp. almost prevented SBP increase after 1st week of administration, after 4 weeks SBP was 216.9 versus 235.3; no effect on heart rate
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125
Title/Abstract Full Text View citing articles Show Details
581 of 992
582 of 992
Effect (Pharmacological Data)
hypotensive
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
Route of Application
peroral
Concentration (Pharmacological Data)
Ca. 9 mg
Kind of Dosing (Pharmacological Data)
administered for 3 weeks; mentioned dose culculated as average dose per 24 h
Method (Pharmacological Data)
renal sympathetic-denervated or sham-operated rat fed with AIN-93G diet containing 0.5 g/kg title comp.; water, food ad libitum; SBP, heart rate measured between 9.30 and 10.30 every week by tail-cuff method using electrosphygmomanometer
Further Details (Pharmacological Data)
SBP: systolic blood pressure
Results
title comp. prevented SBP increase in sham-operated rats (SBP Ca 15 mm Hg lower than that in control during treatment); no effect on SBP in renaldenervated rats showed slower development of hypertension; no effect on heart rate in both groups
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Yamori, Yukio
European Journal of Pharmacology, 2005 , vol. 524, # 1-3 p. 120 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
parakeratosis; inhibition of
Species or TestSystem (Pharmacological Data)
hairless mouse
Route of Application
epicutaneous
Method (Pharmacological Data)
Test on parakeratosis inhibitory action] A 3percent or 30percent oleic acid solution (100 μL, solvent: ethanol) was applied on the back of a hairless mouse. Thereafter, 100 μL of sample solution or reference solution was applied. This procedure was repeated for 3 days, and the keratin layer on the back was peeled with a tape. The nucleus of the keratin layer was stained with hematoxylin, the number of nuclear cells was counted under a microscope, and the results were evaluated in four grades of 1 to 4. The results of application of the 3percent oleic acid solution, and the results of application of the 30percent oleic acid solution are shown in Tables 2 and 3, respectively. Since the evaluation criteria are different between application of the 3percent oleic acid solution and application of the 30percent oleic acid solution, respective results are expressed by relative evaluations.; The results in Tables 2 and 3 show that Lglutamic acid as an agonist to the glutamic acid receptor (NMDA receptor) that is an excitatory cell receptor worsens parakeratosis caused by oleic acid, while MK-801 and D-glutamic acid as antagonists of the glutamic acid receptor (NMDA receptor) improved parakeratosis caused by oleic acid. ATP as an agonist to the ATP receptor (P2X receptor) that is an excitatory cell receptor worsens parakeratosis caused by oleic acid, while suramin, PPADS and TNP-ATP that are antagonists of the ATP receptor (P2X receptor) improved parakeratosis caused by oleic acid. GABA, muscimol and isogubacin as the agonists to the GABA receptor (GABA receptor type A) as inhibitory cell receptors improved parakeratosis caused by oleic acid, while bicuculline methobromide as the antagonist to the GABA receptor (GABA receptor type A) inhibited parakeratosis inhibitory action by oleic acid. Glycine as the agonist to the glycine receptor as an inhibitory cell receptor improved parakeratosis caused by oleic acid.
Results
title comp. improved parakeratosis caused by oleic acid
Location
Page/Page column 5-6
Reference
SHISEIDO COMPANY LIMITED
Patent: EP1550459 A1, 2005 ; Title/Abstract Full Text Show Details
583 of 992
Effect (Pharmacological Data)
pore-shrinking
Species or TestSystem (Pharmacological Data)
human
Sex
male
Route of Application
epicutaneous
Method (Pharmacological Data)
Test on pore-shrinking action] The cheek of healthy males were subjected to the test for applying the sample solution twice a day for 1 month. The sample solutions (glycine, GABA and D-glutamic acid) each had a concentration of 3percent. Replicas were sampled before and after the completion of the test, and the changes of the shape of the pores at the same site were observed under a three-dimensional laser scan microscope. The size of the pore was visually
evaluated in 13 grades of 1 to 13. The difference of the scores before and after the test was calculated and used for evaluating each agent. The results are shown in Table 4.; It was confirmed from the results in Table 4 that glycine, GABA and D-glutamic acid as the antagonists to the excitatory cell receptor and at the agonist to the inhibitory cell receptor have excellent pore-shrinking effects. Results
excellent pore-shrinking effect
Location
Page/Page column 6-7
Reference
SHISEIDO COMPANY LIMITED
Patent: EP1550459 A1, 2005 ; Title/Abstract Full Text Show Details
584 of 992
Effect (Pharmacological Data)
[3H]muscimol binding; inhibition of
Species or TestSystem (Pharmacological Data)
cortex of rat
Results
approx. 0 - 100 percent of control [3H]muscimol bound; figure given
Location
Page/Page column 4; Sheet 3
Reference
THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
Patent: WO2005/108347 A2, 2005 ; Title/Abstract Full Text Show Details
585 of 992
586 of 992
Effect (Pharmacological Data)
secretion stimulant
Species or TestSystem (Pharmacological Data)
mouse
Sex
male
Route of Application
intravenous
Concentration (Pharmacological Data)
0.1 - 100 mg/kg
Kind of Dosing (Pharmacological Data)
dissolved in 0.9 percent saline; administered with 30-min interval between doses
Method (Pharmacological Data)
SSTR2 knockout mice; urethane anesthesia; continuous intragastric perfusion with saline; cumulative bolus injections of title comp.; acid secretion measurements during experiment; backtitration
Further Details (Pharmacological Data)
vehicle control; SSTR2: somatostatin type 2 receptor; reference comp.: pentagastrin and 2-deoxy-D-glucose
Comment (Pharmacological Data)
No effect
Reference
Piqueras, Laura; Martinez, Vicente
British journal of pharmacology, 2004 , vol. 142, # 6 p. 1038 - 1048 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
secretion stimulant
Species or TestSystem (Pharmacological Data)
wild-type mouse
Sex
male
Route of Application
intravenous
Concentration (Pharmacological Data)
0.1 - 100 mg/kg
Kind of Dosing (Pharmacological Data)
dissolved in 0.9 percent saline; administered with 30-min interval between doses
587 of 992
588 of 992
589 of 992
Method (Pharmacological Data)
urethane-anesthetized mice; continuous intragastric perfusion with saline; cumulative bolus injections of title comp.; acid secretion measurements during experiment; backtitration
Further Details (Pharmacological Data)
vehicle control; reference comp.: pentagastrin and 2-deoxy-D-glucose
Comment (Pharmacological Data)
No effect
Reference
Piqueras, Laura; Martinez, Vicente
British journal of pharmacology, 2004 , vol. 142, # 6 p. 1038 - 1048 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with E61G/C94G GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
Further Details (Pharmacological Data)
E61G/C94G: GAT-4 in which glutamate in position 61 of TMD-I and cysteine in position 94 of TMD-II were mutated to glycines; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 6 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with E61G/C94A GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
Further Details (Pharmacological Data)
E61G/C94A: GAT-4 in which glutamate in position 61 of TMD-I and cysteine in position 94 of TMD-II were mutated to glycine and alanine, resp.; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 10 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with E61G/C94T GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
590 of 992
591 of 992
592 of 992
Further Details (Pharmacological Data)
E61G/C94T: GAT-4 in which glutamate in position 61 of TMD-I and cysteine in position 94 of TMD-II were mutated to glycine and threonine, resp.; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 12.5 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with E61G/C94M GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
Further Details (Pharmacological Data)
E61G/C94M: GAT-4 in which glutamate in position 61 of TMD-I and cysteine in position 94 of TMD-II were mutated to glycine and methionine, resp.; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 16 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with C94M GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
Further Details (Pharmacological Data)
C94M: GAT-4 in which cysteine in position 94 of TMD-II was mutated to methionine, resp.; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 15 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with C94T GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
593 of 992
594 of 992
595 of 992
Further Details (Pharmacological Data)
C94T: GAT-4 in which cysteine in position 94 of TMD-II was mutated to threonine, resp.; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 10 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with C94A GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
Further Details (Pharmacological Data)
C94A: GAT-4 in which cysteine in position 94 of TMD-II was mutated to alanine, resp.; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 4 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with C94G GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
Further Details (Pharmacological Data)
C94G: GAT-4 in which cysteine in position 94 of TMD-II was mutated to glycine, resp.; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 3 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with E61S GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
596 of 992
597 of 992
598 of 992
Further Details (Pharmacological Data)
E61S: GAT-4 in which glutamate in position 61 of TMD-I was mutated to serine; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 13 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with E61C GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
Further Details (Pharmacological Data)
E61C: GAT-4 in which glutamate in position 61 of TMD-I was mutated to cysteine; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 10 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with E61A GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
Further Details (Pharmacological Data)
E61A: GAT-4 in which glutamate in position 61 of TMD-I was mutated to alanine; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 12 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with E61G GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
599 of 992
600 of 992
601 of 992
Further Details (Pharmacological Data)
E61G: GAT-4 in which glutamate in position 61 of TMD-I was mutated to glycine; GAT: GABA transporter; GABA: γ-aminobutyric acid; TMD: transmembrane domain
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 12.5 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
uptake; inhibition of
Species or TestSystem (Pharmacological Data)
HeLa cells
Method (Pharmacological Data)
cells transfected with wild-type GAT-4 treated with increasing conc. of title comp. for 10 min in presence of <3H>-labeled title comp; NaCl-containing medium; <3H>-labeled title comp. uptake determined
Further Details (Pharmacological Data)
GAT: GABA transporter; GABA: γ-aminobutyric acid
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 7 μmol/l
Reference
Melamed, Nir; Kanner, Baruch I.
Molecular Pharmacology, 2004 , vol. 65, # 6 p. 1452 - 1461 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocyte expressing bovine GABAA receptor
Method (Pharmacological Data)
affinity to GABAA receptor studied by two-electrode voltage-clamping method; oocyte with two microelectrodes continuously perfused with 2 ml/min frog normal Ringer's solution with title comp. with/without additive; Kd estimated from dose-current curve
Further Details (Pharmacological Data)
electrodes used one for monitoring membrane potential and other for passing current for clamping membrane potential (usually at -40 mV); receptor desensitization prevented by 10 min washing with frog normal Ringer's solution
Type (Pharmacological Data)
Kd
Value of Type (Pharmacological Data)
28 - 59 μmol/l
Results
Kd for title comp. was 59, 33, 38, 43 and 28 μmol/l without additive, with cis-jasmone, jasmine lactone, linalool oxide and methyl jasmonate, respectively, as additives that potentiated response of GABAA receptor
Reference
Hossain, Sheikh Julfikar; Aoshima, Hitoshi; Koda, Hirofumi; Kiso, Yoshinobu
Bioscience, Biotechnology and Biochemistry, 2004 , vol. 68, # 9 p. 1842 - 1848 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Wistar rat forebrain membranes
Concentration
Ca. 0.01 - 1000 μmol/l
(Pharmacological Data)
602 of 992
603 of 992
604 of 992
Method (Pharmacological Data)
GABAA receptor study; brain membrane preparation incubated with title comp. and 8 nmol/l <3H>TBOB at 25 deg C, pH 7.4, for 90 min; samples filtered; radioactivity counted by scintillation spectrometry
Further Details (Pharmacological Data)
endogenous title comp. removed from preparation; nonspecific binding determined in presence of picrotoxin; TBOB: t-butyl-bicyclo-orthobenzoate
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.83 μmol/l
Reference
Van Rijn, Clementina M.; Willems-van Bree, Elly
European Journal of Pharmacology, 2003 , vol. 464, # 2-3 p. 95 - 100 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
Wistar rat forebrain membranes
Concentration (Pharmacological Data)
0.4 - 2.5 μmol/l
Method (Pharmacological Data)
incubation with title comp., retigabine (at EC35, 216 μmol/l), and <3H>TBOB for 90 min at 25 deg C, pH 7.4; effect on binding of <3H>TBOB to GABAA receptor determined and then described by sigmoid-Emax model using isobolic analysis
Further Details (Pharmacological Data)
endogenous title comp. removed from membrane preparation; EC35: conc. that leaved 35 percent binding of <3H>TBOB; TBOB: t-butyl-bicycloorthobenzoate
Results
isobolic analysis revealed that title comp. acted in synergy with retigabine
Reference
Van Rijn, Clementina M.; Willems-van Bree, Elly
European Journal of Pharmacology, 2003 , vol. 464, # 2-3 p. 95 - 100 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
Wistar rat forebrain membranes
Concentration (Pharmacological Data)
0.4 - 2.5 μmol/l
Method (Pharmacological Data)
incubation with title comp., retigabine, and <3H>TBOB for 90 min at 25 deg C, pH 7.4; effect on binding of <3H>TBOB to GABAA receptor determined and then described by the allosteric three-ligand molecular model (the cubic ternary complex)
Further Details (Pharmacological Data)
endogenous title comp. removed from mmembrane preparation; TBOB: t-butyl-bicyclo-orthobenzoate
Results
according to the allosteric molecular model title comp. and retigabine enhanced each other's affinity to GABAA receptor complex with a factor of 4
Reference
Van Rijn, Clementina M.; Willems-van Bree, Elly
European Journal of Pharmacology, 2003 , vol. 464, # 2-3 p. 95 - 100 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antihypertensive, other
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male
605 of 992
606 of 992
607 of 992
Route of Application
intraoral
Method (Pharmacological Data)
diet: 22 percent casein, 10 percent lard, 3.5 percent mineral mixture AIN76, 1.2 percent vitamin mixture AIN76, 0.15 percent choline chloride, 3.0 percent cellulose, 1 percent NaCl, 59.2 percent sucrose and 0.001 percent title comp. fed to test animals at 22-23 deg for 8 weeks
Further Details (Pharmacological Data)
control: the same diet without title comp.
Results
systolic blood pressure remained below 200 mm Hg and significantly lower than that of control group during all period of feeding
Reference
Aoki, Hideyuki; Furuya, Yuji; Endo, Yasushi; Fujimoto, Kenshiro
Bioscience, Biotechnology and Biochemistry, 2003 , vol. 67, # 8 p. 1806 - 1808 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor expression; induction of
Species or TestSystem (Pharmacological Data)
human embryonic kidney HEK 293 cells
Concentration (Pharmacological Data)
1 mmol/l
Kind of Dosing (Pharmacological Data)
dissolved in water
Method (Pharmacological Data)
cells expressing α1β2γ2s GABAA receptors were treated with title comp. for 48 or 96 h; cell membranes were incubated with <3H>flunitrazepam (0.2 - 16 nmol/l); the effect of title comp. on Bmax and Kd of <3H>flunitrazepam binding was determined
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; nonspecific binding determined in the presence of 100 μmol/l diazepam; Scatchard analysis used; further investigation with GABA receptor antagonist and inhibitor of protein synthesis
Results
title comp. increased the maximum number of <3H>flunitrazepam binding sites by 67 and 125 percent at 48 and 96 h, resp.; Kd of these sites was unchanged; GABA receptors and protein synthesis involved
Reference
Pericic, Danka; Strac, Dubravka Svob; Jembrek, Maja Jazvinscak; Rajcan, Ivana
European Journal of Pharmacology, 2003 , vol. 482, # 1-3 p. 117 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor blocking agent
Species or TestSystem (Pharmacological Data)
human embryonic kidney HEK 293 cells
Concentration (Pharmacological Data)
1 mmol/l
Kind of Dosing (Pharmacological Data)
dissolved in water
Method (Pharmacological Data)
cells expressing α1β2γ2s GABAA receptors were treated with title comp. for 96 h; cell membranes were incubated with <3H>flunitrazepam in the presence of title comp. (100 μmol/l) and the effect on <3H>flunitrazepam binding was determined
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; nonspecific binding determined in the presence of 100 μmol/l diazepam; Scatchard analysis used
Comment (Pharmacological Data)
No effect
Reference
Pericic, Danka; Strac, Dubravka Svob; Jembrek, Maja Jazvinscak; Rajcan, Ivana
European Journal of Pharmacology, 2003 , vol. 482, # 1-3 p. 117 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor expression; induction of
Species or TestSystem (Pharmacological
human embryonic kidney HEK 293 cells
Data)
608 of 992
609 of 992
610 of 992
Concentration (Pharmacological Data)
1 mmol/l
Kind of Dosing (Pharmacological Data)
dissolved in water
Method (Pharmacological Data)
cells expressing α1β2γ2s GABAA receptors were treated with title comp. for 96 h; cell membranes were incubated with <3H>TBOB (8 - 200 nmol/l); the effect of title comp. on Bmax and Kd of <3H>TBOB binding was determined
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; <3H>TBOB: t-<3H>butylbicycloorthobenzoate; Scatchard analysis used; nonspecific binding determined in the presence of 100 μmol/l picrotoxin
Results
title comp. increased the maximum number of <3H>TBOB binding sites by 93 percent; Kd of these sites was unchanged
Reference
Pericic, Danka; Strac, Dubravka Svob; Jembrek, Maja Jazvinscak; Rajcan, Ivana
European Journal of Pharmacology, 2003 , vol. 482, # 1-3 p. 117 - 125 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
Caco-2 cells
Method (Pharmacological Data)
basolateral-to-apical transport (37 deg C, 40 min) measurement; 1.5 ml of HBSS (pH 7.4) was added to basolateral side, 0.5 ml of title comp. solution (pH 6.0) containing 0.04 percent fluorescein was added on apical side of inserts; spectrophotometry
Further Details (Pharmacological Data)
HBSS: Hanks' balanced salt solution; results are expressed as proportion of original amount that permeated through monolayer, which was calculated as amount transported divided by initial amount in donor compartment
Type (Pharmacological Data)
relative permeation
Value of Type (Pharmacological Data)
100.4 percent
Reference
Konishi, Yutaka; Hagiwara, Keiko; Shimizu, Makoto
Bioscience, biotechnology, and biochemistry, 2002 , vol. 66, # 11 p. 2449 - 2457 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
muscle relaxant
Species or TestSystem (Pharmacological Data)
Dunkin Hartley guinea pig myenteric muscle
Concentration (Pharmacological Data)
Ca. 1 - 500 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in distilled water
Method (Pharmacological Data)
myenteric plexus-longitudinal muscle from small intestine of guinea-pigs (450-550 g); effect of anandamide (10 μM, 20 min, n=6) or CP55,940 (20 min, 1 nM, n=6) pretreatment on title comp. induced inhibition of electrically evoked contractions of muscle
Further Details (Pharmacological Data)
Student's unpaired t-test
Comment (Pharmacological Data)
No effect
Reference
Begg, Malcolm; Molleman, Areles; Parsons, Mike
European Journal of Pharmacology, 2002 , vol. 434, # 1-2 p. 87 - 94 Title/Abstract Full Text View citing articles Show Details
Effect
muscle relaxant
(Pharmacological Data)
611 of 992
612 of 992
Species or TestSystem (Pharmacological Data)
Dunkin Hartley guinea pig myenteric muscle
Concentration (Pharmacological Data)
1 - 100 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in distilled water
Method (Pharmacological Data)
myenteric plexus-longitudinal muscle from small intestine of guinea-pigs (450-550 g); effect of tiagabine (1 μM) treatment on title comp. induced inhibition of electrically evoked contractions of muscle
Further Details (Pharmacological Data)
Student's unpaired t-test
Results
tiagabine had no effect on size of contractions but greatly increased the duration of inhibitory effect of title comp.; inhibition was reversed by CGP54626A (200 nM)
Reference
Begg, Malcolm; Molleman, Areles; Parsons, Mike
European Journal of Pharmacology, 2002 , vol. 434, # 1-2 p. 87 - 94 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
muscle relaxant
Species or TestSystem (Pharmacological Data)
Dunkin Hartley guinea pig myenteric muscle
Concentration (Pharmacological Data)
Ca. 1 - 500 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in distilled water
Method (Pharmacological Data)
myenteric plexus-longitudinal muscle from small intestine of guinea-pigs (450-550 g); effect on electrically evoked contractions of muscle by cummulative addition; response in presence of CGP54626A (CGP, 20 nM, n=6) or SR141716 (SR, 100 nM, n=6)
Further Details (Pharmacological Data)
Student's unpaired t-test
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
6 - 33 μmol/l
Results
contraction inhibited in conc.-dependent manner; EC50 6 and 33 μM, in absence and presence of CGP, respectively; max. inhibition 35 percent was not affected by CGP; SR had no effect on conc.-response curve for title comp.
Reference
Begg, Malcolm; Molleman, Areles; Parsons, Mike
European Journal of Pharmacology, 2002 , vol. 434, # 1-2 p. 87 - 94 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current; induction of
Species or TestSystem (Pharmacological Data)
mouse L(tk-) cell
Concentration (Pharmacological Data)
0.1 - 100 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in HEPES buffered saline and applied by perfusion for 500 ms with 60-s rest periods
Method
cells transfected with human GABA receptor α1/β1/γ2 subunits stimulated with title comp.; whole-cell currents recorded using patch clamp amplifier
A
(Pharmacological Data)
613 of 992
614 of 992
Further Details (Pharmacological Data)
further investigation on mechanism of action with GABAA (γ-aminobutyric acid) receptor antagonist bicuculline; holding voltage for cells was -30 mV
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
Ca. 2.4 μmol/l
Results
title comp. evoked large whole-cell currents by activation of GABAA receptors with maximal effect at 10 μmol/l (figure, table)
Reference
Nelson, Rachael M; Green; Hainsworth, Atticus H
European Journal of Pharmacology, 2002 , vol. 452, # 3 p. 255 - 262 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
current; induction of
Species or TestSystem (Pharmacological Data)
mouse L(tk-) cell
Concentration (Pharmacological Data)
0.1 - 300 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in HEPES buffered saline and applied by perfusion for 500 ms with 60-s rest periods
Method (Pharmacological Data)
cells transfected with human GABAA receptor α1/β2/γ2 subunits stimulated with title comp.; whole-cell currents recorded using patch clamp amplifier
Further Details (Pharmacological Data)
further investigation on mechanism of action with GABAA (γ-aminobutyric acid) receptor antagonist bicuculline; holding voltage for cells was -30 mV
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
Ca. 11 μmol/l
Results
title comp. evoked large whole-cell currents by direct activation of GABAA receptors with maximal effect at 100 μmol/l (figure, table)
Reference
Nelson, Rachael M; Green; Hainsworth, Atticus H
European Journal of Pharmacology, 2002 , vol. 452, # 3 p. 255 - 262 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
mouse L(tk-) cell
Concentration (Pharmacological Data)
0.1 - 300 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in HEPES buffered saline and applied by perfusion for 500 ms with 60-s rest periods
Method (Pharmacological Data)
cells transfected with human GABAA receptor α1/β2/γ2 subunits co-stimulated with title comp. and 30 - 100 μmol/l CMZ; whole-cell currents recorded using patch clamp amplifier
Further Details (Pharmacological Data)
CMZ: clomethiazole; holding voltage for cells was -30 mV
Results
30 μmol/l CMZ potentiated current amplitude at all title comp. conc. in range 0.1 - 100 μmol/l; potentiation at higher title comp. conc. was not significant; 30 μmol/l CMZ modified E50 of title comp. from ca. 11 to 3.4 μmol/l (figure, table)
615 of 992
616 of 992
617 of 992
Reference
Nelson, Rachael M; Green; Hainsworth, Atticus H
European Journal of Pharmacology, 2002 , vol. 452, # 3 p. 255 - 262 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
mouse L(tk-) cell
Concentration (Pharmacological Data)
0.1 - 100 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in HEPES buffered saline and applied by perfusion for 500 ms with 60-s rest periods
Method (Pharmacological Data)
cells transfected with human GABAA receptor α1/β2/γ2 subunits co-stimulated with title comp. and 30-100 μmol/l CMZ; whole-cell currents recorded using patch clamp amplifier
Further Details (Pharmacological Data)
CMZ: clomethiazole; holding voltage for cells was -30 mV
Results
30 μmol/l CMZ potentiated current amplitude at all title comp. conc. in range 0.1 - 30 μmol/l; potentiation at higher title comp. conc. was not significant; 30 μmol/l CMZ modified E50 of title comp. from ca. 2.4 to 0.8 μmol/l (figure, table)
Reference
Nelson, Rachael M; Green; Hainsworth, Atticus H
European Journal of Pharmacology, 2002 , vol. 452, # 3 p. 255 - 262 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antihypertensive, other
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat
Sex
male and female
Route of Application
peroral
Concentration (Pharmacological Data)
0.5 mg/kg
Kind of Dosing (Pharmacological Data)
title comp. dissolved in saline
Method (Pharmacological Data)
rats treated with title comp.; systolic blood pressure and heart rate measured by tail-cuff method 4, 8 and 25 h later
Further Details (Pharmacological Data)
control: saline
Results
title comp. significantly decreased systolic blood pressure at 4 and 8 h after treatment and had no effect on heart rate (figure)
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Kamata, Katsuo
European Journal of Pharmacology, 2002 , vol. 438, # 1-2 p. 107 - 113 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
vasodilative
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat mesenteric arterial bed
Sex
male and female
Concentration (Pharmacological Data)
1E-06 - 0.0001 mol/l
Kind of Dosing (Pharmacological
title comp. dissolved in distilled water
Data)
618 of 992
619 of 992
620 of 992
Method (Pharmacological Data)
beds perfused with methoxamine 6E-6 - 3E-5 mol/l and title comp. added; vascular responses measured using pressure transducer
Further Details (Pharmacological Data)
control: vehicle; reference comp.: acetylcholine 3E-7 mol/l
Comment (Pharmacological Data)
No effect
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Kamata, Katsuo
European Journal of Pharmacology, 2002 , vol. 438, # 1-2 p. 107 - 113 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
vasodilative
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat mesenteric arterial bed
Sex
male and female
Concentration (Pharmacological Data)
1E-06 - 0.0001 mol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in distilled water
Method (Pharmacological Data)
beds perfused with title comp. after perivascular nerve stimulation; vascular responses measured using pressure transducer
Further Details (Pharmacological Data)
further investigation with saclofen and bicuculline; control: vehicle; reference comp.: baclofen and muscimol
Results
title comp. and baclofen significantly inhibited perivascular nerve stimulation-induced increase in perfusion pressure, presynaptic γ-aminobutyric acid B receptors involved; muscimol had no effect (figures)
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Kamata, Katsuo
European Journal of Pharmacology, 2002 , vol. 438, # 1-2 p. 107 - 113 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transmitter release; inhibition of
Species or TestSystem (Pharmacological Data)
spontaneously hypertensive rat mesenteric arterial bed
Sex
male and female
Concentration (Pharmacological Data)
1E-06 - 0.0001 mol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in distilled water
Method (Pharmacological Data)
beds perfused with title comp. after perivascular nerve stimulation; noradrenaline release measured using high performance liquid chromatography
Further Details (Pharmacological Data)
further investigation with saclofen and bicuculline; control: vehicle; reference comp.: baclofen and muscimol
Results
title comp. and baclofen significantly inhibited perivascular nerve stimulation-induced release of noradrenaline, presynaptic γ-aminobutyric acid B receptors involved; muscimol had no effect (figures)
Reference
Hayakawa, Kazuhito; Kimura, Masayuki; Kamata, Katsuo
European Journal of Pharmacology, 2002 , vol. 438, # 1-2 p. 107 - 113 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological
enzyme; examination of
Data)
Show next 20
621 of 992
622 of 992
623 of 992
Species or TestSystem (Pharmacological Data)
Vibrio fluvialis JS17 amine:pyruvate aminotransferase
Method (Pharmacological Data)
APA active site model on basis of substrate structure - reactivity relationship; 5 mmol/l title comp., 5 mmol/l pyruvate, 0.75 unit/ml APA incub. at 37 deg C, 10 min; reaction stopped by 75 μl HClO4 (16percent (v/v)); analyzed by HPLC
Further Details (Pharmacological Data)
APA: amine:pyruvate aminotransferase; 1 APA unit: amount catalyzed 1 μmol/l acetophenone formation in 1 min at 50 mmol/l (S)-A1; LP: large pocket; SP: small pocket; A1: PhCH(CH3)NH2
Results
title comp. reactivity < 1percent, compared with A1 (100percent); two-binding site model for test ensyme proposed; dual substrate recognition mode for both hydrophobic and carboxyl groups in LP, acidic group repulsion and steric constraint in SP proposed
Reference
Shin, Jong-Shik; Kim, Byung-Gee
Journal of Organic Chemistry, 2002 , vol. 67, # 9 p. 2848 - 2853 Title/Abstract Full Text View citing articles Show Details
Hide facts Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Wistar rat (albino)
Concentration (Pharmacological Data)
10 μmol/l
Method (Pharmacological Data)
synaptosomes from brain hemispheres from rat used as crude prepn. or further extensively washed; incubated for 90 min at 4 deg C in Krebs soln. with 0.01 nmol/l <3H>-flunitrazepam (85 Ci/mmol) in the absence or presence of 10 μmol/l title comp.
Further Details (Pharmacological Data)
filtered, radioactivity retained in the filters counted with liq. scintillation analyzer
Results
stimulatory effect of title comp. on <3H>flunitrazepam binding was detected only when extensively washed rat brain synaptosomes were used; 10 μmol/l title comp. increased <3H>flunitrazepam binding by 90 percent ; discrete stimulatory effect in crude prepn.
Reference
Noel; Mendonca-Silva; Quintas
Arzneimittel-Forschung/Drug Research, 2001 , vol. 51, # 2 p. 169 - 173 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
pharmacokinetics
Species or TestSystem (Pharmacological Data)
Wistar rat brain synaptosomes
Sex
male
Concentration (Pharmacological Data)
30 - 2400 nmol/l
Kind of Dosing (Pharmacological Data)
DMSO solut. of Aroclor 1242 applied; final DMSO conc. <=0.4 percent
Method (Pharmacological Data)
synaptosomes, 15 μg protein/ml, preincubated for 15 min with/without 5 or 10 μM Aroclor 1242; at 25 deg C; then incubation with 3H-title comp. (1.0 μCi) for 3 min; filtration in cell harvester; filters counted in liquid scintillation spectrometer
Further Details (Pharmacological Data)
in Tris-Krebs buffer with 10 mM glucose; pH 7.4; Vmax: maximum uptake rate; control: DMSO only
Results
Km, μM (conc. Aroclor 1242, Μm): 2.2 (0), 2.1 (5), 2.2 (10); Vmax, nmol mg protein per min (conc. Aroclor 1242, Μm): 0.3 (0), 0.15 (5), 0.075 (10)
Reference
Mariussen, Espen; Fonnum, Frode
Toxicology, 2001 , vol. 159, # 1-2 p. 11 - 21 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
624 of 992
625 of 992
626 of 992
Endpoint of Effect (Pharmacological Data)
5-ALA-ME uptake
Species or TestSystem (Pharmacological Data)
WiDr cells
Concentration (Pharmacological Data)
10 mmol/l
Method (Pharmacological Data)
in vitro; cells incub. with title comp. and 5-<14C> ALA-ME (23 μM-1 mM) for 3 h; cells washed with cold PBS; dissolved in aq. NaOH; radioactivity meas. by liquid scintil counter
Further Details (Pharmacological Data)
cells derived from human primary adenocarcinoma of rectosigmoid colon; 5-ALA-ME = 5-aminolaevulinic acid methyl ester
Results
5-ALA-ME uptake slightly inhibited
Reference
Gederaas, Odrun A.; Holroyd, Andrew; Brown, Stanley B.; Vernon, David; Moan, Johan; Berg, Kristian
Photochemistry and Photobiology, 2001 , vol. 73, # 2 p. 164 - 169 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
vasodilative
Species or TestSystem (Pharmacological Data)
porcine epicardial coronary artery
Concentration (Pharmacological Data)
5 mmol/l
Method (Pharmacological Data)
in vitro; arterial strip preparations mounted in organ baths in physiol. salt solution; precontracted with KCl or histamine; tension measured
Further Details (Pharmacological Data)
large branches of arteries (right, anterior descending and circumflex arteries) prepared from pig hearts
Results
relaxation observed
Reference
Nguyen-Duong
Journal of Toxicology and Environmental Health - Part A, 2001 , vol. 62, # 8 p. 643 - 653 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocyte
Sex
female
Concentration (Pharmacological Data)
1 mmol/l
Method (Pharmacological Data)
oocyte isolated, injected (in vitro-transcribed cRNA encoding GLC-3 polypeptide); incubation (saline; 17 deg C, 1-6 d); L-glutamate (10 μmol/l to 100 mmol/l); membrane current measurements ( percent max. response to L-glutamate)
Further Details (Pharmacological Data)
GLC-3: L-glutamate-gated chloride channel subunit from Caenorhabditis elegans
Comment (Pharmacological Data)
No effect
Reference
Horoszok, Lucy; Raymond, Valerie; Sattelle, David B; Wolstenholme, Adrian J
British Journal of Pharmacology, 2001 , vol. 132, # 6 p. 1247 - 1254 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological
receptor; binding activity
Data)
627 of 992
628 of 992
Species or TestSystem (Pharmacological Data)
human hippocampus
Sex
male and female
Concentration (Pharmacological Data)
10 - 400 nmol/l
Method (Pharmacological Data)
post-mortem hippocampal tissuse obtained from Parkinson's Disease Brain Bank (32-77 year); saturation binding of <3H>title comp. to GABAB receptors in presence of 40 μmol/l isoguvacine to preclude binding at GABAA sites (23 deg C, 20 min)
Further Details (Pharmacological Data)
non-specific binding in presence of 100 μmol/l (-)-baclofen; receptor autoradiography; determination of receptor density Bmax and affinity KD values in CA1, CA2, CA3, dentate hilus, stratum moleculare dentate gyrus (SMDG) and subiculum regions
Results
the regions of high binding density were SMDG, CA1 and subiculum; of moderate binding density were CA2, CA3 and dentate hilus (saturation plot from CA1, autoradiographic images, Bmax and KD values shown)
Reference
Billinton, Andrew; Baird, Virginia H.; Thom, Maria; Duncan, John S.; Upton, Neil; Bowery, Norman G.
British Journal of Pharmacology, 2001 , vol. 132, # 2 p. 475 - 480 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
human hippocampus
Sex
male and female
Concentration (Pharmacological Data)
10 - 400 nmol/l
Method (Pharmacological Data)
hippocampal tissuse obtained from 11 patients with HS related intractable TLE (22-48 year); saturation binding of <3H>title comp. to GABAB receptors in presence of 40 μmol/l isoguvacine to preclude binding at GABAA sites (23 deg C, 20 min)
Further Details (Pharmacological Data)
HS: hippocampal sclerosis; TLE: temporal lobe epilepsy; receptor autoradiography; determination of receptor density Bmax and affinity KD values in CA1, CA2, CA3, dentate hilus, stratum moleculare dentate gyrus (SMDG) and subiculum regions
Results
receptor binding density significantly reduced in CA1, CA2, CA3, hilus and SMDG (neuronal loss measurable in these regions) and increased in subiculum compared with post-mortem control (autoradiographic images, Bmax and KD values shown)
Reference
Billinton, Andrew; Baird, Virginia H.; Thom, Maria; Duncan, John S.; Upton, Neil; Bowery, Norman G.
British Journal of Pharmacology, 2001 , vol. 132, # 2 p. 475 - 480 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat frontal cortex membranes
Sex
male
Concentration (Pharmacological Data)
Ca. 1E-06 - 0.01 mol/l
Method (Pharmacological Data)
in vitro; effect on <35S>GTPγS binding to membranes evaluated; 1 nmol/l <35>GTPγS (spec. act.: 1306 Ci/mmol); assay buffer, pH 7.4; 30 deg C; liquid scintillation counting
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
150 μmol/l
Reference
Onali, Pierluigi; Olianas, Maria C
Biochemical Pharmacology, 2001 , vol. 62, # 2 p. 183 - 190 Title/Abstract Full Text View citing articles Show Details
629 of 992
630 of 992
631 of 992
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat frontal cortex membranes
Sex
male
Concentration (Pharmacological Data)
Ca. 1E-05 - 0.01 mol/l
Method (Pharmacological Data)
in vitro; effect on basal or corticotropin-releasing hormone (CRH)-stimulated adenylyl cyclase activity in tissue membranes evaluated; 1 μmol/l CRH; 0.1 mmol/l <α-32P>ATP; assay buffer, pH 7.4; 30 deg C; incubated for 10 min
Further Details (Pharmacological Data)
conversion of <32P>ATP to <32P>cAMP monitored; title comp. is GABAB receptor agonist
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
800 μmol/l
Results
title comp. induced conc.-dependent potentiation of CRH receptor activity and did not affect basal adenylyl cyclase activity
Reference
Onali, Pierluigi; Olianas, Maria C
Biochemical Pharmacology, 2001 , vol. 62, # 2 p. 183 - 190 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney 293 cells
Kind of Dosing (Pharmacological Data)
dissolved in double-distilled H2O
Method (Pharmacological Data)
whole-cell and outside-out patch recordings made at room temperature at 22-25 deg C; cells voltage-clamped at -60 mV
Further Details (Pharmacological Data)
cells expressing rat α1β2γ2 GABAA receptors; GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
14.0 μmol/l
Results
Hill coefficient: 1.2
Reference
Huang, Ren-Qi; Bell-Horner, Cathy L.; Dibas, Mohammed I.; Covey, Douglas F.; Drewe, John A.; Dillon, Glenn H.
Journal of Pharmacology and Experimental Therapeutics, 2001 , vol. 298, # 3 p. 986 - 995 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney 293 cells
Kind of Dosing (Pharmacological Data)
dissolved in double-distilled H2O
Method (Pharmacological
whole-cell and outside-out patch recordings made at room temperature at 22-25 deg C; cells voltage-clamped at -60 mV
Data)
632 of 992
633 of 992
Further Details (Pharmacological Data)
cells expressing rat α3β2γ2 GABAA receptors; GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
33.1 μmol/l
Results
Hill coefficient: 1.1
Reference
Huang, Ren-Qi; Bell-Horner, Cathy L.; Dibas, Mohammed I.; Covey, Douglas F.; Drewe, John A.; Dillon, Glenn H.
Journal of Pharmacology and Experimental Therapeutics, 2001 , vol. 298, # 3 p. 986 - 995 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney 293 cells
Kind of Dosing (Pharmacological Data)
dissolved in double-distilled H2O
Method (Pharmacological Data)
whole-cell and outside-out patch recordings made at room temperature at 22-25 deg C; cells voltage-clamped at -60 mV
Further Details (Pharmacological Data)
cells expressing rat α6β2γ2 GABAA receptors; GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.6 μmol/l
Results
Hill coefficient: 1.6
Reference
Huang, Ren-Qi; Bell-Horner, Cathy L.; Dibas, Mohammed I.; Covey, Douglas F.; Drewe, John A.; Dillon, Glenn H.
Journal of Pharmacology and Experimental Therapeutics, 2001 , vol. 298, # 3 p. 986 - 995 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney 293 cells
Kind of Dosing (Pharmacological Data)
dissolved in double-distilled H2O
Method (Pharmacological Data)
whole-cell and outside-out patch recordings made at room temperature at 22-25 deg C; cells voltage-clamped at -60 mV
Further Details (Pharmacological Data)
cells expressing rat β2γ2 GABAA receptors; GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
64.0 μmol/l
Results
Hill coefficient: 0.8
Reference
Huang, Ren-Qi; Bell-Horner, Cathy L.; Dibas, Mohammed I.; Covey, Douglas F.; Drewe, John A.; Dillon, Glenn H.
Journal of Pharmacology and Experimental Therapeutics, 2001 , vol. 298, # 3 p. 986 - 995
Title/Abstract Full Text View citing articles Show Details
634 of 992
635 of 992
636 of 992
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney 293 cells
Kind of Dosing (Pharmacological Data)
dissolved in double-distilled H2O
Method (Pharmacological Data)
whole-cell and outside-out patch recordings made at room temperature at 22-25 deg C; cells voltage-clamped at -60 mV
Further Details (Pharmacological Data)
cells expressing rat α1β2 GABAA receptors; GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.0 μmol/l
Results
Hill coefficient: 1.4
Reference
Huang, Ren-Qi; Bell-Horner, Cathy L.; Dibas, Mohammed I.; Covey, Douglas F.; Drewe, John A.; Dillon, Glenn H.
Journal of Pharmacology and Experimental Therapeutics, 2001 , vol. 298, # 3 p. 986 - 995 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney 293 cells
Kind of Dosing (Pharmacological Data)
dissolved in double-distilled H2O
Method (Pharmacological Data)
whole-cell and outside-out patch recordings made at room temperature at 22-25 deg C; cells voltage-clamped at -60 mV
Further Details (Pharmacological Data)
cells expressing human α1β2γ2 GABAA receptors; GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
37.0 μmol/l
Results
Hill coefficient: 1.2
Reference
Huang, Ren-Qi; Bell-Horner, Cathy L.; Dibas, Mohammed I.; Covey, Douglas F.; Drewe, John A.; Dillon, Glenn H.
Journal of Pharmacology and Experimental Therapeutics, 2001 , vol. 298, # 3 p. 986 - 995 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport; inhibition of
Species or TestSystem (Pharmacological Data)
rabbit small intestinal brush-border membrane vesicles
Concentration (Pharmacological Data)
25 - 50 mmol/l
Method (Pharmacological
uptake experiments conducted by using Millipore filtration apparatus; incubation with <14C>IBG performed for 30 s in presence of title comp., at pH 7.5; radioactivity measured by scintillation counter
Data)
637 of 992
638 of 992
639 of 992
Further Details (Pharmacological Data)
IBG: pregabalin, 200 μmol/l
Comment (Pharmacological Data)
No effect
Reference
Piyapolrungroj; Li; Bockbrader; Liu; Fleisher
Pharmaceutical Research, 2001 , vol. 18, # 8 p. 1126 - 1130 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transmitter releasing
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat
Concentration (Pharmacological Data)
10 - 100 mmol/l
Kind of Dosing (Pharmacological Data)
dissolved in 0.9 percent saline; given via microdialysis probe for 3 h
Method (Pharmacological Data)
microdialysis probe implanted in submucosa of acid-producing part of stomach; title comp. administered to conscious, fasted rats; histamine in microdialysate measured by radioimmunoassay
Results
title comp. had weak stimulatory effect (at 10 mmol/l 59 percent, at 100 mmol/l 58 percent increase)
Reference
Norlen; Bernsand; Konagaya; Hakanson
British Journal of Pharmacology, 2001 , vol. 134, # 8 p. 1767 - 1777 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
neuroregulatoric
Species or TestSystem (Pharmacological Data)
MD3 cells
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
(Ca2+)i measured after incubation with fura-2-acetoxymethylester (37 deg C, 45 min) using inverted microscope equipped with epifluorescence objective
Further Details (Pharmacological Data)
MD3 cells: hybrid cell line derived by somatic cell fusion of hypoxanthine phosphoribosyl transferase-deficient neuroblastoma N18TG2 cells with Balb/C mouse dorsal root ganglion neurones; (Ca2+)i: intracellular free Ca2+ concentration
Results
title comp. increased (Ca2+)i to peak of 347 nmol/l; effect reversible, after peaking, response declined to plateau, before gradually decreasing to resting levels
Reference
Yokogawa, Tomonori; Kim, Seung U.; Krieger, Charles; Puil, Ernest
British Journal of Pharmacology, 2001 , vol. 134, # 1 p. 98 - 107 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
neuroregulatoric
Species or TestSystem (Pharmacological Data)
cat isolated superior sagittal sinus
Kind of Dosing (Pharmacological Data)
given via microiontophoresis (ca. 12-180 nA)
Method (Pharmacological Data)
primary trigeminal afferents supramaximally stimulated with stimulus-isolated square wave pulses (20-28 V, 250 μs, 0.1-10 Hz) after neuromuscular blockade; extracellular recordings made using microiontopheric combination electrode
Further Details (Pharmacological
L-glutamate given via microiontophoresis, -75 nA 5 s pulses
Data)
640 of 992
641 of 992
642 of 992
Results
title comp. reversibly inhibited cell firing evoked by L-glutamate in current-dependent fashion
Reference
Storer; Akerman; Goadsby
British Journal of Pharmacology, 2001 , vol. 134, # 4 p. 896 - 904 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
neuroregulatoric
Endpoint of Effect (Pharmacological Data)
Km and Vmax of synaptosomal uptake
Species or TestSystem (Pharmacological Data)
Wistar rat brain synapsomes
Sex
male
Kind of Dosing (Pharmacological Data)
0.021 μM of <U-14C>-title comp.; for low-affinity binding: 1-20 mM of title comp.; for high-affinity binding: 0.01-1 mM of title comp.
Exposure Period (Pharmacological Data)
10 min
Method (Pharmacological Data)
synaptosomes were incub. with title comp. in the pres. of 14C-labeled title comp. in Krebs-phosph. buffer (pH 7.4) at 0 deg C for 10 min; reaction was stopped by centrifugation; measuring of radioactivity; Eadie-Hosfstee plot
Further Details (Pharmacological Data)
synaptosomal membranes were isolated from the brain of rats weighing 200-250 g; estimation of kinetic parameters (Km and Vmax) of title comp. binding with synaptosomes
Results
low afinity parameters of title comp. binding with synaptosomes: Km = 2.7 mM and Vmax = 32.5 nmol/mg protein/min; high affinity parameters: Km = 0.5 mM and Vmax = 12.4 nmol/mg protein/min
Reference
Baldocchi Pizzo, Andrea; Karklin Fontana, Andreia Cristina; Coutinho-Netto, Joaquim; Ferreira dos Santos, Wagner
Journal of Biochemical and Molecular Toxicology, 2000 , vol. 14, # 2 p. 88 - 94 Title/Abstract Full Text Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
1.45 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. as cation
Method (Pharmacological Data)
cells incubation with <3H>-labelled and unlabelled title comp. for 1 min at 37 deg C; apical pH 5.0-7.0, basolateral pH 7.4; preincubation in Na(1+)-free buffer
Further Details (Pharmacological Data)
mannitol as inert control marker; uptake across apical membrane; cationic form conc. was kept constant by varying total title comp. conc. from 10 to 859 μmol/l
Results
uptake of title comp. was pH-dependent and varying from 2187 (pH 5.0) to 392 (pH 7.0) fmol/cm2/min
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration
10 μmol/l
(Pharmacological Data)
643 of 992
644 of 992
645 of 992
Kind of Dosing (Pharmacological Data)
title comp. as zwitterion (> 85.5 percent)
Method (Pharmacological Data)
cells incubation with <3H>-labelled and unlabelled title comp. for 1 min at 37 deg C; apical pH 5.0-7.0, basolateral pH 7.4; preincubation in Na(1+)-free buffer
Further Details (Pharmacological Data)
mannitol as inert control marker; scintillation counting; uptake across apical membrane was determined
Results
uptake of title comp. was pH-dependent: from 15.1 pmol/cm2/min (pH 5.0) to 2.9 pmol/cm2/min (pH 7.0) (table)
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
<= 20 μmol/l
Method (Pharmacological Data)
cells incubation with <3H>-labelled and unlabelled title comp. for 1 min at 37 deg C; apical pH 5.0, basolateral pH 7.4; preincubation in Na(1+)-free buffer
Further Details (Pharmacological Data)
mannitol as inert control marker; scintillation counting; uptake across apical membrane, Km and Vmax were determined
Results
acid-stimulated, Na(1+)-independent uptake of title comp. was concentration-dependent; Km was 1.95 mmol/l; Vmax was 2127 pmol/cm2/min
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
Accumulation
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
<3H>-labelled and unlabelled title comp. added to give conc. 100 μmol/l; incubation for 60 min at 37 deg C in the presence or absence of extracellular Na(1+); apical pH 5.5, basolateral pH 7.4; title comp. accumulation across membrane was determined
Further Details (Pharmacological Data)
scintillation counting; mannitol transport as inert marker; cell/medium ratio was determined
Results
in the presence of extracellular Na(1+): cell/medium ratio was 4.9, title comp. accumulation was 489 μmol/l; in the absence of extracellular Na(1+): cell/medium ratio was 6.7, title comp. accumulation was 627 μmol/l
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
Accumulation
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological
100 μmol/l
Data)
646 of 992
647 of 992
648 of 992
Method (Pharmacological Data)
<3H>-labelled and unlabelled title comp. added to give conc. 100 μmol/l; incubation for 60 min at 37 deg C in the presence or absence of extracellular Na(1+); accumulation across the apical pH 7.4 and basolateral pH 7.4 membranes was determined
Further Details (Pharmacological Data)
scintillation counting; mannitol as inert marker; cell/medium ratio was determined
Results
in the presence of extracellular Na(1+) title comp. accumulation was 204 μmol/l; in the absence of extracellular Na(1+) title comp. accumulation was 39 μmol/l
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
cells incubation with <3H>-labelled and unlabelled title comp. added to give conc. 100 μmol/l for 1 min at 37 deg C; apical pH varied (5.0-8.0), basolateral pH 7.4; preincubation in Na(1+)-free buffer
Further Details (Pharmacological Data)
scintillation counting; mannitol as inert control marker; title comp. uptake across apical membrane was determined
Results
uptake of title comp. was pH-dependent: it was maximal at pH 5.0-5.6 (29.7 times greater than mannitol) and min at pH 7.7-8.0 (1.5 times greater than mannitol)
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
title comp. transport across the apical pH 5.5 and basolateral pH 7.4 membranes was determined after cells incubation for 60 min at 37 deg C in the presence <3H>-labelled and unlabelled title comp. and extracellular Na(1+); scintillation counting
Further Details (Pharmacological Data)
mannitol as inert control marker; direction of transporting was determined
Results
net absorption of title comp. (854 pmol/cm2/h) was increased in the apical-to-basal direction
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
title comp. transport across the apical pH 5.5 and basolateral pH 7.4 membranes was determined after cells incubation for 60 min at 37 deg C with <3H>labelled and unlabelled title comp. in the absence of extracellular Na(1+); scintillation counting
649 of 992
650 of 992
651 of 992
Further Details (Pharmacological Data)
mannitol as inert control marker; direction of transporting was determined
Results
net absorption of title comp. was small (151 pmol/cm2/h) in the apical-to-basal direction
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
title comp. transport across the apical pH 5.5 and basolateral pH 7.4 membranes was determined by cells incubation for 60 min at 37 deg C with <3H>labelled and unlabelled title comp. in the absence of extracellular Na(1+); scintillation counting
Further Details (Pharmacological Data)
mannitol as inert control marker; direction of transporting was determined
Results
net absorption of title comp. was increased (2201 pmol/cm2/h) in the apical-to-basal direction
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
title comp. transport across the apical pH 7.4 and basolateral pH 7.4 membranes was determined after cells incubation for 60 min at 37 deg C with <3H>labelled and unlabelled title comp. in the presence of extracellular Na(1+); scintillation counting
Further Details (Pharmacological Data)
mannitol was indicated as inert control marker; direction of transporting was determined
Results
net secretion of title comp. was -256 pmol/cm2/h in the basal-to-apical direction
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
20 mmol/l
Method (Pharmacological Data)
short-circuit current (Isc) at apical pH 5.5 and basolateral pH 7.4 in Na(1+)-free media in the present of title comp. was determined; square-wave pulse was excursion of the voltage-clamp to +1 mV
Results
title comp. induced increase in Isc
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
652 of 992
653 of 992
654 of 992
655 of 992
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
5 mmol/l
Method (Pharmacological Data)
cells incubation with <3H>-title comp. (5 or 100 μmol/l) and unlabelled title comp. for 2-5 min at 37 deg C; apical pH 5.5 over HEPES and MES (10 μmol/L), basolateral pH 7.4; preincubation with Na(1+)-free buffer
Further Details (Pharmacological Data)
scintillation counting; uptake across the apical membrane was compared to uptake of mannitol
Results
title comp. inhibited uptake of <3H>-title comp.
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
acidic
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
20 mmol/l
Method (Pharmacological Data)
BCECF-loaded cells were incubated with title comp. for 30-50 s at 37 deg C in the presence of extracellular Na(1+); apical pH 5.5 or 7.4, basolateral pH 7.4; title comp. was added to apical surface
Further Details (Pharmacological Data)
control: without title comp.; BCECF: 2',7',-bis(2-carboxyethyl)-5(6)-carboxyfluorescein
Results
in the presence or absence of extracellular Na(1+) title comp. caused small but inconsistent reversible acidification; acidification rate (ΔpHi/min) was 0.215 in the presence of extracellular Na(1+)
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
acidic
Species or TestSystem (Pharmacological Data)
human intestinal epithelial cells Caco-2
Concentration (Pharmacological Data)
20 mmol/l
Method (Pharmacological Data)
BCECF-loaded cells were incubated for 30-50 s at 37 deg C in the presence of extracellular Na(1+); apical pH 7.4 and basolateral pH 7.4; title comp. was added to basolateral surface
Further Details (Pharmacological Data)
control: without title comp.; BCECF: 2'7',-bis(2-carboxyethyl)-5(6)-carboxyfluorescein
Results
title comp. failed to increase the rate of acidification
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or Test-
human intestinal epithelial cells Caco-2
System (Pharmacological Data)
656 of 992
657 of 992
658 of 992
Concentration (Pharmacological Data)
5 mmol/l
Method (Pharmacological Data)
cells incubation with <3H>- or <14C>-β-alanine 5-100 μmol/l and title comp. for 2-5 min at 37 deg C in Na(1+)-free buffer; apical pH 5.5, basolateral pH 7.4
Further Details (Pharmacological Data)
scintillation counting; uptake across the apical membrane; was compared with uptake of mannitol
Results
title comp. inhibited <3H>- or <14C>-β-alanine uptake
Reference
Thwaites, David T.; Basterfield, Laura; McCleave, Peter M.J.; Carter, Simon M.; Simmons, Nicholas L.
British Journal of Pharmacology, 2000 , vol. 129, # 3 p. 457 - 464 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
rat embryo striatum neurones
Concentration (Pharmacological Data)
100 μmol/l
Kind of Dosing (Pharmacological Data)
application during 20 ms
Method (Pharmacological Data)
cell cultures were grown from lateral ganglionic eminences of rat embryos (E17); cultures were used 12-22 d in vitro; patch-clamp experiments were performed (23-25 deg C); cells were superfused by title comp. solution
Further Details (Pharmacological Data)
GABAA-receptor-mediated responses were elicited every 5 s using a pressure pipette
Results
title comp. induced a whole-cell inward current with a rise time less 100 ms and peak amplitude of 1-3 nA, which returned to base line with time constants of order 100-200 ms
Reference
Behrends, Jan C.
British Journal of Pharmacology, 2000 , vol. 129, # 2 p. 402 - 408 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
enzyme; inhib. of
Species or TestSystem (Pharmacological Data)
human liver microsomes
Concentration (Pharmacological Data)
0.1 - 500 μmol/l
Method (Pharmacological Data)
human liver samples were obtained from unrelated white Spanish patients (no liver disease); microsomal fractions were prepared; CYP3A enzyme activity was measured using the enzyme-specific substrate midazolam (0.5-20 μmol/l), incubated with title comp.
Further Details (Pharmacological Data)
midazolam and its main metabolites, 1'-hydroxymidazolam and 4-hydroxymidazolam analysed by HPLC
Comment (Pharmacological Data)
No effect
Reference
Martinez; Gervasini; Agundez; Carrillo; Ramos; Garcia-Gamito; Gallardo; Benitez
European Journal of Clinical Pharmacology, 2000 , vol. 56, # 2 p. 145 - 151 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
neuroregulatoric
Species or Test-
Wistar rat
System (Pharmacological Data)
659 of 992
660 of 992
Sex
male
Route of Application
intracerebral
Concentration (Pharmacological Data)
1 mol/l
Kind of Dosing (Pharmacological Data)
injected through cannula inserted into the cisterna magna
Method (Pharmacological Data)
in vivo; effect on resting vascular tone assayed; 10-21 and 46-67-week-old freely moving rats; cannula inserted into the cisterna magna; electromagnetic flow probe located around CA, CE, SM, R arteries and descending aorta
Further Details (Pharmacological Data)
MAP, HR and CA, CE, SM, R and HQ resistance measured for 60 min after treatment; MAP: mean arterial pressure; HR: heart rate; CA: carotid; CE: coeliac; SM: superior mesenteric; R: renal; HQ: hindquarters
Results
title comp. reduced MAP, HR and CA and HQ resistance between 5-30 min after injection; title comp. produced transient increase in SM resistance; timeresponse curves
Reference
Takemoto
Experimental Physiology, 2000 , vol. 85, # 5 p. 479 - 485 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocyte, expressing human ρ1 GABAC receptor
Concentration (Pharmacological Data)
0.125 - 16 μmol/l
Method (Pharmacological Data)
oocyte voltage-clamped at -70 mV; current induced by title comp. measured
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.81 μmol/l
Reference
Chang, Yong; Covey, Douglas F.; Weiss, David S.
Molecular Pharmacology, 2000 , vol. 58, # 6 p. 1375 - 1380 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocyte, expressing human ρ1 GABAC receptor
Concentration (Pharmacological Data)
Ca. 0.1 - 16 μmol/l
Method (Pharmacological Data)
single oocyte binding technique; oocyte incubated with 1 μmol/l <3H>GABA and title comp. in OR2, pH 7.5, for 30 s at room temp.; then rinsed, placed to OR2 for 60 s to let <3H>GABA to dissociate; scintillation fluid added, radioactivity measured
Further Details (Pharmacological Data)
OR2: oocyte Ringers-2 incubation solution; Ki: apparent dissociation constant
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
1.48 μmol/l
661 of 992
662 of 992
663 of 992
664 of 992
Results
Ki = 0.58 μmol/l
Reference
Chang, Yong; Covey, Douglas F.; Weiss, David S.
Molecular Pharmacology, 2000 , vol. 58, # 6 p. 1375 - 1380 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
human GABAA receptors expresed in Xenopus oocyces
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
15 μmol/l
Reference
Stuhr-Hansen, Nicolai; Ebert, Bjarke; Krogsgaard-Larsen, Povl; Kehler, Jan
Organic Letters, 2000 , vol. 2, # 1 p. 6 - 10 Title/Abstract Full Text Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat brain synaptosomes (GABAB receptors)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
0.025 μmol/l
Reference
Stuhr-Hansen, Nicolai; Ebert, Bjarke; Krogsgaard-Larsen, Povl; Kehler, Jan
Organic Letters, 2000 , vol. 2, # 1 p. 6 - 10 Title/Abstract Full Text Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat brain synaptosomes (GABAA receptors)
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
0.128 μmol/l
Reference
Stuhr-Hansen, Nicolai; Ebert, Bjarke; Krogsgaard-Larsen, Povl; Kehler, Jan
Organic Letters, 2000 , vol. 2, # 1 p. 6 - 10 Title/Abstract Full Text Show Details
Effect (Pharmacological Data)
cell regulation
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes (XLO)
Concentration (Pharmacological Data)
300 μmol/l
Method (Pharmacological Data)
XLO injected with α9 rat nicotinic acetylcholine receptor cDNA; inward current (I) recorded under two-electrode voltage clamp; cells superfused with frog saline, title comp. added to perfusate
665 of 992
666 of 992
667 of 992
Further Details (Pharmacological Data)
title comp. effect on I studied (graph)
Comment (Pharmacological Data)
No effect
Reference
Rothlin; Katz; Verbitsky; Elgoyhen
Molecular pharmacology, 1999 , vol. 55, # 2 p. 248 - 254 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes (XLO)
Concentration (Pharmacological Data)
300 μmol/l
Method (Pharmacological Data)
XLO injected with α9 rat nicotinic acetylcholine receptor cDNA; inward current (I) recorded under two-electrode voltage clamp; cells superfused with frog saline, title comp. added to perfusate; I elicited by 10 μM acetylchloline (ACh)
Further Details (Pharmacological Data)
title comp. effect on ACh-elicited I studied (graph)
Comment (Pharmacological Data)
No effect
Reference
Rothlin; Katz; Verbitsky; Elgoyhen
Molecular pharmacology, 1999 , vol. 55, # 2 p. 248 - 254 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with ε subunits
Concentration (Pharmacological Data)
30 μmol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells expressing human ε subunit; whole-cell patch-clamp recording at -75 mV; holding current measured; direct application of title comp., 6 s
Further Details (Pharmacological Data)
effect of title comp. on holding current
Comment (Pharmacological Data)
No effect
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with β3ε subunits
Concentration (Pharmacological Data)
300 μmol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells coexpressing rat β3, human ε subunits; whole-cell patch-clamp recording at -75 mV; holding current measured; direct application of title comp., 6 s
668 of 992
669 of 992
670 of 992
Further Details (Pharmacological Data)
effect of title comp. on holding current
Comment (Pharmacological Data)
No effect
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with α1ε subunits
Concentration (Pharmacological Data)
30 μmol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells coexpressing rat α1, human ε subunits; whole-cell patch-clamp recording at -75 mV; holding current measured; direct application of title comp., 6 s
Further Details (Pharmacological Data)
effect of title comp. on holding current
Comment (Pharmacological Data)
No effect
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with α1β3ε subunits
Concentration (Pharmacological Data)
1 μmol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells coexpressing rat α1, β3, human ε subunits; outside-out patch-clamp recording -80 to +80 mV; current measured; application of title comp.; title comp.-evoked current measured
Further Details (Pharmacological Data)
examination of single-channel properties of receptor
Results
relatively long single-channel openings, separated into grouped bursts; average amplitude 1.6 pA at -70 mV; average conductance of channel openings 23.7 pS (vs. spontaneous 22.2 pS); average reversal potential for individual patches near 0 mV
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with α1β3ε subunits
Concentration (Pharmacological Data)
1 μmol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells coexpressing rat α1, β3, human ε subunits; outside-out patch-clamp recording from -80 to +80 mV; current measured; application of title comp., 5-10 min; title comp.-evoked current measured
Further Details
kinetic properties of single-channel openings and closings of receptor
(Pharmacological Data)
671 of 992
672 of 992
673 of 992
Results
low frequency openings with average percent open time of 1.04 percent; open time 1.18 ms, shut time 132 ms, burst duration 3.72 ms, openings/burst 2.94, mean values
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with α1β3ε subunits
Concentration (Pharmacological Data)
1E-08 - 0.0001 mol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells coexpressing rat α1, β3, human ε subunits; whole-cell patch-clamp recording -75 mV; holding current measured; direct application of title comp.
Further Details (Pharmacological Data)
effect of title comp. on holding current
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.8 μmol/l
Results
concentration-dependent increase of holding current by title comp.; faster apparent activation rates, greater apparent desensitization with higher concentrations; Hill coefficient: 0.8
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with α1β3ε subunits
Concentration (Pharmacological Data)
1 μmol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells coexpressing rat α1, β3, human ε subunits; whole-cell patch-clamp recordings from -100 to +75 mV; repeated application of title comp., 5 s; subsequent reapplication at -75 mV after each I-V protocol
Further Details (Pharmacological Data)
current-voltage (I-V) relation for effect of title comp. on holding current
Results
I-V relation linear at negative potentials; inward rectification above +25 mV; no current rundown as demonstrated by reapplication
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with α1β3γL subunits
Concentration (Pharmacological Data)
10 μmol/l
Method (Pharmacological
mouse fibroblast L929 cells coexpressing rat α1, β3 and γ2L subunits; whole-cell patch-clamp recording at -75 mV; holding current measured; direct application of title comp., 6 s
Data)
674 of 992
675 of 992
676 of 992
Further Details (Pharmacological Data)
effect of title comp. on holding current
Results
inward current evoked by title comp.
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with α1β3δ subunits
Concentration (Pharmacological Data)
30 μmol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells coexpressing rat α1, β3 and δ subunits; whole-cell patch-clamp recording at -75 mV; holding current measured; direct application of title comp., 6 s
Further Details (Pharmacological Data)
effect of title comp. on holding current
Results
inward current evoked by title comp., small effect
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
γ-aminobutyric acidA receptors with α1β3 subunits
Concentration (Pharmacological Data)
30 μmol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells coexpressing rat α1, β3 subunits; whole-cell patch-clamp recording at -75 mV; holding current measured; direct application of title comp., 6 s
Further Details (Pharmacological Data)
effect of title comp. on holding current
Results
inward current evoked by title comp., small effect
Reference
Neelands, Torben R.; Fisher, Janet L.; Bianchi, Matt; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 1 p. 168 - 178 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
enzyme; examination of
Endpoint of Effect (Pharmacological Data)
protection from enzyme inactivation
Species or TestSystem (Pharmacological Data)
pig brain γ-aminobutyric acid aminotransferase
Concentration (Pharmacological Data)
0.5 - 10 mmol/l
Method (Pharmacological Data)
enzyme incubated at 25 deg C in solution containing (Z)- or (E)-4-amino-2-(trifluoromethyl)-2-butenoic acid, α-ketoglutarate, title comp., and potassium pyrophosphate at pH 8.5; at time intervals over 60 min, aliquots assayed for enzyme activity significant decrease in rate of enzyme inactivation caused by (Z)- or (E)-4-amino-2-(trifluoromethyl)-2-butenoic acid
Results
677 of 992
678 of 992
679 of 992
Reference
Johnson, Theodore R.; Silverman, Richard B.
Bioorganic and Medicinal Chemistry, 1999 , vol. 7, # 8 p. 1625 - 1636 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Endpoint of Effect (Pharmacological Data)
inhibition of (3H)L-carnitine uptake
Species or TestSystem (Pharmacological Data)
human hepatoma HLF cells
Concentration (Pharmacological Data)
1 mmol/l
Method (Pharmacological Data)
in vitro; 3E6 cells; Krebs-Ringer phosphate buffer, pH 7.4; incub. with test comp. for 15 min; incub. in the pres. of (3H)-label. L-carnitine (1.27 nM) for further 5 min; 37 deg C; radioact. meas. by scintil. count.
Results
title comp. slightly inhib. uptake of (3H)-L-carnitine (78.8 percent of that in the absence of title comp.)
Reference
Yokogawa, Koichi; Miya, Kazuhiro; Tamai, Ikumi; Higashi, Yasuhiko; Nomura, Masaaki; Miyamoto, Ken-Ichi; Tsuji, Akira
Journal of Pharmacy and Pharmacology, 1999 , vol. 51, # 8 p. 935 - 940 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
cortical synaptoneurosomes from Long-Evans rat
Sex
male
Concentration (Pharmacological Data)
5 - 100 μmol/l
Method (Pharmacological Data)
in vitro; cortical synaptoneurosomes, ca. 1 mg protein; preincubation for 12 min at 30 deg C; 0.2 μCi/sample 36Cl(-) was added; with/without title comp. and 1 or 5 μM cyanazine; incubation for 5 s
Further Details (Pharmacological Data)
synaptoneurosomes were prepared by Schwartz; effect cyanazine on title comp.-stimulated 36Cl(-) flux into synaptoneurosomes was evaluated; EC50s for title comp. were estimated
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
19.4 - 28.8 μmol/l
Results
cyanazine shifted the EC50 for title comp.-stimulated 36Cl(-) flux into synaptoneurosomes from 28.9 to 19.4 μM; EC50, μM: 28.8 (title comp.), 23.0 (title comp. + 1 μM cyanazine), 19,4 (title comp. + 1 μM cyanazine)
Reference
Shafer, Timothy J.; Ward, Thomas R.; Meacham, Connie A.; Cooper, Ralph L.
Toxicology, 1999 , vol. 142, # 1 p. 57 - 68 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
peritubular myoid cells (PMCs) from Sprague-Dawley rat
Sex
male
Concentration (Pharmacological Data)
50 μmol/l
Kind of Dosing (Pharmacological
solut. of title comp. in DMSO added to cell culture medium; final DMSO conc. <=0.1 percent
Data)
680 of 992
681 of 992
682 of 992
Method (Pharmacological Data)
in vitro; 6E5 cells/ml PMC incubated with 200 nM bisoxonol for 2-4 min; incubation with title comp. and 200 μM lindane for 5 min in regular buffer; membrane depolarization (MD) measured fluorimetrically at ex/em 540/580 nm
Further Details (Pharmacological Data)
PMCs: from testis of 18-d old rats; control: DMSO only; regular buffer: DMEM/F12; ex/em: excitation/emission; effect title comp. on lindane-induced MD was evaluated
Comment (Pharmacological Data)
No effect
Reference
Silvestroni, Leopoldo; Rossi, Fabio; Magnanti, Massimo; Lubrano, Carla; Santiemma, Vittorio; Palleschi, Simonetta
Reproductive Toxicology, 1999 , vol. 13, # 6 p. 431 - 441 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
metabolic
Species or TestSystem (Pharmacological Data)
pig brain γ-aminobutyric acid aminotransferase
Method (Pharmacological Data)
in vitro; determination of kinetic constants; <5-14C>2-ketoglutarate; β-mercaptoethanol; potassium pyrophosphate buffer, pH 8.5; 25 deg C; 60-min incubation; resulting <14C>glutamate isolated and quantified
Type (Pharmacological Data)
Km
Value of Type (Pharmacological Data)
2.4 mmol/l
Results
served as enzyme substrate with kcat of 49 1/min and specificity const. (kcat/Km) of 20.4 1/(mmol/l * min)
Reference
Qiu, Jian; Pingsterhaus, Joyce M.; Silverman, Richard B.
Journal of Medicinal Chemistry, 1999 , vol. 42, # 22 p. 4725 - 4728 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat olfactory bulb
Sex
male
Concentration (Pharmacological Data)
1E-06 - 0.001 mol/l
Method (Pharmacological Data)
olfactory bulb granule cell layers from rats (200-350g); adenylyl cyclase activity stimulated by title comp. determined by monitoring the conversion of (α-32P)-ATP into <32P>-cyclic AMP; comparison with the effect of (-)-baclofen
Further Details (Pharmacological Data)
pD2 calculated (negative logarithmic form of EC50 values in mol/l)
Type (Pharmacological Data)
pD2
Value of Type (Pharmacological Data)
3.56 dimensionless
Results
title comp. mimicked the (-)-baclofen stimulation; (diagram)
Reference
Olianas, Maria C.; Onali, Pierluigi
British Journal of Pharmacology, 1999 , vol. 126, # 3 p. 657 - 664 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or Test-
human intestinal epithelial (Caco-2) cells
System (Pharmacological Data)
683 of 992
684 of 992
Concentration (Pharmacological Data)
10 - 100 μmol/l
Method (Pharmacological Data)
uptake of title comp. across cell monolayer (grown on 12 mm diameter filter) between two compartments of the chamber: basal side filled with B solution (pH 7.4) of <2,3-3H>-title comp., apical with B of variing pH (4.9-8.0) (scint. counting)
Further Details (Pharmacological Data)
B = modified sodium-free Krebs buffer
Results
title comp. showed pH-dependent uptake (minimum at pH 8, maximum at pH < 5.3); diagram given
Reference
Thwaites, David T.; Stevens, Beverley C.
Experimental Physiology, 1999 , vol. 84, # 2 p. 275 - 284 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
membrane current; effect on
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat pituitary intermediate lobe cells
Sex
male
Concentration (Pharmacological Data)
50 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in solution containing (mmol/l): NaCl (140), KCl (3.5), glucose (10), NaH2PO4 (1.25), CaCl2 (2), MgCl2 (2), HEPES (20), pH 7.3
Method (Pharmacological Data)
endocrine cells of 4-6 weeks old rats were prepared; patch-clamp recording at room temperature with a holding potential -70 mV; title comp. added for 8 s through patch pipette or through gravity-feed tube; whole-cell current was recorded
Further Details (Pharmacological Data)
control: without title comp.; further investigation of title comp.-induced current using Bicuculline methbromide (100 μmol/l) and picrotoxinin (100 μmol/l)
Results
title comp. stimulated high response in cell current with amplitude 530-740 pA; desensitization time was 5160 -5420 ms; title comp. response was blocked completely by bicuculline and 89 percent blocked by picrotoxinin (table, diagram)
Reference
Hansen, Suzanne L.; Fjalland, Bjarne; Jackson, Meyer B.
Molecular Pharmacology, 1999 , vol. 55, # 3 p. 489 - 496 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
membrane current; effect on
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat posterior pituitary nerve terminal
Sex
male
Concentration (Pharmacological Data)
50 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in solution containing (mmol/l): NaCl (140), KCl (3.5), glucose (10), CaCl2 (2), MgCl2 (2), NaH2PO4 (1.25), HEPES (20), pH 7.3
Method (Pharmacological Data)
cells of 4-6 weeks old rats were prepared; patch-clamp recording at room temperature with a holding potential -70 mV; title comp. added for 1-2 s through patch pipette or through gravity-feed tube; whole-cell current was recorded
Further Details (Pharmacological Data)
control: without title comp.
Results
title comp. stimulated high response in cell current with amplitude 45 pA; desensitization time was 300 ms (table, diagram)
Reference
Hansen, Suzanne L.; Fjalland, Bjarne; Jackson, Meyer B.
Molecular Pharmacology, 1999 , vol. 55, # 3 p. 489 - 496 Title/Abstract Full Text View citing articles Show Details
685 of 992
686 of 992
687 of 992
Effect (Pharmacological Data)
membrane current; effect on
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat anterior pituitary cells
Sex
male
Concentration (Pharmacological Data)
50 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in solution containing (mmol/l): NaCl (140), KCl (3.5), glucose (10), CaCl2 (2), MgCl2 (2), NaH2PO4 (1.25), HEPES (20), pH 7.3
Method (Pharmacological Data)
cells of 4-6 weeks old rats were prepared; patch-clamp recording at room temperature with a holding potential -70 mV; title comp. added for 1-2 s through patch pipette or through gravity-feed tube; whole-cell current was recorded
Further Details (Pharmacological Data)
control: without title comp.
Results
title comp. caused very small response (3-pA)
Reference
Hansen, Suzanne L.; Fjalland, Bjarne; Jackson, Meyer B.
Molecular Pharmacology, 1999 , vol. 55, # 3 p. 489 - 496 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
rat hippocampal dentate granule cells
Concentration (Pharmacological Data)
0.3 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in extracellular solution
Method (Pharmacological Data)
title comp.A receptor assay; cells were isolated from rats aged 7-14 and 45-52 days; whole cell title comp. receptor currents recorded by patch-clamp method (pH 7.4, 24 deg C)
Results
title comp. effect increased with age: minimum conc. required for evoking currents were 1 and 0.3 μmol/l (ca. 10 and 50 days old respectively), peak currents evoked by 10 μmol/l were 40 and 252 pA (ca. 10 and 50 days old respectively)
Reference
Kapur, Jaideep; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 3 p. 444 - 452 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
rat hippocampal dentate granule cells
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in extracellular solution
Method (Pharmacological Data)
title comp.A receptor assay; cells were isolated from rats aged 7-14 days; whole cell title comp. receptor currents recorded by patch-clamp method (pH 7.4, 24 deg C); concentration-response curves obtained
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological
31 μmol/l
Data)
688 of 992
689 of 992
690 of 992
Reference
Kapur, Jaideep; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 3 p. 444 - 452 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
rat hippocampal dentate granule cells
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in extracellular solution
Method (Pharmacological Data)
title comp.A receptor assay; cells were isolated from rats aged 45-52 days; whole cell title comp. receptor currents recorded by patch-clamp method (pH 7.4, 24 deg C); concentration-response curves obtained
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
40 μmol/l
Reference
Kapur, Jaideep; Macdonald, Robert L.
Molecular Pharmacology, 1999 , vol. 55, # 3 p. 444 - 452 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
muscle contractive
Species or TestSystem (Pharmacological Data)
guinea-pig ileum
Sex
male and female
Concentration (Pharmacological Data)
1E-06 - 0.001 mol/l
Kind of Dosing (Pharmacological Data)
dissolved in distilled water
Method (Pharmacological Data)
longitudinal muscle strips; intact myenteric plexus; PSS at 37 deg C; histamine (1 μmol/l) induced preconstriction; electric field stimulation; addition of title comp.; inhibition by title comp. of stimulation-evoked relaxation
Further Details (Pharmacological Data)
stimulation: 1 Hz, 1 ms, 300 mA for 10 s at 10 min interval; isometric force measurements; PSS: physiological salt solution, gassed with 95 percent O2/5 percent CO2; further investigation using tetrodotoxin
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
5 μmol/l
Results
title comp. inhibited stimulation-evoked relaxation in concentration-dependent manner (figure); effect of title comp. was significantly stronger in presence of tetrodotoxin
Reference
Kilbinger; Ginap; Erbelding
Naunyn-Schmiedeberg's Archives of Pharmacology, 1999 , vol. 359, # 6 p. 500 - 504 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
muscle contractive
Species or TestSystem (Pharmacological
guinea-pig ileum
Data)
691 of 992
692 of 992
Sex
male and female
Concentration (Pharmacological Data)
100 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in distilled water
Method (Pharmacological Data)
longitudinal muscle strips; intact myenteric plexus; PSS at 37 deg C; histamine (1 μmol/l) induced preconstriction; addition of title comp.; 15 min later effect of title comp. on SNP (100 μmol/l) stimulated relaxation was tested
Further Details (Pharmacological Data)
isometric force measurements; PSS: physiological salt solution, gassed with 95 percent O2/5 percent CO2; control: without title comp.; SNP: sodium nitroprusside
Reference
Kilbinger; Ginap; Erbelding
Naunyn-Schmiedeberg's Archives of Pharmacology, 1999 , vol. 359, # 6 p. 500 - 504 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
enzyme; induction of
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat cerebral cortex membranes
Sex
male
Concentration (Pharmacological Data)
Ca. 1E-06 - 0.005 mol/l
Method (Pharmacological Data)
membranes incubated at 37 deg C in 50 mmol/l Tris-HCl, pH 7.4, containing 0.3 μmol/l <γ-32P>GTP and 2 mmol/l MgCl2 for 15 min in presence of title comp.; GTPase activity measured as radioactivity of 32Pi release with liquid scintillation spectrometer
Further Details (Pharmacological Data)
further investigation in presence of 0.5-20 mmol/l MgCl2 or in absence of MgCl2
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
63.4 μmol/l
Results
title comp. sign. augmented GTP hydrolysis in presence of MgCl2; no effect in absence of MgCl2 (figure)
Reference
Odagaki, Yuji; Nishi, Nobuyuki; Nakagawa, Shin; Koyama, Tsukasa
Journal of Pharmacology and Experimental Therapeutics, 1999 , vol. 291, # 3 p. 1250 - 1256 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
rat brain membranes
Concentration (Pharmacological Data)
0.3 - 4 μmol/l
Method (Pharmacological Data)
test system incubated with anisatin and <3H>EBOB in presence of title comp. (37 deg C, 90 min) in sodium phosphate buffer contg. NaCl; filtered; radioactivity of <3H>EBOB that specifically bound to membranes on filters was measured with LSC
Further Details (Pharmacological Data)
LSC: liquid scintillation counter; EBOB: 1-(4-ethynylphenyl)-4-n-propyl-2,6,7-trioxabicyclo<2.2.2>octane
Results
title comp. failed to affect the potency of anisatin in inhibiting <3H>EBOB binding; at 0.3 and 4.0 μmol/l, title comp. caused 25 and 74 percent inhibition of <3H>EBOB binding, respectively; fig., table
Reference
Kakemoto, Eiji; Okuyama, Emi; Nagata, Keiichi; Ozoe, Yoshihisa
Biochemical Pharmacology, 1999 , vol. 58, # 4 p. 617 - 621 Title/Abstract Full Text View citing articles Show Details
693 of 992
694 of 992
695 of 992
696 of 992
Comment (Pharmacological Data)
inhibits specific R-<3H>-baclofen binding to rat brain synaptic membranes (male Wistar rats) by IC 50: 0.058 μM; Ki inhibition constant at GABAB receptors: 0.045 μM
Reference
Meza-Toledo, Sergio E.; Martinez-Munoz, Dalila; Carvajal-Sandoval, Guillermo
Arzneimittel-Forschung/Drug Research, 1998 , vol. 48, # 11 p. 1051 - 1057 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Endpoint of Effect (Pharmacological Data)
inhibition of EBOB binding
Species or TestSystem (Pharmacological Data)
Wistar rat-brain P2 membranes
Sex
male
Exposure Period (Pharmacological Data)
90 min
Method (Pharmacological Data)
incubation of test compound with brain membranes and <3H>EBOB in NaCl/sodium phosphate buffer (pH 7.5) at 37 deg C; measurement of <3H>EBOB bound to membranes with liquid scintillation
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
1.05 μmol/l
Reference
Ozoe; Niina; Matsumoto; Ikeda; Mochida; Ogawa; Matsuno; Miki; Yanagi
Bioorganic and medicinal chemistry, 1998 , vol. 6, # 1 p. 73 - 83 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
binding
Species or TestSystem (Pharmacological Data)
brain of Sprague-Dawley rat
Sex
male
Concentration (Pharmacological Data)
50 nmol/l
Exposure Period (Pharmacological Data)
20 min
Method (Pharmacological Data)
rats (250-300 g) cannulated, injection of vehicle or gamma-2 ASO (18 μg, every 12 h 3 days) into right i.c.v. space; 6 h after last i.c.v. injection rats killing, brain slices prepn.; incubation with 3H-labeled title compd. and 100 μM baclofen
Further Details (Pharmacological Data)
autoradiographic anal. of dried slices; ASO - antisense oligodeoxynuclide
Results
specific binding in various brain tissue areas (dependence on gamma-2 ASO pretreatment) evaluated (diagram)
Reference
Zhao, Tai-Jun; Ming; Chiu, Ted H.; Rosenberg, Howard C.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 287, # 2 p. 752 - 759 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
modulation of 35S-TBPS binding
Species or TestSystem (Pharmacological Data)
brain of Sprague-Dawley rats
Sex
male
697 of 992
698 of 992
699 of 992
Concentration (Pharmacological Data)
1E-06 - 0.0001 mol/l
Exposure Period (Pharmacological Data)
3 h
Method (Pharmacological Data)
adult rats (200-300 g); with/without GHB-induction of absence seizures (100 mg/kg GBL, i.p.); 15 - 60 min after onset of GHB seisures rats sacrificed, brain tissues prepd., incubated in 35S-TBPS (70-100 Ci/mmol, 2 nM) and title compd.
Further Details (Pharmacological Data)
TBPS - t-butylbicyclophosphorothionate; GHB - γ-hydroxybutyric acid; GBL - γ-butyrolactone
Results
concn.-dependent biphasis effect (binding in thalamic ventrobasal nucleus) and influence of GHB-induced absence seizures evaluated (diagrams)
Reference
Banerjee, Pradeep K.; Olsen, Richard W.; Tillakaratne, Niranjala J. K.; Brailowsky, Simon; Tobin, Allan J.; Snead III, O. Carter
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 287, # 2 p. 766 - 772 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
murine B82 cell line (HM2-B10) expressing human M2 receptor
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
title comp./<3H>(-)-N-methyl-3-quinuclidinyl benzilate (MQNB) competition assay was carried out using average concentration of 341 pM <3H>MQNB in 1 ml of IMDM at 37 deg C for 3 hr; liquid scintillation counting
Further Details (Pharmacological Data)
specific binding was determined as the amount of binding inhibited by 1 μM atropine sulfate
Results
title comp. showed < 40 percent inhibition of <3H>(-)-MQNB binding
Reference
Kovacs, Ildiko; Yamamura, Henry I.; Waite, Sue L.; Varga, Eva V.; Roeske, William R.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 2 p. 500 - 507 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
HEK 293 cells expressing α2β1 wild-type GABA receptor
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Method (Pharmacological Data)
in vitro; cDNA encoding receptor expressed in HEK 293 cells; title comp. applied through local perfusion; electrophysiological recordings performed on cells using whole cell patch-clamp technology
Further Details (Pharmacological Data)
dose-response curve given
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
9.8 μmol/l
Results
maximal response to title comp.=608 pA
Reference
Krasowski, Matthew D.; Finn, Suzanne E.; Ye, Qing; Harrison, Neil L.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 3 p. 934 - 942 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
700 of 992
701 of 992
Species or TestSystem (Pharmacological Data)
HEK 293 cell expr. α2(S270I)β1 mutant GABA receptor
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Method (Pharmacological Data)
in vitro; cDNA encoding receptor expressed in HEK 293 cells; title comp. applied through local perfusion; electrophysiological recordings performed on cells using whole cell patch-clamp technology
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
14.4 μmol/l
Results
maximal response to title comp.=489 pA
Reference
Krasowski, Matthew D.; Finn, Suzanne E.; Ye, Qing; Harrison, Neil L.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 3 p. 934 - 942 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
HEK 293 cell expr. α2(S270H)β1 mutant GABA receptor
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Method (Pharmacological Data)
in vitro; cDNA encoding receptor expressed in HEK 293 cells; title comp. applied through local perfusion; electrophysiological recordings performed on cells using whole cell patch-clamp technology
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
3.4 μmol/l
Results
maxiaml response to GABA=598 pA
Reference
Krasowski, Matthew D.; Finn, Suzanne E.; Ye, Qing; Harrison, Neil L.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 3 p. 934 - 942 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
HEK 293 cells expr. α2(A291W)β1 mutant GABA receptor
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Method (Pharmacological Data)
in vitro; cDNA encoding receptor expressed in HEK 293 cells; title comp. applied through local perfusion; electrophysiological recordings performed on cells using whole cell patch-clamp technology
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.4 μmol/l
Results
maximal response to title comp.=935 pA
Reference
Krasowski, Matthew D.; Finn, Suzanne E.; Ye, Qing; Harrison, Neil L.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 3 p. 934 - 942 Title/Abstract Full Text View citing articles Show Details
702 of 992
703 of 992
704 of 992
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
HEK 293 cells expr. α2β1(S265I) mutant GABA receptor
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Method (Pharmacological Data)
in vitro; cDNA encoding receptor expressed in HEK 293 cells; title comp. applied through local perfusion; electrophysiological recordings performed on cells using whole cell patch-clamp technology
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
37.5 μmol/l
Results
maximal response to title comp.=709 pA
Reference
Krasowski, Matthew D.; Finn, Suzanne E.; Ye, Qing; Harrison, Neil L.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 3 p. 934 - 942 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
HEK 293 cells expr. α2β1(M286W) mutant GABA receptor
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Method (Pharmacological Data)
in vitro; cDNA encoding receptor expressed in HEK 293 cells; title comp. applied through local perfusion; electrophysiological recordings performed on cells using whole cell patch-clamp technology
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
7.4 μmol/l
Results
maximal current response to title comp.=422 pA
Reference
Krasowski, Matthew D.; Finn, Suzanne E.; Ye, Qing; Harrison, Neil L.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 3 p. 934 - 942 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
HEK 293 cells expressing GABAρ1 receptor
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Method (Pharmacological Data)
in vitro; cDNA encoding GABA receptor expressed in HEK 293 cells; title comp. applied through local perfusion; electrophysiological recordings performed on cells using whole cell patch-clamp technology
Further Details (Pharmacological Data)
GABA=γ-aminobutyric acid
Type (Pharmacological Data)
EC50
705 of 992
706 of 992
707 of 992
Value of Type (Pharmacological Data)
3.9 μmol/l
Results
maximal response to title comp.=700 pA
Reference
Krasowski, Matthew D.; Finn, Suzanne E.; Ye, Qing; Harrison, Neil L.
Journal of Pharmacology and Experimental Therapeutics, 1998 , vol. 284, # 3 p. 934 - 942 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney HEK 293 cells
Kind of Dosing (Pharmacological Data)
diluted into extracellular solution before use
Method (Pharmacological Data)
cells transiently expressing α2β1 wild-type GABAA receptors; continuously perfused at room temp.; whole-cell patch-clamp at -60 mV; stimulation by title comp. of inward current was assessed
Further Details (Pharmacological Data)
extracellular medium (mmol/l): 145 NaCl, 3 KCl, 1.5 CaCl2, 1 MgCl2, 5.5 glucose, 10 HEPES, pH 7.4; intracellular solution (mmol/l): 145 N-methyl-Dglutamine hydrochloride, 5 K2ATP, 5 HEPES/KOH, 2 MgCl2, 0.1 CaCl2, 1.1 EGTA, pH 7.2
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
8.7 μmol/l
Results
Hill slope value 1.9
Reference
Krasowski, Matthew D.; Koltchine, Vladimir V.; Rick, Caroline E.; Ye, Qing; Finn, Suzanne E.; Harrison, Neil L.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 530 - 538 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney HEK 293 cells
Kind of Dosing (Pharmacological Data)
diluted into extracellular solution before use
Method (Pharmacological Data)
cells transiently expressing α2(S270I)β1 mutant GABAA receptors; continuously perfused at room temp.; whole-cell patch-clamp at -60 mV; stimulation by title comp. of inward current was assessed
Further Details (Pharmacological Data)
extracellular medium (mmol/l): 145 NaCl, 3 KCl, 1.5 CaCl2, 1 MgCl2, 5.5 glucose, 10 HEPES, pH 7.4; intracellular solution (mmol/l): 145 N-methyl-Dglutamine hydrochloride, 5 K2ATP, 5 HEPES/KOH, 2 MgCl2, 0.1 CaCl2, 1.1 EGTA, pH 7.2
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
14.6 μmol/l
Results
Hill slope value 2.4
Reference
Krasowski, Matthew D.; Koltchine, Vladimir V.; Rick, Caroline E.; Ye, Qing; Finn, Suzanne E.; Harrison, Neil L.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 530 - 538 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological
human embryonic kidney HEK 293 cells
Data)
708 of 992
709 of 992
Kind of Dosing (Pharmacological Data)
diluted into extracellular solution before use
Method (Pharmacological Data)
cells transiently expressing α2(S270H)β1 mutant GABAA receptors; continuously perfused at room temp.; whole-cell patch-clamp at -60 mV; stimulation by title comp. of inward current was assessed
Further Details (Pharmacological Data)
extracellular medium (mmol/l): 145 NaCl, 3 KCl, 1.5 CaCl2, 1 MgCl2, 5.5 glucose, 10 HEPES, pH 7.4; intracellular solution (mmol/l): 145 N-methyl-Dglutamine hydrochloride, 5 K2ATP, 5 HEPES/KOH, 2 MgCl2, 0.1 CaCl2, 1.1 EGTA, pH 7.2
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
3.5 μmol/l
Results
Hill slope value 1.5
Reference
Krasowski, Matthew D.; Koltchine, Vladimir V.; Rick, Caroline E.; Ye, Qing; Finn, Suzanne E.; Harrison, Neil L.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 530 - 538 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney HEK 293 cells
Kind of Dosing (Pharmacological Data)
diluted into extracellular solution before use
Method (Pharmacological Data)
cells transiently expressing α2(A291W)β1 mutant GABAA receptors; continuously perfused at room temp.; whole-cell patch-clamp at -60 mV; stimulation by title comp. of inward current was assessed
Further Details (Pharmacological Data)
extracellular medium (mmol/l): 145 NaCl, 3 KCl, 1.5 CaCl2, 1 MgCl2, 5.5 glucose, 10 HEPES, pH 7.4; intracellular solution (mmol/l): 145 N-methyl-Dglutamine hydrochloride, 5 K2ATP, 5 HEPES/KOH, 2 MgCl2, 0.1 CaCl2, 1.1 EGTA, pH 7.2
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.4 μmol/l
Results
Hill slope value 1.7
Reference
Krasowski, Matthew D.; Koltchine, Vladimir V.; Rick, Caroline E.; Ye, Qing; Finn, Suzanne E.; Harrison, Neil L.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 530 - 538 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney HEK 293 cells
Kind of Dosing (Pharmacological Data)
diluted into extracellular solution before use
Method (Pharmacological Data)
cells transiently expressing α2β1(S265I) mutant GABAA receptors; continuously perfused at room temp.; whole-cell patch-clamp at -60 mV; stimulation by title comp. of inward current was assessed
Further Details (Pharmacological Data)
extracellular medium (mmol/l): 145 NaCl, 3 KCl, 1.5 CaCl2, 1 MgCl2, 5.5 glucose, 10 HEPES, pH 7.4; intracellular solution (mmol/l): 145 N-methyl-Dglutamine hydrochloride, 5 K2ATP, 5 HEPES/KOH, 2 MgCl2, 0.1 CaCl2, 1.1 EGTA, pH 7.2
Type (Pharmacological Data)
EC50
710 of 992
711 of 992
712 of 992
Value of Type (Pharmacological Data)
37.5 μmol/l
Results
Hill slope value 1.2
Reference
Krasowski, Matthew D.; Koltchine, Vladimir V.; Rick, Caroline E.; Ye, Qing; Finn, Suzanne E.; Harrison, Neil L.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 530 - 538 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human embryonic kidney HEK 293 cells
Kind of Dosing (Pharmacological Data)
diluted into extracellular solution before use
Method (Pharmacological Data)
cells transiently expressing α2β1(M286W) mutant GABAA receptors; continuously perfused at room temp.; whole-cell patch-clamp at -60 mV; stimulation by title comp. of inward current was assessed
Further Details (Pharmacological Data)
extracellular medium (mmol/l): 145 NaCl, 3 KCl, 1.5 CaCl2, 1 MgCl2, 5.5 glucose, 10 HEPES, pH 7.4; intracellular solution (mmol/l): 145 N-methyl-Dglutamine hydrochloride, 5 K2ATP, 5 HEPES/KOH, 2 MgCl2, 0.1 CaCl2, 1.1 EGTA, pH 7.2
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
8.7 μmol/l
Results
Hill slope value 0.8
Reference
Krasowski, Matthew D.; Koltchine, Vladimir V.; Rick, Caroline E.; Ye, Qing; Finn, Suzanne E.; Harrison, Neil L.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 530 - 538 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport; inhibition of
Species or TestSystem (Pharmacological Data)
ICR mouse brain synaptosomes
Sex
male
Concentration (Pharmacological Data)
0.5 mmol/l
Method (Pharmacological Data)
γ-hydroxybutyrate transport study; synaptosomes incubated with increasing conc. of <3H>γ-hydroxybutyrate in presence of title comp. (3 min, 37 deg C); then γ-hydroxybutyrate added; radioactivity measured in scintillation spectrometer
Comment (Pharmacological Data)
No effect
Reference
McCormick; Tunnicliff
Pharmacology, 1998 , vol. 57, # 3 p. 124 - 131 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological
receptor expressed in oocytes: αβ
Data)
713 of 992
714 of 992
715 of 992
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
3.4 μmol/l
Results
Hill coefficient: 0.97
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αβH267S
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.7 μmol/l
Results
Hill coefficient: 0.67
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αβH267I
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.2 μmol/l
Results
Hill coefficient: 1.40
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Method (Pharmacological Data)
716 of 992
717 of 992
718 of 992
Further Details (Pharmacological Data)
receptor expressed in oocytes: αβH267C
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.6 μmol/l
Results
Hill coefficient: 1.48
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αS272Hβ
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
5.6 μmol/l
Results
Hill coefficient: 0.79
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αS272H βH267S
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.7 μmol/l
Results
Hill coefficient: 0.83
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
719 of 992
720 of 992
721 of 992
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αS272H βH267Sγ
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.7 μmol/l
Results
Hill coefficient: 0.64
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αβγ
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
7.8 μmol/l
Results
Hill coefficient: 0.96
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αS272H γI282H
Comment (Pharmacological Data)
No effect
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
722 of 992
723 of 992
724 of 992
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: βγI282H
Comment (Pharmacological Data)
No effect
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αβH267S γI282H
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.9 μmol/l
Results
Hill coefficient: 1.03
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αS272H βH267S γI282H
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.9 μmol/l
Results
Hill coefficient: 0.86
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
725 of 992
726 of 992
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αS272Hβγ
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
3.8 μmol/l
Results
Hill coefficient: 1.07
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αβγI282H
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
3.4 μmol/l
Results
Hill coefficient: 0.78
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes expressing GABAA receptors
Method (Pharmacological Data)
currents recorded under two-electrode voltage-clamp at holding potential of -50 mV at room temperature
Further Details (Pharmacological Data)
receptor expressed in oocytes: αS272H βγI282H
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.4 μmol/l
Results
Hill coefficient: 0.86
Reference
Horenstein, Jeffrey; Akabas, Myles H.
Molecular Pharmacology, 1998 , vol. 53, # 5 p. 870 - 877 Title/Abstract Full Text View citing articles Show Details
727 of 992
728 of 992
729 of 992
730 of 992
Comment (Pharmacological Data)
inhibition of activity of NADP-malic enzyme from Bradyrhizobium japonicum A1017
Reference
Chen; Okabe; Osano; Tajima
Bioscience, Biotechnology and Biochemistry, 1997 , vol. 61, # 2 p. 384 - 386 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
membrane depolarization
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat coronal slices
Sex
male
Concentration (Pharmacological Data)
20 μmol/l
Method (Pharmacological Data)
rat (weighing 125-200 g), brain coronal slices cut, in vitro amygdalar slice prepared; pretreated with phenytoin (PHT, 100 μmol/l, 20 min) in presence of CNQX (10 μmol/l), picrotoxin (50 μmol/l) and TTX (0.5 μmol/l) then with title comp.
Further Details (Pharmacological Data)
CNQX: 6-cyano-7-nitroquinoxaline-2,3-dione; TTX: tetrodotoxin; GABA-induced membrane depolarization
Results
PHT had no effect on GABA-induced membrane depolarization
Reference
Cheng, Li-Ling; Wang, Su-Jane; Tsai, Jing-Jane; Gean, Po-Wu
Pharmacology, 1997 , vol. 55, # 5 p. 228 - 234 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
effect on extracellular acidification rate
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat cerebellar granule cells (CGC)
Concentration (Pharmacological Data)
0.01 - 1000 μmol/l
Method (Pharmacological Data)
primary CGC prepared from 8-day-post-natal rats; cells (9-12E5 cells/transwell cup) at 8 days in vitro assessed for response to increasing concentrations of title comp. (25 deg C, 33 s stimulation followed by 15 min washout between each concentration)
Further Details (Pharmacological Data)
measurement of CGC extracellular acidification rate in cytosensor microphysiometer
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.0 μmol/l
Results
title comp. stimulated a concentration-dependent increase in the extracellular acidification rate with maximal increase Emax = 15.4 percent and Hill slope 0.8; graphical representation
Reference
Brown; Wood; Coldwell; Bristow
British journal of pharmacology, 1997 , vol. 121, # 1 p. 71 - 76 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiological response
Species or TestSystem (Pharmacological Data)
recombinant P2x2 receptor
Concentration (Pharmacological Data)
100 μmol/l
731 of 992
732 of 992
733 of 992
Method (Pharmacological Data)
receptor expressed in defolliculated Xenopus oocytes; cells superfused with solution adjusted or not to pH 7.45; ATP (3 μmol/l) evoked invard currents recorded under voltage-clamp by use of twin-electrode amplifiers; title comp. applied for 2 min
Results
title comp. did no affect response to ATP (diagram) and did not caused acidification of the bathing solution
Reference
Wildman; King; Burnstock
British Journal of Pharmacology, 1997 , vol. 120, # 2 p. 221 - 224 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
rat cerebellar granule cells
Concentration (Pharmacological Data)
Ca. 1E-07 - 0.001 mol/l
Method (Pharmacological Data)
in vitro; effect on <3H>flunitrazepam binding assayed; <3H>flunitrazepam (spec. act. >80 Ci/mmol); intact cells; Tris-citrate buffer (pH 7.4); 0 or 25 deg C; radioactivity measured by scintillation counting
Further Details (Pharmacological Data)
results expressed as percent of control binding (<3H>flunitrazepam binding in absence title comp.)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.7 - 2.1 μmol/l
Results
increased <3H>flunitrazepam binding dose-dependently both at 0 and 25 deg C; EC50 values were 1.7 and 2.1 μM at 0 and 25 deg C, respectively; graphical representation
Reference
Vale, Carmen; Pomes, Anna; Rodriguez-Farre, Eduard; Sunol, Cristina
European Journal of Pharmacology, 1997 , vol. 319, # 2-3 p. 343 - 353 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
rat cerebellar granule cells
Concentration (Pharmacological Data)
30 μmol/l
Method (Pharmacological Data)
in vitro; radioligand binding assay; 1.8-2.1 nM <35S>TBPS (spec. act. >60 Ci/mmol); intact cells; Tris-citrate buffer (pH 7.4); 25 deg C; incubation time 30 min; radioactivity measured by scintillation counting
Further Details (Pharmacological Data)
results expressed as percent of control binding (binding in absence title comp.); TBPS: t-butylbicyclophosphorothionate
Results
reduced <35S>TBPS binding to ca. 25 percent of control; graphical representation
Reference
Vale, Carmen; Pomes, Anna; Rodriguez-Farre, Eduard; Sunol, Cristina
European Journal of Pharmacology, 1997 , vol. 319, # 2-3 p. 343 - 353 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellar granule cell membranes
Concentration (Pharmacological Data)
0.05 - 50 nmol/l
Method
in vitro; equilibrium binding assay; <3H>labeled title comp. (spec. act.: 86 Ci/mmol); cell membranes (25-70 γ protein) treated with Triton X-100; Triscitrate buffer; 0 deg C; incubation time 20 min; scintillation counting
(Pharmacological Data)
734 of 992
735 of 992
736 of 992
Type (Pharmacological Data)
Kd
Value of Type (Pharmacological Data)
12.6 nmol/l
Results
Bmax 1.1 pmol/mg protein; concentration response curve
Reference
Vale, Carmen; Pomes, Anna; Rodriguez-Farre, Eduard; Sunol, Cristina
European Journal of Pharmacology, 1997 , vol. 319, # 2-3 p. 343 - 353 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
on cell input conductance
Species or TestSystem (Pharmacological Data)
Ascaris suum muscle cell
Concentration (Pharmacological Data)
1E-05 - 0.01 mol/l
Method (Pharmacological Data)
worm sectioned and preparation perfused by APF, 34 deg C; one muscle cell impaled with two glass microelectrodes; current pulses (20 nA, 0.2 Hz, 500 ms) injected intracellulary via one electrode; title comp. added; voltage changes recorded
Further Details (Pharmacological Data)
APF: artificial perienteric fluid; controle: title comp. free perfusate
Results
title comp. elicited muscle cell input conductance increase in concentration-dependent manner (diagram)
Reference
Holden-Dye; Brownlee; Walker
British Journal of Pharmacology, 1997 , vol. 120, # 3 p. 379 - 386 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
on cell hyperpolarization
Species or TestSystem (Pharmacological Data)
Ascaris suum muscle cell
Concentration (Pharmacological Data)
1E-05 - 0.01 mol/l
Method (Pharmacological Data)
worm sectioned and preparation perfused by APF, 34 deg C; one muscle cell impaled with two glass microelectrodes; current pulses (20 nA, 0.2 Hz, 500 ms) injected intracellulary via one electrode; title comp. added; voltage changes recorded
Further Details (Pharmacological Data)
APF: artificial perienteric fluid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
59 μmol/l
Results
title comp. elicited muscle cell hyperpolarization in concentration-dependent manner (diagram)
Reference
Holden-Dye; Brownlee; Walker
British Journal of Pharmacology, 1997 , vol. 120, # 3 p. 379 - 386 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor modulation
Species or TestSystem (Pharmacological Data)
human embryonic kidney (HEK 293) cells
737 of 992
738 of 992
739 of 992
Concentration (Pharmacological Data)
0.1 - 1000 μmol/l
Method (Pharmacological Data)
cells transfected with plasmids containing cDNAs for rat α1, β3 GABAA receptor subunits; membranes perfused with extracellular HEPES-buffer (pH 7.4); inward whole-cell currents (Ii) recorded with the patch-clamp technique at -60 mV holding potential
Further Details (Pharmacological Data)
title comp. added to extracellular sol.; title comp. effect on Ii of α1β3 receptors studied
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
9.1 μmol/l
Results
at -60 mV: conc.-dependent increase of Ii (graph)
Reference
Davies, Paul A.; Kirkness, Ewen F.; Hales, Tim G.
British Journal of Pharmacology, 1997 , vol. 120, # 5 p. 899 - 909 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
human embryonic kidney (HEK 293) cells
Concentration (Pharmacological Data)
0.001 - 100 μmol/l
Method (Pharmacological Data)
cells transfected with plasmids containing cDNAs for rat α1, β3 GABAA receptor subunits (alone or in combination); membranes incub. with title comp.+5 nM <35S>-tert-butyl bicyclophosphorothioate (<35S>-TBPS) in Tris-buffer (90 min; 25 deg C; pH 7.5)
Further Details (Pharmacological Data)
<35S>-TBPS binding to α1β3, β3 receptors determined by scintillation counting; title comp. effect on <35S>-TBPS binding studied
Results
α1β3: biphasic effect on <35S>TBPS binding; 10 nM-1 μM: binding enhanced; 10-100 μM: binding inhibited; β3: binding unaffected (graph)
Reference
Davies, Paul A.; Kirkness, Ewen F.; Hales, Tim G.
British Journal of Pharmacology, 1997 , vol. 120, # 5 p. 899 - 909 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rats
Sex
male
Concentration (Pharmacological Data)
0.01 - 0.1 mmol/l
Method (Pharmacological Data)
rats (100-200g) anaesthetized and decapitated; crude synaptic membranes prepared from whole brain
Further Details (Pharmacological Data)
scintillation counting; (3H)-GABAB binding; GABAA receptors blocked by isoguvacine
Results
concentration-dependent effect: concentration of title compound, ca. percent(3H)-GABA specifically bound in the presence of title compound: 0mM, 100, 0.01mM, 10; 0.1mM, 5
Reference
Grobaski, Kenneth C.; Ping, Hanxian; DaSilva, Helena M.A.; Bowery, Norman G.; Connelly, Stephen T.; Shepard, Paul D.
British Journal of Pharmacology, 1997 , vol. 120, # 4 p. 575 - 580 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or Test-
mouse fibroblast L929 cells
System (Pharmacological Data)
740 of 992
741 of 992
Concentration (Pharmacological Data)
Ca. 0.01 - 1000 μmol/l
Method (Pharmacological Data)
cells expressing GABA receptor isoform α6/α1β3γ2L studied using whole-cell recording; currents recorded with patch-clamp amplifier
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.36 μmol/l
Results
dose-dependent current response, maximum currents evoked: 782.0 pA; Hill slope: 1.1
Reference
Fisher, Janet L.; Zhang, Jie; Macdonald, Robert L.
Molecular Pharmacology, 1997 , vol. 52, # 4 p. 714 - 724 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
mouse fibroblast L929 cells
Concentration (Pharmacological Data)
Ca. 1 - 1000 μmol/l
Method (Pharmacological Data)
cells expressing GABA receptor isoform α1/α6β3γ2L studied using whole-cell recording; currents recorded with patch-clamp amplifier
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
67.9 μmol/l
Results
dose-dependent current response, maximum currents evoked: 1123.6 pA; Hill slope: 1.4
Reference
Fisher, Janet L.; Zhang, Jie; Macdonald, Robert L.
Molecular Pharmacology, 1997 , vol. 52, # 4 p. 714 - 724 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
mouse fibroblast L929 cells
Concentration (Pharmacological Data)
Ca. 0.1 - 1000 μmol/l
Method (Pharmacological Data)
cells expressing GABA receptor isoform α1(L258T)β3γ2L studied using whole-cell recording; currents recorded with patch-clamp amplifier
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid
Type (Pharmacological
EC50
Data)
742 of 992
743 of 992
744 of 992
Value of Type (Pharmacological Data)
11.3 μmol/l
Results
dose-dependent current response, maximum currents evoked: 1293.9 pA; Hill slope: 1.3
Reference
Fisher, Janet L.; Zhang, Jie; Macdonald, Robert L.
Molecular Pharmacology, 1997 , vol. 52, # 4 p. 714 - 724 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
mouse fibroblast L929 cells
Concentration (Pharmacological Data)
Ca. 0.1 - 1000 μmol/l
Method (Pharmacological Data)
cells expressing GABA receptor isoform α1β3γ2L studied using whole-cell recording; currents recorded with patch-clamp amplifier
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
11.5 μmol/l
Results
dose-dependent current response, maximum currents evoked: 974.6 pA; Hill slope: 1.3
Reference
Fisher, Janet L.; Zhang, Jie; Macdonald, Robert L.
Molecular Pharmacology, 1997 , vol. 52, # 4 p. 714 - 724 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
mouse fibroblast L929 cells
Concentration (Pharmacological Data)
Ca. 0.01 - 1000 μmol/l
Method (Pharmacological Data)
cells expressing GABA receptor isoform α6β3γ2L studied using whole-cell recording; currents recorded with patch-clamp amplifier
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.7 μmol/l
Results
dose-dependent current response, maximum currents evoked: 812.0 pA; Hill slope: 1.2
Reference
Fisher, Janet L.; Zhang, Jie; Macdonald, Robert L.
Molecular Pharmacology, 1997 , vol. 52, # 4 p. 714 - 724 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or Test-
Xenopus laevis oocytes
System (Pharmacological Data)
745 of 992
746 of 992
747 of 992
Method (Pharmacological Data)
cells expressing human GABAA receptor α1β1γ2 subunit voltage clamped between -40 and -70 mV
Type (Pharmacological Data)
pEC50
Value of Type (Pharmacological Data)
4.60 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Method (Pharmacological Data)
cells expressing human GABAA receptor α1β2γ2 subunit voltage clamped between -40 and -70 mV
Type (Pharmacological Data)
pEC50
Value of Type (Pharmacological Data)
4.70 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Concentration (Pharmacological Data)
Ca. 0.1 - 1000 μmol/l
Method (Pharmacological Data)
cells expressing human GABAA receptor α1β3γ2 subunit voltage clamped between -40 and -70 mV
Type (Pharmacological Data)
pEC50
Value of Type (Pharmacological Data)
5.10 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Method (Pharmacological Data)
cells expressing human GABAA receptor α2β3γ2 subunit voltage clamped between -40 and -70 mV
748 of 992
749 of 992
750 of 992
Type (Pharmacological Data)
pEC50
Value of Type (Pharmacological Data)
5.40 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Method (Pharmacological Data)
cells expressing human GABAA receptor α3β3γ2 subunit voltage clamped between -40 and -70 mV
Type (Pharmacological Data)
pEC50
Value of Type (Pharmacological Data)
4.55 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Method (Pharmacological Data)
cells expressing human GABAA receptor α5β3γ2 subunit voltage clamped between -40 and -70 mV
Type (Pharmacological Data)
pEC50
Value of Type (Pharmacological Data)
5.52 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Ltk cell membrane
Concentration (Pharmacological Data)
1E-10 - 1E-06 mol/l
Method (Pharmacological Data)
cells expressing human GABAA receptor α1β1γ2 subunit; cell membranes incubated with 8 nmol/l <3H>muscimol for 1 h at 20 deg C, pH 7.4 in presence of title comp.; radioactivity counted by liquid scintillation counting
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; nonspecific binding defined with 1 mmol/l title comp.
Type (Pharmacological Data)
pKi
751 of 992
752 of 992
753 of 992
Value of Type (Pharmacological Data)
7.11 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Ltk cell membrane
Concentration (Pharmacological Data)
1E-10 - 1E-06 mol/l
Method (Pharmacological Data)
cells expressing human GABAA receptor α1β2γ2 subunit; cell membranes incubated with 8 nmol/l <3H>muscimol for 1 h at 20 deg C, pH 7.4 in presence of title comp.; radioactivity counted by liquid scintillation counting
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; nonspecific binding defined with 1 mmol/l title comp.
Type (Pharmacological Data)
pKi
Value of Type (Pharmacological Data)
7.24 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Ltk cell membrane
Concentration (Pharmacological Data)
1E-10 - 1E-06 mol/l
Method (Pharmacological Data)
cells expressing human GABAA receptor α1β3γ2 subunit; cell membranes incubated with 8 nmol/l <3H>muscimol for 1 h at 20 deg C, pH 7.4 in presence of title comp.; radioactivity counted by liquid scintillation counting
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; nonspecific binding defined with 1 mmol/l title comp.
Type (Pharmacological Data)
pKi
Value of Type (Pharmacological Data)
7.67 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Ltk cell membrane
Concentration (Pharmacological Data)
1E-10 - 1E-06 mol/l
754 of 992
755 of 992
756 of 992
Method (Pharmacological Data)
cells expressing human GABAA receptor α2β3γ2 subunit; cell membranes incubated with 8 nmol/l <3H>muscimol for 1 h at 20 deg C, pH 7.4 in presence of title comp.; radioactivity counted by liquid scintillation counting
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; nonspecific binding defined with 1 mmol/l title comp.
Type (Pharmacological Data)
pKi
Value of Type (Pharmacological Data)
7.64 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Ltk cell membrane
Concentration (Pharmacological Data)
1E-10 - 1E-06 mol/l
Method (Pharmacological Data)
cells expressing human GABAA receptor α3β3γ2 subunit; cell membranes incubated with 8 nmol/l <3H>muscimol for 1 h at 20 deg C, pH 7.4 in presence of title comp.; radioactivity counted by liquid scintillation counting
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; nonspecific binding defined with 1 mmol/l title comp.
Type (Pharmacological Data)
pKi
Value of Type (Pharmacological Data)
7.30 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Ltk cell membrane
Concentration (Pharmacological Data)
1E-10 - 1E-06 mol/l
Method (Pharmacological Data)
cells expressing human GABAA receptor α5β3γ2 subunit; cell membranes incubated with 8 nmol/l <3H>muscimol for 1 h at 20 deg C, pH 7.4 in presence of title comp.; radioactivity counted by liquid scintillation counting
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; nonspecific binding defined with 1 mmol/l title comp.
Type (Pharmacological Data)
pKi
Value of Type (Pharmacological Data)
8.06 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect
receptor; binding activity
(Pharmacological Data)
757 of 992
758 of 992
Species or TestSystem (Pharmacological Data)
Ltk cell membrane
Concentration (Pharmacological Data)
1E-10 - 1E-06 mol/l
Method (Pharmacological Data)
cells expressing human GABAA receptor α6β3γ2 subunit; cell membranes incubated with 8 nmol/l <3H>muscimol for 1 h at 20 deg C, pH 7.4 in presence of title comp.; radioactivity counted by liquid scintillation counting
Further Details (Pharmacological Data)
GABA: γ-aminobutyric acid; nonspecific binding defined with 1 mmol/l title comp.
Type (Pharmacological Data)
pKi
Value of Type (Pharmacological Data)
7.11 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Method (Pharmacological Data)
cells expressing human GABAA receptor α6β3γ2 subunit voltage clamped between -40 and -70 mV
Type (Pharmacological Data)
pEC50
Value of Type (Pharmacological Data)
5.82 dimensionless
Reference
Ebert, Bjarke; Thompson, Sally A.; Saounatsou, Koralia; Mckernan, Ruth; Krogsgaard-Larsen, Povl; Wafford, Keith A.
Molecular Pharmacology, 1997 , vol. 52, # 6 p. 1150 - 1156 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Concentration (Pharmacological Data)
Ca. 0.3 - 30 μmol/l
Method (Pharmacological Data)
receptor activity measured by two electrode voltage clamp recording, oocytes voltage clamped at -60 mV
Further Details (Pharmacological Data)
oocytes expressing human ρ1 subunit of GABAC receptors; GABA: γ-aminobutyric acid; KD: apparent dissociation constant, effective dose activating 50 percent of maximal current
Type (Pharmacological Data)
KD
Value of Type (Pharmacological Data)
0.82 μmol/l
Results
title comp. dose-dependently induced current; Hill coefficient: 2.6
759 of 992
760 of 992
761 of 992
762 of 992
763 of 992
Reference
Chebib, Mary; Vandenberg, Robert J.; Johnston, Graham A. R.
British Journal of Pharmacology, 1997 , vol. 122, # 8 p. 1551 - 1560 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
secretion inhibition
Species or TestSystem (Pharmacological Data)
Wistar rat anococcygeus muscle
Sex
male
Concentration (Pharmacological Data)
100 μmol/l
Kind of Dosing (Pharmacological Data)
dissolved in distilled water
Method (Pharmacological Data)
tissues incubated for 30 min at 37 deg C in presence of title comp. in PSS; ascorbate release determined by high-performance liquid chromatography with electrochemical detection
Further Details (Pharmacological Data)
PSS: physiological saline solution
Comment (Pharmacological Data)
No effect
Reference
Lilley, Elliot; Gibson, Alan
British Journal of Pharmacology, 1997 , vol. 122, # 8 p. 1746 - 1752 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocyte
Method (Pharmacological Data)
oocytes expressing human ρ1 subunit and producing GABAC receptors were voltage clamped at -60 mV and continuously superfused with ND96 buffer containing title comp.; receptor activation measured
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.82 μmol/l
Results
title comp. activated inward current (figure); Hill coefficient value was 2.6
Reference
Chebib; Vandenberg; Froestl; Johnston
European Journal of Pharmacology, 1997 , vol. 329, # 2-3 p. 223 - 229 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
effect on cerebral glucose consumption
Reference
Cinotti; Le Bars; Garcia-Larrea; Peyron; Gregoire; Lavenne; Krogsgaard-Larsen; Comar; Mauguiere
Journal de Chimie Physique et de Physico-Chimie Biologique, 1996 , vol. 93, # 1 p. 48 - 52 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
no inhib. of lipid peroxidation using heat-inactivated hepatic microsomes from Fischer-344 rats
Reference
Rekatas, George V.; Tani, Ekaterini; Demopoulos, Vassilis J.; Kourounakis, Panos N.
Archiv der Pharmazie, 1996 , vol. 329, # 8-9 p. 393 - 398 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
inhibition of baclofen (0.5 mM) intestinal absorption in combination with taurine (25 mM) and leucine (50 mM), male Wistar rats, perfusion in jejunum, in situ, 25 mM isotonic solution, 37 deg C
764 of 992
765 of 992
766 of 992
767 of 992
Reference
Moll-Navarro; Merino; Casabo; Nacher; Polache
Journal of Pharmaceutical Sciences, 1996 , vol. 85, # 11 p. 1248 - 1254 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
inhibition of <3H>GABA binding, Ki = 0.018 μM (pH 7.1), membranes from rat cerebral cortex, in vitro; inhibition of GABA-specific 36Cl- ion flux, dpm = 383, 0percent, cortical membrane vesicles, in vitro, 40 μM, pH 7.5
Reference
Kardos; Blandl; Luyen; Doernyei; Gacs-Baitz; Simonyi; Cash; Blasko; Szantay
European Journal of Medicinal Chemistry, 1996 , vol. 31, # 10 p. 761 - 765 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human GABAA receptors expressed in Xenopus oocytes
Method (Pharmacological Data)
α6β2γ2S (α6); effect of title comp. on current in oocytes
Further Details (Pharmacological Data)
oocytes placed in bath with modified Barth's medium and impaled with two 1-3 Mο containing 2M KCl; voltage-clamp
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
10.1 μmol/l
Reference
Hadingham, Karen L.; Garrett, Elizabeth M.; Wafford, Keith A.; Bain, Corinna; Heavens, Robert P.; Sirinathsinghji, Dalip J. S.; Whiting, Paul J.
Molecular Pharmacology, 1996 , vol. 49, # 2 p. 253 - 259 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
human GABAA receptors expressed in Xenopus oocytes
Method (Pharmacological Data)
α6β2γ2S (α6); effect of title comp. on current in oocytes
Further Details (Pharmacological Data)
oocytes placed in bath with modified Barth's medium and impaled with two 1-3 Mο containing 2M KCl; voltage-clamp
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
19.8 μmol/l
Reference
Hadingham, Karen L.; Garrett, Elizabeth M.; Wafford, Keith A.; Bain, Corinna; Heavens, Robert P.; Sirinathsinghji, Dalip J. S.; Whiting, Paul J.
Molecular Pharmacology, 1996 , vol. 49, # 2 p. 253 - 259 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus oocytes
Concentration (Pharmacological Data)
3 μmol/l
Kind of Dosing
in MBS
(Pharmacological Data)
768 of 992
769 of 992
770 of 992
Method (Pharmacological Data)
in vitro; oocytes (from adult Xenopus laevis) expressed human α6β2γ2s receptor; cells were impaled with electrodes; add. of pentobarbitone (PB, 1-3000 μM), bicuculline methiodide (Bic, 0.1-1mM), picrotoxin (PTX, 100 μM) and SR 95521 (SR, 1 μM)
Further Details (Pharmacological Data)
determination of maximal response ( percent)-concentration curves
Results
pentobarbitone potentiated response title compound and this effect was blocked by picrotoxin (as GABA antagonist), but other GABA antagonist (Bic, SR95531) did not affect.
Reference
Thompson; Whiting; Wafford
British Journal of Pharmacology, 1996 , vol. 117, # 3 p. 521 - 527 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
hypotensive
Endpoint of Effect (Pharmacological Data)
systemic arterial pressure
Species or TestSystem (Pharmacological Data)
white mongrel mice
Route of Application
intravenous
Concentration (Pharmacological Data)
200 mg/kg
Exposure Period (Pharmacological Data)
60 min
Method (Pharmacological Data)
mice narcotized with pentobarbital (40 mg/kg, i.p.); solution of test comp. in 10 percent aq. ethanol injected into jugular vein; systemic arterial pressure measured in carotid artery 1-60 min after test comp. injection
Results
pronounced hypotensive effect
Reference
Gracheva; Orekhova; Kopelevich; Tyurenkov; Kleshchitskii; Shvets
Pharmaceutical Chemistry Journal, 1996 , vol. 30, # 7 p. 453 - 457 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor modulation
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Concentration (Pharmacological Data)
<= 10 mmol/l
Method (Pharmacological Data)
rat wild-type and mutated α1, β2, γ2S GABAA receptor subunits coexpressed in oocytes; infected cells perfused with title comp.; receptor response measured with the two-electrode voltage-clamp method
Results
chloride-currents activated
Reference
Buhr; Baur; Malherbe; Sigel
Molecular Pharmacology, 1996 , vol. 49, # 6 p. 1080 - 1084 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
rat brain cortical membranes
Concentration (Pharmacological Data)
5 μmol/l
Method
200-250 g rats killed; cortices homogenized; membranes separated; incub. with <35S>t-butylbicyclophosphorothionate (TBPS) or <3H>flunitrazepam (Flu)
771 of 992
772 of 992
773 of 992
(Pharmacological Data)
or <3H>muscimol (MS); binding inhib. with 1E-9-1E-5 M Co 2-1970 or 3α-OH-5α-pregnan-20-one (3α,5α-P)
Further Details (Pharmacological Data)
incub. medium without/with title comp., effect on inhibition of radioligand binding by Co or 3α,5σ-P studied; radioligand binding determined by liquid scintillation
Results
without title comp. binding unaffected; with title comp. binding inhibited by Co, 3α,5α-P
Reference
Hawkinson; Drewe; Kimbrough; Chen; Hogenkamp; Lan; Gee; Shen; Whittemore; Woodward
Molecular Pharmacology, 1996 , vol. 49, # 5 p. 897 - 906 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
bovine homomeric β1 GABAA subunit
Concentration (Pharmacological Data)
0.1 - 1000 μmol/l
Method (Pharmacological Data)
Xenopus oocytes injected with bovine β1 cDNA; electrophysiological recording tech.; membrane conductance
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
29.34 μmol/l
Results
title comp. evoked a distinct conductance increase; inhibition of the effect by bicuculline (10 μM) and picrotoxin (10 μM); midazolam (50 μM) failed to enhance the title comp.-activ. response, but pentobarbitone (50 μM) induced a small enhancement
Reference
Krishek; Moss; Smart
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 494 - 504 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
murine homomeric β1 GABAA subunit
Concentration (Pharmacological Data)
500 μmol/l
Method (Pharmacological Data)
Xenopus oocytes injected with the murine β1 cRNA in the presence of actinomycin D (50 μg/ml); electrophysiological recording tech.; membrane conductance
Comment (Pharmacological Data)
No effect
Reference
Krishek; Moss; Smart
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 494 - 504 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
murine homomeric β1 GABAA subunit
Concentration (Pharmacological Data)
0.1 - 1000 μmol/l
Method (Pharmacological Data)
β1 mouse cDNA, injected in Xenopus oocytes and A293 cells; electrophysiological recording tech.; membrane conductance
No effect
Comment (Pharmacological Data)
774 of 992
775 of 992
776 of 992
Reference
Krishek; Moss; Smart
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 494 - 504 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
murine homomeric β1 GABAA subunit
Concentration (Pharmacological Data)
1 mmol/l
Method (Pharmacological Data)
expression of murine β1 subunits in Xenopus oocytes injected with the Lac Z gene encoding for β-galactosidase; electrophysiological recording tech.; membrane conductance
Comment (Pharmacological Data)
No effect
Reference
Krishek; Moss; Smart
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 494 - 504 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellar α1β3γ2L GABAR isoform
Concentration (Pharmacological Data)
1E-07 - 0.0003 mol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells cotransfected with γ-aminobutyric acidA receptor (GABAR) subunit cDNA expression vectors; whole-cell current recording
Further Details (Pharmacological Data)
normalized conc.-response curve for title comp. (EC50 = 13.6 μM, Hill slope = 1.5)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
16.4 μmol/l
Results
max. peak current = 803 pA; Hill slope = 1.2
Reference
Saxena, Nina C.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 567 - 579 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellar α6β3γ2L GABAR isoform
Concentration (Pharmacological Data)
1E-07 - 1E-05 mol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells cotransfected with γ-aminobutyric acidA receptor (GABAR) subunit cDNA expression vectors; whole-cell current recording
Further Details (Pharmacological
normalized conc.-response curve for title comp. (EC50 = 1.9 μM, Hill slope = 1.5)
Data)
777 of 992
778 of 992
779 of 992
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.2 μmol/l
Results
max. peak current = 730 pA; Hill slope = 1.9
Reference
Saxena, Nina C.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 567 - 579 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellar α6β3δ GABAR isoform
Concentration (Pharmacological Data)
1E-08 - 1E-05 mol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells cotransfected with γ-aminobutyric acidA receptor (GABAR) subunit cDNA expression vectors; whole-cell current recording
Further Details (Pharmacological Data)
normalized conc.-response curve for title comp. (EC50 = 0.27 μM, Hill slope = 1.2)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.36 μmol/l
Results
max. peak current = 371 pA; Hill slope = 1.3
Reference
Saxena, Nina C.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 567 - 579 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellar α1β2γ2L GABAR isoform
Concentration (Pharmacological Data)
1E-06 - 0.001 mol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells cotransfected with γ-aminobutyric acidA receptor (GABAR) subunit cDNA expression vectors; whole-cell current recording
Further Details (Pharmacological Data)
normalized conc.-response curve for title comp. (EC50 = 10 μM, Hill slope = 1.5)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
11.2 μmol/l
Results
max. peak current = 404 pA; Hill slope = 1.7
Reference
Saxena, Nina C.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 567 - 579 Title/Abstract Full Text View citing articles Show Details
Effect
receptor; binding activity
(Pharmacological Data)
780 of 992
781 of 992
Species or TestSystem (Pharmacological Data)
rat cerebellar α6β2γ2L GABAR isoform
Concentration (Pharmacological Data)
1E-07 - 0.0001 mol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells cotransfected with γ-aminobutyric acidA receptor (GABAR) subunit cDNA expression vectors; whole-cell current recording
Further Details (Pharmacological Data)
normalized conc.-response curve for title comp. (EC50 = 2.2 μM, Hill slope = 1.5)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.4 μmol/l
Results
max. peak current = 292 pA; Hill slope = 1.5
Reference
Saxena, Nina C.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 567 - 579 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellar α6β2δ GABAR isoform
Concentration (Pharmacological Data)
1E-08 - 0.0001 mol/l
Method (Pharmacological Data)
mouse fibroblast L929 cells cotransfected with γ-aminobutyric acidA receptor (GABAR) subunit cDNA expression vectors; whole-cell current recording
Further Details (Pharmacological Data)
normalized conc.-response curve for title comp. (EC50 = 0.19 μM, Hill slope = 1.2)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.18 μmol/l
Results
max. peak current = 130 pA; Hill slope = 1.2
Reference
Saxena, Nina C.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 49, # 3 p. 567 - 579 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
haematological
Species or TestSystem (Pharmacological Data)
Wistar rat
Sex
male
Concentration (Pharmacological Data)
0.2 mmol/l
Exposure Period (Pharmacological Data)
1 - 30 min
782 of 992
783 of 992
784 of 992
Method (Pharmacological Data)
rat erythrocytes (RBC) separated; uptake of methylmercury (MeHg) cysteine (0.025 mM) determined at 5 and 20 deg C; aq. solution; effect on the halftimes of MeHg-cysteine uptake measured
Further Details (Pharmacological Data)
rats of age 10-12 weeks used; maintained at 23 deg C, 50-60 percent RH and a 12-h light/dark cycle; blood taken from hearts; RBC suspended in Hank's buffer to a 2.5 percent haematcrit at pH 7.4; uptake values represent mean of 3 experiments
Results
inhibited MeHg-cysteine uptake at 5 deg C (lost effect at 20 deg C); half-time of MeHg-cysteine uptake (h): 0.97 and 0.25 at 5 and 20 deg C, resp. (control: 0.57 and 0.23, resp.)
Reference
Wu, Guang
Journal of Applied Toxicology, 1996 , vol. 16, # 2 p. 95 - 102 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
muscle relaxant
Species or TestSystem (Pharmacological Data)
Wistar rat
Sex
female
Method (Pharmacological Data)
uteri removed of i) non-pregnant, ii) pregnant (5-20 d), iii) ovariectomized rats; placed into Krebs-Hanseleit solution, with or without 40 mM KCl, 1-1000 μM title comp.; contraction of uterine rings recorded by isometric method
Further Details (Pharmacological Data)
uterine-relaxant effect on spontaneous and KCl-induced contraction
Comment (Pharmacological Data)
No effect
Reference
Perusquia, Mercedes; Villalon, Carlos M.
Life Sciences, 1996 , vol. 58, # 11 p. 913 - 926 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
inhibitor
Species or TestSystem (Pharmacological Data)
rat cerebral cortex synaptosomes
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
in vitro; synaptosomal preparation in artificial cerebro-spinal fluid; preincub. for 15 min at 25 deg C; incub. with <3H>-gabapentin (1 μmol/l) in the presence of title comp. for 4 min; filtration; liquid scintillation counting
Further Details (Pharmacological Data)
inhibitory effect of title comp. on the uptake of <3H>-gabapentin in brain synaptosomes
Results
effect of title comp. on the initial rate of uptake of <3H>-gabapentin (Fig. 4)
Reference
Thurlow, Richard J.; Hill, David R.; Woodruff
British Journal of Pharmacology, 1996 , vol. 118, # 3 p. 449 - 456 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Method (Pharmacological Data)
in vitro; oocytes voltage-clamped at -60 mV; two-electrode voltage-clamp mode; continuously superfused (7-10 ml/min) with frog Ringer soln.; title comp. applied by the superfusion system
Further Details (Pharmacological Data)
oocytes expressing human α3, β1 and γ2L GABAA receptor subunits
Type
EC50
(Pharmacological Data)
785 of 992
786 of 992
787 of 992
Value of Type (Pharmacological Data)
102 μmol/l
Results
title comp.-induced current was concentration-dependent (Fig. 1)
Reference
Belelli, Delia; Callachan, Helen; Hill-Venning, Claire; Peters, John A.; Lambert, Jeremy J.
British Journal of Pharmacology, 1996 , vol. 118, # 3 p. 563 - 576 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Method (Pharmacological Data)
in vitro; oocytes voltage-clamped at -60 mV; two-electrode voltage-clamp mode; continuously superfused (7-10 ml/min) with frog Ringer soln.; title comp. applied by the superfusion system
Further Details (Pharmacological Data)
oocytes expressing Drosophila melanogaster Rdl GABA receptor subunit
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
9.2 μmol/l
Results
title comp.-induced current was concentration-dependent (Fig. 1)
Reference
Belelli, Delia; Callachan, Helen; Hill-Venning, Claire; Peters, John A.; Lambert, Jeremy J.
British Journal of Pharmacology, 1996 , vol. 118, # 3 p. 563 - 576 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Method (Pharmacological Data)
in vitro; oocytes voltage-clamped at -60 mV; two-electrode voltage-clamp mode; continuously superfused (7-10 ml/min) with frog Ringer soln.; title comp. applied by the superfusion system
Further Details (Pharmacological Data)
oocytes expressing Drosophila melanogaster Rdl splice variant GABA receptor subunit
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
152 μmol/l
Results
title comp.-induced current was concentration-dependent (Fig. 1)
Reference
Belelli, Delia; Callachan, Helen; Hill-Venning, Claire; Peters, John A.; Lambert, Jeremy J.
British Journal of Pharmacology, 1996 , vol. 118, # 3 p. 563 - 576 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
hippocampal neurones from embryonic Sprague-Dawley rats
Concentration (Pharmacological Data)
3 μmol/l
788 of 992
789 of 992
790 of 992
Method (Pharmacological Data)
in cultured hippocampal neurones, in presence of 0.4 μM tetrodotoxin, 100 μM (R)-4-chloro-(2-hydroxy-3-morpholinopropyl)-5-phenyl-4-isoxazolin-3-one (CS-722) bath perfused for 3 min
Further Details (Pharmacological Data)
then ligand-gated currents evoked by application of title comp. by -60 mV holding potential
Results
CS-722 has no effect on the current resposes produced by title comp.
Reference
Marszalec, William; Song, Jin-Ho; Narahashi, Toshio
British Journal of Pharmacology, 1996 , vol. 119, # 1 p. 126 - 132 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
modulator
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat vas deferens
Concentration (Pharmacological Data)
0.1 - 100 μmol/l
Method (Pharmacological Data)
in vitro; organ bath; force-displacement transducer; incub. with title comp.; exogenous ATP (150 μmol/l) or noradrenaline (50 μmol/l)
Further Details (Pharmacological Data)
effect of title comp. on ATP- and noradrenaline-induced contractions of the rat isolated vas deferens
Comment (Pharmacological Data)
No effect
Reference
Kwan, Yiu Wa; Ngan, Man-Piu; Tsang, Kay-Yan; Lee, Ha-Man; Chu, Lai-Ah
British Journal of Pharmacology, 1996 , vol. 118, # 3 p. 755 - 761 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
modulator
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat vas deferens
Concentration (Pharmacological Data)
0.1 - 100 μmol/l
Method (Pharmacological Data)
in vitro; organ bath; force-displacement transducer; electrical field stimulation by Grass Stimulator S8800 (8Hz, 0.3-0.5 ms duration for 10 s); title comp. added cumulatively 30 s before stimulation
Further Details (Pharmacological Data)
effect of title comp. on electrical field stimulated contractions of the rat isolated vas deferens
Results
title comp. caused a concn.-dependent inhibition of the biphasic response
Reference
Kwan, Yiu Wa; Ngan, Man-Piu; Tsang, Kay-Yan; Lee, Ha-Man; Chu, Lai-Ah
British Journal of Pharmacology, 1996 , vol. 118, # 3 p. 755 - 761 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
calcium metabolism regulator
Species or TestSystem (Pharmacological Data)
Wistar rat cortical neurons
Concentration (Pharmacological Data)
1E-07 - 0.001 mol/l
Method (Pharmacological Data)
rat embryos, at embryonic day 18; primary cultured cortical neurons, loaded with fura-2/AM, perfused with BSS, 37 deg C; title comp. added pulse-like (for 30 s) to perfusion soln.; intracellular <Ca2+> (Cai) monitored by fluorescence
791 of 992
792 of 992
793 of 992
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
7 μmol/l
Results
evoked transient increase in Cai, single peak within 30 s; effect dose-dependent; co-application with 25 mM K+ led to non-additive increase in Cai response; had no effect in extracellular Ca-free medium; time-response, dose-response curves
Reference
Takebayashi; Kagaya; Hayashi; Motohashi; Yamawaki
European Journal of Pharmacology, 1996 , vol. 297, # 1-2 p. 137 - 143 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiological
Species or TestSystem (Pharmacological Data)
mouse L929 fibroblast cells
Method (Pharmacological Data)
cDNAs encoding α5 and γ2L subunit subtypes of γ-aminobutyric acid type A receptor (GABAR) transfected into cells together with either β1, β2, or β3 subunit subtype; whole-cell, patch clamp technique at rt
Further Details (Pharmacological Data)
one-way ANOVA; post-hoc Dunnett's test
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
6 - 26 μmol/l
Results
concentration dependent inward chloride current for all three α5βXγ2L isoforms; EC50 for β2 and β3 subtype-containing receptors (6 μM), for β1 subtypecontaining receptors (26 μM)
Reference
Burgard, Edward C.; Tietz, Elizabeth I.; Neelands, Torben R.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 119 - 127 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiological
Species or TestSystem (Pharmacological Data)
mouse L929 fibroblast
Concentration (Pharmacological Data)
0.1 - 300 μmol/l
Method (Pharmacological Data)
whole-cell currents in transiently transfected cells expressing wild-type recombinant α1β1γ2L GABAR (γ-aminobutyric acid type A receptor) in absence and presence of PKM (40 nM intracellularly); multipuffer drug-application system at 5-sec duration
Further Details (Pharmacological Data)
whole-cell patch-clamp technique; paired Student's t test; n=11
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
13.1 - 21.7 μmol/l
Results
currents conc. dependent; without PKM Imax 102 percent, EC50 13.1 μM; PKM treated cells Imax 174 percent, 21.7 μM
Reference
Lin, Yu-Fung; Angelotti, Timothy P.; Dudek, Ellen M.; Browning, Michael D.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 185 - 195 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiological
Species or TestSystem
mouse L929 fibroblast
(Pharmacological Data)
794 of 992
795 of 992
Concentration (Pharmacological Data)
0.1 - 300 μmol/l
Method (Pharmacological Data)
whole-cell currents in transiently transfected cells expressing wild-type recombinant α1β1γ2L GABAR (γ-aminobutyric acid type A receptor); currents obtained during control reimpalement recording
Further Details (Pharmacological Data)
whole-cell patch-clamp technique; paired Student's t test
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.3 μmol/l
Reference
Lin, Yu-Fung; Angelotti, Timothy P.; Dudek, Ellen M.; Browning, Michael D.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 185 - 195 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiological
Species or TestSystem (Pharmacological Data)
mouse L929 fibroblast
Concentration (Pharmacological Data)
0.1 - 300 μmol/l
Method (Pharmacological Data)
whole-cell currents in transiently transfected cells expressing α1β1(S409A)γ2L(S327A,S343A) GABAR (γ-aminobutyric acid type A receptor); currents obtained during control reimpalement recording
Further Details (Pharmacological Data)
whole-cell patch-clamp technique; paired Student's t test
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
14.7 μmol/l
Reference
Lin, Yu-Fung; Angelotti, Timothy P.; Dudek, Ellen M.; Browning, Michael D.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 185 - 195 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiological
Species or TestSystem (Pharmacological Data)
mouse L929 fibroblast
Concentration (Pharmacological Data)
0.1 - 300 μmol/l
Method (Pharmacological Data)
whole-cell currents in transiently transfected cells expressing α1β1(S409A)γ2L(S327A, S343A) GABAR (γ-aminobutyric acid type A receptor) in absence and presence of PKM (40 nM intracellularly); multipuffer drug-application system at 5-sec duration
Further Details (Pharmacological Data)
whole-cell patch-clamp technique; paired Student's t test; n=7
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
15.5 - 16.7 μmol/l
796 of 992
797 of 992
798 of 992
Results
currents conc. dependent; without PKM Imax 101 percent, EC50 16.7 μM; PKM treated cells Imax 103 percent, 15.5 μM
Reference
Lin, Yu-Fung; Angelotti, Timothy P.; Dudek, Ellen M.; Browning, Michael D.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 185 - 195 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiological
Species or TestSystem (Pharmacological Data)
mouse L929 fibroblast
Concentration (Pharmacological Data)
0.1 - 300 μmol/l
Method (Pharmacological Data)
whole-cell currents in transiently transfected cells expressing α1β1γ2L(S327A, S343A) GABAR (γ-aminobutyric acid type A receptor) in absence and presence of PKM (40 nM intracellularly); multipuffer drug-application system at 5-sec duration
Further Details (Pharmacological Data)
whole-cell patch-clamp technique; paired Student's t test; n=8
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
18.4 - 20.4 μmol/l
Results
currents conc. dependent; without PKM Imax 101 percent, EC50 20.4 μM; PKM treated cells Imax 135 percent, 18.4 μM
Reference
Lin, Yu-Fung; Angelotti, Timothy P.; Dudek, Ellen M.; Browning, Michael D.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 185 - 195 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiological
Species or TestSystem (Pharmacological Data)
mouse L929 fibroblast
Concentration (Pharmacological Data)
0.1 - 300 μmol/l
Method (Pharmacological Data)
whole-cell currents in transiently transfected cells expressing α1β1(S409A)γ2L GABAR (γ-aminobutyric acid type A receptor) in absence and presence of PKM (40 nM intracellularly); multipuffer drug-application system at 5-sec duration
Further Details (Pharmacological Data)
whole-cell patch-clamp technique; paired Student's t test; n=8
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
12.8 - 18.3 μmol/l
Results
currents conc. dependent; without PKM Imax 101 percent, EC50 18.3 μM; PKM treated cells Imax 118 percent, 12.8 μM
Reference
Lin, Yu-Fung; Angelotti, Timothy P.; Dudek, Ellen M.; Browning, Michael D.; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 1 p. 185 - 195 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
changes in cell proliferation
Species or TestSystem (Pharmacological Data)
rat cortical astrocytes
Concentration (Pharmacological
1 mmol/l
Data)
799 of 992
800 of 992
801 of 992
Method (Pharmacological Data)
cells incubated for 24 h with title compound and (3H)thymidine in presence or absence of 10 percent serum; proliferation assayed by incorporation of (3H)thymidine into cell DNA
Results
title compound not changed basal or serum-induced proliferation
Reference
Guizzetti, Marina; Costa, Paola; Peters, Janet; Costa, Lucio G.
European Journal of Pharmacology, 1996 , vol. 297, # 3 p. 265 - 273 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
α1β3γ2 GABAA receptors, cloned on HEK 293 cells
Method (Pharmacological Data)
membranes from cells transfected with α1β3γ2 subunits of GABAA receptors incubated in Tris-citrate buffer, 180 min, roomtemp., with 2 nM <35S>TBPS in pres. title comp.; non-specific binding in pres. IPTBO; scintillation counting
Further Details (Pharmacological Data)
potency for inhibition of <35S>TBPS binding; HEK: human embryonic kidney
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
0.5 μmol/l
Results
comparable: potency of inhibition of <35S>TBPS binding and of stimulation of <3H>flunitrazepam binding in α1β3γ2-receptors and in cerebellar membranes, inhibition of <35S>TBPS binding in α1β3-, β3γ2-, β3-receptors; diagram, numerical table
Reference
Zezula, Juergen; Slany, Astrid; Sieghart, Werner
European Journal of Pharmacology, 1996 , vol. 301, # 1-3 p. 207 - 214 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
rat uterus
Concentration (Pharmacological Data)
0.001 - 100 μmol/l
Kind of Dosing (Pharmacological Data)
in DMSO
Method (Pharmacological Data)
250-300 g female Sprague-Dawley rats ovariectomized; 6-7 d later sacrificed; uterine tubes (UT) removed; ca. 1 cm smooth muscle strips of UT susp. in organ bath (O2:CO2=95:5; 37 deg C); isometric tension (IT) measured by force-displacement transducer
Further Details (Pharmacological Data)
with precontraction using 40 mM KCl in bath; relaxation of stimulated IT by diazepam (D), clonazepam (C), 4'-chlorodiazepam (4'-ClD); title comp. effect on stimulated IT or on relaxation by D, C, 4'-ClD of stimulated IT studied
Comment (Pharmacological Data)
No effect
Reference
Yiu, Man-Kit; Kwan, Yiu Wa; Ngan, Man-Piu
European Journal of Pharmacology, 1996 , vol. 302, # 1-3 p. 99 - 108 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
ion transport
Species or TestSystem (Pharmacological Data)
mouse cortical neurons (MCN)
Concentration (Pharmacological
1 - 300 μmol/l
Data)
802 of 992
803 of 992
804 of 992
Method (Pharmacological Data)
MCN from 15-d-old fetuses incub. in Cl(-)-containing HEPES buffer (external: pH 7.4; pipette: pH 7.3) inward Cl-currents (ICl-) recorded in whole-cell configuration, voltage-clamp mode (-75 V)
Further Details (Pharmacological Data)
conc.-response parameters determined by non-linear least-squares fit; title comp. effect on ICl- studied
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
10.3 μmol/l
Results
conc.-dependent ICl-
Reference
Kume; Greenfield L.J.; Macdonald; Albin
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 3 p. 1784 - 1792 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
recomb. human α1β1γ2s receptors in Xenopus laevis oocytes
Concentration (Pharmacological Data)
0.1 - 10000 μmol/l
Method (Pharmacological Data)
from adult X. laevis stage V and VI oocytes isolated; nuclei were directly inj. with human GABAA subunit cDNAs; incub. for 24-72 h, oocytes perfused with Barth's medium with title comp.; 2M KCl, 1-3 MΩ; voltage-clamped between -40 and -70 mV
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
25 μmol/l
Results
conc.-response curve; Hill coeff. = 1.5 (diagram, table given)
Reference
Wafford; Thompson; Thomas; Sikela; Wilcox; Whiting
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 670 - 678 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
recomb. human α6β1γ2s receptors in Xenopus laevis oocytes
Concentration (Pharmacological Data)
0.1 - 10000 μmol/l
Method (Pharmacological Data)
from adult X. laevis stage V and VI oocytes isolated; nuclei were directly inj. with human GABAA subunit cDNAs; incub. for 24-72 h, oocytes perfused with Barth's medium with title comp.; 2M KCl, 1-3 MΩ; voltage-clamped between -40 and -70 mV
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
14 μmol/l
Results
conc.-response curve; Hill coeff. = 0.8 (diagram, table given)
Reference
Wafford; Thompson; Thomas; Sikela; Wilcox; Whiting
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 670 - 678 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological
receptor; binding activity
Data)
805 of 992
806 of 992
Species or TestSystem (Pharmacological Data)
recomb. human α4β1γ2s receptors in Xenopus laevis oocytes
Concentration (Pharmacological Data)
1 - 10000 μmol/l
Method (Pharmacological Data)
from adult X. laevis stage V and VI oocytes isolated; nuclei were directly inj. with human GABAA subunit cDNAs; incub. for 24-72 h, oocytes perfused with Barth's medium with title comp.; 2M KCl, 1-3 MΩ; voltage-clamped between -40 and -70 mV
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
33 μmol/l
Results
conc.-response curve; Hill coeff. = 1.3 (diagram, table given)
Reference
Wafford; Thompson; Thomas; Sikela; Wilcox; Whiting
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 670 - 678 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
regulation of GABA uptake
Species or TestSystem (Pharmacological Data)
Wistar rats
Concentration (Pharmacological Data)
1 - 33 μmol/l
Exposure Period (Pharmacological Data)
2 h
Method (Pharmacological Data)
animals killed; antral mucosa incubated at 37 deg C; 1.67 μCi/ml of <2,3-(3)H>GABA added; samples centrifuged; liquid scintillation counting of supernatant; specific uptake of labelled title compd. determined
Results
graded concentrations of title compd. inhibited specific uptake of labelled GABA by rat antral mucosa
Reference
Varro; Athanassopolous; Dockray
Experimental Physiology, 1996 , vol. 81, # 1 p. 151 - 154 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
analgesic, other
Species or TestSystem (Pharmacological Data)
Wistar rat
Sex
male
Route of Application
intrathecal
Concentration (Pharmacological Data)
0.58 - 14.55 μmol
Kind of Dosing (Pharmacological Data)
effect confined to spinal cord by administering title comp. in 6 percent dextrose soln., which has higher density than cerebrospinal fluid
Method (Pharmacological Data)
rats 160-200 g with lumbar subarachnoid catheters (adjacent to lower lumbar and sacral segments); analgesic effect by electrical current threshold (ECT) test at neck and at tail, min. current causing vocalization, and by tail flick latency (TFL) test
Further Details (Pharmacological Data)
ECT: stimulated by constant current pulses, electrodes at base of the neck, 1 cm apart, and at base of the tail, electrodes 4 cm apart, result expressed as times of control (predrug) value; TFL: result as percent MPE (maximum possible effect)
Results
increased simultaneously, dose-dependently TFL and ECT (at tail, but not at neck) (analgesic effect spinally mediated); dose-effect, time-effect diagrams, numerical tables
Reference
Nadeson; Guo; Porter; Gent; Goodchild
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 278, # 2 p. 620 - 626 Title/Abstract Full Text View citing articles Show Details
807 of 992
808 of 992
809 of 992
Effect (Pharmacological Data)
increase of inward potassium current
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Sex
female
Concentration (Pharmacological Data)
1 μmol/l
Method (Pharmacological Data)
oocytes isolated and injected with 50 nl RNAs encoding OFQ receptor and potassium channel subunit Kir3.1 and Kir 3.4; incubation (18 deg C, 2-7d); title comp. treatment; electrophysiological recordings with two glass microelectrodes
Further Details (Pharmacological Data)
OFQ = orphanin FQ; RNA = ribonucleic acid
Comment (Pharmacological Data)
No effect
Reference
Matthes, Hans; Seward, Elizabeth P.; Kieffer, Brigitte; North, R. Alan
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 447 - 450 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
increase of γ-aminobutyric acid type A receptor current
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat hippocampal dentate granule cell
Sex
male and female
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Method (Pharmacological Data)
cells isolated from 28-35-day-old rats; 6 neurons investigated; title comp. application (modified U-tube rapid-application technique); whole-cell voltageclamp technique at 24 deg C
Further Details (Pharmacological Data)
concentration-response curve analysis
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
46 μmol/l
Results
title comp. dose-dependently increased γ-aminobutyric acid type A receptor current, maximal current 842 pA (diagrams given)
Reference
Kapur, Jaideep; Macdonald, Robert L.
Molecular Pharmacology, 1996 , vol. 50, # 3 p. 458 - 466 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
Xenopus laevis frog oocytes expressing ρ1 receptors
Concentration (Pharmacological Data)
400 nmol/l
Method (Pharmacological Data)
anesthetized; a piece of ovary removed; stage V, VI oocytes isolated; ρ1 receptor subunit cDNA in pcDNA1 vector injected into oocytes; ρ1 receptors expressed 2-3 d after injection; currents recorded in presence/absence of alcohols and anesthetics
810 of 992
811 of 992
812 of 992
Further Details (Pharmacological Data)
PB=pentobarbital; C2 = ethanol; C4 = butanol; C6 = hexanol; C7 = heptanol; C8 = octanol; C9 = nonanol
Results
title comp.-induced current dose dependently inhibited C2, C4, C6, C7, C8, C9; potencies increased with chain length of carbon backbone; enflurane, halothane, isoflurane inhibited, PB, alphaxalone, propofol had no effect on title comp. produced currents
Reference
Mihic; Harris
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 1 p. 411 - 416 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus laevis frog oocytes expressing ρ1 receptors
Method (Pharmacological Data)
anesthetized; a piece of ovary removed; stage V, VI oocytes isolated; ρ1 receptor subunit cDNA in pcDNA1 vector injected into oocytes; ρ1 receptors expressed 2-3 d after injection; dose-response curves constructed in absence/presence of C2 and C4
Further Details (Pharmacological Data)
C2 = ethanol; C4 = butanol
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.1 - 1.9 μmol/l
Results
there was significant difference between concentration-response curves in presence or absence of alcohols: EC50 in absence of ethanol (100 mM) was 1.9 μM in presence 2.3 μM; in absence of butanol (50 mM) EC50 was 1.1 μM in presence 2.8 μM
Reference
Mihic; Harris
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 1 p. 411 - 416 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
potency in gating Cl- current
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat cerebellar granule cells
Concentration (Pharmacological Data)
0.03 - 300 μmol/l
Method (Pharmacological Data)
cells prepared from 8-d-old pups; treated daily by flumazenil (10 μM) adding to the growth medium from 3 to 6 d after plating; currents recorded with whole-cell patch-clamp technique at a holding potential of -50 mV; concentration-response curves
Further Details (Pharmacological Data)
EC50 = concentration eliciting half of the maximal response
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.15 - 8.3 μmol/l
Results
flumazenil exposure caused significant shift to right in the dose-response curve: EC50 1.2 μM and 8.3 μM in vehicle- and flumazenil-treated cultures, resp.; shorter exposure to flumazenil failed to modify potency in gating Cl- currents: EC50 1.1 μM
Reference
Zheng; Caruncho; Wei Jian Zhu; Vicini; Ikonomovic; Grayson; Costa
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 277, # 1 p. 525 - 533 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
GABAA receptor subunit α1β2γ2L in HEK 293 cells
813 of 992
814 of 992
815 of 992
Method (Pharmacological Data)
cDNAs (rat α1, rat β2, rat γ2L) introduced into human embryonic kidney 293 cells by electroporation; title comp. elicited responses recorded by standard whole-cell method 24-72 h after transfection at 21-23 deg C; isolated single cell measurement
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
13 μmol/l
Results
Hill coefficient 1.3
Reference
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
GABAA receptor subunit α1Fβ2γ2L in HEK 293 cells
Concentration (Pharmacological Data)
0.1 - 1000 μmol/l
Method (Pharmacological Data)
cDNAs (rat α1 with a FLAG epitope, rat β2, rat γ2L) introduced into human embryonic kidney 293 cells by electroporation; title comp. elicited responses recorded by standard whole-cell method 24-72 h after transfection at 21-23 deg C
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
7 - 16 μmol/l
Results
concentration-response curve; loreclezole (1-10 μM) strongly potentiated title comp. effect
Reference
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
GABAA receptor β1 subunit expressed in HEK 293 cells
Method (Pharmacological Data)
human β1 cDNA introduced into human embryonic kidney 293 cells by electroporation; title comp. elicited responses recorded by standard whole-cell method 24-72 h after transfection at 21-23 deg C; isolated single cell measurement
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
Ca. 10 μmol/l
Results
10 μM bicuculline reduced the responses to title comp. to 10 percent of control; 10 μM picrotoxin effectively blocked the responses
Reference
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
GABAA receptor subunit α1Fβ2(Y205S)γ2L in HEK 293 cells
Concentration (Pharmacological
0.1 - 1000 μmol/l
Data)
816 of 992
817 of 992
818 of 992
Method (Pharmacological Data)
cDNAs (rat α1 with a FLAG epitope, rat β2 (Y205S), rat γ2L) introduced into human embryonic kidney 293 cells by electroporation; title comp. elicited responses recorded by standard whole-cell method 24-72 h after transfection at 21-23 deg C
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
67 μmol/l
Results
concentration-response curve; Hill coefficient 1.1
Reference
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
GABAA receptor subunit α1Fγ2L expressed in HEK 293 cells
Concentration (Pharmacological Data)
0.1 - 1000 μmol/l
Method (Pharmacological Data)
cDNAs (rat α1 with a FLAG epitope, rat γ2L) introduced into human embryonic kidney 293 cells by electroporation; title comp. elicited responses recorded by standard whole-cell method 24-72 h after transfection at 21-23 deg C
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
37 μmol/l
Results
Hill coefficient 1.3; concentration-response curve; loreclezole (1-10 μM) strongly potentiated title comp. effect
Reference
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
GABAA receptor subunit α1Fβ3γ2L in HEK 293 cells
Concentration (Pharmacological Data)
0.1 - 1000 μmol/l
Method (Pharmacological Data)
cDNAs (rat α1 with a FLAG epitope, human β3, rat γ2L) introduced into human embryonic kidney 293 cells by electroporation; title comp. elicited responses recorded by standard whole-cell method 24-72 h after transfection at 21-23 deg C
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
9 μmol/l
Results
Hill coefficient 1.3; concentration-response curve
Reference
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or Test-
GABAA receptor subunit α1Fβ2γ2L expressed in QT6 cells
System (Pharmacological Data)
819 of 992
820 of 992
Show next 20
821 of 992
Concentration (Pharmacological Data)
0.1 - 1000 μmol/l
Method (Pharmacological Data)
cDNAs (rat α1 with a FLAG epitope, rat β2, rat γ2L) introduced in quail fibroblasts by electroporation; title comp. elicited responses recorded by standard whole-cell method 24-72 h after transfection at 21-23 deg C; isolated single cell measurements
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
8 μmol/l
Results
concentration-response curve; Hill coefficient 1.7
Reference
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
GABAA receptor subunit α1Fβ2(Y205S)γ2L in QT6 cells
Concentration (Pharmacological Data)
100 - 1000 μmol/l
Method (Pharmacological Data)
cDNAs (rat α1 with a FLAG epitope, rat β2(Y205S), rat γ2L) introduced into quail fibroblasts by electroporation; title comp. elicited responses recorded by standard whole-cell method 24-72 h after transfection at 21-23 deg C
Comment (Pharmacological Data)
No effect
Reference
Ueno, Shinya; Zorumski, Chuck; Bracamontes, John; Steinbach, Joe Henry
Molecular Pharmacology, 1996 , vol. 50, # 4 p. 931 - 938 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
expression of α1 subunit protein of GABAA receptor
Species or TestSystem (Pharmacological Data)
primary cerebellar granule cells from Sprague-Dawley rats
Concentration (Pharmacological Data)
5 - 1000 μmol/l
Method (Pharmacological Data)
in vitro; cells isolated from post-natal day 8 Sprague-Dawley rats, culture density 6-7E6 cells per 25 cm2, culture treated with the title comp. at day 8 in vitro (8 DIV), enhanced chemiluminescence (ECL) used to detect GABAA receptor subunit proteins
Further Details (Pharmacological Data)
Western blotting; optical density readings
Results
dose-dependent decrease in the expression of the GABAA receptor α1 subunit protein, at 5 μM 10+/-11 percent decrease, at 10 μM 31+/-13 percent decrease, at 1 mM 66+/-14 percent decrease
Reference
Brown, Maria J.; Bristow, David R.
British Journal of Pharmacology, 1996 , vol. 118, # 5 p. 1103 - 1110 Title/Abstract Full Text View citing articles Show Details
Hide facts Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological
dorsal horn of spinal cord from Wistar rats
Data)
822 of 992
823 of 992
Sex
male
Concentration (Pharmacological Data)
10 - 300 μmol/l
Method (Pharmacological Data)
slice continously superfused at 1 ml/min with oxygenated Krebs-bicarbonate solution, 1 h, electrical stimulation (20 V, 0.5 ms, 1 Hz, 3 min), the tittle compound added to the superfusing medium 1 min before and during the second electrical stimulation
Further Details (Pharmacological Data)
concentration of amino acid determined by h.p.l.c. with fluorescence detection, S1 the first stimulated response, S2 the second one
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
78.38 μmol/l
Results
GABA concentration-dependently decreased the electrically-evoked release of Glu, at 300 μM the S2/S1 ratio for Glu was 0.25+/-0.08 percent
Reference
Teoh, Hwee; Malcangio, Marzia; Bowery, Norman G.
British Journal of Pharmacology, 1996 , vol. 118, # 5 p. 1153 - 1160 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Sprague-Dawley CD rat
Sex
male
Concentration (Pharmacological Data)
0.3 μmol/l
Method (Pharmacological Data)
300 - 400 μg of protein of washed (GABA present) cerebral cortical membrane preparations; incubated with title comp., loreclezole (1E-7 - 1E-4 μmol/l) and <35S>TBPS (2 nmol/l) for 90 min; separated by filtration; membrane radioactivity determined
Further Details (Pharmacological Data)
nonspecific binding determined in the presence of 100 μmol/l of picrotoxin; <35S>TBPS: <35S>butylbicyclophosphorothionate
Results
title comp. reversed enhancing of specific <35S>TBPS binding caused by low concentrations of loreclezole and enhanced increasing of specific binding caused by higher concentrations of loreclezole (diagram)
Reference
Ghiani, Cristina A.; Tuligi, Graziella; Maciocco, Elisabetta; Serra, Mariangela; Sanna, Enrico; Biggio, Giovanni
Biochemical Pharmacology, 1996 , vol. 51, # 11 p. 1527 - 1534 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Sprague-Dawley CD rat
Sex
male
Concentration (Pharmacological Data)
0.3 μmol/l
Method (Pharmacological Data)
300 - 400 μg of protein of washed (GABA present) cerebral cortical membrane preparations; incubated with title comp., diazepam (1E-7 - 1E-4 μmol/l) and <35S>TBPS (2 nmol/l) for 90 min; separated by filtration; membrane radioactivity determined
Further Details (Pharmacological Data)
nonspecific binding determined in the presence of 100 μmol/l of picrotoxin; <35S>TBPS: <35S>butylbicyclophosphorothionate
Results
title comp. did not affect increase in <35S>TBPS binding induced by diazepam (diagram)
Reference
Ghiani, Cristina A.; Tuligi, Graziella; Maciocco, Elisabetta; Serra, Mariangela; Sanna, Enrico; Biggio, Giovanni
Biochemical Pharmacology, 1996 , vol. 51, # 11 p. 1527 - 1534 Title/Abstract Full Text View citing articles Show Details
824 of 992
825 of 992
826 of 992
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
rat hippocampal neurons
Concentration (Pharmacological Data)
1 - 200 μmol/l
Method (Pharmacological Data)
neurons from 1-4 d old postnatal rat pups; cultured in Dulbecco modified minimum Eagle's media; inward chloride current measured by whole cell patch clamp technique at -60 V and at room temp.
Type (Pharmacological Data)
ED50
Value of Type (Pharmacological Data)
14.7 μmol/l
Results
dose-dependently increased chloride current; Hill coefficient = 1.2
Reference
Uchida, Ichiro; Cestari, Ismar N.; Yang, Jay
European Journal of Pharmacology, 1996 , vol. 307, # 1 p. 89 - 96 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat brain
Sex
male
Concentration (Pharmacological Data)
1E-08 - 0.1 mol/l
Kind of Dosing (Pharmacological Data)
dissolved in DMSO
Method (Pharmacological Data)
in fresh rat brain cortical membranes <3H>SR 95531 binding was examined; incubated with 5 nmol/l labeled comp. and 5μl DMSO; nonspecific binding was defined using 100 μmol/l title comp.; radioactivity was determ. by liquid scintillatin spectrometry
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
1.9 - 58 μmol/l
Results
title comp. displaced <3H>SR95531 binding with high affinity (IC50 1.9 μmol/l, 60 percent) and low affinity (IC50 58 μmol/l, 31 percent) components (diagram)
Reference
Hawkinson, Jon E.; Acosta-Burruel, Manuel; Kimbrough, Catherine L.; Goodnough, Dayan B.; Wood, Paul L.
European Journal of Pharmacology, 1996 , vol. 304, # 1-3 p. 141 - 146 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat brain membrane
Concentration (Pharmacological Data)
10 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. dissolved in DMSO or water
Method (Pharmacological
competition binding study of title comp. to inhibit specific binding of 4 nmol/l <3H>MDL 105,519 to membrane protein in 0.25 ml assay buffer; samples were filtered and the radioactivity determined after overnight drying of the filter
Data)
827 of 992
828 of 992
829 of 992
Further Details (Pharmacological Data)
title comp. has no affinity for the glycine recognition site of NMDA receptor
Results
title comp. did not inhibit the binding of <3H>MDL 105,519 to the glycine recognition site of NMDA receptor
Reference
Baron, Bruce M.; Siegel, Barry W.; Harrison, Boyd L.; Gross, Raymond S.; Hawes, Calvin; Towers, Pat
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 1 p. 62 - 68 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
pharmacokinetics
Species or TestSystem (Pharmacological Data)
Wistar rat kidney
Sex
male
Concentration (Pharmacological Data)
0.05 - 500 μmol/l
Method (Pharmacological Data)
kidney was perfused with Ringer-Krebs solution pH 7.4 with dextran 2 percent, bubbled with O2-CO2 (19:1 v/v), 37 deg C; consective 5 min clearance period studied with adding increasing conc. of title comp.
Further Details (Pharmacological Data)
fractional excretion of glucose, water and sodium; perfusion pressure
Results
title comp. increased fractional excretion of water, sodium and glucose in conc.-related manner (figure); induced an increment in perfusion pressure
Reference
Monasterolo, Liliana A.; Trumper, Laura; Elias, M. Monica
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 2 p. 602 - 607 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat cortical synaptoneurosomes
Sex
male
Concentration (Pharmacological Data)
0.025 - 5 μmol/l
Method (Pharmacological Data)
rats (4-5 wk); purified cerebrocortical membranes were incubated with 5 nmol/l <35S>-TBPS in the presence of 50 μmol/l stanozolol and title comp. at 22 deg C for 90 min
Further Details (Pharmacological Data)
radioactivity quantitation using liquid scintillation spectrometry
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
1.50 μmol/l
Results
stanozolol exhibited biphasic effect on <35S>-TBPS binding to cortical synaptoneurosomes as a function of title comp. concentration (diagram)
Reference
Masonis, A. E. Tory; McCarthy, Michael P.
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 1 p. 186 - 193 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat cortical synaptoneurosomes
Sex
male
830 of 992
831 of 992
Concentration (Pharmacological Data)
0.025 - 5 μmol/l
Method (Pharmacological Data)
rats (4-5 wk); purified cerebrocortical membranes were incubated with 5 nmol/l <35S>-TBPS in the presence of title comp. at 22 deg C for 90 min
Further Details (Pharmacological Data)
radioactivity quantitation using liquid scintillation spectrometry
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
2.49 μmol/l
Results
title comp. inhibited <35S>-TBPS binding to cortical synaptoneurosomes (diagram)
Reference
Masonis, A. E. Tory; McCarthy, Michael P.
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 1 p. 186 - 193 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat cortical synaptoneurosomes
Sex
male
Concentration (Pharmacological Data)
0.025 - 5 μmol/l
Method (Pharmacological Data)
rats (4-5 wk); purified cerebrocortical membranes were incubated with 5 nmol/l <35S>-TBPS in the presence of 50 μmol/l flunitrazepam and title comp. at 22 deg C for 90 min
Further Details (Pharmacological Data)
radioactivity quantitation using liquid scintillation spectrometry
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
0.95 μmol/l
Results
flunitrazepam inhibited <35S>-TBPS binding to cortical synaptoneurosomes at every concentration of title comp. (diagram)
Reference
Masonis, A. E. Tory; McCarthy, Michael P.
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 1 p. 186 - 193 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat cortical synaptoneurosomes
Sex
male
Concentration (Pharmacological Data)
0.1 - 1000 μmol/l
Method (Pharmacological Data)
rats 4-5 wk; cerebral cortices were homogenized in HEPES/Tris buffer, pH 7; incubated with title comp. in the presence or absence of 50 μmol/l stanozolol and/or 10 μmol/l Fln at 30 deg C in influx buffer containing 0.3 μCi <36Cl->
Further Details (Pharmacological Data)
radioactivity quantitation using liquid scintillation spectrometry; Fln: flunitrazepam
Type (Pharmacological
EC50
Data)
832 of 992
833 of 992
834 of 992
835 of 992
836 of 992
837 of 992
Value of Type (Pharmacological Data)
38.7 μmol/l
Results
title comp. stimulated <36Cl->-influx into cortical synaptoneurosomes; Emax=28.5 nmol/mg; modulation of this effect by stanozolol and Fln was investigated
Reference
Masonis, A. E. Tory; McCarthy, Michael P.
Journal of Pharmacology and Experimental Therapeutics, 1996 , vol. 279, # 1 p. 186 - 193 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
ddY mouse cerebral cortex
Sex
male
Concentration (Pharmacological Data)
1 - 200 nmol/l
Method (Pharmacological Data)
<3H>title comp. binding studied in morphine-dependent and withdrawed animals; membrane vesicles incubated with <3H>title comp. at 2 deg C for 30 min, then radioactivity measured by liquid scintillation counting
Further Details (Pharmacological Data)
morphine dependence: increasing doses (8-45 mg/kg, s.c.) for 5 days; withdrawal: naloxone, 1 mg/kg; Kd: dissociation constant
Results
Kd at high affinity/low affinity sites in control, morphine-dependent and withdrawed mice: 13.0/144.4, 11.0/163.3 and 14.4/113.0, respectively
Reference
Ichida, Tatsuya; Kuriyama, Kinya
Life Sciences, 1996 , vol. 59, # 25-26 p. 2173 - 2179 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
binding to GABA-B receptor, IC50=8E-8 M for displacing of tritiated baclofen bound to cat cerebellar membranes
Reference
Hall, Roger G.; Kane, Peter D.; Bittiger, Helmut; Froestl, Wolfgang
Journal of Labelled Compounds and Radiopharmaceuticals, 1995 , vol. 36, # 2 p. 129 - 136 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
IC50 = 17 nM for inhibition of binding of <3H>CGP27492 to GABAB receptors of rat cortex
Reference
Froestl; Mickel; Hall; Von Sprecher; Strub; Baumann; Brugger; Gentsch; Jaekel; Olpe; Rihs; Vassout; Waldmeier; Bittiger
Journal of Medicinal Chemistry, 1995 , vol. 38, # 17 p. 3297 - 3312 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
IC50 = 0.025 μM for inhibition of binding of <3H>bacoflen to GABAB receptors of cat cerebellum, and IC50 = 0.128 μM for inhibition of binding of <3H>muscimol to GABAA receptors of rat cortex
Reference
Froestl; Mickel; Hall; Von Sprecher; Strub; Baumann; Brugger; Gentsch; Jaekel; Olpe; Rihs; Vassout; Waldmeier; Bittiger
Journal of Medicinal Chemistry, 1995 , vol. 38, # 17 p. 3297 - 3312 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
in vitro affinities for GABAA (IC50 = 0.018 μM) and GABAB (IC50 = 0.030 μM) receptor sites and GABA uptake sites (IC50 =2.0 μM) in rat brain membrane preparations with <3H>GABA as the radioligand
Reference
Froelund, Bente; Kristiansen, Uffe; Brehm, Lotte; Hansen, Annette B.; Krogsgaard-Larsen, Povl; Falch, Erik
Journal of Medicinal Chemistry, 1995 , vol. 38, # 17 p. 3287 - 3296 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Endpoint of Effect (Pharmacological Data)
stimulation of GABAA-subunits
Species or TestSystem (Pharmacological
Xenopus oocytes
Data)
838 of 992
839 of 992
Concentration (Pharmacological Data)
5 - 10000 nmol/l
Method (Pharmacological Data)
in vitro; the oocytes from adult Xenopus laevis frogs; human β1 cDNA or mixtures of α1β1 or α1β1γ2S cDNAs were injected into the oocytes nuclei, electrophysiological recording; add. of propofol, pentobarbital, alphaxalone or bicuculline
Further Details (Pharmacological Data)
Cl(1-) currents induced by GABA; two-electrode voltage-clamp recording
Type (Pharmacological Data)
ED50
Value of Type (Pharmacological Data)
123 μmol/l
Results
small currents in β1 not affected by bicuculine; big currents in the other subunits; effects potentiated by propofol, pentobarbital and alphaxalone
Reference
Sanna, Enrico; Garau, Franca; Harris, R. Adron
Molecular Pharmacology, 1995 , vol. 47, # 2 p. 213 - 217 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus oocytes
Concentration (Pharmacological Data)
1 - 10 μmol/l
Method (Pharmacological Data)
in vitro; Xenopus laevis oocytes expressing α6β2γ2 GABA receptors; electrophysiological measurements, membrane potential - 70 mV
Further Details (Pharmacological Data)
calculated from the peak currents
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
Ca. 2.3 μmol/l
Results
determination of GABA sensitivity
Reference
Korpi, Esa R.; Kuner, Thomas; Seeburg, Peter H.; Lueddens, Hartmut
Molecular Pharmacology, 1995 , vol. 47, # 2 p. 283 - 289 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Xenopus oocytes
Method (Pharmacological Data)
in vitro; Xenopus laevis oocytes expressing α1β2γ2 GABA receptors; electrophysiological measurements, membrane potential - 70 mV
Further Details (Pharmacological Data)
calculated from the peak currents
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
Ca. 19.9 μmol/l
840 of 992
841 of 992
842 of 992
Results
determination of GABA sensitivity
Reference
Korpi, Esa R.; Kuner, Thomas; Seeburg, Peter H.; Lueddens, Hartmut
Molecular Pharmacology, 1995 , vol. 47, # 2 p. 283 - 289 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
baculovirus Sf21 cells
Concentration (Pharmacological Data)
50 - 500 μmol/l
Method (Pharmacological Data)
in vitro; cells coinfected with Drosophilla Rdl plus Drosophila β subunits of GABA receptors; electrophysiological recording; add. of picrotoxin (PTX, 500 μM) or bicuculline (BIC, 100 μM)
Further Details (Pharmacological Data)
Cl(1-) currents, patch electrode voltage-clamp recording
Results
coinfection produces 2 separate receptor populations: Rdl homomultimers (PTX sensitive, BIC insensitive), Rdl plus β heteromultimers (PTX insensitive, BIC sensitive)
Reference
Zhang, Hai-Guang; Lee, Hwa-Jung; Rocheleau, Thomas; Ffrench-Constant, Richard H.; Jackson, Meyer B.
Molecular Pharmacology, 1995 , vol. 48, # 5 p. 835 - 840 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat synaptosomal membrane
Sex
male
Concentration (Pharmacological Data)
0.5 μmol/l
Method (Pharmacological Data)
in vitro; membranes prepared from forebrains of Wistar rats; incubated with title comp. for 2 h with title comp.; add. of pentylenetetrazol, (+) or (-)-2oxabicyclo<3.3.0>octane-3-one (SBL) or (+) - (-)-2-oxabicyclo<3.3.0>oct-6-en-3-one (UBT)
Further Details (Pharmacological Data)
determination of displacing potencies
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
Ca. 0.66 - 13.6 mmol/l
Results
IC50 values: 0.66 =/- 0.04 (for pentylenetetrazol), 11.1 +/- 1.6 (for (+)-UBL), 13.6 +/- 1.1 (for (-)-UBL), 2.9 +/- 0.3 (for (+)-SBL) and 2.1 +/- 0.4 (for (-)SBL)
Reference
Maksay, Gabor; Molnar, Peter; Gruber, Lajos
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 288, # 1 p. 61 - 68 Title/Abstract Full Text Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat retinal bipolar cell
Sex
not specified
Concentration (Pharmacological Data)
0.01 - 100 μmol/l
Method
in vitro; cells from 6-d-old Wistar rats; electrophysiological recording γ-aminobutyric acid (GABA)-induced membrane currents; add. of bicuculline (BIC,100
843 of 992
844 of 992
(Pharmacological Data)
μM);single channel conductance; add. of flunitrazepam (FLU, 1 μM) or pentobarbital (PB,50 μM)
Further Details (Pharmacological Data)
determination of I/Ic ( GABA-induced peak current in the presence of the drug/ control GABA-induced peak current); I/Imax (Imax: maximal current)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.2 μmol/l
Results
EC50 value for GABAC receptor; main-state conductance 7.9 pS
Reference
Feigenspan, Andreas; Bormann, Joachim
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 288, # 1 p. 97 - 104 Title/Abstract Full Text Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat retinal bipolar cell
Sex
not specified
Concentration (Pharmacological Data)
0.01 - 100 μmol/l
Method (Pharmacological Data)
in vitro; cells from 6-d-old Wistar rats; electrophysiological recording γ-aminobutyric acid (GABA)-induced membrane currents; add. of bicuculline (BIC,100 μM);single channel conductance; add. of flunitrazepam (FLU, 1 μM) or pentobarbital (PB,50 μM)
Further Details (Pharmacological Data)
determination of I/Ic ( GABA-induced peak current in the presence of the drug/ control GABA-induced peak current); I/Imax (Imax: maximal current)
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
27 μmol/l
Results
EC50 value for GABAA receptor; main-state conductance 29.6 pS
Reference
Feigenspan, Andreas; Bormann, Joachim
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 288, # 1 p. 97 - 104 Title/Abstract Full Text Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
neonatal rat cortical neuron
Method (Pharmacological Data)
neurons prepared from 1-day-old pups, slices of cerebral tissue trypsinized and dissociated; whole-cell currents measured using -20 mV holding voltage; patch-clamp technique
Further Details (Pharmacological Data)
ED 50 measured in presence of flumazenil
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.34 - 1.76 μM
Results
potentiated whole-cell current; combined with carbamazepine cell current increased depending on GABA concentration
Reference
Granger, Patrick; Biton, Bruno; Faure, Cecile; Vige, Xavier; Depoortere, Henri; Graham, David; Langer, Salomon Z.; Scatton, Bernard; Avenet, Patrick
Molecular Pharmacology, 1995 , vol. 47, # 6 p. 1189 - 1196
Title/Abstract Full Text View citing articles Show Details
845 of 992
846 of 992
847 of 992
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
neonatal rat cortical neuron
Method (Pharmacological Data)
neurons prepared from 1-day-old pups, slices of cerebral tissue trypsinized and dissociated; whole-cell currents measured using -20 mV holding voltage; patch-clamp technique
Further Details (Pharmacological Data)
ED 50 measured in presence of flumazenil
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.52 - 1.85 μM
Results
potentiated whole-cell current; combined with phenytoin cell current increased depending on GABA concentration
Reference
Granger, Patrick; Biton, Bruno; Faure, Cecile; Vige, Xavier; Depoortere, Henri; Graham, David; Langer, Salomon Z.; Scatton, Bernard; Avenet, Patrick
Molecular Pharmacology, 1995 , vol. 47, # 6 p. 1189 - 1196 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat hippocampal neuronal cultures
Concentration (Pharmacological Data)
3 - 30 μM
Method (Pharmacological Data)
cultures prepared from rats on postnatal day 1
Further Details (Pharmacological Data)
electrophysiology at 22 deg C, patch-clamp technique
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
9 μM
Results
coapplication with α,α-diisopropyl-γ-butyrolactone, α-ethyl-α-isopropyl-γ-butyrolactone increased GABA responses; β-ethyl-β-methyl-γ-thiobutyrolactone dose-dependently inhibited (10 μM - 2 mM) or increased (above 2 mM)
Reference
Holland, Katherine D.; Mathews, Gregory C.; Bolos-Sy, Annabel M.; Tucker, Joseph B.; Reddy, P. Amruta; Covey, Douglas F.; Ferrendelli, James A.; Rothman, Steven M.
Molecular Pharmacology, 1995 , vol. 47, # 6 p. 1217 - 1223 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
human embrionic kidney (HEK) 293 cells
Concentration (Pharmacological Data)
3 - 30 μM
Method (Pharmacological Data)
cells transiently transfected with rat α1β2γ2 GABA receptor subunits
848 of 992
849 of 992
850 of 992
Further Details (Pharmacological Data)
electrophysiology at 22 deg C, patch-clamp technique
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
14 μM
Results
coapplication with α,α-diisopropyl-γ-butyrolactone, α-ethyl-α-isopropyl-γ-butyrolactone increased GABA responses
Reference
Holland, Katherine D.; Mathews, Gregory C.; Bolos-Sy, Annabel M.; Tucker, Joseph B.; Reddy, P. Amruta; Covey, Douglas F.; Ferrendelli, James A.; Rothman, Steven M.
Molecular Pharmacology, 1995 , vol. 47, # 6 p. 1217 - 1223 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
human GABAA receptor α1β2γ2 expressed in Xenopus oocyte
Concentration (Pharmacological Data)
1 - 3000 μmol/l
Method (Pharmacological Data)
Xenopus oocytes from anesthetized frogs; oocyte nuclei injected with human GABAA subunit cDNAs (20 ng/μl); 24 h incubation; saline perfusion; coapplication with 10 μM loreclezole and 100 μM DMCM
Further Details (Pharmacological Data)
GABA=γ-aminobutyric acid; DMCM=methyl 6,7-dimethoxy-4-ethyl-β-carboline-3-carboxylate
Results
at 3 mM maximum effect, at 1 μM ca. 15 percent of maximum effect; loreclezole potentiated; coapplication with DMCM no further potentiation
Reference
Stevenson; Wingrove; Whiting; Wafford
Molecular Pharmacology, 1995 , vol. 48, # 6 p. 965 - 969 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
17 day-fetal Wistar rat hippocampal neurons
Concentration (Pharmacological Data)
10 - 100 nmol/l
Method (Pharmacological Data)
neuron isolation; inward current recording with conventional whole-cell voltage-clamp methods; patch clamp amplifier; 30-300 μM suramin, 10-100 μM RB2 or 100 μM α,β-Me-ATP applied by 0.4 ml/s superfusion 10 s before and during administration
Further Details (Pharmacological Data)
room temperature; RB2=reactive blue 2; α,β-Me-ATP=α,β-methylene-adenosine-5'-triphosphate
Results
suramin or RB2 concentration-dependently inhibited, but α,β-methylene-ATP not, GABA-activated inward current; inhibition reversible and not exhibit voltage-dependence between -30 and -90 mV; RB2 ca. 10-fold more potent than suramin
Reference
Nakazawa; Inoue; Ito; Koizumi
Naunyn-Schmiedeberg's Archives of Pharmacology, 1995 , vol. 351, # 2 p. 202 - 208 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
bovine cortex
Method (Pharmacological Data)
immunoprecipitation of <3H>flunitrazepam binding sites from benzodiazepine-affinity-purified γ-aminobutyric acidA receptors with β3 subunit-specific antibodies
Further Details
enhancement of 1 nmol/l <3H>flunitrazepam binding in immunopellets and in antibody-treated supernatants, respectively; binding activities determ. using
851 of 992
852 of 992
853 of 992
(Pharmacological Data)
nonlinear curve-fitting program
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
18 - 33 nmol/l
Results
maximal enhancement Emax = 46 percent and 38 percent, respectively
Reference
Huh, Kyung-Hye; Delorey, Timothy M.; Endo, Shuichi; Olsen, Richard W.
Molecular Pharmacology, 1995 , vol. 48, # 4 p. 666 - 675 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
bovine cortex
Method (Pharmacological Data)
benzodiazepine-affinity-purified γ-aminobutyric acidA receptors prepared
Further Details (Pharmacological Data)
enhancement of 1 nmol/l <3H>flunitrazepam binding in supernatants; binding activities determ. using nonlinear curve-fitting program
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
32 nmol/l
Results
maximal enhancement Emax = 43 percent
Reference
Huh, Kyung-Hye; Delorey, Timothy M.; Endo, Shuichi; Olsen, Richard W.
Molecular Pharmacology, 1995 , vol. 48, # 4 p. 666 - 675 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat brain
Method (Pharmacological Data)
immunoprecipitation of <3H>flunitrazepam binding sites from soluble extract γ-aminobutyric acidA receptors containing α1 and α2 subunit-specific antibodies, respectively
Further Details (Pharmacological Data)
enhancement of 0.7 nmol/l <3H>flunitrazepam binding in immunopellets; binding activities determ. using nonlinear curve-fitting program
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
32 - 142 nmol/l
Results
maximal enhancement Emax = 35 percent and 75 percent, respectively
Reference
Huh, Kyung-Hye; Delorey, Timothy M.; Endo, Shuichi; Olsen, Richard W.
Molecular Pharmacology, 1995 , vol. 48, # 4 p. 666 - 675 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat brain
854 of 992
855 of 992
Method (Pharmacological Data)
immunoprecipitation of <3H>flunitrazepam binding sites from soluble extract γ-aminobutyric acidA receptors containing α3 subunit-specific antibodies
Further Details (Pharmacological Data)
enhancement of 0.7 nmol/l <3H>flunitrazepam binding in immunopellets; binding activities determ. using nonlinear curve-fitting program
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
36 nmol/l
Results
maximal enhancement Emax = 63 percent
Reference
Huh, Kyung-Hye; Delorey, Timothy M.; Endo, Shuichi; Olsen, Richard W.
Molecular Pharmacology, 1995 , vol. 48, # 4 p. 666 - 675 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor-interaction
Species or TestSystem (Pharmacological Data)
Xenopus laevis oocytes
Sex
female
Concentration (Pharmacological Data)
1E-06 - 0.001 mol/l
Method (Pharmacological Data)
oocytes in modified Barth's saline; effect of platelet-derived growth factor receptor activation on GABAA-receptor concentration response curves; increasing GABA-concentrations; activation with platelet-derived growth factor-BB
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
36 - 47 μmol/l
Results
platelet-derived growth factor activation produced a 75 percent decrease in Emax of title comp. response
Reference
Valenzuela; Kazlauskas; Brozowski; Weiner; Demali; McDonald; Moss; Dunwiddie; Harris
Molecular Pharmacology, 1995 , vol. 48, # 6 p. 1099 - 1107 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
embryonic Sprague-Dawley rat olfactory bulb neurons
Concentration (Pharmacological Data)
0.5 - 1100 μmol/l
Exposure Period (Pharmacological Data)
<= 30 s
Method (Pharmacological Data)
current responses measured and expressed relative to the response to 2 μM title compound
Further Details (Pharmacological Data)
agonist at the GABAA receptor Cl- channels
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
150 μmol/l
856 of 992
857 of 992
858 of 992
859 of 992
Reference
Kristiansen; Barker; Serafini
Molecular Pharmacology, 1995 , vol. 48, # 2 p. 268 - 279 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellar membranes
Method (Pharmacological Data)
adult rats killed, cerebellum dissected and homogenized in buffer, suspension centrifuged, membrane suspension (used freshly or frozen) incubated with <35S> labeled TBPS and title comp. for 90 min at 4 degC
Further Details (Pharmacological Data)
membranes filtered, filters subjected to scintillation counting
Type (Pharmacological Data)
IC50
Value of Type (Pharmacological Data)
0.24 μmol/l
Results
title comp. inhibited the binding of <35S>TBPS
Reference
Slany; Zezula; Tretter; Sieghart
Molecular Pharmacology, 1995 , vol. 48, # 3 p. 385 - 391 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
human embryonic kidney 293 cells
Method (Pharmacological Data)
cells were cultured and transfected with cDNA encoding for β3 subunit of GABAA receptors, membranes extracted, frozen membranes thawed, centrifuged, incubated in buffer with <35S> labeled TBPS and with title comp., then filtered
Further Details (Pharmacological Data)
filters were subjected to scintillation counting
Results
title comp. inhibited the binding of <35S>TBPS
Reference
Slany; Zezula; Tretter; Sieghart
Molecular Pharmacology, 1995 , vol. 48, # 3 p. 385 - 391 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
rostral ventrolateral medulla (RVLM) of Sprague-Dawley rats
Method (Pharmacological Data)
rats perfused transcardially with modified artificial cerebrospinal (maCSF) fluid; after removal of the brain slices were cut through the RVLM, then incubated first in maCSF then in aCFS with low Ca++/high Mg++, used to block synaptic transmission
Further Details (Pharmacological Data)
stable RVLM neurons were recorded intra- and extracellular; GABAA selective receptor agonist title comp. (100 μM in aCFS soln.)
Results
GABAB receptor antagonists: 2-hydroxysalcofen, CGP-5426A, CGP-55845A have not effect on inhibitory activity of title comp.
Reference
Li; Guyenet
American Journal of Physiology - Regulatory Integrative and Comparative Physiology, 1995 , vol. 268, # 2 37-2 p. R428-R437 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or Test-
Sprague-Dawley rats
System (Pharmacological Data)
860 of 992
861 of 992
Sex
male
Method (Pharmacological Data)
anesthetized rats with cannulation of carotid artery and unilateral craniotomy through the occipital plate, paralyzed (pancuronium 1 mg/kg) and administered with urethan 0.1 g/kg iv;title comp. in 0.2 M water soln. pH 4.0 (90 nA, 2-4 min)
Further Details (Pharmacological Data)
recordings with six-barrel electrodes that include channel for automatic current balancing; records were made from three classes of cells: 1) presympathetic vasomotor cells, 2.) respiratory cells, 3.) nonrespiratory, nonpresympathetic cells
Results
bicuculine (40 nA) attenuated the activating effects of title comp.
Reference
Li; Guyenet
American Journal of Physiology - Regulatory Integrative and Comparative Physiology, 1995 , vol. 268, # 2 37-2 p. R428-R437 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
effect on enzyme activity
Species or TestSystem (Pharmacological Data)
Wistar rat
Sex
male
Route of Application
intraperitoneal
Concentration (Pharmacological Data)
500 mg/kg
Kind of Dosing (Pharmacological Data)
title comp. prepared in saline, injected twice daily, begining 16 h before PH and continued until evening before death
Method (Pharmacological Data)
rat (300-360 g) anaesthetized, partial hepatectomy (PH) performed, mid-line incision made in subxyphoid area and median and left lateral lobes removed (about 65 percent of liver); killed 1, 2 and 7 d after surgery
Further Details (Pharmacological Data)
glutathione S-transferases (GTSs) activity toward 1-chloro-2,4-dinitrobenzene (0.08-10 mM) and 1,2-dichloro-4-nitrobenzene (0.8 mM) were determined
Results
PH caused significant decrease of hepatic and increase of intestinal GTSs activity; in non regenerating rat (title comp. treated) increase on intestinal GTSs activity completely abolished
Reference
Carnovale; Monti; Favre; Scapini; Carrillo
Life Sciences, 1995 , vol. 57, # 9 p. 903 - 910 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
guinea-pig alveolar macrophages
Sex
male
Concentration (Pharmacological Data)
1000 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. administered 2 min prior FMLP
Exposure Period (Pharmacological Data)
7 min
Method (Pharmacological Data)
effect of title comp. on basal and 1 μM formyl-Met-Leu-Phe (FMLP)-induced platelet activating factor (PAF) release
Further Details (Pharmacological Data)
FMLP-induced PAF release was 54 percent of total content
Comment (Pharmacological
No effect
Data)
862 of 992
863 of 992
864 of 992
Reference
Gentilini; Franchi-Micheli; Mugnai; Bindi; Zilletti
British Journal of Pharmacology, 1995 , vol. 115, # 3 p. 389 - 394 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
guinea-pig serosal mast cells
Sex
male
Concentration (Pharmacological Data)
10 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. administered 3 min prior ovalbumin
Exposure Period (Pharmacological Data)
6 min
Method (Pharmacological Data)
cells from guinea-pigs sensitized with 500 μg s.c. ovoalbumin; effect of title comp. on basal and 5 mg/ml ovalbumin-induced histamine release at 37 deg C by fluorimetric determination
Further Details (Pharmacological Data)
ovalbumin-induced histamine release was 53 percent of total content
Results
title comp. alone was inactive; inhibited histamine release only by 10 percent at highest concentration
Reference
Gentilini; Franchi-Micheli; Mugnai; Bindi; Zilletti
British Journal of Pharmacology, 1995 , vol. 115, # 3 p. 389 - 394 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
bronchodilatoric
Species or TestSystem (Pharmacological Data)
guinea-pig trachea
Sex
male
Concentration (Pharmacological Data)
1E-06 - 0.001 mol/l
Exposure Period (Pharmacological Data)
20 min
Method (Pharmacological Data)
tracheal strips with or without epithelium from guinea-pigs sensitized with 500 μg s.c. ovoalbumin; superfused with oxygenated modified Krebs-Henseleit solution; 1E-9-1E-4 M ovalbumin-induced contraction (OIC) measured with isometric transducer
Further Details (Pharmacological Data)
with or without 2-hydroxysaclofen (2-HS), bicuculline (BIC), β-alanine (β-Ala), nipecotic acid (NA), tetrodotoxin (TXT), capsaicin (CAP), indomethacin (INDO), nordihydroguaiaretic acid (NDGA); ovalbumin was cumulatively administered
Results
title comp. concentration-dependently reduced OIC; CAP, 2-HS, INDO and removal of epithelium prevented, BIC, NA, TTX, NDGA and β-Ala did not affect this inhibition
Reference
Gentilini; Franchi-Micheli; Mugnai; Bindi; Zilletti
British Journal of Pharmacology, 1995 , vol. 115, # 3 p. 389 - 394 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
secretion stimulant
Species or TestSystem (Pharmacological Data)
pituitary of Wistar rat
Concentration (Pharmacological
100 μmol/l
Data)
865 of 992
866 of 992
867 of 992
Method (Pharmacological Data)
pituitary lobes of 2-d-old neonatal (N) rats of either sexes incubated in Krebs-Ringer buffer for 90 min; pH 7.4; T: 37 deg C; 5 percent CO2; 30 min incub. with title comp.
Further Details (Pharmacological Data)
pituitary homogenized; growth hormone (GH), cAMP determined by radioimmunoassay
Results
no significant increase of cAMP; ca. 4.5-fold increase of GH secretion
Reference
Mergl, Zsuzsanna; Acs, Zsuzsanna; Makara, G. B.
Life Sciences, 1995 , vol. 56, # 8 p. 579 - 586 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
pituitary of Wistar rat
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
pituitary lobes of 2-d-old neonatal (N) rats of either sexes incubated in Krebs-Ringer buffer for 90 min; pH 7.4; T: 37 deg C; 5 percent CO2; 30 min incub. with 0.5 mM isobutylmethylxanthine (IBMX) + title comp.
Further Details (Pharmacological Data)
pituitary homogenized; growth hormone (GH), cAMP determined by radioimmunoassay; title comp. effect on GH, cAMP stimulation by IBMX studied
Comment (Pharmacological Data)
No effect
Reference
Mergl, Zsuzsanna; Acs, Zsuzsanna; Makara, G. B.
Life Sciences, 1995 , vol. 56, # 8 p. 579 - 586 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiology
Species or TestSystem (Pharmacological Data)
HEK 293 cell line
Concentration (Pharmacological Data)
10 μmol/l
Method (Pharmacological Data)
cells transfected with rat α6β2γ2 receptor cDNA; measurements performed on clusters of 5-10 cells or on single cells at r.t. in the whole-cell configuration of the patch-clamp technique at -50 mV; output current recorded
Results
inward current induced
Reference
Hauser, Charlotte A. E.; Chesnoy-Marchais, Dominique; Robel, Paul; Baulieu, Etienne E.
European Journal of Pharmacology, Molecular Pharmacology Section, 1995 , vol. 289, # 2 p. 249 - 258 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor blocking agent
Species or TestSystem (Pharmacological Data)
Drosophila melanogaster
Method (Pharmacological Data)
normal and mutant strains, the mutants contain in the Rdl GABA subunit Ser instead of Ala302, flies frozen, heads recovered, homogenized in buffer, centrifuged, membrane prepared, treated with <3H>EBOB and title comp., binding detd.
Results
title comp. at 300 μM inhibited the specific binding in the normal strain, the mutants were significantly less sensitive
Reference
Cole, Loretta M.; Roush, Richard T.; Casida, John E.
Life Sciences, 1995 , vol. 56, # 10 p. 757 - 766 Title/Abstract Full Text View citing articles Show Details
868 of 992
869 of 992
870 of 992
Effect (Pharmacological Data)
receptor blocking agent
Species or TestSystem (Pharmacological Data)
Drosophila simulans
Method (Pharmacological Data)
normal and mutant strains, the mutants contain in the Rdl GABA subunit Ser or Gly instead of Ala302, flies frozen, heads recovered, homogenized in buffer, centrifuged, membrane prepared, treated with <3H>EBOB and title comp., binding detd.
Results
title comp. at 300 μM inhibited the specific binding in the normal strain, the Ser-mutants were significantly less sensitive
Reference
Cole, Loretta M.; Roush, Richard T.; Casida, John E.
Life Sciences, 1995 , vol. 56, # 10 p. 757 - 766 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
OVX Sprague-Dawley rat preoptic area neurosomes
Sex
female
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
single dose in 10 μl modified Krebs-Ringer buffer
Exposure Period (Pharmacological Data)
2 min
Method (Pharmacological Data)
postpubertal rat weight 150-175 g; OVX bilaterally; EB (2x2 μg s.c. inj. 24-48 h presacr.) and/or P (500 μg s.c. inj. 3.5-4 h presacr.) pretreatment; neurosome preparation; <3H>-glutamate pretreat. (37 deg C, 30 min); drug incubation; radioactivity
Further Details (Pharmacological Data)
in vitro; 37 deg C; glutamate release and drug exchange with <3H>-drug; OVX female rat=ovariohysterectomized female rat; EB=β-estradiol-3-benzoate; P=progesterone
Results
EB+P significantly increased drug-induced glutamate release, but no effect on drug exchange with <3H>-drug
Reference
Fleischmann; Makman; Etgen
Life Sciences, 1995 , vol. 56, # 20 p. 1665 - 1678 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
secretion stimulant
Species or TestSystem (Pharmacological Data)
OVX Sprague-Dawley rat preoptic area neurosomes
Sex
female
Concentration (Pharmacological Data)
1000 μmol/l
Kind of Dosing (Pharmacological Data)
single dose in 10 μl modified Krebs-Ringer buffer
Exposure Period (Pharmacological Data)
2 min
Method (Pharmacological Data)
postpubertal rat weight 150-175 g; OVX bilaterally; sacrifice; neurosome preparation and incubation; <3H>-glutamate pretreatment (37 deg C, 30 min); drug incubation; radioactivity
Further Details (Pharmacological Data)
in vitro; 37 deg C; glutamate release and drug exchange with <3H>-drug; OVX female rat=ovariohysterectomized female rat
Comment
No effect
(Pharmacological Data)
871 of 992
872 of 992
873 of 992
Reference
Fleischmann; Makman; Etgen
Life Sciences, 1995 , vol. 56, # 20 p. 1665 - 1678 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
secretion stimulant
Species or TestSystem (Pharmacological Data)
gonadally intact Sprague-Dawley rat preoptic area neurosomes
Sex
male
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
single dose in 10 μl modified Krebs-Ringer buffer
Exposure Period (Pharmacological Data)
2 min
Method (Pharmacological Data)
postpubertal rat weight 150-175 g; sacrifice; neurosome preparation and incubation; <14C>- or <3H>-glutamate pretreatment (37 deg C, 30 min); drug incubation; radioactivity
Further Details (Pharmacological Data)
in vitro; 37 deg C; glutamate release
Results
dose-dependently potentiated glutamate efflux
Reference
Fleischmann; Makman; Etgen
Life Sciences, 1995 , vol. 56, # 20 p. 1665 - 1678 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
gonadally intact Sprague-Dawley rat preoptic area neurosomes
Sex
male
Concentration (Pharmacological Data)
100 μmol/l
Kind of Dosing (Pharmacological Data)
single dose in 10 μl modified Krebs-Ringer buffer
Exposure Period (Pharmacological Data)
2 min
Method (Pharmacological Data)
postpubertal rat weight 150-175 g; sacrifice; neurosome preparation and incubation; <3H>-glutamate pretreatment (37 deg C, 30 min); drug incubation with 25 μM picrotoxin, 10 μM bicuculline or 10 μM SR-95531; radioactivity
Further Details (Pharmacological Data)
in vitro; 37 deg C; glutamate release
Results
picrotoxin, bicuculline and SR-95531 inhibited drug-induced glutamate release
Reference
Fleischmann; Makman; Etgen
Life Sciences, 1995 , vol. 56, # 20 p. 1665 - 1678 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
secretion stimulant
Species or TestSystem
gonadally intact Sprague-Dawley rat hypothalamic neurosomes
(Pharmacological Data)
874 of 992
875 of 992
Sex
male
Concentration (Pharmacological Data)
1000 μmol/l
Kind of Dosing (Pharmacological Data)
single dose in 10 μl modified Krebs-Ringer buffer
Exposure Period (Pharmacological Data)
2 min
Method (Pharmacological Data)
postpubertal rat weight 150-175 g; sacrifice; neurosome preparation and incubation; <14C>-glutamate pretreatment (37 deg C, 30 min); drug incubation; radioactivity
Further Details (Pharmacological Data)
in vitro; 37 deg C; glutamate release
Comment (Pharmacological Data)
No effect
Reference
Fleischmann; Makman; Etgen
Life Sciences, 1995 , vol. 56, # 20 p. 1665 - 1678 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
secretion stimulant
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat frontal cortical neurosomes
Sex
male
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
single dose in 10 μl modified KRB
Exposure Period (Pharmacological Data)
2 - 5 min
Method (Pharmacological Data)
gonadally intact, postpubertal rat weight 150-175 g; sacrifice; neurosome preparation and incubation in calcium- or high magnesium-containing KRB; <14C>-glutamate pretreatment (37 deg C, 30 min); drug incubation; radioactivity
Further Details (Pharmacological Data)
in vitro; 37 deg C; glutamate release; KRB=Krebs-Ringer buffer
Results
at 2 min drug incubation no effect; at 5 min incubation 500 μM drug induced significant glutamate release in calcium-containing KRB, but not in high magnesium-containing KRB
Reference
Fleischmann; Makman; Etgen
Life Sciences, 1995 , vol. 56, # 20 p. 1665 - 1678 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
secretion stimulant
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat striatum
Sex
male
Route of Application
intracerebral
Concentration (Pharmacological Data)
10 mmol/l
Exposure Period
20 - 240 min
(Pharmacological Data)
876 of 992
877 of 992
Method (Pharmacological Data)
rat weight 250-350 g; surgical preparation; immobilization; dialysis (perfusion rate 2 μl/min with Ringer solution); drug treatment alone or with 10 mM GVA; 20 min dialysate collections; HPLC-ECD; decapitation and cannula location after experiment
Further Details (Pharmacological Data)
serotonin (5-HT) release; GVA=δ-guanidinovaleric acid
Results
alone no effect; drug+GVA increased 5-HT release between 20 and 120 min and between 160 and 220 min, the release smaller than that induced by GVA alone
Reference
Kabuto; Yokoi; Iwaya; Mori
Life Sciences, 1995 , vol. 56, # 20 p. 1741 - 1748 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
secretion inhibition
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat striatum
Sex
male
Route of Application
intracerebral
Concentration (Pharmacological Data)
10 mmol/l
Exposure Period (Pharmacological Data)
20 - 240 min
Method (Pharmacological Data)
rat weight 250-350 g; surgical preparation; immobilization; dialysis (perfusion rate 2 μl/min with Ringer solution); drug treatment; 20 min dialysate collections; HPLC-ECD; decapitation and cannula location after experiment
Further Details (Pharmacological Data)
dopamine (DA) release
Results
decrease DA release between 180 and 240 min
Reference
Kabuto; Yokoi; Iwaya; Mori
Life Sciences, 1995 , vol. 56, # 20 p. 1741 - 1748 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat striatum
Sex
male
Route of Application
intracerebral
Concentration (Pharmacological Data)
10 mmol/l
Exposure Period (Pharmacological Data)
20 - 240 min
Method (Pharmacological Data)
rat weight 250-350 g; surgical preparation; immobilization; dialysis (perfusion rate 2 μl/min with Ringer solution); drug treatment with 10 mM GVA; 20 min dialysate collections; HPLC-ECD; decapitation and cannula location after experiment
Further Details (Pharmacological Data)
dopamine (DA) release; GVA=δ-guanidinovaleric acid
Results
drug+GVA increased DA release between 20 and 80 min, 160 min, the release smaller than that induced by GVA alone
Reference
Kabuto; Yokoi; Iwaya; Mori
Life Sciences, 1995 , vol. 56, # 20 p. 1741 - 1748 Title/Abstract Full Text View citing articles Show Details
878 of 992
879 of 992
880 of 992
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
human ebrionic kidney cells transfected with rat cDNAs
Concentration (Pharmacological Data)
10 - 10000 nmol/l
Exposure Period (Pharmacological Data)
90 min
Method (Pharmacological Data)
HEK 293 cells transfected with rat cDNAs encoding α1, α6, β2, γ2S and γ2L subunits; <35S>TBPS binding measured, radioactivity determined with scintillation counter; ethanol(100 mM) and TICO added to binding mixture
Further Details (Pharmacological Data)
TBPS: t-butylbicyclophosphorothionate; TICO: title compound
Results
ethanol potentiated TICO inhibition of binding, without interaction with α and/or γ2 variants; inhibition significant in all receptors at 100 nM TICO, but abolished at 10 μM TICO
Reference
Korpi; Herb; Luddens
Pharmacology and Toxicology, 1995 , vol. 77, # 2 p. 87 - 90 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
human ebrionic kidney cells transfected with rat cDNAs
Concentration (Pharmacological Data)
10 - 10000 nmol/l
Exposure Period (Pharmacological Data)
90 min
Method (Pharmacological Data)
HEK 293 cells transfected with rat cDNAs encoding α1, α6, β2, γ2S and γ2L subunits; <35S>TBPS binding measured, radioactivity determined with scintillation counter; ethanol (100 mM) and TICO added to mixture
Further Details (Pharmacological Data)
TBPS: t-butylbicyclophosphorothionate; TICO: title compound
Results
TICO inhibited α6β2γ2S receptors binding more efficiently than homologous γ2L receptors; binding of α1β2γ2L receptors more efficiently stimulated by 100 nM TICO and inhibited by 1 μM TICO than α1β2γ2S receptors
Reference
Korpi; Herb; Luddens
Pharmacology and Toxicology, 1995 , vol. 77, # 2 p. 87 - 90 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Fischer 344 rat brain membrans
Sex
male
Method (Pharmacological Data)
three month old rats entire forebrain rostral to cerebellum used for preparation of crude synaptic membrans; TICO ability to compete for binding to TICO receptors investigated
Further Details (Pharmacological Data)
TICO: title compound; TICOA sites studied using <3H>SR-95531 and <3H>muscimol; TICOB sites studied using <3H>TICO in presence of isoguvacine to saturate TICOA sites
Results
IC50 values for inhibition of <3H>SR-99531, <3H>Muscimol, <3H>TICO (total) and <3H>TICO (+isoguvacine) binding 2.2 mM, 0.37 mM, 52 mM and 37 mM respectively
Reference
Klunk, William E.; Debnath, Manik L.; McClure, Richard J.; Pettegrew, Jay W.
Life Sciences, 1995 , vol. 56, # 26 p. 2377 - 2384 Title/Abstract Full Text View citing articles Show Details
881 of 992
882 of 992
883 of 992
884 of 992
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellar membrane GABAA receptor
Exposure Period (Pharmacological Data)
1 h
Method (Pharmacological Data)
receptors immunoprecipitated by sera specific for δ-subunit of GABAA receptor, bound to protein A-Sepharose; receptor labelled with <3H>-muscimol, competition curve with title comp.
Type (Pharmacological Data)
Ki
Value of Type (Pharmacological Data)
9.1 nmol/l
Reference
Quirk; Whiting; Ragan; McKernan
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 290, # 3 p. 175 - 181 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellar membrane GABAA receptor
Exposure Period (Pharmacological Data)
1 h
Method (Pharmacological Data)
receptors immunoprecipitated by sera specific for γ2-subunit of GABAA receptor, bound to protein A-Sepharose; receptor labelled with <3H>-muscimol, competition curve with title comp.
Type (Pharmacological Data)
Ki
Value of Type (Pharmacological Data)
13.5 nmol/l
Reference
Quirk; Whiting; Ragan; McKernan
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 290, # 3 p. 175 - 181 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
oocytes of Xenopus laevis
Concentration (Pharmacological Data)
0.0001 mol/l
Method (Pharmacological Data)
defolliculated oocytes injected with 50 nl mRNA soln. (1 mg/ml in water) isolated from rat cerebellum, incubated for 2-4 day at 18 deg C in Barth'soln.
Further Details (Pharmacological Data)
single oocyte impaled with two microelectrodes in a medium contg. 1E-5 M bicuculline (pH 7.0, room temp.), title comp. added, voltage-clamped at -40 mV for 1 min
Results
title comp. in presence of bicuculline produced an outward current under voltage-clamp conditions
Reference
Yoshimura; Yoshida; Taniyama
Life Sciences, 1995 , vol. 57, # 26 p. 2397 - 2401 Title/Abstract Full Text View citing articles Show Details
Effect
drug interaction
(Pharmacological Data)
885 of 992
886 of 992
887 of 992
Species or TestSystem (Pharmacological Data)
oocytes of Xenopus laevis
Concentration (Pharmacological Data)
0.0001 mol/l
Method (Pharmacological Data)
defolliculated oocytes injected with 50 nl mRNA soln. (1 mg/ml in water) isolated from rat cerebellum, incubated for 2-4 day at 18 deg C in Barth'soln.; single ocyte place impaled with two microlectrodes
Further Details (Pharmacological Data)
15 min before title comp. administration, 1E-3 M dibutyric cyclic AMP (db-cAMP) or 1E-5 M forskolin added to the perfusion medium contg. 1E-5 M bicuculline (pH 7.0, room temp.), then title comp., voltage-clamped at -40 mV
Results
pretreatment with db-cAMP or with forskolin suppressed the bicuculline-intensive title comp.-induced response
Reference
Yoshimura; Yoshida; Taniyama
Life Sciences, 1995 , vol. 57, # 26 p. 2397 - 2401 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
protein binding
Species or TestSystem (Pharmacological Data)
Hydra vulgaris (attenuata)
Concentration (Pharmacological Data)
40 - 1200 nmol/l
Exposure Period (Pharmacological Data)
10 min
Method (Pharmacological Data)
membranes, from 3000-4000 starved (24-48 h) hydra, (0.250-0.30 mg protein), incubated 10 min at 0 deg C with 20 nM 3H-labeled title comp. and with various concn. of unlabeled title comp.
Results
specific binding 60-70 percent of total binding; one population of binding sites for title comp. (Scatchard analysis); equilibrium dissociation constant KD = 76 nM; maximal number of binding sites Bmax = 4.75 pmol/mg protein
Reference
Pierobon, Paola; Concas, Alessandra; Santoro, Giovanna; Marino, Giuseppe; Minei, Rosario; et al.
Life Sciences, 1995 , vol. 56, # 18 p. 1485 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
protein binding
Species or TestSystem (Pharmacological Data)
Hydra vulgaris (attenuata)
Concentration (Pharmacological Data)
20 nmol/l
Exposure Period (Pharmacological Data)
10 min
Method (Pharmacological Data)
membranes, from 3000-4000 starved (24-48 h) hydra, (0.250-0.30 mg protein), incubated 10 min at 0 deg C with 20 nM 3H-labeled title comp. in presence or absence of 30 μM muscimol, or 100 μM bicuculine or with 100 μM baclofen
Results
muscimol completely inhibited (96.5 percent) no signif. modification by bicuculline or baclofen in title comp. binding
Reference
Pierobon, Paola; Concas, Alessandra; Santoro, Giovanna; Marino, Giuseppe; Minei, Rosario; et al.
Life Sciences, 1995 , vol. 56, # 18 p. 1485 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem
Hydra vulgaris (attenuata)
(Pharmacological Data)
888 of 992
889 of 992
890 of 992
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
feeding reaction in vivo; animals starved 3 d before; mouth opening (Ti) and closing (Tf) time measured; stimulation with 1-12 μM reduced gluthathione (GSH) in presence or absence of title comp. and title comp.+ (10-100 μM) bicuculline methiodide
Results
in living animals title comp. increased the duration of mouth opening during GSH-induced feeding response; effect abolished by simultaneous administration of bicuculline methiodide
Reference
Pierobon, Paola; Concas, Alessandra; Santoro, Giovanna; Marino, Giuseppe; Minei, Rosario; et al.
Life Sciences, 1995 , vol. 56, # 18 p. 1485 - 1498 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
transfected human embryonic kidney (HEK) cell line 293
Concentration (Pharmacological Data)
100 μmol/l
Method (Pharmacological Data)
HEK cells transfected with cDNA encoding for rat brain α1-, β3- and γ2-subunits of GABAA receptors; polymerase chain reaction (PCR) used for estimation of the amount of GABAA receptor subunit mRNA, endogenously present in HEK 293 cells
Further Details (Pharmacological Data)
transfected cells, with various combinations of plasmids encoding for GABAA receptor subunits, incubated with (3H)Ro 15-1788 in various concns. in presence or absence of title comp. for 120 min at 4 deg C; KD detn.
Results
binding of (3)Ro 15-1788 to cells transfected with α1,β3,γ2 GABAA subunits in presence of title comp. KD 1.44 nM; not detected in case of α1β3 and β3γ2; KD 1.8 nM to transfected cells with α1γ2 GABAA subunits
Reference
Fuchs; Zezula; Slany; Sieghart
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 289, # 1 p. 87 - 95 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
human embryonic kidney cell line 293 (HEK 293)
Concentration (Pharmacological Data)
1E-09 - 0.0001 nmol/l
Method (Pharmacological Data)
membranes from HEK cells in Tris-citrate buffer (pH 7.4) incubated with 2 nM (3H)flunitrazepam at 4 deg C in absence or presence of various concns. of title comp.
Results
title comp. (agonist) has no effect on (3H)flunitrazepam binding to HEK membranes
Reference
Fuchs; Zezula; Slany; Sieghart
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 289, # 1 p. 87 - 95 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
Wistar rats
Sex
male
Concentration (Pharmacological Data)
0.0001 mol/l
Method (Pharmacological Data)
rats decapitated, cerebral cortex removed and homogenized, pellets separated and resuspended in Tris, citrate contg. AgNO3 (5E-4 M) at 0-4 deg C for 10 min; pellets washed, and resuspended in Tris, citrate buffer pH 7.1 at a concn. of 20 mg tissue/ml
891 of 992
892 of 992
893 of 992
Further Details (Pharmacological Data)
2 ml of Ag+-pretreated membrane suspension, preincubated with title comp. for 40 min in the dark at 0-4 deg C; UV radiation applied for 40 min at 254 nm; resuspended for (1E-5 M) thiomuscimol photolabeling
Results
title comp. inhibits photolabeling of thiomuscimol on to Ag+-treated membrane preparation
Reference
Nielsen; Witt; Ebert; Krogsgaard-Larsen
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 289, # 1 p. 109 - 112 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
dopaminergic
Species or TestSystem (Pharmacological Data)
rat brain dopamine neurons
Concentration (Pharmacological Data)
1 - 3 mmol/l
Method (Pharmacological Data)
in vitro; brains from male Sprague-Dawley rats (180-300 g); synaptic currents in substantia nigra zona compacta and ventral tegmental area measured; recording chamber; pH 7.4; 36 deg C; also with 100-300 μM adenosine
Further Details (Pharmacological Data)
membrane currents measured using whole-cell recording technique
Results
evoked outward current; adenosine failed to block drug activity
Reference
Wu; Mercuri; Johnson
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 273, # 2 p. 576 - 581 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
enzyme; induction of
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat striatal membranes
Sex
male
Method (Pharmacological Data)
striatal membranes incub. at 30 deg C 15 min in Tris cont. 0.3 μM <γ-32P>GTP and increasing concn. of title comp. or a combination of agonists; highaffinity GTPase activity assayed by <γ-32P>GTP hydrolysis
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
210 μmol/l
Results
GTPase activity was stimulated by title comp., Emax = 8.6 percent above basal value; stimulation effect additive: dopamine + title comp. or dopamine + carbachol + title comp.; diagrams given
Reference
Odagaki; Dasgupta; Fuxe
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 291, # 3 p. 245 - 253 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
Spraue-Dawley rat hippocampus
Sex
male
Method (Pharmacological Data)
rats (200-300 g) killed by decapitation; hippocampal membranes incubated 120 min at 4 deg C in Tris-HCl cont. 8 nM <3H>levetiracetam and title comp.
Further Details (Pharmacological Data)
radioactivity determined by liquid scintillation
Type
pKi
(Pharmacological Data)
894 of 992
895 of 992
896 of 992
Value of Type (Pharmacological Data)
3.0 dimensionless
Results
title comp. did not demonstrate affinity (less than 20 percent inhibition)
Reference
Noyer, Michel; Gillard, Michel; Matagne, Alain; Henichart, Jean-Pierre; Wuelfert, Ernst
European Journal of Pharmacology, 1995 , vol. 286, # 2 p. 137 - 146 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
electrophysiologic
Species or TestSystem (Pharmacological Data)
transfected human embrionic kidney 293 cells
Concentration (Pharmacological Data)
0.3 - 100 μmol/l
Method (Pharmacological Data)
cells transfected with plasmids containing cDNAs for human α2β2γ2s GABAA receptors; effect of title comp. on inward current measured with whole-cell patch-clamp method
Results
title comp. dose-dependently increased amplitude of inward current in both transfected cells (EC50=17 and 10 μM for activation of α2β1γ2s and α2β1 receptors, respectively); diagrams
Reference
Jones; Harrison; Pritchett; Hales
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 2 p. 962 - 968 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
human embryonic kidney (HEK) 293 cells
Concentration (Pharmacological Data)
1E-07 - 0.0003 mol/l
Method (Pharmacological Data)
HEK cells, native or transfected with cDNAs for rat GABAA receptor α1β3γ2- or α1γ2-subunits incub. in buffer (pH 7.4; 90 min; 4 deg C) with <3H>flunitrazepam (F); binding determined with liquid scintillation
Further Details (Pharmacological Data)
binding parameters (KD, nM; Bmax, fmol/mg protein) determined by Scatchard analysis
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.5 μmol/l
Results
F binding to α1β3γ2 stimulated (max. 150 percent)
Reference
Slany; Zezula; Fuchs; Sieghart
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 291, # 2 p. 99 - 105 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
rat cerebellum
Concentration (Pharmacological Data)
1E-07 - 0.0003 mol/l
Method (Pharmacological Data)
membranes from cerebellum of adult rats incub. in buffer (pH 7.4; 90 min; 4 deg C) with <3H>flunitrazepam (F); binding determined with liquid scintillation
897 of 992
898 of 992
899 of 992
Further Details (Pharmacological Data)
binding parameters (KD, nM; Bmax, fmol/mg protein) determined by Scatchard analysis
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.43 μmol/l
Results
F binding to α1β3γ2 stimulated (max. 100 percent)
Reference
Slany; Zezula; Fuchs; Sieghart
European Journal of Pharmacology - Molecular Pharmacology Section, 1995 , vol. 291, # 2 p. 99 - 105 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
PA3 cells
Exposure Period (Pharmacological Data)
4 d
Method (Pharmacological Data)
cells cultured in Dulbecco's modified Eagle's medium; induction with 1 μM dexamethasone; after 2 d 50 μM title comp.
Further Details (Pharmacological Data)
effect on (GABA)A receptor function; Kd, Bmax, GABA shift
Results
Kd = 3.47 nM, Bmax = 145 percent of control, GABA shift: 1.63
Reference
Klein; Mascia; Harkness; Hadingham; Whiting; Harris
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 3 p. 1484 - 1492 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
γ-aminobutyric acid (GABA) release
Species or TestSystem (Pharmacological Data)
Wistar-Kyoto (WKY) rat
Sex
male
Method (Pharmacological Data)
spont. hypertensive (SHR), and normotensive rats killed; brain removed, immersed in Krebs-Ringer (KRB) soln.; medulla oblongata, PH, hippocampus dissected; chopped slices incub. 37 deg C, 15 min in KRB cont. <3H>GABA and 100 μmol/l aminooxyacetic acid
Further Details (Pharmacological Data)
high K+ (30 mmol/l) stimulation was applied 16 min after incub.; spontaneous and high K+ evoked release of <3H>GABA determined by liquid scint. technique; kinetic parameters: fraction rate constant (k) and t1/2 calculated
Results
release of GABA under high K+ in eleven-week-old SHR rat hippocampus and the spontaneous release of GABA in the same aged SHR medulla oblongata were lower than those of age-matched normotensive WKY rat; tables given
Reference
Ichida, Tatsuya; Takeda, Kazuo; Sasaki, Susumu; Nakagawa, Masao; Hashimoto, Tsuneichi; Kuriyama, Kinya
Life Sciences, 1995 , vol. 58, # 3 p. 209 - 215 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
Accumulation
Species or TestSystem (Pharmacological Data)
rat glial cells
Concentration (Pharmacological Data)
1 - 20 mmol/l
Method (Pharmacological Data)
in vitro; primary cultures established from newborn rat hemispheres; cultured in DMEM for 48 h and then incubated with <3H>labeled taurine in KrebsRinger phosphate buffer for 10 min; pH 7.4; 37 deg C; title comp. added to culture or incubation medium
900 of 992
901 of 992
902 of 992
Further Details (Pharmacological Data)
taurine uptake determined in primary and secondary cultures
Results
uptake of taurine increased to 119 and 105 percent of control when added at 5 and 20 mM to culture medium, respectively; inhibited taurine uptake to 34, 12 and 5 percent of control when added at 1, 5 or 20 mM to incubation medium, respectively
Reference
Petegnief, Valerie; Lleu, Pierre-Louis; Gupta, Ramesh C.; Bourguignon, Jean-Jacques; Rebel, Gerard
Biochemical Pharmacology, 1995 , vol. 49, # 3 p. 399 - 410 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
Accumulation
Species or TestSystem (Pharmacological Data)
rat glial cells
Concentration (Pharmacological Data)
5 mmol/l
Method (Pharmacological Data)
in vitro; primary cultures established from newborn rat hemispheres; cultured in DMEM for 48 h and then incubated with <3H>labeled β-alanine in KrebsRinger phosphate buffer for 15 min; pH 7.4; 37 deg C; title comp. added to incubation medium
Further Details (Pharmacological Data)
β-alanine uptake determined
Results
inhibited β-alanine uptake to 14 percent of control when added to incubation medium
Reference
Petegnief, Valerie; Lleu, Pierre-Louis; Gupta, Ramesh C.; Bourguignon, Jean-Jacques; Rebel, Gerard
Biochemical Pharmacology, 1995 , vol. 49, # 3 p. 399 - 410 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
neuroregulatoric
Species or TestSystem (Pharmacological Data)
cat
Concentration (Pharmacological Data)
10 mmol/l
Kind of Dosing (Pharmacological Data)
title compound administered from a multi-barrel glass pipette electrode
Method (Pharmacological Data)
16 cats anaesthetized with ketamine chloride; stimulating electrodes inserted in the left motor cotex and to the pyrmidal tract; title compound applied in an iontophoretic system; neuronal activity recorded at right motor cortex
Further Details (Pharmacological Data)
effect of title compound on pyramidal tract neuron responses to transcallosal stimulation; number of spikes in 30 ms from the stimulus onset for 20 transcallosal stimulations counted
Results
title compound decreased number of spikes from 10.3 to 7.8 in pyramidal tract neurons, while the latency 4.3 ms almost as control 4.4 ms
Reference
Chowdhury; Kawashima; Konishi; Niwa; Matsunami
European Journal of Pharmacology, 1995 , vol. 285, # 1 p. 99 - 102 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
Accumulation
Species or TestSystem (Pharmacological Data)
porcine cerebral arteries
Concentration (Pharmacological Data)
1 mmol/l
Method (Pharmacological Data)
in vitro; fresh (nerve-intact) and cold-storage-denervated arteries with or without endothelial cells (EC); biochemical assay of 0.05 mM <ureido14C>citrulline (spec. act.: 55.9 mCi/mmol) uptake in tissues
Further Details
oxygenated (95 percent O2 - 5 percent CO2) buffer (pH 7.4) containing 5 mM D-α-glucose, 20 mM HEPES (pH 7.4) and 1 percent BSA; 37 deg C; 1 h
903 of 992
904 of 992
905 of 992
(Pharmacological Data)
incubation; uptake of radioactivity into vessels measured in liquid scintillation counter
Results
had no effects on citrulline uptake in either fresh or denervated arteries with or without EC
Reference
Chen; Lee
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 273, # 2 p. 895 - 901 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
neuroregulatoric
Species or TestSystem (Pharmacological Data)
Fischer-344 rat brain
Concentration (Pharmacological Data)
300 μmol/l
Method (Pharmacological Data)
125-150 g rats (25 deg C; 12 h light:dark cycle) anesth.; dopamine (DA) depletion ind. by i.t. inj. of 6-OHDA into right substantia nigra (Sub); 2-3 m later rats sacrificed; brains removed; striatum (St), substantia nigra (Sub) dissected
Further Details (Pharmacological Data)
tissues homogenized; preincub. in Krebs buffer with 1.0 mM IBMX (37 deg C; 60 min; O2:CO2=95:5); incub. with 10 μM forskolin (FORS)+title comp. (15 min); cyclic adenosine monophosphate (cAMP) determined by radioimmunoassay
Results
F-induced cAMP accumulation in St, Sub inhibited (diagram)
Reference
Hossain; Weiner
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 1 p. 237 - 244 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
sympatholytic
Species or TestSystem (Pharmacological Data)
Sprague-Dawley rat
Sex
male
Route of Application
intraarterial
Method (Pharmacological Data)
anesthetized, artificially ventilated rats (250-350 g); electrical stimulation within obscurus; microinjection of title comp. (200 mM, 100 nl) into raphe obscurus
Results
decrease of the early sympathoexcitatory response
Reference
Zhou Shi-Yi; Gilbey
The American journal of physiology, 1995 , vol. 268, # 52 p. R1230-R1235 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
sympathomimetic
Species or TestSystem (Pharmacological Data)
New Zealand White rabbit
Sex
male and female
Concentration (Pharmacological Data)
4 - 40 nmol
Method (Pharmacological Data)
anesthetized rabbits (2.4-4.3 kg); microinjections of title comp. in the caudal medullary raphe oder in CVLM
Further Details (Pharmacological Data)
MAP, mean arterial pressure; RSNA, renal sympathetic nerve activity; CVLM, caudal ventrolateral medulla
Results
no effect of title comp. on MAP or RSNA when injected into the caudal medullary raphe but evoked a pressor and sympathoexcitatory response when injected into the CVLM
Reference
Coleman; Dampney
American Journal of Physiology - Regulatory Integrative and Comparative Physiology, 1995 , vol. 268, # 5 37-5 p. R1295-R1302 Title/Abstract Full Text View citing articles Show Details
906 of 992
907 of 992
908 of 992
Effect (Pharmacological Data)
effect on vasopressin cell responses to caval occlusion
Species or TestSystem (Pharmacological Data)
Wistar rat
Sex
male
Concentration (Pharmacological Data)
5 - 10 nmol
Method (Pharmacological Data)
anesthetized rats (200-300 g); microinjections of title comp. in the caudal ventrolateral medulla (CVLM); arterial blood pressure measured
Results
eliminated increase in vasopressin cell firing elicited by moderate caval occlusion; no blocking of response to severe caval occlusion
Reference
Smith; Sibbald; Khanna; Day
The American journal of physiology, 1995 , vol. 268, # 52 p. R1336-R1342 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
effect on binding activity
Species or TestSystem (Pharmacological Data)
Wistar rat brain
Sex
male
Concentration (Pharmacological Data)
5e-006 mol/l
Kind of Dosing (Pharmacological Data)
2 neurosteroids prepared in 50 percent EtOH-50 percent DMSO, picrotoxin, TBPS, pentobarbital and title comp. dissolved in distilled H2O then diluted with DMSO in incubation buffer
Method (Pharmacological Data)
brain from 200-220 g rat frozen, cut into sections; interaction of 3α-OH-5α-pregnan-20-one, pregnenolone sulfate, pentobarbital, picrotoxin and TBPS with <35S>-TBPS binding to GABA-A receptor in presence of title comp.
Further Details (Pharmacological Data)
experiments in various structures of rat brain: cortex layers I-III; IV; V-VI; CA1 stratum oriens; dentate gyrus stratum moleculare; paraventricular, medio dorsal lateral and rhomboid nucleus of thalamus
Results
dose-inhibition curves shown; title comp. decreased the IC50 of 3α-OH-5α-pregnan-20-one, pentobarbital, pregnenolone sulfate in all brain regions studied; IC50 of picrotoxin and TBPS were not significantly altered in presence of title comp.
Reference
Vincens; Dartois; Moyse; Haour; Fillion
Naunyn-Schmiedeberg's Archives of Pharmacology, 1995 , vol. 351, # 4 p. 356 - 362 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
human embryonic kidney cells (A293)
Concentration (Pharmacological Data)
5 μmol/l
Method (Pharmacological Data)
human embryonic kidney cell-lines expressing the α1β2γ2 subunit of of GABAA (γ-aminobutyric acid) receptor derived by transfection of plasmids containing cDNA and plasmid encoding G418 resistance into kidney cells
Further Details (Pharmacological Data)
whole-cell patch clamp technique used for examination of 20 nmol 3α,21-dihydroxy-5α-pregnan-20-one (5α-THDOC) effect on title comp.-induced and by 5 μM U-89843A enhanced Cl- currents
Results
5α-THDOC has a potentiating effect on title comp.-induced and by U-89843A enhanced Cl- currents in A293 cells expressing the α1β2γ2 subtype of GABAA
receptors Reference
Im; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 3 p. 1390 - 1395 Title/Abstract Full Text View citing articles Show Details
909 of 992
910 of 992
911 of 992
912 of 992
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
human embryonic kidney cells (A293)
Concentration (Pharmacological Data)
5 μmol/l
Method (Pharmacological Data)
human embryonic kidney cell-lines expressing the α1β2γ2 subunit of of GABAA (γ-aminobutyric acid) receptor derived by transfection of plasmids containing cDNA and plasmid encoding G418 resistance into kidney cells
Further Details (Pharmacological Data)
whole-cell patch clamp technique used for examination of 5 μM pentobarbital effect on title comp.-induced and by 5 μM U-89843A enhanced Cl- currents
Results
pentobarbital has a potentiating effect on title comp.-induced and by U-89843A enhanced Cl- currents in A293 cells expressing the α1β2γ2 subtype of GABAA receptors
Reference
Im; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 3 p. 1390 - 1395 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
neuroregulatoric
Species or TestSystem (Pharmacological Data)
human embryonic kidney cells (A293)
Concentration (Pharmacological Data)
5 μmol/l
Method (Pharmacological Data)
human embryonic kidney cell-lines expressing the α1β2γ2 subunit of of GABAA (γ-aminobutyric acid) receptor derived by transfection of plasmids containing cDNA and plasmid encoding G418 resistance into kidney cells
Further Details (Pharmacological Data)
whole-cell patch clamp technique used for examination of U-89843A (0.05-20 μM) effect in presence of title comp. on GABAA-induced Cl- currents
Results
U-89843A in presence of title comp. dose-dependently increased Cl- currents in A293 cells expressing the α1β2γ2 subtype of GBAA receptors
Reference
Im; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 3 p. 1390 - 1395 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
drug interaction
Species or TestSystem (Pharmacological Data)
embryos from 14-day-old C57B1/6CR mouse
Concentration (Pharmacological Data)
1 - 100 μmol/l
Method (Pharmacological Data)
coverslips contg. cortical cultured neurons pretreated with pentobarbital (200 μM, 5-days), or not (control) removed from the tissue culture, in HEPESbuffered saline, incubated with title comp. in various concns. in presence of 1 nM (3H)flunitrazepam
Results
in chronic pentobarbital treated cortical neurons title comp. concn.-dependent enhanced the specific binding of (3H)flunitrazepam; Emax (efficacy) decreased to 88 percent, from 130 percent of control; no influence on EC50 (potency) 16 μM, EC50 14 μM control
Reference
Yu; Ticku
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 3 p. 1442 - 1446 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
receptor; binding activity
Species or TestSystem (Pharmacological Data)
embryos from 14-day-old C57B1/6CR mouse
913 of 992
914 of 992
Concentration (Pharmacological Data)
4 nmol/l
Method (Pharmacological Data)
coverslips contg. cortical cultured neurons pretreated with pentobarbital (200 μM, 5-days), or not (control) removed from the tissue culture and a mitocondrial and mircrosomal (P2+P1) fraction prepared, homogenized, centrifuged pellets suspended
Further Details (Pharmacological Data)
in HEPES-buffered saline, incubated with (3H)title comp. for 10 min at 0-4 deg C; nonspecific binding detn. in the presence of 1E-4 M title comp.
Results
specific binding: control 262 fmol/mg protein; in cells pretreated with 200 μM pentobarbital for 5 days 289 fmol/mg protein; pretreatment with pentobarbital did not change basal title comp. binding to its recognition sites in intact cortical neurons
Reference
Yu; Ticku
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 275, # 3 p. 1442 - 1446 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
GABAA receptor-mediated Cl(1-) current stimulant
Species or TestSystem (Pharmacological Data)
Xenopus laevis frog oocyte expr. α1β1γ2S GABAA receptor
Concentration (Pharmacological Data)
5 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. in 2 ml/min MBS perfusion
Method (Pharmacological Data)
oocyte isolation; cDNAs injection (1.5 ng/30 nl) into oocyte nucleus; 24 h incubation in MBS at 16 - 19 deg C; 5 min title comp. perfusion in 10 min intervals at RT; patch clamp recording
Further Details (Pharmacological Data)
cDNAs for the human α1, β1, γ2S GABAA receptor subunits were subcloned into the pCDM8 expression vector; MBS = modified Barth's saline
Results
rapid desensitization of stimulated Cl(1-) inward current: ca. 60 percent of the initial current amplitude left by the end of drug perfusion (graphical representation)
Reference
Sanna; Mascia; Klein; Whiting; Biggio; Harris
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 1 p. 353 - 360 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
GABAA receptor-mediated Cl(1-) current stimulant
Species or TestSystem (Pharmacological Data)
Xenopus laevis frog oocyte expr. α1β1γ2S GABAA receptor
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. in 2 ml/min MBS perfusion
Method (Pharmacological Data)
oocyte isolation; cDNAs injection (1.5 ng/30 nl) into oocyte nucleus; 24 h incubation in MBS at 16 - 19 deg C; 20 s title comp. perfusion in 10 min intervals at RT; patch clamp recording
Further Details (Pharmacological Data)
cDNAs for the human α1, β1, γ2S GABAA receptor subunits were subcloned into the pCDM8 expression vector; MBS = modified Barth's saline
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
Ca. 20 μmol/l
Results
title comp. dose-dependently stimulated Cl(1-) inward current; graphical representation
Reference
Sanna; Mascia; Klein; Whiting; Biggio; Harris
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 1 p. 353 - 360
Title/Abstract Full Text View citing articles Show Details
915 of 992
916 of 992
917 of 992
Effect (Pharmacological Data)
GABAA receptor-mediated Cl(1-) current stimulant
Species or TestSystem (Pharmacological Data)
Xenopus laevis frog oocyte expr. α1β1 GABAA receptor
Concentration (Pharmacological Data)
1 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
title comp. in 2 ml/min MBS perfusion
Method (Pharmacological Data)
oocyte isolation; cDNAs injection (1.5 ng/30 nl) into oocyte nucleus; 24 h incubation in MBS at 16 - 19 deg C; 20 s title comp. perfusion in 10 min intervals at RT; patch clamp recording
Further Details (Pharmacological Data)
cDNAs for the human α1, β1 GABAA receptor subunits were subcloned into the pCDM8 expression vector; MBS = modified Barth's saline
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
Ca. 5 μmol/l
Results
title comp. dose-dependently stimulated Cl(1-) inward current; graphical representation
Reference
Sanna; Mascia; Klein; Whiting; Biggio; Harris
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 274, # 1 p. 353 - 360 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
transport
Species or TestSystem (Pharmacological Data)
bovine brain capillary endothelial cells (BCECs)
Concentration (Pharmacological Data)
0.25 - 0.5 mmol/l
Method (Pharmacological Data)
in vitro; effect on <3H>taurine uptake assayed; incub. solution, pH 7.4; 290 mOsmol; 2 or 100 nM <3H>taurine (spec. act.: 28-32 Ci/mmol) added; incub. in the presence of title comp. for 0.5 h
Further Details (Pharmacological Data)
<3H>taurine added to luminal or antiluminal solution for luminal and antiluminal uptake of <3H>taurine measurements, respectively; liquid scintillation counting
Type (Pharmacological Data)
Ki
Value of Type (Pharmacological Data)
470 μmol/l
Results
title comp. decreased luminal uptake of <3H>taurine to 67.5 percent of control uptake (with Ki value of 470 μM) and decreased antiluminal uptake to 25.4 percent of control uptake
Reference
Tamai; Senmaru; Terasaki; Tsuji
Biochemical Pharmacology, 1995 , vol. 50, # 11 p. 1783 - 1793 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β2γ2 GABAA receptor subunits
Concentration
0.03 - 1000 μmol/l
(Pharmacological Data)
918 of 992
919 of 992
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.5 μmol/l
Results
maximal Cl- current elicited by title comp. >750 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α6β1γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.5 μmol/l
Results
maximal Cl- current elicited by title comp. > 500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β3γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
920 of 992
921 of 992
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.7 μmol/l
Results
maximal Cl- current elicited by title comp. 250-500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α3β2γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing human (α3) and rat (β2,γ2) receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
15.1 μmol/l
Results
maximal Cl- current elicited by title comp. >700 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α4β2γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological
1.4 μmol/l
Data)
922 of 992
923 of 992
924 of 992
Results
maximal Cl- current elicited by title comp. < 100 pA
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α5β2γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.2 μmol/l
Results
maximal Cl- current elicited by title comp. > 750 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α6β2γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.16 μmol/l
Results
maximal Cl- current elicited by title comp. 250-500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect
agonist
(Pharmacological Data)
925 of 992
926 of 992
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β1γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
4.5 μmol/l
Results
maximal Cl- current elicited by title comp. > 650 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α3β1γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing human (α3) and rat (β1,γ2) receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
15.1 μmol/l
Results
maximal Cl- current elicited by title comp. 250-500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α5β1γ2 GABAA receptor subunits
Concentration (Pharmacological
0.03 - 1000 μmol/l
Data)
927 of 992
928 of 992
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
5.6 μmol/l
Results
maximal Cl- current elicited by title comp. 250-500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β1γ1 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing human (γ1) and rat (α1,β1) receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.2 μmol/l
Results
maximal Cl- current elicited by title comp. 250-500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β2γ1 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
929 of 992
930 of 992
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing human (γ1) and rat (α1,β2) receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.67 μmol/l
Results
maximal Cl- current elicited by title comp. 250-500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β3γ1 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing human (γ1) and rat (α1,β3) receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
2.1 μmol/l
Results
maximal Cl- current elicited by title comp. > 500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β2γ3 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological
1.3 μmol/l
Data)
931 of 992
932 of 992
933 of 992
Results
maximal Cl- current elicited by title comp. > 250-500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β1 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.5 μmol/l
Results
maximal Cl- current elicited by title comp. < 250 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β1γ3 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.6 μmol/l
Results
maximal Cl- current elicited by title comp. 250-500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect
agonist
(Pharmacological Data)
934 of 992
935 of 992
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α6β2δ GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
1.2 μmol/l
Results
maximal Cl- current elicited by title comp. < 100 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α6β2γ1 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing human (γ1) and rat (α6,β2) receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.4 μmol/l
Results
maximal Cl- current elicited by title comp. > 500 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α6β2 GABAA receptor subunits
Concentration (Pharmacological
0.03 - 1000 μmol/l
Data)
936 of 992
937 of 992
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.5 μmol/l
Results
maximal Cl- current elicited by title comp. < 200 pA; graphical representation
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK-293 cells expressing α1β2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.03 - 1000 μmol/l
Kind of Dosing (Pharmacological Data)
rapid application (<10 ms) using Y-shaped tubing method
Method (Pharmacological Data)
in vitro; electrophysiological study; Cl- current elicited by title comp. determined by whole-cell voltage-clamp technique; bathing buffer (pH 7.4); room temp.; osmolarity: 325 mOsmol
Further Details (Pharmacological Data)
studies performed within 3 days after transfection with pCIS2 containing rat receptor subunit cDNAs; HEK: human embryonic kidney
Type (Pharmacological Data)
EC50
Value of Type (Pharmacological Data)
0.5 μmol/l
Reference
Ducic; Caruncho; Zhu Wei Jian; Vicini; Costa
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 1 p. 438 - 445 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
agonist
Species or TestSystem (Pharmacological Data)
HEK293 cells expressing α1β2γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
2 μmol/l
Method (Pharmacological Data)
in vitro; single channel study; cells patch clamped at -60 mV; superfused continuously with external solution (pH 7.3); room temp.
Results
activated Cl- current; mean current amplitude at -60 mV was -1.66 pA; channel open time constants (short and long) were 2.3 and 16.8 ms respectively; channel short and long closed time constants were 4.2 and 86.7 ms respectively
Reference
Dillon; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 2 p. 597 - 603 Title/Abstract Full Text View citing articles Show Details
938 of 992
939 of 992
940 of 992
941 of 992
Effect (Pharmacological Data)
receptor binding regulator
Species or TestSystem (Pharmacological Data)
SF9 cells expressing α1β2γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.01 - 100 μmol/l
Method (Pharmacological Data)
in vitro; radioligand binding assay; 2-160 nM <35S>TBPS; 50 μg membrane protein; Tris/HCl buffer (pH 7.4); 24 deg C; incubation time 120 min
Further Details (Pharmacological Data)
TBPS: <35S>t-butylbicyclophosphorothionate
Results
at doses up to 5 μM enhanced radioligand binding but at higher concentrations inhibited radioligand binding dose-dependently
Reference
Dillon; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 2 p. 597 - 603 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
SF9 cells expressing α1β2γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.01 - 100 μmol/l
Method (Pharmacological Data)
in vitro; effect on 5α-THDOC-induced increase in radioligand binding assayed; 2-160 nM <35S>TBPS; 0.5 μM 5α-THDOC; 50 μg membrane protein; Tris/HCl buffer (pH 7.4); 24 deg C; incubation time 120 min
Further Details (Pharmacological Data)
TBPS: <35S>t-butylbicyclophosphorothionate; 5α-THDOC: 3α,21-dihydroxy-5α-pregnan-20-one
Results
at doses up to 1 μM did not antagonize 5α-THDOC effect on radioligand binding; at doses higher than 1 μM completely reversed effect of 5α-THDOC on radioligand binding
Reference
Dillon; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 2 p. 597 - 603 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
antagonist
Species or TestSystem (Pharmacological Data)
SF9 cells expressing α1β2γ2 GABAA receptor subunits
Concentration (Pharmacological Data)
0.01 - 100 μmol/l
Method (Pharmacological Data)
in vitro; effect on U-93631-induced decrease in radioligand binding assayed; 2-160 nM <35S>TBPS; 5 μM U-93631; 50 μg membrane protein; Tris/HCl buffer (pH 7.4); 24 deg C; incubation time 120 min
Further Details (Pharmacological Data)
TBPS: <35S>t-butylbicyclophosphorothionate; U-93631: 4-dimethyl-3-t-butylcarboxyl-4,5-dihydro (1,5-a) quinoxaline
Comment (Pharmacological Data)
No effect
Reference
Dillon; Wha Bin Im; Pregenzer; Carter; Hamilton
Journal of Pharmacology and Experimental Therapeutics, 1995 , vol. 272, # 2 p. 597 - 603 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological
enzyme; examination of
Data)
942 of 992
943 of 992
944 of 992
945 of 992
946 of 992
947 of 992
948 of 992
949 of 992
Species or TestSystem (Pharmacological Data)
(R,S)-α-fluoro-β-alanine defluorinating enzyme
Concentration (Pharmacological Data)
25 mmol/l
Method (Pharmacological Data)
in vitro; effect on transaminase activity assayed; 1 mM pyruvate as amino-acceptor substrate; transfer reaction monitored spectrophotometrically
Comment (Pharmacological Data)
No effect
Reference
Porter, David J. T.; Harrington, Joan A.; Almond, Merrick R.; Chestnut, William G.; Tanoury, Gerald; Spector, Thomas
Biochemical Pharmacology, 1995 , vol. 50, # 9 p. 1475 - 1484 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
antiepileptic activity
Reference
Satzinger
Arzneimittel-Forschung/Drug Research, 1994 , vol. 44, # 3 p. 261 - 266 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
in vitro potency of inhibition of <3H>GABA uptake at cloned GABA transporters: IC50: 5 (hGAT-1), 5 (rGAT-2), 7 (hGAT-3), 36 (hBGT-1) μM
Reference
Dhar; Borden; Tyagarajan; Smith; Branchek; Weinshank; Gluchowski
Journal of Medicinal Chemistry, 1994 , vol. 37, # 15 p. 2334 - 2342 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
inhibition of <3H>GABA uptake into rat hippocampal slices in vitro, IC50: 8.6 +/- 0.94 μM
Reference
Pavia, Michael R.; Lobbestael, Sandra J.; Nugiel, David; Mayhugh, Daniel R.; Gregor, Vlad E.; et al.
Journal of Medicinal Chemistry, 1992 , vol. 35, # 22 p. 4238 - 4248 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
inhibition of the cytoplasmic enzyme N8-AcSpd deacetylase from rat liver cytosol (in vitro)
Reference
Huang; Dredar; Manneh; Blankenship; Fries
Journal of medicinal chemistry, 1992 , vol. 35, # 13 p. 2414 - 2418 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
in vitro effect on proliferation and differentiation of the leukemic promyelocytic cell line HL-60
Reference
Nudelman, Abraham; Ruse, Margaretta; Aviram, Adina; Rabizadeh, Ester; Shaklai, Matityahu; et al.
Journal of Medicinal Chemistry, 1992 , vol. 35, # 4 p. 687 - 694 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
ability to displace the labeled agonist <3H>GABA (IC50: 25 nM) and the labeled antagonist <3H>gabazine (IC50: 1450 nM) from rat brain and provoke convulsions after iv injections (mice)
Reference
Melikian; Schlewer; Chambon; Wermuth
Journal of Medicinal Chemistry, 1992 , vol. 35, # 22 p. 4092 - 4097 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
affinity for the <3H>GABA binding assay, IC50 (μmol): 0.03
Reference
Mann; Boulanger; Brandau; Durant; Evrard; Heaulme; Desaulles; Wermuth
Journal of Medicinal Chemistry, 1991 , vol. 34, # 4 p. 1307 - 1313 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
slight anticonvulsant activity; sedative activity (effect on sleeping time induced by sodium pentobarbital); (mice)
950 of 992
951 of 992
952 of 992
953 of 992
954 of 992
955 of 992
Reference
Sasaki; Mori; Nakamura; Shibasaki
Journal of Medicinal Chemistry, 1991 , vol. 34, # 2 p. 628 - 633 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
ability to displace <3H>muscimol (GABAA sites): IC50 = 0.10 μM and (R)-(-)-<3H>baclofen (GABAB sites): IC50 = 0.04 μM (from rat brain membranes)
Reference
Berthelot; Vaccher; Flouquet; Debaert; Luyckx; Brunet
Journal of Medicinal Chemistry, 1991 , vol. 34, # 8 p. 2557 - 2560 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
in vitro inhibition of synaptosomal GABA uptake (IC50 = 3.0 μM) and of GABAA receptor binding (IC50 = 0.03 μM); no effect on binding of 3H-quinuclidinyl benzilate (3H-QNB) to muscarinic acetylcholine receptors in rat cortical membranes
Reference
Falch; Krogsgaard-Larsen
European Journal of Medicinal Chemistry, 1991 , vol. 26, # 1 p. 69 - 77 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
ability to displace binding R(-) <3H> baclofen (IC50 = 0.04 μM) and RS <3H> baclofen (IC50 = 0.03 μM) to GABAB sites in rat whole brain synaptic membranes, ability to displace <3H> muscimol (IC50 = 0.10 μM) from GABAA sites in rat brain membranes
Reference
Berthelot; Vaccher; Flouquet; Luyckx; Brunet; Boulanger; Frippiat; Vercauteren; Debaert; Evrard; Durant
European Journal of Medicinal Chemistry, 1991 , vol. 26, # 4 p. 395 - 402 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
affinity for GABA binding sites in rat brain (IC50 61 nM)
Reference
Toja; Bonetti; Butti; Hunt; Fortin; Barzaghi; Formento; Maggioni; Nencioni; Galliani
European Journal of Medicinal Chemistry, 1991 , vol. 26, # 9 p. 853 - 868 Title/Abstract Full Text View citing articles Show Details
Effect (Pharmacological Data)
enzyme; examination of
Species or TestSystem (Pharmacological Data)
bovine carbonic anhydrase CA I
Concentration (Pharmacological Data)
5e-05 mol/l
Method (Pharmacological Data)
micromethod of Maren
Further Details (Pharmacological Data)
2 deg C
Type (Pharmacological Data)
percent activation
Value of Type (Pharmacological Data)
112.0 percent activation
Results
control CA activity in the absence of activator = 100 percent
Reference
Supuran, Claudiu T.; Dinculescu, Antonie; Manole, Gheorghe; Savan, Florina; Puscas, Ioan; Balaban, Alexandru T.
Revue Roumaine de Chimie, 1991 , vol. 36, # 8 p. 937 - 946 Title/Abstract Full Text Show Details
Effect (Pharmacological Data)
enzyme; examination of
Species or TestSystem (Pharmacological Data)
bovine carbonic anhydrase CA II
Concentration (Pharmacological Data)
5e-05 mol/l
Method
micromethod of Maren
(Pharmacological Data)
956 of 992
957 of 992
958 of 992
959 of 992
960 of 992
961 of 992
962 of 992
963 of 992
Further Details (Pharmacological Data)
2 deg C
Type (Pharmacological Data)
percent activation
Value of Type (Pharmacological Data)
115.0 percent activation
Results
control CA activity in the absence of activator = 100 percent
Reference
Supuran, Claudiu T.; Dinculescu, Antonie; Manole, Gheorghe; Savan, Florina; Puscas, Ioan; Balaban, Alexandru T.
Revue Roumaine de Chimie, 1991 , vol. 36, # 8 p. 937 - 946 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
antihemolytic activity (in vitro); effect on antithermic, antihypoxic activity, and antistressor action (white mice); weak antioxidant activity
Reference
Pisarskii, Yu. B.; Vvedenskii, V. Yu.; Voronkov, M. G.; Kazimirovskaya, V. B.; Kishkina, I. M.; et al.
Pharmaceutical Chemistry Journal, 1990 , vol. 24, # 1 p. 26 - 30 Khimiko-Farmatsevticheskii Zhurnal, 1990 , vol. 24, # 1 p. 23 - 26 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
antihypoxic and anticonvulsant activity in mice
Reference
Fridman, Ya. D.; Kebets, N. M.; Nanaeva, M. T.; Zurdinov, A. Z.; Sabirova, T. S.; Atarskaya, L. I.
Pharmaceutical Chemistry Journal, 1989 , vol. 23, # 11 p. 879 - 883 Khimiko-Farmatsevticheskii Zhurnal, 1989 , vol. 23, # 11 p. 1310 - 1313 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
filaricidal activity on infective larvae and microfilarie of Molinema dessetae
Reference
Deverre; Loiseau; Couvreur; Letourneux; Gayral; Benoit
Journal of Pharmacy and Pharmacology, 1989 , vol. 41, # 3 p. 191 - 193 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
no inhibition of binding to GHB receptor in crude membranes from rat brain
Reference
Bourguignon; Schoenfelder; Schmitt; Wermuth; Hechler; Charlier; Maitre
Journal of Medicinal Chemistry, 1988 , vol. 31, # 5 p. 893 - 897 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
substrate acts on neurotransmitter receptors; little ability to compete for <3H>zacopride binding in homogenates for the rat entorhinal cortex
Reference
Barnes; Costall; Naylor
The Journal of pharmacy and pharmacology, 1988 , vol. 40, # 8 p. 548 - 551 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
no influence on the mink relfex (mouse); no effect on muscle relaxant activity; no corazole, bicuculline, or picrotoxin antagonism
Reference
Kovler, M. A.; Karaev, A. L.; Kopelevich, V. M.; Bulanova, L. N.; Rozanov, V. A.; et al.
Pharmaceutical Chemistry Journal, 1987 , vol. 21, # 9 p. 616 - 619 Khimiko-Farmatsevticheskii Zhurnal, 1987 , vol. 21, # 9 p. 1051 - 1054 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
potent depression of the carotid arterial blood pressure in spontaneously hypertensive rats
Reference
Kohama; Matsumoto; Mimura; Tanabe; Inada; Nakanishi
Chemical and Pharmaceutical Bulletin, 1987 , vol. 35, # 6 p. 2484 - 2489 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
in vitro ability to displace <3H>GABA from rat brain membranes (GABAA sites, IC50 = 0.03 μM) and to displace <3H>baclofen (GABAB sites, IC50 = 0.03 μM) from rat brain membranes
964 of 992
965 of 992
966 of 992
967 of 992
968 of 992
969 of 992
970 of 992
971 of 992
972 of 992
973 of 992
Reference
Berthelot; Vaccher; Musadad; Flouquet; Debaert; Luyckx
Journal of Medicinal Chemistry, 1987 , vol. 30, # 4 p. 743 - 746 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
intraperitoneally injected produced a dose. dependent hypothermia in restrained rats
Reference
Minano; Sancibrian; Serrano
Journal of Pharmacy and Pharmacology, 1987 , vol. 39, # 9 p. 721 - 726 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
effects (growth and activity) on the production of xylanase by alkalophilic Bacillus No. C-125
Reference
Ikura, Yoko; Horikoshi, Koki
Agricultural and Biological Chemistry, 1987 , vol. 51, # 11 p. 3143 - 3146 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
inhibitory neurotransmitter in the brain, IC50 = 0.008 uM, EC50 = 1.0, max. enhancement = 150 percent
Reference
Blasko, Gabor; Kardos, Julianna; Baitz-Gacs, Eszter; Simonyi, Miklos; Szantay, Csaba
Heterocycles, 1986 , vol. 24, # 10 p. 2887 - 2900 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
effect on neuronal responses (brainstem reticular neurons from Wistar rats, both sexes), influence of etoperidone
Reference
Janiri; Salera; Tempesta
Arzneimittel-Forschung/Drug Research, 1986 , vol. 36, # 12 p. 1721 - 1726 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
effect by i.v. administration on carrageenan-induced paw inflammation in rats depending on time
Reference
Bhattacharya; Sarkar
Journal of Pharmacy and Pharmacology, 1986 , vol. 38, # 2 p. 144 - 146 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
effect on release of preloaded <14C>glutamate from slices of rat dentate gyros, in response to K+ stimulation; inhibition of Ca2+ dependent glu release and enhancement of Ca2+ independent release
Reference
Spencer; Lynch; Bliss
The Journal of pharmacy and pharmacology, 1986 , vol. 38, # 5 p. 393 - 395 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
effects on <3H>GABAA, <3H>GABAB, and tert-butyl <35S>bicyclophosphorothionate binding in rat brain membranes and <3H>GABA uptake into rat brain synaptosomes
Reference
Witiak, Donald T.; Patch, Raymond J.; Enna, S. J.; Fung, Yiu K.
Journal of Medicinal Chemistry, 1986 , vol. 29, # 1 p. 1 - 8 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
binding ability (in rat brain membranes) <3H>GABA: IC50=0.03 μM, <3H>baclofen: IC50=0.06 μM, uptake inhibn. IC50=1.8 μM
Reference
Mann; Humblet; Chambon; Schlichter; Desarmenien; Feltz; Wermuth
Journal of Medicinal Chemistry, 1985 , vol. 28, # 10 p. 1440 - 1446 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
inhibition of <3H>-γ-aminobutyric acid (<3H>GABA) (IC50 = 2.60 μM) uptake by rat brain synaptosomes in vitro, inhibition of <3H>muscimol binding to rat cerebellum membranes (IC50 = 0.029 μM) in vitro
Reference
Ali, Fadia E.; Bondinell, William E.; Dandridge, Penelope A.; Frazee, James S.; Garvey, Eleanor; et al.
Journal of Medicinal Chemistry, 1985 , vol. 28, # 5 p. 653 - 660 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
in vitro inhibitor in rats brain for GABA (IC50 0.033 μm), THIP (IC50 0.015 μm), P4S (IC50 0.025 μm) receptor binding and GABA uptake (IC50 3 μm)
Reference
Krogsgaard-Larsen, Povl; Nielsen, Lone; Falch, Erik; Curtis, David R.
Journal of Medicinal Chemistry, 1985 , vol. 28, # 11 p. 1612 - 1617 Title/Abstract Full Text View citing articles Show Details
974 of 992
975 of 992
976 of 992
977 of 992
978 of 992
979 of 992
980 of 992
981 of 992
982 of 992
983 of 992
Comment (Pharmacological Data)
the preservation of the inhibitory effects of gabapentin on the electrically evoked 3H overflow from slices preincubated 3H-noradrenaline or 3H-serotonin, 1000 μmol/l, rat brain cortex
Reference
Schlicker; Reimann; Gothert
Arzneimittel-Forschung/Drug Research, 1985 , vol. 35, # 9 p. 1347 - 1349 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
inhibition of the formation of stress-induced gastric ulcers in guinea-pigs
Reference
Minano; Serrano; Duran; Sancibrian
Journal of Pharmacy and Pharmacology, 1985 , vol. 37, # 9 p. 675 - 677 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
contraction of guinea-pig ileum ED50: 2.2+/-0.1 (μM); enhancement of <3H>diazepam binding ED50: 0.46+/-0.06 (μM)
Reference
Allan; Dickenson; Johnston; et al.
Australian Journal of Chemistry, 1985 , vol. 38, # 11 p. 1651 - 1656 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
Inactive as central nervous system depressant by inhibiting the general motor activity of mice. Brain penetration index = 0.96, dose 3-39 mg/kg, sc.
Reference
Jacob; Shashoua; Campbell; Baldessarini
Journal of Medicinal Chemistry, 1985 , vol. 28, # 1 p. 106 - 110 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
affects intestinal motility during darkness (dog, intravenously)
Reference
Fargeas; Fioramonti; Bueno
Journal of Pharmacy and Pharmacology, 1984 , vol. 36, # 2 p. 130 - 132 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
no effect on acetylcholine-induced contractions of bladder muscle (male albino rabbit, in-vitro); reduced field stimulation-induced contractions
Reference
Santicioli; Maggi; Meli
Journal of Pharmacy and Pharmacology, 1984 , vol. 36, # 6 p. 378 - 381 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
displacement of 3H-GABA specifically bound from rat brain synaptic membranes in Tyrode buffer
Reference
Kardos; Blasko; Simonyi; Szantay Cs.
Arzneimittel-Forschung/Drug Research, 1984 , vol. 34, # 12 p. 1758 - 1759 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
effect on general motor activity in the mouse; IC50 = 70 nM for inhibition of <3H>GABA binding to synaptic membranes from rat cerebellum
Reference
Shahsoua, Victor E.; Jacob, James N.; Ridge, Richard; Campbell, Alexander; Baldessarini, Ross J.
Journal of Medicinal Chemistry, 1984 , vol. 27, # 5 p. 659 - 664 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
inhibition of glutamate uptake by Brevibacterium flavum No 2247 (ATCC 14067), 24percent at 1 mM
Reference
Mori, Michiko; Shiio, Isamu
Agricultural and Biological Chemistry, 1983 , vol. 47, # 5 p. 983 - 990 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
inhibitor of 3H-GABA: IC 50 (μM): 0.15 (rats)
Reference
Borea; Bonora; Baraldi; Simoni
Farmaco, Edizione Scientifica, 1983 , vol. 38, # 6 p. 411 - 417
Title/Abstract Full Text View citing articles Show Details
984 of 992
985 of 992
986 of 992
987 of 992
988 of 992
989 of 992
990 of 992
991 of 992
992 of 992
Comment (Pharmacological Data)
small contractions of human internal anal sphincter muscle at 5E-4 M and no effect at 10 - 100E-6 M
Reference
Burleigh
Journal of Pharmacy and Pharmacology, 1983 , vol. 35, # 4 p. 258 - 260 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
no effect on the motor responce of the male rat anococcygeus muscle stimulated at a frequency of 20 Hz (70 V; 1 ms) for 30 s and at 3 min intervals at concentrations up to 1E-4 M level
Reference
Oriowo
Journal of Pharmacy and Pharmacology, 1983 , vol. 35, # 8 p. 511 - 515 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
inhibition of GABA receptor binding IC50 0.033 μM, inhibition of GABA uptake in synaptosomes IC50 2 μM
Reference
Jacobsen; Labouta; Schaumburg; Falch; Krogsgaard-Larsen
Journal of Medicinal Chemistry, 1982 , vol. 25, # 10 p. 1157 - 1162 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
no nematicidal activity against Bursaphelenchus lignicolus
Reference
Nagase; Kuwahara; Tominaga; Sugawara
Agricultural and Biological Chemistry, 1982 , vol. 46, # 1 p. 167 - 172 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
competitve inhibition of the activity both of 3-guanidinopropionate amidinohydrolase from Pseudomonas aeruginosa PAO 1 and of 4-guanidinobutyrate amidinohydrolase from Pseudomonas sp. ATCC 14676 at 5.0 mM, Ki = 2.8 mM and 1.0 mM, respectively
Reference
Yorifuji, Takamitsu; Sugai, Ichiro; Matsumoto, Hideki; Tabuchi, Akira
Agricultural and Biological Chemistry, 1982 , vol. 46, # 5 p. 1361 - 1368 Title/Abstract Full Text Show Details
Comment (Pharmacological Data)
therapeutic efficacy in the treatment of cerebrovascular disorders (3 g daily, 8 weeks, with 600 mg of pyrithioxine); also in combination with placebo
Reference
Otomo; Araki; Mori; Kurihara
Arzneimittel-Forschung/Drug Research, 1981 , vol. 31, # 9 p. 1511 - 1523 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
effect on the rabbit isolated intestine; effect of various concentration of GABA on intestinal tone and PGE-like substance in the bathing fluid
Reference
Girdhar; Dhumal; Gulati; Bhavsar; Hemavathi
Journal of Pharmacy and Pharmacology, 1981 , vol. 33, # 9 p. 614 - 615 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
central hypotensive effect (intraventricularly, dog)
Reference
Dhumal; Gulati; Bhavsar
Journal of Pharmacy and Pharmacology, 1980 , vol. 32, # 10 p. 724 - 725 Title/Abstract Full Text View citing articles Show Details
Comment (Pharmacological Data)
sodium-independent γ-aminobutyric acid (γ-Abu) receptor binding in rat brain tissue (<3H>Abu displacing IC50=2.00E-8 mol/L)
Reference
O'Donnell, John P.; Johnson, David A.; Azzaro, Albert J.
Journal of Medicinal Chemistry, 1980 , vol. 23, # 10 p. 1142 - 1144 Title/Abstract Full Text View citing articles Show Details
Ecotoxicology (27) 1 of 27
Effect (Ecotoxicology)
repellent
Species or TestSystem (Ecotoxicology)
Liriomyza trifolii, American serpentine leafminer fly
2 of 27
3 of 27
4 of 27
5 of 27
Sex
female
Kind of Dosing (Ecotoxicology)
water solution
Method (Ecotoxicology)
cut leaf of kidney bean dipped in solution of title comp., dried and put in Petri dish; five flies placed on treated leaf for 24 h at 27 deg C under 16:8 illumination; number of leaf punctures made by flies counted
Further Details (Ecotoxicology)
control: without title comp.
Results
title comp. decreased number of ovipositional marks; table
Reference
Dekebo, Aman; Kashiwagi, Takehiro; Tebayashi, Shin-Ich; Kim, Chul-Sa
Bioscience, Biotechnology and Biochemistry, 2007 , vol. 71, # 2 p. 421 - 426 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
central nervous system effects
Endpoint of Effect (Ecotoxicology)
electrical activity of DUM neurons
Species or TestSystem (Ecotoxicology)
terminal abdominal ganglion from Periplaneta americana L.
Concentration (Ecotoxicology)
20 mmol/l
Method (Ecotoxicology)
in vitro; abdominal nerve cord and its desheathed ganglion mount. in exper. chamber; superfused with saline; repetitive pulses of title comp.; pressure ejection; electrical activ. of DUM neurons record. with intracellular electrodes
Results
fast transient hyporpolarization of DUM neuronal cell bodies followed by sustained phase
Reference
Le Corronc; Hue
Pesticide Science, 1999 , vol. 55, # 10 p. 1007 - 1011 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
central nervous system effects
Endpoint of Effect (Ecotoxicology)
polarization of motoneuron Df
Species or TestSystem (Ecotoxicology)
metathoracic ganglion from Periplaneta americana L.
Concentration (Ecotoxicology)
20 mmol/l
Method (Ecotoxicology)
in vitro; methatoracic ganglion isol., desheathed in saline, pH 7.2; mount. in experim. chamber; one of paired Df neurons located and impaled with glass electrode; repetitive pulses of title comp. delivered by pressure ejection for 3 min
Results
biphasic response; initial fast transient hyperpolarization followed by sustained hyperpolarization
Reference
Le Corronc; Hue
Pesticide Science, 1999 , vol. 55, # 10 p. 1007 - 1011 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
central nervous system effects
Endpoint of Effect (Ecotoxicology)
membrane conductance
Species or TestSystem (Ecotoxicology)
terminal abdominal ganglion from Periplaneta americana L.
Kind of Dosing (Ecotoxicology)
title comp. ejected within TAG neuropile using broken micropipette connected to pneumatic pressure-ejection system
Method (Ecotoxicology)
in vitro; single-fibre oil-gap method; terminal abdominal ganglion (TAG); continuously superfused with saline; direct meas. of membrane conductance changes; hyperpolarized square current pulses (5 nA)
Results
dose-dependent response; biphasic increase in membrane conductance at high dose of title comp.; stable increase in membrane conductance reaching 30 percent of maximum response at low conc. of title comp.
Reference
Le Corronc; Hue
Pesticide Science, 1999 , vol. 55, # 10 p. 1007 - 1011 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
central nervous system effects
Endpoint of Effect (Ecotoxicology)
inhibition of EBOB binding to P2 membranes
Species or Test-
Musca domestica L. WHO, housefly, head P2 membranes
System (Ecotoxicology)
6 of 27
7 of 27
8 of 27
Exposure Period (Ecotoxicology)
70 min
Method (Ecotoxicology)
incubation of test compound with P2 membranes and <3H>EBOB in NaCl/sodium phosphate buffer (pH 7.5) at 22 deg C; measurement of <3H>EBOB bound to membranes by liquid scintillation
Type (Ecotoxicology)
IC50
Value of Type (Ecotoxicology)
162 μmol/l
Reference
Ozoe; Niina; Matsumoto; Ikeda; Mochida; Ogawa; Matsuno; Miki; Yanagi
Bioorganic and medicinal chemistry, 1998 , vol. 6, # 1 p. 73 - 83 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
behavioral symtoms
Endpoint of Effect (Ecotoxicology)
feeding response
Species or TestSystem (Ecotoxicology)
Diabrotica virgifera virgifera, western corn rootworm
Concentration (Ecotoxicology)
10 - 500 nmol/disk
Kind of Dosing (Ecotoxicology)
test comp. dissolv. in water
Exposure Period (Ecotoxicology)
24 h
Method (Ecotoxicology)
no-choice regenerated cellulose disk bioassay; adult rootworms; Petri dishes; regener. cellulose disks (27.4 mm2); test comp. sol. applied in 4x1-μl aliquots; Optomax V image analyzer; dry disk areas; mean percent disk consumption
Further Details (Ecotoxicology)
2 beetles without sex discrimination used in tests after 24 h of starvarion
Comment (Ecotoxicology)
No effect
Reference
Kim, Jae Hak; Mullin, Christopher A.
Journal of Chemical Ecology, 1998 , vol. 24, # 9 p. 1499 - 1511 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Method (Ecotoxicology)
oocytes expressing ρ1L301F GABA mutant receptors; addition of title comp.; activation by title comp. of inward currents; standard two-electrode voltageclamp at -70 mV
Further Details (Ecotoxicology)
in receptors leucine was substituted with phenylalanine (F); perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5
Type (Ecotoxicology)
EC50
Value of Type (Ecotoxicology)
0.85 μmol/l
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Concentration (Ecotoxicology)
0.003 - 3 μmol/l
Method (Ecotoxicology)
oocytes expressing ρ1L301A GABA mutant receptors; addition of title comp.; inhibition by title comp. of spontaneous inward membrane currents; standard two-electrode voltage-clamp at -70 mV
Further Details (Ecotoxicology)
in receptors leucine was substituted with alanine (A); perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5; further investigations using competitive antagonist of GABA receptor 3-AMPA
Type (Ecotoxicology)
IC50
Value of Type
0.12 μmol/l
(Ecotoxicology)
9 of 27
10 of 27
11 of 27
12 of 27
Results
title comp. closed spontaneously opened mutant GABA receptors; 3-AMPA (3 μmol/l) antagonized effect of title comp. (figure, table)
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Concentration (Ecotoxicology)
0.003 - 3 μmol/l
Method (Ecotoxicology)
oocytes expressing ρ1L301G GABA mutant receptors; addition of title comp.; inhibition by title comp. of spontaneous inward membrane currents; standard two-electrode voltage-clamp at -70 mV
Further Details (Ecotoxicology)
in receptors leucine was substituted with glycine (G); perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5
Type (Ecotoxicology)
IC50
Value of Type (Ecotoxicology)
0.33 μmol/l
Results
title comp. closed spontaneously opened mutant GABA receptors (figure, table)
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Concentration (Ecotoxicology)
0.003 - 3 μmol/l
Method (Ecotoxicology)
oocytes expressing ρ1L301S GABA mutant receptors; addition of title comp.; inhibition by title comp. of spontaneous inward membrane currents; standard two-electrode voltage-clamp at -70 mV
Further Details (Ecotoxicology)
in receptors leucine was substituted with serine (S); perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5
Type (Ecotoxicology)
IC50
Value of Type (Ecotoxicology)
0.18 μmol/l
Results
title comp. closed spontaneously opened mutant GABA receptors (figure, table)
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Concentration (Ecotoxicology)
0.003 - 3 μmol/l
Method (Ecotoxicology)
oocytes expressing ρ1L301T GABA mutant receptors; addition of title comp.; inhibition by title comp. of spontaneous inward membrane currents; standard two-electrode voltage-clamp at -70 mV
Further Details (Ecotoxicology)
in receptors leucine was substituted with threonine (T); perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5; 10 mV hyperpolarizing voltage steps were applied before, during and after addition of title comp.
Type (Ecotoxicology)
IC50
Value of Type (Ecotoxicology)
0.021 μmol/l
Results
title comp. decreased current step in response to 10-mV voltage step indicating decrease in membrane conductance (figure, table)
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
13 of 27
14 of 27
15 of 27
16 of 27
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Method (Ecotoxicology)
oocytes expressing ρ1L301I GABA mutant receptors; addition of title comp.; activation by title comp. of inward currents; standard two-electrode voltageclamp at -70 mV
Further Details (Ecotoxicology)
in receptors leucine was substituted with isoleucine (I); perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5
Type (Ecotoxicology)
EC50
Value of Type (Ecotoxicology)
0.55 μmol/l
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Method (Ecotoxicology)
oocytes expressing ρ1L301V GABA mutant receptors; addition of title comp.; activation by title comp. of inward currents; standard two-electrode voltageclamp at -70 mV
Further Details (Ecotoxicology)
in receptors leucine was substituted with valine (V); perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5
Type (Ecotoxicology)
EC50
Value of Type (Ecotoxicology)
2.27 μmol/l
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Method (Ecotoxicology)
oocytes expressing ρ1L301Y GABA mutant receptors; addition of title comp.; activation by title comp. of inward currents; standard two-electrode voltageclamp at -70 mV
Further Details (Ecotoxicology)
in receptors leucine was substituted with tyrosine (Y); perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5
Type (Ecotoxicology)
EC50
Value of Type (Ecotoxicology)
1.81 μmol/l
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Method (Ecotoxicology)
oocytes expressing wild-type ρ GABA receptors; addition of title comp.; activation by title comp. of inward currents; standard two-electrode voltage-clamp at -70 mV
Further Details (Ecotoxicology)
perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5; further investigations using competitive GABA antagonist 3-AMPA
Type (Ecotoxicology)
EC50
Value of Type (Ecotoxicology)
1.16 μmol/l
Results
effect of title comp. was antagonized by 3-AMPA (figure)
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem
Xenopus laevis oocytes
(Ecotoxicology)
17 of 27
18 of 27
19 of 27
20 of 27
Concentration (Ecotoxicology)
3 μmol/l
Method (Ecotoxicology)
oocytes expressing wild-type ρ GABA receptors; addition of title comp.; effect of title comp. on membrane currents; standard two-electrode voltage-clamp at -70 mV
Further Details (Ecotoxicology)
perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5; further investigations using noncompetitive GABA receptor antagonist picrotoxin
Results
title comp. produced large inward current, that was blocked by picrotoxin in concentration-dependent manner (figure)
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Concentration (Ecotoxicology)
3 - 3000 μmol/l
Method (Ecotoxicology)
oocytes expressing ρ1L301A, ρ1L301G, ρ1L301S or ρ1L301T GABA mutant receptors; addition of title comp.; effect of title comp. on membrane currents; standard two-electrode voltage-clamp at -70 mV
Further Details (Ecotoxicology)
in receptors leucine was substituted with alanine (A), glycine (G), serine (S) or threonine (T); perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5
Results
title comp. initially blocked receptors producing outward currents, then receptors were activated producing inward currents; after removal of title comp. channels were closed and then reopened (figure)
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
membrane current; effect on
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Concentration (Ecotoxicology)
10 μmol/l
Method (Ecotoxicology)
oocytes expressing wild-type ρ1 GABA mutant receptors; continuous application of title comp.; effect of title comp. on reversal potential was determined; standard two-electrode voltage-clamp at -70 mV
Further Details (Ecotoxicology)
control: without title comp.; perfusion solution (mmol/l): 92.2 NaCl, 2.5 KCl, 5 HEPES, 1 CaCl2, 1 MgCl2, pH 7.5
Results
title comp. caused positive shift of reversal potential
Reference
Chang, Yongchang; Weiss, David S.
Molecular Pharmacology, 1998 , vol. 53, # 3 p. 511 - 523 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
behavioral symtoms
Species or TestSystem (Ecotoxicology)
Globodera pallida pathotype Pa2/3, potato cyst nematode
Sex
male
Kind of Dosing (Ecotoxicology)
10 μl of title comp. was introduced onto the center of the agar
Method (Ecotoxicology)
behavioral bioassay; 20 adult males; 6-cm-diameter Petri dish; 1.5 percent (w/v) freshly prepared water agar (depth 1.0-1.5 mm); 20 deg C; low light intensity; nematode was placed at a known point 0.5 cm from the edge of the Petri dish; experiment time 1 h
Further Details (Ecotoxicology)
influence on the distance traveled by males; strong response would be demonstrated by movement of 1.0-2.0 cm; control: artificial tap water, 0.08 cm
Results
mean distance traveled by males: 0.43 cm/h
Reference
Riga, Ekaterini; Perry, Roland N.; Barrett, John; Johnston, Mike R. L.
Journal of Chemical Ecology, 1997 , vol. 23, # 2 p. 417 - 428 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
behavioral symtoms
Species or TestSystem (Ecotoxicology)
Globodera rostochiensis pathotype Ro1, potato cyst nematode
Sex
male
Kind of Dosing (Ecotoxicology)
10 μl of title comp. was introduced onto the center of the agar
Method (Ecotoxicology)
behavioral bioassay; 20 adult males; 6-cm-diameter Petri dish; 1.5 percent (w/v) freshly prepared water agar (depth 1.0-1.5 mm); 20 deg C; low light intensity; nematode was placed at a known point 0.5 cm from the edge of the Petri dish; experiment time 1 h
Further Details (Ecotoxicology)
influence on the distance traveled by males; strong response would be demonstrated by movement of 1.0-2.0 cm; control: artificial tap water, 0.08 cm
Results
mean distance traveled by males: 0 cm/h
Reference
Riga, Ekaterini; Perry, Roland N.; Barrett, John; Johnston, Mike R. L.
Journal of Chemical Ecology, 1997 , vol. 23, # 2 p. 417 - 428 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
electrophysiological
Species or TestSystem (Ecotoxicology)
Globodera pallida pathotype Pa2/3, potato cyst nematode
Sex
male
Concentration (Ecotoxicology)
10 mmol/l
Kind of Dosing (Ecotoxicology)
test solution was immediately pipetted onto the nematode
Method (Ecotoxicology)
extracellular recording; 5 adult nematodes; plastic well with artificial tap water (ATW); recording electrode: cephalic region of nematode; indifferent electrode: in the ATW close to the cephalic region
Further Details (Ecotoxicology)
electrical activity was recorded from each nematode before, during, and after stimulation for up to 20-30 min at 20 deg C
Results
strong response in 1 male, slight respone in 3 males, no response in 1 male; mean number of spikes per second before, during, and after exposure: 44, 139, 65, resp.
Reference
Riga, Ekaterini; Perry, Roland N.; Barrett, John; Johnston, Mike R. L.
Journal of Chemical Ecology, 1997 , vol. 23, # 2 p. 417 - 428 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
electrophysiological
Species or TestSystem (Ecotoxicology)
Globodera rostochiensis pathotype Ro1, potato cyst nematode
Sex
male
Concentration (Ecotoxicology)
10 mmol/l
Kind of Dosing (Ecotoxicology)
test solution was immediately pipetted onto the nematode
Method (Ecotoxicology)
extracellular recording; 5 adult nematodes; plastic well with artificial tap water (ATW); recording electrode: cephalic region of nematode; indifferent electrode: in the ATW close to the cephalic region
Further Details (Ecotoxicology)
electrical activity was recorded from each nematode before, during, and after stimulation for up to 20-30 min at 20 deg C
Comment (Ecotoxicology)
No effect
Reference
Riga, Ekaterini; Perry, Roland N.; Barrett, John; Johnston, Mike R. L.
Journal of Chemical Ecology, 1997 , vol. 23, # 2 p. 417 - 428 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
chloride channel opener
Species or TestSystem (Ecotoxicology)
Xenopus laevis oocytes
Concentration (Ecotoxicology)
3 - 3000 μmol/l
Method (Ecotoxicology)
cells injected with cRNA of wild-type Drosophila melanogaster GABA-receptor RDL subunit; perfused with saline; title comp. added to perfusate
Further Details (Ecotoxicology)
membrane currents (I) recorded with two-electrode voltage-clamp (-60 mV; 20 deg C)
Type (Ecotoxicology)
EC50
Hide facts 21 of 27
22 of 27
23 of 27
24 of 27
25 of 27
26 of 27
27 of 27
Value of Type (Ecotoxicology)
28.0 μmol/l
Results
dose-dependent inward currents; at higher conc. desensitization observed
Reference
Hosie, Alastair M.; Sattelle, David B.
British Journal of Pharmacology, 1996 , vol. 117, # 6 p. 1229 - 1237 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
enzyme induction
Species or TestSystem (Ecotoxicology)
DNA gyrase from Staphylococcus aureus FDA 209-P (Sa)
Concentration (Ecotoxicology)
700 mmol/l
Exposure Period (Ecotoxicology)
1 h
Method (Ecotoxicology)
Sa cells lysed; precipitated; chromatographed; enzyme isolated from protein fraction; incub. in Tris-containing buffer with relaxed pBR322 plasmid DNA (pH 7.7; 37 deg C); analysed by electrophoresis
Further Details (Ecotoxicology)
unit of supercoiling activity (SA, U/μg): amount of enzyme to catalyze supercoiling of 50 percent of the relaxed pBR322 DNA; title comp. effect on SA studied
Comment (Ecotoxicology)
No effect
Reference
Blanche, Francis; Cameron, Beatrice; Bernard, Francois-Xavier; Maton, Laurent; Manse, Benedicte; Ferrero, Lucy; Ratet, Nathalie; Lecoq, Claudine; Goniot, Anne; Bisch, Didier; Crouzet, Joel
Antimicrobial Agents and Chemotherapy, 1996 , vol. 40, # 12 p. 2714 - 2720 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
accumulation
Species or TestSystem (Ecotoxicology)
crustose red algae (CRA)
Exposure Period (Ecotoxicology)
120 h
Method (Ecotoxicology)
stones (1-2 cm) covered CRA; from Cable Bay, Nelson; placed in seawater amended with 50-1000 μM putrescine and 0.4 μCi/ml 1,4-(3)H-putrescine; with or without 10 μg/ml gabaculine; determined production of title comp. at various intervals over 120 h
Further Details (Ecotoxicology)
seawater and stones were collected from the same area; at 25 deg C; controls with 0.4 percent formalin or without stones; measured conc. title comp. by derivatisation with phenylisothiocyanate followed by HPLC
Results
no formation of title comp. in absence of gabaculine; time-dependent accumulation of title comp. in the presence of gabaculine; maximal levels after 96 h: 70 μM title comp. at 1 mM putrescine, <=45 μM title comp. at < 1 mM putrescine
Reference
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 212 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
accumulation
Species or TestSystem (Ecotoxicology)
crustose red algae (CRA)
Exposure Period (Ecotoxicology)
120 h
Method (Ecotoxicology)
stones (1-2 cm) covered CRA; from Cable Bay, Nelson; placed in seawater amended with 50-1000 μM glutamate and 0.5 μCi/ml L-<G-(3)H>glutamate; with or without 10 μg/ml gabaculine; determined production of title comp. at various intervals over 120 h
Further Details (Ecotoxicology)
seawater and stones were collected from the same area; at 25 deg C; controls with 0.4 percent formalin or without stones; measured conc. title comp. by derivatisation with phenylisothiocyanate followed by HPLC
Results
no formation of title comp. in presence or absence of gabaculine
Reference
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 212 Title/Abstract Full Text View citing articles Show Details
Effect (Ecotoxicology)
electrophysiological
Species or TestSystem (Ecotoxicology)
Diabrotica virgifera virgifera LeConte, corn rootworm
Concentration (Ecotoxicology)
1E-06 - 0.01 mol/l
Method
standard tip-recording technique; newly emerged adults used; galeal chemosensilla
(Ecotoxicology) Further Details (Ecotoxicology)
in 0.01 M KCl
Results
dose-response curve; stimulated a single cell over a conc. range of 1 μM to 10 mM; substantial increase in the firing rate observed >100 μM
Reference
Chyb, Sylwester; Eichenseer, Herbert; Hollister, Benedict; Mullin, Christopher A.; Frazier, James L.
Journal of Chemical Ecology, 1995 , vol. 21, # 3 p. 313 - 330 Title/Abstract Full Text View citing articles Show Details
Other Data Biodegradation (5) 1 of 5
2 of 5
3 of 5
4 of 5
Type (Biodegradation)
aerobic
Inoculum
crustose red algae (CRA)
Concentration (Biodegradation)
10 μmol/l
Temperature (Biodegradation)
14 - 22 °C
Method, Remarks (Biodegradation)
in aquaria; coralline CRA-covered stones, 1-4 cm; from Cable Bay, Nelson; added seawater with title comp.; incubated 7-10 h; determined conc. title comp. by HPLC; degradation rate: 0.45-1.12 nmol/cm-2/h; seasonal effect on degradation rate
Reference
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 212 Title/Abstract Full Text View citing articles Show Details
Type (Biodegradation)
aerobic
Inoculum
crustose red algae (CRA)
Concentration (Biodegradation)
10 μmol/l
Degradation Rate (Biodegradation)
Ca. 40 - 50 percent %
Exposure Period (Biodegradation)
7 - 8 h
Method, Remarks (Biodegradation)
coralline CRA-covered stones, 1-4 cm; from Cable Bay, Nelson; exposed to grazers in aquaria 0-7 d; removed; incubated with title comp. for 1-8 h; no differ. in degradation rate between grazed and ungrazed stones; presented as graph
Reference
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 212 Title/Abstract Full Text View citing articles Show Details
Type (Biodegradation)
aerobic
Inoculum
crustose red algae (CRA)
Concentration (Biodegradation)
10 μmol/l
Degradation Rate (Biodegradation)
Ca. 95 - 100 percent %
Exposure Period (Biodegradation)
6 - 7.5 h
Method, Remarks (Biodegradation)
coralline CRA-covered stones, 1-4 cm; from Cable Bay, Nelson; exposed to grazers in aquaria 15 or 22 d; removed; incubated with title comp. for 1-8 h; 95100 percent degraded with ungrazed stones; ca. 6 percent and 0 percent degraded with 15- and 22-days grazed stones
Reference
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 212 Title/Abstract Full Text View citing articles Show Details
Type (Biodegradation)
aerobic
Inoculum
crustose red algae (CRA)
Concentration (Biodegradation)
10 μmol/l
Degradation Rate (Biodegradation)
Ca. 100 percent %
Exposure Period
5.5 - 7 h
(Biodegradation)
5 of 5
Method, Remarks (Biodegradation)
coralline CRA-covered stones or bare stones; from Cable Bay, Nelson; incubated with title comp. for 0.1-8 h; 100 percent degraded with CRA-coverted stones for 5.5 h and with bare stones for 7 h; no degradation with water or acetone-wiped stones
Reference
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 212 Title/Abstract Full Text View citing articles Show Details
Type (Biodegradation)
aerobic
Inoculum
crustose red algae (CRA)
Concentration (Biodegradation)
10 μmol/l
Method, Remarks (Biodegradation)
with young biofilms; from tidal rock pool; from Cable Bay, Nelson; taken at 5-80 days; incubated with title comp. for 1-8 h; degradation rate ca. 100-380 pmol/cm-2/h; degradation rate signif. higher for marbles in plastic netting than for individual
Reference
Kaspar; Mountfort
FEMS Microbiology Ecology, 1995 , vol. 17, # 3 p. 205 - 212 Title/Abstract Full Text View citing articles Show Details
Use (200) Use Pattern
Location
Reference
Cosmetics/dental/toilet
Page/Page column 17; 18
Sunny BioDiscovery, Inc.; Bojanowski, Krzysztof; Zhao, Hui
Patent: US9238153 B2, 2016 ;
Page/Page column 17; 18
Sunny BioDiscovery, Inc.; Bojanowski, Krzysztof; Zhao, Hui
Patent: US9238153 B2, 2016 ;
Page/Page column 17; 18
Sunny BioDiscovery, Inc.; Bojanowski, Krzysztof; Zhao, Hui
Patent: US9238153 B2, 2016 ;
Page/Page column 17; 18
Sunny BioDiscovery, Inc.; Bojanowski, Krzysztof; Zhao, Hui
Patent: US9238153 B2, 2016 ;
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ;
Pharmaceuticals
component of bioadhesive patch
component of slow release bioadhesive patch
Pharmaceuticals
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
anti-inflammatory
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
anti-osteoporosis activity
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
antioxidant
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
body temperature stabilization
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
body weight stabilization
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ;
Title/Abstract Full Text Show Details
cardioprotective activity
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
estrogenic activity
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
managing menopause/estrogen deficiency
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
reduces risks or symptoms of estrogen deficiency body weight gain
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
reduces risks or symptoms of estrogen deficiency cardiovascular disease
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
reduces risks or symptoms of estrogen deficiency elevated body temperature
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
reduces risks or symptoms of estrogen deficiency inflammation
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
reduces risks or symptoms of estrogen deficiency osteoporosis
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
reduces risks or symptoms of estrogen deficiency oxidative stress
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
reduces risks or symptoms of estrogen deficiency reproductive system atrophy or discomfort
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
Show next 20
Hide facts
Use Pattern
Location
Reference
up-regulation of genes promoting bone formation
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ; Title/Abstract Full Text Show Details
up-regulation of genes promoting uterine proliferation
Page/Page column 28
UNIVERSITI PUTRA MALAYSIA; ISMAIL, Maznah; MUHAMMAD SANI, Ismaila; MAHMUD, Rozi; ABU BAKAR&at;ZAKRIYA, Zuki
Patent: WO2015/76667 A1, 2015 ;
Title/Abstract Full Text Show Details
Dravet's syndrome
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
Pharmaceuticals
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
attention deficit hyperactivity disorder
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
autism spectrum disorder
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
controlling hippocampal neural circuit hyperexcitability occurring in a neurological disease with combination of adenosine, an adenosine mimetic, an adenosine modulator, an adenosine transport inhibitor and an adenosine receptor agonist
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
disorder associated with epileptogenesis
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
febrile seizures
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
intractable epilepsy
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
neurological disease
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
severe myoclonic epilepsy
Page/Page column 29-32
UNIVERSITY OF HOUSTON; ZIRBURKUS, Jokubas; ERIKSEN, Jason; GU, Feng
Patent: WO2014/28883 A1, 2014 ; Title/Abstract Full Text Show Details
Pharmaceuticals
bacterial infections
Agricultural use
amino acid component for preparing of amino acid-containing cyanoacrylate polymer nanoparticles as antibacterial agent
Page/Page column 56-59
BIOLOG, INC.; BOCHNER, Barry; LEI, Xiang-He
Patent: WO2014/130655 A2, 2014 ;
Page/Page column 56-59
BIOLOG, INC.; BOCHNER, Barry; LEI, Xiang-He
Patent: WO2014/130655 A2, 2014 ;
Page/Page column 11; 12
Shirotake, Shoichi
Patent: EP2805617 A1, 2014 ;
Page/Page
Shirotake, Shoichi
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
against plant disease-causing bacteria
column 11; 12
Patent: EP2805617 A1, 2014 ;
pain
MOSKOWITZ, Michael; GOLDEN, Maria, Depolo; GORDON, Dana
Patent: WO2013/2749 A1, 2013 ;
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
Pharmaceuticals
delaying the onset of diabetes
treating hyperglycemia
stimulation of VR1 receptor (capsaicin receptor)
Page/Page column 37
Ligon, Brooke
Patent: US2013/252886 A1, 2013 ;
Page/Page column 37
Ligon, Brooke
Patent: US2013/252886 A1, 2013 ;
Page/Page column 37
Ligon, Brooke
Patent: US2013/252886 A1, 2013 ;
AJINOMOTO CO. INC
Patent: US2009/170942 A1, 2009 ;
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
blood circulation enhancer
AJINOMOTO CO. INC
Patent: US2009/170942 A1, 2009 ; Title/Abstract Full Text Show Details
gamma-amino butyric acid (GABA) receptor agonist; pontine micturition centre (PMC) modulator; periaqueductal gray (PAG) modulator
Overactive bladder (OAB)
Bruinstroop, Jan Kees Piet
Patent: EP1889612 A2, 2008 ; Title/Abstract Full Text Show Details
Bruinstroop, Jan Kees Piet
Patent: EP1889612 A2, 2008 ; Title/Abstract Full Text Show Details
urge incontinence
Bruinstroop, Jan Kees Piet
Patent: EP1889612 A2, 2008 ; Title/Abstract Full Text Show Details
Migraine headaches
Rose, Abe
Patent: US2008/139510 A1, 2008 ; Title/Abstract Full Text Show Details
Acute pain of a classic migraine headache
Rose, Abe
Patent: US2008/139510 A1, 2008 ; Title/Abstract Full Text Show Details
Classic migraine attack
Rose, Abe
Patent: US2008/139510 A1, 2008 ; Title/Abstract Full Text Show Details
Headache symptoms
Rose, Abe
Patent: US2008/139510 A1, 2008 ; Title/Abstract Full Text Show Details
Acute migraine pain
Rose, Abe
Patent: US2008/139510 A1, 2008 ; Title/Abstract Full Text Show Details
Migraine
Rose, Abe
Patent: US2008/139510 A1, 2008 ;
Title/Abstract Full Text Show Details
Cranial pain
Rose, Abe
Patent: US2008/139510 A1, 2008 ; Title/Abstract Full Text Show Details
Associated symptoms of classic migraine
Rose, Abe
Patent: US2008/139510 A1, 2008 ; Title/Abstract Full Text Show Details
antidepressant
The Jordanian Pharmaceutical Manufacturing Co.
Patent: EP1955693 A1, 2008 ; Title/Abstract Full Text Show Details
The Jordanian Pharmaceutical Manufacturing Co.
Patent: EP1955710 A1, 2008 ; Title/Abstract Full Text Show Details
The Jordanian Pharmaceutical Manufacturing Co.
Patent: EP1955711 A1, 2008 ; Title/Abstract Full Text Show Details
self-immolative linker
pest control composition
suppressive neuro transmitter
Page/Page column 31; 80-81; 87; 4/8
ONCONOVA THERAPEUTICS, INC.
Patent: WO2008/33475 A2, 2008 ;
Page/Page column 23
ACTIVETRAD (PROPRIETARY) LIMITED
Patent: WO2008/110984 A1, 2008 ;
Taiyokagaku Co., Ltd.
Patent: EP1743633 A1, 2007 ;
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
sleep improvement composition
Taiyokagaku Co., Ltd.
Patent: EP1743633 A1, 2007 ; Title/Abstract Full Text Show Details
sleep disorder
Taiyokagaku Co., Ltd.
Patent: EP1743633 A1, 2007 ; Title/Abstract Full Text Show Details
an anti-HP agent
ANTROMED INC
Patent: US2007/21508 A1, 2007 ; Title/Abstract Full Text Show Details
cosmetic composition for promoting collagen biosynthesis
DOOSAN CORPORATION; BIOVAN CO., LTD.
Patent: WO2007/7989 A1, 2007 ; Title/Abstract Full Text Show Details
preventing or improving skin senescence
DOOSAN CORPORATION; BIOVAN CO., LTD.
Patent: WO2007/7989 A1, 2007 ; Title/Abstract Full Text Show Details
anti-inflammatory
DOOSAN CORPORATION; BIOVAN CO., LTD.
Patent: WO2007/7989 A1, 2007 ; Title/Abstract Full Text Show Details
preventing or improving skin injury
DOOSAN CORPORATION; BIOVAN CO., LTD.
Patent: WO2007/7989 A1, 2007 ; Title/Abstract Full Text Show Details
GAT2 substrate
XenoPort, Inc.
Patent: US2007/86950 A1, 2007 ;
Title/Abstract Full Text Show Details
conjugate formed from a neuropharmaceutical agent or imaging component
XenoPort, Inc.
Patent: US2007/86950 A1, 2007 ; Title/Abstract Full Text Show Details
stabilizing agent of composition comprising plasmin or an enzymatically equivalent derivative thereof and matrix metalloproteinase (MMP) inhibitor for effecting or inducing a controlled posterior vitreous detachment (PVD) and treatment of potential complication of a pathological ocular condition
growth factor modulator; cytokine modulator; neuronal element response modulator; vascular element response modulator; neuronal receptors modulator; block the modulation of neuronal or vascular elements by a pro-inflammatory molecule; glial cells modulator
Removal of vascular extensions form a degenerating disc
Bartels, Stephen P.
Patent: US2007/212358 A1, 2007 ; Title/Abstract Full Text Show Details
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
Removal of neuronal extensions form a degenerating disc
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
Discogenic pain
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
Neck pain
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
Back pain
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
Back pain with radiculopathy
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
Neck pain with radiculopathy
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
Back pain without radiculopathy
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
Neck pain without radiculopathy
Roy, Josee; Drapeau, Susan J.; Marx, Jeffrey C.
Patent: US2007/253930 A1, 2007 ; Title/Abstract Full Text Show Details
zwitterionic stabilizer in a dental whitening composition
Sharma, Deepak; Edelstein, Jenette Suh
Patent: US2007/231276 A1, 2007 ; Title/Abstract Full Text Show Details
sympathoinhibitory substance
KAO CORPORATION
Patent: US2006/115517 A1, 2006 ; Title/Abstract Full Text Show Details
Neurotransmitter
The Research Foundation of the City University of New York; New York University
Patent: US7112319 B2, 2006 ; Title/Abstract Full Text Show Details
neuromuscular inhibitor
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
wrinkles
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Neuromuscular impulses
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Fine lines
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Protection of the face
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Protection of the neck
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Protection of the hands
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Protection of the body
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Treatment of the face
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Treatment of the neck
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Treatment of the hands
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Treatment of the body
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Makeup composition
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Composition for artificial tanning
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Day creams
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Night creams
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ;
Title/Abstract Full Text Show Details
Sunscreen creams
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Sunscreen oils
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Lotions
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Body milks
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
Foundation
Woodridge Labs, Inc.
Patent: US2006/198809 A1, 2006 ; Title/Abstract Full Text Show Details
neurotransmitter
Ophthalmic Research Associates, Inc.
Patent: US2006/270592 A1, 2006 ; Title/Abstract Full Text Show Details
Dry eye condition
Ophthalmic Research Associates, Inc.
Patent: US2006/270592 A1, 2006 ; Title/Abstract Full Text Show Details
Ocular allergy
Ophthalmic Research Associates, Inc.
Patent: US2006/270592 A1, 2006 ; Title/Abstract Full Text Show Details
neurological disease
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
epilepsy
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
seizures secondary to stroke
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
head/brain trauma
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
chronic pain
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
neuropathic pain
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ;
Title/Abstract Full Text Show Details
muscular pain
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
skeletal pain
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
tardive dyskinesia or migraines
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
reflect sympathetic dystrophy syndrome (RSD)
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
fibromyalgia
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
bi-polar disease
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
panic
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
anxiety
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
depression
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
alcoholism
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
manic behavior
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
premenstrual tension
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
mood swings
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
hot flashes
PHARMANOVA INC.; QUAY PHARMACEUTICALS LTD.
Patent: WO2006/78811 A2, 2006 ; Title/Abstract Full Text Show Details
liquid seasoning having an antihypertensive effect
Kao Corporation
Patent: US2006/105065 A1, 2006 ; Title/Abstract Full Text Show Details
antihypertensive agent
Kao Corporation
Patent: US2006/105065 A1, 2006 ; Title/Abstract Full Text Show Details
ocular disorders
NOVARTIS AG; NOVARTIS PHARMA GMBH
Patent: WO2005/39594 A1, 2005 ; Title/Abstract Full Text Show Details
myopia
NOVARTIS AG; NOVARTIS PHARMA GMBH
Patent: WO2005/39594 A1, 2005 ; Title/Abstract Full Text Show Details
An agent for improving mobility and general health of senior companion animals
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
pet food additive
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
pet food
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
difficulty breathing
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
forced or labored breathing
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
leg trembling
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
difficulty walking
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
decreased reaction times
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
decreased excretion
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ;
Title/Abstract Full Text Show Details
failure of one or more of the five senses
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
loss of directional sense
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
inactivity
Inagawa, Kentaro; Bannai, Makoto; Seki, Shinobu; Kogure, Norio
Patent: US2005/106220 A1, 2005 ; Title/Abstract Full Text Show Details
Agonist to the Cl- channel-involving bicuculline sensitive receptor
SHISEIDO COMPANY LIMITED
Patent: EP1550459 A1, 2005 ; Title/Abstract Full Text Show Details
Parakeratosis inhibitor
SHISEIDO COMPANY LIMITED
Patent: EP1550459 A1, 2005 ; Title/Abstract Full Text Show Details
Parakeratosis inhibitory skin preparation for external use
SHISEIDO COMPANY LIMITED
Patent: EP1550459 A1, 2005 ; Title/Abstract Full Text Show Details
Pore-shrinking agent
SHISEIDO COMPANY LIMITED
Patent: EP1550459 A1, 2005 ; Title/Abstract Full Text Show Details
Pore-shrinking skin preparation for external use
SHISEIDO COMPANY LIMITED
Patent: EP1550459 A1, 2005 ; Title/Abstract Full Text Show Details
starting material
Goldschmidt GmbH
Patent: EP1566375 A1, 2005 ; Title/Abstract Full Text Show Details
synthesis of amino acid esters
Goldschmidt GmbH
Patent: EP1566375 A1, 2005 ; Title/Abstract Full Text Show Details
γ-aminobutyric acid (GABAB) receptor agonist
Han, Chien-Hsuan; Hsu, Ann F.; Hsu, Larry; Hsiao, Charles; Teng, Ching-Ling Diana
Patent: US2005/220864 A1, 2005 ; Title/Abstract Full Text Show Details
damaged tissue
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
damaged skin
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
scurvy
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
atopic dermatosis
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ;
Title/Abstract Full Text Show Details
psoriasis
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
pemphigus
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
congenital biliary atresia
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
stem cell focused disease
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
bronchial asthma
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
reducing the risk of kidney transplantation rejections
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
inflammatory bowel diseases
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
ulcerative colitis
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
mucous colitis
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
liver disease
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
deforming diseases
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
leprosy
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
skin damage
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
nerve damage
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
bacterial infections
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ;
Title/Abstract Full Text Show Details
bacterial epidemics
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
drug resistant tuberculosis epidemics
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
skin diseases
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
hair diseases
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
nails diseases
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
teeth diseases
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
healing and reduce the risks of corneal graft rejection
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
milk allergies
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
colitis
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
autoimmune diseases
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
AIDS
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
damaged eye
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
damaged liver
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
damaged gastrointestinal organ
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
damaged kidney
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
damaged lung
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
damaged bowel tissue
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
Crohn's disease
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
inflammatory bowel disease
Girsh, Leonard S.
Patent: US6974796 B1, 2005 ; Title/Abstract Full Text Show Details
restoring healthy energy balance in humans and animals, aiding in weight management efforts
Lee, Steve S.; Hynson, Richard B.; Zhang, Ke-Qin; Li, Wu-Zhou; Zhou, Jing Shi
Patent: US2005/233013 A1, 2005 ; Title/Abstract Full Text Show Details
balancing blood sugar levels by way of assisting the body to make more efficient use of existing (i.e., endogenous) insulin
Lee, Steve S.; Hynson, Richard B.; Zhang, Ke-Qin; Li, Wu-Zhou; Zhou, Jing Shi
Patent: US2005/233013 A1, 2005 ; Title/Abstract Full Text Show Details
enhancing the transport of glucose into muscle cells
Lee, Steve S.; Hynson, Richard B.; Zhang, Ke-Qin; Li, Wu-Zhou; Zhou, Jing Shi
Patent: US2005/233013 A1, 2005 ; Title/Abstract Full Text Show Details
GABAB receptor agonist
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
synaptic plasticity
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
cognitive function
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
memory impairment
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
Alzheimer's disease
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
dementia
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
attention deficit disorder
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
mild cognitive impairment
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
forgetfulness
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
pharmaceutical composition
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Patent: WO2005/37215 A2, 2005 ; Title/Abstract Full Text Show Details
Agent for incorporation during peptide synthesis
CRC FOR ASTHMA LIMITED
Patent: WO2004/84890 A1, 2004 ; Title/Abstract Full Text Show Details
Isolation from Natural Product (38) Isolation from Natural Product
Location
Reference
extract of barley germ
Paragraph 0025; 0032; 0039
Chen, Ken
Patent: CN105367433 A, 2016 ;
Paragraph 0037
Shanghai Pharmaceutical on the first biochemical Pharmaceutical Co; Yuan, Yonglei; Ding, Jinguo; Huang, Zhenghui; Li, Yingfei
Patent: CN105669480 A, 2016 ;
ethanolic extract of Trichosanthes kirilowii
Title/Abstract Full Text Show Details
Title/Abstract Full Text Show Details
leaves of Suregada glomerulata; collected in Hainan, China
Yan, Ren-Yi; Wang, Hong-Qing; Liu, Chao; Chen, Ruo-Yun; Yu, De-Quan
Fitoterapia, 2011 , vol. 82, # 2 p. 247 - 250 Title/Abstract Full Text View citing articles Show Details
leaves and roots of Withania somnifera genotype NMITLI-101, Ashwagandha/Indian ginseng/winter cherry
Chatterjee, Sandipan; Srivastava, Shatakshi; Khalid, Asna; Singh, Niharika; Sangwan, Rajender Singh; Sidhu, Om Prakash; Roy, Raja; Khetrapal; Tuli, Rakesh
Phytochemistry, 2010 , vol. 71, # 10 p. 1085 - 1094 Title/Abstract Full Text View citing articles Show Details
mature leaves of Capsicum annuum var. angulosum, sweet pepper
Dekebo, Aman; Kashiwagi, Takehiro; Tebayashi, Shin-Ich; Kim, Chul-Sa
Bioscience, Biotechnology and Biochemistry, 2007 , vol. 71, # 2 p. 421 - 426 Title/Abstract Full Text View citing articles Show Details
Fenugreek (Trigonella foenum graecum), seeds
Lee, Steve S.; Hynson, Richard B.; Zhang, Ke-Qin; Li, Wu-Zhou; Zhou, Jing Shi
Patent: US2005/233013 A1, 2005 ; Title/Abstract Full Text Show Details
seeds of Cycas revoluta
Pan, Meide; Mabry, Tom J.; Beale, John M.; Mamiya, Blain M.
Phytochemistry, 1997 , vol. 45, # 3 p. 517 - 519 Title/Abstract Full Text View citing articles Show Details
red-mold rice prepared with Monascus pilosus
Kohama; Matsumoto; Mimura; Tanabe; Inada; Nakanishi
Chemical and Pharmaceutical Bulletin, 1987 , vol. 35, # 6 p. 2484 - 2489 Title/Abstract Full Text View citing articles Show Details
the root bark of mulberry tree (Morus bombycis KOIDZ)
Daigo; Inamori; Takemoto
Chemical and Pharmaceutical Bulletin, 1986 , vol. 34, # 5 p. 2243 - 2246 Title/Abstract Full Text View citing articles Show Details
thes de Ceylan, thes Yunnan Tuocha, thes du Grand Yunnan
Chaboud; Debourcieu; Raynaud
Pharmazie, 1986 , vol. 41, # 1 p. 72 - 74 Title/Abstract Full Text View citing articles Show Details
the seeds of Castanea sativa and C. crenata varieties, in three stages of maturity; Limousin, France, autumn 1982, measuring the amounts
Desmaison, A. M.; Marcher, M. H.; Tixier, M.
Phytochemistry (Elsevier), 1984 , vol. 23, # 11 p. 2453 - 2456 Title/Abstract Full Text View citing articles Show Details
aus Alge Chlorella pyrenoidosa, %13&CO2
London et al.
Journal of the American Chemical Society, 1978 , vol. 100, p. 3723,3724,3725 Full Text View citing articles Show Details
Naematoloma fasciculare
Diak
Planta Medica, 1977 , vol. 32, p. 181,186 Full Text Show Details
Antirrhinum majus
Pande; Harkiss
Planta Medica, 1976 , vol. 30, p. 317,318 Full Text Show Details
Wurzeln von Astragalus membranaceus
Hikino et al.
Planta Medica, 1976 , vol. 30, p. 297,301 Full Text Show Details
aus Quisqualis Fructus
Takemoto; Takagi; Nakajima; Koike
Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan, 1975 , vol. 95, # 2 p. 176 - 179 Title/Abstract Full Text View citing articles Show Details
Pisum sativum
Grobbelaar; Steward
Phytochemistry (Elsevier), 1969 , vol. 8, p. 553,557 Full Text Show Details
in hecanora (Aspicilia)Myrinii
Solberg
Z. Naturforsch., B: Anorg. Chem., Org. Chem., Biochem., Biophys.,, 1969 , vol. 24, p. 447 Full Text Show Details
Vork. u. Verteilung in d. Organen von Rauwolfia serpentina Benth.
Madan
Planta Medica, 1967 , vol. 15, p. 118,119 Full Text Show Details
Vork. in Lunaria annua
Larsen,P.O.
Acta Chemica Scandinavica (1947-1973), 1967 , vol. 21, p. 1592 - 1604 Full Text View citing articles Show Details
Hide facts Isolation from Natural Product
Reference
Vork. u. Isolier. aus d. Myzel saprophytischer Kulturen von Claviceps purpurea
Kirsten et al.
Planta Medica, 1966 , vol. 14, p. 241,242 Full Text Show Details
in Erbsenkeimlingen nach Bhdl. m. 5-Amino-2-oxo-valeriansaeure
Macholan et al.
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1965 , vol. 340, p. 97,101 Full Text Show Details
im Gift von Bombina variegata L.
Miehl; Bachmayer
Monatshefte fuer Chemie, 1964 , vol. 95, p. 480,482 Chem.Abstr., 1962 , vol. 56, # 5380 Full Text Show Details
Biosynthese aus Glyoxylsaeure in Samen von Oelpflanzen
Morgunova et al.
Doklady Biochemistry, 1964 , vol. 156, p. 162,163 p. 467 Full Text Show Details
im Samen von Lunaria annua
Larsen,P.O.
Acta Chemica Scandinavica (1947-1973), 1962 , vol. 16, p. 1511 - 1518 Full Text View citing articles Show Details
in wss. Extrakten von Catha edulis
Alles,G.A. et al.
Journal of Medicinal and Pharmaceutical Chemistry, 1961 , vol. 3, p. 323 - 352 Full Text View citing articles Show Details
in Puccinia graminis
McKillican
Canadian Journal of Chemistry, 1960 , vol. 38, p. 244,246 Full Text Show Details
in Ascites und Pleura-punktaten
Knauff et al.
Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie, 1960 , vol. 318, p. 73,77 Full Text Show Details
aus Honig (papierchromatogr. isoliert)
Komamine
Suomen Kemistilehti B, 1960 , vol. 33, p. 185 Full Text Show Details
in Harn nach Injektion von Arginin-C%14&
Boulanger; Osteux
Bulletin de la Societe de Pharmacie de Lille, 1960 , p. 27,28 Chem.Abstr., 1961 , # 723 Full Text Show Details
Gehalt in Pflanzenteilen von Atropa belladonna
Schermeister et al.
Journal of the American Pharmaceutical Association, Scientific Edition, 1960 , vol. 49, p. 698 Full Text Show Details
Nachweis in Blaettern und Trieben von Satha edulis Forskal
Winterfeld; Berusmann
Archiv der Pharmazie und Berichte der Deutschen Pharmazeutischen Gesellschaft, 1960 , vol. 293, p. 991,994 Full Text Show Details
in freier Form im Organismus von Gallus domesticus und Geoclemys reevesii
Aoyama
Okayama Igakkai Zasshi, 1959 , vol. 71, p. 5513,5514-5517 Chem.Abstr., 1960 , # 24970 Full Text Show Details
Vorkommen in Kartoffelknollen
Steward; Thompson; Dent
Science (Washington, DC, United States), 1949 , vol. 110, p. 439 Full Text Show Details
Vorkommen in Aepfeln, Aprikosen, Avocato-Birnen und Pflaumen
Joslyn; Stepka
Food Research, 1949 , vol. 14, p. 459 Full Text View citing articles Show Details
Vorkommen im Rinderserum und in der Gewebefluessigkeit des embryonalen Rindermuskels
Gordon
Biochemical Journal, 1949 , vol. 45, p. 101 Full Text Show Details
Vorkommen im aethanol.Extrakt von Corynebacterium diphtheriae nach Hydrolyse mit Saeure
Work
Biochimica et Biophysica Acta, 1949 , vol. 3, p. 406 Full Text Show Details
Ueber das Vorkommen in Pflanzen, Mikroorganismen und tierischen Geweben s.a.
Holden,J.T.
Amino Acid Pools <Amsterdam 1962> Full Text Show Details
Greenstein,J.P.; Winitz,M.
Chemistry of the Amino Acids <New York 1961>S.36,1412-1414 Full Text Show Details
Quantum Chemical Calculations (1) Calculated Properties
Method (Quantum Chemical Calculations)
Reference
Atom distances, angles
Ab initio calcns. (LCAO, GO SCF, DIM, SAMO, X-à, Hartree-Fock)
Song, Il Keun; Kang, Young Kee
Journal of Molecular Structure, 2012 , vol. 1024, p. 163 - 169,7 Title/Abstract Full Text Show Details