Cancer Therapy Volume 1 Issue A by Cancer Therapy

CANCER THERAPY

Volume 1 2003

CANCER THERAPY Addresses of Members of the Editorial Board FREE ACCESS www.cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!!! Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd. Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!!! Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!!! Editorial Board

Richard J. Ablin, Ph.D., Research Professor Department of Microbiology and Immunology and the Arizona Cancer Center University of Arizona College of Medicine 1501 N. Campbell Avenue P.O. Box 245049 Tucson, AZ 85724-5049 Telephone: 520-622-8319 Facsimile: 520-622-0518 E-mail: ablinrj@email.arizona.edu President, Robert Benjamin Ablin Foundation for Cancer Research 115 Franklin Turnpike, Suite 200 Mahwah, NJ 07430 E-mail: ablinrj@prostatefoundation.org Armand, Jean Pierre, M.D. Ph.D., Chairman Protocol Review European Organization for Research and Treatment of Cancer (EORTC) Avenue Mounier 83 bte 11 B-1200 Brussels Belgium Department of Medicine Gustave Roussy Institute

Villejuif France E-mail: armand@igr.fr Aurelian, Laure, Ph.D., Professor Departments of Pharmacology and Experimental Therapeutics University of Maryland School of Medicine Baltimore 21201 USA Tel.: +1-410-706-3895; fax: +1-410-706-2513; email: laurelia@umaryland.edu Berdel, Wolfgang E, M.D., Department of Medicine/Hematology University Hospitals Munster Germany Albert-Schweitzer-StraĂ&#x;e 33 48149 MĂźnster Tel. +49-(0)251-83-47587 Fax +49-(0)251-83-47588 E-Mail: berdel@uni-muenster.de Beyan, Cengiz, M.D., Gulhane Military Medical Academy Department of Hematology Etlik, 06010 Ankara, Turkey Tel: +312.304 4101 Fax: +312.304 4100 E-mail: cbeyan@yahoo.com,

cengizbeyan@hotmail.com Bottomley, Andrew, PhD, Quality of Life Unit, European Organization for Research and Treatment of Cancer Data Center, Avenue E. Mounier 83/11, 1200 Brussels, Belgium; email: abo@eortc.be Bouros, Demosthenes, M.D., Demokritus University of Thrace Medical school, Department of Pneumonology University Hospital of Alexandroupolis 68100 Alexandroupolis Greece Phone: +30-25510-76105 Fax: +30-25510-76106 e-mail: bouros@med.duth.gr Cabanillas, Fernando, M.D, Chairman, Professor, Department of Hematology, Division of Lymphoma/Myeloma The University of Texas M. D. Anderson Cancer Center, Houston, Texas e-mail: fcabanil@mail.mdanderson.org Castiglione, Monica, MHA, SIAK/IBCSG Director SIAK/IBCSG Coordinating Center Effingerstrasse 40 3008 Bern (Switzerland) Tel. +41 31 389 91 91 Fax +41 31 389 92 00 e-mail: monica.castiglione@siak.ch Chou, Kuo-Chen, Ph.D., D.Sc., Gordon Life Science Institute, 13784 Torrey Del Mar Drive, San Diego, California 92130. Tel: 858-484-1018. E-mail: kchou@san.rr.com Chu, Kent-Man, MD, Division of Upper Gastrointestinal Surgery, Department of Surgery, University of Hong Kong Medical Center, Queen Mary Hospital, Pokfulam, Hong Kong, China; email: chukm@hku.hk Chung, Leland W.K, Ph.D., Professor & Director Of Research Department of Urology B4100 Winship Cancer Institute 1365B Clifton Rd Phone: 404 778-4319 Email: lwchung@emory.edu Coukos, George, M.D., Ph.D., Center for Research on Reproduction and Women's

Health Department of Obstetrics and Gynecology University of Pennsylvania Medical Center 1209 Biomedical Research Building II/III 421 Curie Boulevard Philadelphia, PA 19104-6142 Phone: 215-662-3316 Fax: 215-573-7627 E-Mail: gcks@mail.med.upenn.edu Darzynkiewicz, Zbigniew, M.D., Ph.D., Director, Brander Cancer Research Institute New York Medical College 19 Bradhurst Ave. Hawthorne, NY 10532 tel: 914-347-2801 fax: 914-347-2804 e-mail: darzynk@nymc.edu Devarajan, Prasad M.D., Director, Nephrology & Hypertension, Cincinnati Childrenâ&#x20AC;&#x2122;s Hospital Medical Center, MLC 7022, 3333 Burnet Avenue, Cincinnati, OH 45229-3039. Phone: 513-636-4531. FAX: 513-636-7407. E-mail: prasad.devarajan@cchmc.org Der, Channing J. Ph.D, Professor Pharmacology Molecular Therapeutics Lineberger Comprehensive Cancer Center CB# 7295 Chapel Hill NC 27599 Telephone: (919) 966-5634 FAX: (919) 966-0162 e-mail: cjder@med.unc.edu Dritschilo, Anatoly, M.D., Department of Radiation Medicine Georgetown University Hospital 3800 Reservoir Road, NW Washington, D.C. 20007 Tel: (202) 687-2144 e-mail: DRITSCHA@gunet.georgetown.edu Duesberg, Peter H., Ph.D, Professor Department of Molecular & Cell Biology c/o Stanley/Donner Administrative Services Unit 229 Stanley Hall #3206 University of California at Berkeley Berkeley, CA 94720-3206 Fax: (510) 643-6455 Email: duesberg@uclink4.berkeley.edu El-Deiry, Wafik S. M.D., Ph.D., Associate Professor of Medicine (Hem/Onc), Genetics, and Pharmacology Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, 437 Clinical Research Building Philadelphia, PA 19104, USA Tel: 215-898-9015 Fax: 215-573-9139 Email: Wafik@mail.med.upenn.edu

Federico, Massimo, M.D. Dipartimento di Oncologia ed Ematologia, Centro Oncologico Modenese, Università di Modena e Reggio Emilia, Policlinico – Via del Pozzo 71, 41100 Modena, Italy. Phone +39-059-4224547; Fax +39-059-4224549; e-mail: federico@unimore.it

Gridelli, Cesare M.D., Divisione di Oncologia Medica, Azienda Ospedaliera "S.G.Moscati", via Circumvallazione, 83100 Avellino, Italy Tel :39-0825-203573; Fax. :39-0825-203556; E-mail:cgridelli@libero.it

Fiebig, Heiner H, Albert-Ludwigs-Universität Klinik für Tumorbiologie Breisacher Straße 117 79106 Freiburg, Germany Tel: (+49) 761-51 55 9 11 e-mail: fiebig@ruf.uni-freiburg.de

Hengge, Ulrich, M.D., Department of Dermatology Heinrich-Heine-University Duesseldorf Moorenstrasse 5 40212 Duesseldorf Tel.: +49 (0)211 - 811 8066 Fax: +49 (0)211 - 811 8700 E-Mail: ulrich.hengge@uni-duesseldorf.de

Fine, Howard A., M.D., Branch Chief Neuro-Oncology Branch Building 10, Room 12S245 10 Center Drive Bethesda, MD 20892 Phone: 301-402-6298 Fax: 301-480-2246 E-Mail: hfine@mail.nih.gov Frustaci, Sergio, M.D., Division of Medical Oncology, Centro di Riferimento Oncologico di Aviano, Via Pedemontana Occ. 12, 33170 Aviano (PN), Italy; email: sfrustaci@cro.it Georgoulias, Vassilis, MD, PhD Professor of Medical Oncology University General Hospital of Heraklion Dpt of Medical Oncology Tel: +30 2810 392750 Fax: + 30 2810 392802 E-mail: georgoul@med.uoc.gr Giordano, Antonio, M.D., Ph.D., Sbarro Institute for Cancer Research and Molecular Medicine Professor of Biology and Medicine College of Science and Technology Temple University BioLife Science Bldg. Suite 333 1900 N 12th Street Philadelphia PA 19122 Tel: 215-204 9520 Fax: 215-204 9522 E-Mail: antonio.giordano@temple.edu Greene, Frederick Leslie, M.D., Chairman, Department of General Surgery Carolinas Medical Center 1000 Blythe Boulevard., PO Box 32861 Charlotte, NC 28232-2861 Phone: 704/355-3176 Fax: 704/355-5619 E-Mail: rgreene@carolinas.org

Huber, Christian M.D., Chair of the Department for Oncology and Hematology of the University of Mainz Medizinische Klinik und Poliklinik Johannes-Gutenberg-University Langenbeckstrasse 1 55131 Mainz GERMANY Tel.:49-6131-177-281 Fax:49-6131-17-3446 E-mail:ch.huber@3-med.klinik.uni-mainz.de Hunt, Kelly, M.D., Associate Professor Department of Surgical Oncology, Unit 444 Chief, Surgical Breast Section The University of Texas M. D. Anderson Cancer Center 1515 Holcombe Blvd. Houston, TX 77030 Tel: 713-792-7216 Fax: 713-792-4689 email: khunt@mdanderson.org Kamen, Barton A., M.D. Ph.D, Professor of Medicine Specialty: Pediatrics - Board Certified SubSpecialty: Hematology - Board Certified 195 Little Albany Street New Brunswick NJ 08903 Telephone: (732) 235-8131 E-mail: kamenba@umdnj.edu Kazuma, Ohyashiki, M.D., Ph.D., Chairman and professor of the First Department of Internal Medicine, Tokyo Medical University, 6-7-1 Nishishinjuku, Shinjuku-ku, Tokyo, Japan. Phone: international+81-3-33426111 Fax: international+81-3-53816651 E-mail: ohyashik@rr.iij4u.or.jp Kinsella, Timothy J. M.D.,

Professor, Radation Oncology The research Institute of University Hospitals in Cleveland 11100 Euclid Avenue Cleveland, OH 44106 Mail Stop: LTR 6068 Department Phone: 216-844-2530 Department Fax: 216-844-4799 e-mail: tjk4@po.cwru.edu

Hong Kong SAR, China; email: waitongleung@cuhk.edu.hk

Kmiec, Eric B, Ph.D., University of Delaware Department of Biological Sciences Delaware Biotechnology Institute Innovation Way Room 270 Newark, Delaware 19716 Tel: (302) 831-3420 Fax: (302) 831-3427 E-mail: ekmiec@udel.edu

Lichtor, Terry M.D., Ph.D., Department of Neurosurgery, 1900 West Polk Street Chicago, Illinois 60612 Telelphone: 312-864-5120; Fax: 312-864-9606; e-Mail: Terry_Lichtor@rush.edu

Kosmidis Paris, M.D. ESMO President 2nd Medical Oncology Department, Hygeia Hospital, 2 An Tsoha & Vas Sofias Ave, 11521 Athens, Greece; email: parkosmi@otenet.gr Koukourakis, Michael, M.D. Ass.Professor - Head Dept. of Radiotherapy and Oncology Democritus University of Thrace Alexandroupolis 68100, Greece tel -30-6932-480808, fax: -30-25510-74623 Email: targ@her.forthnet.gr

Levin, Mark M.D., Director, Sister Regina Lynch Regional Cancer Center Holy Name Hospital 718 Teaneck Road Teaneck NJ 17666 e-mail: mlevinmd@aol.com

Liebermann, Dan A., Ph.D., Professor Fels Institute for Cancer Research and Molecular Biology and the Department of Biochemistry Temple University School of Medicine 3307 N. Broad Street Philadelphia, PA 19140 Tel: 215 707 6903 FAX: 215 707 2805 Email: lieberma@temple.edu, lieberma@unix.temple.edu Lipps, Hans J, Ph.D., Institut f체r Zellbiologie Universit채t Witten/Herdecke Stockumer Str. 10 58448 Witten -GermanyTel.: (49) 2302 669144 Fax.: (49) 2302 669220 e-mail: lipps@uni-wh.de

Kroemer, Guido, M.D. Ph.D Research Director CNRS-UMR1599 Institut Gustave Roussy, Pavillon de Recherche 1 39, rue Camille Desmoulins 94805 VILLEJUIF FRANCE Tel : 33-1- 42 11 60 46 Fax: 33-1- 42 11 60 47 or 33-1-42 11 52 44 E-mail : kroemer@igr.fr, kroemer@pobox.igr.fr

Lokeshwar, Balakrishna L., Ph.D., Tenured Associate Professor Department of Urology, McKnight Vision Research Building, University of Miami School of Medicine, P.O. Box 016960 (D880), Miami, FL 33101, USA Fax: +305-243-6893 e-mail: blokeshw@med.miami.edu

Kurzrock, Razelle, M.D., F.A.C.P., Department of Bioimmunotherapy, University of Texas M.D. Anderson Cancer Center; 1515 Holcombe Blvd, Box 422, Houston, TX 77030; email: rkurzroc@mdanderson.org

Mackiewicz, Andrzej, M.D., Ph.D., Head of The Dept. of Cancer Immunology, Chair of Oncology, University School of Medical Sciences (USOMS) at GreatPoland Cancer Center, Poznan, Poland e-mail: amac@amu.edu.pl

Leung, Thomas Wai-Tong M.D., Department of Clinical Oncology, Prince of Wales Hospital, The Chinese University of Hong Kong, Shatin, New Territories,

Marin, Jose J. G., Ph.D., Campus Miguel de Unamuno, ED-S09. 37007-Salamanca, SPAIN Tel: +34-923-294674 Fax: +34-923-294669 mail: jjgmarin@usal.es

McMasters, Kelly M., M.D., Ph.D., Sam and Lolita Weakley Professor of Surgical Oncology University of Louisville, J. Graham Brown Cancer Center 315 E. Broadway, Suite 305 Louisville, KY 40202 502-629-3380 phone 502-629-3393 fax kelly.mcmasters@nortonhealthcare.org Morishita, Ryuichi, M.D., Ph.D., Division of Clinical Gene Therapy, Graduate School of Medicine, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan. E-mail morishit@cgt.med.osaka-u.ac.jp Mukhtar, Hasan PhD, Department of Dermatology, University of Wisconsin Medical School Center, Room B25, 1300 University Avenue, Madison, WI 53706; email: hmukhtar@wisc.edu Norris, James Scott, Ph.D., Department of Microbiology and Immunology, Medical University of South Carolina, 173 Ashley Avenue, Charleston, South Carolina 29425, USA. e-mail: Norrisjs@musc.edu Palu, Giorgio, M.D., Department of Histology, Microbiology, and Medical Biotechnologies, University of Padova, Via Gabelli 63, I-35121 Padova, Italy. E-mail: giorgio.palu@unipd.it Park, Jae-Gahb, M.D., Ph.D., Professor Laboratory of Cell Biology Cancer Research Institute Seoul National University College of Medicine, 28 Yongon-dong, Chongno-gu, Seoul 110-744, Korea Tel : 82-2-760-3380 / Fax : 82-2-742-4727 E-mail : jgpark@plaza.snu.ac.kr Perez-Soler, Roman M.D., Professor, Chief, Division of Oncology , Department of Medicine Montefiore Medical Center The Albert Einstein Cancer Center 111 East 210th Street Hofheimer Main , Room 100

Bronx, NY, 10467 Tel: 718-920-4001 e-mail: rperezso@montefiore.org Peters, Godefridus J., Ph.D., Department of Medical Oncology VU University Medical Center (VUMC) PO Box 7057 1007 MB Amsterdam The Netherlands Phone: +31-20-4442633 Fax: +31-20-4443844 E-mail: gj.peters@vumc.nl Poon, Ronnie Tung-Ping, M.D., Associate Professor Department of Surgery, Queen Mary Hospital, 102 Pokfulam Rd, Hong Kong, China; email: poontp@hkucc.hku.hk Possinger Kurt-Werner, M.D., Division of Oncology/Hematology, School of Medicine (Charité), Humboldt University, Schumannstr. 20/21, 10117, Berlin, Germany Tel: +49 30 450-513002 Fax: +49 30 450-513952 e-mail: kurt.possinger@charite.de Rainov G Nikolai M.D., D.Sc., Department of Neurological Science Clinical Sciences Center The University of Liverpool Lower Lane Liverpool L9 7LJ Telephone: 0151 529 5323 Fax: 0151 529 5465 E-mail: N.G.Rainov@liverpool.ac.uk Randall, E Harris, M.D., Ph.D., The Ohio State University School of Public Health B-121 Starling Loving Hall 320 West 10th Avenue Columbus, Ohio 43210 Phone: (614) 293-3903 Fax: (614) 293-3937 Email: harris.44@postbox.acs.ohio-state.edu Ravaioli Alberto, M.D. Divisione di Oncologia ed Onco-Ematologia Ospedale Infermi Via Settembrini, 2 47900 Rimini Italy Tel/fax 0039 – 0541 – 705567 e-mail: aravaiol@auslrn.net Remick, Scot, C. M.D., Division of Hematology/Oncology, University Hospitals of Cleveland,

11100 Euclid Ave, Cleveland, OH; email: scr@po.cwru.edu Rhim, Johng S M.D., Professor and Associate Director Center for Prostate Disease Research, Uniformed Services University of Health Sciences, 4301 Jones Bridge Road, Bethesda MD 20814-4799, USA. Phone: 301-319-8223 Fax: 301-295-1978 e-mail: jrhim@cpdr.org Schadendorf, Dirk, M.D., Klinische Kooperationseinheit für Dermato-Onkologie (DKFZ) an der Universitäts-Hautklinik Mannheim Theodor Kutzer Ufer 1 68135 Mannheim Tel.: (0621)383 - 2126, Fax: (0621) 383 – 2163 e-mail: d.schadendorf@dkfz.de Schmitt, Manfred, Ph.D., Vice-Chairman (EORTC) Frauenklinik der Technischen Universität München Klinikum rechts der Isar Ismaninger Str. 22 D-81675 München Germany Tel: 49-89-4140 2449 49-89-4140 2427 (secret.) Fax: 49-89-4140 7410 E-mail: manfred.schmitt@lrz.tum.de Schuller, Hildegard M., D.V.M., Ph.D., Professor And Head Experimental Oncology Laboratory, College of Veterinary Medicine, University of Tennessee, A201a Veterinary Teaching Ho Knoxville, TN 37996-4542 Tel: (865) 974-8217 e-mail: hmsch@utk.edu Slaga, Thomas J., Ph.D., President AMC Cancer Research Center (UICC International Directory of Cancer Institutes and Organisations) 1600 Pierce Street 80214 Denver Colorado, USA Tel: (303) 239-3372 e-mail: slagat@amc.org Soloway, Mark S., M.D., Department of Urology, McKnight Vision Research Building, University of Miami School of Medicine PO Box 016960 (M814), Miami, FL 33101; Phone: (305) 243-6596 Fax: (305) 243-4653

email: msoloway@miami.edu Srivastava, Sudhir, Ph.D., MPH, MS, Chief, Cancer Biomarkers Research Group National Cancer Institute Executive Plaza North 6130 Executive Boulevard, Room 330F MSC 7346 Bethesda, MD 20892-7346 Phone: 301/496-3983 Fax: 301/402-0816 E-Mail: srivasts@mail.nih.gov Stefanadis, Christodoulos, M.D., University of Athens, Medical School, Greece e-mail: cstefan@cc.uoa.gr Stein, Gary S Ph.D., Chairman Department of Cell Biology UNIVERSITY OF MASSACHUSETTS Medical School 55 Lake Avenue North Worcester, Massachusetts 01655 Phone: (508) 856-5625 Fax: (508) 856-6800 E-mail: gary.stein@umassmed.edu Tirelli, Umberto, National Cancer Institute, Via Pedemontana Occidentale 12, 33081 Aviano (PN), Italy; email: oma@cro.it Todo, Tomoki, M.D., Ph.D., Assistant Professor of Neurosurgery The University of Tokyo 7-3-1 Hongo Bunkyo-ku, Tokyo 113-8655 Japan TEL: +81-3-5800-8853 FAX: +81-3-5800-8655 E-mail: toudou-nsu@umin.ac.jp van der Burg, Sjoerd H, Ph.D., Department of Immunohematology and Blood Transfusion, Building 1, E3-Q, Leiden University Medical Center, P. O. Box 9600, 2300 RC Leiden, the Netherlands. Phone: 31-71-52-64-00-7; Fax: 31-71-52-16-75-1; E-mail: shvdburg@worldonline.nl Wadhwa, Renu, Ph. D., Gene Function Research Center, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562, Japan; Phone: +81 29 861 9464; Fax: +81 29 861 3019, e-mail: renu-wadhwa@aist.go.jp

Waldman, Scott A. M.D., Ph.D., Division of Clinical Pharmacology Departments of Internal Medicine and Pharmacology Thomas Jefferson University 132 South 10th Street 1170 Main Philadelphia, Pennsylvania 19107 email: scott.waldman@mail.tju.edu Walker, Todd Ph.D., School of Biomedical Sciences Charles Sturt University Wagga Wagga. NSW 2650 AUSTRALIA Tel: +61 2 6933 2541 Fax: +61 2 6933 2587 E-mail towalker@csu.edu.au Watson, Dennis K. Ph.D., Professor Department of Pathology and Laboratory Medicine Interim Director Laboratory of Cancer Genomics Tel: 843-792-3962 e-mail: watsondk@musc.edu Waxman, David J., Ph.D., Professor of Cell and Molecular Biology, Boston University Professor of Medicine, Boston University School of Medicine Department of Biology Division of Cell and Molecular Biology Boston University 5 Cummington Street Boston, MA 02215-2406 U.S.A. Phone: 617-353-7401 Fax: 617-353-7404 E-mail: djw@bu.edu Weinstein, Bernard I., M.D., D.Sci (Hon.), Frode Jensen Professor of Medicine Columbia University 701 West 168th Street, HHSC 1509 New York, NY 10032 phone: 212-305-6921 fax: 212-305-6889 e-mail: ibw1@columbia.edu Werner, Jochen Alfred M.D., Professor and Chairman Dept. of Otolaryngology, Head and Neck Surgery Philipps-University of Marburg Deutschhausstr. 3 35037 Marburg, Germany Phone: +49-6421-2866478

Associate Board Members Chen, Zhong, M.D, Ph.D., National Institute of Deafness and other Communication Disorders, National Institutes of Health, USA Dietrich Pierre Yves, M.D., Division of Oncology, Hopitaux Universitaires de GenFve Switzerland

Fax: +49-6421-2866519 e-mail: wernerj@med.uni-marburg.de Whiteside, Theresa L Ph.D., Professor Pathology University of Pittsburgh Cancer Institute and the Departments of Pathology Immunology and Otolaryngology University of Pittsburgh School of Medicine Pittsburgh PA Phone: 412-624-0096 e-mail: whitesidetl@msx.upmc.edu Wieand, Harry Samuel Ph.D., Professor Biostatistics One Sterling Plaza Suite 325 201 N. Craig Street Pittsburgh PA 15213 Telephone: 412-383-2243 Facsimile: 412-383-1535 Email: wieand@nsabp.pitt.edu Yamada, Akira Ph.D., Cancer Vaccine Development Division, Kurume University Research Center for Innovative Cancer Therapy, Asahi-machi 67, Kurume 830-0011, Japan. Phone: 81-942-31-7744; Fax: 81-942-31-7745; E-mail: akiymd@med.kurume-u.ac.jp Yu, Dihua M.D., Ph.D., Professor Dept. Surgical Oncology, Unit 107 Director of Research, Division of Surgery The Univ. Texas M. D. Anderson Cancer Center 1515 Holcombe Blvd. Houston, TX 77030 Tel: 713-792-3636 Fax: 713-794-4830 email: dyu@mdanderson.org Zagon, Ian S., Ph.D, Professor of Neuroscience and Anatomy Department affiliation: Neuroscience & Anatomy College of Medicine office address: Department of Neuroscience and Anatomy H-109 Hershey Medical Center Hershey PA 17033 office phone: 717-531-8650 fax: 717-531-5003 email: isz1@psu.edu

1211 Geneva 14 Switzerland Tel: +41-22-37 29 861 Fax: +41-22-37 29 858 e-mail: pierre-yves.dietrich@hcuge.ch Jeschke Marc G, M.D., Ph.D., Klinik und Poliklinik für Chirurgie Abteilung für Plastische Chirurgie und Handchirurgie Universität Erlangen-Nürnberg Krankenhausstr. 12 91054 Erlangen Tel: +49-9131-8533277 Fax: +49-9131-8539327 e-mail: Mcjeschke@hotmail.com Limacher Jean-Marc, M.D., Département d'Hématologie et d'Oncologie Hôpitaux Universitaires de Strasbourg 1 place de l'Hôpital 67091 STRASBOURG Cedex Tel : 03.88.11.57.85 Fax : 03.88.11.63.60 E-mail: Jean-Marc.Limacher@chru-strasbourg.fr Los Marek J, M.D., Ph.D., Associate Professor Department of Biochemistry and Medical Genetics, CFI Canada Research Chair in New Cancer Therapies Manitoba Institute of Cell Biology University of Manitoba, 675 McDermot Ave. Rm. ON6010 Winnipeg, MB R3E 0V9 Tel: (204) 787-2294 Fax: 787-2190 Lab: 787-1403; 787-4108 E-mail: losmj@cc.umanitoba.ca Mazda Osam, M.D., Ph.D., Associate professor Department of Microbiology, Kyoto Prefectural University of Medicine, Kamikyo, Kyoto 602-8566, Japan Phone: +81-75-251-5329 FAX: +81-75-251-5331 E-mail_mazda@basic.kpu-m.ac.jp Merlin Jean-Louis, Ph.D., Centre Alexis Vautrin National Cancer Institute University Henri Poincaré France Avenue de Bourgogne 54511 Vandœuvre Les Nancy cedex Tel: 03 83 59 83 07 Fax: 03 83 44 78 51 Email jl.merlin@nancy.fnclcc.fr Okada Takashi, M.D., Ph.D., Assistant professor Division of Genetic Therapeutics, Center for Molecular Medicine Jichi Medical School 3311-1 Yakushiji, Minami-kawachi, Tochigi 329-0498, JAPAN Phone: (+81) 285-58-7402, Fax: (+81) 285-44-8675 E-mail: tokada@jichi.ac.jp

Pisa Pavel, M.D, Ph.D., Associate Professor of Internal Medicine Senior lecturer in Clinical Experimental Oncology Department of Oncology Karolinska Hospital, Stockholm, Sweden Fax: +46-8-5177 6630; e-mail pavel.pisa@cck.ki.se Squiban Patrick, M.D., Executive VP Medical and Regulatory Affairs Transgene SA 11 rue de Molsheim Strasbourg 67000, France Tel + 33 (0)3 88 27 91 73 Fax + 33 (0)3 88 27 91 41 e-mail: squiban@transgene.fr Tsuchida Masanori, M.D., Ph.D., Division of Thoracic and Cardiovascular Surgery Niigata University Graduate School of Medical and Dental Sciences 1-757 Asahimachi, Niigata 951-8120, Japan Phone:025-227-2243 Fax:025-227-0780 e-mail:mtsuchi@med.Niigata-u.ac.jp Ulutin, C端neyt, M.D., G端lhane Military Medicine Academy Radiation Oncology Department, Mesire sok., 8/6 Etlik, 06018, Ankara, Turkey e-mail: culutin@yahoo.com Xu Ruian, Ph.D., Gene Therapy Laboratory, IMB, The University of Hong Kong, Hong Kong Honorary Professor of Basic Medical School, Peking Union Medical College Tel: 00852-22990757 Fax: 00862-28179488 E-mail: rxua@hkucc.hku.hk

For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org

Cancer Therapy Vol 1

Table of contents Cancer Therapy Vol 1, December 2003

Pages

Type of Article

Article title

Authors (corresponding author is in boldface)

1-9

Research Article

Intraarterial chemotherapy and chemoembolization in head and neck cancer. Establishment as a neoadjuvant routine method

Adorján F. Kovács

11-19

Review Article

Current aspects in the treatment of patients with relapsed or refractory testicular cancer

Oliver Rick, Jörg Beyer, Thomas Braun, Kurt Possinger, Wolfgang Siegert

21-29

Research Article

Gene expression profiles related with overcoming cisplatin resistance in human cancer cell lines

Moonkyu Kim, Young Jin Park, Ok Ju Kim, Gab Yong Lee, Eun Jung Chung, Young Kwan Sung, Jung Chul Kim, Insook Han, Youn Soo Sohn

31-37

Research Article

Vascular endothelial growth factor modulates cisplatin sensitivity in human ovarian carcinoma cells

Guodong Hu, Sean Ryan, Yunfeng Zhu, Eddie Reed, Xiping Li, Gangduo Wang, and Qingdi Q. Li

39-46

Research Article

Overexpression of angiogenic growth factors in lung cancer cells is associated with cisplatin resistance

Xiping Li, Xuyi Liu, Jie Wang, Zengli Wang, Wei Jiang, Eddie Reed, Yi Zhang, Yuanlin Liu, and Qingdi Q. Li

47-61

Review Article

Cisplatin nephrotoxicity: molecular mechanisms

Marie H. Hanigan and Prasad Devarajan

63-70

Research Article

Mitoxantrone, prednisone, pentostatin and bleomycin for patients with indolent non-Hodgkin’s lymphoma relapsed or unresponsive to previous treatments. Results of a phase II study conducted by the Gruppo Italiano per lo Studio dei Linfomi (GISL)

Massimo Federico, Vincenzo Callea, Romano Danesi, Antonella Montanini, Nicola Di Renzo, Mario Petrini, Mario Del Tacca, Maria Angela Sirotti, Giovanni Santacroce, Alberto Bagnulo, Matteo Dell’Olio and Maura Brugiatelli for GISL

71-79

Review Article

Chemotherapy in elderly patients with advanced breast cancer

Giuseppe Colantuoni, Antonio Rossi, Carmine Ferrara, Dario Nicolella, Filomena Del Gaizo, Ciro Guerriero, Giuseppe Airoma, Maria Luisa Barzelloni, Paolo Maione, Vincenzo Salerno, Cesare Gridelli

81-91

Review Article

Drug resistance in breast cancer

Hermann Lage

93-101

Review Article

Screening for lung cancer: a review and current status

Debora S. Bruno and William Tester

103-107

Research Article

Expression of RB1CC1, a novel tumor suppressor gene, is inversely correlated with the Ki-67 proliferation index in primary breast cancers

Koji Teramoto, Tokuhiro Chano, Yoshitomo Ozaki, Satoru Sawai, Noriaki Tezuka, Keiichi Kontani, Shozo Fujino, Hidetoshi Okabe

109-120

Research Article

Approaches to the treatment of brain tumors using cytokine-secreting allogeneic fibroblasts

Terry Lichtor, Roberta P Glick, Edward P Cohen

121-131

Research Article

Safety, feasibility and clinical benefit of localized chemotherapy using microencapsulated cells for inoperable pancreatic carcinoma in a phase I/II trial

Matthias Löhr, Jens-Christian Kröger, Anne Hoffmeyer, Mathias Freund, Johannes Hain, Albrecht Holle, Wolfram T. Knöfel, Stefan Liebe, Horst Nizze, Matthias Renner, Robert Saller, Petra Müller, Thomas Wagner, Karlheinz Hauenstein, Brian Salmons and Walter H. Günzburg

133-142

Review Article

Electrochemotherapy: advantages and drawbacks in treatment of cancer patients

Gregor Sersa, Maja Cemazar, and Zvonimir Rudolf

143-151

Research Article

p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells

Yi Lu, Jun Zhang, Derrick J. Beech, Linda K. Myers, and Lisa K. Jennings

153-162

Research Article

Wenyin Shi and Dietmar W. Siemann Basic fibroblast growth factor antisense oligonucleotides inhibit renal cell carcinoma cell growth and angiogenesis

163-171

Review Article

Antitumoral cell-based therapies

173-178

Research Article

Can mortalin be a candidate target for Renu Wadhwa, Kazunari Taira and Sunil C Kaul cancer therapy?

179-190

Review Article / Hypothesis

Therapeutic potential of antinuclear autoantibodies in cancer

Vladimir P. Torchilin, Leonid Z. Iakoubov, Zeev Estrov

191-196

Research Article

Filgrastim use: evaluation in cancer and critically ill non- cancer patients

Yolande B. Saab, Leyla Sharaf, Ismail Zeidan, Abdelrahman Bizri

Javier García-Castro, Daniel Rubio, Ricardo de la Fuente, Antonio Bernad

Cancer Therapy Vol 1

197-202

Research Article

Gemcitabine, cisplatin, fluorouracil and folinic acid as first line treatment of locally advanced and/or metastatic pancreatic cancer: a phase II study of the gruppo oncologico dell’Italia meridionale (G.O.I.M.)

Vittorio Gebbia, Francesco Giuliani, Generoso Uomo, Evaristo Maiello, Maria Rosaria Valerio, Nicolo Borsellino, Nicolò Gebbia, Giuseppe Colucci

203-208

Research Article

Phase I study of high dose 5fluorouracil and folinic acid in weekly continuous infusions

Jean-Marc Limacher, Bernard Duclos, Patrick Dufour, Jean-Marie Wihlm, Dominique Leveque, François Jehl, François Eichler, Roger Keiling, Shanti Natarajan-Ame, Jean-Emmanuel Kurtz, Jean-Pierre Bergerat

209-213

Research Article

High-dose methotrexate with citrovorum factor for malignant fibrous histiocytoma of soft tissue: a cell culture study

Toshiaki Hitora, Takashi Marui, Tetsuji Yamamoto, Toshihiro Akisue, Teruya Kawamoto, Keiko Nagira, Tetsuya Nakatani, Shinichi Yoshiya, Masahiro Kurosaka

215-221

Research Article

Phase II intergroup trial of sequential chemotherapy and radiotherapy for AIDS-related primary central nervous system lymphoma

Richard F Ambinder, Sandra Lee, Walter J Curran, Joseph A Sparano, Robert L Krigel, Justin McArthur, Christopher Schultz, Carl E Freter, Leslie Kaplan, Jamie H VonRoenn

223-232

Review Article

Sentinel lymph node biopsy for breast cancer: addressing the controversies

Anees Chagpar, John Pilavas, Celia Chao, Robert C.G. Martin II, Kelly M. McMasters

233-236

Research Article

A randomised, double-blind, phase II study of three different marimastat schedules administered to patients with resected Dukes C colorectal cancer

Philippa G. Corrie, David J. Kerr, Kim Bennett, Charles B. Wilson, Rachel Midgley, Peter Brown

237-244

Review Article

LY900003: A novel compound for the treatment of non-small cell lung cancer

Susannah E. Motl

245-256

Research Article

Activity of chemotherapy and immunotherapy on malignant mesothelioma: a systematic review of the literature with meta-analysis

Thierry Berghmans, Jean-Jacques Lafitte, Céline Mascaux, Anne-Pascale Meert, Marianne Paesmans and JeanPaul Sculier

257-261

Research Article

Expression of insulin-like growth factors and their receptors in malignant fibrous histiocytoma of soft tissues

Tetsuji Yamamoto, Toshihiro Akisue, Tetsuya Nakatani, Takashi Marui, Ikuo Fujita, Keiji Matsumoto, Toshiaki Hitora, Teruya Kawamoto, Keiko Nagira, Masahiro Kurosaka

263-268

Review Article

Ethical, cultural and religious aspects of hereditary cancer in Jewish communities

Mark Levin

269-273

Review Article

Selective intraarterial cisplatin chemotherapy in treatment of advanced malignant squamous cell carcinoma of the head and neck

Afshin Teymoortash and Jochen A.Werner

275-281

Review Article

Protein kinase C-! and its downstream effectors as potential targets for cancer therapy

Jihua Liu, David Durrant and Ray M. Lee

283-291

Reserach Article

293-298

A Phase I Safety and Imaging Study Using Radiofrequency Ablation (RFA) Followed by 131I-chTNT-1/B Radioimmunotherapy Adjuvant Treatment of Hepatic Metastases

Peter M. Anderson, Gregory A. Wiseman, Bradley D. Lewis, J. William Charboneau, William L. Dunn, Susan P. Carpenter, Terrence Chew

Reserach Article

Allelic loss at the SEP15 locus in breast cancer

Mohamed A. Nasr, Ya Jun Hu, and Alan M. Diamond

299-314

Review Article

Dendritic cell based vaccines for immunotherapy of colorectal cancer

Asim Saha, Sunil K. Chatterjee, Kartik Mohanty, Kenneth A. Foon, Malaya Bhattacharya-Chatterjee

315-322

Review Article

Multitargeted antifolate (Pemetrexed): A comprehensive review of its mechanisms of action, recent results and future prospects

Delphine Exinger, Franรงoise Exinger, Bertrand Mennecier, Jean-Marc Limacher, Patrick Dufour, JeanEmmanuel Kurtz

323-333

Review Article

Molecular therapy of gastric cancer

Jie Chen, Minhu Chen, Christoph Rรถcken , Tobias Gรถtze, Peter Malfertheiner and Matthias P.A. Ebert

335-342

Review Article

Tumor angiogenesis as a strategy for radiosensitization

Bo Lu, Dong W. Kim, Dennis E. Hallahan

343-351

Review Article

p14ARF: Role in the cellular stress response and applications to cancer

Yinghui Huang and Ruth A. Gjerset

353-362

Review Article

The role of B lymphocytes in breast cancer: a review and current status

Sazini Nzula, James J. Going, David I. Stott

363-371

Review Article

Advances in breast cancer therapy and chemoprevention: current strategies and new approaches

Brittney-Shea Herbert

Cancer Therapy Vol 1

373-391

Review Article

Treatment planning in endometrial cancer

Angiolo Gadducci, Stefania Cosio, Andrea Riccardo Genazzani

393-405

Review Article

Dendritic cell-mediated immunosuppression in malignant melanoma

Marta E Polak, Nicola J Borthwick, Martine J Jager, Ian A Cree

CANCER THERAPY Addresses of Members of the Editorial Board FREE ACCESS www.cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!!! Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd. Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!!! Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!!! Editorial Board

Fiebig, Heiner H, Albert-Ludwigs-Universität Klinik für Tumorbiologie Breisacher Straße 117 79106 Freiburg, Germany Tel: (+49) 761-51 55 9 11 e-mail: fiebig@ruf.uni-freiburg.de

Hong Kong SAR, China; email: waitongleung@cuhk.edu.hk

Lichtor, Terry M.D., Ph.D., Department of Neurosurgery, 1900 West Polk Street Chicago, Illinois 60612 Telelphone: 312-864-5120; Fax: 312-864-9606; e-Mail: Terry_Lichtor@rush.edu

Levin, Mark M.D., Director, Sister Regina Lynch Regional Cancer Center Holy Name Hospital 718 Teaneck Road Teaneck NJ 17666 e-mail: mlevinmd@aol.com

Kurzrock, Razelle, M.D., F.A.C.P., Department of Bioimmunotherapy, University of Texas M.D. Anderson Cancer Center; 1515 Holcombe Blvd, Box 422, Houston, TX 77030; email: rkurzroc@mdanderson.org

Leung, Thomas Wai-Tong M.D., Department of Clinical Oncology, Prince of Wales Hospital, The Chinese University of Hong Kong, Shatin, New Territories,

Marin, Jose J. G., Ph.D., Campus Miguel de Unamuno, ED-S09. 37007-Salamanca, SPAIN Tel: +34-923-294674 Fax: +34-923-294669 mail: jjgmarin@usal.es

Cancer Therapy Vol 1, page 1 Cancer Therapy Vol 1, 1-9, 2003

Intraarterial chemotherapy and chemoembolization in head and neck cancer. Establishment as a neoadjuvant routine method Research Article

Adorján F. Kovács Department of Maxillofacial Plastic Surgery, Johann Wolfgang Goethe University Medical School, Frankfurt am Main, Germany

__________________________________________________________________________________ Corresponding author: Adorján F. Kovács MD, DMD, Department of Maxillofacial Plastic Surgery, Johann Wolfgang Goethe, University Medical School, Theodor-Stern-Kai 7, D – 60590 Frankfurt am Main, Germany; Tel.: ++49-69-63016610; Fax: ++49-6963015644; E-mail: A.Kovacs@em.uni-frankfurt.de Key words: cisplatin, head and neck, chemoembolization, clinical trials, intraarterial Received: 18 February 2003; Accepted: 24 February 2003; electronically published: April 2003

Summary Over decades, local chemotherapy for head and neck cancer was a challenging treatment modality mainly for palliative use. In the last decade, a reappraisal started due to technical innovations. But a regular and safe clinical use has not been established, nor has a pharmacological rationale for this modality been given for humans. A routine intensification of effectivity by embolization in the region of the head and neck also had been a desideratum. In an unselected patient population of 213 patients suffering from oral and oropharyngeal cancer, the routine usage of intraarterial chemotherapy in a neoadjuvant pre-surgery setting could be demonstrated. Remissions, side effects and survival data are presented. In 88 of these patients, a novel dosage format of cisplatin and clear-cut indications enabled a safe routine execution of chemoembolization. By means of microdialysis, tumor and plasma concentrations of drugs involved could be measured in patients. The results presented prove the therapeutic advantage of intraarterial chemotherapy and, especially, of chemoembolization. The prognostic value of response to local chemotherapy is discussed. Intraarterial chemotherapy is an effective modality with low toxicity and should be used broadly in multi-modality regimens for head and neck cancer. models (Harker and Stephens, 1992), the method nevertheless had the great advantage of higher tumor drug concentrations. Cisplatin proved to be the most effective drug (Harker, 1999) and gave the chance for rapid perfusion due to its relative cell phase non-specificity. Robbins transposed the so-called “two-route” chemotherapy (intraarterial cisplatin and its systemic neutralization by intravenous sodium thiosulfate) from the abdominal usage to the head and neck (Robbins et al, 1992). Modern sophisticated techniques like transfemoral catheterization, angiographic control, and superselective administration of a high dose of cisplatin (150mg/m2 body surface) combined with peripheral neutralization reduced the complications and side-effects. The therapeutic approach was organ-preserving (combination with parallel radiation) or palliative. The reported high effectivity and low systemic acute toxicity urged a broader usage of the method especially in consideration of the high mortality of head and neck

I. Introduction Local chemotherapy as perfusion of drug solutions and as embolization by means of particles is mainly used for hepatocellular carcinoma and liver metastases of colorectal cancer (Tellez et al, 1998). This is safely possible because vessels are quite large in diameter, and metastases and liver tissue are nourished by different circulatory systems of the liver with consequent low risk to jeopardize healthy tissue (Breedis and Young, 1954). In the area of the head and neck, local chemotherapy, though used for decades, had many drawbacks, mainly caused by catheter complications and adverse effects due to flow-out of the antineoplastic agents (Molinari et al, 1999). Eleven percent failures of catheterization (mainly retrograde from the temporal artery into the external carotid artery), 8 % catheter dislocations, 15 % local inflammations, and 4-6 % neurological complications including head ache, apoplexias, and facial pareses made the method unattractive. Theoretically, as demonstrated in animal 1

Kovács: Intraarterial chemotherapy in H&N cancer Postoperative adjuvant treatment consisted in radiation or chemoradiation depending on the histological result, contraindications for docetaxel, and patient agreement. Precise regimen is described elsewhere (Kovács et al, 2002b). Patients who could not be operated on have been offered a chemoradiation as organpreserving treatment (71,3 Gy to the primary, 51,3 Gy to the neck, 5 cycles docetaxel 20 mg/m2 body surface) or radiation (if there has been contra-indication for docetaxel). During this study, it was planned to achieve a pharmacological rationale for intraarterial chemotherapy in humans. Tumor and plasma concentrations of cisplatin and sodium thiosulfate have been compared by means of microdialysis (Ungerstedt, 1991) in 10 and 6 patients with oral cancer treated either with intraarterial perfusion using a cisplatin solution (150 mg/m 2 in 500 ml 0.9% NaCl) or with embolization using a crystalline cisplatin suspension (150 mg/m2 in 45-60 ml 0.9% NaCl), respectively. The microdialysis catheter was placed into the tumor (Figure 1), the intraarterial catheter into the tumor-feeding artery. Cisplatin was rapidly administered through the intraarterial catheter and sodium thiosulfate (9 g/m2) was infused intravenously. STS infusion was started 10 sec after starting the cisplatin infusion. Main advantage of the method is continuous measurement. Biopsies are not necessary. Further information can be found in Tegeder et al, 2003. Primary endpoints have been local clinical and histological remission, and side-effects of chemoperfusion and chemoembolization, respectively. Secondary endpoints have been the establishment of a clinical routine chemoembolization method for cancer of the head and neck, and the survival analysis. End of follow-up has been January, 2003.

cancer. Unselected populations of patients suffering from cancer of the oral cavity and the pharynx have a 5-yearsurvival of 40-45 % (Funk et al, 2002). Since 1996, intraarterial chemotherapy was used widely in a neoadjuvant pre-operative setting in the Department of Maxillofacial Plastic Surgery at Frankfurt am Main/Germany. The experimental and clinical results as well as novel developments of the method, leading to a routine usage of chemoperfusion and chemoembolization in the head and neck, are presented here.

II. Patients and methods 213 consecutive unselected patients with untreated primary squamous cell carcinoma of the oral cavity and the anterior oropharynx have been prospectively scheduled for treatment with neoadjuvant intraarterial chemotherapy and following surgery of the primary and the neck. Staging examinations encluded patient history, inspection, palpation, neck ultrasound, neck CT, chest Xray, and “whole-body” PET. Patient and tumor data can be seen in Table 1. The methods for transfemoral catheterization and administration of the cisplatin solution, the cisplatin crystal suspension, and sodium thiosulfate are described in detail elsewhere (Kovács et al, 1999; 2002a). Cisplatin as lyophilisate was produced by medac GmbH, Hamburg, Germany. At least one cycle was planned. Three weeks later, dimension of response was assessed (CR=complete remission, a complete disappearance of local tumor mass; PR=partial remission, a partial reduction of local tumor mass of more than 50%; SD=stable disease, a partial reduction of local tumor mass of less than 50% or stability of local tumor mass; PD=progressive disease, growth of the tumor > 25%) and patients were scheduled to surgery. Surgery was executed according generally accepted rules (radical resection of the primary in healthy margins, ipsilateral modified radical neck dissection with preservation of the jugular vein, the sternocleidomastoid muscle and the accessory nerve in case of a clinically positive neck, contralateral selective neck dissection of the upper two levels of the neck in case of midline tumour location).

III. Results All patients (100 %) received intraarterial chemotherapy. The therapy compliance has been excellent. In 32 patients, cycles have been repeated up to twice in case of non-operability and non-radiability, for palliative reason. There have been 256 interventions with 3 catheter-related complications (apoplexies, in two cases with complete remissions). Local remissions of the tumor after one cycle of intraarterial chemotherapy can be seen in Figures 2A (chemoperfusion) and 2B (chemoembolization).

155 males, 58 females; average age: 60 yrs cT 0 1

107

208

106

cStage

22 24

24 68

114

4C Sum

pStage

5 213

213

171

Table 1. Demographic and tumor-related data of 213 unselected consecutive patients suffering from oral and oropharyngeal cancer. UICC classification: cT = clinical tumor category; cN = clinical node category; cM = clinical metastasis category; cStage = clinical staging; pStage = pathological staging.

Figure 1: Patient suffering from cancer of the floor of the mouth lying on the angiography table. Microdialysis probe is placed via submental route into the tumor center. Tube (right) is perfusing the probe with saline solution, tube leading to vial fixed at the neck is saving the dialysate.

Cancer Therapy Vol 1, page 3 Very low acute side-effects of both chemoperfusion and chemoembolization (mainly grade 1 WHO) are demonstrated in Figure 3. In the first 42 patients with 50 interventions of chemoembolization, there have been 3 temporary paralyses of the facial nerve and 4 facial skin necroses, both due to flow-out of cisplatin crystals into the medial meningeal artery (from the maxillary artery) or the skin collaterals of the tumor-feeding vessel. In the following 46 patients with 50 interventions, no such complications occurred. A containment of indications for chemoembolization has been the reason: safe procedure can be expected in the oral tongue, the floor of the mouth and the mandibular alveolar ridge (Figure 4). Preferential arteries for superselective catheterization have been the lingual and the facial arteries. High-dose chemotherapy with cisplatin and systemic sodium thiosulfate can be used routinely in a neoadjuvant setting in the head and neck. Chemoembolization for oral cancer with cisplatin crystals is a safe routine method if administered in the mentioned localizations using the established method with cisplatin crystals. Hundred-seventy-one patients (80 %) have been operated on radically. Radicality of resections and

postoperative complications were not influenced by pre-op chemotherapy. The neck surgery is listed in Table 2 . Seven patients have not been operated on at the neck due to maxillary tumor location. Forty-two patients (20 %) could not be operated on due to non-resectability of the primary or due to bad general condition. 20 patients have been in such bad initial state that intraarterial chemotherapy was repeated as only treatment for local control. One of these patients (cT2cN0) is living free of tumor since 4 years now, the others died after a mean survival period of 4 months. 8 of these non-operated patients were in the condition to receive chemoradiation. In 4 patients, this organpreserving treatment resulted in complete clinical remission of the detectable disease lasting for 13 months mean observation time. 14 patients without surgery received radiation therapy. These patients survived 3 months on average. 60 patients received no adjuvant treatment after surgery (small primaries, no histologic neck disease, refusals). 112 patients (53 %) underwent adjuvant radiation (n = 28) or adjuvant chemoradiation (n = 84).

Figure 2A: Clinical and histological response to intraarterial chemotherapy (chemoperfusion with cisplatin solution 150 mg/m2 body surface) in 125 patients. cCR = clinical complete remission, pCR = pathological complete remission, PR = partial remission, SD = stable disease, PD = progressive disease. Overall response (cCR + cPR) = 43 %.

Figure 2B: Clinical and histological response to intraarterial chemotherapy (chemoembolization with cisplatin crystal suspension 150 mg/m2 body surface) in 88 patients. Overall response = 74 %.

Kovรกcs: Intraarterial chemotherapy in H&N cancer

Figure 3: Acute side-effects of chemoperfusion and chemoembolization (n = 213 patients). All grade 1 WHO normalizing after 5-7 days. Note high percentage of patients with no measurable side-effects at all. Chemoembolization has no hematological side-effects but causes post-embolization-syndrome which lasts 7-10 days.

RND RND,MRND MRND MRND,MRND MRND,SHND MRND,SND SHND SHND,SHND SHND,SND SND SND,SND No neck surgery Sum

1 1 27 10 38 1 13 33 1 22 17 7 117

Table 2: Neck surgery in 171 unselected consecutive patients with oral and oropharyngeal cancer (RND = radical neck dissection level 1-4; MRND = modified radical neck dissection level 1-4; SHND = suprahyoidal neck dissection level 1-2; SND = selective neck dissection [sentinel node biopsy]; MRND,SHND = ipsilateral modified radical neck dissection with contralateral suprahyoidal neck dissection, et cetera). Figure 4: Areas of safe chemoembolization with the cisplatin crystal suspension marked in yellow (oral tongue, floor of mouth, mandibular alveolar ridge).

Cancer Therapy Vol 1, page 5 formed particles measuring 30x50 µm. No extra embolizing particles have been necessary. Embolization has been very rarely used in the head and neck area for cancer. Reports of other investigators are listed in Table 3. The fabrication of particles and encoating of the drugs was complicated and expensive, the head vessels having a small diameter have been occluded too early resulting in low doses of antineoplastic drugs, the danger of flow-out of stray emboli caused the investigators to stop the usage after a small number of patients. According to this body of literature, only 66 head and neck cancer patients have been treated with embolization regimens in the last 20 years all over the world. Effectivity has been not convincing. Side-effects have been neglected in these reports so far. The novel method of chemoembolization using a crystal suspension of cisplatin could be used routinely in 88 patients since May 2000 up to now. It was found to be very effective (remissions were evaluated following one cycle). Side-effects have been low, and early complications ceased after a confinement of indications to areas within the oral cavity. These areas harbor more than 60 % of the carcinomas of the oral cavity which guarantees a broad usage of this method. Molar sodium thiosulfate/cisplatin ratios of >500 are required outside the tumor to neutralize cisplatin whereas tumor ratios should be <100 to avoid a loss of tumor cell killing (Abe et al, 1986, 1990). The first goal was achieved with both treatment modalities, the second only with cisplatin embolization suggesting that crystalline cisplatin embolization is superior to intraarterial cisplatin perfusion in terms of tumor cisplatin concentrations. This gave a definitive rationale for both intraarterial chemoperfusion as well as chemoembolization with a cisplatin crystal suspension in humans. Overall compliance has been excellent. Intraarterial chemotherapy fits perfectly into a multimodality regimen as described. The survival of 65 % of an unselected population after a median observation time of 3 years must be considered as an improvement in overall survival which should be examined more precisely in a randomized study. Although administered locally and with local effect, the chemotherapy caused response has clear prognostic value (Figure. 6). The response apparently is dependent from the size of the primary tumor (Figure. 7), but even within the tumor classifications T1-2 and T3-4 there are differences in survival dependent from response (Figure. 8). Therefore, response to local chemotherapy can be used as prognostic sign. In contrast to other local treatment modalities like electroporation, photodynamic therapy or chemotherapeutic gel injections, intraarterial chemotherapy can be used in all tumor stages without side-effect limitations and is, therefore, best suited as a potential marker for differential therapeutic strategies. Potential subtypes of oral cavity squamous cell carcinomas may be found by more easily using a combination of intraarterial chemotherapy and gene expression analyses of the tumors.

First results of adjuvant chemoradiation have been reported (Kovács et al, 2002b). After a median observation time of 3 years (period from December 1996 to January 2003), 74 patients have died (35 %). 20 deaths have not been tumor-related. Kaplan-Meier-analysis generated a 5-year-survival expectation of 62 % but such estimations are solid only in case when 80 % of all patients reached the observation time of 5 years. Following embolization, maximum cisplatin tumor concentrations and tumor-AUCs were about 5 times higher than those achieved after intraarterial perfusion with a cisplatin solution (maximum concentration: 180.3±62.3 µM versus 37.6±8.9 µM) whereas the opposite was true for plasma concentrations (maximum concentration: 0.9±0.2 µM versus 4.7±0.6 µM). Sodium thiosulfate plasma levels were about three times higher than its tumor concentrations (maximum tumor concentration 1685±151 µM; maximum plasma concentration 5051±381 µM). Following the standard intraarterial perfusion average sodium thiosulfate/cisplatin AUC ratios for tumor and plasma were 211±75 and 984±139, respectively. Following cisplatin embolization the respective ratios were 48.5±29.5 and 42966±26728 (Figure 5, Tegeder et al, 2003).

IV. Discussion Intraarterial chemotherapy via transfemoral catheterization for advanced head and neck cancer was executed by several authors in a neoadjuvant pre-radiation setting (Vieitez et al, 1991; Scheel et al, 1996; Hirai et al, 1999) or as an organ-preserving method parallelly with radiation (Imai et al, 1995; Robbins et al, 1997; Oya and Ikemura, 1999; Regine et al, 2001). True neoadjuvant pre surgery usage of the method was very rare (Siegel et al, 1998; Benazzo et al, 2000). In the Department of Maxillofacial Plastic Surgery at Frankfurt am Main/Germany, the “two-route” chemotherapy was used since 1996 for all tumor stages to improve overall survival of an unselected population (Kovács et al, 1999). The reported side-effects have been so low that broad usage of the method seemed to be feasible. The results after 256 interventions demonstrated a great technical safety of the method. Remissions have been high and side-effects very low (grade 1 WHO). The method was intensified by the usage of a new dosage format of cisplatin (crystal suspension) resulting in an embolization of the tumor bed (Kovács et al, 2002a). Embolization theoretically encreases the therapeutic advantage by a longer tumor residence time of the drug. The lyophilized cisplatin was reconstituted with 0.9% sodium chloride leading to a yellow mixture with a final concentration of 5 mg ml-1. Microscopic assessment of the crystal diameters showed rod-shaped cisplatin crystals measuring 3x8 µm; regular clumping of these crystals

Kovács: Intraarterial chemotherapy in H&N cancer

Figure 5: Mean ± s.e.m cisplatin (CDDP; top) and sodium thiosulfate (STS; bottom) concentrations in tumor tissue (left) and plasma (right) following superselective high dose intraarterial cisplatin perfusion (!) and crystalline cisplatin embolization (!). Note the different scaling of the y-axes for tumor and plasma. Insert: Sodium thiosulfate/cisplatin AUC ratios for tumor and plasma following intraarterial cisplatin perfusion and cisplatin embolization (Tegeder et al, 2003).

Number of patients

Response

Side-effects

63%

100% local pain

28 (incl. 11 of Okamoto et al)

28%

Carboplatin 100 mg

20%

60% local pain

Cisplatin 13.6 mg

5-Fluorouracil 700 mg/m2 + Methotrexate 40 mg/m2

58%

Authors

Particles

Okamoto et al, 1985, 1986

Ethyl cellulose microcapsules

Cisplatin 40 – 60 mg

Kato et al, 1996

Ethyl cellulose microcapsules

diverse (mainly Cisplatin)

Tomura et al, 1996, 1998

Ethyl cellulose microcapsules Albumine microspheres

Li et al, 1999 Suvorova et al, 2002

Coil fragments

Chemotherapeutics

Table 3: List of other reported chemoembolizations for cancer in the head and neck area. Note low dosage of drugs and small patient populations.

Cancer Therapy Vol 1, page 7

Figure 6: Local response to neoadjuvant intraarterial chemotherapy and prognosis.

Figure 7: Histological complete local remission (pT0) to neoadjuvant intraarterial chemotherapy in relation to local tumor classification. N. s. = non significant, *** = highly significant (Chi-square-test).

Kovács: Intraarterial chemotherapy in H&N cancer

Figure 8: Prognostic influence of local response within “small” (T1-2) and “advanced” (T3-4) local tumor classifications. carboplatin (CBDCA) combined infusion for head and neck cancers. Eur J Radiol. 21, 94-99 Kato T, Sato K, Sasaki R, Kakinuma H, Moriyama M (1996) Targeted cancer chemotherapy with arterial microcapsule chemoembolization: review of 1013 patients. Cancer Chemother Pharmacol. 37, 289-296 Kovács AF, Turowski B, Ghahremani TM, Loitz M (1999) Intraarterial Chemotherapy as neoadjuvant treatment of oral cancer. J Cranio-Maxillofac Surg. 27, 302-307 Kovács AF, Obitz P, Wagner M (2002a) Monocomponent chemoembolization in oral and oropharyngeal cancer using an aqueous crystal suspension of cisplatin. Br J Cancer. 86, 196-202 Kovács AF, Schiemann M, Turowski B (2002b) Combined modality treatment of oral and oropharyngeal cancer including neoadjuvant intraarterial cisplatin and radical surgery followed by concurrent radiation and chemotherapy with weekly docetaxel - three year results of a pilot study. J Cranio-Maxillofac Surg. 30, 112-120 Li H, Wang C, Wen Y, Wu H (1999) Treatment of squamous cell carcinoma of the tongue using arterial embolism with cisplatin-loaded albumin microspheres: a microstructural and ultrastructural investigation. Chin J Dent Res. 2, 61-66 Molinari R, Chiesa F, Cantù G, Costa L, Grandi C, Sala L (1999) Prognostic factors in cancer of the oral cavity and anterior oropharynx treated with preliminary neoadjuvant intraarterial chemotherapy followed by surgery. In: Eckardt A (ed). Intra-arterial Chemotherapy in Head and Neck Cancer – Current Results and Future Perspectives. Einhorn-Presse Verlag: Reinbek, 148-161 Okamoto Y, Konno A, Togawa K, Kato T, Amano Y (1985) Microcapsule chemoembolization for head and neck cancer. Arch Otorhinolaryngol. 242, 105-111

References Abe R, Akiyoshi T, Tsuji H, and Baba T (1986) Protection of antiproliferative effect of cis-diamminedichloroplatinum (II) by sodium thiosulfate. Cancer Chemother Pharmacol . 18, 98-100 Abe R, Akiyoshi T, and Baba T (1990) Inactivation of cisdiamminedichloroplatinum (II) in blood by sodium thiosulfate. Oncology. 47, 65-69 Benazzo M, Caracciolo G, Zappoli F, Bernardo G, Mira E (2000) Induction chemotherapy by superselective intra-arterial highdose carboplatin infusion for head and neck cancer. Eur Arch Otorhinolaryngol. 257, 279-282 Breedis C, Young G (1954) The blood supply of neoplasms of the liver. Amer J Path. 30, 969-985 Funk GF, Karnell LH, Robinson RA, Zhen WK, Trask DT, Hoffman HAT (2002) Presentation, treatment and outcome of oral cavity cancer: a National Cancer Data Base report. Head Neck. 24, 165-180 Harker GJS, Stephens FO (1992) Comparison of intra-arterial versus intravenous 5-fluorouracil in sheep bearing epidermal squamous carcinoma. Eur J Cancer. 28, 1437-1441 Harker GJS (1999) Intra-arterial infusion chemotherapy in a sheep squamous cell carcinoma model. In: Eckardt A (ed). Intra-arterial Chemotherapy in Head and Neck Cancer – Current Results and Future Perspectives. Einhorn-Presse Verlag: Reinbek, 54-63 Hirai T, Korogi Y, Hamatake S, Nishimura R, Baba Y, Takahashi M, Uji Y, Taen A (1999) Stages III and IV squamous cell carcinoma of the mouth: three-year experience with superselective intraarterial chemotherapy using cisplatin prior to definitive treatment. Cardiovasc Intervent Radiol. 22, 201-205 Imai S, Kajihara Y, Munemori O, Kamei T, Mori T, Handa T, Akisada K, Orita Y (1995) Superselective cisplatin (CDDP)-

Cancer Therapy Vol 1, page 9 Okamoto Y, Konno A, Togawa K, Kato T, Tamakawa Y, Amano Y (1986) Arterial chemoembolization with cisplatin microcapsules. Br J Cancer. 53, 369-375 Oya R, Ikemura K (1999) Targeted intra-arterial carboplatin infusion with concurrent radiotherapy and administration of tegafur for advanced squamous cell carcinoma of the oral cavity and oropharynx. In: Eckardt A (ed). Intra-arterial Chemotherapy in Head and Neck Cancer – Current Results and Future Perspectives. Einhorn-Presse Verlag: Reinbek, 183-190 Regine WF, Valentino J, Arnold SM, Haydon RC, Sloan D, Kenady D, Strottmann J, Pulmano C, Mohiuddin M (2001) High-dose intra-arterial cisplatin boost with hyperfractionated radiation therapy for advanced squamous cell carcinoma of the head and neck. J Clin Oncol. 19, 33333339 Robbins KT, Storniolo AM, Kerber C, Seagren S, Berson A, Howell SB (1992) Rapid superselective high-dose cisplatin infusion for advanced head and neck malignancies. Head Neck. 14, 364-371 Robbins KT, Kumar P, Regine WF, Wong FS, Weir AB 3rd, Flick P, Kun LE, Palmer R, Murry T, Fontanesi J, Ferguson R, Thomas R, Hartsell W, Paig CU, Salazar G, Norfleet L, Hanchett CB, Harrington V, Niell HB (1997) Efficacy of targeted supradose cisplatin and concomitant radiation therapy for advanced head and neck cancer: the Memphis experience. Int J Radiat Oncol Biol Phys. 38, 263-271 Scheel JV, Schilling V, Kastenbauer E, Knöbber D, Böhringer W (1996) Cisplatin intraarteriell und sequentielle Bestrahlung. Langzeitergebnisse. Laryngorhinootologie. 75, 38-42 Siegel RS, Bank WO, Maung CC, Harisiadis L, Wilson WR (1998) Assessment of efficacy and tolerance of high-dose intra-arterial cisplatin in advanced head and neck tumors. Proc Amer Soc Clin Oncol. Abstract 1582 Suvorova IuV, Tarazov PG, Korytova LI, Sokurenko VP, Khazova TV (2002) [Arterial chemoembolization in the combined treatment of malignant tumors of the tongue and maxilla: preliminary results] Vestn Rentgenol Radiol. 2, 238 Tegeder I, Bräutigam L, Seegel M, Al-Dam A, Turowski B, Geisslinger G, and Kovács AF (2003) Cisplatin tumor concentrations following IA cisplatin infusion or

embolization in oral cancer patients. Clinical Pharmacology & Therapeutics, in press Tellez C, Benson AB, Lyster MT, Talamonti M, Shaw J, Braun MA, Nemcek AA, Vogelzang RL (1998) Phase II trial of chemoembolization for the treatment of metastatic colorectal carcinoma to the liver and review of the literature. Cancer. 82, 1250-1259 Tomura N, Kobayashi M, Hirano J, Watarai J, Okamoto Y, Togawa K, Kowada M, Murota H (1996) Chemoembolization of head and neck cancer with carboplatine microcapsules. Acta Radiol. 37, 52-56 Tomura N, Kato K, Hirano H, Hirano Y, Watarai J (1998) Chemoembolization of maxillary tumors via the superficial temporal artery using a coaxial catheter system. Radiat Med. 16, 157-160 Ungerstedt U (1991) Microdialysis--principles and applications for studies in animals and man. J Intern Med. 230, 365-73 Vieitez JM, Bilbao JI, Hidalgo OF, Martin S, Manzano RG, Tangco E (1991) Intra-arterial chemotherapy with carboplatin and 5-fluorouracil in epidermoid cancer of the oropharynx and oral cavity. Reg Cancer Treat. 4, 152-155

Adorján F. Kovács MD, DMD

Kovรกcs: Intraarterial chemotherapy in H&N cancer

Cancer Therapy Vol 1, page 11 Cancer Therapy Vol 1, 11-19, 2003.

Current aspects in the treatment of patients with relapsed or refractory testicular cancer Review Article

Oliver Rick1*, Jörg Beyer2, Thomas Braun1, Kurt Possinger1, Wolfgang Siegert1 1

Medizinische Klinik II m.S. Onkologie/Hämatologie, Universitätsklinikum Charité, Campus Mitte, Humboldt Universität, Schumann Str. 20/21, 10117 Berlin; 2Klinik für Innere Medizin m.S. Hämatologie/Onkologie, Universitätsklinikum Marburg, Baldingerstr., 35033 Marburg

__________________________________________________________________________________ *Correspondence: Dr. O. Rick, Medizinische Klinik II m.S. Onkologie/Hämatologie, Charité Campus Mitte, Schumann Straße 20/21, 10117 Berlin, Germany; Tel.: ++ 49-30 - 450 513268; Fax: ++ 49-30 - 450 513966; e-mail: oliver.rick@charite.de Key words: Testicular cancer, salvage treatment, high-dose chemotherapy Abbreviations: germ cell tumors, (GCT); high-dose chemotherapy, (HDCT); autologous stem cell rescue, (ASCR); cisplatin, etoposide and ifosfamide, (PEI); European Group for Blood and Marrow Transplantation, (EBMT); carboplatin, etoposide and cyclophosfamide, (PEC); carboplatin and etoposide, (CE); human chorionic gonadotropin, (HCG); alpha-fetoprotein, (AFP) Received: 22 February 2003; Accepted: 27 February 2003; electronically published: April 2003

Summary The optimal treatment of patients with relapsed or refractory germ cell tumors (GCT) after cisplatin-based firstline chemotherapy remains controversial. It is well known that the majority of these patients will ultimately die of their disease. Therefore, improvement of standard treatment is clearly desirable. The question of using conventional-dose or high-dose chemotherapy (HDCT) in this high-risk situation is under discussion. However, HDCT as subsequent salvage therapy in patients with relapsed or refractory GCT remains to be a relevant curative option. Prognostic factors have recently been recognized to aid in this decision. This report reviews the current treatment options and recent developments in respect to HDCT given as salvage treatment and discusses the role of prognostic factors in management of such situations. Depending on the presence or absence of adverse prognostic factors, only about 15-30% of these relapsed patients overall will become long-term survivors after conventional-dose salvage chemotherapy (Loehrer et al, 1988; Harstrick et al, 1991). To improve the unfavorable outcome of patients with relapse or progressive disease after conventional-dose treatment, high-dose chemotherapy (HDCT) followed by autologous stem cell rescue (ASCR) has been explored as a therapeutic option (Siegert et al, 1994; Rick et al, 2001). Due to increasing clinical experience in the management of side-effects, the use of ASCR and the availability of hematopoietic growth factors, HDCT has become a relatively safe procedure. Dose-escalations to about three to five times of the conventional-dose can be achieved for most drugs active in GCT as hematologic toxicities have become manageable with ASCR. However, acute nonhematologic toxicities, particularly mucositis, renal impairment and peripheral neurotoxicity are increased after HDCT as compared to conventional-dose regimens.

I. Introduction Most patients with metastatic germ-cell tumors can be cured using multimodal treatment with standard combination chemotherapy followed by surgical resection of residual masses (Bosl and Motzer, 1997). The outcome is worse if one of poor prognostic features are present, such as extragonadal primary mediastinal nonseminoma GCT, extrapulmonary visceral metastases and high levels of tumor markers at initial diagnosis. These patients have a chance of cure of less than 50% with standard first-line chemotherapy and are being classified as "poor prognosis" patients. Most of them progress after incomplete response to first-line cisplatin-based chemotherapy or relapse from prior complete remission and will be candidates for salvage treatment (Table 1) (International Germ Cell Cancer Collaborative Group, 1997). Conventional-dose salvage chemotherapy in combination with resection of residual masses will result in second complete remissions in only about 30-60% of patients. In addition, at least half of these patients will suffer subsequent relapses after salvage treatment and will ultimately die of their disease. 11

Rick et al: Current aspects in testicular cancer Table 1: Prognostic classification for first-line treatment (International Germ Cell Cancer Collaborative Group, 1997) GOOD PROGNOSIS Non-Seminoma Seminoma Testis or retroperitoneal primary and Non-pulmonary visceral metastases absent and Good markers AFP < 1000 ng/ml and HCG < 5000 U/l and LDH < 1.5 ! upper limit of normal

Any primary site and No non-pulmonary visceral metastases absent and Normal AFP, any HCG, any LDH

INTERMEDIATE PROGNOSIS Non-Seminoma

Seminoma

Testis/retroperitoneal primary and Non-pulmonary visceral metastases absent and Intermediate markers AFP " 1000 and # 10,000 ng/ml and HCG " 5000 and # 50,000 U/l or LDH " 1.5 ! N and # 10 ! N

Any primary site and Non-pulmonary visceral metastases present Normal AFP, any HCG, any LDH

POOR PROGNOSIS Non-Seminoma

Seminoma

Mediastinal primary or Non-pulmonary visceral metastases present or Poor markers AFP > 10,000 ng/ml or HCG > 50,000 U/l or LDH > 10 ! upper limit of normal

No patients classified as poor prognosis

Abbreviations: AFP, alpha-fetoprotein; HCG, $-subunit human chorionic gonadotropin; LDH, lactat dehydrogenase treatment which seems to be superior to survival rates obtained with conventional chemotherapy schedules. In patients receiving second or subsequent salvage treatment investigators in the US and Europe still reported long-term remission rates of 15-25% using high-dose carboplatin and etoposide with or without the addition of an alkylating agent (Rick et al, 1999). More recently, three study groups have modified this initial schedule. Rick et al, and the GTCSG explored a treatment strategy that combined intensive conventional-dose salvage with paclitaxel, ifosfamide and cisplatin followed by a single HDCT cycle with carboplatin, etoposide and thiotepa. The rationale for the trial was to optimize conventional-dose salvage treatment by using paclitaxel as well as intensifying HDCT with thiotepa (Rick et al, 2001). Motzer at al. (2000) investigated sequential dose-intensive paclitaxel and ifosfamide followed by three sequential cycles of high-dose carboplatin and etoposide. Rodenhuis et al, (1999) explored sequential dose-intensive treatment with

Also long-term non-hematologic organ toxicities and hematologic complications such as the incidence of secondary myelodysplasias or leukemias may be a concern years after successful HDCT.

II. Salvage HDCT in patients with relapsed or refractory GCT Standard treatment for patients with relapsed or refractory GCT after cisplatin-based first-line chemotherapy includes a combination of cisplatin, etoposide and ifosfamide (PEI) or cisplatin, vinblastine and ifosfamide (VeIP) (Rick et al, 1999). With regard to the worse long-term prognosis of patients with relapsing or progressing GCT after conventional-dose chemotherapy, however, the concept of HDCT with ASCR was investigated in numerous studies. Overall, event-free survival rates of 40-60% have been reported after such

Cancer Therapy Vol 1, page 13 etoposide and ifosfamide, followed by one cycle of highdose carboplatin and etoposide and two cycles of highdose carboplatin, cyclophosphamide and thiotepa supported by ASCR. Recently, Bhatia and co-workers (2000) reported data from 65 patients with relapsed or

refractory GCT treated with high-dose carboplatin and etoposide followed by PBPC rescue as initial salvage chemotherapy.

Figure 1: Overall-(A) and event-free (B) survival of patients after salvage treatment either with high-dose or standard-dose chemotherapy in 55 pairs of patients (Beyer et al, 2002)

Rick et al: Current aspects in testicular cancer factors". Until now the minimal range of the follow-up period is short and only 104/280 (37%) patients were analyzed for disease-free survival. Considering the interpretation of the results these facts must be mentioned. In 1986 Indiana University initiated a phase I/II trial using tandem HDCT with carboplatin and etoposide (CE) followed by ASCR in patients with multiple relapses, since then several investigators have examined the concept of repetitive HDCT cycles. Employing tandem cycles of HDCT with CE might be a method to overcome cisplatin resistance and to eradicate residual cancer cells rather than a single application or multiple applications with long term intervals between the cycles. Therefore, to maximize the dose-intensity of chemotherapy multiple large doses may be administered in short intervals (Nichols et al, 1989; Broun et al, 1997; Bhatia et al, 2000; Motzer et al, 2000). However, all current trials are encouraging that some of the patients with second or subsequent relapses can successfully be salvaged by HDCT. In addition, patients with poor prognostic features at the time of relapse or progression also seem to profit from early intensification of first salvage treatment. Whereas side-effects differ between schedules, the results of these most recent trials indicate, that prognostic factors for treatment outcome after HDCT could be more important than the use of a particular HDCT strategy or combination.

However, the majority of the patients included in the latter study showed "good-risk" factors for relapse prior to salvage HDCT. This fact may explain the very good outcome of these patients. In a retrospective matched-pair analysis Beyer et al, (2002) compared HDCT with conventional-dose chemotherapy as first-salvage treatment in patients with relapsed or refractory non-seminomas. The analysis suggests a benefit from HDCT with an estimated absolute improvement in event-free survival of 12% and in overall survival of 11% at 2 years (Figure 1). At the ASCO meeting Rosti et al, (2002) presented the data from a preliminary analysis of a prospective randomized multicenter study initiated by the European Group for Blood and Marrow Transplantation (EBMT), the "IT94 study". 280 patients with relapse from first-line cisplatin-based chemotherapy were randomized to receive either three cycles of conventional-dose PEI/VeIP plus HDCT included carboplatin, etoposide and cyclophosfamide (PEC) or four courses of standard PEI/VeIP. Calculation of the sample size was based on a 15% difference in the event-free survival rate at one year. The recruitment of the study stoped in September 2001 and 128/140 patients (91%) for the conventional treatment and 135/140 patients (96%) for the HDCT could be analyzed. In terms of event-free and overall survival no statistically significant differences were observed between both treatment groups (Rosti et al, 2002). However, only patients without any prior salvage chemotherapy who relapsed from complete remission or progressed from incomplete remission were included. Therefore the results of the study can only allow interpretation for patients with these "good prognosis

III. Ongoing trials Since September 2001 the "IT94"-study was stopped, in the salvage situation only one trial in Europe is actively recruiting.

Figure 2: Ongoing GTCSG trials for salvage treatment.

Cancer Therapy Vol 1, page 15 have been more favorable, if HDCT had been used early in these patients.

Colleagues from Berlin, Marburg and T端bingen in cooperation with the GTCSG initiated a prospective randomized multicenter trial to compare three cycles of standard PEI plus single HDCT with carboplatin, etoposide and cyclophosphamide versus one cycle of PEI followed by sequential cycles of dose-intensified carboplatin and etoposide (Figure 2). Patients with good or intermediate prognosis according to the criteria from Beyer et al, (1996) who require salvage treatment are included into the study and in January 2003 two thirds of the planned number of 230 patients were recruited. This trial continues to include patients with first relapse after a minimum of three cycles of a cisplatin-based chemotherapy despite the preliminary data from the "IT94-study". The randomized GTCSG-study includes patients with insufficient response to primary treatment and patients who relapsed after first- or subsequent salvage treatment. The results of this trial should help to determine the optimal HDCT regimen in terms of clinical outcome, long-term survival and toxicities when given as intensification of salvage treatment.

V. Treatment related toxicities Early as well as the late toxicities after salvage chemotherapy are substantial. Although the treatmentrelated mortality was considerably lower compared to reports that pioneered HDCT, it remained constantly around 3% in consecutive protocols. Apart from the expected hematologic toxicity that resulted in transfusion requirements in all patients, the majority of patients also experienced severe mucositis that necessitated hospitalization, total parenteral nutrition and intravenous analgesia (Siegert et al, 1994; Rick et al, 1998; Rick et al 2001). Other non-hematologic toxicities that eventually became dose-limiting were renal impairment. Overall, 8% of the patients required hemodialysis, of whom most patients recoverd with their renal function until discharge. The use of ifosfamide as a third drug in addition to highdose carboplatin and etoposide might have precipitated these toxicities. Despite activity of ifosfamide in germ cell tumors at conventional-doses, only modest dose increments were possible in high-dose combinations (Siegert et al, 1994; Beyer et al, 1997; Rick et al, 1998). Another relevant side effect after conventional-dose chemotherapy and HDCT is the peripheral nervous toxicity. After salvage treatment with three cycles of conventional-dose paclitaxel, ifosfamide and cisplatin followed by high-dose carboplatin, etoposide and thiotepa sensorymotor toxicity " grade II developed in 29% of the patients among 8% suffered from grade IV sensorymotor toxity. Furthermore, paresthesias " grade II developed in 24% of the patients. Peripheral nervous toxicity after HDCT persisted during the 12 week re-evaluation period and improved only gradually thereafter. Ototoxicity with tinnitus and hearing loss greater or equal grade II occurred in 32% of the patients after HDCT. Hearing began to improve in most patients shortly after HDCT and therefore, hearing aids were required in only few patients (Rick et al, 2001). Whereas most of the acute toxicities were reversible, about one third of the patients reported persisting sideeffects, mainly paresthesias and/or tinnitus, that interfered with their daily activities (Rick et al, 1998). Long-term toxicities have also been reported after conventional-dose cisplatin-based treatment, but persisting side-effects as well as more severe late toxicities such as renal impairment, transfusion-related hepatitis and etoposideinduced secondary leukemia clearly represent a reminder to use HDCT judiciously, preferably only within clinical trials and at experienced centers (Beyer et al, 1997; Rick et al, 1998).

IV. Prognostic factors Several retrospective analyses have tried to identify prognostic factors for conventional-dose as well as for high-dose salvage chemotherapy. Primary mediastinal nonseminomatous tumors seem to be incurable if first-line treatment fails. At least two large series did not find longterm survivors, neither with conventional-dose treatment nor with HDCT (Saxman et al, 1994; Beyer et al, 1996). In a multivariate analysis Beyer et al, (1996) tried to identify prognostic variables in 383 patients treated with HDCT given as first or subsequent salvage treatment. Progressive disease at the time of HDCT, nonseminomatous mediastinal primary tumor, refractory disease to conventional-dose cisplatin and human chorionic gonadotropin (HCG) levels greater than 1,000 U/L prior HDCT were identified as independent adverse prognostic factors for long-term survival after HDCT (Beyer et al, 1996). Overall survival rates for each prognostic group are shown in Figure 3.One of the relevant conclusions of the study was that all patients of the poor prognosis category progressed immediately after HDCT, had no benefit from the dose intensive strategy and should not be treated with HDCT. Fossa et al, (1999) analyzed the results of 164 nonseminoma patients who relapsed or progressed after cisplatin-based first-line chemotherapy and who received different conventional-dose regimens as first-salvage treatment. In a multivariate analysis response to first-line treatment, response duration as defined by the progression-free interval as well as serum levels of HCG and alpha-fetoprotein (AFP) prior to salvage treatment were identified as independent prognostic variables (Table 2). Unfortunately, the impact of histology on prognosis could not be assessed as seminoma patients were not included. Limited by its retrospective approach and the lack of a control group, this analysis cannot exclude the possibility that the results of salvage chemotherapy might

VI. Residual tumor resection and adjuvant chemotherapy After primary cisplatin-based chemotherapy surgical resection of residual tumor masses is currently the standard treatment if the metastases have not completely disappeared (Donohue et al, 1992; Fox et al, 1993). The histological status of the operated specimen may reveal 15

Rick et al: Current aspects in testicular cancer necrosis, mature teratoma or viable cancer cells. Whereas the resection of necrosis has no therapeutic benefit, the resection of mature teratoma or undifferentiated cancer is relevant. Therefore, attempts have been made to distinguish between patients with necrosis from patients with viable cancer (De Santis et al, 2001). Only few data exist of the histological status of tumor residuals and the probability of viable cancer after first or subsequent salvage chemotherapy (Hartmann et al,

1997; Donohue et al, 1994). Furthermore, the relevance of residual tumor resection and the incidence of cancer cells after HDCT has not yet been determined. Hartmann et al, (1997) found undifferentiated tumor in 20/25 patients (80%), Donohue et al, (1994) reported from viable carcinoma only in 53/164 patients (32%). Furthermore, two other analyses confirmed these results and demonstrated a high rate of patients with viable cancer after second-line chemotherapy (Peckham et al, 1988; Fox

Figure 3: Survival according to prognostic categories in 282 patients treated with high-dose salvage chemotherapy (Beyer et al, 1996)

Table 2: Prognostic model for conventional-dose salvage according to Fossa et al, (1999) • • •

no complete remission to first-line treatment progression-free interval < 2 years AFP > 100 kU/L or HCG > 100 U/L at initiation of salvage

Prognostic groups

survival at 2 years (95% confidence intervals)

“good prognosis”

74%

one risk factor present #

(60% - 88%)

“intermediate prognosis” any two risk factors present

45% (32% - 58%)

“poor prognosis” all three risk factors present

7% (0% - 15%)

Cancer Therapy Vol 1, page 17 et al, 1993). These data after salvage treatment showed a much higher frequency of viable cancer in comparison with histological findings after primary chemotherapy. Residual tumor resection following first-line cisplatinbased chemotherapy showed viable cancer in 10% of the patients (Fossa et al, 1989; Fizazi et al, 2001). One explanation may be the development of resistance against chemotherapy in patients received salvage treatment. Viable cancer and mature teratoma may be the origin of localized and/or late relapse (Loehrer et al, 1986). Thus, the complete removal of mature teratoma or residual cancer is indicated, particularly due to the lack of reliable non-invasive examinations to detect viable cancer cells. After resection of necrosis or mature teratoma, no further treatment is required. In the case of resection of viable cancer cells after primary cisplatin-based chemotherapy the application of an adjuvant chemotherapy remains disputable. Whereas several investigations have confirmed that the use of additive chemotherapy may improve the outcome of these patients (Tait et al, 1984; Fox et al, 1993; Donohue et al, 1994; Gerl et al, 1995; Stenning et al, 1998), other trials could not detect any benefit from an adjuvant treatment (Pizzocaro et al, 1998). Furthermore, Fizazi et al (2001) performed a multivariate analysis of prognostic factors for overall and event-free survival after resection of viable tumor cells in patients with disseminated GCT. They identified an incomplete resection, " 10% viable malignant cells in the residual tumor manifestation and an "intermediate or poor prognosis" in according to the IGCCCG classification as unfavourable features. Only patients with one adverse prognostic factor showed a statistically significant advantage from the adjuvant chemotherapy. In the salvage situation there is also no clear recommendation because only few data are available (Hartmann et al, 1997; Donohue et al, 1994) Whereas some authors did not find any benefit from adjuvant chemotherapy after resection of residual viable cancer, other investigators recommended the maintenance chemotherapy with daily oral etoposide following salvage therapy (Donohue et al, 1994; Cooper and Einhorn, 1995; Hartmann et al, 1997; Pizzocaro et al, 1998). Therefore, to answer this question the GTCSG have investigated a prospective randomized multicenter study to evaluate the efficacy of three cycles of oral etoposide in patients with viable cancer cells in the resected residual tumor masses (Figure 2).

subsequent retrospective multivariate analyses, may lead to individualized risk-adapted treatment strategies in relapsed patients. Considering these evaluated prognostic subcategories the addition of a new drug, such as paclitaxel, to the conventional-dose salvage chemotherapy in patients with good prognosis features could be a new option. In patients with poor prognosis factors the use of HDCT may be helpful to optimize the treatment efficacy. This risk-adapted strategy can avoid HDCT-induced toxicities in good prognosis patients and maintain a curative option in patients of the intermediate/poor prognosis category. Nevertheless, the use of a sequential HDCT concept in patients with unfavorable prognostic features could enhance the clinical outcome of these patients and should be investigated in future trials. Therefore, the results of the randomized GTCSG study are necessary to answer this open question and the data must constantly be seen and evaluated. The results of salvage chemotherapy may be further improved if combined with residual tumor resection in selected patients. Patients with viable cancer cells in the resected tumor masses should be included in ongoing studies. In order to find rational approaches for rare clinical situations, cooperative multiinstitutional efforts are needed.

References Beyer J, Kingreen D, Krause M, Schleicher J, Schwaner I, Schwella N, Huhn D, Siegert W (1997) Long term survival of patients with recurrent or refractory germ cell tumors after high dose chemotherapy. Cancer 79, 161-168. Beyer J, Kramar A, Mandanas R, Linkesch W, Greinix A, Droz JP, Pico JL, Diehl A, Bokemeyer C, Schmoll HJ, Nichols CR, Einhorn LH, Siegert W (1996) High-dose chemotherapy as salvage treatment in germ cell tumors: a multivariate analysis of prognostic factors. J Clin Oncol 14, 2638-2645. Beyer J, Rick O, Weinknecht S, Kingreen D, Lenz K, Siegert W (Nephrotoxicity after high-dose carboplatin, etoposide and ifosfamide in germ-cell tumors: incidence and implications for hematologic recovery and clinical outcome. Bone Marrow Transplant 20, 813-819. Beyer J, Stenning S, Gerl A, Fossa S, Siegert W (2002) Highdose versus conventional-dose chemotherapy as first-salvage treatment in patients with non-seminomatous germ-cell tumors: a matched-pair analysis. Ann Oncol 13, 599-605. Bhatia S, Abonour R, Porcu P, Seshadri R, Nichols CR, Cornetta K, Einhorn LH (2000) High-dose chemotherapy as initial salvage chemotherapy in patients with relapsed testicular cancer. J Clin Oncol 18, 3346-3351. Bosl G, Motzer RJ (1997) Testicular germ-cell cancer. N Engl J Med 337, 242-253. Broun ER, Nichols CR, Gize G (1997) Tandem high dose chemotherapy with autologous bone marrow transplantation for initial relapse of testicular germ cell cancer. Cancer 79, 1605-1610. Cooper M, Einhorn LH (1995) Maintenance chemotherapy with daily oral etoposide following salvage therapy in patients with germ cell tumors. J Clin Oncol 13, 1167-1169. De Santis M, Bokemeyer C, Becherer A, Stoiber F, Oechsle K, Kletter K, Dohmen BM, Dittrich C, Pont J (2001) Predictive impact of 2-Fluoro-2-Deoxy-D-Glucose positron emission tomography for residual postchemotherapy masses in patients with bulky seminoma. J Clin Oncol 19, 3740-3744. Donohue JP, Birhle R, Foster RS (1992) Evolving concepts in

VII. Conclusion In patients with relapsed/refractory disease HDCT has been demonstrated as a feasible and safe treatment concept which will be curative for a substantial proportion of these patients. Therefore, all of these patients should be included in ongoing studies. Considering the complication rate and the not yet finally clarified role of HDCT this treatment is not acceptable outside clinical trials. Prognostic factors in patients with relapsed or progressive disease are clearly necessary and therefore known risk factors should be included in future prospective randomized trials. These results, if confirmed by 17

Rick et al: Current aspects in testicular cancer surgical management of testis cancer. Cancer Treat Res 59, 89-97. Donohue JP, Fox EP, Williams SD, Loehrer PJ, Ulbright TM, Einhorn LH, Weathers TD (1994) Persistent cancer in postchemotherapy retroperitoneal lymph-node dissection: Outcome analysis. World J Urol 12, 190-195. Fizazi K, Tjulandin S, Salvioni R, Germa-Lluch JR, Bouzy J, Ragan D, Bokemeyer C, Gerl A, Flechon A, de Bono JS, Stenning S, Horwich A, Pont J, Albers P, De Giorgi U, Bower M, Bulanov A, Pizzocaro G, Aparicio J, Nichols CR, Theodore C, Hartmann JT, Schmoll HJ, Kaye SB, Culine S, Droz JP, Mahe C (2001) Viable malignant cells after primary chemotherapy for disseminated nonseminomatous germ cell tumors: prognostic factors and role of postsurgery chemotherapy-results from an international study group. J Clin Oncol 19, 2647-2657. Fossa SD, Aass N, Ous S, Hoie J, Stenwig AE, Lien HH, Paus E, Kaalhus O (1989) Histology of tumor residuals following chemotherapy in patients with advanced nonseminomatous testicular cancer. J Urol 142, 1239-1242. Fossa SD, Stenning SP, Gerl A, Horwich A, Clark PI, Wilkinson PM, Jones WG, Williams MV, Oliver RT, Newlands ES, Mead GM, Cullen MH, Kaye SB, Rustin GJ, Cook PA. (1999) Prognostic factors in patients progressing after platinum-based chemotherapy for malignant nonseminomatous germ cell tumours. Br J Cancer 80, 13921399. Fox EP, Weathers TD, Williams SD, Loehrer PJ, Ulbright TM, Donohue JP, Einhorn LH (1993) Outcome analysis of patients with persistent nonteratomatous germ cell tumor in postchemotherapy retroperitoneal lymph node dissections. J Clin Oncol 11, 1294-1299. Gerl A, Clemm C, Schmeller N, Dienemann H, Lamerz R, Kriegmair M, Wilmanns W (1995) Outcome analysis after post-chemotherapy surgery in patients with nonseminomatous germ cell tumours. Ann Oncol 6, 483-438. Harstrick A, Schmoll HJ, Kohne-Wompner CH, Bergmann L, Lammers U, Hohnloser J, Dolken G, Reichhardt P, Siegert W, Natt F, et al, (1991) Cisplatin, etoposide, and ifosfamide salvage therapy for refractory or relapsing germ cell carcinoma. J Clin Oncol 9, 1529-1535 Hartmann JT, Schmoll HJ, Kuczyk MA, Candelaria M, Bokemeyer C (1997) Postchemotherapy resections of residual masses from metastatic non-seminomatous testicular cell tumors. Ann Oncol 8, 531-538. International Germ Cell Cancer Collaborative Group (1997) International germ cell consensus classification: a prognostic factor-based staging system for metastatic germ cell cancers. J Clin Oncol 15, 594-603. Loehrer PJ Sr, Hui S, Clark S, Seal M, Einhorn LH, Williams SD, Ulbright T, Mandelbaum I, Rowland R, Donohue JP (1986) Teratoma following cisplatin-based combination chemotherapy for nonseminomatous germ cell tumors: a clinicopathological correlation. J Urol 135, 1183. Loehrer PJ Sr, Lauer R, Roth BJ, Williams SD, Kalasinski LA, Einhorn LH (1988) Salvage therapy in recurrent germ cell cancer: Ifosfamide and cisplatin plus either vinblastine or etoposide. Ann Intern Med 109, 540-546 Motzer RJ, Mazumdar M, Sheinfeld J, Bajorin DF, Macapinlac HA, Bains M, Reich L, Flombaum C, Mariani T, Tong WP, Bosl GJ (2000) Sequential dose-intensive paclitaxel, ifosfamide, carboplatin and etoposide salvage therapy for germ cell tumor patients. J Clin Oncol 18, 1173-1180. Nichols CR, Tricot G, Williams SD, van Besien K, Loehrer PJ, Roth BJ, Akard L, Hoffman R, Goulet R, Wolff SN, et al, (1989) Dose-intensive chemotherapy in refractory germ cell cancer-a phase I/II trial of high-dose carboplatin and

etoposide with autologous bone marrow transplantation. J Clin Oncol 7, 932-939. Peckham MJ, Horwich A, Easton DF, Hendry WF (1988) The management of advanced testicular teratoma. Br J Urol 62, 63-68. Pizzocaro G, Nicolai N, Milani A, Piva L, Merson M, Colavita M, Salvioni R (1998) Is further chemotherapy necessary in radically resected residual cancer in non-seminomatous germ cell tumors (NSGCT) of the testis following induction chemotherapy. Proc Am Soc Clin Oncol 17, abstract. Rick O, Beyer J, Kingreen D, Schwella N, Krusch A, Schleicher J, Kirsch A, Huhn D, Siegert W (1998) High-dose chemotherapy in germ cell tumours: a large single centre experience. Eur J Cancer 34, 1883-1888. Rick O, Bokemeyer C, Beyer J, Hartmann JT, Schwella N, Kingreen D, Neureither S, Metzner B, Casper J, Wandt H, Hartmann F, Schmoll HJ, Derigs G, Gerl A, Berdel WE, Kanz L, Siegert W (2001) Salvage treatment with paclitaxel, ifosfamide and cisplatin (TIP) plus high-dose carboplatin, etoposide and thiotepa (CET) followed by autologous stem cell rescue in patients with relapsed or refractory germ cell cancer. J Clin Oncol 19, 81-88. Rick O, Siegert W, Beyer J (1999) High-dose salvage chemotherapy. Germ-cell tumor treatment results in Germany. Int J Cancer 83, 839-840. Rodenhuis S, de Wit R, de Mulder PH, Keizer HJ, Sleijfer DT, Lalisang RI, Bakker PJ, Mandjes I, Kooi M, de Vries EG (1999) A multi-center prospective phase II study of highdose chemotherapy in germ-cell cancer patients relapsing from complete remission. Ann Oncol 10, 1467-1473. Rosti G, Pico JL, Wandt H, Koza V, Salvioni R, Theodore C, Lelli G, Siegert W, Horwich A, Marangolo M, Schmoll HJ, Linkesch W, Pizzocaro G, Bouzy J, Kramar A, Droz JP, Biron P (2002) High-dose chemotherapy in the salvage treatment of patients failing first-line platinum chemotherapy fo advanced germ cell tumors; first results of a prospective randomised trial of the European Group for Blood and Morrow Transplantation (EBMT): IT-94 study. Proc Am Soc Clin Oncol 21, abstract 716. Saxman SB, Nichols CR, Einhorn LH (1994) Salvage chemotherapy in patients with extragonadal nonseminomatous germ cell tumors: the Indiana University experience. J Clin Oncol 12, 1390-1393. Siegert W, Beyer J, Strohscheer I, Baurmann H, Oettle H, Zingsem J, Zimmermann R, Bokemeyer C, Schmoll HJ, Huhn D (1994) High-dose treatment with carboplatin, etoposide, and ifosfamide followed by autologous stem-cell transplantation in relapsed or refractory germ cell cancer: a phase I/II study. The German Testicular Cancer Cooperative Study Group. J Clin Oncol 12, 1223-1231. Stenning SP, Parkinson MC, Fisher C, Mead GM, Cook PA, Fossa SD, Horwich A, Jones WG, Newlands ES, Oliver RT, Stenwig AE, Wilkinson PM (1998) Postchemotherapy residual masses in germ cell tumor patients: Content, clinical features, and prognosis. Medical Research Council Testicular Tumor Working Party. Cancer 83, 1409-1419. Steyerberg EW, Gerl A, Fossa SD, Sleijfer DT, de Wit R, Kirkels WJ, Schmeller N, Clemm C, Habbema JD, Keizer HJ (1998) Validity of predictions of residual retroperitoneal mass histology in nonseminomatous testicular cancer. J Clin Oncol 16, 269-274. Steyerberg EW, Keizer HJ, Fossa SD, Sleijfer DT, Toner GC, Schraffordt Koops H, Mulders PF, Messemer JE, Ney K, Donohue JP, et al, (1995) Prediction of residual retroperitoneal mass histology after chemotherapy for metastatic nonseminomatous germ cell tumor: multivariate analysis of individual patient data from six study groups. J Clin Oncol 13, 1177-1187.

Cancer Therapy Vol 1, page 19 Tait D, Peckham MJ, Hendry WF, Goldstraw P (1984) Postchemotherapy surgery in advanced non-seminomatous germcell testicular tumours: The significance of histology with

particular reference to differentiated (mature) teratoma. Br J Cancer 50, 601-609.

Rick et al: Current aspects in testicular cancer

Cancer Therapy Vol 1, page 21 Cancer Therapy Vol 1, 21-29, 2003.

Gene expression profiles related with overcoming cisplatin resistance in human cancer cell lines Research Article

Moonkyu Kim 1, Young Jin Park1, Ok Ju Kim 2, Gab Yong Lee2, Eun Jung Chung3, Young Kwan Sung1, Jung Chul Kim1, Insook Han3*, Youn Soo Sohn4 1

Department of Immunology, School of Medicine, Kyungpook National University, Daegu 700-422

Department of Chemistry, Taegu Catholic University, Kyongsan 712-70

Trichogene, Inc., Daegu 700-422, Korea

Department of Chemistry, Ewha Womans University, Seoul, 120-750, Korea

__________________________________________________________________________________ *Corresponding author: Insook Han, e-mail: ishan60@hanmail.net Key words: cDNA microarray, platinum complex, liposome, cisplatin resistance, overcoming drug resistance Abbreviations: superoxide dismutase, (SOD); high-mobility group protein, (HMG) Received: 28 February 2003; Accepted: 29 February 2003; electronically published: April 2003

Summary Gene expression profiles were analyzed using cDNA microarray for cisplatin-sensitive and their resistant cancer cell lines. Sensitive cells included the cervical ME180, leukemia K562, and ovarian A2780. Their corresponding resistant cell lines to cisplatin were ME180/PDD, K562/PDD and A2780/PDD, respectively. All three cisplatinresistant cell lines showed small changes in gene expression profiles between them. Genes of cell adhesion & matrix, DNA binding & response, and specific enzymes, were up- or down-regulated depending on the cell type. However genes involved in cell cycle, oncogenes and SOD (superoxide dismutase) were up-regulated only in cisplatinresistant cell lines. In order to investigate changes in gene expression linked with overcoming cisplatin resistance, we have treated A2780/PDD cells with pegylated liposomal trans(+)-1,2-diaminocyclohexane glutamatoplatinum(II) complex [L-Pt(dach)(glu)], which is known to overcome cisplatin resistance. This treatment resulted in upregulation of cytokine, tumor suppressor and carbohydrate-modifying enzymes, whereas oncogene, DNA binding & response, cell membrane redox- and cacium-related enzymes, and SOD were down-regulated. All these changes in gene expression profiles between drug-treated and untreated A2780/PDD cells seemed to be related with the cytotoxicity to L-Pt(dach)(glu) in resistant cells, arising from overcoming cisplatin resistance. We show that microarray analysis is useful for evaluating the overcoming in cisplatin resistance and can efficiently be custom applied as an indicator of maintenance or lack of cisplatin resistance in chemotherapy for predicting therapeutic efficacy. significant toxic side effects such as acute nephrotoxicity and neurotoxicity, and its pre-existed or acquired drug resistance. Cisplatin resistance is multifactorial. It consists of mechanisms such as decreased drug accumulation (Andrews et al, 1988; Kelland et al, 1992), increased drug deloxification (Behrens et al, 1987; Mistry et al, 1991; Godwin et al, 1992), and an enhanced ability to repair (Lai et al, 1988; Masuda et al, 1988; Parker et al, 1991; Zhen et al, 1992) and tolerate (Johnson et al, 1997) DNA damage. Up-regulation of DNA repair genes including XPB, XPD, XPA and ERCC-1 have been implicated in the development of cisplatin resistance in human tumor cells (Wood, 1997; Dabholkar et al, 2000; Aloyz et al, 2002; Xu et al, 2002).

I. Introduction Cisplatin [cis-diamminedichloroplatinum(II)] is very effective in the treatment of various types of human cancers (Carter et al, 1984). The cytotoxicity of this drug is believed to result from the platinum binding to DNA. The reaction between cisplatin and DNA produces several types of platinum-DNA adducts; monoadducts and bifunctional intrastrand or interstrand crosslinked adducts. These DNA-platinum adducts prevent efficient DNA replication and transcription to exert the cytotoxic effect of cisplatin. Though cisplatin has excellent cytostatic effect in tumors as a result of DNA binding, the success of cisplatin-based chemotherapy is limited due to its

Kim et al: Gene expression and cisplatin resistance from Dr. Sohn in Ewha Womans University, Korea. Lipids like DMPC, PEG2000-DMPE, cholesterol were purchased from Avanti Polar Lipids (Alabaster, Ala).

Recently, cDNA microarrays have been successfully used to study global patterns of gene expression in human cancer research field (DeRisi et al, 1996; Golub et al, 1999; Alizadeh et al, 2000; Perou et al, 2000). Microarray can detect gene expression changes between two samples about the known and unknown huge number of genes by a single experiment. Thus, to investigate the change of gene expression concerned with cisplatin sensitivity and resistance, gene expressions was compared by using microarray analysis. Through the reports of gene expressions in cisplatin resistant cells and tissues, many kinds of genes were included such as apotosis, cell adhesion, motility, cell cycle, cell development regulators, receptors, growth factors, invasion regulators, oncogenes, as well as DNA damage and repair genes (Sakamoto et al, 2001), whereas previous studies before microarray on cisplatin resistance mechanism only focused on the genes related with the DNA damage and repair mechanisms. Therefore, we tried to use cDNA microarray analysis to identify diverse gene expressions in cisplatin-resistant cells compared to sensitive ones. First, we tried to analyze the gene expression profiles concerned with cisplatin sensitivity and resistance using three different cancer cell lines. Those are human cervical ME180, leukemia K562, and ovarian A2780 cancer cell lines; and their corresponding cisplatin-resistant cell lines, ME180/PDD, K562/PDD and A2780/PDD, respectively. Several strategies have been developed to both overcome cisplatin resistance (Canon et al, 1990) and reduce cisplatin-induced toxicity on extra-tumoral normal tissues (Konno et al, 1992). Among the strategies in platinum drug, the dach-platinum(II) complex have attracted significant attention for many years because they are not cross-resistant to cisplatin (Jennerwein et al, 1989). Another strategy was the application of liposome to overcome the cisplatin resistance. Liposomes offer a versatile drug-carrier technology with great potential for improving the pharmakokinetics of anti-cancer drugs. They have been widely used as a means to reduce the toxicity of drugs (Gabizon et al, 1998) and enhance their therapeutic indexes (Sharma et al, 1993). In the case of cytostatic drugs, increasing local tumor exposure by liposomes has been reported to be a useful strategy for overcoming the resistance of cancer cells to chemotherapy (Khokhar et al, 1991; Ho et al, 1997). Our results also proved the effect of the encapsulation of Pt(dach)(glu) in liposomes to increase cytostatic activity and overcome the cisplatin resistance in several cancer cell lines. Thus, we have applied cDNA microarray analysis to evaluate the overcoming cisplatin resistance in A2780/PDD cells by the treatment of liposomal (L-) Pt(dach)(glu). By comparing the changes of gene expressions in A2780/PDD cells by the treatment of L- Pt(dach)(glu), we have tried to figure out which genes are important to overcome the cisplatin resistance.

B. Preparation of liposomal platinum drug Liposomes containing Pt(dach)(glu) complex were prepared by lyophilization-rehydration method (Han et al, 2002). Briefly, lipids in chloroform were mixed at the desired molar ratio (DMPC/PEG2000-DMPE/CH=50/5/45), and the chloroform was removed in a rotary evaporator. To the dried lipid film, the platinum drug dissolved in methanol were added at the weight ratio of drug to lipid (1:20) and subsequently the methanol solvent was removed by rotary evaporator. Then, tertbutanol was added and the solutions was shaked at 40-50oC for 10-30 min to obtain the clear solutions. Aliquoted samples in vials were frozen in dry ice/acetone bath, and tert-butanol was removed by lyophilization overnight to give the lyophilized preliposomal powders. To reconstitute the preliposomes, saline or PBS solution was added at the concentration of 50 mg/ml, and the resulting suspension was shaked at 40oC for 60 min with vortexing and sonication.

C. Cancer cell lines ME180, K562 and A2780 cancer cell lines were derived from the patients prior to chemotherapy and obtained from Dr. Perez-Soler in Albert Einstein College of Medicine. All these cell lines (ME180, K562, A2780) were made resistant to cisplatin in vitro by means of continuous stepwise exposure to ciplatin to produce the corresponding cisplatin-resistant cell lines; ME180/PDD, K562/PDD, and A2780/PDD, respectively.

D. Cell cytotoxicity and resistance index Cell cytotoxicity was determined by MTT (methylthiazoletetrazolium) dye reduction assay. Cells were seeded in 150 Âľl of medium/well in 96-well plates, allowed to attach overnight, and then exposed to various concentrations of drugs for 48 h. After washing the cells with PBS twice, 40 Âľl of a 5 mg/mL solution of MTT was added per well. After 4 h at 37oC, the cells were lysed by adding 100 Âľl of dimethyl sulfoxide and incubated for 2 h. The cell survival fractions were determined by reading the absorbance at 570nm in a microplate reader (Model MCC/340, Titertek multiscan). All the IC50 (50% inhibitory cell dose) values of liposomal platinum drug were normalized against those of the corresponding empty liposomes.

II. Materials and methods A. Platinum drug and Cisplatin was purchased from Dong-A Pharmaceutical Co. (Ahnyang, Korea) and dachglutamatoplatinum drug [Pt(dach)(glu) in Figure 1] was obtained

Figure 1. Chemical structure of anti-cancer platinum drug

Cancer Therapy Vol 1, page 23 The reported values are the averages of triplicate experiments. The resistance indexes were calculated as the ratio of IC50 in resistant cells to IC50 in sensitive cells.

a filter that included all genes exhibiting a minimum level of expression of intensity of >1,000 fluorescent units (on a scale of 0-65,535 fluorescent units) for both red and green channels for each pair of experiments.

E. Preparation of total and messenger RNA

III. Results and discussion

Total RNA was extracted from cultured cells using a modified acid phenol method. Briefly, the growth medium was removed and the cells lysed with Trizol (Life Technologies). The lysate was cleared and extracted with 1/10 volume of 1-bromo-3chloropropane. The aqueous layer was collected in a new tube and precipitated with isopropanol. After 75% ethanol washing, the pellet was air dried and resuspended in DEPC-treated water, and quantified by A260/280 measurement using UV spectrometer (DU 530, Beckman, USA). For assessing the quality, 3~5 ug of total RNA was loaded onto denaturing 1.0% formaldehyde agarose gels and for electrophoresed. mRNA was then isolated from total RNA with oligotex mRNA midi kit (Qiagen, Chatsworth, CA, USA).

A. Preparation of cDNA microarray and hybridization To screen the specific genes in cisplatin-resistant cancer cell lines, we tested with our in-house cDNA microarray, which contains 3,063 cDNA clones from 7 different cDNA libraries. Housekeeping genes, !-actin (Accession No. NMµ001101) and glyceraldehyde-3phosphate dehydrogenase (GAPDH; Accession No. NMµ002046) was printed on the same array to serve as internal controls. The microarray was subsequently hybridized with cDNA probes labeled with fluorochromes. Probes were prepared with aRNA from cultured drug sensitive and resistant cells. The fluorescent targets were pooled and allowed to hybridize under stringent conditions to the clones on the microarray. Laser excitation of the incorporated targets yields an emission with a characteristic spectra, which is measured using a scanning confocal laser microscope. Monochrome images from the scanner (Scanarray 4000) were imported into software (GenePix) in which the images were pseudo-colored. The color images of the hybridization results were generated by representing the Cy-3 fluorescent image as green and the Cy-5 fluorescent image as red and then merging the two color images. To ensure reproducibility of the microarray results, we repeated each experiment twice with each RNA samples. The cDNA probe derived from sensitive cells was labeled with Cy-3 dUTP (green) and the cDNA probe from resistant cells was labeled with Cy5 dUTP (red). Green and red fluorescent signals indicate greater relative expression in sensitive and resistant cells, respectively. The yellow fluorescent signal indicates that both of the RNA is equal expression level. The spots with signal intensities that were at least 1.5-fold different from control levels in both experiments were designated as genes that are differentially expressed.

F. cDNA microarrays 1. Preparation of fluorescent DNA probe from mRNA Probes were made as described (DeRisi et al, 1996) with several modifications. The reverse transcriptase used here was Superscript II RNase H (Life Technologies). The Cy-3 dCTP and Cy-5 dCTP were purchased from Amersham Pharmacia Biotech. Each reverse transcription reaction contained 3 µg of mRNA and 0.5 µg of oligo(dT) primer. Following the reverse transcription step, samples were treated with each 1.0 µl of 1.5 M sodium hydroxide and 30 mM EDTA for 10 minutes at 65oC, them neutralized by adding 468 µl of TE buffer (pH 7.4). Using a Micron 30 (Millipore), the probe was purified and concentrated. Cy-3 and Cy-5 fluorescently labeled probes were mixed in 3 X SSC, 0.1 % SDS with 0.5 mg/ml poly A blocker (Amersham Pharmacia Biotech), and 0.5 mg/ml yeast tRNA (Life Technologies) to a final volume of 25 µl

2. Microarray hybridization Arrays were prehybridized in 3.5 X SSC, 0.1% SDS, 10 mg/ml BSA in a Coplin jar for 20 minutes at 50oC, and washed by dipping in water and in isopropanol, and dried using centrifuge. The prepared probes was denatured by heating at 95100oC for 2 minutes and added onto a array with cover slide. The hybridization was done in a CMT-Hybridization chamber (Corning) for 20 hours in a 50oC waterbath. Arrays were washed for 5 minutes at room temperature in low stringency wash buffer (0.1 X SSC/0.1% SDS), then twice for 5 minutes in high stringency wash buffer (0.1 X SSC) and dried using centrifuge.

B. Analysis of gene expression pattern in cisplatin-resistant cancer cell lines In order to examine the gene expression profiles in resistant cell lines to cisplatin, we analyzed three different human cancer cell lines; cervical ME180, leukemia K562, ovarian A2780 sensitive and their-resistant counterparts to cisplatin ME180/PDD, K562/PDD, and A2780/PDD cancer cell lines, respectively. The resistance index of ME180/PDD, K562/PDD and A2780/PDD cancer cell lines to cisplatin are 5.0, 3.7 and 6.0, respectively.

3. Microarray hybridization Fluorescence intensities at the immobilized targets were measured using Scanarray 4000 with a laser confocal microscope (GSI Lumonics, USA). The two fluorescent images (Cy-3 and Cy-5) were scanned separately from a confocal microscope, and color images were formed by arbitrarily assigning differentiated cell intensity values into the red channel and control intensity into the green channel and data were analyzed using Quantarray software (version 2.0.1, GSI Lumonics). Results were also analyzed by normalization between the images to adjust for the different efficiencies in labeling and detection with the two different fluors. This was achieved by matching of the detection sensitivities to bring a set of 32 internal control genes (!-actin and GAPDH) to nearly equal intensity. For this analysis, we used

Figure 2 shows tree view image of clustered data set of 3,063 genes in three human cancer cell lines. Table 1 summarizes 30~40 of up-regulated and 10~15 of downregulated genes with expression ratio in these cisplatinresistant cancer cell lines. Compared to the sensitive cells, three resistant cells showed the up-regulated genes with

Kim et al: Gene expression and cisplatin resistance Table 1: List of up- and down-regulated genes in three human resistant cancer cell lines to cisplatin Up-regulated genes Cell adhesion & matrix actin, alpha 2 integral type I protein myosin, light chain vimentin keratin 5 (KRT5) integrin-linked kinase(ILK) collagen, type V, alpha 3 tubulin, alpha, brain-specific myosin (MYL6) Cell cycle thymosin, beta 4 thymosin beta-10 cyclin-dependent kinase 4 DNA binding & response high-mobility group protein G protein (GNB2L1) G-rich RNA sequence binding factor 1 PAI-RBP1 Oncogenes RAS oncogene family prostate tumor over expressed gene 1 Enzymes B4GALT1 PPAP2B ubiquitin esterase L1 aldo-keto reductase family 1 Ca-independent phospholipase A2 tissue inhibitor of metalloproteinase 1 N-terminal acetyltransferase complex Other genes superoxide dismutase 1 anti-oxidant protein 2 fibroblast activation protein osteonectin HS1 binding protein (HAX1) prostatic binding protein (PBP)

Exp. ratio 3.7 2.4 2.2 2.1 1.9 1.7 1.6 1.6 2.0

Down-regulated genes

Exp. ratio

Cell adhesion & matrix elastin lumican decorin cadherin 2

0.1 0.1 0.2 0.2

DNA binding & response transcription factor Dp-2 nuclear receptor BP

0.4 0.4

3.2 1.8 1.7 1.8 2.3 2.0 1.9 1.9 1.8

Enzymes

2.9 2.7 2.6 2.0 1.9 1.7 1.7 1.8 2.0 2.1 2.0 2.2 1.7

antizyme inhibitor kinectin 1(kinesin receptor) thyroid receptor protein

0.5 0.4 0.5

Other genes Dickkopf-1 ATP binding protein netrin 4 selenoprotein (SEP15) crystallin, alpha B

0.1 0.5 0.5 0.5 0.5

expression profiles, respectively, however majortrends in described genes in Table 1 were similar. Characteristic point in Table 1 is that several genes of cell adhesion & matrix, DNA-associated, and enzyme are up- or downregulated depending on their types, however genes of cell cycle and oncogene were only shown in up-regulated genes of cisplatin-resistant cell lines.

expression ratio higher than 1.60 including genes of cell adhesion & matrix such as actin, integrin, collagen, tubulin, and keratin; cell cycle such as thymosin and cyclin-dependent kinase; DNA binding & response such as G protein, RNA binding factor and high mobility group; oncogene such as RAS oncogene and prostate tumor overexpressed gene; various enzymes such as ubiquitin esterase, aldo-keto reductase, and phospholipase; and superoxide dismutase (SOD).They also showed the downregulated genes with expression ratio lower than 0.5 including genes of cell adhesion such as elastin, cadherin, and decorin; DNA binding & response such as transcription factor Dp-2 and nuclear receptor binding protein; enzyme such as thyroid receptor protein, and antizyme inhibitor; and Dickkopf-1. ME180, K562 and A2780 resistant cell lines showed a little different gene

C. Analysis of gene expressions of A2780/PDD cells treated with liposomal platinum drug To examine the changes of gene expressions by overcoming the cisplatin resistance, we tried to compare the microarray results between untreated and treated A2780/PDD cells with liposomal Pt(dach)(glu),

Cancer Therapy Vol 1, page 25 respectively. Table 2 shows cell cytotoxicity results of cisplatin and L-Pt(dach)(glu), in A2780 sensitive and A2780/PDD resistant cells. L-Pt(dach)(glu) was known to overcome the cisplatin resistance due to the dach group in platinum complex and cell fusion ability of liposome. As a result, the IC50 values of cisplatin (20 Âľg/ml) and L-

Pt(dach)(glu) (10 Âľg/ml) were similar in sensitive cells, however those in resistant cells were 120 and 25 Âľg/ml, respectively. Therefore, the resistance indexes were calculated out to be 6.0 and 1.25 for cisplatin and LPt(dach)(glu), respectively. It means that L-Pt(dach)(glu) can overcome the cisplatin resistance in A2780/PDD cells.

Figure 2. Tree view image of clustered data set of 3,063 genes in three human carcinoma cell lines. The vertical axis corresponds to genes, and the horizontal axis to cell lines. Red colors indicate up-regulated transcripts and green colors indicate down-regulated transcripts in each cell line.

Kim et al: Gene expression and cisplatin resistance Table 2. Cell cytotoxicity of cisplatin and liposomal dach-platinum drug (L-Pt(dach)(glu)) in human ovarian A2780 cancer cell linesa Drug type

A2780

A2780/PDD

Resistance Index

Cisplatin

IC50c = 20

IC50 = 120

6.0

Liposomalb platinum drug (L-Pt(dach)(glu))

1.25

Table 3. Lists the up- and down-regulated genes in A2780/PDD resistant cells treated with liposomal dach-platinum drug. Up-regulated genes Exp. ratio Down-regulated genes Exp. ratio Cell adhesion & matrix Cell adhesion & matrix integrin beta 1 BP1 2.5 collagen, type VI, alpha 3 0.2 cyclophilin B 2.4 aggrecan 1 0.4 actin, beta 2.3 integrin beta 4 BP 2.1 tubulin, beta 2 1.9 fibrillarin 1.9

Enzymes fructose aldolase A carboxypeptidase E glucose phosphate isomerase proteasome subunit, beta catechol-O-methyltransferase enolase 1, alpha NADH dehydrogenase cytochrome c oxidase 8 isocitrate dehydrogenase Cytokines IL-1 receptor-kinase 1 IL-10 interferon-induced protein 1-8U Tumor suppressor non-metastatic cells 2 BCL2-associated athanogene 3 downregulated in ovarian cancer1 Other genes heat shock protein 1 dickkopf homolog 3 chromatin assembly factor 1 chloride intracellular channel 1 clusterin (lusis inhibitor) annexin A5

DNA binding & response high-mobility group protein 1 translation initiation factor 3 transcription factor BTF3 methyl-CpG BP 2 Enzymes topoisomerase II alpha glutathione S-transferase,13 thioredoxin isolog peroxiredoxin 3 glycyl-tRNA synthetase asparaginyl-tRNA synthetase

4.8 5.5 2.9 4.1 3.4 2.8 2.2 2.1 1.9

Ca2+ related genes calumenin reticulocalbin 1 calnexin Oncogenes hypoxia-inducible factor 1 ras homolog gene family, C RAB7 (RAS oncogene) TGF beta 2 Other genes superoxide dismutase 1 anti-oxidant protein 2 dynein, LIC-2 SMT3, homolog 2

2.0 2.1 3.0 2.6 2.6 2.0

6.9 3.5 2.6 2.3 2.2 1.9

0.2 0.2 0.5 0.5 0.2 0.5 0.5 0.5 0.1 0.4

0.2 0.3 0.5 0.2 0.2 0.5 0.2 0.5 0.3 0.5 0.5

Cancer Therapy Vol 1, page 27

Figure 3. Tree view image of clustered data set of 3,063 genes in A2780/PDD cell lines treated with liposomal dach-platinum drug (LPt(dach)(glu)). The vertical axis corresponds to genes, and the horizontal axis to cell lines treated with the liposomal dach-platinum drug. Red colors indicate up-regulated transcripts and green colors indicate down-regulated transcripts.

Based on chemosensitivity results in Table 2, A2780/PDD resistant cells were treated with LPt(dach)(glu) at the concentrations of IC50 values for 24 hours. After analyzing the microarray results using drugtreated and -untreated cells, the clustered data set of 3,063 genes are shown in Figure 3. Red colors indicate upregulated transcripts and green colors indicate downregulated transcripts. Table 3 shows up- and downregulated genes in A2780/PDD cells when treated with LPt(dach)(glu). Gene expressions of cell cyle, DNA binding & response, oncogene, superoxide dismutase (SOD) and anti-oxidant protein those were found to up-regulated in cisplatin-resistant cell lines compared to sensitive cell lines (Table 1) were reduced or even found in downregulated gene profile.

Pt(dach)(glu). On the other hand, gene expressions of cytokines such as IL-10, IL-1 receptor kinase 1, and interferon-induced protein; and tumor suppressors such as non-metastatic related, Bcl2 associated, and down regulator of ovarian cancer 1 were newly appeared in list of up-regulated genes. In brief, L-Pt(dach)(glu) reduced gene expressions of oncogenic factors, DNA-associated, cell cycle and proliferation, and induced those of cytokine and tumor suppressor genes. These results proved the positive effect of cell cytotoxicity of L-Pt(dach)(glu) in A2780/PDD cell lines which indicates overcoming cisplatin resistance. Furthermore, some carbohydratemodifying enzymes were newly added in up-regulated profiles. This suggests that this liposomal drug may go through different mode of action and cell-killing mechanism including several important carbohydrate modifications to overcome cisplatin resistance.

For example, DNA binding & response high-mobility group protein (HMG), oncogene (RAS), SOD and antioxidant protein were down-regulated from 1.8, 1.9, 1.8 and 2.0 expression ratio in A2780/PDD cells to 0.2, 0.2, 0.5 and 0.3 in drug-treated A2780/PDD cells, respectively. Most of cell adhesion and matrix genes were still found to up-regulated without significant changes by L-

Among down-regulated genes by the treatment of LPt(dach)(glu) (Table 3), high mobility group protein 1, RAS, SOD, and anti-oxidant protein genes were found in up-regulated gene list in cisplatin-resistant profile (Table 1). Many other oncogenes such as hypoxia-inducible

Kim et al: Gene expression and cisplatin resistance Andrews PA, Velury S, Mann SC, Howell SB (1988) cisDiamminedichloroplatimum(II) accmulation in sensitive and resistant human ovarian carcinoma cells. Cancer Res 48, 6873. Behrens BC, Hamilton TC, Masuda H, Grotzinger KR, WhangPeng J, et al (1987) Characterization of a cis-diammine dichloroplatimum(II)-resistant human ovarian cancer cell line and its use in evaluation of platinum analogues. Cancer Res 47, 414-418. Canon JL, Humblet Y, Symann M ( 1990) Resistance to cisplatin. How to deal with the problem? Eur J Cancer 26, 1-3. Carter S (1984) Cisplatin-past, present and future. In: Hacker MP (ed). Platinum Coordination Complexes in Cancer Chemotherapy Martinus Nijhoff Press: Boston, 359-370. Dabholkar M, Thornton K, Vionnet J, Bostick-Bruton F, Yu JJ, Reed E (2000) Increased mRNA levels of xeroderma pigmentosum complementation group B (XPB) and Cockayne’s syndrome complementation group B (CSB) or metallothionein-II (MT-II) in platinum-resista. Biochem Pharmacol 60, 1911-1619 DeRisi JL, Penland PO, Brown ML, Bittner PS, Meltzer M, Ray Y, Chen YAS, Trent JM (1996) Use of cDNA microarray to analyse gene expression patterns in human cancer. Nat Genet 14, 457-460. Gabizon AA, Goren D, Cohen R, Barenholz Y (1998) Development of liposomal anthracyclines: from basics to clinical applications. J Con Rel 53, 275-279. Godwin AK, Meister A, O’Dwyer PJ, Huang CS, Hamilton TC, Anderson ME (1992) High resistance to cisplatin in human ovarian cancer cell lines is associated with marked increase of glutathione synthesis. Proc Matl Acad Sci USA 89, 30703074.

factor, RAB7, and TGF-! and DNA binding & response genes such as transcription factor and methyl CpG binding protein genes were also down-regulated in L-Pt(dach)(glu) treatment. In addition, topoisomerase and redox-related enzymes such as glutathion, thioredoxin, and peroxiredoxin; and calcium-related genes such as calumenin, reticulocalbin, and calnexin were appeared in down-regulated profiles. In summary, L-Pt(dach)(glu) up-regulated gene expressions of cytokines, tumor suppressors and carbohydrate-modifying enzymes; and down-regulated those of oncogene, DNA binding & response, redox- and cacium-related enzymes, and SOD in cisplatin-resistant A2780/PDD cells. Therefore, some gene expression profiles of cisplatin resistant cells were changed to the opposite direction by the treatment of L-Pt(dach)(glu) which may explain their losing cisplatin resistance in A2780/PDD cells. Up-regulation of cytokine and tumor suppressor and down-regulation of oncogene definitely related with the cytotoxicity of anticancer-drug to kill the cancer cells. However, up-regulations of carbohydratemodifying enzymes; and down-regulations of redox- and calcium-related enzymes would give a clue that LPt(dach)(glu) have overcome cisplatin resistance through different mode of action and cell killing mechanism compared to previous anti-cancer drug, cisplatin. All these results proved that cDNA microarray analysis could be useful to evaluate the keeping or overcoming of cisplatin resistance in human cancer cell lines.

Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, et al (1999) Molecular claasification of cancer: class discovery and class prediction by gene expression monitoring. Science 286, 531-537. Ho SY, Babarese E, D’Arrigo JS (1997) Evaluation of lipidcoated microbubbles as a delivery vehicle for Taxol in brain tumor therapy. Neurosurgery 40, 1260-268. Jennerwein M, Eastman A, Khokhar AR (1989) Characterization of adducts produced in DNA by isomeric 1,2diaminocyclohexaneplatinum(II) complexes. Chem Biol Interact 70, 39-49. Johnson SW, Laub PB, Beesley JS, Ozols RF, Hamilton TC (1997) Increased platinum-DNA damage tolerance is associated with cisplatin resistance and cross-resistance to various chemotherapeutic agents in unrelated human ovarian cancer cell lines. Cancer Res 57, 850-856. Kelland LR, Mistry P, Abel G, Loh SY, O’Neill CF, Murrer VA, Harrap KR (1992) Mechanism-related circumvention of acquired cis-diamminedichloroplatinum(II) resistance using two pairs of human ovarian carcinoma cell lines by ammine/amine platinum(II) dicarboxylates. Cancer Res 52, 3857-3864. Khokhar AR, Al-Baker S, Brown T, Perez-Soler R (1991) Chemical and biological studies on a series of lipid-soluble DACH-Pt(II) complexes incorporated in liposomes. J Med Chem 34, 325-329. Konno T. (1992) Targeting chemotherapy for hepatoma-arterial administration of anticancer drugs dissolved in lipidol. Eur J Cancer 28, 403-409. Lai G-M, Ozols RF, Smyth JF, Young RC, Hamilton TC (1988) Enhanced DNA repair, resistance to cisplatin in human ovarian cancer. Biochem Pharmacol 37, 4597-4600. Masuda H, Ozols RF, Lai G-M, Fojo A, Rothenberg M, Hamilton TC (1988) Increased DNA repair as a mechanism of acquired resistance to cis-diammine dichloroplatimum(II)

The prediction of the cisplatin resistance and sensitivity of tumors is an extremely important criteria to use anti-cancer drug for cancer chemotherapy. One approach to solve the limitation of anti-cancer drug based chemotherapy is to elucidate the mechanisms of drug resistance and then develop ways to overcome resistance effectively or to prevent its occurrence. As for clinical application, microarray can be used to compare the gene expression profiles directly from patient samples to differentiate between chemotherapy sensitive group and the resistant group. It will really help to decide the treatment modalities. Thus, microarray analysis will be applied for personalization of chemotherapy such as selection of effective chemotherapy protocol and prediction of therapeutic efficacy in near future.

Acknowledgements This work was supported by grant (FG00-0101-0012-2-0) from the 21C Frontier Human Genome Project, The Ministry of Science and Technology, Republic of Korea.

References Alizadeh AA, Eisen MB, Davis RE, Ma C, Lossos IS, Rosenwald A, et al (2000) Distinct types of diffuse large Bcell lymphoma identified by gene expression profiling. Nature 403, 503-511. Aloyz R, Xu ZY, Bello V, Bergeron J, Han FU, Yan Y, Malapetsa A, et al (2002) Regulation of cisplatin resistance and homologous recombinational repair by the TFIIH subunit XPD. Cancer Res 62, 5457-5462.

Cancer Therapy Vol 1, page 29 in human ovarian cancer cell lines. Cancer Res 48, 57135716. Mistry P, Kelland LR, Abel G, Sidhar S, Harrap KR (1991) The relationships between glutathione, glutathione-S-transferase, cytotoxicity of platinum drugs, melphalan in eight human ovarian carcinoma cell lines. Br J Cancer 64, 215-220. Parker RJ, Eastman A, Bostick-bruton F, Reed E (1991) Acquired cisplatin resistance in human ovarian cancer cells is associated with enhanced repair of cisplatin-DNA lesions and reduced drug accumulation. J Clin Invest 87, 772-777. Perou CM, Sorlie T, Eisen MB, Jeffrey SS, Rees CA, Pollack JR, Ross DT, et al (2000) Molecular portraits of human breast tumors. Nature 406, 747-752. Sakamoto M, Kondo A, Kawasaki K, Goto T, Sakamoto H, Miyake K, et al (2001) Analysis of gene expression profiles associated with cisplatin resistance in human ovarian cancer

cell lines and tissues using cDNA microarray. Human Cell 14, 305-315. Sharma A, Mayhew E, Straubinger RM (1993) Antitumor effect of Taxol-containing liposomes in a Taxol-resistant murine tumor model. Cancer Res 53, 5877-5881. Wood RD (1997) Nucleotide excision repair in mammalian cells. J Biol Chem 272, 23465-23468. Xu ZY, Chen ZP, Malapetsa A, Alaoui-Jamali MA, Bergeron J, et al (2002) DNA repair protein levels vis-Ă -vis anticancer drug resistance in the human tumor cell lines of the National Cancer Institute drug screening program. Anti-Cancer Drugs 13, 511-519. Zhen W, Link CJ Jr, Oâ&#x20AC;&#x2122;Connor PM, Reed E, Parker R, Howell SB, Bohr VA (1992) Increased gene-specific repair of cisplatin interstrand cross-links in cisplatin-resistant human ovarian cancer cell lines. Mol Cell Bio 12, 3689-3698.

Kim et al: Gene expression and cisplatin resistance

Cancer Therapy Vol 1, page 31 Cancer Therapy Vol 1, 31-37, 2003

Vascular endothelial growth factor modulates cisplatin sensitivity in human ovarian carcinoma cells Research Article

Guodong Hu, Sean Ryan, Yunfeng Zhu, Eddie Reed, Xiping Li, Gangduo Wang, and Qingdi Q. Li* The Mary Babb Randolph Cancer Center and Department of Microbiology, Immunology and Cell Biology, West Virginia University School of Medicine and Robert C. Byrd Health Sciences Center, Morgantown, WV 26506, USA __________________________________________________________________________________________________ *Corresponding Author: Qingdi Q. Li, M.D., Ph.D., 1831 Mary Babb Randolph Cancer Center, West Virginia University, Health Sciences Center, P.O. Box 9300, Morgantown, WV 26506-9300, USA; Tel: 304-293-6870; Fax: 304-293-4667; e-mail: qli@hsc.wvu.edu Key words: Angiogenesis, VEGF, ovarian cancer, Caov3 cells, cisplatin resistance. Abbreviations: VEGF, vascular endothelial growth factor; VPF, vascular permeability factor; GSH, glutathione; cisplatin (CDDP), cisdiamminedichloroplatinum (II); bFGF, basic fibroblast growth factor; HGF, hepatocyte growth factor; PGF, placenta growth factor; PDEGF, platelet-derived endothelial growth factor; PBS, phosphate-buffered saline; DMSO, dimethyl sulfoxide; MTT, 3-(4,5dimethylthuazole-2-yl)-2,5 diphenyl tetrazolium bromide; RT-PCR, reverse transcriptase polymerase chain reaction; FasL, Fas ligand; NER, nucleotide excision repair; JNK, c-Jun N-terminal kinase; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase; MEK, mitogen-activated protein kinase/ERK kinase; AP-1, activator protein 1. Received: 11 February 2003; Accepted: 19 February 2003; electronically published: April 2003

Summary Cisplatin is among the most effective and widely used chemotherapeutic agents employed for treatment of human cancers, and a major limitation of cisplatin chemotherapy is serious drug resistance. Vascular endothelial growth factor (VEGF), a potent angiogenic factor, plays an important role in cell growth and survival of endothelial cells and tumor cells. However, the role of VEGF in cisplatin resistance in human cancers is unclear. Therefore, the present study sought to examine the effect of VEGF on cisplatin-induced cytotoxicity in human ovarian cancer CaOV3 cells. We show in this report that VEGF mediated cytoprotection against cisplatin-caused cell killing and significantly increased cell survival in CaOV3 cells exposed to cisplatin. VEGF was found to reduce cisplatin cytotoxicity and decrease cisplatin sensitivity in these cells, which are dependent upon the concentrations of cisplatin. The effect of VEGF was also sequence-dependent. Concurrent treatment of VEGF and cisplatin markedly increased cell viability as compared to cells exposed to cisplatin alone. By contrast, only a little effect of VEGF was observed when cells were treated with VEGF after or prior to cisplatin. These findings suggest that VEGF may contribute to the chemoresistance to cisplatin in patients with ovarian cancer and other tumors, and hence highlight that potential therapeutic strategies of anti-angiogenesis which specifically inhibit VEGF activity may reverse drug resistance to cisplatin. statistics stem from the fact that while most patients have a response to initial therapy, the majority of these responses are transient. Most patients will have cisplatin-resistant disease. The precise mechanism of cisplatin resistance in human cancers is, however, still not fully understood although substantial efforts have been made to solve this enigma. Multiple mechanisms have been implicated in the development of cisplatin resistance including reduced accumulation of the drug, elevated levels of glutathione (GSH), enhanced expression of metallothionein, increased DNA repair, enhanced tolerance of cisplatin damage, increased levels of Bcl-2-related anti-apoptosis genes, and

I. Introduction Human ovarian cancer is the fifth leading cause of cancer death among women in the United States and the most common cause of death in women in whom gynecologic cancer develops. The mainstay of therapy for advanced stage ovarian cancer is cisplatin-based systemic chemotherapy (Young et al, 1993; Reed, 1993; Reed, 1996; Reed et al, 1996; Reed, 1998). However, long-term disease-free survival following appropriate aggressive initial treatment ranges from 10 to 20% (Young et al, 1993; Omura et al, 1991). The disappointing survival 31

Hu et al: VEGF reduces sensitivity to cisplatin in ovarian cancer cells subculturing. Cisplatin (Sigma-Aldrich Co., St. Louis, MO) was initially dissolved in phosphate-buffered saline without Ca2+ or Mg2+ at 1.0 mg/ml (3.33 µM cisplatin), and dilutions from this solution were made in medium to obtain the desired drug treatment concentrations. VEGF (Human Recombinant VEGF165) was purchased from Oncogene Research Products (Cambridge, MA). VEGF was initially dissolved in phosphatebuffered saline (PBS) at 5 µg/ml, and dilutions from this solution were made in medium to obtain the desired cytokine treatment concentrations. CaOV3 cells were assayed for sensitivity to cisplatin by measurement of the inhibition of growth following 24 to 48-h exposure to cisplatin ranging from 20 to 40 µM. Cells were seeded at an initial cell density of 2 X 104 cells/ml. Cells were starved for 48 h with the medium containing 0.2% fetal bovine serum. Cells were then treated with VEGF or cisplatin alone, or the combination of VEGF and cisplatin in different sequences. After continuous contact with cisplatin for 24-48 h, medium was removed, and cell viabilities were determined using the MTT cell viability assay. Cells treated similarly in the absence of VEGF and/or cisplatin served as controls.

alterations in signal transduction pathways involved in apoptosis (Reed et al, 1996; Gosland et al, 1996; Dabholkar and Reed, 1996; Kerbel, 1997; Reed, 1998; Reed, 1998). Angiogenesis is the process of new blood vessel growth and is necessary for growth of solid malignant tumors (Folkman, 1991). Angiogenesis not only allows a tumor to increase in size, but also increases the probability of metastasis (Folkman, 1993). Vessel growth is controlled by a balance of endogenous inhibitors and stimulators (Folkman, 1991). A number of growth factors and cytokines have been identified as potential positive inducers of angiogenesis, including vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), hepatocyte growth factor (HGF), placenta growth factor (PGF), and platelet-derived endothelial growth factor (PDEGF) (Kerbel, 2000; Slodkowska et al, 2000; Liekens et al, 2001). Recently, an increasing number of studies both in vitro and in mice demonstrated that angiogenic growth factors augment tumor cell survival and confer drug resistance by inhibiting apoptosis (Borsellino et al, 1995; Volm et al, 1999; Grothey et al, 1999; Coleman et al, 2000). For instance, evidence showed that HGF reduces sensitivity to chemotherapeutic agents and stimulates cell invasion and migration (Meng et al, 2000). Other investigations indicated that elevated levels of intracellular bFGF correlate with resistance to fludarabine in chronic lymphocytic leukemia (Menzel et al, 1996). Furthermore, overexpression of bFGF is associated with resistance to cisplatin in a human bladder cancer cell line (Miyake et al, 1998). Moreover, the addition of exogenous bFGF to endothelial cells inhibits apoptosis induced by DNA damage from ionizing radiation (Fuks et al, 1994). However, the role of VEGF and other angiogenic factors in the development of cisplatin drug resistance is unknown at the present time. The goal of the current study was to evaluate the effect of VEGF on cisplatin antitumor activity in human ovarian cancer cells. We show in this paper that VEGF decreases drug sensitivity and increases cell survival in human CaOV3 ovarian tumor cells exposed to cisplatin.

B. Cell toxicity assay The effect of VEGF and/or cisplatin on antitumor activity in human CaOV3 ovarian carcinoma cells was determined by the MTT survival assay, or using a commercial MTT assay kit (CellTiter 96! Aqueous One Solution Cell Proliferation Assay; Promega Corporation, Madison, WI) according to the manufacturer’s instructions. The MTT survival assay was performed as described previously (Yu et al, 2000). The MTT assay is a commonly used method in evaluation of cell survival, based on the ability of viable cells to convert MTT, a soluble tetrazolium salt [3-(4,5-dimethylthuazole-2-yl)-2,5 diphenyl tetrazolium bromide], into an insoluble formazan precipitate, which is quantitated by spectrophotometry following solubilization in dimethyl sulfoxide (DMSO). Briefly, CaOV3 cells untreated and treated with VEGF or cisplatin alone, or the combination of VEGF and cisplatin in 96-well tissue culture dishes were incubated with MTT (2 µg/ml) for 4 h. The cells were then solubilized in 125 µl of DMSO and absorbance readings were taken using a 96-well Opsys MR" Microplate Reader (ThermoLabsystems; Chantilly, VA). The amount of MTT dye reduction was calculated based on the difference between absorbance at 570 nm and at 630 nm. Cell viability in treated cells was expressed as the amount of dye reduction relative to that of untreated control cells. The wells which contained only medium and 10 µl of MTT were used as blanks for the plate reader. Three sets of experiments were performed in 8-12 wells for each treatment.

II. Materials and methods A. Cell line and cell culture conditions The human ovarian carcinoma cell line CaOV3 (HTB-75; American Type Culture Collection, Manassas, VA) that has been described previously was used in all of the experiments. Cells were cultured in monolayers using a RPMI 1640 medium supplemented with 10% (v/v) fetal calf serum, 2 mM Lglutamine, 0.2 units/ml human insulin, 50 units/ml penicillin, and 50 µg/ml streptomycin (Life Technologies, Inc, Gaithersburg, MD). Cells were grown in logarithmic growth at 37 ˚C in a humidified atmosphere consisting of 5% CO2 and 95% air. Cells were routinely tested for mycoplasma infection using a commercial assay system (MytoTect; Life Technologies); new cultures were established monthly from frozen stocks. All media and reagents contained <0.1 ng/ml endotoxin as determined by Limulus polyphemus amebocyte lysate assay (Whittaker Bioproducts, Walkersville, MD). Cell viability was determined in triplicate by trypan blue dye exclusion. Before starting the experiments, cells were grown to 70-90% confluence after

III. Results A major goal of the ongoing project is to understand whether angiogenic growth factors that induce angiogenesis might reverse the drug resistance to cisplatin in human ovarian cancer and better understand the underlying mechanisms in the process. In the present investigation, we first determined whether the angiogenic factor VEGF could influence the cisplatin anticancer activity in human ovarian carcinoma cells. VEGF was found to significantly reduce cell susceptibility to cell killing caused by cisplatin and augment cell survival in the CaOV3 human ovarian tumor cell line. As shown in Fig. 1, concurrent treatment of both VEGF and cisplatin for 24

Cancer Therapy Vol 1, page 33 h dramatically decreased cisplatin-induced cell killing in these cells from 80% cells to 32-47% cells. This amounts to approximately a 2.5-fold reduction in the amount of cell killing as compared to the control in which cells were treated with cisplatin alone. A greater effect of VEGF was observed in cells exposed to VEGF plus cisplatin for 24 h, and then fresh medium containing only VEGF was replenished for an additional 24 h. In contrast, only a little effect of VEGF in this regard was seen when VEGF was given after or prior to cisplatin. We also examined the cytoprotective effect of VEGF in cells exposed to 20 µM cisplatin for a longer time (48 h) and in cells exposed to a higher concentration of cisplatin at 40 µM. In each case, the effect of VEGF was virtually identical to the effect seen in cells exposed to 20 µM cisplatin for 24 h. Figure 2 shows that there was marked cell kill in the cisplatin-treated group, in which approximately 87% of the cells were killed in a 48-h incubation time. By contrast, VEGF treatment significantly diminished the cell kill in this model system, yielding a 4.7 to 5.8-fold higher level of cell viability than in cells exposed to cisplatin alone.

The same was true when CaOV3 cells were exposed to 40 µM of cisplatin. Our data in Fig. 3 shows that VEGF, at the concentration of 50 ng/ml, both decreased cisplatininduced cytotoxicity and increased cell survival in these cells. Table I is the comparison of the effect of VEGF on cell viability between different concentrations of cisplatin, or different exposure time to the drug in human CaOV3 ovarian cancer cells. As seen in the table, there is no significant difference in the effect of VEGF on cell toxicity between the cells exposed to cisplatin for 24 h or for 48 h. However, the cell viability following cisplatin and VEGF treatment was much lower in cells exposed to 40 µM cisplatin than in cells exposed to 20 µM cisplatin, indicating that the higher the concentration of cisplatin, the lower the protective effect of VEGF. Together, these results suggest that VEGF has strong cytoprotective activity against cisplatin-caused cell death and promotes cell survival in cisplatin-treated human CaOV3 ovarian cancer cells.

Figure 1. Effect of VEGF on cytotoxicity by CDDP (20 µM for 24 h) in human ovarian carcinoma cells as assessed by the MTT survival assay. 2 X 10 4 cells per well from CaOV3 cells were evenly distributed in 96-well plates, and were starved for 48 h in culture medium containing 0.2% fetal bovine serum. Cells were then treated as the following: Control, treated with medium only; VEGF alone, treated with 50 ng/ml VEGF only; CDDP alone, exposed to CDDP at 20 µM for 24 h, and fresh medium was then replenished; CDDP-VEGF, exposed to CDDP for 24 h, and then fresh medium containing VEGF was replenished; CDDP+VEGF, exposed to CDDP and VEGF for 24 h, and then fresh medium was replenished; CDDP+VEGF-VEGF, exposed to CDDP and VEGF for 24 h, and then fresh medium containing VEGF was replenished; VEGF-CDDP, treated with VEGF for 24 h, changed to fresh medium containing CDDP for another 24 h, and then fresh medium was replenished; VEGF-CDDP-VEGF, treated with VEGF for 24 h, changed to fresh medium containing CDDP for an additional 24 h, and then fresh medium containing VEGF was replenished. All the cells were harvested 48 h from the time when 20 µM CDDP was added to the culture. Cell viability was measured by the MTT assay and is expressed as a percentage of untreated control. CDDP, cisplatin.

Figure 2. Effect of VEGF on cytotoxicity by CDDP (20 µM for 48 h) in human ovarian cancer cells as determined by the MTT cell viability assay. 2 X 104 cells per well from CaOV3 cells were evenly plated in 96-well plates, and were starved for 48 h in culture medium containing 0.2% fetal bovine serum. Cells were then treated as the following: Control, treated with medium only; VEGF alone, treated with 50 ng/ml VEGF only; CDDP alone, exposed to CDDP at 20 µM for 48 h, and fresh medium was then replenished; CDDP-VEGF, exposed to CDDP for 48 h, and then fresh medium containing VEGF was replenished; CDDP+VEGF, exposed to CDDP and VEGF for 48 h, and then fresh medium was replenished; CDDP+VEGF-VEGF, exposed to CDDP and VEGF for 48 h, and then fresh medium containing VEGF was replenished; VEGF-CDDP, treated with VEGF for 24 h, changed to fresh medium containing CDDP for 48 h, and then fresh medium was replenished; VEGF-CDDP-VEGF, treated with VEGF for 24 h, changed to fresh medium containing CDDP for 48 h, and then fresh medium containing VEGF was replenished. All the cells were harvested 72 h from the time when 20 µM CDDP was added to the culture. Cell viability was measured by the MTT assay and is expressed as a percentage of untreated control. CDDP, cisplatin.

Hu et al: VEGF reduces sensitivity to cisplatin in ovarian cancer cells

IV. Discussion VEGF, also known as vascular permeability factor (VPF), is a cytokine/growth factor, and has been known to be a potent, endothelial-cell-specific angiogenic mitogen. VEGF is secreted from tumor cells and other cells via its specific binding to its tyrosine kinase receptors (VEGFR1/Flt-1 and VEGFR2/Flk-1/KDR). Binding of VEGF to its receptors leads to intracellular propagation of a mitogenic signal through activation of the PI3 kinaseAkt and the ras-raf-MAP kinase pathways. VEGF and its receptors are expressed in angiogenic tissues during development, wound healing, and other situations such as neoplasm (Boocock et al, 1995) when angiogenesis occurs. Evidence has been accumulated that VEGF and its receptor mRNAs or proteins have been identified by reverse transcriptase polymerase chain reaction (RT-PCR), in situ hybridization, or immunohistochemistry in a number of tumors, including ovarian cancer (Boocock et al, 1995). The spatial and temporal patterns of expression of VEGF and its receptors as well as the results of targeted mutagenesis support that they are required for both normal and pathological angiogenesis during development. Similarly, the role of VEGF in tumor angiogenesis has been clearly demonstrated using tumor models in rodents. Moreover, recent studies also found that VEGF plays a role in the regulation of apoptosis induction and cell survival. Thus, VEGF contributes to the development and progression of malignant tumors. However, the role of VEGF and its receptor tyrosine kinases in the formation and development of drug resistance in human cancers remains unknown. In the present study, we demonstrated for the first time that VEGF plays an important role in the modulation of cisplatin antitumor activity in human ovarian carcinoma cells.

Figure 3. Effect of VEGF on cell toxicity by CDDP (40 µM for 24 h) in human ovarian tumor cells as measured by the MTT survival assay. 2 X 10 4 cells per well from CaOV3 cells were evenly distributed in 96-well plates, and were starved for 48 h in culture medium containing 0.2% fetal bovine serum. Cells were then treated as the following: Control, treated with medium only; VEGF alone, treated with 50 ng/ml VEGF only; CDDP alone, exposed to CDDP at 40 µM for 24 h, and fresh medium was then replenished; CDDP-VEGF, exposed to CDDP for 24 h, and then fresh medium containing VEGF was replenished; CDDP+VEGF, exposed to CDDP and VEGF for 24 h, and then fresh medium was replenished; CDDP+VEGF-VEGF, exposed to CDDP and VEGF for 24 h, and then fresh medium containing VEGF was replenished; VEGF-CDDP, treated with VEGF for 24 h, changed to fresh medium containing CDDP for an additional 24 h, and then fresh medium was replenished; VEGF-CDDP-VEGF, treated with VEGF for 24 h, changed to fresh medium containing CDDP for another 24 h, and then fresh medium containing VEGF was replenished. All the cells were harvested 48 h from the time when 40 µM CDDP was added to the culture. Cell viability was determined by the MTT assay and is expressed as a percentage of untreated control. CDDP, cisplatin

Table I. Comparison of the effect of VEGF on cell viability between CDDP at different concentrations or exposure time in human CaOV3 ovarian cancer cells.

See Figures 1-3 legends for additional details. Cell viabilities were determined by the MTT survival assay and expressed as a percentage of untreated control. CDDP, cisplatin

Cancer Therapy Vol 1, page 35 damages. It is broadly accepted that the antitumor activity of cisplatin results from the formation of cisplatin-DNA adducts that strongly interfere with the processing of genomic information (Rosenberg, 1979; Reed et al, 1993; Dabholkar and Reed, 1996). Cisplatin-DNA damage is repaired predominantly by the nucleotide excision repair (NER) machinery. Enhanced DNA repair capacity contributes to the formation of drug resistance to cisplatin in a wide variety of tumor cells. Our and other previous studies revealed that cisplatin may increase NER repair gene expression and DNA repair activity through a JNK-AP1 pathway leading to cell survival (Potapova et al, 1997; Li et al, 1998; Li et al, 1998; Li et al, 1999). On the other hand, a great deal of studies have supported the general view that activation of the ERK pathway delivers a survival signal. Consistent with such a prosurvival function for ERK, studies have shown that an inhibition of ERK signaling leads to increased sensitivity of ovarian cancer cell lines to cisplatin (Hayakawa et al, 1999; Persons et al, 1999). Therefore, it is possible that JNK and ERK may act collaboratively or synergistically to enhance survival of cisplatin-treated cells, as inhibition of either pathway accentuated cisplatin toxicity (Hayakawa et al, 1999). Based on these observations, we propose that VEGF may stimulate a ras-raf-MEK-ERK or PI3K-Akt cascade activity that enhances cisplatin-induced activation of JNKAP1. Such a mechanism might serve to integrate the actions of receptor protein tyrosine kinases and nonreceptor protein tyrosine kinases, which may underlie the mechanism of VEGF and cisplatin mediated DNA repair and cell survival in human ovarian cancer and other carcinomas. Studies are in progress to explore whether VEGF mediates cytoprotection against cisplatin-induced apoptosis in human cancer cells by upregulating apoptosisrescue signals, assess the effect of VEGF on DNA repair activity, and elucidate the role of PI3K-Akt, ERK or JNK in the signal transduction pathways through which VEGF modulates DNA repair activity or apoptotic activity in human carcinoma cells. In conclusion, we provided in vitro evidence for the first time that VEGF mediated cytoprotection against cisplatin-caused cell killing and significantly increased cell survival in human ovarian cancer cells exposed to cisplatin. Taken together with previous studies, our results strengthen the case that VEGF contributes to the carcinogenesis and chemoresistance of the chemotherapeutic agent cisplatin. Strategies targeting VEGF signaling pathway or the activity of VEGF, or down-regulating its expression could be employed to reduce drug resistance, increase tumor cell apoptosis, and enhance the chemotherapeutic effectiveness of cisplatin.

The addition of exogenous VEGF to the growth medium of CaOV3 cells markedly enhanced the dose-dependent survival of cells exposed to increasing concentrations of cisplatin, and therefore directly reduced the sensitivity of CaOV3 cells to this chemotherapy drug. The cytoprotective effect of VEGF against cisplatin toxicity is sequence-dependent, with maximal effect seen in cells exposed to VEGF and cisplatin simultaneously, suggesting that VEGF may exert its action through reducing cisplatincaused cell damage. A higher survival rate was observed in cells treated with VEGF plus cisplatin for 24 h, followed by VEGF only for an additional 24 h, as compared to the cells incubated with medium only after VEGF and cisplatin were removed from the cultures. This appears to suggest that continuous exposure of the cells to VEGF after cisplatin damage may prevent the cells from further damage or apoptosis caused by cisplatin, or it may enhance cell repair of cisplatin-induced DNA damage leading to a higher rate of cell viability. Exogenous VEGF did not produce any cytotoxic effects in the absence of cisplatin, and it had the expected stimulatory effect on cell growth (Figures 1 and 2). Similar effect of VEGF was also observed in TOV-21G human ovarian cancer cell line, indicating that augmented cell survival and decreased cisplatin sensitivity appear to be a common effect of VEGF in different ovarian cancer cells. The mechanism underlying the effect of VEGF in ovarian tumor cells is, however, unclear at this point. Given its broad spectrum of activities, VEGF may exert its effect in mediating the development of drug resistance through several ways. First of all, VEGF may be involved in cisplatin drug resistance via anti-apoptotic activity. Recently, experimental and clinical studies showed that VEGF was related not only to angiogenic activity, but also to the inhibition of apoptotic activity (Slodkowska et al, 2000). For example, the effects of VEGF on delaying apoptosis and prolonging the survival of tumor cell may be indirect, via the inhibition of specific genes that promote apoptosis, such as down-regulating Fas and Fas ligand (FasL) proteins, or decreasing levels of cytochrome c in the cytoplasm (Volm et al, 1996; Coleman et al, 2000). Alternatively, VEGF may block cisplatin-induced apoptosis through reducing cisplatin-caused DNA damage. Cisplatin-induced apoptosis has been closely tied to its ability to cause DNA damage (Eastman, 1990). In addition, VEGF-mediated protection of tumor cells against cisplatin may result not only from activation of an anti-apoptosis pathway, but also from an increase in repair of DNA damage. In other words, VEGF may modulate cisplatin sensitivity indirectly through the regulation of DNA repair activity. Although we do not have direct evidence at this point that VEGF mediate this effect by enhancing DNA repair, we showed in a separate study that SU5416, a selective inhibitor of VEGF receptors, counteracted the effect of VEGF by augmenting cisplatin cytotoxicity and increasing cisplatin sensitivity in human ovarian tumor cells. We further found that the effect of SU5416 on the increase in cell death or reduction of cell survival of cisplatin-treated cells is due in part to the reduction in repair efficiency of cisplatin-caused DNA

Acknowledgements This project was supported by grants from the National Institutes of Health, Bethesda, Maryland (No. 1P20RR016440-010003) and West Virginia University Research Development Grant (to Q.Q.L.).

Hu et al: VEGF reduces sensitivity to cisplatin in ovarian cancer cells Menzel T, Rahman Z, Gabrilove J (1996) Elevated intracellular level of basic fibroblast growth factor correlates with stage of chronic lymphocytic leukemia and is associated with resistance to fludarabine. Blood 87, 1056-1063. Miyake H, Hara I, Kamidono S (1998) Expression of basic fibroblast growth factor is associated with resistance to cisplatin in a human bladder cancer cell line. Cancer Lett. 123, 121-126. Omura GA, Brady MF, Park RC (1991) Long-term follow-up and prognostic factor analysis in advanced ovarian carcinoma: The Gynecologic Oncology Group experience. J. Clin. Oncol. 9, 1138-1150. Persons DL, Cui W, Pelling JC (1999) Cisplatin-induced activation of mitogen-activated protein kinases in ovarian carcinoma cells: inhibition of extracellular signal-regulated kinase activity increases sensitivity to cisplatin. Clin. Cancer Res. 5, 1007-1014. Potapova O, Haghighi A, Bost F, Liu C, Birrer MJ, Gjerset R, Mercola D (1997) The Jun kinase/stress-activated protein kinase pathway functions to regulate DNA repair and inhibition of the pathway sensitizes tumor cells to cisplatin. J. Biol. Chem. 272, 14041-14044. Reed E (1993) Platinum analogs, anticancer drugs. In Cancer Principles and Practice of Oncology Rosenberg SA, Ed. Philadelphia, PA, Lippincott, pp. 390-400. Reed E (1996) The chemotherapy of ovarian cancer. PPO Updates 10, 1-12. Reed E (1998) Nucleotide excision repair and anti-cancer chemotherapy. Cytotechnology 27, 187-201. Reed E ( 1998) Platinum-DNA adduct, nucleotide excision repair and platinum based anti-cancer chemotherapy. Cancer Treatment Reviews 24, 331-344. Reed E, Dabholkar M, Chabner BA (1996) Platinum analogues. In Cancer Chemotherapy and Biotherapy: Principles and Practice, 2nd ed. Longo DL, Ed. Philadelphia, PA, Lippincott-Raven Publishers, pp. 357-378. Reed E, Parker RJ, Gill I, Bicher A, Dabholkar M, Vionnet JA (1993) Platinum-DNA adduct in leukocyte DNA of a cohort of 49 patients with 24 different types of malignancies. Cancer Res. 53, 3694-3699. Rosenberg B (1979) Anticancer activity of cisdichlorodiammineplatinum (II) and some relevant chemistry. Cancer Treat. Rep. 63, 1433-1438. Slodkowska J, Sikora J, Roszkowski-Sliz K (2000) Expression of vascular endothelial growth factor and basic fibroblast growth factor receptors in lung cancer. Analyt. Quant. Cytol. Histol. 22, 398-402. Snedecor GW, Cochran WG (1967) Statistical methods. Ames, IA, The Iowa State University Press. Volm M, Koomagi R, Mattern J (1996) Interrelationships between microvessel density, expression of VEGF and resistance to doxorubicin of non-small lung cell carcinoma. Anticancer Res. 16, 213-218. Volm M, Mattern J, Koomagi R (1999) Inverse correlation between apoptotic (Fas ligand, Caspase-3) and angiogenic factors (VEGF, Microvessel density) in squamous cell lung carcinomas. Anticancer Res. 19, 1669-1672. Young RC, Perez CA, Hoskins WJ (1993) Cancer of the ovary. In Cancer-Principles & Practice of Oncology, 4th ed. Rosenberg SA, Ed. Philadelphia, PA, J. B. Lippincott, pp. 1245-1252. Yu JJ, Li Q, Reed E (2000) Comparison of two human ovarian carcinoma cell lines (A2780/CP70 and MCAS) that are

References Boocock CA, Sharkey AM, McLaren J, Barker PJ, Wright KA, Twentyman PR, Smith SK (1995) Expression of vascular endothelial growth factor and its receptors flt and KDR in ovarian carcinoma. J. Natl. Cancer Inst. 87, 506-516. Borsellino N, Belldegrun A, Bonavida B (1995) Endogenous interleukin 6 is a resistance factor for cisdiaminedichloroplatinum and etoposide-mediated cytotoxicity of human prostate carcinoma cell lines. Cancer Res. 55, 4633-4639. Coleman AB, Momand J, Kane SE (2000) Basic fibroblast growth factor sensitizes NIH 3T3 cells to apoptosis induced by cisplatin. Molecular Pharmacology 57, 324-333. Dabholkar M, Reed E (1996) Cisplatin. Cancer Chemother. Biol. Response Modif. 16, 88-110. Eastman A (1990) Activation of programmed cell death by anticancer agents: cisplatin as a model system. Cancer Cells 2, 275-280. Folkman J (1971) Tumor angiogenesis: Therapeutic implications. N. Engl. J. Med. 285, 1182-1186. Folkman J (1993) Diagnostic and therapeutic applications of angiogenesis research. C. R. Acad. Sci. III 316, 909-918. Fuks Z, Persaud RS, Haimovitz-Friedman A (1994) Basic fibroblast growth factor protects endothelial cells against radiation-induced programmed cell death in vitro and in vivo. Cancer Res. 54, 2582-2590. Gosland M, Lum B, Schimmelpfennig J, Baker J, Doukas M (1996) Insights into mechanisms of cisplatin resistance and potential for its clinical reversal. Pharmacotherapy 16, 1639. Grothey A, Voigt W, Schmoll HJ (1999) The role of insulin-like growth factor I and its receptor in cell growth, transformation, apoptosis, and chemoresistance in solid tumors. J. Cancer Res. Clin. Oncol. 125, 166-173. Hayakawa J, Ohmichi M, Kurachi H, Mercola D, Murata Y (1999) Inhibition of extracellular signal-regulated protein kinase or c-Jun N-terminal protein kinase cascade, differentially activated by cisplatin, sensitizes human ovarian cancer cell line. J. Biol. Chem. 274, 31648-31654. Kerbel RS (1997) A cancer therapy resistant to resistance. Nature 390, 335-336. Kerbel RS (2000) Tumor angiogenesis: past, present and the near future. Carcinogenesis 21, 505-515. Li Q, Ding L, Yu JJ, Mu C, Tsang B, Bostick-Bruton F, Reed E (1998) Cisplatin and phorbol ester independently induce ERCC-1 protein in human ovarian tumor cells. Int. J. Oncol. 13, 987-992. Li Q, Gardner K, Zhang L, Tsang B, Bostick-Bruton F, Reed E (1998) Cisplatin induction of ERCC-1 mRNA expression in A2780/CP70 human ovarian cancer cells. J. Biol. Chem. 273, 23419-23425. Li Q, Tsang B, Bostick-Bruton F, Reed E (1999) Modulation of ERCC-1 messenger RNA expression by pharmacological agents in human ovarian carcinoma cells. Biochem. Pharmacol. 57, 347-353. Liekens S, Clercq ED, Neyts J (2001) Angiogenesis: regulators and clinical applications. Biochem. Pharmacol. 61, 253270. Meng Q, Rosen EM, Fan S (2000) Hepatocyte growth factor decreases sensitivity to chemotherapeutic agents and stimulates cell adhesion, invasion, and migration. Biochem. Biophys. Res. Commun. 274, 772-779.

Cancer Therapy Vol 1, page 37 equally resistant to platinum, but differ at codon 118 of the ERCC1 gene. Int. J. Oncol. 16, 555-560.

Front row from left: Qingdi Q. Li and Sean Ryan Rear row from left: Hang Hu, Guodong Hu, Xiping Li and Gangduo Wang

Hu et al: VEGF reduces sensitivity to cisplatin in ovarian cancer cells

Cancer Therapy Vol 1, page 39 Cancer Therapy Vol 1, 39- 46, 2003.

Overexpression of angiogenic growth factors in lung cancer cells is associated with cisplatin resistance Research Article

Xiping Li1, 2, Xuyi Liu3, Jie Wang3, Zengli Wang2, Wei Jiang3, Eddie Reed1, Yi Zhang4, Yuanlin Liu4, and Q. Quentin Li1* 1

Mary Babb Randolph Cancer Center and Department of Microbiology, Immunology and Cell Biology, West Virginia University School of Medicine and Robert C. Byrd Health Sciences Center, Morgantown, WV 26506, USA; 2Department of Respiratory Medicine, Sichuan University Huaxi Medical Center, Chengdu 610041, P. R. China; 3Department of Medicine, Peking University School of Oncology, Beijing 100036, P. R. China; 4Institute for Basic Medical Research, Chinese Academy of Military Medical Sciences, Beijing 100850, P. R. China

__________________________________________________________________________________ *Correspondence: Q. Quentin Li, M.D., Ph.D., 1831 Mary Babb Randolph Cancer Center, West Virginia University Health Sciences Center, P.O. Box 9300, Morgantown, WV 26506-9300, USA, Tel: 304-293-6870; Fax: 304-293-4667; E-mail: qli@hsc.wvu.edu Key Words: Angiogenesis, VEGF, bFGF, c-erbB-2, lung cancer, cisplatin resistance Received: 13 March 2003; Accepted: 19 March 2003; electronically published: April 2003

Summary Cisplatin is among the most effective agents in the treatment of human lung cancer, and the development of resistance to this drug is the main reason that results in chemotherapy failure in the clinic. Recent evidence showed that angiogenesis growth factors, including vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), augment tumor cell growth and survival, and confer drug resistance by inhibition of apoptosis. However, the relationship between angiogenesis and drug resistance in human cancer remains poorly understood. We therefore conducted this study to investigate the expression of angiogenic growth factors and drug-resistance related genes in cisplatin-sensitive and cisplatin-resistant human lung cancer cells. We report in this work that the levels of the mRNA and protein expression of VEGF and bFGF were strikingly elevated in resistant A549DDP lung cancer cells than those in parental A549 lung cancer cells. We also found that the levels of multidrug resistancerelated protein (MRP) and c-erbB-2 were significantly higher in A549DDP resistant cells when compared with A549 parental cells. As expected, lung resistance protein (LRP) was expressed only in A549DDP resistant cells but not in A 549 parental cells. Interestingly, there was a strong correlation between bFGF and c-erbB-2 or bFGF and MRP in these cells. These findings indicate that the overexpression of VEGF and bFGF, as well as the drug-resistance related genes, is associated positively with cisplatin resistance in human lung cancer cells, and therefore support the potential therapeutic applications of anti-angiogenics in regulating cisplatin sensitivity in resistant lung cancer and other tumors. and metallothionines, increased DNA repair, enhanced tolerance of cisplatin damage, increased levels of bcl-2related anti-apoptosis genes, and alterations in signal transduction pathways involved in apoptosis (Dabholkar and Reed, 1996; Gosland et al, 1996; Reed et al, 1996; Reed, 1998; Reed, 1998). However, the mechanism by which cells develop resistance to cisplatin is far from clear at this time. Therefore, intense research is needed to solve this problem because it is a major impediment to the clinical success of the drug.

I. Introduction Lung cancer is the major cause of death from all human malignancies in the United States. cisDiamminedichloroplatinum (II) (cisplatin, DDP) is one of the most effective drugs currently available for treatment for a wide variety of solid tumors, including lung cancer, bladder cancer, ovarian cancer, testicular cancer, and head and neck cancer (Reed, 1993; Reed, 1996; Reed et al, 1996). One of the hurdles with cisplatin treatment is the clinical development of resistance to this drug (Dabholkar and Reed, 1996; Gosland et al, 1996; Reed et al, 1996; Reed, 1998; Reed, 1998). Multiple mechanisms have been implicated in the development of cisplatin resistance, including reduced cisplatin uptake or decreased accumulation of the drug, elevated levels of glutathione

Angiogenesis, the formation of new blood vessels, is essential for normal reproduction, development, and organ repair. Angiogenesis is also important in a variety of tumor processes, such as tumor growth and metastasis and drug resistance (Kerbel, 2000; Stavrovskaya, 2000;

Li et al: Association between angiogenic factor expression and cisplatin resistance TagTM 0.5 µl, cDNA 2 µl, sterilized distilled water 36.5 µl. The amplification for VEGF was done for 5 min at 95 oC, 1 min at 94 o C, 1.5 min (last 2 cycles, 2 min) at 58 oC, and 2 min (last 2 cycles, 5 min) at 72 oC for a total of 32 cycles. For bFGF was 40 sec (last 3 cycles, 1.5 min) at 94 oC, 1.3 min (last 3 cycles, 2 min) at 48 oC, and 1.2 min (last 3 cycles, 2 min) at 72 oC for a total of 28 cycles. For MRP and LRP: 94 oC 4 min; 94 oC 30 sec, 55 oC 1 min, and 72 oC 2 min for a total of 30 cycles. For bcl-2 and cerbB-2: 94 oC 4 min; 94 oC 30 sec, 55 oC 30 sec, and 72 oC 30 sec for a total of 30 cycles. All genes were extended thoroughly at 72 oC for 10 min. The PCR primers for the target gene cDNA were listed in Table 1. Electrophoresis was performed with 10 µl of PCR products in 1.8% agarose gel. The electrophoretogram was scanned. The relative mRNA expression levels of target genes were calculated with the optical density (OD) values from the target genes and "-actin.

Liekens et al, 2001). These processes are regulated differentially by a variety of distinct pro-angiogenic molecules and anti-angiogenic molecules (Slodkowska et al, 2000). The angiogenic switch is mediated by the balance of angiogenic inducers and angiogenic inhibitors. A number of growth factors, cytokines, chemokines, enzymes, and adhesion molecules have been identified as potential positive regulators of angiogenesis so far. Vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) are among the most important ones (Kerbel, 2000; Liekens, 2001). Recently, experimental and clinical studies are accumulating to show that angiogenic factors augment tumor cell growth and survival, and confer drug resistance by inhibition of apoptotic activity (Volm et al, 1999; Coleman et al, 2000). However, the relationship between angiogenesis and cisplatin drug resistance in human tumors is poorly understood. The present investigation was therefore designed to study the expression of the angiogenesis growth factors VEGF and bFGF in cisplatinsensitive and cisplatin-resistant human lung cancer cell lines. We also set out to examine the expression of the drug-resistance related genes lung resistance protein (LRP), multidrug resistance-related protein (MRP), cerbB-2 and blc-2, and analyze the relationships between the angiogenic factors and the drug-resistance related genes in these model systems. We report herein the results of this investigation.

C. Immunocytochemistry The protein expression of VEGF, bFGF, MRP, LRP, bcl-2, and c-erbB-2 in A549 and A549DDP cells was assessed by immunocytochemistry using an anti-VEGF monoclonal antibody (1:100) and an anti-bFGF polyclonal antibody (1:200) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), as well as antiMRP, LRP, bcl-2 and c-erbB-2 monoclonal antibodies (1:201:40) (Beijing Zhongshan Biotech Company, Beijing, China). The samples were stained by SP staining. All reagents were used in the negative controls except the primary antibodies.

D. Statistical analysis of data Data were analyzed for significance using the student's t test. The relationship between the data was analyzed statistically by Peason correlation test. The criterion for statistical significance was p<0.05.

II. Materials and methods A. Cell lines and cell culture conditions The human lung adenocarcinoma parental cell line A549 and the cisplatin-resistant cell line A549DDP were cultured in DMEM medium containing 10 % fetal calf serum, at 37 oC in a humidified 5% CO2 incubator.

III. Results A. The cytotoxicity of cisplatin to cisplatin-sensitive and cisplatin-resistant human lung adenocarcinoma cell lines

Both cell lines were assayed for sensitivity to cisplatin by measurement of the inhibition of growth following 48-h exposure to cisplatin ranging from 0.1 to 1,000 µM. Cell lines were seeded at an initial cell density of 5 ! 104 cells/ml. After continuous contact with the drug for 48 h, medium was removed, and cell viabilities were determined by using MTT assay. Cells treated similarly in the absence of drug served as controls.

Sensitivity to cisplatin was determined by measuring inhibition of cell growth following continuous exposure of cells to concentrations of the drug ranging from 0.1 to 1,000 µM cisplatin for 48 h. The A549 human lung adenocarcinoma parental cell line and A549DDP cisplatinresistant cell line exhibited cisplatin IC50 values of 1 µM and 10 µM, respectively (Figure 1).

B. RNA isolation and RT-PCR analysis Total RNA was extracted from cell lines using Trizol reagent (GIBCO-BRL, Gaithersburg, MD, USA), according to the standard acid-guanidium-phenol-chloroform method. The RT-PCR was performed using the TaKaRa RNA RT-PCR Kit (TaKaRa Shuzo Co., Ltd., CA, USA). The reverse-transcribed total volume was 20 µl per sample. It included that MgCl2 4 µl, 10X RNA PCR buffer 2 µl, RNase free H2O 7.5 µl, dNTP 2 µl, RNase inhibitor 0.5 µl, reverse transcriptase 1 µl, random primer 1 µl, RNA 2 µl. Placed all tubes in a thermal cycler and set the parameters by the following conditions: 30 oC 10 min, 46 oC 30 min, 99 oC 5 min, and 5 oC 5 min per cycle. The reverse transcriptase reaction product was served as a template DNA for PCR amplification. "-actin cDNA was used as an internal reference. Total volume of PCR was 50 µl per sample. It included that 10 µRNA PCR buffer 5 µl, 25 mM MgCl2 3 µl, 10 µM dNTP 1 µl, 10 µM primer: sense 1 µl and antisense 1 µl,

B. The mRNA expression of angiogenic growth factors and drug-resistance related genes in cisplatin-sensitive and cisplatinresistant human lung cancer cells Reverse transcription PCRs were performed to analyze the levels of mRNA expression of the angiogenic factors and the drug-resistance related genes. Table 1 shows the primers used and the PCR-amplified products for each gene in our experiments. Figure 2 presents the relative mRNA expression of the angiogenesis growth factors and the drug-resistance related genes in both cisplatin resistant A549DDP lung cancer cells and A549 parental cells. 40

Cancer Therapy Vol 1, page 41 Table 1. RT-PCR primers and amplification products of VEGF, bFGF, MRP, LRP, bcl-2, c-erbB-2 and "-actin genes. Gene

Primer

VEGF

Amplification product

Sense: 5'-GAA GTG GTG AAG TTC ATG GAT GTC-3'

541 bp, 408 bp

Antisense: 5'-CGA TCA TTC TGT ATC AGT CTT TCC-3' bFGF

Sense: 5'-GTG TGT GCT AAC CGT TAC CT-3'

237 bp

Antisense: 5'-GCT CTT AGC AGA CAT TGG AAG-3' MRP

Sense: 5'-TCT CTC CCG ACA TGA CCG AGG-3'

140 bp

Antisense: 5'-CCA GGA ATA TGC CCC GAC TTC-3' LRP

Sense: 5'-GTC TTC GGG CCT GAG CTG GTG TCG-3'

221 bp

Antisense: 5'-CTT GGC CGT CTC TTG GGG GTC CTT-3' bcl-2

Sense: 5'-GTG GAG GAG CTC TTC AGG GA-3'

304 bp

Antisense: 5'-AGG CAC CCA GGG TGA TGC AA-3' c-erbB-2

Sense: 5'-GAT GTA TTT GAT GGT GAC CT-3'

183 bp

Antisense: 5'-ATC TGG CTG GTT CAC ATA TT-3' "-actin Sense: 5'-ATC TTC AAA CCT CCA TGA TG-3'

120 bp

Antisense: 5'-ACC CCC ACT GAA AAA GAT GA-3' _______________________________________________________________________ Compared to cisplatin-sensitive cells, cisplatin-resistant cells show consistently higher mRNA levels of VEGF, bFGF, MRP, LRP, and c-erbB-2. The relative mRNA levels of expression were 10.03 for VEGF, 3.08 for bFGF, 0.96 for MRP, 2.07 for c-erbB-2, and 0.81 for LRP. In A549 parental cells, the relative mRNA levels of expression for VEGF was 1.81, 1.53 for bFGF, 0.53 for MRP, 0.84 for c-erbB-2, and was not detectable for LRP. The differences between A549DDP resistant cells and A549 parental cells in relative mRNA expression levels for VEGF, bFGF, MRP, c-erbB-2 and LRP were statistically significant (all p<0.01) (Table 2).

C. The protein expression of angiogenic growth factors and drug-resistance related genes in cisplatin-sensitive and cisplatinresistant human lung carcinoma cells Our experimental results from immunocytochemistry showed that the levels of protein expression of VEGF, bFGF, and MRP were all higher in A549DDP resistant cells, as compared with A549 parental cells. While LRP and cerbB-2 were negative in A549 parental cells, they were positive in A549DDP resistant cells (Table 2; Figures 3, 4, 5, 6, 7 and 8).

Figure 1. The sensitivity of A549 and A549DDP human lung adenocarcinoma cell lines to cisplatin. 5 X 104 cells per well from A549 cells or A549DDP cells were evenly plated in 96-well plates. Cells were then exposed to cisplatin at 0.1, 1, 10, 100, or 1,000 ÂľM for 48 h. Cell viability was measured by the MTT assay 48 h after drug exposure and is expressed as a percentage of the untreated control.

Li et al: Association between angiogenic factor expression and cisplatin resistance bFGF and MRP shows correlative expression of these two genes in A549 parental cells (r = 0.979; p = 0.032). A comparison of bFGF and c-erbB-2 shows that mRNA levels for bFGF were also correlated with c-erbB-2 in A549DDP resistant cells (r = 1; p = 0.004). The relationships shown suggest that as bFGF mRNA increases, so do MRP and c-erbB-2 mRNAs

D. The relationship between angiogenic growth factors and drug-resistance related genes in A549 and A549DDP human lung adenocarcinoma cells Peason correlation test has been used to measure the degree to which two genes may show concurrent increased or decreased mRNA expression levels. Comparison of

Figure 2. The levels of the mRNA expression of angiogenic growth factors and drug-resistance related genes in cisplatinsensitive and cisplatin-resistant human lung adenocarcinoma cell lines. RT-PCR analysis of the mRNA levels of VEGF, bFGF, MRP, LRP, c-erbB-2, and bcl-2 in cisplatin-sensitive human A549 lung adenocarcinoma cells (A) and in cisplatin-resistant human A549DDP lung adenocarcinoma cells (B). A 541-bp and a 408bp segments of VEGF cDNA, a 237-bp segment of bFGF cDNA, a 140-bp segment of MRP cDNA, a 221-bp segment of LRP cDNA, a 304-bp segment of bcl-2 cDNA, a 183-bp segment of c-erbB-2 cDNA, and a 120-bp segment of "-actin cDNA were amplified by RT-PCR, respectively, and the aliquots of amplified DNAs were electrophoresed through a 1.8% agarose gel. The relative mRNA levels of the target genes were quantified by densitometry and expressed as a ratio to "-actin, and these values are shown graphically in panel (C). 1, LRP; 2, c-erbB-2; 3, bcl-2; 4, MRP; 5, bFGF; 6, VEGF.

drug resistance and the molecular basis involved could lead to strategies resulting in improved therapeutic benefits to patients with cisplatin resistant carcinomas.

IV. Discussion Although significant progress has been made in the treatment of lung cancer with combination chemotherapy, lung cancer remains the leading cause of cancer death (American Cancer Society, 2000). Platinum-containing anti-tumor drugs are the most commonly used agents for the treatment of lung carcinoma (Reed, 1993; Dabholkar and Reed, 1996; Reed et al, 1996). Toxicities and emergence of drug-resistant tumors, however, are major problems preventing curative therapy (Reed, 1993; Dabholkar and Reed, 1996; Reed et al, 1996). While several mechanisms of resistance to cisplatin have been identified (Gosland et al, 1996), no single mechanism can clearly explain cisplatin drug-resistance in lung cancer. Understanding the relationship between angiogenesis and

In our study, we found that the levels of the angiogenic growth factors VEGF and bFGF expression were dramatically increased in cisplatin resistant A549DDP lung cancer cells as compared to A549 parental cells, suggesting a role of angiogenic growth factors in the formation of cisplatin drug resistance in these cells. We also confirmed the previous observations by others that LRP, MRP, bcl-2 and c-erb-2 are actively associated with drug resistance in lung cancer. However, the mechanism underlying the relationship between angiogenesis and drug resistance, as well as the role of angiogenic growth factors in the development of cisplatin drug resistance in human tumors remains unclear at this time. 42

Cancer Therapy Vol 1, page 43 Table 2. The comparison of the levels of mRNA and protein expression of angiogenic growth factors and drug-resistance related genes between cisplatin-sensitive and cisplatin-resistant human lung cancer cells.

Figure 3. VEGF protein levels in cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-VEGF monoclonal antibody (1:100) (Santa Cruz, CA, USA) shows that VEGF protein is strongly positive in human lung A549DDP adenocarcinoma cells (SP staining _ 40).

Figure 5. bcl-2 protein expression in cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-bcl-2 monoclonal antibody shows that bcl-2 protein is strongly positive in human lung A549DDP adenocarcinoma cells (SP staining _ 40).

Figure 4. bFGF protein levels in cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-bFGF polyclonal antibody (1:200) (Santa Cruz, CA, USA) shows that bFGF protein is strongly positive in human lung A549DDP adenocarcinoma cells (SP staining _ 40).

Figure 6. MRP protein expression in cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-MRP monoclonal antibody shows that MRP protein is positive in human lung A549DDP adenocarcinoma cells (SP staining ! 40).

Li et al: Association between angiogenic factor expression and cisplatin resistance

Figure 7. The levels of c-erbB-2 protein expression in cisplatinsensitive A549 and cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-c-erbB2 monoclonal antibody shows that c-erbB-2 protein is negative in the human lung adenocarcinoma cell line A549 (A), but it is positive in human lung A549DDP adenocarcinoma cells (B) (SP staining _ 40).

Figure 8. The levels of LRP protein expression in cisplatinsensitive A549 and cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-LRP monoclonal antibody shows that LRP protein is negative in the human lung adenocarcinoma cell line A549 (A), but it is positive in human lung A549DDP adenocarcinoma cells (B) (SP staining _ 40).

The MRP gene is a member of the ATP-binding cascade (ABC) transporter superfamily. It is involved in the efflux of cytotoxic drugs. MRP overexpression can lead to reduced drug access to its intracellular target, by increasing drug efflux and/or by altering its intracellular distribution (Kuwano et al, 1999). LRP is the main human vault protein. It mediated the drug resistance to cisplatin and alkylating agents by becoming involved in the rapid drug distribution from the nucleus to cytoplasmic vesicles. LRP can reduce the drug concentration in the nucleus and decrease the drug effect on DNA targets (Martin et al, 1998). The c-erbB-2 gene belongs to the epidermal growth factor receptor family. It is involved in the regulation of a variety of vital functions controlled by any of the erbBreceptor family members, including cell growth, differentiation, and apoptosis.

(American Cancer Society, 2000). Platinum-containing anti-tumor drugs are the most commonly used agents for the treatment of lung carcinoma (Reed, 1993; Dabholkar and Reed, 1996; Reed et al, 1996). Toxicities and emergence of drug-resistant tumors, however, are major problems preventing curative therapy (Reed, 1993; Dabholkar and Reed, 1996; Reed et al, 1996). While several mechanisms of resistance to cisplatin have been identified (Gosland et al, 1996), no single mechanism can clearly explain cisplatin drug-resistance in lung cancer. Understanding the relationship between angiogenesis and drug resistance and the molecular basis involved could lead to strategies resulting in improved therapeutic benefits to patients with cisplatin resistant carcinomas. In our study, we found that the levels of the angiogenic growth factors VEGF and bFGF expression were dramatically increased in cisplatin resistant A549DDP lung cancer cells as compared to A549 parental cells, suggesting a role of angiogenic growth factors in the formation of cisplatin drug resistance in these cells. We also confirmed the previous observations by others that LRP, MRP, bcl-2 and c-erb-2 are actively associated with

IV. Discussion Although significant progress has been made in the treatment of lung cancer with combination chemotherapy, lung cancer remains the leading cause of cancer death

Cancer Therapy Vol 1, page 45 the angiogenic growth factor expression in A549DDP were strikingly higher than those in A549 cells, indicating an association between angiogenic growth factor expression and cisplatin drug resistance in the lung carcinoma cells. Little is known at present about the exact role of VEGF and bFGF in the process and the underlying mechanisms. Given their broad spectrum of activities, angiogenic growth factors may play an important role in mediating the development of drug resistance through several ways. Firstly, angiogenic growth factors can lead to drug resistance by suppression of tumor cell apoptosis. For example, the effects of VEGF and bFGF on delaying apoptosis and prolonging the survival of tumor cell may be indirect, via the induction of one or more of cytokines or inhibition of specific genes that promote apoptosis (Volm et al, 1996; Coleman et al, 2000). Secondly, angiogenic growth factors may modulate cisplatin sensitivity indirectly through the regulation of the activity of MRP, cerbB-2, or some other drug-resistance related genes in tumor cells. As an indication, we show in this work that bFGF expression is correlated positively with c-erbB-2 and MRP expression in these cells. Thirdly, tumor vasculature is often inadequate for the tumor mass because the rate of neovascularization frequently fails to keep pace with tumor growth. A number of studies have indicated that VEGF may play an important role in tumor angiogenesis, and VEGF has been demonstrated to be upregulated by hypoxia. It has been shown that hypoxia can induce resistance to a number of antineoplastic agents. Hypoxia can also enhance genetic instability in tumor cells, which can lead to more rapid development of drug resistant tumor cells (Volm et al, 1996). Finally, we demonstrated recently in a separate study that VEGF mediated cytoprotection against cisplatin cell death and increased cell survival in cisplatin-resistant human tumor cells. Although the underlying mechanism is not known at this point, we showed that SU5416, a selective inhibitor of VEGF receptors, counteracted the effect of VEGF by enhancing cisplatin cytotoxicity and increasing cisplatin sensitivity in the cells. We further found that the effect of SU5416 on the increase in cell death or reduction of cell survival of cisplatin-treated cells is due in part to the reduction in repair efficiency of cisplatin-caused DNA damages. Enhanced DNA repair capacity contributes to the formation of drug resistance to cisplatin in a wide variety of tumor cells. Studies are under way to investigate whether angiogenic growth factors mediate protection against cisplatin-induced apoptosis in human cancer cells by upregulating apoptosis-rescue signals, assess the effect of angiogenic growth factors on DNA repair activity, and elucidate the role of PI3-kinase or Akt in the signal transduction pathway through which VEGF regulates DNA repair activity in human carcinoma cells. In summary, we show in this article that the levels of the angiogenesis growth factors, VEGF and bFGF, and the drug-resistance related genes LRP, MRP and c-erbB-2 are significantly elevated in cisplatin-resistant human A549 DDP lung carcinoma cells, as compared to A549 parental cells. There is a strong correlation between the expression of the angiogenic growth factors and the drug-resistance related genes in the lung carcinoma cells. These data suggest that

drug resistance in lung cancer. However, the mechanism underlying the relationship between angiogenesis and drug resistance, as well as the role of angiogenic growth factors in the development of cisplatin drug resistance in human tumors remains unclear at this time. The MRP gene is a member of the ATP-binding cascade (ABC) transporter superfamily. It is involved in the efflux of cytotoxic drugs. MRP overexpression can lead to reduced drug access to its intracellular target, by increasing drug efflux and/or by altering its intracellular distribution (Kuwano et al, 1999). LRP is the main human vault protein. It mediated the drug resistance to cisplatin and alkylating agents by becoming involved in the rapid drug distribution from the nucleus to cytoplasmic vesicles. LRP can reduce the drug concentration in the nucleus and decrease the drug effect on DNA targets (Martin et al, 1998). The c-erbB-2 gene belongs to the epidermal growth factor receptor family. It is involved in the regulation of a variety of vital functions controlled by any of the erbBreceptor family members, including cell growth, differentiation, and apoptosis. Data from laboratory studies showed that higher levels of p185c-erbB-2 expression in tumor cell lines were correlated with increased resistance to Taxol (Yu et al, 1998)). Our study showed that the expression of MRP, LRP and c-erbB-2 in cisplatin drug-resistant cells was significantly higher than that in parental cells. These results suggest that these genes may be involved in the formation and development of cisplatin drug resistance in A549DDP lung cancer cells. Although the precise mechanism involved is unclear now, it has been demonstrated that the overexpression of MRP confers resistance to the chemotherapy-induced apoptosis that is associated with the overexpression of anti-apoptotic genes and the downregulation of pro-apoptotic genes (Gupta et al, 1998). Further studies are necessary to investigate the mechanisms that may be responsible for the role of these genes in mediating the formation of the cisplatin resistance phenotype in lung cancer and other tumors. Angiogenesis is important in a variety of processes, such as growth, metastasis and resistance (Stavrovskaya, 2000, Liekens et al, 2001). The angiogenic cascade is regulated differentially by a variety of distinct proangiogenic molecules, as well as a number of antiangiogenic molecules (Slodkowska et al, 2000). VEGF, endothelial cell-specific mitogen and angiogenesis factor, is emerging as a major regulator of normal and pathologic angiogenesis (Volm et al, 1999; Volm et al, 1999). bFGF is a multifunctional molecule that belongs to a family of fibroblast growth factors. It appears to play a role in embryonic development, tumor invasion, wound healing, and angiogenesis (Gupta et al, 1998). VEGF and bFGF may be involved in tumorigenesis via proliferative and anti-apoptotic activities. Recently, experimental and clinical studies showed that VEGF and bFGF were related not only to angiogenic activity, but also to rapid tumor growth and the inhibition of apoptotic activity (Slodkowska et al, 2000). Our study showed that although VEGF and bFGF were all expressed in A549 and A549DDP cells, the levels of

Li et al: Association between angiogenic factor expression and cisplatin resistance Liekens S, Clercq ED, Neyts J (2001) Angiogenesis: regulators and clinical applications. Biochem. Pharmacol. 61, 253270. Martin F, Gudrun P, Thomas S (1998) Expression of the lung resistance protein predicts poor outcome in De Novo acute myeloid leukemia. Blood 91, 1508-1513. Reed E (1993) Platinum analogs, anticancer drugs. In Cancer Principles and Practice of Oncology. DeVita VT, Hellman S, Rosenberg SA, Eds. Philadelphia, PA, Lippincott, p. 390400. Reed E (1996) The chemotherapy of ovarian cancer. PPO Updates 10, 1-12. Reed E (1998) Nucleotide excision repair and anti-cancer chemotherapy. Cytotechnology 27, 187-201. Reed E ( 1998) Platinum-DNA adduct, nucleotide excision repair and platinum based anti-cancer chemotherapy. Cancer Treatment Reviews 24, 331-344. Reed E, Dabholkar M, Chabner BA (1996) Platinum analogues. In Cancer Chemotherapy and Biotherapy: Principles and Practice, 2nd ed. Chabner BA, Longo DL, Eds. Philadelphia, PA, Lippincott-Raven Publishers, p. 357-378. Slodkowska J, Sikora J, Roszkowski-Sliz K (2000) Expression of vascular endothelial growth factor and basic fibroblast growth factor receptors in lung cancer. Analyt. Quant. Cytol. Histol. 22, 398-402. Stavrovskaya AA (2000) Cellular mechanisms of multidrug resistance of tumor cells. Biochemistry (Mosc) 65, 95-106. Volm M, Koomagi R, Mattern J (1996) Interrelationships between microvessel density, expression of VEGF and resistance to doxorubicin of non-small lung cell carcinoma. Anticancer Res. 16, 213-218. Volm M, Koomagi R, Mattern J (1999) Angiogenesis and cigarette smoking in squamous cell lung carcinomas: an immunohistochemical study of 28 cases. Anticancer Res. 19, 333-336. Volm M, Mattern J, Koomagi R (1999) Inverse correlation between apoptotic (Fas ligand, Caspase-3) and angiogenic factors (VEGF, Microvessel density) in squamous cell lung carcinomas. Anticancer Res. 19, 1669-1672. Yu D, Liu B, Jing T, Sun D, Huang M-C (1998) Overexpression of both p185c-erbB2 and p170mdr-1 renders breast cancer cells highly resistant to taxol. Oncogene 16, 2087-2094.

the overexpression of VEGF and bFGF is strongly associated with cisplatin drug resistance in these lung cancer model systems. Therefore, our studies provide the rationale for the development of novel and potentially useful therapeutic strategies of anti-angiogenesis for cisplatin resistant malignancies.

Acknowledgements This work was supported by grants from Beijing Natural Science Foundation (No. 7992005), Beijing New Star Plan for Science and Technology (No.148) and China State '9. 5' Research Program (No. 96-906-01-23), and by grants from the National Institutes of Health, Bethesda, Maryland (No. 1P20RR016440-010003) and West Virginia University Research Development Grant (to Q.Q.Li).

References American Cancer Society (2000) Cancer Facts and Figures. Coleman AB, Momand J, Kane SE (2000) Basic fibroblast growth factor sensitizes NIH 3T3 cells to apoptosis induced by cisplatin. Molecular Pharmacology 57, 324-333. Dabholkar M, Reed E (1996) Cisplatin. Cancer Chemother. Biol. Response Modif. 16, 88-110. Gosland M, Lum B, Schimmelpfennig J, Baker J, Doukas M (1996) Insights into mechanisms of cisplatin resistance and potential for its clinical reversal. Pharmacotherapy 16, 1639. Gupta S, Aggarwal S, Nakamura S (1998) A possible role of multidrug resistance-associated protein (MRP) in basic fibroblast growth factor secretion by AIDS-associated Kaposi's sarcoma cells: A survival molecule? J. Clin. Immunol. 18, 256-263. Kerbel RS (1997) A cancer therapy resistant to resistance. Nature 390, 335-336. Kerbel RS (2000) Tumor angiogenesis: past, present and the near future. Carcinogenesis 21, 505-515. Kuwano M, Toh S, Uchiumi T (1999) Multidrug resistanceassociated protein subfamily transporters and drug resistance. Anticancer Res. 14, 123-131.

Cancer Therapy Vol 1, page 47 Cancer Therapy Vol 1, 47-61, 2003.

Cisplatin nephrotoxicity: molecular mechanisms Review Article

Marie H. Hanigan# and Prasad Devarajan* #

Department of Cell Biology, University of Oklahoma Health Sciences Center, and *Departments of Nephrology & Hypertension and Developmental Biology, Cincinnati Childrenâ&#x20AC;&#x2122;s Hospital Medical Center, University of Cincinnati

__________________________________________________________________________________ *Correspondence to : Prasad Devarajan M.D., Director, Nephrology & Hypertension, Cincinnati Childrenâ&#x20AC;&#x2122;s Hospital Medical Center, MLC 7022, 3333 Burnet Avenue, Cincinnati, OH 45229-3039. Phone: 513-636-4531. FAX: 513-636-7407. E-mail: prasad.devarajan@cchmc.org Key words: cisplatin, nephrotoxicity, molecular mechanisms, thiol compounds, apoptosis, death receptor, caspases, oxidative stress Abbreviations: copper transporter, (Ctr1); gamma-glutamyl transpeptidase, (GGT); hepatocyte growth factor, (HGF)

Received: 24 March 2003; Accepted: 31 March 2003; electronically published: April 2003 Contributed by Dr. Prasad Devarajan

Summary Cisplatin is one of the most widely used chemotherapeutic agents for the treatment of several human malignancies. The efficacy of cisplatin is dose dependent, but the significant risk of nephrotoxicity frequently hinders the use of higher doses to maximize its antineoplastic effects. Several advances in our understanding of the biochemical and molecular mechanisms underlying cisplatin nephrotoxicity have recently emerged, and are reviewed in this article. Evidence is presented for distinct mechanisms of cisplatin toxicity in actively dividing tumor cells versus the normally quiescent renal proximal tubular epithelial cells. The unexpected role of gamma-glutamyl transpeptidase in cisplatin nephrotoxicity is elucidated. Recent studies demonstrating the ability of proximal tubular cells to metabolize cisplatin to a nephrotoxin are reviewed. The evidence for apoptosis as a major mechanism underlying cisplatin-induced renal cell injury is presented, along with the data exploring the role of specific intracellular pathways that may mediate the programmed cell death. The information gleaned from this review may provide critical clues to novel therapeutic interventions aimed at minimizing cisplatin-induced nephrotoxicity while enhancing its antineoplastic efficacy.

escalation. However, high-dose therapy with cisplatin is limited by its cumulative nephrotoxicity and neurotoxicity (O'Dwyer et al, 1999). Its dose-limiting toxicities have spurred the development of the non-nephrotoxic derivative carboplatin and other platinum-based drugs. However, cisplatin is still the drug of choice in many platinum-based therapy regimens, and remains one of the most commonly used chemotherapy drugs. The structure of cisplatin is shown in Figure 1. Cisplatin is toxic to the renal proximal tubules (Gonzales-Vitale et al, 1977). The severity of toxicity in early clinical trials called into question the use of cisplatin as a chemotherapy agent (DeConti et al, 1973). Hydration protocols were developed that reduced the nephrotoxicity and allowed dose escalation to therapeutic levels (Cornelison and Reed 1993).

I. Introduction Cisplatin is a potent antitumor drug. Cisplatin-based combination chemotherapy regimens are currently used as front-line therapy in the treatment of testicular cancer, ovarian germ cell tumors, epithelial ovarian cancer, head and neck cancer, advanced cervical cancer, bladder cancer, mesothelioma, endometrial cancer, non-small cell lung cancer, malignant melanoma, carcinoids, penile cancer, adrenocorticol carcinoma and carcinoma of unknown primary (Langerak and Dreisbach 2001). Cisplatin-based chemotherapy is used with radiation therapy in the treatment of esophageal cancer, localized cervical cancer and head and neck cancer (Curran 2002). It is used as consolidation therapy for many types of solid tumors that have failed standard treatment regimens. The therapeutic effects of cisplatin are significantly improved by dose

Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity

Figure 1. Structure of cisplatin.

Figure 2. Proposed biochemical mechanisms of cisplatin nephrotoxocity. See text for details. GGT = gamma-glutamyl transpeptidase; AP-N = diaminopeptidase N.

However, even with vigilant hydration, approximately one-third of patients treated with cisplatin have transient elevation of blood urea nitrogen levels or other evidence of kidney damage in the days following cisplatin treatment (Meyer and Madias 1994). Reports of accidental overdoses, all of which have led to renal failure, confirm the potency of cisplatin as a renal toxin in humans (Chu et al, 1993). Nephrotoxicity is an unusual side effect of chemotherapy in general. Most chemotherapy drugs target pathways that are essential to dividing cells. The rapidly dividing cells in the bone marrow are sensitive to these agents. The dose-limiting toxicity of carboplatin is bonemarrow suppression with cumulative anemia (McKeage 2000). Carboplatin can be administered at doses 5-fold higher than cisplatin without evidence of nephrotoxicity or neurotoxicity. Both cisplatin and carboplatin bind DNA, killing dividing tumor cells (Fink and Howell 2000; Perez 1998). The toxicity of cisplatin towards the quiescent renal proximal tubular cells indicates that there are at least two distinct mechanisms by which cisplatin kills cells, as illustrated in Figure 2.

II. Cisplatin uptake and DNA binding Cisplatin is transported into cells by the copper transporter Ctr1 (Ishida et al, 2002; Lin et al, 2002). Once inside the cell the chloride ions dissociate from the platinum due to the low intracellular chloride concentrations. The positively charged platinum ion binds cellular nucleophiles in DNA, RNA and proteins (Cohen and Lippard 2001). Experimental evidence indicates that platinum-DNA adducts are the lesion that is toxic to dividing cells, as shown in Figure 2 (Eastman 1999). Thiols such as the sulfur of GSH will bind to the platinum molecule, replacing one of the chloride ions and preventing binding to other cellular nucleophiles (BernersPrice and Kuchel 1990). Increased intracellular GSH concentrations correlate with decreased platinum-DNA binding in freshly isolated peripheral blood mononuclear cells (Sadowitz et al, 2002). Studies of tumor cell lines have shown a correlation between increased levels of intracellular GSH and resistance to cisplatin (Chen et al, 1995; Hrubisko et al, 1993; Godwin et al, 1992). GSTs are 48

Cancer Therapy Vol 1, page 49 a family of enzymes that catalyze the conjugation of GSH to a variety of substrates. GSTs can also bind the electrophilic substrates and thereby inactivate them (Oakley et al, 1999). Several isoforms of GST have been shown to bind cisplatin in vivo (Sadzuka et al, 1994). There are conflicting data in the literature as to which GST isozymes correlate with cisplatin resistance (Puchalski and Fahl 1990; Leyland-Jones et al, 1991; Nakagawa et al, 1990; Ban et al, 1996; Townsend et al, 1992; Nishimura et al, 1998; Cheng et al, 1997; Hamada et al, 1994; Kigawa et al, 1998; Germain et al, 1996; van der Zee et al, 1992; Murphy et al, 1992). Of the studies in which increased resistance to cisplatin was observed, none determined whether the inactivation of cisplatin was due to GST binding to the cisplatin or catalyzing its conjugation to GSH.

III. Evidence for two mechanisms of cisplatin toxicity

alkenes are conjugated to glutathione (GSH) in the liver and the kidney (Lash et al, 1998). The GSTs that catalyze the conjugation have not been identified, but the reaction rates of several of the nephrotoxic halogenated alkenes are higher with the microsomal GSTs than with the cytosolic GSTs (Wolf et al, 1984). Hexachlorobutadiene is conjugated to GSH predominantly in the liver and the GSH-conjugate is excreted into the bile (Nash et al, 1984). The metabolite is further processed through a hepatobiliary route (Anders and Dekant 1998). Bile duct cells express high levels of GGT and aminopeptidase N on their cell surface. GSH-conjugates in the bile are cleaved to cysteinyl-glycine (cys-gly)-conjugates by GGT and to cysteine-S-conjugates by aminodipeptidase N. The cysteine-S-conjugate is reabsorbed by the intestine and transported in the serum to the kidney. The kidney also contains GSTs that can metabolize the halogenated alkenes (Hassall et al, 1984). Renal GSH-conjugates would have to be excreted from the cell to undergo further processing by GGT and diaminopeptidase N expressed the surface of the proximal tubular cells. The cysteine-Sconjugates are transported into the renal proximal tubular cells by a carrier-mediated process (Wright et al, 1998), and are metabolized to a reactive thiol by a PLP-dependent cysteine-S-conjugate-beta-lyase. The enzyme that catalyzes this reaction has not been identified, although cysteine-S-conjugate beta-lyase activity has been found in the cytosolic and mitochondrial fractions of the kidney (Cooper et al, 2002). The thioacylating metabolites produced by cysteine-S-conjugate beta-lyase are highly reactive, and will bind to proteins in the proximity of the beta-lyase (Bruschi et al, 1993). Mitochondrial aspartate aminotransferase, which has cysteine-S-conjugate betalyase activity, is modified by the thioacylating products and is one of the likely candidates for the cysteine-Sconjugate beta-lyase that metabolizes the halogenated alkenes (Bruschi et al, 1998). The mitochondria of the proximal tubular cells are the primary target of haloalkene-induced toxicity as has been observed with cisplatin (Hayden et al, 1991; Brady et al, 1990; Lash et al, 1986; Hayden and Stevens 1990; Chen et al, 2001; Anders 1995). The cysteine-conjugates of the halogenated alkenes have been shown to induce either apoptosis or necrosis in LLC-PK1 cells depending on the chemical structure of the compound and the antioxidant status of the cell (Zhan et al, 1999; van de Water et al, 2001).

distinct

A series of studies on the role of the enzyme gammaglutamyl transpeptidase (GGT) in cisplatin toxicity revealed that in tumor cells GGT expression increased resistance to cisplatin, while in kidney GGT expression made the cells sensitive to cisplatin toxicity (Hanigan et al, 1999; Hanigan et al, 2001). GGT is a cell surface enzyme that cleaves the gamma-glutamyl bonds. GGT cleaves extracellular GSH into glutamic acid and cysteinyl-glycine (Figure 2). Cysteinyl-glycine is cleaved into cysteine and glycine by diaminopeptidase N (McIntyre and Curthoys 1982). Thus, by initiating the cleavage of extracellular GSH into its constituent amino acids, GGT provides the cell with an increased supply of cysteine (Hanigan and Ricketts 1993). In rapidly dividing cells, cysteine can become limiting for cell growth and for intracellular GSH synthesis. Transfection of human prostate tumor cells with GGT increased their growth rate in nude mice and increased their resistance to cisplatin (Hanigan et al, 1999). In contrast, the high level of GGT expression in renal proximal tubular cells renders them sensitive to cisplatin toxicity. Inhibition of GGT blocked the nephrotoxicity of cisplatin in both rats and mice (Hanigan et al, 1994; Townsend and Hanigan 2002). Cisplatin is not toxic to the kidneys in GGT knockout mice (Hanigan et al, 2001). The disparate roles of GGT in the antitumor activity and nephrotoxicity of cisplatin suggest that the mechanism by which cisplatin kills tumor cells is distinct from the mechanism by which it kills the proximal tubular cells in the kidney.

V. Evidence that cisplatin metabolized to a nephrotoxin

There is compelling evidence from both in vivo studies and cell culture that cisplatin is metabolized to a nephrotoxin through a GSH-conjugate intermediate as are the halogenated alkenes. The proposed pathway is shown in Figure 2. Platinum-GSH conjugates may be formed in either the liver or the kidney. Studies with 195mPt-labeled cisplatin show that following injection the highest levels of platinum are found in the liver and kidney (Lange et al, 1973; Benard et al, 1983). Platinum accumulation in the liver is transient. Biliary excretion of cisplatin accounts for

IV. Role of GGT in the nephrotoxicity of halogenated alkenes Cisplatin is not unique in its requirement for GGT activity to exert its nephrotoxic effects. The nephrotoxic halogenated alkenes, which kill the proximal tubular cells in the kidney, also require GGT activity for their metabolism to a nephrotoxin (Dekant 2001). These compounds include hexachlorobutadiene, dichloroacetylene and trichloroethylene. The halogenated 49

Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity approximately 1% of the administered dose in 6 hr (Siddik et al, 1987). The structures of the platinum-containing compounds that are excreted into the bile have not been identified. Metabolic intermediates of cisplatin have been identified in rat serum. Seven platinum-containing species were resolved by HPLC from serum within 15 min of cisplatin injection (Daley-Yates and McBrien 1984). The mixture was more nephrotoxic than equimolar cisplatin. Inhibiting the conjugation of cisplatin to GSH has been shown to reduce cisplatin nephrotoxicity. In mice, systemic inhibition of GSTs with ketoprofen reduced cisplatin nephrotoxicity (Sadzuka et al, 1994a; Sadzuka et al, 1994). In rats, inhibition of GSH synthesis also protected against the nephrotoxicity of cisplatin (Mayer et al, 1987). The nephrotoxic platinum-conjugates are very unstable relative to the metabolic intermediates of the halogenated alkenes. The GSH and cysteine-conjugates of the halogenated alkenes can be synthesized and purified whereas the nephrotoxic platinum-conjugates are unstable in solution (Kramer et al, 1987; Gaskin et al, 1995; Townsend et al, 2003). At least some of the platinum-GSH conjugates may be formed and metabolized within the kidney (Mistry et al, 1989). Cisplatin-GSH conjugates can be transported out of the cell by MRP2 (cMOAT), a member of the multidrug resistance-associated protein family of efflux pumps (Ishikawa et al, 1996; Borst et al, 2000). There is evidence that other pumps that have not yet been defined can also serve this function (Ueda et al, 1999). GSH-conjugates are metabolized extracellularly to cysteinyl-glycine-conjugates by GGT, which is a cell surface enzyme. Inhibition of GGT has been shown to block the nephrotoxicity of cisplatin in both rats and mice (Hanigan et al, 1994; Townsend and Hanigan 2002). Cisplatin is not nephrotoxic in GGT-knockout mice (Hanigan et al, 2001). Cysteinyl-glycine conjugates are cleaved by aminopeptidase N which is also on the cell surface (Hughey et al, 1978; McIntyre and Curthoys 1982). AOAA, an inhibitor of PLP-dependent enzymes, blocks the nephrotoxicity of cisplatin (Townsend and Hanigan 2002). AOAA also blocks the final enzymatic step in the bioactivation of the nephrotoxic halogenated alkenes. AOAA blocks the beta-elimination reaction that converts the cysteine-S-conjugates of the halogenated alkenes to reactive thiols (Lash et al, 1994; Elfarra et al, 1986). These data demonstrate that cisplatin can undergo enzymatic activation to a metabolite that is more toxic than the parent compound. Confluent cultures of proximal tubular cells have been used to study cisplatin nephrotoxicity (Montine and Borch 1988; Kroning et al, 1999; Legallicier et al, 1996; Park et al, 2002; Townsend et al, 2003). The toxicity of cisplatin toward confluent monolayers of proximal tubular cells suggests that cells express the enzymes and transporters required in each step of the bioactivation of cisplatin to a reactive thiol. However, the efficiency with which they conjugate cisplatin to GSH may not be optimal. Preincubating cisplatin with equimolar cisplatin for up to 30 min potentiated the toxicity of cisplatin toward confluent monolayers of LLC-PK1 cells (Townsend et al, 2003). Examination of the incubation mixtures revealed a monoplatinum-mono-GSH conjugate

and a diplatinum-monoGSH conjugate that formed spontaneously in the solution (Townsend et al, 2003). With prolonged incubation, the cisplatin-GSH solution became non-toxic in parallel with increased formation of the diplatinum-monoGSH conjugate. Solutions containing the monoplatinum-monoGSH were more toxic than equimolar cisplatin. The increased toxicity due to the presence of the platinum-GSH conjugate could be blocked by inhibiting GGT (Townsend et al, 2003). Preincubation of cisplatin with equimolar N-acetyl-cysteine (NAC) also potentiated the toxicity of the cisplatin, and this correlated with the formation of a monoplatinum-monoNAC conjugate (Townsend et al, 2003). NAC is deacetylated to cysteine (Commandeur et al, 1991). The transporter of the platinum-cystiene conjugate into the cell has not been identified. In vivo, AOAA inhibits the nephrotoxicity of cisplatin (Townsend and Hanigan 2002). In LLC-PK1 cells, AOAA blocks the toxicity of the platinum-NAC conjugate, as well as the platinum-conjugates that are upstream in the metabolic pathway (Townsend et al, 2003). Prolonged incubation of cisplatin with NAC inactivated solution and correlated with the formation of diplatinum-monoNAC conjugates. As detailed below, the molecular mechanism by which cisplatin kills renal cells is dependent on the concentration of cisplatin and the antioxidant status of the cell (Lee et al, 2001; Park et al, 2002).

VI. Protection from cisplatin nephrotoxicity by thiol compounds Thiol compounds have been used clinically to reduce the nephrotoxicity of cisplatin. High doses of GSH injected intravenously within 30 min of cisplatin administration is protective (Tedeschi et al, 1991; Smyth et al, 1997). The amount of GSH that is necessary to achieve this protective effect in humans is 30 to 40-fold higher than the dose of cisplatin. These data may appear to contradict the hypothesis that the formation of a cisplatinGSH conjugate activates cisplatin to a nephrotoxin, but high concentrations of GSH can protect against cisplatin nephrotoxicity by serving as a competitive inhibitor of GGT activity (Hanigan et al, 1994). GSH is the major physiologic substrate for GGT (Curthoys and Hughey 1979; Hanigan and Pitot 1985). GGT is localized to the cell surface and would be inhibited by high levels of GSH in the extracellular fluid (Hanigan and Frierson Jr. 1996). By inhibiting GGT activity, GSH would reduce the metabolism of the cisplatin-GSH to a cisplatin-cysteinylglycine conjugate. A large number of sulfur-containing compounds such as procainamide, diethyldithiocarbamate, N-methyl-D-glucaminedithio carbamate, methimazole, sulfathiazole and the prodrug Amifostine have been shown to reduce the nephrotoxicity of cisplatin without inhibiting its antitumor effect (Jones et al, 1992; Borch et al, 1980; Jones et al, 1992; Yee et al, 1994; Korst et al, 1998; Osman et al, 2000). Procainamide is an antiarrhythmic drug that binds cisplatin forming a procainamide-cisplatin complex (Esposito et al, 1996). In the presence of procainamide more platinum is bound to DNA, which

Cancer Therapy Vol 1, page 51 would explain the maintenance of the antitumor activity (Viale et al, 2000). The binding of procainamide to the cisplatin may prevent the formation of a cisplatin-GSH complex and thereby protect against the metabolism of cisplatin to a nephrotoxin. Other thiol compounds may also be binding cisplatin in a complex that does not prevent the binding of the platinum to DNA but does prevent the formation of a GSH-cisplatin conjugate. In contrast, sodium thiosulfate and biotin inhibit both the nephrotoxicity and antitumor activity of cisplatin (Howell and Taetle 1980; Uozumi et al, 1984; Jones et al, 1992).

receptor proteins such as Fas and TNFR1 (Ashkenazi and Dixit 1996). On the other hand, activation of the initiator pro-caspase 9 is dependent primarily on mitochondrial signaling pathways regulated by members of the Bcl-2 family of proteins (Adams and Cory 1996; Brenner and Kroemer 2000). Activation of pro-apoptotic Bcl-2 family members such as Bax can trigger a sequence of events that leads to alterations in mitochondrial permeability, release of mitochondrial cytochrome c into the cytosol, and activation of pro-caspase 9 (Korsmeyer et al, 2000; Goldstein et al, 2000). The anti-apoptotic Bcl-2 family members such as Bcl-2 itself play a pivotal protective role by preserving mitochondrial function and preventing release of cytochrome c (Adams and Cory 1996). Several levels of cross-talk exist between the caspase 8- and 9dependent pathways. First, initial activation of caspase 8 via death receptor pathways can induce the mitochondrial translocation of BID, a pro-apoptotic member of the Bcl-2 family, with resultant cytochrome c release and activation of caspase 9 (Luo et al, 1998). Second, the p53 gene is a potent transcription factor that regulates apoptosis most notably by activating pro-apoptotic Bcl-2 family members as well as the Fas-FADD axis (Burns and El-Deiry 1999). Third, both pathways culminate in the activation of caspase 3, with subsequent entry into the "execution" phase of apoptosis (Thornberry and Lazebnik, 1996). In this review, the evidence for cisplatin-induced apoptosis in renal tubular cells will first be presented. In the subsequent sections, the role of each of these pathways in cisplatininduced apoptosis of renal tubular cells will be reviewed. Studies from a number of laboratories over the past few years have demonstrated that cisplatin can induce apoptosis in renal tubular cells both in animal models and in cell culture systems. Using an established mouse model of cisplatin nephrotoxicity (intraperitoneal injection of cisplatin 20 mg/kg body weight), the appearance of apoptotic epithelial cells by Tunel assay was first shown predominantly in the distal tubular and collecting duct (Megyesi et al, 1998). Subsequent studies have confirmed and extended these findings. Apoptosis in this model has now been documented by a variety of additional methods (including hematoxylin-eosin staining, DNA laddering, and electron microscopy) to occur in both distal and proximal tubular cells, predominantly in the outer medullary region (Shiraihi et al, 2000; Tsuruya et al, 2003). Apoptosis was evident within 3 days of cisplatin injection, temporally correlating with the onset of renal dysfunction. Several analogous studies have also been completed in a rat model (cisplatin 5 mg/kg intraperitoneally), with comparable results (Zhou et al, 1999; Miyaji et al, 2001; Huang et al, 2001; Nishikawa et al, 2001; Chang et al, 2002). Importantly, several maneuvers aimed at attenuating the extent of tubular cell apoptosis have also resulted in amelioration of renal dysfunction (Megyesi et al, 1998; Zhou et al, 1999; Shiraishi et al, 2000,Miyaji et al, 2001; Nishikawa et al, 2001; Chang et al, 2002; Tsuruya et al, 2003). These findings have provided support for the notion that inhibition of apoptosis may represent a novel and powerful therapeutic strategy for the prevention and treatment of cisplatin nephrotoxicity, and have stimulated recent efforts

VII. Evidence for cisplatin-induced apoptosis in renal tubular cells It has long been recognized that in acute renal failure induced by nephrotoxins or other causes, renal tubular cells suffer a spectrum of cytotoxic injuries, ranging from mild sublethal changes to a catastrophic necrotic death characterized by swelling and rupture of cells and activation of an inflammatory response (Thadani et al, 1996). The ensuing clinical syndrome has conventionally been designated by the term acute tubular necrosis. However, it is now known that at least two distinct mechanisms may be responsible for renal tubular cell death following injury, depending primarily on the extent and severity of the insult. While extensive injury can lead to necrotic cell death, increasing evidence has indicated that the less severe renal injuries most commonly encountered in modern clinical practice are associated predominantly with patchy apoptosis of tubular epithelial cells (Ueda et al, 2000; Levine and Lieberthal 2001). Apoptosis or programmed cell death is characterized by distinct morphologic changes consisting of cell shrinkage, nuclear condensation, and internucleosomal DNA fragmentation (Kerr et al, 1972). It is well known that induction of programmed cell death is a common mechanism by which cytotoxic drugs such as cisplatin kill tumor cells (Friesen et al, 1999). In recent years, kidney tubular cell apoptosis has been detected in an increasing array of renal disorders, and is emerging as a final common pathway in response to a variety of cellular stresses applied at an intensity below the threshold for necrosis (Ueda et al, 2000; Levine and Lieberthal 2001). This observation especially holds true for cisplatin nephrotoxicity, in which necrotic cell death is encountered with higher doses whereas lower concentrations induce apoptosis (Lieberthal et al, 1996; Lau 1999). The past decade has witnessed an explosion of information on the molecular and cellular biology of programmed cell death, and specific intracellular proteases belonging to the caspase family have emerged as crucial effectors of apoptosis (Thornberry and Lazebnik 1998). Members of this family (now totaling at least 14) are expressed as pro-enzymes and require activation by upstream signal transduction pathways to commit a cell into the execution phase of apoptosis. It is convenient to classify the major intracellular apoptotic pathways according to the type of pro-caspase that is activated. Activation of the initiator pro-caspase 8 results predominantly from signaling via integral membrane death 51

Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity at identifying the programmed cell death pathways induced by cisplatin. These investigations have been facilitated by the establishment and elucidation of cell culture models. Cisplatin was first shown to cause apoptosis in cultured mouse proximal tubular cells (Lieberthal et al, 1996; Takeda et al, 1997; Takeda et al, 1998; Fukuoka et al, 1998). Several subsequent studies have now documented the ability of cisplatin to induce apoptosis in pig proximal tubular (Kruidering et al, 1998; Lau 1999; Okuda et al, 1999; Zhan et al, 1999; Kaushal et al, 2001; Park et al, 2002), human proximal tubular (Razzaque et al, 1999; van de Water et al, 2000; Nowak 2002; Cummings and Schnellmann 2002), and even collecting duct cells (Liu et al, 1998; Lee et al, 2001). A recurrent theme gleaned from these works is that cisplatin induces apoptosis in a dose- and duration-dependent manner, and that while this agent activates programmed cell death at lower (10-100 µM) doses, it can also result in necrotic cell death at higher (200-800 µM) concentrations.

drugs such as cisplatin induce apoptosis in tumor cells (Friesen et al, 1999). A possible role for this pathway in cisplatin nephrotoxicity was first suggested by experiments done in cultured human proximal tubular epithelial cells, in which cisplatin (20-80 µM) resulted in apoptosis which was temporally correlated with an increased expression of Fas (Razzaque et al, 1999). A subsequent detailed analysis in mouse and rat kidney as well as in cultured murine proximal tubular cells has recently provided substantial support for this mechanism (Tsuruya et al, 2003). In this study, wild-type mice subjected to cisplatin displayed renal dysfunction, tubular cell apoptosis, and an increase in mRNAs encoding Fas and Fas ligand in the kidneys, whereas Fas-mutant B6lpr/lpr mice exhibited an attenuated response. Proximal tubular cells cultured from wild-type mice responded to cisplatin by upregulation of Fas mRNA and protein, increase in caspase 8 activity, and apoptosis, all of which were blunted in cells from kidneys of Fas-mutant mice (Tsuruya et al, 2003). Furthermore, the cells derived from wild-type mice exhibited increased TNF-! secretion following cisplatin exposure, and kidneys of TNFR1deficient mice displayed an attenuated functional and apoptotic response to cisplatin (Ramesh and Reeves 2002; Tsuruya et al, 2003). Taken together, these results suggest that cisplatin induces renal epithelial cell apoptosis at least in part via activation of death receptor pathways, as illustrated in Figure 3.

VIII. Activation of death receptor pathways Renal tubular epithelial cells upregulate Fasdependent pathways and undergo apoptosis following ischemic injury both in vitro (Feldenberg et al, 1999) and in vivo (Nogae et al, 1998), and activation of the Fas pathway is a common mechanism by which cytotoxic

Figure 3. Proposed apoptotic pathways in cisplatin nephrotoxicity. See text for details. ROM = reactive oxygen metabolites; Casp = caspase. Death receptor pathways are shown in green, and mitochondrial pathways are in purple. All arrows indicate stimulatory influences, except Bcl2 which is inhibitory.

Cancer Therapy Vol 1, page 53 mitochondrial function and structure (Gordon and Gattone 1986). This issue has recently been revisited, especially in reference to injury induced by oxidative stress (Nishikawa et al, 2001; Chang et al, 2002), and is reviewed in the section on role of oxidative damage. At any rate, cisplatininduced oxidative stress in renal mitochondria has been postulated to result in the release of cytochrome c into the cytosol, with resultant activation of caspase 9 (Nishikawa et al, 2001). However, this does not explain the welldocumented observation of Bax translocation from the cytosol to the mitochondria following cisplatin exposure (Lee et al, 2001; Park et al, 2002).

However, it is worth emphasizing that following cisplatin treatment, both Fas-mutant and TNFR1-deficient animals continued to exhibit a significant number of Tunel-positive apoptotic tubular cells (albeit about 50% less than in wildtype mice), and displayed only a partial protection of renal function (a rise in BUN of approximately 50% compared to wild-type). These observations indicate that other pathways leading to apoptosis must additionally be invoked in cisplatin nephrotoxicity. Also, the precise mechanism by which cisplatin (or its toxic metabolite) activates either the Fas- or the TNFR1-dependent pathways is unknown. Based on results obtained from other cell types, a possible role for p53 (Miyashita and Reed 1995; Muller et al, 1998; Burns and El-Deiry 1999; Chandel et al, 2000) and oxidative stress (Bauer et al, 1998) as inducers of Fas-mediated apoptosis in this situation has been postulated (Figure 3). These notions are detailed in subsequent sections.

X. Activation of caspases Since caspases represent the final mediators of apoptosis in most situations, several authors have sought evidence for caspase activation following cisplatin exposure. A role for the "executioner" caspase 3 was first suggested in cultured proximal tubular cells, which responded to cisplatin exposure by increasing caspase 3 activity in a dose- and duration-dependent manner (Fukuoka et al, 1998; Lau 1999). Cell-permeant inhibitors of caspase 3, such as zVAD.fmk and DEVD.CHO, were effective in protecting against cisplatin-induced DNA damage and cell death (Zhan et al, 1999; Kaushal et al, 2001). Subsequent studies searching for activation of the more proximate caspases have revealed a dramatic activation of caspase 9, and to a lesser extent of caspase 8 (Kaushal et al, 2002; Park et al, 2002). These findings are in agreement with the collective previous data implicating both the mitochondrial and the death receptor pathways in cisplatin-induced nephrotoxocity. However, more detailed analyses have shown that while specific inhibition of caspase 9 (with LEHD-CHO) largely prevented cisplatininduced DNA fragmentation in cultured cells, a specific inhibitor of caspase 8 (IETD.fmk) was much less efficacious (Park et al, 2002). Furthermore, recent results have indicated that cisplatin-induced apoptosis in cultured renal proximal tubular cells proceeds via both caspasedependent and caspase-independent pathways, and that inhibition of the executioner caspase 3 blocks only about 50% of cisplatin-induced apoptosis (Cummings and Schnellmann 2002; Nowak 2002). The potential efficacy of caspase inhibition in a complex in vivo system such as the kidney in response to cisplatin is currently unknown.

IX. Activation of mitochondrial pathways Substantial evidence is now available to implicate the mitochondrial apoptotic pathways in cisplatin-induced tubular cell death. Initial studies completed in cultured proximal tubular cells demonstrated that forced overexpression of Bcl-2 rendered the cells partially resistant to cisplatin-induced apoptosis (Takeda et al, 1997; Zhan et al, 1999). This observation has been confirmed in rats in which pretreatment with uranyl acetate caused a significant upregulation of Bcl-2 in the kidney, and ameliorated cisplatin-induced tubular cell apoptosis as well as the ensuing renal dysfunction (Zhou et al, 1999). According to the "dueling dimers" prediction, Bcl-2 inhibits apoptosis primarily by opposing pro-apoptotic molecules in the mitochondrial pathway (Oltvai and Korsmeyer 1994). Indeed, cisplatin nephrotoxicity has been associated with increased renal expression of Bax in vivo (Huang et al, 2001), and with translocation of Bax from the cytosol to a membrane fraction in cultured cells (Lee et al, 2001). A detailed analysis of mitochondrial pathways activated by cisplatin has recently been completed in cultured proximal tubular cells (Park et al, 2002). Cisplatin-induced apoptosis was associated with increased caspase 9 activity, and the DNA laddering was inhibited by pretreatment with specific caspase 9 inhibitors, thereby implicating the mitochondrial mechanisms. Cisplatin also triggered a duration-dependent translocation of Bax from the cytosol to the mitochondria, induction of mitochondrial permeability transition, and release of cytochrome c into the cytosol (Park et al, 2002). Collectively, these studies suggest a major role for mitochondrial pathways in cisplatin-induced apoptosis, at least in cultured renal epithelial cells, as shown in Figure 3. The relative contribution of these pathways in the analogous in vivo situation remains under active investigation. Also, the precise mechanisms by which cisplatin activates the mitochondrial apoptotic pathways is unclear. It has been known for a long time that cisplatininduced nephrotoxicity is accompanied by alterations in

XI. Role of regulatory pathways In order to reconcile the seemingly disparate results indicating activation of both death receptor and mitochondrial pathways in cisplatin-induced nephrotoxicity, investigators have examined the regulatory mechanisms that can account for "cross-talk" between the two. Studies have now documented the rapid activation and nuclear translocation of p53 in response to cisplatin both in kidneys (Miyaji et al, 2001) and in cultured renal proximal tubular cells (Cummings and Schnellmann 2002). Inhibition of p53 prior to cisplatin exposure blunted the apoptotic response by 50%, attesting to the importance 53

Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity of this regulatory pathway at least in vitro. It is well known that both cisplatin-induced DNA damage and cisplatin-induced oxidant stress are potent activators of p53 (Muller et al, 1998; Chandel et al, 2000), and that p53 can in turn activate both Bax as well as the Fas-FADD axis (Miyashita and Reed 1995; Burns and El-Deiry 1999). It is therefore likely that this regulatory mechanism may play a crucial role in cisplatin-induced apoptosis. It is well known that one of the responses of the normally quiescent renal tubular epithelial cell to damage induced by cisplatin includes entry into the cell cycle with subsequent cell proliferation, which presumably represents a reparative event (Megyesi et al, 1995; Sano et al, 2000). However, cisplatin also results in DNA damage (Zamble and Lippard 1995), and uncontrolled proliferation of these cells would be expected to result in apoptotic and/or necrotic cell death.Fortunately, renal epithelial cells have evolved mechanisms to prevent further progression of the cell cycle, allowing time and opportunity for their DNA to be repaired and the cell to then complete the regeneration and replacement process (Megyesi et al, 1998; Megyesi et al, 2002). Candidate proteins that contribute to the cell cycle arrest required for DNA repair include p21 and 14-33". Several studies have now documented that cisplatininduced nephrotoxicity is associated with upregulation of p21 mRNA (Megyesi et al, 1996; Huang et al, 2001) and protein (Megyesi et al, 1998; Miyaji et al, 2001; Megyesi et al, 2002). While it is well known that the p53 gene is a potent regulator of p21 (El-Deiry et al, 1993), induction of p21 in cisplatin nephrotoxicity appears to be p53dependent as well as -independent (Megyesi et al, 1996). Mice lacking p21 develop normally, but respond to cisplatin with a more severe nephrotoxic injury, including a more rapid onset of renal failure, uncoordinated progression into S-phase of the cell cycle, and increased apoptosis (Megyesi et al, 1998). Recent work has suggested a role for another cell cycle inhibitor, 14-3-3". Following cisplatin exposure, there is a marked induction of 14-3-3" mRNA and protein in the kidney tubular cells both in vivo and in vitro (Megyesi et al, 2002). Both p21 and 14-3-3" are known to be induced following DNAdamaging injury, at least in part via a p53-dependent mechanism (Hermeking et al, 1997). Both are overexpressed in terminally differentiating epithelia, both are required for proper coordination of the cell cycle, and the absence of either of these factors can accelerate apoptosis (Megyesi et al, 2002). It is recognized that apoptosis represents a default pathway in most cells, and can be activated by a relative deficiency of a variety of "survival factors" (Raff 1992). One example of a survival factor for kidney tubular cells following cisplatin injury is hepatocyte growth factor (HGF). Kidney mRNA levels for HGF are rapidly induced by ischemic or nephrotoxic injury (Liu et al, 1998), and administration of exogenous HGF ameliorates the renal dysfunction induced by cisplatin in vivo by enhancing tubular repair processes (Kawaida et al, 1994). It has recently been shown by a variety of assays that forced over-expression of HGF in cultured renal tubular cells partially inhibited the apoptotic response to cisplatin

incubation (Liu et al, 1998). Whether HGF exerts its beneficial effects in vivo also by protecting tubular cells from cisplatin-induced apoptotic death is not known.

XII. Role of oxidative stress and mitochondrial dysfunction The mechanisms by which cisplatin activates the myriad of apoptotic pathways outlined above remain unclear. However, a role for cisplatin-induced oxidative stress may provide an attractive hypothesis (Baliga et al, 1997). Several studies have now documented the importance of reactive oxygen metabolites (ROM) in cisplatin-induced renal cell apoptosis (Ueda et al, 2000). It is well known that mitochondria continuously produce ROM such as superoxide (Richter et al, 1995). Mitochondria also continuously scavenge ROM via the action of antioxidant enzymes such as superoxide dismutase, glutathione peroxidase, catalase, and glutathione S-transferase (Richter et al, 1995). Cisplatin is known to accumulate in mitochondria of renal epithelial cells (Singh 1989; Gemba and Fukuishi 1991). Several investigators have demonstrated that cisplatin induces ROS in renal epithelial cells primarily by decreasing the activity of antioxidant enzymes and by depleting intracellular concentrations of GSH (Sadzuka et al, 1992; Kruidering et al, 1997; Husain et al, 1998; Huang et al, 2001). A large number of studies have now accumulated documenting the beneficial effects of a variety of antioxidants in cisplatin-induced nephrotoxicity. Agents such as superoxide dismutase, dimethylthiourea, and GSH have been shown to reduce the degree of renal failure and tubular cell damage when administered simultaneously with cisplatin in rats (McGinness et al, 1978; Sadzuka et al, 1992; Matsushima et al, 1998). Antioxidants such as GSH, superoxide dismutase, catalase, deferoxamine, probucol, and heme oxygenase-1 specifically provide partial protection against cisplatin-induced apoptosis in cultured renal epithelial cells (Lieberthal et al, 1996; Okuda et al, 2000; Shiraishi et al, 2000). Furthermore, significant attenuation of cisplatin-induced apoptosis and renal failure in animal models have resulted from maneuvers such as treatment with the hydroxyl radical scavenger DMTU (Zhou et al, 1999), targeted proximal tubular delivery of superoxide dismutase (Nishikawa et al, 2001), and pre-treatment with L-carnitine (Chang et al, 2002). Reactive oxygen molecules can trigger several of the apoptotic mechanisms activated by cisplatin (Figure 3). For example, ROM can induce Fas (Bauer et al, 1998), activate p53 (Chandel et al, 2000), alter mitochondrial permeability (Kruidering et al, 1997; Nowak 2002), release cytochrome c into the cytosol (Reed 1997), and even directly activate caspases (Higuchi et al, 1998). However, one recent study has suggested that at least in cultured proximal tubular cells, the primary cause of cell death following cisplatin exposure is not ROM formation per se (Kruidering et al, 1996). Rather, cisplatin-induced mitochondrial dysfunction with consequent induction of cell death pathways appeared to be the underlying mechanism. Several studies have

Cancer Therapy Vol 1, page 55 demonstrated that cisplatin causes mitochondrial dysfunction in kidney epithelial cells (Gordon and Gattone 1986; Brady et al, 1990; Brady et al, 1993; Kruiderink et al, 1996; Nowak 2002). The major mitochondrial targets of cisplatin appear to be the enzymatic complexes that comprise the electron transport chain, leading to a reduction in cellular ATP levels (Kruiderink et al, 1996; Nowak 2002). If the dose of cisplatin is high, ATP depletion is severe, and a rapid metabolic collapse and necrotic cell death would follow (Lieberthal et al, 1996). Lesser grades of ATP depletion associated with lower (pharmacologic) doses of cisplatin can induce apoptosis via release of mitochondrial cytochrome c, which has been documented in cultured renal epithelial cells exposed to cisplatin (Kruiderink et al, 1996; Park et al, 2002; Nowak 2002). It is currently not known exactly how cisplatin inhibits the enzymatic complexes of the respiratory chain. The mechanisms by which cisplatin causes release of cytochrome c also remain controversial, and include induction of mitochondrial permeability transition (Park et al, 2002) and increases in mitochondrial transmembrane potential (Nowak 2002). By analogy with studies of ATP depletion by alternative methods (exposure to inhibitors of oxidative phosphorylation such as antimycin A), it may be inferred that cisplatin-induced ATP depletion can also trigger death receptor-mediated apoptosis (Feldenberg et al, 1999) and the mitochondrial apoptotic pathways (Saikumar et al, 1998). Thus, partial ATP depletion may constitute a common biochemical pathway that leads to apoptosis following a variety of cellular stresses applied at an intensity below the threshold for necrosis. If ATP depletion plays a central role in cisplatininduced apoptosis, and the primary cause of cell death is not ROM formation, then how does one explain the encouraging results obtained from ROM inhibition as detailed above? One possibility is that these two pathogenetic processes co-exist, and are not mutually exclusive. Thus, while ATP-depletion may induce the primary cell injury and programmed cell death, this in turn may accelerate ROM formation by the damaged cells, which may contribute to an amplification loop leading to ROM-mediated cell death of the same cell or even the neighboring cells. ROM inhibition can limit this amplification loop, and may also alleviate nephrotoxicity by reducing the accompanying inflammatory response (Kruidering et al, 1997).

cisplatin to a nephrotoxin, use of antioxidants to counter the ravages of reactive oxygen molecules, and targeted inhibition of apoptotic mechanisms activated by cisplatin specifically in kidney cells.

References Adams JM, and Cory S (1996) The Bcl-2 protein family: arbiters of cell death. Science 281, 1322-1326. Anders MW (1995) Mitochondrial bioactivation of cysteine Sconjugates and 4-thiaalkanoates: implications for mitochondrial dysfunction and mitochondrial diseases. Biochim Biophys Acta 1271, 51-57. Anders MW, and Dekant W (1998) Glutathione-dependent bioactivation of haloalkenes. Annu Rev Pharmacol Toxicol 38, 501-537. Ashkenazi A, and Dixit VM (1996) Death receptors: signaling and modulation. Science 281, 1305-1308. Baliga R, Ueda N, Walker PD, Shah SV (1997) Oxidant mechanisms in toxic acute renal failure. Am J Kid Dis 29, 467-477 Ban N, Takahashi Y, Takayama T, Kura T, Katahira T, Sakamaki S, Niitsu Y (1996) Transfection of glutathione Stransferase (GST)-pi antisense complementary DNA increases the sensitivity of a colon cancer cell line to adriamycin, cisplatin, melphalan, and etoposide. Cancer Res 56, 3577-3582. Bauer MK, Vogt M, Los M, Siegel J, Wesselborg S, SchulzeOsthoff K (1998) Role of reactive oxygen intermediates in activation-induced CD95 (APO-1/Fas) ligand expression. J Biol Chem 273, 8048-8055. Benard P, Desplanches G, Macquet JP, Simon J (1983) Wholebody autoradiographic study of the distribution of 195mPt in healthy and tumor-bearing mice treated with labeled cisplatin. Cancer Treat Rep 67, 457-466. Berners-Price SJ and Kuchel PW (1990) Reaction of cis- and trans-[PtCl2(NH3)2] with reduced glutathione studied by 1H, 13C, 19Pt, and 15N-{1H}DEPT NMR. J Inorg Biochem 38, 305-326. Borch RF, Katz JC, Lieder PH, Pleasants ME (1980) Effect of diethyldithiocarbamate rescue on tumor response to cisplatinum in a rat model. Proc Natl Acad. Sci U S A 77, 5441-5444. Borst P, Evers R, Kool M, Wijnholds J (2000) A family of drug transporters: the multidrug resistance-associated proteins. J Natl Cancer Inst 92, 1295-1302.

XIII: Summary and future perspectives This review has focused on recent evidence for the paradoxical role of GGTP in cisplatin nephrotoxicity, the unexpected ability of proximal tubular cells to metabolize cisplatin to a nephrotoxin, and the evidence for apoptotic pathways and reactive oxygen metabolites as major mechanisms underlying cisplatin-induced renal cell injury. The information gleaned from this review may provide critical clues to novel therapeutic interventions aimed at minimizing cisplatin-induced nephrotoxicity while enhancing its antineoplastic efficacy. Such strategies may include inhibition of pathways leading to activation of

Brady HR, Kone BC, Stromski ME, Zeidel ML, Giebisch G, Gullans SR (1990) Mitochondrial injury: an early event in cisplatin toxicity to renal proximal tubules. Am J Physiol 258, F1181-F1187 Brady HR, Zeidel ML, Kone BC, Giebisch G, Gullans SR ( 1993) Differential actions of cisplatin on renal proximal tubule and inner medullary collecting duct cells. J Pharmac Exp Ther 265, 1421-1428.

Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity Brenner C, and Kroemer G (2000) Mitochondria-the death signal integrators. Science 289, 1150-1151.

Cornelison TL and Reed E (1993) Nephrotoxicity and hydration management for cisplatin, carboplatin, and ormaplatin. Gynecol. Oncol. 50, 147-158.

Brown R, Hirst GL, Gallagher WM, McIlwrath AJ, Margison GP, van der Zee AG, Anthoney DA (1997) hMLH1 expression and cellular responses of ovarian tumour cells to treatment with cytotoxic anticancer agents. Oncogene 15, 45-52.

Cummings BS and Schnellmann RG (2002) Cisplatin-induced renal cell apoptosis: caspase 3-dependent and -independent pathways. J Pharmacol Exp Ther 302, 8-17. Curran WJ (2002) New chemotherapeutic agents: update of major chemoradiation trials in solid tumors. Oncology 63 Suppl 2, 29-38.

Bruschi SA, Lindsay JG, Crabb JW (1998) Mitochondrial stress protein recognition of inactivated dehydrogenases during mammalian cell death. Proc Natl Acad Sci U S A 95, 13413-13418.

Curthoys NP, Hughey RP (1979) Characterization and physiological function of rat renal gamma-glutamyl transpeptidase. Enzyme 24, 383-403.

Bruschi SA, West KA, Crabb JW, Gupta RS, Stevens JL (1993) Mitochondrial HSP60 (P1 protein) and a HSP70-like protein (mortalin) are major targets for modification during S(1,1,2,2-tetrafluoroethyl)- L-cysteine-induced nephrotoxicity. J. Biol. Chem. 268, 23157-23161.

Daley-Yates PT, McBrien DCH (1984) Cisplatin metabolites in plasma, A study of their pharmacokinetics and importance in the nephrotoxic and antitumour activity of cisplatin. Biochem Pharmacol 33, 3063-3070.

Burns TF, and El-Deiry WS (1999) The p53 pathway and apoptosis. J Cell Physiol 181, 231-239.

DeConti RC, Toftness BR, Lange RC, Creasey WA (1973) Clinical and pharmacological studies with cisdiamminedichloroplatinum(II). Cancer Res 33, 1310-1315.

Chandel NS, Vander Heiden MG, Thompson CB, and Schumaker PT (2000) Redox regulation of p53 during hypoxia. Oncogene 19:3840-3848.

Dekant W (2001) Chemical-induced nephrotoxicity mediated by glutathione S-conjugate formation. Toxicol Lett 124, 21-36.

Chang B-J, Nishikawa M, Sato E, Utsumi K, and Inoue M (2002) L-Carnitine inhibits cisplatin-induced injury of the kidney and small intestine. Arch Biochem Biophys 405, 55-64.

Eastman A (1999) The mechanism of action of cisplatin:From adducts to apoptosis. In: Lippert B (ed) Cisplatin:Chemistry and Biochemistry of a Leading Anticancer Drug. WileyVCH, New York, pp 111-135.

Chen G, Hutter KJ, Zeller WJ (1995) Positive correlation between cellular glutathione and acquired cisplatin resistance in human ovarian cancer cells. Cell Biol Toxicol 11, 273281.

El-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW, and Vogelstein B (1993) WAF-1, a potential medictor of p53 tumor suppression. Cell 75, 817-825.

Chen Y, Cai J, Anders MW, Stevens JL, Jones DP (2001) Role of mitochondrial dysfunction in S-(1,2-dichlorovinyl)-lcysteine- induced apoptosis. Toxicol Appl Pharmacol 170, 172-180.

Elfarra AA, Lash LH, Anders MW (1986) Metabolic activation and detoxication of nephrotoxic cysteine and homocysteine s-conjugates. Proc Natl Acad Sci USA 83, 2667-2671.

Cheng X, Kigawa J, Minagawa Y, Kanamori Y, Itamochi H, Okada M, Terakawa N (1997) Glutathione S-transferase-pi expression and glutathione concentration in ovarian carcinoma before and after chemotherapy. Cancer 79, 521527.

Esposito M, Viale M, Vannozzi MO, Zicca A, Cadoni A, Merlo F, Gogioso L (1996) Effect of the antiarrhythmic drug procainamide on the toxicity and antitumor activity of cisdiamminedochloroplatinum(II). Toxicol Appl Pharmacol 140, 370-377.

Chu G, Mantin R, Shen YM, Baskett G, Sussman H (1993) Massive cisplatin overdose by accidental substitution for carboplatin. Toxicity and management. Cancer 72, 37073714.

Feldenberg LR, Thevananther S, Del Rio M, De Leon M, and Devarajan P (1999) Partial ATP depletion induces Fas- and caspase-mediated apoptosis in MDCK cells. Am J Physiol (Renal Physiol) 276, F837-F846.

Cohen SM, Lippard SJ (2001) Cisplatin: from DNA damage to cancer chemotherapy. Prog Nucleic Acid Res Mol Biol 67, 93-130.

Fink D, Howell SB (2000) How does cisplatin kill cells? In: Kelland LR, Favilli F (eds) Platinum-based Drugs in Cancer Therapy. Humana Press, Totowa, New Jersey, pp 149-167.

Commandeur JN, Stijntjes GJ, Wijngaard J, Vermeulen NP (1991) Metabolism of L-cysteine S-conjugates and N(trideuteroacetyl)-L- cysteine S-conjugates of four fluoroethylenes in the rat. Role of balance of deacetylation and acetylation in relation to the nephrotoxicity of mercapturic acids. Biochem Pharmacol 42, 31-38.

Friesen C, Fulda S, and Debatin KM (1999) Cytotoxic drugs and the CD95 pathway. Leukemia 13, 1854-1858. Fukuoka K, Takeda M, Kobayashi M, Osaki T, Shirato I, Soejima A, Nagasawa T, and Endou H (1998) Distinct interleukin-1#-converting enzyme family proteases mediate cisplatin- and staurosporine-induced apoptosis of mouse proximal tubule cells. Life Sci 62, 1125-1138.

Cooper AJ, Bruschi SA, Anders MW (2002) Toxic, halogenated cysteine S-conjugates and targeting of mitochondrial enzymes of energy metabolism. Biochem Pharmacol 64, 553-564.

Gaskin PJ, Adcock HJ, Buckberry LD, Teesdale-Spittle PH, Shaw PN (1995) The C-S lysis of L-cysteine conjugates by

Cancer Therapy Vol 1, page 57 aspartate and alanine aminotransferase enzymes. Hum Exp Toxicol 14, 422-427.

Hayden PJ, Ichimura T, McCann DJ, Pohl LR, Stevens JL (1991) Detection of cysteine conjugate metabolite adduct formation with specific mitochondrial proteins using antibodies raised against halothane metabolite adducts. J Biol Chem 266, 18415-18418.

Gately DP, Howell SB (1993) Cellular accumulation of the anticancer agent cisplatin: a review. Br J Cancer 67, 11711176.

Hayden PJ, Stevens JL (1990) Cysteine conjugate toxicity, metabolism, and binding to macromolecules in isolated rat kidney mitochondria. Mol Pharmacol 37, 468-476.

Gemba M, and Fukuishi N (1991) Amelioration by ascorbic acid of cisplatin-induced injury in cultured renal epithelial cells. Contrib Nephrol 95, 138-142.

Hermeking H, Lengauer C, Polyak K, He TC, Zhang L, Thiagalingam, Kinzler KW, and Vogelstein B (1997) 14-33" is a p53-regulated inhibitor of G2/M progression. Mol Cell 1, 3-11.

Germain I, Tetu B, Brisson J, Mondor M, Cherian MG (1996) Markers of chemoresistance in ovarian carcinomas: an immunohistochemical study of 86 cases. Int J Gynecol Pathol 15, 54-62.

Higuchi M, Honda T, Proske RJ, Yeh ETH (1998) Regulation of reactive oxygen species-induced apoptosis and necrosis by caspase 3-like proteases. Oncogene 17, 2752-2760.

Godwin AK, Meister A, O'Dwyer PJ, Huang CS, Hamilton TC, Anderson ME (1992) High resistance to cisplatin in human ovarian cancer cell lines is associated with marked increase of glutathione synthesis. Proc Natl Acad Sci USA 89, 30703074.

Howell SB, Taetle R (1980) Effect of sodium thiosulfate on cisdichlorodiammineplatinum(II) toxicity and antitumor activity in L1210 leukemia. Cancer Treat Rep 64, 611-616.

Goldstein JC, Waterhouse NJ, Juin P, Evan GI, and Green DR (2000) The coordinate release of cytochrome c during apoptosis is rapid, complete and kinetically invariant. Nat Cell Biol 2, 156-162.

Hrubisko M, McGown AT, Fox BW (1993) The role of metallothionein, glutathione, glutathione S-transferases and DNA repair in resistance to platinum drugs in a series of L1210 cell lines made resistant to anticancer platinum agents. Biochem Pharmacol 45, 253-256.

Gonzales-Vitale JC, Hayes DM, Cvitkovic E, Sternberg SS (1977) The renal pathology in clinical trials of cis-platinum (II) diamminedichloride. Cancer 39, 1362-1371.

Huang Q, Dunn RT, Jayadev S, DiSorbo O, Pack FD, Farr SB, Stoll RE, and Blanchard KT (2001) Assessment of cisplatininduced nephrotoxocity by microarray technology. Toxicol Sci 63, 196-207.

Gordon JA, and Gattone VH (1986) Mitochondrial alterations in cisplatin-induced acute renal failure. Am J Physiol (Renal Fluid Electrolyte Physiol) 19, F991-F998.

Hughey RP, Rankin BB, Elce JS, Curthoys NP (1978) Specificity of a particulate rat renal paptidase and its localization along with other enzymes of mercapturic acid synthesis. Arch Biochem Biophys 186, 211-217.

Hamada S, Kamada M, Furumoto H, Hirao T, Aono T (1994) Expression of glutathione S-transferase-pi in human ovarian cancer as an indicator of resistance to chemotherapy. Gynecol Oncol 52, 313-319. Hanigan MH, Frierson Jr. HF (1996) Immunohistochemical detection of gamma-glutamyl transpeptidase in normal human tissue. J Histochem Cytochem 44, 1101-1108.

Husain K, Morris C, Whitworth C, Trammell GL, Rybak LP, Somani SM (1998) Protection by ebselen against cisplatininduced nephrotoxicity: antioxidant system. Mol Cell Biochem 178, 127-133.

Hanigan MH, Gallagher BC, Taylor PTJr, Large MK (1994) Inhibition of gamma-glutamyl transpeptidase activity by acivicin in vivo protects the kidney from cisplatin-induced toxicity. Cancer Res 54, 5925-5929.

Ishida S, Lee J, Thiele DJ, Herskowitz I (2002) Uptake of the anticancer drug cisplatin mediated by the copper transporter Ctr1 in yeast and mammals. Proc Natl Acad Sci U S A 99, 14298-14302.

Hanigan MH, Gallagher BC, Townsend DM, Gabarra V (1999) Gamma-glutamyl transpeptidase accelerates tumor growth and increases the resistance of tumors to cisplatin in vivo. Carcinogenesis 20, 553-559.

Ishikawa T, Bao JJ, Yamane Y, Akimaru K, Frindrich K, Wright CD, Kuo MT (1996) Coordinated induction of MRP/GS-X pump and gamma-glutamylcysteine synthetase by heavy metals in human leukemia cells. J Biol Chem 271, 1498114988.

Hanigan MH, Lykissa ED, Townsend DM, Ou C, Barrios R, Lieberman MW (2001) Gamma-glutamyl transpeptidasedeficient mice are resistant to the nephrotoxicity of cisplatin. Am J Pathol 159, 1889-1894.

Jones MM, Basinger MA, Holscher MA (1992) Control of the nephrotoxicity of cisplatin by clinically used sulfurcontaining compounds. Fundamental and Applied Toxicology 18, 181-188.

Hanigan MH, Pitot HC (1985) Gamma-glutamyl transpeptidase its role in hepatocarcinogenesis. Carcinogenesis 6, 165-172.

Katano K, Kondo A, Safaei R, Holzer A, Samimi G, Mishima M, Kuo YM, Rochdi M, Howell SB (2002) Acquisition of resistance to cisplatin is accompanied by changes in the cellular pharmacology of copper. Cancer Res 62, 65596565.

Hanigan MH, Ricketts WA (1993) Extracellular glutathione is a source of cysteine for cells that express gamma-glutamyl transpeptidase. Biochemistry 32, 6302-6306. Hassall CD, Gandolfi AJ, Duhamel RC, Brendel K (1984) The formation and biotransformation of cysteine conjugates of halogenated ethylenes by rabbit renal tubules. Chem Biol Interact 49, 283-297.

Kaushal GP, Kaushal V, Hong X, and Shah SV (2001) Role and regulation of caspases in cisplatin-induced injury to renal tubular epithelial cells. Kidney Int 60, 1726-1736.

Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity Kawaida K, Matsumoto K, Shimazu H, aand Nakamura T (1994) Hepatocyte growth factor prevents acute renal failure and accelerates renal regeneration in mice. Proc Natl Acad Sci USA 91, 4357-4361.

Lash LH, Sausen PJ, Duescher RJ, Cooley AJ, Elfarra AA (1994) Roles of cysteine conjugate b-lyase and s-oxidase in nephrotoxicity: studies with s-(1,2-dichlorovinyl)-l-cysteine and s-(1,2-dichlorovinyl)-l-cysteine sulfoxide. J Pharmacol Exp Therap 269, 374-383.

Kerr JFR, Wyllie AH, and Currie AR (1972) Apoptosis: a basic biological phenomenon with wide-ranging implication in tissue kinetics. Br J Cancer 26, 239-257.

Lau AH (1999) Apoptosis induced by cisplatin nephrotoxic injury. Kidney Int 56, 1295-1298.

Kigawa J, Minagawa Y, Kanamori Y, Itamochi H, Cheng X, Okada M, Oishi T, Terakawa N (1998) Glutathione concentration may be a useful predictor of response to second-line chemotherapy in patients with ovarian cancer. Cancer 82, 697-702.

Lee RH, Song JM, Park MY, Kang SK, Kim YK, and Jung JS (2001) Cisplatin-induced apoptosis by translocation of endogenous Bax in mouse collecting duct cells. Biochem Pharmacol 62, 1013-1023. Legallicier B, Leclere C, Monteil C, Elkaz V, Morin JP, Fillastre JP (1996) The cellular toxicity of two antitumoral agents derived from platinum, cisplatinum versus oxaliplatinum, on cultures of tubular proximal cells. Drugs Exptl Clin Res 22, 41-50.

Komatsu M, Sumizawa T, Mutoh M, Chen ZS, Terada K, Furukawa T, Yang XL, Gao H, Miura N, Sugiyama T, Akiyama S (2000) Copper-transporting P-type adenosine triphosphatase (ATP7B) is associated with cisplatin resistance. Cancer Res 60, 1312-1316. Korsmeyer SJ, Wei MC, Saito M, Weiler S, Oh KJ, and Sclesinger PH (2000) Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Diff 7, 1166-1173.

Leyland-Jones BR, Townsend AJ, Tu CP, Cowan KH, Goldsmith ME (1991) Antineoplastic drug sensitivity of human MCF-7 breast cancer cells stably transfected with a human alpha class glutathione S-transferase gene. Cancer Res 51, 587594.

Korst AE, Boven E, van der Sterre ML, Fichtinger-Schepman AM, Van der Vijgh WJ (1998) Pharmacokinetics of cisplatin with and without amifostine in tumour- bearing nude mice. Eur J Cancer 34,412-416

Lieberthal W, Triaca V, and Levine J (1996) Mechanisms of death induced by cisplatin in proximal tubular epithelial cells: apoptosis vs. necrosis. Am J Physiol (Renal Physiol) 39, F700-F708.

Kramer RA, Foureman G, Greene KE, Reed DJ (1987) Nephrotoxicity of S-(2-chloroethyl)glutathione in the Fischer rat: Evidence for gamma-glutamyltranspeptidaseindependent uptake by the kidney. J Pharmacol Exp Ther 242, 741-748.

Levine JS, andLieberthal W (2001) Terminal pathways to cell death. In Acute Renal Failure, Molitoris BA and Finn WF (editors), W.B. Saunders, Philadelphia, pp 30-59). Lin X, Okuda T, Holzer A, Howell SB (2002) The copper transporter CTR1 regulates cisplatin uptake in Saccharomyces cerevisiae. Mol Pharmacol 62, 1154-1159.

Kroning R, Katz D, Lichtenstein AK, Nagami GT (1999) Differential effects of cisplatin in proximal and distal renal tubule epithelial cell lines. Br J Cancer 79, 293-299.

Liu Y, Sun AM, and Dworkin LD (1998) Hepatocyte growth factor protects renal epithelial cells from apoptotic death. Biochem Biophys Res Comm 246, 821-826.

Kruidering M, Van de Water B, De Heer E, Mulder GJ, Nagelkerke JF (1997) Cisplatin-induced nephrotoxicity in porcine proximal tubular cells: mitochondrial dysfunction by inhibition of complexes I to IV of the respiratory chain. J Pharmacol Exp Therap 280, 638-649.

Luo X, Budihardjo I, Zou H, Slaughter C, and Wang X (1998) Bid, a Bcl-2-interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell 94, 481-490.

Kruidering M, van der Water B, Zhan Y, Baelde JJ, Heer E, Mulder GJ, Stevens JL, and Nagerkerke JF (1998) Cisplatin effects on F-actin and matrix proteins precede renal tubular cell detachment and apoptosis in vitro. Cell Death Diff 5, 601-614.

Matsushima H, Yonemura K, Ohishi K, Hishida A (1998) The role of oxygen free radicals in cisplatin-induced acute renal failure in rats. J Lab Clin Med 131, 518-526. Mayer RD, Lee K, Cockett ATK (1987) Inhibition of cisplatininduced nephrotoxicity in rats by buthionine sulfoximine, a glutathione synthesis inhibitor. Cancer Chemother Pharmacol 20, 207-210.

Lange RC, Spencer RP, Harder HC (1973) The antitumor agent cis-Pt(NH3)2Cl2: Distribution studies and dose calculations for 193m Pt and 195m Pt. J Nuclear Medicine 14, 191-195.

McGinness JE, Proctor PH, Demopoulos HB, Hokanson JA, Kirkpatrick DS (1978) Amelioration of cis-platinum nephrotoxicity by orgotein (superoxide dismutase). Physiol Chem Phys 10, 267-277.

Langerak AD, Dreisbach LP (2001) Chemotherapy Regimens and Cancer Care. Landes Bioscience, Georgetown, Texas. Lash LH, Elfarra AA, Anders MW (1986) Renal cysteine conjugate beta-lyase. Bioactivation of nephrotoxic cysteine S-conjugates in mitochondrial outer membrane. J Biol Chem 261, 5930-5935.

McIntyre TM, Curthoys NP (1982) Renal catabolism of glutathione: characterization of a particulate rat renal dipeptidase that catalyzes the hydrolysis of cysteinylglycine. J Biol Chem 257, 11915-11921.

Lash LH, Qian W, Putt DA, Jacobs K, Elfarra AA, Krause RJ, Parker JC (1998) Glutathione conjugation of trichloroethylene in rats and mice: sex-, species-, and tissuedependent differences. Drug Metab Dispos 26, 12-19.

McKeage MJ (2000) Clinical toxicology of platinum-based cancer chemotherapeutic agents. In: Kelland LR, Farrell NP

Cancer Therapy Vol 1, page 59 (eds) Platinum-based Drugs in Cancer Therapy. Humana Press, Totowa, New Jersey, pp 251-275.

relevance to nephrotoxicity. Toxicol Appl Pharmacol 73, 124-137.

Megyesi J, DiMari J, Udvarhelyi M, Price PM, and Safirstein R (1995) DNA synthesis is dissociated from the immediateeary gene response in the post-ischemic kidney. Kidney Int 48, 1451-1458.

Nishikawa M, Nagatomi H, Chang B-J, Sato E, and Inoue M (2001) Targeting superoxide dismutase to renal proximal tubule cells inhibits mitochondrial injury and renal dysfunction induced by cisplatin. Arch Biochem Biophys 387, 78-84.

Megyesi J, Udvarhelyi N, Safirstein RL, and Price PM (1996) The p53-independent activation of transcription of p21WAF1/CIP1/SDI1 after acute renal failure. Am J Physiol 271, F1211-F1216.

Nishimura T, Newkirk K, Sessions RB, Andrews PA, Trock BJ, Rusmussen AA, Montogomery EA, Bischoff EK, Hanigan MH, Cullen KJ (1998) Association between expression of glutathione-associated enzymes and response to platinumbased chemotherapy in head and neck cancer. Chem Biol Interac 112, 187-198.

Megyesi J, Safirstein RL, and Price PM (1998) Induction of p21WAF1/CIP1/SDI1 in kidney tubule cells affects the course of cisplatin-induced acute renal failure. J Clin Invest 101, 777-782.

Nogae S, Masanobu M, Kobayashi N, Saito T, Abe K, Saito H, Nakane PK, Nakanishi Y, and Koji T (1998) Induction of apoptosis in ischemia-reperfusion model of mouse kidney: Possible involvement of Fas. J Am Soc Nephrol 9, 620-631.

Meyer KB, Madias NE ( 1994) Cisplatin nephrotoxicity. Mineral Electrolyte Metab 20, 201-213. Mistry P, Lee C, McBrien DC (1989) Intracellular metabolites of cisplatin in the rat kidney. Cancer Chemother Pharmacol 24, 73-79.

Nowak G (2002) Protein kinase C-! and ERK1/2 mediate mitochondrial dysfunction, decreases in active Na transport, and cisplatin-induced apoptosis in renal cells. J Biol Chem 277, 43377-43388.

Miyaji T, Kato A, Yasuda H, Fujigaki Y, and Hishida A (2001) Role of the increase in p21 in cisplatin-induced acute renal failure in rats. J Am Soc Nephrol 12, 900-908.

Oakley AJ, Lo BM, Nuccetelli M, Mazzetti AP, Parker MW (1999) The ligandin (non-substrate) binding site of human Pi class glutathione transferase is located in the electrophile binding site (H-site). J Mol Biol 291, 913-926.

Miyashita T, and Reed JC (1995) Tumor suppressor p53 is a direct transcriptonal activator of the human bax gene. Cell 80, 293-299.

O'Dwyer PJ, Stevenson JP, Johnson SW (1999) Clinical Status of Cisplatin, Carboplatin and Other Platinum-Based Antitumor Drugs. In: Lippert B (ed) Cisplatin: Chemistry and Biochemistry of a Leading Anticancer Drug. Wiley-VCH, Zurich, pp 29-70.

Miyashita H, Nitta Y, Mori S, Kanzaki A, Nakayama K, Terada K, Sugiyama T, Kawamura H, Sato A, Morikawa H, Motegi K, Takebayashi Y (2003) Expression of copper-transporting P-type adenosine triphosphatase (ATP7B) as a chemoresistance marker in human oral squamous cell carcinoma treated with cisplatin. Oral Oncol 39, 157-162.

Okuda M, Masaki K, Fukatsu S, Hashimoto Y, and Inui K (2000) Role of apoptosis in cisplatin-induced toxicity in the renal epithelial cell line LLC-PK1. Biochem Pharmacol 59, 195201.

Montine TJ, Borch RF (1988) Quiescent LLC-PK1 cells as a model for cis-diamminedichloroplatinum (II) nephrotoxicity and modulation by thiol rescue agents. Cancer Res 48, 6017-6024.

Oltvai Z, and Korsmeyer S (1994) Checkpoints of dueling dimers foil death wishes. Cell 79, 189 â&#x20AC;&#x201C;192.

Muller M, Wilder S, Bannasch D, Israeli D, Lehlbach K, LiWeber M, Friedman SL, Galle PR, Stremmel W, Oren M, and Krammer PH (1998) P53 activates the CD95 (APO1/Fas) gene in response to DNA damage by anticancer drugs. J Exp Med 188, 2033-2045.

Osman AM, El Sayed EM, El Demerdash E, Al Hyder A, El Didi M, Attia AS, Hamada FM (2000) Prevention of cisplatininduced nephrotoxicity by methimazole. Pharmacol Res 41, 115-121. Park MS, De Leon M, and Devarajan P (2002) Cisplatin induces apoptosis in LLC-PK1 cells via activation of mitochondrial pathways. J Am Soc Nephrol 13, 858-865.

Murphy D, McGown AT, Hall A, Cattan A, Crowther D, Fox BW (1992) Glutathione S-transferase activity and isoenzyme distribution in ovarian tumour biopsies taken before or after cytotoxic chemotherapy. Br J Cancer 66, 937-942.

Perez RP (1998) Cellular and molecular determinants of cisplatin resistance. Eur J Cancer 34, 1535-1542.

Nakagawa K, Saijo N, Tsuchida S, Sakai M, Tsunokawa Y, Yokota J, Muramatsu M, Sato K, Terada M, Tew KD (1990) Glutathione-S-transferase pi as a determinant of drug resistance in transfectant cell lines. J Biol Chem 265, 42964301.

Puchalski RB, Fahl WE (1990) Expression of recombinant glutathione S-transferase pi, Ya, or Yb1 confers resistance to alkylating agents. Proc Natl Acad Sci U S A 87, 2443-2447. Raff M (1992) Social controls on cell survival and cell death. Nature 356, 397-400.

Nakayama K, Miyazaki K, Kanzaki A, Fukumoto M, Takebayashi Y (2001) Expression and cisplatin sensitivity of copper-transporting P-type adenosine triphosphatase (ATP7B) in human solid carcinoma cell lines. Oncol Rep 8, 1285-1287.

Ramesh G, and Reeves WB (2002) TNF-! mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J Clin Invest 110, 835-842. Razzaque MS, Koji T, Kumatori A, and Taguchi T (1999) Cisplatin-induced apoptosis in human proximal tubular

Nash JA, King LJ, Lock EA, Green T (1984) The metabolism and disposition of hexachloro-1:3-butadiene in the rat and its

Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity epithelial cells is associated with the activation of the Fas/Fas ligand system. Histochem Cell Biol 111, 359-365.

Tedeschi M, De Cesare A, Oriana S, Perego P, Silva A, Venturino P, Zunino F (1991) The role of glutathione in combination with cisplatin in the treatment of ovarian cancer. Cancer Treat Rev 18,253-259.

Reed JC (1997) Cytochrome c: can't live with it - can't livewithout it. Cell 91, 559-562.

Thadani R, Pascual M, and Bonventre JV (1996) Acute renal failure. N Engl J Med 334, 1448-1460.

Richter C, Gogvadze V, Laffranchi R, Schlapbach R, Schweizer M, Suter M, Walter P, Yaffee M (1995) Oxidants in mitochondria: from physiology to disease. Biochim. Biophys. Acta 1271, 67-74.

Thornberry NA, and Lazebnik Y (1998) Caspases: enemies within. Science 281, 1312-1316.

Sadowitz PD, Hubbard BA, Dabrowiak JC, Goodisman J, Tacka KA, Aktas MK, Cunningham MJ, Dubowy RL, Souid AK (2002) Kinetics of cisplatin binding to cellular DNA and modulations by thiol- blocking agents and thiol drugs. Drug Metab Dispos. 30, 183-190.

Townsend AJ, Tu CP, Cowan KH (1992) Expression of human mu or alpha class glutathione S-transferases in stably transfected human MCF-7 breast cancer cells: effect on cellular sensitivity to cytotoxic agents. Mol Pharmacol 41, 230-236.

Sadzuka Y, Shoji T, Takino Y (1992) Effect of cisplatin on the activities of enzymes which protect against lipid peroxidation. Biochem Pharmacol 43, 1872-1875.

Townsend DM, Deng M, Zhang L, Lapus MG, Hanigan MH (2003) Metabolism of cisplatin to a nephrotoxin in proximal tubule cells. J Am Soc Nephrol 14, 1-10.

Sadzuka Y, Shimizu Y, Takino Y (1994) Role of glutathione Stransferase isoenzymes in cisplatin-induced nephrotoxicity in the rat. Toxicol Lett 70, 211-222.

Townsend DM, Hanigan MH (2002) Inhibition of gammaglutamyl transpeptidase or cysteine S-conjugate beta-lyase activity blocks the nephrotoxicity of cisplatin in mice. J Pharmacol Exp Ther 300, 142-148.

Sadzuka Y, Shimizu Y, Takino Y, Hirota S (1994) Protection against cisplatin-induced nephrotoxicity in the rat by inducers and an inhibitor of glutathione S-transferase. Biochem Pharmacol 48, 453-459.

Townsend DM, Marto JA, Deng M, Macdonald TJ, Hanigan MH (2003) HPLC and mass spectrometry characterization of the nephrotoxic biotransformation products of cisplatin. Drug Metab Dispos, in press.

Saikumar P, Dong Z, Weinberg JM, Venkatachalam MA (1998) Mechanisms of cell death in hypoxia/reoxygenation injury. Oncogene 17, 3341-3349.

Tsuruya K, Ninomiya T, Tokumoto M, Hirakawa M, Masutani K, Taniguchi M, Fukuda K, Kanai H, Kishihara K, Hirakata H, and Iida M (2003) Direct involvement of the receptormediated apoptotic pathways in cisplatin-induced renal tubular cell death. Kidney Int 63, 72-82.

Sano K, Fujigaki Y, Miyaji T, Ikegaya N, Ohishi K, Yonemura H, and Hishida A (2000) Role of apoptosis in uranyl acetateinduced acute renal failure and acquired resistance to uranyl acetate. Kidney Int 57, 1560-1570.

Ueda K, Suzuki H, Akiyama S, Sugiyama Y (1999) Differences in substrate specificity among glutathione conjugates (GS-X) pump family members: comparison between multidrug resistance- associated protein and a novel transporter expressed on a cisplatin- resistant cell line (KCP-4). Jpn J Cancer Res 90, 439-447.

Shiraishi F, Curtis LM, Truong L, Poss K, Visner GA, Madsen K, Nick HS, and Agarwal A (2000) Heme oxygenase-1 gene ablation or expression modulates cisplatin-induced renal tubular apoptosis. Am J Physiol (Renal Physiol) 278, F726F736.

Ueda N, Kaushal GP, and Shah SV (2000) Apoptotic mechanisms in acute renal failure. Am J Med 108, 403-415.

Siddik ZH, Newell DR, Boxall FE, Harrap KR (1987) The comparative pharmacokinetics of carboplatin and cisplatin in mice and rats. Biochem Pharmacol 36, 1925-1932.

Uozumi J, Ishizawa M, Iwamoto Y, Baba T (1984) Sodium thiosulfate inhibits cis-diamminedichloroplatinum (II) activity. Cancer Chemother Pharmacol 13, 82-85.

Singh G (1989) A possible cellular mechanism of cisplatininduced nephrotoxicity. Toxicology 58, 71-80.

Van Der Water B, Tijdens IB, Verbrugge A, Huigsloot M, Dihal AA, Stevens JL, Jaken S, and Mulder GJ (2000) Cleavage of the actin-capping protein !-adducin at Asp-Asp-Ser-Asp633Ala by caspase-3 is preceded by its phosphorylation on serine 726 in cisplatin-induced apoptosis of renal epithelial cells. J Biol Chem 275, 25805-25813.

Smyth JF, Bowman A, Perren T, Wilkinson P, Prescott RJ, Quinn KJ, Tedeschi M (1997) Glutathione reduces the toxicity and improves quality of life of women diagnosed with ovarian cancer treated with cisplatin: results of a double-blind, randomised trial. Ann Oncol 8, 569-573. Takeda M, Kobayashi M, Shirato I, Osaki T, and Endou H (1997) Cisplatin-induced apoptosis of immortalized mouse proximal tubule cells is mediated by interleukin-1# converting enzyme (ICE) family of proteases but inhibited by overexpression of Bcl-2. Arch Toxicol 71, 612-621.

Van der Water B, Houtepen F, Huigsloot M, Tijdens IB (2001) Suppression of chemically induced apoptosis but not necrosis of renal proximal tubular epithelial (LLC-PK1) cells by focal adhesion kinase (FAK). Role of FAK in maintaining focal adhesion organization after acute renal cell injury. J Biol Chem 276, 36183-36193.

Takeda M, Kobayashi M, Shirato I, and Endou H (1998) Involvement of macromolecule synthesis, endonuclease activation and c-fos expression in cisplatin-induced apoptosis of mouse proximal tubule cells. Toxicol Lett 94, 83-92.

Van der Zee AG, van Ommen B, Meijer C, Hollema H, Van Bladeren PJ, de Vries EG (1992) Glutathione S-transferase activity and isoenzyme composition in benign ovarian tumours, untreated malignant ovarian tumours, and

Cancer Therapy Vol 1, page 61 malignant ovarian tumours after platinum/cyclophosphamide chemotherapy. Br J Cancer 66, 930-936. Viale M, Vannozzi MO, Pastrone I, Mariggio MA, Zicca A, Cadoni A, Cafaggi S, Tolino G, Lunardi G, Civalleri D, Lindup WE, Esposito M (2000) Reduction of cisplatin nephrotoxicity by procainamide: does the formation of a cisplatin-procainamide complex play a role? J Pharmacol Exp Ther 293, 829-836. Wolf CR, Berry PN, Nash JA, Green T, Lock EA (1984) Role of microsomal and cytosolic glutathione S-transferases in the conjugation of hexachloro-1:3-butadiene and its possible relevance to toxicity. J Pharmacol Exp Ther 228, 202-208. Wright SH, Wunz TM, North J, Stevens JL (1998) Na-dependent transport of S-(1,2-dichlorovinyl)-L-cysteine by renal brushborder membrane vesicles. J Pharmacol Exp Ther 285, 162-169. Yee S, Fazekas-May M, Walker EM, Montague D, Stern S, Heard KW (1994) Inhibition of cisplatin toxicity without decreasing antitumor efficacy. Use of a dithiocarbamate. Arch Otolaryngol Head Neck Surg 120, 1248-1252. Zamble BD, and Lippard SJ (1995) Cisplatin and DNA repair in cancer chemotherapy. Trends Biol Sci 20, 435-439. Zhan Y, van de Water B, Wang Y, and Stevens JL (1999) The roles of caspase-3 and bcl-2 in chemically-induced apoptosis but not necrosis of renal epithelial cells. Oncogene 18, 65056512. Zhou H, Miyaji T, Kato A, Fujigaki Y, Sano K, and Hishida A (1999) Attenuation of cisplatin-induced acute renal failure is associated with less apoptotic cell death. J Lab Clin Med 134, 649-658

Dr. Prasad Devarajan

Dr. Marie H. Hanigan

Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity

Cancer Therapy Vol 1, page 63 Cancer Therapy Vol 1, 63-70, 2003.

Massimo Federico1*, Vincenzo Callea2, Romano Danesi3, Antonella Montanini1, Nicola Di Renzo4, Mario Petrini3, Mario Del Tacca3, Maria Angela Sirotti1, Giovanni Santacroce1, Alberto Bagnulo1, Matteo Dell’Olio5 and Maura Brugiatelli6 for GISL 1

Dipartimento di Oncologia ed Ematologia, Università di Modena e Reggio Emilia; 2Divisione di Ematologia, Presidio Ospedali Riuniti “Bianchi, Melacrino, Morelli”, Reggio Calabria; 3Divisione di Farmacologia e Chemioterapia, Dipartimento di Oncologia, Trapianti e Tecnologie Avanzate in Medicina, Università di Pisa; 4Unità Operativa di Ematologia ed Oncologia Medica, C.R.O.B., Ospedale Oncologico Regionale, Rionero in Vulture (PZ); 5Divisione di Ematologia, Centro Trapianti di Midollo Osseo, IRCCS “Casa Sollievo della Sofferenza”, S. Giovanni Rotondo (FG); 6 Divisione di Ematologia, Azienda Ospedaliera Papardo, Messina.

__________________________________________________________________________________ *Correspondence to: Massimo Federico, Dipartimento di Oncologia ed Ematologia, Centro Oncologico Modenese, Università di Modena e Reggio Emilia, Policlinico - Via del Pozzo 71, 41100 Modena, Italy. Phone +39-059-4224547; Fax +39-059-4224549; e-mail: federico@unimore.it Key words: chemotherapy, indolent NHL, MiPPeB, non-Hodgkin's lymphoma, Pentostatin Received: 25 March 2003; Accepted: 10 April 2003; electronically published: April 2003 Contributed by Massimo Federico

Summary Background. Taking into account the promising results achieved with purine analogs in combination regimens in patients with indolent NHL, we designed a phase II study aimed at assessing the efficacy of Pentostatin in combination with Mitoxantrone, Prednisone and Bleomycin (MiPPeB). Patients and Methods. Thirty patients (18 males and 12 females) with relapsed or unresponsive indolent NHL were treated with MiPPeB. The treatment consisted of Pentostatin 5 mg/m2, on day 1 and 8, Mitoxantrone 10 mg/m2, on day 1, Bleomycin 8 mg/m2, on day 8, Prednisone 100 mg, on day 1 and 8; cycles were administered at 3 week intervals for a maximum of 6 cycles. In 5 patients we investigated the pharmacokinetics of Pentostatin and 2’-deoxyadenosine. Results. A median of 5 cycles (range 2-6) was administered. Ten Complete Remissions (CRs) and 8 Partial Remissions (PRs) were observed, with an overall (CR+PR) response rate of 60%. The median response duration was 38 months (95% CI: 28 to 48 months). The actuarial 3-year relapse free survival for 10 patients in CR was 57%. The 3-year overall and failure free survival rates were 71% and 23%, respectively. Toxicity was mainly hematological with grade 3-4 neutropenia in 37% and grade 3 thrombocytopenia in 7% of the cases. Conclusion. MiPPeB, as used in the present study, showed a promising activity with acceptable toxicity in patients with relapsed or unresponsive indolent NHL and resulted in durable remission. Harris et al, 2000), include different disease entities characterized by a similar clinical course, with a relatively long median survival and, usually, good response to initial therapy. A typical feature in the clinical course of patients

I. Introduction Low-grade non-Hodgkin's lymphomas (NHL) or, as they are now defined, indolent NHL (Harris et al, 1994;

Federico: Pentostatin combination chemotherapy in Non-Hodgkinâ&#x20AC;&#x2122;s Lympoma with indolent NHL is their tendency to relapse, with subsequent responses of progressively shorter duration (Horning, 1993). New therapeutic approaches for indolent NHL currently under investigation include (a) attempts to eradicate the disease using high-dose chemotherapy with stem cell rescue (Schouten et al, 1994; Ladetto et al, 2002) and (b) new combinations of drugs of known specific efficacy in these diseases. Fludarabine (2-fluoro-ara-AMP), 2-CdA (2chlorodeoxyadenosine) and Pentostatin (2deoxycoformicin) are new structurally similar purine nucleoside analogs (Figure 1) recently considered with increasing interest for the treatment of different lymphoproliferative disorders, including hairy cell leukemia (Chassileth et al, 1991; Ganeshaguru et al, 1991), chronic lymphocytic leukemia (Bergmann et al, 1993; Keating et al, 1998;), cutaneous T-cell lymphomas (Grever et al, 1983; Foss et al, 1994), and indolent NHL (Hoffman et al, 1994). The sensitivity of indolent NHL to purine analogs is now largely demonstrated, although the majority of studies deal with Fludarabine (Hochster et al, 1992; Redman et al, 1992) and 2-chlorodeoxyadenosine (Brugiatelli et al, 1996; Robak et al, 2001). So far, Pentostatin has been less commonly employed for the treatment of NHL (Cummings et al, 1991; Iannitto et al, 2002), although its efficacy has been well documented in other indolent lymphoproliferative disorders such as hairy cell leukemia (Grever et al, 1995), prolymphocytic leukemia (Dohner et al, 1993), Sezary Syndrome and Mycosis Fungoides (Mercieca et al, 1994). More recently a higher activity of purine analogs has been demonstrated in combination regimens (McLaughlin et al, 1994; Tobinai et al, 1995; McLaughlin et al, 1996; Flinn et al, 2000).

Considering that in patients with indolent NHL the highest therapeutic activity of purine analogs was obtained in combination regimens and, in particular, the promising results of the combination with Mitoxantrone and steroids, we designed a phase II pilot study aimed at assessing the efficacy of Pentostatin in combination with Mitoxantrone, Prednisone and Bleomycin (MiPPeB) in patients with relapsed or unresponsive indolent NHL. Bleomycin was added to the schedule in order to increase the absolute dose intensity of the regimen since this drug is characterized by very limited myelotoxicity that favors its use in combination regimens. Moreover, considering that (a) the pharmacokinetic of Pentostatin is not well described in the literature, (b) limited data are available concerning the pharmacodynamic effect of the drug, and (c) information on drug distribution would be helpful in optimizing its use in combination regimens, in 5 patients we also investigated the pharmacokinetics and pharmacodynamic effect of Pentostatin.

II. Patients and methods Between November 1997 and July 2000, 30 patients with indolent NHL, were registered for the study and scheduled to receive 6 courses of a combination of Mitoxantrone, Prednisone, Pentostatin and Bleomycin (MiPPeB). The characteristics of these patients are summarized in Table 1. Patients were eligible for the study if they presented with a diagnosis of indolent NHL (categories A-D of the Working Formulation, or lymphocytic or follicular lymphoma of the R.E.A.L. classification), had relapsed or were unresponsive to previous therapy and presented with active disease. According to the Gruppo Italiano per lo Studio dei Linfomi (GISL) criteria (Morabito et al, 2002), active phase of the disease was defined as the presence of at least one of the following signs or symptoms: presence of systemic symptoms; bulky disease (>5 cm); anemia (Hb <10 g/L) or thrombocytopenia (Plt <100.000/L); diffuse bone marrow pattern of infiltration; lymphocyte doubling time (LDT) <12 months or a doubling of the maximum diameter of at least 3 measurable sites in less than 12 months. Patients unresponsive to previous therapy could be included only in case of no treatment requirement for the last 6 months. Additional inclusion criteria were: age 18-75 years; stage II-IV; no more than 3 previous lines of chemotherapy; life expectancy >6 months; absence of history of repeated and/or severe infectious complications; absence of cardiac, renal, hepatic and respiratory failure; ECOG performance status 0-2; HBsAg negativity, HCV-RNA negative in HCV-Ab positive cases. Exclusion criteria included: severe or symptomatic restrictive or obstructive lung disease; ejection fraction less than 50%, signs or symptoms of congestive heart failure, or myocardial infarction within the past 3 months, angina pectoris, any major ventricular arrythmia, or uncontrolled blood pressure; active infections; concurrent or previous malignancy, other than non melanomatous skin cancer, surgically cured carcinoma in situ of the cervix, or a history of cancer that had not been active in the past 5 years; patients who were HIV positive or who had AIDS or ARC. The present protocol was approved by the ethical committees according to the local rules and the period. It was the responsibility of the investigator to ensure that each patient gave her/his consent in writing, prior to partecipating in this study. All completed informed consent forms were retained by the investigator.

Figure 1: The structures of deoxyadenosine (A), and the purine analogs fludarabine (B), 2-chlorodeoxyadenosine (C), and 2'deoxycoformycin (D).

Cancer Therapy Vol 1, page 65 Table 1. Patient characteristics.

Characteristics

B. Response assessment

No.

18 12

60 40

18 12

60 40

21 8 1

70 27 3

Response to treatment was assessed within four weeks after the end of the last chemotherapy. At this time, a CT-scan of the chest and abdomen/pelvis was performed together with any other instrumental investigation found to be abnormal at any previous evaluation. Complete remission (CR) was defined as the disappearance of all clinical evidence of disease and the normalization of all laboratory values and radiographs abnormal before starting treatment. Patients who achieved CR during therapy, but relapsed within 30 days after therapy had been completed, were classified as non responders. Partial remission (PR) was defined as a greater than 50% reduction in the largest dimension of each anatomic site of measurable disease for at least one month. No remission (NR) was defined as a less than 50% regression or stable or progressive disease. All early deaths due to disease progression or treatment-related toxicity were considered as treatment failure, and included in the group of NR.

15 12 3

50 40 10

Patients were considered evaluable for response assessment after at least 3 courses, unless treatment was discontinued because of disease progression or early death. Toxicity was assessed according to the WHO criteria.

22 8

73 27

27 3

90 10

26 4

33 13

10 16 4

33 54 13

17 7 6

57 23 20

9 10 11

31 33 36

Sex Male Female Age !60 years >60 years WHO performance status 0 1 2 IPI 0-1 2 Not assessable Systemic symptoms Absent Present Bulky disease No Yes Leukemic Phase No Yes Beta2-microglobulin levels High Normal Not assessed Doubling time >12 months <12 months Not assessable Previous therapy 1 2 3

Pentostatin 5 mg/m2 Prednisone 100 mg Mitoxantrone 10 mg/m2 Bleomycin 8 mg/m2

time

hours

Day 1

Day 8

21 days

Figure 2. Treatment plan.

A. Treatment plan

Table 2. Dose modifications.

Patients received a maximum of 6 courses of the MiPPeB regimen, given every 3 weeks, in an outpatient setting according to the following schedule: Pentostatin 5 mg/m2, on days 1 and 8, at hour 0, administered as an IV infusion in 100 ml of normal saline, over 30 minutes; Prednisone 100 mg, on days 1 and 8, at hour 0, administered as an IV infusion in 50 ml of normal saline, over 15 minutes; Mitoxantrone 10 mg/m2, on day 1, at hour 6, administered as an IV infusion in 100 ml of normal saline, over 30 minutes; Bleomycin 8 mg/m2, on day 8, at hour 4, administered as an IV infusion in 100 ml of normal saline, over 15 minutes (Figure 2). The MiPPeB courses were given at 21-day intervals, provided that at the time of recycling WBC count was >4.0 x 109/L, and platelet count >100 x 109/L. If the above-mentioned criteria were not satisfied on the day of recycling, the administration of a subsequent MiPPeB course was performed according to the dose modifications rules reported in Table 2.

WBC

PLT

DOSES

DRUGS

>4.0 3.9 - 3.0

>100 99 - 75

100% 100% 50%

<3.0

<75

100% 0%

All Bleomycin Mitoxantrone Pentostatin Bleomycin Mitoxantrone Pentostatin

Federico: Pentostatin combination chemotherapy in Non-Hodgkin’s Lympoma It was the responsibility of the clinical investigators to ensure that all clinical record forms designed for the study were completed satisfactorily and returned to the trial office. The clinical investigator was required to sign each completed record form to signify that it represented an accurate record of the patient.

of two extranodal sites. In addition, 20% presented with systemic symptoms and 23% had LDH over the normal range. Six patients were refractory to previous therapy, 12 had a duration of CR lasting less than 12 months and 12 relapsed after more than one year of CR. At study entry 9 patients had relapsed after first line therapy, and 21 had received two or more chemotherapy regimens before MiPPeB. Seven patients had already received a purine analog (Fludarabine), in 6 cases combined with an anthracycline which in 4 of those cases, consisted of Mitoxantrone. Finally, one patient was in relapse after high dose therapy with stem cell rescue. Median time between initial diagnosis and inclusion in the present study was 46 months (range 10-110 months). The disease history lasted less than one year, 1-3 years, and more than 3 years in 6, 12 and 12 patients respectively. The mean interval between last therapy and study entry was 18 months (range 4-46 months); this interval was less than one year in 12 patients (40%), and more than one year in the remaining 18 cases. A total of 152 courses were administered to the 30 patients. The median number of cycles was 5 (range 2 to 6) and the median interval between cycles was 26 days (range 19 to 70). Twentyeight patients completed at least 3 courses and 18 received all the 6 planned courses. Reasons for early withdrawal and status at that time are summarized in Figure 3. The main reason for interrupting planned therapy was progressive disease (6 patients) or unsatisfactory response (3 patients). However, four patients stopped therapy while in CR after 3, 4, 5, 5 courses, respectively, because of poor patient compliance.

C. Statistical analysis This was a prospective, open label, multicenter, phase II pilot study to assess the feasibility, safety, tolerability and efficacy of a Pentostatin-based regimen in patients with relapsed indolent NHL. The sample size was small and no statistical hypothesis testing was planned. The trial size was based on feasibility and was chosen for practical rather than statistical considerations in order to obtain information for planning a possible phase III study. Main endpoints were: complete remission, duration of remission, disease free survival. Secondary endpoint was overall survival. All data were analyzed with the Statistical Package for the Social Sciences (SPSS), release 9.0.1. Differences in CR rates between the groups were analyzed by the Pearson’s C2 test for contingency tables. Overall survival (OS), disease free survival (DFS) and relapse free survival (RFS) curves were estimated by the method of Kaplan-Meier. Overall survival was calculated from the beginning of treatment until death from any cause. DFS and RFS were calculated from the end of induction therapy to the first evidence of disease. Response rates, survival, relapse and toxicity were analyzed on all patients. A p value of 0.05 (two-sided) was considered the limit of significance for all the analyses.

D. Pharmacokinetic/pharmacodynamic study of Pentostatin In addition to the clinical trial, 5 of the 30 patients were enrolled in a pharmacokinetic/pharmacodynamic study of Pentostatin.

A. Response With MiPPeB, 10 patients (33%) (95% CI: 16% to 50%) achieved a CR and an additional 8 patients (27%) (95% CI: 11% to 43%) a PR, with an overall response rate of 60% (95% CI: 43% to 76%). In addition, 7 (23%) (95% CI: 8% to 39%) cases showed a durable stable phase of the disease after treatment. The objective response rate was similar for patients with early or late relapse (p=0.247), and for those with one or more previous therapies (p=0.602). After a median follow-up of 30 months (39 months for patients still alive) 6 patients out of 10 in CR relapsed. The 3-year RFS is 57% (95% CI: 27 to 52) (Figure 4). The median duration of remission for 18 responding patients was 38 months (range 2 - 57), better than the median duration of the last response (21 months, range 6-36 months). Nine patients died, all of them because of disease progression. The 3-year survival rate for the 30 enrolled patients is 71% (Figure 5). Among baseline patients’ characteristics of potential prognostic value only a short doubling time was associated with a significantly lower chance of achieving a response to MiPPeB therapy (P=0.047). Moreover, performance status (P=0.0192), number of previous therapies (0.0001), and beta2-microglobulin (0.0174), resulted of prognostic relevance in univariate analysis of survival. Given the limited number of cases a multivariate analysis was not performed.

Heparinized plasma samples were obtained at baseline (before the administration of Pentostatin) and at 5, 15, 30, 60 min, 2, 3, 6, 12, 18, 24, 48, and 72 hours after drug dose in five patients, three on day 1 and two on day 8 of treatment. Plasma concentrations of Pentostatin (Danesi et al, 2002) and 2’deoxyadenosine (Koller et al, 1980) were assessed by specific high-performance liquid chromatography (HPLC) methods with ultraviolet detection. Intra- and inter-assay precision (coefficients of variation) were <10.1% for Pentostatin and <9.4% for 2’deoxyadenosine. Individual plasma concentration vs. time data were fitted using non-linear least-squares regression analysis by means of computer software (MWPHARM, MediWare, Groeningen, the Netherlands) and peak plasma concentration, terminal half life, total body clearance and apparent volume of distribution at steady state were calculated by conventional methods (Rowland and Tozer, 1995).

III. Results Between November 1997 and July 2000, 30 patients were registered for the study and all were assessable for response and toxicity. The median age was 57 years (range 36 - 72), with 18 patients younger than 60 years. Among the remaining clinical features at presentation, it should be noted that 76% had advanced (stage III or IV) disease, 13 (43%) had non follicular histology, and 5 (17%) had the involvement 66

Cancer Therapy Vol 1, page 67

Figure 5. Kaplan Meier Overall survival.

B. Toxicity Toxicity was rather mild, especially considering that the majority of cases were heavily pretreated. No significant organ toxicity was reported. As expected in a pretreated patient setting, toxicity was mainly hematological consisting of frequent although not severe leucopenia and in few instances thrombocytopenia. Leucopenia was not associated with severe infection occurrence.

C. Pentostatin pharmacokinetic /pharmacodynamic study Mean peak plasma concentrations of Pentostatin and 2’-deoxyadenosine were 7±2.6 µM and 68±23 µM, respectively, while mean baseline 2’-deoxyadenosine levels were 4.1±1.9 µM. Plasma concentration-time curves showed a first-order elimination with biphasic decay, with a terminal half life of Pentostatin of 8.7±3.1 hours. Average total body clearance (CLTB) of Pentostatin was 103.45±22.4 mL/min and apparent volume of distribution at steady state (Vdss) was 42.4±7.

Figure 3. Flow-chart of the study.

V. Discussion One of the main features of the clinical course of indolent lymphomas is represented by its continuous pattern of relapse with subsequent responses of shorter and shorter duration after conventional chemotherapy (Horning SJ, 1993). So far, this clinical behavior has not been changed by the introduction of purine analogs and immunotherapy with monoclonal antibodies. Some more durable responses have been reported after high dose chemotherapy with stem cell rescue (Schouten et al, 1994; Ladetto et al, 2002) although this treatment approach cannot be used in the vast majority of cases. Therefore, keeping in mind this unavoidable tendency to relapse, it would be advisable to design a long-term treatment program for each patient by choosing among the different treatments now available for this histological category.

Figure 4. Kaplan Meier Relapse-free survival.

Federico: Pentostatin combination chemotherapy in Non-Hodgkinâ&#x20AC;&#x2122;s Lympoma Therefore, the present study introduces the combination of Pentostatin with Mitoxantrone and Bleomycin among the effective therapeutic options suitable for patients with advanced indolent lymphomas. Previously, the activity of purine analogs as single agents has been clearly demonstrated. In patients with relapsed or recurrent indolent NHL the response rate to Fludarabine ranges between 43% and 70% (Hochster et al, 1992; Hoffman et al, 1994). Similar results have been reported for 2-CdA. In a group of 14 patients unresponsive to previous treatments, 3 CR and 4 PR have been reported by Brugiatelli et al. (1996) in a multicentric study. In a preliminary study of 26 patients with untreated indolent NHL Emanuele et al (1994) reported 35% and 54% CR and PR respectively. As far as Pentostatin is concerned an overall response rate of 29% and 33% has been reported in patients with relapsed or refractory indolent NHL by Cummings et al (1991), and Duggan et al (1990), respectively. These two studies using Pentostatin as salvage treatment demonstrate the possibility of obtaining clinical responses, up to more than 50 months in patients with NHL. The higher efficacy of Fludarabine in combination with Mitoxantrone as compared with its use as single agent has been repeatedly reported with response rates up to 90%, when used as first line and salvage treatment respectively (McLaughlin et al, 1994; Seymour et al, 2001). Using Fludarabine, Mitoxantrone and Dexamethasone (FND), McLaughlin et al (1996) achieved an overall response rate of 94% (47% CR and 47% PR) in a group of 51 patients with recurrent or refractory indolent NHL. Although all purine analogs could exert similar effectiveness, so far, the clinical experience with 2-CDA and Pentostatin for the treatment of lymphomas (Cummings et al, 1991; Brugiatelli et al, 1996; Iannitto et al, 2002) is much more limited as compared to Fludarabine. At the moment their use is almost completely confined to the treatment of hairy cell leukemia (Grever et al, 1995) and in the case of Pentostatin of T-cell neoplastic diseases as a single agent (Mercieca et al, 1994). More recently, the combination of Pentostatin with Cyclophosphamide or Chlorambucil has been reported with promising results (Goodman, 2000; Waselenko et al, 2000; Weiss, 2000). Based on the known efficacy of the combination of Fludarabine and Mitoxantrone and on in vitro data of synergism of the latter one with Pentostatin (Morabito et al, 1997), we designed the present MiPPeB schedule in order to take advantage of the synergistic effect of the two drugs, possibly potentiated by the addition of a third nonmyelotoxic drug, namely Bleomycin. In addition, we tried to maximize the synergistic effect of the combination by using a time-dependent scheme of administration which could respect the biological properties of the different drugs, similar to the schedules employed for the treatment of acute leukemias.

The results of the present study performed on heavily pretreated patients show that MiPPeB combination chemotherapy induced an overall response rate of 60% with 33% CR, thus at least comparable to the results obtained with the combination of Fludarabine and Cyclophosphamide (Flinn et al, 2000) or Fludarabine and Mitoxantrone (McLaughlin et al, 1994; McLaughlin et al, 1996; Seymour et al, 2001). The efficacy of this combination is confirmed by the duration of response which is similar that obtained in our patients by the previous treatment. It is noteworthy that out of 7 cases already treated with Fludarabine mostly in combination with Mitoxantrone 2 CR were obtained and 2 cases reached a stable disease status, thus suggesting the possibility of effectively using both purine analogs during the course of the disease. Moreover, the toxicity profile of the MiPPeB schedule deserves a comment. The main side effect was myelotoxocity, but, despite frequent episode of neutropenia, purine analog-induced immunedepression and heavy pretreatment, often including another purine analog, infectious complications were not frequent and never severe. Only one death due to infection occurred in a patient with disease progression. Finally, the pharmacokinetic and pharmacodynamic studies demonstrated that at the present dosing schedule, Pentostatin reaches effective ADA inhibitory levels in plasma, as shown by the increase in 2â&#x20AC;&#x2122;-deoxyadenosine concentrations over baseline levels; in addition to this, the Vdss value lower than total body water indicates that extensive tissue binding does not occur, while the extent of drug clearance suggests that the kidney is the main route of drug excretion from the body, as confirmed by a recent study in patients with mild renal impairment (Lathia et al, 2002). In conclusion, the results of the present study demonstrate the efficacy with acceptable toxicity of Pentostatin included in combination chemotherapy for the salvage treatment of indolent lymphomas not suitable for high dose chemotherapy approaches. Accordingly, MiPPeB or MiPPeB-like schedules deserve inclusion among the conventional chemotherapy options for this category of lymphoproliferative disorders and should be tested also in a front-line setting.

Acknowledgments The study was supported by Associazione Angela Serra per la Ricerca sul Cancro, Modena, and Fondazione Ferrata-Storti, Pavia, Italy.

Participating institutions Gruppo Italiano per lo Studio dei Linfomi (GISL) Chairpersons: M. Federico, P. G. Gobbi, L. Baldini. List of Institutions contributing to the present study: Dipartimento di Ematologia e Trasfusionale (F. Nobile), Presidio Ospedali Riuniti "Bianchi, Melacrino, Morelli", Reggio Calabria; Cattedra e Servizio di Ematologia (A. T. Maiolo, L. Baldini), IRCCS Ospedale

Cancer Therapy Vol 1, page 69 Cyclophosphamide for the treatment of refractory autoimmune disorders. Semin Oncol 27 (2 suppl 5), 67-71. Grever M, Kopecky K, Foucar MK, Head D, Bennett JM, Hutchison RE, Corbett WE, Cassileth PA, Habermann T and Golomb H (1995) Randomized comparison of Pentostatin versus interferon alfa-2a in previously untreated patients with Hairy Cell Leukemia, an intergroup study. J Clin Oncol 13 , 974-982. Grever MR, Bisaccia E, Scarborough DA, Metz EN and Neidhart JA (1983) An investigation of 2'- deoxycoformicin in the treatment of cutaneous T-cell lymphoma. Blood 61, 279-282. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J (2000) Lymphoma classification - from controversy to consensus, the R.E.A.L. and WHO classification of lymphoid neoplasm. Ann Oncol 11, 3-10. Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, Delsol G, De Wolf- Peeters C, Falini B, and Gatter KC (1994) A revised European-American classification of lymphoid neoplasms, a proposal from the International Lymphoma Study Group. Blood 84, 1361-1392. Hochster HS, Kim KM, Green MD, Mann RB, Neiman RS, Oken MM, Cassileth PA, Stott P, Ritch P and O'Connell MJ (1992) Activity of Fludarabine in previously treated nonHodgkin's lymphoma, results of an Eastern Cooperative Group Study. J Clin Oncol 10, 28-32. Hoffman M, Tallman MS, Hakimian D, Janson D, Hogan D, Variakogis D, Kuzel T, Gordon LI and Rai K (1994) 2Chlorodeoxyadenosine is an active salvage therapy in advanced indolent non-Hodgkin's lymphoma. J Clin Oncol 12, 788-792. Horning SJ (1993) Natural history of and therapy for the indolent non-Hodgkin's lymphomas. Semin Oncol 20, 75-88. Iannitto E, Barbera V, Quintini G, Cirrincione S and Leone M (2002) Hepatosplenic "# T-cell lymphoma, complete response induced by treatment with Pentostatin. Brit J Haematol 117, 995-99. Keating MJ, O’Brien S, Lerner S, Koller C, Beran M, Robertson LE, Freireich EJ, Estey E and Kantarjian H (1998) Longterm follow-up of patients with CLL receiving Fludarabine regimens as initial therapy. Blood 92, 1165-1171. Koller CA, Stetson PL, Nichamin LD, Mitchell BS (1980) An assay of deoxyadenosine and adenosine in human plasma by HPLC. Biochem Med 24, 179-184. Ladetto M, Corradini P, Vallet S, Benedetti F, Vitolo M, Martelli M, Brugiatelli M, Coser P, Perrotti A, Majolino I, Fioritoni G, Morandi S, Musso M, Zambello R, Chisesi T, Di Renzo N, Vivaldi P, De Crescenzo A, Gallamini A, Salvi F, Santini G, Boccomini C, Sorio M, Astolfi M, Drandi D, Pileri A and Tarella C (2002) High rate of clinical and molecular remission in follicular lymphoma patients receiving highdose sequential chemotherapy and autografting at diagnosis, a multicenter, prospective study by the Group Italiano Trapianto Midollo Osseo (GITMO). Blood 100, 1559-1565. Lathia C, Fleming GF, Meyer M, Ratain MJ, Whitfield L (2002) Pentostatin pharmacokinetics and dosing recommendations in patients with mild renal impairment. Cancer Chemoth Pharm 50, 121-126. McLaughlin P, Hagemeister FB, Romaguera JE, Sarris AH, Pate O, Younes A, Swan F, Keating M and Cabanillas F (1996) Fludarabine, Mitoxantrone and Dexametasone, an effective new regimen for indolent lymphoma. J Clin Oncol 14, 12621268. McLaughlin P, Hagemeister FB, Swan F, Jr, Cabanillas F, Pate O, Romaguera JE, Rodriguez MA, Redman JR and Keating M (1994) Phase I study of the combination of Fludarabine, Mitoxantrone and Dexametasone in low-grade lymphoma. J Clin Oncol 12, 575-579.

Maggiore, Milano; Dipartimento di Oncologia ed Ematologia (G. Torelli, M. Federico, S. Sacchi), Università di Modena e Reggio Emilia, Modena; Divisione di Medicina (G. Partesotti, G. Santacroce), Ospedale Civile, Sassuolo, Modena; Divisione di Medicina (A. Bagnulo, A. Zoboli), Ospedale S. Sebastiano, Correggio, Reggio Emilia; Divisione di Ematologia (A.M. Carella, N. Di Renzo, M. Dell’Olio), IRCCS "Casa Sollievo della Sofferenza", S. Giovanni Rotondo, Foggia; Dipartimento di Oncologia (M. Petrini, F. Caracciolo), Divisioni di Ematologia e Farmacologia, Università di Pisa; Unità Operativa di Oncologia Medica (V. Pitini), Policlinico Universitario, Messina.

References Bergmann L, Fenchel K, Jahn B, Mitrou PS and Hoelzer D (1993) Immunosuppressive effects and clinical response of Fludarabine in refractory chronic lymphocytic leukemia. Ann Oncol 4, 371-375. Brugiatelli M, Holowiecka B, Dmoszynska A, Krieger O, Planinc-Peraica A, Labar B, Callea V, Morabito F, Jaksic B, Holowiecki J, Lutz D (1996) 2-Chlorodeoxyadenosine treatment in non-Hodgkin's lymphoma and B-cell chronic lymphocytic leukemia resistant to conventional chemotherapy, results of a multicentric experience. Ann Hematol 73, 79-84. Cassileth PA Cheuvart B, Spiers AS, Harrington DP, Cummings FJ, Neiman RS, Bennett JM and O'Connell MJ (1991) Pentostatin induces durable remissions in hairy cell leukemia. J Clin Oncol 9, 243-246. Cummings FJ, Kim K, Neiman RS, Comis RL, Oken MM, Weitzman SA, Mann RB and O'Connell MJ (1991) Phase II trial of Pentostatin in refractory lymphomas and cutaneous Tcell disease. J Clin Oncol 9, 565-571. Danesi R, Petrini M, Loni L, Federico M, Riggi G, Del Tacca M (2002) Pharmacokinetics and pharmacodynamics of Pentostatin in non-Hodgkin lymphomas. Proceedings ASCO 21, 120a (abstract 479). Dohner H, Ho AD, Thaler J, Stryckmans P, Sonneveld P, De Witte T, Lechner K, Lauria F, Bodewadt-Radzun S and Suciu S (1993) Pentostatin in prolymphocytic leukemia, phase II trial of the European Organization for Research and Treatment of Cancer, Leukemia Cooperative Study Group. J Natl Cancer Inst 85, 658-662. Duggan DB, Anderson JR, Dillman R, Case D, Gottlieb AJ (1990) 2-deoxycoformycin (Pentostatin) for refractory nonHodgkin's lymphoma, a CALGB phase II study. Med Pediatr Oncol 18, 203-6. Emanuele S et al. (1994) 2-Chlorodeoxyadenosine (2-CDA) activity in patients with untreated low-grade lymphoma. Proceedings ASCO 13, 1002 (abstract). Flinn IW, Byrd JC, Morrison C, Jamison J, Diehl LF, Murphy T, Piantadosi S, Seifter E, Ambinder RF, Vogelsang G and Grever MR (2000) Fludarabine and Cyclophosphamide with Filgrastim support in patients with previously untreated indolent lymphoid malignancies. Blood 96, 71-75. Foss FM, Ihde DC, Linnoila IR, Fischmann AB, Schechter GP, Cotelingam JD, Steinberg SM, Ghosh BC, Stocker JL and Bastian A (1994) Phase II trial of Fludarabine phosphate and interferon alfa-2a in advanced mycosis fungoides and Sezary syndrome. J Clin Oncol 12, 2051-2059. Ganeshaguru K, de Mel WC, Sissolak G, Catovsky D, Dearden CE, Mehta AB, Hoffbrand AV (1991) Increase in 2',5'oligoadenylate synthetase caused by deoxycoformycin in hairy cell leukaemia Adv Exp Med Biol 309A, 65-8. Goodman M (2000) Pentostatin and high dose

Federico: Pentostatin combination chemotherapy in Non-Hodgkinâ&#x20AC;&#x2122;s Lympoma Mercieca J, Matutes E, Dearden C, MacLennan K and Catovsky D (1994) The role of Pentostatin in the treatment of T-cell malignancies, analysis of response rate in 145 patients according to disease subtype. J Clin Oncol 12, 2588-2593. Morabito F, Baldini L, Stelitano C, Luminari S, Frassoldati A, Merli F, Colombi M, Sabbatini R, Brugiatelli M, Federico M, for the Gruppo Italiano per lo Studio dei Linfomi (GISL) (2002) Prospective study of indolent non-follicular nonHodgkinâ&#x20AC;&#x2122;s lymphoma, validation of Gruppo Italiano per lo Studio dei Linfomi (GISL) prognostic criteria for watch and wait policy. Leuk Lymph 43, 1933-38. Morabito F, Callea I, Console G, Stelitano C, Sculli G, Filangeri M, Oliva B, Musolino C, Iacopino P, Brugiatelli M (1997) The in vitro cytotoxic effect of Mitoxantrone in combination with Fludarabine or Pentostatin in B-cell chronic lymphocytic leukemia. Haematologica 82, 560-65. Redman JR, Cabanillas F, Velasquez WS, McLaughlin P, Hagemeister FB, Swan F, Jr, Rodriguez MA, Plunkett WK, and Keating MJ (1992) Phase II trial of Fludarabine phosphate in lymphoma, an effective new agent in low-grade lymphoma. J Clin Oncol 10, 790-794. Robak T, Blonski JZ, Kasznicki M, G_ra-Tybor J, DwilewiczTrojaczek J, Boguradzki P, Konopka L, Ceglarek B, Sulek J, Kuliczkowski K, Wolowiec D, Stella-Holowiecka B, Skotnicki AB, Nowak W, Moskwa-Sroka B, Dmoszynska A and Calbecka M (2001) Cladribrine combined with Cyclophosphamide and Mitoxantrone as front-line therapy in chronic lymphocytic leukemia. Leukemia 15, 1510-16. Rowland M, Tozer TN (1995) Clinical pharmacokinetics, concepts and applications (3rd Edition). Baltimore, Williams & Wilkins. Schouten HC, Colombat P, Verdonck LF, Gorin NC, Bjorkstrand B, Taghipour G, Goldstone AH (1994) Autologous bone marrow transplantation for low-grade non-Hodgkin's Lymphoma, the European Bone Marrow Transplantation Group experience. Ann Oncol 5(suppl 2), S147-149. Seymour JF, Grigg AP, Szer J and Fox RM (2001) Fludarabine and Mitoxantrone, effective and well tolerated salvage therapy in relapsed indolent limphoproliferative disorders. Ann Oncol 12, 1455-1460. Tobinai K, Shimoyama M, Tajima K, Kozuru M, Tomonaga M, Araki K, Kasai M, Takatsuki K, Tara M, Hotta T et al (1995) Deoxycoformycin containing combination chemotherapy for adult T-cell leukemia-lymphoma (ATL), Japan Clinical Oncology Group (JCOG) Study 9109. Proceedings ASCO 14, A1217 (meeting abstract). Waselenko JK, Grever MR, Beer M, Lucas MA, Byrd JC (2000) Pentostatin (Nipent) and Chlorambucil with granulocytemacrophage colony-stimulating factor support for patients with previously untreated, treated and Fludarabine-refractory B-cell chronic lymphocytic leukemia. Semin Oncol 27 (2, suppl 5), 44-51. Weiss MA (2000) A phase I and II study of Pentostatin (Nipent) with Cyclophosphamide for previously treated patients with chronic lymphocytic leukemia. Semin Oncol 27 (2 suppl 5), 41-43.

Dr. Federico Massimo

Cancer Therapy Vol 1, page 71 Cancer Therapy Vol 1, 71-79, 2003.

Chemotherapy in elderly patients with advanced breast cancer Review Article

Giuseppe Colantuoni, Antonio Rossi, Carmine Ferrara, Dario Nicolella, Filomena Del Gaizo, Ciro Guerriero, Giuseppe Airoma, Maria Luisa Barzelloni, Paolo Maione, Vincenzo Salerno1, Cesare Gridelli* U.O. Oncologia Medica, Azienda Ospedaliera “S.G. Moscati”, Avellino, Italy 1 Facoltà di Medicina e Chirurgia, Università “Federico IIÆ”, Napoli, Italy

__________________________________________________________________________________ *Correspondence to: Cesare Gridelli, M.D.; U.O. Oncologia Medica; Azienda Ospedaliera “S.G. Moscati”; Via Circumvallazione, 68, 83100 Avellino; Tel +39 0825 203 573, Fax +39 0825 203 556, e-mail: cgridelli@libero.it Key words: breast cancer, single-agent chemotherapy, elderly patients, age cut-off, comorbidities and frailty, combination regimens,oral drugs, new biological agents Received: 11 April 2003; Accepted: 20 April 2003; electronically published: April 2003 Contributed by Cesare Gridelli

Summary Breast cancer arises in about 48% of patients older than 65 years and more than 30% occurs in those over 70 years. Chemotherapy is administered to elderly patients with advanced breast cancer resistant to hormonal treatment or with visceral metastases. Elderly patients tolerate chemotherapy poorly compared to their younger counterpart because of progressive reduction of organ function and comorbidities related to age. For this reason, the elderly have been excluded from or underrepresented in most cancer studies and in clinical practice, they often receive inadequate and untested treatments. One of the main field of clinical research is the role of new biological agents. In order to plan medical treatment in advanced breast cancer elderly patients, and to further individualise treatment choice, is mandatory to practice a comprehensive geriatric assessment that includes assessment of comorbidity, socio-economic conditions, functional dependence, emotional and cognitive conditions, an estimate of life expectancy and recognition of frailty. (The authors review the literature regarding age-specific issues in the management of advanced breast cancer elderly patients, and report their own experience in the field.) Program show an increase of patients diagnosed with breast cancer and having 65 years or older from 37% in 1973 to 46.7% in 1995 (Surveillance, Epidemiology and End Results (SEER) Program 1998). Breast cancer arises in about 48% of patients older than 65 years and more than 30% occurs in those over 70 years. Breast cancer mortality is declining by 8% in the US and 3% in Europe, although the decline is smaller in elderly patients than in younger ones, and thus leaving open questions on diagnosis and treatment approaches (Levi et al 2001). Chemotherapy is indicated in elderly patients with advanced breast cancer resistant to hormonal treatment or with visceral metastases. Anyway, physicians are less likely to offer chemotherapy to their older breast cancer patients presumably because of perceived poorer tolerance, greater risks associated with myelosuppression, and reduced efficacy compared with younger patients. When given the option, older women are less likely to

I. Introduction Ongoing epidemiologic research over the past several decades has consistently confirmed a continuing trend toward an aging population. The over-65 age group is growing faster than other age groups, and therefore accounts for an increasing percentage of the total population. The portion of the population older than 65 rose from approximately 8% in 1950 to 13% in 1990. By the year 2030, fully 20% of the population will be older than 65 (Yancik, and Lies 2000). Increasing age is a major risk factor for developing breast cancer, peaking at about age 75 and then declining slightly. The prevalence and incidence of breast cancer in older women may increase by 30% over the next decade if the expansion of the older population continues at the present rate (Klimmick and Balducci 2000). Breast cancer in the elderly has attracted considerable interest in the recent years. Data from the Surveillance, Epidemiology and End Results (SEER) 71

Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer accept chemotherapy presumably because of concerns regarding subjective side effects such as alopecia, nausea and vomiting (Busch et al 1996). Nonetheless, due to physiologic reduction of functional organ reserve and presence of comorbid conditions, elderly patients are often unsuitable for a standard polichemotherapy as used in their younger counterpart. Consequently, they are usually excluded from clinical trials as well. Elderly patients with advanced breast cancer (ABC) frequently suffer from tumour-related symptoms and need some kind of palliative treatments. In clinical practice, they often receive inadequate and untested treatments (Fentiman et al 1990; Monfardini and Yancik 1993). This article explores age-specific issues of the management of ABC in older women, and the authors report their own experience in this setting.

system, the renal or hepatic system, and any other major organ system. These conditions are usually chronic rather than self-limiting or acute and easily treated. Comorbidity, like impaired functional status, is a key negative prognostic factor in elderly patients with cancer and it can also adversely affect the patientâ&#x20AC;&#x2122;s functional status. Another important issue is the definition of frail elderly persons. With the expansion of the older population, the number of frail elderly and frail elderly with cancer is expected to rise. According to a conservative estimate, approximately 400.000 frail elderly in United States are affected by some form of cancer at any given time. Moreover, frailty is not equivalent to near death in fact, the average life expectancy of a frail person is in excess of 2 years (Balducci and Stanta 2000; Balducci and Exterman 2000). The frailty is a condition in which most functional reserve is exhausted. Frail patients are those who depend on others for the activities of daily living prevalently because of physical and cognitive dysfunction. Generally in these group of patients chemotherapy should be avoided. Reliable information regarding patient comorbid health problems is mandatory in order to plan an appropriate treatment. However, to date, a standard, fully satisfactory way to assess comorbidity has not been defined (Yancik et al 2001). A better understanding of the effects of chemotherapeutic agents on older patients and increased knowledge of pharmacokinetic data will help to determine their appropriate use in the elderly (Litchman and Villani 2000). In order to plan medical treatment in ABC elderly patients, and to further individualise treatment choice, is mandatory to practice a comprehensive geriatric assessment (CGA). The CGA includes assessment of comorbidity, socio-economic conditions, functional dependence, emotional and cognitive conditions, an estimate of life expectancy and recognition of frailty. The choice of the drug should be based on the evaluation of both toxicity profile of each drug and on the CGA of the patient. The basic component of CGA are presented in Table 1 (Balducci et al 2001).

II. Age cut-off Within epidemiological literature the age of 65 is usually considered as a cut-point to select elderly population. On the contrary, in clinical trials, the age of 70 is frequently used as lower limit for patients selection. A cut-off age of 75 years is less common. Indirect comparison of trials including or not patients aged 65 to 70 may be biased. A further bias may be due to the distribution of the so called â&#x20AC;&#x153;very oldâ&#x20AC;? patients, aged 80 or more (Surveillance, Epidemiology and End Results (SEER) Program 1998). Furthermore we must consider that is very difficult to establish a maximum age for chemotherapy treatment in the elderly. In clinical practice biological instead of chronological age should be considered. Unfortunately, to date, laboratory tests and geriatric evaluation are inadequate to define ageing; therefore, at the present, chronological age should be used as frame of reference for clinical trials. A cut-off of 70 years seems to be the most appropriate. In fact, 70 years of age may be considered as the lower boundary of senescence, because the incidence of age-related changes starts to increase after the age of 70 years (Balducci 2000).

III. Comorbidities and frailty IV. Literature review

The data indicate that the clinical outcome in each type of cancer is predicted not by age itself but by the degree of comorbidity and functional decline that may be present. In fact, elderly patients tolerate chemotherapy poorly because of comorbidity and organ failure. Elderly patients who are otherwise healthy can obtain the same benefits from chemotherapy as younger patients. Furthermore, older patients are as able as younger patients to tolerate chemotherapy, but their management may require more attention to supportive care. Preliminary observation on cancer patients also confirm the coexistence of other disease in elderly cancer patients (Surveillance, Epidemiology and End Results (SEER) Program 1998). Comorbidities are serious medical conditions that are not directly related to the cancer itself but involve the cardiovascular system, the respiratory

All published papers specifically addressing chemotherapy of elderly ABC patients until March 31, 2003 were searched using MEDLINE (PubMed, National Library of Medicine, Bethesda, MD, USA; used keywords: advanced breast cancer, elderly patients, chemotherapy). Therefore, all published papers in medical journals were reviewed and all abstracts presented at the last 5 years main international meetings were considered. Our literature search found 25 studies. Twelve of them have been published as abstract at main international meetings and 13 have been published as extended papers. One trial only was a phase III randomised study.

Cancer Therapy Vol 1, page 73

Table 1. Elements of a Comprehensive Geriatric Assessment (CGA) Parameter assessed

Elements of the assessment

Function

Performance status Activities of daily living (ADL) Instrumental activities of daily living (IADL)

Comorbidity

Number of comorbid conditions Severity of comorbid conditions (comorbidity index)

Socio-economic conditions

Living conditions Presence and adequacy of a caregiver

Cognition

Folstein mini-mental state evaluation Other tests

Emotional conditions

Geriatric depression scale (GDS)

Pharmacy

Number of medications Appropriateness of medications Risk of drug interactions

Nutrition

Mini-nutritional assessment (MNA)

Geriatric syndromes

Dementia Delirium Depression Falls Neglect and abuse Spontaneous bone fractures among 27 patients aged > 68 years; MDR and OS were 6 and 8 months, respectively. Single-agent docetaxel (TXT) has been tested in 2 different schedules: every 3 weeks and weekly. In a phase I trial 4 patients older than 70 years were treated with escalating dose of TXT (75, 85, 90, 95 and 100 mg/m2) given every 3 weeks. The authors stopped the study after the first 4 patients enrolled at the first dose-level due to toxicity and reporting no clinical response. They concluded that TXT at 75 mg/m2 and over, every 21 days, is too toxic in the elderly (Zanetta et al 2000). On the contrary, Constenia et al (1999) treated 14 elderly patients (> 65 years, six of which frail) with TXT at 75 mg/m2 and 100 mg/m2, every 3 weeks, with lenograstim support. They reported a RR of 71% with acceptable hematological toxicity. Two trials used weekly TXT. Dâ&#x20AC;&#x2122;hondt et al (2000) administered weekly TXT at the dose of 36 mg/m2 in 29 elderly or younger unfit patients, mostly heavily pretreated. The median age was 60 years and the RR was 21% with a good tolerability. In another phase II study, TXT (36 mg/m2) was administered weekly for 6 weeks in 41 elderly or poor performance status patients with ABC. The reported RR was 36% with a 72% of disease control, a median TTP of 7 months, a median OS of 13 months and with 1- and 2year actuarial survival rate of 61% and 29%, respectively. Most common toxicity was grade 3-4 fatigue occurring in 20% of patients (Hainsworth et al 2001).

The Table 2 and 3 summarised the results of single-agent and combination chemotherapy, respectively.

A. Single-agent chemotherapy Sixteen trials of single-agent chemotherapy were reported. Three trials used single-agent oral idarubicin (IDA). Chevalier et al (1990) on 30 elderly patients (> 70 years) with ABC using m2 IDA (15 mg/m2, p.o., d 1, 2, 3, every 3 weeks) reported a RR of 26% with a median duration of response (MDR) of 2.7 months. ProvĂ¨ et al (1998) treated 29 elderly patients failing hormonal therapy with IDA (20 mg/m2/week x 4). The Authors reported a RR of 24% with MDR of 8.5 months and mild toxicity consisting, mainly of myelosuppression. Toffoli et al (2000) used IDA on 10 elderly patients, at the dose of 5 mg/day and 10 mg/day every other day, for 21 days, recycled every 4 weeks. A RR of 20% was reported with severe toxicity and the Authors suggested a safer dosage of 5 mg/day for further experiences. Another trial by Chevalier et al (1992) using singleagent pirarubicin (30 mg/m2, i.v., d 1, every 3 weeks) on 31 elderly patients reported 25% RR with a median time to progression (TTP) of 3 months. Repetto et al, (1995) using mitoxantrone (MITO) (10-14 mg/m 2, i.v., d 1 every 3 weeks), reported 26% PR

Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer

Table 2. Phase II studies with single agent chemotherapy Author

No.pts

Age (years)

Drug

RR (%)

MTP (mos)

Chevallier, 1990

> 70

Idarubicin

2.7

Provè, 1998

> 65

Idarubicin

8.5

Toffoli, 2000

> 65

Idarubicin

Chevallier, 1992

> 70

Pirarubicin

Repetto, 1995

> 68

Mitoxantrone

Zanetta, 2000

> 70

Docetaxel

Constenia, 1999

> 65

Docetaxel

D’hondt, 2000

60*

Docetaxel

Hainsworth, 2001 Repetto, 2002

> 65**

Docetaxel

> 70

Paclitaxel

O’Shaughnessy, 1998

> 55

Capecitabine Vs CMF

Procopio, 2001

33 31

> 65

Capecitabine

Sorio, 1997

> 65

Vinorelbine

Buonadonna, 1998

> 65

Vinorelbine

39.5

Vogel, 1999

> 60

Rossi, 2003

> 70

Vinorelbine Vinorelbine

37.5

RR = response rate; MTP = median time to progression; *median age; **younger patients with poor performance status included.

Table 3. Studies with combination chemotherapy Author

Phase

No.pts

Age (years)

Drug

RR (%)

MTP (mos)

72*

Idarubicin + Cyclophosphamide

37.2

Kurtz, 2000

II I

> 65

Idarubicin + Cyclophosphamide

6.6

Gladieff, 1996

> 70

Mitoxantrone + vinorelbine

Mammoliti, 1996

> 65

Mitoxantrone + Levo-leucovorin + 5-fluorouracil

van Veelen, 1998

> 70

Mitoxantrone + methotrexate

6.8

Jagiello-Gruszfeld, 2002

> 70

Mitoxantrone + methotrexate

Bajetta, 1998

> 70

> 65

Doxifluridine + levo-leucovorin Paclitaxel + carboplatin

O’Rourke, 2002

II II

Taylor, 1986

III

181

> 65

Tamoxifen Vs CMF

10.4

7.9

Zaniboni, 1998

RR = response rate; MTP = median time to progression; CMF = cyclophosphamide, methotrexate, 5-fluorouracil; *median age

Cancer Therapy Vol 1, page 75 Gladieff et al (1996) in a phase II study, treated 25 women older than 70 years with the combination of MITO (10 mg/m2, i.v., d 1) plus VNR (20 mg/m2, i.v., d 1-8), both recycled every 3 weeks. The RR was 22% with a median TTP of 13 months. The dose-limiting toxicity was myelosuppression with no case of febrile neutropenia. Mammoliti et al (1996) used a combination of MITO (10 mg/m2, i.v., d 1), 5-fluorouracil (500 mg/m2, i.v., d 15-16) and levo-leucovorin (LV) (250 mg/m2, i.v., d 15-16), recycled every 4 weeks, in a phase II study on 24 patients over 65 years. The RR was 50% with a disease control of 87.5% and mild toxicity. The median PFS and OS were 9 and 14 months, respectively. Two trials investigated the combination of MITO plus methotrexate in patients aged more than 70 years. The RR reported in the 2 trials was 39% and 50% with MDR of 6.8 and 6 months and a median OS of 9 and 8 months, respectively (van Veelen et al 1998. Jagiello-Gruszfeld et al 2002). TAX–based combination regimens have been investigated in elderly women also. O’Rourke et al (2002) treated 39 elderly patients (> 65 years) with TAX 100 mg/m2 by 1-h infusion plus carboplatin AUC 2, on days 1, 8 and 15 every 4 weeks. The RR was 46% with a median OS of 13 months. Grade 3-4 neutropenia in 33% of cases and a grade 3-4 neuropathy in 18% of patients was reported. Beex et al (1992) treated 23 elderly patients (> 70 years) using 100% (in 10 cases) and 75% (in 13 cases) of the standard dose of CMF regimen. Results were similar in both groups and superimposible to those commonly reported with standard CMF. These results seem to suggest that the CMF dose could not exceed 75% of the standard dose in the elderly. Taylor et al treated 181 patients over 65 years with either tamoxifen or CMF in a randomised crossover study. Response rate was 45% with tamoxifen and 38% with CMF, with MDR of 10.4 and 7.9 months, respectively. The authors concluded that starting with hormonal therapy rather than CMF chemotherapy could be justified in elderly patients while polichemotherapy, however, is safe and active after hormonal treatment failure (Taylor 4th et al 1986). Bajetta et al (1998) treated 73 women (> 70 years) with doxifluridine (600 mg/m 2/b.i.d., p.o., d 1, 2, 3, 4) and LV (25 mg/b.i.d., p.o., d 1, 2, 3, 4), both given orally, recycled every 12 days. The OR was 26% with MDR and OS of 7 and 24 months, respectively. The treatment was very well tolerated and side effects were manageable and always reversible.

Paclitaxel (TAX) was administered weekly (80 mg/m2, i.v. day 1, 8 and 15 every 4 weeks), in a phase II study, in 29 elderly patients with ABC. The reported results were 3 complete and 13 partial responses for an overall RR of 55% with mild toxicity (Repetto et al 2002). Two studies with capecitabine were reported. O’Shaughnessy et al randomised patients in a phase II trial to capecitabine (2510 mg/m2/b.i.d., p.o., days 1 to 14, every 3 weeks) or CMF (cyclophosphamide, methotrexate and 5-fluorouracil). The study accrued 95 women aged > 55 years. Objective response was 25% for capecitabine and 16% for CMF with a median TTP of 132 days and 94 days, respectively. The authors concluded that home-based monotherapy with capecitabine shows at least comparable efficacy to CMF (O’Shaughnessy et al 1998). Procopio et al (2001) treated 40 women older than 65 years with capecitabine (2500 and than 2000 mg/m2/b.i.d., p.o., day 1 to 14, every 3 weeks). They reported RR of 35% with a median TTP of 6 months, one patient died due to gastrointestinal toxicity among 31 evaluable patients. Four studies reported on single-agent vinorelbine (VNR) in the treatment of elderly patients with ABC (Sorio et al 1997; Buonadonna et al 1998; Vogel et al 1999; Rossi et al 2003). Sorio et al (1997) treated 20 patients (> 65 years) with VNR at the dose of 30 mg/m2, i.v., as first-, second- and third-line therapy, on days 1 and 8 every 3 weeks, reporting 30% OR. Buonadonna et al (1998) reported 39.5% RR with MDR of 7 months and a disease control of 60.5%. The schedule of VNR used was 25 mg/m2, on days 1 and 8, every 3 weeks. Median age was 70 years and about 40% of patients were treated as second-line therapy. Vogel et al (1999) reported a RR of 38% with MDR of 9 months and a disease control of 76%. VNR was administered at the dose of 30 mg/m2, weekly for the first 13 weeks and then every 2 weeks. Median dose intensity of VNR was 20.6 mg/m2/week. Recently, Rossi et al (2003), treated 24 elderly ABC patients with VNR 30 mg/m2, i.v. day 1 and 8, every 3 weeks. Nine (37.5%) objective responses (2 complete and 7 partial responses) were observed with MDR and survival of 7 and 11 months, respectively. VNR given on day 1 and 8, recycled every 3 weeks, has a very similar dose-intensity and seems to be better tolerated as compared to weekly administration.

B. Combination regimens Among polichemotherapy trials, 2 included treatment with anthracyclines. Zaniboni et al (1998) used an oral regimen with IDA plus cyclophosphamide (CTX) in 39 heavily pretreated breast cancer elderly patients. The treatment was well tolerated with a 37.2% RR. Kurtz et al performed a phase I trial using a fixed dose of CTX (200 mg/m2/day, p.o., d 1, 2, 3) and an increasing dose of IDA (10 mg/m2/day, p.o., d 1, 2, 3), recycled every 3 weeks, both administered orally. Nineteen patients were treated with myelosuppression as dose-limiting toxicity and maximum tolerated dose reached at 12 mg/m 2/day. Among 14 patients, 4 (21%) achieved a PR with MDR of 6.6 months (Kurtz et al 2000).

V. New Directions Our literature review showed an increasing interest for oral drugs. In 8 out of the 25 reported studies the Authors used an oral drug formulation. In the future novel biological agents should be an interesting new approach. The use of oral drugs in this setting as well is of great interest.

Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer pharmacokinetics of oral VNR is not altered in older patients who presented similar bioavalability and at least comparable inter-individual variability to younger patients (Puozzo et al 2001). Based on these data studies of oral VNR in ABC elderly patients are warranted.

A. Oral drugs Patientâ&#x20AC;&#x2122;s preferences and quality of life issues, which are becoming central considerations in palliative treatment regimens, request the development of oral drugs administration. Indeed, a work has suggested that i.v. lines were a major source of discomfort and stress for cancer patients and approximately 90% of them expressed a preference for oral versus i.v. chemotherapy, predominantly because of the convenience of administration outside a clinical setting or current concerns or previous problems with i.v. access (Liu et al 1997). For the mentioned reasons, if equivalent safety and efficacy can be demonstrated, the oral drugs formulation provides more convenience for patients; this added convenience may be particularly important in elderly and unfit patients. Anyway, the majority of drugs administered orally are intended to act systematically, and for these, absorption is a prerequisite for activity. Delays or losses of the drug during absorption may contribute to variability in the drug response, and occasionally, may result in the treatment failure. An ideal chemotherapeutic drug would have little interpatient variability in absorption and time curve (AUC) and, more importantly, little intrapatient variability with successive doses (DeMario and Ratain 1998). In the present review, capecitabine is an interesting oral drug. Capecitabine is a selectively tumor activated fluoropyrimidine which is effective in a wide range of solid tumors, particularly in breast and colon cancer. In the two reported studies, capecitabine was active and well tolerated in the treatment of ABC elderly patients (Oâ&#x20AC;&#x2122;Shaughnessy et al 1998; Procopio et al 2001). Based on the available data and our experience as well, VNR seems to be one of the most active singleagent. Bonneterre et al. conducted a dose-finding phase I study in advanced breast cancer patients. Three dose levels were evaluated on a weekly regimen basis: 60, 80 and 100 mg/m2. Twenty-seven patients were enrolled in the study and the maximum tolerated dose was 100 mg/m2 with a dose-limiting toxicities being neutropenia, nausea /vomiting and neuroconstipation. The recommended dose of oral VNR for further trials was defined at 80 mg/m2 /week. The activity was observed at 80 and 100 mg/m2 (Bonneterre et al 1996). Following these results, the absolute bioavailability of oral VNR was determined in 24 patients receiving oral administration at 80 mg/m2 or i.v. VNR at 25 mg/m2 one week apart in a cross over design. The bioavailability factor calculated on blood exposure (AUC) was 43 + 14%. When data from the population pharmacokinetic analysis is taken into account (including all the patients from phase I studies) the bioavailability factor is 36 + 10% and this has formed the justification for a pragmatic use of about 40% as the basis for clinical equivalence studies. Based on these results the oral dose of 80 mg/m2 was demonstrated to correspond to 30 mg/m2 of the i.v. formulation and 60 mg/m2 oral to 25 mg/m2 i.v. (Marty et al 2001). Recently, a trial performed in elderly patients with advanced non small cell lung cancer, demonstrated that the

B. New biological agents The numerous molecular mechanisms implicated in the pathogenesis of breast cancer present exciting avenues for target-specific approaches to therapy. Based on the current data, the inhibitors of cell signalling seem to be the most promising class of agents for the treatment of breast cancer. Her-2/neu, a member of the group I growth factor receptor family, is a tyrosine-kinase membrane receptor that, when activated, induces a phosphorylation cascade in cytoplasmic kinases leading to increased transcription of nuclear proteins and cellular growth. It is amplified and/or overexpressed in 20% to 30% of patients with breast cancer (Press et al 1990). Overexpression of this oncogene product is associated with increased rates of tumour growth, enhanced rates of metastasis, shorter disease-free survival, and overall survival (Slamon et al 1989; Press et al 1990; Liu et al 1995). Patients with HER-2/neuoverexpressing tumours have more aggressive and more malignant courses. HER-2/neu has been targeted by monoclonal antibodies, immunoconjugates, vaccines, antibody-directed enzyme prodrug therapy, antisense therapy and gene therapy (Hortobagyi 1990). Trastuzumab is a humanized monoclonal antibody against the extracellular domain of HER-2/neu (Hudziak et al 1989). As a single agent, trastuzumab resulted in 15% objective response in ABC, as second-line treatment (Cobleigh et al 1999). Trastuzumab is well tolerated, lowgrade fever, chills, fatigue and constitutional symptoms occur primarily with the first infusion and serious adverse effects are infrequent (Hortobagyi 1999). Trastuzumab has been showed well tolerated in elderly women (> 60 years) with HER-2-positive ABC and produces significant benefits added to chemotherapy (Fyfe et al 2001). The EGFR (Epidermal Growth Factor Receptor), another member of the group I growth factor receptor family, is a 170 kDa transmembrane glycoprotein that consists of an extracellular domain, a hydrophobic transmembrane domain and an intracellular region containing the tyrosine kinase domain. The EGFR exists as inactive monomers, which dimerize after ligand activation. This causes homodimerization or heterodimerization between EGFR and another member of the erb receptor family. After the ligand binding, the tyrosine kinase intracellular domain of the receptor is activated, with autophosphorylation of the intracellular domain, which initiates a cascade of intracellular events. Several studies have demonstrated that EGFR-mediated signals also contribute to other processes that are crucial to cancer progression, including angiogenesis, metastatic spread, and inhibition of apoptosis (Ciardiello and Tortora 2001). ZD1839, a synthetic anilinoquinazoline, is a p.o. 76

Cancer Therapy Vol 1, page 77 active, selective reversible inhibitor of EGFR tyrosine kinase. Recently, 2 phase II trials tested ZD1839 in ABC patients. Robertson et al (2002) treated with ZD1839 500 mg, 22 patients with either ER-negative or ER-positive breast cancer that became clinical resistant to tamoxifen. The median age was 61 years (range 32-85 years). The Authors reported a partial response in 9% of patients. Albain et al, (2002) treated with an oral daily 500 mg dose of ZD1839 until disease progression, intolerable disease or consent withdrawal, 63 pretreated ABC patients (ages 3480 years) with interesting results. The use of oral drugs as well among new biological agents is of great interest.

peculiar patient population. In conclusion, chemotherapy is feasible and active in ABC elderly patients resistant to hormonal therapy or with visceral metastases. Considering that the most part of these patients need to be treated with chemotherapy, large randomised phase III trials, including quality of life evaluation, are warranted.

References Albain K, Elledge R, Gradishar WJ, Hayes DF, Rowinsky E, Hudis C, Pustzai L, Tripathy D, Modi S, and Rubi S (2002). Open-label, phase II, multicenter trial of ZD1839 (â&#x20AC;&#x2DC;Iressaâ&#x20AC;&#x2122;) in patients with advanced breast cancer. Breast Cancer Res Treat 76 (suppl 1), 20 (abstr). Bajetta E, Biganzoli L, Carnaghi C, Di Bartolomeo M, Spagnoli I, Cassata A, Galante E, Mariani L, Stampino CG, and Buzzoni R (1998). Oral doxifluridine plus levoleucovorin in elderly patients with advanced breast cancer. Cancer 83, 1136-1141. Balducci L, and Stanta G (2000). Cancer in the frail patient: a coming epidemic. Hematol Oncol Clin North Am 14, 235250. Balducci L, and Exterman M (2000). Management of the frail person with advanced cancer. Crit Rev Oncol Hematol 33, 143-148. Balducci L (2000). Geriatric oncology: challenge for the new century. Eur J Cancer 36, 1741-1754. Balducci L, Extermann M, and Carreca I (2001). Management of breast cancer in the older woman. Cancer Control 8, 431441. Beex LV, Hermus AR, Pieers GF, van Hoesel QG, Nooy MA, and Mignolet F (1992). Dose intensity of chemotherapy with cyclophosphamide, methotrexate and 5-fluorouracil in the elderly with advanced breast cancer. Eur J Cancer 28, 686690. Bonneterre J, Chevalier B, and Le Bras F (1996). Phase I clinical trial of oral vinorelbine (VRL) in patients (PTS) with advanced breast cancer (ABC): preliminary results. Breast Cancer Res Treat 41, 505. Buonadonna A, Crivellari D, and Frustaci S (1998). Vinorelbine (VRL) as palliative treatment in elderly patients (PTS) with metastatic breast cancer. Final results. Proc 8th International Congress on Anti-Cancer Chemotherapy P103 (abstr). Busch E, Kemeny M, Fremgen A, Osteen RT, Winchester DP, and Clive ER (1996). Patterns of breast cancer care in the elderly. Cancer 78, 101-111. Chevalier B, Monnier A, Metz R, Namer M, Marty M, Roche H, Bastit P, and Hurteloup P (1990). Phase II study of oral idarubicin in elderly patients with advanced breast cancer. Am J Clin Oncol 13, 436-439. Chevalier B, Mignot L, Delozier T, Morvan F, Ferme C, and Herait P (1992). Phase II study of tetrahydropyranyl adriamycin (pirarubicin) in elderly patients with advanced breast cancer. Am J Clin Oncol 15, 395-398. Ciardiello F, and Tortora G (2001). A novel approach in the treatment of cancer: targeting the Epidermal Growth Factor Receptor. Clin Cancer Res 7, 2958-2970. Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehrenbacher L, Wolter JM, Paton V, Shak J, Lieberman G, and Slamon DJ (1999). Multinational study of the efficacy end safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast

VI. Conclusions The treatment of elderly patients is an emerging issue. Unfortunately, among the published studies, one only is a randomised phase III trial while several phase II trials have been performed. The most part of the studies enrolled elderly patients with a cut-off age ranging from 60 to 65 years old, probably not representative of real elderly population. Many referenced studies included in the same series patients treated as first-, second- and third-line chemotherapy confounding the reported results. Some of the cited trials used anthracycline-based chemotherapy. It is widely believed that the incidence and severity of toxic effects from anthracyclines are greater in older patients than in younger ones, and clinical experience often reinforces this belief. Anyway, Ibrahim et al confirmed the possibility to administer anthracyclines in elderly women with ABC. They performed a retrospective analysis on 1011 women over 65 years (24%) or 50-64 years, all treated with a doxorubicin-based chemotherapy. Although OR was higher for the younger patients (67% versus 51%, p = 0.001), no significant difference in terms of doseintensity, TTP, OS and toxicity was observed (Ibrahim et al 1996). While the response to chemotherapy and clinical outcome are certainly poorer in elderly patients with chronic comorbidity than in younger and healthier patients, the evidence to date suggests that the benefits and toxic effects of chemotherapy in otherwise-healthy older patients are comparable to those in younger patients. Age is not predictive of treatment failure and chemotherapy is not necessarily less effective or less tolerable in older patients. Based on the described studies, single-agent chemotherapy seems to determine superimposible results as compared to polichemotherapy. To date even if there is no specifically randomised study, single-agent chemotherapy probably might be considered the standard treatment for ABC in the elderly. Great interest is for oral drugs if well tolerated and usually with a good patientâ&#x20AC;&#x2122;s compliance. One of the main research-line to explore is the introduction of new biological agents in the treatment schemes. In fact, if new biological agents proved to be effective in the treatment of ABC, therapeutic strategies in the elderly could include a very useful tool, considered their excellent toxicity profile, very suitable for this 77

Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol 17, 2639-2648. Constenia M, Carrete N, Lorenzo I, Garcia-Arroyo FR, Campos B, Rey C, and Ozores R (1999). Docetaxel (TXT) monotherapy & lenograstim (G-CSF) for advanced breast cancer in the elderly. Eur J Cancer 35 (suppl 4), S323 (abstr 1298). DeMario MD, and Ratain MJ (1998). Oral chemotherapy: rationale and future directions. J Clin Oncol 16, 2557-2567. D’hondt R, Paridaens R, Wildiers J, and Thomas J (2000). Weekly docetaxel in aged or frail metastatic breast cancer patients: toxicity profile and activity. Ann Oncol 11 (suppl 4), 72 (abstr 319PD). Fentiman IS, Tirelli U, Monfardini S, Schneider M, Festen J, Cognetti F, and Aapro MS (1990). Cancer in the elderly: why so badly treated? Lancet 28, 1020-1022. Fyfe G, Mass R, Murphy M, and Slamon D (2001). Older (age > 60 years) patients obtain survival benefit from herceptin plus chemotherapy. Eur J Cancer 37 (suppl 6), S189 (abstr 692). Gladieff L, Houyau P, Mihura J, Martinez M, Caunes N, Chevreau C, Bugat R, and Roche H (1996). A phase II study with mitoxantrone-vinorelbine association in the treatment of advanced breast cancer in elderly women. Bull Cancer 83, 703-706. Hainsworth JD, Burris III HA, Yardley AD, Bradof JE, Grimaldi M, Kalman LA, Sullivan T, Baker M, Erland JB, and Greco A (2001). Weekly docetaxel in the treatment of elderly patients with advanced breast cancer: A Minnie Pearl Cancer Research Network phase II trial. J Clin Oncol 19, 35003505. Hortobagyi GN (1990). Options for treatment of metastatic breast cancer. ASCO Educational Book pp. 515-521. Hudziak RM, Lewis GD, Winget M, Fendly BM, Shepard HM, and Ullrich A (1989). p185HER2 monoclonal antibody has antiproliferative effects in vitro and sensitizes human breast tumor cells to tumor necrosis factor. Mol Cell Biol 9, 11651172. Ibrahim NK, Frye DK, Buzdar AU, Walters RS, and Hortobagyi GN (1996). Doxorubicin-based chemotherapy in elderly patients with metastatic breast cancer. Arch Intern Med 156, 882-888. Jagiello-Gruszfeld AI, Pienkowski T, and Giermek J (2002). The combination of mitoxantrone and methotrexate in elderly patients with advanced breast cancer. Proc Am Soc Clin Oncol 21, 259b (abstr 2855). Klimmick GG, and Balducci L (2000). Breast cancer and aging: clinical interactions. Hematol Oncol Clin North Am 14, 213-234. Kurtz JE, Deplanque G, Borel C, Mathelin C, Prevost G, Poulin G, Barats JC, Bergerat JP, Chapelle-Marcillac I, Bardonnet M, and Dufour P (2000). Dose-finding study of oral idarubicin and cyclophosphamide in first-line treatment of elderly patients with metastatic breast cancer. Ann Oncol 11, 229-230. Levi F, Lucchini F, Negri E, Boyle P, and La Vecchia C (2001). Changed trends of cancer mortality in the elderly. Ann Oncol 12, 1467-1477. Litchman SM, and Villani G (2000). Chemotherapy in the elderly: pharmacologic considerations. Cancer Control 7, 548-556. Liu Y, El-Ashry D, Chen D, Ding IJ, and Kern FG (1995). MCF7 breast cancer cells overexpressing transfected c-erbB-2 have an in vitro growth advantage in estrogen-depleted

conditions and reduced estrogen-dependence and tamoxifensensitivity in vivo. Breast Cancer Res Treat 34, 97-117. Liu G, Franssen E, Fitch MI, and Warner E (1997). Patients preferences for oral versus intravenous palliative chemotherapy. J Clin Oncol 15, 110-115. Mammoliti S, Merlini L, Caroti C, and Gallo L (1996). Phase II study of mitoxantrone, 5-fluorouracil, and levo-leucovorin (MLF) in elderly advanced breast cancer patients. Breast Cancer Res Treat 37, 93-96. Marty M, Fumoleau P, Adenis A, Rousseau Y, Merrouche Y, Robine G, Senac I, and Puozzo C (2001). Oral vinorelbine pharmacokinetics and absolute bioavalability study in patients with solid tumors. Ann Oncol 12, 1643-1649. Monfardini S, and Yancik R (1993). Cancer in the elderly: meeting the challenge of an aging population. J Natl Cancer Inst 85, 532-538. O’Rourke M, Loesch D, Robert N, Cox E, Roppolo G, and Asmar L (2002). Efficacy and tolerability of a weekly taxol (T) plus carboplatin (C) regimen in patients < 65 years versus > years with advanced breast cancer (ABC). Proc Am Soc Clin Oncol 21, 39b (abstr 1967). O’Shaughnessy J, Moiseyenko V, Bell D, Nabholtz JM, Miles D, Gorbunova V, Laws S, Griffin T, and Osterwalder B (1998). A randomized phase II study of xeloda (capecitabine) vs CMF as first line chemotherapy of breast cancer in women aged > 55 years. Proc Am Soc Clin Oncol 17, 103a (abstr 398). Press MF, Jones LA, Godolphin W, Edwards CL, and Slamon DJ (1990). HER-2/neu oncogene amplification and expression in breast and ovarian cancers. Prog Clin Biol Res 354A, 209221. Procopio G, Bajetta E, Catena L, Alù M, Longarini R, Zilembo N, La Torre I, Platania M, Della Torre S, and Dognini G (2001). Safety and activity of capecitabine in elderly patients with advanced breast cancer. Eur J Cancer 37 (suppl 6), S197 (abstr 720). Provè A, Becquart D, Dirix L, Joosen E, Vonck I, Lobelle J, Riggi M, Paridaens R, and Van Oosterom A (1998). Oral idarubicin (IDA) chemotherapy (CT) in elderly advanced breast cancer (ABC) patients (pts) failing hormonal therapy: conclusive results. Proc Am Soc Clin Oncol 17, 167a (abstr 641). Puozzo C, Gridelli C, and Jaworski M (2001). Pharmacokinetics of navelbine® in elderly patients. Tumori 88 (suppl 1), S75S76. Repetto L, Simoni C, Venturino A, Biancardi V, Gasco M, Campora E, and Rosso R (1995). Mitoxantrone in elderly women with advanced breast cancer: a phase II study. Anticancer Res 15, 2297-2300. Repetto L, Del Mastro L, Perrone F, Di Nota A, Zagonel V, Fratino L, Marenco D, Diadema MR, Lattuada S, and Rosso R (2002). Weekly paclitaxel – phase II trial in older patients with advanced breast cancer: A GIOGer study. Ann Oncol 13 (suppl 5), 105 (abstr 382P). Robertson JFR, Gutteridge E, Cheung KL, Owers R, Koehler M, and Hamilton L (2002). A phase II study of ZD1839 (‘Iressa’) in tamoxifen resistant ER-positive and endocrineinsensitive (ER-negative) breast cancer. Breast Cancer Res Treat 76 (suppl 1), 357 (abstr). Rossi A, Gridelli C, Gebbia V, Rosati G, Tortoriello A, Maione P, Borsellino N, Rossi N, Pisano A, Colantuoni G, Iaffaioli RV, Castaldo V, and Manzione L (2003). Single agent vinorelbine as first-line chemotherapy in elderly patients with advanced breast cancer. Anticancer Res in press.

Cancer Therapy Vol 1, page 79 Slamon DJ, Godolphin W, Jones LA, et al (1989). Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science 244, 707-712. Sorio R, Robieux I, Galligioni E, Freschi A, Colussi AM, Crivellari D, Saracchini S, and Monfardini S (1997). Pharmacokinetics and tollerance of vinorelbine in elderly patients with metastatic breast cancer. Eur J Cancer 33, 301-303. Surveillance, Epidemiology and End Results (SEER) Program (1998). Public use CD-ROM (1973-1995). Bethesda (MD): Cancer Statistics Branch; National Cancer Institute. Taylor SG 4th, Gelman RS, Falkson G, and Cummings FJ (1986). Combination chemotherapy compared to tamoxifen as initial therapy for stage IV breast cancer in elderly women. Ann Intern Med 104, 455-461. Toffoli G, Crivellari D, Magri MD, Sorio R, Spazzapan S, Lombardi D, Scuderi C, Paolello C, Boiocchi M, and Veronesi A (2000). Innovative schedule of oral idarubicin (IDA) in elderly patients with metastatic breast cancer: a phase II study. Ann Oncol 11 (suppl 4), 37 (abstr 156). van Veelen H, Tjabbes T, Bong SB, Piersma H, and Runhaar EA (1998). Mitoxantrone and methotrexate (MM) in elderly patients (pts) with metastatic breast cancer (MBC). Ann

Oncol 9 (suppl 4), 20 (abstr 93P). Vogel C, Oâ&#x20AC;&#x2122;Rourke M, Winer E, Hochster H, Chang A, Adamkiewicz B, White R, and McGuirt C (1999). Vinorelbine as first-line chemotherapy for advanced breast cancer in women 60 years of age or older. Ann Oncol 10, 397-402. Yancik R, and Lies RAG (2000). Aging and cancer in America: demographic and epidemiologic perspectives. Hematol Clin North Am 14, 17-23. Yancik R, Ganz P, Varricchio CG, and Conley B (2001). Perspective on comorbidities and cancer in older patients: approaches to expand the knowledge base. J Clin Oncol 19, 1147-1151. Zanetta S, Albrand G, Bachelot T, Ardiet CJ, Tranchand B, and Droz JP (2000). A phase I trial of docetaxel every 21 days in elderly patients with metastatic breast cancer (MBC). Ann Oncol 11 (suppl 4), 73 (abstr 322PD). Zaniboni A, Bolognesi A, Arnoldi E, Tabiadon D, Barni S, and Intini C (1998). Oral idarubicin and cyclophosphamide for metastatic breast cancer in elderly patients. Anticancer Drugs 9, 295-299.

Seated Cesare Gridelli From right Paolo Maione, Alida Barbato,Dario Nicolella, Giuseppe Airoma,Giuseppe Colantuoni, Filomena Del Gaizo, Rosa Bruno, Antonio Rossi, Carmine Ferrara.

Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer

Cancer Therapy Vol 1, page 81 Cancer Therapy Vol 1, 81-91, 2003.

Drug resistance in breast cancer Review Article

Hermann Lage Humboldt University Berlin, Charité Campus Mitte, Institute of Pathology, Schumannstr. 20/21, D-10117 Berlin, Germany

__________________________________________________________________________________ Correspondence: PD Dr. H. Lage, Institute of Pathology, Charité Campus Mitte, Humboldt University Berlin, Schumannstr. 20/21, D10117 Berlin, Germany; Tel.: +49-30-450 536 045; Fax: +49-30-450 536 900; e-mail: hermann.lage@charite.de Key words: breast cancer, multidrug resistance, ABC-transporters, P-gp, MRP1, MRP2, BCRP, Major vault protein, YB-1 Received: 28 April 2003; Accepted: 06 May 2003; electronically published: May 2003

Summary Resistance to cytotoxic chemotherapy is the main cause of therapeutic failure and death in women suffering on breast carcinoma. Commonly, patients refractory to chemotherapeutic treatment regimens show resistance to multiple antineoplastic agents of different structure and mode of action, i.e. the cancerous breast tissue exhibits a multidrug resistance (MDR) phenotype. Clinical MDR of breast cancer is likely to be multifactorial and heterogenous. Several mechanisms have been identified to play a role in MDR, e.g. overexpression of various members of the superfamily of ABC (adenosine triphosphate binding cassette)-transporters have been shown to be associated with MDR in solid tumors including breast cancer. Besides the classical MDR transporter P-glycoprotein (P-gp) additional ABC-transporters such as MRP1 or BCRP have been analyzed concerning their role in clinical MDR of breast cancer. Moreover, “upstream” factors like transcription factors regulating the gene activity of ABCtransporter encoding genes, such as the Y-box transcription factor YB-1 were demonstrated to play a role in MDR of mammary carcinoma. However, since the available data are contradictorily, hitherto the clinical significance of these and various other molecules on breast cancer remains unclear. This review will discuss the current state of knowledge of MDR-associated factors and their impact on clinical MDR in breast carcinoma. HER-2/neu-postive neoplasms of the breast, the use of the monoclonal antibody trastuzumab directed against that oncoprotein (Hortobagyi, 2001; Vogel et al., 2002). For the majority of patients, the necessary treatment will probably be a combination of these pharmacological treatment options. However, here the mechanisms of drug resistance against classical cytotoxic compounds used against breast cancer will be discussed; endocrine and immunological therapy will not be within the scope of this mini overview. Biological resistance mechanisms of solid tumors against cytotoxic antitumor agents can be distinguished in (i) pharmacokinetic resistance, and (ii) cellular resistance. Important factors of pharmacokinetics include low dose metabolic inactivation, the location of tumor deposits in so-called pharmacological sanctuaries, e.g. compartments behind the blood-brain barrier, and poor penetration of drugs through the interstitial tumor tissue. However, within this mini-review merely the cellular drug resistance mechanisms in breast cancer will be discussed. Traditional chemotherapy protocols for the treatment of advanced breast cancer consisted of cyclophosphamide, methotrexate, 5-fluorouracil, prednisone, and vincristine combinations (Harris et al., 2000). Later on, anthracycline-

I. Introduction Breast cancer is the most frequent form of cancer and the leading cause of death among females in the Western world, where, despite of radical mastectomy approximately one third of affected women die (Kelsey and Berkowitz, 1988). Around one of 10 Western women will develop breast cancer at some time in their lifetime. Although chemotherapy improves survival rates in the adjuvant setting, around 50% of all treated patients will relapse (Harris et al., 1993). The major reason for therapeutic failure is the development of resistance against anticancer agents used. Under clinical circumstances it is unknown whether drug-resistant mammary carcinoma cells occur as a result of the pressure of antineoplastic agents, or if they were already present in the tumor at the start of the chemotherapeutic treatment that they survive. Recent pharmacological treatment regimens of breast cancer include (i) conventional chemotherapy on the basis of cytotoxic anticancer drugs, (ii)) in steroid-hormone receptor-positive patients an endocrine therapy, e.g. the use of adjuvant tamoxifen in estrogen receptor (ER)positive tumors (Osborne, 1998), and (iii) an immunological-basing therapy, e.g. in proto-oncogene

Lage: Drug resistance in breast cancer based chemotherapy has gradually become standard in the treatment of advanced breast cancer. Doxorubicin and its analogue epirubicin are considered as highly active anthracyclines, that are commonly used in combinations with 5-fluorouracil and cyclophosphamide. Although, breast cancer is often considered as one of the more drugsensitive solid tumors, all initially responsive cancers relapse and develop drug resistance, in the case of resistance against a broad spectrum of structurally unrelated drugs with different mode of action a multidrug resistance (MDR).

At least two types of MDR can be distinguished on the basis of different mechanisms: (i) the so-called “classical” or P-glycoprotein (P-gp)-depending MDR, and (ii) the “atypical” or non-P-gp-depending MDR. The most extensively studied mechanism of drug resistance is the “classical” MDR phenotype characterized by a typical cross resistance pattern against natural product-derived anticancer agents, such as anthracyclines (doxorubicin and epirubicin are among the most effective cytotoxic drugs used in the treatment of breast cancer), epipodophyllotoxines, Vinca alkaloids, or taxanes, and the reversibility by the calcium channel inhibitor verapamil and cyclosporin A derivatives. The underlying mechanism conferring this “classical” MDR phenotype is the cellular overproduction of a 170-kDa, membrane-spanning P-gp (P-170, PGY1, MDR1, ABCB1) (Ling et al., 1997), member of the superfamily of ABC (adenosine triphosphate binding cassette)-transporters (Lage, 2003).

II. The multidrug resistance (MDR) phenotype in breast cancer The original concept of MDR was introduced into the scientific literature in 1970 (Biedler et al., 1970). The multidrug-resistant phenotype is frequently characterized by a cross-resistance to drugs to which the tumor has not been exposed previously. Such a MDR phenotype can be intrinsic (primary) or acquired (secondary). The development of a MDR in advanced breast cancer is primarily responsible for the failure of current treatment regimens (Trock et al., 1997). Despite comprehensive knowledge on in vitro mechanisms of MDR, the precise nature of the in vivo drug-resistant phenotype in breast cancer remains unclear.

III. Human ABC-transporters ABC-transporters act as energy-dependent drug efflux pumps, thereby decreasing the accumulation of cytotoxic agents in the intracellular millieu (Figure. 1). ABC-transporter proteins are defined by the presence of a highly conserved approximately 215 amino acids consensus sequence designated as ABC, ABC domain,

Figure 1. Schematic diagram that shows various possibilities of mechanistic action of ABC-transporters mediating drug resistance in breast cancer. (a) ABC-transporters are predominantly localized to the cytoplasm membrane. In an ATP-dependent manner the drugs will be extruded from the cell by the transporter proteins. (b) On the other side, it is also possible that ABC-transporters pump activity contributes to vesicular compartmentation of cytotoxic drugs, or (c) that ABC-transporters facilitate phase II drug metabolism by carrying xenobiotic substances into the lumen of the endoplasmic reticulum. D, anticancer drug.

Cancer Therapy Vol 1, page 83 treatment failure. Likewise this meta-analysis confirmed the considerable heterogeneity among the studies. The Pgp incidence in these 31 studies ranged from 0% to 80%. As shown in Table 2, also in very recent studies of P-gp expression these discrepancies persist anymore. Even when using the same monoclonal anti-P-gp antibody JSB1, the detection rate ranged from 0% to 71% (Yang et al., 1999; Faneyte et al., 2001). The putative reasons for the enormous discrepancies in P-gp detection were already discussed extensively in the mid 1990s (Beck et al., 1996). The problems designing a study providing improved P-gp expression data can be summarized as follows: (i) methods using P-gp on protein level as well as on mRNA level using whole tumor specimens can not differentiate from adjacent normal epithelial cells, stroma cells and tumor cells; (ii) Western blotting analyzes for P-gp protein expression and Northern blotting analyzes for mdr1 mRNA expression are not sensitive enough to detect low levels in clinical samples; (iii) many polymerase chain reaction (PCR)-based assays for detection of the mdr1-specific mRNA fail to take into account the fact that quantitation of PCR amplification

ABC-ATPase domain, or nucleotide-binding domain (NBD). The domain contains two short peptide motifs, a glycine-rich Walker A - and a hydrophobic Walker B motif (Walker et al., 1982), both involved in ATP binding and commonly present in all nucleotide-binding proteins. A third consensus sequence is named ABC signature (Hyde et al., 1990) and is unique in ABC domains. ABCcontaining proteins couple the phosphate bond energy of ATP hydrolysis to many cellular processes and are not necessarily restricted to transport functions. However, the proper meaning of the term ABC-transporter protein, is satisfied when the ABC-protein is in addition, associated with a hydrophobic, membrane-embedded transmembrane domain (TMD) usually composed of at least six transmembrane (TM) !-helices. The TMDs are believed to determine the specificity for the substrate molecules transported by the ABC-transporter protein. The minimal structural requirement for a biological active ABCtransporter seems to be two TMDs and two ABCs [TMDNBD]2. In “full-transporters”, this structural arrangement may be formed by a single polypeptide chain and in multiprotein complexes by more than one polypeptide chain. The organization of human ABC-transporter encoding genes are commonly distributed in one gene encoding a “full-transporters” [TMD-NBD]2 or two genes encoding subunits of heteromeric “half-transporters“ [TMD-NBD] (Figure. 2). Since completion of the human genome sequence (Lander et al., 2001; Venter et al., 2001), 48 different ABC-transporters have been identified and were divided by their phylogenetic characteristics into 7 subfamilies, ABCA, ABCB, ABCC, ABCD, ABCE, ABCF, and ABCG (Dean et al., 2001). Besides P-gp mediating the “classical” MDR phenotype, ABC-transporters have important roles in “atypical” forms of MDR and at least 12 human ABC-transporters are associated with drug transport in human cancers (Table 1).

A. P-gp (ABCB1) The 170 kDa P-gp represents the first purified (Riordan et al., 1979) human ABC-transporter protein and is the best characterized molecule involved in MDR (Ling et al., 1997). Structurally, this mdr1 gene encoded transporter consists of 1280 amino acids residues forming a [TMD-NBT] 2 configuration. Very early studies of MDR demonstrated frequently expression of P-gp in breast cancer (e.g. Sugawara et al., 1988; Goldstein et al., 1989; Ro et al., 1990; Gerlach et al., 1987; Wallner et al., 1991; Verrelle et al., 1991; Keith et al., 1990; Merkel et al., 1989; Sanfillippo et al., 1991; Wishart et al., 1990; Schneider et al., 1989). These early studies were limited by small sample size, the retrospective character, differences in detection methods and therewith the enormous discrepancies in results. In these studies the percentage of P-gp-positive breast cancer samples varied between 0% and 85%. However, a meta-analysis of 31 studies performed by Trock et al. (1997) revealed that 41% of breast cancers expressed P-gp, the frequency of detectable expression increased after therapy, and the P-gp expression was associated with a higher likelihood of

Figure 2. Models for the predicted domain arrangements of human ABC-transporter proteins involved in anticancer drug resistance. (a) Nucleotide binding domain [NBD] containing a Walker A and a Walker B motif, and the ABC signature. (b) Transmembrane domain [TMD] consisting of six transmembrane (TM) !-helices. Probably, the TMDs are forming a pore structure in the membrane. (c) [NBT-TMD] configuration, e.g. ABC8 (White, ABCG1), BCRP (ABCG2). (d) [TMD-NBT] configuration, e.g. TAP1 (ABCB2), and TAP2 (ABCG3). (e) [TMD-NBT]2 configuration, e.g. MDR1 (ABCB1), MRP4 (ABCC4), MRP5 (ABCC5), MRP7 (ABCC7). (f) [TMD 0(TMDNBT)2] configuration, e.g. MRP1 (ABCC1), MRP2 (ABCC2), MRP3 (ABCC3), MRP6 (ABCC6). The upper parts of the topological models represent the extracellular orientation or the lumen of a cellular compartment, such as the endoplasmic reticulum, Golgi apparatus, peroxisome, or mitochondrium, whereas the bottom represents the intracellular, cytosolic compartment. It is notable that the topological models are highly schematic, and that “half-transporters” (c, d) have to assemble in a homo- or heterodimeric structure to form a biological active transporter molecule.

Lage: Drug resistance in breast cancer products is most accurate in the exponential phase of the reaction; (iv) PCR-based detection protocols may exhibit a much higher sensitivity that alternative methods including immunohistochemistry (IHC); (v) although IHC has the advantage that cancer cells can be distinguished from contaminating cells, problems arise in the quantification of the P-gp expression level; (vi) it is difficult to detect P-gp in formalin-fixed tumor tissue and differences in fixation techniques may contribute to the variability of the data, even when the same antibody was used; (vii) the commonly used anti-P-gp antibodies exhibit experimental difficulties, e.g. C219 crossreacts with the human MDR3transporter protein, that has not been demonstrated to confer MDR, and also shows cross reaction with myosin, or MRK16 that is highly specific for P-gp, but may have heterogeneous staining even in control cell lines; (viii) disagreements whether breast cancer cells should be scored as Pgp-positive if cytoplasm is stained but membrane staining cannot be identified. Breast cancer studies requiring P-gp-specific membrane staining often report a far lower frequency of P-gp expression (Faneyte et al., 2001). All of these problems are not specific for Pgp; they obtain alike for all other ABC-transporters and alternative drug resistance-mediating factors. Correlation of P-gp expression in breast cancer and clinical drug resistance was investigated in several studies. In locally advanced breast cancer P-gp expression has been demonstrated to increase as a result of chemotherapy. Chevillard et al. (1996) reported that the P-gp incidence increased from 14% to 43%; Chung et al. (1997) found an increasing P-gp incidence from 26% to 57%. Although the meta-analysis of P-gp expression studies in breast cancer by Trock et al. (1997) concluded that women with P-gppositive tumors were more likely to experience chmotherapy failure, several recent studies have not been able to confirm a significant infuence of P-gp expression on response rate or overall survival (Linn et al., 1997; Wang et al., 1997; Honkoop et al., 1998). Thus, the impact of P-gp expression on clinical outcome of breast cancer patients still remains open.

MRP1 encoding mRNA in 100% of breast cancer specimens by RT-PCR at expression levels comparable with normal tissues reinforces this point (Filipits et al., 1996; Dexter et al., 1998; Burger et al., 2003). An immunohistochemical study finding 34 % of breast cancer samples positive for MRP1 expression reported a correlation between MRP1 expression and relapse-free Table 1: Recent expression analyzes of drug resistancemediating factors in breast cancer Study P-gp (ABCB1) Burger et al., 2003 Faneyte et al., 2001 Arnal et al., 2000 Yang et al., 1999 Dexter et al., 1998 Linn et al., 1997 Filiptis et al., 1996 MRP1 (ABCC1) Burger et al., 2003 Dexter et al., 1998 Linn et al., 1997 Nooter et al., 1997 Filiptis et al., 1996 MRP2 (ABCC2) Burger et al., 2003 BCRP (ABCG2) Faneyte et al., 2002 Burger et al., 2003 YB-1 Janz et al., 2002 Saji et al., 2003 MVP (LRP) Burger et al., 2003 Pohl et al., 1999 Linn et al., 1997

B. MRP1 (ABCC1) The second major ABC-transporter involved in MDR of human cancers was first described in 1992 (Cole et al., 1992). This 190 kDa ABC-transporter was found to be over-expressed in a doxorubicin-selected lung cancer cell line and originally named â&#x20AC;&#x153;MDR-associated proteinâ&#x20AC;?, MRP. Due to the identification of various homologous proteins to MRP (Borst et al., 2000), it is now designated as MRP1 or ABCC1. In addition to the [TMD-NBT]2 configuration of P-gp, MRP1 has an additional TMD0 domain consisting of 5 TM !-helices attached to the Nterminal forming a [TMD0(TMD-NBT)2] configuration. Anticancer drug substrates for MRP1 include anthracyclines and methotrexate commonly used for treatment of breast cancer, and Vinca alkaloids, and epipodophyllotoxins, (Jedlitschky et al., 1996). Since MRP1 is expressed ubiquitously in normal human tissues, it is not surprising detecting MRP1 expression in neoplastic tissue including breast cancer. Finding of the

Expression [%]

Method

4 high; 54 low

RT-PCR

140 30 40

71 (cytoplasm) 100 low 92-100

IHC RT-PCR RT-PCR

106 33 31 31 40

IHC RT-PCR IHC RT-PCR RT-PCR

134 63

0 39 6 100 low 64 before CT; 57 after CT 60 9 strong; 48 weak

27 high; 31 low

RT-PCR

31 31 40

IHC RT-PCR RT-PCR

259

100 100 low 20 before CT; 56 after CT 34

134 63

100 24 strong; 76 weak

RT-PCR IHC

23 high; 32 low

RT-PCR

52 59

100 (variable levels) 0 29 high; 71 low

RT-PCR IHC RT-PCR

IHC

100

IHC

17 high; 41 low

RT-PCR

21 high; 47 intermediate; 20 low 71 before CT; 69 after CT

IHC

RT-PCR IHC

IHC

RT-PCR

IHC, immunohistochemistry; RT-PCR, reverse transcriptase polymerase chain reaction; CT, chemotherapy.

Cancer Therapy Vol 1, page 85 Table 2: Human ABC-transporters associated with drug resistance ABC-transporter HUGO Common names nomenclature ABCA2 ABCA2

Physiological substrates

Drugs

References

steroids

estramustine

Laing et al., 1998; Vulevic et al., 2001 Ling, 1997; Ueda et al., 1999

P-gp, P-170, MDR1, PGY1

ABCB1

phospholipids, neutral and cationic organic compounds

TAP1

ABCB2

peptides

TAP2

ABCB3

peptides

MDR3, PGY3

ABCB4

phosphatidylcholine

anthracyclines, Vinca alkaloids, epipodophyllotoxines, taxanes, antibiotics, and many others mitoxantrone, epipodophyllotoxins mitoxantrone, epipodophyllotoxins paclitaxel, Vinca alkaloids

BSEP, SPGP, ABC16, PGY4 MRP, MRP1

ABCB11

bile salts

paclitaxel

ABCC1

glutathion-, and other conjugates, organic anions, leukotrienes

MRP2, cMOAT

ABCC2

glutathion-, and other conjugates, organic anions, leukotriene C4

MRP3, MOAT-D, MLP2

ABCC3

glucuronides, bile salts, peptides

MRP4, MOAT-B

ABCC4

organic anions

anthracyclines, Vinca alkaloids, epipodophyllotoxins, methotrexate platin-drugs, anthracyclines, Vinca alkaloids, epipodophyllotoxins, camptothecins, methotrexate Vinca alkaloids, epipodophyllotoxins, methotrexate nucleotide analoga, methotrexate

MRP5, MOAT-C

ABCC5

BCRP, MXR, ABCP

ABCG2

organic anions, cyclic nucleotides prazosin

nucleotide analoga mitoxantrone, anthracyclines, camptothecins, topotecan

Izquierdo et al., 1996a; Lage et al., 2001 Izquierdo et al., 1996a; Lage et al., 2001 Ruetz et al., 1994; Gottesman et al., 2002 Childs et al., 1998; Gerloff et al., 1998 Cole et al., 1992; Jedlitschky et al., 1996; Borst et al., 2000; Taniguchi et al., 1996; Cui et al., 1999; König et al., 1999 de Jong et al., 2001; Kool et al., 1999; Zeng et al., 1999 Schuetz et al., 1999; Chen et al., 2001; Chen et al., 2002 Jedlitschky et al. 2000; Wijnholds et al., 2000 Doyle et al., 1998; Allikmets et al., 1998; Miyake et al., 1999; Lage and Dietel, 2000

have a role in clinical MDR of breast cancer treated with anthracyclineor methotrexate -containing chemotherapeutic regimes. However, there are only sporadic data available concerning to MRP2 expression in breast cancer. So far, a RT-PCR-basing study demonstrated no correlation between clinical outcome and MRP2 mRNA expression level (Burger et al., 2003). These preliminary data suggest that the importance of MRP2 in breast cancer remains uncertain and that further studies are necessary to clarify the role of MRP2 in drugresistant phenotypes of mammary carcinoma.

survival (Nooter et al., 1997), whereas a RT-PCR-based study reported that MRP1 expression merely correlated with progression-free survival in patients treated with anthracycline-based therapy regime (5-fluorouracil, adriamycin/epirubicin, and cyclophosphamide), but not in patients treated without anthracyclines (cyclophosphamide, methotrexate, 5-fluorouracil) (Burger et al., 2003). Thus, the role of MRP1 in clinical MDR of mammary carcinoma remains to be elucidated.

C. MRP2 (ABCC2) MRP2 (cMOAT / ABCC2) ehibiting a [TMD 0(TMDNBT)2] configuration, has been shown to be the bilirubin glucuronide transporter at the cannalicular membrane of the hepatocyte (König et al., 1999). MRP2 originally was found to be over-expressed in cisplatin-resistant cancer cells (Taniguchi et al., 1996). Moreover, transfection experiments demonstrated that MRP2 can confer resistance to the clinical important substance class of anthracyclines and methotrexate, as well as to platinum containing drugs, Vinca alkaloids, epipodophyllotoxins, and camptothecins (Cui et al., 1999). Thus, MRP2 may

D. Other MRPs (ABCC3 – ABCC6) Transfection experiments have shown that overexpression of MRP3 conferred resistance against Vinca alkaloids, epipodophyllotoxins, and methotrexate (Kool et al., 1999; Zeng et al., 1999). MRP4 was shown to confer resistance against nucleotide-based antiviral drugs as well as methotrexate (Schuetz et al., 1999; Chen et al., 2001; Chen et al., 2002). In addition, transfection studies demonstrated that MRP5 is able to mediate resistance against thiopurine anticancer drugs 6-mercaptopurine and

Lage: Drug resistance in breast cancer thioguanine and the anti-HIV drug 9-(2phosphonylmethoxyethyl)adenine (Wijnholds et al., 2000). Finally, there is no indication that MRP6 is associated with any form of drug resistance. However, so far there are no data available demonstrating an expression of these MRPs in breast cancer.

weak correlation between expression and drug-resistant phenotype. Thus, over-expression of ABC2 contributes to estramustine resistance (Laing et al., 1998) and that overexpression of both sub-units of the dimeric “transporter associated with antigen presentation” (TAP), TAP1 and TAP2, results in increased resistance against mitoxantrone or etoposide (Izquierdo et al., 1996a; Lage et al., 2001). However, so far there are no data available that these ABC-transport proteins play any role in drug resistance of breast cancer.

E. BCRP (ABCG2) Recently, the long sought mitoxantrone transporter was identified by 3 independent studies nearly contemporaneously. Since this ABC-transporter was identified in a breast cancer-derived cell line, it was designated as “breast cancer resistance protein” (BCRP) (Doyle et al., 1998). Alternative designations are “mitoxantrone resistance-associated protein” (MXR) (Miyake et al., 1999), “placenta-specific ABC gene” (Allikmets et al., 1999) or ABCG2 according to the suggestions of the HUGO, Human Gene Nomenclature Committee. The 72 kDa ABC-transporter is a so-called “half-transporter” with a [NBD-TMD] configuration that probably forms dimers to produce an active transport complex (Lage and Dietel, 2000). Up to the present, detection of BCRP in clinical samples of breast carcinoma was performed in three different studies using immunohistochemistry and/or RTPCR. The first study analyzed samples of 43 breast cancer patients by RT-PCR and found no correlation of BCRP mRNA expression and relapse or prognosis (Kanazaki et al., 2001). Faneyte et al. (2002) analyzed 52 breast cancer samples (25 primary breast carcinomas and 27 patients who received preoperative anthracycline-based chemotherapy) by RT-PCR and found widely varied BCRP mRNA expression levels, whereby no difference in BCRP mRNA expression between anthracycline-naive and treated tumor samples could be detected. Applying immunohistochemistry, BCRP was detected in normal breast epithelium and vessels but not in neoplastic cells. As a consequence, BCRP expression level was not associated with a decreased response or survival time. On the contrary, an alternative RT-PCR-based study analyzed 59 primary breast cancer specimens of patients who received either anthracycline-based (5-fluorouracil, adriamycin/epirubicin, cyclophosphamide) chemotherapy or a cyclophosphamide, methotrexate, 5-fluorouracil consisting regime as first-line systemic treatment after diagnosis of advanced disease. In the anthracycline-treated subgroup of patients, this study demonstrated a correlation between BCRP mRNA expression level and progressionfree survival (Burger et al., 2003). However, no correlation between the BCRP mRNA expression level and post-relapse overall survival was found. In conclusion, these preliminary data suggest that BCRP expression may have some predictive value for clinical outcome, but the role of BCRP in clinical drug-resistant breast cancer has to be investigated much more in detail.

IV. YB-1 YB-1, a member of the DNA-binding protein family, was initially reported as a transcription factor which interacts with the so-called Y-box - an inverted CCAAT box - region of the promoter of MHC class II genes (Didier et al. 1988). In vitro experiments using multidrugresistant MCF-7 breast carcinoma cells demonstrated that nuclear localization of this transcription factor regulates the transcriptional activity of the P-gp encoding mdr1 gene (Ohga et al., 1996). Immunohistochemistry demonstrated that in 27 out of 27 samples of untreated primary breast cancers, YB-1 was expressed in the cytoplasm although it was not detectable in normal surrounding breast tissue. In a subgroup of breast tumors (9 of 27), however, YB-1 was also localized in the nucleus and, in these cases, high levels of P-gp were present (Bargou et al., 1997). The data suggest that nuclear localization of YB-1 is associated with expression of P-gp and as a result with a MDR phenotype in breast carcinoma. There are contradictory data concerning the clinical relevance of nuclear YB-1 protein expression in breast cancer. An immunohistochemical study with 83 samples of breast cancer patients (41 patients treated with different chemotherapeutic regimens and 42 patients without any postoperative chemotherapy) reported that high YB-1 expression in neoplastic tissue and surrounding benign epithelial cells was significantly associated with poor patient outcome (Janz et al., 2002). In patients, who received postoperative chemotherapy, the 5-year relapse rate was 66% in patients with high YB-1 expression. In contrast, in patients with low YB-1 expression level, no relapse has been observed within that time. These data clearly suggest that YB-1 protein expression indicates clinical drug resistance in breast cancer and has prognostic and predictive significance. In marked contrast to these observations, an alternative immunohistochemical study using samples of 63 breast carcinoma specimens concluded that nuclear expression of YB-1 (and P-gp expression) may not be a useful prognostic marker in breast carcinoma (Saji et al., 2003). However, patients in this study underwent mastectomy and the influence of YB1 expression on chemotherapeutic responding rate - if there has been any chemotherapy – has not been analyzed. Thus, the impact of YB-1 expression on clinical drug resistance of mammary carcinoma remains a promising topic.

F. Other ABC-transporters The remaining human ABC-transporters that were demonstrated to be able to transport drugs, exhibit only a 86

Cancer Therapy Vol 1, page 87 others. On the contrary, these studies found no significant difference in Topo II mRNA levels in breast cancer patients between relapsed and nonrelapsed groups (Efferth et al., 1992; Ito et al., 1998). Drug resistance can result from defective cellular signal transduction pathways leading to apoptosis. Defects may be the consequence of malignant transformation; e.g. in cancers with mutant or non-functional p53 (Lowe et al., 1993). Furthermore, cancer cells may acquire deficiencies in apoptotic pathways during exposure to anticancer drugs, such as alterations of ceramide levels (Liu et al., 2001) or alterations in the cell cycle machinery that regulate checkpoints and prevent initiation of programmed cell death. MDR can also result from coordinately regulated detoxifying cellular systems, such as DNA repair pathways, e.g. enhanced activity of O6-methylguanineDNA methyltransferase (MGMT) (Pegg et al., 1990) or alterations in the DNA mismatch repair (MMR) system (Lage and Dietel, 1999). Furthermore, activation of the system of the cytochrome P450 mixed-function oxidases can mediate a drug-resistant phenotype. A coordinate induction of P-gp and cytochrome P450 3A has been reported (Schuetz et al., 1996). However, all those data have not been consistent, and studies using specimens of human breast cancer have not yet confirmed a link with clinical drug resistance (Symmans, 2001).

V. Major vault protein (MVP) Another MDR-associated factor included in many clinical studies is MVP, the “major vault protein” also known as LRP (“lung resistance protein”). MVP is an integral part of the vault complex that is found in the cytoplasm and in the nuclear membrane (Scheffer et al., 2000). Vaults are the largest ribonucleoprotein particles known so far (13 MDa); they are almost ubiquitously expressed at the highest levels in potentially toxin-exposed epithelia of the gastrointestinal tract and in macrophages (Izquierdo et al., 1996b). It has been reported that vaults are involved in the intracellular distribution of chemotherapeutic agents including anthracyclines (Dalton et al., 1999). Thought to mediate redistribution of anticancer drugs away from their targets in the nucleus, MVP expression may be coordinately regulated with ABC-transporters such as P-gp or MRP1 although direct evidence that this is the case is lacking. Clinical data indicate that MVP is often expressed in human malignancies and that the expression level may be associated with poor response to chemotherapeutic treatment in ovarian carcinoma and acute myelogenous leukemia (AML) (Dalton et al., 1999; Scheffer et al., 2000). Studies on MVP expression in breast cancer are limited. The available data showed by immunohistochemistry that MVP is frequently expressed in primary breast cancer, but its expression level was independent to response to chemotherapy or survival (Linn et al., 1997; Pohl et al., 1999). A recent study applying a RT-PCR-based MVP detection protocol reported that high expression level of MVP mRNA was found to be significantly associated with poor progression-free survival in anthracycline-treated patients but not in a subgroup of patients who received an chemotherapeutic regime without anthracyclines (Burger et al., 2003). In conclusion, MVP may have some predictive value for clinical outcome of breast carcinoma patients, but its role has to be confirmed in additional studies.

V. Additional mechanisms

drug

VI. Conclusions For overcoming therapy resistance of mammary carcinoma the mechanisms that are involved have to be elucidated. In the case of a monocausal drug resistance mechanism, such as the overexpression of an ABCtransporter, a disruption of drug extrusion results in a resensitization of tumor cells to treatment with antineoplastic agents, and therewith may allow a successful drug treatment of the multidug-resistant cancer cells. Pharmacologically active drug resistance-reversing compounds are designated as MDR modulators or chemosensitizers. One obstacle in applying MDR modulators arised from their commonly occurring intrinsic toxicity at doses necessary to be active, e.g. heart failure, hypotension, hyperbilirubinemia, bone-marrow and neurological toxicity. Additionally, tumor cells can develop resistance against the applied chemosensitizers, a so-called tertiary resistance. However, with recognition of the problems of potency and pharmacokinetic interactions, so far the third-generation of MDR-modulators (e.g. XR9576, R-101933, LY-335979, OC144-093) has been developed and was applied in the first clinical trials (Gottesman et al., 2002). Although, several mechanisms have been identified to contribute to clinical drug-resistance of breast carcinoma, hitherto the problem of therapy resistance against anti cancer drugs was not vanquished. An important problem is the principle that neoplastic tissues including breast carcinoma cells are genetically heterogenous. Although this phenomenon occurs as a

resistance

Resistance to antineoplastic agents clinically applied for the treatment of breast carcinoma can also be mediated by additional mechanisms. A mechanism that has been identified to contribute to drug resistance in cancer is mediated by a decreased activity of the nuclear enzyme DNA topoisomerase II (Topo II) (Danks et al., 1988). In mammalian cells two Topo II isoforms, the 170 kDa Topo II! and the 180 kDa Topo II" exist as homodimers. Drug resistance phenotypes due to decreased expression and activity of Topo II isoforms have been described for several drug-resistant cancer cell lines derived from various tissues including breast cancer cells (Sinha et al., 1988). One study analyzing specimens of 15 cases of breast carcinoma concluded that Topo II mRNA expression level might be a useful marker of clinical response to anthracyline treatment in breast cancer patients (Kim et al., 1991). However, these conclusions could not be confirmed by 87

Lage: Drug resistance in breast cancer Chen ZS, Lee K, and Kruh GD (2001) Transport of cyclic nucleotides and estradiol 17-beta-D-glucuronide by multidrug resistance protein 4. Resistance to 6mercaptopurine and 6-thioguanine. J Biol Chem 276, 3374733754.

result of uncontrolled cell growth in the cancerous tissue and favors clonal expansion, tumor cells that are exposed to anticancer drugs will be selected for their ability to survive and grow in the presence of antineoplastic agents. Thus, in any population of cancer cells that underwent chemotherapeutic treatment, more than one mechanismof drug resistance may be active. In other words, the clinical drug resistance of breast carcinoma probably represents a multifactorial multidrug resistance phenomenon. Hence, the needful strategy for overcoming drug resistance has to target various drug resistance mediating factors simultaneously, e.g. by the development of “multispecific” inhibitors, such as the acridinecarboxamide derivative GF120918 that reverses P-gp-mediated MDR as well as BCRP-mediated resistance (de Bruin et al., 1999). Moreover, it may be a promisingly strategy to inhibit upstream factors of drug resistance-mediating mechanisms. One possible upstream factor represents the Y-box transcription factor YB-1. Besides the regulation of the P-gp encoding mdr1 gene, in vitro data suggest that YB-1 can induce the activation of alternative MDR factors such as MRP1 (Stein et al., 2001). Thus, the identification of additional upstream factors regulating the activity of MDR-mediating genes in breast cancer is of urgent need.

Chen ZS, Lee K, Walther S, Raftogianis RB, Kuwano M, Zeng H, and Kruh GD (2002) Analysis of methotrexate and folate transport by multidrug resistance protein 4 (ABCC4): MRP4 is a component of the methotrexate efflux system. Cancer Res 62, 3144-3150. Chevillard S, Pouillart P, Beldjord C, Asselain B, Beuzeboc P, Magdelenat H, and Vielh P (1996) Sequential assessment of multidrug resistance phenotype and measurement of S-phase fraction as predictive markers of breast cancer response to neoadjuvant chemotherapy. Cancer 77, 292-300. Childs S, Yeh RL, Hui D, and Ling V (1998) Taxol resistance mediated by transfection of the liver-specific sister gene of P-glycoprotein. Cancer Res 58, 4160-4167. Chung HC, Rha SY, Kim JH, Roh JK, Min JS, Lee KS, Kim BS, and Lee KB (1997) P-glycoprotein: the intermediate end point of drug response to induction chemotherapy in locally advanced breast cancer. Breast Cancer Res Treat 42, 6572. Cole SP, Bhardwaj G, Gerlach JH, Mackie JE, Grant CE, Almquist KC, Stewart AJ, Kurz EU, Duncan AM, and Deeley RG (1992) Overexpression of a transporter gene in a multidrug-resistant human lung cancer cell line. Science 258, 1650-1654.

Acknowledgements

Cui Y, König J, Buchholz JK, Spring H, Leier I, and Keppler D (1999) Drug resistance and ATP-dependent conjugate transport mediated by the apical multidrug resistance protein, MRP2, permanently expressed in human and canine cells. Mol Pharmacol 55, 929-937.

Own work in this field has been supported by the “Deutsche Forschungsgemeinschaft” (DFG) (grants no. LA 1039/1-3, LA 1039/2-1), and the “Deutsche Krebshilfe” (grant no. 10-1628-La 4).

Dalton WS, and Scheper RJ (1999) Lung resistance-related protein: determining its role in multidrug resistance. J Natl Cancer Inst 91, 1604-1605. Danks MK, Schmidt CA, Cirtain MC, Suttle DP, and Beck WT (1988) Altered catalytic activity of and DNA cleavage by DNA topoisomerase II from human leukemic cells selected for resistance to VM-26. Biochemistry 27, 8861-8869.

References Allikmets R, Schriml LM, Hutchinson A, Romano-Spica V, and Dean M (1998) A human placenta-specific ATP-binding cassette gene (ABCP) on chromosome 4q22 that is involved in multidrug resistance. Cancer Res 58, 5337-5539. Arnal M, Franco N, Fargeot P, Riedinger JM, Brunet-Lecomte P, and Lizard-Nacol S (2000) Enhancement of mdr1 gene expression in normal tissue adjacent to advanced breast cancer. Breast Cancer Res Treat 61, 13-20.

Dean M, Rzhetsky A, and Allikmets R (2001) The human ATPbinding cassette (ABC) transporter superfamily. Genome Res 11, 1156-1166. de Bruin M, Miyake K, Litman T, Robey R, and Bates SE (1999) Reversal of resistance by GF120918 in cell lines expressing the ABC half-transporter, MXR. Cancer Lett 146, 117-126. de Jong MC, Slootstra JW, Scheffer GL, Schroeijers AB, Puijk WC, Dinkelberg R, Kool M, Broxterman HJ, Meloen RH, and Scheper RJ (2001) Peptide transport by the multidrug resistance protein MRP1. Cancer Res 61, 2552-2557. Dexter DW, Reddy RK, Geles KG, Bansal S, Myint MA, Rogakto A, Leighton JC, and Goldstein LJ (1998) Quantitative reverse transcriptase-polymerase chain reaction measured expression of MDR1 and MRP in primary breast carcinoma. Clin Cancer Res 4, 1533-1542. Didier DK, Schiffenbauer J, Woulfe SL, Zacheis M, and Schwartz BD (1988) Characterization of the cDNA encoding a protein binding to the major histocompatibility complex class II Y box. Proc Natl Acad Sci USA 85, 7322-7326.

Bargou RC, Jurchott K, Wagener C, Bergmann S, Metzner S, Bommert K, Mapara MY, Winzer KJ, Dietel M, Dorken B, and Royer HD (1997) Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat Med 3, 447-450. Biedler JL, and Riehm H (1970) Cellular resistance to actinomycin D in Chinese hamster cells in vitro: crossresistance, radioautographic, and cytogenetic studies. Cancer Res 30, 1174-1184. Borst P, Evers R, Kool M, and Wijnholds J (2000) A family of drug transporters: the multidrug resistance-associated proteins. J Natl Cancer Inst 92, 1295-1302. Burger H, Foekens JA, Look MP, Meijer-van Gelder ME, Klijn JG, Wiemer EA, Stoter G, and Nooter K (2003) RNA expression of breast cancer resistance protein, lung resistance-related protein, multidrug resistance-associated proteins 1 and 2, and multidrug resistance gene 1 in breast cancer: correlation with chemotherapeutic response. Clin Cancer Res 9, 827-836.

Doyle LA, Yang W, Abruzzo LV, Krogmann T, Gao Y, Rishi AK, and Ross DD (1998) A multidrug resistance transporter from human MCF-7 breast cancer cells. Proc Natl Acad Sci USA 95, 15665-15670.

Cancer Therapy Vol 1, page 89 Efferth T, Mattern J, and Volm M (1992) Immunohistochemical detection of P glycoprotein, glutathione S transferase and DNA topoisomerase II in human tumors. Oncology 49, 368375.

lung resistance protein in normal human tissues and tumors. Am J Pathol 148, 877-887. Janz M, Harbeck N, Dettmar P, Berger U, Schmidt A, JĂźrchott K, Schmitt M, and Royer HD (2002) Y-box factor YB-1 predicts drug resistance and patient outcome in breast cancer independent of clinically relevant tumor biologic factors HER2, uPA and PAI-1. Int J Cancer 97, 278-282.

Faneyte IF, Kristel PM, Maliepaard M, Scheffer GL, Scheper RJ, Schellens JH, and van de Vijver MJ (2002) Expression of the breast cancer resistance protein in breast cancer. Clin Cancer Res 8, 1068-1074. Faneyte IF, Kristel PM, and van de Vijver MJ (2001) Determining MDR1/P-glycoprotein expression in breast cancer. Int J Cancer 93, 114-122.

Jedlitschky G, Leier I, Buchholz U, Barnouin K, Kurz G, and Keppler D (1996) Transport of glutathione, glucuronate, and sulfate conjugates by the MRP gene-encoded conjugate export pump. Cancer Res 56, 988-994.

Filipits M, Suchomel RW, Dekan G, Haider K, Valdimarsson G, Depisch D, and Pirker R (1996) MRP and MDR1 gene expression in primary breast carcinomas. Clin Cancer Res 2, 1231-1237. Gerlach JH, Bell DR, Karakousis C, Slocum HK, Kartner N, Rustum YM, Ling V, and Baker RM (1987) P-glycoprotein in human sarcoma: evidence for multidrug resistance. J Clin Oncol 5, 1452-1460.

Jedlitschky G, Burchell B, and Keppler D (2000) The multidrug resistance protein 5 functions as an ATP-dependent export pump for cyclic nucleotides. J Biol Chem 275, 3006930074. Kanzaki A, Toi M, Nakayama K, Bando H, Mutoh M, Uchida T, Fukumoto M, and Takebayashi Y (2001) Expression of multidrug resistance-related transporters in human breast carcinoma. Jpn J Cancer Res 92, 452-458.

Gerloff T, Stieger B, Hagenbuch B, Madon J, Landmann L, Roth J, Hofmann AF, and Meier PJ (1998) The sister of Pglycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 273, 10046-10050.

Keith WN, Stallard S, and Brown R (1990) Expression of mdr1 and gst-pi in human breast tumours: comparison to in vitro chemosensitivity. Br J Cancer 61, 712-716. Kelsey JL, and Berkowitz GS (1988) Breast cancer epidemology. Cancer Res 48, 5615-5623.

Goldstein LJ, Galski H, Fojo A, Willingham M, Lai SL, Gazdar A, Pirker R, Green A, Crist W, and Brodeur GM (1989) Expression of a multidrug resistance gene in human cancers. J Natl Cancer Inst 81, 116-124. Gottesman MM, Fojo T, and Bates SE (2002) Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2, 48-58.

Kim R, Hirabayashi N, Nishiyama M, Saeki S, Toge T, and Okada K (1991) Expression of MDR1, GST-pi and topoisomerase II as an indicator of clinical response to adriamycin. Anticancer Res 11, 429-431. KĂśnig J, Nies AT, Cui Y, Leier I, and Keppler D (1999) Conjugate export pumps of the multidrug resistance protein (MRP) family: localization, substrate specificity, and MRP2mediated drug resistance. Biochim Biophys Acta 1461, 377394.

Harris JR, Morrow M, and Bonadonna G (1993) Cancer of the breast. In: DeVita VT Jr, Hellman S, Rosenberg SA, eds. Cancer, Priciples and Practice of Oncology. Philadelphia: Lippincott, pp. 1264-1332. Harris JR, Lippman ME, Morrow M, and Osborne CK (1993) Treatment of metastatic breast cancer. In: Harris JR, Lippmann ME, Morrow M, eds. Diseases of the breast. Philadelphia: Lippincott Williams & Wilkens, p. 749.

Kool M, van der Linden M, de Haas M, Scheffer GL, de Vree JM, Smith AJ, Jansen G, Peters GJ, Ponne N, Scheper RJ, Elferink RP, Baas F, and Borst P (1999) MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl Acad Sci USA 96, 6914-6919.

Honkoop AH, van Diest PJ, de Jong JS, Linn SC, Giaccone G, Hoekman K, Wagstaff J, and Pinedo HM (1998) Prognostic role of clinical, pathological and biological characteristics in patients with locally advanced breast cancer. Br J Cancer 77, 621-626. Hortobagyi GN (2001) Overview of treatment results with trastuzumab (Herceptin) in metastatic breast cancer. Semin Oncol 288, 43-47. Hyde SC, Emsley P, Hartshorn MJ, Mimmack MM, Gileadi U, Pearce SR, Gallagher MP, Gill DR, Hubbard RE, and Higgins CF (1990) Structural model of ATP-binding proteins associated with cystic fibrosis, multidrug resistance and bacterial transport. Nature 346, 362-365.

Lage H (2003) ABC-transporters: implications on drug resistance from microorganisms to human cancers. Int J Antimicrob Agents, in press Lage H, and Dietel M (1999) Involvement of the DNA mismatch repair system in antineoplastic drug resistance. J Cancer Res Clin Oncol 125, 156-165.

Ito K, Fujimori M, Nakata S, Hama Y, Shingu K, Kobayashi S, Tsuchiya S, Kohno K, Kuwano M, and Amano J (1998) Clinical significance of the increased multidrug resistanceassociated protein (MRP) gene expression in patients with primary breast cancer. Oncol Res 10, 99-109.

Laing NM, Belinsky MG, Kruh GD, Bell DW, Boyd JT, Barone L, Testa JR, and Tew KD (1998) Amplification of the ATPbinding cassette 2 transporter gene is functionally linked with enhanced efflux of estramustine in ovarian carcinoma cells. Cancer Res 58, 1332-1337.

Izquierdo MA, Neefjes JJ, Mathari AE, Flens MJ, Scheffer GL, and Scheper RJ (1996a) Overexpression of the ABC transporter TAP in multidrug-resistant human cancer cell lines. Br J Cancer 74, 1961-1967. Izquierdo MA, Scheffer GL, Flens MJ, Giaccone G, Broxterman HJ, Meijer CJ, van der Valk P, and Scheper RJ (1996b) Broad distribution of the multidrug resistance-related vault

Lander ES, Linton LM, Birren B, et al; International Human Genome Sequencing Consortium (2001) Initial sequencing and analysis of the human genome. Nature 409, 860-921.

Lage H, and Dietel M (2000) Effect of the breast-cancer resistance protein on atypical multidrug resistance. Lancet Oncol 1, 169-175. Lage H, Perlitz C, Abele R, Tampe R, Dietel M, Schadendorf D, and Sinha P (2001) Enhanced expression of human ABCtransporter TAP is associated with cellular resistance to mitoxantrone. FEBS Lett 503, 179-184.

Ling V (1997) Multidrug resistance: molecular mechanisms and clinical relevance. Cancer Chemother Pharmacol 40 Suppl, S3-S8.

Lage: Drug resistance in breast cancer Linn SC, Pinedo HM, van Ark-Otte J, van der Valk P, Hoekman K, Honkoop AH, Vermorken JB, and Giaccone G (1997) Expression of drug resistance proteins in breast cancer, in relation to chemotherapy. Int J Cancer 71, 787-795.

Schneider J, Bak M, Efferth T, Kaufmann M, Mattern J, and Volm M (1989) P-glycoprotein expression in treated and untreated human breast cancer. Br J Cancer 60, 815-818. Schuetz EG, Beck WT, and Schuetz JD (1996) Modulators and substrates of P-glycoprotein and cytochrome P4503A coordinately up-regulate these proteins in human colon carcinoma cells. Mol Pharmacol 49, 311-318.

Liu YY, Han TY, Giuliano AE, and Cabot MC (2001) Ceramide glycosylation potentiates cellular multidrug resistance. FASEB J 15, 719-730. Lowe SW, Ruley HE, Jacks T, and Housman DE (1993) p53dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell 74, 957-967. Merkel DE, Fuqua SA, Tandon AK, Hill SM, Buzdar AU, and McGuire WL (1989) Electrophoretic analysis of 248 clinical breast cancer specimens for P-glycoprotein overexpression or gene amplification. J Clin Oncol 7, 1129-1136.

Schuetz JD, Connelly MC, Sun D, Paibir SG, Flynn PM, Srinivas RV, Kumar A, and Fridland A (1999) MRP4: A previously unidentified factor in resistance to nucleoside-based antiviral drugs. Nat Med 5, 1048-1051. Sinha BK, Haim N, Durse L, Kerrigan D, and Pommier Y (1988) DNA strand breaks produced by etoposide (VP-16,213) in sensitive and resistant human breast tumor cells: implications for the mechanisms of action. Cancer Res 48, 5096-5100. Stein U, J端rchott K, Walther W, Bergmann S, Schlag PM, and Royer HD (2001) Hyperthermia-induced nuclear translocation of transcription factor YB-1 leads to enhanced expression of multidrug resistance-related ABC transporters. J Biol Chem 276, 28562-28569. Sugawara I, Kataoka I, Morishita Y, Hamada H, Tsuruo T, Itoyama S, and Mori S (1988) Tissue distribution of Pglycoprotein encoded by a multidrug-resistant gene as revealed by a monoclonal antibody, MRK 16. Cancer Res 48, 1926-1929. Symmans WF (2001) Breast cancer response to paclitaxel in vivo. Drug Res Updates 4, 297-302. Taniguchi K, Wada M, Kohno K, Nakamura T, Kawabe T, Kawakami M, Kagotani K, Okumura K, Akiyama S, and Kuwano M (1996) A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant human cancer cell lines with decreased drug accumulation. Cancer Res 56, 4124-4129.

Miyake K, Mickley L, Litman T, Zhan Z, Robey R, Cristensen B, Brangi M, Greenberger L, Dean M, Fojo T, and Bates SE (1999) Molecular cloning of cDNAs which are highly overexpressed in mitoxantrone-resistant cells: demonstration of homology to ABC transport genes. Cancer Res 59, 8-13. Nooter K, Brutel de la Riviere G, Look MP, van Wingerden KE, Henzen-Logmans SC, Scheper RJ, Flens MJ, Klijn JG, Stoter G, and Foekens JA (1997) The prognostic significance of expression of the multidrug resistance-associated protein (MRP) in primary breast cancer. Br J Cancer 76, 486-493. Ohga T, Koike K, Ono M, Makino Y, Itagaki Y, Tanimoto M, Kuwano M, and Kohno K. (1996) Role of the human Y boxbinding protein YB-1 in cellular sensitivity to the DNAdamaging agents cisplatin, mitomycin C, and ultraviolet light. Cancer Res 56, 4224-4228. Osborne CK (1998) Tamoxifen in the treatment of breast cancer. New Eng J Med 339, 1609-1618. Pegg AE (1990) Mammalian O6-alkylguanine-DNA alkyltransferase: Regulation and importance in response to alkylating carcinogenic and therapeutic agents. Cancer Res 50, 6119-6129.

Trock BJ, Leonessa F, and Clarke R (1997) Multidrug resistance in breast cancer: a meta-analysis of MDR1/gp170 expression and its possible functional significance. J Natl Cancer Inst 89, 917-931.

Pohl G, Filipits M, Suchomel RW, Stranzl T, Depisch D, and Pirker R (1999) Expression of the lung resistance protein (LRP) in primary breast cancer. Anticancer Res 1999 19, 5051-5055. Riordan JR, and Ling V (1979) Purification of P-glycoprotein from plasma membrane vesicles of Chinese hamster ovary cell mutants with reduced colchicine permeability. J Biol Chem 254, 12701-12705. Ro J, Sahin A, Ro JY, Fritsche H, Hortobagyi G, and Blick M (1990) Immunohistochemical analysis of P-glycoprotein expression correlated with chemotherapy resistance in locally advanced breast cancer. Hum Pathol 21, 787-791.

Ueda K, Yoshida A, and Amachi T (1999) Recent progress in Pglycoprotein research. Anticancer Drug Des 14, 115-121. Venter JC, Adams MD, Myers EW et al(2001) The sequence of the human genome. Science 291, 1304-1351. Verrelle P, Meissonnier F, Fonck Y, Feillel V, Dionet C, Kwiatkowski F, Plagne R, and Chassagne J (1991) Clinical relevance of immunohistochemical detection of multidrug resistance P-glycoprotein in breast carcinoma. J Natl Cancer Inst 83, 111-116. Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN, Fehrenbacher L, Slamon DJ, Murphy M, Novotny WF, Burchmore M, Shak S, Stewart SJ, and Press M (2002) Efficacy and safety of trastuzumab as a single agent in firstline treatment of HER2-overexpressing metastatic breast cancer. J Clin Oncol 20, 719-726.

Ruetz S, and Gros P (1994) Phosphatidylcholine translocase: a physiological role for the mdr2 gene. Cell 77, 1071-1081. Saji H, Toi M, Saji S, Koike M, Kohno K, and Kuwano M (2003) Nuclear expression of YB-1 protein correlates with Pglycoprotein expression in human breast carcinoma. Cancer Lett 190, 191-197. Sanfilippo O, Ronchi E, De Marco C, Di Fronzo G, and Silvestrini R (1991) Expression of P-glycoprotein in breast cancer tissue and in vitro resistance to doxorubicin and vincristine. Eur J Cancer 27, 155-158. Scheffer GL, Schroeijers AB, Izquierdo MA, Wiemer EA, and Scheper RJ (2000) Lung resistance-related protein/major vault protein and vaults in multidrug-resistant cancer. Curr Opin Oncol 12, 550-556.

Vulevic B, Chen Z, Boyd JT, Davis W Jr, Walsh ES, Belinsky MG, and Tew KD (2001) Cloning and characterization of human adenosine 5'-triphosphate-binding cassette, subfamily A, transporter 2 (ABCA2). Cancer Res 61, 33393347. Walker JE, Saraste M, Runswick MJ, and Gay NJ (1982) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1, 945-951. Wallner J, Depisch D, Hopfner M, Haider K, Spona J, Ludwig H, and Pirker R (1991) MDR1 gene expression and prognostic

Cancer Therapy Vol 1, page 91 factors in primary breast carcinomas. Eur J Cancer 27, 1352-1355. Wang CS, LaRue H, Fortin A, Gariepy G, and Tetu B (1997) mdr1 mRNA expression by RT-PCR in patients with primary breast cancer submitted to neoadjuvant therapy. Breast Cancer Res Treat 45, 63-74. Wijnholds J, Mol CA, van Deemter L, de Haas M, Scheffer GL, Baas F, Beijnen JH, Scheper RJ, Hatse S, De Clercq E, Balzarini J, and Borst P (2000) Multidrug-resistance protein 5 is a multispecific organic anion transporter able to transport nucleotide analogs. Proc Natl Acad Sci USA 97, 7476-7481.

transporter-D) in human embryonic kidney 293 cells confers resistance to anticancer agents. Cancer Res 59, 5964-5967.

Wishart GC, Plumb JA, Going JJ, McNicol AM, McArdle CS, Tsuruo T, and Kaye SB (1990) P-glycoprotein expression in primary breast cancer detected by immunocytochemistry with two monoclonal antibodies. Br J Cancer 62, 758-761. Yang X, Uziely B, Groshen S, Lukas J, Israel V, Russell C, Dunnington G, Formenti S, Muggia F, Press and MF (1999) MDR1 gene expression in primary and advanced breast cancer. Lab Invest 79, 271-280.

Dr. Hermann Lage

Zeng H, Bain LJ, Belinsky MG, and Kruh GD (1999) Expression of multidrug resistance protein-3 (multispecific organic anion

Lage: Drug resistance in breast cancer

Cancer Therapy Vol 1, page 93 Cancer Therapy Vol 1, 93-101, 2003.

Screening for lung cancer: a review and current status Review Article

Debora S. Bruno and William Tester* Albert Einstein Cancer Center, 5501 Old York Road, Philadelphia, PA 19141

__________________________________________________________________________________ *Correspondence: William Tester, MD, FACP, Albert Einstein Cancer Center, 5501 Old York Road, Philadelphia, PA 19141; Tel: 215-456-3800; e-mail: testerb@einstein.edu Key words: lung cancer, screening, spiral computed tomography, sputum immunocytochemistry Received: 05 May 2003; Accepted: 08 May 2003; electronically published: May 2003

Summary Lung cancer is the leading cause of cancer death in the USA. The overall 5-year survival rate for patients diagnosed with this disease is estimated at 15%. The major reason that the cure rate is so low is that the great majority of lung tumors are found at late stages. After the disappointing results of the National Cancer Institute sponsored trials in the 1970â&#x20AC;&#x2122;s, there was widespread acceptance that screening for lung cancer is not indicated, since none of the randomized screening trials demonstrated a reduction in cancer-related mortality. However, longer follow-up from these early studies does show that individuals who were screened and underwent surgery for early stage lung cancer did experience improved survival. Also, earlier detection has been associated with improved survival for patients with cervical and colon cancer. Some recent studies suggest that the use of newer screening tools may result in improved lung cancer mortality. The objectives of this paper are to review the older prospective screening studies, and to discuss the possible biases and study design flaws that might have affected the outcome of those screening trials. This work will also define populations considered to be at high risk for the development of lung cancer and that should most benefit from screening. The early results of trials employing new techniques for lung cancer screening such as spiral computed tomography, positron emission tomography (PET) scanning and sputum immunocytochemistry for the detection of potential curable lung cancers are presented. for curative treatment, it has been hoped that detection of early stage cancer in asymptomatic individuals can result in meaningful benefit (Mulshine et al, 1989).

I. Introduction Lung cancer is the leading cause of death from cancer in the USA, accounting for more deaths per year than cancers of the breast, colon, prostate, and cervix combined (Bach et al, 1999; Parkin et al, 1999). The American Cancer Society estimates there will be 169,500 new cases of lung cancer diagnosed in 2002 and 157,400 deaths (American Cancer Society, 2003). Lung cancer usually presents as an advanced, unresectable tumor and is usually fatal disease. It has been a challenge during the past decades to develop efficient screening tools and treatment for such an aggressive neoplasm. The overall survival at five years measured by the National Cancer Institute's Surveillance, Epidemiology, and End Results (SEER) program in the United States is 14%. For European countries, the average five-year survival is 8%, the same as for developing countries (Parkin et al, 1999; Black, 2000). However, for resectable patients with pathologic stage I non-small-cell lung cancer, 5-year survival rates range from 65 to 80% (Flehinger et al, 1992; Inoue et al, 1998). Since stage I disease has the potential

II. What population is under high risk for the development of lung cancer? The risks and benefits of screening methods make them applicable predominantly to high-risk populations, since costs and harms that they might generate can only be justified by a reduction in mortality for that specific cause screened. Factors that identify those at risk for lung cancer have been recognized through epidemiologic study over the past 30 years (Tockman et al, 1987). There are two categories of evidence that indicate smoking to be the major cause of human lung cancer. Without exception, epidemiological studies have demonstrated a consistent association between smoking and lung cancer in both genders. Also, chemical analyses of cigarette smoke reveal a multitude of known mutagens and carcinogens that are absorbed and metabolized, and 93

Bruno and Tester: Screening for lung cancer cause demonstrable genetic changes in smokers (Loeb et al, 1984; McLemore et al, 1990). Across studies, risk increases with: number of cigarettes smoked (the relative risk is 3.0 for 1 pack-per-day smokers), years smoked, earlier age at onset of cigarette smoking, degree of inhalation, tar and nicotine content of cigarettes smoked and use of nonfiltered compared with filtered cigarettes (Loeb et al, 1984). Lung cancer rates decrease when smoking is stopped and approaches those of people who have never smoked at 10 years after cessation (Garfinckel and Silverberg, 1991). A study from the United Kingdom evaluating the relationship between smoking, smoking cessation and lung cancer points to the fact that even people who stop smoking at 50 or 60 years of age avoid most of their subsequent risk of developing lung cancer, and those who stop at 30 years of age avoid more than 90% of the risk attributable to tobacco of those who continue to smoke (Peto et al, 2000). Advanced age is also considered a risk factor for lung cancer development. Tockman and colleagues (1987) reported a 2.8 relative risk for lung cancer for an age of greater than 59 years. Most screening programs to date have incorporated a minimum age cut-off of 45 years for recruitment of subjects to be screened. Among cigarette smokers, the presence of airways obstruction is a greater risk for the subsequent development of lung cancer than is age alone or the level of smoking. A measure of the forced expiratory volume in the first second (FEV1) of less than 60% of the predicted value is associated with a 6.4 times greater risk for lung cancer compared with the risk associated with the absence of ventilatory impairment (Tockman et al, 1987). One possible explanation could be that chronic obstructive pulmonary disease may interfere with the ability of the airways to eliminate inhaled carcinogens effectively (Cohen, 1980). In the presence of damaged bronchial mucosa and prolonged exposure to carcinogens, a carcinogenic effect would be enhanced. Occupational exposure is estimated to account for approximately 5% of lung cancer in the United States (Beckett, 2000) and the majority of these cancers are caused by asbestos, followed by radon, silica, chromium, cadmium, nickel, arsenic and beryllium. Among these, asbestos has received the most study (Weiss, 1999). Cigarette smoke and asbestos interact strongly in causing bronchogenic carcinomas and the evidence indicates that the presence of asbestosis is a much better predictor of excess lung cancer risk than measures of exposure to asbestos. Patients with resected stage I NSCLC (T1N0M0 and T2N0M0) have an annual incidence of a second primary lung cancer of 3-5% and this is an order of magnitude greater (10-fold greater) than the incidence experienced by the middle-aged, heavy smokers in the NCI Early Lung Cancer trial almost two decades ago (Mountain, 1997). Second primary lung cancer (SPLC) has been defined as a lung cancer, either of a different histologic cell type which appears within 2 years following resection of the index cancer, or as a tumor of the same cell type, that has characteristics of a primary lung cancer and arises in a

different lobe if it appears after 2 years following resection (Tockman et al, 1988). Since cured NSCLC patients exhibit such high rates of second lung cancer they might constitute an appropriate population for early detection and chemoprevention trials. Similarly, patients successfully treated for head and neck cancers and small cell lung cancer (SCLC) are at high risk for second primary lung cancer. Association of a squamous cell carcinoma of the head and neck and a pulmonary cancer is frequent: prevalence is about 5 to 10% (De Mones et al, 1999). Also, cured SCLC patients have one of the highest rates of second primary tumor (SPT) development, being SPTs the most common cause of cancer death 4 or more years after definitive primary therapy. SPTs occur most commonly in tobacco-exposed sites (i.e., lungs, esophagus and head and neck) (Lippman et al, 1994). Currently no available diagnostic procedure has yet been proven to be of significant value for general use in the early detection of lung cancer in these high-risk populations.

III. Early lung cancer detection - early trials Much research has been conducted to evaluate the effectiveness of various combinations of screening tests on lung cancer mortality. In the 1950s and 1960s, several uncontrolled and nonrandomized controlled studies evaluated various combinations of roentgenograms and cytology given at various time intervals, ranging up to once every 6 months. These studies failed to show a benefit from lung cancer screening (Eddy, 1989). The lack of success of those previous sputum cytologic screening programs has been attributed in part to the technical inability to localize the source of expectorated cancer cells in patients with negative chest roentgenograms (Berlin et al, 1984). With the development of the fiberoptic bronchoscope, localization of occult endobronchial neoplasms became possible and in the early 1970s it became feasible to design studies to determine whether a reduction in lung cancer mortality might be achieved by screening cytology and chest roentgenography (Berlin et al, 1984; Carbone et al, 1970). From 1971 to 1982, three National Cancer Institute sponsored studies on Screening for Early Lung Cancer were conducted at the Mayo Clinic, Johns Hopkins and Memorial Sloan-Kettering Cancer Center. Those studies enrolled a total of 31,360 men 45 years of age and older who smoked at least 1 pack of cigarettes per day or had smoked this amount within the year prior to enrollment. In the Mayo Clinic trial, all participants received chest roentgenograms and sputum cytologic examinations prior to random allocation into screened and control groups (Figure 1) (Fontana et al, 1984; Fontana et al, 1986; Sanderson, 1986). Those free of cancer were randomized to a study group (chest roentgenograms and sputum cytologic tests every 4 months), or a control group (recommendations for annual chest roentgenograms and sputum cytology, without efforts to assure compliance). 94

Cancer Therapy Vol 1, page 95 The study design unfortunately failed to establish that the control group was truly not screened. More than half of the control population underwent periodic screening, including recommendations described above. The Johns Hopkins and Memorial Sloan-Kettering studies randomly allocated their volunteers into “dual screen” and “X-ray only screen” groups (Figure 2) (Melamed et al, 1984; Tockman, 1986). The dual-screen group received an annual chest roentgenogram examination plus annual sputum cytologic testing followed by a 3-day collection of sputum for cytologic examination every 4 months. The “X-ray only” group received only annual chest roentgenograms. Results of the initial screen (prevalence) of the three trials showed that 2,815 patients were found to have indeterminate abnormalities on the screening roentgenograms or x-rays considered “suspicious for cancer”, indicating the need for further evaluation. From those patients, 120 (4.3%) were found to have lung cancer. Only 79 (0.4%) of the 21,127 men who received the dual screen had sputum examinations reported as showing either marked atypia or carcinoma cells. From those patients, 55 had lung cancer and 12 had cancer of the upper respiratory tract (predictive value of 85%). Of the 160 cases detected in the dual-

screen group, 67 (41%) would have been detected by cytologic examination alone and 123 (77%) by X-ray alone. Half of the lung cancers detected on dual screening (81 patients) were stage I. Those that were stage I and were resected had a 5-yr survival that was almost 80%. Of the 81 stage I lung cancers, approximately 60% were visible roentgenographically and nearly 40% were roentgenographically occult and detected by cytology alone. The early stage cancers detected by cytology alone were central squamous cell carcinomas. The most frequently encountered early-stage cancers detected by roentgenograms alone were peripheral adenocarcinomas. Only 9% of stage I cancers were detected by both techniques. It is clear that a higher proportion of early stage cancers were detected and that patients staged as I or II had a better 5-year survival than those in stage III. However, the three trials failed to demonstrate improved resectability or survival rates among the study groups compared to the controls. These trials did not produce lowered overall lung cancer mortality, which is considered the ultimate indicator of the effectiveness of a screening test.

Prevalence screening 10,933 male outpatients, smokers (1 ppd or more) Chest x-ray and sputum cytology

91 cases of lung cancer • 59 cases diagnosed by x-ray • 17 cases diagnosed by cytology • 15 cases diagnosed by both

9,211 men free of disease entered into prospective or incidence screening

Screening group: Chest x-ray and sputum cytology every 4 months

206 new “incidence” lung cancer cases, with 5-year survival rate of 40%

Figure 1: The Mayo Lung Project

Control group: Recommendations for annual chest x-ray and sputum cytology, without any efforts to assure compliance

160 new “incidence” lung cancer cases, with 5-year survival rate of 15%

Bruno and Tester: Screening for lung cancer

Prevalence screening 10,040 male smokers assigned to either dual screening or xray-only

Single screen with chest xrays detected 144 cases of lung cancer

Dual screen with chest x-ray annually plus sputum cytology detected 144 cases of lung cancer

73 resectable cancers, 40% stage I NSCLC

77 resectable cancers, 40% stage I NSCLC

5-year survival rates for both groups were equivalent: 35% 5-year survival for the stage I NSCLC: 76% Figure 2: The Memorial Sloan-Kettering Project

The Mayo Lung Project reported that the 5-year survival for patients who developed lung cancer was better in the screened group (40% versus 15%). However, with extended follow-up the overall lung cancer mortality for the entire population screened was not shown to be improved (Marcus et al, 2000). An analysis (Strauss, 2002) performed to determine which endpoint of that study (survival versus mortality) provides an unbiased measure of effectiveness shows that among resected patients, survival at 7 years was 50% (96% CI, 39% to 61%). The survival plateau demonstrated in the KaplanMeier survival curves argues in favor that overdiagnosis is not a confounder factor. In contrast, among those not undergoing resection, survival at 5 years was only 2% (95% CI, 1% to 8%). The author concluded that survival was superior in the screened population, and that this advantage was not attributable to lead-time bias, length bias, or overdiagnosis bias. Mortality though was biased, because incidence differences (30% higher incidence in the screened group) confounded the ability of mortality to reflect the true effect of screening.

The first of these is lead-time bias: patients who are diagnosed at an early stage in their illness may appear to survive longer than those diagnosed at a later stage only because the diagnosis is established for a longer period of time. Length bias is related to tendency of slow-growing tumors to be discovered during screening while fastgrowing tumors are more likely to become clinically evident between screening intervals. Length bias is expected to improve survival rates for those patients who had a better prognosis from the start. However, if any of these biases accounted for the favorable survival in the screened groups of the Mayo, Sloan-Kettering and Hopkins studies reported above, one would expect that the same stage I patients would have comparable survival even if they remained untreated. Fortunately, this data is available. Although the majority of patients in those studies diagnosed with a stage I non-small-cell lung cancer were treated by surgical resection, 5 to 21% of patients with stage I NSCLC failed to be treated surgically either because patients refused surgery or because there were medical contraindications to surgery. Flehinger (1992) described five-year survivals (with lung cancer death as an endpoint) for those who were operated on ranged from 52 to 62%, while for those who did not undergo surgery survival ranged from 0 to 8%. The third type of potential bias, and perhaps the only screening bias that can account for improvements in stage

IV. Possible Causes of Screening Biases In the evaluation of a screening program, several potential sources of bias must be considered: lead-time bias, length bias and overdiagnosis (MacLean, 1996). 96

Cancer Therapy Vol 1, page 97 distribution, resectability, survival, higher incidence, and equal mortality as end-point in a screened compared to a control population is overdiagnosis (Strauss et al, 1993; Strauss, 1997; Strauss et al, 1997). This term refers to the detection, by screening, of lesions that are not clinically significant and would not adversely affect the lifespan of a patient. It means that some of the slow growing cancers never would have been diagnosed in the absence of screening and those individuals would have died of another disease without their subclinical cancer being recognized (Parkin and Moss, 2000). This concept is especially applicable for slow-growing neoplasms such as prostate cancer. It is well known that the clinical incidence of this disease does not match the prevalence noted at autopsy, where more than 40% of men over 50 years of age are found to have carcinoma of the prostate, while 9.5% of 50 year-old men will actually develop clinically apparent disease over their lifetime (Fried et al, 1997). In a series of over 20,000 autopsies carried out over a 25-year period, 700 cancers (11%) were found in whom the diagnosis of cancer had not been considered relevant clinically (Karwinski et al, 1990). In over half of them the unrecognized tumor was considered an incidental finding, being kidney and prostate the main organs involved in those cases. In contrast, the unrecognized cancers that caused death were almost often from pancreas or lung. These patients tended to be older than those with clinically recognized disease. In conclusion, it seems that because of its biological behavior, lung cancer is unlikely to be an overdiagnosed neoplasm in screening programs.

under way (Tockman et al, 1994; Mulshine et al, 2000) In this study, eleven centers collaborated in the accrual of 1,000 patients with stage I NSCLC who had undergone complete resection. Any patient currently in follow-up 6 months or more after surgical resection, chemotherapy or radiotherapy performed an annual sputum induction. The MoAbs examined in this study are 624H12 and 703D4, the same ones shown to be of value in retrospective studies. Preliminary results from this study indicate that when the predictive value of MoAb markers is compared to routine morphologic study, the positive predictive value of hnRNP MoAb is 67% (Mulshine, 1999). Another promising technology for screening is the detection of growth factors associated with chronic lung injury and transformation of this epithelium from normal, to dysplastic, to frankly invasive cancer. Gastrin-releasing peptide (GRP), Insulin-like Growth Factor I (IGF-I) and Transferrin (TF) are examples of growth factors associated with carcinogenesis. The presence of elevated levels of these growth factors in the bronchial lavage of subjects at high risk for lung cancer may provide complementary information to the sputum immunostaining regarding the early detection of lung cancer (Mulshine et al, 1991). Also, the knowledge of the existence of such molecules has lead to development of monoclonal antibodies, which might be of value as therapy in high-risk individuals. More recently, new early lung cancer screening programs have been designed using low-dose spiral computed tomography (CT) to improve the likelihood of detection of small non-calcified nodules, and thus of lung cancer at an earlier and potentially more curable stage. Once exposure to radiological examinations is associated with the risk of induction of malignancy, this has to be balanced against the benefits of early detection of a malignant tumor. Effective dose equivalent ranges from 0.06 to 0.25 millisieverts (mSv) with chest radiography in 2 views, 3-27 mSv with CT using conventional examination parameters, and 0.3-0.55 mSv using low dose CT settings. Based on considerations by the International Commission on Radiological Protection, it can be expected that radiation exposure with an effective dose equivalent of 1 mSv would lead to 5 additional malignancies in 100,000 individuals exposed (International Commission on Radiological Protection, 1991). The results of a Japanese study conducted by Kaneko et al (1996) brought to focus the idea of screening highrisk populations for lung cancer using a new screening method: spiral CT. A total of 1,369 members from the forprofit organization called Anti-Lung Cancer Association (ALCA) â&#x20AC;&#x201C; mostly men, average age 60 years and smokers (> 20 pack-year) were submitted to dual screening using spiral CT and chest radiography. Chest radiography was able to detect only 4 of the 15 cases of lung cancer that were diagnosed with low-dose spiral CT. Although the yield was low, these results confirmed the superiority of that new technique in the detection of early stage peripheral lung cancers. Sone and colleagues (1998) developed a massscreening program also in Japan to evaluate the usefulness

V. Innovative screening technologies The specimens obtained during the NCI-sponsored trials provided a potential means for identifying other markers of early lung cancer (Mulshine, 1999). To develop a more sensitive detection technique, Tockman and co-workers used immunostaining of sputum cells with lung cancer-associated monoclonal antibodies (MoAbs) to determine if early preneoplastic cytologic changes of lung cancer could be more reliably detected (Mulshine et al, 1991). Using the two MoAbs 703D4 and 624H12, developed against non-small cell and small-cell lung cancer cells, specimens from the Johns Hopkins study were reexamined. They found that in subjects with moderate atypical metaplasia, these antibodies could predict the later development of lung cancer at least 2 years prior to clinical recognition, with a sensitivity of 91% and a specificity of 88% (Tockman et al, 1988). Of the 22 known positive cases of lung cancer, 20 were detected by dual antibody analysis. Nineteen of these cases were recognized by the 703D4 MoAb alone, whereas 624H12 was less sensitive, detecting eight cases of lung cancer alone. Because of the higher sensitivity of the 703D4 antibody, much of the biochemical research has been focused on this marker 12 that recognizes heterogeneous nuclear ribonucleoprotein (hnRNP) A2/B1 involved in cellular proliferation and the carcinogenesis cascade. A prospective validation trial of sputum immunocytochemical early detection of the lung cancer is 97

Bruno and Tester: Screening for lung cancer of annual screening for lung cancer by low-dose CT and the characteristics of identified lung cancers. The prevalence data obtained in 1996 showed that among 5,483 individuals aged between 40 and 74 years, including smokers and non-smokers, suspicious nodules were detected in 279 (5.1%) subjects and 22 (8% of the 279) were confirmed surgically to have lung cancer. Corresponding figures in 1997 were 173 suspicious nodules of 4425 individuals, being 25 of them (14%) confirmed to be lung cancers. In 1998, 136 of 3878 (3.5%) individuals were diagnosed with suspicious nodules and of those only 9 (7%) of them were confirmed malignant. The mean size of lesions was 17mm and CT identified almost ten times as many cancers (0.48%) than a standard mass screening done 1 year before in the same area using roentgenograms and sputum cytology (0.03-0.05%). The sensitivity and specificity of detecting surgically confirmed lung cancers were 55% and 95%, respectively, in 1996. The sensitivity and specificity were 83% and 97% in the 1997 screening. Of the 60 cases of lung cancers identified in the screening 88% were surgically confirmed as stage IA. Such a small number of neoplasms detected in this study can be attributed to the fact that the screening was done in a rural area of Japan where the rate of lung cancer has been reported to be low. That constituted a lowrisk population, once non-smokers were included in the study. The Early Lung Cancer Action Project (ELCAP) was designed to evaluate baseline and annual repeat screening by low-dose CT in people at high risk of lung cancer and is under way at Cornell University-New York Presbyterian Hospital. The projectâ&#x20AC;&#x2122;s overall design and findings from baseline screening were recently published (Henschke et al, 1999). ELCAP has enrolled 1,000 symptom-free volunteers, aged 60 years or older, with at least 10 packyears of cigarette smoking, who were medically fit to undergo thoracic surgery. Non-calcified nodules were detected three times more commonly than by chest radiography, malignant tumors four times more commonly, and stage I tumors six times more commonly. Of the 27 CT-detected lung cancers, 26 (96%) were resectable, compared to only 30 (51%) of the 59 tumors detected on baseline chest radiography done under Mayo Lung Project. Critics to this study include mainly lack of randomization of subjects to a non-screened arm and a number of enrolled individuals that is not sufficient to provide statistical power to evaluate impact in survival and mortality in long-term follow-ups. Another prospective cohort study conducted at Mayo Clinic enrolled 1,520 individuals aged 50 years or older who had smoked at least 20 pack-years to undergo a baseline screening with spiral computed tomography and sputum cytology followed by a three-year annual screening (Swensen et al, 2002). One or more lung nodules were identified in 1,000 (66%) of the 1,520 participants, although primary lung cancers were documented in only 25 of the 1,464 individuals (1.7%) who returned for the first of their annual incidence scans and sputum examinations. CT alone detected 23 cases and sputum cytology alone detected 2 cases. Twelve (57%) of the 21 non-small cell cancers detected by computed

tomography were stage IA, although a stage shift can not be confirmed. Of significant concern was the extremely high rate of false-positive results lesions identified by the spiral CT. The study conducted by Diederich et al (2002) at the University of MĂźnster, Germany, screened with low-dose spiral CT a total of 817 asymptomatic smokers (minimum age of 40 years and minimum tobacco consumption of 20 pack-years). The authors were able to demonstrate a prevalence of lung cancer of 1.3% in this high-risk population. Only seven out the twelve lesions (58%) diagnosed as being malignant were actually stage I. Nawa et al (2002) developed another screening program in Japan, targeting health care professionals. From April 1998 to August 2000, spiral CT screening was performed as part of annual health examinations on a total of 7,956 individuals. The majority of patients were men, with ages ranging from 50 to 59 years. 62.1% of the subjects were current or former smokers. After baseline screening, a total of 36 cases of primary lung cancer were histologicaly confirmed (0.44% prevalence). 28 patients (77.7%) were classified as stage IA. The most common histology was adenocarcinoma (35 of 37) and the mean diameter was 17 mm. The retrospective study by Patz et al (2000) evaluated 510 patients with surgically resected, pathologic stage IA NSCLC. The purpose of this study was to determine the relationship between size and survival in patients with stage IA NSCLC (lesions < 3 cm). No correlation between decrease in tumor dimension and improvement in survival was found, and the authors used this result to caution against the use of low-dose spiral CT as an effective tool for early diagnosis of lung cancer. One explanation why the expected relationship between tumor size and survival was not observed was the fact that the authors reported survival based on deaths from all causes, rather than deaths related only to lung cancer (Black, 2000). Nearly half of deaths in those patients were actually due to other causes and the inclusion of these deaths may have reduced the power of this study to detect differences in lung cancer survival. The size of the studied population was also a concern regarding the statistical power of that study when it comes to evaluation of cancer survival. In summary, several studies have evaluated the utility of CT screening in the detection of early lung cancer. Depending largely upon the population studied, it appears that the detection rates range from 0.4% to 1.7%. The tumors detected tend to be small, peripheral, and are resectable in 50-70% of cases. None of these studies included a prospective control group, therefore the true effect of CT screening on cancer related mortality is unknown. Positron emission tomography (PET) has gained attention as a new modality that appears useful in differentiating benign from malignant lesions when investigating a solitary pulmonary nodule detected previously by chest radiographs or CT scans. The technique is based on the uptake of a radioactive glucose, fluorodeoxyglucose, in metabolically active cells. In a

Cancer Therapy Vol 1, page 99 recent study, Pitman and colleagues (2001) evaluated the accuracy of blinded reading of PET scans in 40 of 60 consecutive patients referred for evaluation of an indeterminate lung nodule or mass. The results showed that PET yielded 23 true positives, 13 true negatives, 3 false positives (2 tuberculosis, 1 sarcoidosis) and 1 false negative (an adenocarcinoma), giving a sensitivity of 96%, a specificity of 81%, a negative predictive value of 93% and a positive predictive value of 88% for malignancy. When it comes to the discussion whether it is cost effective to screen individuals using expensive techniques, Mahadevia and colleagues (2003) evaluated the potential clinical and economic implications of an annual lung cancer-screening program based on helical CT. Using a computer-simulated model they compared annual helical CT screening to no screening for hypothetical cohorts of 100,000 current, quitting, and former heavy smokers. Over a 20-year period, assuming a 50% stage shift, the current heavy smoker cohort had 13% lung cancer-specific mortality reduction, with cost-effectiveness measured at $ 116,300 per quality-adjusted life-year (QALY) gained. The QALY is a measure of the quantity of life gained from a treatment, weighted by the quality of that life. It is generally agreed that any intervention costing more than $100,000 per QALY is not considered to be cost-effective (Earle et al, 2000). Therefore, spiral CT was not considered a cost-effective tool for lung cancer screening by the results of that study. Several additional studies are currently under way. The National Cancer Institute and the American College of Radiology Imaging Network is enrolling 25,000 persons at high risk for lung cancer for a multicenter, randomized-controlled trial (National Cancer Institute and American College of Radiology Imaging Network, 2003). The study has the objective to compare lung cancerspecific mortality in high-risk subjects who undergo lowdose spiral CT scan of the chest versus chest radiography. In addition, the National Lung Screening Trial (NLST) â&#x20AC;&#x201C; sponsored by the National Cancer Institute- has been enrolling participants for what will become the largest

randomized controlled screening trial for lung cancer (Figure 3) (National Institutes of Health, National Cancer Institute, 2002). A total of 50,000 participants (25,000 per arm) will be accrued for this study within 2 years. The study aims to compare spiral computed tomography and chest radiography as screening tools for lung cancer. The study as it is designed has sufficient power to determine if there is 20% or greater reduction in lung cancer mortality by either technique.

VI. Conclusions Screening for lung cancer has been the target of extensive research and controversy over the past decades. A high risk population can be identified, including smokers, those submitted to occupational exposures and survivors of prior lung cancer and head and neck cancer. Previous screening trials showed limited value on early detection and mortality. Those studies, however, did not employ modern technology and some suffered from flaws in their design. An enthusiastic era of prospective trials using promising technologies such as low-dose spiral CT and sputum immunocytochemistry is facing again the challenge of proving that early detection of lung cancer can actually save lives. Until positive results of such studies are available assuring the practice of mass screening for lung cancer in high-risk populations, the decision to screen asymptomatic patients remains an individual decision. Physicians must consider the current value of available screening techniques, their patientsâ&#x20AC;&#x2122; level of risk and whether they would be suitable for surgical intervention before making individualized decisions for screening. Until prospective studies of lung cancer screening show a significant improvement in mortality, general population-based screening cannot be routinely recommended.

50,000 current or former smokers assigned to screening with either chest radiography or spiral CT

25,000 individuals to be screened with chest radiography

25,000 individuals to be screened with spiral computed tomography

Figure 3: The National Lung Screening Trial (NLST)

Bruno and Tester: Screening for lung cancer 3302-3317. Eddy DM (1989) Screening for lung cancer. Ann Intern Med 111, 232-237. Flehinger BJ, Kimmel M, Melamed MR (1992) The effect of surgical treatment on survival from early lung cancer. Chest 101, 1013-1018. Fontana RS, Sanderson DR, Taylor WF, et al (1984) Early Lung cancer detection: results of the initial (prevalence) radiologic and cytologic screening in the Mayo Clinic study. Am Rev Respir Dis 130, 561-565. Fontana RS, Sanderson DR, Woolner LB, et al (1986) Lung cancer screening: the Mayo program. J Occup Med 28, 746750. Frank E, Winkleby MA, AltmanDG, et al (1991) Predictors of physicians’ smoking cessation advice. JAMA 266, 31393144. Fried RM et al (1997) Prostate cancer screening and management. Med Clin North Am 81, 801. Garfinckel L, Silverberg E (1991) Lung cancer and smoking trends in the United Sates over the past 25 years. CA 41, 137.

Until the results of these ongoing prospective studies are known, we cannot recommend population screening. However, we can identify individuals at extremely high risk for lung cancer. These individuals would include those with smoking history of greater than 20 pack years who would be surgical candidates plus (1) a history of resected stage I lung cancer, (2) early stage head and neck cancer that appears cured, and/or (3) abnormal pulmonary function tests (FEV1 < 60% of predicted). However, there is strong evidence that the most effective approach to lung cancer is primary prevention– cessation of cigarette smoking (Wolpaw et al, 1996). Attention to this area needs to increase despite their difficulties and frustration. Although physicians agree that it is appropriate for doctors to counsel patients to stop smoking, they are inconsistent in providing such advice. The most commonly reported barriers to counseling are the belief that most patients are uninterested, perceived lack of skills and time constrains (Frank et al, 1991; Jaen et al, 1994). Studies have found though, that brief, directive smoking interventions delivered during routine care are cost-effective and have the potential for significant public health benefit. The assessment of smoking status and smoking cessation interventions should be definitely integrated into standard office practice (Robinson et al, 1995).

Henschke CI, McCauley DI, Yankelevitz DF, et al (1999) Early Lung Cancer Action Project: overall design and findings from baseline screening. The Lancet 354, 99-105. Inoue K, Sato M, Fujimura S, Sakurada A et al (1998) Prognostic assessment of 1310 patients with non-small-cell lung cancer who underwent complete resection from 1980 to 1993. J Thorac Cardiovasc Surg 116, 407-411. International Commission on Radiological Protection (1991) 1990 Recommendations, Publication 60. Oxford, England: Pergamon Press.

References American Cancer Society: Cancer Facts and Figures 2003. Atlanta, GA: American Cancer Society. Last accessed March 24, 2003.

Jaen CR, Stange KC, Nutting PA (1994) Competing demands of primary care: a model for the delivery of clinical preventive services. J Fam Pract 38, 166-171. Kaneko M, Eguchi K, Ohmatsu H, Kakinuma R, Naruke T, Suemasu K, Moriyama N (1996) Peripheral lung cancer: screening and detection with low-dose spiral CT versus radiography. Radiology 201, 778-802.

Bach PB, Cramer LD, Warren JL, Begg CB (1999) Racial differences in the treatment of early-stage lung cancer. N Engl J Med 34, 1198-1205. Beckett WS (2000) Occupational respiratory diseases. N Engl J Med 342, 406-413. Berlin NI, Buncher R, Fontana RS et al (1984) The National Cancer Institute Cooperative Early Lung Cancer Detection Program – Results of the initial screen (Prevalence). Am Rev Respir Dis 130, 545-549.

Karwinski B, Svendsen E, Hartveit F (1990) Clinically undiagnosed malignant tumors found at autopsy. APMIS 98, 496-500. Lippman SM, Benner SE, Hong WK (1994) Cancer Chemoprevention. J Clin Oncol 12, 851-873. Loeb LA, Ernster VL, Warner KE et al (1984) Smoking and lung cancer: an overview. Cancer Res 44, 5940-5958.

Black, WC (2000) Unexpected Observations on Tumor Size and Survival in Stage IA Non-small Cell Lung Cancer. Chest 117, 1532-1534. Carbone PP, Frost JK, Feinstein AR, et al (1970) Lung cancer: early detection, diagnosis and localization. In: Lung cancer: perspectives and prospects. Ann Intern Med 73, 1003-1024. Cohen BH (1980) Chronic obstructive pulmonary disease: a challenge in genetic Epidemiology. Am J epidemiol 112, 247-288.

MacLean CD (1996) Principles of Cancer Screening. Med Clin North Am 80:1-14.

De Mones E, Hans S, Le Pimpec-Barthes F, Riquet M, Laccourreye O, Brasnu D (1999) Squamous cell carcinoma of the head and neck and pulmonary cancer. Report of 50 cases. Ann Otolaryngol Chir Cervicofac 116, 341-350. Diederich S, Wormanns D, Thomas M, Lenzen H, Roos N, Heindel W (2002) Screening for early lung cancer with lowdose spiral CT: prevalence in 817 asymptomatic smokers. Radiology 222, 773-781.

Marcus PM, Bergstralh EJ, Fagerstrom RM (2000) Lung Cancer Mortality in the Mayo Lung Project: Impact of Extended Follow-up. Journal of the NCI 92: 1308-1316.

Earle CC, Chapman RH, Baker CS, Bell CM, Stone PW, Sandberg EA, Neumann PJ (2000) Systematic Overview of Cost-Utility Assessments in Oncology. J Clin Oncol 18,

Melamed MR, Flehinger BJ, Zaman MB, et al (1984) Screening for early lung cancer – Results of the Memorial SloanKettering Study in New York. Chest 86, 44-53.

Mahadevia PJ, Fleisher LA, Frick KD, Eng J, Goodman SN, Powe NR (2003) Lung Cancer Screening with Helical Computed Tomography in Older Adult Smokers: A Decision and Cost-effectiveness Analysis. JAMA 289, 313-322.

McLemore TL, Adelberg S, Liu MC et al (1990) Expression of CYP1A1 gene in patients with lung cancer: evidence for cigarette smoke-induced gene expression in normal lung tissue and for altered gene regulation in primary pulmonary carcinomas. J Natl Cancer Inst 82, 1333-1339.

100

Cancer Therapy Vol 1, page 101 Mountain CF (1997) Revisions in the international system for staging lung cancer. Chest 111, 1710-1717. Mulshine JL (1999) Reducing Lung Cancer Risk – Early detection. Chest 116, 493S-496S.

Robinson MD, Laurent SL, Little JM Jr (1995) Including smoking status as a new vital sign: it works. J Fam Pract 40, 556-563. Sanderson DR (1986) Lung Cancer Screening – The Mayo Study. In: IV World Conference on Lung Cancer. Chest 84, 324S. Sone S, Takashima S, Li F, et al (1998) Mass screening for lung cancer with mobile spiral computed tomography scanner. The Lancet 351, 1242-1245.

Mulshine JL, De Luca LM, Dedrick RL, et al (2000) Considerations in Developing Succseeful, Population-Based Molecular Screening and Prevention of Lung Cancer. Cancer 89, 2465S-2467S. Mulshine JL, Tockman MS, Smart CR (1989) Considerations in the development of lung cancer screening tools. J Natl Cancer Inst 81, 900-905.

Strauss GM (1997) Measuring Effectiveness of Lung Cancer Screening: From Consensus to Controversy and Back. Chest 112, 216S-228S.

Mulshine JL, Treston AM, Scott FM, et al (1991) Lung cancer: rational strategies for early detection and intervention. Oncology 5, 25-32.

Strauss GM (2002) The Mayo Lung Cohort: a Regression Analysis Focusing on Lung Cancer Incidence and Mortality. J Clin Oncol 20, 1973-1983. Strauss GM, Gleason RE, Sugarbaker DJ (1993) Screening for Lung Cancer Re-examined: a Reinterpretation of the Mayo Lung Project Randomized Trial on Lung Cancer Screening. Chest 103, 337S-341S.

National Cancer Institute and American College of Radiology Imaging Network. Randomized Screening Study of LowDose Helical Computed Tomography versus Radiography of the Chest in Participants at High Risk for Lung Cancer. Available at http://cancer.gov/clinicaltrials. Date last modified: December 23, 2003. National Institutes of Health, National Cancer Institute. Fifty thousand current and former smokers needed for National Lung Screening Trial. September 18, 2002. Available at http://cancer.gov/clinicaltrials. Accessibility verified March 24, 2003. Nawa T, Nakagawa T, Kusano S, Kawasaki Y, Sugawara Y, Nakata H (2002) Lung cancer Screening Using Low-Dose Spiral CT: Results of Baseline and 1-Year Follow-up Studies. Chest 122, 15-20. Parkin DM, Pisani P, Ferlay J (1999) Global cancer statistics. CA Cancer J Clin 49, 33-64.

Strauss GM, Gleason RE, Sugarbaker DJ (1997) Screening for Lung Cancer: Another Look; A Different View. Chest 111, 754-768. Swensen SJ, Jett JR, Sloan JA, Midthun DE, Hartman TE, Sykes AM, Aughenbaugh GL, Zink FE, Hillman SL, Noetzel GR, Marks RS, Clayton AC, Pairolero PC (2002) Screening for lung cancer with low-dose spiral computed tomography. Am J Respir Crit Care Med 165, 508-513. Tockman MS (1986) Survival and Mortality from Lung Cancer in a Screened Population – The Johns Hopkins Study. Chest 84, 324S-325S. Tockman MS, Anthonisen NR, Wright EC, Donithan MG (1987) The Intermittent Positive Pressure Trial Group and the Johns Hopkins Lung Project for the Early Detection of Lung Cancer. Ann Intern Med 106, 512-518. Tockman MS, Erozan YS, Gupta P, et al (1994) The early detection of second primary lung cancers by sputum immunostaining. Chest 106, 385s-390s.

Parkin MD, Moss SM (2000) Lung Cancer Screening: Improved Survival But No Reduction in Deaths – The Role of “Overdiagnosis”. Cancer 89, 2369S-2369S. Patz EF Jr, Rossi S, Harpole DH Jr, Herndon JE, Goodman PC (2000) Correlation of tumor size and survival in patients with Stage IA non-small cell lung cancer. Chest 117, 1568-1571. Peto R, Darby S, Deo H, Silcocks P, et al (2000) Smoking, smoking cessation, and lung cancer in the UK since 1950: combination of national statistics with two case-control studies. BMJ 321, 323-329.

Tockman MS, Gupta PK, Myers JD, et al (1988) Sensitive and specific monoclonal antibody recognition of human lung cancer antigen on preserved sputum cells: a new approach to early lung cancer detection. J Clin Oncol 6, 1685-1693. Weiss W (1999) Asbestosis: a marker for the increased risk pf lung cancer among workers exposed to asbestos. Chest 115, 536-549.

Pitman AG, Hicks RJ, Kalff V, Binns DS, Ware RE, McKenzie AF, Ball DL, MacManus MP (2001) Positron emission tomography in pulmonary masses where tissue diagnosis is unhelpful or not possible. Medical Journal of Australia 175, 303-7.

Wolpaw DR (1996) Early Detection in Lung Cancer: Case Finding and Screening. Med Clin North Am 80, 63-82.

101

Bruno and Tester: Screening for lung cancer

102

Cancer Therapy Vol 1, page 103 Cancer Therapy Vol 1, 103-107, 2003.

Expression of RB1CC1, a novel tumor suppressor gene, is inversely correlated with the Ki-67 proliferation index in primary breast cancers Research Article

Koji Teramoto1, Tokuhiro Chano2,3, Yoshitomo Ozaki1, Satoru Sawai1, Noriaki Tezuka1, Keiichi Kontani1*, Shozo Fujino1, Hidetoshi Okabe2 Departments of 1Surgery and 2Clinical Laboratory Medicine, Shiga University of Medical Science, Seta-tsukinowa, Otsu, Shiga 520-2192, Japan, 3PRESTO, Japan Science and Technology Corporation (JST)

__________________________________________________________________________________ *Correspondence: Keiichi Kontani, Department of Surgery, Shiga University of Medical Science, Seta-tsukinowa, Otsu, Shiga 5202192, Japan. Tel.: +81-77-548-2244; Fax: +81-77-544-2901; e-mail address: konbat@belle.shiga-med.ac.jp Key words: RB1CC1, RB1, Ki-67, tumor suppressor gene, breast cancer Received: 14 May 2003; Accepted: 21 May 2003; electronically published: May 2003

Summary Retinoblastoma 1 (RB1)-inducible coiled-coil 1 (RB1CC1) is a key regulator of RB1, and is frequently mutated in breast cancer. We examined RB1CC1 expression using immunohistochemical means and compared it with RB1 and Ki-67 labeling indices as well as estrogen receptor (ER) status in 54 primary breast cancers. RB1CC1 protein expression was absent in 8 cancers (15%), and RB1 protein was significantly decreased or absent in all of the cases lacking RB1CC1. These 8 cases showed no loss of heterozygosity (LOH) at the RB1 locus. Importantly, a loss of RB1CC1 was significantly correlated with a high Ki-67 index (p < 0.0001) and low ER status (p = 0.0123). RB1CC1 expression predicts tumor progression, and its prognostic value should to be established. (Chano, 2002a). We frequently observed RB1CC1 mutations in breast cancer, suggesting that the functional loss of RB1CC1 results in insufficient RB1 expression, which promotes dysregulation of the RB1CC1-RB1 pathway and subsequent tumorigenesis (Chano, 2002c). To clarify the incidence of RB1CC1 anomalies in primary breast cancers, we analyzed RB1CC1 expression by immunohistochemical methods and examined its relationship with various biopathological parameters in breast cancers from 54 patients. The important findings of the present study suggest that a loss of RB1CC1 expression accelerates cell proliferation.

I. Introduction Inactivation of the retinoblastoma 1 (RB1) gene is considered to play a central role in the pathogenesis of many human malignant neoplasms (Kamb, 1995; Taya, 1997; Kaelin et al, 1999). RB1 is also involved in tumorigenesis and tumor progression (Lemoine, 1994; T’Ang, 1998; Kaelin et al, 1999), and its expression is inversely correlated with its proliferative activity in breast cancer (T’Ang and Fung, 1991). The RB1 locus is genetically altered in 3 to 37% of breast cancers (Varley et al, 1989; Thorlacious et al, 1991; Lemoine, 1994; T’Ang, 1998; Kaelin et al, 1999; Bieche and Lidereau, 2000). However, it is not always responsible for the absence of RB1 expression under such conditions (Varley et al, 1989; Bieche and Lidereau, 2000), and other factors are probably involved in this phenomenon. RB1-inducible coiled-coil 1 (RB1CC1) is thought to be a transcription factor because it is in fact localized to the nucleus and it contains a nuclear localization signal, a leucine-zipper motif and a coiled-coil structure (Chano, 2002a,b). RB1CC1 is co-expressed with RB1 in various cancers and normal tissues (Chano, 2002a,b), where it functions as an inducible regulator of RB1 expression

II. Materials and methods A. Specimens We analyzed formalin-fixed and paraffin-embedded primary breast cancer tissues resected from 54 patients at the Shiga University of Medical Science Hospital between July 1996 and December 2001. The Ethics Committee of our institution approved the use of these specimens, which were histologically classified according to the World Health Organization (WHO) guidelines.

103

Teramoto et al: Expression of RB1CC1 in primary breast cancers

B. Immunohistochemical analysis

evaluated abnormalities of the RB1CC1-RB1 pathway in primary breast cancers and examined relationships with various biopathological parameters. RB1CC1 expression was undetectable and associated with a significant decrease or absence of RB1 positive cells in 8 (15%) of the 54 primary breast cancers.

Antigens were retrieved by autoclaving at 120°C for 1 min. Then RB1CC1, RB1, Ki-67 and estrogen receptor (ER) were immunohistochemically stained using a Streptavidin-Biotin Immunoperoxidase Complex System (DAKO Japan, Kyoto, Japan). Primary antibodies were anti-human RB1CC1 rabbit antiserum (anti-RBICC-642) diluted 1:5000, and mouse monoclonal antibodies to RB1 (G3-245, Pharmingen, San Diego, CA) diluted 1:500, to Ki-67 (NCL-Ki87-MMI, Novocastra, New Castle, UK) diluted 1:100, and to ER (NCL-ER-6F11, Novocastra) diluted 1:100, respectively. Labeling indices of Ki67 and RB1 were determined as the ratio (%) of labeled compared with total neoplastic cells in each section.

C. Loss of heterozygosity (LOH) at RB1 locus We extracted tumor DNA from the samples without RB1CC1 expression using DNAzol reagent (Gibco-BRL, Paisley, Scotland) according to the manufacturer’s protocols. We analyzed them using the AFM058xd6 microsatellite markers (UniSTS: 13158). The PCR products were resolved using 7.5% denaturing PAGE and visualized by silver staining.

RB1CC1

D. Statistical analysis We evaluated relationships between RB1CC1 expression and the RB1 and Ki-67 labeling indices using Student’s t-test. Fisher’s exact test determined the relationships between RB1CC1 status, ER status and clinicopathological factors including tumor size, lymph node involvement, histological subtype and post-menopausal status. Statistical significance was assumed at p < 0.05.

RB1

III. Results A. Positive Correlation between RB1CC1 and RB1 RB1CC1 protein was undetectable in 8 (15%) of 54 primary breast cancers and RB1 positive cells were absent or significantly depleted in all of them (Figures 1b and d). In these 8 tumors lacking RB1CC1 expression, they showed no LOH at RB1 locus (Figure 2). Among the 46 specimens expressing RB1CC1, RB1 was co-expressed in 45 (Figures 1a and c) and significantly decreased in only one. RB1CC1 expression was significantly correlated with the RB1 labeling index (RB1CC1-positive versus RB1CC1-negative specimens, 78.6 ± 13.9 versus 13.6 ± 12.1%, p < 0.0001; Student’s t-test) (Figure 3a). RB1CC1 (Figures 1e and f), and the Ki-67 labeling index was significantly higher in RB1CC1-negative tumors (RB1CC1-positive versus RB1CC1-negative specimens, 20.3 ± 12.8 versus 65.0 ± 12.2%, p < 0.0001; Student’s t-test) (Figure 3b).

Ki-67 Case 11

Case 15

Figure 1. Immunohistochemical analysis of RB1CC1, RB1 and Ki-67 in breast cancer. Both RB1CC1 (a) and RB1 (c) proteins are expressed in the nuclei of breast cancer cells from Patient 11, but barely detectable in those from Patient 15 (b and d). Ki-67positive nuclei are abundant in specimens from Patient 15, whose tumor did not express RB1CC1 (f), but less profuse in tumor samples from Patient 11 (e). (Immunoperoxidase staining with hematoxylin counterstain. Magnification, !200.)

Figure 2. Loss of heterozygosity at RB1 locus. DNA samples from 8 tumors without RB1CC1 expression and from matching blood DNAs of Patient 15 and 46 were amplified using primer pairs for the AFM058xd6 microsatellite marker. PCR products were resolved using 7.5% denaturing PAGE and visualized by silver staining. All DNA samples showed no LOH at RB1 locus. M, "X174/Hae III marker; P, genomic DNA sample from matching blood leukocytes.

III. Discussion The novel human gene, RB1CC1, encodes a putative transcription factor implicated in the regulation of RB1 (Chano et al, 2002a) and exhibits the characteristics of a classical tumor suppressor gene (Chano et al, 2002c). RB1CC1 mutations lacking function have been identified in breast cancer and might be involved in their tumorigenesis (Chano et al, 2002c). The present study 104

Cancer Therapy Vol 1, page 105 was usually associated with a loss of RB1CC1 expression in the present study, the absence of the latter seems to be a major cause of depleted expression of RB1 and subsequent breast cancer tumorigenesis. The loss of RB1CC1 expression was significantly correlated with a higher Ki-67 labeling index in our series (p < 0.0001). Since Ki-67 identifies proliferating cells by recognizing a nuclear antigen (Gerdes et al, 1987), our findings suggest that a loss of RB1CC1 expression promotes breast cancer progression through disruption ofits downstream pathways that normally suppress proliferative activity. Other studies have shown that Ki-67 staining levels are positively correlated with tumor size and nodal involvement in breast cancer (Wintzer, 1991; Molino et al, 1997). The level of Ki-67 may be an independent prognostic factor in breast cancer because Ki67 positivity is correlated with disease-free and overall survival rates (Rolio, 1993; Molino et al, 1997). RB1CC1negative cancers tended to show earlier metastasis than RB1CC1-positive ones. In our series, however, we could not conclude the sure relationship between RB1CC1 expression and the prognosis of breast cancer due to the short period of clinical observation and small numbers of cases. Therefore, longer-term clinical studies involving larger numbers of patients are required to confirm this issue. RB1CC1 expression and ER status were positively correlated. Estrogen regulates the proliferation and maturation of normal breast tissue through its receptors. In addition, both RB1CC1 and RB1 may contribute to the development and maturation of human embryonic cells (Chano, 2002d) and the RB1CC1-RB1 cascade may play a role in the maturation of breast tissues involving functional ER expression. About 70% of primary breast cancers are ER-positive (Andersen and Poulsen, 1989; Harvey et al, 1999) and such patients respond more favorably to endocrine therapy and survive longer than those with ER-negative cancer (Andersen and Poulsen, 1989; Harvey et al, 1999). Evaluating RB1CC1 expression in breast cancer may be helpful in predicting responses to adjuvant therapy. In conclusion, our findings suggest that RB1CC1 plays an important role in the RB1 pathway and that the absence of RB1CC1 expression accelerates cell proliferation in breast cancer. In addition, RB1CC1 status may be an important prognostic factor in breast cancer

Figure 3. RB1 and Ki-67 labeling indices in specimens with or without RB1CC1 expression. (a) RB1 labeling index is significantly higher with, than without RB1CC1 expression (RB1CC1-positive versus -negative specimens, 78.6 ± 13.9 versus 13.6 ± 12.1%, p < 0.0001; Student’s t-test). (b) Ki-67 labeling index is significantly higher in RB1CC1-negative than positive tumors (RB1CC1-positive versus -negative specimens, 20.3 ± 12.8 versus 65.0 ± 12.2%, p < 0.0001; Student’s t-test).

The 8 cases lacking RB1CC1 expression, showed no LOH at RB1 locus. These findings support those of previous reports (Chano et al, 2002a,b,c) suggesting that RB1CC1 functions as a key regulator of RB1 expression and that the dysfunction of RB1CC1 results in insufficient RB1 expression. The present study found a suspected RB1 abnormality in only one specimen with RB1CC1 expression, but we could not examine the LOH status at RB1 locus because of no matching tumor DNA. A LOH and other alterations at the RB1 locus were observed in 3% to 37% of breast cancers (Varley et al, 1989; Thorlacious et al, 1991; Lemoine, 1994; T’Ang, 1998; Kaelin et al, 1999; Bieche and Lidereau, 2000). However, irregular RB1 protein expression is not always linked to such RB1 gene derangement (Varley et al, 1989; Bieche and Lidereau, 2000). Since low or absent RB1 expression

Acknowledgements We would like to thank H. Chen, N. Takashima, H. Honjo and M. Sugimoto for excellent technical assistance. This study was partially supported by grant-in-aids for Scientific Research, the Ministry of Education, Science, Sports and Culture, Japan (08671356, 10671249, 13470520, 13671380 and 15591340).

105

Teramoto et al: Expression of RB1CC1 in primary breast cancers Table 1 Association of RB1CC1 expression with clinicopathological variables Variables Sex; male: female Age (y.o.); mean±SD Tumor size (cases ) _2 cm : _2 cm LNs involvement (cases) positive : negative unknown Pathology (cases) non-invasive : invasive ductal : others Menopausal (cases) post : pre male RB1 labeling index (%), mean±SD Ki-67 labeling index (%), mean±SD ER status (cases) positive : negative NS, not significant, a Fisher's exact test, b Student's t test.

RB1CC1 positive 1 : 45 56.2 ± 12.9

RB1CC1 negative 0:8 57.8 ± 12.7

P NSa NSb

10:36

2:6

NSa

24 : 21 1

3:4 1

NSa

1 : 45 44 : 2

0:8 8:0

NSa NSa

29 : 16 1 78.6 ± 13.9

6:2

NSa

13.6 ± 12.1

<0.0001b

20.3 ± 12.8

65.0 ± 12.2

<0.0001b

38 : 8

3:5

0.0123b

endocrine therapy in breast cancer. J Clin Oncol 17, 14741481. Kaelin Jr WG (1999) Functions of the retinoblastoma protein. BioEssays 21, 950-958. Kamb A (1995) Cell cycle regulators and cancers. Trends Genet 11, 136-140. Lemoine NR (1994) Molecular biology of breast cancer. Ann Oncol 5 (Supple), 31-37. Molino A, Micciolo R, Turazza M, Bonetti F, Piubello Q, Bonetti A, Nortilli R, Pelosi G, Cetto GL (1997) Ki-67 immunostaining in 322 primary breast cancers: associations with clinical and pathological variables and prognosis. Int J Cancer 74, 433-437. Rolio M, Nordling S, von Boguslawsky K, Leivonen M, Kyllonen L, von Smitten K (1993) Prognostic value of Ki-67 immunolabelling in primary operable breast cancer. Br J Cancer 68, 579-583. Taya Y (1997) RB kinases and RB-binding proteins: new points of view. TIBS 22, 14-17. Thorlacious S, Jonasdottir O, Eyfjord JE (1991) Loss of heterozygosity at selective sites on chromosomes 13 and 17 in human breast carcinoma. Anticancer Res 11, 1501-1507. T’Ang A, Fung YK (1991) The role of the retinoblastoma gene in breast cancer development. In Dickson RB, Lippman ME, eds. Genes, Oncogenes and Hormones. Advances in Cellular and Molecular Biology of Breast Cancer. Boston, Kluwer Academic Publishers, 59-68. T’Ang A, Varley JM, Chakraborty S, Murphree AL, Fung YK (1998) Structural rearrangement of the human retinoblastoma gene in human breast carcinoma. Science 242, 263-266. Varley JM, Armour J, Swallow JE, Jeffreys AJ, Ponder BA, T'Ang A, Fung YK, Brammar WJ, Walker RA (1989) The retinoblastoma gene is frequently altered leading to loss of

References Andersen J, Poulsen HS (1989) Immunohistochemical estrogen receptor determination in paraffin-embedded tissue. Prediction of response to hormonal treatment in advanced breast cancer. Cancer 64, 1901-1908. Bieche I, Lidereau R (2000) Loss of heterozygosity at 13q14 correlate with RB1 gene underexpression in human breast cancer. Mol Carcinog 29, 151-158. Chano T, Ikegawa S, Kontani K, Okabe H, Baldini N, Saeki Y (2002a) Identification of RB1CC1, a novel gene that can induce RB1 in various human cells. Oncogene 21, 12951298. Chano T, Ikegawa S, Saito-Ohara F, Inazawa J, Mabuchi A, Saeki Y, Okabe H (2002b) Isolation, characterization and mapping of the mouse and human RB1CC1 genes. Gene 291, 29-34. Chano T, Kontani K, Teramoto K, Ikegawa T, Okabe H (2002c) Truncating mutations of RB1CC1 in human breast cancers. Nat Genet 31, 285-288. Chano T, Saeki Y, Serra M, Matsumoto K, Okabe H (2002d) Preferential expression of RB1CC1 in terminal differentiated musculoskeletal cells. Am J Pathol 161, 359-364. Dahiya R, Perinchery G, Deng G, Lee C (1998) Multiple sites loss of heterozygosity on chromosome 8 in human breast cancer has differential correlation with clinical parameters. Int J Oncol 12, 811-816. Gerdes J, Pickartz H, Brotherton J, Hammerstein J, Weitzel H, Stein H (1987) Growth-fractions and estrogen receptors in human breast cancers as determined in situ with monoclonal antibodies. Am J Pathol 129, 486-492. Harvey JM, Clark GM, Osborne CK, Allred DC (1999) Estrogen receptor status by immunohistochemistry is superior to the ligand-binding assay for predicting response to adjuvant

106

Cancer Therapy Vol 1, page 107 expression in primary breast tumors. Oncogene 4, 725-729. Wintzer HO, Zipfel I, Schulte-Monting J, Hellerich U, von Kleist S (1991) Ki-67 immunostaining in human breast tumors and its relationship to prognosis. Cancer 67, 421-428.

Dr. Keiichi Kontani

107

Teramoto et al: Expression of RB1CC1 in primary breast cancers

108

Cancer Therapy Vol 1, page 109 Cancer Therapy Vol 1, 109-120, 2003.

Approaches to the treatment of brain tumors using cytokine-secreting allogeneic fibroblasts Research Article

Terry Lichtor1*, Roberta P Glick1, Edward P Cohen2 1

Department of Neurological Surgery, Rush Medical College and John H Stroger Hospital of Cook County Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, Illinois

__________________________________________________________________________________ *Correspondence: Terry Lichtor, MD, PhD, Department of Neurosurgery, 1835 West Harrison Street, Suite 3202, Chicago, Illinois 60612; Telelphone: 312-633-6328; Fax: 312-633-6494; e-Mail: Terry_Lichtor@rush.edu Key words: gene therapy, glioma, breast cancer, IL-2, tumor vaccine Received: 21 May 2003; Accepted: 30 May 2003; electronically published: May 2003

Summary The prognosis for patients with an intracerebral neoplasm is poor. Conventional treatments such as surgery, radiation therapy and chemotherapy have done little to affect long-term survival, and new methods of treatment are urgently needed. In this report approaches involving cytokine gene therapy in treatment of malignant brain tumors are reviewed and contrasted to a strategy developed in this laboratory involving the use of allogeneic cells genetically modified to secrete cytokines. In our studies, mice with an intracerebral glioma, melanoma or breast carcinoma treated solely by intratumoral injections with allogeneic cells genetically modified to secrete interleukin-2 were found to survive significantly longer than mice in various control groups. The anti-tumor response was mediated predominantly by T cell subsets (CD8+ and NK/LAK cells). The injections resulted in the killing of only the neoplastic cells; non-neoplastic cells were unaffected. Experiments involving treatment of animals with intracerebral tumor using subcutaneous injections of cytokine secreting allogeneic cells in the presence of tumor antigens demonstrated no effect in prolonging survival in spite of the development of a vigorous systemic antitumor immune response. Of special interest, mice injected intracerebrally with the cytokine-secreting allogeneic cells alone exhibited no neurologic defect and there were no adverse effects on survival. The injection of cytokine-secreting allogeneic cells into the microenvironment of an intracerebral tumor is hypothesized to induce an anti-tumor immune response capable of prolonging survival. This preclinical animal data should directly translate into clinical treatments for patients with a malignant intracerebral tumor. Tumor cells may evade immune responses by losing expression of antigens or major histocompatiblity complex (MHC) molecules or by producing immunosuppressive cytokines. In addition T cells that recognize self-antigens may differentiate into suppressor or regulatory cells, which inhibit the activation and/or functions of effector cells. The inhibitory effects of suppressor cells may be mediated by cytokines. In particular interleukin-10 and TGF-! are two examples of such cytokines. Successful methods to induce immunity to TAAs could lead to tumor cell destruction and prolong the survival of cancer patients. A variety of strategies have been used to increase the immunogenetic properties of vaccine therapies for brain tumors. The immune response can be augmented by genetic modification of tumor cells to secrete cytokines including IL-2, GM-CSF and interferon-". One can also alter the MHC of the tumor cells to express allogeneic

I. Introduction The current prognosis for patients with malignant brain tumors remains poor (Mahaley et al, 1989). Malignant gliomas are the most common primary brain tumor. Despite treatment with surgery, radiation and chemotherapy, the 2-year survival remains less than 20%. One emerging strategy in the treatment of tumors involves stimulation of an immunologic response against the neoplastic cells. The hope is that the immune system can be called into play to destroy malignant cells. However, in most instances, proliferating tumors do not provoke antitumor cellular immune responses. The precise mechanisms that enable antigenic neoplasms to escape host immunity are incompletely understood. The cells appear to escape recognition by the immune system in spite of the fact that neoplastic cells form weakly immunogenic tumor associated antigens (TAAs).

109

Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts determinants. Finally one can genetically modify the tumor cells to express co-stimulatory molecules such as B7. In some instances, objective evidence of tumor regression has been observed in patients receiving immunizations only with tumor cell immunogens, suggesting the potential effectiveness of this type of immunotherapy for malignant neoplasms. In addition modification of delivery techniques to treat intracerebral tumors has included intrathecal, intralymphatic, subcutaneous and intratumoral injections of treatment cells. We have utilized many of these techniques to enhance the immune response in the development of our cellular vaccine, as discussed below. Recent advances in our understanding of the biology of the immune system have led to the identification of numerous cytokines that modulate immune responses (Kelso, 1989; Borden and Sondel, 1990; Gabrilove and Jakubowski, 1990). These agents mediate many of the immune responses involved in anti-tumor immunity. Several of these cytokines have been produced by recombinant DNA methodology and evaluated for their anti-tumor effects. In experimental clinical trials, the administration of cytokines and related immunomodulators has resulted in objective tumor responses in some patients with various types of neoplasms (Lotze et al, 1986; Rosenberg et al, 1988; Borden and Sondel, 1990). Interleukin-2 (IL-2) is an important cytokine in the generation of anti-tumor immunity (Rosenberg et al, 1988). In response to tumor antigens, the helper T-cell subset of lymphocytes secretes small quantities of IL-2. This IL-2 acts locally at the site of tumor antigen presentation to activate cytotoxic T-cells and natural killer cells that mediate systemic tumor cell destruction. Intravenous, intralymphatic or intralesional administration of IL-2 has resulted in clinically significant responses in several types of cancer (Lotze et al, 1986; Pizza et al, 1988; Rosenberg et al, 1988; Gandolfi et al, 1989; Sama et al, 1990). However, severe toxicities (hypotension and edema) limit the dose and efficacy of intravenous and intralymphatic IL-2 administration (Lotze et al, 1986; Sama et al, 1990). The toxicity of systemically administered cytokines is not surprising since these agents mediate local cellular interactions, and they are normally secreted in quantities too small to have systemic effects. To circumvent the toxicity of systemic IL-2 administration, several investigators have examined intralesional injection of IL-2 (Bubenik et al, 1988; Gandolfi et al, 1989). This approach eliminates the toxicity associated with systemic IL-2 administration. However, multiple intralesional injections are required to optimize therapeutic efficacy (Bubenik et al, 1988; Gandolfi et al, 1989). These injections will be impractical for many patients without potential significant morbidity, particularly when tumor sites are not accessible for direct injection. Cytokine gene transfer has resulted in significant anti-tumor immune responses in several animal tumor models (Tepper et al, 1989; Watanabe et al, 1989; Fearon et al, 1990; Gansbacher et al, 1990). In these studies, the

transfer of cytokine genes into tumor cells has reduced or abrogated the tumorigenicity of the cells after implantation into syngeneic hosts. The transfer of genes for IL-2 (Fearon et al, 1990; Gansbacher et al, 1990), gamma interferon (IFN-") (Watanabe et al, 1989), and IL-4 (Tepper et al, 1989) significantly reduced or eliminated the growth of several different histological types of murine tumors. Other cytokines capable of producing similar results include granulocyte-macrophage colonystimulating factor (GM-CSF) (Yu et al, 1997) and interleukin-12 (Ehtesham et al, 2002). In the studies employing IL-2 gene transfer, the treated animals also developed systemic anti-tumor immunity and were protected against subsequent tumor challenges with the unmodified parental tumor (Fearon et al, 1990; Gansbacher et al, 1990). Similar inhibition of tumor growth and protective immunity were also demonstrated when immunizations were performed with a mixture of unmodified parental tumor cells and genetically modified tumor cells engineered to express the IL-2 gene. No toxicity associated with expression of the cytokine transgenes was reported in these animal tumor studies (Tepper et al, 1989; Watanabe et al, 1989; Fearon et al, 1990; Gansbacher et al, 1990). An alternative strategy is to genetically modify tumor cells to express an antisense gene to TGF-!, which is a cytokine highly expressed in glioma cells that acts to inhibit the function of cytotoxic T cells (Fakhrai et al 1996). Previous immunotherapy stategies have utilized classical immunologic cell types including activated lymphocytes and LAK cells. More recently, a variety of cells have been investigated for their usefulness in tumor oncology including tumor cells themselves (syngeneic or allogeneic), Dendritic cells or fibroblasts (syngeneic or allogeneic). Although syngeneic tumor cells have the advantage that they express most of the appropriate antigens needed for targeted therapy, many types of tumors are difficult to establish in culture. In addition cytokine gene therapies requiring the transduction of autologous tumor cells may not be practical for many cancer patients. Modification of neoplastic cells taken directly from tumor-bearing patients may be difficult. In particular a primary tumor cell line, required for retroviral modification has to be established. An alternative cell type that can be used for therapeutic immunizations is the Dendritic cell (DC), which is a specialized antigen presenting cell. Pre-clinical studies have indicated that immunizing either mice or rats with DC pulsed using tumor cell antigens can stimulate a cytotoxic T cell response that is tumor-specific and that engenders protective immunity against CNS tumor in the treated animals (Ashley et al, 1997; Heimberger et al, 2002). It is also conceivable that a subpopulation of the primary tumor, selected for its capacity to grow in vitro, may not reflect the tumor cell population as a whole especially since tumors such as glioma are known to be heterogeneous. We have chosen an allogeneic fibroblast cell line as a cellular vaccine for a number of reasons. Fibroblasts obtained from established allogeneic fibroblast cell lines may be readily cultured in vitro and genetically modified 110

Cancer Therapy Vol 1, page 111 Institute for Molecular and Cellular Biology, Osaka University, Japan) (Yamada et al, 1987). The plasmid contains a human IL-2 cDNA and a gene (neor) that confers resistance to the aminoglycoside antibiotic, G418 (Colbere-Garapin et al, 1981) used for selection. To prepare the IL-2/IFN-" double cytokine-secreting cells, the IL-2 secreting cells were co-transfected (lipofectin-mediated; Gibco BRL, Grand Island, NY) with DNA from pZipNeoSVIFN-" (obtained from M.K.L. Collins, Institute of Cancer Research, London, England) along with DNA from pHyg (obtained from L. Lau, University of Illinois, Chicago, Illinois), as previously described (Kim et al, 1995). The plasmid confers resistance to hygromycin (Sugden et al, 1985) used for selection. IFN-" single cytokine-secreting cell-lines were prepared by co-transfection of LM cells with DNA from pZipNeoSVIFN-" along with DNA from pHyg, as previously described (Kim et al, 1995). The cells were maintained for 14 days in growth medium containing 300 µg/ml hygromycin. To maintain cytokinesecretion, every third passage the cells were routinely placed in the relevant selection medium.

to express and secrete cytokines (Kim et al, 1992; Kim et al, 1994; Tahara et al, 1994; Fakhrai et al, 1995; Sobol et al, 1995). The cells can be genetically modified to secrete cytokines and subsequently injected directly into the tumor bed. The use of allogeneic rather than syngeneic cells was initially based upon evidence that allogeneic MHC determinants augment the immunogenic properties of the tumor vaccine (Kim et al, 1992; Kim et al, 1994; Tahara et al, 1994). Application of genetically modified fibroblasts in therapeutic vaccines facilitates titration of single or multiple cytokine doses independent of tumor cell doses. Like other allografts, the allogeneic cytokine-secreting cells are rejected . Furthermore, the number of cells can be expanded as desired for multiple rounds of therapy. In addition, the slow continuous release of cytokines and the eventual rejection of the allograft may be a useful advantage in the treatment of brain tumors where longterm secretion of high concentrations of certain cytokines may be associated with increased morbidity. Thus, an allogeneic cytokine secreting vaccine is readily available, easily expanded, possibly less toxic and more immunogenic. These considerations provide the rationale for examining the use of allogeneic fibroblasts genetically modified to secrete cytokines as a means of enhancing anti-tumor immune responses in treatment of malignant intracerebral tumors (Kim et al, 1992; Kim et al, 1994; Tahara et al, 1994; Fakhrai et al, 1995; Lichtor et al, 1995; Sobol et al, 1995; Lichtor et al 2002).

C. Modification of LM or LM-IL-2 fibroblasts (H-2k) to express H-2Kb class Ideterminants A plasmid (pBR327H-2Kb from Biogen Research Corp, Cambridge, MA) encoding MHC H-2Kb determinants was used to modify LM or LM-IL-2 fibroblasts to express H-2Kb determinants. Ten µg of PBR327H-2Kb and 1 µg of pBabePuro was mixed with Lipofectin (Gibco BRL), according to the supplier’s instructions. The plasmid pBabePuro (obtained from M.K.L. Collins, University College, London, England) conferring resistance to puromycin, was used for selection. The plasmid-mixture was added to 1x106 LM or LM-IL-2 cells in 10 ml of DMEM, without FBS. For use as a control, an equivalent number of LM or LM-IL-2 cells were transfected with 1µg of pBabePuro alone. The cells were incubated for 18 hrs at 370C in a CO2/air atmosphere, washed with DMEM, followed by the addition of growth medium. After incubation for 48 hrs, the cell cultures were divided and replated in growth medium supplemented with 3.0 µg/ml puromycin (Sigma; St Louis, MO) followed by incubation at 370C for 7 additional days. The surviving colonies were pooled and tested by staining with specific FITC-conjugated antibodies for the expression of H2Kb-determinants. One hundred percent of non-transfected fibroblasts maintained in growth medium containing puromycin died during the seven-day period of incubation.

II. Materials and methods A. Cell lines and experimental animals Gl261 is a malignant glial tumor syngeneic in C57BL/6 mice. The tumor was originally obtained from Dr. J. Mayo (DCT, DPT, National Cancer Institute, Frederick, MD); it was maintained by serial transfer in histocompatible C57BL/6 mice. SB-5b cells are a breast adenocarcinoma that formed spontaneously in a C3H/He mouse. These cells were grown by in vivo passage in female C3H/He mice. B16F1 cells are a highly malignant melanoma cell line derived from a melanoma arising spontaneously in C57BL/6 mice (from I. Fidler, M.D. Anderson, Houston, TX). LM cells, a fibroblast cell line of C3H/He mouse origin, were from the American Type Culture Collection (Manassas, VA). The B16F1 and LM cells were maintained at 370C in a humidified 7% CO2/air atmosphere in DMEM (Life Technologies, Grand Island, NY) supplemented with 10% FBS (Sigma, St Louis, MO) and antibiotics (Life Technologies) (growth medium). The animals used were eight to ten-week-old pathogen-free C57Bl/6 (H-2b) or C3H/He (H-2k) mice obtained from Charles River Breeding Laboratories (Portage, MI). The mice were maintained in the animal care facilities of the University of Illinois, according to National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. They were 8-12 weeks old when used in the experiments.

D. Assays for cytokine secretion IL-2 secretion by the G418-resistant cells was assayed with the use of the IL-2-dependent cell-line CTLL-2, as previously described (Gillis et al, 1978). One unit of IL-2 gave halfmaximal proliferation of CTLL-2 cells under these conditions (Gillis et al, 1978). IL-2 and IFN-" secretion by the transfected cells were assayed by the use of a human IL-2 or a mouse IFN-" ELISA kit (Genzyme, Cambridge, MA).

E. The detection of mRNAs specifying IL-2 or IFN-" by transfected LM cells by the reverse transcription-polymerase chain reaction (RTPCR)

B. Preparation of cytokine (IL-2 and/or IFN") secreting mouse fibroblasts IL-2 secreting mouse fibroblasts were prepared as described previously (Kim et al, 1992). The gene for IL-2 was transduced into LM fibroblasts with a retroviral plasmid (pZipNeoSV-IL-2) (obtained originally from T. Taniguchi,

RT-PCR was used as a further confirmation of the expression of the transferred cytokine genes. Total cellular RNA

111

Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts was prepared from the relevant cell types (Chomczynski et al, 1987) and then transcribed into cDNA and amplified, as previously described (Kim et al, 1995).

injected i.c. with an equivalent number of LM-IL-2 cells alone lived for more than three months and showed no evidence of ill effects or neurologic deficit. Immunocytotoxic studies demonstrated a significantly elevated cromium release from Gl261 cells co-incubated with spleen cells from mice injected i.c. with glioma cells and the cyotkine secreting fibroblasts (Table 1). Thus, therapy with an immunogen that combined the expression of allogeneic antigens and the secretion of cytokines led to the most significant benefit in mice with an intracerebral glioma.

F. Spleen cell-mediated cytotoxicity by 51Crrelease assay Mononuclear cells from the spleens of C57BL/6 mice immunized with the various cell constructs were used as sources of effector cells for the cytotoxicity studies using a standard 4 hour cromium release assay, as previously described (Kim et al, 1995).

B. Specificity of the immune response

G. In vitro determination of the classes of effector cells activated for the anti-glioma cytotoxicity

The specificity of the immunocytotoxic response was evaluated against a variety of tumor cell lines (Table 2). Only spleen cells from immunized animals demonstrated an immunocytotoxic response. The response, although somewhat non-specific when tested against a variety of tumor cell lines, was markedly enhanced when tested against the same tumor cells with which the animal was initially injected.

The effect of monoclonal antibodies (mAbs) for T-cell subsets or NK/LAK cells on the anti-tumor response was used to identify the predominant cell-types activated for anti-tumor cytotoxicity in mice immunized with the cytokine-secreting cells.

H. Statistical analysis Student’s t test was used to determine the statistical differences between the survival of mice in various experimental and control groups. A P value below 0.05 was considered significant.

III. Results A. Simultaneous intracerebral injection of glioma and cytokine secreting allogeneic cells We measured the survival of C57Bl/6 mice injected intracerebrally (i.c.) with a mixture of Gl261 glioma cells and cytokine secreting LM cells. Gl261 cells are a glioma cell-line of C57Bl/6 mouse origin (H-2b). LM fibroblasts are derived from C3H/He mice and express H-2k determinants. We initially evaluated the immunotherapeutic effects of single cytokine-secreting LM-IL-2 cells and double cytokine-secreting LM-IL2/interferon-" cells in mice bearing an i.c. glioma. A mixture of G1261 cells and the single or double cytokinesecreting cells were injected i.c. into the right frontal lobe of C57BL/6 mice, syngeneic with G1261 cells (Figure 1). Mice injected i.c. with the mixture of glioma and LM-IL-2 cells survived significantly longer (P<0.025) than control mice injected i.c. with an equivalent number of glioma cells alone. Somewhat more dramatic results were obtained for mice injected i.c. with a mixture of glioma cells and LM-IL-2/interferon-" double cytokine-secreting cells. In addition, the survival of this group was statistically prolonged relative to either untreated mice with glioma or those animals injected with Gl261 cells and LM-IL-2 cells. The survival time of mice injected with a mixture of glioma cells and LM-Interferon-" cells was not significantly different from that of mice injected with glioma cells alone (P>0.1). Of special interest, mice

Figure 1. Graph showing the survival rate of mice injected i.c. with a mixture of glioma cells and fibroblasts (LM cells) engineered to secrete cytokines. The C57Bl/6 mice (8 per group) were injected i.c. with a mixture of 106 cells of one of the cell types and 105 Gl261 glioma cells. The median lengths of survival were as follows (in days): mice with nonimmunized glioma cells, 16.9 ± 1.9; glioma plus LM cells, 20.0 ± 4.5; glioma plus LM-IL2 cells, 23.4 ± 6.8; glioma plus LM-IFN-" cells, 18.0 ± 1.8; glioma plus LM-IL-2/IFN-" cells, 28.1 ± 5.8. Probability values were: nonimmunized vs. LM-IL-2, p < 0.025; nonimmunized or LM vs LM-IL-2/IFN-", p < 0.005; LM-IL-2 vs LM-IL-2/IFN-(, p < 0.05.

112

Cancer Therapy Vol 1, page 113 Table 1

C57BL/6 mice received a single i.c. injection of (105) glioma cells together with one of the modified fibroblast cell-types (106 cells). Three weeks after the injection, mononuclear cells from the spleens of the immunized mice obtained through Ficoll-Hypaque centrifugation were used for the 51Cr-release assay. All values represent the mean Âą SD of triplicate determinations. b P < 0.005 relative to 51Cr release for spleen cells from animals immunized with glioma. c P < 0.05 relative to 51Cr release for spleen cells from animals immunized with glioma + LM cells. d P < 0.025 relative to 51Cr release for spleen cells from animals immunized with glioma. e P < 0.05 relative to 51Cr release for spleen cells from animals immunized with glioma + LM-IL-2 cells.

Table 2

C57BL/6 mice received a single i.c. injection of (2.0 X 105) Gl261 glioma cells together with one of the modified fibroblast cell-types (106 cells). Two weeks after the injection, mononuclear cells from the spleens of the immunized mice obtained through Ficoll-Hypaque centrifugation were used for the 51Cr-release assay using 4 different 51Cr-labeled cell types as tumor targets including Gl261 glioma, B16F1 melanoma, EL-4 lymphoma and LL/2 Lewis lung carcinoma cells. All tumor cells are of C57Bl/6 origin (H-2b haplotype). All values represent the mean Âą SD of triplicate determinations.

113

Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts in control mice injected with LM (non-cytokine secreting) fibroblasts (data not shown). Thus, modified allogeneic cells fail to survive in the CNS beyond 14 days as evidenced by PCR. The animals implanted with the genetically modified cells were observed daily for evidence of neurologic deficit and other morbidity or mortality for over 60 days, and at no time did the mice exhibit neurologic deficits or adverse effects on survival.

C. Intracerebral survival and toxicity of the cytokine-secreting allogeneic cells The toxicity of the allogeneic cell based cytokine gene therapy for tumors is likely to depend in part on the ability of the genetically modified cells to survive in the CNS. The intracerebral distribution and survival of the cytokine secreting cells was investigated using both allogeneic C57BL/6 and syngeneic C3H/He mice. As a means of assessing survival of the allogeneic cells in the CNS, PCR analysis was performed to identify the presence of the neomycin gene in the brain sections at various time intervals (2-60 days). In brief, high molecular weight DNA was isolated using techniques described previously (Gillis et al, 1978). PCR amplification of the DNA was subsequently performed in a reaction mixture consisting of 0.4 µM of primer for the Neor gene, 3-5 µl of the DNA samples, 1.5 mM MgCl2, 0.5 mM of each dNTP, and 2.0 U Taq polymerase (Gibco). The sequences of the Neo gene primers are as follows: 5’ primer, 5'GCTGTGCTCGACGTTGTCAC3'; 3' primer, 5'CTCTTCGTCCAGATCATCCTG3'. The reactions were run for 38 cycles of 94oC (1 min), 55oC (1 min), 72oC (1 min) using a Perkin-Elmer Cetus thermal cycler. After amplification, 5 µl of the reaction mixture was removed and analyzed by electrophoresis in a 2.0% agarose gel. DNA sequences specific for the neomycin gene were found in DNA isolated from allogeneic mice on days 8, 14, but were no longer detected on days 28 and 60 (Figure 2). Similar experiments in syngeneic mice detected DNA sequences specific for the neomycin gene at 55 days. DNA sequences specific for the neomycin gene were not found

D. Evaluation of the therapeutic benefits of LM cells modified to secrete interleukin-2 in mice with an established pre-existing glioma To determine if the cytokine secreting cells could be effective in treating a clinically relevant model of mice with an established glioma, naïve C57Bl/6 mice bearing cannulas were first injected with Gl261 glioma followed two days later with injection of either non-IL-2-secreting allogeneic LM fibroblasts or syngeneic/allogeneic LM-IL2/Kb cells. The animals received two more injections of the same type of cells as first injected through the cannulas at weekly intervals for a total of three injections. The animals with an established glioma treated with IL-2 secreting syngeneic/allogeneic fibroblasts survived significantly longer in comparision to either untreated animals (P < 0.05) or animals treated with allogeneic LM fibroblasts (P < 0.025) (Figure 3). This experiment was repeated one additional time with similar results.

Figure 2. PCR anaylsis for the survival of modified fibroblasts in the CNS. PCR analysis was performed for the presence of the neomycin resistance gene in brain sections taken at various time intervals (0-60 days) after implantation of modified fibroblasts into the CNS in allogeneic and syngeneic mice. DNA sequences for the neomycin resistance gene were observed on Days 8 and 14 but not on Days 28 or 60 after implantation in allogeneic mice, and up to 55 days in syngeneic mice. Lane 1, low-mass molecular marker (Life Technologies); Lane 2, 8 days after injection into allogeneic mice; Lane 3, 14 days after injection into allogeneic mice; Lane 4, 28 days after injection into allogeneic mice; Lane 5, 60 days after injection into allogeneic mice; Lane 6, 55 days after injection into syngeneic mice; Lane 7, 10 3 LM-IL-2 cells; Lane 8, pZipNeo plasmid. Arrow indicates the location of the 249 – base pair Neor gene.

Figure 3. Treatment of an established glioma with IL-2 secreting cells. C57Bl/6 mice (nine animals/group) were injected i.c. through a cannula with 5.0 X 104 Gl261 cells followed two days later by the first of three weekly injections of 1.0 X 106 LM-IL2/Kb cells. As controls, animals received an equivalent number of tumor cells followed by treatment with either LM cells or media alone at the same time intervals as described previously. MST (days): media alone, 23.4 ± 4.1; LM, 22.3 ± 4.3; LM-IL-2/Kb, 26.7 ± 4.6. P values: media alone versus LM-IL-2/Kb, P < 0.05; LM versus LM-IL-2/Kb, P < 0.025.

114

Cancer Therapy Vol 1, page 115 with spleen cells from mice immunized with RLBA-IL2/interferon-" cells either intracerebrally (Table 3) or subcutaneously (Table 4) was significantly higher than non-immunized mice (p<.005). In addition the cellular anti-melanoma response was mediated primarily by NK/LAK and CD8+ cells. In summary, we find a significantly increased survival time and specific immunocytotoxic responses in mice with CNS melanoma treated intracerebrally with allogeneicfibroblasts modified to secrete IL-2 and IFN-".

E. Intracerebral versus subcutaneous immunization with allogeneic fibroblasts genetically engineered to secrete interleukin-2 in the treatment of central nervous system tumor The purpose of this study was to determine the optimal route of delivery of gene therapy for an intracerebral tumor. Systemic delivery of gene therapy is of significant clinical interest. In this study, allogeneic fibroblasts engineered to secrete interleukin-2 were administered either subcutaneously (in the presence or absence of Gl261 cells) or intracerebrally to C57Bl/6 mice with intracerebral (i.c.) glioma. The results indicate a significant prolongation of survival in mice with i.c. glioma treated intracerebrally with LM-IL-2 cells, relative to the survival of mice with i.c. glioma treated subcutaneously with LM-IL-2 cells (either alone or mixed with Gl261 cells) or untreated mice with glioma (P < 0.05). The specific release of isotope from 51Cr-labeled glioma cells co-incubated with spleen cells from animals treated either subcutaneously or intracerebrally with LMIL-2 cells was significantly greater than the release of isotope from glioma cells co-incubated with spleen cells from nonimmunized mice (P < 0.005). Direct i.c. administration of fibroblasts genetically engineered to secrete IL-2 was more effective in prolonging survival than peripheral subcutaneous administration in the treatment of mice with i.c. glioma even though both treatments stimulated a strong antiglioma immune response (data not shown). Similar studies were carried out using an intracerebral melanoma model to determine the possible immunotherapeutic benefits of IL-2 cells in mice with an intracerebral melanoma. In these studies B16F1 cells were stereotactically implanted into the right frontal lobes of C57BL/6 mice. The mice were treated with intracerebral (i.c.) or subcutaneous (s.c.) immunizations of allogeneic fibroblasts genetically engineered to express melanoma associated antigens and secrete IL-2 and/or gamma interferon. For controls, mice were injected i.c. with an equivalent number of B16 cells and treated with non IL-2secreting RLBA-ZipNeo cells (MAA(+);IL-2(-)). The results indicate that the mice that were injected i.c. with B16 melanoma cells and RLBA-IL-2 cells survived significantly longer (P<0.005) than mice injected i.c. with B16 cells alone or with a mixture of B16 and RLBAZipNeo cells (Figure 4). Similar significant (P<0.005) therapeutic responses were observed in mice injected intracerebrally with a mixture of B16 cells and RLBA-IL2/interferon-" double cytokine-secreting cells. There was no increase in survival in the mice immunized subcutaneously with the cytokine secreting cells. Histopathological evaluation of tumors from treated and untreated mice was performed on all animals at the time of cromium release studies (2 weeks) and at the time of death (3-4 weeks). The most extensive lymphocytic infiltration was in mice treated with the IL-2 secreting cells. Using a standard 51Cr release assay, the specific release of isotope from labeled B16 cells co-incubated

Figure 4. A. Graph showing the survival of mice injected intracerebrally with a mixture of B16F1 melanoma cells and RLBA-IL2 cells. C57Bl/6 mice were injected intracerebrally with a mixture of B16F1 melanoma cells (103) and one of the cell types (106). Mean survival times in days were as follows: B16 cells alone, 14.0 ± 2.6; B16 + RLBA-IFN-" cells, 17.4 ± 3.7; B16 + RLBA-IL-2 cells, 24.6 ± 4.0; B16 +RLBA-IFN-"/IL-2 cells, 23.1 ± 3.4. P Values: nonimmunized or RLBA-IFN-" versus RLBA-IL-2, P < 0.005; nonimmunized or RLBA-IFN-" versus RLBA-IFN-"/IL-2, P < 0.005.B. Graph showing the survival of mice injected intracerebrally with B16F1 melanoma cells and subcutaneously with cytokine secreting cells. C57Bl/6 mice were injected intracerebrally with B16F1 cells (10 3) and subcutanously with one of the cell types (106 cells). Mean survival time (days): B16 cells alone, 22.7 ± 3.0; B16 + RLBA-IFN-", 21.7 ± 3.6; B16 + RLBA-IL-2, 23.3 ± 3.4; B16 + RLBA-IFN-"/IL-2, 22.0 ± 1.9.

115

Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts Table 3

C57BL/6 mice received a single i.c. injection of a mixture of 103 melanoma cells together with one of the modified fibroblast cell-types (106 cells). Two weeks afterward, mononuclear cells from the spleens of the injected mice (Ficoll-Hypaque) were used for the 51 Cr-release assay. All values represent the mean Âą SD of triplicate determinations. b Toward 51Cr-labeled B16F1 cells; E: T ratio = 100 : 1. c P < 0.005 relative to 51Cr-release for spleen cells from mice injected i.c. with B16F1 cells alone.

Table 4

C57BL/6 mice received a single i.c. injection of (103) B16F1 melanoma cells and a s.c. injection of one of the modified fibroblast cell-types (107 cells). Two weeks afterward, mononuclear cells from the spleens of the injected mice (Ficoll-Hypaque) were used for the 51 Cr-release assays. All values represent the mean Âą SD of triplicate determinations. b

E : T ratio = 100 : 1. P < 0.005 relative to 51Cr-release from B16F1 cells co-incubated with spleen cells from mice injected i.c. with B16F1 cells alone. d P < 0.0005 relative to 51Cr-release from B16F1 cells co-incubated with spleen cells from mice injected i.c. with B16F1 cells alone, and P < 0.005 versus 51Cr-release from B16F1 cells co-incubated with spleen cells from mice injected i.c. with RLBA-IL-2 cells. c

116

Cancer Therapy Vol 1, page 117 There was no increase in survival in animals treated subcutaneously, despite a significant systemic immunocytotoxic response.

G. Pretreatment of mice with allogeneic cytokine secreting cells prior to i.c. injection of tumor cells

F. Survival of C3H/He mice when injected i.c. with a mixture of intracerebral breast carcinoma and IL-2 secreting allogeneic fibroblasts

We found previously that the survival of C57Bl/6 mice injected with Gl261 glioma cells mixed with allogeneic IL-2 secreting fibroblasts is significantly prolonged in comparision to various control groups. In previous studies, we also found that allogeneic LM-IL-2 fibroblasts modified to express H-2Kb determinants (syngeneic in C57Bl/6 mice) to form semiallogeneic LMIL-2/Kb cells are more effective than IL-2-secreting fibroblasts that express allogeneic determinants alone in treating mice with Gl261 glioma. In order to investigate the mechanism involved in using these genetically engineered cells for treatment of an intracerebral tumor, cannulas were placed into the right frontal lobe of C57Bl/6 mice. The animals were subsequently injected two times at weekly intervals with LM-IL-2/Kb cells through the cannulas prior to injection of glioma cells. The tumor cells were mixed with the vaccine and introduced through the cannulas one week following the second injection. The results demonstrate a significant delay in the development of glioma (P < 0.005) in the animals treated with either non-secreting cells or IL-2-secreting syngeneic/allogeneic fibroblasts (Figure 6).

On the basis of previous experiments, 106 cytokine secreting cells were chosen as the treatment dose. Confirmation of IL-2 secretion by the LM-IL-2/Kb cells was detected by an enzyme-linked immunoadsorbent assay. Next C3H/He mice (eight mice/group) were injected i.c. with a mixture of 106 IL-2 secreting fibroblasts and 104 SB-5b breast carcinoma cells. LM fibroblasts which are syngeneic with C3H/He mice were modified to express H-2Kb class-I allogeneic MHC determinants (LM-Kb or LM-IL-2/Kb) to provide a potent immune adjuvant. The results indicated that the mean survival time of mice injected with the mixture of breast carcinoma cells and the LM-IL-2/Kb cells was significantly longer than mice injected i.c. with an equivalent number of breast carcinoma cells alone (P < 0.01), or mice injected i.c. with breast cancer cells and non-cytokine secreting LM-Kb fibroblasts (P < 0.05) (Figure 5). Thus, the presence of IL-2 secreting fibroblasts in the tumor bed prolonged survival in mice with intracerebral breast carcinoma.

Figure 6 . Pre-treatment with allogeneic fibroblasts prevents the development of a glioma. C57Bl/6 mice (twelve animals/group) were injected with 1.0 X 10 6 LM-IL-2/Kb cells through a cannula on two occasions separated by one week. One week following the second injection the animals were injected a third time with a mixture of 1.0 X 106 LM-IL-2/Kb cells and 5.0 X 104 Gl261 cells. As controls, animals were injected through the cannula with either 1.0 X 106 LM cells or media at the same time points along with an equivalent number of Gl261 cells at the time of the third injection. MST (days): media alone, 25.4 ± 1.6; LM, 39.6 ± 12.2; LM-IL-2/Kb, 53.9 ± 10.3. P values: media alone versus LM, P < 0.005; media alone versus LM-IL-2/Kb, P < 0.0005; LM versus LM-IL-2/Kb, P < 0.005.

Figure 5. Treatment of C3H/He mice with intracerebral SB-5b breast carcinoma with LM-IL-2/Kb cells. C3H/He mice (eight animals/group) were injected with a mixture of 1.0 X 10 6 LM-IL2/Kb cells and 1.0 X 104 SB-5b cells or, as controls, with an equivalent number of SB-5b cells and either 1.0 X 106 LM-Kb cells or media alone. MST (days): media alone, 15.6 ± 2.7; LMKb, 19.6 ± 8.2; LM-IL-2/Kb, 27.8 ± 11.5. P values: media alone versus LM-IL-2/Kb, P < 0.01; LM-Kb versus LM-IL-2/Kb, P < 0.05

117

Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts Six animals in the IL-2 treated group that survived for over three months were then re-challenged with an intracerebral injection into the same site as the previous injections of 5 X 104 Gl261 glioma cells alone to determine if a long-term resistance toward glioma had been established in these animals. The results demonstrated a significant prolongation of survival (P < 0.01) for those animals that had been previously injected with a mixture of tumor and LM-IL2/Kb cells in comparison to the naïve animals injected with glioma cells alone (Figure 7). There were four long-term survivors (> 90 days) of the six total animals in the group previously treated with LM-IL2/Kb cells after receiving a second tumor challenge. These results suggest that a longterm immunity was established at the injection site in the animals that underwent multiple intracerebral injections of LM-IL-2/Kb cells prior to tumor injection. Whether or not a more generalized systemic immunity against glioma was established in these animals has not been determined.

with enhanced anti-tumor effectiveness by transducing LM cells, a mouse fibroblast cell-line expressing defined MHC-determinants (H-2k), with a modified retroviral vector that specified the gene for IL-2. C57BL/6 mice (H2b) injected intracerebrally (i.c.) with a mixture of Gl261 glioma cells and LM cells (H-2k) modified for IL-2 secretion (LM-IL-2) survived significantly longer than mice in various other treatment groups. The anti-tumor immune responses in the tumor-bearing mice were mediated predominantly by CD8+ and NK/LAK cells. Of special interest, mice injected i.c. with the cytokinesecreting allogeneic cells alone exhibited no neurologic deficit and there were no adverse effects on survival. The injection of cytokine-secreting allogeneic cells into the microenvironment of an intracerebral tumor is hypothesized to induce an anti-tumor immune response capable of prolonging survival. The toxic effects of cytokines in the CNS may limit the quantity that can be administered (Robinson et al, 1987; Birchfield et al, 1992; Kim et al, 1994). Neurologic effects have been seen in animals injected intracranially with syngeneic cytokine-secreting cells. The coimplantation into the rat brain of syngeneic (RG-2) glioma cells and RG-2 cells modified by retroviral transduction to secrete IL-2 or IFN-" resulted in short-term cell mediated anti-glioma responses. However the survival of the tumor bearing rats was not prolonged, and the animals died from secondary effects including severe cerebral edema (Tjuvajev et al, 1995). The toxicity of a cellular-based cytokine gene therapy for tumors is likely to depend in part on the survival of the genetically modified cells in the CNS. We investigated the survival of an allogeneic IL-2 secreting vaccine in the CNS by two different means: PCR and bioassay (Griffitt et al, 1998). We found that the survival of allogeneic cells in the CNS was less than 28 days. The cells like other allografts were rejected. The cells were well tolerated, and the animals did not demonstrate any significant neurologic or systemic toxicity. This suggests that cytokine-secreting allogeneic cells may serve as a useful vehicle for the safe delivery of cytokines into brain tumors, and supports the possibility and safety of using a monthly retreatment schedule in a clinical protocol. Most of the systemic toxicities of IL-2 therapy should be avoided by the introduction of the gene for IL-2 directly into the tumor mass, resulting in primarily local concentrations of the cytokine. This form of treatment is particularly attractive in the treatment of primary gliomas, since these tumors usually only recur locally and are rarely metastatic. More recently, the use of a small intracerebral cannula enables one to inject the treatment cells directly into the tumor bed on numerous occasions (Lichtor et al, 2002). This allows us to investigate both protective vaccine strategies using pretreatment via the cannula prior to tumor injection as well as the effect of the vaccine on the treatment of an established tumor. One of the major concerns related to the immunologic treatment of brain tumors is the effect of the blood brain barrier on the development of a host immune response in the CNS. Studies using IL-4 secreting plasmacytoma cells implanted into the brains of nude mice along with human glioma

IV. Discussion The efficacy of active tumor immunotherapy with cytokine-transduced syngeneic or allogeneic fibroblasts has been reviewed in this paper. Intracerebral injections with IL-2 transduced allogeneic fibroblasts generated systemic anti-tumor immunity capable of eradicating brain tumors. In particular we constructed a cellular vaccine

Figure 7. Long-term immunity in mice with glioma that survived prior treatment with IL-2 secreting allogeneic fibroblasts. Six C57Bl/6 mice surviving 90 days after prior injection of Gl261 cells and LM-IL-2/Kb fibroblasts were injected through the same right frontal burr hole a second time with 5.0 X 104 Gl261 cells alone. As a control, eight naïve C57Bl/6 mice were injected intracerebrally with an equivalent number of Gl261 cells alone. MST for the untreated naïve animals injected with tumor cells was 23.4 ± 4.1 days, and 36.2 ± 7.2 for the animals that had previously been vaccinated with LMIL-2/Kb cells and re-challenged with tumor cells. The four animals that were still alive at the conclusion of this experiment all of which had previously been treated with LM-IL2/Kb cells survived for longer than 90 days without evidence of any neurologic deficit. P < 0.01 for the difference in survival of mice in the two groups.

118

Cancer Therapy Vol 1, page 119 antisense gene therapy. Proc Natl Acad Sci USA 93, 29092914. Fakhrai H, Mantil J, Gramatikova S, Nicholson G, MurphySatter C, Krauss G, Poelstra R, Ruppert J, Sequeira P, Satter M, Kruse CA (2000) Gene therapy of human gliomas with TGF-!2 antisense gene modified autologous tumor cells. A Phase I trial. Proc Am Ass Cancer Res 41, 543. Fakhrai H, Shawler DL, Gjerset R, Naviaux RK, Koziol J, Royston I, Sobol RE (1995) Cytokine gene therapy with interleukin-2 transduced fibroblasts, effects of IL-2 dose on anti-tumor immunity. Hum Gene Ther 6, 591-601. Fearon ER, Pardoll DM, Itaya T, Golumbek P, Levitsky M, Simons JW, Karasuyama H, Vogelstein B, Frost P (1990) Interleukin-2 production by tumor cells bypasses T helper function in the generation of an anti-tumor reponse. Cell 60, 387-403. Gabrilove JL, Jakubowski A (1990) Hematopoietic growth factors, biology and clinical application. Monogr J Natl Cancer Inst 10, 73-77. Gandolfi L, Solmi L, Pizza GC, Bertoni F, Muratori R, DeVinci C, Bacchini P, Morelli MC, Corrado G (1989) Intratumoral echo-guided injection of interleukin-2 and cytokine-activated killer cells in hepatocellular carcinoma. HepatoGastroenterology 36, 352-356. Gansbacher B, Zier K, Daniels B, Cronin K, Bannedi R, Gilboa E (1990) Interleukin-2 gene transfer into tumor cells abrogates tumorigenicity and induces protective immunity. J Exp Med 172, 1217-1223. Giezeman-Smits, KM, Okada H, Brissette-Storkus CS, Villa LA, Attanucci J, Lotze MT, Pollack IF, Bozik ME, Chambers WH (2000) Cytokine gene therapy of gliomas, induction of reactive CD4+ T cells by interleukin-4-transfected 9L gliosarcoma is essential for protective immunity. Cancer Research 60, 2449-2457. Gillis S, Ferm MM, Ou W, Smith KA (1978) T cell growth factors, parameters of production and a quantitative microassay for activity. J Immunol 120, 2027-2032. Glick RP, Lichtor T, Kim TS, Ilangovan S, Cohen EP (1995) Fibroblasts genetically engineered to secrete cytokines suppress tumor growth and induce antitumor immunity to a murine glioma in vivo. Neurosurgery 36, 548-555. Griffitt W, Glick RP, Lichtor T, Cohen EP (1998) Survival and toxicity of an allogeneic cytokine-secreting fibroblast vaccine in the central nervous system. Neurosurgery 42, 335-340. Heimberger AB, Archer GE, Crotty LE, McLendon RE, Friedman AH, Friedman HS, Bigner DD, Sampson JH (2002) Dendritic cells pulsed with a tumor-specific peptide induce long-lasting immunity and are effective against murine intracerebral melanoma. Neurosurgery 50, 158-164. Kelso A (1989) Cytokines, structure function and synthesis. Curr Opin Immunol 2, 215-225. Kim TS and Cohen EP (1994) Interleukin-2-secreting mouse fibroblasts transfected with genomic DNA from murine melanoma cells prolong the survival of mice with melanoma. Cancer Res 54(10)2531-2535. Kim H, Rosenberg SA, Steinberg SM, Cole DJ, Weber JS (1994) A randomized double blind comparison of the antiemetic efficacy of ondansetron and dropidol in patients receiving high dose interleukin-2. J Immunother Emphasis Tumor Immunol 16, 60-65. Kim TS, Russell SJ, Collins MK, Cohen EP (1992) Immunity to B 16 melanoma in mice immunized with IL-2- secreting allogeneic mouse fibroblasts expressing melanomaassociated antigens. Int J Cancer 51, 283-9. Kim TS, Xu WS, Cohen EP (1995) Immunization with interleukin-2/interferon-" double cytokine-secreting

cells demonstrated a dramatic eosinophilic infiltrate in regions of necrotic tumor, suggesting that an immune response can take place against a tumor of the central nervous system in situ. The response, however, was non T-cell dependent (Yu et al, 1993). We found that a specific and significant systemic immunocytotoxic response (by 51 cromium release assay) was present in animals with glioma treated with allogeneic IL-2 secreting fibroblasts (Glick et al, 1995; Lichtor et al, 1995). Thus the secretion of IL-2 by the cellular immunogen, or an immunogenic derivative of the cells, may have altered the blood brain barrier (BBB) enabling the immunogen to reach the spleen and lymph nodes in the periphery (Watts et al, 1989; Zhang et al, 1992). Although preclinical studies with cytokine gene therapy appear promising (Sampson et al, 1997; Yu et al, 1997; Natsume et al, 1999; Giezeman-Smits et al, 2000, Okada et al, 2001; Lichtor et al, 2002), clinical trials for brain tumors have been limited. These trials have involved immunization with tumor cells modified with the IL-2 gene (Sobol et al, 1995), the IL-4 gene (Okada et al, 2000) or TGF-!2 antisense gene (Fakhrai et al, 2000). In summary, our studies suggest that Immuno-Gene therapy using IL-2 secreting fibroblasts as a cellular vaccine can be useful as a new therapeutic approach in treatment of a primary or metastatic intracerebral tumor especially when the tumor burden is small or at the time of tumor resection. The use of cytokine secreting tumor vaccines as a protective treatment introduced following tumor resection hopefully will play an important role in delaying tumor recurrence. We believe that this is where immunotherapy is most promising.

References Ashley DM, Faiola B, Nair S, Hale LP, Bigner DD, Gilboa E (1997) Bone marrow-generated dendritic cells pulsed with tumor extracts or tumor RNA induce antitumor immunity against central nervous system tumors. J Exp Med. 186, 1177-1182. Birchfield GR, Rodgers GM, Girodias KW, Ward JH, Samlowski WE (1992) Hypoprothrobinemia associated with interleukin2 therapy. J lmmunother 11, 71-75. Borden EC; Sondel PM (1990) Lymphokines and cytokines as cancer treatment. Immunotherapy realized. Cancer 65 (3 Suppl) 800 - 814. Bubenik J, Viotenok NN, Kieler J, Prassolov VS, Chumakov PM, Bubenikova D, Simova F, Jandlova T (1988) Local administration of cells containing an inserted IL-2 gene and producing IL-2 inhibits growth of human tumors in nu/nu mice. Immunol Lett 19, 279-282. Chomczynski P, Sacchi N (1987) Single step method of RNA isolation by acid guanidinium-thiocyanate-phenolchloroform extraction. Anal Biochem 162, 156-159. Colbere-Garapin F, Horodniceanu F, Kouritsky P, Garapin AC (1981) A new dominant hybrid selective marker for higher eukaryotic cells. J Mol Biol 150, 1-14. Ehtesham M, Kabos P, Kabosova A, Neuman T, Black KL, Yu JS (2002) The use of interleukin 12-secreting neural stem cells for the treatment of intracranial glioma. Cancer Res 62, 5657-5663. Fakhrai H, Dorigo O, Shawler DL, Lin H, Mercola D, Black KL, Royston I, Sobol RE (1996) Eradication of established intracranial rat gliomas by transforming growth factor !

119

Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts allogeneic fibroblasts prolongs the survival of mice with melanoma. Melanoma Res 5, 217-227. Lichtor T, Glick PP, Kim TS, Hand R, Cohen EP (1995) Prolonged survival of mice with glioma injected intracerebrally with double cytokine-secreting cells. J Neurosurgery 83, 1038-1044. Lichtor T, Glick RP, Tarlock K, Moffett S, Mouw E, Cohen EP (2002) Application of Interleukin-2 Secreting Syngeneic/Allogeneic Fibroblasts in the Treatment of Primary and Metastatic Brain Tumors. Cancer Gene Therapy; 9, 464-469. Lotze MT, Chang A.E, Seipp CA, Simpson C, Vetto JT, Rosenberg SA (1986) High-dose recombinant interleukin-2 in the treatment of patients with disseminated cancer, responses, treatment-related morbidity and histologic findings. JAMA 256, 3117-3124. Mahaley MS, Mettlin C, Natarajan N, Laws ER, Peace BB (1989) National survey of patterns of care for brain-tumor patients. J Neurosurg 71, 826-836. Natsume A, Mizuno M, Ryuke Y, Yoshida J (1999) Antitumor effect and cellular immunity activation by murine interferonbeta gene transfer against intracerebral glioma in mouse. Gene Therapy 6, 1626-1633. Okada H, Pollack IF, Lotze MT, Lunsford LD, Kondziolka D, Lieberman F, Schiff D, Attanucci J, Edington H, Chambers W, Robbins P, Baar J, Kinzler D, Whiteside T, Elder E (2000) Gene therapy of malignant gliomas, a phase I study of IL-4-HSV-TK gene-modified autologous tumor to elicit an immune response. Hum Gene Ther 11, 637-653. Okada H, Villa L, Attanucci J, Erff M, Fellows WK, Lotze MT, Pollack IF, Chambers WH (2001) Cytokine gene therapy of gliomas, effective induction of therapeutic immunity to intracranial tumors by peripheral immunization with interleukin-4 transduced glioma cells. Gene Therapy 8, 1157-1166. Pizza G, Viza D, DeVince C, Vichi-Pascuuchi JM, Busutti L, Bergami T (1988) Intralymphatic administration of interleukin-2 (IL-2) in cancer patients, a pilot study. Cytokine Res 7, 45-48. Robinson WA, Lobe K, Stevens R (1987) Central nervous system metastases in malignant melanoma. Cancer Treat Res 35, 155-163. Rosenberg SA, Lotze MT, Mule JJ (1988) New approaches to the immunotherapy of cancer. Ann Intern Med 108, 853-864. Sama G, Collins J, Figlin R, Robertson P, Altrock B, Abels R (1990) A pilot study of intralymphatic interleukin-2. II Clinical and biological effects. J Biol Response Modif 9, 81-86. Sampson JH, Ashley DM, Archer GE, Fuchs HE, Dranoff G, Hale LP, Bigner DD (1997) Characterization of a spontaneous murine astrocytoma and abrogation of its

tumorigenicity by cytokine secretion. Neurosurgery 41, 1365-1372. Sobol RE, Fakhrai H, Shawler DL, Gjerset R, Dorigo O, Carson C, Khaleghi T, Kozio J, Shiftan TA, Royston I (1995) Interleukin-2 gene therapy in a patient with glioblastoma. Gene Therapy 2, 164-167. Sugden B, Marsh K, Yates J (1985) A vector that replicates as a plasmid and can be efficiently selected in B-lymphoblasts transformed by Epstein-Barr virus. Mol Cell Biol 5, 410413. Tahara H; Zeh HJ 3rd; Storkus WJ, Pappo I, Watkins SC, Gubler U, Wolf SF, Robbins PD, Lotze MT (1994) Fibroblasts genetically engineered to secrete interleukin 12 can suppress tumor growth and induce antitumor immunity to a murine melanoma in vivo. Cancer Res 54: 182-189. Tepper RI, Pattengale PK, Uder P (1989) Murine interleukin-4 displays potent anti-tumor activity in vivo. Cell 57, 503-512. Tjuvajev J, Gansbacher B, Desai R, Beattie B, Kaplitt M, Matie C, Koutcher J, Gilboa E, Blasberg P (1995) RG-2 glioma growth attenuation and severe brain edema caused by local production of interleukin-2 and interferon-". Cancer Res 55, 1902-1910. Watanabe Y, Kuribayashi K, Miyatake S, Nishihara K, Nakayama IL, Taniyama T, Sakata TA (1989) Exogenous expression of mouse interferon gamma cDNA in mouse neuroblastoma C1300 cells results in reduced tumorigenicity by augmented anti-tumor immunity. Proc Natl Acad Sci USA 86, 9456-9460. Watts RG, Wright JL, Atkinson LL, Merchant RE (1989) Histopathological and blood-brain barrier changes in rats induced by intracerebral injection of human recombinant interleukin-2. Neurosurgery 25, 202-208. Yamada G, Kitamura Y, Sonoda H, Harada H, Taki S, Mulligan RC, Osawa H, Diamanststein T, Yokoyama S, Taniguchi T (1987) Retroviral expression of the human IL-2 gene in a murine T cell line results in a cell growth autonomy and tumorigenicity. EMBO J 6, 2705-2709. Yu JS, Burwick JA, Dranoff G, Breakefield XO (1997) Gene therapy for metastatic brain tumors by vaccination with granulocyte-macrophage colony-stimulating factortransduced tumor cells. Hum Gene Ther 8, 1065-1072. Yu JS, Wei MX, Chiocca A, Martuza RL, Tepper RI (1993) Treatment of glioma by engineered interleukin-4-secreting cells. Cancer Res 53, 3125-3128. Zhang RD, Price JE, Fujimaki T, Bucana CD, Fidler IJ (1992) Differential permeability of the blood brain barrier in experimental brain metastases produced by human neoplasms implanted into nude mice. Am J Pathol 141, 1115- 1124.

120

Cancer Therapy Vol 1, page 121 Cancer Therapy Vol 1, 121-131, 2003.

Safety, feasibility and clinical benefit of localized chemotherapy using microencapsulated cells for inoperable pancreatic carcinoma in a phase I/II trial Research Article

Matthias Löhr1,2, Jens-Christian Kröger4, Anne Hoffmeyer2,6, Mathias Freund3, Johannes Hain6, Albrecht Holle 2, Wolfram T. Knöfel8, Stefan Liebe 2, Horst Nizze 5, Matthias Renner6,9, Robert Saller6, Petra Müller2,6, Thomas Wagner10, Karlheinz Hauenstein4, Brian Salmons6,9 and Walter H. Günzburg7* 1

Department of Medicine II, Medical Faculty Mannheim, University of Heidelberg, Germany; 2Division of Gastroenterology, 3Division of Hematology & Oncology, Department of Medicine, 4Department of Diagnostic and Interventional Radiology and 5Department of Pathology, University of Rostock, Rostock, Germany; 6Bavarian Nordic GmbH, Martinsried, Germany, 7Institute of Virology, University of Veterinary Sciences, Vienna, Austria, 8Department of Surgery, University of Hamburg, Hamburg, Germany; 9Austrianova, Veterinärplatz 1, Vienna, Austria; 10Division of Hematology & Oncology, Medical University Lübeck, Lübeck, Germany

__________________________________________________________________________________ *Correspondence: Prof. Walter H. Günzburg, Institute of Virology, University of Veterinary Medicine, Veterinaerplatz 1, A-1210 Vienna, Austria; Tel.: +43-1-25077-2301; Fax: +43-1-25077-2390; e-mail: walter.guenzburg@vu-wien.ac.at Key Words: Pancreatic carcinoma, cell therapy, gene therapy, ifosfamide, microcapsules, angiography Received: 10 June 2003; Accepted: 25 June 2003; electronically published: June 2003

Summary Previous preclinical studies suggested that implantation of encapsulated, genetically modified cells converting a chemotherapeutic agent in the vicinity of tumors may represent an effective treatment for pancreatic cancer. A phase I/II clinical trial was performed to determine safety, feasability and efficacy of such a targeted, low dose, chemotherapy in 14 advanced-stage pancreatic cancer patients. Genetically modified allogeneic cells expressing the enzyme cytochrome P450 2B1 encapsulated in cellulose sulfate polymers were delivered angiographically via catheter into blood vessels leading to the tumor. These cells locally activate systemically administered ifosfamide to its active metabolites, whilst remaining immuno-isolated. Although adverse events were experienced by all patients, none of these were related to the treatment, with the possible exception of increased serum lipase 15 days after CapCell instillation in one patient. According to the NCI tumor response classification, at the final observation within the study, 2 of the 14 patients treated had partial remissions (14.3%), 11 patients had stable disease (78.6%) and one patient died after 8 days. Median survival was doubled compared to a historic control group (p=.008) and 50% more than usually achieved with gemcitabine. One year survival, at 36%, was three fold that of the control group (p=.047) and twice that reported for gemcitabine. Of 13 evaluable patients, 4 patients reported improvements in pain assessment, with 6 remaining unchanged (4 of these experienced no pain) and 3 patients experiencing slightly more pain. Using a worst case scenario, 50% of patients experienced a clinical benefit whereas in a best case scenario benefit was experienced by 71% of patients. significantly prolonged survival or reduced tumor load (Heinemann 2002; Rosenberg 2000). Even the newly introduced chemotherapeutic agent gemcitabine only marginally prolongs the survival of patients (Burris et al, 1997). Nevertheless, this agent has rapidly become a standard treatment because of the additional palliative effect and its ability to improve the clinical benefit response and quality of life of patients with pancreatic cancer. Thus, there is a need for new treatment regimes to

I. Introduction Pancreatic carcinoma ranks as the eighth most frequent solid cancer in industrialized countries but is the fifth leading cause of cancer-related deaths (Greenlee et al, 2001). Radical surgery can only be applied in about 10% of diagnosed cases (Huguier and Mason 1999; Neoptolemos et al, 2001) and, to date, all efforts to control tumor growth by radiation and/or chemotherapy have not 121

Löhr et al: Pancreatic cancer cell/chemotherapy treat pancreatic cancer (Hawes et al, 2000). Along with more classical types of treatment, attempts also have been made to employ gene therapy approaches such as using suicide genes encoding enzymes that are able to convert a prodrug to it’s active, tumor toxic form (Aspinall and Lemoine 1999; Günzburg et al, 2002; Rosenberg 2000). The chemotherapeutic agent, ifosfamide, has been shown to have potentially therapeutic effects for pancreatic cancer (Loehrer et al, 1985). In a phase II trial in which 1.6g/m2/day ifosfamide was administered for 5 days to 21 evaluable patients, 7 Stable Diseases with mostly none severe, grade 1-2 toxicity was reported (Wils et al, 1993). In another study (Keizer et al, 1995), where up to 1.5g/m2/day ifosfamide was given as a 10 day continuous i.v. infusion to patients with various tumor types, of six patients with pancreatic cancer, one showed a partial response and a second evidenced a tumor reduction of 45%. Major side effects observed were leukopenia with granulocytopenia, whilst subjective side-effects included nausea/vomiting and fatigue (probably related to neurotoxicity). More encouraging clinical effects have been observed in other trials where medium doses of ifosfamide (1-2g/ml) have been investigated, but this is accompanied by medium grade toxicity profiles. In an initial study by Gad-El-Mawla and colleagues, where 2g/m2 were given for 5 days, all but two patients developed haemorrhagic cystitis. However there were 6 partial responses in 10 patients (Gad-El-Mawla and Ziegler 1981). A further study revealed that of 25 patients receiving daily doses of 1.8g for five days, 1 patient showed a complete remission and 14 patients showed partial remision (Gad-El-Mawla 1986). However, these patients suffered from grade 3 alopecia (100%), grade 1 anaemia (100%) and leukopenia (30%). Thus, it is to be expected that higher doses (2-3g/ml) of ifosfamide may show even greater efficacy, but that this will be associated with possibly unacceptable levels of toxicity. Ifosfamide is a prodrug that requires activation by liver specific cytochrome enzymes, such as the 2B1 isoform (CYP2B1) to generate tumor toxic metabolites (Dirven et al, 1996). Unfortunately, the short half-life of these metabolites in plasma (Cerny et al, 1991b; Kurowski and Wagner 1993), coupled with the distance that they have to travel, require high systemic levels of ifosfamide to achieve therapeutic levels in the tumor. Indeed, these levels are so high as to lead to unacceptable side effects (Loehrer et al, 1985). Local activation of ifosfamide at the site of the tumor should, in contrast, result in good local cytotoxic activity, and at the same time low systemic ifosfamide concentrations, thus resulting in only minimal systemic side effects (Chen and Waxman 2002). Local activation may be achieved by introducing encapsulated human 293 cells genetically modified to overexpress CYP2B1 at the site of the tumor. Encapsulation in cellulose sulfate allows allogeneic cells to survive in vivo, by protecting them from host immune attack as well as by physically constraining them to the site where they are required (Dautzenberg et al, 1999). Previous experiments had revealed that injection of such encapsulated CYP2B1 expressing cells into pre-established tumors in a nude mouse model of human pancreatic carcinoma (Löhr et al,

1994), resulted in complete tumor regression in about 20% of mice and a significant anti-tumor effect in the remaining mice (Löhr et al, 1998). Nevertheless, this route of application may not be suitable for patients and so a further study was performed to demonstrate the feasibility of intra-arterial placement of micro-encapsulated cells into blood vessels leading to the pig pancreas (Kröger et al, 1999; Löhr et al, 2003). Based upon these encouraging preclinical data, a phase I/II clinical trial was initiated involving patients with inoperable pancreatic carcinoma to assess the feasibility, safety, and tolerability of this new treatment modality (Löhr et al, 1999). We have recently described the results obtained concerning safety and efficacy in a brief report (Löhr et al, 2001). Here, data is presented concerning the outcome and clinical benefit of this treatment.

II. Patients and methods A. Patients, trial design and approval The study was planned as an open, prospective, single-arm, single center phase I/II-study, following the German gene therapy working group (DAG-GT) recommendations. The protocol was approved by the state ethics committee, the gene therapy board of the German Medical Association and published (Löhr et al, 1999), in line with the recommendation of the German working party on gene therapy indicating the approval of all regulatory bodies. The study was opened on the 28th July 1998 and closed on the 20th September 1999. The trial was conducted in full accordance with good clinical practice guidelines (ICH-GCP).

B. Patient enrollment A total of 17 patients were enrolled in the trial between July 1998 and April 1999 (Table 1) from the 51 patients screened during the study period. Reasons for non-enrolment were previous chemotherapy (n = 8), pancreatic surgery (n = 13), poor general condition (n = 18), unwillingness to participate (n = 5), or death (n = 7). Criteria for entering the study included an inoperable pancreatic adenocarcinoma stage III-IV (UICC) (Hermanek et al, 1997), as determined by histology and measured by CAT scan and only patients who had not received prior chemotherapy were enrolled (Löhr et al, 1999). During the preparation period, clinical data were collected and a baseline CAT scan of the abdomen was performed. The patients were scheduled for the initial celiac angiography with capsule placement (day 0). On day 1, the patients were monitored for evidence of any clinically relevant adverse reactions, e.g. allergic, and/or pancreatitis. The levels of serum amylase, lipase, lactate, lactate dehydrogenase, and liver enzymes, as well as complete blood cell count were determined. Systemic chemotherapy commenced on day 2 with 1g/m2 body surface of ifosfamide (Holoxan®) in 250 ml 0.9% normal saline being given as a 1-hour intravenous infusion on three consecutive days. This was accompanied by a 60% dose equivalent of the uroprotector MESNA (Uromitexan®) given as three i.v. injections. This regimen was repeated at days 23-25 for all patients except 5 and 17 who only received one round of ifosfamide. Toxicity was measured based on the WHO/NCI guidelines on common toxicity criteria. Control CAT scans were scheduled for weeks 10 and 20, respectively. During the final visit, a control angiography was performed. On the initial CAT scan, the scan demonstrating the largest diameter of the primary tumor was identified and the area measured. Using appropriate

122

Cancer Therapy Vol 1, page 123 landmarks, an identical scan was used for comparison. CAT scans were evaluated by two unrelated radiologists, one of whom was not involved in the study. Standard NCI criteria for evaluating tumor growth were used to assess stable disease (SD), partial remission (PR), and minor response (MR). After formally finishing the study, patients were followed up on an ambulatory basis with three-monthly visits. Besides measuring tumor size by CAT scan, the need for pain medication and the quality of life was monitored using questionnaires established for pancreatic diseases (Bloechle et al, 1995). A clinical benefit score based upon variables including Karnofsky score, body weight, pain and analgesic consumption was also calculated from this data. Pain intensity was measured on a visual analogue scale ranging from 0 (no pain) to 100 (the most imaginable intensive pain), in steps of 10. Analgesics consumption was assessed using another scale in which 0 indicated no regular administration of analgesic, whereas scores of 25, 50 and 75 indicated administration of nonsteroidal anti-inflammatory drugs (NSAID) or opiates several times per year (25), per month (50) or per week (100) (Bloechle et al, 1995).

the transfemoral approach (Seldinger technique). Digital subtraction angiography of the celiac trunk, superior mesenteric artery, splenic artery, common hepatic artery and, if necessary for identification of tumor leading vessels, of the gastroduodenal artery, was performed with a 4 French introducer system (Terumo), 4 French visceral catheters with a inner diameter of 0,038" (Cordis) and a monomer nonionic contrast medium (Imeron 300, BYK, Gulden). The most appropriate tumor access was determined by relating tumor localization in CAT scans to the vessel anatomy. Supraselective catheterization of an artery leading into the tumor was performed with a coaxial 2.3 French microcatheter system (Cordis) (Kröger et al, 1999; Löhr et al, 2003). The optimal approach to the tumor vasculature was gained through the inferior pancreatoduodenal artery, the dorsal pancreatic artery and/or the superior pancreatic head branches of the gastroduodenal artery. After documentation of the correct microcatheter placement in a non-occluding position, 300 CapCells were instilled slowly one by one with the blood flow in 13 patients. An additional patient received 250 capsules due to limited space in the tumor artery. The patency of the cannulated vessel was controlled periodically by fluoroscopy, followed by a control angiography of the target vessel region. The catheter and introducer systems were then removed, the puncture site compressed for 15 minutes, and a compression tape put in place for 6 hours. Diagnostic angiography visualising the peritumoral vessels was repeated in the same manner during the final visit (week 20).

C. Historical patient collective Survival data of a retrospective (historic) control group and the treatment group of this study were compared. A historic control group was established from an evaluation of all patients (n=35) with pancreatic carcinoma admitted to the Division of Gastroenterology, Rostock during the years 1996 to 1998 who were not treated by tumor resection. Of these patients, 1 had UICC stage I, 2 stage III, and 33 stage IV pancreatic carcinoma, respectively. Seven underwent palliative surgery, 10 received palliative chemotherapy, 24 needed biliary drainage (ERCP or PTCD), and 19 received best supportive care (in addition to biliary drainage or surgery). One stage IV patient was excluded since no date of death was available for this patient. Though the selection criteria for treated patients could not be applied completely to the historic control group, the historic controls and the treated patients were comparable in clinical diagnoses and initial symptoms of the disease (jaundice, abdominal pain were most frequent) and also with respect to median age (63 years in both cohorts) and gender (male patients: 74.3% in historic controls and 64.3% in treated patients).

F. Quality of Life A quality of life core questionnaire for cancer patients, QLQ-C30, has been validated in several languages (Aaronson et al, 1993; Fayers et al, 1999; Hjermstad et al, 1998; Klee et al, 1997; Sprangers et al, 1993), but the module for pancreatic carcinoma is still under development with respect to reliability, sensibility against changes, and multicultural validation (Fayers et al, 1999). Therefore, in this study an unauthorised version of the core questionnaire and a German quality of life scale for pancreas patients was used which had been published (Bloechle et al, 1995). The quality of life-data were documented independently from the safety and efficacy data by filling-out an independent questionnaire by the patient. Thus, the assessment of the quality of life data did not interfere with the routine documentation of the adverse events that were reported by the patient. The quality of life core questionnaire was analyzed in analogy to the prescriptions of the EORTC (Fayers et al, 1999). Quality of Life data were available from the baseline evaluation for all 14 patients and for analysis of change from 8 patients. The analysis was strictly performed according to the EORTC recommendations (Fayers et al, 1999).

D. Production of clinical grade CapCell® The cytochrome P450 2B1 (CYP2B1) expression construct (Löhr et al, 1998), as well as the good laboratory practice (GLP) production and characterization of the CYP2B1 expressing 293 cell clone (22P1G) (Gunzburg et al, 1999) have been described previously. Cells were amplified under good manufacturing practice (GMP) conditions (Q-One, Glasgow, Scotland, UK) and encapsulated in polymers of cellulose sulphate using an apparatus from Inotech (Dottikon, Switzerland) (Dautzenberg et al, 1999). The encapsulated cells (CapCell®) were washed twice with plain RPMI cell culture medium (Gibco/BRL) and stored at 4ÆC. Cell viability was determined using the Life&Dead viability kit (MobiTec, Braunschweig, Germany). Necessary quality control tests required for release included sterility and a demonstration that the CapCell® were both mycoplasma and endotoxin free. The mechanical stability of the capsules was determined and the potency of the encapsulated cells was determined in a cell toxicity bioassay (Löhr et al, 2002).

III. Results Each patient enrolled in the trial received 300 cellulose sulfate capsules (CapCell“) except patient 12 who received 250 CapCell® by angiographic placement (day 0) into a suitable artery feeding a primary, inoperable tumor (stage III-IV). Each capsule had an average diameter of 0.8 mm and contained around 104 cells (Löhr et al, 1999). An appropriate artery leading into the tumor could be supraselectively cannulated (Figure 1) in 14 of the 17 patients entering the study (Table 1). Two patients developed severe infections before the start of the trial and had to be treated by other means, whilst angiography was not successful in one patient.

E. Angiography Visualization of the vasculature leading to the pancreatic tumor was performed by angiography in a standard manner with

123

Löhr et al: Pancreatic cancer cell/chemotherapy Table 1: Patients entering the CT-PCA-1 study Sex Age TNM Stage 1st Symptom Survival wks Metastases Tumor m 48 T4N1Mx IV abd. Pain 102 n SD m 76 T4N1Mx IV abd. Pain 39 n PR m 67 T4NxMx IV Jaundice 64 n MR m 57 T3NxM1 IV Diarrhea 29 y SD m 74 T3N1M1 IV abd. Pain 67 y MR m 65 T4N1M1 IV abd. Pain 20 y SD f 61 T4N1M0 IV abd. Pain 65 n SD m 65 T4N1M1 IV incidental1 28 y PR f 58 T4N1M0 IV abd. Pain m 64 T3NxM1 IV abd. Pain m 53 T3NxMx IV Jaundice 44 n SD f 57 T3N0M0 III Jaundice 33 n SD f 61 T4N1M0 IV abd. Pain 112 n SD f 68 T4N1M1 IV abd. Pain 6 y SD f 70 T3N0M0 III abd. Pain 35 y SD f 60 T4NxM0 IV abd. Pain n m 52 T4N1Mx IV abd. Pain 41 n SD 1 detected on ultrasound, y = yes, n = no SD=stable disease, PR=partial response (more than 50% tumor regression), MR=minor response (between 25 and 50% tumor regression). abd.Pain = abdominal pain

Immediately after instillation of the CapCell®, a transient spasm could be observed (Figure 1D) but this did not significantly impair blood flow. At the trial endpoint, 20 weeks after CapCell® instillation, angiographic visualisation of the targeted vessels was performed. No or only minor alterations to the tumor vessels, such as reduction of diameter or increased compression as compared to day 0, were observed (data not shown). Subsequent to CapCell® instillation, each patient received low dose (1g/m2 body surface) ifosfamide (Holoxan®) on days 2-4 and 23-25, respectively (Löhr et al, 1999). Although 11 serious adverse events (SAEs) were recorded in 7 patients during the study period, none of these were treatment related (i.e. due to CapCell® instillation or ifosfamide treatment) (Löhr et al, 2001) and were attributed to the underlying disease and/or the effects thereof (Table 2). Administration of CapCell® did not result in any obvious allergic or inflammatory response and none of the patients developed pancreatitis at any time during the course of the study. Although elevated amylase levels were detected in some patients, presumably as a result of the tumor infiltration of the pancreas and limited obstructive (chronic) pancreatitis (van Gulik et al, 1997), no further increase was measured after angiography and CapCell® placement (Figure 2). Only one AE (increased lipase activity observed on day 15 after instillation) may have been possibly related to CapCell® administration. The concentration of ifosfamide in the patients blood plasma were monitored 30 to 60 minutes after administration and revealed levels of 100-200 µmol/L (Figure 3).

Figure 1. Angiographic placement of microcapsules in patient #2 with pancreatic carcinoma. (A) Digital subtraction angiography of celiac and mesenteric axis (Acunas and Rozanes 1999). (B) Supraselective cannulation of the A. transversalis (indicated by arrow) with the coaxial 2.3 French microcatheter. (C) Injection of the microcapsules. Arrow points to the area of contrast medium exclusion resulting from the capsules. (D) Celiac axis angiography directly after the capsule instillation indicating the spasm in the vessel filled with the capsules (arrow).

124

Cancer Therapy Vol 1, page 125 Table 2 Percentage of patients experiencing adverse events Adverse events

Grade 1*

Grade 2*

Grade 3*

Total

Pain

12 %

16 %

Malignant pancreas neoplasm

14 %

Aggravated condition

13 %

Decreased weight

Cholestatic hepatitis

Diarrhea

Vomiting

Nausea

Anemia

Anorexia

Ascites

Constipation

Pulmonary embolism

Enzyme abnormality

Gastrointestinal hemorrhage

Other hemorrhage

Hypertension

Subileus

Fungal infection

Intestinal obstruction

Jaundice

Kidney neoplasm

Nervousness

Pleural effusion

Sepsis

Vertigo

response (PR), characterised by a more than 50% reduction in tumor volume, was recorded; the remaining 12 patients showed a stable disease (SD) with tumor sizes in the range of 50-125% of initial size (LĂśhr et al, 2001). Of these 12 patients, 2 demonstrated a minor response (MR), i.e. tumor reduction by 25 to 50%. Kaplan-Meier analysis of the survival of the patients enrolled in the trial showed that the median survival time from the time of diagnosis is 39 weeks (Figure 5). In contrast, data from a historic control group of patients of similar age as well as disease symptoms and stage from the same medical center showed a median survival of 20 weeks (Figure 5). A second survival parameter, the percentage of patients that survived for one year or more was also monitored in long term follow-up of the patients beyond the period defined for the clinical trial. The one year survival for the treatment group was 36 % (i.e. 5 of the 14 patients treated), compared to 11 % (4 out of 35 patients) for the historic control group (LĂśhr et al, 2001). Within the 20 week study period, three patients died from disease progression (on days 9, 85 and 132). The patient who died on day 9, from a recurrent pulmonary embolism, underwent a postmortem examination. Gross pathology (Figure 6A) revealed tumor necrosis. This was confirmed by histological examination demonstrating the well differentiated adenocarcinoma and extensive necrotic tissue (Figure 6B). The capsules could not be localized in serial sections of the pancreas, spleen and liver. Thus it is not strictly possible to rule out that the effects observed were not due to the placement of the capsules and the local chemotherapeutic conversion of ifosfamide. However, sampling difficulties associated with finding tiny, almost transparent, capsules in such large organs have also experienced in pig preclinical studies (Lohr et al, 2003). In the period beyond the 20 weeks defined as the study period, a further 10 patients died. It should be noted that all three patients who died during the trial as well as three of the patients who died after the 20 week observation already had distant (liver) metastasis (Table 1) before beginning the trial.

* NCI â&#x20AC;&#x201C; common toxicity criteria

The chemotherapy regimen was well tolerated with no toxicity beyond grade II being detected in any of the 14 patients treated in this trial (not shown). The data thus strongly suggest that there is no obvious specific treatment-related risk. In addition to safety and tolerability, the efficacy of the treatment was examined. The size of the primary tumor was measured prior to starting the treatment and at weeks 10 and 20 post treatment (Figure 4). The tumor did not grow any further during this observation period in any of the treated patients. In two of the 14 patients, a partial

Figure 2 Serum amylase values of the patient cohort. The course of amylase levels in 14 patients before (d0) and after (day 1 to day 24:d1-d24; week 10, 20: w10, w20) instillation of CapCells. The individual endpoints after completion of study are indicated as ind. end. The normal range for amylase is between 20 and 120 U/L.

125

Lรถhr et al: Pancreatic cancer cell/chemotherapy

Figure 3. Ifosfamide plasma levels in pancreatic carcinoma patients carrying microencapsulated CYP2B1 producing cells in a tumor vessel after 1 g/m2 body surface given IV over 1 hour.

Figure 4. CAT scan of pancreatic tumor (A) before (0), (B) 10 weeks and (C) 20 weeks after instillation of CYP2B1-expressing, microencapsulated cells into the pancreas and low-dose ifosfamide treatment. The area of the tumor is outlined.

Figure 5. Kaplan-Meier analysis of patients treated with microencapsulated, CYP2B1-expressing cells and low-dose ifosfamide (!; n = 14) vs. a historical control group ("; n = 33).

126

Cancer Therapy Vol 1, page 127

Figure 6 . Gross pathology (A) and histology (B) of pancreatic tumor from patient who died on day 9 of treatment from a pulmonary embolism. Gross tumor necrosis (A) was confirmed by histological examination (B) demonstrating the well differentiated adenocarcinoma and extensive necrotic tissue.

"worst case scenario" required a pain relief of 20 points or more to be judged as an improvement and a decrease in the Karnofsky index of 10 points or more taken to indicate worsening. In this scenario, 7 patients (50%) experienced a clinical benefit, 3 were neutral (21.4%, benefits were offset by impairments) and 4 patients (including those dying before the average survival time) had no clinical benefit (28.6%). The second, "best case scenario" assumes a pain relief of 10 points or more as an improvement and a decrease in the Karnofsky index of 20 points or more is taken to indicate worsening. Using these criteria, 10 patients (71.4%) had clinical benefit, 2 patients showed no benefit but no deterioration either (14.3%), and 2 patients had definitely no benefit.

A postmortem examination of the patient who died at week 53 (i.e. outside the study period) confirmed a widespread pancreatic tumor. The information gathered from the patients with respect to clinical benefit is shown in Table 3. If a clinical benefit is considered to be either no increase or a decrease in pain intensity then 10 of the 14 patients show a benefit (Table 3, Pain Intensity, bold). This could be confirmed for 7 of the patients by analgesic consumption (Table 3, Analagesic Consumption, bold). It should be noted that none of the benefiting patients registered an increase in pain medication both in terms of dosage or WHO level. While none of the patients showed an increased Karnofsky score after treatment, 7 of the 14 patients remained stable at the week 10 assessment and 4 of those were stable even at week 20 (Table 3, Karnofsky Score, bold). One patient (patient 1) showed an increase in body weight at week 10 and at week 20 and patient 12 had a weight increase at week 10 (this patient dropped out and so no week 20 weight value could be obtained). A further two patients (7 and 11) showed stable body weight at week 10 but patient 7 dropped out and patient 11 showed weight loss at week 20 (Table 3, Body Weight, bold). Taken together, two of the patients (5 and 11) had stable measurements for all four criteria (italics), with only marginal (4kg) weight loss at week 20. Two scenarios were made to establish the overall (i.e integrative) clinical benefit response, where each patient was given a +2 for an improved value, +1 for a stable value and -1 for a worsened value for each of the 4 criteria (pain, analgesic consumption, Karnofsky index and body weight) compared to the relevant week 0 values. The

IV. Discussion Chemotherapy has previously only been marginally effective for the treatment of pancreatic carcinoma despite the introduction of new cytotoxic agents such as gemcitabine (Carmichael et al, 1996; Storniolo et al, 1999). Gemcitabine acts by multiple mechanisms, including inhibition of ribonucleoside diphosphate reductase, dCMP deaminase and dCTP incorporation into DNA and RNA thereby disrupting DNA synthesis leading to apoptosis (Rieger et al, 1999). Clinical responses are achieved in 5.4-11% of pancreatic cancer patients, with a median survival time of between 5.6 and 6.3 months (Burris et al, 1997; Carmichael et al, 1996; Casper et al, 1994). However, in the face of a general median survival of patients with pancreatic carcinoma of around 4 months (Carmichael 1997), new treatment modalities for single or combinatorial therapy approaches are desperately needed.

127

Löhr et al: Pancreatic cancer cell/chemotherapy

Table 3: Analysis of measures of clinical benefit Pain Intensity(0-100)

Patient

Analgesics Consumption(0-100)

week 0

week 10

week 20

week 0

week 10

week 20

Karnofsky Score(0100) week 0

Body weight (Week 0) and Variation (in kg)

week 10

week 20

week 0

week 10

week 20

100

-1

-9

-11

100

-5

100

-6

-4

100

-1

100

-1

100

-4

100

-2

-4

100

-10

-14

100

Abbreviations: C: completion of trial; nC: noncompletion of trial; D: discontinued/death; nd:not done BOLD: fulfils benefit criteria; Italic: fulfils benefit criteria in all sections with just marginal weight loss (4kg) at week 20

in nude mice (Löhr et al, 1998) as well as into mammary tumors in immunocompetent mice (Kammertöns et al, 2000). In these experiments, the activated metabolites that diffused from the encapsulated cells to the surrounding tumor cells were sufficient to result in a clear anti-tumor effect in both instances. Therefore, we reasoned that a similar approach might prove feasible in patients. Local intratumoral activation holds the promise of good efficacy coupled with low systemic side effects due to reduced concentrations of the chemotherapeutic agent. Direct injection of the capsules, however, brings with it the risk of bleeding as well as the danger of metastatic cells seeding along the needle track. The pancreas is located deep in the retroperitoneum, also making it difficult for repeated transcutaneous injections. The possibility for future repeated intra-arterial instillations of CapCell® was supported by the finding(s) that (i) only 2 patients showed occluded vessels and (ii) only one other patient displayed evidence that the tumor had affected the blood vessels that lead to it. Another potential route of application of CapCell® would be by endoscopic delivery. However, the pancreatic duct is occluded in the majority of tumors, limiting the use of this route of delivery (Schmid et al, 1994).

Oxazaphosphorines such as ifosfamide are naturally activated in the liver and also have been used for the chemotherapy of pancreatic cancer (Cerny et al, 1991a). However, the high systemic concentrations required for effective chemotherapy are associated with significant side effects especially in elderly patients (Loehrer et al, 1985). The response rates reported range between 0 and 30% (Cerny et al, 1991a; Loehrer et al, 1985). Nevertheless, preclinical studies on other tumor types have shown the utility of the local expression of cytochrome enzymes such as the isoform 2B1, in combination with oxazaphosphorines, as reviewed by Chen and Waxman (Chen and Waxman 2002). However, in many of the previous studies, the gene encoding cytochrome P450 was introduced directly into the tumor cells prior to establishing tumors in nude mice and subsequent oxazaphosphorine treatment. Thus, although these studies elegantly demonstrate proof of principle, they represent a situation that is clinically not applicable, given that gene transfer efficacies directly to tumors in vivo are relatively poor, regardless of the vector system used. We have previously demonstrated the efficacy of the intratumoral injection of encapsulated cells expressing cytochrome P450 2B1 into pre-formed pancreatic tumors

128

Cancer Therapy Vol 1, page 129 The relatively non-invasive interventional angiography approach (Dondelinger 1999) was used to deliver 300 CapCell®. Comparable delivery of almost identical size solid particles did not result in substantial occlusion of the blood vessels leading to primary and metastatic hepatic masses (Talamonti et al, 1998; Trinchet 1995). The delivery of CapCell® via the angiographic route was shown to be both feasible and safe. No treatment related Serious Adverse Events (SAEs) were recorded during the study period. The ifosfamide dose was well tolerated, as was the capsule instillation, which could be performed under local anesthesia in 15 minutes on average. Thus the primary objectives of the study, the evaluation of the safety and tolerability of the treatment were met. The efficacy of the treatment was also examined in this trial. In contrast to the usual progression of the disease, in which the tumor mass continues to grow, all the treated patients showed a stabilization of tumor size and 4/14 (28%) showed a reduction in tumor size of more than 25%, suggesting a clear tumor killing effect. Our cell culture studies suggested that the toxic metabolites of ifosfamide act by inducing cell necrosis, rather than apoptosis (Karle et al, 2001). In this light it is of interest that in our preclinical animal studies extensive necrosis was observed after tumor treatment (Löhr et al, 1998) as well as in the one patient treated in this trial whose tumor could be examined retrospectively at postmortem, although it should also be noted that these tumors have a tendency to be necrotic. Especially for pancreatic cancer patients, a decrease in the primary tumor size is of clinical benefit in terms of increased survival time and decreased pain. This was confirmed in our study in which a comparably large increased median survival time after diagnosis of more than 44 weeks and no impaired or even an increased quality of life including no requirement for increased pain medication was noted. Although this is a phase I/II study with a relatively small patient collective, these results compare very favourably with those obtained with gemcitabine, in which a median survival of around 28 weeks was reported (Burris et al, 1997; Carmichael et al, 1996; Casper et al, 1994). The one-year survival rate was also higher in the treated group (36%) as compared to the historic control group (11%). Although the two cohorts of historic controls and treated patients might differ in potential risk factors for survival (Löhr et al, 1999), the difference in survival rate of 25% cannot be explained only by selection bias, and may indicate a possible superior efficacy of the CapCell® treatment. In comparison, the one year survival rate for gemcitabine in a large compassionate use setting in which a comparable 80% of patients were stage IV (86% of patients in our trial were stage IV) was 15% (Storniolo et al, 1999). A phase III trial of gemcitabine yielded a 1 year survival of 18% (Burris et al, 1997). It is possible that with optimisation and/or additional rounds of treatment, higher survival rates may be obtainable after CapCell® therapy, for example in a phase II or III trial. In order to uphold the principle laid down in the declaration of Helsinki stating that the interests of the subject must prevail over the interests of science and

society the effects of clinical trials on quality of life should be determined (Hope-Stone et al, 1997). This is particularly applicable to a devastating disease like pancreatic cancer and, in this light, gemcitabine received approval because of its ability to improve the quality of life of patients (Carmichael 1997). Thus clinical benefit responses were also examined in this phase I/II clinical trial. A best case and a worst case scenario were examined. Even in a worst case scenario, some clinical benefit was experienced by 50% of patients and this was extended to 71% in the best case scenario. It is clear that in it’s present form, this kind of treatment is directed towards the treatment of the primary tumor rather than metastases and that even if the primary tumor could be effectively treated in those patients without obvious metastases, occult micrometastases may later become a problem. One hypothetical outcome of the treatment that has yet to be analysed is that tumor cell death may lead to better tumor antigen presentation and the induction of anti-tumor and metastases responses. There are a number of ways in which this issue may be dealt with including the use of combination chemotherapies, for example capsules with low dose ifsofamide to deal with nonresectable tumors, followed by gemcitabine to treat potential metastases. Other protential strategies include the use of viral vectors that are ideally targeted to deliver the cytochrome P450 gene to metastatic cells (Chen and Waxman, 2002; Kan et al, 2002) or the implantation of encapsulated retroviral vector producing cells (Saller et al, 2002).

Acknowledgements This work was supported in part by a Vaekstfond grant from the Danish Government. The authors thank Prof. R. Kohnen, IMEREM GmbH for professional monitoring of this clinical trial.

References Aaronson NK, Ahmedzai S, Bergman B, Bullinger M, Cull A, Duez NJ, Filiberti A, Flechtner H, Fleishman SB, de Haes JC, et al. (1993) The European Organization for Research and Treatment of Cancer QLQ-C30: a quality-of-life instrument for use in international clinical trials in oncology. J Natl Cancer Inst 85, 365-76 Acunas B, Rozanes I (1999) Hepatocellular carcinoma: treatment with transcatheter arterial chemoembolization. Eur J Radiol 32, 86-89 Aspinall RJ, Lemoine NR (1999) Gene therapy for pancreatic and biliary malignancies. Ann Oncol 10 (Suppl. 4), S188192 Bloechle C, Izbicki JR, Knoefel WT, Kuechler T, Broelsch CE (1995) Quality of life in chronic pancreatitis - results after duodenum-preserving resection of the head of the pancreas. Pancreas 11, 77-85 Burris HA, Moore MJ, Andersen J, Green MR, Rothenberg ML, Modiano MR, Cripps MC, Portenoy RK, Storniolo AM, Tarassoff P, Nelson R, Dorr FA, Stephens CD, von Hoof DD (1997) Improvements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced

129

Löhr et al: Pancreatic cancer cell/chemotherapy pancreatic cancer: a randomized trial. J Clin Oncol 15, 2403-2413 Carmichael J (1997) Clinical response benefit in patients with advanced pancreatic cancer. Role of gemcitabine. Digestion 58, 503-507 Carmichael J, Fink U, Russell RCG, Spittle MF, Harris AL, Spiessi G, Blatter J (1996) Phase II study of gemcitabine in patients with advanced pancreatic cancer. Br J Cancer 73, 101-105 Casper ES, Green MR, Kelsen DP, Heelan RT, Brown TD, Flombaum CD, Trochanowski B, Tarassoff PG (1994) Phase II trial of gemcitabine (2,2'-difluorodeoxycytidine) in patients with adenocarcinoma of the pancreas. Invest New Drugs 12, 29-34 Cerny T, Martinelli G, Goldhirsch A, Terrier F, Joss R, Fey MF, Brunner KW, Küpfer (1991a) Continuous 5-day infusion of ifosfamide with mesna in inoperable pancreatic cancer patients: a phase II study. J Cancer Res Clin Oncol 117, S135-S138 Cerny T, Martinelli G, Goldhirsch A, Terrier F, Joss R, Fey MF, Brunner KW, Küpfer A (1991b) Continuous 5-day infusion of ifosfamide with mesna in inoperable pancreatic cancer patients: a phase II study. J Cancer Res Clin Oncol 117 (Suppl. IV), S135-S138 Chen L, Waxman DJ (2002) Cytochrome P450 Gene-directed Enzyme Prodrug Therapy (GDEPT) for Cancer. Curr Pharm Des 8, 1405-16 Dautzenberg H, Schuldt U, Grasnick G, Karle P, Müller P, Löhr M, Pelegrin M, Piechaczyk M, von Rombs K, Günzburg WH, Salmons B, Saller RM (1999) Development of cellulose sulphate based polyelectrolyte complex microcapsules for medical applications. Ann NY Acad Sci 875, 46-63 Dirven H, van Ommen B, van Blaederen PJ (1996) Glutathione conjugation of alkylating cytostatic drugs with a nitrogen mustard group and the role of glutathione S-transferases. Chem Res Toxicol 9, 351-360 Dondelinger R (1999) Advances in abdominal interventional radiology. Lancet 353, SI15-SI18 Fayers P, Aaronson N, Bjordal K, Curran D, Groenveld M (1999) on behalf of the EORTC Quality of Life Study Group. EORTC QLQ-C30 Scoring Manual. 2nd Edition, Brussels Gad-El-Mawla N (1986) Ifosfamide in advanced pancreatic cancer. Cancer Chemother Pharmacol 18 (Suppl.2), 55-56 Gad-El-Mawla N, Ziegler JL (1981) Ifosfamide treatment of pancreatic cancer. Cancer Treat Rep 65, 357-8 Greenlee RT, Hill-Harmon MB, Murray T, Thun M (2001) Cancer Statistics 2001. CA Cancer J Clin 51, 16-36 Günzburg WH, Karle P, Renz R, Salmons B, Renner M (1999) Characterisation of a human cell clone expressing cytochrome P450 for safe use in human somatic cell therapy. Ann. N.Y. Acad. Sci. 880, 326-336 Günzburg WH, Löhr M, Salmons B (2002) Novel treatments and therapies in development for pancreatic cancer. Expert Opin Investig Drugs. 769-786 Hawes RH, Xiong Q, Waxman I, Chang KJ, Evans DB, Abbruzzese JL (2000) A multispecialty approach to the diagnosis and management of pancreatic cancer. Am J Gastroenterol 95, 17-31 Heinemann V (2002) Gemcitabine-based combination treatment of pancreatic cancer. Semin Oncol 29 (1 Suppl. 3), 25-35 Hermanek P, Hutter RVP, Sobin LH, Wagner G, Wittekind C (1997) TNM atlas, illustrated guide to the TNM/pTNM classification of malignant tumors.

Hjermstad MJ, Fayers PM, Bjordal K, Kaasa S (1998) Healthrelated quality of life in the general Norwegian population assessed by the European Organization for Research and Treatment of Cancer Core Quality-of-Life Questionnaire: the QLQ=C30 (+ 3). J Clin Oncol 16, 1188-96 Hope-Stone LD, Napier MP, Begent RH, Cushen N, O'Malley D (1997) The importance of measuring quality of life in phase I/II trials of cancer therapy: the effects of antibody targeted therapy: Part I Eur J Cancer Care 6, 267-272 Huguier M, Mason NP (1999) Treatment of cancer of the exocrine pancreas. Am J Surg 177, 257-265 Kammertöns T, Gelbmann W, Karle P, Saller R, Salmons B, Günzburg WH, Uckert W (2000) Combined chemotherapy of murine mammary tumors by local activation of the prodrugs ifosfamide and 5-fluorocytosine. Cancer Gene Therapy 7, 629-636 Kan O, Kingsman S, Naylor S (2002) Cytochrome P450-based cancer gene therapy: current status. Expert Opin Biol Ther 2, 857-68 Karle P, Renner M, Salmons B, Günzburg WH (2001) Necrotic, rather than apoptotic, cell death caused by cytochrome P450 activated ifosfamide. Cancer Gene Therapy 8, 220-230 Keizer HJ, Ouwerkerk J, Welvaart K, van der Velde CJH, Cleton FJ (1995) Ifosfamide treatment as a 10-day continuous intravenous infusion. J Cancer Res Clin Oncol 121, 297302 Klee M, Groenvold M, Machin D (1997) Quality of life of Danish women: population-based norms of the EORTC QLQ-C30. Qual Life Res 6, 27-34 Kröger JC, Benz S, Hoffmeyer A, Bago Z, Bergmeister H, Günzburg WH, Karle P, Klöppel G, Losert U, Müller P, Nizze H, Obermaier R, Probst A, Renner M, Saller R, Salmons B, Schwendenwein I, von Rombs K, Wiessner R, Wagner T, Hauenstein K-H, Löhr M (2003) Intra-arterial instilattion of microencapsulated, ifosfamide-activating cells in the pig pancreas for chemotherapeutic targeting. Pancreatology 3, 55-63 Kurowski V, Wagner T (1993) Comparative pharmacokinetics of ifosfamide, 4-hydroxyifosfamide, chloracetaldehyde, and 2and 3-dechloroethylifosfamide in patients on fractionated intravenous ifosfamide therapy. Cancer Chemother Pharmacol 33, 36-42 Loehrer PJ, Williams SD, Einhorn LH, Ansari R (1985) Ifosfamide: an active drug in the treatment of adenocarcinoma of the pancreas. J Clin Oncol 3, 367-372 Löhr JM, Bago ZT, Bergmeister H, Ceijka M, Freund M, Gelbmann W, Günzburg WH, Hain J, Hauenstein K, Henniger W, Hoffmeyer A, Karle P, Kröger J-C, Kundt G, Liebe S, Losert U, Müller P, Probst A, Püschel K, Renner M, Renz R, Saller R, Salmons B, Schuh M, Schwendenwein I, von Rombs K, Wagner T, Walter I (1999) Cell therapy using microencapsulated 293 cells transfected with a gene contruct expressing CYP2B1, an ifosfamide converting enzyme, instilled intra-arterially in patients with advanced stage pancreatic carcinoma: a phase I/II study. J Mol Med 77, 393-398 Löhr JM, Hoffmeier A, Kröger J-C, Freund M, Hain J, Holle A, Karle P, Knöfel WT, Lieber S, Müller P, Nizze H, Renner M, Saller R, Wagner T, Hauenstein K, Günzburg WH, Salmons B (2001) Microencapsulated cell mediated therapy of inoperable pancreatic carcinoma: a phase I/II study. Lancet 357, 1591-1592 Löhr M, Müller P, Karle P, Stange J, Mitzner S, Jesnowski R, Nizze H, Nebe B, Liebe S, Salmons B, Günzburg WH (1998)

130

Cancer Therapy Vol 1, page 131 Targeted chemotherapy by intratumour injection of encapsulated cells engineered to produce CYP2B1, an ifosfamide activating cytochrome P450. Gene Therapy 5, 1070-1078 Löhr M, Saller RM, Salmons B, Gunzburg WH (2002) Microencapsulation of genetically engineered cells for cancer therapy. Methods in Enzymology 346, 603-618 Löhr M, Trautmann B, M G, Peters S, Zauner I, Maillet B, Klöppel G (1994) Human ductal adenocarcinomas of the pancreas express extracellular matrix proteins. Br J Cancer 69, 144-151 Neoptolemos JP, Stocken DD, Dunn JA, Almond J, Beger HG, Pederzoli P, Bassi C, Dervenis C, Fernandez-Cruz L, Lacaine F, Buckels J, Deakin M, Adab FA, Sutton R, Imrie C, Ihse I, Tihanyi T, Olah A, Pedrazzoli S, Spooner D, Kerr DJ, Friess H, Buchler MW (2001) Influence of resection margins on survival for patients with pancreatic cancer treated by adjuvant chemoradiation and/or chemotherapy in the ESPAC-1 randomized controlled trial. Ann Surg 234, 75868 Rieger J, Durka S, Streffer J, Dichgans J, Weller M (1999) Gemcitabine cytotoxicity of human malignant glioma cells and modulation by antioxidants, Bcl-2 and dexamethasone. Eur J Pharmacol 365, 301-308 Rosenberg L (2000) Pancreatic cancer. A review of emerging therapies. Drugs 59, 1071-1089 Saller RM, Indraccolo S, Coppola V, Esposito G, Stange J, Mitzner S, Heinzmann U, Amadori A, Salmons B, WH G (2002) Encapsulated cells producing retroviral vectors for in vivo gene transfer. J Gene Med 4, 150-160 Schmid RM, Weidenbach H, Lerch MM, Liptay S, Schorr J, Beckh KH, Adler G (1994) Liposome mediated in vivo gene transfer into different tissues of the gastrointestinal tract. Z Gastroenterol 32, 665-670 Sprangers MA, Cull A, Bjordal K, Groenvold M, Aaronson NK (1993) The European Organization for Research and Treatment of Cancer. Approach to quality of life assessment: guidelines for developing questionnaire modules. EORTC Study Group on Quality of Life. Qual Life Res 2, 287-95 Storniolo AM, Enas NH, Brown CA, Voi M, Rothenberg ML, Schilsky R (1999) An investigational new drug treatment program for patients with gemcitabine: results for over 3000 patients with pancreatic carcinoma. Cancer 85, 1261-8 Talamonti M, Tellez C, Benson A (1998) Local-regional therapy for metastatic liver tumors. Cancer Treat Res 98, 172-199 Trinchet JC (1995) A comparison of lipiodol chemoembolization and conservative treatment for unresectable hepatocellular carcinoma. N Engl J Med 332, 1256-1261 van Gulik TM, Reeders JW, Bosma A, Moojen TM, Smits NJ, Allema JH, Rauws EA, Offerhaus GJ, Obertop H, Gouma DJ (1997) Incidence and clinical findings of benign, inflammatory disease in patients resected for presumed

pancreatic head cancer. Gastrointest Endosc 46, 417-23 Wils JA, Kok T, Wagener DJT, Francois E, Selleslags J, Duez N (1993) Phase II trial with ifosfamide in pancreatic cancer. Eur J Cancer 29A, 290

Walter H. Günzburg

131

Lรถhr et al: Pancreatic cancer cell/chemotherapy

132

Cancer Therapy Vol 1, page 133 Cancer Therapy Vol 1, 133-142, 2003.

Electrochemotherapy: advantages and drawbacks in treatment of cancer patients Review Article

Gregor Sersa*, Maja Cemazar, and Zvonimir Rudolf Institute of Oncology, Zaloska 2, 1000 Ljubljana, Slovenia.

__________________________________________________________________________________ *Correspondence: Prof. Gregor Sersa, Ph.D.: Institute of Oncology Ljubljana, Zaloska 2, SI-1000 Ljubljana, Slovenia; Phone/Fax: +386-1-433-74-10; e-mail: gsersa@onko-i.si Key words: electrochemotherapy, bleomycin, cisplatin, malignant tumors, melanoma Received: 17 June 2003; Accepted: 30 June 2003; electronically published: July 2003

Summary Electrochemotherapy combines administration of nonpermeant or poorly permeant chemotherapeutic drugs with application of electric pulses to the tumors in order to facilitate the drug delivery into the cells. Thus, enhanced drug delivery can substantially potentiate chemotherapeutic drug effectiveness, locally at the site of the cell electroporation by electric pulses, without affecting drug effectiveness in the tissues that were not exposed to electric pulses. Vast amount of information gathered on effectiveness and mechanisms of action of electrochemotherapy facilitated clinical trials using bleomycin and cisplatin in electrochemotherapy protocols. All studies provided evidence that electrochemotherapy is effective treatment for local tumor growth in patients with different cancer types. In this review we gathered the data of the clinical trials that have been published so far, and presented our latest clinical experience on electrochemotherapy with cisplatin at the Institute of Oncology in Ljubljana, pointing out the advantages and drawbacks of this treatment. treated by electrochemotherapy (Heller et al, 1999; Mir, 2000).

I. Introduction What is electrochemotherapy? Electrochemotherapy consists of chemotherapy followed by local application of electric pulses to the tumor to increase drug delivery into the cells. In late eighties were published the first reports using different sets of electric pulses, both exponential and square wave, with high amplitude, demonstrating that antitumor effectiveness of chemotherapeutic drug bleomycin can be potentiated, resulting in tumor cures (Belehradek et al, 1991; Mir et al, 1991a; Okino and Mohri, 1987). The idea was to apply electric pulses through a set of metal plate electrodes to the limited area of the tissue, i.e. tumor, in order to permeabilize the membrane of tumor cells and increase uptake and effectiveness of the drug injected before the application of electric pulses. The drug that was used in these first studies, bleomycin, is a hydrophilic drug, that has very limited transport through the cell membrane, but is very cytotoxic once bound to DNA (Mir et al, 1996). Consequently, for good antitumor effectiveness, drug doses could be drastically reduced, because electroporation increased drug effectiveness several fold, locally at the site of electric pulses application. As a result of reduced drug dosage minimal or no side effects were observed in animals and patients

II. Preclinical studies on electrochemotherapy Some review papers have already dealt with this subject, but briefly we will summarize again (Mir, 2000; Sersa, 2000a). In vitro studies tested several chemotherapeutic drugs for potential application in combination with electroporation of the cells (Cemazar et al, 1998a; Gehl et al, 1998; Jaroszeski et al, 2000a; Orlowski et al, 1988; Sersa et al, 1995). Since electroporation can facilitate drug transport through cell membrane for only those molecules that are poorly or nonpermeant, the selection is limited to those drugs that are hydrophilic, and lack transport systems in the membrane. The result of these studies was that only two drugs have been identified as potential chemotherapeutic drugs for electrochemotherapy. The first being bleomycin, that is hydrophilic, has very restricted transport through the cell membrane, but its cytotoxicity could be potentiated several 1000 times with electroporation of cells (Cemazar et al, 1998b; Gehl et al, 1998; Jaroszeski et al, 2000a; Kambe et al, 1996; Kuriyama et al, 2000; Orlowski et al,

133

Sersa et al: Electrochemotherapy â&#x20AC;&#x201C; advantages and drawbacks in treatment of cancer patients 1988). The second being cisplatin that has also hampered transport through the cell membrane (Gately and Howell, 1993). The exact mechanisms of the transport for cisplatin are not fully understood. However, electroporation of cells demonstrated increased cisplatin cytotoxicity up to 80 fold (Cemazar et al, 1998a, 2001; Gehl et al, 1998; Jaroszeski et al, 2000a; Kambe et al, 1996; Kuriyama et al, 2000; Melvik et al, 1986; Sersa et al, 1995). Besides these two drugs other platinum containing compounds, actinomycin D, adriamycin, mitomycin C, 5-FU and cyclophosphamide showed promising results in in vitro studies and in some in vivo studies, but didnâ&#x20AC;&#x2122;t reach clinical testing (Kambe et al, 1996; Kuriyama et al, 2000; Orlowski et al, 1988; Yabushita et al, 1997). Both drugs, bleomycin and cisplatin, have been tested on animal models in vivo. Their effectiveness was demonstrated on several tumor models, in mice, rats, rabbits, cats, dogs, horses and guinea pigs. In these studies solid subcutaneous tumors, in muscle, liver and brain, being either sarcomas, carcinomas, melanoma or neuroblastoma were used to demonstrate antitumor effectiveness of electrochemotherapy (Rols et al, 2002; Mir et al, 1995; Sersa, 2000a). It was established that electric pulses have to be applied at the time of maximal drug concentration in the tumor, in order to achieve the best antitumor effect. Depending on the route of the drug administration, the best timing for intravenous injection of the drug is 3 minutes before application of electric pulses, and for intratumoral administration electric pulses should be applied immediately after drug injection (Cemazar et al, 1998c; Domenge et al, 1996; Heller et al, 1997; Sersa et al, 1995). Electroporation of the tissue before drug administration has minimal or no antitumor effectiveness. In addition, drug dosage dependency of antitumor effectiveness and dependency on amplitude, number of pulses and electric field distribution in the tissues were elaborated in the preclinical studies (Cemazar et al, 1998c; Heller et al, 1997; Jaroszeski et al, 2001; Miklavcic et al, 1998; Mir et al, 1991a; Sersa et al, 1995). Furthermore, elaborated were also other electrical parameters such as the threshold for reversible and irreversible permeabilization of the tissue and frequency of the pulses (Gehl et al, 1999; Macek Lebar et al, 2002; Miklavcic et al, 2000; Pucihar et al, 2002). Based on all these data, we can summarize that for good antitumor effectiveness using plate electrodes with the distance from 4 to 8 mm between them, optimal set of pulses is 8 pulses with amplitude 1100 to 1300 V/cm, pulse duration 100 Âľs, and frequency 1Hz. For better effect 8 electric pulses should be delivered in two perpendicular directions in two sets of 4 pulses (Cemazar et al, 1995; Miklavcic et al, 1998; Sersa et al, 1996a). Application of electric pulses only or treatment with the drug only had minimal or no effect on tumor growth. Needle electrodes with different configuration of the needles were also developed for electrochemotherapy (Gehl et al, 1999; Gilbert et al, 1997; Mir et al, 1997). Due to the different setup of the electrodes it is difficult to prescribe optimal electric pulses parameters for good antitumor effect of electrochemotherapy. However, basically, these types of electrodes require lower electric field intensity than plate electrodes. This is because with

needle electrodes there is no need to overcome the resistance of stratum corneum, since these electrodes are inserted directly in the tumor tissue. Basic mechanism of action of electrochemotherapy is electroporation of cells in tumors, which increases drug effectiveness by enabling the drugs to reach intracellular targets (Belehradek et al, 1994; Cemazar et al, 1998c, 1999). Besides this principal one, other mechanisms that are involved in antitumor effectiveness of electrochemotherapy were described. Application of electric pulses to the tissues induces transient but reversible reduction of blood flow. Restoration of blood flow in normal tissue is much faster than in tumors (Gehl et al, 2002; Sersa et al, 1999a). The decrease in tumor blood flow induces drug entrapment in the tissue, providing more time for drug action (Sersa et al, 1999a,b). Besides, this phenomenon prevents bleeding from the tissue (Gehl and Geertsen, 2000). The effect of electrochemotherapy is not only on tumor cells in the tumors, but also on stromal cells, including endothelial cells in the lining of tumor blood vessels. Therefore, another mechanism involved in antitumor effectiveness of electrochemotherapy is its vascular targeted effect (Cemazar et al, 2001; Sersa et al, 1999b, 2002). Due to the massive tumor antigen shedding in the organisms, electrochemotherapy can induce also some systemic immunity, that can be up-regulated by additional treatment with biological response modifiers like IL-2 and TNF-! (Heller et al, 2000; Mir et al, 1992, 1995; Sersa et al, 1996b, 1997). Summarizing, electrochemotherapy protocols were optimized in preclinical studies in vitro and in vivo, and basic mechanisms elucidated, such as electroporation of cells, tumor drug entrapment, antivascular effect and involvement of immune response. Based on all these data, electrochemotherapy with bleomycin and cisplatin was promptly evaluated in clinical trials.

III. Overview of clinical studies The first report of L.M. Mir on treatment of head and neck patients with electrochemotherapy using bleomycin, published in 1991, stimulated other groups that have already tested electrochemotherapy in preclinical studies, to launch their own clinical studies (Belehradek M et al, 1993; Domenge et al, 1996; Glass et al, 1996ab, 1997; Heller et al, 1996; Mir et al, 1991; Reintgen et al, 1996; Rudolf et al, 1995). At that time, groups from Villejuif and Toulouse in France, and groups in Tampa, USA and Ljubljana, Slovenia were involved in electrochemotherapy studies. Based on the first experience, a joint clinical paper was published, summarizing clinical results (Mir et al, 1998). The results of the joint study indicated that electrochemotherapy with bleomycin in patients, given either intravenously or intratumorally, is feasible, effective and without side effects. The treatment was performed on skin tumor nodules originating from different malignant tumors; however predominant tumor type was malignant melanoma and squamous cell carcinoma. Observed were 85% objective responses, with high percentage (56%) of

134

Cancer Therapy Vol 1, page 135 long lasting complete responses. Thereafter, other groups reported on effectiveness of electrochemotherapy with bleomycin, with similar results as published in the joint study (Burian et al, 2003; Gehl et al, 2000; Heller et al, 1998; Kubota et al, 1998; Panje et al, 1998; Rodriguez et al, 2001; Rols et al, 2000; Sersa et al, 2000b) (Table 1). Our group published the first clinical data on electrochemotherapy with intratumorally injected cisplatin in 1998 and thereafter with intravenous injection (Rebersek et al, 2000; Sersa et al, 1998; 1999c, 2000c, d). The study with intravenously given cisplatin was designed to verify whether electroporation of tumors in patients with progressive disease of malignant melanoma can increase antitumor effectiveness of a standard cisplatin based chemotherapy protocol (Sersa et al, 2000d). Good antitumor effectiveness was observed, but not very high percentage of objective responses, predominantly because big tumor nodules were included, where electrochemotherapy was less effective (Table 2). However, the study demonstrated that electrochemotherapy could be used as an adjunct to systemic ongoing cisplatin treatment, predominantly in patients in whom antitumor effectiveness needs to be potentiated locally. Compared to electrochemotherapy with intratumorally injected cisplatin, electrochemotherapy with intravenously injected cisplatin was less effective (Table 2). Electrochemotherapy with intratumorally injected cisplatin was equally or more effective compared to electrochemotherapy with bleomycin given intratumorally (Glass et al, 1996b, 1997; Heller et al,

1998; Mir et al. 1998; Sersa et al, 1998, 1999c, 2000c). Furthermore, the data obtained on electrochemotherapy with cisplatin demonstrated that when cisplatin was given intravenously it was less effective compared to electrochemotherapy with bleomycin given either intravenously or intratumorally (Glass et al, 1996a, b, 1997; Heller et al, 1998; Mir et al, 1998; Sersa et al, 2000d). Studies on electrochemotherapy with intratumorally injected cisplatin were carried out on patients with squamous cell carcinoma of the neck, basal cell carcinoma and adenocarcinoma of the breast and tubae, however the predominant group was 10 patients with malignant melanoma (Sersa et al, 1998, 2000c). The results on malignant melanoma patients proved that electrochemotherapy with cisplatin is effective in controlling local tumor growth, and that it has a much higher probability for local tumor control than intratumoral cisplatin injection (78% and 19%, respectively) (Sersa et al, 2000c). Table 2 summarizes results of these studies. Long lasting complete responses of the treated nodules up to two years were induced, without scaring of the tissue and good cosmetic effect. Nodules that were bigger than the distance between the electrodes were treated by consecutive application of electric pulses to the tumor nodules, until the whole tumor area was covered in one or in consecutive sessions. If the tumors regrew it was possible to retreat the nodules in the next session with equal effectiveness.

Table 1. Results of clinical studies on electrochemotherapy with bleomycin, given intravenously or intratumorally. Tumor

No. Pts.

No. Tumors

OR (%)

CR (%)

Head and neck squamous cell carcinoma Malignant melanoma Basal cell carcinoma Adenocarcinoma (breast, salivary gland, hypernephroma)

14 2 4

94 6 31

89 100 100

34 17 97

Total

208

62-100

17-97

Head and neck tumors

Squamous, adeno and adenid cystic carcinoma Malignant melanoma Squamous cell carcinoma Kaposi sarcoma Breast cancer Bladder; trans. cell ca.

11 1 1 2 1

106 1 4 14 17

95 100 100 100 100

60 0 100 58 82

Total

116

80-100

0-100

Intravenous BLM dose: 10-15 mg/m2 or 18-27 U/m2

Intratumoral BLM dose: 0.2-0.55 mg/cm3 or 0,25-1.0 U/cm3

135

Sersa et al: Electrochemotherapy – advantages and drawbacks in treatment of cancer patients Table 2. Results of clinical studies on electrochemotherapy with cisplatin, given intravenously or intratumorally. Tumor

No. Pts.

No. Tumors

OR (%)

CR (%)

Head and neck

100

squamous ca. Malignant melanoma Basal cell carcinoma Adenocarcinoma (breast, ovary)

10 1 2

82 4 6

78 100 100

68 100 78

Total

78-100

68-100

Intravenous Cisplatin based chemotherapy protocol Malignant melanoma Intratumoral Cisplatin 1mg/cm3

tumor. In the case of bigger nodules cisplatin was injected in several different locations in the tumor area in order to obtain better distribution of the drug. Cumulative dose was adjusted to the size of the tumor nodule. Intratumoral injection was in most cases successful, without leakage from the tumor. Electric pulses were applied first with custom-made plate electrodes, later with IGEA s.r.l. (Carpi, Modena) made plate electrodes. The distance between the electrodes was 4 or 7 mm. Electric pulses generator Jouan GHT 1287 (Jouan Saint Herblaine, France) was used, which delivered 8 electric pulses, amplitude/distance ratio 1300 V/cm, 100 µs long, with frequency 1 Hz. In order to assure good contact between the electrodes and the skin, ultrasonographic paste was used (Figure 1). Tumor nodules that were treated were of varying size, from 4 mm up to 3 cm in diameter. Electric pulses were delivered in two sets of four pulses in perpendicular direction with 1-second pause in-between. Nodules that were bigger than the distance between the electrodes were treated by consecutive application of electric pulses to the tumor nodules until the whole tumor area was covered. Immediate effects of the treatment were marks of the electrodes on the skin that disappeared after few minutes, and unpleasant sensation, predominantly caused by muscle contractions. The pain was bearable, therefore patients did not require special pain control, and the pain dissipated immediately after application of electric pulses. The patients were regularly checked for the response to the treatment in 2-4 weeks intervals. Some tumors needed retreatment. If the tumors were big, retreatment was needed every 2-4 weeks in order to eradicate the whole tumor mass. In the case of tumor regrowth after complete response, retreatment was performed at the time of tumor progression. The observation time of the patients varied, depending on the time of inclusion into the study, from few weeks to up to one and a half years. In Table 3 are listed the patients that were treated in this study. The number of lesions that were treated in the patient, number of the consecutive treatment sessions, response to the

Many of the patients were treated as out-patients, since they tolerated the treatment well. The patients described the sensation of applied electric pulses as painful. But, the pain dissipated immediately after application of electric pulses and it could be alleviated by xylocaine. Nevertheless none of the patients demanded to stop the treatment, or refused the treatment in the next session.

IV. Our experience with electrochemotherapy with cisplatin from 2000 to 2002 After some of the initial studies that have compared the effectiveness of electrochemotherapy with cisplatin to antitumor effectiveness of cisplatin only given intratumorally, we initiated another clinical study that had three goals: ñTo use electrochemotherapy with cisplatin given intratumorally to treat patients with progressive disease in order to alleviate side effects to the patients. ñTo re-evaluate the effectiveness of electrochemotherapy on similar group of patients as in the previous study (Sersa et al, 2000c). ñTo gain experience in order to be able to further optimize treatment procedure based on assessment of advantages and drawbacks of electrochemotherapy. The study was performed on 14 patients with progressive disease of malignant melanoma. The enrolled patients had local recurrent disease and all standard treatments had been exhausted. Before enrolment, the patients were informed about the principles and procedure of the treatment, and signed an informed consent. The treatment was performed on outpatient basis, without any pre or post medication, or need for hospitalization after the treatment. Before, and in regular intervals after the treatment, tumor nodules were measured and photographed. The treatment was performed by intratumoral injection of cisplatin using hypodermic needle. The dose of cisplatin was app. 1mg/cm3 of the 136

Cancer Therapy Vol 1, page 137 treatment, and observation time are indicated. In most cases the response to the treatment after 4 weeks was partial or complete regression of the treated nodules (objective response: 82%). New electrochemotherapy sessions were needed in order to treat tumor nodules that regrew in the time between the sessions or to treat new tumor nodules that emerged between the two visits. Therefore, in some patients up to 13 consecutive sessions were needed in order to control tumor growth locoregionally. In some cases electrochemotherapy was

effective in controlling growth of specific nodules, however patient’s disease progressed to other sites. Results of the treatment in these 14 patients are in accordance with our previously published results. In our previous study on 10 malignant melanoma patients, 82 tumor nodules were treated with electrochemotherapy with intratumorally injected cisplatin; 78% of the treated nodules were in objective response, from these 68% were in complete response.

Figure 1. Electrochemotherapy treatment procedure on the patient. A.– Electric pulses generator with oscilloscope for the control of the applied electric pulses. B. – two sets of electrodes with 4 mm and 7 mm distance between the plate electrodes. C. – Intratumoral injection of cisplatin in tumor nodule. Noticeable is whitening of the tumor area in cases with successful drug administration. D. – Application of electric pulses to the tumors by placing the electrodes to the tumor, possibly embracing the tumor mass between the electrodes for better electric field distribution.

Table 3. Summary of electrochemotherapy with cisplatin in malignant melanoma patients; in the years 2000-2002. Treatment Patients

No. of treated lesions

No. of treatment sessions

Response to treatment PD

No. 1 No. 2 No. 3 No. 4 No. 5 No. 6 No. 7 No. 8 No. 9 No. 10 No. 11 No. 12 No. 13 No. 14

6 8 3 2 5 7 18 26 34 21 19 16 1 45

1 4 2 2 2 3 5 11 7 9 5 3 1 9

Total

211

5 8

1 16

4-8 64 - 66 7 6 16 - 18 2–6 2 – 15 6 – 36 42 3 – 33 7 - 57 4 – 54 2 2 – 21

24 11.4%

23 10.9%

148 70.1%

2 – 66 median - 13

3 1 3 8 1

1 1

16 7.6%

137

Observation time (weeks)

5 4 5 24 34 21 18 16

Sersa et al: Electrochemotherapy â&#x20AC;&#x201C; advantages and drawbacks in treatment of cancer patients Electrochemotherapy with cisplatin was successful in controlling the growth of the treated nodules. Tumors regressed in most cases within 4-6 weeks, when superficial scab fell off. Good cosmetic effect was observed, with light depigmentation of the skin (Figure 2). During regression of smaller tumor nodules there was no exulceration, therefore no special wound dressing was required, and also no extra visits to the supervising oncologist. Most of the tumor nodules that were up to 1 cm in diameter regressed completely after single treatment, and remained in complete response for a long period of time, the longest that could be followed was 66 weeks, almost 1.5 year. In one treatment session it was feasible to treat up to 15 tumor nodules. It was possible to retreat tumor nodules that did not show typical signs of regression or progressed within 2-4 weeks after therapy. On bigger tumor nodules, it was possible to control tumor growth or reduce the size of the nodules by consecutive treatments in 2- 4 weeks interval (Figure 3). The treatment can be performed on any part of the body. In our study most of the tumor lesions were located on the limbs. However we have treated also tumor nodules that were located on the thorax, stomach, back and head and neck region. The only experience that was demanding abrogation of the treatment was in a patient that was treated in the early beginning of our studies.

Only 7% of nodules were in progressive disease and 15% in no change (Sersa et al, 2000c). Therefore, we can conclude that the described protocol for electrochemotherapy is effective and reproducible, confirmed on two groups of patients in two separate clinical studies. However, we have gained additional experience that we can summarize in two categories: advantages and drawbacks that will be discussed in the next two subheadings.

A. Advantages of electrochemotherapy Concerning the treatment procedure, electrochemotherapy is easy and quick to perform, and is inexpensive. The requirements are a suitable room for patient preparation and treatment, and an electric pulse generator with different sets of electrodes that are used for different sizes of tumor nodules. After the treatment, patients do not require special attention or post-treatment medication. They can wait for a while in the hospital in order to be in the position to obtain medical attention, if needed, but so far no side effects were observed or medical attention of the patients required. Concerning the personnel, a M.D. in charge, a nurse and an assistant trained in handling the electric pulses generator are required to perform the treatment.

Figure 2. Example of good local tumor control in a patient with two tumor nodules on the leg. The first tumor nodule (No. 1) was treated once and tumor regressed, after one year there is no recurrence and good cosmetic effect. The second tumor nodule (No. 2) was treated three times in a two-month interval and each time good response was obtained although the tumor in the intervals grew substantially.

138

Cancer Therapy Vol 1, page 139

Figure 3. Retreatment of the nodules can provide good local tumor control. A plaque on the back of the malignant melanoma patient was treated by electrochemotherapy with cisplatin in 9 consecutive sessions in 2 to 4 weeks intervals. After 8 months, good local tumor growth was obtained.

in one session. Electrochemotherapy is however effective on those nodules that were treated, but has no effect on the general progression of the disease. Furthermore, because of occasional quick progression of the disease, new nodules emerge, that were not detectable in previous sessions. Electrochemotherapy can be performed on these new nodules, and taken collectively it can be effective in local control of the disease, but cannot affect general progression of the disease. Currently, the electrodes that are used are effective in treatment of superficial nodules, whereas they are not quite appropriate for deeper seeded or big nodules. Bigger nodules need application of several sets of electric pulses, and also several treatment sessions, in order to cover the whole tumor area and to be able to remove deeper layers of the tumor. The problems have to be solved, if electrochemotherapy is to be applied to the treatment of nodules that are more than 3 cm in diameter and thicker than 0.5 cm. This issue has been already addressed in the studies performed in Tampa and Villejuif, where they used needle electrodes (Gilbert et al, 1997; Mir et al, 1997).

A patient had a tumor nodule on the back in the region of the diaphragm. During application of the electric pulses, spasm of the diaphragm occurred and breathing was interrupted. After the abrogation of the treatment the patient recovered within a few minutes.

B. Disadvantages of electrochemotherapy Besides the advantages, there are also some disadvantages of electrochemotherapy. Pain is a limiting factor in most of the patients. Pain can be avoided by lifting the treated tumor nodule while applying electric pulses. In addition, it was observed that patients that were obese had less sensation, because adipose tissue prevented electric field distribution deeper into the underlying tissue, therefore less muscle contractions were observed. There was also a difference in sensations between the electrodes that had smaller gap (4 mm) than those that had bigger gap (7 mm), because electrodes with smaller gap required lower electric field intensity for electroporation of the tissue. Electrochemotherapy is local treatment that can be effective in treatment of limited number of tumor lesions that are not bigger than 3 cm in diameter. Therefore, it can be effective in those patients that have few or up to 15 skin metastases in transit. In the case of more nodules electrochemotherapy cannot be performed on all nodules

V. Conclusion Electrochemotherapy cannot be the only biomedical application of tissue electroporation. It has to be envisioned as the first step toward a broader use of

139

Sersa et al: Electrochemotherapy â&#x20AC;&#x201C; advantages and drawbacks in treatment of cancer patients Gehl J, Sorensen T-H, Nielsen K, Raskmark P, Nielsen SL, Skovsgaard T, and Mir L-M (1999) In vivo electroporation of skeletal muscle: threshold, efficacy and relation to electric field distribution. Biochim Biophys Acta 1428, 233-240. Gehl J, and Geertsen (2000) Efficient palliation of haemorrhaging malignant melanoma skin metastases by electrochemotherapy. Melanoma Res 10, 585-589. Gehl J, Skovsgaard T, and Mir L-M (2002) Vascular reactions to in vivo electroporation: characterization and consequences for drug and gene delivery. Biochim Biophys Acta 1569, 51-58. Gilbert R, Jaroszeski M, and Heller R (1997) Novel electrode designs for electrochemotherapy. Biochim Biophys Acta 1334, 9-14. Glass L-F, Fenske N-A, Jaroszeski M, Perrott R, Harvey D-T, Reintgen D-S, and Heller R (1996a) Bleomycin-mediated electrochemotherapy of basal cell carcinoma. J Am Acad Dermatol 34, 82-86, Glass L-F, Pepine M-L, Fenske N-A, Jaroszeski M, Reintgen DS, and Heller R (1996b) Bleomycin-mediated electrochemotherapy of metastatic melanoma. Arch Dermatol 132, 1353-1357. Glass L-F, Jaroszeski M, Gilbert R, Reintgen D-S, and Heller R (1997) Intralesional bleomycin-mediated electrochemotherapy in 20 patients with basal cell carcinoma. J Am Acad Dermatol 37, 596-599. Heller R, Jaroszeski M-J, Glass L-F, Messina J-L, Rapaport D-P, DeConti R-C, Fenske N-A, Gilbert R-A, Mir L-M, and Reintgen D-S (1996) Phase I/II trail for the treatment of cutaneous and subcutaneous tumors using electrochemotherapy. Cancer 77, 964-971. Heller R, Jaroszeski M, Perrott R, Messina J, and Gilbert R (1997) Effective treatment of B16 melanoma by direct delivery of bleomycin using electrochemotherapy. Melanoma Res 7, 10-18. Heller R, Jaroszeski M-J, Reintgen D-S, Puleo C-A, DeConti RC, Gilbert R-A, and Glass L-F (1998) Treatment of cutaneous and subcutaneous tumors with electrochemotherapy using intralesional bleomycin. Cancer 83, 148-157. Heller R, Gilbert R, and Jaroszeski M-J (1999) Clinical application of electrochemotherapy. Adv Drug Deliver 35, 119-129. Heller L, Pottinger C, Jaroszeski M-J; Gilbert R, and Heller R (2000) In vivo electroporation of plasmids encoding GMCFS or interleukin-2 into existing B16 melanomas combined with electrochemotherapy induces long-term antitumour immunity. Melanoma Res 10, 577-583. Jaroszeski M-J, Dang V, Pottinger C, Hickey J, Gilbert R, and Heller R (2000a) Toxicity of anticancer agents mediated by electroporation in vitro. Anticancer Drugs 11, 201-208. Jaroszeski M, Heller R, and Gilbert R (2000b) Electrochemotherapy, electrogenetherapy and transdermal drug delivery Electrically mediated delivery of molecules to cells. First ed. New Jersey: Humana Press. Jaroszeski M-J, Copolla D, Pottinger C, Benson K, Gilbert R-A, and Heller R (2001) Treatment of hepatocellular carcinoma in a rat model using electrochemotherapy. Eur J Cancer 37, 422-430. Kambe M, Arita D, Kikuohi H, Funato T, Tezuka F, Gamo M, Murakawa Y, and Kanamaru R (1996) Enhancing the effect of anticancer drugs against the colorectal cancer cell line with electroporation. Tahoku J Exp Med 180, 161-171.

electroporation in clinical use, predominantly in electrogene therapy and transdermal drug delivery (Jaroszeski et al, 2000b).

Acknowedgements The authors wish to thank Simona Kranjc, Mira Lavric and Lea Tabakovic. This study was supported by the Ministry of Education, Science and Sport of the Republic of Slovenia.

References Belehradek J-Jr, Orlowski S, Poddevin B, Paoletti C, and Mir LM (1991) Electrochemotherapy of spontaneous mammary tumours in mice. Eur J Cancer 27, 73-76. Belehradek J-Jr, Orlowski S, Ramirez LH, Pron G, Poddevin B, and Mir L-M (1994) Electropermeabilization of cells and tissues assessed by the qualitative and quantitative electroloading of bleomycin. Bichim Biophys Acta 1190; 155-163. Belehradek M, Domenge C, Luboinski B, Orlowski S, Belehradek J Jr, and Mir L-M (1993) Electrochemotherapy, a new antitumour treatment. First clinical phase I-II trial. Cancer 72, 3694-3700. Burian M, Formanek M, and Regele H (2003) Electroporation therapy in head and neck cancer. Acta Otolaryngol 123, 264-268. Cemazar M, Miklavcic D, Vodovnik L, Jarm T, Rudolf Z, Stabuc B, Cufer T, and Sersa, G (1995) Improved therapeutic effect of electrochemotherapy with cisplatin by intratumoral drug administration and changing of electrode orientation for electropermeabilization on EAT tumors in mice. Radiol Oncol 29, 121-127. Cemazar M, Sersa G, and Miklavcic D (1998a) Electrochemotherapy with cisplatin in the treatment of tumor cells resistant to cisplatin. Anticancer Res 18, 4463-4466. Cemazar M, Miklavcic D, and Sersa G (1998b) Intrinsic sensitivity of tumor cells to bleomycin as an indicator of tumor response to electrochemotherapy. Jpn J Caner Res 89, 328-333. Cemazar M, Milacic R, Miklavcic D, Dolzan V, and Ser_a G (1998c) Intratumoral cisplatin administration in electrochemotherapy: antitumor effectiveness, sequence dependence and platinum content. Anti-Cancer Drugs 9, 525-530. Cemazar M, Miklavcic D, Scancar J, Dolzan V, Golouh R, and Sersa G (1999) Increased platinum accumulation in SA-1 tumour cells after in vivo electrochemotherapy with cisplatin. Br J Cancer 79, 1386-1391. Cemazar M, Parkins C-S, Holder A-L, Chaplin D-J, Tozer G-M, and Sersa G (2001) Electroporation of human microvascular endothelial cells: evidence for an anti-vascular mechanism of electrochemotherapy. Br J Cancer 84, 565-570. Domenge C, Orlowski S, Luboinski B, De Baere T, Belehradek J-Jr, and Mir L-M (1996) Antitumor electrochemotherapy. New advances in the clinical protocol. Cancer 77, 956-963. Gately D-P, and Howell S-B (1993) Cellular accumulation of the anticancer agent cisplatin: a review. Brit J Cancer 67, 11711176. Gehl J, Skovsgaard T, and Mir L-M (1998) Enhancement of cytotoxicity by electro-permeabilization: an improved method for screening drugs. Anticancer Drugs 9, 319-325.

140

Cancer Therapy Vol 1, page 141 Kubota Y, Mir L-M, Nakada T, Sasagawa I, Suzuki H, and Aoyama N (1998) Successful treatment of metastatic skin lesions with electrochemotherapy. J Urol 160, 1426. Kuriyama S, Matsumoto M, Mitoro A, Tsujinoue H, Nakatami T, Fukui H, and Tsujii T (2000) Electrochemotherapy for colorectal cancer with commonly used chemotherapeutic agents in a mouse model. Digest Dis Sci 45, 1568-1577. Macek Lebar A, Sersa G, Kranjc S, Grosel A, and Miklavcic D (2002) Optimization of pulse parameters in vitro for in vivo electrochemotherapy. Anticancer Res 22, 1731-1736. Melvik J-E, Pettersen E-O, Gordon P-B, and Seglen P-O (1986) Increase in cis-dichlorodiammineplatinum (II) cytotoxicity upon reversible electro-permeabilization of the plasma membrane in cultured human NHIK 3025 cells. Eur J Cancer Clin Oncol 22,1523-1530. Miklavcic D, Beravs K, Semrov D, Cemazar M, Demsar F, and Sersa G (1998) The importance of electric field distribution for effective in vivo electroporation of tissues. Biophysical J 74, 2152-2158. Miklavcic D, Semrov D, Mekid H, and Mir L-M (2000) A validated model of in vivo electric field distribution in tissues for electrochemotherapy and for DNA electrotransfer for gene therapy. Biochim Biophys Acta 1523, 73-82. Mir L-M, Belehradek M, Domenge C, Orlowski S, Poddevin B, Belehradek J Jr, Schwaab G, Luboinski B, and Paoletti C (1991) Electrochemotherapy, a new antitumor treatment: first clinical trial. C R Acad Sci III 313, 613-618. Mir L-M, Orlowski S, Belehradek J-Jr, Paoletti C (1991) Electrochemotherapy potentiation of antitumour effect of bleomycin by local electric pulses. Eur J Cancer 27, 68-72. Mir L-M, Orlowski S, Poddevin B, and Belehradek J-Jr (1992) Electrochemotherapy tumor treatment is improved by interleukin-2 stimulation of the host's defenses. Eur Cytokine Netw 3, 331-334. Mir L-M, Orlowski S, Belehradek J-Jr, Teissie J, Rols M-P, Sersa G, and Miklavcic D, Gilbert R, and Heller R (1995) Biomedical applications of electric pulses with special emphasis on antitumor electrochemotherapy. Bioelectroch Bioener, 38, 203-207. Mir L-M, Roth C, Orlowski S, Quintin-Colonna F, Fradelizi D, and Belehradek J-Jr (1995) Systemic antitumor effects of electrochemotherapy combined with histoincompatible cells secreting interleukin-2. J Immunother Emphasis Tumor Immunol 17, 30-38. Mir L-M, Tounekti O, and Orlowski S (1996) Bleomycin: revival of an old drug. Gen Pharmacol 27, 745-748. Mir L-M, Devauchelle P, Quintin-Colonna F, Delisle F, Doliger S, Fradelizi D, Belehradek Jr-J, and Orlowski S (1997) First clinical trial of cat soft-tissue sarcomas treatment by electrochemotherapy. Brit J Cancer 76, 1617-1622. Mir L-M, Glass L-F, Sersa G, Teissie J, Domenge C, Miklavcic D, Jaroszeski M-J, Orlowski S, Reintgen DS, Rudolf Z, Belehradek M, Gilbert R, Rols M-P, Belehradek J-Jr, Bachaud J-M, DeConti R, Stabuc B, Cemazar M, Coninx P, and Heller R (1998) Effective treatment of cutaneous and subcutaneous malignant tumours by electrochemotherapy. Brit J Cancer 77, 2336-2342. Mir L-M (2000) Therapeutic perspectives of in vivo cell electropermeabilization. Bioelectrochem 53, 1-10. Okino M, and Mohri H (1987) Effects of a high-voltage electrical impulse and an anticancer drug on in vivo growing tumors. Jpn J Cancer Res 78,1319-1321.

Orlowski S, Belehradek J-Jr, Paoletti C, and Mir L-M (1988) Transient electro-permeabilization of cells in culture. Increase of the cytotoxicity of anticancer drugs. Biochem Pharmacol 37, 4727-4733. Panje W-R, Hier M-P, Garman G-R, Harrel E, Goldman A, and Bloch I (1998) Electroporation therapy of head and neck cancer. Am Otol Rhinol Laryngol 107, 779-785. Pucihar G, Mir L-M, and Miklavcic D (2002) The effect of pulse repetition frequency on the uptake into electropermeabilized cells in vitro with possible applications in electrochemotherapy. Bioelectrochemistry 57, 167-172. Rebersek M, Cufer T, Rudolf Z, and Sersa G (2000) Electrochemotherapy with cisplatin of breast cancer tumor nodules in a male patient. Radiol Oncol 34, 357-361. Reintgen D-S, Jaroszeski M-J, and Heller R (1996) Electrochemotherapy, a novel approach to cancer. The Skin Cancer Foundation Journal 14, 17-19. Rodriguez-Cuevas S, Barroso- Bravo S, Almanza- Estrada J, Cristobal- Martinez L, and Gonzales-Rodriguez E (2001) Electrochemotherapy in primary and metastatic skin tumors: Phase II trial using intralesional bleomycin. Arch Med Res 32, 273-276. Rols M-P, Bachaud J-M, Giraud P, Chevreau C, Roche H, and Teissie J (2000) Electrochemotherapy of cutaneous metastases in malignant melanoma. Melanoma Res 10, 468474. Rols M-P, Tamzali Y, and Teissie Y (2002) Electrochemotherapy of horses. A preliminary clinical report. Bioelectrochemistry 55, 101-105. Rudolf Z, Stabuc B, Cemazar M, Miklavcic D, Vodovnik L, and Sersa G (1995) Electrochemotherapy with bleomycin: The first clinical experience in malignant melanoma patients. Radiol Oncol 29: 229-235. Sersa G, Cemazar M, and Miklavcic D (1995) Antitumor effectiveness of electrochemotherapy with cisdiamminedichloroplatinum(II) in mice. Cancer Res 55, 3450-3455. Sersa G, Cemazar M, Semrov D, and Miklavcic D (1996a) Changing electrode orientation improves the efficacy of electrochemotherapy of solid tumors in mice. Bioelectrochem Bioenerg 39, 61-66. Sersa G, Kotnik V, Cemazar M, Miklavcic D, and Kotnik A (1996b) Electrochemotherapy with bleomycin in SA-1 tumor-bearing mice-natural resistance and immune responsiveness. Anti-Cancer Drug 7, 785-791. Sersa G, Cemazar M, Menart V, Gaberc-Porekar V, and Miklavcic D (1997) Anti-tumor effectiveness of electrochemotherapy with bleomycin is increased by TNFalpha on SA-1 tumors in mice. Cancer Lett 116, 85-92. Sersa G, Stabuc B, Cemazar M, Jancar B, Miklavcic D, and Rudolf Z (1998) Electrochemotherapy with cisplatin: potentiation of local cisplatin antitumour effectiveness by application of electric pulses in cancer patients. Eur J Cancer 34, 1213-1218. Sersa G, Cemazar M, Parkins C-S, and Chaplin D-J (1999a) Tumour blood flow changes induced by application of electric pulses. Eur J Cancer 35, 672-677. Sersa G, Cemazar M, Miklavcic D, and Chaplin D-J (1999b) Tumor blood flow modifying effect of electrochemotherapy with bleomycin. Anticancer Res 19(5B), 4017-4022. Sersa G, Cemazar M, Rudolf Z, and Fras A-P (1999c) Adenocarcinoma skin metastases treated by

141

Sersa et al: Electrochemotherapy â&#x20AC;&#x201C; advantages and drawbacks in treatment of cancer patients electrochemotherapy with cisplatin combined with radiation. Radiol Oncol 33, 291-296. Sersa G. (2000a) Electrochemotherapy: Animal work review. In: Jaroszeski MJ, Heller R, Gilbert R, editors. Electrochemotherapy, electrogenetherapy and transdermal drug delivery. Electrically mediated delivery of molecules to cells. Totowa: Humana Press; 119-136. Sersa G, Cufer T, Cemazar M, Rebersek M, and Zvonimir R (2000b) Electrochemotherapy with bleomycin in the treatment of hypernephroma metastasis: case report and literature review. Tumori 86,163-165. Sersa G, Stabuc B, Cemazar M, Miklavcic D, and Rudolf Z (2000c) Electrochemotherapy with cisplatin: clinical experience in malignant melanoma patients. Clin Cancer Res 6, 863-867. Sersa G, Stabuc B, Cemazar M, Miklavcic D, and Rudolf Z (2000d) Electrochemotherapy with cisplatin: the systemic antitumour effectiveness of cisplatin can be potentiated locally by aplication of electric pulses in the treatment of malignant melanoma skin metastases. Melanoma Res 10, 381-385. Sersa G, Krzic M, Sentjurc M, Ivanusa T, Beravs K, Kotnik V, Coer A, Swartz HM, and Cemazar M (2002) Reduced blood flow and oxygenation in SA-1 tumors after electrochemotherapy with cisplatin. Brit J Cancer 87, 10471054. Yabushita H, Yosikawa K, Hirata M, Furuya H, Hojyoh T, Fukatsu H, Noguchi M, and Nakanishi M (1997) Effects of electrochemotherapy on CaSki cells derived from a cervical squamous cell carcinoma. Gynecol 65, 297-303.

Dr. Gregor Sersa

142

Cancer Therapy Vol 1, page 143 Cancer Therapy Vol 1, 143-151, 2003.

p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells Research Article

Yi Lu1,2*, Jun Zhang1,2, Derrick J. Beech3, Linda K. Myers2, and Lisa K. Jennings1,2 1

Vascular Biology Center of Excellence, 2Department of Medicine, 3Department of Surgery, University of Tennessee Health Science Center, Memphis, TN

__________________________________________________________________________________ *Correspondence: Yi Lu, Ph.D., Vascular Biology Center of Excellence, Department of Medicine, College of Medicine, University of Tennessee Health Science Center, 956 Court Avenue, H300, Memphis, TN 38163, USA; Tel: (901) 448-5436; Fax: (901) 448-5496; email: ylu@utmem.edu Key words: breast cancer, VEGF, tumor angiogenesis, CDK inhibitor, adenovirus Received: 18 June 2003; Accepted: 19 August 2003; electronically published: August 2003

Summary One of the major causes of failure in the treatment of breast cancer is the occurrence of metastasis. It is thus important to intervene at a key step such as angiogenesis for breast cancer treatment and prolongation of patient survival Vascular endothelial growth factor (VEGF) plays a pivotal role in tumor angiogenesis. Tumor suppressor gene p16 is a cyclin-dependent kinase inhibitor and a negative cell cycle regulator. It was observed that the degree of tumor malignancy correlates with angiogenic capacity and the loss of p16 activity. To examine whether p16 overexpression decreases VEGF gene expression and inhibits tumor angiogenesis in breast cancer cells, human breast cancer cell line MDA-MB-231 was transduced with recombinant adenovirus expressing p16. Our study showed that p16 downregulated VEGF expression and inhibited in vivo angiogenesis induced by MDA-MB-231 cells in nude mice. toward the growing tumor. The endothelial cells then migrate together forming tubular structures that are ultimately encapsulated by recruiting periendothelial support cells to establish a vascular network that facilitates tumor growth and metastasis (Hanahan and Folkman, 1996). Angiogenesis is driven by a balance between different positive and negative effector molecules (or socalled angiogenic stimulators and inhibitors) that influence the growth rate of capillaries. The angiogenic stimulators include VEGF, basic fibroblast growth factor (Goldfarb, 1990), matrix metalloproteinases (John and Tuszynski, 2001), and angiopoietin-1 (Zetter, 1998). The angiogenic inhibitors include thrompbospondin-1 (TSP-1) (Tuszynski and Nicosia, 1996), angiostatin (Oâ&#x20AC;&#x2122;Reilly et al, 1994), and endostatin (Shichiri and Jirata, 2001). Normal vessel growth results from balanced and coordinated expression of these opposing factors. A switch from normal to uncontrolled vessel growth can occur by upregulating angiogenesis stimulators or downregulating angiogenesis inhibitors (Bouck et al, 1996). Angiogenesis is an essential prerequisite for aggressive tumor proliferation and spreading (Folkman, 1971) and it requires several angiogenic factors during the malignant transformation (Brem et al, 1978; Jensen et al, 1982; Brem et al, 1997). Among these angiogenic factors, VEGF plays a pivotal role in tumor angiogenesis

I. Introduction Breast cancer is the leading type of cancer in women living in the United States today. It is estimated that there will be 211,300 new cases of breast cancer and 39,800 breast cancer death in American women in year 2003 (Jemal et al, 2003). Metastasis, the spread of tumor cells from a primary site to distant organs to form secondary tumors, is a major cause of deaths of breast cancer patients (Marshall, 1993). Metastasis is a complex process including primary tumor growth, invasion through basement membrane and extracellular matrix, dissemination to lymphatic and/or blood circulation, motility to distant organs, angiogenesis and colonization in the secondary site (Steeg et al, 1998). It is thus important to intervene at key steps of metastatic process for breast cancer treatment and prolongation of patientsâ&#x20AC;&#x2122; survival One of the most promising avenues of breast cancer research is the development of biologically based therapies to thwart the progression of metastatic disease. However, not all aspects of the metastatic process may be equally clinical applicable. Therapies targeting angiogenesis and colonization that involve in micrometastatic outgrowth may be one of the most clinically applicable (Steeg et al, 1998). In the angiogenesis process, endothelial cells initially respond to changes in the local environment and migrate 143

Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells described (Steiner et al, 2000). Briefly, a human wild-type p16 cDNA gene was subcloned under the control of a RSV promoter into an E1 deleted adenoviral shuttle vector pAvs6a (Genetic Therapy, Inc., Gaithersburg, MD). The resultant adenoviral shuttle vector was cotransfected into 293 cells with pJM17 (Microbix Biosystems Inc., Toronto, Canada), an adenoviral type 5 genome plasmid, by the calcium phosphate method. The individual plaques were screened by direct plaque screening PCR method (Lu et al, 1998) using primers specific for RSV promoter and p16 cDNA gene. The resultant AdRSVp16 is a replicationdefective, recombinant adenoviral vector. Control virus AdRSVlacZ was generated by a similar method (Lu et al, 1999).

(Hanahan and Folkman, 1996; Klagsbrun and D’Amore, 1996; Risau, 1996; Grunstein et al, 1999; Neufeld et al, 1999). VEGF is a dimeric glycoprotein secreted by cells that is able to induce permeability and angiogenesis in tumor-associated blood vessels (Senger, 1983; Ferrara and Henzel, 1989). The VEGF family comprises five isoforms, including polypeptides of 121, 145, 165, 189, and 206 amino acids that are produced by the alternate splicing of a single gene containing eight exons (Leung et al, 1989; Tischer et al, 1989; Houck et al, 1991; Poltorak et al, 1997). VEGF165 is the one most commonly secreted by tumor cells and acts most strongly on endothelial cells to lead them to form new capillaries (Keyt et al, 1996; Soker et al, 1997). The expression of VEGF, which markedly contributes to tumor-associated neovascularization, is correlated with the malignant transformation of breast cancer and the poor prognosis in the patients (Gasparini et al, 1997; Obermair et al, 1997; Linderholm et al, 1998; Hefflfinger et al, 1999; Salven et al, 1999). VEGF has been shown to be present in breast tumors at levels that are, on average, 7-fold higher than in normal adjacent tissue (Yoshiji et al, 1996). Correspondingly, two VEGF receptors, Flt-1 and KDR/Flk-1 (Shibuya et al, 1990; Terman et al, 1992; Mustonen and Alitalo, 1995), are preferentially expressed in invading and proliferating endothelial cells (Plate and Risau, 1995). Combining results from several studies have showed that angiogenesis is a necessary step for breast cancer progression and metastasis (Liotta et al, 1974; Weidner et al, 1991; McCulloch et al, 1995; Zhang et al, 1995; O’Reilly et al, 1996; Berm et al, 1997). Tumor suppressor gene p16 (also called MTS1, CDKN2 and INK4A) is a cyclin-dependent kinase inhibitor and a negative cell cycle regulator (Shapiro and Rollins, 1996). The inactivation of p16 appears to be a common event in many cancers (Caldas et al, 1994; Hussussian et al, 1994; Jen et al, 1994; Cairns et al, 1995; Chen et al, 1996; Hatta et al, 1995; Li et al, 1995; Mao et al, 1995; Xiao et al, 1995). Angiogenic capacity correlates with the degree of malignancy and the loss of p16 activity in high-grade gliomas (Harada et al, 1999). In this study, we examined the effects of p16 expression on regulation of VEGF gene expression and vascularization of breast cancer cells.

C. Adenovirus preparation, titration and transduction Individual clones of AdRSVp16 and AdRSVlacZ were obtained by three times plaque purification method. Single viral clones were propagated in 293 cells. The culture medium of the 293 cells showing the complete cytopathic effect was collected and adenovirus was purified and concentrated by twice CsCl2 gradient ultracentrifugation. The viral titration and transduction were performed as previously described (Graham and Prevec, 1991).

D. Immunohistochemistry The procedure followed the method as described previously (Steiner et al, 2000). Briefly, for immunohistochemical staining, culture cells were grown on SlideFlasks with bottom detachable slides (Nalge Nunc, Naperville, IL) that could be used for immunohistochemistry staining directly later. The samples (slides) were first incubated with 1% H 2O2 for 30 min. The samples were incubated with first antibody against human p16 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 16 h at 40C, then by corresponding second antibody and the Universal Elite ABC Kit (Vector Laboratories, Inc., Burlingame, CA) according to the manufacturer's protocol. The reaction was visualized with DAB solution (75 mg 3,3’Diaminobenzidine and 30 µl 50% H 2O2 in 150 ml PBS) for 3-10 min.

E. RT-PCR Cells were extracted and total RNA was isolated by RNeasy Total RNA Kit (Qiagen, Santa Clarita, CA). After treatment of total RNA with RNase-free DNase I (Gibco BRL), reverse transcriptase reaction was carried out using Superscript II RT (Gibco BRL) according to the manufacturer's protocol. An aliquot of the RT mixture was subsequently used for the PCR reaction. The primers were specific to VEGF gene: primer 1 was and primer 2 was 5’GGATGTCTATCAGCGCAGCTAC3’ 5’TCACCGCCTCGGCTTGTCACATC3’. This primer set could detect mRNA encoding three molecular species of VEGF, giving rise to 322-, 454-, and 526-bp bands for VEGF121, VEGF 165, and VEGF189, respectively (Houck et al, 1991). PCR was performed in 50 µl total volume containing one fifth of above RT mixture, in a final concentration of 2 mM MgCl2, 50 mM KCl, 0.2 mM each of dNTPs, 20 mM Tris-HCl (pH 8.4), 1 µM each of the primers, and 2.5 units of Taq DNA polymerase (Gibco BRL). The reaction was carried out at 94 0C for 4 min; then for 30 cycles at 94 0C for 1 min, 610C for 2 min, and 720C for 2 min; followed by at 720C for 10 min. To ensure the quality of total RNA samples, the same RT mixture mentioned above was used for PCR of housekeeper gene ß-actin. The primers specific to ß-actin gene were and 5’TCCTGTGGCATCCACGAAACT3’ 5’GAAGCATTTGCGGTGGACGAT3’ which resulted a 314-bp PCR product. The PCR conditions followed the methods described previously (Kuo et al, 2002).

II. Materials and methods A. Cell culture and medium Dulbecco’s modified Eagle medium (D-MEM) and RPM11640 were purchased from Gibco BRL (Gaithersburg, MD). Fetal bovine serum (FBS) was from Hyclone Laboratories (Logan, UT). Human embryonic kidney 293 cells (American Type Culture Collection, Rockville, MD) were grown in DMEM with 10% heat inactivated FBS. Breast cancer cell line MDA-MB-231 (ATCC) was grown in RPM1-1640 medium with 10% FBS. All cell lines were grown in medium containing 100 units/ml penicillin, 100 µg/ml streptomycin at 370C in 5% CO2.

B. Generation of recombinant adenovirus AdRSVp16 The construction of the adenovirus containing p16 cDNA under the control of RSV promoter (AdRSVp16) was previously

144

Cancer Therapy Vol 1, page 145

F. Northern blot

III. RESULTS

Cells were extracted and total RNA was isolated by RNeasy Total RNA Kit (Qiagen, Santa Clarita, CA) according to the manufacturer's protocol. Total RNA (10 µg) was loaded on a 1.2% polyacrylamide gel and processed by electrophoresis. The standard Northern blot transfer to a Nylon membrane (HybondN+, Amersham Life Science, Buckinghamshire, England) was performed. The cDNA probe (p16 and VEGF165) was labeled by !-32P-dCTP using random primer method (Prime-It II Kit, Stratagene, La Jolla, CA). The membrane was hybridized with the probe in Rapid-hyb buffer (Amersham Life Science) according to the manufacturer's protocol. The membrane was exposed to a Kodak X-ray film between two intensifying screens at -800C for autoradiography. The cDNA probe of housekeeper gene "-actin was labeled as described above and used as an internal control for normalization.

A. Adenovirus AdRSVp16 expresses high level p16 protein in breast cancer cells To facilitate induction of p16 expression, a replication-defective recombinant adenovirus expressing human wild-type p16 under the control of a Rous sarcoma virus promoter (AdRSVp16) has been generated (Steiner et al, 2000). To demonstrate that AdRSVp16 is able to transfer and express p16 protein in cancer cells, MDAMB-231 cells were transduced with AdRSVp16 in vitro at multiplicity of infection (moi) of 200. Three days later the cells were processed for immunohistochemical staining for p16 protein using primary antibody against p16. As shown in Figure. 1, cells transduced by AdRSVp16 expressed a positive staining for p16 protein (Figure. 1B) while control untreated cells did not have the p16 staining (Figure. 1A).

G. ELISA for detecting VEGF Cells will be grown in 10-cm culture dishes and either untreated or transduced with AdRSVlacZ or AdRSVp16 (at moi=200). After 90-min viral infection, viral medium will be replaced with an exact 10 ml fresh medium to each sample dish. The cell medium (supernatant) will be collected 72 hr after viral transduction, and cell number attached on the culture dish will be counted. The supernatant will be processed to determine the secreted amount of VEGF165 protein by VEGF immunoassay kit (Quantikine VEGF ELISA Kit, R&D Systems, Minneapolis, MN). The procedures will follow the methods according to the manufacturers’ manual The results will be normalized based on the same amount of cells analyzed.

H. Matrigel in vivo angiogenesis assay Human breast cancer MDA-MB-231 cells were transduced by AdRSVp16 at moi of 200, two days later, the cells were harvested. A matrigel (BD Biosciences, San Jose, CA) mixture containing 1x10 7 transduced cells was injected s.c. into the flank of mice (6-week-old female nude mice, Harlan). Three days later, the mice were sacrificed, the undersurfaces of the injected site of mice were examined and photographed. Untreated control group and AdRSVlacZ control virus treated group were used as controls for comparison.

I. Dorsal air sac assay Cells were either untreated or transduced with control virus AdRSVlacZ or AdRSVp16 at moi of 200. Forty-eight hours later the cells were harvested and suspended in PBS at a concentration of 1x10 8 cells/ml. This suspension (0.1 ml in PBS) was injected into a chamber (Millipore, Bedford, MA) consisting of a ring with a filter (pore size, 0.22 µm) on both sides. The semipermeable membrane chamber allowed for diffusion of growth factor, such as VEGF, but not cells. The chamber was implanted into a dorsal air sac produced by the injection of 10 ml of air in the dorsum of a female 6-week-old nude mouse (Harlan SpragueDawley, Indianapolis, IN). The mouse was sacrificed on day 3 and the implanted chamber was removed. A ring without filters was placed on the same site and then photographed. The newly formed blood vessels in the air sac fascia were morphologically distinguishable from the preexisting background vessels by their zigzagging characters.

Figure 1. In vitro p16 expression in human breast cancer MDA-MB-231 cells after AdRSVp16 transduction. MDAMB-231 cells were grown in culture dish and transduced by AdRSVp16 at moi=200. Seventy-two hrs later the cells were harvested and subjected to immunohistochemistry using primary antibody (mouse anti-human p16 antibody) followed by goat anti-mouse secondary antibody coupled with horseradish peroxidase. Shown are p16-immunostaining for control untreated cells (A), and cells transduced by AdRSVp16 (B). The original magnification was 66X for both images.

145

Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells To demonstrate that the adenovirus can effectively transduce and express the transgene in vivo inside the breast tumor, AdRSVlacZ, an adenovirus carrying E.coli ß-galactosidase (lacZ) reporter gene (Lu et al, 1999), was used to transduce a JygMC(A) breast tumor growing in nude mice.As shown in Figure. 2A, the ß-galactosidase (lacZ) transgene-expressing cells exhibit blue color after X-gal staining. A dose of 1x1010 pfu (plaque forming unit) can effectively transduce breast tumor cells in vivo. Similarly, to demonstrate that AdRSVp16 is able to transduce and express p16 protein in breast cancer cells in vivo, JygMC(A) breast tumors growing in nude mice were transduced by AdRSVp16. The immunohistochemical staining of breast tumor sections by anti-p16 antibody showed p16 expression in vivo (Figure. 2B). These results indicate that AdRSVp16 is able to efficiently transfer and express p16 protein in cancer cells both in vitro and in vivo.

B. p16 downregulates VEGF expression By using primers specific to VEGF gene that would result three RT-PCR (reverse transcription polymerase chain reaction) products corresponding to isoforms VEGF121, VEGF 165, and VEGF189 (Houck et al, 1991), our RT-PCR results showed that there was a decreased expression of VEGF at the mRNA level after induction of p16 (Figure. 3). MDA-MB-231 cells were either untreated or transduced with control virus AdRSVlacZ (AdlacZ) or AdRSVp16 (Adp16) at moi of 200. The cells were harvested at 24 hr and 48 hr after viral transduction and total RNA was isolated for detecting VEGF mRNA expression by RT-PCR. As shown in Figure. 3, all three isoforms of VEGF, including VEGF121 (322-bp), VEGF165 (454-bp), and VEGF189 (526-bp), were dramatically reduced by p16 expression, with a more significant reduction of VEGF expression over the time. In contrast, the control virus (AdlacZ) transduced cells at both 24 hr and 48 hr (lane 3 and 5 from the left in Figure. 3) had no changes of VEGF mRNA expression compared to that of the untreated control (lane 2 from the left in Figure. 3).

Figure 3. RT-PCR of VEGF gene in human breast cancer cell line MDA-MB-231. Total RNA were isolated from cells which were untransduced or transduced with control virus or Adp16 (moi=200) at 24 hr and 48 hr post viral transduction. Reverse transcriptase reaction using total RNA was carried out. An aliquot of the RT mixture was subsequently used for the PCR reaction. The primers specific to VEGF gene which resulted three specific RT-PCR products, 526 bp, 454 bp, and 332 bp, corresponding to VEGF121, VEGF 165, and VEGF189, respectively. To ensure the quality of total RNA samples and equal measurement, the same RT mixture mentioned above was used for PCR of housekeeper gene ß-actin which resulted a 314 bp PCR product.

Figure 2. Adenoviral vectors effectively transduce and express transgene inside the breast tumor. Breast tumors were established in nude mice by subcutaneously injection of 1x107 mouse breast cancer JygMC(A) cells in the flank of nude mice. When tumors reached about 200 mm3, 1x1010 pfu AdRSVlacZ (A) or AdRSVp16 (B) was injected directly into the tumors, respectively. The tumors were harvested at 72 h and processed to either for X-gal staining for ß-galactosidase (lacZ) transgene expression (A, blue-color cells) or immunohistochemistry for p16 expression (B, dark brown-color cells), respectively. Untreated tumor showed neither endogenous lacZ nor p16 staining (not shown).

146

Cancer Therapy Vol 1, page 147 The similar results were also observed in another breast cancer cell line JygMC(A) by RT-PCR assay (our unpublished results). Consistently, our Northern blot analysis results also showed that there was a significant reduction of VEGF mRNA expression in MDA-MB-231 cells transduced by AdRSVp16, compared to untreated control and control virus AdRSVlacZ transduced cells (Figure. 4). To determine whether p16 modulates VEGF gene expression at the protein level, MDA-MB-231 cells were either untreated or transduced by control virus or AdRSVp16, and 72 hrs later the cell culture medium were collected to analyze the secreted form of VEGF protein by ELISA assay. The ELISA results showed that AdRSVp16transduced MDA-MB-231 cells had significantly less VEGF protein secreted into the medium (about 66% reduction compared to the untreated control cells at the same amount of cells) (Figure. 5). These data indicate that p16 decreases VEGF expression at both mRNA and protein levels in MDA-MB231 cells, implying that p16 downregulated VEGF gene expression in breast cancer cells.

transduced with control virus AdRSVlacZ and AdRSVp16, 48 hrs later, the cells were harvested and injected subcutaneously (s.c.) into the flank of the nude mice. Three days after the tumor cell injection, the mice were sacrificed and the blood vessels of undersurface of the injection site were examined and photographed. AdRSVp16-treated MDA-MB-231 cells induced much less newly formed blood vessels (Figure. 6B) compared to its control-virus treated (Figure. 6A) and untreated control (not shown) counterparts. The latter two induced significantly higher amount of newly-formed blood vessels, as demonstrated by their characteristic zigzag and bifurcation/trifurcation forms (arrows in Figure. 6A). These results demonstrate that p16 inhibits angiogenesis induced by injected breast cancer cells. The effects of p16 on neovascularization of tumor surrounding cells were examined by dorsal air sac assay. MDA-MB-231 cells were transduced with AdRSVp16. Forty-eight hrs later the cells were harvested and injected into a chamber that was wrapped with semi-permeable membrane allowing for diffusion of growth factor, such as VEGF, but not cells. The chamber was implanted into a dorsal air sac in nude mice, and the newly formed blood vessels in the undersurface of the chamber will be examined 3 days later after chamber implantation. As shown in Figure. 7, PBS-treated mice (as a negative control) did not have any obvious neovascularization (Figure. 7A). However, the mice injected with MDA-MB231 cells developed tumor cell-induced neovascularization as evidenced by the newly-formed â&#x20AC;&#x153;zigzagging-shapeâ&#x20AC;? small vessels in the air sac fascia (Figure. 7B).

C. p16 inhibits angiogenesis To determine whether p16 inhibits tumor cellinduced angiogenesis, the effects of p16 on tumor cell neovascularization were assessed by "Matrigel in vivo angiogenesis assay" (see Materials and Methods section), in which MDA-MB-231 cells were either untreated or

Figure 5. p16 overexpression decreased VEGF secretion of MDA-MB-231 cells. MDA-MB-231 cells were grown in medium containing charcoal-stripped serum. Cells were either untreated or transduced with control virus AdRSVlacZ or AdRSVp16 at moi of 200. The cell medium were collected 72 hrs after viral transduction and subjected to VEGF determination by ELISA assay using a kit designated for human VEGF165 immunoassay (Quantikine VEGF ELISA Kit, R&D Systems). The data represent the results from two independent experiments, each performed in triplicate.

Figure 4. p16 overexpression decreased VEGF expression at mRNA level in MDA-MB-231 cells. MDA-MB-231 cells were either untreated or transduced with control virus AdRSVlacZ or AdRSVp16 at moi of 200. The cell extracts were harvested at 48 hrs after viral transduction and mRNA expressions of VEGF165, p16 and internal control GAPDH were determined by Northern blot analysis by using corresponding cDNA probes.

147

Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells

Figure 7. p16 suppressed neovessel formation in air sac model. The mouse in air sac model was sacrificed on day 3 after chamber implantation and the implanted chamber was removed from the s.c. air fascia, a ring without filters was placed on the same site and then photographed. The newly formed blood vessels were morphologically distinguishable from the preexisting background vessels by their zigzagging characters (see representative arrows). Shown are undersurface images of sites from chamber contains PBS only as negative control (A), MDA-MB-231 cells (B), AdRSVlacZ-transduced MDA-MB-231 cells (C), and AdRSVp16 transduced MDA-MB-231 cells (D).

IV. Discussion In summary, our studies showed that adenoviralmediated overexpression of p16 decreased VEGF expression at both mRNA and protein levels in human breast cancer MDA-MB-231 cells. In vivo angiogenesis assay and dorsal air sac assay on nude mice showed that p16 inhibited angiogenesis of MDA-MB-231 cells. These results together strongly demonstrate that p16 downregulates VEGF gene expression and suppresses tumor cell angiogenesis and neovascularization, suggesting that p16 expression may have a potential to suppress metastasis in breast cancer cells. Thus, AdRSVp16 may be useful to suppress breast cancer metastasis as a gene therapy approach. Likewise, other tumor suppressor genes p53 (Bouvet et al, 1998) and Rb2/p130 (Claudio et al, 2001) were reported to downregulate VEGF expression and inhibit angiogenesis in colon and lung cancer cells, respectively. Rb2/p130 seems to downregulate VEGF expression at the transcriptional level (Claudio et al, 2001). p53 was also shown to inhibit angiogenesis by stimulating TSP-1 gene and positively regulate TSP-1 promoter (Dameron et al, 1994). Despite all these associations, however, the link between tumor suppressor genes and angiogenesis remains obscure, in particular, how p16 exactly regulates VEGF expression is not clear. It is speculated that p16 may regulate VEGF gene expression at the transcriptional level or via stabilization of VEGF mRNA, or both. Our ongoing study of evaluation of VEGF promoter activity in cells, that are transiently cotransfected with p16 expression vector and a series of VEGF promoter/CAT

Figure 6. p16 inhibited angiogenesis. MDA-MB-231 cells were either untreated or transduced with control virus AdRSVlacZ or AdRSVp16 at moi of 200. Cells were harvested 48 hrs post viral transduction, and 1x107 cells were mixed with Matrigel in 1:1 volume and s.c. injected into the flanks of 6-week-old female nude mice. Three days later, the mice were sacrificed, the undersurfaces of the injected site of mice were examined and photographed. Shown are undersurface blood vessels of mice injected with (A) AdRSVlacZ-treated cells, and (B) AdRSVp16treated cells. Mouse injected with untreated MDA-MB-231 cells gave the similar results as (A) (not shown). The newly formed blood vessels are morphologically distinguishable from the preexisting background vessels by their zigzag characters, some of them are representatively pointed by the arrows (A). Each figure represents a typical image from 3 mice in the same group.

In contrast, mice with AdRSVp16-transduced MDAMB-231 cells induced much less newly-formed blood vessels (Figure. 7D) compared to mice injected with MDA-MB-231 cells alone (Figure. 7B) or mice injected with control viral transduced MDA-MB-231 cells (Figure. 7C); both of the latter two induced a more extensive capillary network. These results suggest that breast cancer cells can induce neovascularization around the tumor by molecules (such as VEGF) secreted from tumor cells to the surrounding environment; and p16 can inhibit this tumor cell-induced neovascularization to the surrounding environment by impairing or blocking this secreted angiogenesis-inducer from the tumor cells.

148

Cancer Therapy Vol 1, page 149 (chloramphenicol acetyltransferase) reporter gene chimeric constructs (a generous gift from Dr. M. Kuwano, Kyushu University, Japan) (Ryuto et al, 1996), will determine whether p16 modulates VEGF gene expression at the transcriptional level. If p16 indeed regulates VEGF expression at the transcriptional level, the transactivation response element within VEGF promoter will be defined. Together with the gel shift assay, we may also find out whether it is due to a direct p16 binding to VEGF promoter or by an indirect p16 regulation, i.e., by binding of a p16-regulated component to the promoter for this transactivation. While research studies focusing on breast cancer treatment have been increased dramatically in recent years and some therapies of local control appear to be effective, there is still no effective approach to prevent and cure tumor metastasis -- the fatal cause for the death of breast cancer patients. The relative success at local control has been confounded by a general failure to progressively and substantially reduce breast cancer death rates. Thus, a critical need exists to understand and develop effective treatments for those parameters contributing to breast cancer metastasis. This study has provided an innovative approach to combat and prevent breast cancer metastasis by using tumor suppressor gene p16, which downregulates VEGF gene expression, suppresses angiogenesis and may have a potential inhibition on secondary tumor formation of breast cancer.

methylthioadenosine phosphorylase, and the !- and ßinterferons in human pancreatic cell carcinoma lines and its implications for chemotherapy. Cancer Res 56, 1083-1090. Claudio, P. P., Stiegler, P., Howard, C. M., Bellan, C., Minimo, C., Tosi, G. M., Rak, J., Kovatich, A., De Fazio, P., Micheli, P., Caputi, M., Leoncini, L., Kerbel, R., Giordano, G. G., and Giordano, A (2001) RB2/p130 gene-enhanced expression down-regulates vascular endothelial growth factor expression and inhibits angiogenesis in vivo. Cancer Res 61, 462-468. Dameron KM, Volpert OV, Tainsky MA, and Bouck N (1994) Control of angiogenesis in fibroblasts by p53 regulation of thrombospondin-1. Science 265, 1582-1584. Folkman J (1971) Tumor angiogenesis: therapeutic implications. N Engl J Med 285, 1182-1186. Ferrara N, and Henzel WJ (1989) Pituitary follicular cells secrete a novel heparin-binding growth factor specific for vascular endothelial cells. Biochem Biophys Res Commun 161, 851858. Gasparini, G., Toi, M., Gion, M., Verderio, P., Dittadi, R., Hanatani, M., Matsubara, I., Vinante, O., Bonoldi, E., Boracchi, P., Gatti, C., Suzuki, H., and Tominaga, T (1997) Prognostic significance of vascular endothelial growth factor protein in node-negative breast carcinoma. J Natl Cancer Inst 89, 139-144. Goldfarb M (1990) The fibroblast growth factor family. Cell Growth Differ 1, 439-445. Graham FL, and Prevec L (1991) Manipulation of adenovirus vectors. In: E.J. Murray (ed.), Methods in Molecular Biology. Vol. 7: Gene transfer and expression protocols, pp. 109-128. Clifton: The Human Press Inc. Grunstein J, Roberts WG, Mathieu-Costello O, Hanahan D, and Johnson RS (1999) Tumor-derived expression of vascular endothelial growth factor is a critical factor in tumor expansion and vascular function. Cancer Res 59, 1592-1598.

Acknowledgments This research was supported by University of Tennessee Vascular Biology Center of Excellence Partnership Grant and University of Tennessee Vascular Biology Center of Excellence Pilot Grant.

Harada H, Nakagawa K, Iwata S, Saito M, Kumon Y, Sakaki S, Sato K, and Hamada K (1999) Restoration of wild type p16 down-regulates vascular endothelial growth factor expression and inhibits angiogenesis in human gliomas. Cancer Res 59, 3783-3789.

References

Hatta Y, Hirama T, Miller CW, Tomonaga M, and Koeffler HP (1995) Homozygous deletions of the p15 (MTS2) and p16 (CDKN2/MTS1) genes in adult T-cell leukemia. Blood 85, 2699-2704. Heffelfinger, S. C., Miller, M. A., Yassin, R., and Gear, R (1999) Angiogenic growth factors in preinvasive breast disease. Clin Cancer Res 5, 2867-2876.

Bouck N, Stellmach V, and Hsu SC (1996) How tumors become angiogenic. Adv Cancer Res 69, 135-174. Bouvet M, Ellis LM, Nishizaki M, Fujiwara T, Liu W, Bucana CD, Fang B, Lee JJ, and Roth JA (1998) Adenovirusmediated wild-type p53 gene transfer down-regulates vascular endothelial growth factor expression and inhibits angiogenesis in human colon cancer. Cancer Res 58, 22882292.

Houck KA, Ferrara N, Winer J, Cachianes G, Li B, and Leung DW (1991) The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol Endocrinol 5, 1806-1814.

Brem SS, Gullino PM, and Medina D (1997) Angiogenesis: a marker for neoplastic transformation of mammary papillary hyperplasia. Science 195, 880-881. Brem SS, Jensen HM, and Gullino PM (1978) Angiogenesis as a marker of preneoplastic lesions of the human breast. Cancer 41, 239-244. Cairns P, Polascik TJ, Eby Y, and Sidransky D (1995) High frequency of homozygous deletion at p16/CDKN2 in primary human tumors. Nature Genet 11, 210-212. Caldas C, Hahn SA, De Costa LT, Redston MS, Schutte M, Seymour AB, Weistein CL, Hruban RH, Yeo CJ, and Kern SE (1994) Frequent somatic mutations and homozygous deletions of the p16 (MTS1) gene in pancreatic adenocarcinoma. Nature Genet 8, 27-32.

Hussussian CJ, Struewing JP, Goldstein AM, Higgins PAT, Ally DS, Sheahan MD, Clark WH, Tucker MA, and Dracopoli NC (1994) Germline p16 mutations in familial melanoma. Nature Genet 8, 15-21. Jemal A, Thomas A, Murray T, Samuels A, Ghafoor A, Ward E, and Thun MJ (2003) Cancer Statistics, 2003. CA Cancer J Clin 53, 5-26. Jen J, Harper JW, Bigner SH, Bigner DD, Papadopoulos N, Markowitz S, Wilson JKV, Kinzler KW, and Vogelstein B (1994) Deletion of p16 and p15 genes in brain tumors. Cancer Res 54, 6353-6358.

Chen Z-H, Zhang H, and Savarese T (1996) Gene deletion

Jensen HM, Chen I, DeValut MR, and Lewis AE (1982) Angiogenesis induced by “normal” human breast tissues; a

INK4

chemoselectivity; Codeletion of the gene for p16

149

Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells probable marker for precancer. Science 218, 293-295. John A, and Tuszynski G (2001) The role of matrix metalloproteinases in tumor angiogenesis and tumor metastasis. Pathol Oncol Res 7, 14-23, 2001.

Plate KH, and Risau W (1995) Angiogenesis in malignant gliomas. Glia 15, 339-347. Shapiro GI, and Rollins BJ (1996) p16INK4A as a human tumor suppressor. Biochem Biophys Acta 1242, 165-169.

Keyt, B. A., Berleau, L. T., Nguyen, H. V., Chen, H., Heinsohn, H., Vandlen, R., and Ferrara, N (1996) The carboxylterminal domain (111-165) of vascular endothelial growth factor is critical for its mitogenic potency. J Biol Chem 271, 7788-7795.

Poltorak Z, Cohen T, Sivan R, Kandelis Y, Spira G, Vlodavsky I, Keshet E, and Neufeld G (1997) VEGF145, a secreted vascular endothelial growth factor isoform that binds to extracellular matrix. J Biol Chem 272, 7151-7158. Risau W (1996) What, if anything, is an angiogenic factor? Cancer Metastasis Rev 15, 149-151. Ryuto M, Ono M, Izumi H, Yoshida S, Weich HA, Kohno K, and Kuwano M (1996) Induction of Vascular Endothelial Growth Factor by tumor necrosis factor ! in human glioma cells. J Biol Chem 45, 28220-28228.

Klagsbrun M, and D'Amore PA (1996) Vascular endothelial growth factor and its receptors. Cytokine Growth Factor Rev 7, 259-270. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, and Ferrara N (1989) Vascular endothelial growth factor is a secreted angiogenic mitogen. Science 246, 1306-1309. Li YJ, Hoang-Xuan K, Delattre JY, Poisson M, Thomas G, and Hamelin R (1995) Frequent loss of heterozygosity on chromosome 9, and low incidence of mutations of cyclindependent kinase inhibitors p15 (MTS2) and p16 (MTS1) genes in gliomas. Oncogene 11, 597-600. Linderholm B, Tavelin B, Grankvist K, and Henriksson R (1998) Vascular endothelial growth factor is of high prognostic value in node-negative breast carcinoma. J Clin Oncol 16, 3121-3128.

Salven P, Perhoniemi V, Tykka H, Maenpaa H, and Joensuu H (1999) Serum VEGF levels in women with a benign breast tumor or breast cancer. Breast Cancer Res Treat 53, 161166. Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, and Dvorak HF (1983) Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid. Science 219, 983-985. Shibuya M, Yamaguchi S, Yamane A, Ikeda T, Tojo A, Matsushime H, and Sato M (1990) Nucleotide sequence and expression of a novel human receptor-type tyrosine kinase gene (flt) closely related to the fms family. Oncogene 5, 519524.

Liotta LA, Kleinerman J, and Saidel GM (1974) Quantitative relationships of intravascular tumor cells, tumor vessels, and pulmonary metastases following tumor implantation. Cancer Res 34, 997-1004.

Shichiri M, and Hirata Y (2001) Antiangiogenesis signals by endostatin. FASEB J 15, 1044-1053. Soker S, Gollamudi-Payne S, Fidder H, Charmahelli H, and Klagsbrun M (1997) Inhibition of vascular endothelial growth factor (VEGF)-induced endothelial cell proliferation by a peptide corresponding to the exon 7-encoded domain of VEGF165. J Biol Chem 272, 31582-31588.

Lu Y, Carraher J, Zhang Y, Armstrong, J., Lerner, J., Roger, W., and Steiner, M.S (1999) Delivery of adenoviral vectors to the prostate for gene therapy. Cancer Gene Ther 6, 64-72. Lu Y, Zhang Y, and Steiner MS (1998) Efficient identification of recombinant adenoviruses by direct plaque-screening. DNA Cell Biol 17, 643-645. Mao L, Merlo A, Bedi G, Shapiro GI, Edwards CD, Rollins BJ, and Sidransky D (1995) A novel p16INK4A transcript. Cancer Res 55, 2995-2997.

Steeg PS, Hartsough MT, and Clare SE (1998) Nm23, breast differentiation, and cancer metastasis. In; Breast Cancer. Bowcock AM (ed). Humana Press: Totowa, New Jersey. pp. 267-283. Steiner, M. S., Zhang, Y., Farooq, F., Lerner, J., Wang, Y., and Lu, Y (2000) Adenoviral vector containing wild type p16 suppresses prostate cancer growth and prolongs survival by inducing cell senescence. Cancer Gene Ther 7, 360-372.

Marshall E (1993) Breast cancer research: a special report. Search for a killer: focus shifts from fat to hormones. Science 259, 618-621. McCulloch P, Choy A, and Martin L (1995) Association between tumor angiogenesis and tumor cell shedding into effluent venous blood during breast cancer surgery. Lancet 346, 1334-1335.

Terman BI, Dougher-Vermazen M, Carrion ME, Dimitrov D, Armellino DC, Gospodarowicz D, and Bohlen P (1992) Identification of the KDR tyrosine kinase as a receptor for vascular endothelial cell growth factor. Biochem Biophys Res Commun 187, 1579-1586. Tischer E, Gospodarowicz D, Mitchell R, Silva M, Schilling J, Lau K, Crisp T, Fiddes JC, and Abraham JA (1989) Vascular endothelial growth factor: a new member of the plateletderived growth factor gene family. Biochem Biophys Res Commun 165, 1198-1206. Tuszynski GP, and Nicosia RF (1996) The role of thrombospondin-1 in tumor progression and angiogenesis. Bioessays 18, 71-76.

Mustonen T, and Alitalo K (1995) Endothelial receptor tyrosine kinases involved in angiogenesis. J Cell Biol 129, 895-898. Neufeld G, Cohen T, Gengrinovitch S, and Poltorak Z (1999) Vascular endothelial growth factor (VEGF) and its receptors. FASEB J 13, 9-22. Obermair, A., Kucera, E., Mayerhofer, K., Speiser, P., Seifert, M., Czerwenka, K., Kaider, A., Leodolter, S., Kainz, C., and Zeillinger, R (1997) Vascular endothelial growth factor (VEGF) in human breast cancer: correlation with diseasefree survival Int J Cancer 74, 455-458. Oâ&#x20AC;&#x2122;Reilly MS, Holmgren L, Chen C, and Folkman J (1996) Angiostatin induces and sustains dormancy of human primary tumors in mice. Nature Med 2, 689-692. Oâ&#x20AC;&#x2122;Reilly MS, Holmgren L, Shing Y, Chen C, Rosenthal RA, Moses M, Lane WS, Cao Y, Sage EH, and Folkman J (1994) Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell 79, 315-328.

Weidner N, Semple JP, Welch WR, and Folkman J (1991) Tumor angiogenesis and metastasis_correlation in invasive breast carcinoma. N Engl J Med 324, 1-8. Xiao S, Li D, Corson JM, Vijg J, and Fletcher JA (1995) Codeletion of p15 and p16 genes in primary non-small cell lung carcinoma. Cancer Res 55, 2968-2971. Yoshiji H, Gomez DE, Shibuya M, and Thorgeirsson UP (1996) Expression of vascular endothelial growth factor, its

150

Cancer Therapy Vol 1, page 151 receptor, and other angiogenic factors in human breast cancer. Cancer Res 56, 2013-2016. Zetter BR (1998) Angiogenesis and tumor metastasis. Annu Rev Med 49, 407-424. Zhang, H.-T., Craft, P., Scott, P. A. E., Ziche, M., Welch, H. A., Harris, A. L., and Bicknell, R (1995) Enhancement of tumor growth and vascular density by transfection of vascular endothelial cell growth factor into MCF-7 human breast carcinoma cells. J Natl Cancer Inst 87, 213-219.

Dr. Yi Lu

151

Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells

152

Cancer Therapy Vol 1, page 153 Cancer Therapy Vol 1, 153-162, 2003.

Basic fibroblast growth factor antisense oligonucleotides inhibit renal cell carcinoma cell growth and angiogenesis Research Article

Wenyin Shi* and Dietmar W. Siemann Department of Radiation Oncology, Shands Cancer Center, University of Florida, Gainesville, FL 32610

__________________________________________________________________________________ *Correspondence: Wenyin Shi, Department of Radiation Oncology, University of Florida, 2000 SW Archer Road Box 100385, Gainesville, FL 32610, USA; Tel: 352-392-0655; Fax: 352-392-5743; e-mail: wshi@ufl.edu Key Words: renal cell carcinoma, fibroblast growth factor, angiogenesis, antisense, oligodeoxynucleotides Received: 8 July 2003; Accepted: 20 August 2003; electronically published: September 2003

Summary Renal cell carcinoma (RCC) is the most common malignancy of the kidney. A characteristic feature of RCC is evidence of abundant angiogenesis and abnormal blood vessel development. Basic fibroblast growth factor (bFGF) is a known contributor in the regulation of RCC initiated angiogenesis. In the present studies we evaluated the effects of blocking bFGF production by antisense phosphorothioate oligodeoxynucleotides (PS-ODNs) on the growth and angiogenic activity of a pre-clinical model of RCC (Caki-1). In vitro studies showed that treating Caki-1 cells with antisense PS-ODNs directed against bFGF mRNA led to a reduction in the levels of bFGF expression sufficient to impair the proliferation and migration of endothelial cells. In addition, such treatments exerted a direct effect on Caki-1 cell growth. The observed effects were antisense sequence specific, dose dependent, and could be achieved at a low, non-toxic concentration of PS-ODNs. When bFGF antisense treated Caki-1 cells were injected into nude mice and evaluated for their angiogenesis potential in an intradermal angiogenesis assay, the number of vessels initiated were approximately half that initiated by untreated Caki-1 cells. To test the antitumor effect of bFGF antisense, PS-ODNs were administrated to nude mice bearing macroscopic Caki-1 xenografts. The results showed that the systemic administration of two doses of bFGF antisense PS-ODNs given 1 and 4 days after the tumors reached a size of ~200 mm3 doubled the time required for tumors to grow to 5 times the size at the start of treatment. carcinoma tissues and renal cell carcinoma cell lines (Mydlo et al, 1988; Gospodarowicz et al, 1986; Mydlo et al, 1993). Serum levels of bFGF often are elevated in RCC patients (Fujimoto et al, 1991) and renal cell carcinoma bFGF mRNA levels have been reported to be 2 - 3 fold higher than those found in surrounding normal tissues (Eguchi et al, 1992). In addition, elevated serum/urine bFGF levels have been shown to be associated with malignant progression and poor treatment outcome (Nanus et al, 1993; Nguyen et al, 1994; Duensing et al, 1995; Miyake et al, 1996; Yoshimura et al, 1996). Taken together, these findings strongly suggest an important role for bFGF in renal cell carcinoma associated angiogenesis. Currently, there is considerable interest in developing angio-suppressive therapies for RCC. For example, interferon-!, a peptide known to have anti-angiogenic effects likely due to suppression of bFGF expression (Singh et al, 1995), has been shown to prolong survival in patients with RCC(1999). Interleukin-12, a cytokine with immuno-regulatory and anti-angiogenic activity (Voest et

I. Introduction Renal cell carcinoma (RCC) is the most common malignancy of the kidney and accounts for about 2% of all adult malignancies (McLaughlin and Lipworth, 2000). Unless discovered at an early stage, at a time when it is a still a resectable neoplasm, RCC has a very unfavorable treatment outcome to conventional measures. Unfortunately, RCC is characterized by a lack of early warning signs resulting in a high proportion of patients with metastases at diagnosis and significant relapse rates following nephrectomy. As a consequence RCC remains fatal in nearly 80% of its patients (Tsui et al, 2000). Histopathologic evaluations of RCC reveal it to be a highly vascularized neoplasm demonstrating clear evidence of abundant angiogenesis and abnormal blood vessel development (Yoshimura et al, 1996). Not surprisingly, several studies have pointed to an important role for pro-angiogenic growth factors in RCC. Basic fibroblast growth factor (bFGF) has often been implicated. This factor has been shown to be expressed in renal cell 153

Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Sonic Dismembrator (Fisher Scientific, Pittsburgh, PA) for 1 min at room temperature to form homogenized liposomes. The particle-size distribution of liposomes was measured using a NICOMP 380 ZLS instrument (Santa Barbara, CA). The average diameter was 144.0 ± 77.0 nm. Liposomes were stored at 4°C and used within 3 months.

al, 1995), also has demonstrated antitumor activity in RCC (Motzer et al, 1998). Other drugs developed principally as angiogenesis inhibitors and studied in RCC include the fumigillin analog TNP-470, thalidomide, and a monoclonal antibody to VEGF (Gordon et al, 1998; Stadler et al, 1999). In the present investigations, antisense phosphorothioate oligodeoxynucleotides (PS-ODNs) complementary to bFGF mRNA were designed and tested for their efficacy to block RCC angiogenesis and growth in vitro and in vivo. The therapeutic potential of bFGF antisense treatments in RCC xenografts also was evaluated.

C. Enzyme immunoassay of bFGF Caki-1 cells (1x10 5) were set in 60 mm dishes and allowed to attach overnight. The medium then was removed and replaced with PS-ODNs in serum free medium with liposome (DOTAP:DOPE) and incubate for 5 hr. Fresh medium containing 10% FBS then was added. Caki-1 cells were collected on day 2, washed and suspended 1x106 in PBS containing protease inhibitors (100 µg/ml Phenylmethanesulphonyl fluoride, 20 µg/ml leupeptin, 3 µg/ml aprotinin). The suspension was subjected to 3 freeze-thaw cycles, ultrasonication for 5 s (100 W) on ice, and centrifugation at 14,000 g for 10 min. The supernatant containing the intracellular bFGF was used for the bFGF concentration determination (human bFGF immunoassay kit, R & D Systems, Minneapolis, MN).

II. Materials and methods A. Cell culture The clear cell RCC cell line Caki-1 was a gift from Dr. Susan Knox (Stanford University). Caki-1 cells were grown in Dulbecco's modified minimum essential medium (DMEM, Invitrogen, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS, Invitrogen, Grand Island, NY), 1% penicillin-streptomycin (Invitrogen, Grand Island, NY) and 1% 200 mmol/L L-glutamine (Invitrogen, Grand Island, NY). The mouse heart endothelial cell line (MHE) was a gift from Dr. Robert Auerbach (University of Wisconsin). MHE cells were grown in Dulbecco's modified minimum essential medium supplemented with 10% heat inactivated fetal bovine serum, 1% penicillin-streptomycin and 1% 200 mmol/L L-glutamine. Human microvascular endothelial cells of the lung (HMVEC-L) were obtained from Clonetics (San Diego, CA). HMVEC-L cells were grown in EBM-2-MV (Clonetics, San Diego, CA) supplemented with 5% FBS. Phosphorothioate Oligodeoxynucleotides (PS-ODNs): Antisense and control PS-ODNs (20-mers) were custom synthesized by Gemini Biotech (Alachua, FL). PS-ODNs B460 was complementary to the translation start site (AUG codon) of bFGF mRNA: 5´ TCC CGG CTG CCA TGG TCC CT 3´; PSODNs B471 was complimentary to the coding region of bFGF mRNA: 5´ CGT GGT GAT GCT CCC GGC TG 3´; PS-ODNs B931 was complimentary to the 3´ UTR: 5´ GAT GTG GCC ATT AAA ATC AG 3´ A random nonsense sequence: 5´ GCC TGG ACC CTG GCT CTC TC 3'; sense sequence: 5´ AGG GAT GGC TGC CGG GA 3´ and an inverted sequence: 5´ TCC CTG GTA CCG TCG GCC CT 3´, were used as PS-ODNs controls. In the tumor distribution studies, the PS-ODNs were labeled at the 5´ end with FITC. All PS-ODNs were suspended in sterile and endotoxin free water at a concentration of 1 mM, aliquoted and stored at -20ÆC.

C. bFGF Relative quantitative RT-PCR Caki-1 cells were set at 3x105 in 100 mm dishes and allowed to attach overnight. The cells were then treated with bFGF antisense or control PS-ODNs as described. 24 hr later the cells were collected and the total RNA was isolated using a RNeasy Mini Kit (Qiagen, Valencia, CA) and RNA concentrations were determined by UV spectrophotometry. A 2 µg total RNA sample was used to reverse synthesize cDNA using Superscript II reverse transcriptase (Invtrogen, Grand Island, NY). A 2.5 µl aliquot of the reverse transcriptase reaction product then was used for the PCR reaction. BFGF PCR reactions were carried out using a forward primer and a reverse primer with a relative RT-PCR Kit (Ambion, Austin, TX). The PCR reactions were run for 22 cycles (denature 94°C 30s, anneal 60°C 60s, extension 72°C 60s) in a DNA Engine 200 (MJ research, Waltham, MA). PCR products then were run on 2% agarose gels and stained by ethidium bromide. The gels were visualized and analyzed using a Gel Doc 2000 gel documentation system (Bio-Rad, Hercules, CA).

D. FGFR1-4 RT-PCR Caki-1 cell total RNA was isolated using an RNeasy Mini Kit (Qiagen, Valencia, CA) and RNA concentrations were determined by UV spectrophotometry. A 2.5 µl aliquot of the reverse transcriptase reaction product then was used for the PCR reaction. Primers for human FGFR 1-4 were used (Tartaglia et al, 2001). The PCR reactions were run for 30 cycles (denature 94°C 30 s, anneal 60°C 60 s, extension 72°C 60s) in a DNA Engine 200 (MJ research, Waltham, MA). The specificities of the cDNA amplifications were then verified by endonuclease restriction analyses. All PCR preparations were carried out in a laminar flow hood using aerosol resistant plugged pipette tips. Negative controls without template DNA were included in each assay. An 18S primer set (Ambion, Austin, TX) was used as a positive control.

B. DOTAP: DOPE liposomes Cationic liposomes were prepared using the method described by Tang (Tang and Hughes, 1999). Briefly, cationic lipid 1,2-dioleoyloxy-3-(trimethylammonium) propane (DOTAP) was dissolved in chloroform and mixed with a helper lipid 1,2dioleoyl-3-sn-phosphatidylethanolamine (DOPE) at a molar ratio of 1:1 (Avanti Polar-Lipids, Alabaster, Al). The mixture was evaporated to dryness in a round-bottomed flask using a rotary evaporator at room temperature. The resulting lipid film was dried by nitrogen for an additional 10 min to evaporate any residual chloroform. The lipid film was re-suspended in sterile water to a final concentration of 1 mg/ml based on the weight of cationic lipid. The resultant mixtures were shaken in a water bath at 35°C for 30 min. The suspensions then were sonicated using a

E. Cell cycle analysis Caki-1 cells were plated in 60 mm dishes (2x10 5 cells/dish) and allowed to attach overnight. The cells were then treated with 1 µM B460 or control PS-ODNs complexed with DOTAP:DOPE as described above. 48 hr later the cells were trypsinized,

154

Cancer Therapy Vol 1, page 155 counted, and fixed in 50% ethanol overnight. Prior to FACS analysis the cells were treated with 1 mg/ml RNase (in PBS) for 30 min. The samples were then washed with PBS twice and resuspended in 25 mg/ml propidium iodine (PI) in PBS at a volume of 1x10 6 cells/ml. The cells were stained in the dark with PI (15 min) and their cell cycle distributions were analyzed using a Beckman Dickinson flow cytometer (University of Florida Flow Cytometry Core Facility).

J. Caki-1 xenografts Female nude mice (NCR, nu/nu), age 8 - 10 weeks were maintained under specific-pathogen-free conditions (University of Florida Health Science Center) with food and water supplied ad libitum. Animals were inoculated subcutaneously in a single flank with 5x10 6 tumor cells. When the tumors reached a size of ~200 mm3, animals were randomly assigned to the different treatment groups.

F. Apoptosis measurement

K. bFGF western blot preparation and analysis

Caki-1 cells were set in 2-well chamber slides and treated with 1 µM B460 or control PS-ODNs as described earlier. 48 hr later, the cells were fixed in 4% para-formaldehyde solution for TdT-mediated dUTP Nick-End labeling (TUNEL) assay. Briefly, the cells were permeabilized in 0.2% Triton X-100 solution, (5 min), DNA strand breaks were labeled with Fluorescein-12dUTP in TdT incubation buffer (37°C for 1 hr), and counterstained with 1 mg/ml PI. Localized green fluorescence of apoptotic cells (Fluorescein-12-dUTP) in a red background (PI) was detected by fluorescence microscopy. The percentage of apoptotic cells was determined by dividing the number of green fluorescent cells by the total number of cells examined. A minimum of 300 cells was counted for each condition.

bFGF antisense PS-ODNs B460 were injected via tail vein at a dose of 10 mg/kg. At various times after injection (24, 48 and 72 hr), the mice were killed, the tumors excised and frozen in liquid nitrogen. The tumors were then homogenized (Dounce tissue grinder, Wheaton, Millville, NJ) and the homogenates were lysed on ice for 30 min with 1 ml of hypotonic buffer (20 mm Tris-HCl, pH 6.8, 1 mm MgCl 2, 2 mm EGTA, 0.5% Nonidet P-40, 2 µM Phenylmethanesulphonyl fluoride (PMSF), 200 U/ml Approtinin, 2 µg/ml leupetin) (Giannakakou et al, 1998) per 0.1 g tissue. Following a brief but vigorous vortex the samples were centrifuged at 14,000 rpm for 10 min at 4_C. A 30 µl aliquot of each sample was mixed with 10 µl 4x SDS-PAGE sample buffer (0.3 M Tris-HCl, pH 6.8, 45% glycerol, 20% "-mercaptoethanol, 9.2% SDS and 0.04 g/100ml bromophenol blue) and heated at 100_C for 10 min. 30 µl of each sample was then analyzed by SDS-PAGE on a 12% separating gel and 3% stacking gel. Following transfer, the membrane was immunoblotted using a bFGF primary antibody (Upstate Biotechnology, Lake Placid, NY) 1:1000 diluted in antibody solution (3% dry milk, 25 mm Tris, pH 7.5, 0.5 M NaCl, 0.05% Tween 20) overnight at 4°C. After washing, a secondary antibody labeled with horseradish peroxidase was applied and incubated at room temperature for 1 hr. Protein bands were visualized and densitometry was performed.

G. Co-culture conditions Transwell 6-well dishes (Corning, Corning, NY) with a membrane pore size of 0.4 µM were used. Caki-1 cells were seeded at 5x104 in the transwell inserts. After allowing the cells to attach overnight, the Caki-1 cell medium was replaced with serum free medium containing 1 µM B460 PS-ODNs or control PS-ODNs complexed with liposome (DOTAP:DOPE). 5 hr later, medium containing 10% heat inactivated FBS was added to yield a final FBS concentration of 2.5%. The transwells containing treated Caki-1 cells were inserted into the 6-well dishes containing MHE or HMVEC-L cells (5x104) and incubated at 37°C for 48 hr. The number of endothelial cells then was determined by hemocytometer count.

L. Tumor response assessments Once the Caki-1 xenografts reached a size of ~200 mm3, animals were assigned randomly to various treatment groups. B460 or control PS-ODNs were administrated via the tail vein with DOTAP:DOPE liposomes at a dose of 5 mg/kg or 10 mg/kg 1 and 4 days later. Tumors were measured using calipers and volumes were approximated by the formula, volume=1/6(#ab2), with a and b represent two perpendicular tumor diameters. The times for the tumors in the various treatment groups to grow from 200 to 1000 mm3 were recorded and compared.

H. Endothelial cell migration Caki-1 cells were set at 1x105 per well in 24-well dishes and allowed to attach overnight. The Caki-1 cells then were treated with 1 µM control or B460 PS-ODNs for 24 hr. HTS FluoroBlok inserts (Becton Dickinson, Franklin Lakes, NJ) with a pore size of 8.0 µm were assembled into the 24-well dish with the Caki-1 cells. MHE or HMVEC-L cells (5x104) were plated into the FluoroBlok inserts. These endothelial cells had been previously stained in medium containing 10 µg/ml Di-I (Molecular Probes, Eugene, OR) for 24 hr and washed 4 times with PBS. After a 24 hr incubation period, the number of migrated endothelial cells was determined by direct measurement of the fluorescence in the bottom well using a CytoFluor 4000 plate reader (Perceptive BioSystems, St. Paul, MN).

III. Results Caki-1 cell bFGF levels were significantly reduced from a normal of 720 pg/106 cells after treatment with 1 µM antisense PS-ODNs (Figure 1). This effect was sequence and target region specific. The antisense PSODNs complimentary to the start codon (AUG) region (B460) was found to be the most effective. For example, the cellular bFGF levels of B460 treated Caki-1 cells were found to be about 41% of those found in control or untreated cells (p<0.05). In comparison, the antisense PSODNs complimentary to the 3´ UTR (B931) or coding region (B471) were less effective at down regulating bFGF expression (57% and 65% of control respectively, p<0.05).

I. Tumor cell-induced angiogenesis Caki-1 cells (5x104) were inoculated (10 µl) intradermally at 4 sites in the ventral surface of mice. Three days later, the mice were killed, the skin carefully separated from the underlying muscle and the number of vessels entering the scoring area was counted under a dissecting microscope (Sidky and Auerbach, 1976).

155

Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Figure 1. Cellular bFGF levels in Caki-1 tumor cells treated with different antisense PS-ODNs. The cells were either untreated (Control), liposome vehicle treated (DOTAP), or treated with a 1 µM dose of control PS-ODNs antisense sequences (Scramble, Sense, Inverted) or a 1 µM dose of PS-ODNs antisense sequences targeted to different regions of bFGF mRNA. Each bar represents the mean ± S.E. of at least 3 different experiments. Stars indicate significant differences (p<0.05) from the untreated control group.

mitogenic effects on renal cells (Gospodarowicz et al, 1986; Issandou and Darbon, 1991), the influence of antisense and control PS-ODNs treatment on Caki-1 cell growth was investigated. Control PS-ODNs or liposome vehicles showed no effect on Caki-1 cell growth (Figure 4). However, Caki-1 cell growth was inhibited by PSODNs targeted against different regions of bFGF mRNA. B460 was found to be the most effective while antisense PS-ODNs targeting the 3´UTR (B931) or coding region (B471) showed less cell growth inhibition. When comparing these data to those illustrated in Figure 1, it is readily apparent that the extent of Caki-1 cell growth inhibition by different antisense PS-ODNs is closely related to their potency in down regulating bFGF expression.

Treating Caki-1 cells with control scramble PS-ODNs or liposome vehicles did not affect bFGF levels in Caki-1 cells. Similarly, treatment with sense or inverted sequence PS-ODNs failed to reduce bFGF expression. Because B460 treatment led to the greatest inhibition of bFGF expression, this PS-ODN was used in all subsequent investigations. The results of Figure 2 illustrate that the inhibitory effect of B460 was clearly dose dependent with doses as low as 0.5 µM leading to significant reductions in the cellular bFGF levels. When higher doses of B460 were applied, bFGF levels could be suppressed to 20% of control values. Levels of bFGF mRNA in Caki-1 cells treated with PS-ODNs also were determined (Figure 3). The results indicated a marked inhibition of bFGF mRNA after treatment with B460 that was absent in cells treated with scramble PS-ODNs. Because bFGF can have

Figure 2. Effect of different doses of bFGF antisense PS-ODNs (B460) on Caki-1 cell bFGF expression level. The 0 µM dose corresponds to cells treated with scramble control oligomers. The bFGF levels were determined after 3-day treatment; each datum point represents the mean ± S.E. of 3 independent experiments. Stars indicate significant differences (p<0.05) from untreated cells.

156

Cancer Therapy Vol 1, page 157

Figure 3. Message RNA levels in Caki-1 cells which were either untreated (Control), liposome vehicle treated (DOTAP) or treated with a 1 µM dose of control PS-ODNs antisense sequence (Scramble) or bFGF antisense PS-ODNs (B460). A. Representative relative RT-PCR results, each group was performed in duplicate; B Relative bFGF mRNA levels of Caki-1 cells treated with different PS-ODNs. Each bar shows the mean ± S.E. of 3 independent experiments. The star indicates a significant difference (p<0.05) from the untreated control group.

Figure 4. Percentage of Caki-1 cells 3 days after treatment with liposome vehicle (DOTAP), 1 µM control PSODNs sequences (Scramble, Sense, Inverted), or different PS-ODNs sequences targeted to bFGF mRNA (B460, B471, B931). Control cells were untreated. Data are the mean ± S.E. of 3 different experiments. Stars indicate significant differences (p<0.05) from the untreated control group.

To gain a better understanding of the underlying mechanisms involved in the observed growth inhibitory effects, the expression of FGF receptors on Caki-1 cells was determined. The results (Figure 5a) showed that Caki-1 cells expressed 3 of 4 FGF receptors involved in the bFGF signal transduction pathway. B460 treatment also led to small but significant changes in cell cycle (Figure 5b) and induction of apoptosis (Figure 5c). Clonogenicity of Caki-1 cells was not however affected by B460 treatment (data not shown).

Since the ultimate goal of bFGF antisense therapy is to inhibit cancer cell induced angiogenic signaling, experiments designed to mimic the in vivo paracrine interaction between tumor and endothelial cells were conducted using a Transwell co-culture system to evaluate the effect of bFGF expression in Caki-1 cells on endothelial cell growth and migration. Caki-1 tumor cells, which had been pretreated with bFGF antisense, were grown in transwells inserts while endothelial cells (MHE and HMVEC-L) were set on the bottom of the wells.

157

Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Figure 5a. FGF receptors expression by Caki-1 cells. Caki-1 cells express FGFR 1-3 but not FGFR4.

Figure 5b. Caki-1 cell cycle analysis performed 72 hr after treatment with a 1 µM dose of B460 or scramble PSODNs. The control group was untreated. Each bar represents the mean + S.E. of 3 experiments. The star indicates a significant difference (p<0.05) compared to the untreated control group.

Figure 5c. Apoptosis rate of Caki-1 cells after B460 treatment. Caki-1 cells were untreated (Control), treated with liposome vehicle (DOTAP), or treated with a 1 µM dose of either scramble PS-ODNs (Scramble) or B460 for a period of 72 hr. Each bar shows the results of 3 experiments + S.E. The star indicates a significant difference (p<0.05) from the untreated control group.

endothelial cell proliferation whereas treating the tumor cells with scramble antisense PS-ODNs had no effect on MHE or HMVEC-L cell growth. Media derived from B460 treated tumor cells also impaired the migration rate of both MHE and HMVEC-L cells whereas media from

The two cell types were separated by a membrane with 0.4 µm pores, chosen to allow the exchange of growth factors while preventing any direct cell-cell interactions. The results (Figure 6) showed that Caki-1 cells pre-treated with B460 significantly inhibited

158

Cancer Therapy Vol 1, page 159 control or scramble treated tumor cells did not (Figure 7). To demonstrate that bFGF antisense treatments could affect the induction of angiogenesis by Caki-1 cells in vivo, tumor cells pretreated with B460 were injected into mice and the number of blood vessels induced 3 days later was determined. The results (Figure 8) showed that untreated or scramble sequence PSODNs treated Caki-1 cells had very similar angiogenic potency, inducing ~45 new vessels in the assay period. In contrast, the angiogenic potency of Caki-1 cells pretreated with B460 was found to be severely impaired; only ~26 new blood vessels were observed.

In order to investigate whether the in vivo administration of bFGF antisense could lead to reductions in tumor bFGF expression levels, B460 PS-ODNs were mixed with cationic liposome DOTAP:DOPE in 5% dextrose and injected (10 mg/kg) via tail vein into Caki-1 xenograft-bearing mice. Western blot analysis of tumor samples collected at various times after B460 injection showed significant reductions in bFGF levels 24, 48 and 72 hr after treatment, with the maximum suppression occurring between 48 hr to 72 hr post B460 administration (Figure 9).

Figure 6. Effect of Caki-1 cell coculture on the growth of MHE and HMVEC-L cells. Caki-1 cells were untreated (Control) or pre-treated with either liposome vehicle (DOTAP), 1 µM control antisense PS-ODNs (Scramble) or 1 µM bFGF antisense PS-ODNs (B460). Cells were counted at the end of a 4-day treatment period. Each bar represents the mean ± S.E. of 3 experiments. Stars indicate significant differences (p<0.05) from the untreated control group.

Figure 7. Effect of conditioned media derived from Caki-1 cells on MHE and HMVEC-L cell migration. Media were obtained from Caki-1 cells which were not treated (Control), liposome vehicle treated (DOTAP), control PSODNs treated (Scramble) or bFGF antisense PS-ODNs (B460) treated. Each treatment was carried out in quadruplicate and the data shown are the mean ± S.E. Stars indicate significant differences (p<0.05) from the untreated control group.

159

Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Figure 8. Number of blood vessels induced 3 days after injecting 5 x 104 Caki-1 cells intradermally at 3-4 sites per mouse. Caki-1 cells were either untreated (Control) or pretreated with a 1 ÂľM dose of PS-ODNs for 2 hr prior to injection. The Scramble group refers to cells pretreated with scramble sequence PS-ODNs whereas the B460 group represents Caki-1 cells pretreated with bFGF antisense PSODNs. Each circle represents one injection site; the bar shows the median of 16 sites. Results for B460 treated cells are significantly different (p<0.05, Wilcoxon rank test) from untreated or scramble PS-ODNs treated cells.

B Figure 9. bFGF protein levels in Caki1 tumors at different times after treatment with 10 mg/kg bFGF antisense PD-ODNs (B460). A Representative bFGF western blot results, showing two tumor samples per group; B Relative bFGF protein levels of Caki-1 tumors in mice treated bFGF antisense PD-ODNs (B460). Each bar represents the mean Âą S.E. of 6 tumors. The stars indicate significant differences from time zero (p<0.05).

Subsequent experiments were designed to determine the antitumor efficacy of the systemic delivery of bFGF antisense PS-ODNs by examining the effect of such treatments on Caki-1 tumor growth. Caki-1 xenograftbearing mice were treated with two doses of bFGF antisense PS-ODNs B460 (5 or 10 mg/kg) 1 and 4 days after the tumors reached a size of ~200 mm3. The time for the tumors to grow from 200 to 1000 mm3 then was recorded (Figure 10). The data show that the median time for the tumors to grow to 5 times the original starting size was significantly prolonged in the bFGF antisense PSODNs (B460) treated groups, and that this increase in growth delay was treatment dose dependent.

IV. Discussion Evidence exists to strongly implicate bFGF as an important growth-promoting and angiogenic factor in RCC. First described in this disease 10 to 15 years ago (Mydlo et al, 1988; Mydlo et al, 1993) higher bFGF mRNA levels now have been noted in RCC than adjacent normal kidney (Eguchi et al, 1992). Associations between serum and urine bFGF levels and malignant progression as well as treatment outcome also have been made (Nanus et al, 1993; Nguyen et al, 1994; Duensing et al, 1995; Miyake et al, 1996; Yoshimura et al, 1996). The RCC model used in the present investigations (Caki-1) expresses 3 of 4 FGF receptors involved in bFGF signal transduction (Figure 5a). Blocking the production of bFGF by antisense PS-ODNs treatment causes a 160

Cancer Therapy Vol 1, page 161 moderate inhibition of RCC growth in vitro (Figure 4). This result was sequence specific, dose dependent and achieved at low concentrations (Figures 1-3). In general, the effects of different antisense PS-ODNs appeared to be directly related to their ability to suppress bFGF expression (Figure 4 vs. 1). The most probable explanation for the observed growth inhibition associated with the bFGF treatment is the small but significant modulation of the cell cycle (increase in G2-M, decrease in S (Figure 5b) coupled with the induction of apoptosis (Figure 5c)). To evaluate whether bFGF mRNA targeted PSODNs could inhibit tumor cell induced angiogenesis, both in vitro and in vivo assessments of this process were made. Since endothelial cell proliferation and migration are key elements in angiogenesis, the ability of Caki-1 cells to induce these components after bFGF antisense PS-ODNs treatment was investigated under conditions that allowed growth factor exchange between tumor and endothelial cells or by exposing endothelial cells to media collected from antisense treated tumor cells. These in vitro experiments were conducted under reduced serum conditions to minimize interference of other growth factors. The results showed that the inhibition of bFGF production in tumor cells by antisense PS-ODNs treatment significantly reduced endothelial cell proliferation (Figure 6) and migration (Figure 7). Subsequent studies demonstrated that inhibiting the production of bFGF by pre-treating Caki-1 cells with bFGF antisense PS-ODNs could significantly impair their ability to induce the angiogenic process in vivo (Figure 8). While these results support the role of bFGF as an important pro-angiogenic growth factor in Caki-1 cellinduced angiogenesis, the direct effect of B460 treatment on Caki-1 cell proliferation (Figure 4) may also be contributing to the reduced vessel counts observed in vivo (Figure 8). When administered in vivo, B460 not only significantly reduced bFGF expression levels in

established Caki-1 xenografts (Figure 9) but also resulted in a dose-dependent tumor growth delay (Figure 10). Previous studies had already shown that down regulating bFGF expression by antisense treatment could inhibit endothelial and tumor cell proliferation (Masood et al, 1997). For example, transfection of bFGF antisense cDNA or treatment with bFGF antisense PS-ODNs led to growth inhibition in several malignant cell types in vitro (Becker et al, 1989; Murphy et al, 1992; Ensoli et al, 1994; Redekop and Naus, 1995). Also, pretreating Kaposiâ&#x20AC;&#x2122;s sarcoma cells with bFGF antisense oligomers prior to injecting them into nude mice led not only to a reduction in the number of KS-like lesions present 4 days later but also to a reduced histopathology and lower levels of bFGF in those lesions that did occur (Ensoli et al, 1994). However, the present investigations provide the first experimental evidence that the systemic administration of bFGF antisense PS-ODNs to mice bearing macroscopic tumors can have significant antitumor efficacy. Indeed, the tumor growth delays observed (Figure 10) were achieved without overt toxicity and with doses well below the LD10 dose. In summary, the results of this study indicate that bFGF is an important factor for the growth and angiogenic potential of Caki-1 cells. Treatment with the novel bFGF antisense PS-ODNs (B460) proved to be an effective means of down-regulating bFGF production and impairing both Caki-1 growth and angiogenic signaling in vitro and in vivo. Moreover, the systemic administration of bFGF antisense PS-ODNs resulted in a significant inhibition of tumor growth when mice bearing established Caki-1 xenografts were treated. Taken together, these findings suggest that the application of an antisense treatment strategy based on targeting the angiogenic growth factor bFGF may have utility in the management of renal cell carcinoma.

Figure 10. The effect of antisense PSODNs targeted to bFGF mRNA treatment on the growth of Caki-1 xenografts. Anti-bFGF (B460) or control PS-ODNs (Scramble) were administered with cationic liposomes (DOTAP:DOPE) via the tail vein 1 and 4 days after the tumors reached a size of ~200 mm3. Control mice were untreated. Liposome vehicle administration on its own had no effect on Caki-1 tumor growth (data not shown). Each circle represents a single tumor; the bar shows the response of the median tumor in each group of 10 mice. The stars show significant differences (p<0.05, Wilcoxon rank test) from control or scramble PS-ODNs treated mice.

161

Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Motzer RJ, Rakhit A, Schwartz LH, Olencki T, Malone TM, Sandstrom K, Nadeau R, Parmar H, Bukowski R (1998) Phase I trial of subcutaneous recombinant human interleukin12 in patients with advanced renal cell carcinoma. Clin Cancer Res 4, 1183-1191 Murphy PR, Sato Y, Knee RS (1992) Phosphorothioate antisense oligonucleotides against basic fibroblast growth factor inhibit anchorage-dependent and anchorage-independent growth of a malignant glioblastoma cell line. Mol Endocrinol 6, 877884 Mydlo JH, Heston WD, Fair WR (1988) Characterization of a heparin-binding growth factor from adenocarcinoma of the kidney. J Urol 140, 1575-1579 Mydlo JH, Zajac J, Macchia RJ (1993) Conditioned media from a renal cell carcinoma cell line demonstrates the presence of basic fibroblast growth factor. J Urol 150, 997-1001 Nanus DM, Schmitz-Drager BJ, Motzer RJ, Lee AC, Vlamis V, Cordon-Cardo C, Albino AP, Reuter VE (1993) Expression of basic fibroblast growth factor in primary human renal tumors, correlation with poor survival. J Natl Cancer Inst 85, 1597-1599 Nguyen M, Watanabe H, Budson AE, Richie JP, Hayes DF, Folkman J (1994) Elevated levels of an angiogenic peptide, basic fibroblast growth factor, in the urine of patients with a wide spectrum of cancers. J Natl Cancer Inst 86, 356-361 Redekop GJ, Naus CC (1995) Transfection with bFGF sense and antisense cDNA resulting in modification of malignant glioma growth. J Neurosurg 82, 83-90 Sidky YA, Auerbach R (1976) Lymphocyte-induced angiogenesis in tumor-bearing mice. Science 192, 1237-1238 Singh RK, Gutman M, Bucana CD, Sanchez R, Llansa N, Fidler IJ (1995) Interferons alpha and beta down-regulate the expression of basic fibroblast growth factor in human carcinomas. Proc Natl Acad Sci U S A 92, 4562-4566 Stadler WM, Kuzel T, Shapiro C, Sosman J, Clark J, Vogelzang NJ (1999) Multi-institutional study of the angiogenesis inhibitor TNP-470 in metastatic renal carcinoma. J Clin Oncol 17, 2541-2545 Tang F, Hughes JA (1999) Synthesis of a single-tailed cationic lipid and investigation of its transfection. J Controlled Release 62, 345-358 Tartaglia M, Fragale A, Battaglia PA (2001) A competitive PCRbased method to measure human fibroblast growth factor receptor 1-4 (FGFR1-4) gene expression. DNA Cell Biol 20, 367-379 Tsui KH, Shvarts O, Smith RB, Figlin RA, deKernion JB, Belldegrun A (2000) Prognostic indicators for renal cell carcinoma, a multivariate analysis of 643 patients using the revised 1997 TNM staging criteria. J Urol 163, 1090-1095 Voest EE, Kenyon BM, O'Reilly MS, Truitt G, D'Amato RJ, Folkman J (1995) Inhibition of angiogenesis in vivo by interleukin 12. J Natl Cancer Inst 87, 581-586 Yoshimura K, Eto H, Miyake H, Hara I, Arakawa S, Kamidono S (1996) Messenger ribonucleic acids for fibroblast growth factors and their receptor in bladder and renal cell carcinoma cell lines. Cancer Lett 103, 91-97

Acknowledgements This work was supported by USPNS grant CA89655.

References Becker D, Meier CB, Herlyn M (1989) Proliferation of human malignant melanomas is inhibited by antisense oligodeoxynucleotides targeted against basic fibroblast growth factor. EMBO J 8, 3685-3691 Duensing S, Grosse J, Atzpodien J (1995) Increased serum levels of basic fibroblast growth factor (bFGF) are associated with progressive lung metastases in advanced renal cell carcinoma patients. Anticancer Res 15, 2331-2333 Eguchi J, Nomata K, Kanda S, Igawa T, Taide M, Koga S, Matsuya F, Kanetake H, Saito Y (1992) Gene expression and immunohistochemical localization of basic fibroblast growth factor in renal cell carcinoma. Biochem Biophys Res Commun 183, 937-944 Ensoli B, Markham P, Kao V, Barillari G, Fiorelli V, Gendelman R, Raffeld M, Zon G, Gallo RC (1994) Block of AIDSKaposi's sarcoma (KS) cell growth, angiogenesis, and lesion formation in nude mice by antisense oligonucleotide targeting basic fibroblast growth factor. A novel strategy for the therapy of KS. J Clin Invest 94, 1736-1746 Fujimoto K, Ichimori Y, Kakizoe T, Okajima E, Sakamoto H, Sugimura T, Terada M (1991) Increased serum levels of basic fibroblast growth factor in patients with renal cell carcinoma. Biochem Biophys Res Commun 180, 386-392 Giannakakou P, Villalba L, Li H, Poruchynsky M, Fojo T (1998) Combinations of paclitaxel and vinblastine and their effects on tubulin polymerization and cellular cytotoxicity, characterization of a synergistic schedule. Int J Cancer 75, 57-63 Gordon MS, Talpaz, and Margolin K. (1998) Phase I trial of recombinant humanized monoclonal anti-vascular endothelial growth factor in patients with metastatic cancer. Proc Am Soc Clin Oncol 17, 210a. Gospodarowicz D, Neufeld G, Schweigerer L (1986) Fibroblast growth factor. Mol Cell Endocrinol 46, 187-204 Issandou M, Darbon JM (1991) Basic fibroblast growth factor stimulates glomerular mesangial cell proliferation through a protein kinase C-independent pathway. Growth Factors 5, 255-264 Masood R, Cai J, Zheng T, Smith DL, Naidu Y, Gill PS (1997) Vascular endothelial growth factor/vascular permeability factor is an autocrine growth factor for AIDS-Kaposi sarcoma. Proc Natl Acad Sci U S A 94, 979-984 Medical Research Council Renal Cancer Collaborators (1999) Interferon-alpha and survival in metastatic renal carcinoma, early results of a randomized controlled trial. Lancet 353, 14-17 McLaughlin JK, Lipworth L (2000) Epidemiologic aspects of renal cell cancer. Semin Oncol 27, 115-123 Miyake H, Hara I, Yoshimura K, Eto H, Arakawa S, Wada S, Chihara K, Kamidono S (1996) Introduction of basic fibroblast growth factor gene into mouse renal cell carcinoma cell line enhances its metastatic potential. Cancer Res 56, 2440-2445

162

Cancer Therapy Vol 1, page 163

Cancer Therapy Vol 1, 163-171, 2003.

Antitumoral cell-based therapies Review Article

Javier GarcĂa-Castro*, Daniel Rubio, Ricardo de la Fuente, Antonio Bernad Department of Immunology and Oncology, Centro Nacional de BiotecnologĂa (CSIC), Madrid, Spain

__________________________________________________________________________________ *Correspondence: Javier GarcĂa-Castro; Phone: +34 915854656, Fax:+34 913720493, e-mail: jgarcia@cnb.uam.es Key Words: Antitumoral cell-based therapies, cellular vehicles, immune cells, NK and T cells, macrophages, dendritic cells, tumor cells, stem cells Received: 29 July 2003; Accepted: 27 August 2003; electronically published: September 2003

Summary Cell therapies are based on biological agents involving cells to be administered to patients with diverse diseases. Examples of cell-based therapies include implantation of cells as an in vivo source of an enzyme, cytokine or factor; infusion of immune cells such as lymphocytes, or transplant of cell populations such as hematopoietic cells, hepatocytes or pancreatic islet cells to perform a complex biological function. A similar concept can be applied to cancer in a new antitumor approach. In this case, carrier cells are usually modified ex vivo by vectors or by preloading with bioactive materials such as toxins or viruses. Several cell types target naturally to the tumor mass, or are engineered to improve this preferential homing. SDF-1 can induce integrin upregulation, aiding adhesion and ligand-dependent transmigration of vascular endothelial cells (Zou et al, 2001). In contrast to systemic drugs currently in use, cells do not distribute randomly via the circulation, but have an intrinsic program for trafficking through the body and entry into organs (Figure 2). A heterogeneous cell population in solid tumors resides in a common stromal microenvironment that is defined by interaction of this population with neighboring cells and local factors such as cytokines, molecules and extracellular matrix (Mareel and Leroy, 2003). Little is known of the interactions among these components that support tumor growth or are involved in tumor rejection (Stetler-Stevenson et al, 1993). Despite this lack of knowledge, it is possible to use cells as carriers to induce tumor inhibition. If a cell could be loaded with antitumor agents, a more specific cell-based therapeutic strategy would be possible, inducing powerful local action on the tumor. Here we will summarize some of the recent progress using cells as carriers of therapeutic products, focusing mainly on review of recent clinical trials.

I. Introduction Current cancer treatments are based on systemic drug administration. It is often difficult to obtain high intratumor concentration of these agents because of unacceptable secondary effects. Significant advances have been made in the development of new therapies with specific tumor targeting, as is the use of antibodies or viral vectors (Viti et al, 2002; Galanis et al, 2001). These agents nonetheless do not home specifically to the tumor and are affected by problems including limited half-life in the bloodstream, non-specific adhesion, as well as difficulty in extravasation and immune response. An ideal candidate would thus be a carrier with properties for specific tumor targeting, capacity for extravasation, which does not present problems to the immune system. Tumors may comprise different cell types: fibroblasts, stroma, immune cells, endothelial progenitors, and the heterogeneous cancer cells themselves (Figure 1). Since cancer cells may produce a variety of factors, a tumor can recruit certain cells (e.g., lymphocytes, macrophages or endothelial progenitors) during its development. During the hyperproliferative stage, tumors induce surrounding tissue to support new blood vessel formation, mainly through production of vascular endothelial growth factor (VEGF) and fibroblast growth factor (FGF) (Rafii et al, 2002). Other factors secreted by malignant cells, such as stromal-derived factor-1 (SDF-1), induce migration of certain immune system cells to the tumor. This migration can be produced indirectly, since

II. Cellular vehicles Cells of the immune system including T cells, macrophages, NK cells and eosinophils or cells related to tumor neoangiogenesis are the most obvious choices as vehicles, but other cell types such as tumor or stem cells could also be used. 163

García-Castro et al: Antitumoral cell-based therapies

Figure 1. Cellular diversity in the tumoral microenvironment. Schematic overview of different cellular types related to the progression of cancer cells. Many of these cells could be used as cellular vehicles in antitumoral therapies in base to their properties related with a specific recruitment to tumor sites.

Figure 2. Physiological models of distribution through the body of the therapeutic agents. In “systemic therapies”, classic drugs or new therapeutics, as viral vectors or antibodies, are administered to the patient and quickly they are distributed by all the body. They reach a homogenous concentration, which can have therapeutic effects but also, sometimes, undesirable secondary effects. By contrast, with “targeted therapies”, using carrier cells loaded with antitumoral agents, we could deliver therapeutics without problems of systemic dilution, minimizing collateral damage and with highly locoregional concentration in base to natural properties of tumor-homing cells.

164

Cancer Therapy Vol 1, page 165 injection to reduce systemic toxicity, or the need to select patients with low tumor burden and a large number of harvested NK cells. Nonetheless, results of clinical trials using LAK cells have shown efficacy in treatment of micrometastases, although not in large tumors (Kimura and Yamaguchi, 1997). Tumor-infiltrating lymphocytes (TIL) are T cells with unique tumor activity, which infiltrate some tumors and can be expanded ex vivo with IL-2 (Mukai et al, 1999). Although data on the physiological behavior of TIL are limited, these cells have already been used clinically in antitumor therapies, especially in melanomas (Rosenberg et al, 1994). TILs were recovered from patient tumors, cultured ex vivo with IL-2, selected and expanded based on their tumor-specific reactivity, then reinfused to the patient. Nonetheless, most common â&#x20AC;&#x153;tumor-specificâ&#x20AC;? antigens are in fact specific for the tissue or cell types that compose it; these antigens can also be expressed by normal tissues or cells of the same type (Song, 1998).

The ideal features of a candidate are a) immunological silence, b) a large number of easily-obtained cells, c) susceptibility to vector transduction (Table 1), d) lack of non-specific adhesion in the bloodstream, e) specific extravasation and homing to the tumor site. No perfect cell vehicle is currently available, although many approaches have been tested.

A. Immune cells Despite the theoretical suitability of immune system cells as vehicles to transport therapeutic products to the heart of the tumor, most studies using these cells center mainly on activating their innate immune capacity. Activation of the immune system is nonetheless a complex process. It requires not only immune cell localization to the tumor, but also an effective immune cell:tumor cell ratio, and adequate signaling through the TCR/CD3 complex plus a co-stimulatory signal (via ligands of the B7 family). In addition, the effect of suppressor cytokines must be avoided, since cytokines such as TGF-! and IL-10 can be secreted by the tumor cell, by surrounding stromal cells, or even by the activated immune cells themselves. The results of clinical studies in immunotherapy will be outlined below, although additional work will be required to determine the validity of immune cells as bystander therapeutic carriers.

Table 1. Vectors for gene and cell therapy. Efficient gene transfer requires the use of a vector and, depending upon the strategy, advantages and disadvantages of each one have to be considered. Type

Vector

Expression

Characteristics

Non-viral

Liposomes

Transitory

Low transfection efficiency. Good safety profile.

Naked DNA or RNA

Transitory

Low transfection efficiency. Simple and cheap production.

Molecular conjugates

Transitory

Flexible design. Unstable in vivo.

Oncovirus

Prolonged

Integrated in proliferating cells.

Lentivirus

Prolonged

Integrated in proliferating and non-proliferating cells.

Adenovirus

Transitory

Very high transfection efficiency. No integrating. Generates immune response.

Poxvirus (vaccinia)

Transitory

Great clinical experience.

Adenoassociates virus (AAV)

Prolonged

Insert-size limit of 4.5 Kb.

Herpes simplex virus

Transitory

Very efficient in vivo.

1. NK and T cells Tumor immunotherapy is a growing field, thanks to recent descriptions of factors implicated in the immune response to tumors and tumor-associated antigens, and reports on the need for lymphocyte activation by dendritic cells. Nevertheless, tumor cells often fail to induce a specific immune response due to the lack of a tumorassociated antigen, lack of a costimulatory signal, or by producing immunological inhibitors (Song, 1998). Absence of adhesion receptors on tumor vessels may also prevent lymphocyte infiltration and contact with tumor cells (Oppenheimer-Marks et al, 1990). In spite of this, experiments in mice showed that T cells can inhibit tumor growth, although few clinical studies have been conducted and the clinical benefits of such treatments have not been clearly documented (Greten and Jafee, 1999). Peripheral blood leukocytes can be cultured in vitro in the presence of several cytokines, particularly IL-2, to obtain lymphokine-activated killer (LAK) cells (Melder et al, 1989). Although some tissue-resident lymphocytes may have spontaneous LAK activity, normal blood mononuclear cells show no LAK activity, which is acquired only after incubation with IL-2 (Phillips et al, 1987). LAK cells have a wide spectrum of lytic activity against tumor cells in both autologous and allogeneic settings, whereas normal tissues are resistant to LAKmediated lysis (Fox and Rosenberg, 1989). Combined infusion of LAK cells and IL-2 has been evaluated in clinical trials, in which antitumor effects correlated with IL-2 dose and the number of LAK cells administered (Yano et al, 1999). Certain aspects remain to be modified, such as use of continuous IL-2 infusion rather than bolus

Viral

165

Retrovirus

GarcĂa-Castro et al: Antitumoral cell-based therapies The activity of the TILs used in this protocol, selected for their ability to recognize tumor-associated antigens, may thus be less specific than desired. A major obstacle in TIL-based therapies is that they can be cultured only from 50% of patients and several weeks of culture are required. Various authors nonetheless reported partial clinical responses in patients treated with TIL infusions, although their data also indicate that tumor size and the number of antigenic targets are essential for the success of TIL-based immunotherapy (Lister et al, 1995; Basse et al, 2000; deMagalhaes-Silverman et al, 2000). In these clinical trials, TIL localization within tumors was demonstrated after infusion, although there is also TIL homing to other organs such as liver and spleen, with potential autoreactivity. Moreover, when peripheral blood lymphocytes (PBL) were infused in patients as a control, no preferential trafficking pattern to the tumor was found for TIL versus PBL (Economou et al, 1996). All together, these data place the central hypothesis of preferential TIL homing to the tumor in doubt. NK cells can also lyse tumor cells, and have the advantage that they are easily obtained from patient peripheral blood (Whiteside et al, 1998). Following systemic injection, these cells were found in large numbers, primarily in the tumor and in lung (Melder et al, 2001). NK cells do not require a second costimulatory signal for complete activation (Hombach et al, 1993), an additional advantage for immunotherapy. In contrast to TIL, however, there is no evidence of benefits in clinical trials using NK cells, although accumulation was demonstrated within tumor metastases (deMagalhaesSilverman et al, 2000). These clinical protocols are based on the innate capacity of T and NK cells to home to the tumor and trigger an immune response. Several groups have focused on strategies based on enhancement of T cell cytotoxicity through gene transfer (van de Winkel et al, 1997; Weiner et al, 1997). Two main strategies are being tested to increase cytotoxicity in T cells. One is based on screening sequences for improved peptide-MHC binding and/or to increase the affinity of this complex with the TCR (Brocker et al, 1996; Chung et al, 1994). A second strategy focuses on activation of costimulatory signals, based on B7 and TNF family molecules (Hurwitz et al, 2000). Different lymphocyte subsets vary in their ability to extravasate and reach sites of tumor growth. This capacity is dictated by their physiological properties and is independent of their immunological specificity (Economou et al, 1996). NK cell populations may have high affinity for tumor vessel regions, but may be limited to a single passage through the tumor vasculature due to entrapment in other organs. In contrast, T lymphocytes may have lower adhesion efficiency to tumor vessels, but are not limited to single-pass delivery (Jain, 2001). Due to these features, several groups are studying improvement of T cell tumor homing. The approach consists mainly of construction of chimeric receptors encoding a peptide or protein able to recognize tumor antigens. The extracellular moiety of this artificial receptor is generally a single-chain antibody or ligand of endothelial and/or tumor cell

receptors. Alternatively, the TCR can be modified, although this requires functional assembly with the endogenous signaling machinery (Goverman et al, 1990; Brocker et al, 1996). Other groups have incorporated an intracellular domain that allows certain activation signals to promote rolling or immune functions (Hombach et al, 2002). Engineering T cells is a promising strategy, but efficacy in clinical trials remains to be demonstrated.

2. Macrophages Macrophages are phagocytic cells distributed throughout the body. Under normal conditions, they circulate without tissue retention, but under pathological circumstances they are mobilized and concentrated in damaged areas. Low oxygen tension (hypoxia) is another signal for macrophage recruitment, for example to areas of tumor necrosis (Goerdt et al, 1999). A significant proportion of cells in tumors are macrophages, apparently rendering them good candidates for cell-based therapies (Ohno et al, 2002). The ability of macrophages to kill tumor cells is controversial. Some groups have reported that activated macrophages kill tumor cells by direct cytotoxicity and by antibodydependent cytotoxicity, although others question the reality of these activities. Activated macrophages could kill tumor cells by secreting superoxide anions, hydrogen peroxide, nitric oxide or proteolytic enzymes, although tumor cell destruction by macrophages requires cell-to-cell contact and is dependent on contact duration, target cell type, and other poorly understood mechanisms (Obening, 1997). Previous studies showed the safety of protocols based on the infusion of large numbers of macrophages into patients. Activated macrophages were effective in treatment of metastases, around which they accumulated; in contrast, primary tumors did not regress (Fidler et al, 1985). Once their tumor homing capacity has been demonstrated, macrophage efficacy could be improved if they carried therapeutic genes to be expressed near or within a tumor. Engineered receptors and hypoxiaregulated promoters have been used to obtain higher specific targeting in some vectors in preclinical models (Griffiths et al, 2000).

3. Dendritic cells Dendritic cells are bone marrow-derived antigenpresenting cells able to migrate to local lymph nodes, where they activate T cells. In addition, the presence of tumor-infiltrating dendritic cells (TIDC) in a tumor has been correlated as a good prognostic factor for several tumor types (Bell et al, 1999). TIDC capture and process tumor cell-derived antigens, then migrate to lymph nodes to activate anti-tumor immune responses (Randolph et al, 1999). Early clinical trials involving immunization of patients with dendritic cells are now in progress. These trials show considerable variation as to the source of these cells and their route of administration, although all are based on an immunization strategy (MulĂŠ, 2000). Little 166

Cancer Therapy Vol 1, page 167 information is available about TIDC use in cell-based local therapies. An indirect approach is based on injection into tumors of gene-modified TIDC expressing IFN-". This chemoattractant promotes a sustained T cell influx into the tumor mass, potentially improving therapeutic efficacy (Kirk et al, 2001). Zou et al, (2001) defined a dendritic cell subpopulation specifically recruited to the tumor microenvironment, and reported that local regeneration or proliferation were not important mechanisms for accumulation. They also suggested a role for VLA-5 in migration to tumor tissue, and speculated that SDF-1 may be the major tumor-related chemoattractant for dendritic cells. This dendritic cell subpopulation may thus be a good candidate for loading with therapeutic agents to target the tumor microenvironment.

C. Stem cells Pluripotent stem cells, derived from human fetal tissues, have the ability to differentiate into almost any cell type found in embryonic germ layers. It was believed until recently that adult organ-specific stem cells were lineagerestricted, but recent studies have questioned this idea, and multipotent stem cells have been found in many adult tissues (Preston et al, 2003). Several groups have reported that some stem cells can target tumors and differentiate into diverse cell types, particularly into blood vessel endothelial cells (Carmeliet, 2003). Tumor growth requires neovascularization, and tumors thus promote remodeling of pre-existing capillaries and mobilization of bone marrow-derived cells through secretion of VEGF and other angiogenic factors (Bergens and Benjamin, 2003). As there are few active angiogenesis sites in a healthy adult, this capacity to home to the tumor site could be used to deliver therapeutic agents following ex vivo manipulation of adult stem cells. Endothelial progenitor cells (EPC) are highly proliferative cells derived from bone marrow; at difference from mature, differentiated circulating endothelial cells, they are incorporated into new tumor vessels (Asahara et al, 1999). Certain hematopoietic cell subsets also contribute to angiogenesis. Human bone marrow-derived EPC, inoculated into tumor-bearing immunodeficient mice, were detected in newly-formed tumor vessels, although with considerable variation among animals. This finding provides additional justification for the use of EPC and/or bone marrow stem cells as carriers in cell-based anti-tumor strategies. This approach has been used by several groups to express angiogenesis inhibitors or suicide genes in mouse models; they inhibited tumor growth and prolonged animal survival (Rafii et al, 2002; Ferrari et al, 2003). A conditioning regime (such as bone marrow transplantation), nonetheless, seems to be necessary for the success of the experiments (Lyden et al, 2001), probably because irradiation suppresses endogenous EPC and/or enhances EPC uptake into tumor vasculature. De Palma et al, (2003) recently reported a bone marrow-derived population that homes to tumors and interacts closely with vascular endothelial cells. This population was termed Tie-2-expressing mononuclear (TEM) cells, as their description is based on expression of a marker gene directed by a Tie-2 promoter. After transplant of hematopoietic cells transduced with Tie-2 promoter-lentiviral vectors, several tumors were injected and their angiogenesis analyzed. TEM expressed CD45 and CD11b, and were associated with small blood vessels assembled into a stromal framework in close association with endothelial cells. Finally, TEM were transduced with a suicide gene; tumor-bearing animals treated with the pro-drug showed delayed tumor appearance and slower tumor growth (De Palma et al, 2003). TEM cells thus appear to be a suitable vehicle for tumor-directed cell therapy. Mesenchymal stem cells (MSC) are the progenitors of several mesenchymal lineages, are present in various tissues and can be expanded in culture without losing their

B. Tumor cells The use of tumor cells as anti-tumor agents is based on several observations suggesting their potential utility. In their respective models, Coukos et al, (1999) and Namba et al, (1998) reported that infused tumor cells bind preferentially to tumor masses of the same histological type. When they loaded a tumor cell carrier line with a therapeutic vector, significant reduction of pre-existing tumor size was observed, although their models were based on tumors implanted in localized areas such as brain and peritoneal cavity. Some researchers have developed a model of spontaneous metastasis, with which they hypothesized that intravenously (IV) injected tumor cells would home to the organs with metastases (Garc_a-Castro et al, unpublished data). Metastases arise from local growth of malignant cells that have separated from the primary tumor, reached the blood and/or the lymphatic circulation and localized in distant organs. In this process, tumor cells traveling in the bloodstream respond to factors produced by or present in the different organs, an interaction that results in a specific metastatic pattern for each tumor. Genetically transduced tumor cells injected IV localize in pre-existing metastatic lesions, and demonstrated that cells carrying an antitumor agent such as a suicide gene or an oncolytic virus could deliver a localized therapeutic effect with negligible systemic toxicity. In vitro experiments using three-dimensional matrices suggested that invading tumor cells leave signals in their wake that drive migration of other cancer cells into the matrix (Horino et al, 2001). It is interesting that the cells following the invasive front in the matrices had a non-invasive phenotype. Tumor cells injected IV would thus participate in this interaction with the microenvironment, and target invading metastases independently of their invasive capacity. Although our experiments were performed with autologous tumor cells, it is possible that the cell carrier could be non-autologous to the patient, and a standard tumor cell line could be even developed with the aim of simplifying use in clinical trials.

167

GarcĂa-Castro et al: Antitumoral cell-based therapies phenotype or multilineage potential (Minguell et al, 2001) (Figure 3). Although MSC are currently recovered from bone marrow, they are distinct from hematopoietic stem cells and have a different expression marker profile. Moreover, MSC can be isolated from muscle, cord blood, cartilage or adipose tissue (Young et al, 2001; Zuk et al, 2001). MSC can be used in therapeutic strategies, as they can target organs (especially when implicated in pathological cases) and are easily transduced with viral vectors. In vivo transgene expression was reported following transplant of retrovirally transduced MSC (Deans and Moseley, 2000). Studeny et al, (2002) reported that when MSC were administered IV into mice with melanoma, these cells were detected inside tumors as stromal fibroblasts. In addition, survival was prolonged when engineered MSC were induced to secrete IFN!. There is a pluripotent cell population that co-purifies with MSC, termed multipotent adult progenitor cells (MAPC). A single MAPC injected into an early blastocyst contributes to mesodermic, neuroectodermic and endodermic tissues (Jiang et al, 2002). MAPC are able to differentiate into endothelial cells in vitro and in vivo. In vitro-generated MAPC-derived endothelial cells respond

to angiogenic stimuli by migrating to tumor sites and contributing to tumor vascularization (Reyes et al, 2002). These characteristics indicate that both MSC and MAPC could thus be used as therapeutic carriers to express antitumor factors at the site of neoplasms. Pharmacological agents for tumors derived from cells of the central nervous system must cross the blood-brain barrier; due to the immune-privileged nature of this tissue, the use of cellular vehicles might overcome this problem. Previous studies using fibroblasts, myoblasts, macrophages and endothelial cells (Schinstine et al, 1991; Jiao et al, 1992; Messina et al, 1992, Lal et al, 1994) encountered specific problems, as they were limited to the injection site due to the lack of motility or potential physiology problems because they are not normal brain components. Nonetheless, a new strategy using neural stem cells (NSC) has recently been reported. NSC have exceptional migratory ability; Aboody et al, (2000) showed that NSC can target invasive primary brain tumors, a behavior not displayed by cells of non-neural origin.

Figure 3. Differentiation potential of mesenchymal stem cells. (A) Mesenchymal stem cells (MSC) have the capacity to differentiate, at least, into osteoblasts, chrondoblast, myoblast, adipocytes and neurons when they are cultured in the induction medium and certain substances are added. (B) Appearance of human bone marrow-derived MSC after several days of culture. (C) Oil Red staining of human MSC after two weeks of culture in adipogenic differentiation medium. Lipid droplets are staining in red. (D) Alkaline phosphatase detection (in red), indicating an osteogenic differentiation of human MSC.

168

Cancer Therapy Vol 1, page 169 (1999) Use of carrier cells to deliver a replication-selective herpes simplex virus-1 mutant for the intraperitoneal therapy of epithelial ovarian cancer. Clin Cancer Res 5, 1523-1537. Chung S, Wucherpfennig KW, Friedman SM, Hafler DA and Strominger JL (1994) 654-8. Functional three-domain singlechain T-cell receptors. Proc Natl Acad Sci USA 91, 12. Deans RJ and Moseley AB (2000) Mesenchymal stem cells: biology and potential clinical uses. Exp Hematol 28, 875884.

These authors also showed reduction of established tumors when suicide gene-transduced NSC were used as a therapeutic approach. NSC also appear to follow infiltrating tumor cells that escape from normal tissue, although no reports have yet described the possibility that NSC injected into systemic circulation target intracerebral tumors. Herrlinger et. al, (2000) used replicationconditional vectors to transduce NSC and observed distribution throughout a glioma tumor. These studies thus indicated that NSC may provide a powerful cell-based antitumor therapy.

deMagalhaes-Silverman M, Donnenberg A, Lembersky B, Elder E, Lister J, Rybka W, Whiteside T and Ball E (2000) Posttransplant adoptive immunotherapy with activated natural killer cells in patients with metastatic breast cancer. J Immunother 23, 154-160.

III. Conclusions

De Palma M, Venneri MA, Roca C and Naldini L (2003) Targeting exogenous genes to tumor angiogenesis by transplantation of genetically modified hematopoietic stem cells. Nat Med 9, 789-795. Economou JS, Belldegrun AS, Glaspy J, Toloza EM, Figlin R, Hobbs J, Meldon N, Kaboo R, Tso CL, Miller A, Lau R, McBride W and Moen RC (1996) In vivo trafficking of adoptively transferred interleukin-2 expanded tumorinfiltrating lymphocytes and peripheral blood lymphocytes. Results of a double gene marking trial. J Clin Invest 97, 515-21. Ferrari N, Glod J, Lee J, Kobiler D and Fine HA (2003) Bone marrow-derived, endothelial progenitor-like cells as angiogenesis-selective gene-targeting vectors. Gene Ther 10, 647-566. Fidler IJ (1985) Macrophages and metastasis--a biological approach to cancer therapy. Cancer Res. 45, 4714-4726.

The use of cells as carriers for antitumor agents is a very attractive therapeutic strategy, although many aspects of this approach remain to be elucidated. Further knowledge is, nonetheless, needed of specific tumortargeting mechanisms and the in vivo physiological behavior of in each carrier cell type. Preclinical researchers must define the properties of these cells and find ways of manipulating them to produce a clinically appropriate outcome. Quality control is necessary in the manufacturing process as well as of the final product. Clinicians will need to adapt therapeutic regimens in accordance with the biology of these cells, their route of administration and the dose to be employed. In conclusion, within a few years these â&#x20AC;&#x153;Trojan horseâ&#x20AC;? cells may offer an alternative therapeutic strategy for certain tumor types.

Fox BA and Rosenberg SA (1989) Heterogeneous lymphokineactivated killer cell precursor populations. Development of a monoclonal antibody that separates two populations of precursors with distinct culture requirements and separate target-recognition repertoires. Cancer Immunol Immunother 29, 155-166.

References Aboody KS, Brown A, Rainov NG, Bower KA, Liu S, Yang W, Small JE, Herrlinger U, Ourednik V, Black PM, Breakefield XO and Snyder EY (2000) Neural stem cells display extensive tropism for pathology in adult brain: evidence from intracranial gliomas. Proc Natl Acad Sci USA 97, 1284612851.

Galanis E, Vile R and Russell SJ (2001) Delivery systems intended for in vivo gene therapy of cancer: targeting and replication competent viral vectors. Crit Rev Oncol Hematol 38, 177-192. Goerdt S, Politz O, Schledzewski K, Birk R, Gratchev A, Guillot P, Hakiy N, Klemke CD, Dippel E, Kodelja V and Orfanos CE (1999) Alternative versus classical activation of macrophages. Pathobiology 67, 222-226.

Asahara T, Masuda H, Takahashi T, Kalka C, Pastore C, Silver M, Kearne M, Magner M and Isner JM (1999) Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization. Circ Res 85, 221-228. Basse PH, Whiteside TL and Herberman RB (2000) Use of activated natural killer cells for tumor immunotherapy in mouse and human. Methods Mol Biol 121, 81-94. Bell D, Chomarat P, Broyles D, Netto G, Harb GM, Lebecque S, Valladeau J, Davoust J, Palucka KA, Banchereau J (1999) In breast carcinoma tissue, immature dendritic cells reside within the tumor, whereas mature dendritic cells are located in peritumoral areas. J Exp Med 190, 1417-1426. Bergers G and Benjamin LE (2003) Angiogenesis: Tumorigenesis and the angiogenic switch. Nat Rev Cancer 3, 401-410.

Goverman J, Gomez SM, Segesman KD, Hunkapiller T, Laug WE and Hood L (1990) Chimeric immunoglobulin-T cell receptor proteins form functional receptors: implications for T cell receptor complex formation and activation. Cell 60, 929-939. Greten TF and Jaffee EM (1999) Cancer vaccines. J Clin Oncol 17, 1047-1060. Griffiths L, Binley K, Iqball S, Kan O, Maxwell P, Ratcliffe P, Lewis C, Harris A, Kingsman S, Naylor S (2000) The macrophage - a novel system to deliver gene therapy to pathological hypoxia. Gene Ther 7, 255-262.

Brocker T, Riedinger M and Karjalainen K (1996) Redirecting the complete T cell receptor/CD3 signaling machinery towards native antigen via modified T cell receptor. Eur J Immunol 26, 1770-1774. Carmeliet P (2003) Angiogenesis in health and disease. Nat Med 9, 653-660. Coukos G, Makrigiannakis A, Kang EH, Caparelli D, Benjamin I, Kaiser LR, Rubin SC, Albelda SM and Molnar-Kimber KL

Herrlinger U, Woiciechowski C, Sena-Esteves M, Aboody KS, Jacobs AH, Rainov NG, Snyder EY and Breakefield XO (2000) Neural precursor cells for delivery of replicationconditional HSV-1 vectors to intracerebral gliomas. Mol Ther 1, 347-357. Hombach A, Jung W, Pohl C, Renner C, Sahin U, Schmits R, Wolf J, Kapp U, Diehl V and Pfreundschuh M (1993) A CD16/CD30 bispecific monoclonal antibody induces lysis of

169

GarcĂa-Castro et al: Antitumoral cell-based therapies Hodgkin's cells by unstimulated natural killer cells in vitro and in vivo. Int J Cancer 55, 830-836. Hombach A, Heuser C and Abken H (2002) The recombinant T cell receptor strategy: insights into structure and function of recombinant immunoreceptors on the way towards an optimal receptor design for cellular immunotherapy. Curr Gene Ther 2, 211-226.

the intact capillary wall in the rat. Proc Natl Acad Sci USA 89, 12018-12022. Minguell JJ, Erices A and Conget P (2001) Mesenchymal stem cells. Exp Biol Med 226, 507-520. Mukai S, Kjaergaard J, Shu S and Plautz GE (1999) Infiltration of tumors by systemically transferred tumor-reactive T lymphocytes is required for antitumor efficacy. Cancer Res 59, 5245-5249. Mule JJ (2000) Dendritic cells: at the clinical crossroads. J Clin Invest 105, 707-708 Namba H, Tagawa M, Iwadate Y, Kimura M, Sueyoshi K and Sakiyama S (1998) Bystander effect-mediated therapy of experimental brain tumor by genetically engineered tumor cells. Hum Gene Ther 9, 5-11.

Horino K, Kindezelskii AL, Elner VM, Hughes BA and Petty HR (2001) Tumor cell invasion of model 3-dimensional matrices: demonstration of migratory pathways, collagen disruption, and intercellular cooperation. FASEB J 15, 932939. Hurwitz AA, Kwon ED and van Elsas A (2000) Costimulatory wars: the tumor menace. Curr Opin Immunol 12, 589-596. Jain RK (2001) Delivery of molecular medicine to solid tumors: lessons from in vivo imaging of gene expression and function. J Control Release 74, 7-25.

Oberling F (1997) Monocyte/macrophages as effector cells in cancer immunotherapy. Transfus Sci 18, 243-250. Ohno S, Inagawa H, Soma G and Nagasue N (2002) Role of tumor-associated macrophage in malignant tumors: should the location of the infiltrated macrophages be taken into account during evaluation? Anticancer Res 22, 4269-4275. Oppenheimer-Marks N, Davis LS and Lipsky PE (1990) Human T lymphocyte adhesion to endothelial cells and transendothelial migration. Alteration of receptor use relates to the activation status of both the T cell and the endothelial cell. J Immunol 145, 140-148. Phillips JH, Gemlo BT, Myers WW, Rayner AA and Lanier LL (1987) In vivo and in vitro activation of natural killer cells in advanced cancer patients undergoing combined recombinant interleukin-2 and LAK cell therapy. J Clin Oncol 5, 19331941.

Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz-Gonzalez XR, Reyes M, Lenvik T, Lund T, Blackstad M, Du J, Aldrich S, Lisberg A, Low WC, Largaespada DA and Verfaillie CM (2002) Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, 41-49. Jiao S, Schultz E and Wolff JA (1992) Intracerebral transplants of primary muscle cells: a potential 'platform' for transgene expression in the brain. Brain Res 575, 143-147. Kimura H and Yamaguchi Y (1997) A phase III randomized study of interleukin-2 lymphokine-activated killer cell immunotherapy combined with chemotherapy or radiotherapy after curative or noncurative resection of primary lung carcinoma. Cancer 80, 42-49. Kirk CJ, Hartigan-O'Connor D, Mule JJ (2001) The dynamics of the T-cell antitumor response: chemokine-secreting dendritic cells can prime tumor-reactive T cells extranodally. Cancer Res 6, 8794-8802. Lal B, Indurti RR, Couraud PO, Goldstein GW and Laterra J (1994) Endothelial cell implantation and survival within experimental gliomas. Proc Natl Acad Sci USA 91, 96959699.

Preston SL, Alison MR, Forbes SJ, Direkze NC, Poulsom R and Wright NA (2003) The new stem cell biology: something for everyone. Mol Pathol 56, 86-96. Rafii S, Lyden D, Benezra R, Hattori K and Heissig B (2002) Vascular and haematopoietic stem cells: novel targets for anti-angiogenesis therapy? Nat Rev Cancer 2, 826-835. Randolph GJ, Inaba K, Robbiani DF, Steinman RM, Muller WA (1999) Differentiation of phagocytic monocytes into lymph node dendritic cells in vivo. Immunity 11, 753-7561. Reyes M, Dudek A, Jahagirdar B, Koodie L, Marker PH and Verfaillie CM (2002) Origin of endothelial progenitors in human postnatal bone marrow. J Clin Invest 109, 337-346.

Lister J, Rybka WB, Donnenberg AD, deMagalhaes-Silverman M, Pincus SM, Bloom EJ, Elder EM, Ball ED and Whiteside TL (1995) Autologous peripheral blood stem cell transplantation and adoptive immunotherapy with activated natural killer cells in the immediate posttransplant period. Clin Cancer Res 1, 607-614.

Rosenberg SA, Yannelli JR, Yang JC, Topalian SL, Schwartzentruber DJ, Weber JS, Parkinson DR, Seipp CA, Einhorn JH and White DE (1994) Treatment of patients with metastatic melanoma with autologous tumor-infiltrating lymphocytes and interleukin 2. J Natl Cancer Inst 86, 11591166. Schinstine M, Kawaja MD and Gage FH (1991) Intracerebral delivery of growth factors: potential application of genetically modified fibroblasts. Prog Growth Factor Res 3, 57-66.

Lyden D, Hattori K, Dias S, Costa C, Blaikie P, Butros L, Chadburn A, Heissig B, Marks W, Witte L, Wu Y, Hicklin D, Zhu Z, Hackett NR, Crystal RG, Moore MA, Hajjar KA, Manova K, Benezra R and Rafii S (2001) Impaired recruitment of bone-marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesis and growth. Nat Med 7, 1194-11201. Mareel M, Leroy A (2003) Clinical, cellular, and molecular aspects of cancer invasion. Physiol Rev 83, 337-376. Melder RJ, Rosenfeld CS, Herberman RB and Whiteside TL (1989) Large-scale preparation of adherent lymphokineactivated killer (A-LAK) cells for adoptive immunotherapy in man. Cancer Immunol Immunother 29, 67-73. Melder RJ, Kristensen CA, Munn LL and Jain RK (2001) Modulation of A-NK cell rigidity: In vitro characterization and in vivo implications for cell delivery. Biorheology 38, 151-159.

Sogn JA (1998) Tumor immunology: the glass is half full. Immunity 9, 757-763. Stetler-Stevenson WG, Liotta LA, Kleiner DE Jr (1993) Extracellular matrix 6: role of matrix metalloproteinases in tumor invasion and metastasis. FASEB J. 7, 1434-1441. Studeny M, Marini FC, Champlin RE, Zompetta C, Fidler IJ and Andreeff M (2002) Bone marrow-derived mesenchymal stem cells as vehicles for interferon-beta delivery into tumors. Cancer Res 62, 3603-3608.

Messina LM, Podrazik RM, Whitehill TA, Ekhterae D, Brothers TE, Wilson JM, Burkel WE and Stanley JC (1992) Adhesion and incorporation of lacZ-transduced endothelial cells into

van de Winkel JG, Bast B and de Gast GC (1997) Immunotherapeutic potential of bispecific antibodies.

170

Cancer Therapy Vol 1, page 171 Immunol Today 18, 562-574. Viti F, Giovannoni L and Neri D (2002) Recombinant antibodies for the selective targeting of tumor neovasculature. Curr Opin Drug Discov Devel 5, 204-213.

K, Thomas K, Austin T, Edwards C, Cuzzourt J, Duenzl M, Lucas PA and Black AC Jr (2001) Human reserve pluripotent mesenchymal stem cells are present in the connective tissues of skeletal muscle and dermis derived from fetal, adult, and geriatric donors. Anat Rec 264, 51-62.

Weiner LM, Alpaugh RK and von Mehren M (1997) Redirected cellular cytotoxicity employing bispecific antibodies and other multifunctional binding proteins. Cancer Immunol Immunother 45, 190-192. Whiteside TL, Vujanovic NL and Herberman RB (1998) Natural killer cells and tumor therapy. Curr Top Microbiol Immunol 230, 221-244.

Zou W, Machelon V, Coulomb-L'Hermin A, Borvak J, Nome F, Isaeva T, Wei S, Krzysiek R, Durand-Gasselin I, Gordon A, Pustilnik T, Curiel DT, Galanaud P, Capron F, Emilie D, Curiel TJ (2001) Stromal-derived factor-1 in human tumors recruits and alters the function of plasmacytoid precursor dendritic cells. Nat Med. 7:1339-1346. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP and Hedrick MH (2001) Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 7, 211-228.

Yano T, Sugio K, Yamazaki K, Kase S, Yamaguchi M, Ondo K, Yoshino I and Sugimachi K (1999) Postoperative adjuvant adoptive immunotherapy with lymph node-LAK cells and IL-2 for pathologic stage I non-small cell lung cancer. Lung Cancer 26, 143-148. Young HE, Steele TA, Bray RA, Hudson J, Floyd JA, Hawkins

171

GarcĂa-Castro et al: Antitumoral cell-based therapies

172

Cancer Therapy Vol 1, page 173 Cancer Therapy Vol 1, 173-178, 2003.

Can mortalin be a candidate target for cancer therapy? Review Article

Renu Wadhwa*, Kazunari Taira and Sunil C Kaul National Institute of Advanced Industrial Science & Technology (AIST), 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562, Japan

__________________________________________________________________________________ *Correspondence: Renu Wadhwa, Gene Function Research Center, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562, Japan; Phone: +81 29 861 9464; Fax: +81 29 861 3019, e-mail: renuwadhwa@aist.go.jp Key Words: mortalin, localization, p53, inactivation, tumors, therapy Received: 29 July 2003; Accepted: 27 August 2003; electronically published: August 2003

Summary Differential staining pattern of mortalin (mot-2/mthsp70/PBP74/GRP75) is a reliable marker for normal and cancerous phenotype of cells. It is an essential protein, sojourns multiple subcellular sites while residing predominantly in mitochondria. It has multiple binding partners and performs multiple functions including mitochondrial import, intracellular trafficking, receptor internalization and inactivation of the tumor suppressor protein p53. The present article updates our understanding on its functions in cellular senescence and immortalization and proposes its use as a target for cancer therapy. alleles in mouse (Kaul et al, 2000b). The mot-1 cDNA encoding the pancytoplasmic form of mouse mortalin when introduced into NIH 3T3 cells induced cellular senescence like phenotype in these cells (Wadhwa et al, 1993c). In contrast, the mot-2 cDNA that encoded perinuclear protein resulted in malignant transformation of NIH 3T3 cells (Kaul et al, 1998). Differential cellular distribution of mortalin in normal and transformed cells was also endorsed by human system. In more than 50 different human immortal cell lines examined, mortalin was observed as nonpancytoplasmically distributed (Wadhwa et al, 1995) (Figure 1) in contrast to the normal cells that showed pancytoplasmic staining. Cloning and analyses of mortalin cDNA from normal and transformed human cells, however, revealed no significant difference (Kaul et al, 1998) proposing that there are, at least, two mechanisms operating for differential distribution of mortalin in normal and transformed cells. One is by distinct cDNAs, mot-1 and mot-2, and is found in mouse. The other may involve protein modifications, binding partners or other cellular factors and operates in mouse and human. Such mechanism(s) remains to be elucidated. Human mortalin cDNA clone when expressed in mouse immortal cells led to their malignant transformation similar to the one caused by mouse mot-2 cDNA. Both mouse mot-2 cDNA and human mortalin also led to lifespan extension of normal human fibroblasts (Kaul et al, 2000a). Based on these functional data, human mortalin cDNA was called hmot-2 and its overexpression was suggested to have proproliferative function.

I. Introduction Mortalin is a member of hsp70 family of proteins. It was first cloned from the cytoplasmic fraction of normal mouse fibroblasts; the immortal cells lack this protein in their cytoplasmic fraction (Wadhwa et al, 1993a). Subsequently, by immunostaining its differential subcellular distribution was recognized in normal and immortal mouse cells (Wadhwa et al, 1993b). A large variety of human normal and immortal cells were demonstrated to have pancytoplasmic and perinuclear cellular distribution of mortalin, respectively. As discussed below, its mutliple subcellular sites and binding partners signify its multiple roles, some of which are crucial for continued proliferation of cells.

II. Cancerous mouse and human cells lack the pancytoplasmic distribution of mortalin Immunostaining of normal and immortal cells with a mortalin specific antibody revealed that it is widely distributed in the cytoplasm of normal cells and is restricted to the perinuclear region in immortal mouse cells. cDNAs encoding the cytoplasmically distributed protein (mot-1) and the perinuclear protein (mot-2) were cloned from normal and immortal mouse fibroblasts, respectively (Wadhwa et al, 1993c). These were shown to be different by two amino acids (Wadhwa et al, 1993c), have contrasting biological activity and coded by two

173

Wadhwa et al: Can mortalin be a candidate target for cancer therapy?

Figure 1. Mortalin immunostaining in normal (skin fibroblasts, TIG-1) and transformed (osteogenic sarcoma, U2OS) human cells.

antibodies in a variety of cell lines revealed its existence in multiple subcellular sites that includes mitochondria, endoplasmic reticulum, cytoplasmic vesicles and cytosol (Dahlseid et al, 1994; Domanico et al, 1993; Poindexter et al, 2002; Ran et al, 2000; Singh et al, 1997; Soltys and Gupta, 1999, 2000; Wadhwa et al, 1995; Webster et al, 1994). These data suggest its involvement in multiple cellular functions. In support to its localization at multiple subcelluar sites, mortalin was shown to bind to residents of different organelles by a variety of protocols. Far-western screening identified glucose regulated ER chaperone (GRP94) as one of its binding partners. Mortalin-GRP94 interactions were confirmed by mammalian two-hybrid assays, in vitro and in vivo coimmunoprecipitations (Takano et al, 2001). Mortalin was also isolated as FGF-1 binding protein by FGF-1 affinity chromatography and was shown to aid in its intracellular trafficking (Mizukoshi et al, 1999), mediated by its cell cycle specific phosphorylation (Mizukoshi et al, 2001). ATP-sensitive association of mortalin with IL-1 receptor type was also detected and predicted to have a role in receptor internalization (Sacht et al, 1999). Yeast interactive screen for mortalin binding proteins isolated the mitochondrial proteins hsp60, NADH dehydrogenase, Tim44, Tim23 (unpublished data) and the peroxisomal protein MPD (Wadhwa et al, 2003a) as its binding partners. It appears that mortalin routes through multiple subcellular sites and thus interacts with different proteins therein. Recently, it has been recognized that protein distribution in a cell is more dynamic than was earlier thought. Many other proteins have been detected in subcellular localizations that were considered foreign previously (Soltys and Gupta, 1996, 1997, 1999). The studies warrant further analyses to elucidate the kinetics of mortalin binding to its binding partners, their temporal and special relevance to cellular mortal, immortal and stressed phenotypes including apoptosis.

Subcellular distribution of mortalin shifted from the perinuclear to the pancytoplasmic type when cancerous cells were induced to senescence. For example, introduction of human chromosome 7 to carcinogentransformed liver fibroblasts (SUSM-1) resulted in their senescence in culture as determined by their proliferation, senescence associated !-gal activity. The senescent cells showed pancytoplasmic distribution of mortalin (Nakabayashi et al, 1999). In a similar approach when chromosome-fragments and genes from human chromosome 4 were introduced into cervical carcinoma (HeLa) cells, resulted in an induction of senescence phenotype that was accompanied by a shift in the subcellular distribution of mortalin from a perinuclear to pancytoplasmic type (Bertram et al, 1999). Induction of senescence like growth arrest by bromodeoxyuridine (Michishita et al, 1999) or MKT-077 (a rhodacyanine dye that is selectively toxic to cancer cells) also caused shift of subcellular distribution of mortalin from perinuclear to pancytoplasmic type, characteristic of normal cells (Wadhwa et al, 2000). On the other hand, Simian Virus 40 large T antigen (SV40 LTAg) - induced cellular transformation of human lung fibroblast (MRC-5) cells resulted in shift of pancytoplasmic mortalin staining in normal cells to the nonpancytoplasmic staining in its immortal derivatives. Taken together, these studies showing the absence of pancytoplasmic mortalin staining pattern in cancerous cells have assigned mortalin staining as a reliable marker of cellular normal and transformed phenotypes.

III. Multiple subcellular sites and binding partners of mortalin Mortalin is a highly conserved member of hsp70 family of proteins. It was also cloned as a peptide binding protein (PBP74) (Dahlseid et al, 1994; Domanico et al, 1993), mitochondrial heat shock protein 70 (mthsp70) (Bhattacharyya et al, 1995) glucose regulated protein 75 (GRP75) (Webster et al, 1994) and was found in multiple subcellular sites by a variety of protocols. Confocal laser microscopy of the native protein with protein-specific

174

Cancer Therapy Vol 1, page 175 of these include breast carcinomas, glioblastomas and teratocarcinomas.

IV. Mortalin-p53 interactions and p53 function Mortalin binds to p53 in transformed human cells (Wadhwa et al, 1998). These interactions result in cytoplasmic sequestration of p53 and inhibition of its transcriptional inactivation function (Wadhwa et al, 1998; 2002b). Such inactivation of p53 function could account for lifespan extension of normal human cells. Recently, it has been shown that telomerase in cooperation with mortalin could accelerate the immortalization of normal human cells (Kaul et al, 2003). Binding studies using deletion mutants have demonstrated that an N-terminal region of mortalin binds to the C-terminus of p53, previously shown to be involved in cytoplasmic sequestration of p53 (Kaul et al, 2001; Moll et al, 1992; Wadhwa et al, 2002b). Most recently, it has been shown that p53 also exists in the mitochondria (also a predominant localization of mortalin) and interacts with mortalin/mthsp70, Bcl-2 and hsp60 (Dumont et al, 2003; Mihara et al, 2003) and these interactions are involved in p53-mediated apoptosis by a pathway independent to its nuclear function. In this scenario, if mortalin could interfere with the p53-Bcl-2 interactions it may act as an antiapoptotic factor (Figure 2). Such possibilities remain to be tested. On the other hand, abrogation of moratlin-p53 interaction by a cationic rhodacyanine dye analogue (MKT-077) resulted in nuclear translocation and reactivation of p53 function sufficient to cause growth arrest of transformed human cells (Wadhwa et al, 2000; 2002a). In tumors with wild type p53, the abrogation of mortalin-p53 interactions and reactivation of p53 function could be valid for cancer therapy. Most common examples

V. Mortalin functions other than p53 inactivation Expression of mortalin could be suppressed in malignant human fibroblasts using specifically designed active hammerhead ribozymes. The cells with decreased expression of mortalin undergo growth arrest and show reactivation of wild type p53 function (Wadhwa et al, 2003b). However, the cells that lack p53 function also experienced growth arrest suggesting that mortalin is involved in functions other than p53 inactivation and are crucial for continued proliferation of cancerous cells. One possibility could be due to its role as mitochondrial importer as demonstrated in yeast with its homologue, SSC1p. The yeast homologue of mortalin, SSC1p, was shown to be vital for mitochondrial import (Geissler et al, 2001; Krimmer et al, 2000) and its knock-out resulted in cell death (Craig et al, 1989). SSC1p was shown to bind to Tim-44, an inner mitochondrial membrane anchor, and forms an essential component of mitochondrial import machinery (Krimmer et al, 2000; Strub et al, 2001). Other proposed functions of SSC1p include unfolding of proteins outside mitochondria, unidirectional translocation across mitochondrial membranes initiated by membrane potential M"#, completion of import by acting as an ATP-driven motor and degradation of misfolded peptides by m-AAA and PIM1 proteases in mitochondria (Lim et al, 2001; Liu et al, 2001). These functions may be critical for continued proliferation of cancerous cells and thus targeting of mortalin may arrest the growth of these cells.

Figure 2. Predictive anti-apoptotic function of mortalin. Its interaction with p53 in mitochondria may lead to abrogation of p53-Bcl-2 association resulting in maintenance of anti-apoptotic functioning of Bcl-2 protein.

175

Wadhwa et al: Can mortalin be a candidate target for cancer therapy? protein family, is a mitochondrial protein. Mol Biol Cell 5, 1265-1275. Domanico SZ, DeNagel DC, Dahlseid JN, Green JM, Pierce SK (1993) Cloning of the gene encoding peptide-binding protein 74 shows that it is a new member of the heat shock protein 70 family. Mol Cell Biol 13, 3598-3610. Dumont P, Leu JI, Della Pietra AC, George DL, Murphy M (2003) The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33, 357365. Geissler A, Rassow J, Pfanner N, Voos W (2001) Mitochondrial import driving forces: enhanced trapping by matrix hsp70 stimulates translocation and reduces the membrane potential dependence of loosely folded preproteins. Mol Cell Biol 21, 7097-7104. Ibi T, Sahashi K, Ling J, Marui K, Mitsuma T (1996). [Immunostaining of mitochondrial heat shock proteins (mtHSPs) in skeletal muscle fibers of mitochondrial cytopathy]. Rinsho Shinkeigaku Clinical Neurol 36, 61-64. Kaul SC, Duncan EL, Englezou A, Takano S, Reddel RR, Mitsui Y, Wadhwa R (1998) Malignant transformation of NIH3T3 cells by overexpression of mot-2 protein. Oncogene 17, 907911. Kaul SC, Reddel RR, Sugihara T, Mitsui Y, Wadhwa R (2000a). Inactivation of p53 and life span extension of human diploid fibroblasts by mot-2. FEBS Lett 474, 159-164. Kaul SC, Duncan E, Sugihara T, Reddel RR, Mitsui Y, Wadhwa R (2000b) Structurally and functionally distinct mouse hsp70 family members mot-1 and mot-2 proteins are encoded by two alleles. DNA Res 7, 229-231. Kaul SC, Reddel RR, Mitsui Y, Wadhwa R (2001) An Nterminal region of mot-2 binds to p53 in vitro. Neoplasia 3, 110-114. Kaul SC, Yaguchi T, Taira K, Reddel RR, Wadhwa R (2003). Overexpressed mortalin (mot-2)/mthsp70/GRP75 and hTERT cooperate to extend the in vitro lifespan of human fibroblasts. Exp Cell Res 286, 96-101. Krimmer T, Rassow J, Kunau WH, Voos W, Pfanner N (2000) Mitochondrial protein import motor: the ATPase domain of matrix hsp70 is crucial for binding to Tim44, while the peptide binding domain and the carboxy-terminal segment play a stimulatory role. Mol Cell Biol 20, 5879-5887. Lim JH, Martin F, Guiard B, Pfanner N, Voos W (2001) The mitochondrial Hsp70-dependent import system actively unfolds preproteins and shortens the lag phase of translocation. EMBO J 20, 941-950. Liu Q, Krzewska J, Liberek K, Craig EA (2001) Mitochondrial Hsp70 Ssc1: role in protein folding. J Biol Chem 276, 61126118. Marchenko ND, Zaika A, Moll UM (2000) Death signal-induced localization of p53 protein to mitochondria. A potential role in apoptotic signaling. J Biol Chem 275, 16202-16212. Merrick BA, Pence PM, He C, Patterson RM, Selkirk JK (1995) Phosphor image analysis of human p53 protein isoforms. Biotechniques 18, 292-299. Michishita E, Nakabayashi K, Suzuki T, Kaul SC, Ogino H, Fujii M, Mitsui Y, Ayusawa D (1999) 5-Bromodeoxyuridine induces senescence-like phenomena in mammalian cells regardless of cell type or species. J Biochem 126, 10521059. Mihara M, Erster S, Zaika A, Petrenko O, Chittenden T, Pancoska P, Moll UM (2003) p53 has a direct apoptogenic role at the mitochondria. Mol Cell 11, 577-590.

Independent studies have assigned multiple functions to mortalin. They range from stress response (Craig et al, 1998; Merrick et al, 1995; Sadekova et al, 1997; Carette et al 2002; Resendez et al, 1986; Schneider and Hood, 2000; Wu et al, 1999), muscle activity (Ibi et al, 1996), mitochondrial biogenesis (Ornatsky et al, 1995; Takahashi et al, 1998), intracellular trafficking (Mizukoshi et al, 1999; 2001; Sacht et al, 1999), antigen processing (Domanico et al, 1993), control of cell proliferation (Kaul et al, 1998; 2000a), differentiation (Xu et al, 1999), fate determination (Rivolta and Holley, 2002), tumorigenesis (Bini et al, 1997; Kaul et al, 1998; Takahashi et al, 1994; Takano et al, 1997) and apoptosis (Marchenko et al, 2000; Taurin et al, 2002; Dumont et al, 2003; Mihara et al, 2003). As expected, an overexpression of mortalin and accentuation of such functions may impart growth or proliferative advantage to cells. Comparative studies on the expression level of mortalin in normal and tumor cells indeed revealed its upregulation in tumors and its decrease during replicative senescence of fibroblasts (unpublished observations). Complete understanding of its various functions and their precise contribution to normal and cancerous phenotypes warrant further studies. Nevertheless there is an evidence showing that the abrogation of one or more functions of mortalin may compromise cell proliferation and thus could serve as a cancer therapeutic tool. The next challenge is to validate this therapeutic approach by analyzing the expression of mortalin in a variety of clinical tumor tissues and to unravel ways to target these functions specifically in cancerous cells without affecting normal cells.

References Bertram MJ, Berube NG, Swanson XH, Pereira-Smith OM (1999) Assembly of a BAC contig of the complementation group B cell senescence gene candidate region at 4q33-q34.1 and identification of expressed sequences. Genomics 56, 353-354. Bini L, Magi B, Marzocchi B, Arcuri F, Tripodi S, Cintorino M, Sanchez JC, Frutiger S, Hughes G, Pallini V, et al. (1997). Protein expression profiles in human breast ductal carcinoma and histologically normal tissue. Electrophoresis 18, 28322841. Bhattacharyya T, Karnezis AN, Murphy SP, Hoang T, Freeman BC, Phillips B, Morimoto RI (1995) Cloning and subcellular localization of human mitochondrial hsp70. J Biol Chem 270, 1705-1710. Carette J, Lehnert S, Chow TYK (2002) Implication of PBP74/mortalin/GRP75 in the radio-adaptive response. Int J Radiat Biol 78, 183-190. Craig EA, Kramer J, Shilling J, Werner-Washburne M, Holmes S, Kosic-Smithers J and Nicolet CM (1989) SSC1, an essential member of the yeast HSP70 multigene family, encodes a mitochondrial protein. Mol Cell Biol 9, 30003008. Craig EE, Chesley A and Hood DA (1998) Thyroid hormone modifies mitochondrial phenotype by increasing protein import without altering degradation. Am J Physiol 275, C1508-1515. Dahlseid JN, Lill R, Green JM, Xu X, Qiu Y, Pierce SK (1994) PBP74, a new member of the mammalian 70-kDa heat shock

176

Cancer Therapy Vol 1, page 177 Mizukoshi E, Suzuki M, Loupatov A, Uruno T, Hayashi H, Misono T, Kaul SC, Wadhwa R, Imamura T (1999) Fibroblast growth factor-1 interacts with the glucoseregulated protein GRP75/mortalin. Biochem J 343, 461-466. Mizukoshi E, Suzuki M, Misono T, Loupatov A, Munekata E, Kaul SC, Wadhwa R, Imamura T (2001) Cell-cycle dependent tyrosine phosphorylation on mortalin regulates its interaction with fibroblast growth factor-1. Biochem Biophys Res Commun 280, 1203-1209. Moll UM, Riou G, Levine AJ (1992) Two distinct mechanisms alter p53 in breast cancer: mutation and nuclear exclusion. Proc Natl Acad Sci USA 89, 7262-7266. Nakabayashi K, Ogino H, Michishita E, Satoh N, Ayusawa D (1999) Introduction of chromosome 7 suppresses telomerase with shortening of telomeres in a human mesothelial cell line. Exp Cell Res 252, 376-382. Ornatsky OI, Connor MK, Hood DA (1995) Expression of stress proteins and mitochondrial chaperonins in chronically stimulated skeletal muscle. Biochem J 311, 119-123. Poindexter BJ, Pereira-Smith O, Wadhwa R, Buja LM, Bick RJ. (2002) 3D Reaconstruction and localization of mortalin by deconvolution microscopy. Micros Anal 89, 21-23. Ran Q, Wadhwa R, Kawai R, Kaul SC, Sifers RN, Bick RJ, Smith JR, Pereira-Smith OM (2000) Extramitochondrial localization of mortalin/mthsp70/PBP74/GRP75. Biochem Biophys Res Commun 275, 174-179. Resendez E Jr, Ting J, Kim KS, Wooden SK, Lee AS (1986) Calcium ionophore A23187 as a regulator of gene expression in mammalian cells. J Cell Biol 103, 2145-2152. Rivolta MN, Holley MC (2002) Asymmetric segregation of mitochondria and mortalin correlates with the multi-lineage potential of inner ear sensory cell progenitors in vitro. Brain Res Dev Brain Res 133, 49-56. Sacht G, Brigelius-Flohe R, Kiess M, Sztajer H, Flohe L (1999) ATP-sensitive association of mortalin with the IL-1 receptor type I. Biofactors 9, 49-60. Sadekova S, Lehnert S, Chow TY (1997) Induction of PBP74/mortalin/Grp75, a member of the hsp70 family, by low doses of ionizing radiation: a possible role in induced radioresistance. Int J Radiat Biol 72, 653-660. Schneider JJ, Hood DA (2000) Effect of thyroid hormone on mtHsp70 expression, mitochondrial import and processing in cardiac muscle. J Endocrinol 165, 9-17. Singh B, Soltys BJ, Wu ZC, Patel HV, Freeman KB, Gupta RS (1997) Cloning and some novel characteristics of mitochondrial Hsp70 from Chinese hamster cells. Exp Cell Res 234, 205-216. Soltys BJ, Gupta, R. S. (1996). Immunoelectron microscopic localization of the 60-kDa heat shock chaperonin protein (Hsp60) in mammalian cells. Exp Cell Res 222, 16-27. Soltys BJ, Gupta RS (1997) Cell surface localization of the 60 kDa heat shock chaperonin protein (hsp60) in mammalian cells. Cell Biol Int 21, 315-320. Soltys BJ, Gupta RS (1999) Mitochondrial-matrix proteins at unexpected locations: are they exported ? Trends Biochem Sci 24, 174-177. Soltys BJ, Gupta RS (2000) Mitochondrial proteins at unexpected cellular locations: export of proteins from mitochondria from an evolutionary perspective. Int Rev Cytol 194, 133-196. Strub A, Lim JH, Pfanner N, Voos W (2001) The mitochondrial protein import motor. Biol Chem 381, 943-949.

Takahashi S, Mikami T, Watanabe Y, Okazaki M, Okazaki Y, Okazaki A, Sato T, Asaishi K, Hirata K, Narimatsu E, et al. (1994) Correlation of heat shock protein 70 expression with estrogen receptor levels in invasive human breast cancer. Am J Clin Pathol 101, 519-525. Takahashi M, Chesley A, Freyssenet D, Hood DA (1998) Contractile activity-induced adaptations in the mitochondrial protein import system. Am J Physiol 274, C1380-1387. Takano S, Wadhwa R, Yoshii Y, Nose T, Kaul SC, Mitsui Y (1997) Elevated levels of mortalin expression in human brain tumors. Exp Cell Res 237, 38-45. Takano S, Wadhwa R, Mitsui Y, Kaul SC (2001) Identification and characterization of molecular interactions between glucose-regulated proteins (GRPs) mortalin/GRP75/peptidebinding protein 74 (PBP74) and GRP94. Biochem J 357, 393-398. Taurin S, Seyrantepe V, Orlov SN, Tremblay TL, Thibault P, Bennett MR, Hamet P, Pshezhetsky AV (2002) Proteome analysis and functional expression identify mortalin as an antiapoptotic gene induced by elevation of [Na+]i/[K+]i ratio in cultured vascular smooth muscle cells. Circ Res 91, 915922. Wadhwa R, Kaul SC, Ikawa Y, Sugimoto Y (1993a) Identification of a novel member of mouse hsp70 family. Its association with cellular mortal phenotype. J Biol Chem 268, 6615-6621. Wadhwa R, Kaul SC, Mitsui Y, Sugimoto Y (1993b) Differential subcellular distribution of mortalin in mortal and immortal mouse and human fibroblasts. Exp Cell Res 207, 442-448. Wadhwa R, Kaul SC, Sugimoto Y, Mitsui Y (1993c) Induction of cellular senescence by transfection of cytosolic mortalin cDNA in NIH 3T3 cells. J Biol Chem 268, 22239-22242. Wadhwa R, Pereira-Smith OM, Reddel RR, Sugimoto Y, Mitsui Y, Kaul SC (1995) Correlation between complementation group for immortality and the cellular distribution of mortalin. Exp Cell Res 216, 101-106. Wadhwa R, Takano S, Robert M, Yoshida A, Reddel RR, Nomura H, Mitsui Y, Kaul SC (1998) Inactivation of tumor suppressor p53 by mot-2, an hsp70 family member. J Biol Chem 273, 29586-29591. Wadhwa R, Sugihara T, Yoshida A, Nomura H, Reddel RR, Simpson R, Maruta H, Kaul SC (2000) Selective toxicity of MKT-077 to cancer cells is mediated by its binding to the hsp70 family protein mot-2 and reactivation of p53 function. Cancer Res 60, 6818-6821. Wadhwa R, Colgin L, Yaguchi T, Taira K, Reddel RR, Kaul SC (2002a) Rhodacyanine dye MKT-077 inhibits in vitro telomerase assay but has no detectable effects on telomerase activity in vivo. Cancer Res 62, 4434-4438. Wadhwa R, Yaguchi T, Hasan MK, Mitsui Y, Reddel RR, Kaul SC (2002b) Hsp70 family member, mot-2/mthsp70/GRP75, binds to the cytoplasmic sequestration domain of the p53 protein. Exp Cell Res 274, 246-253. Wadhwa R, Yaguchi T, Taira K, Kaul SC (2003a) MortalinMPD (mevalonate pyrophosphate decarboxylase) interactions and their role in control of cellular proliferaction. Biochem Biophys Res Commun 302, 735-742. Wadhwa R, Ando H, Kawasaki H, Taira K, Kaul SC (2003b) Targeting mortalin using and RNA-helicase-coupled hammerhead ribozymes. EMBO Reports 4, 595-601. Webster TJ, Naylor DJ, Hartman DJ, Hoj PB, Hoogenraad NJ (1994) cDNA cloning and efficient mitochondrial import of pre-mtHSP70 from rat liver. DNA Cell Biol 13, 1213-1220.

177

Wadhwa et al: Can mortalin be a candidate target for cancer therapy? Wu R, Zhao YH, Plopper CG, Chang MM, Chmiel K, Cross JJ, Weir A, Last JA, Tarkington B (1999) Differential expression of stress proteins in nonhuman primate lung and conducting airway after ozone exposure. Am J Physiol 277, L511-522. Xu J, Xiao HH, Sartorelli AC (1999) Attenuation of the induced differentiation of HL-60 leukemia cells by mitochondrial chaperone HSP70. Oncol Res 11, 429-435. Dr. Renu Wadhwa, Dr. Kazunari Taira,

178

Dr Sunil Kaul

Cancer Therapy Vol 1, page 179 Cancer Therapy Vol 1, 179-190, 2003.

Therapeutic potential of antinuclear autoantibodies in cancer Review Article / Hypothesis

Vladimir P. Torchilin1*, Leonid Z. Iakoubov2**, Zeev Estrov3 1

Department of Pharmaceutical Sciences, Bouve College of Health Sciences, Northeastern University, Boston, MA; 2c/o Procyon Biopharma, Dorval, Canada; 3Department of Bioimmunotherapy, The University of Texas M.D.Anderson Cancer Center, Houston, TX

__________________________________________________________________________________ *Correspondence: Vladimir Torchilin, Ph.D., D.Sc., Department of Pharmaceutical Sciences, Northeastern University, Mugar Building, Room 312, 360 Huntington Avenue, Boston, MA 02115, USA; Tel: 617-373-3206; Fax: 617-373-8886; e-mail: v.torchilin@neu.edu ** Current address: Chronix Biomedical, Inc., Benicia, CA, USA Key Words: cancer immunotherapy, autoimmunity, natural antitumor antibodies, antinuclear autoantibodies, nucleosomes Abbreviations: MRD, minimal residual disease; AIDS, aquired immunodeficiency syndrome; NHL, non-Hodgkin’s lymphoma; mAb, monoclonal antibody; ANA, antinuclear autoantibody; IgM, immunoglobulin M; IgG, immunoglobulin G; ADDC, antibody-dependent cellular cytotoxicity; NK, natural killer; NS - nucleosome; BSA, bovine serum albumin; Kd – dissociation constant. Received: 19 August 2003; Accepted: 22 August 2003; electronically published: August 2003

Summary We review the numerous data supporting an anticancer function of certain antinuclear autoantibodies (ANAs). Circulating ANAs are well known to accompany certain pathological (autoimmunity) and physiological (aging) conditions and can be artificially induced by immunization. The pathogenic role of ANAs in autoimmunity is established; but the non-pathogenic ANAs, are generally believed not to possess any functional activity. However, important research and clinical data permit to hypothesize a definite connection between cancer and ANAs. The idea of inducing autoimmunity as an approach to enhance the immune component in cancer therapy has been proposed recently (Pardoll, D 1999, Proc Natl Acad Sci USA 10, 5340-5342). Based on the available data, we hypothesize that exogenous ANAs may be used as anticancer therapeutics. Among these ANAs, nucleosome-specific ANAs of the aged may be particularly useful since, at least in the aged, they exist as a non-pathogenic moiety, which suggests they will have minimal adverse effects when used as anticancer therapeutics. patients who have undergone allogeneic stem cell transplantation for chronic myelogenous leukemia and in patients with acute myeloid leukemia (Chang et al, 1993; Nucifora et al, 1993; Radich et al, 1995; Kenchtli et al, 1998) and childhood leukemia (Vora et al, 1998), suggesting that leukemia cells may survive for more than a decade in a dormant state. “Ultra-late” recurrences of solid tumors have been described over the years (Tsao et al, 1997; Karrison et al, 1999). Recent reports on the detection of MRD in hematological malignancies such as lymphomas as well as in solid tumors (Corradini et al, 1999; Sharp and Chan, 1999; Gath and Brakenhoff 1999; Kvalheim et al, 1999; Maguire et al, 2000) indicate that long-lasting MRD is not disease- or tissue-specific. The capability to confine tumor cells is not limited to the state of MRD. Asymptomatic occult neoplasms such as prostate cancer have been detected in elderly patients who died of unrelated causes (Gatling 1990), and “diseasespecific” fusion gene products including BCR-ABL, BCL2IgH, MLL-AF4, and the partial tandem duplications of MLL have been detected in healthy individuals who did not develop cancer during the follow-up period (Biernaux et al, 1995; Dolken et al, 1996; Uckun et al, 1998). Thus,

I. Introduction Natural control over neoplasia Studies over the past two decades have revealed the presence of neoplastic cells in cancer patients who were considered cured or who had attained complete remission following successful therapy. Tumor cells detected at a level below the resolution of conventional microscopy have been termed MRD (reviewed in Moss 1999; Faderl et al, 1999, 1999a). When MRD persists asymptomatically for years without any increment in tumor mass, the tumor is thought to be “dormant” (Uhr et al, 1997). Modern sensitive techniques such as flow cytometry, fluorescence in situ hybridization, and polymerase chain reaction have increased the sensitivity of MRD detection. Molecular evidence of residual leukemia cells has been detected in the bone marrow for as long as 9 years following completion of therapy for acute lymphoblastic leukemia (Potter et al, 1993). Low levels of MRD were found in 15 of 17 acute lymphoblastic leukemia patients who remained in complete remission 2-to-35 months after completion of all treatments (Roberts et al, 1997). Long-term persistence of MRD without clinical relapse has been observed in

179

Torchilin et al: Therapeutic potential of antinuclear autoantibodies in cancer neoplastic cells may remain dormant for years (Faderl et al, 1999, 1999a; Estrov and Freedman 1999) while the human organism successfully confines them, keeping them at a “subclinical” level. For this reason, the benefits of therapeutic intervention in patients with MRD remain questionable (Faderl et al, 1999, 1999a, 2000; Estrov and Freedman 1999). Finally, the spontaneous remission of cancer, though extremely rare (1 in 60,000 - 140,000 cancer cases) (Chang 2000), is a well-established clinical phenomenon that provides additional evidence that the human organism is capable of combating cancer. Spontaneous remission has been reported in leukemia (Bernard and Bessis 1983, Paul 1994; Bhatt et al, 1995; Dinulos et al, 1997; Grundy et al, 2000), malignant melanoma (Barr 1994) and other skin tumors (Barnetson and Halliday 1997), brain tumors (Bowles and Perkins 1999), breast cancer (Jena et al, 2000), lung cancer, and other neoplasms (Kappauf et al, 1997). This phenomenon is not age-restricted or diseaseor tissue-specific. What mechanisms does the human organism recruit to confine neoplasia, and how can they be used clinically? The data on increased tumor frequency in immunocompromised hosts indicate that immune surveillance plays an important role in tumor growth suppression. The sporadic occurrence of both virusdependent and -independent opportunistic tumors has been reported in immune-deficient patients (Ioachim 1990; Filipovich et al, 1994; Penn 2000) such as those who are immunosuppressed owing to organ or bone marrow transplantation (Penn 1993, Restrepo et al, 1999, Sobecks et al, 1999, Swinnen 2000, Kwok and Hunt 2000, Angel et al, 2000, Rinaldi et al, 2001, Haagsma et al, 2001, Bhatia et al, 2001), severe combined immunodeficiency (McClain 1997; Elenitoba-Johnson and Jaffe 2001), or AIDS (Fiegal 1999; White et al, 2001; Frisch et al, 2001). Perhaps the most compelling data are from patients with AIDS. The incidences of NHL, central nervous system NHL, and Hodgkin’s disease are approximately 100-fold, 3000-fold, and 10-fold higher in AIDS patients than the incidences in the overall population (Straus 2001). Similarly, AIDS patients have an increased risk of developing B-cell and Tcell lymphomas of all types (Biggar et al, 2001). In addition, neoplasms thought not to be immunodeficiencyrelated or virally induced, such as carcinomas of the rectum, rectosigmoid, trachea, bronchus, lung, skin, connective tissues, brain, and central nervous system have been found in AIDS patients up to 7 times more frequently than in the general population (Gallagher et al, 2000; Phelps et al, 2001; Clarke and Glaser 2001). One may assume that other, slower growing tumors might remain undetected in these patients because of their shortened life span. Of the two branches of the immune system, cellular and humoral, cellular immunity has been investigated most extensively and utilized clinically (Pardoll 2001). Donor lymphocyte infusion has been utilized to suppress tumor cell re-growth in patients treated with marrow or blood stem cell transplantation (Appelbaum 2001), and exvivo-expanded dendritic cells were successfully used in

clinical trials in patients with various neoplasms (Baggers et al, 2000). Recent success in using certain mAbs as anticancer agents has re-attracted investigators’ attention to the role of antibodies in antitumor immunity. This article reviews the evidence supporting the hypothesis that the autonomous production of anticancer antibodies is one measure used by the immune system to confine neoplasia and that certain ANAs of different etiologies confer the humoral branch of antitumor immunity.

II. Humoral immunity, ANAs, and cancer A. Autonomously produced antitumor antibodies It has been well established that natural antitumor antibodies may be present in healthy individuals (Colnaghi et al,1977, Chow et al, 1981, Colnaghi et al, 1982). The data on the potent in vivo suppression of experimental tumors by natural antibodies (Kerstin et al, 1996) support their possible tumor-preventive role. Normal human serum was shown to contain natural IgM antibodies cytotoxic to human neuroblastoma cells (Ollert et al, 1996; David et al, 1999). Preliminary results of a phase I/II clinical trial showed an effective arrest of neuroblastoma growth in patients who received such antibodies purified from the blood of healthy antibody-positive donors (Schmitt et al, 1999). Nevertheless, influenced by the limited success of tumor-specific antibodies against established tumors in early clinical trials (Jurcic et al, 1996), most investigators remained skeptical about the antineoplastic role of humoral immunity in general. Several factors were blamed for the limited success of mAb therapy: the shedding of the target antigen from the tumor cell surface, the limited capability of the antibodies to penetrate bulky tumors (Jain 1994), the antibodies’ short half-life in the circulation and limited delivery to tumor sites, the inadequate recruitment of host leukocytes bearing constant (Fc) region receptors, the internalization of the target antigens that render the neoplastic cell resistance, and the lack of highly specific tumor antigens (Schnipper and Strom 2001). Recently, mAbs targeting antigens that are not shed from the surface of tumor cells were shown to have a substantial therapeutic effect: trastuzumab (Herceptin, a mAb against HER-2/neu, a protein overexpressed in breast cancer cells) against solid tumors, and rituximab (Rituxan, a humanized mAb against the B-cell-specific antigen CD20) against hematologic malignancies (Agus et al, 2000; Marshall 2001). The clinical efficacy of these mAbs supports an important anticancer role of humoral immunity. Natural antibodies might be effective as well, particularly in the early stages of tumorigenesis, when increased intratumoral interstitial pressure, which prevents antibody penetration, does not exist. Though little is known about their targets on tumor cells (Chow et al, 1981; Aoki et al, 1966; Pierotti and Colnaghi 1967; Martin and Martin 1975; Cote et al, 1983), most natural anticancer antibodies are tumor type-specific. Nevertheless, in recent years, we have identified a subset

180

Cancer Therapy Vol 1, page 181 of natural antibodies capable of binding to the surface of a broad spectrum of cancer cells but not normal cells (Iakoubov et al, 1995, 1995a; Iakoubov and Torchilin 1997, 1998). These antibodies are the natural ANAs, which are present in a substantial proportion of healthy rodents and humans, especially, aged (Globerson 1993; Xavier et al, 1995).

aged (Ziolkowska et al, 1987) might represent such an upregulated immune mechanism. The hypothesis that certain ANAs of the aged have antitumor activity is strongly supported by the results of direct in vivo experiments, in which mAb 2C5 (monoclonal tumor cell surface-reactive ANA of IgG2a isotype obtained from non-immunized healthy aged Balb/c mouse) effectively suppressed the growth of EL4 T lymphoma in young syngeneic C57BL/6 mice and prolonged survival time in B16 melanoma-bearing mice (Iakoubov et al, 1995, 1995a, Iakoubov and Torchilin 1997). Data on the tumor reactivity and antitumor properties of some ANAs of a different origin (autoimmune ANAs and ANAs induced by immunization) (Walker and Bole 1976; Johnson and Shin 1983; LeFeber et al, 1984; Okudaira et al, 1987; Rekvig et al, 1987; Astaldi Ricotti et al, 1987; Jacob et al, 1989; Prabhakar et al, 1990; Bachman et al, 1990; Sorace and Johnson 1990; Kubota et al, 1990; Bennett et al, 1991; Mecheri et al, 1992; Klinman 1992; Bouanani et al, 1993; Raz et al, 1993; review in refs. Brinkman et al, 1990; Jacob and Viard 1992) seem to favor the hypothesis. Key properties of ANAs formulated in connection with systemic autoimmune diseases (Monestier and Kotzin 1992; Monestier et al, 1993; Casiano and Tan 1996) may also be relevant to ANAsâ&#x20AC;&#x2122; possible involvement in the control of neoplasia. ANAs are directed against certain components of functionally important subcellular particles (Mohan et al, 1993; Monestier 1997), and frequently target autoantigens associated with active cell division and proliferation. Casiano and Tan (1996) further stated that these properties â&#x20AC;&#x153;support the hypothesis that ANAs are driven by subcellular particles such as organelles or macromolecular complexes which might be in an activated or functional state. This hypothesis leads to the central question of how endogenous subcellular particles that are normally sequestered can be released from cells and exposed to the immune system in a manner that renders them capable of driving a sustained ANA response. An emerging view is that apoptosis could be a mechanism by which potentially immunostimulatory self-antigens might be released from cells.â&#x20AC;? Similar phenomena may take place in the development of a pan-specific anticancer immune response. Certain additional data discussed below, though not directly related to ANA of the aged support ANAs anticancer properties. Numerous reports provide direct and indirect evidence that ANAs unrelated to age may also possess antitumor activity. First, supportive data were obtained in studies of patients with autoimmune diseases. It was found that the mortality rate from cancer in patients with autoimmune diseases is noticeably less than that in the healthy population (Palo et al, 1977). The proportion of cancer-related deaths in patients with multiple sclerosis is 67% of that observed in the age-matched general population (Sadovnik et al, 1991). Conversely, experimental suppression of autoimmune manifestations in spontaneously autoimmune mice sharply increases the incidence of spontaneous tumors with the most common types being carcinomas, pulmonary adenomas, and

B. Possible anticancer activity of agerelated and age-unrelated ANAs Natural autoantibodies are a substantial part of the natural antibody repertoire, which is present throughout the life span of higher mammals (Cote et al, 1983, Daar and Fabre 1981, Guilbert et al, 1982, Dighiero et al, 1983, Iakoubov et al, 1988; review in ref. Avrameas 1991). It was found that the natural autoantibody repertoire of aged mice is drastically different from that of newborns and healthy adults (Sakharova et al, 1986; Iakoubov et al, 1988), with antinuclear specificity being more frequent in the aged (Xavier et al, 1995; Iakoubov et al, 1988). Ten of 11 IgG class monoclonal autoantibodies, derived from the splenocytes of healthy aged non-immunized Balb/c mice, were shown to possess antinuclear activity, whereas no such mAbas could be obtained from newborn or healthy adult non-immunized mice. Autoantibodies, such as antithyroglobulin antibodies and ANAs, have repeatedly been found at significantly higher titers in older humans and laboratory animals without overt disease than in younger controls (review in refs. Walford 1974, Globerson 1993). Although, certain natural antibodies have long been suspected to participate in host protection against neoplasia (Aoki et al, 1966; Pierotti Colnaghi 1967; Martin and Martin 1975; Chow et al, 1981; Cote et al, 1983), ANAs of the aged were believed just to reflect some disregulation in the immune system and were not known to have any functional activity (Ben-Yehuda and Weksler 1992). The presence of elevated blood levels of non-pathogenic ANAs is a characteristic feature of the immune system of the aged (Whitaker and Willkens 1966; Cammarata et al, 1967; Siegel et al, 1972; Hallgren et al, 1973; Walford 1974; Wijk 1976; Globerson et al, 1993; Xavier et al, 1995). Based on their binding specificity, it was hypothesized that ANAs of the aged are an important component of the natural autoantibody repertoire and participate in antitumor immunosurveillance (Iakoubov and Torchilin 1997). The hypothesis was also based on other considerations. Aging is an established risk factor for tumorigenesis. Various immune functions, especially those of T lymphocytes, decline with aging (review in ref. BenYehuda and Weksler 1992). However, implanted tumors grow at a significantly lower rate in aged laboratory animals than in younger ones (Weksler et al, 1990). Although this difference could be attributed to physiological changes caused by aging, such as reduced blood flow and a diminished supply of nutrients, certain immune tumor-suppressor mechanisms upregulated in the aged might compensate for the deterioration of the T-cell immune function. Age-related elevation of ANA in combination with enhanced ADCC mechanisms in the 181

Torchilin et al: Therapeutic potential of antinuclear autoantibodies in cancer lymphomas (Walker and Bole 1976, Russell and Hicks 1968, Walker et al, 1978, Hahn et al, 1975, Morris et al, 1976). These data suggest that certain components of the immune system characteristic of systemic autoimmunity may at the same time have an antitumor function (Walker and Bole 1976). An important feature of systemic autoimmunity is the presence of ANAs (review in ref. von Muhlen and Tan 1995). Although the appearance of tumors in immunosuppressed animals may be connected to the suppression of various immune mechanisms controlling tumors, some autoantibodies from autoimmune mice may have the same specificities as autoantibodies from the aged (Astaldi et al, 1987; Klinman 1992, Bouanani et al, 1993) and may thus be related to tumor control. Data from many investigators indicating the ability of autoimmune ANAs to react with the cell surface (LeFeber et al, 1984; Okudaira et al, 1987; Rekvig et al, 1987; Jacob et al, 1989; Prabhakar et al, 1990; Bachman et al, 1990; Kubota et al, 1990; Bennett et al, 1991; Mecheri et al, 1992; Raz et al, 1993; Rekvig and Hannestad 1997; Koutouzov et al, 1996; review in refs. Brinkman et al, 1990; Jacob and Viard 1992) also support such possibility. It should be emphasized that most of these investigations aimed to study ANAsâ&#x20AC;&#x2122; role in autoimmunity and to show that ANAs add to the severity of autoimmune disturbances owing to their ability to react with the cell surface; no special attention was paid to whether there are ANAs that can selectively recognize the surface of tumor cells but not normal cells. Second, ANAs have been described that appear in response to immunization. In one study, a mAb that was later found to have an antinuclear nature (Sorace and Johnson 1990), was generated by active immunization with leukemia cells. Treatment with this antibody significantly suppressed leukemia cell growth in rats engrafted with 102 - 10 3 leukemia cells (Johnson and Shin 1983). The life span of mice bearing Daltonâ&#x20AC;&#x2122;s lymphoma ascites tumor cells was increased by immunization with conjugates of guanosine-BSA, GMP-BSA, and tRNAMDSA complex before transplantation of the tumor cells (Kala and Antony 1996). In addition, nucleic acid-reactive antibodies were shown to inhibit the growth of transformed cells in vitro as a result of the higher rate of endocytosis in transformed cells. Third, a certain positive role of ANAs has been noted in some cancer patients. Multiple reports on circulating ANAs in patients with malignancies have been recently confirmed in patients with lung cancer (Fernandez-Madrid et al, 1999, Blaes et al, 2000) and colorectal carcinoma (Syrigos et al, 2000), and some of these antibodies were associated with a prolonged survival without disease progression. Earlier, antibodies against autologous tumor cell proteins in patients with small-cell lung cancer were shown to be associated with improved survival (Winter et al, 1993).

mediate ADCC, induce complement-mediated lysis, or, in some cases, trigger apoptotic cell death. The second and third of these mechanisms probably have no significant role in the antitumor effect of ANAs. Complementmediated lysis, though crucial in bacterial killing, is not considered a major mechanism in killing eukaryotic cells (Ross 1986). We are also not aware of any ANA able to initiate apoptosis, though ANA binding to surface NSs is known to induce internalization (Koutouzov et al, 1996). The monoclonal ANA 2C5 neither induced complementmediated cytotoxicity nor affected the proliferation of EL4 and S49 T cell lymphoma cells. However, the monoclonal ANA 2C5 induced significant ADCC in vitro, especially in the presence of exogenous NSs in the culture medium (Iakoubov and Torchilin 1997, 1998). That is why ADCC may underlie the efficacy of ANAs in vivo, along with the ability of ANA-based immune complexes to cause the production of immunostimulatory cytokines (Nakoin and Ralph 1988). The effectiveness of ADCC is related to the isotype of the biologically active Fc part of the immunoglobulin molecule. Differences between various murine IgG isotypes exist; there is no clear pattern, although IgG2a, IgG2b, and IgG3 have been claimed to be the most effective (Herlyn et al, 1985). These isotypes (especially IgG2a) are much less effective in mediating complement-dependent lysis of target cells. Many monoclonal ANAs originating from autoimmune mice, as well as monoclonal ANAs 2C5 and 1G3 originating from healthy aged mice (Iakoubov et al, 1995, Iakoubov and Torchilin 1997), belong to the IgG2a isotype. In addition to ADCC, the monoclonal ANA 2C5 and similar antibodies as well as immune complexes these antibodies can form with free chromatin (NSs) in cancer patientsâ&#x20AC;&#x2122; circulation might also enhance cancer immunosurveillance by activating some other tumor-specific and non-specific immune mechanisms. Routes for such activation vary from a well-known phenomenon of immune complexinduced release of inflammatory cytokines and proteolytic enzymes to recently described toll receptor-involving events (Leadbetter et al, 2002) and dendritic cells empowerment (Schuurhuis et al, 2002).

III. ANAs, nucleosomes, and cancer A. Tumor cell surface NSs as ANA targets Some ANAs with anti-DNA or antihistone specificity recognize the surface of both tumor cells and normal cells (Rekvig and Hannestad 1979, Mecheri et al, 1992, Raz et al, 1993). An ability to recognize tumor cells but not normal cells was found to be characteristic of two monoclonal ANAs of the aged with NS-restricted specificity; their target was surface-bound NSs (wellcharacterized constituents of nuclear material consisting of DNA and four pairs of histones arranged in a characteristic pattern) (Iakoubov and Torchilin 1997, 1998). One can conclude that NSs are specifically associated with tumor cells and represent a universal molecular target on their surface, whereas free DNA, individual histones, or crossreactive determinants are associated with the surface of normal cells as well.

C. Hypothetical mechanisms of antitumor activity of ANAs ANAs bind tumor cells, but it is unclear how this binding affects the cells. Unconjugated mAbs may 182

Cancer Therapy Vol 1, page 183 Nucleosome binding to the surface of tumor cells might be mediated by a 94 kDa protein on the tumor cell surface membrane, identified as a NS receptor in the human B-lymphoblastoid Raji cell line, monkey CVI cells, and rat pancreas islet tumoral cell line RINm (Jacob et al, 1989). A 50 kDa cell surface NS receptor was also recently claimed to be present on the surface of tumor cells (Koutouzov et al, 1996); this protein was identified as calreticulin by microsequencing (Seddiki et al, 2001). Although no nuclear antigens were found on the surface of freshly isolated normal blood cells (Emlen et al, 1992), the ability of certain normal blood cells to bind NSs in vitro , probably via surface DNA receptors, has been demonstrated (Bell and Morrison 1991; Hefeneider et al, 1992). Therefore, the possibility should be considered that the absence of NSs from the surface of normal cells may be explained by a low concentration of free NSs in the normal circulation rather than by the absence of an appropriate normal cell surface receptor. At the same time, free NSs originating from dead tumor cells are always present in spent media of growing tumor cell lines as well as in cancer patients (Bell and Morrison 1991; Le Lann et al, 1994). They can bind to the surface of DNA- or NSreceptor-bearing living tumor cells, which are the first cells NSs run into after being released from the dead tumor cells in vivo. In addition to binding to a chromatin-binding receptor on the surface of activated monocytes (Emlen et al, 1992), NSs may bind to the surface of activated T cells via cell surface proteoglycans, such as heparin sulfate, through an electrostatic interaction (usually of low affinity) with basic N-terminal residues of NS-forming histones (Watson et al, 1999). This finding is in agreement with data on the existence of low affinity (Kd 400 nM) receptors (in addition to NS-specific high-affinity receptors [Kd 7 nM]) on the surface of transformed cells (Koutouzov et al, 1996). Recent studies also indicated possible involvement of serum amyloid P component in chromatin binding (Bickerstaff et al, 1999). Thus, the possibility of amyloid P-mediated recognition of NSs by scavenging cells exists.

by living neighboring cells or special phagocytes via special receptors. However, free extracellular nucleochromatin has been observed in vivo under conditions accompanied by massive apoptotic death, such as lupus erythematosis, AIDS, and cancer (Emlen et al, 1994; Licht et al, 2001). Although there are clear evidences that most of circulating NSs in the blood of cancer patients originate from the tumor (Trejo-Becerril et al, 2003), the particular molecular mechanisms of NSs release from the debris of apoptotic cells are not known.

C. Practical value of measuring free blood NSs Although an elevated level of circulating NSs is not specific for any benign or malignant disorder, some recent data connecting NSs and cancer are of interest. The level of plasma NSs was significantly higher (13- to 18-fold) in patients with primary breast cancer than in individuals without cancer; some other studied cancers also showed much increased level of NSs (up to 25-fold) (Kuroi et al, 2001). The finding that sera of patients with malignant tumors contained considerably higher concentrations of NSs compared with sera of healthy persons (almost 10fold) and patients with benign diseases was also reported (Holdenrieder et al, 2001). The concentration of NSs in serum was still further increased after chemotherapy or radiotherapy. A subsequent decrease in the level of NSs often correlated with regression of the tumor (TrejoBecerril et al, 2003; Holdenrieder et al, 2001a).

D. ANAs and tumor-protective role of free NSs. Reduced NK activity in neoplastic diseases and other disorders characterized by increased (apoptotic?) cell death was reported (Moy et al, 1985; Dunlap et al, 1990). An immunosuppressive effect of apoptotic cells was noticed (Voll et al, 1997) as well as their ability to downregulate the antitumor activity of macrophages (Reiter et al, 1999). The authors of (Reiter et al, 1999) concluded that â&#x20AC;&#x153;given the fact that apoptosis is a consequence of various cancer treatment modalities, this (macrophage impairment) may lead to a suppression of local antitumor reactions and thus actually counteract endogenous immune-mediated tumor defence mechanismsâ&#x20AC;?. Extracellular chromatin fragments inhibited cell killing by NK cells in vitro (Le Lann et al, 1994; Le Lann-Terrisse et al, 1997). It is as if release of NSs into the extracellular space is a tumor self-defense mechanism against NK-mediated lysis. If so, the increased production of NS-specific cytotoxic autoantibodies may be considered an organism's effort to overcome this tumor mechanism. A similar situation has been described in autoimmune diseases (Van Bruggen et al, 1999). Data demonstrating a prolonged time to disease progression and an increased survival rate in cancer patients showing the presence of serum ANAs (Palo et al, 1977; Blaes et al, 2000; Syrigos et al, 2000) seem to support their possible antitumor activity (Figure 1).

B. Source of extracellular NSs Extracellular NSs are known to be present in substantial quantities in tumor cell cultures (Bell and Morrison 1991) as well as in patients with tumors (Le Lann et al, 1994), where they may originate from apoptotic tumor cells, which are present in varying quantities in every developing tumor in vivo (Wyllie 1993). In a dexamethasone-sensitive S49 T cell lymphoma, in which the apoptotic death was initiated among some of the cells, NSs released from apoptotic cells were able to attach to the surface of surviving tumor cells, converting them into better targets for ANAs (monoclonal ANA 2C5 binding was increased 50-fold) (Iakoubov and Torchilin 1998). Nucleosomes appear in apoptotic cells as a result of DNA fragmentation by endonucleases. It is believed that all the degraded intracellular material from an apoptotic cell is endocytosed

183

Torchilin et al: Therapeutic potential of antinuclear autoantibodies in cancer

Figure 1. Hypothetical mechanism of anticancer activity of ANAs. Based on the currently available data, the following sequence of events might be suggested. First, some tumor cells die via the apoptosis and release free nucleosomes (this phenomenon is well established). Second, these released nucleosomes (a) attach to the surface surrounding live tumor cells (b, the mechanism or this attachment as well as its physiological significance are not completely understood yet), or diffuse into the circulation (c), where some of them (d) form complexes with the circulating ANAs (e), the concentration of these complexes being especially high in the tumor vasculature. Third, in addition to the formation of immunocomplexes with nucleosomes in the circulation, some ANAs diffuse into the tumor and bind (f) nucleosomes exposed on the surface of the live tumor cells. Fourth, freely circulating immunocomplexes (g) attach immune effector cells via exposed Fc fragments (h) and make these cells activated. Fifth, as a result of all these phenomena two ANA/nucleosome-mediated antitumor mechanisms may begin to work: (I) Tumor cell killing by ANA (probably, mainly via the ADCC, though other mechanisms may also be involved); and (II) Tumor attack by various tumor-specific and non-specific immune mechanisms, including immune effector cells, activated by locally elevated concentration of ANA/nucleosome immunocomplexes.

Naschitz et al, 1995; Seda and Alarcon 1995) that complicate anticancer therapy and are clinically troublesome, the presence of ANAs and autoimmune symptoms may be beneficial. For example, patients with chronic myelogenous leukemia who develop autoimmune phenomena as a result of alpha-interferon therapy attain a significantly higher remission rate than those who do not (Sacchi et al, 1995). The antitumor function of ANAs is the first evidence of a beneficial role of ANAs for the host (Iakoubov et al, 1995a; Iakoubov and Torchilin 1997; Torchilin et al, 2001). As antitumor agents, certain ANAs may have a number of advantages compared with conventional antitumor antibodies. First, the ANAs may be effective against a broad spectrum of tumors, since they appeare reactive against the surface of various tumor cells - lymphoid and non-lymphoid, rodent and human. Second, side-effects of ANAs may be minimal, since their natural presence in the blood is not harmful to the host. Third, the underlying antitumor mechanisms may be multimodal and hence more efficient. In other words, if certain ANAs are found to be effective against a broad spectrum of tumors, future optimal treatment regimens may include the

However, the real situation may be more complex since a recent study found that both node-negative and nodepositive breast cancer patients with high plasma levels of NSs had a significantly better relapse-free survival rate than patients with low levels of NSs (Kuroi et al, 1999). Although plasma concentration of NSs was suggested as a new prognostic factor for breast cancer, the cellular and biological significance of this observation should be further investigated.

IV. ANAs as potential therapeutic agents Data accumulated over the past decade indicate that the ANAsâ&#x20AC;&#x2122; biological role should no longer be considered just a pathogenic moiety in autoimmunity (Ben-Yehuda and Weksler 1992; Isenberg et al,1994). Circulating ANAs are found in about 30% of patients with cancer (Lynn et al, 1976; Idel et al, 1978; Schattner et al, 1983; Silburn et al, 1984; Takimoto et al, 1989). Although some of these patients develop autoimmune syndromes (review in refs.

184

Cancer Therapy Vol 1, page 185 Baggers J, Ratzinger G, and Young JW (2000) Dendritic cells as immunologic adjuvants for the treatment of cancer. J Clin Oncol 18, 3879-3882. Barnetson RS, and Halliday GM (1997) Regression in skin tumors: a common phenomenon. Australas J Dermatol 38, S63-S65. Barr RJ (1994) The many faces of completely regressed malignant melanoma. Pathology 2, 359-370. Bell DA, and Morrison B (1991) The spontaneous apoptotic cell death of normal human lymphocytes in vitro: the release of, and immunoproliferative response to, nucleosomes in vitro. Clin Immunol Immunopathol 60, 13-26. Bennett R.M. Cornell K.A. Merritt M.J. Bakke A.C. Hsu P.H. and Hefeneider S.H (1991) Autoimmunity to a 28-30 kD cell membrane DNA binding protein: occurrence in selected sera from patients with SLE and mixed connective tissue disease (MCTD). Clin Exp Immunol 86, 374-379. Ben-Yehuda A, and Weksler ME (1992) Immune senescence: mechanisms and clinical implications. Cancer Invest 10, 525-531. Bernard J, and Bessis M (1983) Unexpected remissions in acute leukemia. Blood Cells 9, 71-73. Bhatia S, Louie AD, Bhatia R, O'Donnell MR, Fung H, Kashyap A, Krishnan A, Molina A, Nademanee A, Niland JC, Parker PA, Snyder DS, Spielberger R, Stein A, and Forman SJ (2001) Solid cancers after bone marrow transplantation. J Clin Oncol 19, 464-471. Bhatt S, Scheck R, Graham JM, Korenberg JR, Hurvitz CG, and Fischel-Ghodsian N (1995) Transient leukemia with trisomy 21: description of a case and review of the literature. Am J Med Genet 58, 310-314. Bickerstaff MC, Botto M, Hutchinson WL, Herbert J, Tennent GA, Bybee A, Mitchell DA, Cook HT, Butler PJ, Walport MJ, and Pepys MB (1999) Serum amyloid P component controls chromatin degradation and prevents antinuclear autoimmunity. Nat Med 5, 694-697. Biernaux C, Loos M, Sels A, Huez G, and Stryckmans P (1995) Detection of major bcr-abl gene expression at a very low level in blood cells of some healthy individuals. Blood 86, 3118-3122. Biggar RJ, Engels EA, Frisch M, and Goedert JJ (2001) AIDS Cancer Match Registry Study Group. Risk of T-cell lymphomas in persons with AIDS. J AIDS 26, 371-376. Blaes F, Klotz M, Huwer H, Straub U, Kalweit G, Schimrigk K, and Schafers HJ (2000) Antineural and antinuclear autoantibodies are of prognostic relevance in non-small cell lung cancer. Ann. Thorac Surg 69, 254-258. Bouanani M, Dietrich G, Hurez V, Kaveri S-V, Rio MD, Pau B. and Kazatchkine MD (1993) Age-related changes in specificity of human natural autoantibodies to thyroglobulin. J Autoimmun 6, 639-648. Bowles AP Jr, and Perkins E (1999) Long-term remission of malignant brain tumors after intracranial infection: a report of four cases. Neurosurgery 44, 636-642. Brinkman K, Termaat R, Berden JHM, and Smeenk RJT (1990) Anti-DNA antibodies and lupus nephritis: the complexity of crossreactivity. Immunol Today 11, 232-233. Cammarata RJ, Rodnan, GP, and Fennell RH (1967) Serum antig-globulin and antinuclear factors in the aged. JAMA 199, 455-458. Casiano CA, and Tan EM (1996) Recent developments in the understanding of antinuclear antibodies. Int Arch Allergy Immunol 111, 308-313.

monoclonal ANAs in combination with existing tumor type-specific therapies. Both clinical and laboratory data indicate that the immune system is capable of suppressing neoplastic cell growth and certain autoimmune processes are accompanied by elevated antitumor potential. Should intentional induction of autoimmunity be considered an antineoplastic therapeutic strategy (Pardoll 1999), especially against the background of observations that lupus patients are better protected from cancer (Huges 2001)? The clinical utilization of certain monoclonal ANAs appears to be an attractive option. Since ANAs in aged animals are not associated with any known abnormality, we can also expect that their application as anticancer agents will be not accompanied by adverse reactions. A possibility that tumor immunity can be uncoupled from autoimmune manifestations was demonstrated recently in another experimental system (Weber et al, 1998). In what setting should ANAs be used? It is possible that the full antitumor potential of this type of antibody can be realized only in the presence of apoptosis-inducing agents that generate the conversion of tumor cell chromatin into NSs and release of these NSs into the interstitium and binding to the surface of surviving tumor cells to make them better targets for the antibodies. As with many other antibodies, the ability of ANAs to eradicate bulky disease may be limited because of tumor penetration problems, their efficacy may lie in fighting small metastases and controlling MRD. Still, clinical trials is the only way to determine if certain ANAs are effective against a broad spectrum of tumors as many experimental data suggest.

References Agus DB, Bunn PA, Jr, Franklin W, Garcia M, and Ozols RF (2000) HER-2/neu as a therapeutic target in non-small cell lung cancer, prostate cancer, and ovarian cancer. Semin Oncol 27, Suppl 11, 53-63. Angel LF, Cai TH, Sako EY, and Levine SM (2000) Posttransplant lymphoproliferative disorders in lung transplant recipients: clinical experience at a single center. Ann Transplant 5, 26-30. Aoki T, Boyse EA, and Old LJ (1966) Occurence of natural antibody to the G (Gross) leukemia antigen in mice. Cancer Res 26, 1415-1420. Appelbaum FR (2001) Haematopoietic cell transplantation as immunotherapy. Nature 411, 385-389. Astaldi Ricotti GC, Pazzaglia M, Martelli AM, Cerino A, Bestagno M, Caprelli A, Riva S, Pedrini MA, and Facchini A. (1987) Autoantibodies to purified nuclear proteins related to DNA metabolism during aging and in SLE patients. Immunology 61, 375-381. Avrameas S (1991) Natural autoantibodies: from "horror autotoxicus" to "gnothi seauton". Immunol Today 12, 154156. Bachman M, Chang S, Slor H, Kukulies J, and Muller WE (1990) Shuttling of the autoantigen La between nucleus and cell surface after UV irradiation of human keratinocytes. Exp Cell Res 191, 171-180.

185

Torchilin et al: Therapeutic potential of antinuclear autoantibodies in cancer Chang KS, Fan YH, Stass SA, Estey EH, Wang G, Trujillo JM, Erickson P, and Drabkin H (1993) Expression of AML1ETO fusion transcripts and detection of minimal residual disease in t(8;21)-positive acute myeloid leukemia. Oncogene 8, 983-988. Chang WY (2000) Complete spontaneous regression of cancer: four case reports, review of literature , and discussion of possible mechanisms involved. Hawaii Med J 59, 379-387. Chow DA, Wolosin LB, and Greenberg AH (1981) Murine natural anti-tumor antibodies. II The contribution of natural antibodies to tumor surveillance. Int J Cancer 27, 459-461. Clarke CA, and Glaser SL (2001) Epidemiologic trends in HIVassociated lymphomas. Curr Opin Oncol 13, 354-359. Colnaghi MI, Menard S, and Torre GD (1977) Natural antitumor serum reactivity in BALB/c mice. II. Control by regulator T-cells. Int J Cancer 19, 275-280. Colnaghi MI, Menard S, Tagliabue E, and Torre GD (1982) Heterogeneity of the natural humoral anti-tumor immune response in mice as shown by monoclonal antibodies. J Immunol 128, 2757-2762. Corradini P, Ladetto M, Pileri A, ans Tarella C (1999) Clinical relevance of minimal residual disease monitoring in nonHodgkinâ&#x20AC;&#x2122;s lymphomas: a critical reappraisal of molecular strategies. Leukemia 13, 1691-1695. Cote RJ, Morrissey DM, Houghton AN, Biattie EG, and Oetgen HF (1983) Generation of human monoclonal antibodies reactive with cellular antigens. Proc Natl Acad Sci USA 80, 2026-2030. Daar AS, and Fabre JW (1981) Organ-specific IgM autoantibodies to liver, heart and brain in man: generalized occurrence and possible functional significance in normal individuals and studies in patients with multiple sclerosis. Clin Exp Immunol 46, 37-47. David K, Ollert MW, Vollmert C, Heiligtag S, Eickhoff B, Erttmann R, Bredehorst R, and Vogel CW (1999) Human natural immunoglobulin M antibodies induce apoptosis of human neuroblastoma cells by binding to a Mr 260,000 antigen. Cancer Res 59, 3768-3775. Dighiero G, Limberi P, Mazie J-C, Rouyre S, Butler-Browne GS, Whalen RG, and Avrameas S (1983) Murine hybridomas secreting natural monoclonal antibodies reacting with self antigens. J Immunol 131, 2267-2272. Dinulos JG, Hawkins DS, Clark BS, and Francis JS (1997) Spontaneous remission of congenital leukemia. J Pediatr 131, 300-303. Dolken G, Illerhaus G, Hirt C, and Mertelsmann R (1996) BCL2/JH rearrangements in circulating B cells of healthy blood donors and patients with nonmalignant diseases. J Clin Oncol 14, 1333-1344. Dunlap NE, Lane VG, Cloud GA, and Tilden AB (1990) In vitro natural killer and lymphokine-activated killer activity in patients with bronchogenic carcinoma. Cancer 66, 14991504. Elenitoba-Johnson KS, and Jaffe ES (2001) Lymphoproliferative disorders associated with congenital immunodeficiencies. Semin Diagn Pathol 14, 35-47. Emlen W, Holers VM, Arend WP, and Kotzin B (1992) Regulation of nuclear antigen expression on the cell surface of human monocytes. J Immunol 148, 3042-3048. Emlen W, Niebur J, and Kadera R (1994) Accelerated in vitro apoptosis of lymphocytes from patients with systemic lupus erythematosus. J Immunol 152, 3685-3692. Estrov Z, and Freedman MH (1999) Detection of residual disease

in acute lymphoblastic leukemia of childhood. Leuk Lymphoma 33, 47-52. Faderl S, Kurzrock R, and Estrov Z (1999) Minimal residual disease in hematologic disorders. Arch Pathol Lab Med 123, 1030-1034. Faderl S, Talpaz M, Kantarjian HM, and Estrov Z (1999a) Should polymerase chain reaction analysis to detect minimal residual disease in patients with chronic myelogenous leukemia be used in clinical decision making? Blood 93, 2755-2759. Faderl S, Talpaz M, Kantarjian HM, and Estrov Z (2000) Clinical significance of minimal residual disease in leukemia. Int J Oncol 17, 1277-1278. Fernandez-Madrid F, VandeVord PJ, Yang X, Karvonen RL, Simpson PM, Kraut MJ, Granda JL, and Tomkiel JE (1999) Antinuclear antibodies as potential markers of lung cancer. Clin Cancer Res 5, 1393-1400. Fiegal EG (1999) AIDS-associated malignancies: research perspectives. Biochim Biophys Acta 1423, C1-9. Filipovich AH, Mathur A, Kamat D, Kersey JH, and Shapiro RS (1994) Lymphoproliferative disorders and other tumors complicating immunodeficiencies. Immuniodeficiency 5, 91-112. Frisch M, Biggar RJ, Engels EA, and Goedert JJ (2001) Association of cancer with AIDS-related immunosuppression in adults. JAMA 285, 1736-1745. Gallagher B, Wang Z, Schymura MJ, Kahn A, and Fordyce EJ (2000) Cancer incidence in New York state acquired immunodeficiency syndrome patients. Am J Epidemiol 154, 544-556. Gath HJ, and Brakenhoff RH (1999) Minimal residual disease in head and neck cancer. Cancer Metastasis Rev 18, 109-126. Gatling RR (1990) Prostate carcinoma: an autopsy evaluation of the influence of age tumor grade and therapy on tumor biology. South Med J 83, 782-784. Globerson A, Tomer Y, and Shoefeld Y (1993) Aging, natural autoantibodies, and autoimmunity. In: Shoenfeld Y, Isenberg DA (eds.) Natural Autoantibodies. Tokyo: CRC Press 60-79. Goodwin JS, Searles RP, and Tung KS (1982) Immunological responses of a healthy elderly population. Clin Exp Immunol 48, 403-407. Grundy RG, Martinez A, Kempski H, Malone M, and Atherton D (2000) Spontaneous remission of congenital leukemia: a case of conservative treatment. J Pediatr Hematol Oncol 22, 252-255. Guilbert B, Dighiero G, and Avrameas S (1982) Naturally occurring antibodies against nine common antigens in normal humans. I. Detection, isolation and characterization. J Immunol 128, 2779-2787. Haagsma EB, Hagens VE, Schaapveld M, van den Berg AP, de Vries EG, Klompmaker IJ, Slooff MJ, and Jansen PL (2001) Increased cancer risk after liver transplantation: a populationbased study. J Hepatol 34, 84-91. Hahn BH, Knotts L, Ng M, and Hamilton TR (1975) Influence of cyclophosphamide and other immunosuppressive drugs on immune disorders and neoplasia in NZB/NZW mice. Arthr Rheum 18, 145-152. Hallgren HM, Buckley CE, Gilbertsen VA, and Yunis, EJ (1973) Lymphocyte phytohemagglutinin responsiveness, immunoglobulins and autoantibodies in aging humans. J Immunol 4, 1101-1107. Hefeneider SH, Cornell KA, Brown LE, Bakke AC, McCoy SL, and Bennet RM (1992) Nucleosomes and DNA bind to

186

Cancer Therapy Vol 1, page 187 specific cell-surface molecules on murine cells and induce cytokine production. Clin Immunol Immunopathol 63, 245-251. Herlyn D, Herlyn M, Steplewski Z, and Koprowski H (1985) Monoclonal anti-human tumor antibodies of six isotypes in cytotoxic reactions with human and murine effector cells. Cell Immunol 92,105-114. Holdenrieder S, Stieber P, Bodenmuller H, Busch M, Fertig G, Furst H, Schalhorn A, Schmeller N, Untch M, and Seidel D (2001) Nucleosomes in serum of patients with benign and malignant diseases. Int J Cancer 95, 114-120. Holdenrieder S, Stieber P, Bodenmuller H, Busch M, Von Pawel J, Schalhorn A, Nagel D, and Seidel D (2001a) Circulating nucleosomes in serum. Ann NY Acad Sci 954, 93-102. Huges GR (2001) Lupus patients are protected from cancer. Lupus 10, 833-834. Iakoubov LZ, and Torchilin VP (1997) A novel class of antitumor antibodies: nucleosome-restricted antinuclear autoantibodies (ANA) from healthy aged nonautoimmune mice. Oncol Res 9, 439-446. Iakoubov LZ, and Torchilin VP (1998) Nucleosome-releasing treatment makes surviving tumor cells better targets for nucleosome-specific anticancer antibodies. Cancer Det Prev 22, 470-475. Iakoubov LZ, Mongayt D, and Torchilin VP (1995) Monoclonal anti-nuclear autoantibody from the aged effectively suppresses tumor development in vivo. Cancer Biother Radiopharm 8, 299-310. Iakoubov LZ, Rokhlin OV, and Torchilin VP (1995a) Antinuclear autoantibodies of the aged reactive against the surface of tumor but not normal cells. Immunol Lett 47, 147-149. Iakoubov LZ, Sakharova AV, Romanova NV, Cherepakhin VV, Rokhlin OV (1988) Natural autoantibodies of neonatal rats detectable by the hybridoma technique. Biull Eksp Biol Med 106, 200-202. Idel H, Bunke R, and Seemayer N (1978) Antinuclear antibodies (ANA) in patients with malignant diseases: frequency of occurrence and immunological characterization. Zentralbl Bakteriol 167, 253-261. Ioachim HL (1990) The opportunistic tumors of immune deficiency. Adv Cancer Res 54, 301-317. Isenberg DA, Ehrenstein MR, Longhurst C, and Kalsi JK (1994) The origin, sequence, structure, and consequences of developing anti-DNA antibodies. Arthr Rheum 2, 169-180. Jacob L, and Viard JP (1992) Anti-DNA antibodies and their relationships with anti-histone and anti-nucleosome specificities. Eur J Med 1, 425-431. Jacob L, Viard JP, Allenet B, Anin MF, Slama FB, Vandekerckhove J, Primo J, Markovits J, Jacob F, Bach JF, et al, (1989) A monoclonal anti-double-stranded DNA autoantibody binds to a 94-kDa cell-surface protein on various cell types via nucleosomes or a DNA-histone complex. Proc Natl Acad Sci USA 86, 4669-4673. Jain RK (1994) Barriers to drug delivery in solid tumors. Sci Am 271, 58-65. Jena R, Wilson CB, and Earl H (2001) Complete resolution of metastatic breast cancer by withdrawal of hormone replacement therapy. Clin Oncol 13, 200-201. Johnson RJ, and Shin HS (1983) Monoclonal antibody against a differentiation antigen on human leukemia cells: crossreactivity with rat leukemia and suppression of rat leukemia in vivo. J Immunol 130, 2930-2936.

Jurcic JG, Scheinberg DA, and Houghton AN (1996) Monoclonal antibody therapy of cancer. Cancer Chemother Biol Resp Mod 16, 168-188. Kala KC, and Antony A (1996) Effect of nucleic acid reactive antibodies on tumor cells grown in vivo. Immunol Invest 25, 321-331. Kappauf H, Gallmeier WM, Wunsch PH, Mittelmeier HO, Birkmann J, Buschel G, Kaiser G, and Kraus J. (1997) Complete spontaneous remission in a patient with metastatic non-small-cell lung cancer. Case report, review of the literature, and discussion of possible biological pathways involved. Ann Oncol 8, 1031-1039. Karrison TG, Ferguson DJ, and Meier P (1999) Dormancy of mammary carcinoma after mastectomy. J Natl Cancer Inst 91, 80-85. Kerstin D, Ollert MW, Juhl H, Vollmert C, Erttmann R, Vogel C.-W, and Bredehost R (1996) Growth arrest of solid human neuroblastoma xenografts in nude rats by natural IgM from healthy humans. Nat Med 2, 686-689. Klinman D.M (1992) Similarities in B cell repertoire development between autoimmune and aging normal mice. J Immunol 148, 1353-1358. Knechtli CJ, Goulden NJ, Hancock JP, Grandage VL, Harris EL, Garland RJ, Jones CG, Rowbottom AW, Hunt LP, Green AF, Clarke E, Lankester AW, Cornish JM, Pamphilon DH, Steward CG, and Oakhill A (1998) Minimal residual disease status before allogeneic bone marrow transplantation is an important determinant of successful outcome for children and adolescents with acute lymphoblastic leukemia. Blood 92, 4072-4079. Koutouzov S, Cabrespines A, Amoura A, Chabre H, Lotton C, and Bach J-F (1996) Binding of nucleosomes to a cell surface receptor: redistribution and endocytosis in the presence of lupus antibodies. Eur J Immunol 26, 472-486. Kubota T, Kanai Y, and Miyasaka N (1990) Interpretation of the cross-reactivity of anti-DNA antibodies with cell surface proteins: the role of cell surface histones. Immunol Lett 23, 187-194. Kuroi K, Tanaka C, and Toi M (1999) Plasma nucleosome levels in node-negative breast cancer patients. Breast Cancer 6, 361-364. Kuroi K, Tanaka C, and Toi M (2001) Clinical significance of plasma nucleosome levels in cancer patients. Int J Oncol 19, 143-148. Kvalheim G, Naume B, and Nesland JM (1999) Minimal residual disease in breast cancer. Cancer Metastasis Rev 18,101108. Kwok BW, and Hunt SA (2000) Neoplasia after heart transplantation. Cardiol Rev 8, 256-259. Le Lann AD, Fournie GJ, Boissier L, Toutain P-L, and Benoist H (1994) In vitro inhibition of natural-killer-mediated lysis by chromatin fragments. Cancer Immunol Immunother 39,185-192. Le Lann-Terrisse AD, Fournie GJ, and Benoist H (1997) Nucleosome-dependent escape of tumor cells from naturalkiller-mediated lysis: nucleosomes are taken up by target cells and act at a postconjugation level. Cancer Immunol Immunother 43, 337-344. Leadbetter EA, Rifkin IR, Hohlbaum AM, Beaudette BC, Shlomchik MJ, and Marshak-Rothstein A (2002) ChromatinIgG complexes activate B-cells by dual engagement of IgM and Toll-like receptors. Nature 416, 603-607. LeFeber WP, Norris DA, Ryan SR, Huff JC, Lee LA, Kubo M,

187

Torchilin et al: Therapeutic potential of antinuclear autoantibodies in cancer Boyce ST, Kotzin BL, and Weston WL (1984) Ultraviolet light induced binding of antibodies to selected nuclear antigens on cultured human keratinocytes. J Clin Invest 74, 1545-1551. Licht R, van Bruggen MC, Oppers-Walgreen B, Rijke TP, and Berden JH (2001) Plasma levels of nucleosomes and nucleosome-autoantibody complexes in murine lupus: effect of disease progression and lipopolysaccharide administration. Arthr Rheum 44, 1320-1330. Lynn TC, Hsu MM, Hsieh T, Tu SM, and Hamajima K (1976) Nasopharyngeal carcinoma and Epstein-Barr virus. III. The detection of anti-nuclear antibodies. Jpn J Exp Med 46, 289-295. Maguire D, Oâ&#x20AC;&#x2122;Sullivan GC, Collins JK, Morgan J, and Shanahan F (2000) Bone marrow micrometastases and gastrointestinal cancer detection and significance. Am J Gastroenterol 95, 1644-1651. Marshall H (2001) Anti-CD20 antibody therapy is highly effective in the treatment of follicular lymphoma. Trends Immunol 4, 183-184. Martin SE, and Martin VJ (1975) Natural antibodies in normal mouse sera. Int J Cancer 15, 658-664. McClain KL (1997) Immunodeficiency states and related malignancies. Cancer Treat Res 92, 39-61. Mecheri S, Dannecker G, Dennig D, Poncet P, and Hoffman MK (1992) Anti-histone autoantibodies react specifically with the B cell surface. Mol Immunol 30, 549-557. Mohan C, Adams S, Stanik V, and Datta SK (1993) Nucleosome: a major immunogen for pathogenic autoantibody-inducing T cells of lupus. J Exp Med 177, 1367-1381. Monestier M, and Kotzin B. (1992) Antibodies to histones in systemic lupus erythematosus and drug-induced lupus syndromes. Rheum Dis Clin North Am 18, 415-436. Monestier M, Fasy TM, Losman MJ, Novick KE, and Muller S (1993) Structure and binding properties of monoclonal antibodies to core histones from autoimmune mice. Mol Immunol 30, 1069-1075. Monestier M. (1997) Autoantibodies to nucleosomes and histone-DNA complexes. Methods 11, 36-43. Morris AD, Esterly J, Chase J, and Sharp GC (1976) Cyclophosphamide protection in NZB/NZW disease. Arthr Rheum 19, 49-55. Moss TJ. (1999) Clinical relevance of minimal residual cancer in patients with solid malignancies. Cancer Metastasis Rev 18, 91-100. Moy PM, Holmes C, and Golub SH (1985) Depression of natural killer cell cytotoxic activity in lymphocytes infiltrating human pulmonary tumours. Cancer Res 45, 57-60. Nakoin I, and Ralph P (1988) Stimulation of macrophage antibody-dependent killing of tumor targets by recombinant lymphokine factors and M-CSF. Cell Immunol 116, 331340. Naschitz JE, Rozner I, Rozenbaum M, Elias N, and Yeshurun D (1995) Cancer-associated rheumatic disorders: clues to occult neoplasia. Sem Arthr Rheum 24, 231-241. Nucifora G, Larson RA, and Rowley JD (1993) Persistence of the 8;21 translocation in patients with acute myeloid leukemia type M2 in long-term remission. Blood 82, 712715. Okudaira K, Yoshizava H, and Williams RC Jr (1987) Monoclonal murine anti-DNA antibody interacts with living mononuclear cells. Arthr Rheum 30, 669-675.

Ollert MW, David K, Schmitt C, Hauenschild A, Bredehorst R, Erttmann R, and Vogel CM (1996) Normal human serum contains a natural IgM antibody cytotoxic for human neuroblastoma cells. Proc Natl Acad Sci USA 93, 44984503. Palo J, Duchesne J, and Wilkstrom J (1977) Malignant diseases among patients with multiple sclerosis. J Neurol 216, 217222. Pardoll D (2001) T cells and tumors. Nature 411, 1010-1012. Pardoll DM (1999) Inducing autoimmune disease to treat cancer. Proc Natl Acad Sci USA 10, 5340-5342. Paul R, Remes K, Lakkala T, and Peliniemi TT (1994) Spontaneous remission in acute myeloid leukemia. Br J Haematol 86, 210-212. Penn I (1993) The effect of immunosuppression on pre-existing cancers. Transplantation 55, 742-747. Penn I (2000) Post-transplant malignnacy: the role of immunosuppression. Drug Saf 23, 101-113. Phelps RM, Smith DK, and Heilig CM (2001) Cancer incidence in women with or at risk for HIV. Int J Cancer 94, 753-757. Pierotti MA, and Colnaghi MI (1967) Natural antibodies directed against murine lymphosarcoma cells: variability of level in individual mice. Int J Cancer 18, 223-229. Potter MN, Stewart CG, and Oakhill A (1993) The significance of detection of minimal residual disease in childhood acute lymphoblastic leukemia. Br J Haematol 83, 412-418. Prabhakar BS, Allaway GP, Srinivasappa J, and Notkins AL (1990) Cell surface expression of 70-kD component of Ku a DNA-binding nuclear autoantigen. J Clin Invest 86, 13011305. Radich JP, Gehly G, Gooley T, Bryant E, Clift RA, Collins S, Edmands S, Kirk J, Lee A, Kessler P, et al, (1995) Polymerase chain reaction detection of BCR-ABL fusion transcript after allogeneic marrow transplantation of CML: results and implications in 346 patients. Blood 85, 26322638. Raz E, Ben-Bassat H, Davidi T, Shlomai Z, and Eilat D (1993) Cross-reactions of anti-DNA autoantibodies with cell surface proteins. Eur J Immunol 23, 383-390. Reiter I, Krammer B, and Schwamberger G (1999) Cutting edge: differential effects of apoptotic versus necrotic tumor cells on macrophage antitumor activities. J Immunol 163, 17301732. Rekvig O.P. and Hannestad K (1997) Certain polyclonal antinuclear antibodies crossreact with the surface membrane of human lymphocytes and granulocytes. Scand J Immunol 6, 1041-1054. Rekvig OP, and Hannestad K (1979) Properties of antinuclear antibodies that cross-react with plasma membranes. Scand J Immunol 9, 325-32. Rekvig OP, Muller S, Briand JP, Skogen B, and Van Regenmortel MH (1987) Human antinuclear autoantibodies crossreacting with the plasma membrane and the N-terminal region of histone H2B. Immunol Invest 16, 535-547. Restrepo A, Albrecht F, Raez LE, Fernandez HF, Nassiri M, Byrne G Jr, and Cassileth PA (1999) Post-liver transplantation lymphoproliferative disorders with and without infusions of donor bone. Crit Rev Oncogenesis 10, 239-245. Rinaldi M, Pellegrini C, D'Armini AM, Aiello M, Negri M, Arbustini E, Ippoliti G, and Vigano M (2001) Neoplastic disease after heart transplantation: single center experience. Eur J Cardiothorac Surg 19, 696-701.

188

Cancer Therapy Vol 1, page 189 Roberts WM, Estrov Z, Ouspenskaia MV, Johnston DA, McClain KL, and Zipf TF (1997) Measurement of residual leukemia during remission in childhood acute lymphoblastic leukemia. N Engl J Med 336, 317-323. Ross GD. Introduction and history of complement research. (1986) In: Ross GD (ed.). Immunology of the complement system. New York: Academic Press, 1-9. Russell PJ, and Hicks JD (1968) Cyclophosphamide treatment of renal disease in (NZBxNZW)F1 hybrid mice. Lancet 1, 440446. Sacchi S, Kantarjian H, Oâ&#x20AC;&#x2122;Brien S, Cohen PR, Pierce S, and Talpaz M (1995) Immune-mediated and unusual complications during interferon alfa therapy in chronic myelogenous leukemia. J Clin Oncol 13, 2401-2407. Sadovnik AD, Eisen K, Ebers GC, and Paty DW (1991) Cause of death in patients attending multiple sclerosis clinics. Neurology 41, 1193-1196. Sakharova AV, Iakoubov LZ, Grivennikov IA, Romanova NV, and Lobazina NYu (1986) Ontogenetic changes in the spectrum of specificities of natural monoclonal autoantibodies reacting with nerve tissue antigens. Zh Obshch Biol 47, 625-630. Schattner A, Shani A, Talpaz M, and Bentwich Z (1983) Rheumatoid factors in the sera of patient with gastrointestinal carcinoma. Cancer 52, 2156-2161. Schmitt C, David K, Hiller J, Schrum J, Bredehorst R, Vogel CW, Loliger C, and Erttmann R (1999) Natural human IgMantibodies in neuroblastoma therapy: preliminary findings of a phase I/II clinical trial. Klin Padiatr 211, 314-318. Schnipper LE, and Strom TB (2001) A magic bullet for cancer â&#x20AC;&#x201C; how near and how far? N Engl J Med 345, 283-284. Schuurhuis DH, Ioan-Facsinay A, and Nagelkerken, B (2002) Antigen-antibody immune complexes empower dendritic cells to efficiently prime specific CD8+ CTL responses in vivo. J Immunol 168, 2240-2246. Seda H, and Alarcon GS (1995) Musculoskeletal syndromes associated with malignancies. Curr Opin Rheumatol 7, 4853. Seddiki N, Nato E, Lafaye P, Amoura Z, Piette JC, and Mazie JC (2001) Calreticulin, a potential cell surface receptor involved in cell penetration of anti-DNA antibodies. J. Immunol. 166, 6423-6429. Sharp JG, and Chan WC (1999) Detection and relevance of minimal disease in lymphomas. Cancer Metastasis Rev 18, 127-142. Siegel BV, Brown M, and Morton JI (1972) Detection of antinuclear antibodies in NZB and other mouse strains. Immunology 22, 457-463. Silburn PA, Neil JC, Khoo SK, Daunter B, Hill R, Collins RG, and Mackay EV (1984) Immune complexes in ovarian cancer: association between IgM class complexes and antinuclear autoantibodies in ascitic fluid. Int. Arch. Allergy Appl Immunol 74, 63-66. Sobecks RM, Le Beau MM, Anastasi J, and Williams SF (1999) Myelodysplasia and acute leukemia following high-dose chemotherapy and autologous bone marrow or peripheral blood stem cell transplantation. Bone Marrow Transplantation 23, 1161-1165. Sorace JM, and Johnson RJ (1990) A cytotoxic monoclonal antileukemia antibody binds to histone H1. Hybridoma 5, 419427. Straus DJ (2001) HIV-associated lymphomas. Curr Oncol Rep 3, 260-265, 2001.

Swinnen LJ (2000) Diagnosis and treatment of transplant-related lymphoma. Ann Oncol 11, Suppl 1, 45-48. Syrigos KN, Charalambopoulos A, Pliarchopoulou K, Varsamidakis N, and Machairas A, Mandrekas D (2000) The prognostic significance of autoantibodies against dsDNA in patients with colorectal adenocarcinoma. Anticancer Res 20, 4351-4353. Takimoto T, Ishikawa S, Masuda K, Tanaka S, Yoshizaki T, and Umeda R (1989) Antinuclear autoantibodies in the sera of patients with nasopharyngeal carcinoma. Am J Otolaryngol 10, 399-403. Torchilin VP, Iakoubov LZ, and Estrov Z (2001) Antinuclear autoantibodies as potential antineoplastic agents. Trends Immunol 22, 424-427. Trejo-Becerril C, Perez-Cardenas E, Trevino-Cuevas H, TajaChayeb L, Garcia-Lopez P, Segura-Pacheco B, ChavezBlanco A, Lizano-Soberon M, Gonzalez-Fierro A, Mariscal I, Wegman-Ostrosky T, and Duenas-Gonzalez A (2003) Circulating nucleosomes and response to chemotherapy: An in vitro, in vivo and clinical study on cervical cancer patients. Int J Cancer 104, 663-668. Tsao H, Cosimi AB, and Sober AJ (1997) Ultra-late recurrence (15 years or longer) of cutaneous melanoma. Cancer 79, 2361-2370. Uckun FM, Hermann-Hatten K, and Crotty ML (1998) Clinical significance of MLL-Af4 fusion transcript expression in the absence of a cytogenetically detectable t(4;11)(q21;q23) chromosomal translocation. Blood 92, 810-821. Uhr JW, Scheuermann RH, Street NE, and Vitetta ES (1997) Cancer dormancy: opportunities for new therapeutic approaches. Nat Med 3, 505-509. Van Bruggen MC, Kramers C, Hylkema MN, Smeenk RJ, and Berden JH (1999) Pathophysiology of lupus nephritis: the role of nucleosomes. Neth J Med 199445, 273-279. Voll RE, Herrmann M, Roth EA, Stach C, Kalden JR, and Girkontaite I ( 1997) Immunosuppressive effects of apoptotic cells. Nature 390, 350-351. von Muhlen CA, and Tan EM (1995) Autoantibodies in the diagnosis of systemic rheumatic diseases. Semin Arthr Rheum 24, 323-358. Vora A, Frost L, Goodeve A, Wilson G, Ireland RM, Lilleyman J, Eden T, Peake I, and Richards S (1998) Late relapsing childhood lymphoblastic leukemia. Blood 92, 2334-2337. Walford RL (1974) Immunologic theory of aging: current status. Fed Proc 33, 2020-2027. Walker SE, and Bole GG (1976) Suppressed heterogeneous antinuclear antibody response in lymphoma bearing NZB/NZW mice. Clin Exp Immunol 24, 210-217. Walker SE, Anver MR, Schechter SL, and Bole GG (1978) Prolonged lifespan and high incidence of neoplasms in NZB/NZW mice treated with hydrocortisone sodium succinate. Kidney Int 14, 151-157. Watson K, Gooderham NJ, Davies DS, and Edwards RJ (1999) Nucleosomes bind to cell surface proteoglycans. J Biol Chem 274, 21707-21713. Weber LW, Bowne WB, and Wolchok JD (1998) Tumor immunity and autoimmunity induced by immunization with homologous DNA. J Clin Invest 102,1258-1264. Weksler ME, Tsuda T, Kim YT, and Siskind GW (1990) Immunobiology of aging and cancer. Cancer Detect Prev 14, 609-611. Whitaker RR, and Willkens RF (1966) Antinuclear factors in the aged. Clin Res 14, 143.

189

Torchilin et al: Therapeutic potential of antinuclear autoantibodies in cancer White JD, Bowman CA, and Woll PJ (2001) Lung cancer as the presenting feature of AIDS. Lung Cancer 33, 81-87. Wijk A (1976) Antinuclear antibodies in sera from healthy blood donors. Acta Pathol. Microbiol Scand 84, 215-221. Winter SF, Sekido Y, Minna JD, McIntire D, Johnson BE, Gazdar AF, and Carbone DP (1993) Antibodies against autologous tumor cell proteins in patients with small-cell lung cancer: association with improved survival. J Natl Cancer Inst 85, 2012-2018. Wyllie AH (1993) Apoptosis. (the 1992 Frank Rose Memorial Lecture). Br J Cancer 67, 205-208. Xavier RM, Yamauchi Y, Nakamura M, Tanigawa Y, Ishikura H, Tsunematsu T, and Kobayashi S (1995) Antinuclear antibodies in healthy aging people: a prospective study. Mech Ageing Dev 78, 145-154.

Ziolkowska M, Nowak JJ, and Ryzewska A (1987) ADCC in aging rats with methylcholanthrene-induced sarcoma (MCSa). Arch Immunol Ther Exp 35, 853-862.

Dr. Vladimir P. Torchilin

190

Cancer Therapy Vol 1, page 191 Cancer Therapy Vol 1, 191-196, 2003.

Filgrastim use: evaluation in cancer and critically ill non- cancer patients Research Article

Yolande B. Saab*, Leyla Sharaf, Ismail Zeidan, Abdelrahman Bizri School of Pharmacy, Lebanese American University, Byblos, Lebanon

__________________________________________________________________________________ *Correspondence: Yolande B. Saab, PharmD, School of Pharmacy, Lebanese American University, Byblos, Lebanon, P.O.Box: 36 F 19; Tel: 961-9-547254 (Ext: 2312); Fax: 961-9-54725; e-mail: ysaab@lau.edu.lb Key Words: filgrastim, G-CSF, febrile neutropenia, sarcoma, leukemia, lymphoma Abbreviations: ANC, absolute neutrophil count; G-CSF, granulocyte colony-stimulating factors Received: 19 August 2003; Accepted: 3 September 2003; electronically published: September 2003

Summary Since 1991, the benefits of using colony-stimulating factors (CSF) in cancer patients were evolving. They included preventing febrile neutropenia, decreasing its severity and duration, and reducing the risk of infection associated with dose intensive cancer chemotherapy. The American Society of Clinical Oncology (ASCO) guidelines summarize current data on the appropriate use of CSFs. If the rate of febrile neutropenia for a given combination chemotherapy regimen is <40%, routine prophylactic use of a CSF is not considered cost-effective and is not recommended by ASCO. In randomly selected patient population of 113 patients, filgrastim, a granulocyte CSF (GCSF), use was evaluated. The following parameters including indications, dosage, route of administration, day of initiation, day of discontinuation, and absolute neutrophil count monitoring plan were evaluated for appropriateness based on ASCO guidelines. The results of this drug utilization review suggest a strong need for optimization of G-CSF use in our hospital setting. The major areas of optimization are: initiation and duration of G-CSF therapy, control of G-CSF use in febrile neutropenia, dosing, and the need for increasing the frequency of G-CSF use as prophylaxis. Clinical Oncology, 1994). Since then, the guidelines were updated twice in March 1996 and in October 2000 (Ozer et al, 2000). A list of the relevant updated recommendations for the use of CSF are as follows: 1. Primary administration of CSF should be reserved for patients expected to experience a 40% or greater risk of febrile neutropenia; i.e., patients with compromised bone marrow, advanced cancer, advanced age, active infection, and/or open wounds. 2. Secondary prophylactic CSF administration can be considered in subsequent chemotherapy cycles of equal dose intensity if febrile neutropenia occurs with a prior cycle. 3. As adjunct to peripheral blood progenitor cell (PBPC) mobilization and post-transplantation, CSFs are effective. (A higher dose of G-CSF (10mcg/kg/day) in the setting of mobilization may be considered). 4. In established febrile neutropenia in certain highrisk patients (e.g., patients with pneumonia, hypotension, sepsis syndrome, multiorgan dysfunction, fungal infection, uncontrolled primary disease, or profound neutropenia (absolute neutrophil count (ANC) < 100/mcL), the use of CSFs together with antibiotics may be rational. 5. In patients with acute leukemia and myelodyplastic syndromes, G-CSF use is not

I. Introduction Filgrastim, a granulocyte colony-stimulating factor (G-CSF), is a hematopoietic hormone promoting the growth and maturation of myeloid cells, and in particular, the proliferation and differentiation of neutrophils (Valley, 2002). In 1991, filgrastim was marketed in the U.S to substantially reduce the duration and severity of neutropenia. Clinical trials have then indicated that CSFs enhanced patient quality of life, and reduced hospital costs (Hartmann et al, 1997; McQuaker et al, 1997; Ozer et al, 2000; Valley, 2002) by reducing the days of hospitalization and total number of days of treatment with parenteral antibiotics (Crawford et al, 1991; Valley et al, 2002). G-CSF has been safely administered in the prevention of infection as manifested by febrile neutropenia with non-myeloid malignancies, in druginduced neutropenia for longer periods, in chemotherapyinduced neutropenia and in congenital and cyclic neutropenia (Hammond et al, 1989; Heard and Fink 1999). Also, filgrastim has been effective in intra-abdominal sepsis, neonatal sepsis, and pneumonia (Kollef, 1999; Bernstein et al, 2001; Khadaroo and Marshall, 2002). To optimize CSF use, the American Society of Clinical Oncolgy (ASCO) adopted evidence-based guidelines in September 1994 (American Society of 191

Saab et al: Filagrastim use: evaluation in cancer and critically ill non- cancer patients recommended before or during chemotherapy for priming effects; however, CSFs are recommended after completion of chemotherapy. 6. G-CSF administration in patients with acute lymphoblastic leukemia should begin after completion of the first few days of chemotherapy of the initial induction or first post-remission course, thus shortening the duration of neutropenia of less than 1000/mm3 by approximately one week. 7. In drug- induced neutropenia (e.g. neutropenic patients receiving pentamidine for treatment of pneumocystis pneumonia) CSF shall be considered, as well. CSF dosing, initiation, duration, and ANC monitoring are among other issues addressed by the ASCO guidelines. The objective of this study was to assess the extent of compliance of G-CSF use with the ASCO guidelines.

were curative in 66% courses and palliative in 34% courses. Only 10% of G-CSF courses were started on inpatient basis but continued on outpatient basis. Outpatient prescriptions for G-CSF were excluded from the study.

B. Indications The majority of patients (81) were admitted for febrile neutropenia. Approximately 62% of G-CSF courses were administered to patients with established febrile neutropenia or pancytopenia following chemo and/or radiotherapy (Table 2). Five patients received G-CSF for PBPC mobilization and post infusion support. Also 22.5% and 19% of G-CSF courses were for primary and secondary prophylaxis, respectively. Twelve episodes of febrile neutropenia requiring hospitalization occurred while patients were receiving G-CSF for primary or secondary prophylaxis. In all cases, G-CSF was continued during hospitalization.

II. Materials and methods

Table 1. Patient Diagnoses.

The study was conducted in a 430-bed university hospital with inpatient and out-patient care services, including a PBPC transplant unit. A total of 113 patients who received G-CSF between February 1999 and May 2003 were identified and selected randomly through the pharmacy computer system. The charts were retrieved from the department of health records. Included in the study were medical records with complete and sufficient data for cancer patients and those with autologous PBPC donation and other causes of neutropenia (neonatal sepsis, pneumonia, and septic shock). Outpatients and neutropenic HIV patients were excluded from the study. A data collection standard form was developed, pre-tested, and modified prior to including the following data: Patient demographic details (ID number, gender, age, weight, etc), prescribing data for the use of filgrastim (cancer and critically ill non-cancer patients), admitting diagnosis, and units of admission. Chemotherapy intent was classified as curative or palliative based on the assessment of the malignancy type and its stage. Dose, dosing interval, duration of therapy, route of administration, ANC monitoring plan, and major adverse effects were also included. Results were recorded and analyzed using a database system (SPSS). Microsoft Excel was used to produce related figures. Drug use was evaluated for appropriateness based on whether ASCO guidelines were adopted.

Diagnosis

No. Patients n =113 (%) 3 (2.6) 3(2.6) 3(2.6)

Breast cancer Kidney tumor Neutropenia of premature birth/ Neonatal sepsis / Drug-induced cancer/ Aplastic anemia Acute lymphoblastic leukemia 8 (7.1) Acute myeloid leukemia 16 (14.1) Nonhodgkin’s lymphoma 13 (11.5) Metastatic pancreatic cancer 4 (3.5) Hodgkin’s disease 3 (2.6) Neuroblastoma 4 (3.5) Multiple myeloma 2 (1.8) Non small-cell lung cancer 6 (5.3) Burkitt lymphoma 6 (5.3) Sarcoma 17 (15) Germ cell and pineal gland tumor 1 (0.9) Medulloblastoma 1 (0.9) Hairy cell leukemia 1 (0.9) Septic shock /Acute respiratory 3 (2.6) syndrome/ Pneumonia/ Multi organ dysfunction Metastatic colon carcinoma 2 (1.8) Walderstrom’s 1 (0.9) macroglobulinemia Astrocytoma 1 (0.9) Myelodysplasia / Anemia 1 (0.9) Retinoblastoma 2 (1.8) Squamous cell carcinoma 2 (1.8) Spindle cell carcinoma 1 (0.9) Ovarian cancer 1 (0.9) Chromic lymphoblastic leukemia 1 (0.9) Gastric adenocarcinoma 1 (0.9) Metastatic rectal carcinoma 1 (0.9) Mantle cell lymphoma 2 (1.8) Non small cell lung cancer 1 (0.9) Cholangiocarcinoma 1 (0.9) Glioma multiforme (occipital) 1 (0.9)

III. Results A. Patient characteristics: Oncology patients accounted for 92%, whereas the remaining applied to intensive care unit patients. The median patient age was 39.5 years (range: 0– 85). Female subjects constituted 47.3% and 32% were of the pediatric age. The patient diagnosis as well as the type of malignancy in cancer patients is listed in Table 1. A total of 173 courses of chemotherapy and radiation therapy were administered to 113 patients. Out of 173 G-CSF courses, 137 were thoroughly followed and included in the study. The goals of chemotherapy and radiation therapy

192

No. G-CSF courses n =173 (%) 4 (2.3) 3 (1.7) 4 (2.3) 14 (8.1) 32 (18.5) 19 (11) 5 (3) 3 (1.7) 6 (3.5) 4 (2.3) 8 (4.6) 8 (4.6) 29 (16.7) 1 (0.6) 1 (0.6) 1 (0.6) 6 (3.5) 2 (1.2) 1 (0.6) 1 (0.6) 1 (0.6) 6 (3.5) 3 (1.7) 1 (0.6) 1 (0.6) 1 (0.6) 2 (1.2) 1 (0.6) 2 (1.2) 1 (0.6) 1 (0.6) 1 (0.6)

Cancer Therapy Vol 1, page 193 Moreover, in 60% of febrile neutropenic patients, one or more high risk factor (pneumonia, sepsis, hypotension, multiorgan dysfunction, fungal infection, ANC<100/mm3) was concomitantly present (Figure 1).

unresponsive pancytopenia associated with sepsis and pneumonia. However, G-CSF was prescribed for daily subcutaneous administration in 109 patients. The usual prescribed dose was 5 mcg/kg/day. In 24 patients, doses were increased by 5 mcg/kg/day according to the duration and severity of neutropenia. In 5 patients, 5 mcg/kg of GCSF were given three times daily. For peripheral blood progenitor cell collection (n=4) and post-infusion support, the dose of G-CSF was 10 mcg/kg/day. A total of 101 (74%) G-CSF courses were rounded to a G-CSF vial size (300 mcg). The thirty-three courses not rounded to a vial size were dosed exactly at 5 or 10 mcg/kg. In 40 courses, the doses were 210 mcg. In these instances, several doses were obtained from a single vial. Doses < 5 mcg/kg/day are listed in Table 3.

C. Reported adverse effects of G-CSF Bone pain was reported in nineteen (16.5%) patients receiving G-CSF. In one patient, G-CSF use was associated twice with maculopopular rash necessitating discontinuation of the drug and replacement with a granulocyte macrophage CSF.

D. Dosing Only in 4 patients, G-CSF was prescrided for intravenous administration because of a profound

Figure 1. Risk factors justifying the use of G-CSF in febrile neutropenia according to ASCO guidelines. (MOF: Multiorgan dysfunction; ANC: Absolute neutrophil count).

Table 2. Indications for G-CSF courses. Indications Primary prophylaxis Secondary prophylaxis Peripheral blood progenitor cell mobilization Following peripheral blood progenitor cell infusion Established febrile neutropenia post radiation Established febrile neutropenia post chemotherapy Sepsis syndrome/ Drug-induced cancer/ Pneumonia/ Febrile neutropenia/ Neutropenia of premature birth Post induction chemotherapy in acute lymphoblastic leukemia Post consolidation chemotherapy in acute myeloid leukemia Chemotherapy induced a febrile neutropenia or pancytopenia Aplastic anemia Inappropriate indications a one G-CSF course could be used for more than one of the above mentioned indications. (n=186)

No. of G-CSF courses na (%) 31 (17) 26 (14) 4 (2) 4 (2) 6 (3) 59 (32) 12 (6) 4 (2) 5 (3) 20 (11) 4 (2) 11(6)

Table 3. Discrepancies between calculated G-CSF doses per body weight and actual administered doses (Underdosing). No. G-CSF courses (n=66)

Discrepancy (-) < 6% (-) 10% - 17% (-) 20% - 27% (-) 30% - 46%

13 29 18 6

193

Saab et al: Filagrastim use: evaluation in cancer and critically ill non- cancer patients CSF by mailing surveys to oncologists, indicated that the majority of G-CSF use was similar to that recommended by the ASCO guidelines, except that most physicians chose to use G-CSFs for the treatment of febrile neutropenia, an indication not supported by ASCO guidelines (Bennett et al, 1996). A total of 35% of physicians described discontinuing CSFs with an ANC of ! 4999/mm3 and 65% with ANC of ! 9999/mm3. In addition, Baker et al, (2000) conducted a drug utilization evaluation on G-CSF use in cancer patients. 65% of GCSF courses in their study were prescribed for primary prophylaxis. Of these, 74% followed chemotherapy in patients with an expected incidence of febrile neutropenia " 40%. They found that the greatest departure from the ASCO guidelines included aspects of initiation and discontinuation of G-CSF courses and inadequate documentation of ANC recovery. Our drug utilization review emphasized on whether G-CSF multiuse at a 430 bed hospital was compliant with 2000 the ASCO guidelines. The majority (88%) of prophylactic G-CSF courses were appropriately prescribed. In some cases, G-CSF administration followed a dose-intensive chemotherapy with an expected incidence of febrile neutropenia of >40% like sarcomas, non-Hodgkinâ&#x20AC;&#x2122;s lymphoma, Burkitt lymphoma, acute myeloid leukemia and acute lymphoblastic leukemia (Manero and Kantarjian, 2000; Ozer et al, 2000, Holdsworth , 2001). Some courses followed chemotherapy in patients with compromised bone marrow reserve secondary to extensive prior chemoor radiotherapy, with poor performance status and more advanced cancer, or patients with advanced age.

E. Initiation and Duration The initiation of G-CSF is described for almost all GCSF courses (Table 4). As for prophylactic G-CSF courses 77% were initiated 24 hours after the last dose of chemotherapy. The rest started 48 hours post chemotherapy. Approximately 42.5% of prophylactic GCSF courses were initiated following chemotherapy of one to two day duration, 29% following three-day duration chemotherapy and 16% following chemotherapy of fiveday duration. Three patients were given G-CSF 24 hours before starting chemotherapy cycle because they were found to have neutropenia (based on ANC readings) upon admission. The mean duration of G-CSF therapy was 4.8 days (range: 1-25 days).

F. Monitoring and Discontinuation Absolute neutrophil count values at day of G-CSF initiation are shown in Figure 2. In 35 courses, ANC was far less than 200/mm3 when G-CSF was initiated. Inpatients' ANCs were monitored on a daily basis in 96% of cases. Among 137 G-CSF courses, 126 had ANC results documented on the day of discontinuation, or even two days following discontinuation while 10 courses were continued on an outpatient basis. ANC values at day of GCSF discontinuation are shown in Figure 3.

IV. Discussion A few studies have evaluated the use of G-CSF. In a multi-center drug utilization review, a total of 31% and 49% of G-CSF use were proven to be inappropriate with respect to the indication and dose, respectively (Yim et al, 1995). Another study, conducted to assess the use of G-

Table 4. Day of G-CSF initiation in patients receiving chemotherapy. a Duration of Chemotherapy (No of days)

Day of G-CSF initiation -1 0 1 2 3 1 3 17 1 2 4 3 4 5 6 a The G-CSF uses for established febrile neutropenia were not included in this table.

Figure 2. ANC at day of G-CSF initiation.

4 2 13 -

5 3 4 3 -

6 1 10 -

7 1

Figure 3. ANC at day of G-CSF discontinuation

194

8 1 -

Cancer Therapy Vol 1, page 195 its routine use. As much as 74% of G-CSF courses were rounded to a G-CSF vial size (300 mcg) to enhance patient convenience and reduce costs without compromising clinical response. As for initiating CSFs compared to ASCO guidelines, at least 53 doses in our patient sample would have been eliminated if G-CSF use were started at 48-72 hours rather than 24 hours after chemotherapy regimens of three days or less while retaining efficacy. In 93% of our reviewed "more than 3 day" chemotherapy regimens, patients received prophylactic G-CSF 24 hours after the last dose of chemotherapeutic agent. According to ASCO recommendations, G-CSF should be started 24 hours after chemotherapy administration in patients receiving chemotherapy regimens lasting more than 4 days to avoid possibility of therapeutic failure. In 3 patients, G-CSF therapy was initiated 24 hours before chemotherapy cycle because they were found to be leukopenic upon admission, neglecting the potential sensitivity of rapidly dividing myeloid cells to cytotoxic chemotherapy (Lacy et al, 2002). Note that ANC >1000/mm3 and platelets>100000/ 3 mm are two conditions allowing for initiating a doseintensified chemotherapy. Although studies have investigated optimal schedules for administering G-CSF (Ribas et al, 1996; Soda and Kanda, 1996), in our study, daily ANC monitoring was recorded for all hospitalized patients during each course of G-CSF therapy. However, in patients who were discharged on G-CSF, it was impossible to monitor ANC because outpatients were excluded from our study. To evaluate CSF response, the ASCO guidelines (McQuaker et al, 1997; Ozer et al, 2000) recommend assessing a response to GSFs by obtaining ANCs twice weekly and documenting the neutrophil nadir, as well as the recovery. ANC parameters, and the predicted time for neutrophil recovery following the nadir should determine the duration of G-CSF therapy. Since the timing of neutrophil nadir varies among patients, ANC remains the most reliable parameter defining the duration of G-CSF therapy. In our patient sample, the mean duration of G-CSF therapy was 5 days. However, the range was very wide (125 days) because in 36 out of 137 G-CSF courses, G-CSF was used for prolonged febrile neutropenia. In our study, most of G-CSF administration as prophylaxis lasted less than seven days. Comparable to previous studies, this finding needs further evaluation to assess clinicians' compliance in using the neutrophil nadir and recovery as endpoints of CSF therapy. In established febrile neutropenia, discontinuation of G-CSF administration is mainly based on ANC monitoring; consequently, earlier discontinuation of GCSF and decreasing cost while maintaining effectiveness would result (Crawford et al, 1992). In this review study, 77% G-CSF courses were discontinued with an ANC <10000 cells/mm3, while 14% of courses achieved ANC> 10000 cells/mm3. Moreover, 8% of evaluated G-CSF courses did not have an ANC recorded within 48 hours of discontinuation of G-CSF.

As for G-CSF courses that followed chemotherapy cycles for prophylaxis, G-CSF dosage reductions could improve patient convenience and decrease the cost of the treatment. In addition, the use of G-CSF post-induction chemotherapy in acute lymphoblastic leukemia and postconsolidation chemotherapy in acute myeloid leukemia in 7 of our patients has been recommended by the updated 2000 evidence based ASCO guidelines (Ozer et al, 2000). The use of G-CSF for established cases of febrile neutropenia demonstrated a strong need for improvement (Berghmans, 2002). Approximately 77 % of our G-CSF courses were for established febrile neutropenia and chemotherapy induced established pancytopenia. As much as 80% of febrile neutropenia cancer patients did not receive G-CSF prophylaxis post-chemotherapy, which demonstrated a gap in the strategy followed in the Oncology unit to prevent neutropenic fever. A small percentage (9%) of the courses were indicated for critically ill non-cancer patients but presenting with either septic shock, drug-induced cancer, pneumonia, neutropenia of premature birth, multiorgan failure, or drug-induced aplastic anemia. The ASCO guidelines recommend that CSFs may be warranted in high risk patients with febrile neutropenia with certain prognostic factors, such as pneumonia, hypotension, multiorgan dysfunction, sepsis syndrome, fungal infection or ANC<100/mm3 (Ozer et al, 2000). However, only fourty-two studied patients with febrile neutropenia had the above-mentioned prognostic factors warranting CSF use. This implied an abuse of G-CSF in some reviewed cases of febrile neutropenia. G-CSF was administered to 12 patients who developed febrile neutropenia despite prophylactic administration of G-CSF. The ASCO guidelines do not tackle the benefit of continuing CSFs during febrile neutropenia episodes among patients receiving prophylaxis (Ozer et al, 2000). On the other hand, it was difficult to deduce from our results whether continuing CSFs when febrile neutropenia occurred translated into a reduction in antibiotic use or days of hospitalization. The use of G-CSF for peripheral blood progenitor cell mobilization collection in 3% of the courses is warranted by the ASCO guidelines. Note that we considered G-CSF use in 8% of courses deserve further analysis, inappropriate according to the strict criteria defined by ASCO guidelines (Ozer et al, 2000). Although G-CSF is a safe drug, it has two major disadvantages: its high cost and its side effects. Medullary bone pain, a common incidence (Lacy et al, 2002), was reported in 16.5% of our reviewed records. On the other hand, severe maculopapular rash which is a rare side effect of G-CSF, was reported in only one patient requiring discontinuation of the drug (Lacy et al, 2002). Most prescribed G-CSF doses at the study site followed ASCO recommendations, yet low dose regimens (< 5 mcg/kg/d) were included in 48% of courses. Although some studies have shown that lower doses are effective (Eguchi et al, 1989), more evidence is needed to support 195

Saab et al: Filagrastim use: evaluation in cancer and critically ill non- cancer patients Wieand HS, Miller LL, and Mortel CG (1997) G-CSF in severe chemotherapy induced afebrile neutropenia. N Engl J Med 336, 1776-1780. Heard SO and Fink MP (1999) Counterregulatory control of the acute inflammatory response: Granulocyte colonystimulatory factor has anti-inflammatory properties. Critical Care Medicine 27, 1019-1021. Holdsworth MT (2001) Efficacy of Colony stimulating factors in acute leukemia. Ann Pharmacother. 35, 92-108. Khadaroo RG and Marshall JC (2002) ARDS and the multiorgan dysfunction syndrome. Critical Care Clinics 18(1), 531570. Kollef MH (1999) Epidemiology and risk factors for nosocomial pneumonia. Clinics in Chest Medicine 20(3), 653-670. Lacy CF, Armstrong LL, Goldman MP, and Lance LL (2002) Drug information Handbook 2002-2003, (p 503-505). Lexi-Comp, Ohio, USA Manero GG and Kantarjian HM (2000) Advances in the treatment of adult acute lymphocytic leukemia. Hematology/Oncology Clin North America 14, 1381-1396. McQuaker IG, Hunter AE, Pacey S, Haynes AP, Iqbal A, Russell NH (1997) Low-dose filgrastim significantly enhances neutrophil recovery following autologous peripheral blood stem-cell transplantation in patients with lymphoproliferative disorders: evidence for clinical and economic benefit. J Clin Oncol 15, 451-457. Ozer H, Armitage JO, Bennett CL, Crawford J, Demetri GD, Pizzo PA, Schiffer CA, smith TJ, Somlo J, Wade JC, Wade III JL, Winn RJ, Wozniak AJ, and Somerfield MR (2000) 2000 Update of Recommendations for the use of hematopoietic colony-stimulating factors: evidence-based, clinical practice guidelines. J Clin Oncol 18, 3558-3585. Ribas A, Albanell J, Bellmunt J, Sole-Calvo LA, Bermejo B, Gallardo E, Vidal R, Vera R, Eres N, Carulla J, Baselga J (1996) Five-day course of granulocyte colony-stimulating factor in patients with prolonged neutropenia after adjuvant chemotherapy for breast cancer is a safe cost-effective schedule to maintain dose intensity. J Clin Oncol 14, 15731580. Soda H, Oka M, Fukuda M, Kinoshita A, Sakamoto A, Araki J, Fujino S, Itoh N, Watanabe K, Kanda T, Nakano M, Hara K. (1996) Optimal schedule for administering G-CSF in chemotherapy induced neutropenia in NSCL cancer. Cancer Chemother Pharmacol 38, 9-12. Valley AW (2002) New treatment options for managing chemotherapy-induced neutropenia. Am J Health-Syst Pharm 59 (suppl 4), S11-16. Yim JM, Matuszewski KA, Vermeulen LC Jr, Ratko TA, Burnett DA, Vlasses PH. (1995) Surveillance of colony-stimulating factor use in US academic health centers. Ann Pharmacother. 29, 475-481

One way to minimize laboratory costs for daily ANC monitoring in future chemotherapy cycles where G-CSF will be prescribed for primary or secondary prophylaxis is to frequently monitor and document ANC in initial cycles potentially projecting the number of G-CSF doses required (Baker and McCune, 2000; Valley, 2002). It is evident that health care practitioners should improve G-CSF use at the hospital setting and facilitate cost-effective therapy. Based on this review, a better ANC monitoring, and a decrease in chemotherapy dosage in palliative therapy, as an alternative to G-CSF use should be adopted. Practitioners should remind not to prescribe G-CSF in febrile neutropenia except when associated with the above-mentioned prognostic factors (Figure 1). In addition, initiation of CSF therapy 48-72 hours rather than 24 hours following chemotherapy regimens of three days or less is recommended. Also, G-CSF as prophylaxis could be optimized and included more frequently in future chemotherapy cycles to prevent frequent and fatal episodes of febrile neutropenia.

Acknowledgements We were indebted to Mrs Georgette Yazbeck for her cooperation to complete this study.

References American Society of Clinical Oncology: (1994) The American Society of Clinical Oncology recommendations for the use of hematopoietic colony-stimulating factors: evidence-based, clinical practice guidelines . J Clin Oncol 12, 2471â&#x20AC;&#x201C;2508. Baker J, McCune JS, Harvey III D, Bonsignore C, and Lindley C (2000) Granulocyte colony-Stimulating factor use in cancer patients. Ann Pharmacother 34, 851-857 Bennett CL, Weeks JA, Somerfield MR, Feinglass J, Smith TJ. (1996) Use of hemopoietic colony stimulating factors: The American Society of Clinial Oncolgy Survey. J Clin Oncol. 14, 2511-2520 Berghmans T (2002) Therapeutic use of G-CSF and GM-CSF in febrile neutropenic cancer patients. A systematic review of the literature with meta-analysis. Support Care Cancer 10, 181-188. Bernstein HM, Pollock BH, Calhoun DA, and Christensen RD (2001) Administration of recombinant granulocyte colonystimulating factor to neonates with septicemia: A metaanalysis. J Pediatrics 138, 917-920. Crawford J, Ozer H, Stoller R, Johnson D, Lyman G, Tabbara I, Kris M, Grous J, Picozzi V, Raush G, Smith R, Graishar W, Yahanda A, Vincent M, Stewart M, and Glaspy J (1991) Reduction by G-CSF of fever and neutropenia induced by chemotherapy in patients with small cell lung cancer. N Engl J Med 325, 164-170 Eguchi I, Sasaki S, and Tamura T (1989) Dose escalation study of recombinant human granulocyte colony stimulating factors in patients with advanced malignancy. Cancer Res 49, 5221-5224. Hammond IV WP, Price TH, Souza LM, and Dale DC (1989) Treatment of cyclic neutropenia with ganulocyte colony stimulating factor. N Engl J Med 320, 1306-1311. Hartmann LC, Tschetter LC, habermann TM, Ebbert LP, Johnson PS, Maillard JA, Levitt R, Suman V, Witzig TE,

Dr. Yolande B. Saab

196

Cancer Therapy Vol 1, page 197 Cancer Therapy Vol 1, 197-202, 2003.

Vittorio Gebbia 1*, Francesco Giuliani 2, Generoso Uomo 3, Evaristo Maiello 2, Maria Rosaria Valerio4, Nicolo Borsellino5, NicolĂ˛ Gebbia4, Giuseppe Colucci2 1

Department of Experimental Oncology, University of Palermo; 2Medical and Experimental Oncology Unit, Oncology Institute, Bari; 3XI Internal Medicine and Diabetology, Cardarelli Hospital, Napoli; 4Chemotherapy Service, University Palermo; 5Medical Oncology Unit, La Maddalena Oncological Hospital, Palermo;

__________________________________________________________________________________ *Correspondence: Vittorio Gebbia MD, Via Alessandro Paternostro n. 48, 90133 Palermo, Italy; Tel: ++39-091-6806906; Fax: ++39091-6806710; E-mail vittorio.gebbia@tin.it Key Words: Pancreatic adenocarcinoma, gemcitabine, cisplatin, fluorouracil and folinic acid Abbreviations: PS, performance status; TGCR ,tumor growth control rate; PD, progressive disease; ORR overall response arte; OS, overall survival; TTP, time to disease progression; CB, clinical benefit; APCa, advanced pancreatic cancer; SD, stable disease; OR, objective response; CR, complete response; GEM, gemcatibine; CDDP, cisplatin; 5-FU, 5-fluorouracil; FA, folinic acid; TXT, taxotere Received: 19 August 2003; Accepted: 5 September 2003; electronically published: September 2003

Summary A phase II trial was carried out to determine the activity of the triplet drugs combination of gemcitabine (GEM), cisplatin (CDDP) and 5-fluorouracil (5-FU) modulated by folinic acid (FA) in the treatment of advanced pancreatic cancer patients. The clinical benefit, the toxicity pattern, the median time to disease progression and the median overall survival were evaluated. Patients with measurable, locally advanced and/or metastatic pancreatic adenocarcinoma entered the trial. They received at the first cycle GEM at a dose of 1000 mg/m2, once a week for 7 consecutive weeks; CDDP was administered on day 1, 8, 15, 29, 36 and 42 at a dose of 25 mg/m2 one hour before GEM, while FA/FU were given on the same day, immediately after GEM, at a dose of 100 mg/ m2 and 300 mg/ m2 bolus, respectively. After a 2-week rest, treatment was continued on day 1, 8, and 15 of a 4-week cycle; treatment was administered until progression or unacceptable toxicity. Thirty-three patients entered the trial. In the 28 patients evaluable for activity we obtained no complete response and 6 partial responses for an ORR rate of 21% (ITT analysis: 18%). Twelve stable disease (36%) and ten progressive disease (30%) were also observed. The median time to progression was 16 weeks and the median overall survival was 30 weeks. Twenty-two patients were evaluable for clinical benefit: 10 patients (40%) were considered as responders. The main grade 3-4 side effects (according to NCI criteria) were: thrombocytopenia 21%, neutropenia 18%, diarrhea and anemia 9%. Four patients discontinued treatment: 3 due to toxicity, 1 for refusal. The addition of 5-FU modulated by FA to the combination of GEM and CDDP does not seem to yield better results than the administration of the only GEM plus CDDP. The clinical benefit is similar to that observed in clinical trials employing GEM and CDDP alone, such as time to disease progression and overall survival. The toxicity pattern is severely increased by the addition of 5FU/FA at least in this weekly schedule.

I. Introduction Cancer of the exocrine pancreas is considered one of the most difficult cancers to treat, since patients show a five-year overall survival rate lower than 5%. At the time

curative surgery with a median survival of 10-18 months while the majority of patients have locally advanced inoperable and/or metastatic disease with a median survival ranging from 3 to 6 months (Evans et al, 1997). Single-agent gemcitabine (GEM) is currently

Gebbia et al: Gemcitabine, Cisplatin, Fluorouracil and Folinic acid in advanced pancreatic cancer pancreatic cancer (APCa). Collective data gave employing only GEM have shown an objective overall response rate (ORR) in the range of 5.4-16.6% and a median survival of 3.9-6.3 months (Casper et al, 1994; Carmichael et al, 1996; Burris et al, 1997; Crino et al, 1997). In a randomised phase III trial, GEM obtained a statistically significant advantage in terms of clinical benefit (CB) rate, based on measurements of pain, functional impairment and weight loss (23.8% versus 5.4%, p:0.0022), and overall survival (OS; 5.65 versus 4.41 weeks, p:0.0025) when compared to the standard 5-fluorouracil (5-FU) (Burris et al, 1997). Combination chemotherapy with GEM, therefore, has been studied to improve the outcome of patients with APCa. 5-FU, the most extensively studied single drug in the treatment of APCa, yields an ORR of less than 10% with marginal impact on quality of life and OS (Ahlgren, 1996). In vitro the combination of 5-FU and GEM have demonstrated to have synergistic activity: GEM depletes the polls of cellular deoxyuridine monophoshate (dUMP) pools, decreasing competition with 5-FdUMP at the target enzyme thymidilate synthase: 5-FU metabolites may inhibit deoxycytidine monophosphate deaminase, the enzyme responsible for inactivation of GEM monophosphate (Kanzawa and Saijo, 1997). Several phase I-II trials of GEM in combination with 5-FU have been conducted in patients with APCa. Although the dose and schedule of GEM were similar in all trials, the administration of 5-FU varied from protracted continuous infusion, to 24 hours continuous venous infusion (cvi), to weekly bolus at different dose levels, with or without folinic acid (FA). Four phase II trials evaluated the combination of GEM and bolus 5-FU administered for 3 consecutive weeks every 4 weeks. The ORR was in the range of 3.7-34.7% and the OS in the range of 4.4-9.0 months (Cascinu et al, 1998; Berlin et al, 2000; Murad et al, 2000; Pastorelli et al, 2000). Reported toxicities were mild, with a low percentage of hematological and gastrointestinal grade 3-4 side effects. Several other trials of GEM in combination with bolus or cvi 5-FU modulated by FA have been reported to date: the ORR was in the range of 5-26% and the median OS was 9 months (Gutzler et al, 1999; Hidalgo et al, 1999; Louvet et al, 1999; Kurtz et al, 2000; Lencioni et al, 2000; Polyzos et al, 2000; Rauch et al, 2001). Hematological and gastrointestinal side-effects were the main observed toxicities, whose severity depended on treatment schedule. However, in a recent phase III trial, the combination of GEM and 5-FU showed no advantage with respect to only GEM in median OS (6.7 vs 5.4 months, p:0.09) and ORR (6.9 vs 5.6%) (Berlin et al, 2002). Single-agent cisplatin (CDDP) has been reported to produce a 21% ORR in APCa patients with a median OS of 4 months (Wils et al, 1993). The combination of GEM and CDDP has been shown to be synergistic in vitro, since GEM is able to inhibit DNA repair after CDDP-induced damage, and CDDP is able to influence GEM catabolism through the inhibition of ribonucleotide-reductase (Bergman et al, 1996). Several schedules have been adopted for the combination of the two drugs. In two

plus CDDP on day 1 and 15 every 4 weeks, obtained a 11.5% and 26.0% ORR, a median time to progression (TTP) of 4.3 and 5.4 months, and a median OS of 8.2 and 7.1 months, respectively (Heinemann et al, 2000; Philip et al, 2001; Colucci et al, 2002). In a previous multicenter randomised phase III trial conducted by our group, the combination of GEM plus CDDP, administered weekly for 7 weeks, demonstrated to be more effective than GEM alone in terms of ORR (31% vs 10%, p:0.01), and median TTP (20 vs 8 weeks, p: 0.048) with a similar CB rate (52% vs 49%). The median OS showed a trend in favour of the combination arm but it did not reached the statistical significance (30 vs 20 weeks, p:0.48). Toxicity recorded in the CDDP plus GEM arm was more acceptable than that reported in other phase II trials with the same combination (Heinemann et al, 2000). This difference most likely was related to dosages and schedules employed. A nationwide confirmatory phase III trial is currently ongoing. Taking into account these data, the Gruppo Oncologico Italia Meridionale (GOIM) carried out a phase II trial with the aim to evaluate the activity of a triplet combination regimen in APCa patients. The main endpoints of the study were the efficacy of the treatment in terms of ORR and CR rate, and the toxicity of the treatment; median TTP and OS were also evaluated.

II. Patients and methods A. Patient selection and study design Patients were enrolled into the study if they satisfied the following inclusion criteria: a) histological or cytological diagnosis of locally advanced and/or metastatic pancreatic carcinoma; b) bi-dimensionally measurable disease according to standard WHO criteria, c) no previous chemotherapy, hormonal therapy, or radiotherapy; d) age between 18 and 75 years; e) performance status (PS) >50 according to the Karnofsky Index; f) no evidence of congestive heart failure, serious arrhythmias or coronary artery disease; g) absence of severe uncontrolled metabolic, infectious or neurological disease; h) absence of other malignant neoplasms with the exception of adequately treated in situ carcinoma of the uterine cervix or non-melanotic skin cancer. Informed written consent was also requested from all patients before their inclusion into the study. Besides patients should have an adequate baseline bone marrow reserve (WBC count >4,000/mm3, neutrophils > 1,500/mm3, platelets > 100,000/mm3 and hemoglobin level > 10gr/dl), an adequate hepatic function (levels of bilirubin and transaminases < 2.5 normal values) and an adequate renal function (defined as serum creatinine concentration < 1.5 mg/dL, and BUN < 50 mg/dL). Patients were excluded from the trial in the presence of brain metastases or any pre-existing medical condition of sufficient severity to prevent full compliance with the study. Geographical accessibility was also considered as a prerequisite in order to guarantee correct therapy and follow-up.

B. Treatment schedule Patients were centrally registered at the GOIM headquarters at the Oncology Institute of Bari, Italy. The treatment schedule was as follows: at the first cycle (8 weeks) GEM was administered as a 30-minute iv infusion at a dose of 1000 mg/m 2 diluted in 250 normal saline solution, once a week for 7 consecutive weeks; CDDP was administered on day 1, 8,

Cancer Therapy Vol 1, page 199 normal saline ensuring adequate hydration, one hour before the administration of GEM, while FA and 5-FU were administered on the same days, immediately after GEM, at a dose of 100 mg/m2 in 500 cc of normal saline solution in 2 hours, and 300 mg/m2 bolus, respectively. After a 2-week rest, treatment was continued on day 1, 8, and 15 of a 4-week cycle; treatment was administered until progression or unacceptable toxicity. Antiemetic therapy consisted of anti-HT3 agent and dexametasone. G-CSF was not administered routinely in this study. Toxicities were graded according to the NCI common toxicity criteria. If multiple toxicities were observed, the dose administered was based on the most severe toxicity experienced. The dose adjustment schedule was evaluated at the beginning of a new administration. Dose reductions were performed as follows: if the absolute neutrophil count (ANC) was > 1,000/mm3 and platelets were >100,000/mm3, 100% of the dose was administered; if ANC was in the range of 500-1,000/mm3 and platelets in the range of 50,000-100,000/mm3, 75% of the dose was administered; if ANC was <500/mm3 and platelets <50,000/mm3, treatment was delayed for one week.

C. Pre-treatment evaluation and follow-up Staging and clinical evaluation procedures consisted of complete medical history and physical examination, EKG, complete peripheral blood cell counts, serum chemistry panel including serum tumor markers (CEA,Ca19-9). Bidimensionally measurable disease was determined by chest x-rays, CT and/or NMR as needed. Elevated CEA or Ca 19.9 levels were not considered as measurable disease. Endoscopy was employed according to patientsâ&#x20AC;&#x2122; needs. After withdrawal from the study, patients underwent follow-up examinations every two months until death.

D. Efficacy assessment The first evaluation of disease status and CB was performed after the first cycle (8 weeks). Objective responses (OR) were determined according to the WHO criteria: a complete response (CR) was defined as the complete disappearance of all disease sites and of all disease-related symptoms with no evidence of new lesions for at least 4 consecutive weeks; a partial response (PR) was defined as a 50% or more reduction in the sum of the products of the longer perpendicular diameters of all measurable lesions, without any evidence of new lesions; stable disease (SD) was defined as a less than 50% reduction or a less than 25% increase in the sum of the products of the measurable lesions, with no evidence of new lesions; progressive disease (PD) was defined as a > 25% increase in one or more lesions or the appearance of new lesions. The sum of CR, PR, and SD was reported as tumor growth control rate (TGCR). Patients with complete or partial response and those with stable disease continued treatment and were reevaluated after two 28-day cycles. TTP was estimated from the date of first treatment to the first evidence of PD. OS was estimated from the date of first treatment to the date of death or the last follow-up. Clinical Benefit (CB) assessment was based on the measurement of three common signs or symptoms two of which were defined as primary, i.e. pain and functional impairment, and one as secondary, i.e. weight loss. Pain was assessed by pain intensity and analgesic consumption. Pain intensity was determined daily by a visual analogic scale and the weekly value was defined as the median of the entire recorded daily values; an improvement of >50% from baseline which was sustained for > 4 weeks was considered to be a positive response, assuming a

baseline pain score of 30. Analgesic consumption was recorded weekly employing the following scale: 0 = no analgesic consumption; 1 = administration of non-steroidal antiinflammatory drugs; 2 = consumption of codeine phosphate; 3 = oral administration of morphine sulfate; 4 = parenteral administration of morphine; 5 = neurosurgical procedures. A change from a higher to a lower level was considered to be a positive response. When consumption of analgesic drugs was considered within each level, patients who required an increase in their daily dose were defined as non-responders. Functional impairment was assessed by the Karnofsky performance scale. Two different investigators determined baseline values weekly. For patients with a PS of 50, 60 and 70, an improvement of >20 points from baseline which was sustained for > 4 weeks was considered to be a positive response. Weight was measured weekly and a weight gain of >7% (excluding third spaces) sustained for > 4 weeks was considered to be a positive response. Therefore, a patient was classified as a clinical benefit responder if one of the two primary parameters improved without deterioration in the others or if the primary parameters were stable and a weight gain >7% from baseline was observed.

E. Statistical Analysis Objective responses were reported as their relative rates with 95% confidence interval (95% CI) accordingly to an intentto-treat (ITT) analysis and in evaluable patients. Percentages of response or other data were adjusted to the nearest unit. A univariate analysis of TTP and OS according to the KaplanMeier product limit estimate was performed. The population sample size was calculated considering a response rate of 20% in previous studies, assuming a minimum difference wished to be significant of 0.2 and estimated response rate of 30% with a type 1 error of 0.05 and a type 1 error of 80%. Therefore 33 patients had to be enrolled into the trial.

III. Results A. Patients population and disease status A total of 33 patients entered the trial; the main characteristics of the enrolled patients are summarized in Table 1. Overall, there were 20 males and 13 females with a median age of 65 years (range 42-75) and a median Karnofsky PS of 80 (range 50-100). Few patients (9%) had recurrent disease after radical surgery, while 30 patients (91%) had locally advanced and/or metastatic disease at the time of diagnosis; 22 patients (67%) had multiple sites of disease while 11 patients (33%) had only one site of disease. The main disease sites were primary tumor (30 patients), liver (15 patients), and lymph nodes (12 patients).

B. Objective response, progression, and overall survival

time

Twenty-eight patients were available for objective response, while 4 patients withdrew from treatment, before re-evaluation: 3 patients due to treatment-related toxicity, and 1 because he refused treatment due to side-effects. ORR, CR rate, median TTP, and OS are depicted in Table 2. According to an ITT analysis, no CR and 6 PR were observed for an ORR of 18% (95% CL 7% - 35%), 12

Gebbia et al: Gemcitabine, Cisplatin, Fluorouracil and Folinic acid in advanced pancreatic cancer patients (30%) had PD. In the evaluable patients the ORR was 21.4% (95% CL 8%-41%). The duration of objective responses were 12+, 28+, 32, 36, 48 and 52 weeks respectively (median 34 weeks), and were observed at primary tumor (20% of cases), liver (13%) and lymph nodes (17%). The median TTP was 16 weeks, while the median OS was 30 weeks. Thirteen patients (39%) were alive at 6 months and 5 patients (15%) at 1 year. The median survival of responder patients was 11 months. Table 1: Patient characteristics Enrolled:

33 (100%)

Sex Male: Female:

20 (61%) 13 (39%)

Age (yr) Median: Range:

65 42-75

Karnofsky PS: Median: Range:

80 50-100

Stage III: IV:

8 (24%) 25 (76%)

Surgery Radical: Biopsy:

3 (9%) 30 (91%)

Twenty-two (67%) of 33 patients enrolled were evaluable for CB assessment; 11 patients (50%) were evaluable for both PS and pain; 6 (18%) only for PS and 5 (15%) only for pain. Both pain and PS improved in one patient, whereas 4 patients showed a decrease in pain without deterioration of PS and 1 patient an improvement of PS with no change of pain. Furthermore 2 patients showed a weight increase > 7% with no change in PS and pain. Therefore 10 patients (40%; 95% CL 24%-68%) were considered CB responders. Improvement in the CB parameters was observed after the fourth week of administration (Table 3).

D. Toxicity The pattern of toxicity is depicted in Table 4. All patients were evaluable for toxicity. No toxic-related death has been observed. The main grade 3-4 toxicities were: neutropenia 18%, thrombocytopenia 21%, diarrhea 21%, anemia 9%, mucositis (12%), and nausea/emesis 2%. Four patients discontinued treatment for grade 3-4 thrombocytopenia and diarrhea. Grade 1-2 toxicity were: neutropenia 21%, thrombocytopenia 45%, anemia 30%, nausea/emesis 36%, diarrea 12%, transaminases 15%, fever 12%, asthenia 12%, alopecia 18%. Table 3: Results on Clinical Benefit

Sites of disease Pancreas: Liver: Lymph nodes: Other:

30 (91%) 15 (45%) 12 (36%) 5 (15%)

Sites: Single: multiple:

11 (33%) 22 (67%)

Table 2: Objective response rate, time to progression, overall survival Enrolled patients: 33 (100%) Evaluable patients: 28 ( 85%) CR: PR: SD: PD:

C. Clinical benefit (CB)

0 (00.0%) 6 (21.4%) 12 (36.3%) 10 (30.3%)

Overall response rate (ORR):

Evaluable patients:

22/33 (67%)

pain and performance: only performance: only pain:

11 (50%) 6 (27%) 5 (23 %)

Responders: pain and performance: only performance: only pain: weight:

3 1 4 2

Table 4: Toxicity recorded according to NCI criteria Mucositis

2 (6)

4 (12)

Diarrhea

1 (3)

3 (9)

5 (18)

1 (3)

Nausea/Vomiting

8 (24)

4 (12)

1 (3)

Leukopenia

8 (24)

9 (27)

3 (9)

2 (6)

Neutrophils

4 (12)

3 (9)

Anemia

3 (9)

7 (21)

3 (9)

Platelets

6 (18)

9 (27)

4 (12)

3 (9)

Transaminases

3 (9)

2 (6)

Evaluable pts:

21.4%

Asthenia

4 (12)

ITT analysis:

18.0%

Loss of Hair

4 (12)

3 (9)

Flu-like syndrome

2 (6)

1 (3)

Median time to progression (weeks): Median overall

Cancer Therapy Vol 1, page 201

IV. Discussion To date, GEM is considered as the standard palliative chemotherapy for patients with APCa by most oncologists on the basis of the results obtained in phase II-III trials reporting a CB response in 23-40% of patients. However GEM has limited antineoplastic activity when used as single-agent: the major objective responses are in the range of 5.4-16.6% with a median OS of 3.9-6.3 months. The Investigational New Drug Treatment Program reported a 12% ORR in 982 patients with APCa treated with single-agent GEM. The survival data from 2380 patients showed that the median survival was 4.8 months, with a 1-year survival rate of 15% (Storniolo et al, 1999). These data have led to numerous studies with the aim to evaluate the activity and efficacy of GEM employed in combination with other drugs that showed to be synergistic in vitro such as 5-FU, docetaxel, CDDP, and oxaliplatin. In this phase II study we have explored the activity and the tolerability of the triplet combination of GEM, CDDP and 5-FU/FA employing the same weekly schedule tested in our previous study aiming to maximize the potential synergism among the drugs and to reduce toxicity. In the twenty-eight evaluable patients we observed a 21% of ORR with a 36% of stable disease and a tumor growth control rate of 54%, a median TTP of 16 weeks and a median OS of 32 weeks. A CB was obtained in 40% of patients. These results are in the range reported for GEM-based combination chemotherapy regimens in medical literature, but they do not seem to be better than those observed in our previous randomised phase III trial with the combination of GEM and CDDP. With regard to toxicity, the addition of 5FU/FA to CDDP/GEM results in an increase in the severity of the side effects: we recorded grade 3-4 neutropenia in 18% of cases, diarrhea in 21%, anemia in 9%, mucositis in 12%, and thrombocytopenia in 21%. Toxicity determined the discontinuation of treatment in four patients (14%). Therefore the addition of 5-FU/FA to GEM/CDDP on a weekly schedule results in a significative increase in the severity and the incidence of toxicity without improving clinical efficacy. Philip et al, (2001) considering the results of their previous phase II trial of GEM and CDDP, recently tested the activity and toxicity of the triplet combination of GEM administered at 1000 mg/m2 on day 1, 8 and 15 of a 4week cycle, CDDP at 50 mg/m2 on days 1 and 15 and 5FU 175 mg/m2 cvi for 14 days obtaining analogue results than our trial (El-Rayes et al, 2003). Among the 47 evaluable patients they observed 11 PR (26%) and 27 SD (57%), with a median TTP of 5.7 months and a median OS of 8.6 months (El-Rayes et al, 2003). Also the main grade 3-4 toxicities were similar: neutropenia (19%), thrombocytopenia (38%) and mucositis/ stomatitis (15%). GEM has also been tested in combination with docetaxel initially with poor results: less than 10% of ORR has been reported in three clinical experiences employing TXT at single administration every 3-4 weeks (Kakolyris et al, 1999; Cascinu et al, 1999; Clark et al, 2000). Different schedules of treatment have been explored; the weekly administration of both GEM and TXT seems to gave the better results. Both Schmidt et al, (2002) and

Schneider et al, (2002) recently reported a 24.0% ORR employing GEM at the dosage of 750-1000 mg/m2/week and docetaxel at the dosage of 35 mg/m2/week for 3 weeks on a 4-week cycle. Recently the combination of GEM and CPT-11 revealed to be active with an ORR of 24%, a median TTP of 2.8 months and a median OS of 5.7 months in 45 patients with a low grade of grade 3-4 toxicities (Rocha-Lima et al, 2002). The GEM and oxaliplatin regimen was shown to yield 31% ORR, a median TTP of 5.3 months, and a median OS of 9.2 months and a CB of 40% in 64 eligible patients (Louvet et al, 2002). In conclusion the data of this trial demonstrate that the triplet combination of GEM, CDDP and bolus 5-FU modulated by FA is an active treatment for patients affected by APCa. However the results achieved with our weekly schedule are no better than those observed in our previous randomised phase III trial with GEM plus CDDP (Colucci et al, 2002). Furthermore, the addition of 5FU/FA seems to increase the severity of toxicity reported with weekly GEM/CDDP. Other schedules or combinations should be tested to increase the results in the treatment of APCa.

References Ahlgren JD (1996) Chemotherapy for pancreatic carcinoma. Cancer 78, (suppl.1), 654-663. Bergman AM, Ruiz van Haperen VWT, Veerman G, Kuiper CM, Peters GJ (1996) Synergistic interaction between cisplatin and gemcitabine in vitro. Clin Canc Res 2, 521-530. Berlin DJ, Catalano P, Thomas JP, Kugler JW, Haller DG, Benson A (2002) Phase III study of Gemcitabine in combination with Fluorouracil versus Gemcitabine alone in patients with advanced pancreatic carcinoma Eastern Cooperative Oncology Group Trial E 2297. J Clin Oncol 15, 3270-3275. Berlin JD, Adak K, Vaughn DJ, Flinker D, Blaszkowsky L, Harris JE, Benson III AB (2000) A phase II study of gemcitabine and 5-fluorouracil in metastatic pancreatic cancer an Eastern Cooperative Oncology Group Study (E3296). Oncology 58, 215-218. Burris III HA, Moore MJ, Andersen J, Green MR, Rothenberg ML, Modiano MR, Cripps MC, Portenoy K, Storniolo AM, Tarassoff P, Nelson R, Dorr FA, Stephens CD, Von Hoff DD (1997) Improvements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced pancreas cancer a randomised trial. J Clin Oncol 15, 24032413. Carmichael J, Fink U, Russel RCG, Spittle MF, Harris AL, Spiessi G, Blatter J (1996) Phase II study of gemcitabine in patients with advanced pancreatic cancer. Br J Cancer 73, 101-105. Cascinu S, Silva RR, Barni S, Labianca R, Frontini L, Piazza E, Giordani P, Giuliodori L, Pessi MA, Fusco V, Luporini G, Cellerino G (1998) A combination of Gemcitabine and 5Fluorouracil in advanced pancreatic cancer, a repot from Group of the Studies of Digestive Tract Cancer (GISCAD). Br J Cancer 80, 1595-1598. Cascinu S, Gasparini G, Catalano V, Silva RR, Pancera G, Morabito A, Giordani P, Gattuso D, Catalano G (1999) A phase I-II study of gemcitabine and Docetaxel in advanced pancreatic cancer a report from the Italian Group for the Study of Digestive Tract Cancer (GISCAD). Ann Oncol 10,

Gebbia et al: Gemcitabine, Cisplatin, Fluorouracil and Folinic acid in advanced pancreatic cancer Casper ES, Green MR, Kelsen DP, Heelan RT, Brown TD, Flombaum T (1994) Phase II trial of 2’,2’difluorodeoxycytidine in patients with adenocarcinoma of the pancreas. Invest New Drugs 12, 29-34. Clark JW, Ryan DP, Kulke MH (2000) Phase II study of gemcitabine and Docetaxel in patients with metastatic pancreatic cancer. Proc. ASCO 19, 1238. Colucci G, Giuliani F, Gebbia V, Biglietto M, Rabitti p, Uomo G, Cigolari S, Testa A, Macello E, Lopez M (2002) Gemcitabine alone or with Cisplatin for the treatment of patients with locally advanced and/or metastatic pancreatic carcinoma. A prospective randomized phase III study of the Gruppo Oncologico dell’Italia Meridionale. Cancer 4, 902910. Crino L, Mosconi AM, Calandri C, Corgna E, Darwish S, Tonato M (1997) Gemcitabine in advanced pancreatic cancer a phase II trial. Eur J Cancer 33, (suppl.8)S280 (abst 1266). El-Rayes BF, Zalupski M, Shields A, Vaihampayan U, Heilbrun LK, Jain V, Adsay V, Day J, Philip PA (2003) Phase II study of gemcitabine, cisplatin and infusional 5-fluorouracil in advanced pancreatic cancer. J Clin Oncol 21, 2020-2925. Evans DB, Abbruzzese JL, Rich TR (1997) Cancer of the pancreas, in De Vita VT Jr, Hellman S, Rosenberg SA (eds) Cancer Principles and Practice of Oncology. (ed. 5). Philadelphia, PA, Lippincott, pp 1054-87. Gutzler F, Moehler M, Hosch WP, Wagner V, Hehme M, Rudi J, Stremmel W (1999) A phase I study of gemcitabine (GEM) in combination with five days 5-fluorouracil (5-FU) and folinic acid (FA) in patients with advanced adenocarcinoma of pancreas or bile duct. Proc. ASCO 18, A 1097. Heinemann V, Wilke H, Mergenthaler K, Clemens M, Konig HJ, Arning M, Schalhorn A, Possinger K, Fink U (2000) Gemcitabine and Cisplatin in the treatment of advanced and metastatic pancreatic cancer. Final results of a phase II study. Ann Oncol 11, 1399-1403. Hidalgo M, Castellano D, Paz-Ares L, Gravalos C, Diaz-Puente M, Alonso S, Cortes-Funes H (1999) Phase I-II study of Gemcitabine and Fluorouracil as a continuous infusion in patients with pancreatic cancer. J Clin Oncol 17, 585-92. Kakolyris S, Stathopoulos G, Tsavaris N, Androulakis N, Kourossis C, Samantas E, Dimopoulos AM, Fountzilas G, Sarra E, Hatzidaki D, Samonis G, Georgoulias V (1999) First line treatment with docetaxel and gemcitabine in patients with a advanced pancreatic cancer a multicenter phase II study. Proc ASCO 18, 250a, (abst 960). Kanzawa F, Saijo N (1997) In vitro interaction between gemcitabine and other anticancer drugs using a novel threedimensional model. Sem Oncol 24 (suppl.7), S7-8-S7-16. Kurtz JE, Kohser F, Negrier S, Trillet-Lenoir V, Walter S, Limach C, Unterreiner M, Kayitalire L, Jaeck D, Dufour P (2000) Gemcitabine and protracted 5-FU for advanced pancreatic cancer. A phase II study. Hepatogastroenterology 47, 1450-1453. Lencioni M, Falcone A, Masi L, Fioretto L, Meucci I, Di Marsico R, Pfanner E, Galli C, Bonifazi V, Mazzocchi B, Tognarini L, Conte PF (2000) Phase I-II study of Gemcitabine (GEM) in combination with 24 hours continuous infusion (CI) of 5-fluorouracil (5-FU) and Lleucovorin (LV) in patients (pts) with advanced pancreatic carcinoma (APC). Proc. ASCO 11(suppl. 4), A289. Louvet C, Hammel P, Andrè T, Vanica R, Landi B, Balosso J, Cattan S, Fonck M, Flesch M, Colin P, Gruson T, deGramont A (1999) Multicenter phase II study in advanced adenocarcinoma patients with a combination of leucovorin, 5FU bolus and infusion, and gemcitabine (FOLFUGEM regimen). Proc ASCO 18, 275a, (abst.1054).

Louvet C, Andre’ T, Uedo G, Hammel P, Bleiberg H, Bouleuc C, Gamelin E, Flesch M, Cvitkovic E, deGramont A (2002) Gemcitabine combined with Oxaliplatin in advanced pancreatic adenocarcinoma final results of a GERCOR multicenter phase II study. J Clin Oncol 20, 1512-1518. Murad AM, de Gusmao CBRA, Scalabrini-Neto AO (2000) Phase II trial of the use of gemcitabine and 5-fluorouracil (5FU) in the treatment of advanced pancreatic (APC) and biliary tract (ABTC) adenocarcinoma. Final report. Ann Oncol 11 (suppl. 4), A 302P. Pastorelli D, Pedrazzoli S, Sperti C, Vicario G, Scelzi E, Santarossa S, Sgarbossa G, Fosser V, Manente P (2000) Phase II trial with gemcitabine (GEM) + 5-fluorouracil (5FU) in advanced pancreatic cancer (APC). Proc ASCO 19, A 1110. Philip PA, Zalupski M, Vaitkevicius VK, Arlauskas P, Shields A (2001) Phase II study of Gemcitabine and Cisplatin in advanced or metastatic pancreatic cancer. Cancer 3, 569577. Polyzos A, Tsavaris N, Kosmas C, Arnaoutis T, Vadiaka M, Apostolopoulos P, Vafiadis I, Tsatali K, Toskas A, Nikou G (2000) A phase II study of gemcitabine (GEM) plus 5fluorouracil (5-FU) modulated by leucovorin (LV) for advanced pancreatic cancer. Proc. ASCO 19, A 1229. Rauch DP, Maurer CA Aebi S, PampallonaS, Friess H, Ludwig C, Borner MM (2001) Activity of Gemcitabine and continuous infusion fluorouracil in advanced pancreatic cancer. Oncology 60, 43-48. Rocha-Lima CMS, Savarese D, Bruckner W,Dudek A, Eckardt J, Hainsworth J, Yunus F, Lester E, Miller W, Saville W, Elfring GL, Locker PK, Comptom LD, Miller LL, Green MR (2002) Irinotecan plus Gemcitabine induces both radiographic and Ca19-9 tumor marker responses in patients with previously untreated advanced pancreatic cancer. J Clin Oncol 20, 1182-1191. Schmidt C, Fahlke J, Kettner E, Greiner L, Kuhn R, Eichelmann, Kroning H, Manger T, Ridwelski K, Lippert H (2002) Phase II multicenter study of gemcitabine and docetaxel in patients with inoperable or metastatic pancreatic cancer. Proc ASCO 21, part 1 577. Schneider BP, Ganjoo KN, Seitz DE, Picus J, Fata F, Stoner C, Calley C, Loeher PJ (2002) Phase II study of gemcitabine and docetaxel in combination for advanced pancreatic cancer- a Hoosier Oncology Group study. Proc. ASCO 21, part. 1 546. Storniolo AM, Enas NH, Brown CA, Voi M, Rothenberg ML, Schilsky R (1999) An investigational new drug treatment program for patients with gemcitabine. Cancer 85, 12611268. Wils JA, Kok T, Wagener DJT, Selleslags J, Duez N (1993) Activity of cisplatin in adenocarcinoma of the pancreas. Eur J Cancer 29, 203-204.

Dr. Vittorio Gebbia

Cancer Therapy Vol 1, page 203 Cancer Therapy Vol 1 203-208, 2003.

Phase I study of high dose 5-fluorouracil and folinic acid in weekly continuous infusions Research Article

Jean-Marc Limacher*, Bernard Duclos, Patrick Dufour, Jean-Marie Wihlm¨, Dominique Leveque†, François Jehl_, François Eichler, Roger Keiling, Shanti Natarajan-Ame, Jean-Emmanuel Kurtz, Jean-Pierre Bergerat Département d’Hématologie et d’Oncologie, †Service de Pharmacie, Hôpitaux Universitaires de Strasbourg, 1 place de l’Hôpital, 67091 Strasbourg Cedex, France, ¨Laboratoire de Biochimie, Centre Régional de Lutte Contre le Cancer Paul Strauss, Strasbourg, _Laboratoire de Bactériologie, Faculté de Médecine, Strasbourg

__________________________________________________________________________________ *Correspondence: Jean-Marc Limacher, Département d'Hématologie et d'Oncologie, Hôpitaux Universitaires de Strasbourg, 1 place de l'Hôpital, 67091 Strasbourg Cedex; Tel: 03.88.11.57.85; Fax: 03.88.11.63.60; e-mail: Jean-Marc.Limacher@chru-strasbourg.fr Key Words: 5-fluorouracil (5FU), folinic acid, chemotherapy, colorectal cancer, breast cancer, hand-foot syndrome Received: 19 August 2003; Accepted: 10 September 2003; electronically published: September 2003

Summary We present a phase I study of a 5-fluorouracil (5FU) and folinic acid combination given at high doses in weekly continuous infusions. The aim of the study was to determine the maximal tolerated dose of 5FU and the encountered toxicities. 5FU was given as a weekly 24 hr continuous infusion at doses between 1.8 and 2.7 g/m2. 600 mg/m2 of calcium folinate was given as a 200 mg loading dose followed by the rest as a continuous infusion simultaneously with 5FU. All 42 patients entered in the study were diagnosed with malignant diseases in which 5FU chemotherapy was of potential benefit. Plasma concentrations of 5FU and folinic acid during the continuous infusions were determined in three of them. The treatment was well tolerated using up to 2.4 g/m2 of 5FU with only minor side effects. At higher doses (2.5, 2.6 and 2.7 g/m2) the toxic manifestations became rapidly more important. Diarrhea, nausea and vomiting and hand-foot syndrome were the most frequent. Other toxicities observed included: angina pectoris, transient encephalopathy and colectasia. The loading dose of calcium folinate allowed plasma concentrations of reduced folinate compatible with optimal potentiation of 5FU during nearly the entire time of the infusion. The maximal tolerated dose of 5FU under such conditions is 2.4 g/m2. Up to this dosage the treatment can be used in even heavily pretreated patients with conservation of quality of life. The therapeutic value of this treatment is currently evaluated in its principal indication, advanced colorectal cancer, in comparison with the classical five day bolus administration. al, 1992; Piedbois and Michiels 2003). The 5FU-folinic acid association is usually given in a five day schedule using bolus administrations repeated every three to four weeks (Machover et al, 1986). A different way of administering this combination has been described based on a simultaneous continuous 24hr infusions of the two compounds. 5FU was given at 2.6 g/m 2 with folinic acid at 500 mg/m2. Despite the high dose intensity of 5FU the toxic side effects were limited. Its efficacy in the treatment of advanced colorectal cancers was interesting with an overall response rate of 45 % reaching 52% in previously untreated patients (Ardalan et al, 1991). We present a phase I study of a similar treatment modified by the addition of a loading dose of folinic acid before the continuous infusions (Figure 1). The goal of the study was to determine the maximal tolerated doses of 5FU under such conditions and to describe the encountered toxicities.

I. Introduction Though new drugs like oxaliplatin or irinotecan have improved the treatment of colorectal cancer they are usually associated to 5-fluorouracil (5FU) which remains the pivotal drug in this pathology (Baker, 2003; Rougier and Mitry, 2001). Nevertheless, the best way of administering 5FU in this indication remains a matter of debate (Leichman et al, 1995). Experimental and clinical studies have found continuous infusions to give higher response rates compared to bolus injections (Seifert et al, 1975; Lokich et al, 1989; Weinermann et al, 1990; Patel et al, 2003). A dose effect for 5FU has clearly been demonstrated for both bolus and continuous infusions, yet the latter allows the delivery of higher dose intensities (Hrynuk et al, 1987). The other way of improving 5FU activity is by biomodulation. Several drugs have been associated with 5FU but only folinic acid is considered to increase response rates and survival (Köhne Wömpner et 203

Limacher et al: Phase I study of 5-fluorouracil and folinic acid

Figure 1. Treatment Scheme

D. Determination of plasma folinic acid concentration

II. Materials and methods A. Treatment scheme 5FU (Roche) was given as a 24 hr continuous infusion, the drug being diluted in 5% glucose and administered by a portable pump (CADD, Pharmacia Deltec) connected to a sub-cutaneously implanted double lumen venous access (Porth-a-cath, Pharmacia). The dose of 5FU for the first patients was 1.8 g/m2. The explored dose stages were 1.8, 2.0, 2.2, 2.4, 2.5, 2.6 and 2.7 g/m2. At least three patients were treated at each dose level. If no major toxicity was observed at a particular dose it was then increased for the next group of patients. For a given patient, the dose of 5FU administered weekly remained constant throughout the study. The calcium folinate dose was 600 mg/m 2. Two hundred mg was administered as a two hours infusion with the rest of the dose delivered over 24 hours concommitanly with 5FU using another portable pump (Singleday Infusor 2 ml/hr, Baxter) connected to the implanted port. Calcium folinate and 5FU are not stable when mixed together for several hours and therefore cannot be placed together. This treatment was repeated every week until progression. In the event of grade 2 or 3 toxicity the treatment was delayed until resolution and the 5FU dose subsequently decreased by 0.2 g/m2. All patients underwent a weekly clinical examination assessing tolerance to the treatment. Toxic events were graded according to WHO criteria. Whenever possible the response to treatment was assessed every two months. 5FU and folinic acid plasma levels during continuous infusion were measured in three patients at the 1.8 g/m2 dose level. Five ml blood samples were taken every three hours during the infusion. Blood was immediately centrifuged at 3000 rpm for 5 min and 2 ml of the plasma were removed and frozen at -200C.

B. Patients This treatment was administered to informed and consenting patients suffering from a malignant disease in which chemotherapy with 5FU was indicated. Other eligibility criteria were age less than 70 years, ECOG performance status 0, 1 or 2, WBC > 4000/mm 3, platelets >100,000/mm 3, and no major hepatic or renal dysfunction.

C. Determination of plasma 5FU concentration 5FU was measured in the serum by HPLC as previously described (Christophidis et al, 1979). The limit of detection was 5 ng/ml. The within-run and day to day precision expressed in terms of coefficient of variation was less then 5%.

Folinic acid was measured in the plasma by a specific HPLC method. Briefly, 500 µl of plasma were deproteinized with 500 µl of acetonitrile. After centrifugation, 3.5 ml of methylene chloride were added to the supernatant. The mixture was gently shaken by rotation for 10 mn (20 rpm) and then centrifuged for 10 mn at 1000 g. Twenty microlitres of the upper aqueous layer were injected in the chromatograph. The chromatograph consisted of a 126 programmable solvent delivery module (Beckman, Fullerton, CA), a model 210 sample injection valve with a 20 µl 100P (Beckman), and a model 166 programmable wavelength detector (Beckman). Chromatograms were processed by a GOLD chromatographic data system (Beckman). The assay was carried out using a 125 x 4.6 mm (inner diameter) C18 column (5 _m particle size, Merck, Darmstadt, Germany). The mobile phase consisted of 8% acetonitrile in 5mM tetrabutylammonium bromide (final concentration) adjusted to pH 2.0 and delivered at a flow rate of 1 ml/mn. Quantization was based on UV detection at 280 nm. The limit of detection in plasma was 200 ng/ml. Within- and between-day reproducibilities were less than 10% in terms of coefficient of variation.

III. Results A. Patients 42 patients entered the study during the 2 year study period. Population characteristics are summarized in Table 1.

B. Toxicity The administration of 5FU doses of between 1.8 and 2.4 g/m2 was very well tolerated with only occasionally grade I minor side effects including mild erythrodermatitis, nausea and diarrhea. For the three higher dose levels of 5FU (2.5, 2.6 and 2.7 g/m2) the toxicities became quickly more frequent and more intense. The most frequently observed toxic effects were hand-foot syndrome, nausea/vomiting and diarrhea (Figure 2). The hand-foot syndrome was present after three to five weeks treatment in about half of the patients receiving 2.5 g/m2 or more 5FU. Hand-foot syndrome was treated with moisturizing creams and dose reduction. Grade II or III diarrhea and nausea/vomiting were observed in 50% and 75% of the patients who received 2.6 and 2.7 g/m2 respectively.

204

Cancer Therapy Vol 1, page 205 Table 1. Patients characteristics _________________________________________________________________________

Number of patients: Mean age: Men: Women: Previously treated: Untreated:

42 56 (38-76) 16 26 28 14

Distribution according to pathology: Colorectal cancer: 23 Breast cancer: 9 Ovarian cancer: 3 Gastric cancer: 2 Hepato-biliary cancer: 2 Soft tissue sarcoma: 2 Bladder cancer: 1 Distribution according to 5FU dose: 1.8 gr/sqm 11 2.0 gr/sqm 3 2.2 gr/sqm 3 2.4 gr/sqm 5 2.5 gr/sqm 8 2.6 gr/sqm 8 2.7 gr/sqm 4 _________________________________________________________________________

Figure 2: Frequency per dose level of the three most frequent toxicities (% patients with WHO grade II or higher toxicities)

Two patients presented a grade II mucositis at 5FU doses of 2.5 and 2.6 g/m2. Angina pectoris was observed during 5FU infusion in one patient. This patient had a previous history of coronary disease. This cardiac complication appeared during the first cycle and the treatment was not repeated. A thirty year old woman presented a neurological disorder with sleepiness and confusion spontaneously regressive within 24 hr, during the first infusion (5FU 2.5 g/m2). The cerebral CT Scan was normal. Some patients reported watery eyes; slight alopecia was present in a few patients after several months of treatment. Grade III neutropenia has been observed in one

Diarrhea disappeared usually after two weeks of rest and dose reduction. Nausea and vomiting when present were observed during the two first days of the cycle. Minor nausea was treated with metoclopramide, more severe nausea and vomiting responded to 8 mg ondansetron or 3 mg granisetron given intravenously before the start of the 5FU infusion. Beside these main side effects we observed in two patients an episode of colectasia with ileus. The two patients had in common their age of more then 65 years and a dose of 5FU of 2.4 g/m2 or more. In one case clostridium difficile toxin was detected in the stool. The treatment applied was diet and vegetal coal, whreas colonoscopic exsuflation was necessary in one patient. 205

Limacher et al: Phase I study of 5-fluorouracil and folinic acid 70 years old patient treated with 2.6 gr/m2 of 5FU. No other haematological or biological grade II or higher toxicity was noted. Neither toxic death nor grade IV toxicity were encountered.

autologous bone marrow graft, relapse after 7 months, no response to 5FU-CDDP. She was then treated with 1.8 g/m2 of 5FU. One women with ovarian cancer refractory to carboplatine based chemotherapy achieved complete response with the 2.4 g/m2 weekly administration of 5FU.

C. Responses to treatment

D. Pharmacokinetic study

The response to treatment was not the goal of the study but was evaluated whenever possible. The responses observed in the patients with colorectal or breast cancers are presented in Table 2. The objective response rate in previously untreated patients with advanced colorectal cancer (3/7) is consistent with the response rate observed by Ardalan et al, (1991). No patient previously treated for metastatic colorectal cancer achieved an objective response. One of the patients with breast cancer achieved a complete response after the following history: liver metastasis treated by FAC, complete response, intensification chemotherapy with

1. 5-fluorouracil plasma levels The 24 hr continuous infusions of 5FU were started at 3:00 PM. The 5FU plasma concentration increased rapidly in the first six hours, then more slowly between the sixth and twelfth hour. The maximal concentrations, 600 to 800 ng/ml (4.5 to 6ÂľM), were observed between 0:00 AM and 3:00 AM. The concentrations decreased subsequently despite the regular infusion of 5FU (Figure 3). These variations are consistent with the circadian variations observed by Petit and al (1988).

Table 2: Responses to therapy observed in patients with colorectal or breast cancer _________________________________________________________________________

Colorectal cancer Patients with response evaluation:

Untreated patients Complete response: Partial response: Stabilisation: Progression:

7 1 2 4 0

Previously treated patients: Complete response: Partial response Stabilisation: Progression :

10 0 0 8 2

Breast cancer Patients with response evaluation : All pre-treated

Complete response: Partial response: Stabilisation: Progression:

2 0 2 2

_________________________________________________________________________

Figure 3: 5FU Pharmacokinetics

206

Cancer Therapy Vol 1, page 207 of the treatment on the bowel but remains without a pathophysiological explanation. The interindividual differences in the tolerance of 5FU are likely to arise from differences in the metabolism of the drug. The differences observed in the areas under the curve (AUC) for three patients treated with the same dose of 5FU are consistent with this hypothesis. It raises the possibility of adapting 5FU doses to individual pharmacokinetic parameters. Circadian variations in 5FU plasma concentration have been previously observed by Petit et al. (1988) and are the basis of chronotherapy treatment schemes (Lévi et al, 1994). The high doses of calcium folinate used in this study are justified if we admit that a 6[R,S]5,10-methyiene-THF plasma concentration higher than 20 _M is necessary for the optimal potentiation of 5FU at the level of the thymidylate synthetase. In this respect, a prospective comparative study has found significantly higher response rates in advanced colorectal cancer patients treated with 5FU and high-dose calcium folinate compared with 5FU and lowdose folinate (Jäger et al, 1991). Despite the high doseintensity of this treatment, the toxic manifestations are not frequent if the 5FU dose does not exceed 2.4 g/m2. Administered in this manner, such a chemotherapy schedule can be very useful in the treatment of advanced tumours like colorectal cancer or other adenocarcinoma especially if a dose related effect is desired. The lack of myelosuppression allows its use in patients presenting with poor haematological reserve or heavy prior chemotherapy. Ambulatory administration which is made possible by the use of portable pumps preserves quality of life. We are presently comparing, in a multi-centric randomized study, this treatment with a classical five day bolus schedule for patients with advanced colorectal cancer. In conclusion, this phase I study confirmed the feasibility of this treatment scheme and determined the MTD.

2. Folinic acid plasma levels After the infusion of 200 mg of calcium folinate over two hours, the observed plasma concentration of 6[R,S]5,10-methylene-tetra-hydro-folate (THF) were approximately equal to or above 20 µM. This concentration has been reported to be mandatory in-vitro to obtain efficient potentiation of 5FU cytotoxicity (Moran and Scanlon 1991; Zhang et al, 1992). Subsequently during the continuous infusion of calcium folinate, the plasma concentrations continued to increase up to between 30 to 50 µM (Figure 4)

IV. Discussion In this study, we define the maximal tolerated dose of 5FU to be 2.4 g/m2. At higher doses of 5FU the toxic manifestations are more frequent as described by Ardalan et al (1991) using 2.6 g/m2. We believe this difference is due in part to the slightly higher dose of calcium folinate (600 versus 500 mg/m2) and in particular to the use of a 200 mg loading dose. This loading dose leads to plasma concentrations of 6[R,S]5,10-methylene-THF compatible with the optimal potentiation of 5FU during nearly all the time of the continuous 5FU infusion. The pattern of the encountered toxicities is in agreement with the known side effects of 5FU in similar treatment schemes (Nobile et al, 1993). Nausea and vomiting, even if moderate, are common with 5FU in all the treatment schemes. Diarrhea is present in continuous infusions and in 5 day treatments. The hand-foot syndrome is usually noted with the continuous infusions. Myelosuppression which is common when using repeated daily bolus administration of 5FU was absent in our series. The possibility of coronary manifestations during 5FU continuous infusions justifies in our opinion a pretreatment cardiac evaluation in patients with a cardiac history, and if necessary the prophylactic use of calcium channel inhibitors. Encephalopathy is a rare but known side effect of 5FU. Colectasia has not previously been reported in patients treated with 5FU and/or calcium folinate. The occurrence of colectasia in our patients after several courses of treatment suggests a cumulative effect

Acknowledgements We thank Dr Michael Nord for reviewing of an earlier draft of the manuscript.

Figure 4: 6[R,S]5,10-methylene-tetra-hydro-folate pharmacokinetics

207

Limacher et al: Phase I study of 5-fluorouracil and folinic acid Petit E, Milano G, Lévi F, Thyss A, Bailleul F, Schneider M (1988) Circadian Rhythm-varying plasma concentration of 5fluorouracil during a five-day continuous venous infusion at a constant rate in cancer patients. Cancer Res 48, 16761679. Piedbois P and Michiels S for the Meta-Analysis Group In Cancer (2003) Survival benefit of 5FU/LV over 5FU bolus in patients with advanced colorectal cancer: An updated metaanalysis based on 2,751 patients. Proc Am Soc Clin Oncol 22, 294 (abstr 1180). Rougier P, Mitry E (2001) Review of the role of CPT-11 in the treatment of colorectal cancer. Clin Colorectal Cancer 1,8794 Seifert P, Baker LH, Reed ML, and Vaitkevicius VK (1975) Comparison of continuous infused 5-fluorouracil with bolus injection in the treatment of patients with colorectal adenocarcinoma. Cancer 36,123-128. Weinermann B, Shah A, Fields A, Kerr I, Cripps C, Shepherd F, Wierzbicki R, Temple W, Maroun J, Bogues W and Pater J (1990) A randomized trial of continuous systemic infusion vs bolus therapy with 5-fluorouracil in metastatic measurable colorectal cancer. Proc Am Soc Clin Oncol 9, 103 (abstr 399). Zhang ZG, Harstrick A, Rustum YM (1992) Modulation of fluoropyrimidines: role of dose and schedule of leucovorin administration. Semin Oncol 19(suppl 3), 10-15.

References Ardalan B, Chua L, Tian EM, Reddy R, Sridhar K, Benedetto P, Richman S, Legaspi A, Waldman S, Morrell L, Feun L, Savaraj N and Livingstone A (1991) A phase II study of weekly 24-hour infusion with high-dose fluorouracil with leucovorin in colorectal carcinoma. J Clin Oncol 4, 625-630. Baker DE (2003) Oxaliplatin: a new drug for the treatment of metastatic carcinoma of the colon or rectum. Rev Gastroenterol Disord. 3, 31-8. Christophidis N, Mihaly G, Vajda E, and Louis W (1979) Comparison of liquid and gas-liquid chromatographic assays of 5-fluorouracil in plasma. Clin Chem 1, 83-86. Hryniuk WM, Figueredo A, and Goodyear M (1987) Applications of dose intensity to problems in chemotherapy of breast and colon cancer. Semin Oncol 14, 3-11. Jäger E, Klein O, Bernhard H, Wächter B, Heike M, Theiss F, Dippold W, Meyer zum Büschenfelde H and Knuth A (1994) Weekly high dose folinic acid(FA)/5-fluorouracil(FU) versus low dose FA/FU in advanced colorectal cancer. Results of a randomized multicenter trial. Proc Am Soc Clin Oncol 13, 192 (abstr 556). Köhne Wömpner CH, Schmoll HJ, Harstrick A, and Rustum YM (1992) Chemotherapeutic strategies in metastatic colorectal cancer: An overview of current clinical trials. Semin Oncol 19(2 suppl 3), 105-125. Leichman CG, Fleming TR, Muggia FM, Tangen CM, Ardalan B, Doroshow JH, Meyers FJ, Holcombe RF, Weiss GR, Mangalik A, and Macdonald JS (1995) Phase II study of fluorouracil and its modulation in advanced colorectal cancer: a Southwest Oncology Group study. J Clin Onco 13,1303-1311. Lévi F, Zinadi R, Di Palma M, Faggiulo R, Garuffi C, Chollet P, Focan C, Iacobelli S, Perpoint B, Le Rol A, Itzaki M, Vannetzel JM and Misset JL (1994) Improved therapeutic index through ambulatory circadian rhythmic delivery of high dose 3-drug chemotherapy in a randomized phase III multicenter trial. Proc Am Soc Clin Oncol 13, 197 (abstr 574). Lokich J, Ahlgren JD, Gullo JJ, Philips JA, and Fryer JG (1989) A prospective randomized comparison of continuous infusion fluorouracil with a conventional bolus schedule in metastatic colorectal carcinoma: A mid-Atlantic Oncology Program Study. J Clin Oncol 7, 425-432. Machover D, Goldschmidt E, Chollet P, Metzger G, Zittoun J, Marquet J, Vandenbulcke JM, Misset JL, Schwarzenberg L, Fourtillan JB, Gaget H and Mathé G (1986) Treatment of advanced colorectal and gastric adenocarcinomas with 5fluorouracil and high-dose folinic acid. J Clin Oncol 4, 685696. Moran RG, Scanlon KL (1991) Schedule-dependent enhancement of the cytotoxicity of fluoropyrimidines to human carcinoma cells in the presence of folinic acid. Cancer Res 51, 4618-4623. Nobile MT, Sanguineti O, Barzacchi MC, Percivale PL, Bertoglio P, Meszaros PM, Ardizzoni A and Rosso R (1993) Twenty-four hours weekly infusion of 5-fluorouracil and oral 6S-leucovorin in advanced colorectal cancer: a phase II study, preliminary results. Proc Am Soc Clin Oncol 12, 227 (abstr 699). Patel M, Ardalan K, Hochman I, Tian EM, and Ardalan B (2003) Cytotoxic effects and mechanisms of an alteration in the dose and duration of 5-fluorouracil. Anticancer Res 23, 447-452.

Dr. Jean-Marc Limacher

208

Cancer Therapy Vol 1, page 209 Cancer Therapy Vol 1, 209-213, 2003.

High-dose methotrexate with citrovorum factor for malignant fibrous histiocytoma of soft tissue: a cell culture study Research Article

Toshiaki Hitora, Takashi Marui*, Tetsuji Yamamoto, Toshihiro Akisue, Teruya Kawamoto, Keiko Nagira, Tetsuya Nakatani, Shinichi Yoshiya, Masahiro Kurosaka Department of Orthopaedic Surgery, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan _____________________________________________________________________________________________________________ *Correspondence: Takashi Marui, M.D., Department of Orthopaedic Surgery, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan; Phone: +81-78-382-5985; Fax: +81-78-351-6944; E-mail: tmarui@med.kobe-u.ac.jp Key Words: malignant fibrous histiocytoma, cell line, methotrexate, citrovorum factor, chemosensitivity Abbreviations: high-dose methotrexate (HD-MTX), citrovorum factor (CF), malignant fibrous histiocytoma (MFH), (CellTiter One Aqueous Solution) MTS, (Analysis Of Variance) ANOVA Received: 27 August 2003; Accepted: 15 September 2003; electronically published: September 2003

Summary Spindle-pleomorphic sarcomas of soft tissues are resistant for various chemotherapy regimens that are currently used. Although high-dose methotrexate (HD-MTX) with citrovorum factor (CF) rescue regimen is widely used in chemotherapy for skeletal osteosarcoma, the effect of HD-MTX-CF on spindle-pleomorphic soft tissue sarcomas remains unknown. The purpose of the present study is to investigate the pertinence of clinical application of the HD-MTX-CF regimen for chemotherapy of malignant fibrous histiocytoma (MFH) in soft tissue. A human MFH cell line TNMY1 was used. The cytotoxic effect by MTX and the cell revival effect by CF were determined by MTS tetrazolium assay. The chemosensitivity was compared to that of an osteosarcoma cell line KHOS/NP. The growth inhibition rates by MTX in the MFH cells significantly increased time-dependently by the subsequent incubation. The growth inhibition rate of the MFH cells, however, was lower than that of the osteosarcoma cells. The decreased cell proliferation of MFH by MTX was not significantly reversed by CF. Our data indicate that a HD-MTX-CF protocol is potentially applicable to the treatment of MFH pleomorphic soft tissue sarcomas consist of doxorubicin, epirubicin, cisplatin, and ifosfamide (Edmonson et al, 2002; Reichardt, 2002), there is little consensus concerning the doses and the combinations of these chemotherapeutic agents. To our knowledge, little has been reported concerning the clinical use of HD-MTX for softtissue MFH. The purpose of the present study is to experimentally examine the effects of the HD-MTX with CF rescue regimen on proliferative activity of a MFH cell line, comparing that of an osteosarcoma cell line.

I. Introduction Malignant fibrous histiocytoma (MFH) is one of the most common high-grade sarcomas in late adult life that develops in bone and soft tissue. MFH has a predilection for extremities, and the prognosis of the disease is reported to be poor due to its chemo-resistance (Papai et al, 2000; Reichardt, 2002; Spira and Ettinger, 2002). Recent studies introduced combination adjuvant chemotherapy protocols consisting of doxorubicin, cisplatin, and high-dose methotrexate (HD-MTX) for skeletal osteosarcomas, and the successful clinical results have been reported (Bacci et al, 2001, 2002; Thompson et al, 2002). Of these, HDMTX with citrovorum factor (CF) rescue regimen is one of the frequently used chemotherapy protocol for osteosarcoma (Breithaupt and Kuenzlen, 1983). In contrast, the effectiveness of adjuvant chemotherapy for spindle-pleomorphic sarcomas including MFH of soft tissue remains controversial. Although many chemotherapy protocols currently used for spindle-

II. Materials and methods A. Cell lines and cell culture The MFH cell line TNMY1 that was previously established in our laboratory was used (Nakatani et al, 2001). The osteosarcoma cell line KHOS/NP was purchased from American Type Culture Collection (CRL-1427, Rockville, MD, USA). Each cell line was maintained as a monolayer culture in a humidified 5% CO2 incubator at 37Ă&#x2020;C. The culture medium consisted of Eagleâ&#x20AC;&#x2122;s minimum essential medium (MEM)

209

Hitora et al: Methotrexate with citrovorum factor against malignant fibrous histiocytoma containing 0.292 g/L L-glutamine (Sigma Chemical Co., St. Louis, MO, USA) supplemented with 10% fetal bovine serum (Sigma Chemical Co.), 100 U/ml penicillin G (Sigma Chemical Co.), and 100 U/ml streptomycin (Sigma Chemical Co.).

III. Results A. The effect of MTX on the cell proliferation The Gi rates of the KHOS/NP cells after 24 hours exposure to MTX and additional 0 hour incubation are shown in Table 1A and Figure 1, and those in the TNMY1 cell line are shown in Table 1B and Figure 2, respectively. One-way repeated measures ANOVA showed that MTX significantly inhibited the cell growth of the KHOS/NP cell line at the concentrations of 10-8 to 10-2 M dose-dependently, but no significant effect was observed on the TNMY1 cell line. The Gi rates of the cells after 24 hours exposure to MTX and additional 48-hour incubation in the KHOS/NP cell line are shown in Table 2A and Figure 1, and those in the TNMY1 cell line are shown in Table 2B and Figure 2, respectively. One-way repeated measures ANOVA showed that MTX significantly inhibited the cell growth at the concentrations of 10-8 to 10-2 M in the KHOS/NP cell line, while MTX inhibited the cell growth at the concentrations of 10-6 to 10-2 M in the TNMY1 cell line. The Gi rates of the cells after 24 hours exposure to MTX and additional 48-hour incubation in the KHOS/NP cell line are shown in Table 3A and Figure 1, and those in the TNMY1 cell line are shown in Table 3B and Figure 2, respectively. One-way repeated measures ANOVA showed that MTX significantly inhibited the cell growth at the concentrations of 10-8 to 10-2 M in the KHOS/NP cell line, while MTX inhibited the cell growth at the concentrations of 10-7 to 10-2 M in the TNMY1 cell line. Two-way repeated measures ANOVA revealed that the growth inhibitory effect of MTX on both KHOS/NP and TNMY1 cell lines significantly increased by incubating for 48 and 96 hours after the cells were exposed to MTX.

B. Chemicals Methotrexate and CF were kindly provided by Lederle Laboratories (Pearl River, NY, USA).

C. The effect of MTX on the cell proliferation The cells were suspended in the culture medium at a concentration of 5.0x103/ml. A hundred microliter aliquot of the cell suspension was dispersed to each well in 96-well cell culture plates (Costar, Cambridge, Massachusetts, U.S.A), and the cells were kept quiescent for 48 hours. The culture medium of each well was replaced by 100 µl of fresh medium, and MTX was pulsed to each well at a final concentration of 1.0 x 10-2 to 1.0 x 10-8mol/L. An equivalent volume of fresh medium, instead of MTX, was added to certain wells to serve as controls. At this time, the serum concentration in the culture medium was reduced to 1%. After the cells were incubated for 24 hours, the culture medium was replaced by a new medium following cell rinse with phosphate buffer saline (PBS). Finally, the cells were incubated another 0, 48, or 96 hours. The cell viability was determined using a modified MTS tetrazolium assay (Malich et al, 1997). The medium in each well was replaced by 100 µl of Eagle’s MEM with 0.292 g/L Lglutamine without FBS, and 20 µl of MTS reagent (CellTiter 96_ AQueous Non-Radioactive Cell Proliferation Assay, Promega Co., Madison, WI, USA) was pulsed to each well. After 2 hours of further incubation at 37ÆC in a humidified 5% CO2 incubator, the optical density (OD) value of each well was measured at 490nm using an automatic microplate reader (Microplate Reader, Bio Rad, USA). The growth inhibition (Gi) rate of the cells in each well was determined by the following equation (Reinecke et al, 2000). Gi = {1- (ODS -ODB)/ (ODC-ODB)}x100 Gi; growth inhibition rate (%) ODS; OD value of each sample ODC; OD value of control ODB; OD value of blank well The data were shown in mean ± SD from six replicate wells for each MTX concentration and three replicate experiments for each cell lines.

Table 1A. Gi rates of the KHOS/NP cells after 24 hours exposure to MTX and additional 0 hour incubation Gi rate (%) MTX concentration (M) KHOS/NP cell line 35.0±15.4 10-8 49.8±6.2 10-7 50.1±6.7 10-6 51.0±7.9 10-5 50.3±6.7 10-4 51.4±6.7 10-3 60.5±4.6 10-2

D. The reversal effect of CF on the cytotoxicity of MTX The monolayered cell culture of TNMY1 cell line was prepared in a plastic 96-well plate in the same way as was described above. After the cells were exposed to subsequent doses of MTX for 24 hours, the culture supernatant was replaced by refresh culture medium containing 1% FBS, 100U/ml penicillin G, and 100U/ml streptomycin. Then, the cells were cultured for 96 hours in absence or presence of CF at the concentration of 10-7 mol/L. The cell growth inhibition rate of each well was determined by MTS assay.

Table 1B. Gi rates of the TNMY1 cell line after 24 hours exposure to MTX and additional 0 hour incubation Gi rate (%) MTX concentration (M) TNMY1 cell line 1.4±2.2 10-8 2.5±2.6 10-7 4.5±1.7 10-6 4.7±2.9 10-5 6.9±5.9 10-4 7.6±5.5 10-3 4.0±7.9 10-2

E. Statistical analysis The data was analyzed using One-way repeated measures ANOVA for comparing the Gi rates in each group, and Two-way repeated measures ANOVA for comparison between each cell line or each incubation time. The p-values less than 0.05 were considered statistically significant.

210

Cancer Therapy Vol 1, page 211

Table 2A. Gi rates of the KHOS/NP cells after 24 hours exposure to MTX and additional 48-hour incubation Gi rate (%) MTX concentration (M) KHOS/NP cell line 67.4±3.1 10-8 69.2±2.6 10-7 69.2±2.8 10-6 69.9±2.8 10-5 70.5±2.6 10-4 72.1±3.3 10-3 0.6±1.8 10-2

Table 2B. Gi rates of the TNMY1 cell line after 24 hours exposure to MTX and additional 48-hour incubation. Gi rate (%) MTX concentration (M) TNMY1 cell line 2.6±3.9 10-8 7.0±4.3 10-7 20.2±5.9 10-6 35.8±4.5 10-5 34.7±4.8 10-4 34.2±3.9 10-3 35.1±5.5 10-2

Figure 1: The effect of MTX on the cell proliferation of the osteosarcoma cell line KHOS/NP. Each value represents the mean ± standard deviation from MTS assays of six replicate wells per microtiter plate and three replicate experiments per cell line (n=18). An asterisk beside each error bar indicates statistical significance (p<0.05) compared to the control specimen. MTX: methotrexate

Table 3A. Gi rates of the KHOS/NP cells after 24 hours exposure to MTX and additional 96-hour incubation Gi rate (%) MTX concentration (M) KHOS/NP cell line 34.7±13.8 10-8 71.9±12.2 10-7 74.8±9.9 10-6 75.6±9.4 10-5 75.1±9.3 10-4 74.3±8.7 10-3 77.3±6.2 10-2

Figure 2: The effect of MTX on the cell proliferation of the MFH cell line TNMY1. Each value represents the mean ± standard deviation from MTS assays of six replicate wells per microtiter plate and three replicate experiments per cell line (n=18). An asterisk beside each error bar indicates statistical significance (p<0.05) compared to the control specimen. MTX: methotrexate

Table 3B. Gi rates of the TNMY1 cell line after 24 hours exposure to MTX and additional 96- hour incubation Gi rate (%) MTX concentration (M) TNMY1 cell line 0.9±2.1 10-8 15.1±4.5 10-7 43.5±16.6 10-6 63.4±5.0 10-5 62.9±4.2 10-4 63.1±6.0 10-3 60.3±9.4 10-2

B. The reversal effect of CF on the cytotoxicity of MTX The Gi rates of the TNMY1 cells after 24 hours exposure to MTX and subsequent 96-hour incubation in the absence of CF at the MTX concentrations of 10-7, 10 -6, 10-5, 10 -4, and 10-3 M, are shown in Table 4A and Figure 3, and those in the presence of 10-7 M CF are shown in Table 4B and Figure 3, respectively. Two-way repeated measures ANOVA showed no significant decrease in the Gi rates in the presence of 1.0 x 10-7 mol/L CF. One-way repeated measures ANOVA revealed no significant decrease in the Gi rates at any concentrations of MTX in the presence of CF except for at 1x10-6 M.

211

Hitora et al: Methotrexate with citrovorum factor against malignant fibrous histiocytoma Table 4A. Gi rates of the TNMY1 cell line after 24 hours exposure to MTX and additional 96- hour incubation in the absence of CF. Gi rate (%) MTX concentration (M) TNMY1 cell line 6.1±11.1 10-7 36.1±15.0 10-6 63.1±5.7 10-5 61.7±4.2 10-4 59.7±2.7 10-3

chemotherapy (Breithaupt and Kuenzlen, 1983). The standard dose of CF in the practical regimen in osteosarcoma chemotherapy is 15 mg/m2 for every six hours, bearing a serum concentration of 1x10 -6 to 1x10-7 M (Diddens et al, 1987). In the present study, the data obtained showed that the response to MTX in the MFH cells was significantly lower than that in the osteosarcoma cells shortly after the cells were exposed to MTX for 24 hours. However, a delayed effect of MTX on the MFH cell proliferation was observed; the Gi rates in the MFH cells significantly increased 48 and 96 hours after 24-hour exposure to MTX time-dependently, with the maximal Gi rate of approximately 65%. The cause of such a delayed effect of MTX on the MFH cell growth is of an important consideration. MTX is a potent inhibitor of dihydrofolate reductase (DHFR), a key enzyme for intracellular folate metabolism (Bertino et al, 1996). After transportation into the cell, MTX needs to be polyglutamylated by folylpolyglutamate synthetase (FPGS) before functioning as DHFR inhibitor. DHFR inhibition by polyglutamylated MTX results in decreased regeneration of tetrahydorfolate from dihydrofolate, which is a product of thymidylate synthase, leading to decrease in DNA biosynthesis (Bertino et al, 1996). The decreased transport of MTX into the cells, impaired polyglutamylation of MTX, and increased DHFR enzyme activity of the cells have been suggested to be the main factors of cell resistance to MTX (Bertino et al, 1996). Assuming that the MFH cells had increased activities of the latter two pathways, the growth inhibition rates should have remained low despite the subsequent incubation after MTX exposure. There is a possibility that a decreased transport of MTX into the MFH cells could result in a delayed increase of intracellular concentration of polyglutamylated MTX, leading to the late response to MTX. Our data showed that the growth inhibition effects of MTX on both MFH and osteosarcoma cells increased dose-dependently. The maximal Gi rate was attained at the concentrations of over 1x10-5 M in the MFH cells, and at the concentrations of over 10 -7 M in the osteosarcoma cells when the cells were subjected to 96 hours incubation following 24-hour exposure to MTX. In the clinical HDMTX chemotherapy, the serum concentrations of MTX have been reported to be 1x10-5 to 1x10-3 M during 24 hours after administration (Breithaupt and Kuenzlen, 1983). These data indicate that the MTX dosages used in the clinical chemotherapy for osteosarcomas could sufficiently cover the effective serum concentration levels for MFH of soft tissue. Although the maximum Gi rate in MFH cells was lower than that in osteosarcoma cells, the MFH cells are considered to be sensitive to MTX. Citrovorum factor is readily converted to reduced folate independently of DHFR within the cells and bypasses the block of DHFR by MTX, thereby replenishing cellular pools of tetrahydrofolate depleted by MTX action (Diddens et al, 1987; Haskell, 1980). Since a certain neoplastic cell has an insufficient active transporting ability of CF in its cell membrane, such a protective effect of CF from MTX cytotoxicity is often

Table 4B. Gi rates of the TNMY1 cell line after 24 hours exposure to MTX and additional 96- hour incubation in the presence of 10-7 M CF. Gi rate (%) MTX concentration (M) TNMY1 cell line 6.0±11.6 10-7 20.9±9.4 10-6 57.4±7.4 10-5 60.7±3.6 10-4 60.8±3.0 10-3

Figure 3: The reversal effect of CF on the cytotoxicity of MTX. Each value represents the mean±standard deviation from MTS assays of six replicate wells per microtiter plate and three replicate experiments per cell line (n=18). An asterisk beside each error bar indicates statistical significance (p<0.05). MTX: methotrexate, CF: Citrovorum factor.

IV. Discussion Chemotherapy for locally advanced or metastatic spindle-pleomorphic soft tissue sarcomas remains highly investigational. Doxorubicin, epirubicin, and ifosfamide are chemotherapeutic agents commonly used, with a clinical response rate of approximately 20% (Reichardt, 2002); little has been known concerning the effect of HDMTX with CF rescue on spindle-pleomorphic soft tissue sarcomas either in vivo or in vitro. The present experimental study was designed to provide a conceptual basis for further optimization of the HD-MTX with CF rescue protocol that may be useful in the practical use. The concentration ranges of MTX used in this study were determined to simulate the actual serum levels attained clinically 24 hours after cessation of intravenous administration of HD-MTX in osteosarcoma 212

Cancer Therapy Vol 1, page 213 Breithaupt H, Kuenzlen E (1983) High-dose methotrexate for osteosarcoma: toxicity and clinical results. Oncology 40,8589. Diddens H, Teufel T, Niethammer D (1987) High-dose methotrexate therapy with leucovorin rescue: in vitro investigations on human osteosarcoma cell lines. Cancer Chemother Pharmacol 20,128-132. Edmonson JH, Petersen IA, Shives TC, Mahoney MR, Rock MG, Haddock MG, Sim FH, Maples WJ, O'Connor MI, Gunderson LL, Foo ML, Pritchard DJ, Buckner JC, Stafford SL (2002) Chemotherapy, irradiation, and surgery for function-preserving therapy of primary extremity soft tissue sarcomas: initial treatment with ifosfamide, mitomycin, doxorubicin, and cisplatin plus granulocyte macrophagecolony-stimulating factor. Cancer 94,786-792. Haskell CM (1980) Drugs used in cancer chemotherapy. In Haskell CM (ed), Cancer Treatment. Philadelphia: W.B. Saunders, 53-123. Malich G, Markovic B, Winder C (1997) The sensitivity and specificity of the MTS tetrazolium assay for detecting the in vitro cytotoxicity of 20 chemicals using human cell lines. Toxicology 124,179-192. Nakatani T, Marui T, Yamamoto T, Kurosaka M, Akisue T, Matsumoto K (2001) Establishment and characterization of cell line TNMY1 derived from human malignant fibrous histiocytoma. Pathol Int 51,595-602. Papai Z, Bodoky G, Szanto J, Poller I, Rahoty P, Eckhardt S, Lang I, Szendroi M (2000) The efficacy of a combination of etoposide, ifosfamide, and cisplatin in the treatment of patients with soft tissue sarcoma. Cancer 89,177-180. Reichardt P (2002) High-dose chemotherapy in adult soft tissue sarcoma. Crit Rev Oncol Hematol 41,157-167. Reinecke P, Knopf C, Schmitz M, Schneider EM, Gabbert HE, Gerharz CD (2000) Growth inhibitory effects of paclitaxel on human epithelioid sarcoma in vitro: heterogeneity of response and the multidrug resistance phenotype. Cancer. 88,1614-1622. Spira AI, Ettinger DS (2002) The use of chemotherapy in softtissue sarcomas. Oncologist 7,348-359. Thompson RC, Jr., Cheng EY, Clohisy DR, Perentesis J, Manivel C, Le CT (2002) Results of treatment for metastatic osteosarcoma with neoadjuvant chemotherapy and surgery. Clin Orthop 397,240-247.

more effective in normal tissues than in neoplasms (Haskell, 1980). The data in the present study showed that 10-7 M CF did not reverse the cell proliferation of TNMY1 cell line when the cells were pretreated with over 10-5 M of MTX, although a significant reversal effect of CF was observed after pretreatment with 10-6 M of MTX. The reversal effect of CF after pretreatment with the lower dose of MTX could be explained by the fact that MTX and CF competitively share an active transporting mechanism, hence high levels of MTX may require large doses of CF to prevent cell death (Haskell, 1980). These data indicated that the standard concentration of CF administration after HD-MTX could act as the rescue for normal cells without preventing the cytotoxicity of MTX for TNMY1 cells.

V. Conclusions Our data in the present study have indicated that MFH of soft tissue is potentially sensitive to MTX. The HD-MTX with CF rescue chemotherapy protocol that is frequently used for osteosarcoma is possibly applicable to treatment of MFH of soft tissue, although clinical prospective studies are required to verify this.

References Bacci G, Briccoli A, Ferrari S, Longhi A, Mercuri M, Capanna R, Donati D, Lari S, Forni C, DePaolis M (2001) Neoadjuvant chemotherapy for osteosarcoma of the extremity: long-term results of the Rizzoli's 4th protocol. Eur J Cancer 37,2030-2039. Bacci G, Ferrari S, Lari S, Mercuri M, Donati D, Longhi A, Forni C, Bertoni F, Versari M, Pignotti E (2002) Osteosarcoma of the limb. Amputation or limb salvage in patients treated by neoadjuvant chemotherapy. J Bone Joint Surg Br 84,88-92. Bertino JR, Goker E, Gorlick R, Li WW, Banerjee D (1996) Resistance Mechanisms to Methotrexate in Tumors. Oncologist 1,223-226.

213

Hitora et al: Methotrexate with citrovorum factor against malignant fibrous histiocytoma

214

Cancer Therapy Vol 1, page 215 Cancer Therapy Vol 1, 215-221 2003.

Phase II intergroup trial of sequential chemotherapy and radiotherapy for AIDS-related primary central nervous system lymphoma Research Article

Richard F Ambinder1, Sandra Lee2, Walter J Curran3, Joseph A Sparano4*, Robert L Krigel5, Justin McArthur1, Christopher Schultz6, Carl E Freter7, Leslie Kaplan8, Jamie H VonRoenn9 1

Johns Hopkins School of Medicine, Baltimore, MD, ambinri@jhmi.edu, jm@jhmi.edu; 2Dana-Farber Cancer Institute, Boston, MA, sjlee@jimmy.harvard.edu; 3Thomas Jefferson University Hospital, Philadelphia, PA, walter.curran@mail.tju.edu; 4Montefiore Medical Center, Bronx, NY, jsparano@montefiore.org; 5Lankenau Hospital, Wynnewood PA; 6Medical College of Wisconsin, Milwaukee, WI, cschultz@mcw.edu; 7Georgetown University Medical Center, Washington, D.C., carl.freter@yvmh.org; 8Northwestern University Medical Center, Chicago, IL, jvonroenn@northwestern.edu __________________________________________________________________________________________________ *Correspondence: Joseph A. Sparano, M.D., Montefiore Medical Center-Weiler Division, Department of Oncology, 2South, Room 4748, 1825 Eastchester Road, Bronx, New York 10461; Phone 718-904-2555/Fax 718-904-2892; Email: jsparano@montefiore.org Key Words: HIV, cyclophosphamide, EBV, doxorubicin, vincristine, dexamethasone, radiation therapy, antiretroviral therapy, cerebrospinal fluid Abbreviations: primary central nervous system lymphoma (PCNSL), Epstein-Barr virus (EBV), cerebrospinal fluid (CSF), computerized tomography (CT), human immunodeficiency virus (HIV), antiretroviral therapy (HAART), CHOD (cyclophosphamide, doxorubicin, vincristine, and dexamethasone) Received: 29 August 2003; Accepted: 15 September 2003; electronically published: September 2003

Summary The purpose of this study is to determine the value of a systemic evaluation in patients with primary central nervous system lymphoma (PCNSL) associated with human immunodeficiency virus (HIV) infection, to investigate the diagnostic utility of detection of Epstein-Barr virus (EBV) DNA in cerebrospinal fluid (CSF), and to determine the overall survival in patients treated with one cycle of chemotherapy followed by radiation therapy. Patients underwent computerized tomography (CT) and bilateral bone marrow biopsy. CSF was analyzed for EBV DNA. A single cycle of an anthracycline containing combination chemotherapy regimen was followed by radiation therapy. Thirty-five patients were enrolled. Bone marrow biopsy did not reveal lymphoma in any case. Chest X ray identified one patient with a coexistent thoracic lymphoma. EBV DNA was detected in CSF in 8 of 10 patients. The median survival was 2.4 months (C.I. 1.1 to 3.2 months). Four patients survived more than a year. CONCLUSIONS: In HIV-infected patients with intracranial mass lesions, systemic evaluation with CT scan and bone marrow biopsy has a low yield. EBV DNA is usually detected in CSF. A single cycle of an anthracyclinecontaining regimen followed by radiation was associated with a poor survival. evaluated. In addition, at the time that this study was performed, brain biopsy was considered necessary for establishing a definitive diagnosis, but was known to be associated with considerable morbidity and occasional mortality (Corn et al, 1995; Skolasky et al, 1999). Results of standard therapy with radiation were poor engendering therapeutic nihilism (Baumgartner et al, 1990). Finally, the relationship between PCNSL and systemic lymphoma, particularly in the setting of acquired immunodeficiency syndrome (AIDS) was not clear. Extranodal-presentations of systemic AIDS-related lymphoma are common. The central nervous system is one of the most frequent extranodal sites, raising the concern that central nervous system involvement at presentation may be a

I. Introduction The incidence of primary central nervous system lymphoma (PCNSL) in individuals infected with the human immunodeficiency virus (HIV) was 3,600-fold greater than in the general population in the era before highly active antiretroviral therapy (Cote et al, 1996). Since the introduction of highly active antiretroviral therapy (HAART), there has been a decline in the incidence of HIV-associated PCNSL (Sparano et al, 1999; Besson et al, 2001; Kirk et al, 2001; Hoffmann et al, 2003). The diagnostic yield of a systemic work up, including computerized tomography (CT) of the body and bilateral bone marrow biopsy has not been previously

215

Ambinder et al: Chemotherapy and RT against PCNS in AIDS patients weekly until cytology was negative, then once weekly for six weeks, and once monthly for ten months.

manifestation of systemic disease. We sought to determine whether a systemic work up (particularly bone marrow biopsy) was necessary to exclude occult systemic disease. We also sought to determine whether in light of the nearly uniform EBV-PCNSL association (MacMahon et al, 1991) a likely diagnosis could be established without brain biopsy by sampling the cerebrospinal fluid for EBV DNA by polymerase chain reaction (PCR) (Arribas et al, 1995; Antinori et al, 1997, 1999; Cinque et al, 1993). Finally, we sought to determine whether chemotherapy administered before radiation might improve the outcome (DeAngelis et al, 1992; Forsyth et al, 1994). In 1995, the Eastern Cooperative Oncology Group (ECOG) initiated a multi-institutional study to address each of these issues. Other participating groups included the Radiation Therapy Oncology Group (RTOG), the Cancer and Acute Leukemia Group B (CALGB), and the AIDS Clinical Trials Group (ACTG). This study forms the basis for this report.

C. Radiotherapy Patients started radiotherapy 7-10 days after chemotherapy. Daily treatments of 2.5 Gy were given 5 days per week for 12 days to the entire cranial contents using opposed shaped lateral whole brain treatment portals. Four daily 2.5 Gy fractions where then delivered via shaped reduced fields to the identifiable lesion(s) with a margin. The total tumor dose was 40.0 Gy in 16 fractions given in less than 4 weeks. Treatment plans, diagnostic imaging, and field localization were reviewed on all treated patients by the radiation.

D. Supportive care Granulocyte colony stimulating factor (G-CSF) was given at 5 ug/kg subcutaneously beginning on day 2 for a minimum of 10 days until granulocyte counts exceeded 5000/ul for two days. Prophylaxis for pneumocystis carinii (trimethoprim /sulfamethoxazole, dapsone or aerosolized pentamidine) and fungal infection (fluconazole, ketoconazole, or clotrimazole oral troches) were standard. As this trial was initiated before the availability of highly active antiretroviral therapy, antiretroviral therapy consisted of standard doses of didanosine, zidovudine, or zalcitabine unless contraindicated.

II. Patients and methods A. Methods This study plan included a diagnostic step (step 1), a treatment step (step 2), and a correlative laboratory component. To be eligible for step 1, patients were required to be HIV seropositive and to have biopsy proven PCNSL of intermediate or high-grade histology involving the parenchyma of the brain with an intracranial space-occupying lesion documented on an imaging study. Other requirements included no prior chemotherapy (unless given for Kaposi’s sarcoma), no prior cranial irradiation, to be within 3 weeks of diagnostic brain biopsy, age 16 or older, no prior history of lymphoma or clinical evidence of systemic lymphoma, no prior or concomitant malignancy other than Kaposi’s sarcoma or curatively treated carcinoma of the cervix, or squamous cell or basal carcinoma of the skin. To be eligible for step 2, patients were required to have no evidence of systemic disease as documented by computerized tomography (CT) of the chest, abdomen, and pelvis, and bilateral bone marrow biopsies. Other requirements included an ECOG performance status of 0-3, adequate hematologic function (absolute neutrophil count of ! 1,000/mm3 and platelets ! 50,000/mm3) and adequate renal and hepatic function (serum creatinine " 3.0 mg/dl and bilirurbin < 3 x the upper limit of normal), and no active acute infection. Lumbar puncture was required for the evaluation of cerebrospinal fluid (CSF) for malignant cells and EBV DNA unless clinically contraindicated. Patients were excluded if they were receiving concurrent treatment with investigational agents other than investigational antiretroviral agents, if they had an active duodenal ulcer, uncontrolled diabetes mellitus, active heart disease, or were pregnant or lactating. Patients were required to provide written informed consent. The protocol was approved by the institutional review board at each participating institution.

E. Cerebrospinal fluid polymerase chain reaction to detect EBV DNA CSF samples from patients enrolled in this study and specimens that had been archived in the Johns Hopkins AIDS Neurological Tissue Bank were studied for EBV DNA by polymerase chain reaction (PCR). CSF from study participants was shipped overnight on dry ice and stored at –70oC until analysis. CSF archived in the AIDS Neurological Tissue Bank were collected from patients treated at Johns Hopkins with HIV infection who had neurological signs or symptoms or who were asymptomatic. These samples were amplified with PCR primers to two regions of the genome in two separate assays as described (Ambinder et al, 1990; Arribas et al, 1995). For these assays, a 20µL aliquot of CSF was heated at 95oC for 10 minutes. PCR products were analyzed by agarose gel electrophoresis with Southern blot transfer and 32 hybridization with P-labeled oligonucleotide probes. Autoradiography was carried out overnight with Kodak X-Omat film. To prevent contamination PCR set up and amplification were performed in separate rooms.

F. Statistical considerations The primary objectives of the trial were descriptive. The methods of Kaplan and Meier were used to estimate survival curves. With the intent of estimating one-year survival with a maximum 90% confidence interval width of +/- 16%, the goal was to enroll at least 30 patients. The sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of CSF EBV DNA in patients not yet treated for PCNSL were calculated using standard definitions (Dunn, 1995).

B. Chemotherapy Patients without systemic lymphoma were registered on step 2 and received intravenous cyclophosphamide 750 mg/m2, doxorubicin 50 mg/m2, vincristine 1.4 mg/m2 (2 mg maximum) and dexamethasone 16 mg/m2, followed by the same dexamethasone dose orally or intravenously on a daily basis; daily dexamethasone treatment was permitted to maintain the patient's best neurologic function. Patients with positive CSF cytology were treated with intrathecal cytarabine, 50 mg twice

III. Results A. Patient Characteristics This study accrued 35 patients between April 1994 and April 1997 to step 1, including patients accrued from ECOG (N=24), CALGB (N=6), RTOG (N=3), and ACTG (N=2). The characteristics of the study population are

216

Cancer Therapy Vol 1, page 217 summarized in Table 1. The median age was 36 years and 33 (94%) were male. The median CD4 count was 10.5/ÂľL (range 1-91/ ÂľL). The ECOG performance status was 0 or 1 in 11 (34%), 2 in 10 (31%) and 3 in 10 (31%). Prior opportunistic infection included pneumocystis carinii in 10 (33%), cytomegalovirus infection in 9 (30%), candida esophagitis in 7 (24%), mycobacterium avium intracellulare in 6 (19%), and other infections in 11 (42%). CSF cytology was performed in 16 patients, of whom three were positive for malignant cells consistent with meningeal lymphoma. In many instances lumbar puncture was felt to be contraindicated and CSF cytology not available.

Table 1. Patient Characteristics Age Median Range

36 years 22 - 54 years

ECOG Performance Status (N=32) 0, 1 11 (34.4%) 2 10 (31.3%) 3 10 (31.3%) 4 1 (3.1%) CD 4 Count (N=26) Median 10.5/uL Range 1-91/uL Neutrophil Count (N=31) Median 2800/ul Range 1000-15,100/ul Hemoglobin (N=31) Median 12.0 g/dl Range 9.2-15.7 Platelet Count (N=31) Median 210,000/ul Range 64,000-452,000

B. Systemic diagnostic workup Bone marrow biopsy revealed no evidence of lymphoma in any patient. In one patient the CXR revealed coexistant lymphoma in the lung, which was confirmed on computerized tomography (CT) of the chest.

Table 2. Clinical and Radiographic Findings Clinical Findings Number Percent

C. Clinical and radiographic presentation of CNS disease Clinical and radiographic features are shown in Table 2. All patients had neurologic symptoms at diagnosis. The most common presenting signs and/or symptoms included motor deficits in 13 (37%), altered mental status in 11 (31%), headache in 10 (29%), visual disturbance in 9 (26%), cranial nerve deficits in 8 (23%), speech impairment in 8 (23%), cerebellar deficits in 7 (20%), sensory deficits in 6 (17%), and papilledema in 1 (4%). Imaging studies of the brain revealed the tumors to be unilateral in 23 patients (66%), and the median tumor size was 5.2 cm2 (1.5-27.5). Supratentorial structures were involved in 20 patients (57%) and infratentorial structures were involved in 4 patients (11%).

Motor deficits Altered mental status Headache Visual disturbance Cranial nerve deficits Speech impairment Cerebellar deficits Sensory deficits Papilledema

13 11 10 9 8 8 7 6 1

37% 31% 29% 26% 23% 23% 20% 17% 4%

23 20 4

66% 57% 11%

Radiographic Findings Unilateral lesions Supratentorial lesions Infratentorial lesions

D. Response and survival Thirty-four patients proceeded to step 2 and received protocol treatment. Complete response occurred in 3 patients (9%), and partial response in 1 patient (3%). Fifteen patients (43%) did not complete radiation therapy, including seven patients who died before completion, five patients who declined to complete therapy, and three patients who had showed tumor progression during radiation therapy. The median survival was 2.4 months (95% confidence intervals 1.1, 3.2 months) (Figure 1). Four patients survived at least one year. The characteristics of the responders and/or longterm survivors are summarized in Table 3.

E. Toxicity There were 8 patients (23%) who died within 30 days of initiating treatment, including four patients who died of infectious complications, two patients who had pulmonary failure, one patient who had a brain herniation, and one

Figure.1. Overall survival of treated patients (N=-34).

217

Ambinder et al: Chemotherapy and RT against PCNS in AIDS patients At the time the study was initiated, bone marrow biopsy and computerized tomography of the chest, abdomen and pelvis were routinely recommended in order to rule out the possibility of occult systemic disease. Patterns of involvement by B-cell and B-cell derived malignancies are notably distinct in HIV-infected patients and cannot be predicted by extrapolation from uninfected hosts. Thus non-Hodgkin's lymphoma much more commonly involves extra lymphatic sites in HIV patients than in others (Levine et al, 2001; Sparano, 2001). Similarly, Hodgkin's disease not uncommonly presents with bone marrow involvement in HIV patients (Levine, 1998). Finally, visceral plasmacytomas occur in HIVinfected patients (Carraway and Ambinder, 2002). There has been no previous systematic study of bone marrow involvement in AIDS PCNSL. The results of step 1 of this study showed that the most invasive staging test, bone marrow biopsy, never showed lymphomatous involvement. CT scanning identified systemic lymphoma in only one patient who had intrathoracic disease demonstrable on chest x-ray. Our findings suggest that routine bone marrow biopsy and CT scans of the body have a low diagnostic yield in this setting and are generally not indicated. A related diagnostic issue is the utility of detecting EBV DNA in the CSF by PCR in patients with HIV infection and intracranial mass lesions. Previous reports have documented the presence of EBV DNA in the CSF in the majority of patients with HIV infection and PCNSL (MacMahon et al, 1991; Cinque et al, 1993; Arribas et al, 1995; Antinori et al, 1997, 1999). For example, Cingolani et al (1998) evaluated CSF EBV DNA by PCR in 122 patients with HIV infection, including 42 patients with PCNSL and 80 with a variety of non-malignant conditions. CSF EBV DNA had a sensitivity of 80% (95% confidence intervals 61%, 92%) and a specificity of 100% (95% confidence intervals 93%, 100%). The authors concluded that sampling of the lumbar CSF would have led to a correct diagnosis in 63% of patients with HIV-associated PCNSL, and would have excluded this diagnosis in 76%.

patient who died during a grandmal seizure. Grade 4 toxicity included leukopenia in 63%, thrombocytopenia in 20%, and liver, pulmonary, neurosensory, neuromotor, and metabolic toxicities one patient each (3%).

F. Evaluation of cerebrospinal fluid for EBV DNA The results of the studies of CSF for EBV DNA are shown in Table 4. CSF specimens from 15 patients with PCNSL enrolled on this study and 73 patients with HIV infection and other conditions obtained from the Johns Hopkins AIDS Specimen Bank were available for analysis by EBV PCR. Of the 15 patients with PCNSL who had specimens evaluated, in 10 patients the CSF was obtained before therapy. EBV DNA was detected in 8 of 10 patients with pre-treatment CSF specimens available. In 5 patients with CSF obtained after either complete tumor excision by surgery (1 patient) or the initiation of chemotherapy (4 patients), EBV DNA was not detected. In addition, EBV DNA was detected in 1 of 16 patients (6%) with toxoplasmosis, 1 of 27 patients (4%) with progressive multifocal leukoencephalopathy, 2 of 8 patients (25%) with cytomegalovirus encephalitis, and none of 15 patients without neurologic diagnoses. In 7 patients with systemic lymphoma without central nervous system involvement, EBV was detected in none. In patients with PCNSL, detection of EBV DNA in the CSF had a sensitivity of 80%, specificity of 94 %, positive predictive value of 67%, and a negative predictive value of 97%.

IV. Discussion We report the results of a multi-institutional trial evaluating a diagnostic algorithm and treatment program for patients with HIV infection and biopsy-confirmed PCNSL. The objectives of this study were to evaluate the role of routine screening for systemic disease, the accuracy of detecting EBV DNA in the cerebrospinal fluid for diagnosing PCNSL, and whether the administration of a single cycle of chemotherapy prior to brain irradiation improved the outcome for patients with this condition.

Table 3. Summary of Patient Data for Responders and/or Long Term Survivors Case

Response

Age

14001 14004 14011 14020 14601

CR CR PR CR SD

32 46 38 32 22

Performance Status 1 1 0 1 0

CD4 11 50 59 91

Survival (Months) 14.3 37.9 3.2 23.4 16.3

Survival Status Dead Alive Dead Alive Alive

Table 4. Analysis of CSF for EBV DNA Diagnosis PCNSL Systemic lymphoma Cerebral toxoplasmosis Progressive multifocal leukoencephelopathy Cytomegalovirus encephalitis Other neurological diagnosis

No. Positive/Samples 8/10 0/7 1/16 1/27 2/8 1/15

218

Percent Positive 80% 0% 6% 4% 25% 7%

Cancer Therapy Vol 1, page 219 In addition, the same group reported that EBV DNA in the CSF usually disappears with treatment of the lymphoma (Antinori et al, 1999). Our findings are consistent with these previous reports. In combination with imaging techniques, a positive EBV PCR result may obviate the need for brain biopsy in some patients with intracranial mass lesions and HIV infection. The identification of EBV in the CSF of some patients with HIV is consistent with the occasional identification of EBV in patients with infectious mononucleosis and associated neurological symptoms. It is curious that in this series (Table 4), EBV in the CSF in patients without lymphoma was most commonly found in HIV patients with cytomegalovirus encephalitis. Whether the detection of EBV in this setting points to some specific interaction between the two viruses or simply reflects profound cellular immunodeficiency is not clear. Future studies using quantitative methods for EBV load in CSF may facilitate differentiation between benign and malignant central nervous system disease. Chemotherapy used alone or in combination with brain irradiation has been used for the treatment of nonHIV-associated PCNSL (Dahlborg et al, 1996; Freilich et al, 1996; Mead et al, 2000). The Radiation Therapy Oncology Group (RTOG) reported that CHOD (cyclophosphamide, doxorubicin, vincristine, and dexamethasone) chemotherapy preceding brain irradiation was not associated with improved survival when compared with historical data employing radiation alone in nonimmunocompromised patients (Schultz et al, 1996). A study from the United Kingdom also showed no advatage to CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone) chemotherapy following radiation therapy (Mead et al, 2000). Recent evidence suggests that highdose methotrexate based regimens may be effective for immunocompetent patients with PCNSL. (DeAngelis et al, 1992; Glass et al, 1994; Guha-Thakurta et al, 1999; O'Brien et al, 2000; Batchelor et al, 2003). For example, DeAngelis and colleagues (1992) reported a five-year survival of 22% for patients treated with methotrexate, high dose cytarabine, and irradiation, compared with 4% for historical controls treated with radiation alone. A subsequent multicenter study confirmed improved survival compared with historical data using irradiation alone, although delayed neurotoxicity was a major complication of therapy, especially in patients older than 60 years of age (DeAngelis et al, 2002). Likewise, Sandor and colleagues (1998) treated 14 patients with PCNSL or intraocular lymphoma with high dose methotrexate with leucovorin rescue, thiotepa, vincristine, and dexamethasone. The complete response rate was 79%, and 69% of the patients survived nearly five years, of whom about one-half were progression-free. Others have also evaluated high-dose methotrexate alone, with deferral of irradiation until relapse or progression, with encouraging results (Batchelor et al, 2003). An expert panel has recommended high-dose methotrexate-based regimen with deferred irradiation for older (more than 60 years) in order to reduce the risk of delayed neurotoxicity in this group, and high-dose methotrexate and cytarabine based-combinations in conjunction with irradiation in younger patients; the panel

did not address treatment of primary CNS lymphoma in patients with HIV infection (Ferreri et al, 2003). The treatment of PCNSL in AIDS patients presents two obstacles: the blood brain barrier and the patients profound immunocompromised status. With regard to the blood brain barrier, imaging studies make clear that the integrity of this barrier evolves with therapy. Contrast enhancement of tumors prior to treatment suggests that the tumor itself leads to profound disruption of the barrier. As treatment proceeds, the barrier is often reestablished. Poor tolerance of chemotherapy in AIDS patients has established a role for reduced-dose or reduced-length treatment in some settings (Kaplan et al, 1997). Thus for our study we reasoned that a single cycle of chemotherapy administered prior to the initiation of radiation therapy might increase tumor kill with only minimal increase in toxicity. We gave one cycle of CHOD chemotherapy followed by irradiation in a manner similar to that employed by the RTOG for PCNSL in immunocompetent patients. Our results are similar to other reports that included radiation therapy alone (Donahue et al, 1995; Bower et al, 1999). Although those who survived more than 1 year had CD4 counts that exceeded the median in every case in which they were available, and the patient with the highest CD4 count was among the longer survivors. CD4 count was not a very good prognosticator. Thus, the longest survivor (37.9 months) had a CD4 count of only 11_barely above the median. Our findings suggest that administration of a single cycle of an anthracycline containing combination chemotherapy regimen before radiation in patients with PCNSL and HIV infection fails to improve patient outcome. Our study was conducted prior to the use of HAART in clinical practice. Several reports have indicated that patients with HIV-associated PCNSL treated in the postHAART era had a much improved prognosis, especially those who had a substantial reduction in viral load due to HAART therapy (Skiest and Crosby, 2003). This finding parallels improvements in survival also noted for patients with systemic HIV-associated lymphoma treated with standard cytotoxic therapy (Vaccher et al, 2001). Spontaneous remission of PCSNL has been reported in immunocompetent patients after treatment with dexamethasone (Al-Yamany et al, 1999), and in patients with HIV infection after treatment with HAART and corticosteroids (Terriff et al, 1992; McGowan and Shah, 1998). In addition, Raez reported the use of parenteral zidovudine (1.6 g twice daily), gancyclovir (5 mg/kg twice daily), and interleukin-2 (2 million units twice daily) in five patients with HIV-associated PCNSL, some of whom had progressive disease after prior brain irradiation (Raez et al, 1999). The treatment regimen was based upon the premise that the treatment was effective against EpsteinBarr virus-positive B-cell lymphoma cell lines in vitro. Four of five had an objective response, of whom two were alive and disease-free at 22 and 13 months. These findings suggest that the prognosis may be improved for patients with PCNSL diagnosed in the post-HAART era, Treatment with high-dose methotrexate-based regimens plus optimization of HAART therapy may therefore

219

Ambinder et al: Chemotherapy and RT against PCNS in AIDS patients related primary central nervous system lymphoma. J Natl Cancer Inst 90, 364-9 Cinque P, Brytting M, Vago L, et al (1993) Epstein-Barr virus DNA in cerebrospinal fluid from patients with AIDS-related primary lymphoma of the central nervous system. Lancet 342, 398-401 Corn BW, Trock BJ, Curran WJ, Jr (1995) Management of primary central nervous system lymphoma for the patient with acquired immunodeficiency syndrome. Confronting a clinical catch-22. Cancer 76, 163-6 Cote TR, Manns A, Hardy CR, et al (1996) Epidemiology of brain lymphoma among people with or without acquired immunodeficiency syndrome. AIDS/Cancer Study Group. J Natl Cancer Inst 88, 675-9 Dahlborg SA, Henner WD, Crossen JR, et al (1996) Non-AIDS Primary CNS Lymphoma: First Example of a Durable Response in a Primary Brain Tumor using Enhanced Chemotherapy Delivery without Cognitive Loss and without Radiotherapy. Cancer J Sci Am 2, 166, 1996 DeAngelis LM, Seiferheld W, Schold SC, Fisher B, Schultz CJ (2002) Combination chemotherapy and radiotherapy for primary central nervous system lymphoma: Radiation Therapy Oncology Group Study 93-10. J Clin Oncol 20, 4643-4648 DeAngelis LM, Yahalom J, Thaler HT, et al (1992) Combined modality therapy for primary CNS lymphoma. J Clin Oncol 10, 635-43 Donahue BR, Sullivan JW, Cooper JS (1995) Additional experience with empiric radiotherapy for presumed human immunodeficiency virus-associated primary central nervous system lymphoma. Cancer 76, 328-32 Dunn GE (1995) Clinical biostatistics: an introduction to evidence-based medicine. London, E Arnold Ferreri AJ, Abrey LE, Blay JY, et al (2003) Summary statement on primary central nervous system lymphomas from the Eighth International Conference on Malignant Lymphoma, Lugano, Switzerland, June 12 to 15, 2002. J Clin Oncol 21, 2407-2414 Forsyth PA, Yahalom J, DeAngelis LM (1994) Combinedmodality therapy in the treatment of primary central nervous system lymphoma in AIDS. Neurology 44, 1473-9 Freilich RJ, Delattre JY, Monjour A, et al (1996) Chemotherapy without radiation therapy as initial treatment for primary CNS lymphoma in older patients. Neurology 46, 435-9 Glass J, Gruber ML, Cher L, et al (1994) Preirradiation methotrexate chemotherapy of primary central nervous system lymphoma: long-term outcome. J Neurosurg 81, 188-95 Guha-Thakurta N, Damek D, Pollack C, et al (1999) Intravenous methotrexate as initial treatment for primary central nervous system lymphoma: response to therapy and quality of life of patients. J Neurooncol 43, 259-68 Hoffmann C, Wolf E, Fatkenheuer G, et al (2003) Response to highly active antiretroviral therapy strongly predicts outcome in patients with AIDS-related lymphoma. Aids 17, 15211529 Kaplan LD, Straus DJ, Testa MA, et al (1997) Low-dose compared with standard-dose m-BACOD chemotherapy for non-Hodgkin's lymphoma associated with human immunodeficiency virus infection. National Institute of Allergy and Infectious Diseases AIDS Clinical Trials Group. N Engl J Med 336, 1641-8 Kirk O, Pedersen C, Cozzi-Lepri A, et al (2001) Non-Hodgkin lymphoma in HIV-infected patients in the era of highly active antiretroviral therapy. Blood 98, 3406-12 Levine AM (1998) Hodgkin's disease in the setting of human immunodeficiency virus infection. J Natl Cancer Inst Monogr 37-42

represent a prudent strategy for patients with HIVassociated PCNSL that merits evaluation in clinical trials.

Acknowledgements This study was conducted by the Eastern Cooperative Oncology Group (Robert L. Comis, MD, Chair) and was open in the Radiation Therapy Oncology Group, The Southwest Oncology Group, the Cancer and Leukemia Group B, and the AIDS Clinical Trials Group. It was supported in part by Public Health Service grants CA14958, CA23318, CA13650, CA 16116, CA15488, CA17145, CA66636, CA21115 from the National Cancer Institute, National Institutes of Health and the Department of Health and Human Services. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the National Cancer Institute. It is with great sadness and gratitude that the authors acknowledge Dr. Robert L. Krigel, who conceived of and designed this study, but who passed away before it could be completed.

References Al-Yamany M, Lozano A, Nag S, Laperriere N, Bernstein M (1999) Spontaneous remission of primary central nervous system lymphoma: report of 3 cases and discussion of pathophysiology. J Neurooncol 42, 151-159 Ambinder RF, Lambe BC, Mann RB, et al (1990) Oligonucleotides for polymerase chain reaction amplification and hybridization detection of Epstein-Barr virus DNA in clinical specimens. Mol Cell Probes 4, 397-407 Antinori A, Ammassari A, De Luca A, et al (1997) Diagnosis of AIDS-related focal brain lesions: a decision-making analysis based on clinical and neuroradiologic characteristics combined with polymerase chain reaction assays in CSF. Neurology 48, 687-94 Antinori A, Cingolani A, De Luca A, et al (1999) Epstein-Barr virus in monitoring the response to therapy of acquired immunodeficiency syndrome-related primary central nervous system lymphoma. Ann Neurol 45, 259-61 Arribas JR, Clifford DB, Fichtenbaum CJ, et al (1995) Detection of Epstein-Barr virus DNA in cerebrospinal fluid for diagnosis of AIDS-related central nervous system lymphoma. J Clin Microbiol 33, 1580-3 Batchelor T, Carson K, O'Neill A, et al (2003) Treatment of primary CNS lymphoma with methotrexate and deferred radiotherapy: a report of NABTT 96-07. J Clin Oncol 21. 1044-1049 Baumgartner JE, Rachlin JR, Beckstead JH, et al (1990) Primary central nervous system lymphomas: natural history and response to radiation therapy in 55 patients with acquired immunodeficiency syndrome. J Neurosurg 73:206-11 Besson C, Goubar A, Gabarre J, et al (2001) Changes in AIDSrelated lymphoma since the era of highly active antiretroviral therapy. Blood 98, 2339-44 Bower M, Fife K, Sullivan A, et al (1999) Treatment outcome in presumed and confirmed AIDS-related primary cerebral lymphoma. Eur J Cancer 35, 601-4 Carraway H, Ambinder RF (2002) Plasma cell dyscrasia, Hodgkin lymphoma, HIV, and Kaposi sarcoma-associated herpesvirus. Curr Opin Oncol 14, 543-5 Cingolani A, De Luca A, Larocca LM, et al (1998) Minimally invasive diagnosis of acquired immunodeficiency syndrome-

220

Cancer Therapy Vol 1, page 221 Levine AM, Scadden DT, Zaia JA, et al (2001) Hematologic Aspects of HIV/AIDS. Hematology (Am Soc Hematol Educ Program) 463-78 MacMahon EG, Hayward SD, Mann RB, Becker PS, Charache P, McArthur J, Ambinder, RF (1991) Epstein-Barr virus (EBV): A tumor marker for primary central nervous system lymphoma (PCNSL) in AIDS? Blood 78S, 399a MacMahon EM, Glass JD, Hayward SD, et al (1991) EpsteinBarr virus in AIDS-related primary central nervous system lymphoma. Lancet 338, 969-73 McGowan JP, Shah S (1998) Long term remission of AIDSrelated primary CNS lymphoma associated with highly active antiretroviral therapy. AIDS 12, 952-958 Mead GM, Bleehen NM, Gregor A, et al (2000) A medical research council randomized trial in patients with primary cerebral non-Hodgkin lymphoma: cerebral radiotherapy with and without cyclophosphamide, doxorubicin, vincristine, and prednisone chemotherapy. Cancer 89, 1359-70 O'Brien P, Roos D, Pratt G, et al (2000) Phase II multicenter study of brief single-agent methotrexate followed by irradiation in primary CNS lymphoma. J Clin Oncol 18, 519-26 Raez L, Cabral L, Cai JP, et al (1999)Treatment of AIDS-related primary central nervous system lymphoma with zidovudine, ganciclovir, and interleukin 2. AIDS Res Hum Retroviruses 15, 713-719. Sandor V, Stark-Vancs V, Pearson D, et al (1998) Phase II trial of chemotherapy alone for primary CNS and intraocular lymphoma. J Clin Oncol 16, 3000-6

Schultz C, Scott C, Sherman W, et al (1996) Preirradiation chemotherapy with cyclophosphamide, doxorubicin, vincristine, and dexamethasone for primary CNS lymphomas: initial report of radiation therapy oncology group protocol 88-06. J Clin Oncol 14, 556-64 Skiest DJ, Crosby C (2003) Survival is prolonged by highly active antiretroviral therapy in AIDS patients with primary central nervous system lymphoma. Aids. 17, 1787-1793 Skolasky RL, Dal Pan GJ, Olivi A, et al (1999) HIV-associated primary CNS lymorbidity and utility of brain biopsy. J Neurol Sci 163, 32-8 Sparano JA (2001) Clinical aspects and management of AIDSrelated lymphoma. Eur J Cancer 37, 1296-305 Sparano JA, Anand K, Desai J, et al (1999) Effect of highly active antiretroviral therapy on the incidence of HIVassociated malignancies at an urban medical center. J AIDS 21 Suppl 1, S18-22 Terriff BA, Harrison P, Holden JK (1992) Apparent spontaneous regression of primary CNS lymphoma mimicking resolving toxoplasmosis. J AIDS 5, 953-954 Vaccher E, Spina M, di Gennaro G, Talamini R, Nasti G, Schioppa O, Vultaggio G, Tirelli U (2001) Concomitant cyclophosphamide, doxorubicin and prednisone chemotherapy plus highly active antiretroviral therapy in patients with human immunodeficiency virus-related nonHodgkin lymphoma. Cancer 91, 155-163

221

Ambinder et al: Chemotherapy and RT against PCNS in AIDS patients

222

Cancer Therapy Vol 1, page 223 Cancer Therapy Vol 1, 223-232, 2003.

Sentinel lymph node biopsy for breast cancer: addressing the controversies Review Article

Anees Chagpar, John Pilavas, Celia Chao, Robert C.G. Martin II, Kelly M. McMasters* Division of Surgical Oncology, Department of Surgery, University of Louisville

__________________________________________________________________________________ *Correspondence: Kelly M. McMasters M.D., Division of Surgical Oncology, Department of Surgery, University of Louisville, 315 East Broadway, Suite 309, Louisville, KY 40202, Phone: 502-629-3380, Fax: 502-629-3379, e-mail: kelly.mcmasters@nortonhealthcare.org Key Words: Breast cancer, sentinel lymph node biopsy, lymphoscintigraphy Abbreviations: axillary lymph node dissection (ALND), sentinel lymph node biopsy (SLNB), sentinel lymph node (SLN), internal mammary (IM), ductal carcinoma-in-situ (DCIS), immunohistochemistry (IHC), false negative rates (FN rates), serial section histology (SS histology) Received: 1 September 2003; Accepted: 18 September 2003; electronically published: October 2003

Summary Sentinel lymph node biopsy is widely accepted as the state-of-the-art in breast cancer management today. This technique allows for accurate nodal staging, while affording patients the benefits of minimally invasive surgery. There are a number of controversies, however, which surround this technique ranging from the technical execution of the procedure, to patient selection, to the pathological analysis of the sentinel node. This article reviews the literature and presents current data addressing these issues.

I. Introduction

II. Technical issues

It is well accepted that axillary nodal status is one of the most powerful prognostic factors predicting recurrence and survival in breast cancer patients, and significantly affects adjuvant therapy decisions (Donegan, 1997). Axillary lymph node dissection (ALND), however, carries with it considerable morbidity (Lin et al, 1993). Much of this morbidity, including lymphedema, shoulder motion restriction and numbness, is thought to be a result of complete dissection of levels I and II of the axilla, with sacrifice of the intercostobrachial nerves. Over the past decade, sentinel lymph node biopsy (SLNB) has emerged as a minimally invasive technique that accurately stages the axilla, while sparing patients the morbidity of an ALND (Guiliano, 1996; Veronesi et al, 1997; Krag et al, 1998). This technique uses a blue dye or radiotracer to identify the first draining lymph node from a tumor, thereby accurately staging the nodal basin (Figure 1). Although SLNB is not universally accepted as the standard of care, this technique has gained international popularity and is considered the state-of-the-art in breast cancer treatment. Despite its widespread use, there remain a number of controversies surrounding this technique (Jakub et al, 2003) including technical issues of how best to perform the procedure, patient selection, and pathological analysis of the SLN tissue.

A. Blue dye versus radioactive colloid The concept of SLNB in breast cancer evolved from the pioneering work of lymphatic mapping in melanoma. In 1992, Morton and colleagues reported their experience using blue dye to map the sentinel lymph node (SLN) in 500 patients with melanoma. Subsequently, Krag et al (1993, 1995) described an alternative lymphatic mapping technique using the injection of unfiltered 99m-technetium sulfur colloid. While both of these methods have been used in lymphatic mapping in breast cancer patients, the optimal technique remains debated. Table 1 summarizes several large published series examining the efficacy of SLNB using blue dye, radioactive colloid or both. 1. Blue dye The use of blue dye in lymphatic mapping in patients with breast cancer was first reported by Guiliano in 1994 (Guiliano et al, 1994). In this study, 3 to 5 mL of 1% isosulfan blue dye (Lymphazurin, Hirsch Industries, Inc, Richmond, VA) was injected into the breast parenchyma around the tumor or biopsy site. The breast was massaged for 3-7 minutes, and the axilla was then explored until a blue lymphatic channel (Figure 2) or node (Figure 3) was identified. After a substantial initial learning curve, this

223

Chagpar et al: SLNB in breast cancer fairly simple technique was found to be reliable in identifying the SLN and accurate in axillary staging (Guiliano, 1996). Blue dye travels rapidly through lymphatics, typically identifying the SLN within 3-10 minutes of injection (Ollila, 1999). However, it has been noted that the dye may not always remain in the node long enough for surgical identification due to its quick transit

time (Noguchi, 2001). Another disadvantage of this technique is the inability to preoperatively identify the site of the SLN. As a result, incisions may be placed some distance away from the SLN, resulting in long flaps and extensive dissection (Noguchi, 2001).

Figure 1: Concept of sentinel lymph node biopsy. Dye or radiocolloid is injected to identify first draining lymph node from tumor.

Table 1: Techniques of SLNB Study Giuliano et al (1996) Giuliano et al (1997) Guenther et al (1997) Veronesi et al (1997) Feldman et al (1999) Veronesi et al (1999) Moffat et al (1999) Borgstein et al (1998) Krag et al (1998) Viale et al (1999) Schlag and Bembenek (2000) Krag et al (2001) Quan et al (2002) Albertini et al (1997) Oâ&#x20AC;&#x2122;Hea et al (1998) Molland et al (2000) Nwariaku et al (1998) Bass et al (1999) Haigh et al (2000) Nano et al (2002) Shivers et al (2002) Tafra et al (2001) Bergkvist et al (2001) Doting et al (2000) McMasters et al (2001)

N 174 107 145 163 75 376 70 130 443 155 146 145 152 62 60 103 119 186 283 328 426 535 498 136 2206

Technique Dye Dye Dye Radioactive colloid Radioactive colloid Radioactive colloid Radioactive colloid Radioactive colloid Radioactive colloid Radioactive colloid Radioactive colloid Radioactive colloid Radioactive colloid Both Both Both Both Both Both Both Both Both Both Both Both

224

SLN ID (%) 65 66 71 98 93 99 93 94 93 100 81 98 93 92 93 85 81 93 81 87 86 87 90 93 93

Accuracy (%) 96 100 88 98 94 96 97 99 97 97 93 98 100 100 95 98 99 99 99 94 99 96 n/a 98 97

FN rate (%) 12 0 12 5 19 7 10 2 11 7 8 4 0 0 15 5 4 2 3 8 4 13 11 5 8

Cancer Therapy Vol 1, page 225

Figure 2: Blue lymphatic channel

Figure 3: Blue lymph node

225

Chagpar et al: SLNB in breast cancer through” from radioactive material injected around the primary tumor. Using this combined technique, they were able to achieve a 92% SLN identification (Albertini et al, 1996). Similarly, in a large multicenter trial, McMasters et al (2000) concluded that the false negative rate was significantly higher when lymphatic mapping used either blue dye or radioactive colloid than when both were used concurrently (11.8% vs. 5.8%, p<0.05).

2. Radioactive colloid Krag et al (1993) first described the use of radioactive colloid in lymphatic mapping in breast cancer. The location of greatest radioactivity was found transcutaneously using a hand-held gamma probe. This guided the surgeon to locate the incision in this area. The nodes with the greatest radioactivity were removed as SLNs. Although this technique is thought to be easier to perform than the blue dye approach (Noguchi, 2001) it still has a substantial learning curve. In their initial series of 22 patients, Krag et al (1993) found the SLN successfully in 82% of cases Their subsequent experience with 443 patients improved their success rate to 93% (Krag et al, 1998). There has been some debate over which radiopharmaceutical is optimal for sentinel lymph node mapping. Although 99m-Tc sulfur colloid is the only agent approved by the United States Food and Drug Administration for lymphoscintigraphy (Noguchi, 2001) a number of other materials have been used in Europe and elsewhere. The various agents vary in particle size and opinions regarding the “ideal” size differ. The majority of studies conclude that particles approximately 200 nm work well for lymphatic mapping (Galimberti et al, 2000; Mariani et al, 2001) as particles smaller than 50 nm have very rapid transit and are not retained in the initial draining lymph nodes and those larger than 500 nm take a prolonged period of time to accumulate in the SLN (Galimberti et al, 2000). Some investigators have studied the use of filters which reduce the large particle size of 99 m-Tc sulfur colloid to particles which are 50-100 nm in diameter, resulting in more rapid transit (Hung et al, 1995). However, a non-randomized comparison between unfiltered and filtered 99m-Tc sulfur colloid found a better SLN identification rate in patients injected with the unfiltered compound (Linehan et al, 1999). Similarly, Paganelli et al (1998) found that the SLN could be more easily identified using radiolabeled colloidal albumin (200-1000 nm) rather than small-particle radiotracer (<80 nm), and felt that the radiolabeled albumin technique limited the removal of second echelon, or non-sentinel nodes. The University of Louisville Breast Cancer Sentinel Lymph Node study, however, found no difference in the SLN identification rate, false negative rate, or number of SLN removed whether filtered or unfiltered 99 m-Tc sulfur colloid was used (unpublished data).

B. Radioactive colloid: where to inject? 1. Peritumoral injection The initial studies of breast SLNB used peritumoral injection of either blue dye, radioactive colloid, or both. This was based on the reasonable assumption that injection of the breast tissue immediately surrounding the tumor would result in reliable and accurate identification of the sentinel nodes to which the breast cancer would drain. Peritumoral blue dye injection remains the “gold standard” for SLN identification_an afferent blue-stained lymphatic channel entering a blue lymph node indicates an unequivocal direct lymphatic drainage pathway from the site of the primary tumor. However, it has become apparent that peritumoral injection of radioactive colloid is sometimes not always optimal for SLN identification. When peritumoral injection is used, typically 4 to 8 mL of radioactive colloid is injected. This causes significant diffusion of the radioactive tracer. This background radioactivity, or “shine through,” can obscure the often slightly radioactive sentinel nodes in the axilla. This is especially problematic for upper outer quadrant tumors, which represent half of all breast cancers. Failure to identify SLN in all cases using this technique, even when combined with blue dye injection, led some investigators to evaluate other techniques.

2. Dermal and subdermal injection Dermal injection of radioactive colloid for SLNB in melanoma is highly reliable and results in nearly a 100% SLN identification rate. Borgstein and colleagues (1997) first demonstrated that the skin overlying the breast parenchyma shares the same lymphatic drainage pathway as the breast tissue beneath it. At the same time, Veronesi and colleagues (1997) found that subdermal injection of radioactive colloid was associated with a 98% identification rate and a low false negative rate. Linehan et al (1999) showed concordance of peritumoral blue dye and dermal radioactive colloid in 95% of cases. In the University of Louisville study, dermal radioactive colloid injection was associated with significant improvement in the SLN identification rate compared to peritumoral injection. Furthermore, dermal injection was associated with improved ability of surgeons learning to perform SLNB to accurately identify SLN (McMasters et al, 2001). While data from several centers substantiates the value of dermal injection for identification of axillary SLN (Linehan et al, 1999; Cody et al, 2001; Kersey et al, 2001, McMasters et al, 2001) it is not clear whether dermal injection will accurately identify internal mammary (IM) or extra-axillary nodal drainage, for those surgeons who

3. Both blue dye and radioactive colloid A number of studies demonstrated an advantage to using both blue dye and radioactive colloid to identify the SLN. Albertini et al (1996) injected filtered 99m-Tc sulfur colloid into the breast parenchyma 2-4 hours prior to surgery. After induction of general anesthesia, 1% isosulfan blue was injected. A hand-held gamma probe was used to detect the location of the SLN prior to making the incision. The radioactivity was useful in directing them to the SLN when a blue stained lymphatic channel was difficult to identify. At the same time, the dye was useful in finding the SLN when there was considerable “shine

226

Cancer Therapy Vol 1, page 227 are interested in searching for them. For example, Uren et al (1995, 1998) found significant variation between lymphatic drainage from intradermal and intraparenchymal injection sites.

been demonstrated that preoperative lymphoscintigraphy, while increasing the cost and time required to treat patients, does not improve the ability to accurately identify axillary SLN (McMasters et al, 2000). On the other hand, extra-axillary SLNs can be found in 10% of patients with preoperative imaging (Dupont et al, 2001). The majority of these cases have dual drainage to both the axilla and the IM chains, however approximately 2% of patients have drainage the IM nodes alone (Cserni and Szekeres, 2001). These extra-axillary drainage sites may be missed using the hand-held gamma probe if preoperative imaging directing the surgeon to the alternate site was not done (Noguchi et al, 2000). Unless biopsy of the IM nodes is performed, however, the utility of preoperative knowledge of this drainage pattern is debatable (Rubio and Klimberge, 2001). Several authors have demonstrated that SLNB of the IM nodes is feasible (Johnson et al, 2000; Sacchini et al, 2001). Proponents of this technique argue that metastatic disease found in IM SLNs may alter decisions regarding adjuvant radiation and systemic therapy. The current American Joint Committee on Cancer (AJCC) staging system for breast cancer has noted the prognostic implication of IM nodal involvement, factoring this in to the staging system (Singletary et al, 2002). However, the technique of IM SLNB has not gained wide acceptance. As evaluation of the axillary nodes has been the cornerstone of breast cancer staging for the past century, it appears to be a reasonable viewpoint that SLNB of the axillary nodes alone would be a less invasive alternative to ALND.

3. Subareolar and periareolar injection Peritumoral, dermal, or subdermal injection of radioactive colloid require localization of non-palpable tumors by ultrasound or mammogram in order to guide the injection. It would be simpler if all patients with breast cancer could undergo the same injection procedure, regardless of tumor location. In fact, significant evidence now suggests that the lymphatic drainage of the entire breast is to the same few sentinel nodes. This has prompted a number of investigators to evaluate subareolar or periareolar injection techniques (Klimberg et al, 1999; Beitsch et al, 2001; Donahue, 2001; Bauer et al, 2002; Tuttle et al, 2002). The concept of subareolar injection builds upon the embryology of the breast, and early studies which mapped its lymphatic drainage. The breast develops from an ectodermal streak, which becomes the nipple-areola complex. As the lymphatics of the breast elongate, they maintain their connection to the subareolar complex (Gray, 1939). This concept was confirmed by Sappey in 1834. His experiments of mercury injection into breast lymphatic channels demonstrated a centripetal flow of lymph into the subareolar plexus and then onto regional lymphatics. Turner-Warwick (1959) illustrated, through studies using autoradiography of surgical specimens, that the lymphatic flow of the breast is from superficial to deep, arriving at the regional lymphatics through channels in the interlobular spaces and along lactiferous ducts (Turner-Warwick, 1959). As these channels would be in close proximity to each other in the subareolar space, proponents of subareolar injection argue that this technique should identify the sentinel lymph node regardless of tumor location in the breast. A number of authors have demonstrated that subareolar injection is not only feasible, but may be as accurate as peritumoral injection (Klimberg et al, 1999; Beitsch et al, 2001; Donahue, 2001; Bauer et al, 2002; Tuttle et al, 2002). The subareolar technique has advantages in avoiding the need for image guided injection for non-palpable tumors, avoiding shine through in upper outer quadrant lesions, and may be useful in patients with multicentric disease. However, at present, there is insufficient evidence of a low false negative rate for subareolar or periareolar injection techniques to recommend their routine use.

III. Patient Issues SLNB has become commonplace in the surgical management of invasive breast cancers. There are several scenarios, however, in which the use of SLNB has been controversial.

A. Ductal carcinoma-in-situ In theory, axillary nodal staging for ductal carcinoma-in-situ (DCIS) is not necessary. By definition, DCIS is not an invasive malignancy and does not metastasize to lymph nodes or elsewhere. It is known, however, that axillary metastases may be present in 1 to 2% of these patients, and is generally attributed to microinvasion which is undetected in the breast specimen (Cox et al, 2001). While ALND is not recommended in these patients given the morbidity associated with this procedure, the minimal risk of SLNB has brought the question of axillary staging in patients with pure DCIS back to the fore. Although the goal of SLNB is to identify the rare patients with DCIS who have nodal metastases to potentially improve their outcome, SLNB may actually give us misleading information that adversely affects patient care. Reported rates of SLN metastasis for patients with DCIS (without microinvasion) have been as high as 12-23% when immunohistochemistry (IHC) for cytokeratins is used for histopathologic analysis of the

C. Preoperative lymphoscintigraphy Another area of debate is in the use of preoperative lymphoscintigraphy. Although this nuclear medicine technique of obtaining a road map of lymphatic drainage preoperatively is employed routinely for localization of SLN in melanoma (Haddad et al, 1999), its utility in the setting of breast cancer is less clear given the nearly universal drainage of breast cancers to the axilla. It has 227

Chagpar et al: SLNB in breast cancer SLN (Klauber-DeMore et al, 2000; Cox et al, 2001; Tamhane et al, 2002). This has generated enormous controversy regarding the prognostic implications of IHCdetected micrometastases for patients with breast cancer. Some of these patients with DCIS and IHC-detected micrometastases have undergone completion ALND and have received adjuvant chemotherapy. Given that historically over 98% of patients with DCIS have been cured with appropriate surgical therapy, it is difficult to justify the risk of such therapy in nearly 20% of patients who were found to have â&#x20AC;&#x153;micrometastasesâ&#x20AC;? which may have, in reality, only been isolated tumor cells which would not have impacted their outcome. SLNB for pure DCIS is justifiable, however, when performing mastectomy based on a core needle biopsy diagnosis of DCIS. In this situation, the core needle biopsy can underestimate the presence of invasive cancer in up to 35% of cases (Lieberman, 2000; Jackman et al, 2001). Because SLNB cannot be performed later, after the breast has been removed, SLNB is warranted to avoid the need for ALND at a later date. When SLNB is performed for DCIS, however, caution should be exercised in the interpretation of the results, and patients with isolated tumor cells should not be treated as if they had macrometasis (McMasters et al, 2002). IHC should not be used for routine analysis of SLN for DCIS, or invasive cancer.

axillary dissection in those with a positive SLN at the time of definitive surgery (Sabel et al, 2003).

C. Immediate reconstruction The oncologic safety of skin sparing mastectomy and the psychological benefits of immediate reconstruction have been well documented in the literature (Kroll et al, 1991). With the introduction of SLNB, however, the question of the accuracy of intra-operative assessment of the SLN has become pivotal. False negative intraoperative SLN pathology results may have important ramifications in mandating an ALND around a microvascular anastamosis in patients who have had immediate free flap reconstruction with anastomosis to the thoracodorsal vessels (Kronowitz et al, 2002). Some authors have suggested timing the SLNB prior to the mastectomy in order to allow for more accurate pathologic assessment based on permanent section histology (Brady et al, 2003). Whether a full axillary node dissection is required in the setting of a positive SLN is still under active investigation (Grube and Guiliano, 2001).

IV. Pathologic issues The concept of SLNB which maintains that the SLN is the first node to which tumor cells spread puts a heavy responsibility on the pathologist to carefully evaluate this node for metastatic disease. The optimal technique for evaluation of the SLN, both intraoperatively and on permanent sections, has not been well established. Furthermore, the meticulous search for microscopic foci of disease has led to further debate as to the implications for such miniscule metastases.

B. Neoadjuvant chemotherapy Increasingly, patients are being treated with neoadjuvant chemotherapy as a method of monitoring in vivo tumor response to cytotoxic agents (Fisher et al, 1997). The response of axillary lymph nodes to neoadjuvant therapy is not necessarily uniform, and hence, the accuracy of SLNB in these patients has been questioned. Several small single-institution studies addressing this issue have now been performed with varying results. Two studies have found very high false negative rates (up to 33%) and conclude that SLNB is not accurate after neoadjuvant chemotherapy (Nason et al, 2000; Fernandez et al, 2001). Four other studies, however, found SLNB to have an acceptable false negative rate except in patients with inflammatory breast cancer (Breslin et al, 2000; Tafra et al, 2001; Stearns et al, 2002; Piato et al, 2003). All of these studies are small, and therefore the use of SLNB after neoadjuvant chemotherapy is an issue which continues to be debated in the literature. Mamounas et al (2003) recently reported their multiinstitutional experience using SLNB after neoadjuvant chemotherapy in patients participating in the NSABP B-27 study. Of 343 patients who underwent SLNB followed by ALND, they found a false negative rate of 7% and an overall accuracy of 96%. While this study may suggest that there may be a role for SLNB after neoadjuvant chemotherapy, this remains an area of controversy. Many do not accept SLNB in this setting to be completely reliable and, therefore, some have advocated the strategy of doing a SLNB prior to the initiation of neoadjuvant chemotherapy to stage the axilla, and proceeding to

A. Intraoperative evaluation Intraoperative SLN evaluation has the potential to guide surgical decision-making while sparing patients a potentially unnecessary second procedure. Two techniques have been evaluated in the literature, both having advantages and disadvantages. Frozen section has been found to have a negative predictive value of 90-95% (Zurrida et al, 2001; Chao et al, 2002). Most pathologists are comfortable with this technique, which allows visualization of histologic architecture. However, using frozen section is often purported to waste valuable tissue in the cryostat. Touch imprint cytology, on the other hand, preserves all of the tissue, but relies on cytologic interpretation of cells touched to a glass slide. This technique has been found to be an acceptable alternative to frozen section analysis with negative predictive values of 87-99% (Kane et al, 2001; Henry-Tillman et al, 2002; Shiver et al, 2002). The preferred technique for intraoperative analysis of SLN depends on the expertise at individual centers. Because touch prep cytology and frozen section are both associated with the potential for both false-negative and false-positive results, many centers prefer to wait for permanent section pathology results before deciding to perform ALND. In a formal decision analysis of this topic,

228

Cancer Therapy Vol 1, page 229 we found no clear overall patient benefit for intraoperative SLN analysis (Chao et al, 2003).

B. Histological immunohistochemistry

analysis

References Albertini JA, Lyman GH, Cox C et al (1996) Lymphatic mapping and sentinel node biopsy in the patients with breast cancer JAMA 6, 13-22.

and

Albertini JJ, Lyman GH, Cox C, et al (1996) Lymphatic mapping and sentinel node biopsy in the patient with breast cancer. JAMA 276, 1818-22. Bass SS, Cox CE, Ku NN et al (1999) The role of sentinel lymph node biopsy in breast cancer. J Am Coll Surg 189, 183-94. Bauer TW, Spitz FR, Callans LS, et al (2002) Subareolar and peritumoral injection identify similar sentinel nodes for breast cancer. Ann Surg Oncol 9, 169-176. Beitsch PD, Clifford E, Whitworth P, Abarca Alberto (2001) Improved lymphatic mapping technique for breast cancer. The Breast J 7, 219-223.

The question of optimal tissue processing is no less in the setting of the final pathologic evaluation of SLNs. Given the importance of the SLN in staging, pathologists have become increasingly rigorous in their search for metastatic disease, using serial sectioning, IHC, and in some cases, reverse transcriptase-polymerase chain reaction (RT-PCR) to improve their yield. These techniques have all been found to upstage patients who were previously thought to be node negative on routing hematoxylin and eosin staining (Table 2). The implications of such findings, however, are unclear. Some studies have found that micrometastases found using IHC impact survival (Bettelheim et al, 1990; Nasser et al, 1993; McGuckin et al, 1995) while others do not demonstrate any difference (Wilkinson et al, 1982; Friedman et al, 1988; Cote et al, 1999). The current AJCC staging system has established the definition of micrometastases to be metastatic deposits between 0.2 â&#x20AC;&#x201C; 2.0 mm (Singletary et al, 2002). The significance of such minimal nodal disease, and indeed of isolated tumor deposits less than 0.2 mm, has yet to be established. The current recommendation from the College of American Pathologists, the American College of Surgeons Oncology Group, and the clear message from the studies of SLNB for DCIS is that IHC of SLN should not be used for making patient care decisions until further evidence is available.

Bergkvist L, Frisell J, Liljegren G, et al (2001) Multicentre study of detection and false-negative rates in sentinel node biopsy for breast cancer. Br J Surg 88, 1644-8. Bettelheim R, Price KN, Gelber RD et al (1990) Prognostic imposrtance of occult axillary lymph node micrometastases from breast cancers. Lancet 335, 1565-8. Borgstein PJ, Meijer S, Pijpers R (1997) Intradermal blue dye to identify sentinel lymph node in breast cancer. Lancet 349, 1668-9. Borgstein PJ, Pijpers R, Comans FF, et al (1998) Sentinel lymph node biopsy in breast cancer, guidelines and pitfalls of lymphoscintigraphy and gamma probe detection. J Am Coll Surg 186, 275-283. Brady B, Fant J, Jones R, et al (2003) Sentinel lymph node biopsy followed by delayed mastectomy and reconstruction. Am J Surg 185, 114-7. Breslin TM, Cohen L, Sahin A, et al (2000) Sentinel lymph node biopsy is accurate after neoadjuvant chemotherapy for breast cancer. J Clin Oncol 18, 3480-3486.

V. Conclusions

Chao C, Abell T, Martin RCG, McMasters KM (2003) Is intraoperative frozen section evaluation of sentinel node biopsy (SLN) for breast cancer preferable? A formal decision analysis. Presented at the Midwestern Surgical Society

SLNB has become an accepted minimally invasive alternative to routine level I and II ALND for patients with breast cancer. While it is widely practiced, and considered state-of-the-art, there remain a number of controversies surrounding the technical, clinical and pathologic aspects of this procedure. Further investigation is warranted to address these issues, and participation in trials which seek to clarify these questions should be encouraged.

Chao C, Wong SL, Ackermann D, et al (2002) Utility of intraoperative frozen section analysis of sentinel lymph nodes in breast cancer. Am J Surg 182, 609-615. Cody HS, Fey J, Akhurst T et al (2001) Complementarity of blue dye and isotope in sentinel node localization for breast cancer, univariate and multivariate analysis of 966 procedures. Ann Surg Oncol 8, 13-9.

Table 2: Detection of micrometastases Study

Technique

No. upstaged (%)

Wong et al (2001)

869

IHC

58 (7)

Pendas et al (1999)

385

IHC

41 (11)

Schreiber et al (1999)

210

IHC

17 (9)

McIntosh et al (1999)

IHC

8 (14)

Weaver et al (2000)

489

IHC/SS

20 (4)

Pargaonkar et al (2003)

IHC/SS

5 (8)

Stitzenberg et al (2002)

IHC/SS

7 (13)

Sakaguchi et al (2003)

RT-PCR

13 (16)

Cserni G, Szekeres JP (2001) Internal mammary lymph nodes and sentinel node biopsy in breast cancer. Surg Oncol 10, 25-33. Donahue EJ (2001) Sentinel node imaging and biopsy in breast cancer patients. Am J Surg 182, 426-8.

Manzotti et al (2001)

117

RT-PCR

23 (20)

Donegan WL (1997) Tumor-related prognostic factors for breast cancer. CA Cancer J Clin 47, 28-51.

Cote RJ, Peterson HF, Chaiwun B et al (1999) Role of immunohistochemical detection of lymph node metastases in management of breast cancer. Lancet 354, 896-900. Cox CE, Nguyen K, Gray RJ, et al (2001) Importance of lymphatic mapping in ductal carcinoma in situ (DCIS) , why map DCIS? Am Surg 67, 513-519. Cox CE, Nguyen K, Gray RJ, Salud C, Ku NN, Dupont E, et al (2001) Importance of lymphatic mapping in ductal carcinoma in situ (DCIS), why map DCIS? Am Surg 67, 513-521.

229

Chagpar et al: SLNB in breast cancer Doting MH, Jansen L, Niewing OE et al (2000) Lymphatic mapping with intralesional tracer administration in breast carcinoma patients. Cancer 88, 2546-52. Dupont EL, Kamath VJ, Ramnath EM, et al (2001) The role of lymphoscintigraphy in the management of the patient with breast cancer. Ann Surg Oncol 8, 354-360. Feldman SM, Krag DN, McNally RK, et al (1999) Limitation in gamma probe localization of the sentinel node in breast cancer patients with large excisional biopsy. J Am Coll Surg 188, 248-54. Fernandez A, Cortes M, Benito E, et al (2001) Gamma probe sentinel node localization and biopsy in breast cancer patients treated with a neoadjuvant chemotherapy scheme. Nucl Med Commun 22, 361-6.

Jakub JW, Pendas S, Reintgen DS (2003) Current status of sentinel lymph node mapping and biopsy, facts and controversies. The Oncologist 8, 59-68. Johnson N, Soot L, Nelson J et al (2000) Sentinel node biopsy and internal mammay lymphatic mapping in breast cancer. Am J Surg 139, 386-388. Kane JM, Edge SB, Winston JS, et al (2001) Intraoperative pathologic evaluation of a breast cancer sentinel lymph node biopsy as a determinant for synchronous axillary lymph node dissection. Ann Surg Oncol 8, 361-367. Kersey TW, van Eyk J, Lannin DR et al (2001) Comparison of intradermal and subcutaneous injections in lymphatic mapping. J Surg Res 96, 255-9. Klauber-DeMore N, Tan LK, Liberman L, Kaptain S, Fey J, Borgen P, et al (2000) Sentinel lymph node biopsy, is it indicated in patients with high-risk ductal carcinoma-in-situ and ductal carcinoma-in-situ with microinvasion? Ann Surg Oncol 7, 636-642. Klimberg SV, Rubio IT, Henry R, et al (1999) Subareolar versus peritumoral injection for location of the sentinel lymph node. Ann Surg 229, 860-871.

Fisher B, Brown A, Mamounas E et al (1997) Effect of preoperative chemotherapy on local-regional disease in women with operable breast cancer, Findings from National Surgical Adjuvant Breast and Bowel Project B-18. J Clin Oncol 15, 2483-93. Friedman S, Bertin F, Mouriesse H et al (1988) Importance of tumor cells in axillary node sinus margins (‘clandestine metastasis’) discovered by serial sectioning in operable breast carcinoma. Acta Oncol 27, 483-7.

Krag D, Weaver D, Ashikaga T, et al (1998) The sentinel node in breast cancer, a multicenter validation study. N Engl J Med 339, 941-6.

Galimberti V, Zurrida S, Intra M et a (2000) Sentinel node biopsy interpretation, the Milan experience. The Breast J 5, 306-9.

Krag DN, Harlow S, Weaver D, Ashikaga T ( 2001) Radiolabeled sentinel node biopsy, collaborative trial with the National Cancer Institute. World J Surg 25, 823-8. Krag DN, Meijer SJ, Weaver DL et al (1995) Minimal access surgery for staging of malignant melanoma. Arch Surg 130, 654-660.

Giuliano AE, Barth AM, Spivak B et al (1996) Incidence and predictors of axillary metastasis in T1 carcinoma of the breast. J Am Coll Surg 183, 45-9. Giuliano AE, Jones RC, Brennan M et al (1997) Sentinel lymphadenectomy in breast cancer. J Clin Oncol 15, 234550. Gray J (1939) The relation of the lymphatic vessels to the spread of cancer. Br J Cancer 26, 462-95. Grube BJ, Guiliano AE (2001) Observation of the breast cancer patient with a tumor-positive sentinel node, implications of the ACOSOG Z0011 Trial. Semin Surg Oncol 20, 230-7.

Krag DN, Weaver OJ, Alex JC et al (1993) Surgical resection and radiolocalization of the sentinel lymph node in breast cancer using a gamma probe. Surg Oncol 2, 335-340. Kroll SS, Ames F, Singletary SE, Schusterman MA (1991) The oncologic risks of skin preservation at mastectomy when combined with immediate reconstruction of the breast. Surgery, Gynecology and Obstetrics 71, 17-20.

Guenther JM, Krishnamoorthy M, Tan LR (1997) Sentinel lymphadenectomy for breast cancer in a community managed care setting. Cancer J Sci Am 3, 336-40.

Kronowitz SJ, Chang DW, Robb GL, et al (2002) Implicaitons of axillary sentinel lymph node biopsy in immediate autologous reconstruction. Plast Reconstr Surg 109, 1888-1896.

Guiliano AE (1996) Sentinel lymphadenectomy in primary breast carcinoma, an alternative to routine axillary dissection. J Surg Oncol 62, 75-77. Guiliano AE, Kirgan DM, Guenther JM et al (1994) Lymphatic mapping and sentinel lymphadenectomy for breast cancer. Ann Surg 220, 391-401. Haddad FF, Costello D, Reintgen DS (1999) Radioguided surgery for melanoma. Surg Oncol Clin North Am 8, 41326.

Lieberman L (2000) Percutaneous imaging-guided core breast biopsy, state of the art at the millennium. AJR Am J Roentgenol. 174, 1191-9. Lin PP, Allison DC, Wainstock J et al (1993) Impact of axillary lymph node dissection on the therapy of breast cancer patients. J Clin Oncol 11, 1536-44. Linehan DC, Hill AD, Akhurst T et al (1999) Intradermal radioactive colloid and intraparenchymal blue dye injection optimize sentinel node identification in breast cancer patients. Ann Surg Oncol 6, 450-4. Linehan DC, Hill AD, Tran KN, et al (1999) Sentinel lymph node biopsy in breast cancer, unfiltered radioisotope is superior to filtered. J Am Coll Surg 188, 377-81. Mamounas E (2003) Sentinel lymph node biopsy after neoadjuvant systemic therapy. Surg Clin N Am 83, 931-42. Manzotti M, Dell’Orto P, Maisonneuve P et al (2001) Reverse transcription-polymerase chain reaction assay for multiple mRNA markers in the detection of breast cancer metastases in sentinel lymph nodes. In J Cancer 95, 307-312.

Haigh PI, Hansen NM, Qi K et al (2000) Biopsy method and excision volume do not affect success rate of subsequent sentinel lymph node dissection in breast cancer. Ann Surg Oncol 7, 21-7. Henry-Tillman RS, Korourian S, Rubio IT et al (2002) Intraoperative touch preparation for sentinel lymph node biopsy, a 4-year experience. Ann Surg Oncol 9, 333-339. Hung JC, Wiseman GA, Wahner HW, et al (1995) Filtered technetium 99m-sulfur colloid evaluated for lymphoscintigraphy. J Nucl Med 36, 1895-901. Jackman RJ, Burbank F, Parker SH et al (2001) Stereotactic breast biopsy of nonpalpable lesions, determinants of ductal carcinoma in situ underestimation rates. Radiology. 218, 497-502.

Mariani G, Moresco L, Viale G et al (2001) Radioguided sentinel lymph node biopsy in breast cancer surgery. J Nucl Med 42, 1198-1215.

230

Cancer Therapy Vol 1, page 231 McGuckin MA, Cummings MC, Walsh MD, et al (1995) Occult axillary node metastases in breast cancer, their detection and prognostic significance. Br J Cancer 88-95. McIntosh SA, Going JJ, Soukop M et al (1999) Therapeutic implications of the sentienl lymph node in breast cancer. Lancet 354, 570. McMasters K, Chao C, Wong SL, Martin RC 2nd, Edwards MJ (2002) Sentinel lymph node biopsy for ductal carcinoma in situ, A proposal. Cancer 95, 15-20.

lymphadenectomy in the management of patients with breast cancer. Adv Surg 32, 349-64. Paganelli G, DeCicco C, Cremonesi M et al (1998) Optimized sentinel node scintigraphy in breast cancer. Q J Nucl Med 48, 49-53.

McMasters KM, Tuttle TM, Carlson DJ et al (2000) Sentinel lymph node biopsy in breast cancer, a suitable alternative to routine axillary dissection in multi-institutional practice when optimal technique is used. J Clin Oncol 18, 2560-6. McMasters KM, Wong SL, Chao E, Woo C, Tuttle TM, Noyes RD, Carlson DJ, Laidley AL, McGlothin TQ, Ley PB, Brown CM, Glaser RL, Pennington RE, Turk PS, Simpson DS, Edwards MJ (2001) Defining the optimal surgeon experience for breast cancer sentinel lymph node (SLN) biopsy, a model for implementation of new surgical technique. Ann Surg 234(3) , 292-300. McMasters KM, Wong SL, Martin RC et al (2001) Dermal injection of radioactive colloid is superior to peritumoral injection for breast cancer sentinel lymph node biopsy, results of a multiinstitutional study. Ann Surg 233, 676-87. McMasters KM, Wong SL, Tuttle TM, et al (2000) Preoperative lymphoscintigraphy for breast cancer does not improve the ability to identify axillary sentinel lymph nodes. Ann Surg 231, 724-731.

Pendas S, Dauway E, Cox CE, et al (1999) Sentinel node biopsy and cytokeratin staining for the accurate staging of 478 breast cancer patients. Am Surg 65, 500-506.

Pargaonkar AS, Beissner RS, Snyder S, Speights VO (2003) Evaluation of immunohistochemistry and multiple-level sectioning in sentinel lymph nodes from patients with breast cancer. Arch Pathol Lab Med 127, 701-5.

Piato JR, Barros AC, Pincerato KM, et al (2003) Sentinel lymph node biopsy in breast cancer after neoadjuvant chemotherapy, a pilot study. Eur J Surg Oncol 29, 118-120. Quan ML, McCready D, Temple WJ, McKinnon JG (2002) Biology of lymphatic metastases in breast cancer, lessons learned from sentinel node biopsy. Ann Surg Oncol 9, 46771. Roumen RMH, Valkenburg JGM, Geuskens LM (1997) Lymphoscintigraphy and feasibility of sentinel node biopsy in 83 patients with primary breast cancer. Eur J Surg Oncol 23, 495-502. Rubio IT, Klimberge VS (2001) Techniques of sentinel lymph node biopsy. Semin Surg Oncol 20, 214-223. Sabel MS, Schott AF, Kleer CG, et al (2003) Sentinel node biopsy prior to neoadjuvant chemotherapy. Am J Surg 186, 102-5.

Moffat FL, Jr., Gulec SA, Sittler SY, et al (1999) Unfiltered sulfur colloid and sentinel node biopsy for breast cancer, technical and kinetic considerations. Ann Surg Oncol 6, 746-55. Molland JG, Dias MM, Gillett DJ (2000) Sentinel node biopsy in breast cancer, results of 103 cases. Aust N Z J Surg 70, 98102.

Sacchini V, Borgen PI, Galimberti V, et al (2001) Surgical approach to internal mammary lymph node biopsy. J Am Coll Surg 193, 709-713. Sakaguchi M, Virmani A, Dudak MW, et al (2003) Clinical relevance of reverse transcriptase-polymerase chain reaction for the detection of axillary lymph node metastases in breast cancer. Ann Surg Oncol 10, 117-125.

Morton D, Wen DR, Wong J et al (1992) Technical details of intraoperative lymphatic mapping for early stage melanoma. Arch Surg 11, 105-116.

Sappey MPC (1834) Injection preparation et conservation des vais-seaux lymphatics (thes pour le doctorat en medicine, No. 241. Paris, Rignoux Imprimeur de la Faculte de Medecine,. Schlag PM, Bembenek A (2000) Specification of potential indications and contraindications of sentinel lymph node biopsy in breast cancer. Recent Results Cancer Res 157, 228-36. Schneebaum S, Stadler J, Cohen M et al (1999) Gamma probeguided sentinel node biopsy – optimal timing for injection. Eur J Nucl Med 26(Suppl), S36-S46. Schreiber RH, Pendas S, Ku NN (1999) Microstaging of breast cancer patients using cytokeratin staining of the sentinel lymph node. Ann Surg Oncol 65, 95-101.

Nano MT, Kollias J, Farshid G, Gill PG, Bochner M (2002)Clinical impact of false-negative sentinel node biopsy in primary breast cancer. Br J Surg 89, 1430-4. Nason KS, Anderson BO, Byrd DR, et al (2000) Increased false negative sentinel node biopsy rates after preoperative chemotherapy for invasive breast carcinoma. Cancer 89, 2187-94. Nasser IA, Lee AKC, Bosari S, et al (1993) Occult axillary lymph node metastases in “node negative” breast cancer. Hum Pathol 24, 950-7. Noguchi M (2001) Sentinel lymph node biopsy as an alternative to routine axillary lymph node dissection in breast cancer patients. J Surg Oncol 76, 144-156.

Shiver SA, Creager AJ, Geisinger K, et al (2002) Intraoperative analysis of sentinel lymph nodes by imprint cytology for cancer of the breast. Am J Surg 184, 424-427.

Noguchi M, Tsugawa K, Miwa K et al (2000) Sentinel lymph node biopsy in breast cancer using blue dye with or without isotope localization. Breast Cancer 7, 287-96.

Shivers S, Cox C, Leight G, et al (2002) Final results of the Department of Defense multicenter breast lymphatic mapping trial. Ann Surg Oncol 9, 248-55. Singletary SE, Allred C, Ashley P et al (2002) Revision of the American Joint Committee on Cancer Staging System for breast cancer. J Clin Oncol 20, 3628-36.

Nwariaku RE, Euhus DM, Beitsch RD et al (1998) Sentinel lymph node biopsy, an alternative to elective axillary dissection for breast cancer. Am J Surg 176, 529-31. O'Hea BJ, Hill AD, El-Shirbiny AM, et al (1998) Sentinel lymph node biopsy in breast cancer, initial experience at Memorial Sloan-Kettering Cancer Center. J Am Coll Surg 186, 423-7. Ollila DW, Brennan MB, Guiliano AE (1999) The role of intraoperative lymphatic mapping and sentinel

Stearns V, Ewing CA, Slack R et al (2002) Sentinel lymphadenectomy after neoadjuvant chemotherapy for breast cancer may reliably represent the axilla except for inflammatory breast cancer. Ann Surg Oncol 9, 235-242.

231

Chagpar et al: SLNB in breast cancer Stitzenberg KB, Calvo BF, Iacocca MV, et al (2002) Cytokeratin immunohistochemical validation of the sentinel node hypothesis in patients with breast cancer. Am J Clin Pathol 117, 729-737.

Weaver DL, Krag DN, Ashikaga T et al (2000) Pathologic analysis of sentinel and nonsentinel lymph nodes in breast carcinoma, a multicenter study. Cancer 88, 1099-1107. Wilkinson EJ, Hause LL, Hoffman RG, et al (1982) Occult axillary lymph node metastases in invasive breast carcinoma, characteristics of the primary tumor and significance of the metastases. Pathol Ann 17, 67-91.

Tafra L, Verbanac KM, Lannin DR (2001) Preoperative chemotherapy and sentinel lymphadenectomy for breast cancer. Am J Surg 182, 312-315. Tamhane R, Dahlstrom JE, McCallum DD, et al (2002) The clinical significance of cytokeratin-positive cells in lymph nodes at the time of mastectomy from patients with ductal carcinoma-in-situ. Ann Surg Oncol 9, 999-1003.

Wong SL, Chao C, Edwards MJ, et al (2001) The use of cytokeratin staining in sentinel lymph node biopsy for breast cancer. Am J Surg 182, 330-4. Zurrida S, Mazzarol G, Galimberi V, et al (2001) The problem of the accuracy of intraoperative examination of axillary sentinel nodes in breast cancer. Ann Surg Oncol 8, 817-820.

Turner-Warwick RT (1959) The lymphatics of the breast. Br J Surg 46, 574-82. Tuttle TM, Colbert M, Christensen R et al (2002) Subareolar injection of 99m-Tc facilitates sentinel lymph node identification. Ann Surg Onc 9, 77-81. Uren RF, Howman-Giles RB, Thompson JF et al (1995) Mammary lymphoscintigraphy in breast cancer. J Nucl Med 36, 1775-80. Uren RF, Thompson JF, Howman-Giles R (1998) Sentinel lymph node biopsy in breast cancer. Lancet 352, 1472-3. Veronesi U, Paganelli G, Galimberti V et al (1997) Sentinel-node biopsy to avoid axillary dissection in breast cancer with clinically negative lymph-nodes. Lancet 349, 1864-1867. Veronesi U, Paganelli G, Viale G et al (1999) Sentinel lymph node biopsy and axillary dissection in breast cancer, results in a large series. J Nat Cancer Inst 91, 368-373. Viale G, BosariS, Mazzarol G et al (1999) Intraoperative examination of axillary sentinel lymph nodes in breast carcinoma patients. Cancer 85, 2433-8.

Dr. Kelly M. McMasters

232

Cancer Therapy Vol 1, page 233 Cancer Therapy Vol 1, 233-236, 2003.

A randomised, double-blind, phase II study of three different marimastat schedules administered to patients with resected Dukes C colorectal cancer Research Article

Philippa G. Corrie1*, David J. Kerr2, Kim Bennett1, Charles B. Wilson1, Rachel Midgley2, Peter Brown3 1

Oncology Centre, Addenbrooke's Hospital, Cambridge, CB2 2QQ; University of Oxford, Department of Clinical Pharmacology, Radcliffe Infirmary, Woodstock Road, Oxford, OX2 6HE; 3 British Biotech Pharmaceuticals Ltd, Watlington Road, Oxford OX4 6LY 2

__________________________________________________________________________________ *Correspondence: Dr P.G. Corrie PhD FRCP, Oncology Centre (Box 193), Addenbrooke's Hospital, Hills Road, Cambridge CB2 2QQ, Tel: 01223 274401; Fax: 01223 412213; e-mail: pippa.corrie@addenbrookes.nhs.uk Key Words: adjuvant therapy, colorectal cancer, marimastat; matrix metalloproteinase inhibitor Received: 3 September 2003 and revised: 7 October 2003; Accepted: 9 October 2003; electronically published: December 2003

Summary The aim of this study was to determine whether scheduling treatment holidays would improve tolerance of marimastat, an oral matrix metalloproteinase inhibitor known to have dose-limiting musculoskeletal side effects on continuous daily administration. The trial compared 3 different schedules of marimastat given orally, 10 mg twice daily for 48 weeks, to patients with resected Dukes stage C colorectal cancer. Twenty-nine patients were randomised to one of three treatment schedules: group 1 received marimastat daily; group 2 received 3 x 16 week cycles comprising 12 weeks of marimastat followed by 4 weeks of placebo; group 3 received 12 x 4 week cycles comprising 3 weeks of marimastat followed by 1 week of placebo. The primary end points were toxicity and safety; secondary end points were time to initiating further cancer therapy and/or death. Of 28 patients commencing treatment, 4 patients completed the study and two patients withdrew due to disease recurrence. The remaining 22 patients all withdrew due to adverse events related to the musculoskeletal system. This study suggests that alternative schedules of 1 week off in 4 or 1 month off in 4 are no better tolerated than continuous therapy. Inability to tolerate the drug leading to early withdrawal of almost 80% of patients implies that clinical trials with marimastat in the adjuvant setting are unlikely to prove successful. dependent, but reversible on stopping drug treatment (Tierney et al, 1999; Nelson et al, 2000). As with other broad spectrum MMP inhibitors, marimastat is orally bioavailable, and a daily administration schedule is standard. A number of phase II and III clinical trials evaluating marimastat in the treatment of a range of human cancers have been completed (reviewed by Coussens et al, 2002). Overall, results have proved disappointing. Two key factors probably provide most of the explanation as to why benefits anticipated from excellent preclinical data have not been realised in patients. Firstly, the high prevalence of MSS was not seen in animal models or phase I studies in normal human volunteers. This unexpected side effect had limited the ability of patients to tolerate marimastat when tested in subsequent larger trials. Secondly, most of the trials have been performed in patients with advanced, high volume malignancies. In contrast, in mouse models, MMP inhibition appears most effective in controlling early stages of cancer (Brown, 2000). To address both these

I. Introduction Marimastat is a broad spectrum inhibitor of the family of enzymes known as matrix metalloproteinases (MMPs). MMPs degrade extracellular matrix and are thought to play a key role in the process of tumour invasion. Preclinical studies have shown that in animal models, MMP inhibitors can restrict tumour growth, prevent invasion and metastasis and block neovascularisation (Egeblad and Werb, 2002; Overall and Lopez-Otin, 2002). Marimastat (BB-2516) was the first in a series of new generation MMP inhibitors entering clinical trials. From the early stages of clinical development of this group of agents, a characteristic syndrome involving musculoskeletal side effects has been observed (Hutchison et al, 1998; Drummond et al, 1999). This musculoskeletal syndrome (MSS) is characterised by muscle tendonitis and a variety of clinical signs, including stiffness, inflammation and pain particularly in the joint of hands, arms and shoulders. MSS is both dose- and time-

233

Corrie et al: Phase II study of marimastat against colorectal cancer reinitiated, otherwise the patient was withdrawn. Similar omission of treatment was allowed if symptoms recurred a second time, but on the third occasion, the patient was withdrawn from the study.

issues, a phase II trial was designed to evaluate 3 different dosing schedules of marimastat allowing for â&#x20AC;&#x2DC;drug holidaysâ&#x20AC;&#x2122;, in the context of resected, early stage colorectal cancer.

II. Patients and methods

Table 1: Grading of musculoskeletal toxicity, amended from NCI CTC

The study was conducted between January 1997 and January 1999 at the Queen Elizabeth Hospital, Birmingham and the Oncology Centre, Cambridge, UK. Patients eligible for treatment were ambulant, with Eastern Co-operative Oncology Group (ECOG) performance status of 0-2, having fully recovered from resection of histologically proven Dukes C colorectal cancer performed at least 2 weeks previously. Standard adjuvant radiotherapy and chemotherapy was allowed and must have been completed at least 8 weeks before trial entry. The trial had approval from research ethics committees of the local institutions and all patients entering the trial gave written informed consent

Grade 0 1 2 3 4

Symptoms and signs None Aches and pains with no restriction of movement Pain, causing restriction of activity Pain and the presence of nodules or clinically inflamed joints or tendons Pain and the presence of contracture

A second treatment interruption for toxicity was allowed, but further toxicity necessitating treatment cessation led to the patient being withdrawn. After halting study drug, patients were followed 3 monthly for survival and/or time to initiation of next anti-cancer treatment.

A. Treatment Consenting patients were assigned to 1 of 3 treatment groups (Figure 1) according to a computer generated random code. Ten patients were to be assigned to each group. All patients received marimastat at a dose of 10 mg twice daily, or matching placebo twice daily. The planned treatment period was 48 weeks. Group 1 received marimastat daily for the study duration; Group 2 received 3 x 16 week cycles comprising 12 weeks of marimastat followed by 4 weeks of placebo; Group 3 received 12 x 4 week cycles comprising 3 weeks of marimastat followed by 1 week of placebo. The pharmacist and investigator were provided with sealed randomisation codes for each patient and decode envelopes were kept with the study materials stored securely in the pharmacy. The code could only be broken in emergency conditions. Patients were instructed to take the study drug twice a day at 12 hourly intervals, with water and with or after meals and to return supplies at each study visit for a drug accountability and compliance check, before further supplies were dispensed.

C. Statistical methods No statistical sample size calculation was performed for this study. However, 10 patients per group was regarded as a minimum number of patients to meet the study objectives. The times to treatment interruption and times to musculoskeletal events were presented as Kaplan-Meier plots and compared between groups using the log-rank test.

III. Results Twenty-nine (17 male, 11 female, median age 64 years, range 39 -76 years) patients entered the study, all of whom had received prior adjuvant chemotherapy and 5 had prior radiotherapy. Nine patients were randomised to Group 1 (continuous daily treatment), 9 to Group 2 (12 weeks on, 4 weeks off marimastat) and 11 to Group 3 (3 weeks on, 1 week off marimastat). One patient in Group 3 did not receive study treatment and withdrew after screening due to disease recurrence. Four patients (3 male, 1 female) completed the 48 week study period. Two patients (1 in Group 1 and 1 in Group 3) chose to continue to take study treatment beyond 48 weeks. Twenty-four patients failed to complete the study. Two withdrew due to disease recurrence and the remaining 22 withdrew because of adverse events (Table 2). Of these, 20 withdrew because of one or more events classed under the musculoskeletal body system and two withdrew because of events that were musculoskeletal in nature, although classed under other body systems.

B. Patient evaluation Patients were assessed prior to commencing treatment and then at 4 weekly intervals during the planned study period of 48 weeks. Physical examination, performance status, weight, blood count, renal and liver function tests, carcinoembryonic antigen and plasma marimastat levels were evaluated at baseline and at every study visit. Toxicity, compliance and concomitant medications were recorded at every visit. Toxicity was assessed using the National Cancer Institute common toxicity criteria (NCI CTC). For the purposes of this study, grading of musculoskeletal toxicity was modified slightly from the NCI CTC, as described in Table 1. Study drug was discontinued in the event of any grade II or higher musculoskeletal toxicity and any other grade III or higher toxicity thought to be related to marimastat. If symptoms resolved within 3 weeks, treatment was

Figure 1: Schematic to describe the three treatment schedules

234

Cancer Therapy Vol 1, page 235 The median duration of study treatment for those commencing therapy, excluding drug holidays, was 115 days for Group 1, 85 days for Group 2 and 106 days for Group 3. The proportion of patients with an interruption to treatment within the first 12 weeks of the study was 4/9 (44%) for Group 1, 5/9 (56%) for Group 2 and 6/10 (60%) in Group 3. The respective proportions with treatment interruptions within the first 20 weeks were 6/9 (67%), 7/9 (78%) and 7/10 (70%). The median time to the first treatment interruption was 88 days for Group 1, 84 days for Group 2 and 66.5 days for Group 3. Eight patients in each group experienced musculoskeletal events requiring treatment modification. The most commonly recorded adverse events were musculoskeletal in nature, as would be expected for this particular drug, and were reported for all but one patient on study. Swelling of hands coded as peripheral oedema is also a recognised toxicity of marimastat and occurred in eight (29%) patients (Table 3). The types of musculoskeletal events experienced by patients were similar in all groups, namely pain and stiffness in the muscles and joints of the shoulders, arms, elbows and fingers. The severity of events and the numbers of joints affected tended to shift from mild to moderate and in some cases, to severe, with continued treatment. Two patients developed nodules and/or contractures in the palmar aponeurosis. Patients were allowed access to any analgesics in this study. In twenty-two patients, nonsteroidal analgesics were initiated and 3 patients received paracetamol-based products, primarily in an attempt to control pain associated with the MSS. The benefit of such intervention was unclear. Three patients, one of whom completed the full 48 week study, did not receive any analgesia. The severity of the events reversed after stopping treatment. No other side effects occurred. There were no statistically significant differences between groups with respect to the sequencing or time to development of musculoskeletal events. Over the first 12 weeks, mean marimastat concentrations were 28.7 ng/ml for Group 1 (N=8), 47.1 ng/ml for Group 2 (N=6) and 23.5 ng/ml for Group 3 (N=8). These levels are compatable with ranges recorded in other marimastat trials (Bramhall et al, 2002) and are at the lower end of the target range of 40 â&#x20AC;&#x201C; 200 ng/ml thought to be associated with biological activity (Miller et al, 2002). The high rate of treatment discontinuation in this study makes interpretation of plasma marimastat concentrations measured at later time points difficult to interpret. All patients had baseline CEA values within the normal range. As for pharmacokinetic analysis, the high patient attrition rate in this study precludes any meaningful conclusions being drawn from subsequent data points. At the time of final audit of the data, median followup was 2 years 9 months. At this time, 21 patients were disease free and 2 patients were known to have died.

Table 2: Summary of patients on treatment Group 1 9

Group 2 9

Group 3 11

No. entered study No. receiving study treatment 9 9 10 No. completed study 1 1 2 No. not completing study: 8 8 9 disease recurrence 0 1 2 adverse event 8 7 7 Group 1: continuous daily treatment Group 2: 12 weeks on, 4 weeks off treatment Group 3: 3 weeks on, 1 week off treatment

Total 29 28 4 25 3 22

Table 3: Occurrence of treatment- related events involving predicted toxicities: musculoskeletal events and peripheral oedema. Group 1 N=9

Group 2 N=9

Group 3 N=10

Musculoskeletal events: mild 10 (8) 8 (8) 11 (8) moderate 14 (9) 12 (9) 12 (7) severe 6 (5) 5 (5) 5 (4) Peripheral oedema: mild/moderate 4 (4) 1 (1) 3 (3) severe 1 (1) 1 (1) 2 (2) The number of patients experiencing toxicity is shown in brackets Group 1: continuous daily treatment Group 2: 12 weeks on, 4 weeks off treatment Group 3: 3 weeks on, 1 week off treatment

marimastat, compared with standard continuous daily dosing in the adjuvant setting. Musculoskeletal side effects of marimastat tend to develop in the second and third months of treatment. Although the number of patients with grade III/IV musculoskeletal toxicity was a little lower (not statistically significant) in the group of patients receiving a 3 week on, 1 week off treatment schedule, the time to onset and incidence of treatment interruption due to musculoskeletal side effects were not improved. Thus, it appears that the simple strategy of altered treatment scheduling does not ameliorate the problem of doselimiting MSS. The mechanism of MSS is not fully understood, although several hypotheses have been proposed (Drummond et al, 1999). A rat model predictive of MSS was recently described (Renkiewicz et al, 2003). It is hoped that such models will yield a better understanding of the underlying pathology and significantly improve the chances of identifying more selective, less toxic MMP inhibitors in the future. The small size of this pilot study prevents any conclusions from being drawn regarding the clinical utility of marimastat as an adjuvant therapy for colorectal cancer. The chosen dose for this study of 10 mg twice daily was recommended after initial marimastat trials in cancer patients determined that higher doses up to 50 mg twice daily were too poorly tolerated (Nemunaitis et al, 1998; Primrose et al, 1999). The most promising trial outcome to date was recorded in a study evaluating the 10 mg twice

IV. Discussion The aim of this study was to determine whether prospectively planned treatment â&#x20AC;&#x153;holidaysâ&#x20AC;? would provide a better tolerated treatment schedule for patients receiving 235

Corrie et al: Phase II study of marimastat against colorectal cancer Brown PD (2000). Ongoing trials with matrix metalloproteinase inhibitors. Expert Opin Investig Drugs 9: 2167 - 2177. Coussens LM, Fingleton B, Matrisian LM (2002). Matrix metalloproteinase inhibitors and cancer; trials and tribulations. Science 295: 2387-2392. Drummond AH, Beckett P, Brown PD, Bone EA, Davidson AH, Galloway WA, Gearing AJ, Huxley P, Laber D, McCourt M, Whittaker M, Wood LM, Wright A (1999). Preclinical and clinical studies of MMP inhibitors in cancer. Ann NY Ac Sci 878: 228-35. Egeblad M, Werb Z (2002). New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2: 163-174. Hutchison JW, Tierney GM, Parsons SL, Davis TR (1998). Dupytren's disease and frozen shoulder induced by treatment with a matrix metalloproteinase inhibitor. J Bone Joint Surg Br 80; 907-908. Miller KD, Gradishar W, Schuchter L, Sparano JA, Cobleigh M, Robert N, Rasmussen H, Sledge GW (2002). A randomized phase II trial of adjuvant marimastat in patients with early breast cancer. Ann Oncol 13: 1220-1224. Nelson AR, Fingleton B, Rothenberg ML, Matrisian LM (2000). Matrix metalloproteinases; biologic activity and clinical implications. J Clin Oncol 18; 1135-1149. Nemunaitis J, Poole C, Primrose J, Rosemurgy A, Malfetano J, Brown P, Berrington A, Cornish A, Lynch K, Rasmussen H, Kerr D, Cox D, Millar A (1998). Combined analysis of studies of the effects of the matrix metalloproteinase inhibitor marimastat on serum tumor markers in advanced cancer: selection of a biologically active and tolerable dose for longer-term studies. Clin Cancer Res 55: 3263-3266. Overall CM, Lopez-Otin C (2002). Strategies for MMP inhibition in cancer: innovations for the post-trial era. Nat Rev Cancer 9: 652-672. Renkiewicz R, Qiu L, Lesch C, Sun X, Devalaraja R, Cody T, Kaldjian E, Welgus H, Baragi V (2003). Broad-spectrum matrix metalloproteinase inhibitor marimastat-induced musculoskeletal side effects in rats. Arthritis & Rheum 48: 1742-1749. Primrose JN, Bleiberg H, Daniel F, Van Belle S, Mansi JL, Seymour M, Johnson PW, Neoptolemos JP, Baillet M, Barker K, Berrington A, Brown PD, Millar AW, Lynch KP (1999). Marimastat in recurrent colorectal cancer: exploratory evaluation of biological activity by measurement of carcinoembryonic antigen. Br J Cancer 79: 509-514. Tierney G, Steele R, Griffin N, Stuart R, Kasem H, Lynch KP, Lury JT, Brown PD, Millar AW, Parsons S (1999). A pilot study of the efficacy and effects of the matrix metalloproteinase inhibitor marimastat in gastric cancer. Eur J Cancer 35: 563-568.

daily marimastat schedule in patients with advanced gastric cancer (Bramhall et al, 2002). In this placebocontrolled study of 369 patients, marimastat offered a modest median and 2 year survival benefit. One explanation for possible tumour site specificity may be that high drug concentrations are preferentially achieved in the stomach wall (Bramhall et al, 2002). The mean plasma concentrations of marimastat in the gastric cancer patients were typical and similar to those recorded in the current study, as was the extent of MSS recorded. In line with pre-set dose interruptions and reductions, 43% of marimastat-treated gastric cancer patients remained on the twice daily schedule at 3 months falling to 11% by 6 months. Even so, the overall quality of life over the first 3 months measured by the EORTCQLQC30 questionnaire was not statistically different between the placebo and marimastat arms. Only 10% of advanced gastric cancer patients on marimastat withdrew due to adverse events. This, compared with the 80% withdrawal rate seen in the current adjuvant study, illustrates the poor tolerance of non-selective drugs by essentially well people. The practical, ethical, and financial implications of undertaking large, properly powered randomised trials of novel, rationally designed cytostatics in the early stages of cancer are formidable. However, important lessons from the development of the MMP inhibitors suggest that, unless these challenges are met head on, there will remain a sense that the clinical cancer community has failed to truly evaluate the potential of these agents as effective anti-cancer therapy.

Acknowledgements We thank Dr Julie Bowdler and Ms Lyn Ebbs, British Biotech Pharmaceuticals Ltd, for their assistance in compiling the study report.

References Bramhall SR, Hallissey MT, Whiting J, Scholefield J, Tierney G, Stuart RC, Hawkins RE, McCulloch P, Maughan T, Brown PD, Baillet M, Fielding JWL (2002). Marimastat as maintenance therapy for patients with advanced gastric cancer: a randomised trial. Br J Cancer 86: 1864-1870.

236

Cancer Therapy Vol 1, page 237 Cancer Therapy Vol 1, 237-244, 2003.

LY900003: A novel compound for the treatment of non-small cell lung cancer Review Article

Susannah E. Motl University of Tennessee Health Science Center, College of Pharmacy, Tennessee, USA __________________________________________________________________________________________________ *Correspondence: Susannah E. Motl, PharmD, Assistant Professor, University of Tennessee Health, Science Center, College of Pharmacy, 875 Monroe Avenue, Suite 112, Memphis, TN 38163; Tel: (901) 448.7634; fax: (901) 448.5419; e-mail: smotl@utmem.edu Key Words: LY900003, affinitac, ISIS 3521, non-small cell lung cancer (NSCLC), cancer Received: 10 September 2003; Accepted: 20 September 2003; electronically published: September 2003

Summary Non-small cell lung cancer (NSCLC) accounts for 75-80% of all lung cancers and has a five-year disease free survival rate of 8-14%. The disease free survival for advanced patients (ie, Stage IIIC and IV) has plateaued at eight months. These bitter statistics create a need for additional research into the treatment of NSCLC. The future of lung cancer therapy relies on the combination of standard chemotherapy agents (eg, platinum therapy plus paclitaxel, docetaxel, vinorelbine, or gemcitabine) with â&#x20AC;&#x2DC;novel agentsâ&#x20AC;&#x2122;. These novel therapies must target growth mechanisms unique to tumor cells. The protein kinase C (PKC) ! isoenzyme has been associated with tumor development and progression in several types of cancer. LY900003 (Affinitac"), an antisense oligonucleotide, targets this isoenzyme and is an example of a novel agent. All clinical studies exploring the efficacy, safety, pharmacokinetics, and tolerability of LY900003 in the treatment of any type of cancer-related malignancy are presented. LY900003 offers modest to little efficacy as monotherapy for most tumor types. However, Phase II trials of LY900003 in combination with traditional chemotherapeutic agents, such as docetaxel, cisplatin, paclitaxel, and gemcitabine, have demonstrated promising prolongation of survival endpoints in advanced NSCLC. The future of this antisense compound lies in its absolute efficacy with other chemotherapeutic agents in ongoing Phase III trials. To optimize the benefits of novel agents that target tumor-specific factors, such as LY900003, the selection of patients with specific prognostic factors may become essential. al, 2001). Therefore, approximately half of NSCLC cancer patients are diagnosed with a poor prognosis. Treatment goals for this group of patients are no longer curative, as complete resection is not possible. Instead, the palliation of symptoms and prolongation of survival time are the primary objectives. This can be achieved through palliative chemotherapy or best supportive care (ie, palliative radiotherapy, analgesics, and psychological support, Ginsberg et al, 2001). Chemotherapy is considered the standard of care, as several meta-analyses have demonstrated acceptable treatment costs and quality of life improvements by reducing disease-related symptoms in patients with a performance status between 0-2 (Marino et al, 1994, Grilli et al, 1993; Stewart, 1995). However, even with chemotherapy, the median survival of a patient with advanced or metastatic NSCLC is approximately six to eight months (Ginsberg et al, 2001 and Kim; Murren 2002). The American Society of Clinical Oncologists (ASCO) recently reported that the benefits of treatment have plateaued for advanced NSCLC (Evans and Lynch, 2001). The future of lung cancer therapy relies on the combination of standard chemotherapy agents (eg, platinum therapy plus paclitaxel, docetaxel, vinorelbine, or

I. Introduction Although not as widely publicized, more Americans die each year from lung cancer than breast, prostate, and colorectal cancers combined (Cancer Facts and Figures 2002). Lung cancer is compromised of two types; nonsmall cell (NSCLC) and small cell (SCLC). Non-small cell cancer (NSCLC) accounts for 75-80% of all lung cancers and has a five-year survival rate of 8-14% (Hansen 2002). It grows and spreads more slowly than SCLC. However, even with relatively slow tumor growth, approximately 75% of all NSCLC patients present with advanced cancers (ie, defined by the American Joint Committee on Cancer as Stage IIIB or IV) (Hansen, 2002; Patel et al, 1993). This group has a very low five-year disease free survival rate. Specifically, 20% of all NSCLC patients are at Stage IIIB cancer (ie, tumors that have invaded tissue outside the lungs, including mediastinal, scalene, supraclavicular, and hilar lymph nodes or contain malignant pleural effusions) and have a five-year disease free survival rate of 5%. Twenty-seven percent present with Stage IV cancer (ie, tumors that have metastatic involvement) and have a fiveyear disease free survival rate of less than 2% (Ginsberg et

237

Motl: LY900003-A novel compound for the treatment of non-small cell lung cancer gemcitabine) with â&#x20AC;&#x2DC;target agents.â&#x20AC;&#x2122; These novel therapies must be aimed at growth mechanisms unique to tumor cells, distinguishing them from standard chemotherapy, which are often toxic to human cells. A number of novel pipeline products are currently being investigated. These include LY900003 (Affinitac#, Eli Lilly & ISIS Pharmaceuticals), OSI-774 (Tarceva#, Roche), and trastuzumab (Herceptin", Genentech), along with the recent approval of ZD-1839 (Iressa", AstraZeneca). This article reviews data on LY900003, focusing on the efficacy and safety profiles that have been displayed in published clinical trials and meeting abstracts. LY900003 was developed by ISIS Pharmaceuticals (Carlsbad, CA) and received fast track status for the indication of NSCLC in November 2000 (Peterson and Moore, 2003). Eli Lilly and Company licensed this compound in August 2001 and is responsible for commercialization and future clinical studies. LY900003 is considered to be a novel therapy due to its targeted effect on the protein kinase C (PKC) !. This isoenzyme has been implicated with the cancer growth pathway of numerous tumor lines.

at inhibiting the production of protein kinase C-alpha (PKC-!) and does not affect other protein kinase C molecules (Yuen et al, 1999). The class of PKC isoenzymes is involved in numerous physiological processes, specifically the signal transduction of numerous growth factors, neurotransmitters, and hormones (Mani et al, 2002). However, the PKC-! isoenzyme has been implicated in malignant transformation and proliferation and has demonstrated anti-apoptic activity. An association has been demonstrated between certain cancers and a high expression of PKC-!. Specifically, high expression of this isoenzyme has been identified in human lung, bladder, breast, prostate, hepatoma, colon, glioblastoma, and medulloblastoma cancers (Yuen et al, 1999; Nemunaitis et al, 1999; Mani et al, 2002). By inhibiting PKC-!, LY900003 is hypothesized to have a therapeutic effect in cancers over-expressing this protein. The targeted selection of PKC-! by LY900003 prevents a myriad of side effects that would occur if the entire PKC class was selected. LY900003 has shown initial efficacy in several tumor types, however, the most promising results have occurred in NSCLC. LY900003 is a phosphorothioate oligodeoxy nucleotide, 20 oligonucleotides in length. The phosphorothioate component forms the backbone of the molecule, and is thought to increase stability in the serum and provide resistance to metabolizing exonucleases. The drug has a bi-phasic half-life, with the first phase of elimination occurring in 40 minutes with a 1.0 mg/kg/day dose and 60 minutes with a 3.0 mg/kg/day dose. This rapid initial clearance is due to tissue distribution. However, once the drug reaches the tissue, it is cleared much slower from these compartments. The later phase half-life is estimated to be five days in the renal cortex, and one to three days in other tissues. LY900003 displays non-linear kinetics, achieving a steady state plasma concentration at 24 hours with a continuous infusion. Drug clearance from the plasma occurs through tissue distribution and metabolism via an oligonucleotide-shortening exonuclease. In a Phase I two-hour infusion trial, less than 1% of the drug was recovered in urine samples 24 hours after administration (Yuen et al, 1999; Nemunaitis et al, 1999). The drug has been tested as monotherapy in Phase I trials in three different dosing regimens: a 2-hour infusion three times a week (Nemunaitis et al, 1999), a 24-hour infusion once a week (Advani et al, 1999), and a 21-day continuous infusion (Yuen et al, 1999; Sikic et al, 1997). Pharmacokinetic analyses of the different dosing schedules have indicated that a continuous infusion is the optimum dosing regimen. This appears to minimize side effects, specifically fever, chills, and myalgias. Additionally, animal studies have indicated that complement activation and prolongation of activated partial thromboplastin time (aPTT) occur in primates when the plasma concentration is greater than 40 Âľg/mL (Yuen et al, 1999) A continuous infusion provides lower plasma levels compared to intermittent dosing, which avoids this toxic effect (Advani et al, 2000).

II. Antisense technology LY900003 is an antisense oligonucleotide, a new class of molecules known to modify gene expression by interacting with messenger RNA (mRNA) (Tamm et al, 2001). In general, most diseases are caused by the inappropriate production of proteins (Jansen and Zangemeister-Wittke, 2002). Conventional drugs are directed to interact with these proteins. In contrast, antisense agents, such as LY900003, inhibit the production of these specific proteins. Antisense oligonucleotides are developed to act as complements to mRNA involved in the production of disease-specific proteins. These antisense agents bind to mRNA, which allows an enzyme, RNase H, present in the cytoplasm to degrade mRNA (Tamm et al, 2001; Jansen and Zangemeister-Wittke 2002). The end result is the inhibition of disease-promoting protein production. Currently, only one antisense agent is available on the market (Kim and Murren, 2002). Fomivirsen (Vitravene") was approved in 1998 by the Food and Drug Administration (FDA) for the treatment of retinitis induced by the cytomegalovirus in acquired immunodeficiency (AIDs) patients. In oncology, the identification of cancer-related molecular sites allows antisense technology to target tumor-associated DNA products without affecting normal gene expression. As a class, antisense oligonucleotides demonstrate minor toxicities with a unique mechanism of action, making them desirable add-on treatments to standard chemotherapy.

III. Pharmacokinetics / Pharmacodynamics The identification of specific molecular targets has allowed for the design of rationally targeted drug therapies for specific tumor types. LY900003 is specifically aimed 238

Cancer Therapy Vol 1, page 239 phase II trials to minimize adverse events. This was later changed to a 14-day infusion in combination with other chemotherapeutic agents for patient convenience. The majority of severe adverse events seen in Phase I trials were thrombocytopenia (TCP), nausea, fatigue, fever, and diarrhea. Grade 3 (ie, severe) and 4 (ie, life threatening or disabling) toxicities were limited. Some level of efficacy was demonstrated in ovarian, lymphoma, colon, lung, and renal cancers. Because the objectives of Phase I trials in oncology are to determine the safety and tolerability of investigational agents along with identifying a dose for phase II trials, any evidence of efficacy is very exciting. Favorable results were seen in a phase I trial of advanced cancer (N=18), with the majority of patients having advanced NSCLC (N=12).

IV. Clinical trials A. Phase I LY900003 was tested initially in several tumor types in Phase I trials (Yuen et al, 1999; Nemunaitis et al, 1999; Mani et al, 2002; Sikic et al, 1999; Yuen et al, 2000, 2001). The drug regimen, type of tumors treated, and results of the published trials are summarized in Table I. Three different dosing schedules were used in the seven Phase I trials listed, due to changing knowledge about optimizing the safety and efficacy profiles of the drug, as discussed previously. A dose escalation scheme of 0.5, 1.0, 1.5, 2.0, and 3.0 mg/kg/day as a 21-day continuous infusion was conducted (Yuen et al, 1999). The continuous infusion regimen was selected based on the short half-life of the drug. Four of six patients that received 3.0 mg/kg/day developed dose-limiting toxicities of thrombocytopenia and fatigue. Based on this, a 21-day continuous infusion of 2.0 mg/kg/day was chosen for Table 1: Phase I trials LY900003 Regimen 2 hour infusion three times weekly x 3 weeks Q 28 days; Doses 0.15-6.0 mg/kg/day (Nemunaitis et al, 1999) CIV* x 21 days Q 28 days; Doses of 0.5, 1.0, and 1.5 mg/kg/day (Sikic et al, 1997) CIV* x 21 days Q 28 days; Doses of 0.5, 1.0, and 1.5, 2.0, 3.0 mg/kg/day (Yuen et al, 1999)

24 hour continuous infusion Q week; Doses 6, 12, 18, 24, 30 mg/kg/week) (Advani et al, 1999) Cycle 1: Carboplatin AUC 6, Paclitaxel (175 mg/m); Cycle 2: LY900003 CIV* x 14 days + (carboplatin & paclitaxel day 4) Q 28 days (Sikic et al, 1999) CIV* x 21 days; Doses 1.0, 1.5, 2.0 + (5-FU 425 mg/m2/day + leucovorin 20mg/m2 x 5 days) Q 28 days (Mani et al, 2002)

Type of cancer (number) Colon (9); Melanoma (6): Renal (4); Lymphoma (3); Small cell lung (2); NSCLC (4); Sarcoma (1); Other (1) Pancreatic (3); Colon (2); Stomach (1); Lung (1); Breast (1);Ovarian (1) Ovarian (4); Colon (3); Pancreatic (3); Sarcoma (3); Lung (2); Gastric (2); Esophageal (1); Breast (1); Melanoma (1); Lymphoma (1) Refractory solid tumors (11)

Efficacy (number)

Grade 3 & 4 Toxicities (number) G3 TCP (1) G3 nausea (1)

Comments

-Stable disease x 4 months (Colon (1) & Ovarian (1))

None

-Ongoing at time of abstract

-60% reduction in abdominal mass x 11 months(Ovarian (1) -Decreased CA-125 levels x 5 & 7 months (Ovarian (2) -Stable disease x 3+ months (Colon (1))

G3 fatigue (4) G4 TCP (1) G2 TCP with G4 bleeding (1) G3 TCP: 3

-Phase II trial initiated in ovarian patients in progress -Majority of adverse events occurred in 3.0 mg/kg/day -Ongoing at time of presentation

NSCLC (9); Unknown (2); Cervical (2); Esophageal (1); Sarcoma (1)

-Not presented

G3 diarrhea (1) G3/4 neutropenia (12) G3 TCP (3) G3 fatigue (1)

-Ongoing at time of presentation -Study drug did not alter kinetics of carboplatin or paclitaxel

Colorectal (8); unknown primary (2); gallbladder (1); ovarian (1); breast (1); pancreatic (1); esophageal (1)

-> 50% reduction (2; colorectal and unknown) -Minor reduction in tumor size (colorectal (3) & pancreatic (1)) -53% partial response -20% stable disease -Median time to progression: 6.5 months

G3 chest pain (1) G3 mucositis (3) G3/4 neutropenia (12) G3/4 TCP (3)

-Study drug did not alter kinetics of 5-FU or leucovorin

None

-Trial was expanded to Phase II with a focus on NSCLC patients

CIV* x 14 days LY900003 NSCLC (12); Unknown at 2.0 mg/kg/day + (6) (carboplatin AUC 6 + Paclitaxel 175 mg/m2 day 4) Q 21 days (Yeun et al, 2001, Yuen et al, 2000) * CIV = continuous intravenous infusion TCP = Thrombocytopenia

-Complete response (2, lymphoma); stabilization of disease (10)

239

G3 fever/chills (1)

-Elimination half-life of 1-1.5 hours -Decision to investigate longer infusions

Motl: LY900003-A novel compound for the treatment of non-small cell lung cancer Grade 3 / 4 infections, and 9.3% developed Grade 3 / 4 thrombocytopenia. In contrast to the poor efficacy seen with monotherapy, LY900003 showed favorable efficacy in advanced NSCLC in combination with other agents, such as docetaxel, carboplatin, paclitaxel, cisplatin, and gemcitabine (Yuen et al, 2000, Yuen et al, 2001, Moore et al, 2002; Ritch et al, 2002). Specifically, the expanded Phase I/II trial (N=53) of the LY900003, carboplatin, and paclitaxel combination demonstrated a complete or partial response in 42% of patients (Yuen et al, 2000, 2001). The median time to disease progression was 6.6 months and the median overall survival was 19 months. This compares to the standard median survival of six to eight months with chemotherapy treatment (Ginsberg et al, 2001 and Kim and Murren, 2002).

B. Phase II Table II summarizes the published phase II trials completed in LY900003. A dose of 2.0 mg/kg/day was used as either a 21-day or 14-day continuous infusion. This agent showed very little activity as monotherapy in hormone-refractory prostate cancer, advanced colorectal cancer, high-grade astrocytomas, and metastatic breast disease. Modest single-agent activity was demonstrated in non-Hodgkinâ&#x20AC;&#x2122;s lymphoma (Yuen et al, 2000, 2001; Tolcher, et al, 2002; Cripps et al, 2002; Alavi et al, 2000; Gradishar et al, 2001; Emmanouilides et al, 2002; Moore et al, 2002; Ritch et al, 2002). Grade 3 and 4 toxicities were limited with monotherapy. Out of 128 patients treated, 0.8% developed Grade 3 lethargy or Grade 4 elevations in serum glutamic oxaloacetic transaminase (SGOT), 2.3% developed Grade 3 fatigue, 3.1% developed

Table II: Phase II trials * CIV = continuous infusion Regimen Type of cancer (number) LY900003 CIV* or ISIS Hormone-refractory 5132** CIV* x 21 days prostate cancer (HRPC) Q 28 days (Tolcher et al, (31) 2002) LY900003 CIV* or ISIS Untreated advanced 5132** CIV* x 21 days colorectal cancer (32) Q 28 days (Cripps et al, 2002) LY900003 CIV* x 21 High grade astrocytomas days Q 28 days (Alavi et (HGA) (21) al, 2000) LY900003 CIV* x 21 days Q 28 days (Gradishar et al, 2001)

Metastatic Breast Cancer (MBC) (15)

LY900003 CIV* x 21 days Q 28 days (Emmanouilides et al 2002) LY900003 CIV* x 14 days + (docetaxel 75 mg/m2 day 3) Q 21 days (Moore at al. 2002)

Low-grade, nonHodgkinâ&#x20AC;&#x2122;s lymphoma (NHL)(29)

LY900003 CIV* x 14 days + (carboplatin AUC 6 + paclitaxel 175 mg/m2 day 4] Q 21 days21-22

Efficacy (number) -No objective or PSA responses -Stable disease (3) -Stable PSA levels (5) -No objective response -Stable disease on ISIS 3521 (4) -Median time to progression: 35 days -Median survival: 93 days -Median time to progression: 1.2 months -Median survival 8.3 months -73% reduction (1) -stable disease (16) -progressive disease (4)

Advanced, previously treated NSCLC (57)

-Partial response (8) -Stable (23) -Progressive (21)

Phase I: all tumors (18) Phase II: advanced NSCLC (53)

-Complete or partial response (42%) -Progressive (17%) -Median time to progression: 6.6 months Median survival: 19 months -Complete response (3%) -Partial (35%) -Stable (50%) Progressive (13%)

LY900003 CIV* x 14 NSCLC (55) days + (cisplatin 80 mg/m2 + gemcitabine 1250 mg/m2 days 0 and 8) Q 21 days29 TCP = thrombocytopenia ** ISIS 5132 is another antisense oligonucleotide under investigation Note: All doses of LY900003 were 2.0 mg/kg/day

240

Grade 3 & 4 Toxicities (number) G3 lethargy (1)

Not presented

G3 TCP (3) G4 SGOT (1)

Comments -No single agent antitumor activity for HRPC -No single agent antitumor activity for advanced colorectal cancer -No single agent antitumor activity for HGA

G3/4 TCP (2) G3/4 infection (4)

-No single agent antitumor activity for MBC

G3 TCP (6) G4 TCP (1) G3 fatigue (3)

-Observed modest activity in NHL

G3 neutropenia (11) G4 neutropenia (23) G3 TCP (9) G3/G4 infection (9) G3/G4 dyspnea (11) G3/4 neutropenic fever (7) G3 neutropenia (16) G4 neutropenia (14) G3 TCP (9) G3 TCP (4)

-Hematologic toxicity is standard for docetaxel monotherapy -Initial efficacy is favorable

G3/4 neutropenia (57%) G3/4 TCP (43%)

-Well-tolerated -Initial efficacy is very favorable -Phase III trial in progress

Cancer Therapy Vol 1, page 241 and fatigue. Additionally, there were significantly more venous access complications with the LY900003 arm. The investigators concluded that although LY900003 therapy did not extend survival in this patient population, a 14-day continuous infusion of antisense oligonucleotides is feasible. Additional analyses on the stage of disease, gender, age, histology, or percentage receiving second line therapy did not identify any subset of patients that fared better. Potential reasons why LY900003 failed to demonstrate a favorable outcome compared to the control arm include an inadequate dose or regimen of LY900003 and the lack of targeted patient selection for overexpression of the PKC-! protein.

Another promising outcome of LY900003 in the treatment of advanced NSCLC occurred in the combination of LY900003, cisplatin, and gemcitabine in 55 patients (Ritch et al, 2002). Over 90% of these patients had Stage IV disease. In this trial, 37% of all patients responded, with one complete response, 17 partial responses, and 24 patients with stable disease. Grade 3 and 4 toxicities with combination chemotherapy included a much higher incidence of neutropenia (Yuen et al, 2000, 2001; Moore et al, 2002; Ritch et al, 2002).

C. Phase III There are currently two Phase III trials initiated with LY900003 in advanced NSCLC patients with a performance status of 0-1, as shown in Table III (Ritch et al, 2002; Lynch et al, 2002: The Pink Sheet 2002). The first trial compared the combination of a 14-day continuous infusion of LY900003 2 mg/kg/day over days 1â&#x20AC;&#x201C;14 with paclitaxel 175 mg/m 2 and carboplatin AUC 6 on day 3 repeated every 21 days to paclitaxel 175 mg/m2 and carboplatin AUC 6 on day 1 repeated every 21 days (Lynch et al, 2003). Enrollment of over 600 patients was completed in January 2002. Preliminary results were presented at the ASCO annual meeting in May 2003. There was no difference in the treatment groups with regards to prognostic factors, such as age, stage, performance status, weight loss, presence of brain metastases, or adenocarcinoma. Patients randomized to the LY900003 arm were required to have venous access. The primary efficacy measurement was the overall response rate (complete and partial responses) using the intent to treat population. The secondary efficacy measurement was the time to disease progression (TTP). There was no statistically significant difference in either of these outcomes. The overall response rate was 37% and 36% in the LY900003 (n=309) and control arm (n=307), respectively, while the TTP was 4.7 months and 4.5 months, respectively. While there was no difference in treatment-related deaths between the two arms, the LY900003 arm showed significantly more Grade 3 thrombocytopenia and anemia, and Grade 3 / 4 vomiting

Carboplatin and paclitaxel is the recommended regimen by the Eastern Cooperative Oncology Group (ECOG) for advanced NSCLC, however, they do not have regulatory approval for NSCLC in the United States (Shiller et al, 2002). For this reason, another large-scale Phase III trial was initiated. The second phase III trial includes a 14-day continuous infusion of LY900003 plus one day of cisplatin (Day 1) and two days of gemcitabine (Days 1 & 8) on a 21-day cycle (Ritch et al, 2002). Cisplatin and gemcitabine do have FDA regulatory approval for the treatment of advanced NSCLC. Over 670 patients have been enrolled and analyses are expected sometime in 2004. If the results are favorable, a new drug application (NDA) will be submitted to FDA based on Phase II NSCLC trials and this Phase III trial (The Pink Sheet 2002).

V. Adverse effects and drug interactions A. Adverse reactions There are several class effects of phosphorothioate oligonucleotides, including the prolongation of activated partial thromboplastin time (aPTT) and complement activation (Yuen et al, 1999).

Table III: Phase III trials Regimen

Type of cancer (number)

LY900003 CIV* x 14 days + (carboplatin AUC 6 + paclitaxel 175 mg/m2 day 4) Q 21 days (Moore et al, 2002)

Advanced NSCLC (616); previously untreated

LY900003 CIV* x 14 days + (cisplatin day 1 + gemcitabine days 1 & 8) Q 21 days (Ritch et al, 2002, FDA 2002)

Advanced NSCLC (670)

Efficacy (%) LY900003 vs. control -Overall response rate: 37% vs. 36% -Time to tumor progression: 4.7 vs. 4.5 months -Overall survival: 10 vs. 9.7 months --

* CIV = continuous intravenous infusion

241

Grade 3 & 4 Toxicities (%) LY900003 vs. control G3 TCP: 44% vs. 15% G3 anemia: 13% vs. 6% G3/4 nausea: 6% vs. 1% G3/4 fatigue: 16% vs. 8%

Comments

-Completed enrollment -Results expected in 2003

-Currently enrolling

Motl: LY900003-A novel compound for the treatment of non-small cell lung cancer Although these specific effects were seen in primate studies, no associations were made with the adverse effects seen in all clinical trials. In Phase I and II trials, the majority of observed adverse events appear to be complications of advanced cancer or concurrent therapy rather than associated with the administration of LY900003. As previously discussed, LY900003 monotherapy demonstrated few Grade 3 or 4 toxicities. The initial results of the Phase III trial investigating LY900003 in combination with paclitaxel and carboplatin showed that patients receiving LY900003 were more likely to develop Grade 3 thrombocytopenia (TCP) (44% vs. 15%, p<0.0001) and Grade 3 anemia (13% vs. 6%, p=0.008) compared to the control (Lynch et al, 2003). However, neither of these hematologic toxicities resulted in any significant adverse drug reactions, such as bleeding. Additionally, thrombocytopenia was not cumulative, in contrast to standard chemotherapy agents. Grade 3 / 4 vomiting (6% vs. 1%, p=0.006) and fatigue (16% vs. 8%, p=0.003) were also significant non-hematologic concerns in the LY900003 arm compared to the control. Generally, these can be controlled with oral 5-HT3 receptor antagonists & phenothiazines and analgesics, respectively. Finally, catheter-related complications posed several problems in the LY900003 arm (Lynch et al, 2003). Compared to the control, the LY900003 arm had higher rates of catheter infections (8.2% vs. 0.3%) and thrombotic events (5.4% vs. 1.4%). As a result, the control arm received a median of 5 cycles, while the LY900003 arm received a median of 4 cycles. Overall, there was no difference in the rate of regimen-related deaths (3.4% for each arm).

VI. Dosage and administration Due to the long-term nature of the LY900003 infusion, a venous access device is necessary for continuous administration of the drug. Although, no known physiochemical incompatibilities occurred with LY900003, it is ideal to have a line designated for LY900003. This avoids halting other treatments if an infection were to occur in the long-standing line. Information on the type of venous access device in the phase III trial is unknown. ISIS Pharmaceuticals is currently supplying LY900003 to ongoing clinical trials (The Pink Sheet 2002). The drug comes in 2 mL or 11 mL vials, holding 1.1 mL or 10 mL of the active drug, respectively (Yuen et al, 1999; Nemunaitis et al, 1999). The volume of drug needed to achieve a dose of 2 mg/kg/day for seven days is calculated based on the patientâ&#x20AC;&#x2122;s actual body weight prior to beginning LY900003 therapy (Moore et al, 2002). This is then withdrawn from the vials. A volume of normal saline equal to the calculated drug volume is removed from a 250 mL normal saline bag and LY900003 is then added to the bag. In Phase II trials, a portable volumetric infusion pump was used to administer the drug via an indwelling CVC with a 0.22 micron inline filter (Yuen et al, 1999). The fixed dosage regimen of 2 mg/kg/day for 14 days appears to be standard for advanced NSCLC patients in Phase III trials. In one phase II clinical trial in advanced NSCLC patients, this was achieved by administering a daily dose of either 125, 175, or 225 mg based on the patientâ&#x20AC;&#x2122;s actual body weight (Moore et al, 2002). Patients receive a seven-day supply of medication at a time and return to clinic for monitoring and an additional supply of medication to complete the 14-day regimen.

B. Drug interactions LY900003 has been combined successfully with several chemotherapeutic agents in Phase I, II, and III trials (Yuen et al, 1999). Specifically, the pharmacokinetics of paclitaxel, carboplatin, leucovorin, docetaxel, cisplatin, and gemcitabine did not change with concomitant use of LY900003. Additionally, cytochrome P450 interactions are not expected, as the drug undergoes metabolism through a chain-shortening exonuclease mechanism (Yuen et al, 1999).

VII. Conclusion Compared to the promising Phase II results seen with LY900003 in combination with other chemotherapeutic agents in Stage IIIB and IV NSCLC patients, the initial Phase III results are disappointing. While LY900003 appears to break the eight-month survival barrier previously seen with standard chemotherapeutic regimens in advanced NSCLC, the results of the initial Phase III trial with paclitaxel and carboplatin did not demonstrate any efficacy advantage over standard chemotherapy alone. Additionally, there were some toxicity concerns in the LY900003 arm. Although there was no difference in regimen-related deaths, patients on the LY900003 arm were more prone to additional hematological, nonhematological, and catheter-related problems. The investigators hypothesize that the lack of efficacy seen in the first large-scale Phase III trial with LY900003 may be due to lack of patient selection for the overexpression of PKC-!. Perhaps as drug therapy becomes more focused on the inhibition of specific molecular targets, patient selection must also follow. Certainly drugs like trastuzumab (Herceptin") have already proven this theory in the treatment of metastatic

C. Precaution / Contraindications Due to the antisense phosphorothioate class effects of complement activation and a prolongation of aPTT, exclusion criteria in all clinical trials included patients with any underlying disease states associated with bleeding, complement abnormalities, a past medical history of coagulopathy, and use of anticoagulants (Yuen et al, 1999). Patients without adequate hematopoietic function may also be cautioned from clinical involvement with LY900003, as the drug has been shown to cause thrombocytopenia.

242

Cancer Therapy Vol 1, page 243 Poster presented at, The American Society of Clinical Oncology Orlando, FL, May 18-21. Evans TL, Lynch TJ, (2001) Lung Cancer. Oncologist 6(5), 407414. Food and Drug Administration (2002) Lilly affinitac launch supply will be produced by ISIS deliveries start in 2003. Rockville, MD, The Pink sheet. FDC reports 64, 36. Giaccone G (2002) A phase III clinical trial of ZD1839 (Iressa) in combination with gemcitabine and cisplatin chemotherapy-naïve patients with advanced non-small-cell lung cancer (INTACT 1). Presented at European Society for Medical Oncology, Abstract #4. Ginsberg RJ, Vokes EE, Rosenzweig K, (2001) Non-small cell lung cancer. In, DeVita VT, Hellman S, Rosenberg SA, eds. Cancer, principles and practices of oncology. Philadelphia, PA, Lippincott-Raven, 925-982. Gradishar WJ, O’Neill A, Cobleigh M, Goldstein LJ, Davidson NE (2001) A phase II trial with antisense oligonucleotide ISIS 3521/ Cgp 64128a in patients (Pts) with metastatic breast cancer (MBC), ECOG Trial 3197. Poster presented at, The American Society of Clinical Oncology San Francisco, CA, May 12-15. Grilli R, Oxman AD, Julian JA, (1993) Chemotherapy for advanced non-small-cell lung cancer, how much benefit is enough? J Clin Oncol 11(10), 1866-1872. Hansen HH (2002) Treatment of advanced non-small cell lung cancer. BMJ 325, 452-453. Herbst RS, Giaccone G, Schiller J, Miller V, Natale R, Rennie P, et al, (2003) Subset analyses of INTACT results for gefinitib (ZD1839) when combined with platinum-based chemotherapy (CT) for advanced non-small-cell lung cancer (NSCLC). Presented at The American Society of Clinical Oncology Chicago, IL, May 31-June 3, # 2523. Jansen B, Zangemeister-Wittke, (2002) Antisense therapy for cancer- the time of truth. Lancet Oncol 3, 672-683. Johnson DH (2002) ZD1839 (Iressa) in combination with paclitaxel and carboplatin in chemotherapy-naïve patients with advanced non-small-cell lung cancer (NSCLC), Results from a phase III clinical trial (Intact 2). Presented at European Society for Medical Oncology, Abstract #468. Kim TE, Murren JR, (2002) Therapy for stage IIIB and stage IV non-small cell lung cancer. Clin Chest Med 23, 209-224. Lynch TJ, Raju R, Lind M, Riviere A, Gatzemeier U, Dorr A, et al, (2003) Randomized phase III trial of chemotherapy and antisense oligonucleotide LY900003 (ISIS 3521) in patients with advanced NSCLC, initial report. Presentation at, The American Society of Clinical Oncology Chicago, IL, May 31-June 3. Mani S, Rudin CM, Kunkel K, Holmlund JT, Geary RS, Kindler HL et al, (2002) Phase I clinical and pharmacokinetic study of protein kinase C-alpha antisense oligonucleotide ISIS 3521 administered in combination with 5-fluorouracil and leucovorin in patients with advanced cancer. Clin Cancer Res 8, 1042-1048. Marino P, Pampallona S, Preatoni A, Cantoni A, Invernizzi F, (1994) Chemotherapy vs. supportive care in advanced nonsmall cell lung cancer. Results of a meta-analysis of the literature. Chest 106, 861-865. Moore MR, Mansoor S, Jones CM, Irwin D, Gervais R, Kerr R et al, (2002) Phase II trial of ISIS 3521/ LY900003, an antisense inhibitor of PKC-alpha, with docetaxel in nonsmall cell lung cancer (NSCLC). Poster presented at, The American Society of Clinical Oncology, Orlando, FL, May 18-21. National Institute for Clinical Excellence (2003) Technology Appraisal Guidance- No. 26, Guidance on the use of docetaxel, Paclitaxel, gemcitabine, and vinorelbine for the

breast cancer showing an over-expression of the HER2/neu protein. The future of LY900003 lies in the results of the second Phase III trial. Regardless of the outcome, the lessons learned from LY900003 have been bountiful. First, a 14-day continuous infusion of an antisense oligonucleotide is possible. The first phase III trial with LY900003 is the largest trial using an oligonucleotide, to date. Second, as drug therapy in oncology becomes increasingly complex, individualized therapy must occur to optimize patient outcome. None of the clinical trials with LY900003 assessed PKC-! levels. This may be important in large scale, Phase III trials. Finally, it is essential that properly planned and conducted Phase III trials occur in new chemical molecules prior to their approval by the Food and Drug Administration (FDA). The lack of a survival advantage demonstrated in the initial Phase III results of LY900003 in combination with paclitaxel and carboplatin look similar to results seen with gefinitib (Iressa") in two recent Phase III trials that enrolled over 1000 advanced NSCLC patients per trial (Giaccone, 2002; Johnson 2002). Here, gefinitib failed to demonstrate a survival advantage when combined with a paclitaxel / carboplatin or a gemcitabine / cisplatin combination. Interestingly, subset analyses of these trials investigating stratification and prognostic factors also did not identify a group of patients that benefited from gefinitib, similar to the LY900003 subanalyses (Lynch et al, 2003; Herbst 2003).

References Advani R, Fisher G, Grant PA, Yuen A, Holmlund JT, Kwoh TJ et al, (1999) A phase I trial of an antisense oligonucleotide targeted to protein kinase C-alpha (ISIS 3521/ ISI641A) delivered as a 24-hour continuous infusion. Poster presented at, The American Society of Clinical Oncology, Atlanta, GA, May 15-18. Advani R, Fisher G, Lum B, Halsey J, Yuen A, Holmlund J et al, (2000) Coagulation and complement effects of an antisense phosphorothioate oligonucleotide targeting protein kinase C (ISIS 3521) are schedule and dose dependent. Poster presented at, The American Society of Clinical Oncology, New Orleans, LA, May 20-23. Alavi J, Grossman S, Supko J, Carson K, Priet R, Dorr A et al, (2000) Efficacy, toxicity, pharmacology, of an antisense oligonucleotide directed against protein kinase c alpha (ISIS 3521) delivered as a 21 days continuous intravenous infusion in patients with recurrent high-grade astrocytoma (HGA). Poster presented at, The American Society of Clinical Oncology, New Orleans, LA, May 20-23. American Cancer Society (2002) Cancer Facts and Figures, 1-48. Cripps MC, Figueredo AT, Oza AM, Taylor MJ, Fields AL, Holmlund JT et al, (2002) Phase II randomized study of ISIS 3521 and ISIS 5132 in patients with locally advanced or metastatic colorectal cancer, a National Cancer Institute of Canada clinical trials group study. Clin Cancer Res 8, 21882192. Emmanouilides CE, Saleh A, Laufman L, Saven A, Harden E, Lister M et al, (2002) Phase II trial of the efficacy and safety of ISIS 3521/ LY900003, an antisense inhibitor or PKCalpha, in patients with low-grade, non-Hodgkin’s lymphoma.

243

Motl: LY900003-A novel compound for the treatment of non-small cell lung cancer treatment of non-small cell lung cancer. Available at www.nice.org.uk Nemunaitis J, Holmlund JT, Kraynak M, Richards D, Bruce J, Ognoskie N et al, (1999) Phase I evaluation of ISIS 3521, an antisense oligodeoxynucleotide to protein kinase c-alpha, in patients with advanced cancer. J Clin Oncol 17, 3586-3595. Patel AM, Dunn WF, Trastek VF, (1993) Staging systems of lung cancer. Mayo Clin Proc 68, 475-482. Peterson K, Moore JK, (2003) Cancer drugs in clinical development LY900003 (ISIS 3521). ISIS Pharmaceuticals website.Available at www.isispharm.com/press/press02/100102MfgAffinitac.htm. Ritch PS, Belt R, George S, Valdivieso M, Figueroa J, McCachren S et al, (2002) Phase I/II trial of ISIS 3521/ LY900003, an antisense inhibitor of PKC-alpha with cisplatin and gemcitabine in advanced non-small cell lung cancer (NSCLC). Poster presented at, The American Society of Clinical Oncology Orlando, FL, May 18-21. Schiller JH, Harrington D, Belani CP, Langer C, Sandler A, Krook J et al, (2002) Comparison of four chemotherapy regimens for advanced non-small cell lung cancer. N Engl J Med 346, 92-98. Sikic BI, Yuen AR, Advani R, Fisher G, Halsey J, Geary R et al, (1999) A phase I trial of ISIS 3521 (ISI 641 A) an antisense inhibitor of protein kinase C alpha combined with carboplatin and paclitaxel in patients with cancer. Poster presented at, The American Society of Clinical Oncology, Atlanta, GA, May 15-18. Sikic BI, Yuen, AR, Halsey J, Fisher GA, Pribble JB, Smith RM et al, (1997) A phase I trial of an antisense oligonucleotide targeted to protein kinase C-alpha (ISIS 3521) delivered by 21-day continuous intravenous infusion. Poster presented at, The American Society of Clinical Oncology, Denver, CO, May 17-20. Stewart L ( 1995) Chemotherapy in non-small cell lung cancer, a meta-analysis using updated data on individual patients from 52 randomized trials. BMJ 311, 899-909. Tamm I, Dorken B, Hartmann G, (2001) Antisense therapy in oncology, new hope for an old idea? Lancet 358, 489-497.

Tolcher AW, Reyno L, Venner PM, Ernst SD, Moore M, Geary RS et al, ( 2002) A randomized phase II and pharmacokinetic study of the antisense oligonucleotides ISIS 3521 and ISIS 5132 in patients with hormone-refractory prostate cancer. Clin Cancer Res 8, 2530-2535. Yuen AR, Halsey J, Fisher GA, Holmlund JT, Geary RS, Kwoh TJ et al, (1999) Phase I study of an antisense oligonucleotide to protein kinase c-! (ISIS 3521/CGP 64128A) in patients with cancer. Clin Cancer Res 5, 3357-3363. Yuen A, Advani R, Fisher G, Halsey J, Lum B, Geary R et al, (2000) A phase I/II trial of ISIS 3521, an antisense inhibitor of protein kinase C alpha, combined with carboplatin and paclitaxel in patients with non-small cell lung cancer. Poster presented at, The American Society of Clinical Oncology, New Orleans, LA, May 20-23. Yuen A, Halsey J, Fisher G, Advani R, Moore M, Saleh M et al, (2001) A phase I/II trial of ISIS 3521, an antisense inhibitor of PKC-alpha, with carboplatin and paclitaxel in patients with non-small cell lung cancer (Meeting abstract). Poster presented at, The American Society of Clinical Oncology, San Francisco, CA, May 12-15.

Dr. Susannah E. Motl

244

Cancer Therapy Vol 1, page 245 Cancer Therapy Vol 1, 245-256, 2003.

Activity of chemotherapy and immunotherapy on malignant mesothelioma: a systematic review of the literature with meta-analysis Research Article

Thierry Berghmans1*, Jean-Jacques Lafitte3, Céline Mascaux1, Anne-Pascale Meert1, Marianne Paesmans2 and Jean-Paul Sculier1 1

Service de Médecine Interne et Laboratoire d’Investigation Clinique et d’Oncologie Expérimentale and 2Data Centre, Institut Jules Bordet, Centre des Tumeurs de l’Université Libre de Bruxelles, Belgium and 3Department of Pneumology, CHU Calmette, Lille, France

__________________________________________________________________________________ *Correspondence: Dr Thierry Berghmans, Institut Jules Bordet, Rue Héger-Bordet, 1, 1000 Bruxelles, Belgium; Tel: 322/541.31.11; Fax: 322/534.37.56; e-mail: thierry.berghmans@bordet.be Key Words: chemotherapy, immunotherapy, mesothelioma, quality score, systematic review, meta-analysis Abbreviations: cisplatin CDDP; vinblastine VBL; interferon INF; interleukine 2 IL-2; mitomycin C MMC; doxorubicin Doxo; ifosfamide Ifo cyclophosphamide CPA; bleomycin Bleo; hyaluronidase Hyal; global quality score QS; internal validity IV; external validity EV; response rate RR; confidence interval CI Received: 19 September 2003; Accepted: 11 November 2003; electronically published: November 2003

Summary Malignant mesothelioma is a tumour with increasing incidence, for which treatment remains debatable. Different chemotherapy regimens have been tested in phase II studies. The aim of the present report is to update the results of a previous meta-analysis to identify new chemotherapy regimens which could be selected for future randomised trials. Ninety-five articles corresponding to 100 treatment arms, published between 1983 and 2003, were eligible for the analysis. A qualitative evaluation was performed using the ELCWP methodological quality scale. No statistically significant difference in term of methodological score was found between the positive and potentially positive (upper limit of the 95% confidence interval (CI) for the response rate (RR) > 20%) and negative studies (median: 57.3% versus 56.7%; p = 0.68), allowing us to perform an aggregation of the results of the different studies. We found that the most active combination regimens, in terms of response rate are cisplatin plus doxorubicin (RR 28.5%), gemcitabine (RR 29.8%) or etoposide (RR 27.1%). When single agent therapy is considered, cisplatin seems to be the most active single agent (RR 17.0%). No other endpoints such as survival, toxicity or quality of life could be meta-analysed, due to the lack of data in the publications. Cisplatin plus doxorubicin, gemcitabine or etoposide appear as the most active regimens in the treatment of malignant mesothelioma. These results must be interpreted in the context of the recently published phase III trial demonstrating a significant survival advantage of cisplatin plus pemetrexed on cisplatin monotherapy. previous systematic review of the literature with metaanalysis, we found that cisplatin-based or cisplatin and doxorubicin-based chemotherapy were the most active regimens with respective response rates of 23.2% and 28.3% (Berghmans et al, 2002). Some new agents have been tested the last two years in phase II studies, including gemcitabine (Nowak et al, 2002;van Haarst et al, 2002), taxans (Vorobiof et al, 2002), raltitrexed (Baas et al, 2003;Fizazi et al, 2003;Maisano et al, 2001) or oxaliplatin (Fizazi et al, 2003; Maisano et al, 2001) and the first randomised phase III trial comparing two chemotherapeutic regimens has been published (Vogelzang et al, 2003). In the present report, we update our previous systematic review on the activity of chemotherapy and

I. Introduction The incidence of malignant mesothelioma is expected to rise in the next few years, due to increased asbestos exposure during the last decades (Driscoll et al, 1993). Few treatments have demonstrated activity against this disease. The beneficial survival impact of surgery, pleurectomy or extrapleural pneumonectomy, has never been proven in randomised trial. Only a minority of the patients are eligible for these treatments (Sugarbaker et al, 1991), whose mortality and morbidity can be considerable. The efficacy of radiotherapy is not proven (Ong and Vogelzang, 1996). A majority of the patients are medically treated. Some chemotherapeutic agents such as cisplatin or doxorubicin are considered as potentially useful. In a 245

Berghmans et al: Chemotherapy and immunotherapy on malignant mesothelioma immunotherapy in malignant mesothelioma, in order to identify new cisplatin-based chemotherapy regimens which could be selected for future randomised trials.

III. Results A. Phase II studies 1. Trials characteristics Ninety-five articles, published between 1983 and 2003, met our selection criteria and were eligible for the analysis. Out of these 95 eligible studies, 92 were single arm phase II trials and 3 were randomised phase II trials. For the purpose of this review, each arm of the randomised studies was assessed as an independent trial. In 2 papers, 2 separate phase II trials were reported in the same publication. Thus, 100 «arms», each considered as an independent study, were analysed. They will be further called «studies». In a first analysis, the studies were separated in 4 groups according to the treatment regimen (Table 1). Group 1 (n = 22) corresponded to the trials testing cisplatin but not doxorubicin. Group 2 (n = 9) was composed of the trials investigating doxorubicin without cisplatin. Seven studies, assessing a combination including both cisplatin and doxorubicin, formed Group 3. The last 62 trials, with regimens without cisplatin or doxorubicin, were included in Group 4. Sixty-two studies (62%) used a single agent regimen. The chemotherapy mainly consisted in platinum (n = 32) and/or anthracycline (n = 27) derivatives. In 20 studies, an immunomodulatory agent was used either alone (n = 8) or combined with cisplatin (n = 8) or with other agents (n = 4). Other tested agents and regimens are detailed in Table 1 (4,12-93). Among the 100 eligible studies, 37 were negative, 5 positive and 58 potentially positive in term of antitumoral response, as defined above. For the purpose of the analysis, the potentially positive trials were pooled with the true positive ones and this whole group will be further named as the «positive trials». The total number of patients assessable for response and incorporated in the 100 studies was 2727. Other endpoints have been considered but the lack of data or their presentation precluded to perform meaningful quantitative aggregation. Survival rates were not reported in 18 of the 100 analysed arms. Thirteen studies reported on symptoms evaluation (n = 10) or quality of life (n = 3). Toxicity was only fully described in 46 arms; partial information was available in 44; it was not analysed in 10.

II. Materials and methods The search for prospective published trials relative to the treatment of malignant mesothelioma of pleural or peritoneal origin was performed by consulting the Medline, Health Star and National Cancer Institutes electronic data bases and completed by references found in the papers, in textbooks, in reviews and those known by the investigators. The criteria of eligibility of the articles were the following: to focus only on patients with malignant mesothelioma; to be related to the study of single or combined cytotoxic and/or immunomodulatory agents, administered by systemic or local routes; to be published in English, French or Dutch languages between 1965 and January 2003; to be a prospective single or randomised phase II or phase III trial with a minimum of 14 patients included. If less than 14 patients were included in a prospective phase II trial, the study could be considered as eligible if at least one objective response was observed when targeting a response rate of 20%, according to the Gehan’s design for phase II studies (Gehan EA, 1961). Abstracts were excluded from this analysis because of insufficient data to apply the scoring system and to evaluate the methodological quality of the trial. The methodological qualitative evaluation was performed by a team of 5 medical doctors and 1 biostatistician. Consensual agreement on the scores attributed to each item for each trial was obtained by regular meetings The study quality was assessed according to the information provided in the publication, using the previously published ELCWP quality scale (Berghmans et al, 2002). All items were grouped in ten categories and a global quality score as well as two subscores assessing the internal and external validities of the studies were calculated. For each article, the numbers of eligible patients were recorded by applying the criteria used in ELCWP trials (Sculier et al, 1996) considering toxic death, early death due to cancer or treatment discontinuation due to toxicity as treatment failures. We assumed that a chemotherapeutic agent had a clinical potentially useful activity in a trial if its objective response rate was at least 20%. We considered that a study was negative if the upper limit of the 95% confidence interval (CI) of the response rate was ! 20%. It was considered as positive if the lower limit of the 95% CI was > 20% and as not conclusive but potentially positive if the upper limit of the 95% CI was > 20% but the lower limit < 20%. Descriptive summary statistics were calculated in each category for the distributions of the scores (internal validity, external validity and global score). Normality of the distribution of continuous variables was assessed by a Kolmogorov-Smirnov test. If the distribution was normal, the distribution of these continuous variables according to the levels of a categorical variable were compared by using parametric tests (ANOVA or Student). Otherwise, non parametric tests (Wilcoxon or KruskalWallis) were applied. Relationship between the scores and other continuous variables was assessed by the calculation of Pearson or Spearman correlation coefficients, according to the normality of the distributions of the continuous variables. Confidence intervals for the response rate to the chemotherapeutic regimen were, for consistency, recalculated using the exact binomial distribution. Proportions were compared with chi square tests for homogeneity. All reported p values are two-tailed.

2. Methodological assessment The results of the qualitative methodological evaluation for each trial are given in Table 1. The overall mean and median scores attributed per score subscales are described in Table 2. No statistically significant difference in term of methodological score was found between the positive and negative trials whatever global (median: 57.3% versus 56.7%; p = 0.68), internal (45.8% versus 43.3%; p = 0.58) or external (68.9% versus 71.5%; p = 0.87) validity scores were considered. No statistically significant difference was observed between the 4 groups according to the type of therapeutic regimen (p = 0.42) (Table 3). A significant difference was found according to the method of tumour response assessment (Table 4): studies using radiological techniques as a part or as the whole of the evaluation had better scores than the others 246

Cancer Therapy Vol 1, page 247 Table 1. Treatment regimen, quality scores and response rates with 95% confidence interval (ELCWP) according to treatment group for assessable patients Schedule n pts QS (%) IV (/50) EV (/50) RR (%) 95%CI Group 1 (n = 22) Cisplatin without doxorubicin containing regimens CDDP (Planting et al, 1994)

56.5

19.2

37.3

35.7

7-64.4

CDDP (Markman et al, 1986)

30.9

5.0

25.9

14.3

0-31.6

CDDP (Zidar et al, 1988)

46.1

12.5

33.6

14.3

1.3-27.3

CDDP (Mintzer et al, 1985)

36.9

12.1

24.8

12.5

0-27.8

CDDP/VP16 (Planting et al, 1995)

51.9

15.8

36.1

24.0

5.3-42.7

CDDP/VP16 (Eisenhauer et al, 1988)

44.2

15.8

28.4

11.5

0-25.7

CDDP/VBL (Tsavaris et al, 1994)

56.7

27.1

29.6

25.0

3.5-46.5

CDDP/MMC/VBL (Middleton et al, 1998)

61.7

23.4

38.4

20.5

5.0-33.0

CDDP/5Fluorouracil/Leucovorin/MMC/VP16 (Kasseyet et al, 1999)

61.0

30.0

31.0

37.8

23.0-53.0

CDDP/MMC (Chahinian et al, 1993)

65.0

27.9

37.0

25.7

9.8-41.6

CDDP/MMC/INF"2a (Metintas et al, 1999)

70.0

30.0

40.0

23.3

9.0-37.0

CDDP/MMC/INF"2b (Tansan et al, 1994)

48.6

18.8

29.8

10.5

0-27

CDDP/MMC/INF"/surgery (Hasturk et al, 1996)

48.6

18.8

29.9

0.0

CDDP/INF"2b/tamoxifene (Pass et al, 1995)

63.3

35.0

28.3

19.4

5.1-33.8

CDDP/INF" (Trandafir L et al, 1997)

41.3

11.7

34.5

27.0

10.0-45.0

CDDP/INF"2a (Purohit et al, 1998)

69.0

29.2

39.9

41.7

8.0-67.0

CDDP/INF"2a (Soulie et al, 1996)

67.0

30.0

37.0

40.0

18.8-61.2

CDDP/5 Azacytidine (Samuels et al, 1998)

67.9

31.3

36.3

13.9

0.0-25.0

CDDP/Gemcitabine (Byrne et al, 1999)

81.3

33.8

47.5

47.6

24.0-67.0

CDDP/Gemcitabine (van Haarst et al, 2002)

68.2

27.5

40.7

13.3

3.8-30.7

CDDP/Gemcitabine (Nowak et al, 2002)

75.7

40.0

35.7

32.1

19.5-44.6

CDDP/Irinotecan (Nakano et al, 1999)

76.1

30.0

46.1

40.0

7.0-67.0

Doxo/INF"2a (Upham et al, 1993)

79.5

44.2

35.4

16.0

0-32.4

Doxo/Ifo (Dirix et al, 1994)

59.5

19.2

40.4

31.8

10.1-53.6

Doxo/Ifo (Carmichael et al, 1989)

30.7

5.0

25.7

12.5

0-31.8

Doxo/CPA/Imidazole (Samson et al, 1987)

54.8

28.3

26.5

11.1

0-22.8

Doxo/CPA (Samson et al, 1987)

54.8

28.3

26.5

12.5

0.01-24

Doxo (Sorensen et al, 1985)

19.7

13.3

6.4

0.0

Liposomal doxorubicin (Caelyx) (Baas et al, 2000) Liposomal doxorubicin (Doxil) (Oh et al, 2000)

78.6

37.5

41.1

6.5

0.0-16.0

28.3

3.4

25.0

0.0

Liposomal doxorubicin (Doxil) (Skubitz, 2002)

44.6

13.3

31.3

6.7

2.0-31.9

CDDP/Doxo/MMC (Pennucci et al, 1997)

73.7

30.9

42.9

21.7

0.0-39.0

CDDP/Doxo/MMC/Bleo/Hyal (Breau JL et al, 1993)

35.6

11.7

23.9

44.4

23.8-65

CDDP/Doxo/CPA (Shin et al, 1995)

75.5

33.8

41.7

30.4

9.5-51.4

Group 2 (n = 9) Doxorubicin without cisplatin containing regimens

Group 3 (n = 7) Cisplatin plus doxorubicin containing regimens

247

Berghmans et al: Chemotherapy and immunotherapy on malignant mesothelioma CDDP/Doxo (Henss et al, 1988)

45.1

12.9

32.1

42.1

17.3-66.9

CDDP/Doxo (Ardizzoni et al, 1991)

44.0

17.9

26.1

25.0

5.6-44.4

CDDP/Doxo (Chahinian et al, 1993)

65.0

27.9

37.0

14.3

1.3-27.3

CDDP/Doxo/INF"2b (Parra et al, 2001)

88.6

45.0

43.4

28.6

13.6-43.5

Carboplatin (Mbidde et al, 1986)

31.25

12.5

18.8

11.8

0-30

Carboplatin (Cantwell et al, 1986b)

27.5

5.0

22.5

22.2

0-54.9

Carboplatin (Raghavan et al, 1990)

48.0

15.8

32.1

16.1

1.6-30.7

Carboplatin (Vogelzang et al, 1990)

52.5

16.2

36.3

7.5

0-16.9

Carboplatin/INF"2a (O'Reilly et al, 1999)

72.0

29.2

42.9

6.7

0.0-20.0

Detorubicin (Colbert et al, 1985)

44.8

15.8

28.9

42.9

19.3-66.4

Epirubicin (Mattson et al, 1992)

56.4

22.9

33.5

14.6

3.6-25.6

Epirubicin/Ifo (Magri et al, 1992)

38.6

16.7

22.0

5.9

0-20

Epirubicin/IL-2 (Bretti et al, 1998)

76.5

36.7

38.3

4.8

0.0-14.0

Epirubicin (Magri et al, 1991)

51.5

20.0

31.5

4.8

0-16.3

Liposomal Daunorubicin (Steele et al, 2001)

57.9

21.7

36.3

0.0

Pirarubicin (Kaukel et al, 1990)

53.8

21.7

32.1

8.6

0-19.3

Mitoxantrone (Eisenhauer et al, 1986)

37.9

14.2

23.8

7.1

0-18.5

Mitoxantrone (van Breukelen et al, 1991)

56.3

21.3

35.0

2.5

0-8.6

Menogaril (Hudis and Kelsen, 1992)

39.2

14.2

25.0

4.5

0-15.5

MMC (Bajorin et al, 1987)

28.0

12.5

15.5

21.1

0.1-42

Mitoxantrone/Methotrexate/MMC (Pinto et al, 2001)

68.6

25.0

43.6

31.8

9.0-50.0

Methotrexate/IFN"/IFN#1b (Halme et al, 1999)

72.3

30.9

41.5

26.9

8.0-46.0

Methotrexate (Solheim et al, 1992)

47.5

17.5

30.0

36.7

23.6-49.7

Edatrexate (Kindler et al, 1999)

71.5

34.2

37.3

25.0

5.0-45.0

Edatrexate/Leucovorin (Kindler et al, 1999)

71.5

34.2

37.3

15.8

3.0-29.0

Trimetrexate (Vogelzang et al, 1994)

73.6

32.1

41.5

8.2

0-16.9

Ifo (Andersen et al, 1999)

69.0

30.0

39.0

3.8

0.0-12.0

Ifo (Icli et al, 1996)

44.0

18.3

25.7

20.7

4.2-37.2

Ifo (Falkson et al, 1992)

75.6

35.0

40.6

2.6

0-8.8

Ifo (Zidar et al, 1992)

57.3

22.5

34.8

7.7

0-19.9

CPA (Sorensen et al, 1985)

19.7

13.3

6.4

0.0

5 Azacytidine (Yogelzang et al, 1997)

73.2

29.6

43.6

17.1

4.3-29.8

5 Azacytidine (Dhingra et al, 1991)

55.8

20.0

35.8

0.0

Amsacrine (Falkson et al, 1983)

31.4

7.0

24.4

5.3

0-17.9

Diaziquone (Eagan et al, 1986)

44.8

11.7

33.1

0.0

CB 3717 (Cantwell et al, 1986a)

21.3

2.5

18.8

5.6

0-18.9

Vinorelbine (Steele et al, 2000)

67.3

31.3

36.1

24.1

7.0-41.0

Vindesine (Boutin et al, 1987)

26.8

5.0

21.8

0.0

Vindesine (Kelsen et al, 1983)

42.1

13.8

28.3

5.9

0-20

Vincristine (Martensson and Sorenson, 1989)

38.0

13.8

24.3

0.0

Acivicin (Falkson et al, 1987)

33.9

6.7

27.3

0.0

Group 4 (n = 62) Regimens without cisplatin and doxorubicin

248

Cancer Therapy Vol 1, page 249 5 Fluorouracil (Harvey et al, 1984)

25.8

3.8

21.1

5.0

0-17.1

Etoposide (intravenously) (Sahmoud et al, 1997)

83.7

38.4

45.4

4.3

0.0-11.0

Etoposide (orally) (Sahmoud et al, 1997)

83.7

38.4

45.4

7.3

0.0-16.0

Etoposide (Tammilehto et al, 1994)

45.2

14.6

30.6

5.3

0-17.9

Gemcitabine (Kindler et al, 2001)

79.6

38.4

41.3

0.0

Gemcitabine (van Meerbeeck et al, 1999)

84.8

36.3

48.6

7.4

0.0-19.0

Topotecan (Maksymiuk et al, 1998)

29.0

18.8

39.3

0.0

Docetaxel/Irinotecan (Knuuttila et al, 2000)

68.3

28.4

40.0

0.0

Taxol (Vogelzang et al, 1999)

37.4

10.9

26.6

9.1

0.0-21.0

Taxol (van Meerbeeck et al, 1996)

76.9

37.5

39.4

0.0

Docetaxel (Vorobiof et al, 2002) IL-2 (Astoul et al, 1998)

56.1

25.0

31.1

9.7

0.0-20.1

59.5

25.0

34.5

54.5

27.0-73.0

IL-2 (Castagneto et al, 2001)

57.3

22.5

38.8

22.6

7.0-39.0

IL-2 (Mulatero et al, 2001)

65.5

28.4

37.2

6.9

0.0-17.0

rINF"2b (Ardizzoni et al, 1994)

48.3

20.0

28.3

7.7

0-26

INF"2a (Christmas et al, 1993)

66.1

34.2

32.0

12.0

0-26.7

INF# (Boutin et al, 1991)

59.2

23.3

35.9

31.6

8-55.1

INF$ (Von Hoff et al, 1990)

60.2

23.3

36.9

0.0

INF# (Monnet et al, 2002)

74.4

36.7

37.7

11.8

1.5-36.4

Temozolomide (van Meerbeeck et al, 2002)

76.8

30.0

46.8

3.7

0.1-19.0

Oxaliplatin/raltitrexed (Fizazi et al, 2003)

62.1

18.4

43.6

20.0

10.6-29.4

Oxaliplatin/raltitrexed (Maisano et al, 2001)

49.4

18.4

31.1

45.4

16.7-76.6

Raltitrexed (Baas et al, 2003)

66.3

23.4

42.9

20.8

7.1-42.2

Ranpirnase (Mikulski et al, 2002)

68.4

28.4

40.1

4.9

0.2-9.6

Mycobacterium vaccae (Mendes et al, 2002)

38.4

10.0

28.4

37.5

15.2-64.6

CDDP=cisplatin; VBL=vinblastine; INF= interferon; IL-2= interleukine 2; MMC= mitomycin C; Doxo= doxorubicin; Ifo=ifosfamide; CPA=cyclophosphamide; Bleo=bleomycin; Hyal=hyaluronidase; QS= global quality score; IV=internal validity; EV=external validity; RR=response rate; CI=confidence interval

Table 2. Mean and median scores by categories for all the studies pooled Category (/100) Mean Median

Range

I. Description of the selection criteria for the study

72.2

83.3

0-100

II. Registration modality description

16.3

0.0

0-100

III. Description of work-ups for disease evaluation

43.2

50.0

0-100

IV. Criteria of evaluation description

56.6

50.0

0-100

V. Statistical methods description

33.5

16.7

0-100

Internal validity (/100)

44.4

43.3

5-90

VI. Treatment description

67.1

25-100

VII. Patients characteristics data and analysis

80.0

87.5

22.2-100

VIII. Survival data and analysis

50.3

50.0

0-100

IX. Antitumoral response data and analysis

76.1

78.6

16.7-100

X. Toxicity

62.6

75.0

0-100

External validity (/100)

67.2

69.6

12.8-97.1

Global score (/100)

55.8

57.2

20.1-88.6

249

Berghmans et al: Chemotherapy and immunotherapy on malignant mesothelioma

Table 3. Median quality scores according to 4 treatment groups n studies Global score (%)

Range (%)

Group 1

61.4

30.9-81.3

Group 2

54.8

20.1-78.1

Group 3

63.7

34.8-88.6

Group 4

57.3

20.1-84.8

p = 0.42 Group 1 = trials testing cisplatin but not doxorubicin; Group 2 = trials testing doxorubicin but not cisplatin; Group 3 = trials testing cisplatin and doxorubicin; Group 4 = trials without cisplatin and doxorubicin

Table 4. Median scores according to the method of response assessment Method used (n studies) Global score (%)

Range (%)

A (n = 32)

44.2

21.3-75.6

B (n = 8)

61.7

31.4-79.6

C (n = 60)

63.3

20.1-88.6

p < 0.00003 A = not mentioned; B = standard X-ray; C = Ct scan or presence of a measurable metastasis

Table 5. Response rates according to treatment groups. R/E patients

Response rate (%)

95% confidence interval

Group 1

148/630

23.5

20.2-26.8

Group 2

25/227

11.0

6.9-15.1

Group 3

53/186

28.5

22.0-35.0

Group 4

204/1684

12.1

10.5-13.7 p < 0.001

Group 1 = trials testing cisplatin but not doxorubicin; Group 2 = trials testing doxorubicin but not cisplatin; Group 3 = trials testing cisplatin and doxorubicin; Group 4 = trials without cisplatin and doxorubicin R/E = number of patients responding to the allowed treatment between the number of evaluable patients according to ELCWP criteria

some quality of life/symptoms assessment and the others (p = 0.10).

(p < 0.0003) but were also significantly more recent (p < 0.001). There was a significant quality difference between single and combined agents therapies, with respective median values of 53.8% and 63.5% (p = 0.007) for the global score. Nevertheless, studies assessing polychemotherapy were also more recently published than single agent ones (respective median dates of publication of 1997 and 1992; p = 0.09). A significant correlation with the year of publication, in favour of the most recent trials, was noted as well for the global score (rs = 0.63; p < 0.001) as for internal (rs = 0.57; p < 0.001) and external (rs = 0.63; p< 0.001) validities. A weak but statistically significant correlation was found between the number of patients included in the trial and the methodological assessment, as well for the global (rs = 0.34; p = 0.0009), the internal validity (rs = 0.36; p = 0.0003) and the external validity scores (rs = 0.26; p = 0.01). The repartition of the different methods of response assessment (standard Rx, CT scan or not specified) were similarly distributed among the different treatment groups (p = 0.60). No quality difference was observed between studies reporting on

3. Meta-analysis 3.1. Analysis according to the inclusion of cisplatin and/or doxorubicin The absence of methodological quality difference between the positive and negative studies allowed us to compare the response rates between the 4 groups of trials (Table 5). A significant difference was noted between the 4 types of regimens defined by the presence or not of cisplatin and/or doxorubicin (p < 0.001). Group 3 (with cisplatin and doxorubicin) had a better overall response rate than group 1 (with cisplatin) (28.5% versus 23.5%; p = 0.16), and group 2 (with doxorubicin) (28.5% versus 11.0%; p < 0.0001). Group 1 had a significantly better response rate than group 4 (without cisplatin and without doxorubicin) (23.5% versus 12.1%; p < 0.0001). The difference was statistically significant between groups 1 and 2 (23.5% versus 11.0%; p < 0.0001). No difference was observed between groups 2 and 4 (11.0% versus 12.1%; p = 0.63). Results between cisplatin and carboplatin-containing regimens were significantly 250

Cancer Therapy Vol 1, page 251 different (24.6% versus 11.6%; p = 0.002). The comparison between doxorubicin and 4-epirubicin showed a significant difference in favour of doxorubicin (18.9% versus 9.1%; p = 0.01) but when studies containing cisplatin were withdrawn from the comparison, the difference was no more significant (11.0% versus 9.1%; p = 0.59). Doxorubicin administered in a liposomal form demonstrated no meaningful activity (between 0% and 6.7% response rate). The combined agent regimens had a significantly better response rate than the single agent ones (22.9% versus 11.2%; p < 0.00001). It should be noted that a majority of single agent trials were incorporated in group 4, the group with the lowest response rate. Studies incorporating immunomodulatory agents, alone or in combinations, showed a response rate of 20.2 %. Nevertheless, trials including both cisplatin and interferon showed higher response rates (23.0%) than for interferon alone (13.5%). Interleukin-2 alone seemed more active than interferon alone with a response rate of 25.6%. Other chemotherapeutic agents were generally considered inactive at the exception of raltitrexed and methotrexate. Ifosfamide containing regimens demonstrated a poor activity with response rate of 11.2% as well as taxanes (5.9%) or vinca alkalo誰ds (8.6%), although vinorelbine demonstrated potential usefulness in one study. A response rate of 15.5% was associated with etoposide administration but when cisplatin containing studies were withdrawn from the analysis, VP16 had to be considered

inactive with a response rate of 5.5%. Raltitrexed had some activity with a response rate of 22.9%. Lastly, methotrexate seemed a promising drug with a response rate of 32.7%, needing confirmatory studies (Table 6). 3.2. Comparison of cisplatin-containing regimen among phase II studies In our previous study, we found that cisplatin plus doxorubicin containing regimens had the higher response rate. In the present study, we observed that cisplatin/doxorubicin combination (response rate 28.5%) had the same activity than cisplatin/gemcitabine with respective response rates of 29.8% and 28.5% (p = 0.81). The same observation was made when cisplatin/doxorubicin was compared to the cisplatin/etoposide regimen (27.1%; p = 0.80). No comparison was feasible between cisplatin/doxorubicin and cisplatin/interferon because 2 among the available studies included both doxorubicin and interferon. We compared cisplatin monotherapy with other chemotherapy used as single agent. We found that cisplatin monotherapy was statistically superior in term of response rate (17.0%) to ifosfamide (8.3%; p = 0.05), taxanes (5.9%; p = 0.01), etoposide (5.5%; p = 0.008) and vinca alkalo誰ds, essentially when vinorelbine was not taken into account (1.5%; p = 0.002).

Table 6. Response rates of the principal chemotherapeutic agents and/or combinations used in malignant mesothelioma. Regimen R/E patients Response rate (%) 95% confidence interval Cisplatin

201/816

24.6%

21.7-27.6

Cisplatin (SA)

16/94

17.0%

9.4-24.6

Carboplatin

13/112

11.6%

5.7-17.5

Cisplatin/doxorubicin

53/186

28.5%

22.0-35.0

Cisplatin/gemcitabine

31/104

29.8%

20.0-38.6

Cisplatin/etoposide

26/96

27.1%

18.2-36.0

Cisplatin/interferon

52/226

23.0%

17.5-28.5

Doxorubicin (all studies)

78/413

18.9%

15.1-22.7

4 Epidoxorubicin

10/110

9.1%

3.7-14.5

8/72

11.1%

3.9-18.4

Ifosfamide

20/179

11.2%

6.6-15.8

Ifosfamide (SA)

10/121

8.3%

3.4-13.2

Raltitrexed (all studies)

24/105

22.9%

14.9-30.9

Etoposide (SA)

6/110

5.5%

1.3-9.7

Methotrexate

36/110

32.7%

23.9-41.5

Vincalcalo誰ds

8/93

8.6%

2.9-14.3

Taxanes

6/102

5.9%

1.3-10.5

Interferon/interleukin2

98/484

20.2%

16.7-23.8

Interferon (SA)

12/89

13.5%

6.4-20.6

Interleukin-2 (SA)

21/82

25.6%

16.2-35.0

4 Epidoxorubicin (SA)

SA = single agent; R/E = number of patients responding to the allowed treatment between the number of evaluable patients according to ELCWP criteria

251

Berghmans et al: Chemotherapy and immunotherapy on malignant mesothelioma future, cisplatin plus pemetrexed will probably be considered as the treatment of reference in malignant mesothelioma. Nevertheless, in our meta-analysis, we observed that the combinations of cisplatin and doxorubicin, gemcitabine or etoposide are equally active in terms of response rate which is similar to those obtained with cisplatin plus pemetrexed. As the results of a metaanalysis have only exploratory value, they require confirmation by well conducted prospective trials, comparing these 3 regimens to this new combination in order to determine their possible equivalence on survival. The use of immunomodulatory agents either alone or in combination seems promising. We found in our metaanalysis that cisplatin plus interferon or interleukine-2 have high objective response rates. Nevertheless, the type of immunotherapy (interferon or interleukin), the dosage and the route of administration are heterogeneous. New studies are needed to delineate the exact role of immunotherapy in malignant mesothelioma. Other chemotherapies such as raltitrexed or methotrexate demonstrate some efficacy but these first results need confirmation in further studies. Our results were obtained by aggregation of data obtained in multiple individual phase II trials, including 3 randomised phase II studies. This type of quantitative overview can be the subject of biases related to differences in quality and methodology between the selected studies, namely in patients selection. These biases have been discussed in details in our previous publication (Berghmans et al, 2002). Principally, we compared methodological quality among studies by using the ELCWP methodological assessment scale, specifically designed for phase II studies. We did not find any methodological differences between positive and negative studies, allowing us to compare response rates between groups of studies. Another potential source of biases is the method used to assess tumour response. However, no statistically significant difference in the distribution of the methods of response assessment was observed among the 4 principal groups of studies. In conclusion, this systematic qualitative and quantitative overview of the literature suggests that the most active chemotherapeutic regimen, in term of antitumoral response rate, is the combination of cisplatin and doxorubicin although cisplatin plus gemcitabine or etoposide appears to be equally effective. When single agent therapy is considered, cisplatin seems the best single-agent. These results need to be evaluated in randomised phase III trials, in comparison with the combination of cisplatin and pemetrexed. This regimen is the only combination chemotherapy which has proven its superiority on single agent cisplatin in a randomised comparison.

No statistically significant difference was observed between cisplatin monotherapy and epirubicin (11.1%; p = 0.28), interferon (13.5%; p = 0.16) or interleukin-2 (25.6%; p = 0.51).

B. Phase III randomised trial Pemetrexed (Alimta) is a novel multitargeted antifolate which demonstrates promising activity against malignant mesothelioma. The role of Alimta was assessed in a randomised phase III trial, the only one published at this time (Vogelzang et al, 2003). Survival was the primary endpoint. Four hundred fifty-six patients were randomised between cisplatin monotherapy (75 mg/m2) and cisplatin at the same dosage plus pemetrexed (Alimta; 500 mg/m2), given every 3 weeks. Higher response rate was observed in the combined regimen (41.3% versus 16.7%; p < 0.001). This resulted in longer time to progresion (p = 0.001) and better survival rates. The median survival times for the cisplatin plus Alimta and cisplatin alone regimens were respectively 12.1 months and 9.3 months (p = 0.02). More toxicity was associated with the combination, including grades 3/4 neutropenia, nausea and vomiting, diarrhea and stomatitis. However, among patients taking folate and vitamin B12 supplementation, toxicity was clearly reduced without adversely affecting the efficacy. Some improvements in quality of life and pulmonary function tests were also observed.

IV. Discussion This update of our previous systematic review confirms that the combination of cisplatin and doxorubicin is suggested as one of the most active regimens, in terms of response rate, for the treatment of malignant mesothelioma. Nevertheless, gemcitabine and etoposide, when administered with cisplatin demonstrate similar activity to cisplatin and doxorubicin. When single agent therapy is considered, cisplatin remains the most active agent. Due to lack of data, no other meaningful analysis could be performed on important endpoints such as survival, toxicity or quality of life. The treatment of malignant mesothelioma remains debatable. The role of surgery and radiotherapy is not clear and their impact on survival is not yet proven. Only well selected groups of patients with limited tumour size have been reported, principally in retrospective studies (van Ruth S et al, 2003). Chemotherapy has demonstrated its effectiveness and limitations in phase II studies. No randomised phase III trial has assessed the impact on survival of a chemotherapy regimen versus no active treatment. A recently published phase III trial (Vogelzang et al, 2003) has demonstrated that a combined regimen including pemetrexed and cisplatin is better in terms of response rate and survival than cisplatin alone, which is found the most active monotherapeutic agent in our metaanalysis. Further, the response rate in the cisplatin monotherapy arm (16.7%) of this phase III trial is similar to those found in our meta-analysis (17.0%). In the near

References Andersen MK, Krarup-Hansen A, Martensson G, WintherNielsen H, Thylen A, Damgaard K, Olling S, Wallin J (1999) Ifosfamide in malignant mesothelioma, a phase II study. Lung Cancer 24, 39-43

252

Cancer Therapy Vol 1, page 253 Ardizzoni A, Pennucci MC, Castagneto B, Mariani GL, Cinquegrana A, Magri D, Verna A, Salvati F, Rosso R (1994) Recombinant interferon alpha-2b in the treatment of diffuse malignant pleural mesothelioma. Am J Clin Oncol 17, 80-82 Ardizzoni A, Rosso R, Salvati F, Fusco V, Cinquegrana A, De Palma M, Serrano J, Pennucci MC, Soresi E, Crippa M, (1991) Activity of doxorubicin and cisplatin combination chemotherapy in patients with diffuse malignant pleural mesothelioma. An Italian Lung Cancer Task Force (FONICAP) Phase II study. Cancer 67, 2984-2987 Astoul P, Picat-Joossen D, Viallat JR, Boutin C (1998) Intrapleural administration of interleukin-2 for the treatment of patients with malignant pleural mesothelioma, a Phase II study. Cancer 83, 2099-2104 Baas P, Ardizzoni A, Grossi F, Nackaerts K, Numico G, van Marck E, van d, V, Monetti F, Smid-Geirnaerdt MJ, van Zandwijk N, Debruyne C, Legrand C, Giaccone G (2003) The activity of raltitrexed (Tomudex) in malignant pleural mesothelioma, an EORTC phase II study (08992). Eur J Cancer 39, 353-357 Baas P, van Meerbeeck J, Groen H, Schouwink H, Burgers S, Daamen S, Giaccone G (2000) Caelyx in malignant mesothelioma, a phase II EORTC study. Ann Oncol 11, 697700 Bajorin D, Kelsen D, Mintzer DM (1987) Phase II trial of mitomycin in malignant mesothelioma. Cancer Treat Rep 71, 857-858 Berghmans T, Paesmans M, Lalami Y, Louviaux I, Luce S, Mascaux C, Meert AP, Sculier JP (2002) Activity of chemotherapy and immunotherapy on malignant mesothelioma, a systematic review of the literature with meta-analysis. Lung Cancer 38, 111-121 Boutin C, Irisson M, Guerin JC, Roegel E, Paramelle B, Brambilla C, Jeannin L, Dabouis G, Le Caer H, Viallat JR (1987) Phase II trial of vindesine in malignant pleural mesothelioma. Cancer Treat Rep 71, 205-206 Boutin C, Viallat JR, van Zandwijk N, Douillard JT, Paillard JC, Guerin JC, Mignot P, Migueres J, Varlet F, Jehan A, . (1991) Activity of intrapleural recombinant gamma-interferon in malignant mesothelioma. Cancer 67, 2033-2037 Breau JL, Boaziz C, MorĂ¨re JF, et al (1993) Chemotherapy with cisplatin, adriamycin, bleomycin and mitomycin C, combined with systemic and intrapleural hyaluronidase in stage II and III pleural mesothelioma. Eur Respir Rev 3, 223-225 Bretti S, Berruti A, Dogliotti L, Castagneto B, Bertulli R, Spadaro P, Toscano G, Astorre P, Verusio C, Lionetto R, Bruzzi P, Santoro A (1998) Combined epirubicin and interleukin-2 regimen in the treatment of malignant mesothelioma, a multicenter phase II study of the Italian Group on Rare Tumors. Tumori 84, 558-561 Byrne MJ, Davidson JA, Musk AW, Dewar J, van Hazel G, Buck M, de Klerk NH, Robinson BW (1999) Cisplatin and gemcitabine treatment for malignant mesothelioma, a phase II study. J Clin Oncol 17, 25-30 Cantwell BM, Earnshaw M, Harris AL (1986a) Phase II study of a novel antifolate, N10-propargyl-5,8 dideazafolic acid (CB3717), in malignant mesothelioma. Cancer Treat Rep 70, 1335-1336 Cantwell BM, Franks CR, Harris AL (1986b) A phase II study of the platinum analogues JM8 and JM9 in malignant pleural mesothelioma. Cancer Chemother Pharmacol 18, 286-288 Carmichael J, Cantwell BM, Harris AL (1989) A phase II trial of ifosfamide/mesna with doxorubicin for malignant mesothelioma. Eur J Cancer Clin Oncol 25, 911-912 Castagneto B, Zai S, Mutti L, Lazzaro A, Ridolfi R, Piccolini E, Ardizzoni A, Fumagalli L, Valsuani G, Botta M (2001)

Palliative and therapeutic activity of IL-2 immunotherapy in unresectable malignant pleural mesothelioma with pleural effusion, Results of a phase II study on 31 consecutive patients. Lung Cancer 31, 303-310 Chahinian AP, Antman K, Goutsou M, Corson JM, Suzuki Y, Modeas C, Herndon JE, Aisner J, Ellison RR, Leone L, . (1993) Randomized phase II trial of cisplatin with mitomycin or doxorubicin for malignant mesothelioma by the Cancer and Leukemia Group B. J Clin Oncol 11, 1559-1565 Christmas TI, Manning LS, Garlepp MJ, Musk AW, Robinson BW (1993) Effect of interferon-alpha 2a on malignant mesothelioma. J Interferon Res 13, 9-12 Colbert N, Vannetzel JM, Izrael V, Schlienger M, Milleron B, Blanchon F, Herman D, Akoun G, Roland J, Chatelet F, . (1985) A prospective study of detorubicin in malignant mesothelioma. Cancer 56, 2170-2174 Dhingra HM, Murphy WK, Winn RJ, Raber MN, Hong WK (1991) Phase II trial of 5,6-dihydro-5-azacytidine in pleural malignant mesothelioma. Invest New Drugs 9, 69-72 Dirix LY, van Meerbeeck J, Schrijvers D, Corthouts B, Prove A, van Marck E, Vermeire P, van Oosterom AT (1994) A phase II trial of dose-escalated doxorubicin and ifosfamide/mesna in patients with malignant mesothelioma. Ann Oncol 5, 653655 Driscoll TR, Baker GJ, Daniels S, Lee J, Thompson R, Ferguson DA, Leigh J (1993) Clinical aspects of malignant mesothelioma in Australia. Aust N Z J Med 23, 19-25 Eagan RT, Frytak S, Richardson RL, Creagan ET, Nichols WC (1986) Phase II trial of diaziquone in malignant mesothelioma. Cancer Treat Rep 70, 429 Eisenhauer EA, Evans WK, Murray N, Kocha W, Wierzbicki R, Wilson K (1988) A phase II study of VP-16 and cisplatin in patients with unresectable malignant mesothelioma. An NCI Canada Clinical Trials Group Study. Invest New Drugs 6, 327-329 Eisenhauer EA, Evans WK, Raghavan D, Desmeules MJ, Murray NR, Stuart-Harris R, Wilson KS (1986) Phase II study of mitoxantrone in patients with mesothelioma, a National Cancer Institute of Canada Clinical Trials Group Study. Cancer Treat Rep 70, 1029-1030 Falkson G, Hunt M, Borden EC, Hayes JA, Falkson CI, Smith TJ (1992) An extended phase II trial of ifosfamide plus mesna in malignant mesothelioma. Invest New Drugs 10, 337-343 Falkson G, Vorobiof DA, Lerner HJ (1983) A phase II study of m-AMSA in patients with malignant mesothelioma. Cancer Chemother Pharmacol 11, 94-97 Falkson G, Vorobiof DA, Simson IW, Borden EC (1987) Phase II trial of acivicin in malignant mesothelioma. Cancer Treat Rep 71, 545-546 Fizazi K, Doubre H, Le Chevalier T, Riviere A, Viala J, Daniel C, Robert L, Barthelemy P, Fandi A, Ruffie P (2003) Combination of raltitrexed and oxaliplatin is an active regimen in malignant mesothelioma, results of a phase II study. J Clin Oncol 21, 349-354 Gehan EA (1961) The determination of the number of patients required in a preliminary and follow-up trial of a new chemotherapeutic agent. J Chron Dis 13, 346-353 Halme M, Knuuttila A, Vehmas T, Tammilehto L, Mantyla M, Salo J, Mattson K (1999) High-dose methotrexate in combination with interferons in the treatment of malignant pleural mesothelioma. Br J Cancer 80, 1781-1785 Harvey VJ, Slevin ML, Ponder BA, Blackshaw AJ, Wrigley PF (1984) Chemotherapy of diffuse malignant mesothelioma. Phase II trials of single-agent 5-fluorouracil and adriamycin. Cancer 54, 961-964 Hasturk S, Tastepe I, Unlu M, Cetin G, Baris YI (1996) Combined chemotherapy in pleurectomized malignant pleural mesothelioma patients. J Chemother 8, 159-164

253

Berghmans et al: Chemotherapy and immunotherapy on malignant mesothelioma Henss H, Fiebig HH, Schildge J, Arnold H, Hasse J (1988) Phase-II study with the combination of cisplatin and doxorubicin in advanced malignant mesothelioma of the pleura. Onkologie 11, 118-120 Hudis CA, Kelsen DP (1992) Menogaril in the treatment of malignant mesothelioma, a phase II study. Invest New Drugs 10, 103-106 Icli F, Karaoguz H, Hasturk S, Kurt B, Akbulut H, Dincol D, Demirkazik A, Cay F, Akyar S (1996) Two dose levels of ifosfamide in malignant mesothelioma. Lung Cancer 15, 207-213 Kasseyet S, Astoul P, Boutin C (1999) Results of a phase II trial of combined chemotherapy for patients with diffuse malignant mesothelioma of the pleura. Cancer 85, 17401749 Kaukel E, Koschel G, Gatzemeyer U, Salewski E (1990) A phase II study of pirarubicin in malignant pleural mesothelioma. Cancer 66, 651-654 Kelsen D, Gralla R, Cheng E, Martini N (1983) Vindesine in the treatment of malignant mesothelioma, a phase II study. Cancer Treat Rep 67, 821-822 Kindler HL, Belani CP, Herndon JE, Vogelzang NJ, Suzuki Y, Green MR (1999) Edatrexate (10-ethyl-deaza-aminopterin) (NSC #626715) with or without leucovorin rescue for malignant mesothelioma. Sequential phase II trials by the cancer and leukemia group B. Cancer 86, 1985-1991 Kindler HL, Millard F, Herndon JE, Vogelzang NJ, Suzuki Y, Green MR (2001) Gemcitabine for malignant mesothelioma, A phase II trial by the Cancer and Leukemia Group B. Lung Cancer 31, 311-317 Knuuttila A, Ollikainen T, Halme M, Mali P, Kivisaari L, Linnainmaa K, Jekunen A, Mattson K (2000) Docetaxel and irinotecan (CPT-11) in the treatment of malignant pleural mesothelioma--a feasibility study. Anticancer Drugs 11, 257-261 Magri MD, Foladore S, Veronesi A, Serra C, Nicotra M, Tommasi M, Grandi G, Monfardini S, Bianchi C (1992) Treatment of malignant mesothelioma with epirubicin and ifosfamide, a phase II cooperative study. Ann Oncol 3, 237238 Magri MD, Veronesi A, Foladore S, De Giovanni D, Serra C, Crismancich F, Tuveri G, Nicotra M, Tommasi M, Morassut S, . (1991) Epirubicin in the treatment of malignant mesothelioma, a phase II cooperative study. The NorthEastern Italian Oncology Group (GOCCNE)--Mesothelioma Committee. Tumori 77, 49-51 Maisano R, Caristi N, Toscano G, Aragona M, Spadaro P, Amadio P, Mare M, Zavettieri M, La Torre F (2001) Oxaliplatin and raltitrexed in the treatment of inoperable malignant pleural mesothelioma, results of a pilot study. Tumori 87, 391-393 Maksymiuk AW, Marschke RF, Jr., Tazelaar HD, Grill J, Nair S, Marks RS, Brooks BJ, Mailliard JA, Burton GM, Jett JR (1998) Phase II trial of topotecan for the treatment of mesothelioma. Am J Clin Oncol 21, 610-613 Markman M, Cleary S, Pfeifle C, Howell SB (1986) Cisplatin administered by the intracavitary route as treatment for malignant mesothelioma. Cancer 58, 18-21 Martensson G, Sorenson S (1989) A phase II study of vincristine in malignant mesothelioma--a negative report. Cancer Chemother Pharmacol 24, 133-134 Mattson K, Giaccone G, Kirkpatrick A, Evrard D, Tammilehto L, van Breukelen FJ, Planteydt HT, van Zandwijk N (1992) Epirubicin in malignant mesothelioma, a phase II study of the European Organization for Research and Treatment of Cancer Lung Cancer Cooperative Group. J Clin Oncol 10, 824-828

Mbidde EK, Harland SJ, Calvert AH, Smith IE (1986) Phase II trial of carboplatin (JM8) in treatment of patients with malignant mesothelioma. Cancer Chemother Pharmacol 18, 284-285 Mendes R, O'Brien ME, Mitra A, Norton A, Gregory RK, Padhani AR, Bromelow KV, Winkley AR, Ashley S, Smith IE, Souberbielle BE (2002) Clinical and immunological assessment of Mycobacterium vaccae (SRL172) with chemotherapy in patients with malignant mesothelioma. Br J Cancer 86, 336-341 Metintas M, Ozdemir N, Ucgun I, Elbek O, Kolsuz M, Mutlu S, Metintas S (1999) Cisplatin, mitomycin, and interferonalpha2a combination chemoimmunotherapy in the treatment of diffuse malignant pleural mesothelioma. Chest 116, 391398 Middleton GW, Smith IE, O'Brien ME, Norton A, Hickish T, Priest K, Spencer L, Ashley S (1998) Good symptom relief with palliative MVP (mitomycin-C, vinblastine and cisplatin) chemotherapy in malignant mesothelioma. Ann Oncol 9, 269-273 Mikulski SM, Costanzi JJ, Vogelzang NJ, McCachren S, Taub RN, Chun H, Mittelman A, Panella T, Puccio C, Fine R, Shogen K (2002) Phase II trial of a single weekly intravenous dose of ranpirnase in patients with unresectable malignant mesothelioma. J Clin Oncol 20, 274-281 Mintzer DM, Kelsen D, Frimmer D, Heelan R, Gralla R (1985) Phase II trial of high-dose cisplatin in patients with malignant mesothelioma. Cancer Treat Rep 69, 711-712 Monnet I, Breau JL, Moro D, Lena H, Eymard JC, Menard O, Vuillez JP, Chokri M, Romet-Lemonne JL, Lopez M (2002) Intrapleural infusion of activated macrophages and gammainterferon in malignant pleural mesothelioma, a phase II study. Chest 121, 1921-1927 Mulatero CW, Penson RT, Papamichael D, Gower NH, Evans M, Rudd RM (2001) A phase II study of combined intravenous and subcutaneous interleukin-2 in malignant pleural mesothelioma. Lung Cancer 31, 67-72 Nakano T, Chahinian AP, Shinjo M, Togawa N, Tonomura A, Miyake M, Ninomiya K, Yamamoto T, Higashino K (1999) Cisplatin in combination with irinotecan in the treatment of patients with malignant pleural mesothelioma, a pilot phase II clinical trial and pharmacokinetic profile. Cancer 85, 2375-2384 Nowak AK, Byrne MJ, Williamson R, Ryan G, Segal A, Fielding D, Mitchell P, Musk AW, Robinson BW (2002) A multicentre phase II study of cisplatin and gemcitabine for malignant mesothelioma. Br J Cancer 87, 491-496 O'Reilly EM, Ilson DH, Saltz LB, Heelan R, Martin L, Kelsen DP (1999) A phase II trial of interferon alpha-2a and carboplatin in patients with advanced malignant mesothelioma. Cancer Invest 17, 195-200 Oh Y, Perez-Soler R, Fossella FV, Glisson BS, Kurie J, Walsh GL, Truong M, Shin DM (2000) Phase II study of intravenous Doxil in malignant pleural mesothelioma. Invest New Drugs 18, 243-245 Ong ST, Vogelzang NJ (1996) Chemotherapy in malignant pleural mesothelioma. A review. J Clin Oncol 14, 10071017 Parra HS, Tixi L, Latteri F, Bretti S, Alloisio M, Gravina A, Lionetto R, Bruzzi P, Dani C, Rosso R, Cosso M, Balzarini L, Santoro A, Ardizzoni A (2001) Combined regimen of cisplatin, doxorubicin, and alpha-2b interferon in the treatment of advanced malignant pleural mesothelioma, a Phase II multicenter trial of the Italian Group on Rare Tumors (GITR) and the Italian Lung Cancer Task Force (FONICAP). Cancer 92, 650-656 Pass HW, Temeck BK, Kranda K, Steinberg SM, Pass HI (1995) A phase II trial investigating primary immunochemotherapy

254

Cancer Therapy Vol 1, page 255 for malignant pleural mesothelioma and the feasibility of adjuvant immunochemotherapy after maximal cytoreduction. Ann Surg Oncol 2, 214-220 Pennucci MC, Ardizzoni A, Pronzato P, Fioretti M, Lanfranco C, Verna A, Giorgi G, Vigani A, Frola C, Rosso R (1997) Combined cisplatin, doxorubicin, and mitomycin for the treatment of advanced pleural mesothelioma, a phase II FONICAP trial. Italian Lung Cancer Task Force. Cancer 79, 1897-1902 Pinto C, Marino A, Guaraldi M, Melotti B, Piana E, Martoni A, Pannuti F (2001) Combination chemotherapy with mitoxantrone, methotrexate, and mitomycin (MMM regimen) in malignant pleural mesothelioma, a phase II study. Am J Clin Oncol 24, 143-147 Planting AS, Schellens JH, Goey SH, van der Burg ME, BoerDennert M, Stoter G, Verweij J (1994) Weekly high-dose cisplatin in malignant pleural mesothelioma. Ann Oncol 5, 373-374 Planting AS, van der Burg ME, Goey SH, Schellens JH, van den Bent MJ, Boer-Dennert M, Stoter G, Verweij J (1995) Phase II study of a short course of weekly high-dose cisplatin combined with long-term oral etoposide in pleural mesothelioma. Ann Oncol 6, 613-615 Purohit A, Moreau L, Dietemann A, Seibert R, Pauli G, Wihlm JM, Quoix E (1998) Weekly systemic combination of cisplatin and interferon alpha 2a in diffuse malignant pleural mesothelioma. Lung Cancer 22, 119-125 Raghavan D, Gianoutsos P, Bishop J, Lee J, Young I, Corte P, Bye P, McCaughan B (1990) Phase II trial of carboplatin in the management of malignant mesothelioma. J Clin Oncol 8, 151-154 Sahmoud T, Postmus PE, van Pottelsberghe C, Mattson K, Tammilehto L, Splinter TA, Planting AS, Sutedja T, van Pawel J, van Zandwijk N, Baas P, Roozendaal KJ, Schrijver M, Kirkpatrick A, Van Glabbeke M, Ardizzoni A, Giaccone G (1997) Etoposide in malignant pleural mesothelioma, two phase II trials of the EORTC Lung Cancer Cooperative Group. Eur J Cancer 33, 2211-2215 Samson MK, Wasser LP, Borden EC, Wanebo HJ, Creech RH, Phillips M, Baker LH (1987) Randomized comparison of cyclophosphamide, imidazole carboxamide, and adriamycin versus cyclophosphamide and adriamycin in patients with advanced stage malignant mesothelioma, a Sarcoma Intergroup Study. J Clin Oncol 5, 86-91 Samuels BL, Herndon JE, Harmon DC, Carey R, Aisner J, Corson JM, Suzuki Y, Green MR, Vogelzang NJ (1998) Dihydro-5-azacytidine and cisplatin in the treatment of malignant mesothelioma, a phase II study by the Cancer and Leukemia Group B. Cancer 82, 1578-1584 Sculier JP, Paesmans M, Bureau G, Giner V, Lecomte J, Michel J, Berchier MC, Van Cutsem O, Kustner U, Kroll F, Sergysels R, Mommen P, Klastersky J (1996) Randomized trial comparing induction chemotherapy versus induction chemotherapy followed by maintenance chemotherapy in small-cell lung cancer. European Lung Cancer Working Party. J Clin Oncol 14, 2337-2344 Shin DM, Fossella FV, Umsawasdi T, Murphy WK, Chasen MH, Walsh G, Komaki R, McMurtrey MJ, Hong WK (1995) Prospective study of combination chemotherapy with cyclophosphamide, doxorubicin, and cisplatin for unresectable or metastatic malignant pleural mesothelioma. Cancer 76, 2230-2236 Skubitz KM (2002) Phase II trial of pegylated-liposomal doxorubicin (Doxil) in mesothelioma. Cancer Invest 20, 693-699 Solheim OP, Saeter G, Finnanger AM, Stenwig AE (1992) Highdose methotrexate in the treatment of malignant

mesothelioma of the pleura. A phase II study. Br J Cancer 65, 956-960 Sorensen PG, Bach F, Bork E, Hansen HH (1985) Randomized trial of doxorubicin versus cyclophosphamide in diffuse malignant pleural mesothelioma. Cancer Treat Rep 69, 1431-1432 Soulie P, Ruffie P, Trandafir L, Monnet I, Tardivon A, Terrier P, Cvitkovic E, Le Chevalier T, Armand JP (1996) Combined systemic chemoimmunotherapy in advanced diffuse malignant mesothelioma. Report of a phase I-II study of weekly cisplatin/interferon alfa-2a. J Clin Oncol 14, 878885 Steele JP, O'Doherty CA, Shamash J, Evans MT, Gower NH, Tischkowitz MD, Rudd RM (2001) Phase II trial of liposomal daunorubicin in malignant pleural mesothelioma. Ann Oncol 12, 497-499 Steele JP, Shamash J, Evans MT, Gower NH, Tischkowitz MD, Rudd RM (2000) Phase II study of vinorelbine in patients with malignant pleural mesothelioma. J Clin Oncol 18, 3912-3917 Sugarbaker DJ, Heher EC, Lee TH, Couper G, Mentzer S, Corson JM, Collins JJ, Jr., Shemin R, Pugatch R, Weissman L, . (1991) Extrapleural pneumonectomy, chemotherapy, and radiotherapy in the treatment of diffuse malignant pleural mesothelioma. J Thorac Cardiovasc Surg 102, 10-14 Tammilehto L, Maasilta P, Mantyla M, Salo J, Mattson K (1994) Oral etoposide in the treatment of malignant mesothelioma. A phase II study. Ann Oncol 5, 949-950 Tansan S, Emri S, Selcuk T, Koc Y, Hesketh P, Heeren T, McCaffrey RP, Baris YI (1994) Treatment of malignant pleural mesothelioma with cisplatin, mitomycin C and alpha interferon. Oncology 51, 348-351 Trandafir L, RuffiĂŠ P, Borel C, Monnet I, Soulie P, Adams D, Cvitkovic E, Armand JP (1997) Higher doses of alphainterferon do not increase the activity of the weekly cisplatininterferon combination in advanced malignant mesothelioma. Eur J Cancer 33, 1900-1902 Tsavaris N, Mylonakis N, Karvounis N, Bacoyiannis C, Briasoulis E, Skarlos D, Pavlidis N, Stamatelos G, Kosmidis P (1994) Combination chemotherapy with cisplatinvinblastine in malignant mesothelioma. Lung Cancer 11, 299-303 Upham JW, Musk AW, van Hazel G, Byrne M, Robinson BW (1993) Interferon alpha and doxorubicin in malignant mesothelioma, a phase II study. Aust N Z J Med 23, 683687 van Breukelen FJ, Mattson K, Giaccone G, van Zandwijk N, Planteydt HT, Kirkpatrick A, Dalesio O (1991) Mitoxantrone in malignant pleural mesothelioma, a study by the EORTC Lung Cancer Cooperative Group. Eur J Cancer 27, 16271629 van Haarst JM, Baas P, Manegold C, Schouwink JH, Burgers JA, de Bruin HG, Mooi WJ, van Klaveren RJ, de Jonge MJ, van Meerbeeck JP (2002) Multicentre phase II study of gemcitabine and cisplatin in malignant pleural mesothelioma. Br J Cancer 86, 342-345 van Meerbeeck J, Debruyne C, van Zandwijk N, Postmus PE, Pennucci MC, van Breukelen F, Galdermans D, Groen H, Pinson P, Van Glabbeke M, van Marck E, Giaccone G (1996) Paclitaxel for malignant pleural mesothelioma, a phase II study of the EORTC Lung Cancer Cooperative Group. Br J Cancer 74, 961-963 van Meerbeeck JP, Baas P, Debruyne C, Groen HJ, Manegold C, Ardizzoni A, Gridelli C, van Marck EA, Lentz M, Giaccone G (1999) A Phase II study of gemcitabine in patients with malignant pleural mesothelioma. European Organization for Research and Treatment of Cancer Lung Cancer Cooperative Group. Cancer 85, 2577-2582

255

Berghmans et al: Chemotherapy and immunotherapy on malignant mesothelioma van Meerbeeck JP, Baas P, Debruyne C, Smit EF, van Klaveren RJ, Galdermans D, Lentz MA, Manegold C, Giaccone G (2002) A phase II EORTC study of temozolomide in patients with malignant pleural mesothelioma. Eur J Cancer 38, 779-783 van Ruth S, Baas P, Zoetmulder FA (2003) Surgical treatment of malignant pleural mesothelioma. A review. Chest 123, 551561 Vogelzang NJ, Goutsou M, Corson JM, Suzuki Y, Graziano S, Aisner J, Cooper MR, Coughlin KM, Green MR (1990) Carboplatin in malignant mesothelioma, a phase II study of the Cancer and Leukemia Group B. Cancer Chemother Pharmacol 27, 239-242 Vogelzang NJ, Herndon JE, Miller A, Strauss G, Clamon G, Stewart FM, Aisner J, Lyss A, Cooper MR, Suzuki Y, Green MR (1999) High-dose paclitaxel plus G-CSF for malignant mesothelioma, CALGB phase II study 9234. Ann Oncol 10, 597-600 Vogelzang NJ, Rusthoven JJ, Symanowski J, Denham C, Kaukel E, Ruffie P, Gatzemeyer U, Boyer M, Emri S, Manegold C, Niyikiza C, Paoletti P (2003) Phase III study of pemetrexed in combination with cisplatin versus cisplatin alone in patients with malignant pleural mesothelioma. J Clin Oncol 21, 2636-2644 Vogelzang NJ, Weissman LB, Herndon JE, Antman KH, Cooper MR, Corson JM, Green MR (1994) Trimetrexate in

malignant mesothelioma, A Cancer and Leukemia Group B Phase II study. J Clin Oncol 12, 1436-1442 Von Hoff DD, Metch B, Lucas JG, Balcerzak SP, Grunberg SM, Rivkin SE (1990) Phase II evaluation of recombinant interferon-beta (IFN-beta ser) in patients with diffuse mesothelioma, a Southwest Oncology Group study. J Interferon Res 10, 531-534 Vorobiof DA, Rapoport BL, Chasen MR, Abratt RP, Cronje N, Fourie L, McMichael G, Hacking D (2002) Malignant pleural mesothelioma, a phase II trial with docetaxel. Ann Oncol 13, 412-415 Yogelzang NJ, Herndon JE, Cirrincione C, Harmon DC, Antman KH, Corson JM, Suzuki Y, Citron ML, Green MR (1997) Dihydro-5-azacytidine in malignant mesothelioma. A phase II trial demonstrating activity accompanied by cardiac toxicity. Cancer and Leukemia Group B. Cancer 79, 22372242 Zidar BL, Green S, Pierce HI, Roach RW, Balcerzak SP, Militello L (1988) A phase II evaluation of cisplatin in unresectable diffuse malignant mesothelioma, a Southwest Oncology Group Study. Invest New Drugs 6, 223-226 Zidar BL, Metch B, Balcerzak SP, Pierce HI, Militello L, Keppen MD, Berenberg JL (1992) A phase II evaluation of ifosfamide and mesna in unresectable diffuse malignant mesothelioma. A Southwest Oncology Group study. Cancer 70, 2547-2551

256

Cancer Therapy Vol 1, page 257 Cancer Therapy Vol 1, 257-261, 2003.

Expression of insulin-like growth factors and their receptors in malignant fibrous histiocytoma of soft tissues Research Article

Tetsuji Yamamoto 1*, Toshihiro Akisue1, Tetsuya Nakatani1, Takashi Marui1, Ikuo Fujita2, Keiji Matsumoto2, Toshiaki Hitora1, Teruya Kawamoto1, Keiko Nagira1, Masahiro Kurosaka1 1

Department of Orthopaedic Surgery, Kobe University Graduate School of Medicine, Kobe 650-0017, Japan, 2Department of Orthopaedic Surgery, Hyogo Medical Center for Adults, Akashi 673-0021, Japan

__________________________________________________________________________________ *Correspondence: Tetsuji Yamamoto, M.D., Department of Orthopaedic Surgery, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan; Tel: +81-78-382-5985; Fax: +81-78-351-6944; E-mail: yamatetu@med.kobe-u.ac.jp Key Words: Malignant fibrous histiocytoma, soft tissue, immunohistochemistry, insulin-like growth factor, insulin-like growth factor receptor Abbreviations: insulin-like growth factor (IGF), malignant fibrous histiocytoma (MFH), insulin-like growth factor receptor (IGF-R) Received: 24 September 2003; Accepted: 12 November 2003; electronically published: November 2003

Summary The insulin-like growth factor (IGF) family of ligands and receptors is an important cell growth factor involved in the development and progression of a variety of malignant tumors. Little information is currently available regarding the expression of IGFs and their receptors in soft tissue tumors of a fibrohistiocytic origin. We investigated the expression of IGFs and their receptors in 43 malignant fibrous histiocytoma (MFH) tissue specimens using immunohistochemical techniques. Furthermore, we examined the correlation between the IGF receptor (IGF-R) expression and proliferative activity assessed by MIB-1 immunostaining and mitotic indices. Positive cytoplasmic immunoreactivity for IGF-1 and IGF-2 was identified in tumor cells of all MFHs studied. Positive cytoplasmic immunoreactivity for IGF-1R and IGF-2R was identified in tumor cells of 6 (19%) and 30 (70%) respectively of the MFHs. There was no significant difference in the MIB-1 or mitotic indices between the IGF-1R positive and negative groups. There was no significant difference in the MIB-1 or mitotic indices between the IGF-2R positive and negative groups. The results might indicate that, in most MFHs, any direct autocrine effects of this ligand/receptor system on cell growth regulation are precluded. Further studies on the role of other IGF family members are required to determine the tumor growth mechanism of MFH. tissues of epithelial and mesenchymal origin, and are involved in the promotion of cell growth, differentiation and motility (Cullen et al, 1991; LeRoith and Roberts, 2003). However, little information is currently available on the prevalence and distribution of IGFs and their receptors in soft tissue tumors with a fibrohistiocytic origin, including malignant fibrous histiocytoma (MFH) (Sekyi-Otu et al, 1995). Malignant fibrous histiocytoma is one of the most common soft tissue sarcomas in adult life, and has an aggressive behavior and a high metastatic potential (Enzinger and Weiss, 1995). The aims of the present study were to investigate the endogenous expression of IGF-1, IGF-2 and their receptors in human MFH tissues using immunohistochemical techniques, and discuss its significance in tumor progression. Furthermore, we aimed to examine the correlation between the IGF-Rs

I. Introduction Insulin-like growth factors (IGF) are polypeptide hormones which regulate the cell growth of normal and neoplastic tissues in vivo and in vitro (Zapf et al, 1978; Van Buul-Offers and Van den Brande 1981). IGFs are secreted in the liver and in a variety of other tissues (Froesch and Zapf, 1985). IGF-1 and IGF-2 are structurally related, and both ligands bind with different affinities to the IGF-1 receptor (IGF-1R). In addition, IGFR1 is known to mediate the variable biologic effects of both ligands through a tyrosine kinase activity (Ullrich et al, 1986). IGF-2 binds to the IGF-2 receptor (IGF-2R), but IGF-2 does not bind with high affinity to the IGF-1R. IGF2R is a single transmembrane polypeptide which does not possess tyrosine kinase activity (Morgan et al, 1987). Previous studies have shown that both IGF-1 and IGF-2 are overexpressed in a variety of tumor cell lines and 257

Yamamoto et al: IGF expression in MFH least 500 viable tumor cells were counted. The specimens were evaluated by two observers. The statistical significance of the individual findings and their association indices were evaluated by Mann-Whitney U test. Probability (P) values less than 0.05 were considered to be significant.

expression in MFHs and proliferative activity assessed by mitotic indices and MIB-1 immunohistochemical staining.

II. Materials and methods A. Tissue samples Tissue samples from 43 cases of soft tissue MFH were selected from the files of the pathology departments in the current authors’ institutes. All the specimens were fixed in 10% neutral buffered formalin and embedded in paraffin blocks. There were 21 female and 22 male patients. The patients ranged in age from 17 to 83 years (mean, 61 years). The tumors were located in the upper extremity (n=10), lower extremity (n=28), and in the trunk (n=5). The specimens were obtained from biopsies or resections prior to chemotherapy. Four-micrometer serial sections were prepared for hematoxylin and eosin staining, and for immunohistochemical studies. After evaluating the specimens stained with hematoxylin and eosin, all cases were confirmed to conform to the diagnostic histologic criteria of MFH proposed by Enzinger and Weiss (Enzinger and Weiss, 1995). The specimens were classified based on their histology into 31 spindle-pleomorphic, 8 myxoid, 2 inflammatory, and 2 giant cell MFHs according to Enzinger and Weiss’s classification (Enzinger and Weiss, 1995). In each specimen, the mitotic index was scored by observing 10 high power fields (HPF) of viable tumor tissue areas using a standard light microscope equipped with a 40X objective.

III. Results The results of immunohistochemical staining for IGFs and their receptors are shown in Table 1. Positive cytoplasmic immunoreactivity for IGF-1 and IGF-2 was identified in tumor cells of all 43 MFH cases analyzed (Figure 1). All the MFHs coexpressed both ligands. Most MFHs showed intense and diffuse immunoreactivity for both ligands (IGF-1: 93%, IGF-2: 91%). Most MFHs analyzed (81%) showed negative immunoreactivity for IGF-1R. Only six of the 43 cases (19%) showed focally positive immunoreactivity for IGF-1R, and number of positive tumor cells was very limited. Positive immunoreactivity for IGF-2R was identified in tumor cells of 30 (70%) of the 43 MFHs studied. Coexpression of IGF-1R and IGF-2 was observed in five cases (12%).

B. Immunohistochemistry Immunohistochemical staining was performed on formalinfixed, paraffin-embedded sections by the indirect immunoperoxidase method. Briefly, the sections were deparaffinized with xylene and routinely dehydrated through a series of graded alcohols. Antigen unmasking in the sections was performed by autoclaving pretreatment for 15 min. Following elimination of endogenous peroxidase activity with a 10-min incubation in 3%H2O2, the sections were incubated at 4ÆC overnight with primary antibodies against IGF-2 (monoclonal, 1:50, GenzymeTechne, Minneapolis, MN, USA), IGF-1R (monoclonal, 1:50, Quertett GMBH, Berlin, Germany), and MIB-1 (monoclonal, prediluted, Dako Japan, Japan), or at room temperature for one hour with primary antibody against IGF-1 (monoclonal, 1:50, Upstate Biotechnology, Lake Placid, NY, USA) and IGF-2R (polyclonal, 1:80, Santa Cruz Biotechnology, Santa Cruz, CA, USA). After washing with Triton-X-100/trisbuffered saline (TBS), for IGF-1, IGF-1R and MIB1 immunostaining, the sections were then incubated at room temperature for 40 min with goat antimouse immunoglobulins conjugated to peroxidaselabeled dextran polymer (EnVision+, HRPTM, Dako Japan). For IGF-2 and IGF-2R immunostaining, the sections were developed using the streptavidine-biotin-peroxidase complex technique (Dako LSAB+kit/HRP, Dako Japan). 3,3-diaminobenzidine was used for color development, and the sections were counterstained with hematoxylin. Negative controls were obtained by substituting the primary antibodies with non-immune mouse serum.

C. Evaluation of immunohistochemistry A semi-quantitative system was employed to evaluate the level of antigen expression: immunoreactivity was scored as either negative (0), focal (1+; less than 10% of positive tumor cells), moderate (2+; 10-50% of positive tumor cells), or diffuse (3+; more than 50% of positive tumor cells). The percentage of MIB-1 positive cells (MIB-1 proliferative index) was determined by examining 20 HPFs in representative areas. In each case, at

Figure 1 Tumor cells of MFH show diffusely positive immunoreactivity for IGF-1 (A) and IGF-2 (B) (immunostain, original magnification x 400).

258

Cancer Therapy Vol 1, page 259 Table 1. Expression of IGFs and their receptors in soft tissue MFH staining

IGF-1

IGF-2 IGF-1R number of cases (%) 0 (0%) 37 (81%) 1 (2%) 6 (19%) 3 (7%) 0 (0%) 39 (91%) 0 (0%)

0 0 (0%) 1+ 0 (0%) 2+ 3 (7%) 3+ 40 (93%) Total: n=43 IGF: insulin-like growth factor, MFH: malignant fibrous histiocytoma

IGF-2R 13 (30%) 12 (28%) 7 (16%) 11 (26%)

to those of normal smooth muscle tissues of the uterus (Hoppener et al, 1988; Gloudemans et al, 1990). Xie et al. reported that IGF-1R was detectable by Western blot analysis in 18 of 35 synovial sarcomas examined, and the IGF-1R positive tumors were associated with a high incidence of lung metastasis and a high tumor cell proliferative rate (Xie et al, 1999). Sekyi-Otu et al. evaluated expression of IGF-1R, IGF-1 and IGF-2 in a variety of bone and soft tissue sarcomas by reversetranscription polymerase chain reaction (RT-PCR), and found that IGF-1R, IGF-1 and IGF-2 were expressed in 41%, 79%, and 63% of sarcomas examined, respectively (Sekyi-Out et al, 1995). Roholl et al. showed that most leiomyosarcomas, malignant schwannomas, and synovial sarcomas immunohistochemically expressed IGF-1 (Roholl et al, 1990). Pollak et al. reported that the IGF-1R in human MG-63 osteosarcoma cells and IGF-1 is a potent stimulator of proliferation fot MG-63 cells in vitro (Pollak et al, 1990). Several other investigators also demonstrated expression of IGF-1, IGF-2 and their receptors in many osteosarcoma cell lines and tissues, suggesting that autocrine stimulation might be an important mechanism for stimulation of osteosarcoma proliferation (Blatt et al, 1984; Mohan et al, 1990; Fournier et al, 1993; Burrow et al, 1998). However, there have been only a few reports on the prevalence and distribution of IGFs and their receptors in soft tissue tumors of a fibrohistiocytic origin including MFH. Roholl et al. reported that 10 of 18 MFHs analyzed expressed IGF-1, and suggested that positive immunoreactivity for IGF-1 in the 10 MFHs appeared to be related to the coexpression of smooth muscle actin (Roholl et al, 1990). Sekyi-Otu et al. evaluated five MFHs for the ligands and IGF-1R by RT-PCR and found that four and two of the MFHs studied expressed high levels of IGF-1 and IGF-1R, respectively, but levels of IGF-2 expression were low in all the MFHs, compared with control cell lines (Sekyi-Otu et al, 1995). In the present study, we immunohistochemically examined the expression of IGFs and their receptors in the human MFH tissue specimens. Our data revealed that, of 43 MFH cases studied, all cases showed positive immunoreactivity for both IGF-1 and IGF-2. More than 90% of the MFHs showed intense and diffuse immunoreactivity for both ligands. In contrast, only 19% of the MFHs studied showed positive immunoreactivity for IGF-1R, and staining was weak and focal. There were no significant differences in the MIB-1 indices or mitotic indices between IGF-1R negative and positive groups.

Overall, in the MFH cases analyzed, the MIB-1 proliferative indices ranged from 2.5 to 74% (mean; 26.0). Because all the MFHs expressed both ligands, the cases were divided into two groups: those with the receptors negative and those with the receptors positive. The mean MIB-1 index was 23.5% in the IGF-1R negative cases and 39.7% in the positive cases. The mean MIB-1 index was 18.3% in the IGF-2R negative cases and 29.8% in the positive cases. There were no significant differences in the MIB-1 indices between the IGF-1R or IGF-2R negative and positive cases. Overall, the mitotic indices ranged from one to 37 per 10 HPFs (mean; 8.1). The mean mitotic index was 7.8 in the IGF-1R negative cases and 9.7 in the positive cases. The mean mitotic index was 6.0 in the IGF2R negative cases and 9.0 in the positive cases. There were no significant differences in the mitotic indices between the IGF-1R or IGF-2R negative and positive cases.

IV. Discussion There have been many in vivo and in vitro studies indicating that IGFs regulate a variety of epithelial and mesenchymal cells, and influence the development and progression of human malignant neoplasms (Cullen et al, 1991; LeRoith et al, 1995; Zumkeller et al, 1996). It has been suggested that this receptor/ligand system might play an important role in tumor growth regulation in an autocrine or paracrine manner. Many investigators demonstrated expression of IGFs and their receptors in various tumor tissues and tumor cell lines of mesenchymal origin (Blatt et al, 1984; Burrow et al, 1998; El-Badry et al, 1990; Toretsky et al, 2001; Van der Ven et al, 1997, van Valen et al, 1992; Yun, 1992). Using in situ hybridization, Minniti et al. demonstrated that all embryonal and alveolar rhabdomyosarcoma specimens examined expressed the gene for IGF-2 and this expression was localized to the tumor cells themselves (Minniti et al, 1994). El-Badry et al. showed that most rhabdomyosarcoma tissues express high levels of IGF-2 mRNA and IGF-1R mRNA, and exogenous IGF-2 was able to stimulate cellular motility in rhabdomyosarcoma cell lines (El-Brady et al, 1990). In addition, Stewart et al. found that, in muscle cell lines, autocrine secretion of IGF-2 plays a critical role in stimulating spontaneous myogenic differentiation in vitro (Stewart et al, 1886), while other investigators have found that high levels of IGF-1 RNAs and IGF-2 RNAs were detected in leiomyomas and leiomyosarcomas, compared 259

Yamamoto et al: IGF expression in MFH El-Badry OM, Minniti C, Kohn EC, Houghton PJ, Daughaday WH, Helman LJ (1990) Insulin-like growth factor II acts as an autocrine growth and motility factor in human rhabdomyosarcoma tumors. Cell Growth Differ 1, 325-331. Enzinger FM, Weiss SW (1995) Malignant fibrohistiocytic tumors. In: Soft tissue tumors. (Enzinger FM, Weiss SW, eds) St. Louis, Mosby-Year Book Inc., 351-180. Fournier B, Ferralli JM, Price PA, Schlaeppi JM (1993) Comparison of the effects of insulin-like growth factors-I and -II on the human osteosarcoma cell line OHS-4. J Endocrinol 136, 173-180. Froesch ER, Zapf J (1985) Insulin-like growth factors and insulin: comparative aspects. Diabetologia 28, 485-493. Gloudemans T, Prinsen I, Van Unnik JA, Lips CJ, Den Otter W, Sussenbach JS (1990) Insulin-like growth factor gene expression in human smooth muscle tumors. Cancer Res 50, 6689-6695. Hirschfeld S, Helman L (1994) Diverse roles of insulin-like growth factors in pediatric solid tumors. In Vivo 8, 81-90. Hoppener JW, Mosselman S, Roholl PJ, Lambrechts C, Slebos RJ, de Pagter-Holthuizen P, Lips CJ, Jansz HS, Sussenbach JS (1988) Expression of insulin-like growth factor-I and -II genes in human smooth muscle tumours. EMBO J 7, 13791385. LeRoith D, Roberts CT Jr (2003) The insulin-like growth factor system and cancer. Cancer Lett 195, 127-137. LeRoith D, Werner H, Neuenschwander S, Kalebic T, Helman LJ (1995) The role of the insulin-like growth factor-I receptor in cancer. Ann NY Acad Sci 766, 402-408. Minniti CP, Tsokos M, Newton WA Jr, Helman LJ (1994) Specific expression of insulin-like growth factor-II in rhabdomyosarcoma tumor cells. Am J Clin Pathol 101, 198203. Mohan S, Bautista CM, Herring SJ, Linkhart TA, Baylink DJ (1990) Development of valid methods to measure insulinlike growth factors-I and 窶的I in bone cell-conditioned medium. Endocrinology 126, 2534-2542. Morgan DO, Edman JC, Standring DN, Fried VA, Smith MC, Roth RA, Rutter WJ (1987) Insulin-like growth factor II receptor as a multifunctional binding protein. Nature 329, 301-307. Nakatani T, Marui T, Yamamoto T, Hitora T, Akisue T, Kawamoto T, Nagira K, Fujita I, Matsumoto K, Yoshiya S, Kurosaka M (2003) Expression of stem cell factor and c-kit in human malignant fibrous histiocytoma cell line (TNMY1). Anticancer Res 23, 2329-2333. Pavelic K, Bukovic D, Pavelic J (2002) The role of insulin-like growth factor 2 and its receptors in human tumors. Mol Med 8, 771-780. Pollak MN, Polychronakos C, Richard M (1990) Insulinlike growth factor I: a potent mitogen for human osteogenic sarcoma. J Natl Cancer Inst 82, 301-305. Roberts CT ( 1996) Control of insulin-like growth factor (IGF) action by regulation of IGF-I receptor expression. Endocr J 43 Suppl: 49-55. Roholl PJ, Skottner A, Prinsen I, Lips CJ, Den Otter W, Van Unnik JA (1990) Expression of insulin-like growth factor 1 in sarcomas. Histopathology 16, 455-460. Sekyi-Otu A, Bell RS, Ohashi C, Pollak M, Andrulis IL (1995) Insulin-like growth factor 1 (IGF-1) receptors, IGF-1, and IGF-2 are expressed in primary human sarcomas. Cancer Res 55, 129-134. Stewart CE, James PL, Fant ME, Rotwein P (1996) Overexpression of insulin-like growth factor-II induces accelerated myoblast differentiation. J Cell Physiol 169, 2332.

Most of the actions of both IGF-1 and IGF-2 are mediated by their activation of the IGF-R (Roberts, 1996). These results might preclude the possibility of any direct autocrine effects of IGF-1 or IGF-2 through IGF-1R on the tumor cell growth in most MFHs. Our results showed that IGF-2R was expressed in 70% of the MFHs studied. Recent studies have shown that the IGF-2R has tumor suppression function, while ligand binding to IGF-1R provokes mitogenic and anti-apoptotic effects (Pavelic et al, 2002; LeRoith and Roberts, 2003). Chen et al. reported that decreased expression of IGF-2R promotes growth of breast cancer cells (Chen et al, 2002). However, in the present study, there were no significant differences in the MIB-1 and mitotic indices between IGF2R negative and positive MFH groups. In MFH, there have been some reports on autocrine/paracrine stimulation systems of growth factor receptors by their ligands. It has been suggested that autocrine/paracrine growth stimulation is related to the cell proliferation of MFH through platelet-derived growth factor (PDGF) receptors (Taniuchi et al, 1997; Abdiu et al, 1998). The current authors have found that the transforming growth factor (TGF)-! ligand/receptor system plays an important role in promoting cell proliferation of MFH (unpublished data). Nakatani et al. reported a MFH cell line expressed both stem cell factor (SCF) and c-kit (Nakatani et al, 2003). In summary, we analyzed the expression of IGFs and their receptors in MFH tissue specimens using immunohistochemical techniques. All MFH cases analyzed demonstrated positive immunoreactivity for both ligands but 81% of the cases were negative for IGF-1R. Because most of the actions of both IGF-1 and IGF-2 on promoting cell growth are mediated by their activation of the IGF-R, the results indicate that any direct autocrine effects of this ligand/receptor system on cell growth regulation are precluded in most MFH cases. There was no significant difference of the cell proliferative indices between IGF-1R positive and negative groups. Further studies on the role of other cell growth factor are required to determine the tumor growth of MFH.

References Abdiu A, Walz TM, Nishikawa BK, Wingren S, Larsson SE, Wasteson A (1998) Human malignant fibrous histiocytomas in vitro: growth characteristics and their association with expression of mRNA for platelet-derived growth factor, transforming growth factor-alpha and their receptors. Eur J Cancer 34, 2094-2100. Blatt J, White C, Dienes S, Friedman H, Foley TP Jr (1984) Production of an insulin-like growth factor by osteosarcoma. Biochem Biophys Res Commun 123, 373-376. Burrow S, Andrulis IL, Pollak M, Bell RS (1998) Expression of insulin-like growth factor receptor, IGF-1, and IGF-2 in primary and metastatic osteosarcoma. J Surg Oncol 69, 2127. Chen Z, Ge Y, Landman N, Kang JX ( 2002) Decreased expression of the mannose 6-phosphate/insulin-like growth factor-II receptor promotes growth of human breast cancer cells. BMC Cancer 2, 18. Cullen KJ, Yee D, Rosen N (1991) Insulinlike growth factors in human malignancy. Cancer Invest 9, 443-454.

260

Cancer Therapy Vol 1, page 261 Taniuchi K, Yamada Y, Nonomura A, Takehara K (1997) Immunohistochemical analysis of platelet-derived growth factor and its receptors in fibrohistiocytic tumors. J Cutan Pathol 24, 393-397. Toretsky JA, Steinberg SM, Thakar M, Counts D, Pironis B, Parente C, Eskenazi A, Helman L, Wexler LH (2001) Insulin-like growth factor type 1 (IGF-1) and IGF binding protein-3 in patients with Ewing sarcoma family of tumors. Cancer 92, 2941-2947. Ullrich A, Gray A, Tam AW, Yang-Feng T, Tsubokawa M, Collins C, Henzel W, Le Bon T, Kathuria S, Chen E, et al. (1986) Insulin-like growth factor I receptor primary structure: comparison with insulin receptor suggests structural determinants that define functional specificity. EMBO J 5, 2503-2512. van Buul-Offers S, Van den Brande JL (1981) The growth of different organs of normal and dwarfed Snell mice, before and during growth hormone therapy. Acta Endocrinol (Copenh) 96, 46-58. Van der Ven LT, Roholl PJ, Gloudemans T, Van Buul-Offers SC, Welters MJ, Bladergroen BA, Faber JA, Sussenbach JS, Den Otter W (1997) Expression of insulin-like growth factors (IGFs), their receptors and IGF binding protein-3 in normal, benign and malignant smooth muscle tissues. Br J Cancer 75, 1631-1640. van Valen F, Winkelmann W, Jurgens H (1992) Type I and type II insulin-like growth factor receptors and their function in human Ewing's sarcoma cells. J Cancer Res Clin Oncol 118,269-275.

Xie Y, Skytting B, Nilsson G, Brodin B, Larsson O (1999) Expression of insulin-like growth factor-1 receptor in synovial sarcoma: association with an aggressive phenotype. Cancer Res 59, 3588-3591. Yun K (1992) A new marker for rhabdomyosarcoma. Insulin-like growth factor II. Lab Invest 67, 653-664. Zapf J, Schoenle E, Froesch ER (1978) Insulin-like growth factors I and II: some biological actions and receptor binding characteristics of two purified constituents of nonsuppressible insulin-like activity of human serum. Eur J Biochem 87, 285-296. Zumkeller W, Groth O, Commentz J (1996) Regulation of insulin-like growth factors and IGF-binding proteins in bone tumours. Growth Regul 6, 10-15.

Dr. Tetsuji Yamamoto

261

Yamamoto et al: IGF expression in MFH

262

Cancer Therapy Vol 1, page 263 Cancer Therapy Vol 1, 263-268, 2003.

Ethical, cultural and religious aspects of hereditary cancer in Jewish communities Review Article Mark Levin Lincoln Medical Center, 234 Maria de Hostos Blvd., Bronx, NY 10451, USA

__________________________________________________________________________________ *Correspondence: Mark Levin, MD, Chief, Division of Hematology and Oncology, Associate Director of the Cancer Center, Lincoln Medical Center, 234 Maria de Hostos Blvd., Bronx, NY 10451, USA; Tel: (845) 426 – 5346; e-mail: mlevinmd@aol.com Key Words: screening, breast cancer, Judaism, bio-ethics, BRCAI and II, genomic medicine Received: 28 July 2003; Accepted: 2 September 2003; electronically published: September 2003

Summary Acceptance and compliance with screening and genetic programs for genetic illness depends crucially on the compatibility and fit of their design with the social, cultural and religious concerns and mores of target communities. As a case in point, genetic screening programs that are currently in use within Jewish populations are considered on the background of ethical and religious concerns. Implications to design of programs for surveillance and screening of hereditary cancer syndromes are discussed. that would be accepted and internalized by the communities that it would benefit. The hope is that the issues raised by this paper may serve to crystallize points of concern in other communities and groups at risk.

I. Introduction The recently defined ability to identify patients and families genetically at increased risk for developing specific cancers has important ramification for ethnic and religious communities composed of individuals with higher risk of carrying the offending alleles. The effects on a community’s self-image, the potential for stigmatization of healthy disease carriers as unfit marriage prospects, and the impact on traditional patterns of behavior in the sphere of matchmaking and marriage are poorly understood but are of potentially great import to the design of screening and surveillance programs. The stresses will likely be accentuated as the genomic revolution makes personal genetic profiles commercially available in the near future. Regrettably, these issues have so far remained unexplored, yet they will affect acceptance of the scientific advances and the milieu in which medical treatment will be offered or provided. Self referral to screening, acceptance of early diagnosis and prevention programs, and maintaining communal and organizational support for population based genetic research is crucially dependent on exploring and defining these issues. What follows is an exploration of the impact of genetic knowledge in the sphere of hereditary cancer on the Jewish community, as a case in point. BRCA associated cancers represent an instructive example in-as-far as their impact on families and communities at risk. It is particularly important to bring together the scientific and social/ ethical issues and investigate how they interact and affect screening and surveillance for cancer. After all, a program rejected by the very community that it attempts to help will be of little practical use. The issues that concern us in this paper are especially those issues that would impact on the design and formulation of a surveillance and screening program

II. The Background: genomics and the Jews

Genetics,

The “Jewish” genetic illnesses can be roughly divided or assigned into three groups. It is estimated that 1 in 4 Ashkenazi Jews carries one or another genetic mutation (Levin, 1999), In itself, this is not unusual in historically interbreeding populations; however, these facts interact poignantly and differently than they do, say in Iceland, with specific social, political and communal concerns. First, the Jewish populations, especially those of Eastern European origin, carry genes for certain genetic diseases at a rate much higher than the general population. These include the recessive Canavan Disease, Gaucher Disease, Tay-Sachs, Familial Dysautonomia, Bloom’s Syndrome, Mucolipidosis IV, Torsion Dystonia, Fanconi Anemia and Nieman-Pick Syndrome. These diseases affect primarily children, can be diagnosed in the carrier state in the unaffected heterozygotes (who carry the gene and can pass it on to their children) and can be prevented through early detection of carriers and, in certain cases, via prenatal testing. The strategies for detection of these conditions have been uniformally supported and wellaccepted by the Jewish community and grass-roots screening programs have been designed and implemented. The second group includes conditions equally common in Jews and non-Jews, such as Down’s

263

Levin: Hereditary cancer in Jewish communities Syndrome, Cystic Fibrosis, and those that represent common condition for which only probabilities of development can be currently predicted. As an example or the latter group, genetic make-up can predict whether an individual has a 5% or 40% risk of developing heart disease or diabetes. The interaction of poly-genic factors that determine such risk in populations is now popularly termed genomics. The third group of illnesses includes those that increase the risk of serious conditions later in life but do not guarantee that illness will develop. Screening, surveillance and prevention strategies for this group are being refined but have already shown promise. BRCA associated cancers, while also affecting certain other ethnic groups, typify this kind of condition. The Jewish community is at a particular risk; it is estimated that some 2.5% of Jewish women of Ashkenazi (Eastern and Central European) origin carry one of the BRCA genes (Tonin et al, 1995; Moslehi et al, 2000), and one in ten Jewish women with breast cancers is a BRCA carrier while almost 40% of Jewish ovarian cancer victims carry this gene. (Tonin et al, 1996) Women with the BRCA I and II mutations are thought to have a lifetime risk of developing breast cancer of up to 85%. The incidence risk rises after age 50, with BRCA II carriers lagging a few years behind in age as compared to BRCA I carriers. Those with BRCA I have an approximately 49% lifetime risk of developing ovarian cancer with risk beginning in lower 30s and rising thereafter. For BRCA II mutation the lifetime risk is approximately 20%, with incidence mostly after age 40 and rising sharply after age 50; incidence rates of both ovarian and breast cancer do vary in different reports (Thompson and Easton, 2001). Parity appears to increase breast cancer risk in mutation carriers, at least in some surveillance studies, inverse to the usual relation of parity and risk in the general population. Similarly use of oral contraceptive use increases risk in some reports among women at high risk but may decrease it in BRCA carriers (Narod et al, 1998; Warner, 2003). As in general, hereditary cancers ultimately affect a large proportion of affected individuals and include familial breast, prostate and ovarian cancer and a type of colon cancer. These cancers tend to occur at earlier ages and strike multiple members of families. These devastating effects on individuals and families can be prevented or at least ameliorated through surveillance or prevention strategies. Unlike the previously discussed groups of disorders, these conditions present unique and specific challenges. This paper will specifically focus on this group of conditions. Traditionally, the Jewish community has supported and encouraged premarital genetic testing for the conditions in the first group; however, it realized more than 20 years ago that the existing screening programs, though ultimately screening more than a million people (Kaback et al, 1992), did not address some important communal and religious concerns. Foremost among these were concern for privacy, confidentiality and the impact on the traditional courting and marriage patterns in the

Orthodox communities. Rabbi M. Feinstein, the leading expert on religious law in the United States, laid the following guidelines in a 1974 responsum: “it is advisable for one preparing to be married, to have himself tested. It is also proper to publicize the fact…that such a test is available. It is clear that absolute secrecy must be maintained to prevent anyone form learning the results of such a test performed on another. The physician must not reveal these to anyone…these tests should be performed in private”. Encouraged by these guidelines, a grass root organization was formed in 1974; by 1997, it has screened 80.000.00 individuals for Tay-Sachs, Canavan and Cystic fibrosis. Currently, anonymous screening for 10 conditions, most recently including familial dysautonomia is available. The program has been immensely successful essentially wiping out Tay-Sachs disease in the New York metropolitan area. The details of this program and its design have been well described 1. One must, however, realize that this program was designed for recessive conditions, ones that can be easily identified, with risk well quantified and with the goal of preventing marriage between carriers. As designed, it is not suitable for BRCA related cancers or other variable penetrance inherited cancer syndromes that remain a significant challenge for organized Jewish communities. The very anonymity of this program makes it a poor vehicle for screening for complex conditions with possible but not certain onset of symptoms at a far-removed future date and for which a variety of interventions is available.

III. Approach to woman with a diagnosed BRCA mutation The options for a woman with a diagnosed BRCA mutation include five potential courses of action: 1. Doing nothing. This course of action has in the past been advocated by some community activists, primarily for its purported benefits in allaying individual and group anxiety. However, as new options for early detection and potential curative intervention have developed, this option has become much less attractive. 2. Surveillance. To better define terms that are used in this field – screening refers to low or average risk population while surveillance is the term applied to high risk groups. For ovarian cancer, we know little securely about screening in high risk populations because screening has not yet been proven to reduce mortality in the general population. Two randomized studies that utilized CA125 screening in combination with trans-vaginal ultrasound failed to show benefit in the general population (Rosenthal and Jacobs, 1998), In addition, there are no randomized studies in BRCA carriers. Unlike the situation in breast cancer screening, where an over aggressive screening strategy leads to more unnecessary biopsies, false positives in ovarian cancer screening result not only in a biopsy but often in a laparotomy (abdominal surgery) and significant morbidity. Observational studies in this population have led some to recommend trans-vaginal ultrasound with color flow Doppler and serum CA125 264

Cancer Therapy Vol 1, page 265 measurements once or twice yearly starting at age 30 (Fishman et al, 2003). Clearly, an ability detect pre-malignant mammary changes in this population would be of great benefit and may enable avoidance of use or, at very least, wiser and better tailored use of prophylactic mastectomy and/ or oophorectomy or timely initiation of chemoprevention with tamoxifen. Although these modalities can markedly reduce the risk, it remains unacceptably high, reinforcing the need for more effective surveillance options. Many women refuse prophylactic surgery out of concern for side effects, because cancer development is not inevitable, curability of breast cancer when detected early, and their faith in development of new, less invasive options in the future. As an alternative to prophylactic mastectomy, surveillance can only be justified if it enables detection at a very early stage, such as T1a, b No (cure rate of 90%), or DCIS(99% survival rate). If the risk of dieing form breast cancer overall is 20%, that with surveillance should be no greater than 6%; 3% if tamoxifen is a part of the prevention regimen. On the other hand, most BRCA carriers develop cancer at a younger age, potentially affecting more years of life (Narod et al, 1998). The current recommendations for surveillance in high risk population by the National Cancer Network consist of breast self examination (BSE) starting at age 18, clinical breast exam by a health care professional at age 25 and annual mammography after 25 years of age (Daly et al, 2002). It must be noted, however, that two large screening studies of women at average risk, the Shanghai and the St. Petersburg study that included BSE and CBE respectively, did not reveal an advantage in terms of breast cancer mortality (Thomas et al, 2002; Semiglazov et al, 1999). Thus breast exams may not be a very useful or effective component of surveillance approaches. Prospective follow-up studies of women with BRCA mutations during surveillance reveal that cancers tend to be diagnosed at sizes greater than 1 cm or with lymph node positivity. Neither mammography nor ultrasound appear to fulfill the criteria for effectiveness set forth; earlier and better methods are needed (Kolb et al, 2002). Mammography usefulness is vitiated by the wellappreciated clinical fact that it is less sensitive in young women with denser breasts. Several studies suggest that BRCA related cancers are less mammographically detectable because of fewer diffuse calcifications, and less tissue distortion; they tend to have a fleshy border and less distortion effect on the surrounding tissue. In surveillance studies of BRCA carriers, cancers have tended to be detected in between screening visits. In other words, they may appear and grow rapidly and not be detectable at set intervals. Other cancers that have been associated with BRCA mutations are prostate, pancreatic, melanoma and buccal cancers; no screening recommendations have been published for these diseases. Magnetic Resonance Imaging (MRI) is a potentially useful modality for screening. MRI presents certain advantages as a screening tool for it does not use ionizing radiation and does not require breast compression. On the

other hand, it has a lower sensitivity for DCIS, it is expensive, and biopsies under MRI are technically difficult. Some 5-10% of the women require sedation due to claustrophobia to be able to tolerate the MRI procedure. Nevertheless, the clinical advantages are real and there is great interest in using this modality for screening or surveillance (Kuhl et al, 2000). Two recent reports at the American Society of Clinical Oncology meeting in 2003, have presented encouraging data in this regard (Kuhle and Krieg, 2003). An alternative strategy focuses on methods that aim to obtain breast tissue for a pathological evaluation. The goal is to detect pre-malignant change that may trigger prophylactic interventions or to detect very early cancers. Since the vast majority of BRCA related cancers arise in the ductal system of the breast, nipple aspiration(NA) and/or ductal lavalge(DL) appear to be reasonable approaches. In addition, periareolar fine needle aspiration (FNA) has been extensively studied (Fabian and Kimler, 2001; Dooley et al, 2001) Methods being explored for application to NA and DL specimens are proteomics, hormone levels, detection of methylation abnormalities, proliferation indices and estrogen hormone expression. Hopefully, these will farther increase our ability to detect incipient malignant change or to detect such change early in women at high risk for breast cancer. We will then be able to intervene at the right time and with the right therapy. 3. Prophylactic tamoxifen A case control study has demonstrated effectiveness of prophylactic Tamoxifen for breast cancer prevention in BRCA carriers (Narod et al, 2000); however, a subset analyses of the large prospective Breast Cancer Prevention Trial (NSABP-P2) failed to confirm these results in subset analyses of women with BRCA mutation (King et al, 2001). The evidence is likewise mixed in terms of the ability of oral contraceptives to prevent ovarian cancer risk in BRCA carriers (Modan et al, 2001) One study has raises an intriguing notion that tubal ligation may in some way reduce cancer risk among BRCA heterozygites (Narod et al, 2001). 4. Prophylactic mastectomy Prophylactic mastectomy has long been considered an effective option for women at higher risk of breast cancer. It does appear to reduce risk substantially but does not remove all breast tissue and breast cancers have been reported to occur after prophylactic mastectomies (Hartmann et al, 1999, 2001). 5. Prophylactic oophorectomy Prophylactic oophorectomy results in markedly decreased estrogen levels and is an equivalent of menopause. As such, it may be protective of breast cancer (Kauff et al, 2002; Rebbeck et al, 2002) while also completely obviating the risk of ovarian cancer (Rebbeck et al, 1999). BRCA related breast and ovarian cancers represent a significant problem for the health and well-being of Jewish communities. While several effective options currently exist, no preferred option has emerged to 265

Levin: Hereditary cancer in Jewish communities universal acceptance. Surveillance strategies appear to represent a potentially appealing alternative as they promise to decrease the incidence of breast and ovarian cancers while leaving the responsibility for prevention in the patients’ hands, at the same time, avoiding morbidity of prophylactic surgery in the here and now. Unfortunately, there is no consensus as to how survaeillance should be marketed or promoted. As a community we could certainly benefit from more discussion and consideration of ethical and religious aspects of difficult decision making in the environment of lack of certainty and rapid scientific progress. Acceptance of surveillance and screening options will certainly be affected by their design and sensitivity to community concerns. The solution may well ultimately lie in development of better surveillance options and new pharmacological interventions to reduce risk without causing significant morbidity and design of programs organic to the mores and lifestyle patterns of Jewish communities.

frequently hears the sentiment that the exemplary cooperation of the Jewish community with genetic researchers has exposed it to the danger of stigmatization as a community of “sick” individuals and that it, in some way and in some minds, may validate Nazi claim on racial purity (Nelson, 1998). Needless to say, that is not the outcome that individual Jews or community leaders would like to see. This concern has been expressed on both the local and national level (Lehrman, 1997). The United Synagogue, the body of Conservative Judaism in the USA, passed a resolution in 1999 stating that concern “about discrimination is currently dissuading members of the Jewish community and other racial/ ethnic groups from participating in potentially important research and diagnostic projects” and urged inclusion of comprehensive genetic counseling and informed consent into such programs (www.uscj.org/scripts/usjc/paper/Article.as?ArticleID+67 3).

V. Stigma and the Jews The concept of stigma as a key-determinant of individual behavior has been gaining currency in healthcare delivery research and policy. Eric Gorfman has pioneered the use of this concept to understand how individual and communities respond to “culturally inacceptable” conditions, traits, attributes or behavior (Gorfman, 1963). Much investigation has confirmed the essential role of the concept of “spoilt identity” in interaction with membership of a despised or persecuted group to eventuate in compensatory mechanism and the use of irony, concealment or defiance by individuals in the affected group to minimize and lessen the psychological impact of stigmatization. It has become apparent that stigma functions not only on the level of an individual also in the settings of kinship, family and community. Numerous reports have demonstrated that concealment of a disability or disease is a widespread strategy that often leads to serious consequences for the affected individuals, their families and marital partners, and the population as a whole. Stigmas often influence social policy, prioritization of research resources and access to healthcare. Fears of contagion often lead to state sponsored denial of basic rights. “Discourses on stigma are deeply implicated in the fault lines of racism, sexism and other discrimination (www.stigmaconference.nih.gov/FinalDasPaper.htm) Neither is such concern misplaced. It wasn’t that long ago that a twice Nobel laureate suggested in an article in the UCLA Law Review that “…there should be tattoed on the forehead of every young person a symbol showing possession of the sickle cell gene or whatever similar gene…If this was done, two young people carrying the same seriously defective gene in single dose would recognize the situation at first sight and would refrain form falling in love with one another.” (Pauling, 1968) It would surprise no one that the Jewish community is particularly sensitive to issues of stigmatization, eugenics and genetic discrimination. After all, tattoing a symbol on a forehead is not that different than legislating a yellow star on one’s garment; as recent subjects of Nazi eugenic pseudo-science, Jews remain deeply troubled by

IV. The impact of BRCA cancers on the Jewish communities Traditionally, the Jewish community has enthusiastically welcomed and participated in mass screenings and genetic research. Unlike the AfricanAmerican or American Indian community that essentially rejected community based screening strategies, Jews in major metropolitan centers in the United States provided organizational and financial support to TaySachs screening and other screening programs. Screening efforts have often been led by members of the community in academic and political positions. Levels of support for genetic testing remain high. A recent study found that the majority of Jewish women in Boston would agree to undergo BRCA testing, if offered. A minority of women (17%) in this study expressed concern or discomfort with Jews being singled out to offer BRCA testing. Most women, however, believed there were scientific reasons for testing Jews (71%), and only 5% of women felt that research that focused on Jews was bad for Jews as a group. Increased concern about genetic discrimination, however, was associated with women who were highly educated. Forty percent of women surveyed were interested in BRCA1/2 testing, 40% were not interested, and 20% were uncertain about whether they would obtain BRCA1/2 testing (Lehmann et al, 2002). In general, women from high- risk families who here already diagnosed with breast or ovarian cancer have a very high rate of agreement for BRCA testing of 87% (Meijers-Hejboer et al, 2003). These attitudes toward testing reflect acceptance in the communities at risk. As recently as 1999, The Women of Reform Judaism passed a resolution urging more genetic screening and counseling for recessive genetic disorders. (rj.org/wrj/reso/completehealth.html) More recently, however, with the description of BRCA associated cancers and the identification of familial non-polyposis colon cancer mutation at higher rates in persons of Eastern European Jewish origin, a backlash has began to develop in some segments of the Jewish community. One 266

Cancer Therapy Vol 1, page 267 population registries, ethnic demarcation policies, or population control strategies. Most of all, any suggestion that they, as a people, carry “defective” genes, will be viscerally resisted as an echo of Nazi propaganda. The fact that many other populations carry their own genetic illnesses does not carry currency with Anti-Semites. Although time and tolerance has began to heal wounds, they remain fairly close to the surface. As a community, Jews will be loath to embrace any screening strategy that partakes of or suggests above notions.

any participant in the process; neither functionaries nor participants in screening. The program codes each participant with a number which is provided solely to the participant. When a marriage is contemplated, the two individuals call the program anonymously and provide their codes and these are matched. If both are carriers of the same disease, they are told that they are not “compatible’; no specific diagnostic information is provided. Thus neither side knows who is “ at fault” and can go on to consider other partners in good conscience. This process is repeated with each potential partner. Dor Yesharim markets its services as most appropriate early in relationship, before significant emotional entanglement is likely to have developed. In addition, the program sponsors annual drives aimed at graduating classes of religious schools and seminaries; thus, building large databases of participant codes. In consequence, anxiety is minimized and privacy is assured. Unfortunately, what works for a recessive and incurable conditions, does not work well for a disease with variable penetrance or expression or for one that, if identified, can be prevented or treated. Can one inform participants who carry a gene for the eminently treateable Gaucher disease that they are “not compatible” and leave it at that? How about a BRCA carrier? Is the screening program under an obligation to provide follow-up counseling and referral to treatment? How does on counsel an individual who finds himself repeatedly “incompatible” and whose responsibility is it? The ethical and moral issues are staggering. Do we break the code to inform carriers of cancer risk or do we lead them through the imperfect options for surveillance or prevention? What are the costs in terms of resultant anxiety, broken engagements, stigmatization of prospective marriage partners and the cost to the community? Clearly the Dor Yesharim model does not suffice for the much more complex situations of inherited pre-dispositions for cancer and other dominant diseases and a different approach must be identified and implemented in order to be accepted by the community. In fact, the newly reported association between Fanconi’s anemia, a condition for which Dor Yesharim tests, and BRCA related cancers presents this program with an immediate ethical quandary (Venkitaraman, 2003). Are there novel surveillance and screening strategies that can satisfy the community’s concern about confidentiality, avoid stigmatization, and become widely accepted while providing the kind of robust reduction in disease incidence and impact that one expects from a first class screening methodology (Khoury et al, 2003)? The experience of the past three decades has shown us that screening or surveillance program will only be accepted by a community if they are sensitive to that community’s cultural and religious/ethical concerns, supported by community’s activists and opinion leaders, and enthusiastically carried into the community by its members. No program can accomplish this goal if it does not go through the time consuming but crucial process of consultation, consensus building and internal marketing. Some steps to begin this conversation have already been taken in the form of symposia, community events and

VI. Communal responses Jewish communities have been slow to respond to the new ethical challenges in an organized and planned fashion; to a large degree this has been due to fragmentation along religious, ethnic and national lines. In the Unites States as well as in Israel, there are religious and non-religious Jews, Orthodox of various gradations and shadings, Reform and Conservatives; there are immigrants and natives, those originating from Europe, those originating from the Middle East and so on. However, it is possible to characterize the responses of the most insular and therefore most homogenous populations – the Chassidic and other ultra-orthodox groups. As the most rapidly growing sub-group, these communities in many ways define responses that influence and impact other religious and cultural Jewish populations; in addition, with average of 6.4 children per family they meet and tackle reproductive, genetic and related social issues to a greater extent than any other Jewish population. That is not to say that the description that follows is universally applicable; however, it is characteristic of an increasing and easily identifiable population that is concentrated in major metropolitan centers and serves as the most easily identifiable subject for genetic investigation and screening.

VII. Cultural and religious correlates of attitudes to genetic screening Matters of genetics and family health are amply discussed in the traditional Jewish sources. As a religious duty, procreation assumes a duty to marry wisely and to avoid spouses with known genetic illness so as to improve and support the resulting progeny (Rosner, 1988). As a practical matter, matches in this insular community occur at a young age and are promoted and often arranged by parents; as a consequence, knowledge of a presence of a genetic defect becomes quickly and widely disseminated, jeopardizing future marriage prospects of all other family members. Put another way, if the information leaks out, the marriage prospects of all of the children of a large family are affected. This state of affairs leads to deplorable but easily understood reluctance to take advantage of genetic screening and, stubborn guarding of genetic information, even to what sometimes appears to be a detriment. The Dor Yeshorim program has incorporated these concerns through designing a truly anonymous program. The results of genetic screening are literally unknown to

267

Levin: Hereditary cancer in Jewish communities Lehrman, S (1997) Jewish leaders seek genetic guidelines. Nature 389, 322 Levin M (1999) Screening Jews and genes: A consideration of ethics of genetic screening within the Jewish community: Challenges and responses, Genet testing 2,207-213 Meijers-Hejboer, H, Brekelman C.T.M, Menke-Pluymers M, Seynaeve C et al (2003), Use of genetic testing and prophylactiv mastectomy and oophorectomy in women with breast and ovarian cacner form families with BRCA1 or BRCA 2 mutation, J Clin Oncol 21, 1675-1681 Modan B, Hartge P, Hirsh-Yechezkel G, et al (2001) Parity, oral contraceptives, and the risk of ovarian cancer among carriers and noncarriers of a BRCA1 or BRCA2 mutation. N Engl J Med 345, 235-240 Moslehi R, Chu W, Karlan B, et al (2000). BRCA1 and BRCA2 mutation analysis of 208 Ashkenazi Jewish women with ovarian cancer. Am J Hum Genet 66,1259-12 Narod SA, Brunet JS, Ghadirian P, et al (2000). Tamoxifen and risk of contralateral breast cancer in BRCA1 and BRCA2 mutation carriers: a case-control study. Hereditary Breast Cancer Clinical Study Group. Lancet 356, 1876-1881 Narod SA, Sun P, Ghadirian P, et al (2001) Tubal ligation and risk of ovarian cancer in carriers of BRCA1 or BRCA2 mutations: a case-control study. Lancet 357, 1467-1470. Narod SSA, Risch H, Moslehi R et al (1998) Oral contraceptives and the rsk of hereditary ovarian cacner N Engl J Med 339, 424-428 Nelson NJ, Ashkenazi community is not unwilling to participate in genetic research (1998). J. Ntl Cancer Inst, 884-885 Pauling L, (1968) Reflection on a new biology: Foreword, â&#x20AC;&#x153;UCLA Law Review 15, 269 Rebbeck TR, Levin AM, Eisen A, et al (1999) Breast cancer risk after bilateral prophylactic oophorectomy in BRCA1 mutation carriers. J Natl Cancer Inst 91, 1475-1479. Rebbeck TR, Lynch HT, Neuhausen SL, et al (2002) Prophylactic oophorectomy in carriers of BRCA1 or BRCA2 mutations. N Engl J Med 46, 1616-1622. rj.org/wrj/reso/completehealth.html Rosenthal A, Jacobs I, (1998) Ovarian cancer screening. Semin Oncol 25,315-325 Rosner F. (1988) Judaism, genetic screening and genetic therapy, Mt. Sinai Med Journal (5-6), 406-413 Semiglazov VF, Miseysnko VM, Manikhas AG et al (1999) Role of breasrt self examination in early detection of breast cancer. Cancer Strategy 1,145-1551 Thomas DB, Gao DL, Ray RM. et al (2002) Randomized trial of breast self-examination in Shnaghai: final results, H Natl Can Inst 94, 1445-1457 Thompson D, Easton D. (2001) Variation in cancer risks, by mutation position, in BRCA2 mutation carriers. Am J Hum Genet 68, 410-419 Tonin P, Serova O, Lenoir G, et al (1995). BRCA1 mutations in Ashkenazi Jewish women. Am J Hum Genet 57,189 Tonin P,Weber B, Offit K, et al (1996) Frequency of recurrent BRCA1 and BRCA2 mutations in Ashkenazi Jewish breast cancer families. Nat Med 2,1179-1183 Venkitaraman A. R.A (2003) Growing Network of CancerSusceptibility Genes N Engl J Med 348, 1917-1919 Warner E. (2003), Surveillance of BRCA I and BRCA II mutation carriers: Can we make it work?, ASCO 2003 Educational Book, 640-648 www.uscj.org/scripts/usjc/paper/Article.as?ArticleID+673

informal discussions. More discussion must surely follow to culminate in a creation of a community wide task force to formulate recommendations for design and implementation of community wide screening and surveillance approach. The process cannot be rushed but the results, should they follow, have a real potential to markedly improve health and well-being of countless individuals. It is a goal that we must all surely support.

References Daly MB et al. (2002) The NCCN 2002 genetic/familial high risk assessment clinical practice guidelines in oncology, version 1, www.nccn.org Das. V, Stigma, contagion, defect: Issues in anthropology of public health, www.stigmaconference.nih.gov/FinalDasPaper.htm Dooley WC, Ljung BM, Veronesi U, et al. (2001) Ductal lavage for detection of cellular atypia in women at high risk for breast cancer. J Natl Cancer Inst 93, 1624-32 Fabian CJ, Kimler BF (2001) Breast cancer risk prediction: should nipple aspiration fluid cytology be incorporated into clinical practice? J Natl Cancer Inst 93, 1762-3 Fishman DA, Cohen L, Maihle N et al (2003) The National Ovarian Cancer Early Detection Program in ASCO 2003 Educational Book, 274-282 Gorfman, E (1963) Stigma: Notes on management of spoilt identity. Englewood Cliffs, NJ: Prentice Hall Hartmann LC, Schaid DJ, Woods JE, et al (1999) Efficacy of bilateral prophylactic mastectomy in women with a family history of breast cancer. N Engl J Med 340, 77-84 Hartmann LC, Sellers TA, Schaid DJ, et al (2001) Efficacy of bilateral prophylactic mastectomy in BRCA1 and BRCA2 gene mutation carriers. J Natl Cancer Inst 93, 1633-1637 Kaback M, Lim-Steel J, Dabholkar D, Brown D et al (1992) TaySachs disease-carrier screening, pre-natal diagnosis and the molecular era; social implications of heterozygote genetic screening program. Am J Public Health 11, 116-1120 Kauff ND, Satagopan JM, Robson ME, et al (2002) Riskreducing salpingo-oophorectomy in women with a BRCA1 or BRCA2 mutation. N Engl J Med 346, 1609-1615 Khoury M. J., McCabe L. L., McCabe E. R.B (2003) Genomic Medicine: Population Screening in the Age of Genomic Medicine, N Engl J Med 348, 50-58 King MC, Wieand S, Hale K, et al (2001) Tamoxifen and breast cancer incidence among women with inherited mutations in BRCA1 and BRCA2: National Surgical Adjuvant Breast and Bowel Project (NSABPP1) Breast Cancer Prevention Trial. JAMA 286, 2251-2256 Kolb TM, Lichy J, Newhouse JH (2002) Comparison of performance of screening mammography, physical examination, and breast ultrasound and evaluation of factors that influence them: An analysis of 27825 patient evaluations Radiology, 214, 165-175 Kuhl CK, Schmutzler RK, Leutner CC, et al (2000) Breast MRI imaging screening in 192 women proved or suspected to be carriers of breast cancer susceptability gene. Radiology 215:267-279 Kuhle CK, Krieg M, (2003) ASCO presentations Lehmann, LS, Weeks, JC, Klar N, Garber JE (2002) A population-based study of Ashkenazi Jewish women's attitudes toward genetic discrimination and BRCA1/2 testing Genetics in Medicine 4, 346-352

268

Cancer Therapy Vol 1, page 269 Cancer Therapy Vol 1, 269-273, 2003.

Selective intraarterial cisplatin chemotherapy in treatment of advanced malignant squamous cell carcinoma of the head and neck Review Article

Afshin Teymoortash*, Jochen A. Werner Department of Otolaryngology, Head and Neck Surgery, Philipps University of Marburg, Germany

__________________________________________________________________________________ *Correspondence: Dr. Afshin Teymoortash, Department of Otolaryngology, Head and Neck Surgery, Philipps University, Deutschhausstr. 3, 35037 Marburg, Germany; Phone: +49-6421-2866478; Fax: +49-6421-2866367; e-mail: teymoort@med.unimarburg.de; www.ent-marburg.de Key Words: advanced head and neck cancer, intraarterial chemotherapy, cisplatin Received: 6 October 2003; Accepted: 28 November 2003; electronically published: November 2003 Contributed by Dr. Werner

Summary The prognosis for patients with advanced head and neck cancer is poor and only a small fraction of these patients are cured. The standard therapy of advanced head and neck carcinomas consists of surgical resection of the tumor with postoperative radiation. Chemotherapy has been added to combined treatment modality of advanced head and neck cancer in attempts to improve survival rates. Selective injection of the cytostatic agents into the tumorsupplying artery is an attractive method to achieve higher doses of cytostatic agents in the tumor with less systemic toxicity and low complication rate. A combination of regional chemotherapy by intraarterial infusion of high doses of cisplatin with radiation therapy seems to be an useful approach when planning integrated treatment for locally advanced head and neck cancer. tumors or in case of tumors of which resection would lead to an unacceptable functional loss and in case of tumors for which postoperative radiation therapy alone is unsatisfactory. Cisplatin, 5-fluorouracil, and mitomycin C belong to the most effective chemotherapeutics in the treatment of squamous cell carcinomas of the head and neck. By combination with radiotherapy their radiosensitizing effects lead to a higher effectiveness of the therapy (Britzel et al, 1998). So often a slightly higher tumor control rate as well as survival rate could be achieved by application of simultaneous radiochemotherapy (Wendt et al, 1998; Pignon et al, 2000). Antitumoral chemotherapy is generally applied systemically and transported through the blood circulation to all organs of the body. Thus other non-diseased organs are concerned beside the tumor. This could be accompanied by significant systemic side effects. The toxic effect to proliferating cells, as for example the bone marrow and the mucosa lead to a reduction of the chemotherapeutic dose. Applying a standard dose often results in a subtherapeutic intratumoral concentration of the chemotherapeutics which reduces the effectiveness of this therapy concept. Another problem with chemotherapy is the development of drug resistance. In vitro and in vivo studies were able to describe a rapid development of

I. Therapy of advanced carcinomas and its limits Carcinomas of the upper aerodigestive tract detected in early stage have in general a good prognosis after surgical therapy or irradiation. However, this statement is not valid for advanced carcinomas of stage III and IV according to UICC which represent about two third of the carcinomas of this region. The current results of therapy of advanced carcinomas of the upper aerodigestive tract can only be compared with significant restrictions as carcinomas in the stage III and IV may consist of tumors with different prognosis. However, these data demonstrate an average rate of locoregional recurrence of more than 50% and according to autopsy studies approximately 50% of these patients develop distant metastasis (Dennington et al, 1980). The five-year survival rate of advanced head and neck carcinomas rarely achieves more than 25% (Vokes et al, 1993; Hart et al, 1995). The standard therapy of advanced head and neck carcinomas (stage III and IV) consists of surgical resection of the tumor in combination with radiotherapy. Chemotherapy has been added to combined treatment modality of advanced head and neck cancer in attempts to improve survival rates and for organ function preservation. Chemotherapy is performed in case of non-resectable 269

Teymoortash and Werner: Selective intraarterial cisplatin chemotherapy against H&N cancer resistances against cisplatin during treatment (Inoue et al, 1985; Andrews et al, 1990).

irradiation possible impairing the blood supply of the tumor (Steffens et al, 1980). First experiences with intraarterial chemotherapy demonstrated furthermore that an isolated intraarterial chemotherapy is associated with a high rate of local recurrences. It could be postulated that this therapy should be considered as a part of a whole therapeutical concept with surgery and radiotherapy (Kreidler and Petzel, 1983). The higher effectiveness of intraarterial chemotherapy in comparison to systemic chemotherapy could already be shown by animal experimental studies (Harker and Stephens, 1992). In the following sections the treatment results of advanced head and neck carcinomas by application of intraarterial cisplatin chemotherapy will be discussed.

II. Concept of intraarterial chemotherapy Due to the poor prognosis of patients suffering from advanced head and neck cancers and the often unsatisfactory results of standard therapies, there is an urgent need for new therapeutical strategies. Especially in the last years several new therapeutical procedures for advanced head and neck carcinomas were developed and applied which are not yet included in the generally accepted methods. These are immunotherapy, photodynamic therapy, gene therapy as well as selective intraarterial chemotherapy. The investigations performed by Robbins and coworkers gave new impulses to intraarterial chemotherapy the oncologic results of which are very promising. Robbins interprets their results in that way that the intraarterial chemotherapy with cisplatin coupled with radiotherapy allow a long-term survival (Robbins et al, 1997; Kerber et al, 1998; Robbins et al, 1999a). Already in 1950, Klopp et al. reported that a more important effectiveness of chemotherapeutics can be achieved by a higher concentration of the intraarterial application. The increased effectiveness of intraarterial chemotherapy is based on the possibility of applying an up to ten times higher dose of cisplatin in comparison to intravenous standard therapy. This procedure should be sufficient to overcome the cellular drug resistance of cisplatin that rapidly develops (von Hoff et al, 1986; Teicher et al, 1987). The intraarterial application of cisplatin allows a higher effectiveness of chemotherapy with lower systemic toxicity which can be even favored by an accompanying therapy with thiosulfates. Thiosulfates can develop a soluble complex without toxicity due to covalent binding with cisplatin (Howell and Taetle, 1980). A disappearance of the active drug due to neutralization in the plasma compartment acts functionally as an increase in clearance. The particular effectiveness of the intraarterial application of chemotherapeutics is based on the first passing of the drug through the tumor site. When the chemotherapeutics have reached the venous circulation they have the same effect compared to systemic application. The relative advantage of the intraarterial chemotherapy in comparison to intravenous application depends on the plasma clearance of cisplatin which is increased by the neutralizing effect of thiosulfates. This is also inversely proportional to the plasma flow of the tumor (Campbell et al, 1983). A reduction of the plasma flow of the tumor can be achieved by a rapid application of the medicament as well as the application in small arteries. In the context of this therapeutical type the condition of the vessels providing the tumour must be considered. The experience of the first years of application of intraarterial chemotherapy made clear that the initial tumor resection and irradiation significantly influences the vascular provision of the tumors. Thus a higher effect of the chemotherapeutics could be achieved in cases of application as initial therapy with no prior surgery or

III. Administration of intraarterial chemotherapy and treatment results The precondition for the mentioned effect of intraarterial chemotherapy is the targeted selective injection of the cytostatic agent into the tumor-supplying artery. This is performed by means of different, specifically developed catheter systems. The so-called bypass method consisted in creating by vascular surgery a directly subcutaneously located cervical vessel which can be identified easily and cannulated repeatedly. By this method the external carotid artery was prolonged end-toend by an autogenic saphenal vein graft and anastomosed with the common carotid artery end-to-side more proximally (Scheel, 1981). Further implantable pump systems were inserted for the application of chemotherapeutics in the past (Backer et al, 1987). Nowadays frequently chemotherapy is applied via angiographically guided selective placement of microcatheters into the tumor-supplying artery by means of a transfemoral access which can be performed repeatedly without significant complications. The intraarterial chemotherapy was performed initially with cisplatin (100-200 mg/m2 per week) in combination with intravenous sodium thiosulfate (9 g/m2 for 30 minutes, followed by 12 g/m2) for a maximum of four cycles (Robbins et al, 1992, 1994a, 1994b, 1996a). Later a combination of the intraarterial cisplatin therapy with radiotherapy was performed. Via a Seldinger catheter high doses of cisplatin were applied intraarterially coupled with simultaneous intravenous neutralization with sodium thiosulfate. This treatment was repeated and completed by parallel radiotherapy which served to reduce the total duration of the therapy and at the same time to increase the toxicity to the tumor. Radiotherapy of the tumor and its lymphatic pathways was performed in a dose of 1.8 to 2.0 Gy per day in 35 fractions for seven to eight weeks (total dose, 68 to 70 Gy). The intraarterial cisplatin therapy was performed on the first, eighth, fifteenth, and 22nd day of irradiation. Cisplatin was applied selectively via a microcatheter into the tumor-supplying artery for three to five minutes. It was dissolved in 400 ml of a electrolyte solution and transfused in a dose of 150 mg/m2 each. Simultaneously the intravenous infusion of 9 g/m2 sodium thiosulfate was performed for 30 minutes, followed by 12 270

Cancer Therapy Vol 1, page 271 g/m2 for two hours. Pretherapeutically an intravenous hydratation was made with two liters of electrolyte solution. Posttherapeutically again an intravenous hydratation was performed with one liter of electrolyte solution. Patients with a clinically staged N2 or N3 neck underwent selective neck dissection two months after the beginning of therapy (Robbins et al, 1999a). In the data established by Robbins et al. (1999b) 83 patients with intraarterial chemotherapy and radiotherapy were treated according to the above mentioned pattern. The patients suffered from carcinomas of the oral cavity, the oropharynx, the hypopharynx, and the larynx. 72 (87%) of the patients had four cycles, 9 (11%) of the patients had three cycles and 2 (3%) of the patients had less than three cycles of cisplatin. After a follow-up period of 17 to 61 months (median 24 months) 76 of the patients allowed a statement on the response rate of the therapy. Referring to the primary tumor 70 patients (92%) showed a complete response, 5 patients (6%) revealed a partial response, and in one patient (1%) no response could be observed. Neck dissection was performed in 30 of 52 patients with N2 or N3 neck. Referring to the cervical lymph nodes, 64 patients (84%) had a complete response and 11 (14%) showed a partial response. Only one patient revealed a response neither in the area of the primary tumor nor in the cervical region. After a follow-up period of 30 months an average survival rate of 58% and a fiveyear survival rate of 40% could be observed. In analogy to these results most of the applied therapeutical procedures with intraarterial chemotherapy combined with radiotherapy revealed an overall response rate of about 90%. These recent results are demonstrated in Table 1. In an investigation on the effectiveness of intraarterial chemotherapy 45 patients suffering from T4 carcinoma with cartilage or bone infiltration were compared to 90 patients suffering from T4 carcinoma without cartilage or bone infiltration (Samant et al, 2001). The complete response rate of the first group amounted to 66.7% which reveals no significant difference to the second group with 71.1%. The two-year survival rate of both patient populations showed no significant difference (46.3% versus 36.9%). The analysis of the quality of life after radiochemotherapy with intraarterial application of cisplatin showed an initial reduction of the quality of life for the patients with advanced oropharyngeal, hypopharyngeal, and laryngeal carcinomas. However, generally an amelioration of the quality of life could be confirmed after the end of the therapy and the values even

exceeded the pretherapeutical number of points six months after the end of the therapy (Murry et al, 1998). In another investigation the quality of life of patients suffering from head and neck cancer of stage IV who were treated according to the above mentioned radio/ chemotherapeutical concept was analyzed. Appropriate questionnaires were evaluated prior to treatment as well as three, six, and twelve months after therapy (Ackerstaff et al, 2002). This evaluation also revealed that the quality of life deteriorated initially in order to improve between the third and twelfth month.

IV. Side effects of the intraarterial chemotherapy Complications resulting from the application of the catheter which have to be treated and vascular complications during angiography and chemotherapy are relatively rare. In a study of 105 patients 385 transfemoral catheterization of the external carotid artery were performed. Gemmete (2003) reported about two asymptomatic dissections of the distal common carotid artery and 22 hematomas which did not need therapy as well as acutely arising occlusions in the area of the femoral and iliacal artery in three patients. Because the tumor is specifically treated via an angiographical microcatheter in the context of this therapeutical concept the systemic side effects occur more rarely than in case of intravenous chemotherapy. Additionally the overlapping intravenous application of the cisplatin antagonist sodium thiosulfate neutralizes the systemic side effects. This therapy reduces the cytostaticsrelated nausea, especially when the maxillary artery and thus the arteria meningia media are not located in the area of transfusion. However, an antiemetic therapy is generally recommended. Renal insufficiencies can be sufficiently excluded by an accompanying intravenous hydratation (Robbins et al, 1996b). During the 323 transfemoral selective intraarterial transfusions a severe chemotoxicity was observed in 5% of the cases. In nine cases this included severe gastrointestinal side effects, in seven cases severe hematological side effects, in one case even neurotoxicity and one death during therapy secondary to a pulmonary embolus. A serious ototoxicity or nephotoxicity did not occur. 25 (30%) of the patients developed a mucositis of degree III to VI. In six patients a neural dysfunction could be observed while three of these patients suffered from a cerebrovascular accident and three of them a transient ischaemic attack.

Table 1. Evaluable response rate referring to the advanced primary tumor for intraarterial chemotherapy combined with radiotherapy author number of patients complete response partial response nonresponse Samant et al, 1999 24 22 (88%) 1 (4%) 1 (4%) Robbins et al, 1999b 76 70 (92%) 5 (6%) 1 (1%) Fuwa et al, 2000 32 21 (66%) 10 (31%) 1 (3%) Regine et al, 2000 20 18 (90%) 2 (10%) 0 Benazzo et al, 2000 40 11 (28%) 25 (63%) 4 (10%) Samant et al, 2001 112 94 (84%) 15 (13%) 3 (3%) Furutani et al, 2002 37 31 (84%) 4 (11%) 2 (5%) 271

Teymoortash and Werner: Selective intraarterial cisplatin chemotherapy against H&N cancer Three patients developed pulmonary embolism while one patient died due to this pulmonary embolism, the other patients died after the end of the therapy due to aspiration pneumonia and/or coronary ischemia (Robbins et al, 1999b). An analysis of swallowing and speech was performed of 14 patients suffering from head and neck cancer who were treated with intraarterial chemotherapy and irradiation in comparison to 16 patients treated with systemic radiochemotherapy. By means of videofluorography and articulation tests no significant difference could be found in comparison to the patients having undergone systemic radiochemotherapy one month after the end of the therapy (Newton et al, 2002). In another study 47 patients undergoing the same treatment were examined concerning the weight loss and swallowing prior to therapy and after the end of the treatment. These patients lost about 10% of their pretherapeutic weight and showed a reduction of the eating behavior. 18 months after the end of the therapy most of the patients were able to eat normally and to keep their weight. The percentage of patients without dysphagia sank during treatment from 38% (18 patients) to 21% (10 patients), and after 18 months after the end of the therapy it increased to 72% (34 patients). The complaints of dysphagia during therapy were in particular the result of mucositis and nausea. While prior to therapy 4 patients (9%) had a PEG tube 12 patients (26%) needed such a probe during treatment. After the end of the therapy up to 18 months afterwards the need of a PEG tube was reduced to 13% (6 patients) (Newman et al, 1998). The ototoxicity of the intraarterial cisplatin therapy was examined in 70 patients (Madasu et al, 1997). The ototoxicity was defined as hearing loss of 15 dB for one frequency or 10 dB for three frequencies between 250 Hz and 4 kHz. The incidence of ototoxicity was 25% for 150 mg/m2, 50% for 300 mg/m 2, 64% for 450 mg/m 2, and 60% for 600 mg/m2. The ototoxicity could only be observed in the high frequencies. The hearing at 2 kHz and frequencies below 2 kHz were concerned only minimally or not affected. The ototoxicity occurred independently from an initially existing hearing loss. A vestibular lesion or tinnitus could not be observed.

head and neck cancer.

References Ackerstaff AH, Tan IB, Rasch CR, Balm AJ, Keus RB, Schornagel JH, Hilgers FJ (2002) Quality-of-life assessment after supradose selective intra-arterial cisplatin and concomitant radiation (RADPLAT) for inoperable stage IV head and neck squamous cell carcinoma. Arch Otolaryngol Head Neck Surg 128, 1185-1190. Andrews PA, Jones JA, Varki NM, Howell SB (1990) Rapid emergence of acquired cis-diamminedichloroplatinum(II) resistance in an in vivo model of human ovarian carcinoma. Cancer Commun 2, 93-100. Baker SR, Forastiere AA, Wheeler R, Medvec BR (1987) Intraarterial chemotherapy for head and neck cancer. An update on the totally implantable infusion pump. Arch Otolaryngol Head Neck Surg 113, 1183-1190. Benazzo M, Caracciolo G, Zappoli F, Bernardo G, Mira E (2000) Induction chemotherapy by superselective intra-arterial highdose carboplatin infusion for head and neck cancer. Eur Arch Otorhinolaryngol 257, 279-282. Brizel DM, Albers ME, Fisher SR, Scher RL, Richtsmeier WJ, Hars V, George SL, Huang AT, Prosnitz LR (1998) Hyperfractionated irradiation with or without concurrent chemotherapy for locally advanced head and neck cancer. N Engl J Med 338, 1798-1804. Campbell TN, Howell SB, Pfeifle CE, Wung WE, Bookstein J (1983) Clinical pharmacokinetics of intraarterial cisplatin in humans. J Clin Oncol 1, 755-762. Dennington ML, Carter DR, Meyers AD (1980) Distant metastases in head and neck epidermoid carcinoma. Laryngoscope 90, 196-201. Furutani K, Fuwa N, Kodaira T, Matsumoto A, Kamata M, Tachibana H, Sakahara H (2002) Continuous selective intraarterial chemotherapy in combination with irradiation for locally advanced cancer of the tongue and tongue base. Oral Oncol 38, 145-152. Fuwa N, Ito Y, Matsumoto A, Kamata M, Kodaira T, Furutani K, Sasaoka M, Kimura Y, Morita K (2000) A combination therapy of continuous superselective intraarterial carboplatin infusion and radiation therapy for locally advanced head and neck carcinoma. Phase I study. Cancer 89, 2099-2105. Gemmete JJ (2003) Complications associated with selective high-dose intraarterial cisplatin and concomitant radiation therapy for advanced head and neck cancer. J Vasc Interv Radiol 14, 743-748. Harker GJ, Stephens FO (1992) Comparison of intra-arterial versus intravenous 5-fluorouracil administration on epidermal squamous cell carcinoma in sheep. Eur J Cancer 28, 1437-1441. Hart AA, Mak-Kregar S, Hilgers FJ, Levendag PC, Manni JJ, Spoelstra HA, Bruaset IA, van der Laan BF, Annyas AA, van der Beek JM (1995) The importance of correct stage grouping in oncology. Results of a nationwide study of oropharyngeal carcinoma in The Netherlands. Cancer 75, 2656-2662. Howell SB, Taetle R (1980) Effect of sodium thiosulfate on cisdichlorodiammineplatinum(II) toxicity and antitumor activity in L1210 leukemia. Cancer Treat Rep 64, 611-616. Inoue K, Mukaiyama T, Mitsui I, Ogawa M (1985) In vitro evaluation of anticancer drugs in relation to development of drug resistance in the human tumor clonogenic assay. Cancer Chemother Pharmacol 15, 208-211. Kerber CW, Wong WH, Howell SB, Hanchett K, Robbins KT (1998) An organ-preserving selective arterial chemotherapy strategy for head and neck cancer. AJNR Am J Neuroradiol 19, 935-941.

V. Conclusion The selective intraarterial chemotherapy can be included in the therapy of carcinomas where surgery and radiotherapy do not promise a curative treatment. Contraindications such as for example a tendency to bleeding against the performance of chemotherapy should not exist. Further a sufficient blood supply of the tumor should be revealed. Intraarterial chemotherapy seems to be a promising strategy in therapy of untreated locally advanced head and neck cancer with concurrent radiotherapy due to advantages of high-dose delivery of drug, minimal procedural complications, low systemic toxicity, and high tumor response rate. Further clinical trials are required to fully assess the effect of intraarterial chemotherapy on survival rate and quality of life in treatment of advanced 272

Cancer Therapy Vol 1, page 273 Klopp CT, Alfort TC, Bateman J (1950) Fractionated intaarterial cancer chemotherapy with methyl bis amine hydrochloride: a preliminary report. Ann Surg 132, 811-832. Kreidler JF, Petzel JR (1983) Combined treatment of maxillofacial carcinoma by intra-arterial proliferation block and irradiation. Recent Results Cancer Res 86, 152-161. Madasu R, Ruckenstein MJ, Leake F, Steere E, Robbins KT (1997) Ototoxic effects of supradose cisplatin with sodium thiosulfate neutralization in patients with head and neck cancer. Arch Otolaryngol Head Neck Surg 123, 978-981. Murry T, Madasu R, Martin A, Robbins KT (1998) Acute and chronic changes in swallowing and quality of life following intraarterial chemoradiation for organ preservation in patients with advanced head and neck cancer. Head Neck 20, 31-37. Newman LA, Vieira F, Schwiezer V, Samant S, Murry T, Woodson G, Kumar P, Robbins KT (1998) Eating and weight changes following chemoradiation therapy for advanced head and neck cancer. Arch Otolaryngol Head Neck Surg 124, 589-592. Newman LA, Robbins KT, Logemann JA, Rademaker AW, Lazarus CL, Hamner A, Tusant S, Huang CF (2002) Swallowing and speech ability after treatment for head and neck cancer with targeted intraarterial versus intravenous chemoradiation. Head Neck 24, 68-77. Pignon JP, Bourhis J, Domenge C, Designe L (2000) Chemotherapy added to locoregional treatment for head and neck squamous-cell carcinoma: three meta-analyses of updated individual data. MACH-NC Collaborative Group. Meta-Analysis of Chemotherapy on Head and Neck Cancer. Lancet 355, 949-955. Regine WF, Valentino J, John W, Storey G, Sloan D, Kenady D, Patel P, Pulmano C, Arnold SM, Mohiuddin M (2000) Highdose intra-arterial cisplatin and concurrent hyperfractionated radiation therapy in patients with locally advanced primary squamous cell carcinoma of the head and neck: report of a phase II study. Head Neck 22, 543-549. Robbins KT, Storniolo AM, Kerber C, Seagren S, Berson A, Howell SB (1992) Rapid superselective high-dose cisplatin infusion for advanced head and neck malignancies. Head Neck 14, 364-371. Robbins KT, Storniolo AM, Kerber C, Vicario D, Seagren S, Shea M, Hanchett C, Los G, Howell SB (1994a) Phase I study of highly selective supradose cisplatin infusions for advanced head and neck cancer. J Clin Oncol 12, 21132120. Robbins KT, Vicario D, Seagren S, Weisman R, Pellitteri P, Kerber C, Orloff L, Los G, Howell SB (1994b) A targeted supradose cisplatin chemoradiation protocol for advanced head and neck cancer. Am J Surg 168, 419-422. Robbins KT, Storniolo AM, Hryniuk WM, Howell SB (1996a) "Decadose" effects of cisplatin on squamous cell carcinoma of the upper aerodigestive tract. II. Clinical studies. Laryngoscope 106, 37-42. Robbins KT, Fontanesi J, Wong FS, Vicario D, Seagren S, Kumar P, Weisman R, Pellitteri P, Thomas JR, Flick P, Palmer R, Weir A 3rd, Kerber C, Murry T, Ferguson R, Los G, Orloff L, Howell SB (1996b) A novel organ preservation protocol for advanced carcinoma of the larynx and pharynx. Arch Otolaryngol Head Neck Surg 122, 853-857. Robbins KT, Kumar P, Regine WF, Wong FS, Weir AB 3rd, Flick P, Kun LE, Palmer R, Murry T, Fontanesi J, Ferguson R, Thomas R, Hartsell W, Paig CU, Salazar G, Norfleet L, Hanchett CB, Harrington V, Niell HB (1997) Efficacy of targeted supradose cisplatin and concomitant radiation

therapy for advanced head and neck cancer: the Memphis experience. Int J Radiat Oncol Biol Phys 38, 263-271. Robbins KT, Wong FS, Kumar P, Hartsell WF, Vieira F, Mullins B, Niell HB (1999a) Efficacy of targeted chemoradiation and planned selective neck dissection to control bulky nodal disease in advanced head and neck cancer. Arch Otolaryngol Head Neck Surg 125, 670-675. Robbins KT (1999b) Targeted cisplatin chemotherapy for advanced head and neck cancer. In: Eckert A (ed.) Intraarterial chemotherapy in head and neck cancer. Current results and future perspectives. Einhorn-Presse Verlag, 173182. Samant S, Kumar P, Wan J, Hanchett C, Vieira F, Murry T, Wong FS, Robbins KT (1999) Concomitant radiation therapy and targeted cisplatin chemotherapy for the treatment of advanced pyriform sinus carcinoma: disease control and preservation of organ function. Head Neck 21, 595-601. Samant S, Robbins KT, Kumar P, Ma JZ, Vieira F, Hanchett C (2001) Bone or cartilage invasion by advanced head and neck cancer: intra-arterial supradose cisplatin chemotherapy and concomitant radiotherapy for organ preservation. Arch Otolaryngol Head Neck Surg 127, 1451-1456. Scheel JV (1981) Zur Methodik der intraarteriellen Chemotherapie maligner Tumoren im Kopf-Hals-Bereich. Laryngorhinootologie 60, 275-277. Stephens FO, Harker GJ, Crea P (1980) The intraarterial infusion of chemotherapeutic agents as "basal" treatment of cancer: evidence of increased drug activity in regionally infused tissues. Aust N Z J Surg 50, 597-602. Teicher BA, Holden SA, Kelley MJ, Shea TC, Cucchi CA, Rosowsky A, Henner WD, Frei E 3d. (1987) Characterization of a human squamous carcinoma cell line resistant to cis-diamminedichloroplatinum(II). Cancer Res 47, 388-393. Vokes EE, Weichselbaum RR, Lippman SM, Hong WK (1993) Head and neck cancer. N Engl J Med 328, 184-194. von Hoff DD, Clark GM, Weiss GR, Marshall MH, Buchok JB, Knight WA 3d, LeMaistre C (1986) Use of in vitro dose response effects to select antineoplastics for high-dose or regional administration regimens. Clin Oncol 4, 1827-1834. Wendt TG, Grabenbauer GG, Rodel CM, Thiel HJ, Aydin H, Rohloff R, Wustrow TP, Iro H, Popella C, Schalhorn A (1998) Simultaneous radiochemotherapy versus radiotherapy alone in advanced head and neck cancer: a randomized multicenter study. J Clin Oncol 16, 1318-1324.

Dr. J. A. Werner

273

Dr. A. Teymoortash

Teymoortash and Werner: Selective intraarterial cisplatin chemotherapy against H&N cancer

274

Cancer Therapy Vol 1, page 275 Cancer Therapy Vol 1, 275-281, 2003.

Protein kinase C-! and its downstream effectors as potential targets for cancer therapy Review Article

Jihua Liu, David Durrant and Ray M. Lee* Huntsman Cancer Institute and Section of Oncology, Department of Internal Medicine, University of Utah, 2000 Circle of Hope, Salt Lake City, UT, 84112

__________________________________________________________________________________ *Correspondence: Ray M. Lee; Phone: 801-585-0611; Fax: 801-585-0900; e-mail: ray.lee@hci.utah.edu Key Words: Protein kinase C-!, cancer therapy, apoptosis Abbreviations: Protein kinase C (PKC); nerve-growth factor, (NGF); Cytarabine, (ara-C); stress-activator protein kinase, (SAPK); mitogen-activated protein kinase, (MAPK); phospholipid scramblase 3, (PLS3); phospholipid scramblase 1, (PLS1); non-small cell lung cancer, (NSCLC); phosphatidylserine, (PS); chronic myelocytic leukemia, (CML) Received: 23 October 2003; Revised: 4 December 2003; Accepted: 4 December 2003; electronically published: December 2003

Summary The Protein kinase C (PKC) family of serine/threonine protein kinases are important in many biologic processes. The PKC-! isoform is particularly involved in the regulation of cell death. During programmed cell death, PKC-! translocates from the cytoplasm to the nucleus, mitochondria, Golgi and plasma membrane. Several key substrates of PKC-! in the nucleus and mitochondria have been identified, and the linkage of these PKC-! targets to regulation of DNA damage checkpoints and mitochondrial apoptosis helps to elucidate the mechanism of PKC-!induced apoptosis. Here we review the apoptotic effects of PKC-! and its substrates in various organelles, and discuss the possibility of using these targets to develop novel approaches for cancer therapy. isoforms ", #I, #II and $, require both calcium and diacylglycerol for activation. The novel PKCs, including !, %, &, and ', are independent of calcium but require diacylglycerol for activation. The atypical PKCs, including ( and ), are independent of both calcium and diacylglycerol. Each isoform plays different roles in cell growth, proliferation, differentiation or apoptosis (Ohno, 1997). Due to their important roles in many different cancers, PKCs could be potential targets for developing novel cancer therapies. For example, treatments utilizing antisense oligonucleotides directed against PKC-" are in clinical development for several cancers (Wang et al, 1999; Roychowdhury and Lahn, 2003). Bryostatin, a compound that inhibits PKC-", has gone through phase I clinical trials (Hofmann, 2001; Marshall et al, 2002; Swannie and Kaye, 2002). However, these two approaches target PKC-", the most well-characterized isoform. Utilization of other PKC isoforms has not yet been realized.

I. Introduction In the post genomic era, the trend for developing novel cancer therapy is based on identification of molecular targets. This kind of mechanism-based drug development requires a comprehensive understanding of the function of molecular targets, their upstream activators and downstream effectors. In addition to utilizing kinases or other signal transduction mediators as targets, members of apoptotic pathways also serve as potentially useful targets due to the possibility of directly inducing cell death and minimizing the development of drug resistance. Here we review the biology of the apoptotic pathway involving PKC-! and the possibility of using PKC-! and its downstream effectors as potential targets for novel cancer therapy.

II. Biological functions of the protein kinase C family Members of the Protein kinase C (PKC) family play diverse roles in many biological processes (Parker, 1997). Isoforms of the PKC family can be divided into three groups based on their interaction with and dependence on calcium and diacylglycerol. The classic PKCs, including

III. Protein kinase C isoforms in apoptosis The balance of survival and apoptotic signals determines cancer cell death, the ultimate goal of cancer 275

Liu et al: Protein kinase C-! for cancer therapy therapy (Cory and Adams, 1998; Reed, 1999; Adams and Cory, 2001; Green and Evan, 2002). Although therapeutic approaches that block survival signals may tip the balance toward cell death, blocking such survival signals does not necessarily mean that cancer cells will automatically undergo apoptosis. In contrast, induction of apoptosis through modulation of key factors in the apoptotic pathway would have a direct and dominant effect on cells. Thus direct activation of the cell death response may be a better approach for cancer therapies. In this review, we focus on the PKC isoform best characterized in triggering apoptosis, PKC-! (Brodie and Blumberg, 2003). Compared with PKC-", which provides a survival and proliferation signal, PKC-! provides a more direct target to enhance apoptosis (Mandil et al, 2001). Involvement of PKC-! in apoptosis was first demonstrated by activation of PKC-! in cells treated with a variety of apoptotic stimuli, including H2O2 (Konishi et al, 2001; Majumder et al, 2001), TNF-" (Emoto et al, 1995), the Fas ligand (Scheel-Toellner et al, 1999), UV and $ irradiation (Denning et al, 1998; Yuan et al, 1998), and etoposide treatment (Reyland et al, 1999; Blass et al, 2002). Inhibition of PKC-! activity by a PKC-!-specific inhibitor, rottlerin, or by a dominant negative mutant resulted in suppression of the apoptotic response (Li et al, 1999; Majumder et al, 2000). Another important clue was shown in PKC-!-deficient mice, which had an increased B cell population and formed numerous germinal centers in the absence of stimulation (Mecklenbrauker et al, 2002; Miyamoto et al, 2002). The observed abnormal B cell proliferation was associated with enhanced autoimmunity due to the persistence of self antigen-recognizing B cells that failed to undergo apoptosis during positive selection. Analysis of these knockout mice thus established a role for PKC-! in controlling B-cell apoptosis in the regulation of B cell tolerance.

V. Translocation of PKC-! during apoptotic responses Depending on the cell types and the apoptotic stimuli, PKC-! has been reported to translocate to nearly all subcellular organelles, including nuclei, mitochondria, the Golgi complex, endoplasmic reticulum (ER) and the plasma membrane (Brodie and Blumberg, 2003; Roychowdhury and Lahn, 2003). At each subcellular organelle, PKC-! phosphorylates different substrates, inducing various responses that eventually lead to cell death. Identification of the substrates is critical to understanding the mechanism of PKC-!, but it has been very challenging to identify physiologic substrates in each organelle. We define three criteria that must be met to convincingly claim any protein as a physiologic substrate of PKC-!; (1) there must be evidence that PKC-! phosphorylates the protein, (2) there should be evidence for their interaction, and (3) most importantly, deletion or inactivation of the substrate must lead to at least a partial loss of PKC-!-induced response. Here we review several known substrates of PKC-! with a goal of connecting these substrates to the apoptotic pathway so that we can understand how PKC-! induces apoptosis.

VI. PKC-! substrates in the nucleus Translocation of PKC-! to the nucleus has been established in T cells and C6 glioma cells (Scheel-Toellner et al, 1999; Blass et al, 2002). A putative nuclear localization signal has been identified at the carboxyl terminus of the catalytic domain of PKC-! (DeVries et al, 2002). Previously, nucleolin, which is required for nervegrowth factor (NGF)-induced differentiation of pheochromocytoma cells PC12, was identified as a substrate of PKC-) (Zhou et al, 1997). However, neither PKC-" nor PKC-! can phosphorylate nucleolin, and nucleolin is not involved in the apoptotic response. Recently, Yoshida et al, (2003) reported that PKC-! is responsible for constitutive and DNA damage-induced phosphorylation of Rad9, a key factor involved in checkpoint regulation of the DNA damage response (alKhodairy et al, 1994). The authors also demonstrated an interaction between PKC-! and Rad9, and showed that PKC-! phosphorylated Rad9 both in vitro and in cells treated with Cytarabine (ara-C) or $-irradiation (Yoshida et al, 2003). Nuclear Rad9 forms a critical heterotrimeric complex with Hus1 and Rad1, the 9-1-1 complex that is involved in DNA damage checkpoint control (Volkmer and Karnitz, 1999). PKC-!, which translocated to the nucleus during apoptosis, enhanced the phosphorylation of Rad9 and the formation of the Rad9-Hus1-Rad1 complex (Yoshida et al, 2003). Interestingly, Rad9 is also phosphorylated by ATM (Chen et al, 2001) and c-Abl (Yoshida et al, 2002). The latter kinase also interacts with PKC-! (Sun et al, 2000a, b). Using ATM siRNA to downregulate the level of ATM, a diminished nuclear targeting of PKC-! was observed, suggesting that ATM is required for nuclear targeting of PKC-! and is functionally upstream of PKC-! (Yoshida et al, 2003). These studies provide a direct linkage between PKC-! and DNA

IV. Regulation of the activity of PKC! Regulation of PKC-! activity is mediated by at least three mechanisms. The regulatory C1 domain has an inhibitory effect on the catalytic domain found at the carboxyl terminus (Ohno, 1997; Parker, 1997). One way to release inhibition is by interaction of diacylglycerol or phorbol esters with the C1 domain, which triggers a conformational change. A second mechanism is mediated by cleavage of the catalytic domain from the C1 regulatory domain, which is achieved during apoptosis by activated caspase 3 (Ghayur et al, 1996; Denning et al, 2002). Tyrosine phosphorylation of PKC-! at Tyr64 and 187 is essential for the cleavage and the apoptotic effect of PKC! (Blass et al, 2002). Tyr311 phosphorylation by Lck kinase after H 2O2 treatment enhances basal PKC-! activity and elevates its maximal activity in the presence of diacylglycerol (Konishi et al, 2001). Finally, activated PKC-! undergoes ubiquitination and degradation through the proteasome pathway, which prevents a persistent effect of PKC-! (Lu et al, 1998).

276

Cancer Therapy Vol 1, page 277 damage-induced checkpoint regulation, and form the basis for future studies of the mechanism of PKC-!-induced apoptosis. Another downstream effector of PKC-! in DNA damage response in cells treated with ara-C is stressactivator protein kinase (SAPK/JNK) (Yoshida et al, 2002) (Figure 1). DNA damage-induced SAPK/JNK activation was attenuated by rottlerin, a dominant negative mutant of PKC-!, and PKC-! siRNA. PKC-! did not directly phosphorylate SAPK/JNK, rather SAPK/JNK was indirectly phosphorylated through the mitogen-activated protein kinase (MAPK) pathway, PKC-! * MEKK1 * MKK7 * SAPK/JNK (Yoshida et al, 2002). The finding that SAPK/JNK is a downstream effector of PKC-! provides another mechanism of PKC-!-induced apoptosis. Interestingly, SAPK/JNK was shown to be the substrate of PKC-# and to translocate to mitochondria after phosphorylation to induce cytochrome c release (Ito et al, 2001a).

VII. PKC-! mitochondria

substrates

PKC-! (Denning et al, 2002). One known substrate of PKC-! is c-Abl kinase (Sun et al, 2000a). It has been demonstrated that PKC-! interacts with c-Abl, and that the phosphorylation of c-Abl results in activation of c-Abl kinase. Cells treated with H2O2 had an increase in c-Abl activity, which was attenuated by the PKC-! inhibitor, rottlerin, and by overexpression of the regulatory domain of PKC-! (Sun et al, 2000a). In the unstimulated condition, c-Abl localized to the nucleus, ER and cytoplasm. On ER stress caused by calcium ionophore A23187, brefeldin A or tunicamycin treatment, c-Abl translocated to mitochondria (Ito et al, 2001b). The second mitochondrial target of PKC-! is the phospholipid scramblase 3 (PLS3) (Liu et al, 2003a), a member of the scramblase family that is responsible for bidirectional movement of phospholipids in the lipid bilayer. Unlike PLS1, which is localized in the plasma membrane (Zhou et al, 1997; Sims and Wiedmer, 2001), PLS3 is found exclusively in the mitochondria (Liu et al, 2003a, b). The function of PLS3 is currently unclear, but is likely involved in translocation of cardiolipin from the mitochondrial inner membrane to the outer membrane during apoptosis. Mitochondria with expression of an inactive mutant of PLS3 have a low level of cardiolipin and poor respiration (Liu et al, 2003b). They also display a unique morphology, being larger in size, fewer in number, and with tightly packed cristae, consistent with the notion that PLS3 moves phospholipids from the inner membrane to the outer membrane (Liu et al, 2003b).

the

Translocation of PKC-! to mitochondria was shown in U937 myeloid leukemia cells and keratinocytes (Li et al, 1999; Majumder et al, 2000). The translocation can be induced by phorbol ester (Denning et al, 1998) and the oxidative stress (Majumder et al, 2001). With UV irradiation, mitochondrial targeted PKC-! was cleaved by caspase 3 to generate the active catalytic fragment of

Figure 1. Diagram of PKC-! and its downstream effectors in DNA damage-induced apoptosis. PKC-! is localized in the cytoplasm before the induction of apoptosis. When DNA is damaged by apoptotic stimuli, PKC-! translocates to the nucleus, where it phosphorylates Rad9 and c-Abl and activates MEKK1. PKC-! also translocates to mitochondria, where it phosphorylates PLS3 and cAbl, and to the Golgi, where it phosphorylates c-Abl and SAPK/JNK. In the plasma membrane, PKC-! phosphorylates PLS1. The pathway from DNA damage to checkpoint activation and apoptosis is outlined.

277

Liu et al: Protein kinase C-! for cancer therapy Cardiolipin translocation is directly tied to the sensitivity of Cardiolipin translocation is directly tied to the sensitivity of mitochondria to tBid-induced cytochrome c release. Because tBid targeting to the mitochondria is mediated by cardiolipin (Lutter et al, 2000), the translocation of cardiolipin from the inner membrane to outer membrane facilitates the recruitment of tBid (Liu et al, 2003b). This idea was confirmed by the finding that mitochondria overexpressing PLS3 were more sensitive to tBid-induced cytochrome c release, whereas those expressing inactive mutant PLS3 were more resistant (Liu et al, 2003b). PLS3 fulfills the three criteria we defined for a physiological substrate of PKC-!. PLS3 can interact with PKC-! and be phosphorylated by PKC-! in vitro (Liu et al, 2003a). HeLa cells expressing PLS3 become more positive in TUNEL studies when they were treated with the phorbol ester, PMA. Expression of mitochondriatargeted PKC-! in cells resulted in apoptosis, and overexpression of PLS3 enhanced this effect. In contrast, overexpression of the inactive PLS3 mutant did not generate this response (Liu et al, 2003a). These data support the view that PLS3 is a mitochondrial target of PKC-!-induced apoptosis.

inactivation of aminophospholipid translocase and activation of the scramblase (Bevers et al, 1998; 1999), but definitive proof of this hypothesis has not yet been materialized. A second plasma membrane target of PKC-! is Fyn kinase, found in the plasma membrane of platelets (Crosby and Poole, 2003). In platelets, activation of PKC by phorbol ester induces platelet degranulation and activation of the integrin "IIb#III. Crosby et al. (2003) showed that activation of the platelet adhesion complex is associated with interaction of Fyn kinase and PKC-!, but not other members of the PKC family. Fyn kinase is also phosphorylated at a serine residue that is found within a PKC consensus sequence. Whether this finding is tied to apoptosis is unknown.

IX. PKC-! is a survival factor in several cancer cells In addition to promoting apoptosis, PKC-! also enhances survival in several types of cancer cells. For example, one study using non-small cell lung cancer (NSCLC) cells, most of the PKC isoforms had enhanced phosphorylation compared to primary human lung epithelial cells (Clark et al, 2003). These authors also showed that blocking PKC-! with rottlerin was highly effective in potentiating chemotherapy-induced apoptosis, and that transfection of cells with a kinase-dead mutant of PKC-! increased apoptosis (Clark et al, 2003). McCracken et al, (2003) used antisense oligonucleotides to downregulate various PKC isoforms in MCF-7 breast cancer cells, and found that down-regulation of PKC-! impaired survival in response to $-irradiation. Similar findings were achieved with rottlerin and a dominant-negative mutant of PKC-!. However, neither of these two studies addressed the translocation of PKC-!. Therefore, it is unclear whether the observed opposite effects of PKC-! are due to differences in translocation or to targeting of different substrates in each cell line.

VIII. PKC-! substrates in the plasma Another member of PLS family, PLS1, has been shown to be a target of PKC-! in the plasma membrane (Frasch et al, 2000). PLS1 is phosphorylated by PKC-! at a PKC phosphorylation consensus site, Thr161. Co-expression of PKC-! and PLS1 significantly increased the activity of scramblase following PMA treatment (Frasch et al, 2000). In contrast, co-expression of PKC-! and a T161A mutant of PLS1 showed no increase in scramblase activity, indicating that phosphorylation of Thr161 by PKC-! is important for scramblase function (Frasch et al, 2000). In addition, PLS1 can be phosphorylated by c-Abl, a kinase known to interact with PKC-! in other organelles (Sun et al, 2001). Although there is solid evidence that PLS1 is activated during apoptosis (Zhao et al, 1998 ; Frasch et al, 2000), a direct link between PLS1 and apoptosis has not been fully established. During apoptosis, phosphatidylserine (PS) translocates from the inner leaflet to the outer leaflet of the plasma membrane. The regulation of transbilayer movement of phospholipids is controlled by at least three enzymes. One is aminophospholipid translocase, or flippase, which moves phospholipids inwards. One is the phospholipid scramblase (PLS1) that moves phospholipids bidirectionally. The third is a less well-characterized outward-directed floppase (Bevers et al, 1999). Probably due to the complexity of the regulation of phospholipid topology in lipid bilayers, cells from mice with homozygous for a deletion of PLS1 still maintain their ability to translocate PS to the surface (Zhou et al, 2002). This could presumably be due to compensation by aminophospholipid translocase activity. Therefore the mechanism of surface translocation of PS remains unclear. It has been hypothesized that apoptosis is associated with

X. Unanswered questions When DNA is damaged by chemotherapeutic agents or irradiation, one would imagine that an early event would be activation of a checkpoint to stop DNA replication or cell cycle progression. This step might be followed by DNA repair or by apoptosis if the damage is too extensive to repair. PKC-! clearly plays an important role in both of these steps. However, it remains an unanswered question how signals are transmitted from checkpoint activation to PKC-! or to mitochondria to activate the cell death cascade (see diagram). This is perhaps the most important question in current studies of apoptosis.

XI. Using PKC-! as a therapeutic target Based on the ample evidence that PKC-! enhances apoptotic responses in certain systems, attempts have been 278

Cancer Therapy Vol 1, page 279 made to target PKC-! in cancers in which PKC-! is known to play a pro-apoptotic, but not pro-survival, role. This has been a very challenging task because none of the PKC activators is specific enough to activate solely PKC-! without any stimulation of the other classic PKCs. One promising drug is a derivative of adriamycin, Nbenzyladriamycin-14-valerate (AD198), which does not inhibit topoisomerase II and binds DNA weakly in contrast to its parental drug adriamycin (Barrett et al, 2002, Roaten et al, 2002). AD198 has a potent anti-tumor effect through activation of PKC-! by interacting with the regulatory domain of PKC-! like the phorbol ester. More importantly, AD198 can override the anti-apoptotic effect of Bcl-2, a common problem in many malignancies (Barrett et al, 2002). It will be interesting to see how effective AD198 is in future clinical studies. Another potential approach is gene therapy to introduce PKC-! by adenoviral vectors, which have been achieved in cell lines (Li et al, 1999). Other approaches include blocking PKC-! degradation through inhibition of the ubiquitin-proteasome pathway (Lu et al, 1998), for which bortezomib (PS-341) is available. We have observed that bortezomib induces activation and accumulation of PKC-! in mitochondria and that the PKC! inhibitor rottlerin compromises the apoptotic effect of bortezomib (Durrant and Lee, manuscript in preparation). Finally, modulation of tyrosine phosphorylation of PKC-! through blocking of Src kinase family and activation of PKC-! is also possible (Joseloff et al, 2002), as there are Src kinase inhibitors in the preclinical developmental stage.

What about the possibility of using Rad9 as a target for the induction of apoptosis? Indeed, overexpression of Rad9 in cells was shown to be pro-apoptotic; whereas down-regulation of Rad9 by an antisense vector suppressed apoptosis (Komatsu et al, 2000). The mechanism of Rad9-induced apoptosis is unclear, but it has been shown that Rad9 contains a BH3 domain and can interact with Bcl-2 and Bcl-xL. Hence Rad9-induced apoptosis could be mediated by inhibition of Bcl-2 through its BH3 domain, or indirectly though the general DNA damage-induced apoptotic pathway. Until the mechanism is sorted out, it may not be practical to use Rad9 as a therapeutic target. Another potential target is PLS3, a newly recognized member of the scramblase family that is present in the mitochondria. There is limited information regarding the function of this enzyme, though its function is apparently very critical for mitochondria. It has been reported that overexpression of wild-type PLS3 enhanced UV-induced apoptosis; whereas expression of an inactive PLS3 mutant suppressed apoptosis. Using 32P labeling and TLC analysis of the phospholipids in mitochondrial inner and outer membranes, Liu et al. (2003b) found that PLS3 may be responsible for moving cardiolipin from the mitochondrial inner membrane to the outer membrane during apoptosis. The translocation of cardiolipin to the mitochondrial outer membrane enhanced sensitivity to tBid-induced cytochrome c release. To target PLS3 to induce apoptosis, we need to have a better understanding of PLS3, and to identify compounds that activate PLS3 to induce mitochondrial apoptosis. A caveat to this approach is that PLS3 has transmembrane domains and thus it is technically difficult to obtain large quantities of recombinant protein for high-throughput screening to identify such activators. Could the MAPK pathway be targeted based on the observation that PKC-! activates SAPK/JNK? The activation of the DNA-damage checkpoint is a protective mechanism to prevent cell cycle progression in the presence of DNA damage. When DNA damage becomes so severe that it is beyond the capacity of repair, the apoptotic pathway is activated. It is currently unknown how DNA damage signals are transmitted to mitochondria. PKC-! and SAPK/JNK are candidates, but the exact mechanism is far from clear. Inhibitors of various MAPK pathways are currently available and may proceed to clinical trials in the near future. Potential advantages include the fact that they block survival signals and downregulate checkpoint regulation to facilitate the activation of apoptosis. In conclusion, PKC-! is clearly an important mediator of the apoptotic pathway with diverse downstream effectors in cells. These facts make it a good target for the development of therapeutic interventions, with the potential benefit of avoiding the development of drug resistance. We anticipate the future development of PKC-!-specific activators, such as AD198, and further understanding of its downstream effectors such as Rad9 and PLS3, so that novel cancer therapeutic approaches can be developed utilizing these targets. Moreover, the novel PKC-!-based therapy may well be used in combination to

XII. Using downstream effectors of PKC-! as therapeutic targets Given the dual roles of PKC-! in promoting survival and apoptosis, it might be better to utilize downstream effectors of PKC-! as potential targets for induction of apoptosis in cancer therapy. One potential target in both the nucleus and mitochondria is c-Abl, since a drug is available, STI-571 (Gleevec), that blocks the tyrosine kinase activity of the fusion protein Bcr-Abl, and effectively controls the proliferation and induces apoptosis in chronic myelocytic leukemia (CML) cells with minimal side effects. STI-571 is widely used to treat CML (Druker et al, 2001; O'Dwyer et al, 2003). However, the in vivo situation may be more complicated with the kinase activity of c-Abl acting as a double-edged sword, like PKC-!. With DNA damage-induced apoptosis, the kinase activity of c-Abl is activated by PKC-!-induced phosphorylation, and is required for the apoptotic response. Given this fact, we predict that blocking the kinase activity of c-Abl will inhibit apoptosis, an opposite effect to that observed in CML cells. This concern was confirmed by Kumar et al., who demonstrated that STI-571 abrogated the cell death response to H2O2 in U937 myeloid leukemia cells (Kumar et al, 2003). This anti-apoptotic effect of STI-571 may explain why STI-571 is only effective in very limited numbers of cancers.

279

Liu et al: Protein kinase C-! for cancer therapy protein kinase C delta by an ICE-like protease in apoptotic cells. EMBO J 14, 6148-56. Frasch, S.C., P.M. Henson, J.M. Kailey, D.A. Richter, M.S. Janes, V.A. Fadok, and D.L. Bratton (2000) Regulation of phospholipid scramblase activity during apoptosis and cell activation by protein kinase Cdelta. J Biol Chem 275, 23065-73. Ghayur, T., M. Hugunin, R.V. Talanian, S. Ratnofsky, C. Quinlan, Y. Emoto, P. Pandey, R. Datta, Y. Huang, S. Kharbanda, H. Allen, R. Kamen, W. Wong, and D. Kufe (1996) Proteolytic activation of protein kinase C delta by an ICE/CED 3-like protease induces characteristics of apoptosis. J Exp Med 184, 2399-404. Green, D.R. and G.I. Evan (2002) A matter of life and death. Cancer Cell 1, 19-30. Hofmann, J. ( 2001) Modulation of protein kinase C in antitumor treatment. Rev Physiol Biochem Pharmacol 142, 1-96. Ito, Y., N.C. Mishra, K. Yoshida, S. Kharbanda, S. Saxena, and D. Kufe (2001) Mitochondrial targeting of JNK/SAPK in the phorbol ester response of myeloid leukemia cells. Cell Death Differ 8, 794-800. Ito, Y., P. Pandey, N. Mishra, S. Kumar, N. Narula, S. Kharbanda, S. Saxena, and D. Kufe (2001) Targeting of the c-Abl Tyrosine Kinase to Mitochondria in Endoplasmic Reticulum Stress-Induced Apoptosis. Mol Cell Biol 21, 6233-42. Joseloff, E., C. Cataisson, H. Aamodt, H. Ocheni, P. Blumberg, A.J. Kraker, S.H. Yuspa (2002) Src family kinases phosphorylate protein kinase C delta on tyrosine residues and modify the neoplastic phenotype of skin keratinocytes. J Biol Chem 277: 12318-23. Komatsu, K., T. Miyashita, H. Hang, K.M. Hopkins, W. Zheng, S. Cuddeback, M. Yamada, H.B. Lieberman, and H.G. Wang (2000) Human homologue of S. pombe Rad9 interacts with BCL-2/BCL-xL and promotes apoptosis. Nat Cell Biol 2, 16. Konishi, H., E. Yamauchi, H. Taniguchi, T. Yamamoto, H. Matsuzaki, Y. Takemura, K. Ohmae, U. Kikkawa, and Y. Nishizuka (2001) Phosphorylation sites of protein kinase C delta in H2O2-treated cells and its activation by tyrosine kinase in vitro. Proc Natl Acad Sci U S A 98, 6587-92. Kumar, S., N. Mishra, D. Raina, S. Saxena, and D. Kufe (2003) Abrogation of the cell death response to oxidative stress by the c-Abl tyrosine kinase inhibitor STI571. Mol Pharmacol 63, 276-82. Li, L., P.S. Lorenzo, K. Bogi, P.M. Blumberg, and S.H. Yuspa (1999) Protein kinase Cdelta targets mitochondria, alters mitochondrial membrane potential, and induces apoptosis in normal and neoplastic keratinocytes when overexpressed by an adenoviral vector. Mol Cell Biol 19, 8547-58. Liu, J., J. Chen, Q. Dai, and R.M. Lee (2003) Phospholipid Scramblase 3 Is the Mitochondrial Target of Protein Kinase C delta-induced Apoptosis. Cancer Res 63, 1153-6. Liu, j., Q. Dai, J. Chen, D. Durrant, A. Freeman, T. Liu, D. Grossman, and R.M. Lee (2003) Phospholipid scramblase 3 controls mitochondiral structure, function and apoptotic response. Molecular Cancer Research 1, 892-902. Lu, Z., D. Liu, A. Hornia, W. Devonish, M. Pagano, and D.A. Foster (1998) Activation of protein kinase C triggers its ubiquitination and degradation. Mol Cell Biol 18, 839-45. Lutter, M., M. Fang, X. Luo, M. Nishijima, X. Xie, and X. Wang (2000) Cardiolipin provides specificity for targeting of tBid to mitochondria. Nat Cell Biol 2, 754-761. Majumder, P.K., N.C. Mishra, X. Sun, A. Bharti, S. Kharbanda, S. Saxena, and D. Kufe (2001) Targeting of protein kinase C delta to mitochondria in the oxidative stress response. Cell Growth Differ 12, 465-70.

create synergism with other agents and help to prevent the development of drug resistance.

Acknowledgement: We thank Ellen Wilson, PhD. for reading and editing the manuscript.

References Adams, J.M. and S. Cory (2001) Life-or-death decisions by the Bcl-2 protein family. Trends Biochem Sci 26, 61-6. al-Khodairy, F., E. Fotou, K.S. Sheldrick, D.J. Griffiths, A.R. Lehmann, and A.M. Carr (1994) Identification and characterization of new elements involved in checkpoint and feedback controls in fission yeast. Mol Biol Cell 5,147-60 Barrett, C. M., F. L. Lewis, et al. (2002) Novel extranucleartargeted anthracyclines override the antiapoptotic functions of Bcl-2 and target protein kinase C pathways to induce apoptosis. Mol Cancer Ther 1: 469-81. Bevers, E.M., P. Comfurius, D.W. Dekkers, and R.F. Zwaal (1999) Lipid translocation across the plasma membrane of mammalian cells. Biochim Biophys Acta 1439, 317-30. Bevers, E.M., P. Comfurius, D.W. Dekkers, M. Harmsma, and R.F. Zwaal (1998) Transmembrane phospholipid distribution in blood cells: control mechanisms and pathophysiological significance. Biol Chem 379, 973-86. Blass, M., I. Kronfeld, G. Kazimirsky, P.M. Blumberg, and C. Brodie (2002) Tyrosine phosphorylation of protein kinase Cdelta is essential for its apoptotic effect in response to etoposide. Mol Cell Biol 22, 182-95. Brodie, C. and P.M. Blumberg (2003) Regulation of cell apoptosis by protein kinase c delta. Apoptosis 8, 19-27. Chen, M.J., Y.T. Lin, H.B. Lieberman, G. Chen, and E.Y. Lee (2001) ATM-dependent phosphorylation of human Rad9 is required for ionizing radiation-induced checkpoint activation. J Biol Chem 276, 16580-6. Clark, A.S., K.A. West, P.M. Blumberg, and P.A. Dennis (2003) Altered protein kinase C (PKC) isoforms in non-small cell lung cancer cells: PKCdelta promotes cellular survival and chemotherapeutic resistance. Cancer Res 63, 780-6. Cory, S. and J.M. Adams (1998) Matters of life and death: programmed cell death at Cold Spring Harbor. Biochim Biophys Acta 1377, R25-44. Crosby, D. and A.W. Poole (2003) Physical and functional interaction between protein kinase C delta and Fyn tyrosine kinase in human platelets. J Biol Chem 278, 24533-41. Denning, M.F., Y. Wang, B.J. Nickoloff, and T. Wrone-Smith (1998) Protein kinase Cdelta is activated by caspasedependent proteolysis during ultraviolet radiation-induced apoptosis of human keratinocytes. J Biol Chem 273, 2999530002. Denning, M.F., Y. Wang, S. Tibudan, S. Alkan, B.J. Nickoloff, and J.Z. Qin (2002) Caspase activation and disruption of mitochondrial membrane potential during UV radiationinduced apoptosis of human keratinocytes requires activation of protein kinase C. Cell Death Differ 9, 40-52. DeVries, T.A., M.C. Neville, and M.E. Reyland (2002) Nuclear import of PKCdelta is required for apoptosis: identification of a novel nuclear import sequence. EMBO J 21, 6050-60. Druker, B.J., M. Talpaz, D.J. Resta, B. Peng, E. Buchdunger, J.M. Ford, N.B. Lydon, H. Kantarjian, R. Capdeville, S. Ohno-Jones, and C.L. Sawyers (2001) Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med 344, 1031-7. Emoto, Y., Y. Manome, G. Meinhardt, H. Kisaki, S. Kharbanda, M. Robertson, T. Ghayur, W.W. Wong, R. Kamen, R. Weichselbaum, and et al. (1995) Proteolytic activation of

280

Cancer Therapy Vol 1, page 281 Majumder, P.K., P. Pandey, X. Sun, K. Cheng, R. Datta, S. Saxena, S. Kharbanda, and D. Kufe (2000) Mitochondrial translocation of protein kinase C delta in phorbol esterinduced cytochrome c release and apoptosis. J Biol Chem 275, 21793-6. Mandil, R., E. Ashkenazi, M. Blass, I. Kronfeld, G. Kazimirsky, G. Rosenthal, F. Umansky, P.S. Lorenzo, P.M. Blumberg, and C. Brodie (2001) Protein kinase Calpha and protein kinase Cdelta play opposite roles in the proliferation and apoptosis of glioma cells. Cancer Res 61, 4612-9. Marshall, J.L., N. Bangalore, D. El-Ashry, Y. Fuxman, M. Johnson, B. Norris, M. Oberst, E. Ness, S. Wojtowicz-Praga, P. Bhargava, N. Rizvi, S. Baidas, and M.J. Hawkins (2002) Phase I study of prolonged infusion Bryostatin-1 in patients with advanced malignancies. Cancer Biol Ther 1, 409-16. McCracken, M.A., L.J. Miraglia, R.A. McKay, and J.S. Strobl (2003) Protein kinase C delta is a prosurvival factor in human breast tumor cell lines. Mol Cancer Ther 2, 273-81. Mecklenbrauker, I., K. Saijo, N.Y. Zheng, M. Leitges, and A. Tarakhovsky (2002) Protein kinase Cdelta controls selfantigen-induced B-cell tolerance. Nature 416, 860-5. Miyamoto, A., K. Nakayama, H. Imaki, S. Hirose, Y. Jiang, M. Abe, T. Tsukiyama, H. Nagahama, S. Ohno, S. Hatakeyama, and K.I. Nakayama (2002) Increased proliferation of B cells and auto-immunity in mice lacking protein kinase Cdelta. Nature 416, 865-9. O'Dwyer, M.E., M.J. Mauro, and B.J. Druker (2003) STI571 as a targeted therapy for CML. Cancer Invest 21, 429-38. Ohno, S., The distinct Biological Potential of PKC Isotypes, in Protein kinase C, P. Parker and L.V. Dekker Editors. 1997, R.G. Landes Company. Parker, P.J. and Dekker, L.V., Protein kinase C. 1997: R. G. Landers Company. Reed, J.C. (1999) Dysregulation of apoptosis in cancer. J Clin Oncol 17, 2941-53. Reyland, M.E., S.M. Anderson, A.A. Matassa, K.A. Barzen, and D.O. Quissell (1999) Protein kinase C delta is essential for etoposide-induced apoptosis in salivary gland acinar cells. J Biol Chem 274, 19115-23. Roaten, J. B., M. G. Kazanietz, M.J. Caloca, P.J. Bertics, L. Lothstein, A.L. Parrill, M. Israel, T.W. Sweatman (2002) Interaction of the novel anthracycline antitumor agent Nbenzyladriamycin-14-valerate with the C1-regulatory domain of protein kinase C: structural requirements, isoform specificity, and correlation with drug cytotoxicity. Mol Cancer Ther 1: 483-92. Roychowdhury, D. and M. Lahn (2003) Antisense therapy directed to protein kinase C-alpha (Affinitak, LY900003/ISIS 3521): potential role in breast cancer. Semin Oncol 30, 30-3. Scheel-Toellner, D., D. Pilling, A.N. Akbar, D. Hardie, G. Lombardi, M. Salmon, and J.M. Lord (1999) Inhibition of T cell apoptosis by IFN-beta rapidly reverses nuclear translocation of protein kinase C-delta. Eur J Immunol 29, 2603-12. Sims, P.J. and T. Wiedmer (2001) Unraveling the mysteries of phospholipid scrambling. Thromb Haemost 86, 266-75. Sun, J., J. Zhao, M.A. Schwartz, J.Y. Wang, T. Wiedmer, and P.J. Sims (2001) c-Abl tyrosine kinase binds and phosphorylates phospholipid scramblase 1. J Biol Chem 276, 28984-90. Sun, X., F. Wu, R. Datta, S. Kharbanda, and D. Kufe (2000) Interaction between protein kinase C delta and the c-Abl tyrosine kinase in the cellular response to oxidative stress. J Biol Chem 275, 7470-3.

Sun, X., P. Majumder, H. Shioya, F. Wu, S. Kumar, R. Weichselbaum, S. Kharbanda, and D. Kufe (2000) Activation of the cytoplasmic c-Abl tyrosine kinase by reactive oxygen species. J Biol Chem 275, 17237-40. Swannie, H.C. and S.B. Kaye (2002) Protein kinase C inhibitors. Curr Oncol Rep 4, 37-46. Volkmer, E. and L.M. Karnitz (1999) Human homologs of Schizosaccharomyces pombe rad1, hus1, and rad9 form a DNA damage-responsive protein complex. J Biol Chem 274, 567-70. Wang, X.Y., E. Repasky, and H.T. Liu (1999) Antisense inhibition of protein kinase Calpha reverses the transformed phenotype in human lung carcinoma cells. Exp Cell Res 250, 253-63. Yoshida, K., H.G. Wang, Y. Miki, and D. Kufe (2003) Protein kinase Cdelta is responsible for constitutive and DNA damage-induced phosphorylation of Rad9. Embo J 22, 1431-41. Yoshida, K., K. Komatsu, H.G. Wang, and D. Kufe (2002) c-Abl tyrosine kinase regulates the human Rad9 checkpoint protein in response to DNA damage. Mol Cell Biol 22, 3292-300. Yoshida, K., Y. Miki, and D. Kufe (2002) Activation of SAPK/JNK signaling by protein kinase Cdelta in response to DNA damage. J Biol Chem 277, 48372-8. Yuan, Z.M., T. Utsugisawa, T. Ishiko, S. Nakada, Y. Huang, S. Kharbanda, R. Weichselbaum, and D. Kufe (1998) Activation of protein kinase C delta by the c-Abl tyrosine kinase in response to ionizing radiation. Oncogene 16, 16438. Zhao, J., Q. Zhou, T. Wiedmer, and P.J. Sims (1998) Level of expression of phospholipid scramblase regulates induced movement of phosphatidylserine to the cell surface. J Biol Chem 273, 6603-6. Zhou, G., M.L. Seibenhener, and M.W. Wooten (1997) Nucleolin is a protein kinase C-zeta substrate. Connection between cell surface signaling and nucleus in PC12 cells. J Biol Chem 272, 31130-7. Zhou, Q., J. Zhao, J.G. Stout, R.A. Luhm, T. Wiedmer, and P.J. Sims (1997) Molecular cloning of human plasma membrane phospholipid scramblase. A protein mediating transbilayer movement of plasma membrane phospholipids. J Biol Chem 272, 18240-4. Zhou, Q., J. Zhao, T. Wiedmer, and P.J. Sims (2002) Normal hemostasis but defective hematopoietic response to growth factors in mice deficient in phospholipid scramblase 1. Blood 99, 4030-8.

Dr. Ray M. Lee

281

Liu et al: Protein kinase C-! for cancer therapy

282

Cancer Therapy Vol 1, page 283 Cancer Therapy Vol 1, 283-291, 2003.

A Phase I safety and imaging study using radiofrequency ablation (RFA) followed by 131IchTNT-1/B radioimmunotherapy adjuvant treatment of hepatic metastases Research Article

Peter M. Anderson1,2,3*, Gregory A. Wiseman3,4, Bradley D. Lewis5, J. William Charboneau5, William L. Dunn4, Susan P. Carpenter6, Terrence Chew6 Dept. of Pediatrics1, Internal Medicine (Hematology)2, and Mayo Clinic Comprehensive Cancer Center3, Nuclear Medicine4, and Radiology5, Mayo Clinic, Rochester MN, Peregrine Pharmaceuticals6, Tustin CA

__________________________________________________________________________________ Correspondence: Peter M. Anderson MD, PhD, Mayo Clinic, 200 First St. SW, Rochester MN 55905, Phone: 507-284-3442; Fax 507284-0727; e-mail: anderson.peter@mayo.edu Key Words: cancer, monoclonal antibody, liver metastases, radioimmunotherapy, radiofrequency ablation Abbreviations: Radiofrequency ablation (RFA); Human anti-chimeric antibody (HACA) Received: 27 October 2003; Accepted: 1 December 2003; electronically published: December 2003

Summary Biologic therapy of solid tumors with monoclonal antibodies has been difficult due to poor antibody localization and heterogeneous expression of target antigens. TNT-1/B is a murine-human monoclonal antibody that recognizes a DNA/histone 1 epitope and concentrates in necrotic tissue and is now available as genetically engineered murinehuman chimeric (ch) construct. Thus, the binding of chTNT-1/B to areas of necrosis in tumors has potential to treat a very wide variety of cancers. Since radiofrequency ablation (RFA) of tumor nodules reliably produces 1-5 cm zones of >99% necrotic tissue, RFA may create abundant binding sites for chTNT-1/B, regardless of initial tumor histology. Study design and results: Hepatic distribution and safety of iv 131I-chTNT-1/B (Peregrine Pharmaceuticals, Tustin CA) given after RFA of hepatic metastases was evaluated in six patients. Five of 6 had metastatic disease confined to the liver. Diagnoses included carcinoid, leiomyosarcoma, colon adenocarcinoma and islet cell carcinoma. RFA of metastases was done in a standard manner under ultrasound guidance using the RITA device. Liver function tests were monitored sequentially after RFA Patients were eligible to receive the 131I radiolabeled antibody when AST and ALT were ! CTC grade 3 and also decreased on 2 successive days and performance was acceptable for the procedure. Patients that had the RFA procedure done percutaneously received the 131I -chTNT-1/B at 3, 3, 4, and 6 days after the procedure. The two patients having RFA intraoperatively received the 131I-chTNT-1/B somewhat later (6 and 10 days). Patients received 0.35 mCi/Kg or 0.71 mCi/Kg 131IchTNT-1/B; total doses ranged between 22 and 55 mCi. Infusions were given over 30 minutes; no infusion toxicity was seen. Between 12 to 29% (Mean 28.1 +/- 4.0%) of an injected dose concentrated in the liver. Gamma camera imaging confirmed selective and avid targeting of radioisotope to areas of RFA within the liver. No significant adverse events were observed. Conclusion: The chTNT-1/B construct has excellent potential to become useful after RFA. Zones of necrosis that facilitate 131I-chTNT-1/B antibody binding were probably created after RFA. A further improvement in patient convenience and specific targeting with this promising immunoconjugate may also be possible using direct antibody injection at the end of the RFA procedure into the zone of necrosis using temperature monitoring. elimination of commonly encountered adenocarcinomas (i.e. >5000 cGy; Goldenberg, 2002, 2003). Other obstacles to radioimmunotherapy of solid tumors include the need to spare radiosensitive normal organs such as the bone marrow, and heterogeneity of target antigen expression and density (Weiner, 1999; von Mehren et al, 2003).

I. Introduction Successful biologic therapy of cancer using monoclonal antibodies against solid tumors has been difficult. In humans, only about 0.001-0.01% of an injected dose of antibody per gram of tumor is delivered, resulting in radiation doses inadequate for the task of 283

Anderson et al: Treatment of hepatic metastases with (RFA) and 131I-chTNT-1/B Nevertheless, the field has experienced revival since successful therapy for hematologic malignancies including non-Hodgkins lymphoma using monoclonal antibodies such as anti-CD20 (Rituxan) and 90Y-anti-CD20 (Zevalin; Witzig et al, 2002). Since target: non-target ratios of antibody binding determine the imaging and non-specific dose-limiting toxicities, a variety of strategies are being tested to improve specificity and efficacy of antibody therapy against non-hematologic cancer. These include affinityenhancement systems with bi-specific antibodies to separate antibody targeting and the delivery of the radioactive payload to the site of neoplasia (Goldenberg, 2002, 2003). Other strategies to increase therapeutic index also include use chemical modification to improve pharmacokinetics (Sharifi et al, 1998) and intact or fragments of interleukin-2 cytokine-antibody fusion proteins to improve vascular permeability (Hu et al, 1996, 2003; Hornick et al, 1999; Carnemolla et al, 2002; Epstein et al, 2003). Although biotin is more commonly used in two and three step pre-targeting methods with streptavidin or avidin, this chemical modification procedure also lowers the ionic charge of the antibody to decrease nonspecific binding in tissues and blood. Thus chTNT-1/B had better performance than chTNT-1 in vivo including better tumor uptake, less non-specific uptake in normal tissues, faster clearance profile (Sharifi et al, 1998). At the present time treatment of metastatic colorectal cancer with radioimmunotherapy has been most successful in the adjuvant setting or in small volume disease (Behr et al, 2002). Another means to increase therapeutic index is to use an antibody that spares normal tissue and binds necrotic tumor tissue (Epstein et al, 1988; 1991; Chen et al, 1989; 1990; Miller et al, 1993). TNT-1 is an antibody that binds a 22 kilodalton nuclear protein associated with the DNA/histone H1 (Epstein et al, 1988). In pre-clinical murine models, however, biodistribution of TNT-1 to human xenografts was similar to other antibodies against solid tumors- about 2% of an injected dose/gram tumor tissue. One means to overcome low accretion into tumor is to directly inject the antibody into a tumor cavity to reduce systemic toxicity. Results of a phase I trial of 131I- chTNT1/B in brain tumors indicated that 20-40 mCi could deliver 700-13,000 cGy to the tumor with 34 +/- 9% dose retention at 24 hours, and a half-life of about 46 +/- 16 hours (Patel et al, 1999). A recently completed phase II trial in brain tumors with 131I-chTNT-1/B showed that after 8.6 to 52 mCi injected locally, the calculated tumor dose was 1641 to 11,171 cGy (Wessels et al, 2001). Because of the critical location of antibody infusion in the brain tumor trials of chTNT-1/B, it is not clear in many cases whether adverse events were related to underlying brain tumor, induction of necrosis, or radiolabeled antibody. Since the target epitope of chTNT-1/B, histone H1/DNA, is available for antibody binding only in necrotic tissue (Epstein et al, 1988), physical means to increase necrosis within a tumor may possibly enhance chTNT-1/B targeting to areas of tumor. Percutaneous ethanol injection is one means to produce necrosis and destroy tumor nodules (Livraghi et al, 1995; Virag et al,

1997; Isozaki et al, 1999; Meloni et al, 2001; Lewis et al, 2002). Radiofrequency ablation (RFA) which uses thermal energy at the tip of a radiofrequency probe is another reliable means to induce 1-5 cm zones of necrosis in hepatic tumor nodules (Bilchik et al, 1999; Wood et al, 2000; Izzo et al, 2001; Charboneau et al, 2002; Curley and Izzo, 2002a, b; Dick et al, 2002; Livraghi and Meloni, 2002; Nordlinger and Rougier, 2002; Seidenfeld et al, 2002a, b; Shibata et al, 2002; Garcea et al, 2003; Lau et al, 2003; Numata et al, 2003). Thus, RFA should markedly increase sites of chTNT-1/B in tumor nodules compared to the amount of necrosis normally present in macroscopic tumor nodules. Therefore, we conducted a limited, phase I study to determine safety and hepatic distribution of 131IchTNT-1/B given intravenously after RFA of hepatic metastases. 131I-chTNT-1/B is a binotinylated40, chimeric antibody with radioiodine attached as shown in Figure 1.

II. Materials and methods A. Materials 131

I-chTNT-1/B was supplied by Peregrine, Inc (Tustin

CA).

B. Methods All patients were informed of indications, risks, and alternatives and signed informed consent. The protocol was approved by the Mayo Clinic Institutional Review Board (IRB O-368-01). Patients with any type of cancer that would have RFA of at least 1 hepatic metastasis were eligible. Other criteria included: no more than two prior chemotherapy regimens, no prior radiotherapy to the liver, > 14 years of age. Karnofsky Performance Status " 70%, adequate CBC as evidenced by absolute neutrophil count > 1,000/mm3 (! Grade 2 toxicity), platelets > 75,000/mm3 (! Grade 2 toxicity), hemoglobin > 8.0 g/dL (! Grade 2 toxicity, and adequate renal function (Cr<3 x ULN; 3.6 mg/dL for males; 2.7 mg/dL for females; ! Grade 2 toxicity). Adequate liver function before RFA was total bilirubin ! 1.5 x ULN; AST, ALT !2.5 x ULN (i.e. <Grade 2 toxicity) and after RFA (within 3 to10 days): total bilirubin ! 3 x ULN; AST, ALT !20 x ULN (i.e. !Grade 3 toxicity). Patients were offered percutaneous or intraoperative RFA as per recommendation of medical oncology and/or surgery consultants before study entry. RFA was done in a standard manner using the RITA device. Ablation of hepatic lesions was confirmed by CT scan. 131I-chTNT-1/B antibody infusion was done 3-10 days after RFA using standard radiation safety precautions when performance was >70%, patients had received at least 2 days of SSKI to protect the thyroid (4 gtt po TID x 14 days), and both AST and ALT were ! CTC grade 3 and had decreased on two consecutive days. Pretreatment prior to 131I-chTNT-1/B antibody infusion consisted of 650 mg acetaminophen and diphenhydramine 50 mg and 250 cc normal saline over 1 hour. 131I-chTNT-1/B was diluted to 50 mL with normal saline and 5% human serum albumin and infused by nuclear medicine personnel over 30 minutes using a lead shielded syringe pump. Total Body Retention Survey (G-M readings) were done daily x 3 and side effects were monitored. SPECT imaging was done on day 3, 4, or 5 after antibody infusion. CBC, liver function tests (AST, ALT, biliribin) were monitored twice weekly x 4 weeks (e.g. day 3, 7, 10, 14, 17, 21, 24, 28). Creatinine was monitored weekly.

284

Cancer Therapy Vol 1, page 285 Figure 1. 131I-chTNT-1/B

Age 20

Sex M

74 81

M M

65 49

F F

Table 1. Patient Characteristics Prior to RFA of Hepatic Metastases Liver Metastasis Karnofsky Diagnosis Size (cm2) Segment Performance score Carcinoid 1.0 8 100 1.3 8 leiomyosarcoma 44.4 4A 90 2.0 5/8 adenocarcinoma 1.6 8 100 adenocarcinoma 16.8 3 90 2/4 17.2 3.2 8 5.6 4E 6.2 6 islet cell <5 -100 islet cell 0.8 6/7 100 1.4 6/7

CT scans confirmed ablation in all patients. Patients had close monitoring of liver function after RFA and all were eligible to receive 131I-chTNT-1/B when LFT had returned to grade 3 CTC and performance was adequate (Karnofsky >70%). Doses infused are detailed in Table 2. Post procedural pain requiring overnight hospitalization occurred in one of the four patients having RFA percutaneously. Median duration from RFA to infusion of 131I-chTNT-1/B in the percutaneous RFA group was 5 days. In the two patients that had RFA done during hepatic surgery, hepatic function as assessed by AST and ALT recovered more quickly than performance and it was 6 and 10 days before 131I-chTNT-1/B was infused. As expected AST, ALT progressively decreased after RFA and became CTC grade 2 (2-5 x ULN) or 3 (>5-20 x ULN) in all patients (Table 3). Bilirubin increase did not ever exceed grade 1 CTC criteria (>1.5 x ULN) Peak elevation of AST and ALT was always on the first determination after RFA with subsequent steady decline. There were no side effects nor significant changes in liver function tests associated with the 131I-chTNT-1/B antibody infusion (Table 3). Targeting of 131I-to areas of the liver that previously had RFA was confirmed by radioscintigraphy (Figures 5, 6, 7). Other parameters that remained normal during period of observation included renal function as determined by

Figure 2. RFA, then 131I-chTNT-1/B study schema. Follow-up visit at 8 weeks included physical exam, discussion of side effects, determination of Karnofsky Performance Status, blood tests (TSH, CBC, chemistry panel), urinalysis, and imaging of the liver metastases.

III. Results Table 1 details patient characteristics including segmental location of indicator lesions in the liver. Figure 1 depicts the structure of 131I-chTNT-1/B, the agent to be tested. Figure 2 shows a schematic diagram of the protocol design. RFA of hepatic lesions was done in a standard manner using ultrasound imaging (Figure 3, 4). 285

Anderson et al: Treatment of hepatic metastases with (RFA) and 131I-chTNT-1/B SPECT confirmed relative selectivity of 131I -TNT-1/B localization to hepatic RFA sites (Figures 5, 6, 7). Examples of gamma camera imaging showing the focally increased hepatic localization of the 131I radioisotope to RFA sites are apparent in Figures 5, 6, and 7. This occurred for all histologies. Pixel analysis showed a RFA target: background liver ratio average of 2.9 3 days after 131 I -TNT-1/B infusion of (Table 5). Because of volume imaging considerations it was not possible to perform dimetric calculations to estimate absorbed radiation dose of a nodule compared to surrounding normal tissue.

serum creatinine and urinalysis. Hematologic parameters did not change with exception of one very mild case of leukopenia (wbc 2000, ANC 1000; CTC grade 2) noted at week 8 which spontaneously resolved. One patient had increased TSH noted at follow-up visit but did not require hormone replacement. Human anti-chimeric antibody (HACA) titers were negative at both time points tested in 6 of 6 patients. Patients had imaging done 1, 2 and 3-5 days after antibody infusion. Approximately 30% of an injected dose of 131I-TNT-1/B became localized to the liver (Table 4).

Figure 3. Radiofrequency ablation (RFA) catheter

Figure 4. Ultrasound guided Radiofrequency ablation (RFA) of hepatic metastases

286

Cancer Therapy Vol 1, page 287

Patient 1 2 3 4 5 6

Table 2. Doses of 131I-chTNT-I/B Dose level Actual Total mCi/kg mCi/kg Dose (mCi) 0.35 0.35 34.3 0.35 0.35 22.1 0.35 0.35 31.6 0.71 0.50 35.2 0.71 0.56 44.6 0.71 0.71 55.0

Days s/p RFA 6 6 4 3 10 6

Table 3. Liver Function Tests after RFA and 131I-chTNT-1/B Patient 1 Patient 2 Patient 3 Patient 5 Patient 6 Bili/AST/ALT Bili/AST/ALT Bili/AST/ALT Bili/AST/ALT Bili/AST/ALT 0.3/108/216 0.6/241/ND 0.8/151/127 1.1/564/486 0.6/96/155 0.4/69/171 0.5/165/ND 0.7/51/91 1.0/280/318 0.3/60/109 0.3/47/131 0.9/103/ND 0.1/23/22 0.4/38/ND 0.4/20/26 0.1/43/69 0.3/19/23

Visit* 2 2.1 2.2 Post** chTNT-1/B *visit 2 is 1 day after RFA, 2.1 is 1-2 days later, and 2.2 is 2-3 days after RFA. ** Post is 3 days s/p infusion of 131I-TNT-1/B

Patient 4 Bili/AST/ALT 0.5/43/165 0.5/38/133 0.5/20/39

Figure 5. Metastatic carcinoid. CT pre and SPECT s/p RFA, then 131I-TNT-1/B

Figure 6. Hepatic metastases of colon adenocarcinoma. SPECT imaging s/p RFA, then 131I-TNT-1/B

287

Anderson et al: Treatment of hepatic metastases with (RFA) and 131I-chTNT-1/B

Figure 7. Hepatic metastases of colon adenocarcinoma. SPECT imaging s/p RFA, then 131I-TNT-1/B. Dose level 2; SPECT imaging

Table 4. Hepatic Distribution of TNT-1/B after RFA Patient Total dose Hours s/p % injected injected (mCi) Infusion dose in liver 1 34.3 97.1 34.6 2 22.1 70.2 37.8 3 31.6 70.8 12.3 4 35.2 44.2 24.1 5 44.6 96.5 23.6 6 55.0 49.5 36.3 Median Mean SD SEM

34.8 37.1 11.3 4.6

70.5 71.4 22.4 9.2

29.4 28.1 9.9 4.0

Table 5. Selectivity of 131I-TNT-1/B for regions of Necrosis s/p RFA: Target to Liver Background Ratioa Target to Background Patient Ratios Mean SEM 1 1.3;1.8;3.5 2.2 0.7 2 1.6;1.9;4.1 2.5 0.8 3 2.0;3.3;6.0 3.8 1.2 4 2.2;2.3;3.8 2.8 0.5 5 2.2;3.1;3.2 2.8 0.3 6 2.1;2.7;4.7 3.2 0.8 all patients (N=6; 3/patient) 2.9 0.3 a pixels of RFA lesion compared to equal area of adjacent liver Lesions s/p RFA were stable at 8 week follow-up. No patient had new disease at the 8 week follow-up visit. Two of 6 patients remain alive >15 months after completing the study, one of whom received a liver transplant. Four of 6 patients have died of progressive

disease. Unfortunately, histopathologic response to the therapy could not be accurately assessed in this safety and imaging study because of other therapeutic interventions including RFA and/or surgical resection of indicator hepatic metastases prior to 131I-chTNT-1/B infusion.

288

Cancer Therapy Vol 1, page 289 center after RFA, but before infusion. Newer RFA techniques use hypertonic saline injections (Ahmed et al, 2002) or saline infused through an RFA ablation device itself (e.g. RITA Medical Systems StarBurst XLi). A direct infusion of 131I-chTNT-1/B immunoconjugate and/or other agents into zones of necrosis within minutes after an RFA procedure could offer advantages including a) less systemic exposure to radioiodine b) improved patient convenience (“one-stop shopping”), and c) studies of additional means to increase effectiveness. Direct injection of some, but not all lesions treated with RFA would also permit efficient analysis of treatment efficacy by comparing time to recurrence in lesions treated with RFA alone versous lesions treated with RFA+ infusion of the agent into the lesion (i.e. paired statistics using patient’s own lesions as RF only control). Other additional potential means to enhance local treatment effects could also include using local application of radio-sensitizer chemotherapy (Gregoire et al, 1999), GM-CSF, or cytokine-antibody fusion protein such as IL2 peptidechTNT-1/B (Epstein et al, 2003). In conclusion, a radioactive antibody that binds a necrotic tissue, 131I-chTNT-1/B, was used in the context of standard RFA of hepatic metastases. No significant toxicity was observed.Nuclear Medicine imaging (SPECT) confirmed localization of the 131I-chTNT-1/B agent to lesions that had been physically ablated by the heat from the RFA procedure. This strategy has potential to improve cancer control in wide variety of malignancies.

IV. Discussion Recurrence of cancer in the liver after local, regional, or systemic treatment remains a common problem (Ravikumar and Gallos, 2002; Donckier et al, 2003). The number, size, and location of metastases, the presence of regional or systemic metastatic disease, and quality-of-life issues are important considerations in the choice of therapeutic options. Although monoclonal antibodies have potential for tumor selectivity compared to normal tissue, therapeutic efficacy has generally been low in solid tumors (Goldenberg, 2002, 2003). Reasons for this include the very low amount of an intravenously administered antibody dose actually reaching the tumor, specific and non-specific binding of other tissues, poor penetration into macroscopic disease, and heterogeneity of target antigen expression. RFA is an increasingly commonly used therapeutic modality for the cancer control in the liver. RFA has also been used in other locations including bone, lung, head and neck, and the kidney (de Baere et al, 2002; Callstrom et al, 2002; Owen et al, 2002; Schaefer et al, 2002, 2003; Jain et al, 2003; Steinke et al, 2003). Since the RFA procedure has a relatively low morbidity in the liver (de Baere et al, 2003; Steinke et al, 2003) and controls macroscopic disease, a well tolerated adjuvant therapy to reduce the potential for local recurrence after RFA would be an advance. In many patients, including those with colorectal adenocarcinoma metastatic to the liver, chemotherapy is often a reasonable adjuvant option (Kindler and Shulman, 2001; Bleiberg and Hendlisz, 2002; Scaife et al, 2003). However, for many patients with metastatic disease, chemotherapy has been previously used and/or is relatively ineffective. Quality-of-life considerations may also play an important role in choice of adjuvant options after RFA. Our study used a radiolabeled monoclonal antibody, 131 I-chTNT-1/B, that has very novel targeting characteristics in the context of RFA. First, it has been previously shown that chTNT-1/B can progressively accumulate in tumor nodules that have necrosis (Epstein et al, 1988). The target to lesion ratio of about 3 is similar to that of other therapeutic antibodies (e.g. anti-CD20 or 131Ianti-CD45) (Matthews et al, 1999; Witzig et al, 2002). RFA is a physical means to induce zones of necrosis in a tumor nodule and surrounding tissue. Secondly, since the target antigen expression after RFA should be universal, chTNT-1/B may possibly effectively target any common or rare histologic type of tumor. Third, chTNT-1/B can deliver a payload (e.g. 131I) that is known to assist in destruction of residual neoplastic cells which are often found in hypoxic and necrotic regions of tumors (Goldenberg 2002, 2003). Our study had several promising aspects. At the doses tested, infusions were well tolerated and adverse effects were rare. Imaging confirmed focal localization of radioisotope into necrotic areas of the liver that had received RFA, thus showing proof-of-principle in humans. Nevertheless, the logistics of the study seemed somewhat complicated to both physicians and patients alike. Use of RFA is standard, but then there was thyroid protection, radioactive monitoring, and extra time at in the medical

Acknowledgements The author thanks the Mayo Clinic Cancer Center, Phase I Oncology group (esp. Dr. C. Erlichman and Dr. A. Adjei), and Dept. of Radiology (especially Nuclear Medicine) for helpful discussions and provision of resources that made the study and writing of the manuscript possible. Assistance of Melissa Jackson, Carol Swanson, the nursing staff on station 72, Nancy Tunistra and Denise Gansen in Nuclear Medicine, and the medical and surgical oncologists that provided care and treatment plans for these patients is also much appreciated. The data collection and management efforts of Tracee Shevlin, Dietra Pickett, Kristina Schmidtknecht, and Nilofar Bassiri are also recognized. Finally the superlative efforts of careproviders that not only helped subjects comply with study requirements including spending extra time in Rochester but also were pleasant and inspiring daily reminders of love-in-action are applauded.

References Ahmed M, Lobo SM, Weinstein J, et al (2002) Improved coagulation with saline solution pretreatment during radiofrequency tumor ablation in a canine model. J Vasc Interv Radiol 13, 717-24. Behr TM, Liersch T, Greiner-Bechert L, et al (2002) Radioimmunotherapy of small-volume disease of metastatic colorectal cancer. Cancer 94(4 Suppl) , 1373-81. Bilchik AJ, Rose DM, Allegra DP, et al (1999) Radiofrequency ablation: a minimally invasive technique with multiple applications. Cancer J Sci Am 5, 356-61.

289

Anderson et al: Treatment of hepatic metastases with (RFA) and 131I-chTNT-1/B Bleiberg H, Hendlisz A (2002) Advanced colorectal cancer treatment in Europe: what have we achieved? Anticancer Drugs 13, 461-71. Callstrom MR, Charboneau JW, Goetz MP, et al (2002) Painful metastases involving bone: feasibility of percutaneous CTand US-guided radio-frequency ablation. Radiology 224, 8797. Carnemolla B, Borsi L, Balza E, et al (2002) Enhancement of the antitumor properties of interleukin-2 by its targeted delivery to the tumor blood vessel extracellular matrix. Blood 99, 1659-65. Charboneau JW, O'Loughlin MT, Milliner DS, Engen DE (2002) Sonographically guided percutaneous radio frequency ablation of a renal cell carcinoma in a transplanted kidney. J Ultrasound Med 21, 1299-302. Chen FM, Epstein AL, Li Z, Taylor CR (1990) A comparative autoradiographic study demonstrating differential intratumor localization of monoclonal antibodies to cell surface (Lym-1) and intracellular (TNT-1) antigens. J Nucl Med 31, 1059-66. Chen FM, Taylor CR, Epstein AL (1989) Tumor necrosis treatment of ME-180 human cervical carcinoma model with 131 I-labeled TNT-1 monoclonal antibody. Cancer Res 49, 4578-85. Curley SA, Izzo F (2002) Radiofrequency ablation of primary and metastatic hepatic malignancies. Int J Clin Oncol 7, 7281. Curley SA, Izzo F (2002) Radiofrequency ablation of primary and metastic liver tumors. Surg Technol Int 10, 99-106. de Baere T, Kuoch V, Smayra T, et al (2002) Radio frequency ablation of renal cell carcinoma: preliminary clinical experience. J Urol 167, 1961-4. de Baere T, Risse O, Kuoch V, et al (2003) Adverse events during radiofrequency treatment of 582 hepatic tumors. Am J Roentgenol 181, 695-700. Dick EA, Taylor-Robinson SD, Thomas HC, Gedroyc WM (2002) Ablative therapy for liver tumours. Gut 50, 733-9. Donckier V, Van Laethem JL, Van Gansbeke D, et al (2003) New considerations for an overall approach to treat hepatocellular carcinoma in cirrhotic patients. J Surg Oncol 84, 36-44 discussion 44. Epstein AL, Chen D, Ansari A, Najafi A, Siegel M, Lee K, Hu E, Rosen P, Watkins K, Stain S, Weaver F, Taylor CR (1991) Radioimmunodetection of necrotic lesions in human tumors using I-131 labeled TNT-1 F(ab') 2 monoclonal antibody. Antibody Immunoconjugates Radiophar 4, 151-161. Epstein AL, Chen FM, Taylor CR (1988) A novel method for the detection of necrotic lesions in human cancers. Cancer Res 48, 5842-8. Epstein AL, Mizokami MM, Li J, et al (2003) Identification of a protein fragment of interleukin 2 responsible for vasopermeability. J Natl Cancer Inst 95, 741-9. Garcea G, Lloyd TD, Aylott C, et al (2003) The emergent role of focal liver ablation techniques in the treatment of primary and secondary liver tumours. Eur J Cancer 39, 2150-64. Goldenberg DM (2002) Targeted therapy of cancer with radiolabeled antibodies. J Nucl Med 43, 693-713. Goldenberg DM (2003) Advancing role of radiolabeled antibodies in the therapy of cancer. Cancer Immunol Immunother 52, 281-96. Gregoire V, Hittelman WN, Rosier JF, Milas L (1999) Chemoradiotherapy: radiosensitizing nucleoside analogues (review). Oncology Rep 6, 949-57. Hornick JL, Khawli LA, Hu P, et al (1999) Pretreatment with a monoclonal antibody, interleukin-2 fusion protein directed against DNA enhances the delivery of therapeutic molecules to solid tumors. Clin Cancer Res 5, 51-60. Hu P, Hornick JL, Glasky MS, et al (1996) A chimeric Lym-1, interleukin 2 fusion protein for increasing tumor vascular

permeability and enhancing antibody uptake. Cancer Res 56, 4998-5004. Hu P, Mizokami M, Ruoff G, et al (2003) Generation of lowtoxicity interleukin-2 fusion proteins devoid of vasopermeability activity. Blood 101, 4853-61. Isozaki T, Kiba T, Numata K, et al (1999) Medullary thyroid carcinoma with multiple hepatic metastases: treatment with transcatheter arterial embolization and percutaneous ethanol injection. Intern Med 38, 17-21. Izzo F, Barnett CC, Jr, Curley SA (2001) Radiofrequency ablation of primary and metastatic malignant liver tumors. Adv Surg 35, 225-50. Jain SK, Dupuy DE, Cardarelli GA, et al (2003) Percutaneous radiofrequency ablation of pulmonary malignancies: combined treatment with brachytherapy. AJR Am J Roentgenol 181, 711-5. Khawli LA, Mizokami MM, Sharifi J, et al (2002) Pharmacokinetic characteristics and biodistribution of radioiodinated chimeric TNT-1, -2, and -3 monoclonal antibodies after chemical modification with biotin. Cancer Biother Radiopharm 17, 359-70. Kindler HL, Shulman KL (2001) Metastatic colorectal cancer. Curr Treat Options Oncol 2, 459-71. Lau TN, Lo RH, Tan BS (2003) Colorectal hepatic metastases: role of radiofrequency ablation. Ann Acad Med Singapore 32, 212-8. Lewis BD, Hay ID, Charboneau JW, et al (2002) Percutaneous ethanol injection for treatment of cervical lymph node metastases in patients with papillary thyroid carcinoma. AJR Am J Roentgenol 178, 699-704. Livraghi T, Lazzaroni S, Meloni F, et al (1995) Intralesional ethanol in the treatment of unresectable liver cancer. World J Surg 19, 801-6. Livraghi T, Meloni F (2002) Treatment of hepatocellular carcinoma by percutaneous interventional methods. Hepatogastroenterology 49, 62-71. Matthews DC, Appelbaum FR, Eary JF, et al (1999) Phase I study of (131)I-anti-CD45 antibody plus cyclophosphamide and total body irradiation for advanced acute leukemia and myelodysplastic syndrome. Blood 94, 1237-47. Meloni F, Lazzaroni S, Livraghi T (2001) Percutaneous ethanol injection: single session treatment. Eur J Ultrasound 13, 107-15. Miller GK, Naeve GS, Gaffar SA, Epstein AL (1993) Immunologic and biochemical analysis of TNT-1 and TNT-2 monoclonal antibody binding to histones. Hybridoma 12, 689-98. Nordlinger B, Rougier P (2002) Nonsurgical methods for liver metastases including cryotherapy, radiofrequency ablation, and infusional treatment: what's new in 2001? Curr Opin Oncol 14, 420-3. Numata K, Isozaki T, Ozawa Y, et al (2003) Percutaneous ablation therapy guided by contrast-enhanced sonography for patients with hepatocellular carcinoma. AJR Am J Roentgenol 180, 143-9. Owen RP, Ravikumar TS, Silver CE, et al ( 2002) Radiofrequency ablation of head and neck tumors: dramatic results from application of a new technology. Head Neck 24, 754-8. Patel SJ, Spicer K, VanTassel P, Haines S, Gordon L, Frankel A, Oliver J (1999) Phase I results of intra-tumoral infusion of I131 chTNT-1, B in the treatment of recurrent malignant gliomas. Proc ASCO 18(abstract 550), 143a. Ravikumar TS, Gallos G (2002) Resection of liver metastases: state of the art. Oncology (Huntingt) 16, 1240-56 discussion 1258-60, 1263. Scaife CL, Curley SA, Izzo F, et al (2003) Feasibility of adjuvant hepatic arterial infusion of chemotherapy after

290

Cancer Therapy Vol 1, page 291 radiofrequency ablation with or without resection in patients with hepatic metastases from colorectal cancer. Ann Surg Oncol 10, 348-54. Schaefer O, Lohrmann C, Herling M, et al (2002) Combined radiofrequency thermal ablation and percutaneous cementoplasty treatment of a pathologic fracture. J Vasc Interv Radiol 13, 1047-50. Schaefer O, Lohrmann C, Markmiller M, et al (2003) Technical innovation. Combined treatment of a spinal metastasis with radiofrequency heat ablation and vertebroplasty. Am J Roentgenol 180, 1075-7. Seidenfeld J, Korn A, Aronson N (2002) Radiofrequency ablation of unresectable liver metastases. J Am Coll Surg 195, 378-86. Seidenfeld J, Korn A, Aronson N (2002) Radiofrequency ablation of unresectable primary liver cancer. J Am Coll Surg 194, 813-28 discussion 828. Sharifi J, Khawli LA, Hornick JL, Epstein AL (1998) Improving monoclonal antibody pharmacokinetics via chemical modification. Q J Nucl Med 42, 242-9. Shibata T, Iimuro Y, Yamamoto Y, et al (2002) Small hepatocellular carcinoma: comparison of radio-frequency ablation and percutaneous microwave coagulation therapy. Radiology 223, 331-7. Steinke K, Glenn D, King J, Morris DL (2003) Percutaneous pulmonary radiofrequency ablation: difficulty achieving complete ablations in big lung lesions. Br J Radiol 76, 7425. Steinke K, King J, Glenn D, Morris DL (2003) Radiologic appearance and complications of percutaneous computed tomography-guided radiofrequency-ablated pulmonary metastases from colorectal carcinoma. J Comput Assist Tomogr 27, 750-7. Virag J, Kadar E, Szentpetery F, Jakab F (1997) Experiences with ethanol infiltration of the liver metastases of colorectal tumors (preliminary study) . Acta Chir Hung 36, 386-8.

von Mehren M, Adams GP, Weiner LM (2003) Monoclonal antibody therapy for cancer. Annu Rev Med 54, 343-69. Weiner LM (1999) Monoclonal antibody therapy of cancer. Semin Oncol 26(5 Suppl 14) , 43-51. Wessels B, Jensen,R., Nelson,A., Shan,J., Chew,T (2001) Image fusion and patient specific dosimetry for tumor response and toxicity evaluation in patients with glioma undergoing radionuclide therapy. Neuro-Oncology 3, 353. Witzig TE, Gordon LI, Cabanillas F, et al (2002) Randomized controlled trial of yttrium-90-labeled ibritumomab tiuxetan radioimmunotherapy versus rituximab immunotherapy for patients with relapsed or refractory low-grade, follicular, or transformed B-cell non-Hodgkin's lymphoma. J Clin Oncol 20, 2453-63. Wood TF, Rose DM, Chung M, et al (2000) Radiofrequency ablation of 231 unresectable hepatic tumors: indications, limitations, and complications. Ann Surg Oncol 7, 593-600.

Dr. Peter M. Anderson

291

Anderson et al: Treatment of hepatic metastases with (RFA) and 131I-chTNT-1/B

292

Cancer Therapy Vol 1, page 293 Cancer Therapy Vol 1, 293-298, 2003.

Allelic loss at the SEP15 locus in breast cancer Research Article

Mohamed A. Nasr, Ya Jun Hu, and Alan M. Diamond* Department of Human Nutrition, University of Illinois at Chicago, Chicago, IL 60612

__________________________________________________________________________________ *Correspondence: Alan Diamond, Ph.D., Department of Human Nutrition, University of Illinois at Chicago, Chicago, IL 60612, USA. Tel: (312) 996-2083; Fax: (312) 413-0319; E-mail: adiamond@uic.edu Key Words: Sep15, breast cancer, heterozygosity, haplotype, alleles, microsatellite Received: 19 November 2003; Accepted: 1 December 2003; electronically published: December 2003

Summary Selenium is currently being considered as a promising chemopreventive agent, although the mechanisms responsible for the suppression of tumorigenesis by this nutrient remain unknown. Sep15 is a selenium-containing protein whose gene is mapped on human chromosome 1 at position 117-123 cM on the human transcript map, corresponding approximately to 1p31, a common position of chromosomal loss in breast cancer and other solid tumors. The coding sequence for Sep15 includes two polymorphic sites located at positions 811 (C/T) and at 1125 (G/A) within the 3â&#x20AC;&#x2122;-untranslated region. Previous work has implicated Sep15 in cancer etiology by demonstrating significant differences in Sep15 allele frequencies between the DNAs of certain tumors as compared to DNA from cancer-free individuals, although this study was unable to distinguish between alleles being associated with cancer risk or allelic loss during tumor development. In this study, four highly polymorphic microsatellite markers on chromosome 1, spanning the region of the chromosome including the Sep15 gene, were used to assess differences in the heterozygosity index at these loci in the DNA from 61 breast cancer samples as compared DNA obtained from cancer-free individuals. Significantly fewer heterozygotes (28%) at the D1S2766 locus, which is tightly linked to Sep15, were observed in the breast cancer DNA samples examined. Similar analysis of other microsatellite markers on 1p failed to detect significant difference in heterozygosity indices between tumor and control DNAs, suggesting that loss of Sep15 or another tightly linked gene was a common event in these samples. These results support a role for Sep15 allelic loss with the development of breast cancer. although it has been shown to be associated with UDPglucose: glycoprotein glucosyltransferase, a protein involved with proper protein folding (Korotkov et al, 2001). While expressed to varying degrees in several tissue types, highest levels of Sep15 expression were seen in the thyroid and prostate (Gladyshev et al, 1998; Kumaraswamy et al, 2002). Sep15 maps to human chromosome 1, at position 117-123 cM on the human transcript gene map corresponding to approximately 1p31 (Gladyshev et al, 1998). Analysis of the EST database has shown two polymorphic positions within the 3â&#x20AC;&#x2122;untranslated region of the Sep15 gene at nucleotide positions 811 and 1125 in the human cDNA (Gladyshev et al, 1998). This analysis indicated that C811 was exclusively associated with G1125, while T811 was exclusively associated with A 1125 in each EST sequence that contained both polymorphic sites, indicating the presence of two haplotypes, C 811/G1125 and T 811/ A 1125. The Sep15 haplotype frequency differs significantly between Caucasians and African Americans, and examination of haplotype frequencies between DNA obtained from either breast cancers or tumors of the head and neck indicated fewer heterozygotes in these tumor DNAs as compared to

I. Introduction The essential trace element selenium is effective in the reduction of tumor frequency when provided to animals at doses only 5-10 fold above the nutritional requirement (Ip, 1986). It is effective in the protection against cancer in a wide variety of tissues, and against many different types of carcinogens (El-Bayoumy et al, 1995). In humans, supplementation with non-toxic doses of selenium has been reported to reduce the incidence of several types of cancers (Clark et al, 1996; Yu et al, 1997). In addition to studies suggesting benefits to selenium supplementation, other data has shown an inverse relationship between dietary selenium levels and cancer risk at several sites (Knekt et al, 1998; Yoshizawa et al, 1998; Ghadirian et al, 2000) While the mechanism of protection offered by selenium remains unknown, genetic data implicating specific selenoproteins in cancer etiology would support the possibility that a particular selenoprotein was involved in the protective effects provided by selenium consumption. Sep15 is a selenoprotein of unknown function (Gladyshev et al, 1998; Kumaraswamy et al, 2002), 293

Nasr et al: Sep15 and breast cancer cycles of denaturation at 94°C for 30 sec, annealing at 55-62°C for 1 min, elongation at 72°C for 90 sec, with a final extension at 72°C for 10 min. PCR products were electrophoresed on 10% polyacrylamide gels and visualized by ethidium bromide staining. Heterozygosity was defined in this study as the presence of two discernable bands observed following gel electrophoresis of the amplification products, with one no less than 50% the intensity of the other. All PCR experiments included an amplification reaction without DNA template as a control for contamination and the analysis of each DNA sample was repeated at least three times.

ethnicity matched cancer-free individuals (Hu et al, 2001) These studies, however, could not distinguish between a particular haplotype being associated with increased risk of cancer, or LOH occurring during tumor development. In addition, this study was unable to determine whether chromosome 1 loss in these samples was extensive or restricted to the immediate vicinity of Sep15. In this study, we have extended the original observation that there are fewer heterozygotes in breast cancer samples than is represented in an ethnicity-matched control population. In order to determine whether the loss of genetic material was localized to the Sep15 gene, heterozygosity analysis was conducted on DNA obtained from 61 breast cancer samples and 50 blood samples obtained from cancer-free individuals. Using 4 frequently heterogeneous DNA microsatellite markers that span chromosome 1, significant reduction in heterozygosity was observed only for the marker in the immediate vicinity of Sep15. These data indicate that allelic loss of Sep15 or another tightly linked gene is a common event in breast cancer development and further suggests that Sep15 is a candidate mediator for the protective effects of selenium.

D. Haplotype analysis Haplotype analysis was performed to determine the nucleotide identity of polymorphic positions 811 and 1125 of the Sep15 gene as previously described (Hu et al, 2001). In short, PCR was performed to amplify a 413 bp region of the 3’-UTR of the Sep15 gene including both polymorphic positions. Differential restriction enzyme digestion was performed with Dra1 to distinguish between a C and a T at position 811, and cleavage with Bfa1 was performed to distinguish between a G and an A at position 1125. All samples were analyzed at both positions without detecting any exceptions to the TA or CG association.

II. Materials and methods

E. Statistical analysis

A. Blood and tissue specimens

Statistical differences in heterozygosity frequencies obtained between cancer-free individuals and tumor samples were calculated by X2. p-values were two-sided. Only informative samples were included in the analysis and p-values less than 0.05 were considered to be significant.

Breast cancer samples were obtained from the Tissue and Sera Bank of the Department of Surgical Oncology at University of Illinois, Chicago, IL under an institutionally approved IRB protocol. Fresh tissue samples were collected from the hospitals of diagnosis, and paraffin sections were mounted on microscopic slides and stained with haemotoxylin and eosin. A pathologist identified areas containing tumor tissue and those containing normal breast tissue, which were then microdissected and immediately frozen in liquid nitrogen then stored at –70 °C. Blood derived from a panel of 50 normal volunteers (free of cancer) were obtained from Loyola Medical Center, Maywood, IL under an approved protocol from that institution. Given previous data indicating differences in Sep15 allele frequencies between Caucasians and African Americans (Hu et al, 2001), the studies presented herein were restricted to samples obtained from African Americans. Obtaining samples from all patients, as well as the analysis described in this manuscript, were conducted under approved institutional protocols.

III. Results A. Sep15 haplotype frequencies in breast cancer samples vs. blood samples obtained from cancer-free individuals We previously examined the frequency of Sep15 alleles representing either the TA or CG haplotype in DNA obtained either from breast tumors or bloods obtained from cancer-free individuals, and this analysis indicated significant differences in haplotype distribution (Hu et al, 2001). These data have been extended in (Table 1) with the analysis of additional tumor samples, and it is apparent that there is a trend towards fewer heterozygotes in the tumor samples. We therefore used frequently heterozygous microsatellite markers on chromosome 1 to assess whether genetic loss in the vicinity of Sep15 was restricted to that locus or spanning a large region of the chromosome.

B. DNA isolation DNA was isolated from the frozen-fresh tumor tissue samples and from blood as described earlier (Hu et al, 2001) using the protocols and procedures included in the Puragene DNA Purification Kit, Gentra System, (Minneapolis, Minnesota, US).

B. Heterozygosity analysis chromosome 1 microsatellite markers

C. Genotyping DNA from both breast cancer tissue and bloods were genotyped for 4 highly polymorphic microsatellite markers on chromosome 1. Primer pairs used to analyze microsatellite markers were obtained from ResGen (Huntsville, AL USA). DNA was used as a template for amplification in a 25 µl reaction volume containing 0.25 mM each of dATP, dGTP, dCTP, and dTTP, 5 pmol of each primer and 4 units of Taq DNA polymerase (Invitrogen). The thermocycling conditions (Eppendorff/Brinkmann Mastercycler gradient, Westbury, NY) consisted of initial denaturation of 3 min at 94°C, followed by 50

Given the differences observed in Sep15 allele frequencies in ethnicity matched control and tumor samples, a strategy was used to investigate allelic loss at or near the Sep15 locus. To accomplish this, microsatellite markers with high heterozygosity indices located on chromosome 1, the same chromosome as Sep15, were analyzed in the sample sets. The identity of each of these markers, their locations, reported heterozygosity index and 294

Cancer Therapy Vol 1, page 295 primer sequences were retrieved from Genome Data Base (GDB) http://www.gdb.org, Marshfield clinic (http://research.marshfieldclinic.org), and Stanford G3 radiation panel (http://www. shgc.stanford.edu/Mapping/rh/Maps). The selected markers, the sequence of PCR primers used to amplify these regions, and the anticipated size range of the PCR products are presented in (Table 2), and their relative position on the chromosome, along with that of Sep15, is presented schematically in (Figure 2). The reported heterozygosity indices for each of the selected microsatellite markers are presented in (Table 3).

To validate these indices, 50 DNA samples derived from cancer-free African American women were analyzed with all 4 markers and the results, indicating good agreement with the provided data, are also included in the table (Table 3). Subsequent analyses used the indices determined in our laboratory. Examples of the banding patterns obtained on ethidium bromide stained gels representing the amplification of the selected microsatellite markers, indicating either heterozygosity (2 bands) or homo/hemizygosity (1 band) are presented for each of the markers in Figure 1.

Table 1: Allelic distribution of Sep 15 haplotypes in DNA from breast tissue vs. lymphocytes from cancer free women. All samples were obtained from African Americans. Genotype Cancer free (n=490) Breast Cancer (n=76) 95 % Odd ratio p- value confidence limit CG/CG 81(16%) 21(28%) 1 CG/TA 259 (53%) 33(43%) 0.02-0.287 0.491 0.0206 TA/TA 150 (31%) 22(29%) 0.294-1.090 0.566 0.0888 Table 2. Primers pair sequences for microsatellite markers and their accession numbers retrieved from GDB Data Base. Accession Locus Primer Name Primer Sequence PCR Product Number GDB: 199861 D1S481 AFM294wg1a ATGTCCATGTTTTACCTAATTGTCC 235-255 AFM294wg1m AGGTTTGCTGGTGCATNTCT GDB: 200204 D1S488 AFM299ze9a GCAAAACAGAGACTTCACCT 181-205 AFM299ze9m CTTCCAGGGACTAGAATGG GDB: 610932 D1S2766 AFMb320yf1a CTCAGCCTAGTGCAGCC 183-195 AFMb320yf1m GCTTAAACCCATGATTGGTAT GDB: 613626 D1S2865 AFMa050ta5a AGTGCCATGTACTGCCC 221-233 AFMa050ta5m GGCTCCATAATTCTGGTAGAAG

Figure 1. Examples of genotype analysis use the D1S481, D1S488, D1S2766 and D1S2865 microsatellite markers. Genotype analysis was performed on frequently heterogeneous microsattelite markers using primers obtained from Resgen (http://www.resgen.com). For each pair of DNAs presented in the Figure, the sample on the left is heterozygous as determined by the observation of 2 PCR bands, while the sample on the right is either homozygous or hemizygous at that position.

295

Nasr et al: Sep15 and breast cancer

Figure 2. Physical map: The location of 4 microsatelite markers in the vicinity of Sep 15 gene on chromosome 1, top and bottom lines are Genethon (cM) and GeneMap99 Genebridge 4 hybrid maps (cR3000), respectively. Marker locations obtained from Genethon (http://www.genethon.fr), the National Center of Biotechnology Information (NCBI) GeneMap99-GB4 (http://www.ncbi.nlm.nih.gov/genemap99/loc.cgi), locations were confirmed using other available web sites, including the National Cancer Institute (NCI) (http://gai.nci.nih.gov).

Table 3. Genotyping analysis, reported heterozygosity indices, calculated heterozygosity indices in DNA samples obtained from cancer-free individuals and breast cancers. Locus Het. Index (%) Het. Index (%) Het. Index (%) p-value3 1 2 2 (Reported) (Cancer-Free) (Breast Cancer) DIS481 86 71 72 0.914 DIS488 76 72 74 0.852 DIS2766 75 68 41 0.004 DIS2865 62 61 61 0.982 of heterozygosity were examined along chromosome 1. Of the four markers examined, only one of these exhibited a significantly lower heterozygosity frequency in tumor samples. That marker, D1S2766, is tightly linked to Sep15 and there were 27% fewer heterozygotes in tumors (from 68% to 41%, p<0.05). The lower heterozygosity frequency of these tightly linked sequences indicates that loss of Sep15 or another unidentified tightly-linked gene is an important event in breast cancer development. Sep15 is a highly conserved selenoprotein, with homologous genes found in mice, rat, B. malayi, and other animals (Gladyshev et al, 1998). Several observations suggest that lower levels of Sep15 may be significant in promoting carcinogenesis. Sep15 has been shown to be expressed at reduced levels in liver tumors that developed in a TGF!/c-myc hepatocellular carcinogenesis animal model as compared to adjacent, normal liver tissue obtained from the same animals (Kumaraswamy et al, 2000). In this same study, virtually undetectable levels of Sep15 were reported in prostate cancer cell lines while the normal prostate usually contains high Sep15 levels. These observations, the studies reported here for breast cancer, and the likelihood that Sep15 protein levels might be reduced in individuals with sub-optimal selenium intake, raise the possibility that the Sep15 gene product provides an anti-cancer protective role and may mediate some of the protective effects associated with selenium adequate or supplemental intake. LOH on the short arm of chromosome 1 has been reported in several cancer types, including breast cancer, melanoma, intestinal cancer, thyroid cancer, liver cancer, and stomach cancer (Kubo et al, 1991; Bardi et al, 1993;

Sample analysis was restricted to those obtained from African American women because of the differences in haplotype frequency reported between Caucasians and African Americans (Hu et al, 2001) Almost all cases were informative for the four loci examined, and the experimentally determined heterozygosity indices in these two populations are presented in Table 3. Examination of the data in that Table indicate that the heterozygosity indices determined for markers DIS481, DIS488 and DIS2865 were statistically indistinguishable in tumor samples vs. controls. In contrast, significantly fewer heterozygotes were present for marker DIS2766 in the tumor samples than the controls (41% vs. 68%). The genomic position of the D1S2766 locus is in close proximity of Sep 15 at 121.9 cM, (Figure 2).

IV. Discussion The data present here extends our previous observations indicating differences in Sep15 haplotype frequencies in breast cancer samples as compared to that obtained from blood samples of individuals of the same ethnicity. This experimental design, involving differential restriction enzyme digestion of PCR products containing the polymorphic sites, cannot distinguish between homozygosity and hemizygosity resulting from loss of one of two Sep15 alleles. In addition, the heterozygosity frequency for Sep15 in cancer-free samples is approximately 50%, making this a difficult locus to use for examining differences in heterozygosity frequencies among different sample sets. To address this issue, polymorphic microsatellite markers with high frequencies 296

Cancer Therapy Vol 1, page 297 Horii A (1996) Deletion mapping on chromosome 1p in well-differentiated gastric cancer. Br J Cancer 73, 424-8. Ghadirian P, Maisonneuve P, Perret C, Kennedy G, Boyle P, Krewski D, Lacroix A ( 2000) A case-control study of toenail selenium and cancer of the breast, colon, and prostate. Cancer Detect Prev 24,305-313. Gladyshev VN, Jeang KT, Wootton JC, Hatfield DL (1998) A new human selenium-containing protein. Purification, characterization, and cDNA sequence. J Biol Chem 273, 8910-9815. Hoggard N, Brintnell B, Howell A, Weissenbach J, Varley J (1995) Allelic imbalance on chromosome 1 in human breast cancer. II. Microsatellite repeat analysis. Genes Chromosomes Cancer 12, 24-31. Hu YJ, Korotkov KV, Mehta R, Hatfield DL, Rotimi CN, Luke A, Prewitt TE, Cooper RS, Stock W, Vokes EE, Dolan ME, Gladyshev VN, Diamond AM (2001) Distribution and functional consequences of nucleotide polymorphisms in the 3'-untranslated region of the human Sep15 gene. Cancer Res 61, 2307-2310. Igarashi J, Nimura Y, Fujimori M, Mihara M, Adachi W, Kageyama H, Nakagawara A (2000) Allelic loss of the region of chromosome 1p35-pter is associated with progression of human gastric carcinoma. Jpn J Cancer Res 91, 797-801. Ip C (1986) The chemopreventive role of selenium in carcinogenesis. Adv Exp Med Biol 206,431-447 Knekt P, Marniemi J, Teppo L, Heliovaara M, Aromaa A (1998) Is low selenium status a risk factor for lung cancer? Am J Epidemiol 148, 975-982. Korotkov KV, Kumaraswamy E, Zhou Y, Hatfield DL, Gladyshev VN (2001) Association between the 15-kDa selenoprotein and UDP-glucose:glycoprotein glucosyltransferase in the endoplasmic reticulum of mammalian cells. J Biol Chem 276, 15330-15336. Kubo K, Yoshimoto K, Yokogoshi Y, Tsuyuguchi M, Saito S (1991) Loss of heterozygosity on chromosome 1p in thyroid adenoma and medullary carcinoma, but not in papillary carcinoma. Jpn J Cancer Res 82, 1097-1103. Kumaraswamy E, Korotkov KV, Diamond AM, Gladyshev VN, Hatfield DL (2002) Genetic and functional analysis of mammalian Sep15 selenoprotein. Methods Enzymol 347,187-197 Loupart ML, Armour J, Walker R, Adams S, Brammar W, Varley J (1995) Allelic imbalance on chromosome 1 in human breast cancer. I. Minisatellite and RFLP analysis. Genes Chromosomes Cancer 12, 16-23. Nagai H, Negrini M, Carter SL, Gillum DR, Rosenberg AL, Schwartz GF, Croce CM (1995) Detection and cloning of a common region of loss of heterozygosity at chromosome 1p in breast cancer. Cancer Res 55, 1752-1757. Peng H, Xu F, Pershad R, Hunt KK, Frazier ML, Berchuck A, Gray JW, Hogg D, Bast RC Jr, Yu Y (2000) ARHI is the center of allelic deletion on chromosome 1p31 in ovarian and breast cancers. Int J Cancer 86, 690-694. Weith A, Brodeur GM, Bruns GA, Matise TC, Mischke D, Nizetic D, Seldin MF, van Roy N, Vance J (1996) Report of the second international workshop on human chromosome 1 mapping. 1995. Cytogenet Cell Genet 72, 114-144. Yeh SH, Chen PJ, Chen HL, Lai MY, Wang CC, Chen DS (1994) Frequent genetic alterations at the distal region of chromosome 1p in human hepatocellular carcinomas. Cancer Res 54, 4188-4192. Yoshizawa K, Willett WC, Morris SJ, Stampfer MJ, Spiegelman D, Rimm EB, Giovannucci E (1998) Study of prediagnostic selenium level in toenails and the risk of advanced prostate cancer. J Natl Cancer Inst 90,1219-1224. Yu SY, Zhu YJ, Li WG (1997) Protective role of selenium

Yeh et al, 1994; Nagai et al, 1995; Ezaki et al, 1996; Bieche et al, 1999; Ragnarsson et al, 1999; Igarashi et al, 2000). Chromosome 1p has been reported as one of the most involved chromosome arms in breast cancer (Nagai et al, 1995; Loupart et al, 1995; Hoggard et al, 1995). Furthermore, chromosome arm 1p is one of the most commonly altered regions in breast cancer (Callahan, et al, 1992; Bieche and Lidereau, 1995; Weith et al, 1996). Frequent LOH (21%) at the D1S488 locus has been previously observed in 8 studied breast cancer samples (Peng et al, 2000) although we have failed to detect a significant allelic loss at this position in the studies presented here. It is unclear why there is a difference between these observations, although some possibilities include the origin of the clinical samples, ethnicity of individualâ&#x20AC;&#x2122;s genotyped, sample size, and the clinical classification of tumors. In summary, the reduced heterozygosity frequency observed at both the Sep15 locus and a tightly linked, microsatellite marker suggest that allelic loss of Sep15 may promote breast cancer development. A putative tumor suppressor role for this selenoprotein may help to explain how selenium supplementation could be effective in reducing cancer incidence. Future studies examining LOH in this region of chromosome 1 using matched pairs of tumor and normal tissue from the same individuals, as well as examination for associations of polymorphisms within the Sep 15 gene and cancer risk will be required to gain a better appreciation for the role of this gene in carcinogenesis.

Acknowledgements This work was supported by grants from The Susan G. Komen Breast Cancer Foundation.

References Bardi G, Pandis N, Fenger C, Kronborg O, Bomme L, Heim S (1993) Deletion of 1p36 as a primary chromosomal aberration in intestinal tumorigenesis. Cancer Res 53, 18951898. Bieche I, Lidereau R (1995) Genetic alterations in breast cancer. Genes Chromosomes Cancer 14, 227-251. Bieche I, Khodja A, Lidereau R (1999) Deletion mapping of chromosomal region 1p32-pter in primary breast cancer. Genes Chromosomes Cancer 24, 255-63. Callahan R, Cropp CS, Merlo GR, Liscia DS, Cappa AP, Lidereau R (1992) Somatic mutations and human breast cancer. A status report Cancer 69, 1582-1588. Clark LC, Combs GF Jr, Turnbull BW, Slate EH, Chalker DK, Chow J, Davis LS, Glover RA, Graham GF, Gross EG, Krongrad A, Lesher JL Jr, Park HK, Sanders BB Jr, Smith CL, Taylor JR (1996) Effects of selenium supplementation for cancer prevention in patients with carcinoma of the skin. A randomized controlled trial. Nutritional Prevention of Cancer Study Group. JAMA 276,1957-1963. El-Bayoumy K, Upadhyaya P, Chae YH, Sohn OS, Rao CV, Fiala E, Reddy BS (1995) Chemoprevention of cancer by organoselenium compounds. J Cell Biochem Suppl 22, 92-100. Ezaki T, Yanagisawa A, Ohta K, Aiso S, Watanabe M, Hibi T, Kato Y, Nakajima T, Ariyama T, Inazawa J, Nakamura Y,

297

Nasr et al: Sep15 and breast cancer against hepatitis B virus and primary liver cancer in Qidong.

Biol Trace Elem Res 56,117-24.

298

Cancer Therapy Vol 1, page 299 Cancer Therapy Vol 1, 299-314, 2003.

Dendritic cell based vaccines for immunotherapy of cancer Review Article

Asim Saha, Sunil K. Chatterjee, Kartik Mohanty, Kenneth A. Foon1, Malaya Bhattacharya-Chatterjee! Department of Internal Medicine and the Barrett Cancer Center, University of Cincinnati, Ohio 45267 1 University of Pittsburgh Cancer Institute, Pittsburgh, PA 15232

__________________________________________________________________________________ *Correspondence: Malaya Bhattacharya-Chatterjee, PhD, The Vontz Center for Molecular Studies, Room 1316, University of Cincinnati, 3125 Eden Avenue, Cincinnati, OH 45267-0509. Tel: (513) 558-0425; Fax: (513) 558-1096; e-mail: malaya.chatterjee@uc.edu Key Words: vaccines, dendritic cells, cancer, immunotherapy Abbreviations: Dendritic cells (DCs); antigen presenting cells (APCs); ELISA method (ELISPOT); Carcinoembryonic antigen (CEA) Received: 16 October 2003; Revised: 17 December 2003 Accepted: 18 December 2003; electronically published: December 2003

Summary Researchers and clinicians have tried for decades to use specific and non-specific immunotherapy for the fight against cancer. Initial attempts were based on soluble immune mediators such as antibodies or cytotoxic proteins for the therapy of malignancies. Major improvements in our understanding of the induction and regulation of cellular immunity have now made it possible to generate effector cells in cancer patients that can specifically recognize and destroy malignant cells. Human tumors express a number of protein antigens that can be recognized by T cells, thus providing potential targets for cancer immunotherapy. Tumor antigens have to be presented to T cells in order to activate them and drive them into clonal expansion. This is done by antigen presenting cells (APCs). Dendritic cells (DCs) are professional APCs, which have an extraordinary capacity to stimulate na誰ve T cells and initiate primary immune responses. This established function of DCs has now offered the hope to apply DC-based immunotherapy for cancers. Pilot clinical trials of DC vaccination have established the safety and feasibility of this approach and have produced encouraging evidence of therapeutic efficacy. Importantly, significant advances in our understanding of the DC biology can be used to support the design of new vaccines in order to elicit effective cellular immune responses for the treatment of cancer. In this review, recent findings of DC immunotherapy for a variety of tumors including colon cancer have been discussed. Also, the development of DC-based vaccines in preclinical models of colorectal cancer as a prelude to clinical trials has been summarized. metastasis of the disease in local lymph nodes and adjacent organs, survival is substantially worse (Greenlee et al, 2000). Systemic chemotherapy with 5-flurouracilbased regimens or newer agents such as irinotecan has improved survival of these patients with high-risk disease (Moore and Haller, 1999). Despite this, only 60% of all patients diagnosed with colorectal cancer survive more than ten years. At present there is no therapeutic regime capable of curing unresectable metastatic disease. Clearly, more effective treatments are necessary for this disease. Vaccines against infectious diseases are the success story of immunology. Smallpox has been eradicated and vaccination strategies have saved countless people from tetanus, polio, measles and hepatitis. Consequently, there is a hope for the generation of effective cancer vaccine(s). However, to date, human antitumor vaccination has not delivered on its promises. Reasons for failure include tumor immune escape

I. Introduction Colorectal cancer is one of the most common malignancies in men and women representing 10% of all cancer deaths in the United States with ~ 130,000 new cases diagnosed annually (Landis et al, 1998). Progression of the disease occurs through invasion of the colonic wall, involvement of regional lymph nodes, and distant metastasis. At the time of diagnosis, almost 50% of the patients have tumors invading through the bowel wall with spread to regional lymph nodes; in addition, 10% of the patients present with synchronous metastatic cancer to the liver. There have been important advances in our understanding of the biology and genetics of this disease, and if diagnosed early, colorectal cancer is curable. Surgery is associated with a 90% five-year survival rate in patients with tumors involving only the mucosa or submucosa. However, for majority of the patients having 299

Saha et al: Dendritic cell based vaccines for cancer mechanisms, limited availability of tumor specific antigens, as well as failure to deliver tumor antigens in the right immunological context. Progress in immunology and molecular biology has provided technologies to detect an ever increasing choice of new tumor specific antigens. One of the most important issues is to deliver these tumor antigens in an effective way to induce immune responses in cancer patients. However, recent insights into the role of DCs as the pivotal APCs that initiate immune response may provide the basis for generating more effective antitumor immune responses in patients. Our understanding of the DC biology has opened new ways for the application of these cells for immunotherapy of cancer. Immunotherapy is an attractive approach to cancer therapy. The aim of immunotherapy is to induce or increase the ability of the host to mount antitumor immune responses in vivo. Convincing evidence now exists that the effector cells of the immune system (T, B, and NK cells), when appropriately activated, are able to lyse tumor cells through specific recognition of tumor associated antigens (TAAs) (Rosenberg, 1996; Finn and Lotze, 1998). Although a variety of both humoral and cellular antitumor immune responses have been documented, T cells, and in particular CD8+ cytotoxic T lymphocytes, are likely to play an important role in antitumor immunity (Maeurer and Lotze, 1997). Identification of TAAs together with a better understanding of the mechanisms involved in the immune response against cancer, have given investigators tools to manipulate the immune system to induce an efficient immune response in the tumor bearing host (Pardoll, 2000; Van Gool et al, 2000; Borrello and Sotomayor, 2002; Drake and Pardoll, 2002).

Prickett, 1993). Costimulatory molecules such as CD80 (B7.1) and CD86 (B7.2), and molecules regulating costimulation such as CD40 are also expressed on mature myeloid DCs. DCs do not express surface differentiation antigens found on B cells (CD19, CD20), T cells (CD3), monocytes (CD14), and natural killer cells (CD56). Several antibodies have been described that preferentially but not exclusively stain mature DCs. Antibodies reactive against human DCs include anti-CD83 and CMRF-44 (Zhou et al, 1992; Hock et al, 1994). Antibodies directed at mouse DCs include 33D1, N418 (anti-CD11c), and DEC-205 (Kraal et al, 1986; Metlay et al, 1990). DCs originate from the bone marrow and their precursors home via the bloodstream to almost all organs, where they can be found as sentinels in an immature state with high endocytic and phagocytic capacity. The current view is that these immature interstitial DCs are the precursors of the mature interdigitating DCs found in the T cell rich area of secondary lymphoid organs. Upon contact with bacterial DNA, LPS, dsRNA, and inflammatory cytokines such as TNF-" or IL-1 the interstitial DCs change their phenotype and function and migrate to the germinal centers of regional lymph nodes, where they present antigens captured in the periphery to resting or na誰ve T cells and induce antigen-specific T cell responses. With DC activation and migration from the tissue, antigen uptake activity and the associated antigen receptors are down regulated, resulting in a switch in APC function from antigen uptake to antigen presentation (Hart and McKenzie, 1988). DCs are capable of processing antigen via classical pathways: endogenous antigens via the proteasome into the MHC class I compartment, and exogenous antigens via endocytic lysosomes into the MHC class II compartment (Lanzavecchia, 1996). DCs also process alternative pathways of antigen processing and can route exogenous antigen into the MHC class I pathway through a mechanism known as cross-priming (Norbury et al, 1997). DCs may also utilize molecular chaperones such as heat shock proteins (hsp96) to deliver antigens via the class I pathway (Arnold-Schild et al, 1999). The family of human DC displays considerable heterogeneity and plasticity at the level of phenotype and function (Banchereau et al, 2000). DC may be derived from two potential lineages: myeloid or lymphoid. Myeloid progenitors give rise to two main precursors: CD14+ CD11c + precursors and CD14$ CD11c + precursors (Caux et al, 1996). CD14+ CD11c+ cells differentiate in the presence of IL-4 and GM-CSF into interstitial DCs that correspond to dermal DCs in vivo (Grassi et al, 1998). In the presence of M-CSF, CD14+ CD11c+ precursor cells acquire characteristics of macrophages. CD11c+ DCs may be also reverted to macrophages under the same conditions. CD14$ CD11c+ precursors yield DC of the Langerhans cell type in response to GM-CSF, IL-4 and TGF-#. Immature dermal or Langerhans type DC correspond to tissue resident sentinels in peripheral tissue sites. Upon encounter of T cell derived signals such as CD40L or microbial products such as LPS, they might be further driven along their differentiation pathway to mature DC. Mature DC resides in T cell areas of lymph

II. What is a dendritic cell? DCs were originally discovered as antigen presenting cells critical for the induction of primary T cell dependent immune responses (Steinman, 1991). DCs represent only 0.5% of blood leukocytes. Like other cell types within the immune system, they arise from a common CD34+ progenitor in the bone marrow whose expansion and differentiation is influenced by a variety of cytokine growth factors including stem cell factor, fetal liver tyrosine kinase-3 (Flt-3) ligand, IL-3, granulocyte/macrophage colony stimulating factor (GMCSF), TNF-" and TGF-# (Shortman and Caux, 1997; Pulendran et al, 2001). Mature DCs have a distinct morphology characterized by the presence of numerous membrane processes that can take the form of dendrites, pseudopods, or veils. Morphologic features of DCs include high concentrations of intracellular structures related to antigen processing such as endosomes, lysosomes, and the Birbeck granules of Langerhans cells of the epidermis. DCs are also characterized by abundant expression of molecules used for their specialized interactions with T cells. These include the antigen-presentation molecules CD1 and the class I and class II MHC proteins, the adhesion molecules CD11a (LFA-1"), CD11b, CD11c, CD50 (ICAM-2), CD54 (ICAM-1), CD58 (LFA-3), and CD102 (ICAM-3), although all of these markers can also be found on monocytes and macrophages (Hart and 300

Cancer Therapy Vol 1, page 301 nodes and marginal zone of spleen with stable phenotype and function. A third major subset of DC are CD14$ CD11c$ IL-3R"+ DC precursors (Grouard et al, 1997). These cells depend on IL-3 as survival factor and may be matured through CD40 signaling. Further surface markers include CD45RA and ILT-3 (Cella et al, 1999). They display low phagocytic activity and are the major source of IFN-" production in response to viral infection (Siegal et al, 1999).

IV. Generation of dendritic cells for cancer immunotherapy Clinical trials of DC vaccination have been made possible by the development of methods for obtaining large numbers of human DCs. Three general approaches have been exploited for use in clinical trials (Table 1). Myeloid DCs can be directly purified from blood by density-gradient centrifugation procedures (Hsu et al, 1996). The systemic administration of Flt-3 ligand or GCSF increases blood DC numbers several fold (Maraskovsky et al, 2000; Pulendran et al, 2000). Alternatively, DCs can be prepared from CD14+ blood monocytes by in vitro culture with GM-CSF and IL-4 for 5-7 days, and differentiation with maturation stimuli (Bender et al, 1996; Romani et al, 1996). Maturation is essential to prevent reversion to monocytes. Autologous monocyte conditioned medium (MCM), CD40L or a cocktail of TNF-", IL-1#, IL-6 and PGE-2 are available for the maturation of DCs (Reddy et al, 1997; Thurner et al, 1999). CD34+ hematopoietic progenitor cells obtained from bone marrow, umbilical cord blood or peripheral blood following treatment with GM-CSF or G-CSF are also source of DC precursors. Following culture in GMCSF and TNF-" (Caux et al, 1997), and stem cell factor or Flt-3 ligand, a mixed population of immature DCs with characteristics of both Langerhans cells and interstitial DCs has been obtained. Comparative studies will be required to establish differences between these various sources of DCs.

III. What is the role of dendritic cell for the induction of tumor immunity? Effector mechanisms against endogenous tumors include both cellular and humoral immunity. The majority of experimental systems clearly demonstrate that tumor immunity is largely provided by CD4+ T lymphocytes (Hung et al, 1998; Dembic et al, 2000; Qin and Blankenstein, 2000), CD8+ T lymphocytes (Celluzzi et al, 1996; Jenne et al, 2000; Terheyden et al, 2000) or NK cells (Fernandez et al, 1999). T cells, and possibly also NK cells, however, require activation by APCs, and in this context DCs are pivotal for this process. To activate na誰ve T cells, DCs take up, process and present antigen by their MHC molecules (Banchereau and Steinman, 1998). In addition, T cell activation requires engagement of costimulatory receptors on the T cell, adequate types and concentrations of T cell activating cytokines and T cell attracting chemokines, and maintenance of the activation signal over a sufficient period of time. Currently, the list of family of co-stimulatory molecules is increasing dramatically, and it appears likely that DCs can minutely control the outcome of immune activation by means of differential surface receptor expression (Coyle and Gutierrez-Ramos, 2001), and that T cells in turn signal back to modulate the function of DCs (Bennett et al, 1998; Ridge et al, 1998; Schoenberger et al, 1998). Activation of NK cells and of macrophages is less well understood, but an interaction between DCs and these cell types has been demonstrated (Fernandez et al, 1999). Apart from generating a powerful antitumor immune response, DCs may also play an active role in the eradication of tumors themselves, since DCs have been shown to kill tumor cells via expression of death receptor ligands (Fanger et al, 1999), and recent data suggest that DCs activated by proinflammatory cytokines or LPS can directly inhibit the growth of tumor cell lines (Chapoval et al, 2000). Thus DCs are at the very center of a developing tumor-specific immune response, and are involved both in the initiation of tumor-specific immunity and the generation of immune effector functions. Promising results obtained in a variety of murine tumor models using DCs presenting tumor antigens as well as the identification of a growing number of T cell epitopes presented by human malignant cells prompted the rationale for evaluating the efficacy of DC-based vaccines in clinical studies.

V. Critical parameters for optimal DC vaccination Apart from choosing the right source of DC, critical issues for successful vaccination involve choice of antigen, antigen loading, route and schedule of administration, as well as immuno-monitoring. The choice of DC is likely to depend on the type of antigen used. The cellular machinery required for processing antigen differs according to whether it is delivered as a peptide, protein or genetic vaccine. Immature DCs, which are actively endocytic and can internalize exogenous antigens efficiently, may be most suitable for the delivery of protein or complex antigens that require processing by the DC. In contrast, mature DCs, with higher expression of MHC molecules, may be more suitable for peptide-based protocols. Strategies to enhance DC function genetically to improve vaccine delivery and the subsequent induction of a powerful immune response are also being evaluated. These include genetic manipulation of DC to express cytokines or immuno-stimulatory molecules that can potentiate DC-Tcell interactions (Philip et al, 1998). Wide range of antigenic preparations are available for loading of DC (Table 2). Peptide antigens are well defined antigenic epitopes binding to a defined set of MHC molecules, and easily accessible for immunomonitoring of a peptide specific T cell response. However, peptide approaches are limited by the requirement of analysis of the MHC background of patients and the

301

Saha et al: Dendritic cell based vaccines for cancer Table 1. DC types available for clinical studies Peripheral blood DC populations Directly isolated from blood or expanded in vivo by growth factors, such as Flt-3 ligand or G-CSF DCs derived from CD14+ monocytes Monocytes enriched by anti-CD14 immunomagnetic beads or by plastic adherence DCs derived from CD34+ hematopoietic progenitors From bone marrow, peripheral blood or cord blood knowledge of the sequence of the relevant peptide epitope. The use of whole protein antigens, DNA, RNA or recombinant viruses encoding the antigen of choice allows host HLA molecules to select the appropriate peptide epitope for presentation as peptide-MHC complex on the cell surface. This approach does not require analysis of MHC molecules, although we have to be aware of the fact that spectrum of epitopes seen by effector T cells might be restricted, since certain peptides are not presented by DC due to incomplete processing at the level of the proteasome (Morel et al, 2000). Recently, other approaches have been applied to use the entire antigenic content of a tumor cell for vaccination to present as many tumor antigens as possible to the immune system and minimize the occurrence of immune escape variants. This might be achieved by either pulsing DCs with whole tumor cell lysate (Ashley et al, 1997), tumor derived RNA (Nair et al, 1998), DNA (Philip et al, 1998) or fusion of tumor cells and DCs (Hart and Colaco, 1997). This technique does not require the definition of the TAA or MHC haplotype of the patients and has the potential for broad clinical application. The limitation of this approach is the availability of tissue serving as a source of tumor lysate or tumor derived RNA. A major disadvantage in using whole tumor in the form of lysates, RNA or DCtumor fusions is that monitoring effector cells functions in vitro and in vivo is difficult to achieve. After pulsing with tumor antigen, DCs need to be administered in an effective way to the cancer patients. Subcutaneous, intradermal, intravenous and intranodal approaches to deliver DCs have been evaluated clinically.

The intranodal approach (Nestle et al, 1998) bypasses the requirement for vaccine-loaded DCs to migrate to lymphoid tissue and simply relies on their capacity to express effective T cell stimulatory capacity. The intravenous route results in the accumulation of DCs to lung, liver, spleen and bone marrow, but not the lymph nodes or tumor sites (Morse et al, 1999). In contrast, studies using intradermal injection of monocyte derived DCs have demonstrated direct migration of DCs to the draining lymph nodes. However, these particular studies used immature DCs, and only ~1% of DCs migrated to the regional lymph node, the majority remained at the injection site (Thomas et al, 1999). In contrast, monocytederived DCs matured in vitro have shown impressive immune responses (Schuler-Thurner et al, 2000). It is unclear whether this effect was due to efficient migration and antigen-presentation induced by in vitro activation of DCs. Detection of an antigen specific immune response is an important surrogate marker to control for an effective vaccination strategy even though correlation with clinical response will be the most important issue. The classic way to detect CTL activity is measurement of lytic activity against 51Cr labeled target cells. Since precursor frequencies are low, in vitro re-stimulations are often necessary in order to reach a CTL frequency detectable by cytotoxicity assays. Although these techniques are time consuming, still this method is the gold standard since it measures lytic activity of effector cells.

Table 2. Delivery of antigens by dendritic cells Known tumor associated antigens: Synthetic or eluted peptides Recombinant or purified protein Non-peptide antigens, such as carbohydrates (e.g. MUC-1) or glycolipids (e.g. GM2) Transfection with cDNA or RNA encoding known tumor-associated antigen Recombinant viruses (adenoviruses, vaccinia, or retroviruses) Approaches when antigens are unknown: Differentiation of DCs from malignant cells (acute myelogenous leukemia, chronic myeloid leukemia) Tumor-DC fusions DC-derived exosomes Tumor RNA Apoptotic or necrotic tumor cells Tumor lysates

302

Cancer Therapy Vol 1, page 303 These tests quantify antigen-specific T cells in the blood. It is unclear whether the blood is the best place to look for evidence of emerging immunity against vaccination, or whether the tumor site or draining lymph nodes may be more appropriate. Recently introduced methods rely on measurement of release of cytokines by CTL after contact with antigen (Romero et al, 1998). Cytokines may be measured by an ELISA method (ELISPOT) or quantified by intracellular cytokine staining and detection by flow cytometry. Detection of cytokine release does not necessarily correlate with the cytolytic activity of a given cell. Peptide-MHC tetrameric complex is another tool for detection of an antigen specific immune response.

However, this technique may not be able to detect low or intermediate affinity T cells, which are important in the context of vaccination against self-antigens. An additional method is delayed type hypersensitivity (DTH) testing for peptide specific immune responses. Peptide DTH testing was demonstrated in humans (Nestle et al, 1998) and this technique is easy to perform even though objective read out might be a problem and is observer dependent. DTH reactions are important since it measures induction of an antigen specific immune response. It is therefore crucial to develop appropriate immunological assays that may predict clinical responses more closely.

Table 3. Published clinical trials conducted with DC-based vaccines against cancer Disease type Melanoma

Lymphoma

Myeloma

Antigen a) Melan-A, gp100, tyrosinase b) MAGE-1, MAGE-3, Melan-A, gp100, tyrosinase c) MAGE-3

DC type mDC

Route i.v.

mDC

intranodal

mDC

s.c., i.v.

d) MAGE-1, MAGE-3, Melan-A, gp100, tyrosinase e) MART-1, gp100

CD34-DC

i.v.

mDC

i.v.

f) Melan-A, MAGE-3, gp100, tyrosinase g) Tulys

CD34-DC

s.c.

mDC

i.d.

h) tumor cell-DC fusion i) Mart-127-35 peptide j) tumor cells

mDC

s.c.

mDC

i.v., or i.d.

mDC

i.d.

k) acid-eluted peptides

mDC

i.d.

a) idiotype

PBDC

b) idiotype

PBDC

c) Tulys

mDC

i.v., s.c. boost. i.v. s.c. boost intranodal

Hsu FJ et al (1996) Timmerman JM et al (2002) Maier T et al (2003)

a) idiotype

mDC

i.v.

b) idiotype

PBDC

c) idiotype

CD34-DC

i.v. s.c. boost s.c., s.c. boost

Lim SH et al (1999) Reichardt VL et al (1999) Titzer S et al (2000)

303

Investigator Lotze MT et al (1997) Nestle FO et al (1998) SchulerThurner B et al (2000) Mackensen A et al (2000) Panelli MC et al (2000) Banchereau J et al (2001) Chang AE et al (2002) Krause SW et al (2002) Butterfield LH et al (2003) Oâ&#x20AC;&#x2122;Rourke MGE et al (2003) Smithers M et al (2003)

Saha et al: Dendritic cell based vaccines for cancer Prostate

a) PSMA

mDC

i.v.

b) Fusion protein (PAP+GM-CSF) c) Fusion protein (PAP+GM-CSF) d) PSM-P1, PSM-P2 e) rmPAP

PBDC

i.v., s.c.

PBDC

i.v.

mDC

i.v.

PBDC

i.v., i.d., or intranodal

a) Tulys

i.v.

b) tumor cell-DC fusion c) Tulys

Allogeneic mDC Allogeneic mDC mDC

d) Tulys

mDC

s.c.

e) tumor cell-DC fusion f) tumor RNA

Allogeneic mDC mDC

i.d.

Liver

Tulys

mDC

intranodal

Various

Tulys

mDC

i.d.

Bladder

MAGE-3

mDC

s.c.

CEA-expressing malignant Lung, colon

CAP-1 (CEA peptide) 610D (CEA peptide)

mDC

i.v., i.d. i.v.

Stomach, esophagus, colon Colon

MAGE-3

FL mobilized, density purified DC mDC

RCC

s.c., s.c. boost i.d.

i.v., i.d.

Tjoa BA et al (1999) Burch PA et al (2000) Small EJ et al (2000) Lodge PA et al (2000) Fong L, Brockstedt D et al (2001) Holtl L et al (1999) Kugler A et al (2000) OosterwijkWakka JC et al (2002) Marten A et al (2002) Marten A et al (2003) Su Z et al (2003) Iwashita Y et al (2003) Geiger J et al (2001) Nishiyama T et al (2001) Morse MA et al (1999) Fong L et al (2001)

i.v.

Sadanaga N et al (2001) CEA mRNA mDC i.v., i.d. Morse MA et al (2003) __________________________________________________________________________________________________ mDC, monocyte-derived DCs; CD34-DC, DCs derived from CD34-positive progenitors; PBDC, peripheral blood-derived DCs; i.v. intravenous; s.c., subcutaneous; i.d., intradermal; MAGE, melanoma antigen; PSMA, prostate-specific membrane antigen; PAP, prostatic acid phosphatase; PSM-P, prostate-specific membrane antigen-derived peptide; rm, recombinant mouse; RCC, renal-cell carcinoma; Tulys, tumor lysate; FL, Flt-3 ligand.

being investigated in DC-based clinical studies. Lotze and co-workers (Lotze et al, 1997; Lotze et al, 1998) used monocyte-derived DCs to treat HLA-A2 positive patients with metastatic melanoma. DCs were pulsed with peptides derived from Melan-A, gp100, or tyrosinase. Twenty-eight patients received weekly intravenous and subcutaneous infusions of peptide-pulsed DCs for four weeks. Two patients achieved a complete response and 1 patient responded partially, although, one of the complete responders later developed overt rheumatoid arthritis. Nestle and colleagues (Nestle et al, 1998; Nestle, 2000) used monocyte-derived DCs pulsed with MAGE-1 and MAGE-3 peptides (for patients expressing HLA-A1), Melan-A, gp100 and tyrosinase peptides (for patients expressing HLA-A2), or MAGE-3 and tyrosinase peptides

VI. Dendritic cell-based vaccines in clinical trials Numerous trials are currently ongoing or planned in the very fast moving field of DC immunotherapy trials. We will only discuss published trials in DC vaccination that includes malignant melanoma, non-hodgkin lymphoma, multiple myeloma, prostate cancer, renal-cell carcinoma, liver cancer, pediatric solid tumor, bladder cancer and colorectal cancer (Table 3).

A. Melanoma Many immunologically relevant melanoma antigens including differentiation antigens Melan-A, gp100, and tyrosinase, as well as cancer-testis antigens, such as those of the melanoma antigen (MAGE) family are currently 304

Cancer Therapy Vol 1, page 305 A!0201+ patients with stage III-IV melanoma using monocyte derived DCs pulsed with MART-127-35 epitope. Patients received three intravenous or intradermal injections at intervals of two weeks. The results of this trial have shown that immunizations with DCs pulsed with single MHC class I peptide could generate robust peptidespecific T cell responses in most patients without toxicity. The investigators have suggested that intradermal route of immunization resulted stronger MART-1-specific immunity compared with intravenous route. An expansion of MART-127-35-specific T cells was observed in most patients by MHC class I tetramer and IFN-& ELISPOT analysis. After completion of vaccination schedule, out of ten patients with stage IV melanoma, one patient had complete response and two patients had disease stabilization. Five patients with stage III disease have had no evidence of relapse at a median of 24+ months of follow-up. Another study was conducted in 19 patients suffering from stage IV melanoma (Oâ&#x20AC;&#x2122;Rourke et al, 2003). DCs were generated from monocytes and cultured with irradiated autologous tumor cells. Patients received tumor antigen-loaded DCs by intradermal infusion, two weeks apart and boosted five times. Treatment was well tolerated and DCs vaccination resulted autologous tumor cells specific DTH response in 3 out of 10 patients. Three of 12 patients, who completed the immunization schedule, had complete responses, three had partial responses and remaining six had progressive disease. Smithers and co-workers (Smithers et al, 2003) performed a phase I/II study in 22 patients with metastatic melanoma by immunization with autologous melanoma peptides and particulate hepatitis B antigen (HBsAg)exposed immature monocyte derived DCs. Patients received 8 intradermal DC vaccinations, each two weeks apart. No major toxic effects were observed during vaccination. Nine out of 19 patients receiving HBsAgexposed DCs, primed or boosted a cellular immune response to HBsAg. Four out of 9 HBsAg-responding patients achieved objective melanoma specific clinical responses (one complete and two partial responses) and one patientâ&#x20AC;&#x2122;s disease stabilized for 2 months. None of the 3 patients receiving DCs exposed only to melanoma peptides responded clinically. Malignant melanoma has been shown to be susceptible to T cell-mediated immunity and, therefore, is a candidate for vaccination approaches. Recent clinical trials with DCs as a cellular adjuvant have concentrated on defined peptides as the source of antigens, and rely on foreign proteins as a source of help to generate a cellmediated immune response. Initial data provide encouragement for targeting melanoma Ags in the clinic, however, additional studies are needed to establish and optimize their clinical efficacy.

(for patients expressing HLA-B44). Patients with metastatic melanoma received weekly intranodal vaccinations for four weeks with a fifth injection in week 6 and then patients had monthly injections for up to 10 months, depending on clinical response. Vaccinations were well tolerated and 8 of 30 patients had clinical responses, with 3 complete and 5 partial remissions. Thurner and colleagues (Thurner et al, 1999) used monocyte-derived DCs pulsed with MAGE-3 peptides to treat HLA-A1 positive patients with metastatic melanoma. Five vaccinations (three subcutaneous followed by two intravenous) were given on every 2 weeks. Six of 11 patients had mixed responses. Eight patients showed an increase in MAGE-3-specific CTL responses. A follow-up study (Schuler-Thurner et al, 2000) involving 12 patients with stage IV melanoma used the same procedure as described by Thurner and colleagues. Three to five vaccinations with mature, monocyte derived DCs loaded with HLA-A2 restricted peptides for MAGE-3 and for influenza matrix generated vigorous immune responses as detected by in vitro assays in all eight vaccinated patients. However, no significant clinical responses were observed after final vaccination. Four patients died early in the treatment period due to disease progression. Only 1 patient had stable disease, but disease progressed in all remaining patients. Mackensen and colleagues (Mackensen et al, 2000) did perform a phase I study in 14 patients with advanced melanoma using CD34 derived DCs matured with TNF-". DCs were pulsed with MAGE-1 and MAGE-3 peptides (for patients expressing HLA-A1) or Melan-A, gp100 and tyrosinase peptides (for patients expressing HLA-A2). Patients received at least four intravenous vaccinations, biweekly. Patients with stable or responding disease continued to receive vaccination every four weeks until disease progression. The vaccines were tolerated. One patient had a mixed response and six patients had stable disease for 3 to 8 months. Peptide-specific DTH response was observed in 4 patients and expansion of peptide specific CTL response was observed in 1 patient. A similar study was conducted (Banchereau et al, 2001) in 18 HLA-A!0201+ patients with stage IV melanoma using CD34 derived DCs. Patients were immunized with DCs pulsed with peptides derived from four melanoma antigens (MelAgs) Melan-A/MART-1, tyrosinase, MAGE-3, and gp 100 subcutaneously every two weeks for a total of four vaccinations. DC injections were well tolerated except for two patients. DC vaccination resulted enhanced immunity to % 1 MelAgs in 16 of 18 patients. Ten of 14 evaluated patients developed DTH to at least one peptide after repeated DC vaccination. The development of T cell response to multiple tumor antigens on peptide-pulsed DCs in this study was associated with a favorable early clinical outcome. Seven of 17 evaluable patients experienced tumor progression. The remaining 10 patients did not progress at this time point (10 weeks from study entry). Among these, four patients had regression of tumor metastases at one or more disease sites and three patients cleared any evidence of disease. Recently, Butterfield and colleagues (Butterfield et al, 2003) have conducted a phase I study in 18 HLA-

B. Lymphoma In the first reported DC trial (Hsu et al, 1996), the effect of autologous DCs pulsed ex vivo with tumorspecific antigen was investigated in 4 patients with malignant B cell lymphoma who had failed conventional chemotherapy. After leukapheresis, peripheral blood DCs 305

Saha et al: Dendritic cell based vaccines for cancer were subjected to a sequence of enrichment steps, before being pulsed with idiotype protein and infused intravenously. Patients received three immunizations of idiotype protein-pulsed DCs at intervals of four weeks. Patients also received subcutaneous injections of idiotype protein or KLH in saline two weeks after each vaccination to boost the primary response induced by the DCs infusion. A fourth idiotype protein-DC immunization was given 5-6 months after study entry. Treatments were well tolerated, and induction of idiotype protein specific immune response was observed as well as complete clinical regression in 2 out of 4 patients. One patient remained in complete remission for more than three years (Fong and Engleman, 2000). A recent follow-up study (Timmerman et al, 2002) involving 35 patients with stage III or IV B-cell non-Hodgkin lymphoma (NHL) confirmed idiotype-specific immune responses and durable clinical responses. Therapy consisted of significant clinical outcome as 4 patients had complete responses, 2 patients had partial responses, and 1 patient had molecular response. In evaluable patients with residual tumor at the time of vaccination, tumor regression was observed in 4 of 18 patients and 16 of 23 patients remained progression free at a median of 43 months after the completion of chemotherapy. Another study (Maier et al, 2003) was conducted in 10 patients with cutaneous T cell lymphoma. Patients received intranodal immunization of mature monocytederived DCs pulsed with autologous tumor lysate once a week for 8 weeks. Immunizations were tolerated with minor adverse effects and 5 patients had objective responses (one complete and four partial responses). Clinical response was associated with tumor-specific DTH response, tumor lysate specific proliferative response, and increased IFN-& production. In NHL, therapeutic options are limited, especially in advanced stages. DCs vaccination was feasible, well tolerated, and induced immunologic and clinical responses in patients with B cell or T cell lymphoma. Clinical studies conducted with B cell lymphoma patients were promising, as DCs vaccination was able to induce both humoral and cellular immune responses and regression of tumor burdens with prolonged survival.

transplantation, these patients were immunized with idiotype protein pulsed-DCs intravenously and the immunization was repeated after four weeks. Patients were boosted five times with idiotype protein-KLH on every four weeks from four weeks after the second idiotype protein-DC vaccine. Two out of 12 patients developed an idiotype-specific cellular proliferative immune response and 1 of 3 patients studied developed a transient but idiotype-specific CTL response. In a study by Titzer and co-workers (Titzer et al, 2000), 11 patients were enrolled, 10 with stage III disease and 1 with stage II disease. Patients were immunized with idiotype protein pulsed DCs subcutaneously followed by three booster immunizations, given every other week with a combination of idiotype protein and GM-CSF (nine patients) or with idiotype-derived peptide pulsed DCs (two patients). After vaccination, clinical benefit was observed in 1 patient with a fall in bone-marrow plasma-cell infiltrate. Three of 10 patients studied had increased amount of antibody to anti-idiotype protein. An increased T cell response specific for idiotype protein was also observed in 4 patients. The results of these studies suggest that treatment with idiotype protein-pulsed DCs is safe, and can result in disease stabilization and possibly also in objective clinical responses.

D. Prostate cancer Murphy and Tjoa have studied extensively on the use of peptide-pulsed DCs for patients with locally advanced or metastatic prostate cancer (Tjoa et al, 1997; Tjoa et al, 1998; Tjoa et al, 1999; Murphy et al, 1999). Monocytederived DCs were pulsed with peptides derived from prostate-specific membrane antigen (PSMA) and were administered intravenously every 6 weeks for a total of six infusions. In a phase II trial, 33 patients were enrolled (Murphy et al, 38, 1999) and of 25 evaluable patients, 8 patients responded (two complete and six partial responses) as identified by declining levels of serum marker. In a group of 37 patients with recurrent disease after primary therapy (Murphy et al, 39, 1999), 11 patients responded (one complete and ten partial responses). Another study was conducted in 13 patients suffering from progressive hormone-refractory metastatic prostate carcinoma (Burch et al, 2000). DCs were generated from circulating blood precursors and pulsed with fusion protein (PA2024) consisting of human GM-CSF and human prostatic acid phosphatase (PAP). Patients received two doses of antigen-loaded DCs by intravenous infusion, one month apart, followed by three subcutaneous doses of PA2024 with monthly intervals. Circulating prostatespecific antigen levels decreased in three patients and antigen specific T cell responses were detected in most of the patients within four weeks of the first DC infusion. Small and colleagues (Small et al, 2000) also used PA2024-loaded DCs in patients with hormone-refractory prostate cancer. Twelve patients were enrolled in the phase I trial and 19 in the phase II trial. DCs were generated from circulating blood precursors and pulsed with fusion protein PA2024. Patients received DC-vaccine, intravenously, in week 0, 4, and 8. A fourth infusion was

C. Myeloma Lim and Bailey-Wood (Lim and Bailey-Wood, 1999) have reported a study of idiotype protein pulsed DC vaccination in myeloma. Six patients were treated with monocyte-derived DCs pulsed with idiotype protein. Patients received three intravenous DC vaccinations, each two weeks apart. The immunizations were well tolerated. The majority of patients showed evidence of increased immune response toward idiotype protein. One patient showed a 25% fall in serum idiotype protein that was sustained over 13 months, and in two other patients it remained constant 8 months after the completion of vaccination. Reichardt and colleagues (Reichardt et al, 1999) conducted a feasibility study for DC vaccination after autologous peripheral-blood stem-cell transplantation for patients with myeloma. After 3-6 months of 306

Cancer Therapy Vol 1, page 307 administered in week 24, to patients with stable disease. Six patients in the phase I study also received DCs loaded with KLH. The treatment was well tolerated. All patients developed antigen specific T cell proliferative responses after second or third vaccination. Circulating prostate specific antigen levels decreased at least 50% in 3 patients and 25-49% in another 3 patients. For patients in the phase II study, median time to disease progression was 29 weeks. The investigators suggested that response was correlated with the development of an immune response to PAP and dose of DCs used. To explore the potential role of xenoantigen immunization in cancer patients, Fong and colleagues (Fong, Brockstedt et al, 2001) performed a phase I clinical trial in 21 patients with metastatic prostate cancer using DCs pulsed with recombinant mouse PAP as a tumor vaccine. Patients were immunized twice with PAP-loaded DCs 4 weeks apart via intravenous, intradermal, or intralymphatic injections. Patients tolerated the vaccinations without significant toxicity. All patients developed T cell response to mouse PAP and 11 of 21 patients also developed T cell response to the homologous self-Ag. Th1 associated immune response was observed with secretion of IFN-& and/or TNF-". Six of 21 patients had evidence of disease stabilization following completion of the vaccinations as determined by serum prostate specific antigen levels and radiographic imaging. However, no correlation was observed between clinical stabilization, and route of DC administration or the development of anti-PAP antibodies. These results suggest that clinical trials with DCbased vaccines are promising with positive clinical outcome. Protein-pulsed DCs are likely to be more effective vaccine candidate as it can stimulate both CD4+ and CD8+ T cells, whereas peptide-pulsed DCs are designed to stimulate CD8+ T cells only. The studies involving recombinant tumor-antigen fusion protein were also remarkable. The use of whole protein was advantageous over peptides in that the eligibility need not be restricted to particular HLA types, since patientâ&#x20AC;&#x2122;s own DCs would process the protein and present it in the context of the patientâ&#x20AC;&#x2122;s own HLA type.

two partial, and one mixed responses) to this therapeutic strategy. Marten and colleagues (Marten et al, 2003) also used monocyte-derived DCs fused with either allogeneic or autologous tumor cells for vaccination of patients with progressive metastatic renal-cell carcinoma. Twelve patients were treated with tumor-cell-DC hybrids intradermally every 4 weeks for a total of three infusions. The vaccine was well tolerated in all patients with no toxicity. After completion of vaccinations, four patients remained in a stable disease state with positive responses to DTH and in vitro cytotoxicity. Interestingly, there was no difference in clinical outcome between vaccination with allogeneic and autologous tumor fusions. Recently, Oosterwijk-Wakka and colleagues (Oosterwijk-Wakka et al, 2002) have conducted a phase I study in twelve patients with metastatic renal cell carcinoma. Patients received intradermal immunizations with autologous immature DCs pulsed with autologous tumor lysate, three times, each two weeks apart. The treatment was combined with low-dose of IL-2. IL-2 was administered for five consecutive days after each vaccination. In six patients, KLH was added to the DCs culture to monitor immunologic response. After vaccinations, cellular anti-KLH response was observed, however, tumor lysate specific proliferative response and humoral responses specific for tumor lysate or KLH were absent. This vaccination strategy with immature DCs had little benefit for patients with advanced renal-cell carcinoma as no objective clinical response was observed at the end of the study. Results from a different clinical trial in which patients with metastatic renal cell cancer were treated with autologous tumor lysate pulsed DCs showed moderate immunologic responses, with an increase in cytotoxic activity of PBLs against renal cell carcinoma cells and an increase in CD3+ CD28+ cells. In this trial seven patients remained with progressive disease, seven patients showed stable disease after treatment, and one patient developed a partial response (Marten et al, 2002). Metastatic renal cell carcinoma (RCC) remains a therapeutic challenge because of its demonstrated resistance to conventional means of therapy. Although the administration of recombinant cytokines has become an accepted standard treatment for patients with metastatic RCC, overall response rates have remained unsatisfactory. Preliminary results using DCs in RCC demonstrate that this treatment modality is well tolerated and can be associated with strong immunological responses. These data indicate a potential role of DCs vaccines for the induction of active immunity in patients with advanced RCC. In addition, observed immunologic changes in patients suggest an activation of the anti-tumoral immune response.

E. Renal-cell carcinoma Holtl and co-workers (Holtl et al, 1998; Holtl et al, 1999) used monocyte-derived DCs to treat patients with metastatic renal-cell carcinoma. DCs were pulsed with tumor-cell lysate and KLH. Patients received three intravenous vaccinations of antigen-pulsed DCs at one month intervals. One patient had a partial response and two others had stable disease. Kugler and colleagues (Kugler et al, 2000) used a different DC approach in the treatment of metastatic renalcell carcinoma. They developed tumor-cell-DC hybrids by electrofusion. Autologous tumor cells were fused with allogeneic monocyte-derived DCs and irradiated before vaccination. Seventeen patients were vaccinated subcutaneously and received a booster injection after 6 weeks. Patients with stable disease received continuous booster immunizations every 3 months. Treatment was well tolerated and 7 patients responded (Four complete,

F. Liver cancer In a recent study by Iwashita and co-workers (Iwashita et al, 2003), 10 patients were enrolled with unresectable primary liver cancer. Monocyte-derived DCs were pulsed with tumor lysate and KLH. Patients received four vaccinations at weekly intervals. Immunization was continued at monthly intervals for up to 12 vaccinations 307

Saha et al: Dendritic cell based vaccines for cancer depending on clinical response. DCs were administered into inguinal lymph nodes under ultrasound control. Treatment was well tolerated and DCs vaccination resulted KLH specific DTH response in 7 out of 10 patients. Three patients responded as serum levels of tumor markers decreased after vaccination in two patients and in one patient, one of the two liver tumors decreased in size and showed necrotic change after eight vaccinations. These results indicate that immunization by tumor lysate pulsed DCs were feasible in unresectable primary liver cancer patients without measured toxicity.

effective strategies for the treatment of advanced bladder cancer.

VII. Dendritic cell-based vaccines directed against colorectal cancer Carcinoembryonic antigen (CEA) is a 180-kDa membrane intercellular adhesion glycoprotein that is over expressed by a significant proportion of human tumors including >90% of colorectal, gastric, and pancreatic cancers, 70% of nonsmall cell lung cancer, and 50% of breast cancer. Human trials using DCs loaded with CEA in the form of peptide or mRNA are underway at several institutions. In the first reported DC trial (Morse et al, 1999), the effect of autologous monocytes-derived DCs pulsed with the HLA-A2-restricted CEA peptide CAP-1 was investigated in patients with advanced CEAexpressing malignancies. In this phase I study, the first 12 patients received four DC vaccinations intravenously, a week apart. The last 9 patients received DCs intravenously, together with peptide-pulsed DCs intradermally every 2 weeks for four immunizations. The last patient received IL-2 subcutaneously each day for 4 days after each DC injection. There were no treatment related toxic effects. Of 19 evaluable patients, 1 patient had a minor response and another had stable disease. Two patients were found to have a peptide-specific DTH response after vaccination. Fong and colleagues (Fong et al, 2001) performed a phase I study in 12 patients with metastatic colorectal or nonsmall cell lung carcinoma by immunization with a CEA-derived peptide. Flt-3 ligand, a hematopoietic growth factor, which expands DCs in vivo, was administered into patients subcutaneously for ten consecutive days before leukapheresis. The enriched DCs were pulsed in vitro with 610D peptide, an HLA-A*0201restricted epitope from CEA (CEA605-613) where aspartate was substituted for asparagine at position 610. Patients received immunizations with peptide pulsed DCs in one month apart by intravenous injection. No major toxic effects were observed during and after vaccination. They reported clinical responses in 5 of 12 patients. Two patients experienced tumor regression, 1 patient had a mixed response, and 2 exhibited stable disease for 3 to 6 months. Seven patients developed CTL response after vaccination. Clinical response correlated with expansion of CD8 tetramer + T cells. Five patients had >1% tetramer+ CD8 cells and 6 patients had %0.5% tetramer+ CD8 cells after vaccination. Sadanaga and colleagues (Sadanaga et al, 2001) have also reported a study of MAGE-3 peptide pulsed DC vaccination in 12 patients with advanced gastrointestinal carcinoma (six stomach, three esophagus, and three colon) expressing MAGE-3 gene. Monocyte-derived DCs were generated after leukapheresis. DCs were pulsed with peptide on day 7 of culture, and patients received four intravenous DC vaccinations, each 3 weeks apart. Treatment was well tolerated and clinical response was promising. In 7 patients, tumor markers decreased after the first or second vaccination compared with pre treatment level. Tumor regression evidenced by imaging studies was

G. Pediatric solid tumor Geiger and colleagues (Geiger et al, 2001) reported the results of a tumor lysate-pulsed DCs vaccine approach in a phase I trial of pediatric patients with solid tumors. Patients with neuroblastoma, sarcoma, and renal-cell carcinoma were treated in this study. DCs were generated from monocytes, after leukapheresis. Monocyte-derived DCs were pulsed separately with tumor cell lysates and KLH and then combined. Patients received three vaccinations, every 2 weeks, by intradermal injection near the inguinal lymph nodes. Fifteen patients were enrolled. Of 10 evaluable patients, DTH response was detected in 7 patients for KLH and 3 of 6 patients for tumor lysates. T cell priming specific for KLH was observed in 6 of 10 patients and to tumor in 3 of 7 patients as demonstrated by specific IFN-& secreting T cells. Five patients showed stable disease, including 3 who had minimal disease during vaccinations and remained tumor free for 16-30 months. Significant regression of multiple metastatic nodules was also observed in one patient with fibrosarcoma. The present clinical trial suggested that DCs vaccination approach is feasible in children with solid tumors. Because of its low toxicity and ability to generate specific immune responses, the use of DC-based tumor vaccines in children may become more beneficial in minimum disease setting.

H. Bladder cancer Nishiyama and co-workers (Nishiyama et al, 2001) have reported a pilot study of MAGE-3 peptide pulsed DC vaccination in four patients with advanced bladder cancer expressing MAGE-3 gene. Monocyte-derived DCs were generated after leukapheresis. DCs were pulsed with MAGE-3 epitope peptide (IMPKAGLLI) and patients received at least 6 subcutaneous DC vaccinations, each two weeks apart. The treatments were continued at regular intervals for up to 18 vaccinations depending on clinical response. During vaccinations, no significant side effects were noted in these patients. Three of four patients responded (one complete and two partial responses) with significant reductions in the size of lymph node metastasis and/or liver metastasis. They have also reported induction of MHC class I-restricted MAGE-3 specific CTLs in vitro in MAGE-3+ bladder cancer. Melanoma antigens such as the MAGE family are now recognized as tumor-rejection antigens and are expressed in various tumors, including bladder cancers and melanoma, but not in normal tissues. The present study indicates that MAGE-specific cancer immunotherapy might be one of the more attractive and 308

Cancer Therapy Vol 1, page 309 observed in 3 patients. Peptide-specific immune response evidenced by DTH reactions, were observed in 3 patients after the fourth vaccination. This study has shown peptidespecific CTL responses in 4 of 8 patients after vaccination. Intracellular cytokine analysis was also performed for 6 patients. In 3 of 6 patients, the ratio of IFN-&/IL-4 of CD4positive cells increased after vaccination and 2 of these 3 patients had tumor regression. These results are interesting and may have favorable outcome in future clinical trial. Morse and co-workers (Morse et al, 2003) have conducted a phase I/II study of CEA mRNA-pulsed DCs for patients with metastatic malignancies expressing this tumor antigen. In the dose-escalating phase I study 29 patients were enrolled and 13 patients in the phase II study. Monocyte derived DCs were pulsed with CEA mRNA and then administered intravenously and intradermally every 2 weeks for a total of four infusions. Eight patients also received IL-2 subcutaneously each day for four days after each DCs infusion. The immunizations were well tolerated. CEA-specific DTH response was observed in 3 of the 19 patients and 6 of the 13 patients in the phase I, and phase II study respectively. CEA-specific CTL response evaluated in 3 patients was moderate after immunization. Of the 24 patients evaluable for response in the phase I study, 6 patients achieved objective clinical responses or disease stabilization- 1 complete, 2 partial responses, and 3 cases of stable disease. In the phase II study, 9 of 13 patients have relapsed at a median of 122 days. Another approach for the development of both cellular and humoral immune responses to known TAAs is the use of anti-idiotype antibodies. Based on the immune network hypothesis of Lindemann (1973) and Jerne (1974), any epitope could be converted into idiotypic determinants expressed on antibodies. Anti-idiotypic (Id) antibodies that share sequence homologies with nominal TAA could act as functional mimics of T cell antigens and stimulate cellular immune responses. The authors have developed and characterized a murine anti-Id mAb, designated 3H1 or CeaVac. 3H1 was generated against an anti-CEA antibody, designated 8019, which reacts with a specific epitope on CEA that is highly restricted to tumor cells and not found on normal tissues (BhattacharyaChatterjee et al, 1990). 3H1 anti-Id antibody functioned as an internal image of CEA by generating anti-anti-Id (Ab3) responses in mice, rabbits and monkeys that recognized CEA and had a major antitumor effect in a murine tumor model (Pervin et al, 1997). In a phase I clinical trial, among 23 patients with advanced colorectal cancer, 17 generated anti-anti-Id Ab3 responses, and 13 of these responses were proven to be true anti-CEA responses (Ab1') (Foon et al, 1995; Foon et al, 1997). These patients were treated with aluminum hydroxide-precipitated 3H1. CeaVac have also shown promise as a potential vaccine candidate in phase II clinical trials (Foon et al, 1999) for colorectal cancer patients. Cellular immune responses observed in these patients were CD4+ Th1 type T cell responses. One area of interest to us has been the development of new immune adjuvants that may augment the potency of 3H1 as a tumor vaccine. In our recent study (Saha et al,

2003), in a murine model of colon cancer, we have shown that efficacy of 3H1 could be improved by using bone marrow derived DCs as direct antigen presenting cells. In this study, immunization of na誰ve C57BL/6 (H-2b) mice with 3H1-pulsed DCs induced humoral and cellular anti3H1 as well as anti-CEA immunity. 3H1-DC immunization activated both MHC class II-restricted CD4+ T cells, as well as MHC class I-restricted CD8+ T cells. Mice immunized with 3H1 were protected against murine colorectal cancer cell line MC-38 transfected with human CEA (clone C15-4.3), whereas no protection was observed when 3H1 vaccinated mice were challenged with nontransfected parental MC-38 cells. One hundred percent of experimental mice immunized with 3H1-DC rejected CEA expressing C-15 tumor cells. The tumor rejection in 3H1-pulsed DC-treated mice was associated with the induction of a memory response that helped those mice to survive a second challenge with a lethal dose of C-15 cells. Currently, we are engaged to evaluate the potency of this vaccine in mice transgenic for human CEA. Our preliminary data in transgenic mice system appear promising and the implication of these findings for the use of 3H1-pulsed DCs as vaccine for CEA-positive human cancer patients need to be investigated. These pre-clinical and clinical results provide evidence of safety and feasibility and induction of antigenspecific immunity using DCs based approach to immunotherapy. These studies also provide supporting evidence that the treatment of gastrointestinal cancers with antigen-pulsed DCs has a promising future. Given these promising results, additional clinical investigations are warranted to confirm and further characterize the efficacy of different approaches.

VIII. Opportunities and challenges for DC-based immunotherapy Several published clinical studies have shown that generation of antigen-loaded DCs ex vivo on a clinical scale is possible and DCs vaccination is safe and well tolerated. Most of these phase I clinical trials have shown specific antitumor immune responses with some clinically meaningful outcome. However, the use of potent immunostimulatory platforms such as DCs carries a risk of inducing autoimmune responses against self-antigens, specifically if the target antigen is also expressed by normal cells (Ludewig et al, 2000). Increasing evidence suggest that DCs could prime T cell mediated autoimmune diseases (Pettit and Thomas, 1999; Drakesmith et al, 2000). Such DC-mediated autoimmunity could be due to cytokine-mediated dysregulation of DCs as well as defects in the expression of genes regulating DC functions (Drakesmith et al, 2000). Thus, the future of DC-based cancer vaccines will also depend on our capacity to evaluate and control the risk of eliciting such autoimmune responses. Another important challenge, specifically when autologous DCs are used to prepare the vaccine, is that cancer patients are known to frequently exhibit defect in DC-based functions. This might include defect in antigen presentation, and in some cases in DC maturation 309

Saha et al: Dendritic cell based vaccines for cancer of defective dendritic cell differentiation in cancer. Clin Cancer Res 6, 1755-1766. Arnold-Schild D, Hanau D, Spehner D, Schmid C, Rammensee HG, dela Salle H, and Schild H (1999) Cutting edge: receptor mediated endocytosis of heat shock proteins by professional antigen-presenting cells. J Immunol 162, 3757-3760. Ashley DM, Faiola B, Nair S, Hale LP, Bigner DD, and Gilboa E (1997) Bone-marrow generated dendritic cells pulsed with tumor extracts or tumor RNA induce antitumor immunity against central nervous system tumors. J Exp Med 186, 1177-1182. Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, and Palucka K (2000) Immunobiology of dendritic cells. Annu Rev Immunol 18, 767-811. Banchereau J, Palucka AK, Dhodapkar M, Burkeholder S, Taquet N, Rolland A, Taquet S, Coquery S, Wittkowski KM, Bhardwaj N, Pineiro L, Steinman R, and Fay J (2001) Immune and clinical responses in patients with metastatic melaloma to CD34+ progenitor-derived dendritic cell vaccine. Cancer Res 61, 6451-6458. Banchereau J and Steinman RM (1998) Dendritic cells and the control of immunity. Nature 392, 245-252. Bender A, Sapp M, Schuler G, Steinman RM, and Bhardwaj N (1996) Improved methods for the generation of dendritic cells from non-proliferating progenitors in human blood. J Immunol Methods 196, 121-135. Bennett SR, Carbone FR, Karamalis F, Flavell RA, Miller JF, and Heath WR (1998) Help for cytotoxic-T-cell responses is mediated by CD40 signaling. Nature 393, 478-480. Bhattacharya-Chatterjee M, Mukherjee S, Biddle W, Foon KA, and Kohler H (1990) Murine monoclonal anti-idiotype antibody as a potential network antigen for human carcinoembryonic antigen. J Immunol 145, 2758-2765. Bodey B, Bodey B Jr, Siegel SE, and Kaiser HE (2000) Failure of cancer vaccines: the significant limitations of this approach to immunotherapy. Anticancer Res 20, 2665-2676. Borrello IM and Sotomayor EM (2002) Cancer vaccines for hematologic malignancies. Cancer Control 9, 138-151. Burch PA, Breen JK, Buckner JC, Gastineau DA, Kaur JA, Laus RL, Padley DJ, Peshwa MV, Pilot HC, Richardson RL, Smits BJ, Sopapan P, Strang G, Valone FH, and Vuk-Pavlovic S (2000) Priming tissue-specific cellular immunity in a phase I trial of autologous dendritic cells for prostate cancer. Clin Cancer Res 6, 2175-2182. Butterfield LH, Ribas A, Dissette VB, Amarnani SN, Vu HT, Oseguera D, Wang H, Elashoff RM, McBride WH, Mukherji B, Cochran AJ, Glaspy JA, and Economou JS (2003) Determinant spreading associated with clinical response in dendritic cell-based immunotherapy for malignant melanoma. Clin Cancer Res 9, 998-1008. Caux C, Massacrier C, Vandervliet B, Dubois B, Durand I, Cella M, Lanzavecchia A, and Banchereau J (1997) CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to granulocyte-macrophage colony- stimulating factor plus tumor necrosis factor alpha: II. Functional analysis. Blood 90, 1458-1470. Caux C, Vanbervliet B, Massacrier C, Dezutter-Dambuyant C, de Saint-Vis B, Jacquet C, Yoneda K, Imamura S, Schmitt D, and Banchereau J (1996) CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to GM-CSF+TNF-alpha. J Exp Med 184, 695-706. Cella M, Jarrossay D, Facchetti F, Alebardi O, Nakajima H, Lanzavecchia A, and Colonna M (1999) Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amount of type 1 interferon. Nat Med 5, 919-923.

(Gabrilovich et al, 1996; Gabrilovich et al, 1997; Almand et al, 2000). Tumors themselves can secrete various mediators including IL-6, IL-10, VEGF that have recently been found to inhibit DC differentiation and/or maturation. The in vitro treatment of DCs must be optimized to resolve this issue. Alternatively, immunopotentiating molecules such as IL-2 (Shimizu et al, 1999) can be administered with antigen-loaded DCs to overcome the problem. It remains questionable whether an immune reaction alone will be able to eradicate large tumor masses in advanced-stage disease. Human tumors are too heterogeneous in terms of the antigens they express and their susceptibility to immune-mediated killing. Immunotherapy in conjunction with standard treatments is likely to be more successful. Therefore more attractive option for tumor immunotherapy might be to maintain or resolve minimal residual disease, once the mass of tumor has been resected by conventional methods (Bodey et al, 2000). Future studies will improve this approach for modulating immunity in the clinic.

IX. Concluding remarks Current therapeutic approaches to metastatic cancer, including chemotherapy and radiotherapy, have had little impact on survival for patients with a range of malignant diseases. It is obvious that we need to find out a better approach for more effective treatments. Recent advances in the field of tumor immunology have expanded our understanding of the nature of TAAs and mechanisms of T cell activation. Successful activation of T cell response to these TAAs requires that they be presented in the context of the appropriate co-stimulatory signals. Recent insights into the role of DCs as the potent antigen-presenting cells that initiate immune responses may provide the basis for generating more effective antitumor immune responses. Several forms of DC-mediated immunotherapy are currently being investigated with great intensity, using a wide variety of different vaccination protocols. Indeed, both preclinical as well as initial clinical results are very promising and clearly justify pursuing this approach. However, it is necessary to perform clinical studies in a well designed and well controlled fashion, since otherwise, negative clinical results will appear that may threaten the acceptance of the whole concept of DC-mediated tumor immunotherapy. Hopefully, our recent understanding of tumor immunology and current clinical approaches of DCbased vaccines will provide us help to develop more effective vaccines against cancer including colorectal cancer in near future.

Acknowledgements This work was supported in part by the following grants from the National Institutes of Health (NIH): RO1 CA86025, RO1 CA91878 and RO1 CA104804.

References Almand B, Resser JR, Lindman B, Nadaf S, Clark JI, Kwon ED, Carbone DP, and Gabrilovich DI (2000) Clinical significance

310

Cancer Therapy Vol 1, page 311 Celluzzi CM, Mayordomo JI, Storkus WJ, Lotze MT, and Falo LD Jr (1996) Peptide-pulsed dendritic cells induce antigenspecific CTL-mediated protective tumor immunity. J Exp Med 183, 283-287. Chang AE, Redman BG, Whitfield JR, Nickoloff BJ, Braun TM, Lee PP, Geiger JD, and Mule JJ (2002) A phase I trial of tumor lysate-pulsed dendritic cells in the treatment of advanced cancer. Clin Cancer Res 8, 1021-1032. Chapoval AI, Tamada K, and Chen L (2000) In vitro growth inhibition of a broad spectrum of tumor cell lines by activated human dendritic cells. Blood 95, 2346-2351. Coyle AJ and Gutierrez-Ramos JC (2001) The expanding B7 superfamily: Increasing complexity in co-stimulatory signals regulating T cell function. Nat Immunol 2, 203-209. Dembic Z, Schenck K, and Bogen B (2000) Dendritic cells purified from myeloma are primed with tumor-specific antigen (idiotype) and activate CD4+ T cells. Proc Natl Acad Sci USA 97, 2697-2702. Drake CG and Pardoll DM (2002) Tumor immunology-towards a paradigm of reciprocal research. Semin Cancer Biol 12, 7380. Drakesmith H, Chain B, and Beverley P (2000) How can dendritic cells cause autoimmune disease? Immunol Today 21, 214-217. Fanger NA, Maliszewski CR, Schooley K, and Griffith TS (1999) Human dendritic cells mediate cellular apoptosis via the tumor necrosis-factor-related apoptosis-inducing ligand (TRAIL). J Exp Med 190, 1155-1164. Fernandez NC, Lozier A, Flament C, Ricciardi-Castagnoli P, Bellet D, Suter M, Perricaudet M, Tursz T, Maraskovsky E, and Zitvogel L (1999) Dendritic cells directly trigger NK cell functions: cross-talk relevant in innate antitumor immune responses in vivo. Nat Med 5, 405-411. Finn OJ and Lotze MT (1998) Third Keystone Symposium on cellular immunology and the immunotherapy of cancer. J Immunother 21, 114-118. Fong L, Brockstedt D, Benike C, Breen JK, Strang G, Ruegg CL, and Engleman EG (2001) Dendritic cell-based xenoantigen vaccination for prostate cancer immunotherapy. J Immunol 167, 7150-7156. Fong L and Engleman EG (2000) Dendritic cells in cancer immunotherapy. Annu Rev Immunol 18, 245-273. Fong L, Hou Y, Rivas A, Benike C, Yuen A, Fisher GA, Davis MM, and Engleman EG (2001) Altered peptide ligand vaccination with Flt3 ligand expanded dendritic cells for tumor immunotherapy. Proc Natl Acad Sci USA 98, 88098814. Foon KA, Chakraborty M, John WJ, Sherratt A, Kohler H, and Bhattacharya-Chatterjee M (1995) Immune response to the carcinoembryonic antigen in patients treated with an antiidiotype antibody vaccine. J Clin Invest 96, 334-342. Foon KA, John WJ, Chakraborty M, Sherratt A, Garrison J, Flett M, and Bhattacharya-Chatterjee M (1997) Clinical and immune responses in advanced colorectal cancer patients treated with anti-idiotype monoclonal antibody vaccine that mimics the carcinoembryonic antigen. Clin Cancer Res 3, 1267-1276. Foon KA, John WJ, Chakraborty M, Das R, Teitelbaum A, Garrison J, Kashalo O, Chatterjee SK, and BhattcharyaChatterjee M (1999) Clinical and immune responses in resected colon cancer patients treated with anti-idiotype monoclonal antibody vaccine that mimics the carcinoembryonic antigen. J Clin Oncol 17, 2889-2895. Gabrilovich DI, Chen HL, Girgis KR, Cunningham HT, Meny GM, Nadaf S, Kavanaugh D, and Carbone DP (1996) Production of vascular endothelial growth factor by human tumors inhibits the functional maturation of dendritic cells. Nature Med 2, 1096-1103.

Gabrilovich DI, Corak J, Ciernik IF, Kavanaugh D, and Carbone DP (1997) Decreased antigen presentation by dendritic cells in patients with breast cancer. Clin Cancer Res 3, 483-490. Geiger J, Hutchinson RJ, Hohenkirk LF, McKenna EA, Yanik GA, Levine JE, Chang AE, Braun TM, and Mule JJ (2001) Vaccination of pediatric solid tumor patients with tumor lysate-pulsed dendritic cells can expand specific T cells and mediate tumor regression. Cancer Res 61, 8513-8519. Grassi F, Dezutter-Dambuyant C, McIlroy D, Jacquet C, Yoneda K, Imamura S, Boumsell L, Schmitt D, Autran B, Debre P, and Hosmalin A (1998) Monocyte-derived dendritic cells have a phenotype comparable to that of dermal dendritic cells and display ultrastructural granules distinct from Birbeck granules. J Leukoc Biol 64, 484-493. Greenlee RT, Murray T, Bolden S, and Wingo PA (2000) Cancer statistics, 2000. CA Cancer J Clin 50, 7-33. Grouard G, Rissoan MC, Filgueira L, Durand I, Banchereau J, and Liu YJ (1997) The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand. J Exp Med 185, 1101-1111. Hart DN and McKenzie JL (1988) Isolation and characterization of human tonsil dendritic cells. J Exp Med 168, 157-170. Hart DN and Prickett TC (1993) Adhesion molecules in tonsil DC-T cell interactions. Adv Exp Med Biol 329, 65-69. Hart I and Colaco C (1997) Immunotherapy. Fusion induces tumour rejection [news]. Nature 388, 626-627. Hock BD, Starling GC, Daniel PB, and Hart DN (1994) Characterization of CMRF-44, a novel monoclonal antibody to an activation antigen expressed by the allostimulatory cells within peripheral blood, including dendritic cells. Immunology 83, 573-581. Holtl L, Rieser C, Papesh C, Ramoner R, Bartsch G, and Thurnher M (1998) CD83+ blood dendritic cells as a vaccine for immunotherapy of metastatic renal-cell cancer [letter]. Lancet 352, 1358. Holtl L, Rieser C, Papesh C, Ramoner R, Herold M, Klocker H, Radmayr C, Stenzl A, Bartsch G, and Thurnher M (1999) Cellular and humoral immune responses in patients with metastatic renal cell carcinoma after vaccination with antigen pulsed dendritic cells. J Urol 161, 777-782. Hsu FJ, Benike C, Fagnoni F, Liles TM, Czerwinski D, Taidi B, Engleman EG, and Levy R (1996) Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells. Nat Med 2, 52-58. Hung K, Hayashi R, Lafond-Walker A, Lowenstein C, Pardoll D, and Levitsky H (1998) The central role of CD4+ T cells in the antitumor immune response. J Exp Med 188, 2357-2368. Iwashita Y, Tahara K, Goto S, Sasaki A, Kai S, Seike M, Chen CL, Kawano K, and Kitano S (2003) A phase I study of autologous dendritic cell-based immunotherapy for patients with unresectable primary liver cancer. Cancer Immunol Immunother 52, 155-161. Jenne L, Arrighi JF, Jonuleit H, Saurat JH, and Hauser C (2000) Dendritic cells containing apoptotic melanoma cells prime human CD8+ T cells for efficient tumor cell lysis. Cancer Res 60, 4446-4452. Jerne NK (1974) Towards a network theory of the immune system. Ann Immunol (Paris) 125C, 373-389. Kraal G, Breel M, Janse M, and Bruin G (1986) Langerhansâ&#x20AC;&#x2122; cells, veiled cells, and interdigitating cells in the mouse recognized by a monoclonal antibody. J Exp Med 163, 981997. Krause SW, Neumann C, Soruri A, Mayer S, Peters JH, Andreesen R (2002) The treatment of patients with disseminated malignant melanoma by vaccination with autologous cell hybrids of tumor cells and dendritic cells. J Immunother 25, 421-428.

311

Saha et al: Dendritic cell based vaccines for cancer Kugler A, Stuhler G, Walden P, Zoller G, Zobywalski A, Brossart P, Trefzer U, Ullrich S, Muller CA, Becker V, Gross AJ, Hemmerlein B, Kanz L, Muller GA, and Ringert RH (2000) Regression of human metastatic renal cell carcinoma after vaccination with tumor cell-dendritic cell hybrids. Nat Med 6, 332-336. Landis SH, Murray T, Bolden S, and Wingo PA (1998) Cancer statistics, 1998. CA Cancer J Clin 48, 6-29. Lanzavecchia A (1996) Mechanisms of antigen uptake for presentation. Curr Opin Immunol 8, 348-354. Lim SH and Bailey-Wood R (1999) Idiotypic protein-pulsed dendritic cell vaccination in multiple myeloma. Int J Cancer 83, 215-222. Lindemann J (1973) Speculations on idiotypes of homobodies. Ann Immunol (Paris) 124, 171-184. Lodge PA, Jones LA, Bader RA, Murphy GP, and Salgaller ML (2000) Dendritic cell-based immunotherapy of prostate cancer: immune monitoring of a phase II clinical trial. Cancer Res 60, 829-833. Lotze M, Elder E, Whiteside T et al. (1998) Dendritic cell therapy of cancer - not just an antigen presenting cell. 5th International Symposium on Dendritic Cells in Fundamental and Clinical Immunology. Pittsburgh, PA, USA. Lotze MT, Hellerstedt B, Stolinski L, Tueting T, Wilson C, Kinzler D, Vu H, Rubin JT, Storkus W, Tahara H, Elder E, and Whiteside T (1997) The role of interleukin-2, interleukin-12, and dendritic cells in cancer therapy. Cancer J Sci Am 3 (Suppl 1), S109-S114. Ludewig B, Ochsenbein AF, Odermatt B, Paulin D, Hengartner H, and Zinkernagel RM (2000) Immunotherapy with dendritic cells directed against tumor antigens shared with normal host cells results in severe autoimmune disease. J Exp Med 191, 795-804. Mackensen A, Herbst B, Chen JL, Kohler G, Noppen C, Herr W, Spagnoli GC, Cerundolo V, and Lindemann A (2000) Phase I study in melanoma patients of a vaccine with peptidepulsed dendritic cells generated in vitro from CD34(+) hematopoietic progenitor cells. Int J Cancer 86, 385-392. Maeurer MJ and Lotze MT (1997) Tumor recognition by the cellular immune system: new aspects of tumor immunology. Int Rev Immunol 14, 97-132. Maier T, Tun-Kyi A, Tassis A, Jungius KP, Burg G, Dummer R, and Nestle FO (2003) Vaccination of patients with cutaneous T-cell lymphoma using intranodal injection of autologous tumor-lysate-pulsed dendritic cells. Blood 102, 2338-2344. Maraskovsky E, Daro E, Roux E, Teepe M, Maliszewski CR, Hoek J, Caron D, Lebsack ME, and McKenna HJ (2000) In vivo generation of human dendritic cell subsets by Flt-3 ligand. Blood 96, 878-884. Marten A, Flieger D, Renoth S, Weineck S, Albers P, Compes M, Schottker B, Ziske C, Engelhart S, Hanfland P, Krizek L, Faber C, von Ruecker A, Muller S, Sauerbruch T, and Schmidt-Wolf IGH (2002) Therapeutic vaccination against metastatic renal cell carcinoma by autologous dendritic cells: preclinical results and outcome of a first clinical phase I/II trial. Cancer Immunol Immunother 51, 637-644. Marten A, Renoth S, Heinicke T, Albers P, Pauli A, Mey U, Caspari R, Flieger D, Hanfland P, von Ruecker A, EisHubinger AM, Muller S, Schwaner I, Lohmann U, Heylmann G, Sauerbruch T, and Schmidt-Wolf IGH (2003) Allogeneic dendritic cells fused with tumor cells: preclinical results and outcome of a clinical phase I/II trial in patients with metastatic renal cell carcinoma. Hum Gene Ther 14, 483494. Metlay JP, Witmer-Pack MD, Agger R, Crowley MT, Lawless D, and Steinman RM (1990) The distinct leukocyte integrins of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies. J Exp Med 171, 1753-1771.

Moore HC and Haller DG (1999) Adjuvant therapy of colon cancer. Semin Oncol 26, 545-555. Morel S, Levy F, Burlet-Schiltz O, Brasseur F, Probst-Kepper M, Peitrequin AL, Monsarrat B, Van Velthoven R, Cerottini JC, Boon T, Gairin JE, and Van den Eynde BJ (2000) Processing of some antigens by the standard proteasome but not by the immunoproteasome results in poor presentation by dendritic cells. Immunity 12, 107-117. Morse MA, Coleman RE, Akabani G, Niehaus N, Coleman D, and Lyerly HK (1999) Migration of human dendritic cells after injection in patients with metastatic malignancies. Cancer Res 59, 56-58. Morse MA, Deng Y, Coleman D, Hull S, Kitrell-Fisher E, Nair S, Scholm J, Ryback ME, and Lyerly HK (1999) A phase I study of active immunotherapy with carcinoembryonic antigen peptide (CAP-1)-pulsed, autologous human cultured dendritic cells in patients with metastatic malignancies expressing carcinoembryonic antigen. Clin Cancer Res 5, 1331-1338. Morse MA, Nair SK, Mosca PJ, Hobeika AC, Clay TM, Deng Y, Boczkowski D, Proia A, Neidzwiecki D, Clavien PA, Hurwitz HI, Schlom J, Gilboa E, and Lyerly HK (2003) Immunotherapy with autologous, human dendritic cells transfected with carcinoembryonic antigen mRNA. Cancer Invest 21, 341-349. Murphy GP, Tjoa BA, Simmons SJ, Jarisch J, Bowes VA, Ragde H, Rogers M, Elgamal A, Kenny GM, Cobb OE, Ireton RC, Troychak MJ, Salgaller ML, and Boynton AL (1999) Infusion of dendritic cells pulsed with HLA-A2-specific prostate-specific membrane antigen peptides: a phase II prostate cancer vaccine trial involving patients with hormone-refractory metastatic disease. Prostate 38, 73-78. Murphy GP, Tjoa BA, Simmons SJ, Ragde H, Rogers M, Elgamal A, Kenny GM, Troychak MJ, Salgaller ML, and Boynton AL (1999) Phase II prostate cancer vaccine trial: report of a study involving 37 patients with disease recurrence following primary treatment. Prostate 39, 54-59. Nair SK, Boczkowski D, Morse M, Cumming RI, Lyerly HK, and Gilboa E (1998) Induction of primary carcinoembryonic antigen (CEA)-specific cytotoxic T lymphocytes in vitro using human dendritic cells transfected with RNA. Nat Biotechnol 16, 364-369. Nestle FO, Alijagic S, Gilliet M, Sun Y, Grabbe S, Dummer R, Burg G, and Schadendorf D (1998) Vaccination of melanoma patients with peptide or tumor lysate-pulsed dendritic cells. Nat Med 4, 328-332. Nestle F (2000) Vaccination of melanoma patients with peptide or tumour lysate-pulsed dendritic cells: a follow-up. 6th International Symposium on Dendritic Cells. Port Douglas, Australia, 46. Nishiyama T, Tachibana M, Horiguchi Y, Nakamura K, Ikeda Y, Takesako K, and Murai M (2001) Immunotherapy of bladder cancer using autologous dendritic cells pulsed with human lymphocyte antigen-A24-specific MAGE-3 peptide. Clin Cancer Res 7, 23-31. Norbury CC, Chambers BJ, Prescott AR, Ljunggren HG, and Watts C (1997) Constitutive macropinocytosis allows TAPdependent major histocompatability complex class I presentation of exogenous soluble antigen by bone marrow derived dendritic cells. Eur J Immunol 27, 280-288. Oosterwijk-Wakka JC, Tiemessen DM, Bleumer I, de Vries IJ, Jongmans W, Adema GJ, Debruyne FM, de Mulder PH, Oosterwijk E, and Mulders PF (2002) Vaccination of patients with metastatic renal cell carcinoma with autologous dendritic cells pulsed with autologous tumor antigens in combination with interleukin-2: a phase I study. J Immunother 25, 500-508.

312

Cancer Therapy Vol 1, page 313 O’Rourke MGE, Johnson M, Lanagan C, See J, Yang J, Bell JR, Slater GJ, Kerr BM, Crowe B, Purdie DM, Elliott SL, Ellem KAO, and Schmidt CW (2003) Durable complete clinical responses in a phase I/II trial using an autologous melanoma cell/dendritic cell vaccine. Cancer Immunol Immunother 52, 387-395. Panelli MC, Wunderlich J, Jeffries J, Wang E, Mixon A, Rosenberg SA, and Marincola FM (2000) Phase I study in patients with metastatic melanoma of immunization with dendritic cells presenting epitopes derived from the melanoma-associated antigens MART-1 and gp 100. J Immunother 23, 487-498. Pardoll DM (2000) Therapeutic vaccination for cancer. Clin Immunol 95, S44-S62. Pervin S, Chakraborty M, Bhattacharya-Chatterjee M, Zytin H, Foon KA, and Chatterjee SK (1997) Induction of antitumor immunity by an anti-idiotype antibody mimicking carcinoembryonic antigen. Cancer Res 57, 728-734. Pettit AR and Thomas R (1999) Dendritic cells: the driving force behind autoimmunity in rheumatoid arthritis. Immunol Cell Biol 77, 420-427. Philip R, Brunette E, Ashton J, Alters S, Gadea J, Sorich M, Yau J, O’Donoghue G, Lebkowski J, Okarma T, and Philip M (1998) Transgene expression in dendritic cells to induce antigen-specific cytotoxic T cells in healthy donors. Cancer Gene Ther 5, 236-246. Pulendran B, Banchereau J, Burkeholder S, Kraus E, Guinet E, Chalouni C, Caron D, Maliszewski C, Davoust J, Fay J, and Palucka K (2000) Flt-3 ligand and granulocyte colonystimulating factor mobilize distinct human dendritic cell subsets in vivo. J Immunol 165, 566-572. Pulendran B, Banchereau J, Maraskovsky E, and Maliszewski C (2001) Modulating the immune response with dendritic cells and their growth factors. Trends Immunol 22, 41-47. Qin Z and Blankenstein T (2000) CD4+ T cell-mediated tumor rejection involves inhibition of angiogenesis that is dependent on IFN gamma receptor expression by nonhematopoietic cells. Immunity 12, 677-686. Reddy A, Sapp M, Feldman M , Subklewe M, and Bhardwaj N (1997) A monocyte conditioned medium is more effective than defined cytokines in mediating the terminal maturation of human dendritic cells. Blood 90, 3640-3646. Reichardt VL, Okada CY, Liso A, Benike CJ, Stockerl-Goldstein KE, Engleman EG, Blume KG, and Levy R (1999) Idiotype vaccination using dendritic cells after autologous peripheral blood stem cell transplantation for multiple myeloma--a feasibility study. Blood 93, 2411-2419. Ridge JP, di Rosa F, and Matzinger P (1998) A conditioned dendritic cell can be a temporal bridge between a CD4+ Thelper and a T-killer cell. Nature 393, 474-478. Romani N, Reider D, Heuer M, Ebner S, Kampgen E, Eibl B, Niederwieser D, and Schuler G (1996) Generation of mature dendritic cells from human blood: an improved method with special regard to clinical applicability. J Immunol Methods 196, 137-151. Romero P, Cerottini JC, and Waanders GA (1998) Novel methods to monitor antigen-specific cytotoxic T-cell responses in cancer immunotherapy. Mol Med Today 4, 305-312. Rosenberg SA (1996) Development of cancer immunotherapies based on identification of the genes encoding cancer regression antigens. J Natl Cancer Inst 88, 1635-1644. Sadanaga N, Nagashima H, Mashino K, Tahara K, Yamaguchi H, Ohta M, Fujie T, Tanaka F, Inoue H, Takesako K, Akiyoshi T, and Mori M (2001) Dendritic cell vaccination with MAGE peptide is a novel therapeutic approach for gastrointestinal carcinomas. Clin. Cancer Res 7, 2277-2284.

Saha A, Chatterjee SK, Foon KA, Primus FJ, and BhattacharyaChatterjee M (2003) Murine dendritic cells pulsed with an anti-idiotype antibody induce antigen-specific protective antitumor immunity. Cancer Res 63, 2844-2854. Schoenberger SP, Toes RE, van der Voort EI, Offringa R, and Melief CJ (1998) T-cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions. Nature 393, 480483. Schuler-Thurner B, Dieckmann D, Keikavoussi P, Bender A, Maczek C, Jonuleit H, Roder C, Haendle I, Leisgang W, Dunbar R, Cerundolo V, von Den Driesch P, Knop J, Brocker EB, Enk A, Kampgen E, and Schuler G (2000) Mage-3 and influenza-matrix peptide-specific cytotoxic T cells are inducible in terminal stage HLA-A2.1+ melanoma patients by mature monocyte-derived dendritic cells. J Immunol 165, 3492-3496. Shimizu K, Fields RC, Giedlin M, and Mule JJ (1999) Systemic administration of interleukin 2 enhances the therapeutic efficacy of dendritic cell-based tumor vaccines. Proc Natl Acad Sci USA 96, 2268-2273. Shortman K and Caux C (1997) Dendritic cell development: multiple pathways to nature’s adjuvants. Stem Cells 15, 409419. Siegal FP, Kadowaki N, Shodell M, Fitzgerald-Bocarsly PA, Shah K, Ho S, Antonenko S, and Liu YJ (1999) The nature of the principal type 1 interferon-producing cells in human blood. Science 284, 1835-1837. Small EJ, Fratesi P, Reese DM, Strang G, Laus R, Peshwa MV, and Valone FH (2000) Immunotherapy of hormonerefractory prostate cancer with antigen-loaded dendritic cells. J Clin Oncol 18, 3894-3903. Smithers M, O’Connell K, MacFadyen S, Chambers M, Greenwood K, Boyce A, Abdul-Jabbar I, Barker K, Grimmett K, Walpole E, and Thomas R (2003) Clinical response after intradermal immature dendritic cell vaccination in metastatic melanoma is associated with immune response to particulate antigen. Cancer Immunol Immunother 52, 41-52. Steinman RM (1991) The dendritic cell system and its role in immunogenicity. Annu Rev Immunol 9, 271-296. Su Z, Dannull J, Heiser A, Yancey D, Pruitt S, Madden J, Coleman D, Niedzwiecki D, Gilboa E, and Vieweg J (2003) Immunological and clinical responses in metastatic renal cancer patients vaccinated with tumor RNA-transfected dendritic cells. Cancer Res 63, 2127-2133. Terheyden P, Straten P, Brocker EB, Kampgen E, and Becker JC (2000) CD40-ligated dendritic cells effectively expand melanoma-specific CD8+ CTLs and CD4+ IFN-gammaproducing T cells from tumor-infiltrating lymphocytes. J Immunol 164, 6633-6639. Thomas R, Chambers M, Boytar R, Barker K, Cavanagh LL, MacFadyen S, Smithers M, Jenkins M, and Andersen J (1999) Immature human monocyte-derived dendritic cells migrate rapidly to draining lymph nodes after intradermal injection for melanoma immunotherapy. Melanoma Res 9, 474-481. Thurner B, Haendle I, Roder C, Dieckmann D, Keikavoussi P, Jonuleit H, Bender A, Maczek C, Schreiner D, von den Driesch P, Brocker EB, Steinman RM, Enk A, Kampgen E, and Schuler G (1999) Vaccination with mage-3A1 peptidepulsed mature, monocyte-derived dendritic cells expands specific cytotoxic T cells and induces regression of some metastases in advanced stage IV melanoma. J Exp Med 190, 1669-1678. Thurner B, Roder C, Dieckmann D, Heuer M, Kruse M, Glaser A, Keikavoussi P, Kampgen E, Bender A, and Schuler G (1999) Generation of large numbers of fully mature and

313

Saha et al: Dendritic cell based vaccines for cancer stable dendritic cells from leukapheresis products for clinical application. J Immunol Methods 223, 1-15. Timmerman JM, Czerwinski DK, Davis TA, Hsu FJ, Benike C, Hao ZM, Taidi B, Rajapaksa R, Caspar CB, Okada CY, van Beckhoven A, Liles TM, Engleman EG, and Levy R (2002) Idiotype-pulsed dendritic cell vaccination for B-cell lymphoma: clinical and immune responses in 35 patients. Blood 99, 1517-1526. Titzer S, Christensen O, Manzke O, Tesch H, Wolf J, Emmerich B, Carsten C, Diehl V, and Bohlen H (2000) Vaccination of multiple myeloma patients with idiotype-pulsed dendritic cells: immunological and clinical aspects. Br J Haematol 108, 805-816. Tjoa BA, Erickson SJ, Bowes VA, Ragde H, Kenny GM, Cobb OE, Ireton RC, Troychak MJ, Boynton AL, and Murphy GP (1997) Follow-up evaluation of prostate cancer patients infused with autologous dendritic cells pulsed with PSMA peptides. Prostate 32, 272-278.

Tjoa BA, Simmons SJ, Bowes VA, Ragde H, Rogers M, Elgamal A, Kenny GM, Cobb OE, Ireton RC, Troychak MJ, Salgaller ML, Boynton AL, and Murphy GP (1998) Evaluation of phase I/II clinical trials in prostate cancer with dendritic cells and PSMA peptides. Prostate 36, 39-44. Tjoa BA, Simmons SJ, Elgamal A, Rogers M, Ragde H, Kenny GM, Troychak MJ, Boynton AL, and Murphy GP (1999) Follow-up evaluation of a phase II prostate cancer vaccine trial. Prostate 40, 125-129. Van Gool SW, Van Den HL, and Ceuppens JL (2000) Activation of the immune system in cancer patients. Med Pediatr Oncol 34, 1-9. Zhou LJ, Schwarting R, Smith HM, and Tedder TF (1992) A novel cell-surface molecule expressed by human interdigitating reticulum cells, Langerhans cells, and activated lymphocytes is a new member of the Ig superfamily. J Immunol 149, 735-742.

314

Cancer Therapy Vol 1, page 315 Cancer Therapy Vol 1, 315-322, 2003.

Multitargeted antifolate (Pemetrexed): A comprehensive review of its mechanisms of action, recent results and future prospects Review Article

Delphine Exinger1, Françoise Exinger2, Bertrand Mennecier3, Jean-Marc Limacher1, Patrick Dufour1, Jean-Emmanuel Kurtz 1,2,* 1

Department of Hematology and Oncology, Hôpitaux Universitaires de Strasbourg, 1 Avenue Molière, 67098-F Strasbourg France; 2 Laboratoire de Génétique, UPR 9003 du CNRS, IRCAD, 1 place de l’Hôpital, 67000-F Strasbourg France; 3 Service de Pneumologie, Hôpital Lyautey, 1 rue des Cannoniers, 67100-F Strasbourg France

__________________________________________________________________________________ *Correspondence: Dr. JE Kurtz, Laboratoire de Génétique, UPR 9003 du CNRS, IRCAD, 1 place de l’Hôpital, 67000-F Strasbourg France; e-mail: jean-emmanuel.kurtz@chru-strasbourg.fr Key Words: Pemetrexed, antifolate, 5-Fluorouracil, malignant mesothelioma Abbreviations: 5-fluoro-2´-deoxyuridine-5´-monophosphate, (FdUMP); glycinamide ribonucleotide formyltransferase, (GARFT); aminoimidazolecarboxamide ribonucleotide formyltransferase, (AICARFT); dihydrofolate reductase, (DHFR); tetrahydrofolate, (THF); Folylpolyglutamate synthase, (FGPS); thymidylate synthase, (TS). Received: 24 November 2003; Revised: 22 December 2003 Accepted: 24 December 2003; electronically published: December 2003

Summary Antifolate drugs belong to the anticancer class of antimetabolites drugs, among which methotrexate and 5Fluorouracil have been used for years in the treatment of various cancers such as colorectal and breast cancer, as well as lymphomas. 5-Fluorouracil exerts its action through incorporation of its triphosphate form into RNA, and through inhibition (by 5-FdUMP) of thymidylate synthase, the enzyme catalyzing the conversion of deoxyuridine 5´ monophosphate into deoxythymidine 5´ monophosphate. Conversely, methotrexate inhibits dihydrofolate reductase, an enzyme required for reduction of folates to di- or tetra-hydrofolates. Pemetrexed is a novel antifolate that targets various enzymes of the folate metabolism as well as thymidylate synthase, and is therefore called multitargeted antifolate. The aim of this work is to comprehensively expose pemetrexed’s mechanisms of action, and review its advantages over 5-fluorouracil or methotrexate in the treatment of solid tumors. Recent results of pemetrexed chemotherapy in breast, pancreas and colorectal cancer are discussed, as well as promising prospects for malignant mesothelioma. inhibition. As a consequence, 5-fluoro-2’-deoxyuridine-5’monophosphate (FdUMP) covalently binds to thymidylate synthase with N5-N10-methylene-THF (a metabolite of leucovorin), inducing a protein conformational change, trapping the enzyme at the intermediate step. Specific inhibitors to thymidylate synthase such as (Raltitrexed, Tomudex®, Astra-Zeneca) have been designed, and were shown to have similar efficacy when compared to 5Fluorouracil/leucovorin. Further development in anticancer drug research led to the synthesis of pemetrexed in 1992. Pemetrexed (Alimta®, Eli Lilly) was designed as a multitargeted antifolate, inhibiting thymidylate synthase, dihydrofolate reductase, and two other enzymes: glycinamide ribonucleotide formyltransferase (GARFT) and aminoimidazole

I. Introduction Among the armamentorium of anticancer agents, antimetabolites are a class of anticancer drugs widely used in a variety of conditions, including colorectal cancer, breast cancer, and hematologic malignancies such as nonHodgkin lymphomas. Antimetabolites exert their anticancer action either through direct inhibition of a key enzyme of folate metabolism (for example inhibition of dihydrofolate reductase by methotrexate), or through their action as irreversible enzyme false ligands (deoxyfluorouridine 5’ monophosphate and thymidylate synthase). Although synthesized in 1957, 5-Fluorouracil is still a cornerstone in the chemotherapy of digestive malignancies usually co-administered with leucovorin in order to positively modulate thymidylate synthase 315

Exinger et al: A comprehensive review of Pemetrexed (Alimta) mechanisms of action carboxamide (AICARFT).

ribonucleotide

formyltransferase

C1-tetrahydrofolate synthase is a trifunctional protein catalyzing the sequential reactions specified by the enzymes 10-formyl TRF synthase (E.C. 6.3.4.3), N5-N10methenyl-THF cyclohydrolase (E.C. 3.5.4.9) and N5-N10methylene-THF dehydrogenase (E.C. 1.5.1.5), which are structurally related to distinct domains (Strong et al, 1990). These three activities supply the activated onecarbon units required for the biosynthesis of thymidylate, purines, methionine, serine, glycine and many other compounds. Thus C1 THF synthase plays a pivotal role in the regulation of folate coenzymes interconversion, allowing the cell to satisfy its most immediate requirements. Thymidylate synthase (E.C. 2.1.1.45) is a key enzyme for the synthesis of deoxythymidine 5’ monophosphate (dTMP) from deoxyuridine 5’ monophosphate, and represents the only way to synthesize thymidylate de novo. Inhibition of TS is a major anticancer target, and has been achieved with fluoropyrimidines among which is 5-Fluorouracil, and more recently, with specific TS inhibitors such as raltitrexed. The metabolism of pyrimidines has been extensively investigated in prokaryotes and eukaryotes, to better characterize the enzymes involved in the activation of fluorinated prodrugs, such as 5-Fluorouracil.

II. The metabolism of folates: a key to understanding pemetrexed mechanisms of action on pyrimidine synthesis The folate coenzymes are found in mitochondria as well as in the cytosol of eukaryotic cells. Their role is to accept one-carbon units from donor molecules and to pass them on via various biosynthetic reactions. Folic acid is the root of the folate family. Reduction of folic acid by dihydrofolate reductase (DHFR) to dihydro- and tetrahydro-folate (THF) is mandatory for its biological activity. However, these unsubtituted forms are chemically unstable, and therefore undergo a further polyglutamation. Folylpolyglutamate synthase (FGPS) (E.C. 6.3.2.17) is required for the addition of glutamate residues to THF. As compared to the native forms, polyglutamated folates are retained in the cell, and are more effective enzymes substrates and regulators of folate-dependent enzymes. Interestingly, loss of FGPS activity through mutations is a major cause of antifolate resistance. One-carbon substituted THF derivatives are associated with particular metabolic cycles, e.g. 10-formyl THF in purine synthesis; N5-N10-methylene-THF in dTMP synthesis and 5-Methyl THF in methionine synthesis. The interconversion of serine and THF to N5-N10-methyleneTHF is catalyzed by the serine hydroxymethyltransferase (SHMT, E.C. 2.1.2.1). Interestingly, N5-N10-methyleneTHF is also the final metabolite of leucovorin, interacting with both thymidylate synthase (TS) and deoxyuridine 5’ monophosphate for the purpose of TS inhibition (Figure 1).

III. Folate derivatives: a bridge between the metabolism of pyrimidines and purines The de novo biosynthesis of inosine 5´ monophosphate, a precursor of purine nucleotides, is a complex metabolic pathway, which involves ten successive enzymatic steps.

Figure 1. The folate cycle. dUMP: deoxyuridine 5´ monophosphate; dTMP: deoxythymidine 5´ monophosphate. TS: thymidylate synthase; DHFR: dihydrofolate reductase; SHMT Serine hydroxy methyl transferase. Anticancer agents 5-FdUMP (5-Fluoro deoxyuridine 5´ monophosphate) and pemetrexed inhibit TS and TS plus DHFR, respectively.

316

Cancer Therapy Vol 1, page 317 Among these, two enzymes are folate dependent: glycinamide ribonucleotide formyltransferase (GARFT) and aminoimidazole carboxamide ribonucleotide formyltransferase (AICARFT). Some drugs interacting with the metabolism of folates may also have activity towards folate-dependent enzymes within purine biosynthesis and have significant antiproliferative activity. Specific inhibitors to GARFT such as lometrexol were obtained for this purpose but clinical development was abandoned due to unacceptable myelotoxicity (Boger et al, 2000).

Figure 2. Chemical structure of pemetrexed

antiproliferative effect of pemetrexed, suggesting an alternate/additional mode of action. As a result, adding both thymidine and hypoxanthine rescued cell growth, showing that pemetrexed exerted its activity on both purine and pyrimidine biosynthesis (Shih et al, 1997, Smith et al, 1999). Pemetrexed was found to be an inhibitor of five enzymes involved in folate metabolism and purine / pyrimidine synthesis, i.e.: thymidylate synthase, dihydrolate reductase, GARFT, AICARFT and C1 THF synthase.

A. Pemetrexed: How does it work ? Pemetrexed or N-4 (2-(2-amino-3,4-dihydro-4-oxo7H-pyrrolo[2,3-d]pyrimidin-5-yl) ethyl) benzoyl)-Lglutamic acid is a structural analogue of methotrexate and lometrexol (Lansiaux et al, 1999) (Figure 2) that enters the cell through the reduced folate carrier, by a mechanism similar to that of raltitrexed and methotrexate (Zhao et al, 2000). Of note is the fact that a decreased expression of the reduced folate carrier may lead to acquired pemetrexed resistance(Wang et al, 2003). Once in the intracellular compartment, pemetrexed undergoes polyglutamation, catalyzed by folylpolyglutamate synthase, for which it has a very low Km, as compared to methotrexate (Habeck et al, 1995). Polyglutamation of pemetrexed reduces the drug clearance from the intracellular compartment, and increases its activity towards some of its enzymatic targets. A reduced rate of polyglutamation has been described as a mechanism of resistance to methotrexate, but also for pemetrexed (McCloskey et al, 1991, Mauritz et al, 2002). Similarly, an increased activity of !glutamyltransferase may result in pemetrexed resistance (Yao et al, 1995), as polyglutamated derivatives of pemetrexed are substrates for this enzyme (Rhee et al, 1993) (Table 1) Resistance to antifolates also involves the modification of cell cycle genes. The loss of pRb has been associated with a higher DHFR level of expression and resistance to methotrexate and 5-fluorodeoxyurine (DFUR) (Banerjee et al 2002). Similarly, it has been shown that high levels of cyclin D1 correlate with high level of DHFR transcription (Hochauser et al, 1996). Whether resistance to pemetrexed is also associated with an altered expression of cell cycle genes remains to be determined. Pemetrexed was synthesized in an effort to discover structural analogues to lometrexol, for the purpose of finding new GARFT inhibitors. However, in cell culture models, the addition of hypoxanthine did not rescue the

B. Thymidylate synthase dihydrofolate reductase

and

Although native pemetrexed is a poor inhibitor of TS, its polyglutamated (glu-3 and glu-5) forms show a 70 to 80-fold lower Ki for the enzyme. Conversely, polyglutamation has no effect on pemetrexed activity against DHFR, as the drug, either native or polyglutamated is a potent inhibitor of DHFR. Inhibition of both TS and DHFR results in a cytotoxic effect, as shown in various cultured cell lines (Chen et al, 2000).

C. GARFT and AICARFT Unlike its properties on DHFR, polyglutamated pemetrexed is a potent inhibitor of GARFT, mainly in its (glu-5) status, for which the Ki is 144-fold lower than the parent compound, thus strongly inhibiting de novo purine biosynthesis. However, in contrast to TS and DHFR inhibition, the pemetrexed-related inhibition of GARFT results in a cytostatic effect (Chen et al, 2000). As shown for GARFT, polyglutamated (glu-5) pemetrexed inhibits AICARFT in a significantly better range (13-fold) than pemetrexed itself (Shih et al, 1997).

D. C1 THF synthase As compared to TS, DHFR, GARFT and AICARFT, pemetrexed is a less potent inhibitor of C1 THF synthase.

Table 1: Mechanisms of resistance to pemetrexed Mechanism of resistance to pemetrexed Consequence Mutation of the Reduced Folate Carrier Decreased activity of folylypolyglutamate synthase Increased activity of !-glutamylhydrolase Increased activity of thymidylate synthase

(TS)

Reference

Decreased accumulation Decreased polyglutamation

Wang et al Mauritz et al

Decreased polyglutamation Decreased activity of pemetrexed

Rhee et al Sigmond et al

317

Exinger et al: A comprehensive review of Pemetrexed (Alimta) mechanisms of action consistent with other reports. These data suggested that pemetrexed was a promising drug for combination chemotherapy trials, especially with platinum in malignant mesothelioma.

However, the observed intracellular pemetrexed concentration (up to 50ÂľM) suggests that C1 THF synthase might still be in vivo a relevant target for pemetrexed. In summary, these effects induce an imbalance in nucleotide pools, consisting in an important decrease in dTTP, concomitantly with dCTP and dGTP, whereas the pool of dATP increases (Chen et al, 1998). The inhibition of TS results in the decrease of dTMP, and as a consequence, of dTTP. However, dTTP negatively regulates deoxycytidine deaminase, an enzyme that catalyzes the deamination of dCMP into dUMP. This modification of metabolic flux in favour of dUMP reduces the amount of dCMP available for further phosphorylation, and ultimately, the pool of dCTP.

VI. Miscellaneous solid tumors Pemetrexed has been evaluated in breast cancer patients who had failed previous anthracycline/taxanebased therapy (Miles et al, 2001, Martin et al, 2003). These trials concluded that in this setting of pretreated patients, objective response rates ranged from 20 to 30% with a median duration of response of 5.5 to 8 months. Toxicity was acceptable, mainly consisting of myelotoxicity and skin toxicity, the latter being well prevented with dexamethasone administration. In metastatic colorectal cancer, single-agent pemetrexed led to response rates of around 15% (Cripps et al, 1999, John et al, 2000), and with disappointing median response durations, of 3.3 and 4.4 months, respectively. Similarly, in gastric cancer, a response rate of 23% with a short median duration of response (4.4 months) was reported (Celio et al, 2002). In this study, toxicity was a major concern, with toxic deaths related to myelotoxicity, requiring folic acid/vitamin B12 prophylaxis in subsequent patients (see infra). In advanced pancreatic cancer, Miller et al, (2000) found a response rate of 6%, consistent with the results of single-agent gemcitabine which is currently the standard treatment for this condition, whereas the toxicity profile was acceptable.

IV. Pemetrexed single-agent therapy: a review of phase I and II trials In phase I studies, three different schedules of administration have been evaluated for pemetrexed singleagent chemotherapy, including a daily injection for 5 days every 3 weeks; a weekly injection for 4 weeks out of 6, and a single injection every 3 weeks (Rinaldi et al, 1995, 1999; McDonald et al, 1998). Severe myelotoxicity was the dose-limiting side-effect in the first two regimen. However, the weekly regimen was recommended at a weekly dose of 600mg/m2. Again, myelotoxicity was the dose-limiting toxicity, but at the recommended dose level, it was acceptable. Hematological and other toxicities from a total of 872 non-supplemented patients who entered phase II studies with pemetrexed (at 500 and 600mg/m2 every 3 weeks) appear in Table 2. Once the tolerance/dosing data had been obtained, pemetrexed was assessed in phase II trials in a variety of tumours, including non small cell lung cancer (NSCLC), malignant mesothelioma, breast, colorectal, gastric and pancreatic cancer. In NSCLC, pemetrexed has been evaluated in first (Rusthoven et al, 1999, Clarke et al, 2002) and second line therapy (Smit et al, 2003). Efficacy and tolerance data from these trials are reported in Table 3. From these data, one can assume that the efficacy of pemetrexed is consistent with that of standard therapy (platin doublets), with perhaps a better toxicity profile although grade 3 neutropenia is a concern.

Table 2: Grade 3 or 4 hematologic and non hematologic toxicity adapted from (Paz-Ares et al, 2003)

Toxicity ANC Hemoglobin Platelets Nausea Emesis Stomatitis Diarrhea Alk phos ALT AST Bilirubin Creatinine Cutaneous Fatigue Infection Pulmonary

V. Malignant mesothelioma Among the various cancers in which pemetrexed was evaluated, malignant mesothelioma might represent the most promising for its future use in current practice, in combination chemotherapy rather than as single agent. Pemetrexed monotherapy was investigated in malignant pleural mesothelioma (Scagliotti et al, 2003), and showed an overall response rate of 14% and a median progressionfree survival of 4.7 months in 64 patients among whom 50% had stage IV disease. The toxicity profile was

318

NCI-CTC toxicity grade (% of patients) 3 4 23 27 14 3 8 7 7 <1 3 2 3 <1 3 2 3 0 3 0 8 <1 6 2 <1 0 5 2 6 <1 3 2 2 2

Cancer Therapy Vol 1, page 319 Table 3: Results of pemetrexed single-agent therapy in NSCLC Trial Nb of evaluable Dose Overall patients (mg/m2) response (%) Rusthoven 30 600 (3 pts) 23.3 et al, 1999 500 (30 pts) Clarke et al, 42 600 15.8 2002 Smit et al, 81 600 8.9 2003

Median survival Toxicity (Gr 3& 4) rate (months) 9.2 9.8

Neutropenia Skin toxicity (rash) Neutropenia Skin toxicity (rash) Neutropenia Thrombopenia

response rate was significantly higher in the combination arm (41.3 vs 16.7%,p<0.0001) that also showed a benefit in overall survival (12.1 vs 9.3 months, p=0.02). However, further trials investigating the superiority of the pemetrexed-cisplatin doublet versus other cisplatin-based combinations are required before pemetrexed is registered.

VI. Pemetrexed-based combinations: is it the future ? Several phase I trials have investigated the maximal tolerated dose of pemetrexed in combination with platinum compounds. They showed (Todtmann et al, 1999, Hughes et al, 2002, Misset et al, 2002), that pemetrexed 500mg/m2 every 3 weeks was the recommended dose in combination with cisplatin, carboplatin or oxaliplatin. Similarly the same schedule of pemetrexed was shown to be well tolerated in combination with gemcitabine 1250mg/ m2 at day 1 and 8 (Adjei et al, 2000). Conversely, combination with protracted intravenous 5-Fluorouracil induced severe toxicity, although a bolus 5-Fluorouracil regimen showed better tolerance with pemetrexed (Schwartz et al, 1999). Other preliminary reports of pemetrexed combination with taxanes (MacKay et al, 2002) or vinorelbine (Millward et al, 2001) need further confirmation before phase II trials can be started. In NSCLC, two phase II trials of the pemetrexedcisplatin combination have been reported. These investigated pemetrexed at 500mg/m2 and cisplatin at 75mg/m2 every 3 weeks (Manegold et al, 2000, Shepherd et al, 2001). These trials showed similar response rates (39 and 45%) and median duration of responses of 10.9 and 8.9 months respectively. The toxicity profile was acceptable, as moderate myelotoxicity was the main sideeffect. Yet in NSCLC, low response rates (16%) for the combination of pemetrexed with gemcitabine (Ettinger et al, 2002) contrasted with better median survival (11.9 months); further trials are required to define the role of pemetrexed-based combinations in this condition. Other phase II pemetrexed-based combinations have focused on colorectal cancer, where the drug was combined with oxaliplatin, with disappointing preliminary results (Atkins et al, 2003) as compared to usual response rates of 40-50% in patients receiving 5-FU-oxaliplatin or irinotecan. This is in contrast with promising results in advanced pancreatic cancer, as others (Kindler et al, 2002) reported a 15% objective response rate with a 29% 1-year overall survival. In the light of promising results of single agent pemetrexed in malignant mesothelioma, a randomized (but not double-blinded) phase III trial was recently reported, comparing cisplatin to the combination of pemetrexed and cisplatin (Vogelzang et al, 2003). In this study, the combination of pemetrexed 500mg/m2 and cisplatin 75 mg/m2 every three weeks demonstrated a significant superiority as compared to single-agent cisplatin. The

VII. Prevention of pemetrexed toxicity The spectrum of antifolate-induced adverse events includes myelotoxicity as well as gastro-intestinal sideeffects. Although usually moderate, this toxicity may be unacceptable and prompted the clinical development of new antifolates, such as lometrexol. It has been shown that folic acid supplementation (Laohavini et al, 1996) reduced lometrexol toxicity. As shown before, myelotoxicity, especially neutropenia, is the dose limiting toxicity for pemetrexed. Cutaneous side effects are well controlled with steroid prophylaxis (Adjei et al, 2000). Obviously, the rationale for folic acid supplementation in patients receiving pemetrexed is based on the requirement of folic acid for DHF and THF synthesis. Similarly, methionine synthase and its cofactor, vitamin B12, requires N5-methyl THF as a methyl group donor for the conversion of homocystein to methionine. Data obtained in mice (Worzalla et al, 1998), as well as in humans (Bunn et al, 2001), have shown that vitamin B12 and folic acid supplementation reduced pemetrexed-induced toxicity. The recommended schedule of vitamin supplementation is oral folic acid (350 to 1000 Âľg/d), starting one week before pemetrexed therapy, combined with intramuscular vitamin B12 (1000Âľg) every 9 weeks (Bunn et al, 2001). Other schedules of supplementation are under investigation (Hammond et al, 2003), but further studies are required to determine whether folic acid supplementation might counterbalance pemetrexed activity on DHFR, and eventually decrease its clinical efficacy. In the above mentioned phase III randomized trial in malignant mesothelioma (Vogelzang et al, 2003), the efficacy parameters did not differ between supplemented and non supplemented patients. However, for all patients, overall survival curves strongly diverged (p= 0.020) whereas in supplemented patients, the difference only approached statistical significance (p=0.051). Surprisingly, patients who received cisplatin with supplementation did better than those with cisplatin alone. The authors suggested that supplementation enabled patients to receive more chemotherapy cycles, which could explain this phenomenon in addition, oral vitamin B12 supplementation might be considered as well to avoid 319

Exinger et al: A comprehensive review of Pemetrexed (Alimta) mechanisms of action intramuscular injections in the setting of patients that might experience chemotherapy-induced thrombopenia.

VII. Antifolates: a anticancer drugs research

phoenix

confirmed by phase III trials, comparing the pemetrexedcisplatin combination with a different platin-based doublet, in order to definitely recommend this combination as the gold standard therapy in this condition. Finally, data on antifolate agents such as pemetrexed emphasize the need for developing drugs which interact with the folate metabolism pathways, and should encourage both new drug development and clinical study of these anticancer agents.

The goal of interfering with the metabolism of nucleotides and folates against cancer was reached decades ago. The old drugs 5-Fluorouracil and methotrexate, are widely used in current oncology practice. Targeting pyrimidine metabolism was achieved through thymidylate synthase inhibition by 5Fluorodeoxyuridine 5’ monophosphate and leucovorin, and more recently with specific inhibitors such as raltitrexed. Although these agents are still part of innovative combination chemotherapy schedules, the concept of inhibiting folate metabolism has been revisited with the discovery of the multiple target antifolate pemetrexed. The search for methotrexate analogues that, supposedly, specifically targeted GARFT led to the development of pemetrexed, as its properties of inhibiting multiple enzymes within the same metabolic pathway were relevant for anticancer therapy. Inhibition of thymidylate synthase might represent the main mechanism of action of pemetrexed, although it is likely to differ from both 5-Fluorouracil and raltitrexed from the molecular point of view. In clinical practice, DHFR inhibition has some effect, at least in terms of toxicity, whereas the in vivo, impact of GARFT, AICARFT and C1 tetrahydrofolate synthase inhibition remains unclear. Therefore, pemetrexed differs from both 5-FU and methotrexate by its mechanisms of action, as well as its clinical spectrum of efficacy. So far, there is no data indicating that pemetrexed will replace 5-FU in the treatment of digestive malignancies or breast cancer, as new drugs such as oral fluoropyrimidines have proven efficacy and are widely used in clinical practice (Kurtz et al. 2003). Advances in the knowledge of pyrimidine metabolism, e.g the enzymes of the de novo and salvage pathway of pyrimidines, have led to the “re-birth” of antifolate chemotherapy. Among these new antimetabolites, capecitabine takes advantage of the overexpression of thymidine phosphorylase in tumor tissues, and UFT and S-1 combine 5-FU prodrugs to catabolic inhibitors. These new anticancer agents have now becomen part of current therapy in a variety of malignancies. Comparison of pemetrexed to methotrexate in terms of efficacy is more difficult, as this drug is mostly administered in combination chemotherapy schedules, except the case of high-dose methotrexate with folinic acid rescue. Clinical research with pemetrexed has led to contrasting results. Its activity on colorectal cancer is disappointing, as it is not better than 5-Fluorouracil or oral fluoropyrimidines, with an increased toxicity. In pancreatic cancer, gastric and breast cancer, large phase II or, optimally, phase III studies, will probably define the future role of pemetrexed. In contrast, there is some evidence that patients with malignant pleural mesothelioma can benefit from the combination of pemetrexed with cisplatin, in terms of response, and more importantly, survival. These data need however to be

References Adjei AA, Erlichman C, Sloan JA, Reid JM, Pitot HC, Goldberg RM, Peethambaram P, Atherton P, Hanson LJ, Alberts SR, Jett J (2000) Phase I and pharmacologic study of sequences of gemcitabine and the multitargeted antifolate agent in patients with advanced solid tumors. J Clin Oncol 18, 17481757. Atkins JN, Jacobs S, Wieand S, Smith R, John W, Renshaw G, Colangelo L, Geyer C, Wolmark N (2003) Pemetrexec and oxaliplatin for first-line treatment of patients with advanced colorectal cancer. A phase II of the NSABP foundation research program. Proc Am Soc Clin Oncol, Abstract 1108. Banerjee D, Mayer-Kuckuk P, Capiaux G, Budak-Alpdogan T, Gorlick R, Bertino JR (2002). Novel aspects of resistance to drugs targeted to dihydrofolate reductase and thymidylate synthase. Biochimica et Biophysica Acta 1587, 164-173 Boger DL, Labroli MA, Marsilje TH, Jin Q, Hedrick MP, Baker SJ, Shim JH, Benkovic SJ (2000) Conformationally restricted analogues designed for selective inhibition of GAR Tfase versus thymidylate synthase or dihydrofolate reductase. Bioorg Med Chem 8, 1075-1086. Bunn P, Paoletti P, Niyikiza C, Rusthoven J, Nelson K, Hanauske AR, Stabler S, Calvert H, Allen R (2001) Vitamin B12 and folate reduce toxicity of Alimta (pemetrexed disodium, LY231514, MTA), a novel antifolate/antimetabolite. Proc Am Soc Clin Oncol Abstract 300. Celio L, Buzzoni R, Longarini R, Marchiano A, Bajetta E (2002) Pemetrexed in gastric cancer, clinical experience and future perspectives. Semin Oncol, 29, 63-68 Chen VJ, Bewley JR, Andis SL, Schultz RM, Iversen PW, Shih C, Mendelsohn LG, Seitz DE, Tonkinson JL (1998) Preclinical cellular pharmacology of LY231514 (MTA): a comparison with methotrexate, LY309887 and raltitrexed for their effects on intracellular folate and nucleoside triphosphate pools in CCRF-CEM cells. Br J Cancer 78, 2734. Chen VJ, Bewley JR, Smith PG, Andis SL, Schultz RM, Iversen PW, Tonkinson JL, Shih C (2000)An assessment of the antithymine and antipurine characteristics of MTA (LY231514) in CCRF-CEM cells. Advan Enzyme Regul 40, 143-154. Clarke SJ, Abratt R, Goedhals L, Boyer MJ, Millward MJ, Ackland SP (2002) Phase II trial of pemetrexed disodium (ALIMTA, LY231514) in chemotherapy-naive patients with advanced non-small-cell lung cancer. Ann Oncol 13, 737741. Cripps C, Burnell M, Jolivet J, Batist G, Lofters W, Dancey J, Iglesias J, Fisher B, Eisenhauer EA (1999) Phase II study of first-line LY231514 (multi-targeted antifolate) in patients with locally advanced or metastatic colorectal cancer, an NCIC Clinical Trials Group study. Ann Oncol 10, 11751179. Ettinger DS, Monnerat C, Kelly K, Novello S, Brahmer JR, Readett D, Rusthoven J, Bunn PA, Le Chevalier T (2002)

320

Cancer Therapy Vol 1, page 321 Phase II trial of pemetrexed +gemcitabine in patients with advanced non-small cell lung cancer, important survival over response. Proc Am Soc Clin Oncol Abstract 1243. Habeck LL, Shih C, Gossett L, Leitner TA, Schultz RM, Andis SL, Moran RG (1995) Substrate specifity of mammalian folylpolyglutamate synthetase for 5,10dideazatetrahydrofolate analogues. Mol Pharmacol 48, 326333. Hammond L, Forero L, Beeram M, Forouzesh B, De Bono J, Tolcher A, Patnaik A, Monroe P, Clark R, Rowinsky EK (2003) Phase I study of pemetrexed (LY231514) with supplementation in patients with locally advanced or metastatic cancer. Proc Am Soc Clin Oncol Abstract 532 Hochhauser D, Schnieders B, Ercikan-Abali EA, Gorlick R, Muise-Helmericks R, Li WW, Fan J, Banerjee D, Bertino JR. (1996) Effect of cyclin D1 overexpression on drug sensitivity in a human fibrosarcoma cell line. JNCI 88, 1269-1275. Hughes A, Calvert P, Azzabi A, Plummer R, Johnson R, Rusthoven J, Griffin M, Fishwick K, Boddy AV, Verrill M, Calvert H (2002) Phase I clinial and pharmacokinetic study of pemetrexed and carboplatin in patients with malignant pleural mesothelioma. J Clin Oncol 15, 3533-3544 John W, Picus J, Blanke CD, Schulman LN, Rowinsky EK, Thornton DE, Loehrer PJ (2000) Activity of multitargeted antifolate (pemetrexed disodium, LY231514) in patients with advanced colorectal carcinoma, results from a phase II study. Cancer 88, 1807-1813. Kindler HL, Dugan W, Hochster H, Strickland D, Jacobs A, John WJ (2002) Clinical outcome in patients with advanced pancreatic cancer treated with pemetrexed/gemcitabine. Proc Am Soc Clin Oncol Abstract 499. Kurtz JE, Andres E, Natarajan-Amé S, Noël E, Dufour P. Oral chemotherapy in colorectal cancer treatment: review of the literature (2003). Eur J Int Med, 14, 18-25 Lansiaux A, Degardin M, Bailly C. Le (1999) LY231514. A multitargeted antifolate (MTA). Bull Cancer 86, 727-731 Laohavinij S, Wedge SR, Lind MJ, Bailey N, Humphreys A, Proctor M, Chapman F, Simmons D, Oakley A, Robson L, Gumbrell L, Taylor GA, Thomas HD, Boddy AV, Newell DR, Calvert AH (1996) Phase I clinical trial study of the antipurine antifolate lométrexol (DDATHF) given with oral folic acid. Investig New Drugs 14, 325-335 Mackay H, Carmichael J, Roberts J, Glasspool R, Molife R, Macham M, Readett D, Vasey P (2002) Phase I study of pemetrexed in combination with docetaxel in patients with advanced solid malignancies. Proc Am Soc Clin Oncol Abstract 885 Manegold C, Gatzemeier U, Von Pawel J, Pirker R, Malayeri R, Blatter J, Krejcy K (2000) Front-line treatment of advanced non-small-cell lung cancer with MTA (LY231514, pemetrexed disodium) and cisplatin, a multicenter phase II trial. Ann Oncol 11, 435-440 Martin M, Spielmann M, Namer M, DuBois A, Unger C, Dodwell DJ, Vodvarka P, Lind MJ, Calvert AH, Casado A, Zelek L, Lluch A, Carrasco E, Kayitalire L, Zielinski C (2003) Phase II study of pemetrexed in breast cancer patients pretreated with anthracyclines. Ann Oncol 14, 1246-1252 Mauritz R, Peters GJ, Priest DG, Assaraf YG, Drori S, Kathmann I, Noordhuis P, Bunni MA, Rosowsky A, Schornagel JH, Pinedo HM, Jansen G (2002) Multiple mechanisms of resistance to methotrexate and novel antifolates in human CCRF-CEM leukemia cells and their implications for folate homeostasis. Biochem Pharmacol 63, 105-115 McCloskey DE, McGuire JJ, Russell CA, Rowan BG, Bertino JR, Pizzorno G, Mini E (1991) Decreased folylpolyglutamate synthetase activity as a mechanism of methotrexate resistance in CCRF-CEM human leukemia sublines. J Biol Chem 266, 6181-6187

McDonald AC, Vasey PA, Adams L, Walling J, Woodworth JR, Abrahams T, McCarthy S, Bailey NP, Siddiqui N, Lind MJ, Calvert AH, Twelves CJ, Cassidy J, Kaye SB (1998) A phase I and pharmacokinetic study of LY231514, the multitargeted antifolate. Clin Cancer Res 4, 605-610 Miles DW, Smith IE, Coleman RE, Calvert AH, Lind MJ (2001) A phase II study of pemetrexed disodium (LY231514) in patients with locally recurrent or metastatic breast cancer. Eur J Cancer 37: 1366-1371 Miller KD, Picus J, Blanke C, John W, Clark J, Shulman LN, Thornton D, Rowinsky E, Loehrer PJ (2000) Phase II study of the multitargeted antifolate LY231514 (ALIMTA, MTA, pemetrexed disodium) in patients with advanced pancreatic cancer. Ann Oncol 11, 101-103 Millward M, Clarke S, Beale P, Boyer M, Childs A, Bishop J, De Souza P (2001) Phase I trial of pemetrexed and vinorelbine in patients with advanced cancer. Proc Am Soc Clin Oncol Abstract 2102 Misset JL, Gamelin E, Campone M, Delaloge S, Bozec L, Cendrin F, Fumoleau P (2002) Pemetrexed/oxaliplatin combination, results of a phase I study in metastatic solid tumors. Proc Am Soc Clin Oncol Abstract 427 Paz-Ares L, Bezares S, Tabernero JM, Castellanos D, CortesFunes H (2003). Review of a promising new agent. Pemetrexed disodium. Cancer 97, 2056-63. Rhee MS, Wang Y, Nair MG, Galivan J (1993) Acquisition of resistance to antifolates caused by enhanced !-glutamyl hydrolase activity. Cancer Res 53, 2227-2230 Rinaldi DA, Burris HA, Dorr FA, Woodworth JR, Kuhn JG, Eckardt JR, Rodriguez G, Corso SW, Fields SM, Langley C (1995) Initial phase I evaluation of the novel thymidylate synthase inhibitor, LY231514, using the modified continual reassessment method for dose escalation. J Clin Oncol 13, 2842-2850 Rinaldi DA, Kuhn JG, Burris HA, Dorr FA, Rodriguez G, Eckhardt SG, Jones S, Woodworth JR, Baker S, Langley C, Mascorro D, Abrahams T, Von Hoff DD (1999) A phase I evaluation of multitargeted antifolate (MTA, LY231514), administered every 21 days, utilizing the modified continual reassessment method for dose escalation. Cancer Chemother Pharmacol 44, 372-380 Rusthoven JJ, Eisenhauer E, Butts C, Gregg R, Dancey J, Fisher B, Iglesias J (1999) Multitargeted antifolate LY231514 as first-line chemotherapy for patients with advanced nonsmall-cell lung cancer, a phase II study. National Cancer Institute of Canada Clinical Trials Group. J Clin Oncol 17, 1194 Scagliotti GV, Shin DM, Kindler HL, Vasconcelles MJ, Keppler U, Manegold C, Burris H, Gatzemeier U, Blatter J, Symanowski JT, Rusthoven JJ (2003) Phase II study of pemetrexed with and without folic acid and vitamin B12 as front-line therapy in malignant pleural mesothelioma. J Clin Oncol 21, 1556-1561 Schwartz G, Johnson T, McCune D, Stephenson J, Johnson R, Baker SD, Aylesworth C, Hammond L, Monroe P, Walling J, Vo HD, Rowinsky E (1999) A phase I study of the multitargeted antifolate LY231514 (MTA) in combination with 5-fluorouracil, schedule-dependant toxicity and tolerance. Proc Am Soc Clin Oncol Abstract 876 Shepherd FA, Dancey J, Arnold A, Neville A, Rusthoven J, Johnson RD, Fisher B, Eisenhauer E (2001) Phase II study of pemetrexed disodium, a multitargeted antifolate, and cisplatin as first-line therapy in patients with advanced nonsmall cell lung carcinoma, a study of the National Institute of Canada Clinical Trials Group. Cancer 92, 595600 Shih C, Chen VJ, Gossett LS, Gates SB, MacKellar WC, Habeck LL, Shackelford KA, Mendelsohn LG, Soose DJ, Patel VF,

321

Exinger et al: A comprehensive review of Pemetrexed (Alimta) mechanisms of action Andis SL, Bewley JR, Rayl EA, Moroson BA, Beardsley GP, Kohler W, Ratnam M, Schultz RM (1997) LY231514, a pyrrolo[2,3-d]pyrimidine-based antifolate that inhibits multiple folate-requiring enzymes. Cancer Res 57, 11161123 Smit EF, Mattson K, Von Pawel J, Manegold C, Clarke S, Postmus PE (2003) ALIMTA (pemetrexed disodium) as second-line treatment of non-small-cell lung cancer, a phase II study. Ann Oncol 14, 455-460 Smith PG, Marshman E, Calvert AH, Newell DR, Curtin NJ (1999) Prevention of thymidine and hypoxanthine rescue from MTA (LY231514) growth inhibition by dipyridamole in human lung cancer cell lines. Semin Oncol 26, 63-67 Strong WB, Tendler SJ, Seither RL, Goldman ID, Schirch V (1990) Purification and properties of serine hydroxymethyltransferase and C1-tetrahydrofolate synthase from L1210 cells. J Biol Chem 265, 12149-12155 Thodtmann R, Depenbrock H, Dumez H, Blatter J, Johnson RD, Van Oosterom A, Hanauske AR (1999) Clinical and pharmacokinetic phase I study of multitargeted antifolate (LY231514) in combination with cisplatin. J Clin Oncol 17, 3009-3016 Vogelzang NJ, Rusthoven JJ, Zymanowski J, Denham C, Kaukel E, Ruffie P, Gatzemeier U, Boyer M, Emri S, Manegold C, Niyikiza C, Paoletti P (2003) Phase III study of pemetrexed in combination with cisplatin versus cisplatin alone in patients with malignant pleural mesothelioma. J Clin Oncol 21, 2636-2644 Wang Y, Zhao R, Goldman ID (2003) Decreased expression of the reduced folate carrier and folylpolyglutamate synthetase is the basis for acquired resistance to the pemetrexed

antifolate (LY231514) in an L210 murine leukemia cell line. Biochem Pharmacol 65, 1163-1170 Worzalla JF, Shih C, Schultz RM (1998) Role of folic acid in modulating the toxicity and efficacy of the multitargeted antifolate, LY231514. Anticancer Res 18, 3235-3239 Yao R, Rhee MS, Galivan J (1995) Effects of gamma-glutamyl hydrolase on folyl and antifolylpolyglutamates in cultured H35 hepatoma cells. Mol Pharmacol 48, 505-511 Zhao R, Babani S, Gao F, Liu L, Goldman ID (2000) The mechanism of transport of the mutitargeted antifolate (MTA) and its cross-resistance pattern in cells with markedly impaired transport of methotrexate. Clin Cancer Res 6, 3687-3695.

Dr. Jean E. Kurtz

322

Cancer Therapy Vol 1, page 323 Cancer Therapy Vol 1, 323-333, 2003.

Molecular therapy of gastric cancer Review Article

Jie Chen 1, Minhu Chen2, Christoph Röcken 3 , Tobias Götze1, Peter Malfertheiner1 and Matthias P.A. Ebert1 1

Department of Gastroenterology, Hepatology and Infectious Diseases, and 3Institute of Pathology, Otto-von-Guericke University, Magdeburg, Germany; 2Department of Gastroenterology, The First Affiliated Hospital, Sun Yat-Sen University, Guangzhou, China

__________________________________________________________________________________ *Correspondence: Matthias Ebert, MD, Department of Gastroenterology, Hepatology and Infectious Diseases, Otto-von-Guericke University; Leipziger Str. 44, D-39120 Magdeburg,Germany; Tel: +49-391-6713156; Fax: +49-391-67190054; Email: Matthias.Ebert@medizin.uni-magdeburg.de Key Words: Gastric cancer, molecular therapy, carcinogenesis, gene therapy Abbreviations: 5-fluorouracil, (5-FU); a d en o m a to s i s p o l y po s i s c o l i, (A P C); ATP-binding cassette, (ABC); biological response modifiers, (BRMs); Breast cancer resistance protein/mitoxantrone resistance associated transporter, (BCRP/MXR); Camptothecin, (CPT); carcinoembryonic antigen, (CEA); CD/5-FC, (cytosine deaminase/5-fluorocytosine); cisplatin, (CDDP); cytotoxic T cells, (CTLs); d e le t e d i n c ol o r e ct a l ca r c i no m a, (D C C); dendritic cells, (DCs); epidermal growth factor receptor, (EGFR); Epithelial cell adhesion molecule, (EpCAM); etoposide phosphate, (EP); extracellular matrix, (ECM); extracellular matrix protein 1, (ECM1); fragile histidine triad, (FHIT); hepatocyte growth factor, (HGF); histone deacetylase, (HDAC); HSK-TK/GCV, (herpes simplex virus thymidine kinase/ganciclovir); human leukocyte antigen, (HLA); human telomerase RNA, (hTR); Human telomeric repeat binding factors, (TRFs); hypoxia-inducible factor-1!, (HIF-1!); Intercellular adhesion molecule-1, (ICAM-1); Intestinal alkaline phosphatase, (IAP); loss of heterozygosity, (LOH); matrix metalloproteinases, (MMPs); multidrug resistance, (MDR); multidrug resistance gene-1/Pglycoprotein, (MDR1/PGP); Multidrug resistance-associated protein 1, (MRP1); N-Methyl-N'-nitro-N-nitrosoguanidine, (MNNG); Nucleotide excision repair, (NER); peroxisome proliferator-activated receptor ", ( PPAR"); phosphatase and tensin homolog, ( PTEN); picibanil, (OK-432); plasminogen activation, (PA); polysaccharide-K, (PSK); proliferating cell nuclear antigen, (PCNA); r e ti n o b la s t o ma, (R b); small interfering RNA, (siRNA); telomerase-associated protein 1, (TEP1); uracil phosphoribosyltransferase/5Fluorouracil, (UPRT/5-FU); vascular endothelial adhesion molecule-1, (VCAM-1); Vascular endothelial growth factor, (VEGF); vincristine, (VCR); Zinc ribbon domain-containing 1, (ZNRD1) Received: 28 November 2003; Accepted: 15 December 2003; electronically published: December 2003

Summary Gastric cancer is the second most common cause of cancer-related death worldwide. In Western countries, most cancer patients are diagnosed at an advanced tumor stage and therefore the overall prognosis of gastric cancer is dismal. Currently the most effective treatment of gastric cancer is surgical resection of the tumor with lymphadenectomy because gastric cancer cells, in general, have low sensitivity to chemotherapy and radiotherapy. During the past decades, much has been learnt about molecular alterations in gastric cancer, which enable us to develop new molecular therapies in gastric cancer. This review will highlight the molecular changes in gastric carcinogenesis and metastasis, as well as the ongoing molecular therapy based on the understanding of the molecular me c hanis ms un de r ly ing g as tr i c c ar cinog ene s i s. options and poor prognosis, gastric cancer therefore remains a major clinical challenge. Carcinogenesis and metastasis of gastric cancer is a complex multistep malignant process, which is considered to be the result of an interplay between the host genetic profile and environmental toxic agents. Several exogenous factors are suspected to contribute to gastric carcinogenesis, including diet (such as high intake of salted and nitrated food), chemicals (such as N-methyl-N´Nitro-N-Nitrosoguanidine, Nitric oxide, Catechol and Nmethyl- N´-Nitrosourea) and infectious agents (such as infection of Helicobactor pylori and Epstein-Barr Virus) (Stadtlander and Waterbor, 1999). H. pylori triggers and promotes gastric carcinogenesis and represents the most

I. Introduction Although the incidence and mortality of gastric cancer has declined during the last 50 years, it continues to be the second most common cancer and the second leading cause of cancer death worldwide (Hanahan and Weinberg, 2000). In Europe the annual incidence is 12-15 per 100000, with Portugal at the top end of this range (Hohenberger and Gretschel, 2003). Currently the most effective treatment of gastric cancer is surgical resection of the tumor with lymphadenectomy because gastric cancers are largely resistent to chemotherapy and radiotherapy. However, two-thirds of the Western gastric cancer patients are diagnosed in advanced stages, when surgery can only be palliative (Nardone, 2003). Due to its limited treatment 323

Chen et al: Molecular therapy of gastric cancer important infectious risk factor. Prevention of gastric cancer seems to be feasible through the eradication of H. pylori and the reduction of inflammation originating from H. pylori infection. However, studies during the past 10 years provide evidence that multiple genetic and epigenetic alterations in oncogenes, tumor-suppressor genes, cell-cycle regulators, cell adhesion molecules, DNA repair genes, as well as genetic instability, telomerase activation, neoangiogenesis, abnormalities in drug metabolism and immune response of the host may play a crucial role in the pathogenesis and progression of gastric cancer (Stadtlander and Waterbor, 1999; Yasui et al, 2001; Nardone, 2003). Based on the understanding of the molecular me c ha nis ms un de rly ing gastric carcinogenesis and metastasis, great hopes are pinned on the development of new targeted therapy directed at tumor-specific molecular defects in gastric cancer. These molecular strategies include direct induction of tumor cell death, reversal of tumorigenesis by correcting genetic abnormalities, enhancing tumor response rate to conventional chemo- and radiotherapy, modulation of the host immune response against tumors, and protection of normal tissue from toxic effects of anti-tumor treatment by means of drug or gene therapy. In this review, we will highlight the ongoing molecular therapies based on the molecular changes in gastric carcinogenesis and metastasis.

reported by Bi et al. (2001). Activation of peroxisome proliferator-activated receptor " (PPAR") by troglitazone, a potent and selective PPAR" ligand, was shown to inhibit the growth of MKN-45 cells, a human gastric cancer cell line, through the suppression of c-met transcription (Kitamura et al, 1999). Antibodies directed against EGFR (MoAb 528) have been reported to result in growth suppression of human gastric cancer cells overexpressing EGFR (Teramoto et al, 1996). HGF (hepatocyte growth factor) is involved in malignant behavior of cancers as a mediator of tumor-stromal interactions, facilitating tumor invasion and metastasis. Blockade of HGF using recombinant NK4, an HGF antagonist, leads to growth inhibition of the human gastric carcinoma cell line TMK1 (Hirao et al, 2002).

III. Tumor-suppressor-gene inactivation and related therapy Tumor suppressor genes act as negative regulators in cell cycle and cell proliferation. Inactivation of tumor suppressor genes such as p53, p16, APC (a de nomatos is polypos is c oli), DC C (dele te d in colorec ta l c a rc inoma ) a nd Rb (retinobla s toma ) by genetic alterations including mutation, loss of heterozygosity (LOH) of chromosomes carrying tumor suppressor genes or c hromos oma l re arra nge me nts is be lieve d to play a n importa nt role in ga stric c a rc inoge ne s is (Stadtlander and Waterbor, 1999; Nardone, 2003). Mutations of p53 have been described in around 50% of advanced gastric cancers and up to 60% of intestinal-type gastric cancers have mutation or loss of heterozygosity of the APC gene (Nardone, 2003). FHIT (fragile histidine triad) is a new suppressor gene that induces apoptosis and inhibits cell proliferation (Sard et al, 1999). In our recent study, we found that absent or reduced expression of FHIT protein is associated with poorly differentiated diffuse type of gastric cancer (Rocco et al, 2003). PTEN (phosphatase and tensin homolog) is another candidate tumor suppressor gene and our study has demonstrated that PTEN expression was reduced in gastric cancer and in the gastric mucosa of gastric cancer relatives (Fei et al, 2002). Apart from genetic alterations, epigenetic alterations, which alter the heritable state of gene expression, have drawn more and more attention in recent years. Epigenetic alterations are mediated by formation of transcriptionally repressive chromatin states around gene transcription start sites caused by methylation in normally unmethylated CpG islands in gene promotor region and histone deacetylase (HDAC) activity (Cameron et al, 1999; Baylin et al, 2001). A significant proportion of tumor-related genes, including well-characterized tumor suppressor genes (p16INK4a, p15INK4b, p14ARF, p73, APC, and BRCA1), DNA repair genes (hMLH1, GSTP1, and MGMT), and genes related to metastasis and invasion (CDH1, TIMP3, and DAPK) have been demonstrated to be silenced by aberrant promotor hypermethylation in cancer (Esteller et al, 2001, 2002). Previous studies have demonstrated that adenovirusmediated transfer of the wild-type p53 gene results in growth inhibition of gastric carcinoma cells both in vitro and in vivo through the apoptosis pathway (Ohashi et al,

II. Oncogene activation and targeted therapy Oncogenes inc lude growth fa ctors a nd growth fa ctor rec e ptors (i.e . c -er bB-2, c -me t), signa l trans duction proteins (i.e . K -ras ), nuc lea r trans c ription fa ctors (i.e . N -my c , c -fos ) and c ell c yc le regulation prote ins (i.e. c yclin D). Abnorma l a c tiva tion of oncoge nes by c hromos omal re arra nge me nts or ge ne mutation c a n le a d to neopla stic tra ns forma tion. Se ve ral oncoge nes we re re porte d to be overe xpres s e d in ga s tric c a nc e r. For exa mple, c-met (a protooncogene encoding the hepatocyte growth factor receptor) and K-sam (a fibroblast growth factor receptor) are preferentially amplified in diffuse type gastric cancer, whereas c-erbB-2 (an epidermal growth factor receptor) is selectively overexpressed in intestinal tumours (Stadtlander and Waterbor, 1999; Nardone, 2003). Molecular therapy targeted to oncogenes and their products include blocking oncogene expression by antisense oligonucleotides or specific hammerhead ribozymes; furthermore inhibition of oncogenes may also result from monoclonal antibodies or antagonistic drugs. Antisense therapy has been shown to reduce the expression of c-myc (Chen et al, 2001), K-ras (Song et al, 2000), EGFR (epidermal growth factor receptor) (Hirao et al, 1999), cyclin D1 (Chen et al, 1999) and PCNA (proliferating cell nuclear antigen) (Sakakura et al, 1995) in gastric cancer cells and resulted in growth inhibition and apoptosis. Tumorigenicity in the nude mice injected with antisense-treated gastric cancer cells was also decreased significantly. Reversion of the malignant phenotype in gastric cancer cells SGC7901 by c-erbB-2specific hammerhead ribozyme treatment has been 324

Cancer Therapy Vol 1, page 325 1999; Tatebe et al, 1999). Two very recently published studies also used this strategy to deliver the wild-type FHIT gene in the treatment of forestomach tumors in mice (Ishii et al, 2003) and p16INK4A gene in the treatment of gastric cancer cells (Jeong et al, 2003); both studies obtained promising results. The other potential molecular therapy is the so-called â&#x20AC;&#x153;transcriptional therapyâ&#x20AC;?, using DNA demethylating drugs (i.e.5Â´-az a de oxyc ytidine, Proc a inamide ) a nd his tone hype ra ce tylating drugs (i.e .4-Phe nylbutyrate , Tric hos ta tin A) to rea c tiva te s ilenc e d tumor suppressor genes, which are considered very promising in the treatment of various cancers, including gastric cancer (Jung, 2001; Chiurazzi and Neri, 2003).

surface receptor, is associated with diffuse type gastric tumors (Vollmers et al, 1997); administration of a monoclonal antibody against SC-1 induces apoptosis and inhibits proliferation of gastric cancer cells (Vollmers et al, 1998). Caspase-8 and Caspase-3 are members of the cysteine protease family that modulate apoptosis induced by a variety of cell death signals. Transfection of caspase8 and caspase-3 could augment apoptosis and inhibit peritoneal dissemination of human gastric carcinoma cells (Nishimura et al, 2001; Fu et al, 2003).

V. Anti-metastasis therapy Advanced gastric cancer is often accompanied by metastasis to the lymph nodes, liver, peritoneum or other organs, resulting in a high mortality rate. With regard to cancer invasion and metastasis, molecular alterations in cell-cell or cell-matrix interactions and angiogenesis are considered to be very important. Several extracellular proteolytic systems are involved in the formation of metastasis by extracellular matrix degradation and the most thoroughly investigated systems are the plasminogen activation (PA) system and the matrix metalloproteinases (MMPs) (Almholt and Johnsen, 2003). MMPs are zinc-dependent proteases, which are active at physiological pH and are either located at the cell membrane (MT-MMP) or are secreted. The MMP-family constitutes over 21 proteases that are capable of selectively digesting a wide spectrum of both extracellular matrix (ECM) and nonmatrix proteins. MMPs play a critical role in tumor growth, angiogenesis, and metastatic processes (Li and Anderson, 2003). In gastric cancer, up-regulation of MMP-1, MMP-2, MMP-7 and MMP-9 have been reported to be associated with peritoneal dissemination and lymph node metastasis (Murray et al, 1998; Yonemura et al, 2000; Monig et al, 2001). Matsuoka et al. (2000, 2001), have reported the inhibition of invasion and lymph node metastasis of gastrointestinal cancer cells by R-94138, a MMP inhibitor specific to MMP-2 and MMP-9, meanwhile, the inhibition of peritoneal dissemination in human gastric cancers by MMP-7-specific antisense oligonucleotide has been reported by Yonemura et al. (2001). Adhesion molecules participate in multiple steps in cancer development including dissociation and release of gastric cancer cells from their primary cancer nests, lodging of malignant cells between endothelial cells and subsequent adhesion to the extracellular matrix of distant host tissues leading to the manifestation of metastatic nodules. Several adhesion molecules were found to be up or down regulated in gastric cancer and provide new targets for molecular therapy. E-c a dhe rin, !- and #c a tenin f o r m t h e c a d h e r i n - c a t e n i n c o m p l e x a nd a re c ritic a l for e s ta blis hing inte rc ellular a dhe s ion. R e duc tion or los s of E-ca dhe rin expression has been described in gastric cancer, and germline mutations of the E-cadherin gene have been detected in 50-70% of diffusetype gastric cancers and are responsible for a small subset of familial gastric cancers (Caldas et al, 1999). We and others have reported the frequent down-regulation of !a nd #-c a tenin i n p r i m a r y a n d m e t a s t a t i c g a s t r i c

IV. Apoptosis targeted therapy Apoptosis plays a fundamental role in a multicellular organism. In contrast to necrosis, it ensures a rapid and complete removal of cells that are no longer required or dangerous for the organism (Raff, 1998). From a biological point of view, the chronic imbalance between cell proliferation and apoptosis is an early step of gastric carcinogenesis, as in other tumors (Hanahan and Weinberg, 2000). Induction of apoptosis and cell cycle arrest is one of the main antineoplastic mechanisms. As we described previously, oncogene blockage or tumor suppressor gene reactivation therapy usually lead to the growth inhibition of gastric carcinoma through apoptosis related pathways. Moreover, various types of antineoplastic agents also achieve therapeutic effects by apoptosis induction. Camptothecin (CPT), a inhibitor of topoisomerase I, is effective in the treatment of certain solid tumors; treatment with CPT effectively inhibits the growth of the human gastric cancer SIIA in nude mice; the mechanism involved is considered to be induction of apoptosis mediated by up-regulation of p53, p21Waf1/Cip1, and p27Kip1 and the down-regulation of Bcl-2 and Bcl-XL (Litvak et al, 1999). Induction of apoptosis by oral anti-neoplastic agents, such as tegafur and uracil (UFT, a combined preparation of 1 mol tegafur and 4 mol uracil) was also observed in human gastrointestinal tumor xenografts generated in nude mice (Oki et al, 1998). One recent study showed that SC-236, a COX-2-specific inhibitor, had anti-proliferative effects in gastric cancer cells by inducing apoptosis through a protein kinase C-#-dependent pathway (Jiang et al, 2002). Muller et al (1998) demonstrated that multiple anticancer drugs, including cisplatin, mitomycin, methotrexate, mitoxantrone, doxorubicin, and bleomycin could induce p53-dependent apoptosis mediated by the CD95 (APO1/Fas) receptor/ligand system in different cancer cell lines. E2F -1 is a transcription factor that regulates cell cycle progression into S-phase. Deregulation of E2F-1 activity has been associated with cellular commitment to apoptosis. Adenovirus-mediated E2F-1 gene transfer together with treatment using cyclin-dependent kinase inhibitors resulted in an enhanced apoptotic response in human gastric carcinoma cells (Atienza et al, 2000). Other apoptosis-related genes have also been described in targeted gastric cancer therapy. SC-1, an apoptosis cell325

Chen et al: Molecular therapy of gastric cancer c a n c e r ( Y u e t a l , 2 0 0 0 ; E b e r t e t a l , 2 0 0 3 ) . Ecadherin gene mutations typically affect the extracellular portion of the homophilic receptor and cancer-specific monoclonal antibodies against the E-cadherin mutational hot spot region are now available. After linking to toxins, drugs or radiolabelling, the E-cadherin mutation-specific antibodies could serve as very specific agents to treat gastric cancer (Becker and Höfler, 2001). Intercellular adhesion molecule-1 (ICAM-1) is another down-regulated adhesion molecule, which contributes to lymph node metastasis of gastric cancer. Sunami et al. (2000) reported that ICAM-1 gene transfection inhibited lymph node metastasis of human gastric cancer cells both in vitro and in vivo; moreover, the adhesion and cytotoxic effect of peripheral blood mononuclear cells were significantly increased against cancer cells with high ICAM-1 expression (Tanaka et al, 2002). Other adhesion molecules, including members of the integrin receptor family, the laminin binding protein, E-selectin, vascular endothelial adhesion molecule-1 (VCAM-1) and CD44 receptor have been found to be up-regulated during the development of gastric cancer metastasis (Streit et al, 1996; Ura et al, 1998; Gulubova, 2000). Neutralizing antibodies directed against integrin !2 or #1 reduced gastric cancer peritoneal dissemination in nude mice (Kawamura et al, 2001), while adhesion polypeptides, which block the binding of integrins to the ECM also resulted in inhibition of peritoneal implantation of gastric cancer cells (Matsuoka et al, 1998). Epithelial cell adhesion molecule (EpCAM) is expressed in gastric cancer but not in normal gastric epithelium. Selective gene delivery toward gastric adenocarcinoma cells via EpCAMtargeted adenoviral vectors has resulted in a favourable tumor-over-normal tissue transduction ratio thereby increasing specificity of gastric cancer gene therapy (Heideman et al, 2002). The growth of solid tumors and the formation of metastases largely depend on angiogenesis. Both tumor cells and host cells secrete a variety of factors to stimulate angiogenesis. Thus, angiogenesis is another potential target for molecular therapy of gastric cancer. Vascular endothelial growth factor (VEGF), hypoxia-inducible factor-1! (HIF-1!) and extracellular matrix protein 1 (ECM1) are angiogenic factors implicated in hematogenous invasion or metastasis in gastric cancers (Kakeji et al, 2002; Wang et al, 2003). Repeated intraperitoneal transduction of a soluble flt-1 gene, one of the VEGF receptors, using HVJ-cationic liposomes suppressed peritoneal metastases of gastric cancer cells (Mori et al, 2000). YC-1, 3-(5'-hydroxymethyl-2'-furyl)-1benzylindazole, a HIF-1 inhibitor, could block angiogenesis and inhibit stomach tumor growth in mice (Yeo et al, 2003). Angiostatin is a circulating inhibitor of angiogenesis generated by proteolytic cleavage of plasminogen (Lucas et al,1998). Angiostatin is also an inhibitor of tumor angiogenesis which targets the proliferating tumor vasculature and induces regression of experimental tumors and enhances the antitumor effects of radiation therapy (Hari et al, 2000). Wu et al. (2003) reported that angiostatin gene transfection inhibited angiogenesis and tumorigenesis of human gastric cancer in

nude mice. Marimastat, a broad-spectrum MMP-inhibitor inhibits peritoneal dissemination of human gastric cancer cells through inhibition of tumor angiogenesis by downregulation of gelatinases in SCID mice (Wada et al, 2003).

VI. Telomerase inhibition therapy Telomeres are DNA-protein structures that cap linear chromosomes and are essential for maintaining genomic stability and cell phenotype. The stabilization of telomeres is required for continuous cell proliferation as well as for the attainment of immortality in tumor cells. Telomere length is regulated by the telomerase and other related proteins. Telomerase is an RNA-dependent DNA polymerase that synthesizes TTAGGG telomeric DNA onto chromosome ends to compensate for sequence loss during DNA replication. In adults, telomerase is downregulated in most somatic tissues while it remains active in germs cells. Activity of telomerase has been found in almost all human tumors and its activation seems to be a mandatory step in carcinogenesis (Krupp et al, 2000). Three components of the human telomerase complex, including human telomerase RNA component (hTR), human telomerase reverse transcriptase (hTERT), and telomerase-associated protein 1 (TEP1) have been cloned; meanwhile, other factors, which regulate telomere length, have also been identified more recently. Human telomeric repeat binding factors (TRFs) TRF1 and TRF2, and human telomere-associated protein TIN2 are negative regulators of telomere length, while tankyrase and Rap1 act as positive regulators (Kim et al, 1999; Li et al, 2000; Cook et al, 2002). Reactivation of telomerase (Hiyama et al, 1995; Kakeji et al, 2001; Nowak et al, 2003; Yoo et al, 2003), down-regulation of TRF1, TRF2 and TIN2 (Miyachi et al, 2002; Yamada et al, 2002), and frequent loss of heterozygosity on chromosome 10p15, a putative telomerase repressor/senescence gene locus (Hiyama et al, 2003) have been reported recently in gastric cancer. This indicates that the maintenance of telomere length may play a significant role in the tumorigenesis of gastric cancer and may reflect the malignant potential of the tumor. Therefore, telomerase inhibitors are attractive tools for gastric tumor therapy. Recently, several groups were able to induce cell cycle arrest and to inhibit cell growth in gastric cancer cells by antisense telomerase RNA (antihTR) treatment. This treatment targets rather specifically and selectively cancer tissue but not normal tissue making it highly attractive for the treatment of gastric cancer (Naka et al, 1999; Yang et al, 2002; Wong et al, 2003).

VII. Gene directed chemotherapy Although gastric cancers are largely resistant to chemotherapy, based on the knowledge of the molecular me c ha nis ms un de rly ing gastric carcinogenesis and anticancer drug metabolism, a new strategy termed “genechemotherapy“ has been introduced more recently in gastric cancer therapy. One type of gene-chemotherapy is aimed at reversal of the chemoresistance of cancer cells in chemotherapy, and the other type was previously called “cytotoxic gene therapy“ or “suicide gene therapy“. The phenomenon of drug resistance frequently 326

Cancer Therapy Vol 1, page 327 occurs in gastric cancer chemotherapy and results in the failure of treatment. Chemoresistance of cancer cells is due to abnormal alterations of oncogenes, tumor suppressor genes, apoptosis-related genes and specific or multidrug resistance (MDR) genes. Gene therapy targeted at these chemoresistance-related genes can reverse tumors with drug-resistance phenotype to drug-sensitive and thereby enhance the effect of chemotherapy. c-erbB-2 expression in gastric cancer is one of the factors related to cisplatin sensitivity and anti-c-erbB-2 antisense oligonucleotides induce increased sensitivity to cisplatin (Funato et al, 2001). Transfer of Bax, an important proapototic gene, could reduce growth rate and increase sensitivity to 5-fluorouracil (5-FU) and cisplatin (CDDP) in human gastric cancer cells both in vitro and in vivo (Komatsu et al, 2000; Kim et al, 2001). However, Bcl-2 gene, a homologue of Bax, counteracts the apoptosis induction activity of Bax. Bcl-2 treatment with antisense oligonucleotides (G3139) could therefore chemosensitize human gastric cancer cells to cisplatin, as demonstrated in a SCID mouse xenotransplantation model with downregulation of Bcl-2 expression and increased apoptosis (Wacheck et al, 2001). DNA repair is another important modulator of resistance to platinum-based anticancer chemotherapy. Nucleotide excision repair (NER) is the DNA repair pathway responsible for the repair of cisplatin-DNA damage. ERCC1 is one critical gene within NER and in human gastric cancer ERCC1 is a useful marker for clinical drug resistance when platinumbased systemic chemotherapy is utilized (Reed, 1998). ZNRD1 (Zinc ribbon domain-containing 1) is a gene associated with vincristine (VCR) resistance in gastric cancer cells; ZNRD1 antisense treatment sensitizes drug resistant gastric cancer cells to VCR treatment as demonstrated in a recent study (Zhang et al, 2003). Multidrug resistance-associated protein 1 (MRP1) and multidrug resistance gene-1/P-glycoprotein (MDR1/PGP) are cell membrane drug efflux pumps related to the classical MDR phenotype of gastric cancer (Stein et al, 2002). For reversal of MDR1 gene-dependent multidrug resistance, Nieth et al (2003) used two small interfering RNA (siRNA) constructs to inhibit MDR1 expression by RNA interference in human gastric cancer cells, which resulted in a significant reduction of resistance against daunorubicin. Another interesting strategy is transduction of the MDR-1 gene into haematopoietic stem cells with the aim of both reducing bone marrow toxicity from chemotherapeutic agents, and faciliting the use of more intensive and high-dose treatment protocols (Szlosarek and Dalgleish, 2000), although it has not been explored in gastric cancer chemotherapy. Breast cancer resistance protein/mitoxantrone resistance associated transporter (BCRP/MXR) is a new member of the superfamily of ATP-binding cassette (ABC) transporters associated with resistance to mitoxantrone and anthracyclines in a multidrug resistant phenotype of gastric cancer (Ross et al, 1999; Stein et al, 2002). Modulation of the atypical multidrug-resistant phenotype of gastric cancer cells by a hammerhead ribozyme directed against the ABC transporter BCRP/MXR/ABCG2 was reported by Kowalski et al. (2002).

The strategy of cytotoxic gene therapy or suicide gene therapy involves the transduction of tumor cells with a foreign enzyme, following administration of a prodrug. The transduced enzyme catalyses the formation of toxic molecules, which induces tumor cell death. By using tissue-specific promoter, the enzyme transduction can be targeted at special tumor tissues. The most frequently investigated enzyme/prodrug systems in cytotoxic gene therapy of gastric cancer are the HSK-TK/GCV (herpes simplex virus thymidine kinase/ganciclovir) system, the CD/5-FC (cytosine deaminase/5-fluorocytosine) system, the UPRT/5-FU (uracil phosphoribosyltransferase/5Fluorouracil) system and very recently the IAP/EP (intestinal alkaline phosphatase/etoposide phosphate) system. Ganciclovir is a widely used non-cytotoxic antivirus drug; after phosphorylation by HSK-TK, it is converted to a cytotoxic drug; transfection of HSK-TK followed by ganciclovir treatment has been shown to be effective in gastric cell lines both in vitro and in vivo (Tanaka et al, 1996; Terazaki et al, 2003). Moreover, in situ gene transfer of HSK-TK followed by ganciclovir treatment has resulted in degeneration of cancer tissue and fibrosis after necrosis and apoptosis in both primary tumors and lymph node metastases in N-ethyl-N'-nitro-Nnitrosoguanidine (ENNG) induced rat and dog gastric cancer models (Matsukura et al, 1999; Okino et al, 2001). These promising results may be useful for the application of suicide gene therapy in humans. Similiar to ganciclovir, the non-cytotoxic fluorocytosine can also be converted to cytotoxic fluorouracil under the activation by the cytosine deaminase. Transduction of gastric cancer cells with the Escherichia coli cytosine deaminase followed by 5fluorocytosine prodrug therapy has been explored both in vitro and in vivo with promising results (Lan et al, 1996, 1997; Ueda et al, 2001). 5-FU, a widely used chemotherapeutic agent, has a limited effect in the treatment of human solid tumors. Transduction of the E. coli UPRT gene results in marked sensitization of gastric cancer cell lines to low concentration of 5-FU both in vitro and in vivo (Kanai et al, 1998; Inaba et al, 1999). Intestinal alkaline phosphatase (IAP) is capable of converting a relatively non-cytotoxic prodrug, etoposide phosphate (EP), into etoposide with a significant antitumor activity. A very recent study demonstrated that the prodrug-converting system by membrane-bound IAP gene and the EP prodrug is useful in gastric cancer treatment (Kim et al, 2003). Since about 40% of gastric cancers express CEA (carcinoembryonic antigen), the CEA promoter is frequently used in different cytotoxic gene therapy systems of gastric cancer for selective gene targeting (Lan et al, 1996, 1997; Tanaka et al, 1996; Ueda et al, 2001).

VIII. Immunotherapy Gastric cancer cells, in general, have a low sensitivity to chemotherapy and a low immunogenicity related to stimulation of immune competent cells. However, a new method including biochemical modulation and nonspecific immunopotentiation with biological response modifiers (BRMs) has permitted to

327

Chen et al: Molecular therapy of gastric cancer augment the clinical efficacy of immunochemotherapy in gastric cancer (Toge, 1999). Adjuvant immunochemotherapy of gastric cancer has been conducted in patients with malignant effusion using BRMs, including polysaccharide-K (PSK) and picibanil (OK-432). OK-432 is a lyophilized, heat-inactivated, penicillin treated powder of a low virulence strain of Streptococcus pyogenes A3. OK-432 strongly stimulates the cellular immune-response, especially of natural killer cells and macrophages, and induces the production of interleukins, interferons and tumor necrosis factor; PSK is a protein-bound polysaccharide extracted from the mycelia of Coriolus versicolor (strain CM-101) of Basidiomycetes. PSK could restore cancer-related immunosuppression by competing with soluble immunosuppressive factors as well as stimulate the cellular immune-response (Toge, 1999). Combining PSK or OK-432 with chemotherapy reagents in the treatment of gastric cancer has demonstrated to be effective in several clinical trails (Toge, 1999). Genetic immunotherapy is another area of active research. Administration of an adenovirus vector expressing IL-6 induced CD8+ cytotoxic T-lymphocytes specific for gastric cancer cells from the precursor human T-lymphocytes in vivo, and thereby inhibited growth and metastasis of autologous human tumors (Tanaka et al, 1997). In another study, tumorigenicity of IL-2 producing gastric cancer cells was significantly reduced in the CD34+ reconstituted but not in the non-reconstituted mice, whereas transduction of IL-6 did not affect tumorigenicity, irrespective of the reconstitution status of the mice (Tagawa et al, 1998). Apart from the nonspecific immunotherapy, novel cancer vaccines have been designed recently and provide specific immune treatment for gastric cancer. Gastrin is an important hormone associated with gastric acid production and growth of gastrointestinal mucosa. The hormone is processed in several steps and the 17-aminoacid product, G17, appears to be important in cancer growth. G17DT is an immunogen created by attaching G17 to the highly immunogenic diphtheria toxin. A phase II trial of the

antigastrin agent G17DT has shown promising results in the treatment of stomach cancer (Watson and Gilliam, 2001; Kerr, 2002). In a pilot clinical trial gastric cancer patients immunized with a cancer vaccine composed of EGF linked to a carrier protein developed antibodies against EGF (Gonzalez et al, 1998). MG7 is a gastric cancer specific tumor associated antigen. The oral DNA vaccine against the MG7-Ag epitope of gastric cancer can induce significant humoral immunity and partially protect against tumor developent in mice (Guo et al, 2003). HER2/neu (c-erbB-2)-derived peptides are naturally processed as tumor-associated antigens and are recognized by tumorspecific, human leukocyte antigen (HLA)-A2-restricted cytotoxic T cells (CTLs) in gastric cancer. A phase-1 vaccination trial in gastric cancer patients using dendritic cells (DCs) pulsed with the immunodominant HER-2/neu (p369) peptides has been reported with promising results (Kono et al, 2002).

IX. Conclusions During the past 10 years, much has been learnt about molecular alterations in gastric cancer. Based on the understanding of the molecular me c ha nis ms un de rly ing gastric carcinogenesis, new therapeutic strategies targeted at the molecular defects in the tumor cells have been designed and many promising therapy results have been obtained from in vitro or in vivo studies (Table 1). Using new technologies including cDNA microarray and proteomics, a full understanding of the molecular processes underlying gastric carcinogenesis may lead to further development and design of new molecular therapies â&#x20AC;&#x153;tailoredâ&#x20AC;? to a single subject with gastric cancer.

Acknowledgements M. Ebert is supported by a grant from the Deutsche Forschungsgemeinschaft (Eb 187/4-1) and a HeisenbergStipend (Eb 187/5-1).

Table 1. Summary of targets and strategies for molecular therapy in gastric cancer Target molecules

Strategies

Effects

c-myc

Antisense oligonucleotides

Growth inhibition and apoptosis

K-ras

Antisense oligonucleotides

Growth inhibition and apoptosis

PCNA

Antisense oligonucleotides

Growth inhibition and apoptosis

cyclin D1

Antisense oligonucleotides

Growth inhibition

EGFR

Antisense oligonucleotides/monoclonal antibodies

Growth inhibition

Oncogenes

c-erbB-2

Hammerhead ribozyme treatment

Malignant phenotype reversion

c-met

Troglitazone, a PPAR" ligand

Growth inhibition

HGF

NK4, an HGF antagonist

Growth inhibition

Tumor-suppressor-genes p53

Gene transduction

Growth inhibition and apoptosis

328

Cancer Therapy Vol 1, page 329 FHIT

Gene transduction

Growth inhibition and apoptosis

INK4A

p16 Gene transduction Group of genes silenced by aberrant DNA demethylating drugs DNA methylation Group of genes silenced by lack of Histone hyperacetylating drugs histone acetylation

Growth inhibition and apoptosis Reactivation of tumor suppressor genes Reactivation of tumor suppressor genes

Apoptosis-related molecules E2F -1

Gene transduction

Growth inhibition and apoptosis

SC-1

Monoclonal antibody

Proliferation inhibition and apoptosis

Caspase-8

Gene transduction

Metastasis inhibition and apoptosis

Caspase-3

Gene transduction

Metastasis inhibition and apoptosis

MMP-2

R-94138, a MMP inhibitor

Metastasis inhibition

MMP-9

R-94138, a MMP inhibitor

Metastasis inhibition

MMP-7

Antisense oligonucleotides

Metastasis inhibition

E-cadherin

Monoclonal antibody

Adhesion-molecule dependent targeting

ICAM-1

Gene transduction

Metastasis inhibition

Integrin

Neutralizing antibody/blocking peptides

Metastasis inhibition

EpCAM

Targeted gene transduction

Targeted gastric cancer gene therapy

VEGF

flt-1 gene transduction

Angiogenesis inhibition

HIF-1!

YC-1, a HIF-1 inhibitor

Angiogenesis inhibition

Angiostatin

Gene transduction

Angiogenesis inhibition

Gelatinases

Marimastat, a MMP inhibitor

Angiogenesis inhibition

Antisense oligonucleotides

Growth inhibition and cell cycle arrest

c-erbB-2

Antisense oligonucleotides

Sensitization to cisplatin

Bax

Gene transduction

Bcl-2

Antisense oligonucleotides

Apoptosis, sensitization to cisplatin

ZNRD1

Antisense oligonucleotides

Sensitization to vincristine

MDR1

Small interfering RNA

Sensitization to daunorubicin

BCRP

Hammerhead ribozyme treatment

Sensitization to mitoxantrone and anthracyclines

HSK-TK

Gene transduction

Ganciclovir phosphorylation

Gene transduction

Fluorocytosine conversion

UPRT

Gene transduction

Sensitization to 5-fluorouracil

IAP

Gene transduction

Etoposide phosphate conversion

IL-6

Gene transduction

Non-specific immunity

IL-2

Gene transduction

Non-specific immunity

HER-2/neu

Cancer vaccine

Specific immunogenicity

EGF

Cancer vaccine

Specific immunogenicity

Gastrin 17

Cancer vaccine

Specific immunogenicity

MG7

Cancer vaccine

Specific immunogenicity

Metastasis-related molecules

Telomerase hTR Chemoresistance related genes

Apoptosis, sensitization to 5-fluorouracil and cisplatin

Suicide genes

Immunogenetic molecules

329

Chen et al: Molecular therapy of gastric cancer cancer vaccine composed of human-recombinant epidermal growth factor linked to a carrier protein: report of a pilot clinical trial. Ann Oncol 9,431-435. Gulubova MV (2002) Expression of cell adhesion molecules, their ligands and tumour necrosis factor ! in the liver of patients with metastatic gastrointestinal carcinomas. Histochem J 34, 67-77. Guo CC, Ding J, Pan BR, Yu ZC, Han QL, Meng FP, Liu N, Fan DM (2003) Development of an oral DNA vaccine against MG7-Ag of gastric cancer using attenuated salmonella typhimurium as carrier. World J Gastroenterol 9,11911195. Hanahan D, Weinberg RA (2000) The hallmarks of cancer. Cell 100,57-70. Hari D, Beckett MA, Sukhatme VP, Dhanabal M, Nodzenski E, Lu H, Mauceri HJ, Kufe DW, Weichselbaum RR (2000) Angiostatin induces mitotic cell death of proliferating endothelial cells. Mol Cell Biol Res Commun 3, 277-282. Heideman DA, van Beusechem VW, Offerhaus GJ, Wickham TJ, Roelvink PW, Craanen ME, Pinedo HM, Meijer CJ, Gerritsen WR (2002) Selective gene transfer into primary human gastric tumors using epithelial cell adhesion molecule-targeted adenoviral vectors with ablated native tropism. Hum Gene Ther 13,1677-1685. Hirao S, Yamada Y, Koyama F, Fujimoto H, Takahama Y, Ueno M, Kamada K, Mizuno T, Maemondo M, Nukiwa T, Matsumoto K, Nakamura T, Nakajima Y (2002) Tumor suppression effect using NK4, a molecule acting as an antagonist of HGF, on human gastric carcinomas. Cancer Gene Ther 9,700-707. Hirao T, Sawada H, Koyama F, Watanabe A, Yamada Y, Sakaguchi T, Tatsumi M, Fujimoto H, Emoto K, Narikiyo M, Oridate N, Nakano H (1999) Antisense epidermal growth factor receptor delivered by adenoviral vector blocks tumor growth in human gastric cancer. Cancer Gene Ther 6, 423427. Hiyama E, Yokoyama T, Tatsumoto N, Hiyama K, Imamura Y, Murakami Y, Kodama T, Piatyszek MA, Shay JW, Matsuura Y (1995) Telomerase activity in gastric cancer. Cancer Res 55, 3258-3262. Hiyama T, Tanaka S, Shima H, Kose K, Kitadai Y, Ito M, Sumii M, Yoshihara M, Shimamoto F, Haruma K, Chayama K (2003) Frequent loss of heterozygosity on chromosome 10p15, a putative telomerase repressor/senescence gene locus, in gastric cancer. Oncol Rep10, 1297-1299. Hohenberger P, Gretschel S (2003) Gastric cancer. Lancet 362, 305-315. Inaba M, Sawada H, Sadata A, Hamada H (1999) Circumvention of 5-fluorouracil resistance in human stomach cancer cells by uracil phosphoribosyltransferase gene transduction. Jpn J Cancer Res 90, 349-354. Ishii H, Zanesi N, Vecchione A, Trapasso F, Yendamuri S, Sarti M, Baffa R, During MJ, Huebner K, Fong LY, Croce CM (2003) Regression of upper gastric cancer in mice by FHIT gene delivery. FASEB J 17,1768-1770. Jeong YW, Kim KS, Oh JY, Park JC, Baek WK, Suh SI, Suh MH, Lee JC, Cho JW (2003) Exogenous wild-type p16INK4A gene induces delayed cell proliferation and promotes chemosensitivity through decreased pRB and increased E2F-1 expressions. Int J Mol Med 12,61-65. Jung M (2001) Inhibitors of histone deacetylase as new anticancer agents. Curr Med Chem 8,1505-1511. Jiang XH, Lam SK, Lin MC, Jiang SH, Kung HF, Slosberg ED, Soh JW, Weinstein IB, Wong BC (2002) Novel target for induction of apoptosis by cyclo-oxygenase-2 inhibitor SC236 through a protein kinase C-#(1)-dependent pathway. Oncogene 21,6113-6122.

References Almholt K, Johnsen M (2003) Stromal cell involvement in cancer. Recent Results Cancer Res 162, 31-42. Atienza C Jr, Elliott MJ, Dong YB, Yang HL, Stilwell A, Liu TJ, McMasters KM (2000) Adenovirus-mediated E2F-1 gene transfer induces an apoptotic response in human gastric carcinoma cells that is enhanced by cyclin dependent kinase inhibitors. Int J Mol Med 6, 55-63. Baylin SB, Esteller M, Rountree MR, Bachman KE, Schuebel K, Herman JG (2001) Aberrant patterns of DNA methylation, chromatin formation and gene expression in cancer. Hum Mol Genet 10, 687-692. Becker KF, Hofler H (2001) Mutant cell surface receptors as targets for individualized cancer diagnosis and therapy. Curr Cancer Drug Targets 1, 121-128. Bi F, Fan D, Hui H, Wang C, Zhang X (2001) Reversion of the malignant phenotype of gastric cancer cell SGC7901 by cerbB-2-specific hammerhead ribozyme. Cancer Gene Ther 8,835-842. Caldas C, Carneiro F, Lynch HT, Yokota J, Wiesner GL, Powell SM, Lewis FR, Huntsman DG, Pharoah PD, Jankowski JA, MacLeod P, Vogelsang H, Keller G, Park KG, Richards FM, Maher ER, Gayther SA, Oliveira C, Grehan N, Wight D, Seruca R, Roviello F, Ponder BA, Jackson CE (1999) Familial gastric cancer: overview and guidelines for management. J Med Genet 36, 873-880. Cameron EE, Bachman KE, Myohanen S, Herman JG, Baylin SB (1999) Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat Genet 21,103-107. Chen B, Zhang XY, Zhang YJ, Zhou P, Gu Y, Fan DM (1999) Antisense to cyclin D1 reverses the transformed phenotype of human gastric cancer cells. World J Gastroenterol 5,1821. Chen JP, Lin C, Xu CP, Zhang XY, Fu M, Deng YP, Wei Y, Wu M (2001) Molecular therapy with recombinant antisense cmyc adenovirus for human gastric carcinoma cells in vitro and in vivo. J Gastroenterol Hepatol 16,22-28. Chiurazzi P, Neri G (2003) Reactivation of silenced genes and transcriptional therapy. Cytogenet Genome Res 100, 56-64. Cook BD, Dynek JN, Chang W, Shostak G, Smith S (2002) Role for the related poly(ADP-Ribose) polymerases tankyrase 1 and 2 at human telomeres. Mol Cell Biol 22, 332-342. Ebert MP, Yu J, Hoffmann J, Rocco A, Rocken C, Kahmann S, Muller O, Korc M, Sung JJ, Malfertheiner P (2003) Loss of #-catenin expression in metastatic gastric cancer. J Clin Oncol 21,1708-1714. Esteller M, Corn PG, Baylin SB, Herman JG (2001) A gene hypermethylation profile of human cancer. Cancer Res 61, 3225-3229. Esteller M, Herman JG (2002) Cancer as an epigenetic disease: DNA methylation and chromatin alterations in human tumours. J Pathol 196,1-7. Fei G, Ebert MP, Mawrin C, Leodolter A, Schmidt N, Dietzmann K, Malfertheiner P (2002) Reduced PTEN expression in gastric cancer and in the gastric mucosa of gastric cancer relatives. Eur J Gastroenterol Hepatol 14, 297-303. Fu YG, Qu YJ, Wu KC, Zhai HH, Liu ZG, Fan DM (2003) Apoptosis-inducing effect of recombinant Caspase-3 expressed by constructed eukaryotic vector on gastric cancer cell line SGC7901. World J Gastroenterol 9, 1935-1939. Funato T, Kozawa K, Fujimaki S, Miura T, Kaku M (2001) Increased sensitivity to cisplatin in gastric cancer by antisense inhibition of the her-2/neu (c-erbB-2) gene. Chemotherapy 47,297-303. Gonzalez G, Crombet T, Catala M, Mirabal V, Hernandez JC, Gonzalez Y, Marinello P, Guillen G, Lage A (1998) A novel

330

Cancer Therapy Vol 1, page 331 Kakeji Y, Maehara Y, Koga T, Shibahara K, Kabashima A, Tokunaga E, Sugimachi K (2001) Gastric cancer with high telomerase activity shows rapid development and invasiveness. Oncol Rep 8, 107-110. Kakeji Y, Maehara Y, Sumiyoshi Y, Oda S, Emi Y (2002) Angiogenesis as a target for gastric cancer. Surgery 131, S48-54. Kanai F, Kawakami T, Hamada H, Sadata A, Yoshida Y, Tanaka T, Ohashi M, Tateishi K, Shiratori Y, Omata M (1998) Adenovirus-mediated transduction of Escherichia coli uracil phosphoribosyltransferase gene sensitizes cancer cells to low concentrations of 5-fluorouracil. Cancer Res 58, 1946-1951. Kawamura T, Endo Y, Yonemura Y, Nojima N, Fujita H, Fujimura T, Obata T, Yamaguchi T, Sasaki T (2001) Significance of integrin !2/#1 in peritoneal dissemination of a human gastric cancer xenograft model. Int J Oncol 18, 809-815. Kerr C (2002) Promising results in stomach cancer trial. Lancet Oncol 3, 523. Kim KY, Cho YJ, Jeon GA, Ryu PD, Myeong JN (2003) Membrane-bound alkaline phosphatase gene induces antitumor effect by G2/M arrest in etoposide phosphatetreated cancer cells. Mol Cell Biochem 252, 213-221. Krupp G, Bonatz G, Parwaresch R (2000) Telomerase, immortality and cancer. Biotechnol Annu Rev 6, 103-140. Kim R, Minami K, Nishimoto N, Toge T (2001) Enhancement of antitumor effect by intratumoral administration of bax gene in combination with anticancer drugs in gastric cancer. Int J Oncol 18, 363-367. Kim SH, Kaminker P, Campisi J (1999) TIN2, a new regulator of telomere length in human cells. Nat Genet 23,405-412. Kitamura S, Miyazaki Y, Hiraoka S, Toyota M, Nagasawa Y, Kondo S, Kiyohara T, Shinomura Y, Matsuzawa Y (1999) PPAR" inhibits the expression of c-MET in human gastric cancer cells through the suppression of Ets. Biochem Biophys Res Commun 265, 453-456. Komatsu K, Suzuki S, Shimosegawa T, Miyazaki JI, Toyota T (2000) Cre-loxP-mediated bax gene activation reduces growth rate and increases sensitivity to chemotherapeutic agents in human gastric cancer cells. Cancer Gene Ther 7, 885-892. Kowalski P, Stein U, Scheffer GL, Lage H (2002) Modulation of the atypical multidrug-resistant phenotype by a hammerhead ribozyme directed against the ABC transporter BCRP/MXR/ABCG2.Cancer Gene Ther 9,579-586. Lan KH, Kanai F, Shiratori Y, Ohashi M, Tanaka T, Okudaira T, Yoshida Y, Hamada H, Omata M (1997) In vivo selective gene expression and therapy mediated by adenoviral vectors for human carcinoembryonic antigen-producing gastric carcinoma. Cancer Res 57, 4279-4284. Lan KH, Kanai F, Shiratori Y, Okabe S, Yoshida Y, Wakimoto H, Hamada H, Tanaka T, Ohashi M, Omata M (1996) Tumor-specific gene expression in carcinoembryonic antigen--producing gastric cancer cells using adenovirus vectors. Gastroenterology 111,1241-1251. Li B, Oestreich S, de Lange T (2000) Identification of human Rap1: implications for telomere evolution. Cell 101, 471483. Li WP, Anderson CJ (2003) Imaging matrix metalloproteinase expression in tumors. Q J Nucl Med 47, 201-208. Litvak DA, Papaconstantinou HT, Hwang KO, Kim M, Evers BM, Townsend CM Jr (1999) Inhibition of gastric cancer by camptothecin involves apoptosis and multiple cellular pathways. Surgery 126, 223-230. Lucas R, Holmgren L, Garcia I, Jimenez B, Mandriota SJ, Borlat F, Sim BK, Wu Z, Grau GE, Shing Y, Soff GA, Bouck N, Pepper MS (1998) Multiple forms of angiostatin induce apoptosis in endothelial cells. Blood 92, 4730-4741.

Matsukura N, Hoshino A, Igarashi T, Hasegawa H, Okino T, Onda M, Iijima O, Akiyama K, Goto T, Takubo K, Suzuki S, Shimada T (1999) In situ gene transfer and suicide gene therapy of gastric cancer induced by N-ethyl-N'-nitro-Nnitrosoguanidine in dogs. Jpn J Cancer Res 90,1039-1049. Matsuoka T, Hirakawa K, Chung YS, Yashiro M, Nishimura S, Sawada T, Saiki I, Sowa M (1998) Adhesion polypeptides are useful for the prevention of peritoneal dissemination of gastric cancer. Clin Exp Metastasis 16,381-388. Matsuoka T, Yashiro M, Sawada T, Ishikawa T, Ohira M, Chung KH (2000) Inhibition of invasion and lymph node metastasis of gastrointestinal cancer cells by R-94138, a matrix metalloproteinase inhibitor. Anticancer Res 20, 4331-4338. Matsuoka T, Yashiro M, Sawada T, Ishikawa T, Ohira M, Hirakawa K, Chung YS (2001) Effect of a matrix metalloproteinase inhibitor on a lymph node metastatic model of gastric cancer cells passaged by orthotopic implantation. J Exp Clin Cancer Res 20, 213-218. Miyachi K, Fujita M, Tanaka N, Sasaki K, Sunagawa M (2002) Correlation between telomerase activity and telomeric-repeat binding factors in gastric cancer. J Exp Clin Cancer Res 21, 269-275. Monig SP, Baldus SE, Hennecken JK, Spiecker DB, Grass G, Schneider PM, Thiele J, Dienes HP, Holscher AH (2001) Expression of MMP-2 is associated with progression and lymph node metastasis of gastric carcinoma. Histopathology 39, 597-602. Mori A, Arii S, Furutani M, Mizumoto M, Uchida S, Furuyama H, Kondo Y, Gorrin-Rivas MJ, Furumoto K, Kaneda Y, Imamura M (2000) Soluble Flt-1 gene therapy for peritoneal metastases using HVJ-cationic liposomes. Gene Ther 7,1027-1033. Muller M, Wilder S, Bannasch D, Israeli D, Lehlbach K, LiWeber M, Friedman SL, Galle PR, Stremmel W, Oren M, Krammer PH (1998) p53 activates the CD95 (APO-1/Fas) gene in response to DNA damage by anticancer drugs. J Exp Med 188, 2033-2045. Murray GI, Duncan ME, Arbuckle E, Melvin WT, Fothergill JE (1998) Matrix metalloproteinases and their inhibitors in gastric cancer. Gut 43,791-797. Naka K, Yokozaki H, Yasui W, Tahara H, Tahara E, Tahara E (1999) Effect of antisense human telomerase RNA transfection on the growth of human gastric cancer cell lines. Biochem Biophys Res Commun 255, 753-758. Nardone G (2003) Review article: molecular basis of gastric carcinogenesis. Aliment Pharmacol Ther 17 Suppl 2,75-81. Nieth C, Priebsch A, Stege A, Lage H (2003) Modulation of the classical multidrug resistance (MDR) phenotype by RNA interference (RNAi). FEBS Lett 545,144-150. Nishimura S, Adachi M, Ishida T, Matsunaga T, Uchida H, Hamada H, Imai K (2001) Adenovirus-mediated transfection of caspase-8 augments anoikis and inhibits peritoneal dissemination of human gastric carcinoma cells. Cancer Res 61, 7009-7014. Nowak J, Januszkiewicz D, Lewandowski K, NowickaKujawska K, Pernak M, Rembowska J, Nowak T, Wysocki J (2003) Activity and expression of human telomerase in normal and malignant cells in gastric and colon cancer patients. Eur J Gastroenterol Hepatol 15, 75-80. Ohashi M, Kanai F, Ueno H, Tanaka T, Tateishi K, Kawakami T, Koike Y, Ikenoue T, Shiratori Y, Hamada H, Omata M (1999) Adenovirus mediated p53 tumour suppressor gene therapy for human gastric cancer cells in vitro and in vivo. Gut 44, 366-371. Oki E, Sakaguchi Y, Toh Y, Oda S, Maehara Y, Yamamoto N, Sugimachi K(1998) Induction of apoptosis in human tumour xenografts after oral administration of uracil and tegafur to nude mice bearing tumours. Br J Cancer 78, 625-630.

331

Chen et al: Molecular therapy of gastric cancer Okino T, Onda M, Matsukura N, Inada KI, Tatematsu M, Suzuki S, Shimada T (2001) Sequential histopathological changes in vivo after suicide gene therapy of gastric cancer induced by N-methyl-N'-nitro-N-nitrosoguanidine in rats. Jpn J Cancer Res 92, 673-679. Raff M (1998) Cell suicide for beginners. Nature 396,119-122. Reed E (1998) Platinum-DNA adduct, nucleotide excision repair and platinum based anti-cancer chemotherapy. Cancer Treat Rev 24, 331-344. Rocco A, Schandl L, Chen J, Wang H, Tulassay Z, McNamara D, Malfertheiner P, Ebert MP (2003) Loss of FHIT protein expression correlates with disease progression and poor differentiation in gastric cancer. J Cancer Res Clin Oncol 129, 84-88. Ross DD, Yang W, Abruzzo LV, Dalton WS, Schneider E, Lage H, Dietel M, Greenberger L, Cole SP, Doyle LA (1999) Atypical multidrug resistance: breast cancer resistance protein messenger RNA expression in mitoxantrone-selected cell lines. J Natl Cancer Inst 91,429-433. Sakakura C, Hagiwara A, Tsujimoto H, Ozaki K, Sakakibara T, Oyama T, Ogaki M, Takahashi T (1995) The antiproliferative effect of proliferating cell nuclear antigenspecific antisense oligonucleotides on human gastric cancer cell lines. Surg Today 25,184-186. Sard L, Accornero P, Tornielli S, Delia D, Bunone G, Campiglio M, Colombo MP, Gramegna M, Croce CM, Pierotti MA, Sozzi G (1999) The tumor-suppressor gene FHIT is involved in the regulation of apoptosis and in cell cycle control. Proc Natl Acad Sci U S A 96, 8489-8492. Song JJ, Lee H, Kim E, Kim YS, Yoo NC, Roh JK, Kim BS, Kim J (2000) Transduction effect of antisense K-ras on malignant phenotypes in gastric cancer cells. Cancer Lett 157, 1-7. Stadtlander CT, Waterbor JW (1999) Molecular epidemiology, pathogenesis and prevention of gastric cancer. Carcinogenesis 20, 2195-2208. Stein U, Lage H, Jordan A, Walther W, Bates SE, Litman T, Hohenberger P, Dietel M (2002) Impact of BCRP/MXR, MRP1 and MDR1/P-Glycoprotein on thermoresistant variants of atypical and classical multidrug resistant cancer cells. Int J Cancer 97, 751-760. Streit M, Schmidt R, Hilgenfeld RU, Thiel E, Kreuser ED (1996) Adhesion receptors in malignant transformation and dissemination of gastrointestinal tumors. J Mol Med 74,253268. Sunami T, Yashiro M, Chung KH (2000) ICAM-1 (intercellular adhesion molecule-1) gene transfection inhibits lymph node metastasis by human gastric cancer cells. Jpn J Cancer Res 91, 925-933. Szlosarek PW, Dalgleish AG (2000) Potential applications of gene therapy in the patient with cancer. Drugs Aging 17, 121-132. Tagawa M, Goto S, Takenaga K, Takeshita A, Saotome T, Takenouchi T, Tsurumachi T, Gunji Y, Matsubara H, Sakiyama S (1998) Reduced tumorigenicity of human gastric carcinoma cells engineered to produce IL-2 in SCID mice reconstituted with peripheral blood cells from cancer patients. Cancer Lett 123, 87-93. Tanaka F, Abe M, Akiyoshi T, Nomura T, Sugimachi K, Kishimoto T, Suzuki T, Okada M (1997) The anti-human tumor effect and generation of human cytotoxic T cells in SCID mice given human peripheral blood lymphocytes by the in vivo transfer of the Interleukin-6 gene using adenovirus vector. Cancer Res 57, 1335-1343. Tanaka H, Yashiro M, Sunami T, Ohira M, Hirakawa-Y S Chung K (2002) Lipid-mediated gene transfection of intercellular adhesion molecule-1 suppresses the peritoneal metastasis of gastric carcinoma. Int J Mol Med 10, 613-617.

Tanaka T, Kanai F, Okabe S, Yoshida Y, Wakimoto H, Hamada H, Shiratori Y, Lan K, Ishitobi M, Omata M (1996) Adenovirus-mediated prodrug gene therapy for carcinoembryonic antigen-producing human gastric carcinoma cells in vitro. Cancer Res 56, 1341-1345. Tatebe S, Matsuura T, Endo K, Teramachi K, Nakamura T, Sato K, Ito H (1999) Adenovirus-mediated transfer of wild-type p53 gene results in apoptosis or growth arrest in human cultured gastric carcinoma cells. Int J Oncol 15, 229-235. Terazaki Y, Yano S, Yuge K, Nagano S, Fukunaga M, Guo ZS, Komiya S, Shirouzu K, Kosai K (2003) An optimal therapeutic expression level is crucial for suicide gene therapy for hepatic metastatic cancer in mice. Hepatology 37,155-163. Teramoto T, Onda M, Tokunaga A, Asano G (1996) Inhibitory effect of anti-epidermal growth factor receptor antibody on a human gastric cancer. Cancer 77(8 Suppl), 1639-1645. Toge T (1999) Effectiveness of immunochemotherapy for gastric cancer: a review of the current status. Semin Surg Oncol 17,139-143. Ueda K, Iwahashi M, Nakamori M, Nakamura M, Matsuura I, Yamaue H, Tanimura H (2001) Carcinoembryonic antigenspecific suicide gene therapy of cytosine deaminase/5fluorocytosine enhanced by the cre/loxP system in the orthotopic gastric carcinoma model. Cancer Res 61, 61586162. Ura H, Denno R, Hirata K, Yamaguchi K, Yasoshima T (1998) Separate functions of !2#1 and !3#1 integrins in the metastatic process of human gastric carcinoma. Surg Today 28,1001-1006. Vollmers HP, Dammrich J, Hensel F, Ribbert H, MeyerBahlburg A, Ufken-Gaul T, von Korff M, Muller-Hermelink HK (1997) Differential expression of apoptosis receptors on diffuse and intestinal type stomach carcinoma. Cancer 79, 433-440. Vollmers HP, Hensel F, Hermann R, Dammrich J, Wozniak E, Gessner P, Herrmann B, Zimmermann U, Muller-Hermelink HK (1998) Tumor-specific apoptosis induced by the human monoclonal antibody SC-1: a new therapeutical approach for stomach cancer. Oncol Rep 5, 35-40. Wada N, Otani Y, Kubota T, Kimata M, Minagawa A, Yoshimizu N, Kameyama K, Saikawa Y, Yoshida M, Furukawa T, Fujii M, Kumai K, Okada Y, Kitajima M (2003) Reduced angiogenesis in peritoneal dissemination of gastric cancer through gelatinase inhibition. Clin Exp Metastasis 20, 431-435. Wang L, Yu J, Ni J, Xu XM, Wang J, Ning H, Pei XF, Chen J, Yang S, Underhill CB, Liu L, Liekens J, Merregaert J, Zhang L (2003) Extracellular matrix protein 1 (ECM1) is overexpressed in malignant epithelial tumors. Cancer Lett 200, 57-67. Watson SA, Gilliam AD (2001) G17DT--a new weapon in the therapeutic armoury for gastrointestinal malignancy. Expert Opin Biol Ther1, 309-317. Wong SC, Yu H, Moochhala SM, So JB (2003) Antisense telomerase induced cell growth inhibition, cell cycle arrest and telomerase activity down-regulation in gastric and colon cancer cells. Anticancer Res 23, 465-469. Wu J, Shi YQ, Wu KC, Zhang DX, Yang JH, Fan DM (2003) Angiostatin up-regulation in gastric cancer cell SGC7901 inhibits tumorigenesis in nude mice. World J Gastroenterol 9,59-64. Yamada M, Tsuji N, Nakamura M, Moriai R, Kobayashi D, Yagihashi A, Watanabe N (2002) Down-regulation of TRF1, TRF2 and TIN2 genes is important to maintain telomeric DNA for gastric cancers. Anticancer Res 22, 3303-3307. Yang SM, Fang DC, Yang JL, Liang GP, Lu R, Luo YH, Liu WW (2002) Effect of antisense human telomerase RNA on

332

Cancer Therapy Vol 1, page 333 malignant phenotypes of gastric carcinoma. J Gastroenterol Hepatol 17,1144-1152. Yasui W, Oue N, Kuniyasu H, Ito R, Tahara E, Yokozaki H (2001) Molecular diagnosis of gastric cancer: present and future. Gastric Cancer 4, 113-121. Yeo EJ, Chun YS, Cho YS, Kim J, Lee JC, Kim MS, Park JW (2003) YC-1: a potential anticancer drug targeting hypoxiainducible factor 1. Natl Cancer Inst 95, 516-525. Yonemura Y, Endo Y, Fujita H, Kimura K, Sugiyama K, Momiyama N, Shimada H, Sasaki T (2001) Inhibition of peritoneal dissemination in human gastric cancer by MMP-7specific antisense oligonucleotide. J Exp Clin Cancer Res 20, 205-212. Yonemura Y, Endou Y, Fujita H, Fushida S, Bandou E, Taniguchi K, Miwa K, Sugiyama K, Sasaki T (2000) Role of MMP-7 in the formation of peritoneal dissemination in gastric cancer. Gastric Cancer 3, 63-70. Yoo J, Park SY, Kang SJ, Kim BK, Shim SI, Kang CS (2003) Expression of telomerase activity, human telomerase RNA, and telomerase reverse transcriptase in gastric adenocarcinomas. Mod Pathol 16,700-707. Yu J, Ebert MP, Miehlke S, Rost H, Lendeckel U, Leodolter A, Stolte M, Bayerdorffer E, Malfertheiner P (2000) !-catenin

expression is decreased in human gastric cancers and in the gastric mucosa of first degree relatives. Gut 46, 639-644. Zhang YM, Zhao YQ, Pan YL, Shi YQ, Jin XH, Yi H, Fan DM (2003) Effect of ZNRD1 gene antisense RNA on drug resistant gastric cancer cells. World J Gastroenterol 9, 894898.

Dr. Matthias P.A. Ebert

333

Chen et al: Molecular therapy of gastric cancer

334

Cancer Therapy Vol 1, page 335 Cancer Therapy Vol 1, 335-342, 2003.

Tumor angiogenesis as a strategy for radiosensitization Review Article

Bo Lu, Dong W. Kim, Dennis E. Hallahan1,3* 1

Department of Radiation Oncology, Vanderbilt School of Medicine, Vanderbilt University, 2Department of Radiology, Vanderbilt School of Medicine, Vanderbilt University, 3 Department of Biomedical Engineering, Vanderbilt School of Engineering, Nashville, TN

__________________________________________________________________________________ *Correspondence: Dennis E. Hallahan, M.D., Department of Radiation Oncology, Vanderbilt University, 1301 22nd Avenue South, B902 The Vanderbilt Clinic, Nashville, Tennessee 37232-5671; Telephone: (615)343-9244; Fax: (615)343-3075; E-mail: dennis.hallahan@mcmail.vanderbilt.edu Key Words: Tumor angiogenesis, radiosensitization, cell survival pathway Abbreviations: tyrosine kinase inhibitors, (TKIs); receptor tyrosine kinases, (RTKs); vascular endothelial growth factor, (VEGF); platelet-derived growth factor, (PDGF); fibroblast growth factor, (FGF); circulating endothelial progenitor cells, (CEPs); high dose rate, (HDR); phosphatidylinositol-3,4,5-triphosphate, (PIP3); Phosphatidylinositol 3-kinases, (PI3Ks); 3-phosphoinositide kinase-1, (PDK1); VE Cadeherin, (VEC),;von Willebrand factor, (vWF); PECAM, (CD31) Received: 10 December 2003; Accepted: 15 December 2003; electronically published: December 2003

Summary Tumor angiogenesis is crucial for the proliferation, survival and metastases of all malignancies. The response of the tumor microvasculature to ionizing radiation can be modified to improve tumor control in preclinical mouse models of cancer. Recent studies have shown that a variety of anti-angiogenic drugs can enhance radiotherapy. Protein tyrosine kinase inhibitors (TKIs) have been shown to enhance radiation-induced destruction of tumor blood vessels. Among these compounds are inhibitors of a broad spectrum of receptor tyrosine kinases (RTKs). Inhibition of RTKs attenuates downstream signaling from various angiogenic growth factors, including vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF) and fibroblast growth factor (FGF). RTK inhibitors with various specificities against the receptors for VEGF, PDGF and FGF manifest significant antiangiogenic activities as well. We have shown using tumor vascular window model and tumor growth delay assays that these compounds can enhance tumor radiation response by attacking tumor microvasculature. Furthermore, we have shown that radiation and RTK inhibitors exert their antiangiogenic effect through inhibition of the PI3K/Akt signaling pathway, which results in induction of apoptosis. Inhibition of these signaling pathways may block vascular repair or neoangiogenesis through suppression of endothelial progenitor cells. Our studies have provided a basis for future clinical investigations of combining radiotherapy and RTK inhibitors. targets non-malignant endothelial cells, drug resistance that is common for cancer cells, may not develop in antiangiogenic therapy (Kerbel, 2000). Several pro-angiogenic factors have been identified. Vascular endothelial growth factor (VEGF) plays an essential role in tumor angiogenesis (Ferrara, 2000). Inhibition of VEGF signaling pathway via VEGF receptor (VEGFR) blocking antibodies or VEGFR kinase inhibitors resulted in tumor growth inhibition in animal models (Angelov, 1999) (Fong, 1999). However, resistance to this therapeutic approach can occur by up-regulation of other angiogenic factors such as fibroblast growth factor (FGF) and plateletderived growth factor (PDGF) (Kerbel, 2001). Compounds that inhibit multiple angiogenic pathways may circumvent this problem. However, the potential side effects of these

I. Introduction Tumor Angiogenesis Tumor angiogenesis plays an important role in the growth, invasion and metastases of solid tumors. In its absence, tumors are limited to a growth of 1-2mm3. Tumor growth is dependent on an adequate supply of oxygen and nutrients as well as removal of toxic metabolites. Angiogenesis occurs when the tumor mass contains 100300 cells and is driven by endothelial cell proliferation. Recruitment of endothelial progenitor cells also plays an active role (Griffioen, 2000). Folkman et al hypothesized that anti-angiogenic therapy would keep tumors in a dormant state and would enhance effectiveness of other cancer therapies (Folkman, 1971). Since anti-angiogenesis

335

Lu et al: Tumor angiogenesis as a strategy for radiosensitization compounds are uncertain and are under investigation.

II. Radiotherapy and tumor angiogenesis Ionizing radiation interacts with cells by the Compton effect, which produces electrons and causes DNA breaks in the tissue. Vascular endothelium is highly resistant to the effects of radiation. The presence of VEGF may cause the increased resistance to radiation-induced damage. Preclinical studies suggest that antiangiogenic agents enhance tumor control in response to fractionated irradiation. The response of tumor microvasculature to radiation is time- and dose-dependent (Johnson, 1976). Blood flow studies using irradiated mouse sarcoma showed that blood flow increased within 3 to 7 days (Kallman, 1972). Tumor blood flow increases if low doses are administered and does not decrease unless high doses are used (Kallman, 1972) (Johnson, 1976). This delayed increase in tumor blood flow may be due in part to radiation-induced VEGF expression (Gorski, 1999). Previous studies of tumor blood vessel response to radiation have relied upon the clearance of Xe and blood volume within tumors following treatment with radiation (Kallman, 1972) (Johnson, 1976). Current technology allows for the direct, longitudinal observation of tumor blood volume and blood flow (Fleischer, 2000) (Lin, 1998). Available experimental models include the tumor vascular window (Lin, 1998); Power Doppler to measure blood flow (Fleischer, 2000); and histologic evaluation of tumor blood vessel (Hallahan, 1998). Using these models, we found that blood flow increased in all tumors receiving 2 to 3 Gy, which is the fractionation scheme used during conventional radiotherapy. Doses used for stereotactic radiosurgery, intraoperative radiotherapy and high dose rate (HDR) brachytherapy (6 to 10 Gy) resulted in a reduction in blood flow in all tumor types (Figure 1).x

Figure 1. A). Dose-dependent Radiation-response of tumor blood vessels in the vascular window model. Tumor blood vessels were treated with the indicated dosage of radiation. Tumor blood vessels were photographed using light microscopy and vascular density was quantified by use of line morphometry. The vascular density is compared to untreated controls (100%). Shown are the mean and standard error of the mean of 3 experiments, using models of B16F0 melanoma; Lewis lung carcinoma (LLC) and GL261 glioma. B). Bar graph of Power Weighted Pixel Density (PWPD) showing dose-dependent changes in tumor blood flow. Doppler blood flow analysis was performed after irradiation. Shown are dose-dependent changes in tumor blood flow relative to untreated control tumors (100%).

from 95 head and neck cancers showed increased PDGF-B in 54% of cases, which was associated with increased risk of systemic recurrences (Aebersold, 2002). These studies establish potential therapeutic benefits through the inhibition of RTKs and their ligands. RTKs are key elements of signaling pathways (Schlessinger, 2000). Platelet-derived growth factor receptor (PDGFR), a prototypical RTK, contains a core domain flanked by unfolded regions. Specifically, the intracellular portion of PDGFR contains a juxtamembrane region, two kinase domains separated by an unfolded kinase insert, and an unfolded C-terminal tail (Claesson-Welsh, 1994). Posttranslational modification of PDGFR creates a binding site that recruits regulatory proteins. The phosphotyrosines in the RTK form binding sites that are recognized by the SH2 domains of several signaling proteins, including Grb2, and Shc, and the p85 component of PI3K (ClaessonWelsh, 1994). This localized activity increases phosphatidylinositol-3,4,5-triphosphate (PIP3) concentrations at the cell membrane, thus locally activating Akt. Akt is a common target that is activated by various signaling pathways stimulated by RTKs. Although studies suggest that redundancy is an underlying feature of RTK signaling networks, there are also examples in which

III. Effects of anti-angiogenic agents on tumor vessels and radiation response A. Angiogenic growth factors and receptor tyrosine kinases (RTKs) Split-kinase domain RTKs, including the PDGF, Flk1/KDR and FGF receptors and their angiogenic ligands play important roles in tumor angiogenesis. The inhibition of VEGF by antibodies (Angelov, 1999) and the receptor antagonists enhanced tumor control when combined with cytotoxic therapy (Fong, 1999). Other RTK ligands, including FGF and PDGF, also contribute to angiogenesis and tumor growth (George, 2001). bFGF has been shown to inhibit apoptosis in the microvasculature of mouse lungs and intestines exposed to irradiation (Paris, 2001). FGF may contribute indirectly to angiogenesis through upregulation of VEGF (Seghezzi, 1998). PDGF also increases VEGF secretion in tumor cell lines (Tsai, 1995). In addition, VEGF, FGF, and PDGF are all up-regulated in response to radiation (Witte, 1989). PDGF is produced by various cancer cells and contributes to both autocrine and paracrine growth and viability (Eshel, 2002). Biopsies 336

Cancer Therapy Vol 1, page 337 specific downstream pathways are required for appropriate cellular response to an RTK-mediated signal (Madhani, 2001).

B. RTK inhibitors (TKIs) Several TKIs with various specificities against the receptors of VEGF, PDGF and FGF have been developed (Table 1). SU5416 is a quinolone derivative that inhibits VEGFR-2 (Flk-1) tyrosine kinase. SU6668 is an oral tyrosine kinase inhibitor with multiple receptor targets, including VEGFR, PDGFR and bFGFR. We have found that both SU5416 and SU6668 resulted in radiation sensitization in several mouse models of solid tumors (Geng, 2001) (Lu, 2004). SU11248 is an orally available, indolinone-based synthetic molecule, which is a low nM selective inhibitor of the angiogenic receptor tyrosine kinases Flk-1/KDR and PDGFR. It also inhibits cellular signaling via Kit and FLT3. SU11248 exhibited broad and potent anti-tumor activity in

mice, causing regression of A431 human epidermoid and Colo205 human colon tumors, growth arrest of H460 human lung, and substantial growth delay of C6 rat and SF763T human glioma xenografts (Mendel, 2003). SU11248 treatment induced a dose-and time-dependent decrease in tumor microvessel density and tumor cell proliferation and an associated increase in tumor cell apoptosis, culminating in tumor regression. SU11248 is currently in Phase I clinical trials in patients with advanced cancer. PK/PD studies in mice have shown that SU11248 inhibited PDGFR and Flk1/KDR phosphorylation in a time- and dose-dependent fashion with target plasma concentrations of 50-100 ng/ml. The selectivity of SU11248 is demonstrated by the fact that it does not inhibit EGFR phosphorylation, even at high plasma concentrations. Using the tumor vascular window model, we have shown that SU11248 enhances vascular injury following radiation (Figure 2) (Schueneman, 2003).

Table 1: Known Spectrum of RTK inhibition

SU5416 SU6668 SU11248

VEGFR2 + + +

Flt + + +

PDGFR + +

c-Kit + +

FGFR + -

ErbB -

Figure 2. Tumor vascular window model and vascular length density analysis. LLC cells were implanted into the dorsal skin-fold window in C57BL6 mice. Shown are representative photographs of tumor vasculature before and 48 h after treatment with SU11248 (left column), 3 Gy (center), and SU11248 + 3 Gy (right column). Five mice were treated in each of the treatment groups. The vascular length density at 48 h after treatment was quantified. The bar graph shows the means of vascular length densities for each treatment group over 4 days and SE.

337

Lu et al: Tumor angiogenesis as a strategy for radiosensitization SU11248 administered with irradiation achieved significantly greater reduction in tumor vasculature than either agent alone. Furthermore, we found that both LLC and GL261 tumors showed a significant growth delay when SU11248 was added before daily 3 Gy fractions as compared with either agent alone (Figure 3). The PDGFR_ is one of the molecular targets for SU11248. Phosphorylation of PDGFR! within tumor tissue therefore serves as a biomarker for response to SU11248 in tumor models. PDGFR! phosphorylation was studied through immunohistochemical analysis of tumor sections with phospho-specific antibody. Figure 3 (C and D) shows that PDGFR! phosphorylation was detected in the stroma and endothelium of tumors before treatment. 3 hours after SU11248 administration, PDGFR phosphorylation was undetectable by immunohistochemistry (Figure 3D). This indicates that SU11248 is biologically active within mouse tumor models after systemic administration.

C. PI3K cell survival pathway Phosphatidylinositol 3-kinases (PI3Ks) are activated by RTKs (Wymann, 1998) (Figure 4). The ability of RTKbinding growth factors to promote cell survival has been attributed, at least in part, to PI3K. It has been shown that PI3K activity is required for the growth factor-dependent survival of a wide range of cultured cell types. PI3K activity promotes cellular survival even in the absence of trophic support. Active PI3K can block toxin-induced apoptosis (Datta, 1999). PI3K also plays an important role in the response of tumors to radiation. We have shown that PI3K inhibitors such as wortmannin and LY294002 enhance the cytotoxic effects of radiation through inducing apoptosis of tumor vasculature (Figure 5) (Edwards, 2002). One important downstream target of D3 phosphorylated phosphoinositides is the serine/threonine kinase Akt-1 (Burgering, 1995). Recruitment to the plasma membrane by 3’ phosphorylated phosphoinositides brings Akt-1 in close proximity to the regulatory kinase 3-phosphoinositide kinase-1 (PDK1). PDK1 phosphorylates Akt at Thr308, thus activating it (Alessi, 1997). Once activated, Akt-1 targets a number of downstream substrates that are involved in apoptotic and anti-apoptotic signaling (Datta, 1999). One of the targets is the Bcl-2 family member Bad. Bad promotes cell death through heterodimerization with the survival protein Bcl-XL (Yang, 1995). Formation of this heterodimer leads to release of cytochrome c from the mitochondria, causing cleavage of procaspase-9 and a subsequent cascade that culminates in apoptosis. Active Akt-1 phosphorylates Bad at Ser-136 (Datta, 1997), which blocks Bad/Bcl-XL heterodimerization (Cardone, 1998). This action is sufficient to block Bad-induced apoptosis (Datta, 1997). However, Akt-1 was shown to block apoptosis even after cytochrome c release, which led investigators to search for other downstream targets of Akt-1. Cardone et. al. showed that Akt-1 phosphorylates caspase-9 at Ser196, which prevents cytochrome c induced activation of pro-caspase 9 (Cardone, 1998). Our laboratory recently showed that combination of radiation and SU11248 induced apoptosis in tumor vasculature (Figure 6A) (Schueneman, 2003), and we found that cells transfected with adenovirus expressing a dominant 338

Figure 3. Tumor growth delay analysis. Mice with (A) LLC and (B) GL261 hind limb tumors were treated with SU11248 or vehicle before irradiation. Therapy was halted after day 8 (arrows). Shown are the means of changes in tumor volumes in five mice in each of the treatment groups (vehicle, SU11248 maintenance main, vehicle + 21 Gy, and SU11248 + 21 Gy). Bars indicate SE. PDGFRß phosphorylation was shown by immunohistochemical analysis of tumor sections. C and D show microscopic (x40) photographs of immunohistochemical staining of LLC tumors after i.p. administration of (C) SU11248 or (D) vehicle. Sections were stained for phosphor-PDFGRß using alkaline phosphatase (blue) stain and counterstained with eosin. Arrows indicate microvasculature that stains positive for phosphor-PDFGRß.

negative mutant of p85 enhanced radiation-induced apoptotic activity, i.e., release of cytochrome c and activation of caspases 3 and 9 in HUVEC cells, a model for tumor angiogenesis (Figure 6B) (Tan, 2003).

Cancer Therapy Vol 1, page 339

Figure 4. PI3K signaling through Akt. PI3K, when recruited to the plasma membrane by an activated RTK, converts PIP2 to PIP3. PIP3 recruits Akt, which is activated by PDK1. Akt phosphorylates several downstream targets that are important players in apoptotic signaling, cell cycle regulation, and metabolism, including GSK-3_, Bad, and Caspase-9.

Figure 5. Induction of apoptosis in endothelial cells by PI3K inhibitors. HUVECs were treated with either 2 ÂľM LY 294002 or 4 nM Wortmannin, incubated for 30 min, and treated with radiation (6 Gy). After a 24-h incubation period, cells were fixed and stained. Four high-powered fields (x400) were observed and counted for each experimental group. Shown is the percentage of apoptotic cells for each experimental group. Photographs show representative HUVECs treated with radiation, LY294002, or LY294002 before irradiation. Arrows, apoptotic nuclei. Bars, SD.

339

Lu et al: Tumor angiogenesis as a strategy for radiosensitization

Figure 6. Induction of apoptosis by SU11248 and mutant Akt. A). Sections of tumors were stained for apoptosis in endothelial cells using brown TUNEL (brown arrows) and endothelial cell marker using VWF red immunostaining (red arrows). B). Cytochrome C released from mitochondria induced by PI3K inhibitor and radiation. cells were transduced with Ad._p83 and radiation alone or together. The adenovirus containing GFP gene insert was using as control.

(Asahara, 1997). These progenitor cells develop foci of neovascularization in ischemic limbs at 4 weeks after injection (Asahara, 1997). Signal transduction through VEGF participates in differentiation of pluripotent stem cells into endothelial cells (Choi, 1998 ). Flk-1 receptors also participate in migration of these cells into ischemic tissue (Shalaby, 1995). To determine the origin of these CEPs, bone marrow stem cells containing the Lac Z reporter gene were transplanted into tumor bearing mice (Asahara, 1999). This study showed that CEPs from bone marrow origin were incorporated into tumor neovascularization. VEGF increases the percentage of pluripotent hematopoietic stem cells that stain positive for CD 34 and Flk-1 (Ziegler, 1999) including circulating stem cells.

IV. Endothelial cell precursors in tumor angiogenesis and therapy response VEGF released by tumors promotes mobilization of circulating endothelial progenitor cells (CEPs) and hematopoietic cells to the vascular bed where they contribute to neovascular formation (Rafii, 2002). CEPs express the VEGFR-2 or FLK1 whereas subsets of hemotopoietic cells express VEGFR1 or FLT1(Rafii, 2002). Co-recruitment of CEPs and hemotopoietic cells facilitates the differentiation and integration of CEPs into rapidly expanding tumor vasculature. These cells express several endothelial protein markers: VE Cadeherin (VEC), von Willebrand factor (vWF), PECAM (CD31), and P1H12. CD34+ endothelial progenitor cells isolated from human peripheral blood differentiate into endothelial cells

340

Cancer Therapy Vol 1, page 341 and Greenberg, M. E. (1997) Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell, 91, 231-241. Edwards, E., Geng, L., Tan, J., Onishko, H., Donnelly, E., and Hallahan, D. E. (2002) Phosphatidylinositol 3-kinase/Akt signaling in the response of vascular endothelium to ionizing radiation. Cancer Res, 62, 4671-4677. Eshel, R., Zanin, A., Kapon, D., Sagi-Assif, O., Brakenhoff, R., van Dongen, G., and Witz, I. P. (2002) Human Ly-6 antigen E48 (Ly-6D) regulates important interaction parameters between endothelial cells and head-and-neck squamous carcinoma cells. Int J Cancer, 98, 803-810. Ferrara, N. (2000) VEGF, an update on biological and therapeutic aspects. Curr Opin Biotechnol, 11, 617-624. Fleischer, A. C. (2000) Sonographic depiction of tumor vascularity and flow, from in vivo models to clinical applications. J Ultrasound Med, 19, 55-61. Folkman, J. (1971) Tumor angiogenesis, therapeutic implications. N Engl J Med, 285, 1182-1186. Fong, T. A., Shawver, L. K., Sun, L., Tang, C., App, H., Powell, T. J., Kim, Y. H., Schreck, R., Wang, X., Risau, W., Ullrich, A., Hirth, K. P., and McMahon, G. (1999) SU5416 is a potent and selective inhibitor of the vascular endothelial growth factor receptor (Flk-1/KDR) that inhibits tyrosine kinase catalysis, tumor vascularization, and growth of multiple tumor types. Cancer Res, 59, 99-106. Geng, L., Donnelly, E., McMahon, G., Lin, P. C., Sierra-Rivera, E., Oshinka, H., and Hallahan, D. E. (2001) Inhibition of vascular endothelial growth factor receptor signaling leads to reversal of tumor resistance to radiotherapy. Cancer Res, 61, 2413-2419. Gorski, D. H., Beckett, M. A., Jaskowiak, N. T., Calvin, D. P., Mauceri, H. J., Salloum, R. M., Seetharam, S., Koons, A., Hari, D. M., Kufe, D. W., and Weichselbaum, R. R. (1999) Blockage of the vascular endothelial growth factor stress response increases the antitumor effects of ionizing radiation. Cancer Res, 59, 3374-3378. Griffioen, A. W. and Molema, G. (2000) Angiogenesis, potentials for pharmacologic intervention in the treatment of cancer, cardiovascular diseases, and chronic inflammation. Pharmacol Rev, 52, 237-268. Hallahan, D. E., Staba-Hogan, M. J., Virudachalam, S., and Kolchinsky, A. (1998) X-ray-induced P-selectin localization to the lumen of tumor blood vessels. Cancer Res, 58, 52165220. Hirashima, M., Kataoka, H., Nishikawa, S., and Matsuyoshi, N. (1999) Maturation of embryonic stem cells into endothelial cells in an in vitro model of vasculogenesis. Blood, 93, 12531263. Johnson, R. (1976) A thermodynamic method for investigation of radiation induced changes in the microcirculation of human tumors. Int J Radiat Oncol Biol Phys, 1, 659-670. Kallman, R. F., DeNardo, G. L., and Stasch, M. J. (1972) Blood flow in irradiated mouse sarcoma as determined by the clearance of xenon-133. Cancer Res, 32, 483-490. Kerbel, R. S. (2000) Tumor angiogenesis, past, present and the near future. Carcinogenesis, 21, 505-515. Kerbel, R. S., Yu, J., Tran, J., Man, S., Viloria-Petit, A., Klement, G., Coomber, B. L., and Rak, J. (2001) Possible mechanisms of acquired resistance to anti-angiogenic drugs, implications for the use of combination therapy approaches. Cancer Metastasis Rev, 20, 79-86. Lin, P., Sankar, S., Shan, S., Dewhirst, M. W., Polverini, P. J., Quinn, T. Q., and Peters, K. G. (1998) Inhibition of tumor growth by targeting tumor endothelium using a soluble vascular endothelial growth factor receptor. Cell Growth Differ, 9, 49-58,. Lu, B., Geng, L., Musiek, A., Onishko, H., Donnelly, E.,

To study the mechanisms of CEPsâ&#x20AC;&#x2122; incorporation into tissue, antigen expression was studied. Flk-1 + EPCs with no other initially expressed endothelial cell markers differentiated into VE Cadherin+ PECAM-1+ and CD 34+ cells (Hirashima, 1999). Following activation of the Flk-1 receptor tyrosine kinase, expression of VE Cadherin was induced, which is required for EPC adhesion (Hirashima, 1999) (Vittet, 1997). Monoclonal antibodies to VE Cadherin inhibited vessel formation (Vittet, 1997). VEGF and Flk-1 are also required for proliferation and migration of the EPCs following adhesion. In summary, tumor microvasculature is novel target for radiation sensitization. Inhibitors of angiogenic RTKs have shown their efficacy in enhancing radiotherapy in several animal models of solid tumors. SU11248, a recently developed RTK inhibitor, is currently planned for clinical trials to be combined with radiotherapy. Inhibition of downstream molecules of RTKs such as PI3K and Akt resulted in similar radiation sensitization. Further investigation of RTK signaling may identify new molecular targets and lead to novel drug development for cancer therapy.

References Aebersold, D. M., Froehlich, S. C., Jonczy, M., Beer, K. T., Laissue, J., Greiner, R. H., and Djonov, V. (2002) Expression of transforming growth factor-", epidermal growth factor receptor and platelet-derived growth factors A and B in oropharyngeal cancers treated by curative radiation therapy. Radiother Oncol, 63, 275-283. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B., and Cohen, P. (1997) Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase B". Curr Biol, 7, 261-269. Angelov, L., Salhia, B., Roncari, L., McMahon, G., and Guha, A. (1999) Inhibition of angiogenesis by blocking activation of the vascular endothelial growth factor receptor 2 leads to decreased growth of neurogenic sarcomas. Cancer Res, 59, 5536-5541. Asahara, T., Masuda, H., Takahashi, T., Kalka, C., Pastore, C., Silver, M., Kearne, M., Magner, M., and Isner, J. M. (1999) Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization. Circ Res, 85, 221-228. Asahara, T., Murohara, T., Sullivan, A., Silver, M., van der Zee, R., Li, T., Witzenbichler, B., Schatteman, G., and Isner, J. M. (1997) Isolation of putative progenitor endothelial cells for angiogenesis. Science, 275, 964-967. Burgering, B. M. and Coffer, P. J. (1995) Protein kinase B (cAkt) in phosphatidylinositol-3-OH kinase signal transduction. Nature, 376, 599-602,. Cardone, M. H., Roy, N., Stennicke, H. R., Salvesen, G. S., Franke, T. F., Stanbridge, E., Frisch, S., and Reed, J. C. (1998) Regulation of cell death protease caspase-9 by phosphorylation. Science, 282, 1318-1321. Choi, K., Kennedy, M., Kazarov, A., Papadimitriou, J. C., and Keller, G. A common precursor for hematopoietic and endothelial cells. (1998) Development, 125, 725-732. Claesson-Welsh, L. Platelet-derived growth factor receptor signals. (1994) J Biol Chem, 269, 32023-32026. Datta, S. R., Brunet, A., Greenberg, M. E. (1999) Cellular survival, a play in three Akts. Genes Dev, 13, 2905-2927. Datta, S. R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y.,

341

Lu et al: Tumor angiogenesis as a strategy for radiosensitization McMahon, G., Choy, H., Hallahan, D. E. SU6668 Enhances Cytotoxicity of Radiation in a Murine Lung Carcinoma and Glioblastoma Multiform Models. (IJROBP, accepted for publication) Madhani, H. D. (2001) Accounting for specificity in receptor tyrosine kinase signaling. Cell, 106, 9-11. Mendel, D. B., Laird, A. D., Xin, X., Louie, S. G., Christensen, J. G., Li, G., Schreck, R. E., Abrams, T. J., Ngai, T. J., Lee, L. B., Murray, L. J., Carver, J., Chan, E., Moss, K. G., Haznedar, J. O., Sukbuntherng, J., Blake, R. A., Sun, L., Tang, C., Miller, T., Shirazian, S., McMahon, G., and Cherrington, J. M. (2003) In vivo antitumor activity of SU11248, a novel tyrosine kinase inhibitor targeting vascular endothelial growth factor and platelet-derived growth factor receptors, determination of a pharmacokinetic/pharmacodynamic relationship. Clin Cancer Res, 9, 327-337. Paris, F., Fuks, Z., Kang, A., Capodieci, P., Juan, G., Ehleiter, D., Haimovitz-Friedman, A., Cordon-Cardo, C., and Kolesnick, R. (2001) Endothelial apoptosis as the primary lesion initiating intestinal radiation damage in mice. Science, 293, 293-297. Rafii, S., Lyden, D., Benezra, R., Hattori, K., and Heissig, B. (2002) Vascular and haematopoietic stem cells, novel targets for anti-angiogenesis therapy? Nat Rev Cancer, 2, 826-835. Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell, 103, 211-225. Schueneman, A. J., Himmelfarb, E., Geng, L., Tan, J., Donnelly, E., Mendel, D., McMahon, G., and Hallahan, D. E. (2003) SU11248 maintenance therapy prevents tumor regrowth after fractionated irradiation of murine tumor models. Cancer Res, 63, 4009-4016. Seghezzi, G., Patel, S., Ren, C. J., Gualandris, A., Pintucci, G., Robbins, E. S., Shapiro, R. L., Galloway, A. C., Rifkin, D. B., and Mignatti, P. (1998) Fibroblast growth factor-2 (FGF2) induces vascular endothelial growth factor (VEGF)

expression in the endothelial cells of forming capillaries, an autocrine mechanism contributing to angiogenesis. J Cell Biol, 141, 1659-1673. Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein, M., Wu, X. F., Breitman, M. L., and Schuh, A. C. (1995) Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature, 376, 62-66. Song, C. W., Payne, J. T., and Levitt, S. H. (1972) Vascularity and blood flow in x-irradiated Walker carcinoma 256 of rats. Radiology, 104, 693-697. Tsai, J. C., Goldman, C. K., and Gillespie, G. Y. (1995) Vascular endothelial growth factor in human glioma cell lines, induced secretion by EGF, PDGF-B, and bFGF. J Neurosurg, 82, 864-873. Vittet, D., Buchou, T., Schweitzer, A., Dejana, E., and Huber, P. (1997) Targeted null-mutation in the vascular endothelialcadherin gene impairs the organization of vascular-like structures in embryoid bodies. Proc Natl Acad Sci U S A, 94, 6273-6278. Witte, L., Fuks, Z., Haimovitz-Friedman, A., Vlodavsky, I., Goodman, D. S., and Eldor, A. (1989) Effects of irradiation on the release of growth factors from cultured bovine, porcine, and human endothelial cells. Cancer Res, 49, 50665072. Wymann, M. P. and Pirola, L. (1998) Structure and function of phosphoinositide 3-kinases. Biochim Biophys Acta, 1436, 127-150. Yang, E., Zha, J., Jockel, J., Boise, L. H., Thompson, C. B., and Korsmeyer, S. J. (1995) Bad, a heterodimeric partner for BclXL and Bcl-2, displaces Bax and promotes cell death. Cell, 80, 285-291. Ziegler, B. L., Valtieri, M., Porada, G. A., De Maria, R., Muller, R., Masella, B., Gabbianelli, M., Casella, I., Pelosi, E., Bock, T., Zanjani, E. D., and Peschle, C. (1999) KDR receptor, a key marker defining hematopoietic stem cells. Science, 285, 1553-1558.

342

Cancer Therapy Vol 1, page 343 Cancer Therapy Vol 1, 343-351, 2003.

p14ARF: Role in the cellular stress response and applications to cancer Review Article

Yinghui Huang and Ruth A. Gjerset Sidney Kimmel Cancer Center, 10835 Altman Row, San Diego, CA 92121

__________________________________________________________________________________ *Correspondence: Ruth, A. Gjerset, Ph.D., Sidney Kimmel Cancer Center, 10835 Altman row, San Diego, CA 92121; Telephone: 858450-5990; FAX: 858-450-3251; email: rgjerset@skcc.org Key Words: p14ARF, p53, mdm2, adenoviral vectors, therapy resistance Abbreviations: mouse embryo fibroblasts, (MEFs); Hypoxia-inducible factor-1 !, (HIF-1 !); retinoblastoma tumor suppressor, (pRb); exon 1"-encoded region of human ARF, (ARF1"); cis-diamminedichloroplatinum, (CDDP); Received: 26 November 2003; Accepted: 23 December 2003; electronically published: December 2003

Summary The p14ARF tumor suppressor (ARF) plays a central role in human cancer, as evidenced by its loss of function in up to 40% of cancers overall, and by the ability of ectopic ARF expression to suppress growth and induce cell death in tumor cells in vitro and in vivo Deletion of ARF or deletion of the N-terminal region of ARF encoded by its first exon (exon1") in mice results in a predisposition to tumor formation. An important and well-described activity of ARF is enhancing p53 stability by binding to the mdm2 protein, and blocking mdm2-mediated ubiquitination and degradation of p53. Loss of ARF results in unopposed mdm2-mediated degradation of p53, thereby attenuating the endogenous p53 pathway of growth arrest and apoptosis. Loss of ARF may attenuate the activity of ectopically expressed p53 as well, compromising the outcome of p53 gene therapy and other p53-based therapies for cancer. ARF also appears to have tumor suppressor function independent of the p53/mdm2/ARF regulatory mechanism, and has been observed to interact with a variety of proteins other than mdm2. Taken together, the combined activities of ARF are likely to play important combined roles in the underlying mechanism of cancer and provide new opportunities to refine and optimize gene based strategies for a wide variety of cancers. phenotype, or in response to environmental stress, which can contribute to drug resistance. The high frequency with which this mechanism is targeted for disruption in cancer suggests that an intact mechanism cannot be easily bypassed and is incompatible with cancer cell growth. The mechanism provides therefore an important point of focus for therapeutics development, as treatments that restore a fully functioning p53/mdm2 regulatory mechanism would be expected to be highly suppressive of most cancers, while having minimal consequences for normal cells that lack the endogenous oncogenic stress signals that feed into the mechanism. In fact, ectopic overexpression of wildtype p53 is highly suppressive of cell growth and viability of most cancer cells (Cai et al, 1993) but is minimally suppressive of normal epithelial cells and fibroblasts (Katayose et al, 1995). Even in cancer cells that retain expression of endogenous wild-type p53 and would likely have defects in other components of the regulatory mechanism, overexpressed ectopic wild-type p53 can have suppressive effects on growth and viability (Saadatmandi et al, 2002a). P53 gene therapy has therefore been investigated as a promising targeted approach to cancer treatment, applicable to a variety of cancers. Several clinical applications of p53 gene therapy have now entered

I. Introduction ARF plays a key role in the p53/mdm2 stress response mechanism that is central to cancer. This mechanism serves as a point of convergence for a variety of stress signals encountered by the cancer cell, including environmental stress (radiation, exposure to chemotherapeutic drugs, hypoxia), and endogenous oncogenic stress (oncogene activation, genome instability and the ensuing DNA damage) (Shieh et al, 1997; Siliciano et al, 1997; Bates et al, 1998; de Stanchina et al, 1998; Palmero et al, 1998; Zindy et al, 1998; Gjerset et al, 1999). In response to these signals, the mechanism promotes the accumulation of p53 protein, followed by induction of p53 downstream events leading to cell cycle arrest or apoptosis. We now know that this mechanism is disrupted in virtually all cancers (see below), usually through deletion or mutation of p53 in more than 50% of cancers (Levine, 1997), or through deletion or promoter methylation of ARF in about 40% of cancers (Gruis et al, 1995; Fulci et al, 2000; Pinyol et al, 2000). Disruption of this mechanism impairs the cancer cellâ&#x20AC;&#x2122;s ability to trigger cell cycle arrest or apoptosis in response to oncogenic abnormalities, enabling it to manifest its transformed

343

Huang and Gjerset: Role of p14ARF in the cellular stress response Phase III trials (Saadatmandi et al, 2002b). With the identification of ARF as a key player in modulating p53 activity, and possibly a critical determinant of p53 activity, it is likely that further refinements in this approach will be possible. Figure 1 diagrams our current understanding of the interactions between ARF, mdm2 and p53. ARF regulates the interaction of p53 with mdm2, a key negative regulator of p53 (Pomerantz et al, 1998; Zhang et al, 1998). Mdm2 (also termed hdm2 in humans) ubiquitinates p53 and targets it for proteosome-mediated degradation. Through this mechanism, mdm2 ensures low steady state levels of wild-type p53 found in normal cells. Mdm2 expression in turn is induced by p53, establishing a feedback loop that controls expression levels of both proteins (Wu et al, 1993). Mdm2 function appears to be largely p53dependent as mdm2 overexpression in transgenic mice results in embryonic lethality, but lethality can be rescued by p53 deletion (Jones et al, 1995; Montes de Oca Luna et al, 1995). Mdm2 overexpression occurs in about 10% of cancers, predominantly in soft tissue sarcomas (Leach et al, 1993; Cordon-Cardo et al, 1994). Such tumors generally continue to express wild-type p53, as would be expected if overexpression of mdm2 were the functional equivalent of p53 loss. ARF interacts physically with mdm2, through the first 20 residues of the N-terminal domain of ARF and the Cterminal domain of mdm2 (Midgley et al, 2000). The interaction opposes mdm2-mediated degradation of p53, and leads to an increase in p53 half-life (Kamijo et al, 1998), enhanced sequence-specific transcriptional transactivation by p53 (Kamijo et al, 1997; Pomerantz et al, 1998) , and p53-mediated cell cycle arrest (Zhang et al, 1998). Nucleolar sequestration of mdm2 by ARF has been proposed as important in this process (Tao and Levine, 1999). ARF expression is induced by oncogenic abnormalities such as oncogene activation (de Stanchina et al, 1998; Palmero et al, 1998; Zindy et al, 1998) and is

necessary to induce p53-mediated cell cycle arrest in response to these abnormalities. The observation that p53 and ARF abnormalities often occur in a reciprocal manner in human cancer is consistent with this p53-dependent model for ARF activity and suggests that ARF loss is to some extent the functional equivalent of p53 loss (Pomerantz et al, 1998; Zhang et al, 1998). However, unlike mdm2, ARF function does not appear to be confined to a largely p53-dependent role, and is now known to interact with proteins other than mdm2, some of which may mediate important tumor suppressor activities of ARF.

II. p53-indpendent activities of ARF In addition to its well-described involvement in regulating p53 activity, several lines of evidence now support the involvement of p53-independent activities of ARF in tumor suppression. In some cancers, for example, ARF loss and p53 mutation occur together (Gazzeri et al, 1998; Sanchez-Cespedes et al, 1999), suggesting that inactivation of ARF per se constitutes an independent survival advantage for the cancer cell. Evidence for a p53independent role for ARF in vivo is also suggested by studies of knockout mice, where ARF-mediated suppression of spontaneous tumor formation in p53-null, mdm2-null mice was inferred based on the decreased predisposition of such mice to spontaneous tumor formation compared to mice lacking ARF as well as p53 and mdm2 (Weber et al, 2000). This effect is also observed in vitro, where mouse embryo fibroblasts (MEFs) from mice triply nullizygous for p53, mdm2, and ARF are growth suppressed by ectopic re-expression of ARF, indicating that ARF is able to suppress growth independently of p53 in this setting (Weber et al, 2000). It has been speculated that in such a setting, ARF may interact with mdmx (discussed below) or another mdm2 homologue to reverse their inhibition of a yet to be identified growth suppressor (Jackson et al, 2001). Another study using MEFs implicated both the Rb and p53 pathways in ARF activity (Carnero et al, 2000). In that study MEFs lacking the p53 pathway could be suppressed by ectopic expression of ARF, but MEFs lacking both p53 and Rb pathways could not be suppressed by ectopic expression of ARF (Carnero et al, 2000). In our own studies in human tumor cell lines, we see that ectopic overexpression of ARF suppresses growth and viability of human tumor cells lacking expression of endogenous wild-type p53 (Saadatmandi et al, 2002a; Huang et al, 2003). Unlike tumor cells expressing endogenous wild-type p53, ectopic overexpression of ARF in tumor cells lacking expression of endogenous wild-type p53 does not lead to p53 accumulation, or to the induction of p53 target gene expression (mdm2, p21waf1, bax), or to an elevated bax to bcl2 ratio (Saadatmandi et al, 2002a). ARF is therefore able to suppress tumor cell growth independently of these key players in p53-dependent growth arrest and apoptosis. Furthermore, since the tumor lines studied lacked a functional Rb pathway as well (Saadatmandi et al, 2002a), ARF appears to have tumor suppressor activity in human tumor cells that is independent of both p53 and Rb.

Figure 1. Schematic representation of the stress-activated regulatory loop involving p53, mdm2, and p14ARF.

344

Cancer Therapy Vol 1, page 345 ARF binding proteins other than mdm2 have been identified through yeast two-hybrid screening techniques, co-immunoprecipitation, and co-localization studies. These proteins, listed in Table 1, include topoisomerase I (Karayan et al, 2001), E2F-1,2,3 (Eymin et al, 2001; Martelli et al, 2001), spinophilin, the regulatory subunit of protein phosphatase I (Vivo et al, 2001), p120E4F, a zinc finger transcription repressor (Rizos et al, 2003), CARF, a novel collaborator of ARF (Hasan et al, 2002), mdmx, a mdm2 homologue (Jackson et al, 2001), and HIF-1!, a hypoxia-inducible transcription factor (Fatyol and Szalay, 2001). ARF has also been found to form oligomers with itself (Menendez et al, 2003). Two of the ARF binding proteins listed in Table 1, mdmx and HIF-1!, may participate in p53 independent functions of ARF. Hypoxia-inducible factor-1! (HIF-1!), a transcriptional regulator of genes induced during hypoxia, is frequently over expressed in advanced tumors and may play an important role in tumor growth. ARF can inhibit the

transcriptional activity of HIF-1! by binding to it and sequestering it into the nucleolus. The interaction between ARF and HIF-1! is independent of both mdm2 and p53, and thus may define a p53 independent role for ARF (Fatyol and Szalay, 2001). Mdmx has been implicated in the p53-dependent activity of ARF, participating through interactions with mdm2, ARF and p53, in the p53/mdm2 regulatory feedback loop, and inhibiting transcriptional transactivation by p53 (Jackson and Berberich, 2000). Through its association with ARF, mdmx appears to interfere with ARF-mdm2 interactions (Jackson et al, 2001). In the presence of wild-type p53, and under conditions of oncogenic stress where p53 and mdm2 levels are induced, mdmx may play a minor role. However, under conditions where p53 and mdm2 are low or absent (i.e., triple knockout MEFS discussed above, or possibly certain human tumor lines), associations between mdmx and ARF may mediate tumor suppressor activities independently of p53 (Jackson et al, 2001).

Table 1. p14ARF binding proteins Protein name

How identified

Protein type

activity

reference

Yeast 2-hybrid

Zinc finger transcription repressor

(Rizos et al., 2003)

IP-Western

Transcription factors that induce S-phase

Forms ternary complex with p53 and ARF; enhances cell cycle inhibition ARF binds to and destabilized them

spinophilin

Yeast 2-hybrid

Regulatory subunit of protein phosphatase I catalytic protein

Synergizes with ARF to suppress cell growth

(Vivo et al., 2001)

Topoisomerase I

IP-Western

DNA binding

DNA repair, DNA synthesis; ARF enhances its activity

(Karayan et al., 2001)

mdmx

Co-localization; IP-Western

Mdm2 homologue

Blocks p53 Binds mdm2 Binds ARF and opposes it

(Jackson et al., 2001)

HIF-1!

IP-Western

Hypoxia-inducible transcription factor

(Fatyol and Szalay, 2001)

Pex19p

Yeast 2-hybrid

Farnysylated cytosolic protein

ARF blocks HIF-1!; sequester 路 to nucleolus; p53independent activity Interacts with mouse ARF, NOT human ARF

CARF

Yeast 2-hybrid

Enhances ARF activity

(Hasan et al., 2002)

P14ARF

Western

Novel serine-rich protein "Collaborator of ARF Tumor suppressor

Forms homooligomers

(Menendez et al., 2003)

E4F

P120

E2F-1, E2F-3

E2F-2,

345

(Eymin et al., 2001; Martelli et al., 2001)

(Sugihara et al., 2001; Wadhwa et al., 2002)

Huang and Gjerset: Role of p14ARF in the cellular stress response involved in mdm2 binding), it seemed likely that this conclusion would extend to human ARF as well. However, while the N-terminal exon 1"-encoded region of human ARF (ARF1") appears sufficient to bind mdm2 and to mediate the p53-dependent activity of ARF, several studies now raise the possibility that ARF C-terminal sequences, encoded by ARF exon 2, also contribute to its tumor suppressor properties. For example, human ARF has nucleolar localization sequences in both N terminal (exon 1") and C-terminal (exon 2) domains (Weber et al, 1999; Rizos et al, 2000), and both may be required for efficient nucleolar localization (Zhang and Xiong, 1999). An example of the differences in subcellular distribution of ARF and ARF1" is shown in Figure 2 (Y Huang and R Gjerset, unpublished). MCF-7 breast cancer cells, which express endogenous wild-type p53 and lack endogenous expression of ARF were treated with replication defective adenoviral vectors encoding ARF1" or full length ARF (vectors described in (Saadatmandi et al, 2002a; Huang et al, 2003). 48 hours post-vector treatment cells were fixed and stained with anti-p14ARF (Zymed laboratories) and goat anti-rabbit Alexa 488 (Molecular Probes) plus Hoechst 33345. The Hoechst stain binds DNA and facilitates the identification of nuclei and subnuclear structures. The results show that over expressed nuclear ARF is concentrated in nucleoli (Figure 2, first column, bottom panel), consistent with published studies (Rizos et al, 2001). In contrast, nuclear ARF1" showed far less nucleolar concentration and distributed more evenly throughout the nucleus (Figure 2, second column, bottom panel). In addition, several studies on melanoma-prone kindreds suggest the involvement of ARF C-terminal sequences in ARF functions (Rizos et al, 2001; Hashemi et al, 2002). In contrast to an earlier study that reported that

III. Functional significance of the ARF C-terminus The ARF tumor suppressor is encoded by the ARFINK4a locus of chromosome 9p21, a region that has already been implicated in human cancer as a very frequent target of genetic alteration (Kamb et al, 1994). Also encoded by this locus is the p16 (MTS1/CDKN2) tumor suppressor, an inhibitor of cyclin D-dependent kinases CDK4 and CDK6 (Serrano et al, 1993). Phosphorylation of the retinoblastoma tumor suppressor (pRb) by CDK4 or CDK6 releases the E2F transcription factor from an inactive complex with pRb, and enables downstream events that promote cell cycle progression. Inactivation of either p16 or pRb deregulates cell cycle progression, a key feature of tumor cell metabolism. While p16 and ARF are structurally and functionally unrelated and have distinct first exons (denoted exon 1! and exon 1", respectively), they are characterized by the unusual property of sharing the same exon 2, although alternate reading frames are used to generate the two proteins. Studies on murine ARF (p19) have localized the p53-dependent tumor suppressor activity of ARF to the Nterminal exon 1" encoded sequences, which are completely non-overlapping with p16 sequences (Zhang et al, 1998). In murine ARF the regions important for nucleolar localization, mdm2 sequestration, and p53dependent apoptosis reside entirely within the first 37 Nterminal residues and these 37 residues are sufficient to carry out these effects (Weber et al, 2000). With regard to this activity, the C-terminal sequences might appear therefore to constitute a largely non-functional and dispensable domain. Because the N-terminal exon 1"encoded sequences of murine and human ARF are highly conserved (particularly in the first 14 amino acids

Figure 2. Subcellular distribution of ectopic ARF and ARF1Ă&#x; in MCF7 breast cancer cells (endogenous ARF null). Cells were treated with adenoviral vectors encoding ARF1Ă&#x; or full length p14ARF, followed 24 hours later by fixing and staining. Nucleoli, indicated by arrows in top panels, are evident by DIC (Differential Interference Contrast) and by Hoechst staining as darker regions (middle panels). Bottom panels show immunofluorescent staining for p14ARF. Magnification = 60x.

346

Cancer Therapy Vol 1, page 347 several cancer associated mutations affecting C-terminal (exon 2-encoded) sequences altered p16 function but not ARF function (Quelle et al, 1997), the melanoma study identified mutations in the C-terminal nucleolar localization domain encoded by exon 2 in certain melanoma-prone kindreds that altered the subcellular distribution of ARF and/or its binding to mdm2 (Rizos et al, 2001). Another study also reported a C-terminal mutation in ARF in a melanoma kindred that gave rise to a protein carrying an 8 residue deletion that was less potent than wild-type ARF at stabilizing p53 and inducing cell cycle arrest (Hashemi et al, 2002). Interestingly, the physical properties of these mutants were often altered as well, as several of them (R81Q, R82L, R88ter) showed greater solubility in the absence of urea than did full length wild-type ARF (Rizos et al, 2001). C-terminal sequences therefore contribute to the proper folding of ARF and conceivably influence the intermolecular interactions and activity of ARF. ARF C-terminal sequences have now been shown to be crucial for ARF interaction with topoisomerase I, for the ability of ARF to stimulate topoisomerase I relaxation activity, and for the co-localization of ARF and topoisomerase I in the nucleolus (Olivier et al, 2003). Furthermore, two ARF C-terminal point mutations that are highly conserved among species were unable to stimulate topoisomerase I activity (Olivier et al, 2003). Taken together the data argue for an important role for the ARF C-terminal sequences in regulating the structure and function of ARF, although the reason why p14ARF and p16 overlap remains unknown.

IV. Perspectives translation

for

serotype 5, a serotype that lacks serious pathogenicity, has a broad host cell range, displays a high infection efficiency for most cell types, and is relatively easy to prepare in high yield and high titer, and is stable. Unlike retroviral vectors, adenoviral genomes do not integrate into the host cell DNA, thereby avoiding the risk of insertional mutagenesis, which is a concern with retroviral vectors. To minimize potential vector toxicity and to maximize the exposure of the target tumor cells to the vector, these trials have generally employed direct administration of the vector into a patientâ&#x20AC;&#x2122;s tumor or into the region where a tumor is localized, with doses as high as 1011 plaque forming units per injection being well tolerated (Saadatmandi et al, 2002b). While patients may develop neutralizing antibody to the vector, expression of the p53 gene in tumors is still detectable, and antibody does not preclude multiple administrations of vector at weekly or biweekly intervals (Saadatmandi et al, 2002b). An extension of such approaches to include ARF therefore seems feasible, and approaches that exploit both p53 and ARF may prove to be far more effective than approaches based on p53 alone. The ultimate challenge for cancer treatment is metastatic disease, for which systemic delivery approaches are required. Systemic delivery of p53 using viral (Lebedeva et al, 2001) or non viral (Ramesh et al, 2001) delivery strategies can have antitumor efficacy in mice and reduce the incidence of metastatic spread when combined with conventional therapy. However, the clinical application of systemic delivery approaches will likely require the development of improved second generation viral or non viral vectors, including vectors consisting of polyethylenimine (PEI)-DNA complexes (Densmore et al, 2001), and possibly incorporating a tumor specific targeting moiety to improve delivery efficiency, a critical factor in the success of any gene transfer strategy. Because systemic gene delivery is likely to be far less efficient than direct intratumoral gene delivery, there is also a need to optimize gene combinations so as to improve therapeutic efficacy at low gene expression levels.

clinical

The disruption of the p53/p14ARF/mdm2 feedback loop is likely to be an essential survival mechanism common to most cancers, as it renders cancer cells unable to undergo growth arrest or apoptosis in response to the intracellular oncogenic stress signals that are universal features of cancer. One would predict that restoration of normal functioning of the loop would be highly suppressive of cancer cell growth and viability, in that it exploits the cancer cell's intrinsic fragility and predisposition to apoptosis, but would have minimal consequence for normal cells that lack the endogenous oncogenic stress signals that feed into the loop. The importance of ARF in regulating this loop, and the high frequency with which ARF function is lost in cancer, makes ARF an important therapeutic target. Numerous therapeutic applications of the p53 tumor suppressor are now in an advanced stage of development, with clinical trials ongoing or completed that attest to the safety and efficacy of adenovirus-mediated gene transfer of p53 for a variety of tumors, including prostate cancer, lung cancer, and head and neck cancer, brain cancer, ovarian cancer, and bladder cancer (see references (Logothetis, 1999; Swisher et al, 1999; Nemunaitis et al, 2000; Sweeney and Pisters, 2000; Swisher and Roth, 2000)). The vector of choice for these applications has been a replication defective vector based on adenovirus

V. Combined potential of p53 and ARF The activity of p53 is attenuated through a feedback mechanism whereby p53 induces the expression of its own inhibitor, mdm2 (Figure 1). This feedback mechanism, which may be exacerbated by certain cancer associated abnormalities such as loss of p14ARF or overexpression of mdm2, may compromise the outcome of p53-based strategies for cancer, including p53 gene transfer. Full activation of the pathway may therefore require additional steps to modulate the activity of mdm2. One approach is to supply both p53 and p14ARF, either as a combination of single gene vectors (Tango et al, 2002) or as a bicistronic vector (Huang et al, 2003). Co-expression of p14ARF and p53 leads to a dramatic enhancement of tumor suppression compared to that achieved with p53 alone, as a result of increased accumulation of p53 protein followed by increased expression of p53 target genes, including mdm2, p21waf1, and bax, an elevated bax to bcl2 ratio, and 347

Huang and Gjerset: Role of p14ARF in the cellular stress response apoptosis (Huang et al, 2003). P14ARF also appears to promote increased recruitment of p53 message into polysomes and increased synthesis of p53 protein, through a mechanism that is not yet understood (Huang et al, 2003) and Huang and Gjerset, unpublished). The cooperative effects of ectopically expressed p53 and p14ARF are observed even in cells expressing endogenous ARF, indicating that the presence of endogenous ARF is likely to be insufficient to counterbalance the effects of induced levels of mdm2. The use of an optimized gene combination involving p53 together with p14ARF, could therefore enhance efficacy under conditions where gene delivery was inefficient or resulted in low levels of transgene expression. Eventually, small molecule approaches targeting specific molecular structures or interactions may provide alternatives to gene delivery when systemic delivery is needed for metastatic disease. One possibility is the use of peptides corresponding to regions of the p53 protein or to segments of p53-binding proteins so as to correct the folding of p53 mutant proteins and reactivate function (Selivanova et al, 1998; Lane and Lain, 2002). A better understanding of how ARF contributes to the pathology of cancer, including a mapping of regions necessary for function and for interaction with itself and other proteins may make it possible to design ARF peptide mimetics or other small molecule therapeutics, to mimic proteinprotein interactions critical for ARF activity, or disrupt interactions that impede its activity (Menendez et al, 2003). Such molecules could be administered systemically, possibly tagged with moieties to facilitate cellular uptake (Ho et al, 2001).

of downstream target genes involved in growth arrest (p21waf1) or apoptosis (bax) (Levine, 1997). P53mediated senescence, or irreversible loss of proliferative potential, has also been associated with the outcome of therapy, and correlates with increased expression of senescence-associated "-galactosidase (Campisi, 2001; Schmitt et al, 2002). In light of the important role played by ARF in the opposing mdm2-mediated degradation of p53, it is likely that ARF gene transfer will be required to optimize the outcome of p53-chemotherapy combination approaches. In fact, deletion of the INK4A/ARF locus in EÂľ-myc murine lymphoma cells impairs apoptosis, compromises p53 function, and reduces the response to the DNA alkylating agent cyclophosphamide in vitro and in vivo (Schmitt et al, 1999). Other studies have shown that ARF expression, though dispensable for initiating a p53 response to DNA damage, is required for a sustained accumulation of p53 following DNA damage (Khan et al, 2000). ARF gene transfer alone can sensitize breast cancer cells to doxorubicin, a drug that acts in part through the induction of DNA damage (Guo-Chang and Chu-Tse, 2000), or to cisplatin, which forms bifunctional adducts on DNA (Deng et al, 2002). A role for ARF in the cellular response to these chemotherapeutic agents would greatly expand its potential application to cancer treatment, as it could be used to help reverse therapy resistance in advanced cancers.

VII. Conclusions ARF has emerged as a critical human tumor suppressor with relevance to the underlying mechanism of cancer and to cancer treatment. Through its involvement in the p53/mdm2 feedback loop, which shuts down cell growth in response to oncogenic abnormalities, ARF plays a key role in suppressing a broad array of cancers that retain wild-type p53 expression. ARF may also be necessary to optimize p53-based therapies and to fully activate the p53-mediated response to conventional chemotherapy. In addition, through pathways that are independent of p53 and less well understood, but which presumably involve ARF interactions with proteins other than mdm2, ARF may contribute additional tumor suppressor activities that add to its p53-dependent activity. As we gain a better understanding of these activities and how they are regulated we will certainly improve and refine our paradigms to understand cancer and find new opportunities for the development of highly targeted cancer therapeutics.

VI. ARF contributes to the p53mediated DNA damage response A variety of anticancer agents, including cisplatin (cis-diamminedichloroplatinum, CDDP) and doxorubicin (adriamycin), generate lesions that promote p53-mediated apoptosis, and that these agents are more effective in vitro and in vivo in animal tumor models, if p53 function is also restored in these tumors (Clarke et al, 1993; Lotem and Sachs, 1993; Lowe et al, 1993; Gjerset et al, 1995; Nguyen et al, 1996; Dorigo et al, 1998; Gjerset and Mercola, 2000; Gjerset et al, 2001; Lebedeva et al, 2001; Saadatmandi et al, 2002b). There is also evidence that loss or mutation of p53 in cancer contributes to therapy resistance (O'Connor et al, 1997), currently the major obstacle to successful treatment of cancer. The fact that many chemotherapeutic agents use the p53 pathway to kill their target cells has now been exploited in clinical trials of several cancers, including advanced head and neck cancer, where p53 gene transfer was seen to improve responses to cisplatin or radiation (Swisher et al, 1999; Nemunaitis et al, 2000; Swisher and Roth, 2000; Saadatmandi et al, 2002b). These observations are consistent with the well-described involvement of p53 in the DNA damage response (Bakalkin et al, 1995; Lee et al, 1995), which leads to phosphorylation of mdm2 and disruption of the interaction between p53 and mdm2. In this way, p53 is stabilized and activated as a transcription factor, followed by induction

Acknowledgements Our work in this field has been supported by grants from the California Tobacco-Related Disease Research Program (11RT-0074), the California Cancer Research Program (99-00517V-10140), the California Breast Cancer Research Program (6JB-0077), and the National Cancer Institute (CA69546).

348

Cancer Therapy Vol 1, page 349 Gjerset R, Mercola D (2000) Sensitization of tumors to chemotherapy through gene therapy. Adv Exp Med Biol 465, 273-291. Gjerset R, Turla S, Sobol R, Scalise J, Mercola D, Collins H, Hopkins P (1995) Use of wild-type p53 to achieve complete treatment sensitization of tumor cells expressing endogenous mutant p53. Mol Carcinog 14, 275-285. Gruis N, Weaver-Feldhaus J, Liu Q, Frye C, Eeles R, Orlow I, Lacombe L, Ponce-Castaneda V, Lianes P, Latres E, et al. (1995) Genetic evidence in melanoma and bladder cancers that p16 and p53 function in separate pathways of tumor suppression. Am J Pathol 146, 1199-1206. Guo-Chang F, Chu-Tse W (2000) Transfer of p14ARF gene in drug-resistant human breast cancer MCF-7/Adr cells inhibits proliferation and reduces doxorubicin resistance. Cancer Lett 158, 203-210. Hasan M, Yaguchi T, Sugihara T, Kumar P, Taira K, Reddel R, Kaul S, Wadhwa R (2002) CARF is a novel protein that cooperates with mouse p19ARF (human p14ARF) in activating p53. J Biol Chem 277, 37765-37770. Hashemi J, Lindstrom M, Asker C, Platz A, Hansson J, Wiman K (2002) A melanoma-predisposing germline CDKN2A mutation with functional significance for both p16 and p14ARF. Cancer Lett 180, 211-221. Ho A, Schwarze S, Mermelstein S, Waksman G, Dowdy S (2001) Synthetic protein transduction domains: enhanced transduction potential in vitro and in vivo. Cancer Res 61, 474-477. Huang Y, Tyler T, Saadatmandi N, Lee C, Borgstrom P, Gjerset R (2003) Enhanced tumor suppression by a p14ARF/p53 bicistronic adenovirus through increased p53 protein translation and stability. Cancer Res 63, 3646-3653. Jackson M, Berberich S (2000) MdmX protects p53 from Mdm2mediated degradation. Mol Cell Biol 20, 1001-1007. Jackson M, Lindstrom M, Berberich S (2001) MdmX binding to ARF affects Mdm2 protein stability and p53 transactivation. J Biol Chem 276, 25336-25341. Jones S, Roe A, Donehower L, Bradley A (1995) Rescue of embryonic lethality in Mdm2-deficient mice by absence of p53. Nature 378, 206-208. Kamb A, Gruis N, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian S, Stockert E, Day R, 3rd, Johnson B, Skolnick M (1994) A cell cycle regulator potentially involved in genesis of many tumor types [see comments]. Science 264, 436-440. Kamijo T, Bodner S, Van De Kamp E, Randle D, Sherr C (1999) Tumor spectrum in ARF-deficient mice. Cancer Res 59, 2217-2222. Kamijo T, Weber J, Zambetti G, Zindy F, Roussel M, Sherr C (1998) Functional and physical interactions of the ARF tumor suppressor with p53 and Mdm2. Proc Natl Acad Sci U S A 95, 8292-8297. Kamijo T, Zindy F, Roussel M, Quelle D, Downing J, Ashmun R, Grosveld G, Sherr C (1997) Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF. Cell 91, 649-659. Karayan L, Riou J, Seite P, Migeon J, Cantereau A, Larsen C (2001) Human ARF protein interacts with topoisomerase I and stimulates its activity. Oncogene 20, 836-848. Katayose D, Gudas J, Nguyen H, Srivastava S, Cowan K, Seth P (1995) Cytotoxic effects of adenovirus-mediated wild-type p53 protein expression in normal and tumor mammary epithelial cells. Clin Cancer Res 1, 889-897. Khan S, Moritsugu J, Wahl G (2000) Differential requirement for p19ARF in the p53-dependent arrest induced by DNA damage, microtubule disruption, ribonucleotide depletion. Proc Natl Acad Sci U S A 97, 3266-3271. Lane D, Lain S (2002) Therapeutic exploitation of the p53 pathway. Trends Mol Med 8, S38-42.

References Bakalkin G, Selivanova G, Yakovleva T, Kiseleva E, Kashuba E, Magnusson Kp, Szekely L, Klein G, Terenius L, Wiman K (1995) p53 binds single-stranded DNA ends through the Cterminal domain and internal DNA segments via the middle domain. Nucleic Acids Res 23, 362-369. Bates S, Phillips Ac, Clark P, Stott F, Peters G, Ludwig R, Vousden K (1998) p14ARF links the tumour suppressors RB and p53. Nature 395, 124-125. Cai D, Mukhopadhyay T, Liu Y, Fujiwara T, Roth J (1993) Stable expression of the wild-type p53 gene in human lung cancer cells after retrovirus-mediated gene transfer. Hum Gene Ther 4, 617-624. Campisi J (2001) Cellular senescence as a tumor-suppressor mechanism. Trends Cell Biol 11, S27-31. Carnero A, Hudson J, Price Cm, Beach D (2000) p16INK4A and p19ARF act in overlapping pathways in cellular immortalization. Nat Cell Biol 2, 148-155. Clarke A, Purdie C, Harrison D, Morris R, Bird C, Hooper M, Wyllie A (1993) Thymocyte apoptosis induced by p53dependent and independent pathways [see comments]. Nature 362, 849-852. Cordon-Cardo C, Latres E, Drobnjak M, Oliva M, Pollack D, Woodruff J, Marechal V, Chen J, Brennan M, Levine A (1994) Molecular abnormalities of mdm2 and p53 genes in adult soft tissue sarcomas. Cancer Res 54, 794-799. De Stanchina E, Mccurrach M, Zindy F, Shieh S, Ferbeyre G, Samuelson A, Prives C, Roussel M, Sherr C, Lowe S (1998) E1A signaling to p53 involves the p19(ARF) tumor suppressor. Genes Dev 12, 2434-2442. Deng X, Kim M, Vandier D, Jung Y, Rikiyama T, Sgagias M, Goldsmith M, Cowan K (2002) Recombinant adenovirusmediated p14(ARF) overexpression sensitizes human breast cancer cells to cisplatin. Biochem Biophys Res Commun 296, 792-798. Densmore C, Kleinerman E, Gautam A, Jia S, Xu B, Worth L, Waldrep J, Fung Y, T'ang A, Knight V (2001) Growth suppression of established human osteosarcoma lung metastases in mice by aerosol gene therapy with PEI-p53 complexes. Cancer Gene Ther 8, 619-627. Dorigo O, Turla S, Lebedeva S, Gjerset R (1998) Sensitization of rat glioblastoma multiforme to cisplatin in vivo following restoration of wild-type p53 function. J Neurosurg 88, 535540. Eymin B, Karayan L, Seite P, Brambilla C, Brambilla E, Larsen Cj, Gazzeri S (2001) Human ARF binds E2F1 and inhibits its transcriptional activity. Oncogene 20, 1033-1041. Fatyol K, Szalay A (2001) The p14ARF tumor suppressor protein facilitates nucleolar sequestration of hypoxiainducible factor-1alpha (HIF-1!) and inhibits HIF-1mediated transcription. J Biol Chem 276, 28421-28429. Fulci G, Labuhn M, Maier D, Lachat Y, Hausmann O, Hegi M, Janzer R, Merlo A, Van Meir E (2000) p53 gene mutation and ink4a-arf deletion appear to be two mutually exclusive events in human glioblastoma. Oncogene 19, 3816-3822. Gazzeri S, Della Valle V, Chaussade L, Brambilla C, Larsen C, Brambilla E (1998) The human p19ARF protein encoded by the beta transcript of the p16INK4a gene is frequently lost in small cell lung cancer. Cancer Res 58, 3926-3931. Gjerset R, Haghighi A, Lebedeva S, Mercola D (2001) Gene therapy approaches to sensitization of human prostate carcinoma to cisplatin by adenoviral expression of p53 and by antisense jun kinase oligonucleotide methods. Methods Mol Biol 175, 495-520. Gjerset R, Lebedeva S, Haghighi A, Turla S, Mercola D (1999) Inhibition of the Jun kinase pathway blocks DNA repair, enhances p53- mediated apoptosis and promotes gene amplification. Cell Growth Differ 10, 545-554.

349

Huang and Gjerset: Role of p14ARF in the cellular stress response Leach F, Tokino T, Meltzer P, Burrell M, Oliner J, Smith S, Hill D, Sidransky D, Kinzler K, Vogelstein B (1993) p53 Mutation and MDM2 amplification in human soft tissue sarcomas. Cancer Res 53, 2231-2234. Lebedeva S, Bagdasarova S, Tyler T, Mu X, Wilson D, Gjerset R (2001) Tumor Suppression and Therapy Sensitization of Localized and Metastatic Breast Cancer by Adenovirus p53. Hum Gene Ther 12, 763-772. Lee S, Elenbaas B, Levine A, Griffith J (1995) p53 and its 14 kDa C-terminal domain recognize primary DNA damage in the form of insertion/deletion mismatches. Cell 81, 10131020. Levine A (1997) p53, the cellular gatekeeper for growth and division. Cell 88, 323-331. Logothetis C, et al. (1999) AdCMV-p53 intraprostatic gene therapy preceeding radical prostatectomy (RP): an in vivo model for targeted therapy development. J. Clin. Oncol. 18, 1203A. Lotem J, Sachs L (1993) Hematopoietic cells from mice deficient in wild-type p53 are more resistant to induction of apoptosis by some agents. Blood 82, 1092-1096. Lowe S, Ruley H, Jacks T, Housman D (1993) p53-dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell 74, 957-967. Martelli F, Hamilton T, Silver D, Sharpless N, Bardeesy N, Rokas M, Depinho R, Livingston D, Grossman S (2001) p19ARF targets certain E2F species for degradation. Proc Natl Acad Sci U S A 98, 4455-4460. Menendez S, Khan Z, Coomber D, Lane D, Higgins M, Koufali M, Lain S (2003) Oligomerization of the human ARF tumor suppressor and its response to oxidative stress. J Biol Chem 278, 18720-18729. Midgley C, Desterro J, Saville M, Howard S, Sparks A, Hay R, Lane D (2000) An N-terminal p14ARF peptide blocks Mdm2-dependent ubiquitination in vitro and can activate p53 in vivo. Oncogene 19, 2312-2323. Montes de oca Luna R, Wagner D, Lozano G (1995) Rescue of early embryonic lethality in mdm2-deficient mice by deletion of p53. Nature 378, 203-206. Nemunaitis J, Swisher S, Timmons T, Connors D, Mack M, Doerksen L, Weill D, Wait J, Lawrence D, Kemp B, Fossella F, Glisson B, Hong W, Khuri F, Kurie J, Lee J, Lee J, Nguyen D, Nesbitt J, Perez-Soler R, Pisters K, Putnam J, Richli W, Shin D, Walsh G, et al. (2000) Adenovirusmediated p53 gene transfer in sequence with cisplatin to tumors of patients with non-small-cell lung cancer. J Clin Oncol 18, 609-622. Nguyen D, Spitz F, Yen N, Cristiano R, Roth J (1996) Gene therapy for lung cancer: enhancement of tumor suppression by a combination of sequential systemic cisplatin and adenovirus-mediated p53 gene transfer. J Thorac Cardiovasc Surg 112, 1372-1376; discussion 1376-1377. O'Connor P, Jackman J, Bae I, Myers T, Fan S, Mutoh M, Scudiero D, Monks A, Sausville E, Weinstein J, Friend S, Fornace Aj, Jr., Kohn K (1997) Characterization of the p53 tumor suppressor pathway in cell lines of the National Cancer Institute anticancer drug screen and correlations with the growth-inhibitory potency of 123 anticancer agents. Cancer Res 57, 4285-4300. Olivier A, Lucie K, Jean-Francois R, Christian-Jacques L, Paule S (2003) Delineation of the domains required for physical and functional interaction of p14ARF with human topoisomerase I. Oncogene 22, 1945-1954. Palmero I, Pantoja C, Serrano M (1998) p19ARF links the tumour suppressor p53 to Ras. Nature 395, 125-126. Pinyol M, Hernandez L, Martinez A, Cobo F, Hernandez S, Bea S, Lopez-Guillermo A, Nayach I, Palacin A, Nadal A, Fernandez P, Montserrat E, Cardesa A, Campo E (2000)

INK4a/ARF locus alterations in human non-Hodgkin's lymphomas mainly occur in tumors with wild-type p53 gene. Am J Pathol 156, 1987-1996. Pomerantz J, Schreiber-Agus N, Liegeois N, Silverman A, Alland L, Chin L, Potes J, Chen K, Orlow I, Lee H, CordonCardo C, Depinho R (1998) The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2's inhibition of p53. Cell 92, 713-723. Quelle D, Cheng M, Ashmun R, Sherr C (1997) Cancerassociated mutations at the INK4a locus cancel cell cycle arrest by p16INK4a but not by the alternative reading frame protein p19ARF. Proc Natl Acad Sci U S A 94, 669-673. Ramesh R, Saeki T, Smyth Templeton N, Ji L, Stephens L, Ito I, Wilson D, Wu Z, Branch C, Minna J, Roth J (2001) Successful Treatment of Primary and Disseminated Human Lung Cancers by Systemic Delivery of Tumor Suppressor Genes Using an Improved Liposome Vector. Mol Ther 3, 337-350. Rizos H, Darmanian A, Holland E, Mann G, Kefford R (2001) Mutations in the INK4a/ARF melanoma susceptibility locus functionally impair p14ARF. J Biol Chem 276, 4142441434. Rizos H, Darmanian A, Mann G, Kefford R (2000) Two arginine rich domains in the p14ARF tumour suppressor mediate nucleolar localization. Oncogene 19, 2978-2985. Rizos H, Diefenbach E, Badhwar P, Woodruff S, Becker T, Rooney R, Kefford R (2003) Association of p14ARF with the p120E4F transcriptional repressor enhances cell cycle inhibition. J Biol Chem 278, 4981-4989. Saadatmandi N, Tyler T, Huang Y, Haghighi A, Frost G, Borgstrom P, Gjerset R (2002a) Growth suppression by a p14(ARF) exon 1beta adenovirus in human tumor cell lines of varying p53 and Rb status. Cancer Gene Ther 9, 830839. Saadatmandi N, Wilson D, Gjerset R (2002b) p53 Gene Therapy. In Encyclopedia of Cancer. (Academic Press) pp. 425-432. Sanchez-Cespedes M, Reed A, Buta M, Wu L, Westra W, Herman J, Yang S, Jen J, Sidransky D (1999) Inactivation of the INK4A/ARF locus frequently coexists with TP53 mutations in non-small cell lung cancer. Oncogene 18, 58435849. Schmitt C, Fridman J, Yang M, Lee S, Baranov E, Hoffman R, Lowe S (2002) A senescence program controlled by p53 and p16INK4a contributes to the outcome of cancer therapy. Cell 109, 335-346. Schmitt C, Mccurrach M, De Stanchina E, Wallace-Brodeur R, Lowe S (1999) INK4a/ARF mutations accelerate lymphomagenesis and promote chemoresistance by disabling p53. Genes Dev 13, 2670-2677. Selivanova G, Kawasaki T, Ryabchenko L, Wiman K (1998) Reactivation of mutant p53: a new strategy for cancer therapy. Semin Cancer Biol 8, 369-378. Serrano M, Hannon G, Beach D (1993) A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4 [see comments]. Nature 366, 704-707. Shieh S, Ikeda M, Taya Y, Prives C (1997) DNA damageinduced phosphorylation of p53 alleviates inhibition by MDM2. Cell 91, 325-334. Siliciano J, Canman C, Taya Y, Sakaguchi K, Appella E, Kastan M (1997) DNA damage induces phosphorylation of the amino terminus of p53. Genes Dev 11, 3471-3481. Sugihara T, Kaul S, Kato J, Reddel R, Nomura H, Wadhwa R (2001) Pex19p dampens the p19ARF-p53-p21WAF1 tumor suppressor pathway. J Biol Chem 276, 18649-18652. Sweeney P, Pisters L (2000) Ad5CMVp53 gene therapy for locally advanced prostate cancer--where do we stand? World J Urol 18, 121-124.

350

Cancer Therapy Vol 1, page 351 Swisher S, Roth J (2000) Gene Therapy in Lung Cancer. Curr Oncol Rep 2, 64-70. Swisher S, Roth J, Nemunaitis J, Lawrence D, Kemp B, Carrasco C, Connors D, El-Naggar A, Fossella F, Glisson B, Hong W, Khuri F, Kurie J, Lee J, Lee J, Mack M, Merritt J, Nguyen D, Nesbitt J, Perez-Soler R, Pisters K, Putnam J, Jr., Richli W, Savin M, Waugh M, et al. (1999) Adenovirus-mediated p53 gene transfer in advanced non-small-cell lung cancer. J Natl Cancer Inst 91, 763-771. Tango Y, Fujiwara T, Itoshima T, Takata Y, Katsuda K, Uno F, Ohtani S, Tani T, Roth J, Tanaka N (2002) Adenovirusmediated p14ARF gene transfer cooperates with Ad5CMVp53 to induce apoptosis in human cancer cells. Hum Gene Ther 13, 1373-1382. Tao W, Levine A (1999) P19(ARF) stabilizes p53 by blocking nucleo-cytoplasmic shuttling of Mdm2. Proc Natl Acad Sci U S A 96, 6937-6941. Vivo M, Calogero R, Sansone F, Calabro V, Parisi T, Borrelli L, Saviozzi S, La Mantia G (2001) The human tumor suppressor arf interacts with spinophilin/neurabin II, a type 1 protein-phosphatase-binding protein. J Biol Chem 276, 14161-14169. Wadhwa R, Sugihara T, Hasan M, Taira K, Reddel R, Kaul S (2002) A major functional difference between the mouse and human ARF tumor suppressor proteins. J Biol Chem 277, 36665-36670. Weber J, Jeffers J, Rehg J, Randle D, Lozano G, Roussel M, Sherr C, Zambetti G (2000) p53-independent functions of the p19(ARF) tumor suppressor. Genes Dev 14, 2358-2365. Weber J, Taylor L, Roussel M, Sherr C, Bar-Sagi D (1999) Nucleolar Arf sequesters Mdm2 and activates p53. Nat Cell Biol 1, 20-26.

Wu X, Bayle J, Olson D, Levine A (1993) The p53-mdm-2 autoregulatory feedback loop. Genes Dev 7, 1126-1132. Zhang Y, Xiong Y (1999) Mutations in human ARF exon 2 disrupt its nucleolar localization and impair its ability to block nuclear export of MDM2 and p53. Mol Cell 3, 579591. Zhang Y, Xiong Y, Yarbrough W (1998) ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell 92, 725-734. Zindy F, Eischen C, Randle D, Kamijo T, Cleveland J, Sherr C, Roussel M (1998) Myc signaling via the ARF tumor suppressor regulates p53-dependent apoptosis and immortalization. Genes Dev 12, 2424-2433.

Dr. Ruth A. Gjerset

351

Dr. Yinghui Huang

Huang and Gjerset: Role of p14ARF in the cellular stress response

352

Cancer Therapy Vol 1, page 353 Cancer Therapy Vol 1, 353-362, 2003

The role of B lymphocytes in breast cancer: a review and current status Review Article

Sazini Nzula1*, James J. Going 2, David I. Stott 1 1

Division of Immunology, Infection & Inflammation and 2Division of Cancer Sciences & Molecular Pathology, University of Glasgow, Western Infirmary, Glasgow, G11 6NT, Scotland, U.K.

__________________________________________________________________________________ *Correspondence: Sazini Nzula, Division of Immunology, Infection & Inflammation,University of Glasgow, Western Infirmary, Glasgow, G11 6NT, Scotland, U.K. email: sn34y@clinmed.gla.ac.uk Key words: B lymphocyte, breast cancer, Medullary carcinoma, Her 2 neu, MUC-1, p53, Carcinoembryonic antigen, Antibody-mediated tumour cell killing Abbreviations: Ductal carcinoma in situ, (DCIS); Infiltrating ductal carcinoma, (IDC); Medullary carcinoma, (MC); tumour-infiltrating lymphocytes, (TIL); complementarity determining regions, (CDR); framework regions, (FR); epidermal growth factor receptor, (EGFR); carcinoembryonic antigen, (CEA); antibody-dependent cell-mediated cytotoxicity, (ADCC); follicular dendritic cell, (FDC) Received: 1 December 2003; Accepted: 23 December 2003; electronically published: December 2003

Summary Primary breast carcinomas are often associated with tumour-infiltrating lymphocytes and metastatic carcinoma cells in axillary lymph nodes make intimate contact with lymphocytic cells. The defensive role of these lymphocytes against breast cancer remains controversial despite several decades of investigation. The identification of human tumour antigens recognised by the autologous host has provided convincing evidence for immune recognition of the tumour. Medullary breast carcinoma is characterized by heavy B lymphocyte infiltration, but these tumourinfiltrating lymphocytes clearly fail to eradicate it and apparently also fail to contain its growth, as the prognosis of medullary breast carcinoma may be no better than that of the more common ductal breast carcinoma. On the other hand, the effectiveness of herceptin has demonstrated that antibodies against tumour-associated antigens are potentially potent agents in the treatment of breast cancer. It is therefore possible that neoplastic zones that elicit effective immunological attack might be destroyed before they are clinically significant. The purpose of this article is to review the role of tumour-infiltrating B lymphocytes in breast cancer, the development of monoclonal antibodies from these lymphocytes, and their possible uses in therapy. It is not our intent nor can we discuss all breast cancer antigens and antibodies against them, as the numbers are too large, nor the role of other types of immune cells such as cytotoxic T cells and natural killer cells. Despite this, it has received the most attention with respect to the role of the immune response in breast carcinomas. Prior to the 1940s, virtually no attention was paid to tumour-infiltrating lymphocytes (TIL) in breast cancer. As interest in lymphocyte infiltration grew, more reports were published and attention turned to the types of cells involved in the infiltrates. Most breast cancers (60-80 %) have detectable lymphocyte infiltrates (Whitford et al, 1990; Hartveit, 1998; Aaltomaa et al, 1992). These infiltrates consist largely of T cells, with variable numbers of macrophages, natural killer cells and B-cells (Chin et al, 1993). Presently, there is disagreement on the relative abundance of T-lymphocyte sub-populations. Some investigators report CD4+ T cells as predominant, especially in large tumours (Balch et al, 1990; Chin et al, 1993; Wong et al, 1998) while others show a higher proportion of CD8+ T-lymphocytes (Durie et al, 1990;

I. Introduction Breast cancer is the most common malignancy of women in many parts of the world, with a lifetime incidence around 1/12. Despite advances in screening, diagnosis and treatment, many people, nearly all women, still die from the disease each year. A variety of distinct histopathological subtypes are recognised. Ductal carcinoma in situ (DCIS), confined to the mammary ducts and lobules, has a cure rate approaching 100%. Infiltrating ductal carcinoma (IDC) accounts for 80% of breast cancer. Malignant growth starts in the ducts and lobules prior to invasion and ultimately metastasis to distal sites. Lobular carcinoma in situ and invasive lobular carcinoma, which represent 10-15% of breast cancer, behave analogously. Medullary carcinoma of the breast (MC) is relatively uncommon, comprising a mere 1-5% of breast cancers.

353

Nzula et al: The role of B lymphocytes in breast cancer Ben-Hur et al, 2002). Owing to the abundance of T lymphocytes in tumour tissue and the belief that cytotoxic T lymphocytes constitute the major contribution to immune responses against tumours, most in-depth studies on TIL have concentrated on T cells (Rohrer et al, 1999; Dutoit et al, 2001; Rosenberg, 2001; Liyanage et al, 2002). In contrast, tumour-infiltrating B cells are less well characterised despite the presence of TIL B-cells in at least 20% of breast cancers (Balch et al, 1990). B lymphocytes control humoral immunity and represent the effector cell type involved in the production of antibodies. The generation of antibody-secreting plasmacytes and memory B cells occurs in secondary lymphoid organs. An immune response is initiated when specialised antigen-presenting cells such as dendritic cells acquire antigen in the periphery and migrate to the draining lymph node where the antigen comes into contact with na誰ve or memory lymphocytes. Antigen-specific B cells presented with their complementary antigen become activated and undergo developmental events in the germinal centre, including somatic mutation of immunoglobulin V genes and affinity selection, which lead to a large clonal expansion of antigen-specific plasma cells and memory B cells (Liu et al, 1991; Pascual et al, 1994). High-affinity antigen-specific B cells leave the lymph node and migrate to the periphery where they recirculate. Plasma cells entering the circulation migrate principally to the bone marrow. While the appreciation of lymphocyte infiltration in breast cancer has grown, controversy surrounds the prognostic significance of lymphocytic infiltrates and the relative importance of various types of lymphocytes. The controversy around the precise role of tumour infiltrates has produced two competing hypotheses: one that lymphocytic infiltrates merely reflect non-specific inflammatory reactions resulting from tumour-derived chemokines and cytokines, and the other, that they represent defensive reactions, overridden by metastatic disease. For most cancers including breast cancers, the immune response seems to have a limited effect on tumour behaviour. However, detailed analysis of the host response has led to the identification of a number of tumourassociated and tumour-specific antigens that are overexpressed, mutated or structurally modified. The identification of several self-antigens such as the HER-2neu protein, p53 (Lenner et al, 1999), CEA, c-Hras, c-myc and MUC-1 (Petrarca et al, 1999) indicates that at least some cancers are immunogenic, and elicit humoral and cellular immune responses, but a tumour-specific immune response does not necessarily translate into tumour rejection. On the other hand, it is possible that many early tumours rejected by the immune system do not progress and only those that the immune response fails to eliminate do progress to a clinically detectable stage. This could account for the high incidence of malignancies in immuno-suppressed individuals.

II. Medullary carcinoma of the breast MC is characterised by a syncytial growth pattern, well circumscribed tumour borders, and dense lymphoplasmacytic cell infiltrates in the tumour stroma (Ridolfi et al, 1977). Brisk mitotic rates, large pleomorphic nucleoli sparse necrosis and a lack of acinar differentiation are also characteristic. This type of breast carcinoma has also been described as bulky carcinoma, circumscribed breast carcinoma, solid circumscribed as well as medullary carcinoma with lymphoid stroma. MC is relatively infrequent, representing 1-5 % of breast cancer but has received considerable attention since the late 1940s when it was reported that patients with MC had a five-year survival of 82.7% compared to 50% for patients with the usual infiltrating forms of carcinoma of the breast (Moore and Foote, 1949). In addition, nodal metastases at mastectomy were 43% in MC compared to 60% in IDC. Moore and Foote suggested that the extensive plasma cell infiltrate could be partly responsible for the unusual survival they observed. Gorski and coworkers confirmed these findings (Gorski et al, 1968). In their study, axillary metastases were found in 16% of patients with MC and 49% of patients with other types of breast carcinoma and axillary metastases in patients with MC did not diminish survival. Ten-year survival for patients with MC was 68% compared with 52% for other breast cancer patients. Maier et al (1977) also reported a better prognosis for MC patients. This group found that lymph node involvement was less common in MC than IDC, but considered the size of the tumour more important than lymph node involvement. A review of 192 patients confirmed the favourable prognosis of MC compared to IDC diagnosed and treated over the same time span in the same institute (Ridolfi et al, 1977). An attempt was made to re-define MC reproducibly using 11 histological criteria to include precisely defined patients in the study. In contrast to other reports, Ridolfi and co-workers did not report a significantly lower frequency of axillary metastases in MC than other types of breast cancers. However, survival of node-positive patients with MC was significantly better than nodepositive patients with IDC. Rapin and co-workers (1988), using the same diagnostic criteria as Ridolfi et al, reported better 5 and 10-year survival, which they attributed to less frequent involvement of axillary nodes in MC. Whether this was because of a lower tendency to metastasize or a specific immunologic response was not determined. Richardson, working on 117 patients, also reported a better prognosis for MC patients (Richardson, 1956). The five-year survival of patients with MC and axillary metastases was better than of patients with non-MC and axillary metastases, 72% and 50%, respectively. According to Richardson however, the better prognosis was not related to the intensity of lymphoid infiltration. He attributed the better prognosis of MC to its poor stroma formation and reduced ability to metastasize. Several papers do not support the conclusion that MC has an especially favourable prognosis. When identical cancer stages were compared, the 5 and 10-year survival rates for patients with MC paralleled those of 354

Cancer Therapy Vol 1, page 355 patients with ductal carcinomas (Fisher et al, 1978; Black et al, 1983). These results corroborated earlier work on 140 patients not matched for disease stage, which found that patients with “circumscribed carcinoma” had the same survival rate as those used for comparison (Haagensen, 1971). On the other hand, a study of 104 cases of MC in a series of 1411 with similar stage reported that after twenty years, 74 % of cases with operable MC were alive compared with 14% for non-MC breast cancers (Bloom et al, 1970). Although 68% of the MC cases in this study were reported to be high grade, axillary metastases were present in only 39% of cases. Compared with other types of breast cancer, unsuccessfully treated MC patients died fastest of all groups, with deaths due to the carcinoma being rare after 5 years. The authors concluded that MC are essentially aggressive malignancies, as indicated by their tumour grade, but their biological potential is countered to a considerable extent by the host’s immune response. Two decades after the findings of Moore and Foote, Schwart reported that 10-year survival was, in fact, worse for patients with “circumscribed carcinoma” among both those with axillary metastasis (28% v 37%) and without (60% v 76%), compared to other types of breast cancers (Schwartz, 1969). Flores et al (1974) concluded that lymphocytic infiltration in MC was associated with an over-all poorer response, as it was positively associated with a higher rate of metastasis. Between the 1940s and early 1990s controversies surrounding MC included its definition, its prognosis and the role of the infiltrating lymphocytes. Distinction of MC from several other forms of invasive breast carcinoma can be difficult. Much of the controversy concerning the prognosis of MC may be attributable to the use of varied or uncertain classification criteria. An attempt was made by Ridolfi et al to group several histological criteria and thus define MC more precisely with a reproducible classification. Pedersen and co workers (1991), further simplified these criteria by eliminating those with poor inter-/intra-observer agreement and those deemed to imply no or little impact on prognosis. Another reason for the differing conclusions concerning the prognosis of MC could be that survival of patients is estimated across different treatments. During this period, there was general agreement on one aspect of MC, namely, that it has less nodal metastasis and when it does occur, fewer nodes are positive than with infiltrating ductal carcinoma (Schwartz, 1969; Flores et al, 1974; Haagensen, 1971; Ridolfi et al, 1977). Towards the end of the 1990s, data were emerging on the role of tumour antigens and the humoral immune response in MC. Kotlan and co-workers (1999) identified somatically mutated immunoglobulin variable region genes expressed by tumour tissue B lymphocytes infiltrating MC. In addition, certain V-genes were preferentially represented, suggesting selection of subpopulations of tumour infiltrating B cells. Coronella et al (2001) demonstrated clonal expansion of tumourinfiltrating B cells in MC. It is well established that B-cells undergoing a germinal centre response, i.e. clonal proliferation accompanied by somatic hypermutation and

affinity selection, are driven by antigen, which is required as both the initial trigger and at the later stage of affinity selection (Jacob et al, 1991; Jacob and Kelsoe, 1992). The observation of clonally expanding, mutating B cells infiltrating the tumour therefore implies a local, antigendriven response. The plasma cells associated with breast carcinomas are predominantly of IgG subtype, with some IgA and few IgM (Coronella et al, 2001). In contrast, the plasma cells associated with normal breast tissue and other secretory epithelia are predominantly IgA (Sienski, 1980; Ito et al, 1986; Jacquemier, 1987). The prominence of IgG in MC versus the usual IgA plasma cells, and the association of infiltrates with the tumour stroma, suggest a specific immune response to tumour-derived antigens but the putative driving antigens have largely not yet been identified. Hansen et al (2002) showed that actin becomes exposed on the cell surface of a large proportion of apoptotic MC cells as an early apoptotic event and that cloned anti-actin antibodies bind specifically and with high affinity. !-actin is prevalent in most cells and is normally non-immunogenic, although low affinity antibodies can be found in healthy individuals. Hansen and co-workers proposed that owing to the increased rate of apoptosis of MC cells, the anti-actin immune response was generated when !-actin was exposed on the surface of apoptotic cells. The clinical significance of this antigen remains to be elucidated.

III. Non-medullary carcinomas of the breast Non-medullary carcinomas account for most breast cancer but unlike MC, they have more variable numbers of tumour-infiltrating lymphocytes and the role of these cells in tumour immunity has not received much attention. The most comprehensive study on the role of lymphocytes in breast cancers was carried out recently by Ben-Hur et al (2002) who investigated different types of breast cancer; fibrocytic disease, fibroadenoma, carcinoma in situ, invasive lobular carcinoma and infiltrating ductal carcinoma. Modest lymphoid infiltration was observed in fibrocytic disease, fibroadenoma and some infiltrating ductal and lobular carcinomas. In contrast, carcinoma in situ and some infiltrating ductal and lobular carcinomas were associated with extensive lymphoid infiltration. DCIS but not lobular carcinoma in situ is often associated with a dense lymphocytic infiltrates. Ramachandra et al (1990) could not interpret the role of the lymphocytes but Ben-Hur et al considered the infiltrating lymphocytes to indicate a host reaction to the tumour. An investigation of tumour-infiltrating B lymphocytes in IDC demonstrated the presence of T cells, follicular dendritic cells, B cells and plasma cells in the tumour-infiltrating lymphoid clusters (Figure 1) (Coronella et al, 2002; Nzula et al, 2003). The presence of FDCs is particularly significant as they are normally localised to germinal centres in peripheral lymphoid tissues where they play a crucial role in affinity maturation

355

Nzula et al: The role of B lymphocytes in breast cancer by antigen selection of B cells with high-affinity mutated antigen receptors (Li et al, 2000; van Nierop and de Groot, 2002). Secondly, highly mutated B cell clones were identified in the B cell clusters in the carcinoma and draining axillary lymph nodes (Figure 2) (Nzula et al, 2003; Coronella et al, 2002; Nzula et al, manuscript submitted for publication). As already noted in the previous section, B cells undergoing a germinal centre reaction as indicated by clonal proliferation and somatic hypermutation are driven by antigen which is required as both the initial trigger and during affinity selection. B cell clones in the tumour originate from the first tumourdraining lymph node, (sentinel lymph node), and possibly other axillary nodes (Nzula et al, manuscript submitted for publication). A few B cells undergoing antigen-driven clonal proliferation and somatic hypermutation in germinal centres of the tumour-draining lymph nodes migrate into the breast tumour where they undergo further rounds of clonal proliferation, somatic hypermutation and affinity selection (Figure 3). Germline, unstimulated VH gene family usage in normal peripheral blood lymphocytes is well understood (Brezinschek et al, 1997). Significant deviations from this baseline state are indicative of antigen-driven selection. Highly biased representation of the uncommon VH5 gene

family (Nzula et al, 2003) and VH1 (Coronella et al, 2002) in tumour-infiltrating B cells is indicative of antigendriven selection within the tumour (Figure 4). This is corroborated by the high proportion of replacement mutations in complementarity determining regions (CDR) relative to the framework regions (FR) (Nzula et al, 2003). The six CDRs (three in the heavy chain and three in the light chain) form the antigen binding sites of an antibody whereas the FRs form the structural domains of the antibody. Although CDRs are more susceptible to mutations leading to amino acid replacements, a high replacement to silent ratio in the CDR is believed to result from selection of mutations providing the best â&#x20AC;&#x2DC;fitâ&#x20AC;&#x2122; for the antigen, whereas the lower ratio in the FR preserves the domain structure supporting the antigen-binding site. Replacement mutations that improve antibody affinity in the CDR are therefore selected for, whereas replacement mutations in the FRs, which may disrupt domain structure, are selected against. Fabs cloned from lymphocytes infiltrating IDC recognised a breast cancer cell line and autologous tumour tissue lysate (Coronella et al, 2002), suggesting that some of the lymphocytes are responding to tumour antigen rather than non-specific inflammatory or cytokine signals. However, the nature of the antigens recognised by tumour infiltrating plasmacytes in IDC is still to be determined.

Figure. 1. Immunohistochemical staining of ductal breast carcinoma. B cells were identified with anti-CD20 (x200), T cells with antiCD3 (x200), FDCs with anti-FDC (x200), plasma cells with anti- plasma cell (x200). (reproduced with permission, from Nzula et al, Cancer Research 63:3275-80, 2003)

356

Cancer Therapy Vol 1, page 357 Figure. 2. A B cell clone showing clonal proliferation and somatic hypermutation within a cluster of lymphocytes in breast carcinoma tissue, based on analysis of clonally related Ig VH-gene sequences. The clone is shown as proliferating from the best matching germline VH-gene segment. Each circle symbolises a B cell and letters within depict individual VH-gene sequences. Deduced intermediates are shown as dotted circles. The numbers alongside the arrows represent the minimum number of mutations between the different sequences. Reproduced with permission, from Nzula et al, Cancer Research 63:3275-80, 2003)

IV. Antibodies antigens

against

clinical trials led to herceptin being FDA-approved for the treatment of breast cancer in 1998, followed by approval in the UK. Herceptin is indicated for the treatment of metastatic breast cancer where the tumour cells overexpress Her 2neu protein and the patients are receiving chemotherapy (Baselga, 2001a; Kennedy and Shearer, 2003). Therapy directed against Her-2neu is now well established in this clinical setting, a clear indication of the beneficial effects of passive immunotherapy with a humanised monoclonal antibody for treating human cancers.

tumour

A. Her 2neu Characterisation of antigens driving humoral and cellular immune responses has been intensely investigated over the last few decades, and detailed molecular analysis of the pathways that control tumour growth has identified tumour-associated growth factor receptors as potential targets for therapy. The epidermal growth factor receptor (EGFR) belongs to the immunoglobulin super-family and bind to different growth factor ligands, resulting in increased DNA synthesis (Kim, 2003). The ErbB family, a subset of the EGFR family, consist of four members designated ErbB1-ErbB4. ErbB interaction with growth factors results in the initiation of a signalling cascade with the activation of tyrosine kinase as a crucial step. ErbB2, also called (human epidermal growth factor receptor 2 (Her2), c-erbB-2, Her2neu), is over-expressed in about 20% of breast cancers. Her2neu over-expression is associated with a poor relapse-free survival following treatment in early stage, node negative patients with breast carcinoma (Slamon et al, 1987; Pegram et al, 1998b). A humanised anti-Her2neu monoclonal antibody herceptin/trastuzumab, was developed by Genentech and tested in clinical trials of patients with metastatic disease. Phase I and II trials demonstrated objective clinical and radiographic responses, particularly when used in combination with cytotoxic chemotherapy (Pegram et al, 1998a; Baselga, 2001a; 2001b). The results from extensive

B. MUC-1 The mucins are another group of important tumour antigens. These glycoproteins are major secretory products of various epithelial cells including breast. The human epithelial mucin MUC-1 is a large, complex and heavily glycosylated transmembrane glycoprotein expressed at the luminal surface of most glandular epithelial tissues. Expression of MUC-1 is increased in many epithelial malignancies, such as breast, gastric, pancreatic and ovarian cancers, and a proportion of colonic and lung cancers (Devine et al, 1992; Correa et al, 2003). Overexpression of MUC-1 occurs in 90% of breast cancers and is believed to be an indicator of poor prognosis (Schlom et al, 1996). In malignancy, under-glycosylation occurs so that shorter carbohydrate chains are produced, allowing the exposure of potentially antigenic cryptic carbohydrate and peptide segments (Schlom et al, 1996).

357

Nzula et al: The role of B lymphocytes in breast cancer

Figure 3. B cells clones identified in breast tumour tissue originate in the sentinel lymph node (SLN). The clone in the SLN is shown as proliferating from a founder memory B cell. Each circle symbolises a B cell. B cells migrate from the clones in the germinal centre of the SLN to the lymphocytic cell cluster in the tumour, where they undergo further rounds of somatic hypermutation and clonal proliferation

High levels of anti-mucin antibodies have been detected in pre-treatment breast carcinoma patients (Kotera et al, 1994; Mensdorff-Pouilly et al, 2000). B cells and monoclonal antibodies specific for MUC-1 have been isolated from the tumour-draining lymph nodes of breast as well as other carcinomas (Petrarca et al, 1999). Production of IgG and IgM anti-MUC-1 antibodies is associated with better disease-specific survival (Mensdorff-Pouilly et al, 2000). The good prognosis of patients with anti MUC-1 antibodies indicates that treatment of MUC-1 expressing carcinomas with monoclonal antibodies could be beneficial. Moreover, vaccination with MUC-1 derived glycopeptides might also favourably influence the outcome of disease.

A synthetic vaccine, Theratope, which corresponds to the glycan epitope of MUC-1, is currently undergoing a multinational phase III trial to test its effectiveness in metastatic breast cancer. Theratope stimulates both the production of antibodies and CD4+ T cell responses (MacLean et al, 1996). If successful, the vaccine may be applicable to other types of cancers such as ovarian and pancreatic where MUC-1 is over-expressed on the tumour cells.

C. p53 The p53 gene is one of the best-known tumour suppressor genes in humans. Wild-type p53 is a critical regulator of cell cycle control pathways whereas the mutated p53 gene acts as an oncogene. 358

Cancer Therapy Vol 1, page 359

Figure 4. VH gene family usage of combined patient data differs significantly from the expected frequencies and from normal PBL (p=0.000015 & <0.0001 respectively). (reproduced with permission, from Nzula et al, Cancer Research 63:3275-80, 2003)

Accumulation of p53 protein, owing to mutations in the p53 gene, is a common event in breast, lung, cervical, colon and gastric carcinomas (Gasco et al, 2003). Accumulation of mutated p53 can trigger the humoral immune response and p53 antibodies have been detected in the sera of patients with different types of tumours (Soussi, 2000). These antibodies can also recognise the native form of p53 (Labrecque et al, 1993). Anti-p53 antibodies can indicate breast cancer relapse (Regele et al, 2003). In a retrospective study of 24 breast cancer patients, Regele et al reported a decrease in p53 antibodies that paralleled therapy in 64% of the patients. In 18% of patients, relapse was preceded by an increase of the antibody titre. Thus, monitoring serum levels of p53 antibodies could provide essential information about the clinical course of the disease. Expression of p53 is correlated with resistance to paclitaxel, an important agent in the pharmacological treatment of metastatic breast cancer (Schmidt et al, 2003). A study of 33 patients with metastatic breast cancer found that none of the tumours with p53 expression responded to paclitaxel. In contrast, all of the patients without p53 expression responded to treatment. Thus, p53 expression could be used to identify paclitaxel-resistant patients prior to using ineffective therapy with major side effects.

Mehren et al, 2000; Greiner et al, 2002). In addition, Phase I clinical trials of a recombinant vaccinia virus-CEA vaccine in metastatic colorectal, breast and lung cancer patients showed enhancement of immune responses with no toxicity (McAneny et al, 1996; Schlom et al, 1996). Consequently, CEA represents another potential target for recombinant vaccines against different types of cancers including breast.

E. Antibody-mediated tumour cell killing mechanisms There are several mechanisms through which antibodies bound to tumour antigens can induce tumour cell death. The main mechanism is called antibodydependent cell-mediated cytotoxicity (ADCC), in which antibodies bound to tumour cells activate effector cells of the immune system. Receptors expressed on natural killer cells and other leucocytes bind to the antibody-tumour cell complex through the antibody Fc region, release cytotoxic granules containg perforin and granzymes and destroy the tumour cell (Velders et al, 1998; Snijdewint et al, 2001). Antibody binding to tumour antigens can also trigger the classical complement cascade, leading to complementmediated cell lysis (Livingston et al, 1997). When the first component of complement, C1q, binds to the Fc portion of the antibody-tumour cell complex, this stimulates binding and activation of the remaining components of the complement system (C1-C9) at the cell surface. The activation of complement results in the release of anaphylatoxic and chemotactic factors (C3a, C5a) and the formation of the membrane attack complex (C5b-C9), which initiates lysis of the tumour cell membrane.

D. Carcinoembryonic antigen Human carcinoembryonic antigen (CEA) is a glycoprotein normally expressed in colon epithelium and some fetal tissues. CEA is over-expressed on approximately 50% of breast cancers and carcinomas of the colon, pancreas, lung and gastrointestinal tract (Marshall, 2003). Despite the poor immunogenicity of endogenous CEA, recent recombinant vaccine strategies have demonstrated cellular and humoral immune responses that recognise CEA and kill tumour cells (von

V. Conclusions The function and prognostic significance of tumourinfiltrating lymphocytes has been controversial for over 50 359

Nzula et al: The role of B lymphocytes in breast cancer Correa I, Plunkett T, Vlad A, Mungul A, Candelora-Kettel J, Burchell JM, Taylor-Papadimitriou J, Finn OJ (2003) Form and pattern of MUC1 expression on T cells activated in vivo or in vitro suggests a function in T-cell migration. Immunology 108, 32-41. Devine PL, Birrell GW, Whitehead RH, Harada H, Xing PX, McKenzie IF (1992) Expression of MUC1 and MUC2 mucins by human tumor cell lines. Tumour Biol 13, 268277. Durie FH, Campbell AM, Lee WR, Damato BE (1990) Analysis of lymphocytic infiltration in uveal melanoma. Invest Ophthalmol Vis Sci 31, 2106-2110. Dutoit V, Rubio-Godoy V, Dietrich PY, Quiqueres AL, Schnuriger V, Rimoldi D, Lienard D, Speiser D, Guillaume P, Batard P, Cerottini JC, Romero P, Valmori D (2001) Heterogeneous T-cell response to MAGE-A10(254-262): high avidity-specific cytolytic T lymphocytes show superior antitumor activity. Cancer Res 61, 5850-5856. Fisher B, Redmond C, Fisher ER (1978) Clinical trials and the surgical treatment of breast cancer. Surg Clin North Am 58, 723-736. Flores L, Arlen M, Elguezabal A, Livingston SF, Levowittz S (1974) Host tumour relations in medullary carcinoma of the breast. Surg Gynecol Obstet 139, 683-688. Gasco M, Yulug IG, Crook T (2003) TP53 mutations in familial breast cancer: functional aspects. Hum Mutat 21, 301-306. Gorski CM, Niepolomska W, Nowak K, Gebel B, Plewa T, Pysz H, Adamus J (1968) Clinical Evaluation and pathological grading in relation to other prognostic factors. In Prognostic factors in breast canser, Forrest APM, Kunkler PB (eds) pp 309-317. Williams and Wilkins: Baltimore Greiner JW, Zeytin H, Anver MR, Schlom J (2002) Vaccinebased therapy directed against carcinoembryonic antigen demonstrates antitumor activity on spontaneous intestinal tumors in the absence of autoimmunity. Cancer Res 62, 6944-6951. Haagensen CD (1971) Diseases of the breast. W.B.Saunders: Philadelphia Hansen MH, Nielsen H, Ditzel HJ (2002) Translocation of an intracellular antigen to the surface of medullary breast cancer cells early in apoptosis allows for an antigen-driven antibody response elicited by tumour-infiltrating B cells. J Immunol 169, 2701-2711. Hartveit F (1998) Breast cancer: poor short-term prognosis in cases with moderate lymphocyte infiltration at the tumour edge: a preliminary report. Oncol Rep 5, 423-426. Ito T, Saga S, Nagayoshi S, Imai M, Aoyam A, Yokoi T, Hoshino M (1986) Class distribution of immunoglobulincontaining plasma cells in the stroma of medullary carcinoma of the breast. Breast Cancer Res Treat 7, 97-103. Jacob J, Kelsoe G (1992) In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl) acetyl. II. A common clonal origin for periolar lymphoid sheath-associated foci and germinal centers. J Exp Med 176 , 679-688. Jacob J, Kelsoe G, Rajewsky K, Weiss U (1991) Intraclonal generation of antibody mutants in germinal centres. Nature 354 , 389-392. Jacquemier J (1987) Immunohistochemical study ofT and B lymphocytes in human breast carcinomas with inflammatory stroma. Breast Diseases 2, 12-20. Kennedy RC, Shearer MH (2003) A role for antibodies in tumor immunity. Int Rev Immunol 22, 141-172. Kim JA (2003) Targeted therapies for the treatment of cancer. Am J Surg 186, 264-268. Kotera Y, Fontenot JD, Pecher G, Metzgar RS, Finn OJ (1994) Humoral immunity against a tandem repeat epitope of human mucin MUC-1 in sera from breast, pancreatic, and colon cancer patients. Cancer Res 54, 2856-2860.

years. It is generally believed that they indicate protective involvement of the hostâ&#x20AC;&#x2122;s immune system. Significant effort has been devoted to the identification of antigens recognised by T cells, with antibodies assumed to have little impact on the growth of breast tumours. In reality, both cellular and antibody-mediated mechanisms are likely to be important in controlling and eliminating tumours. Passive immunotherapy with a humanised monoclonal antibody against HER-2neu is now well established for patients with HER-2neu over-expressing breast cancers. The effectiveness of herceptin demonstrates that antibodies against breast cancer antigens can be potent agents of breast cancer control, if not cure. Since only about 20% of patients have HER-2neu positive cancers, this immunotherapeutic strategy currently excludes a sizeable fraction of women with breast cancers. Antibodies against more widely expressed tumour antigens show potential in the treatment of breast and other carcinomas.

References Aaltomaa S, Lipponen P, Eskelinen M, Kosma VM, Marin S, Alhava E, Syrjanen K (1992) Lymphocyte infiltrates as a prognostic variable in female breast cancer. Eur J Cancer 28A, 859-864. Balch CM, Riley LB, Bae YJ, Salmeron MA, Platsoucas CD, von Eschenbach A, Itoh K (1990) Patterns of human tumourinfiltrating lymphocytes in 120 human cancers. Arch Surg 125, 200-205. Baselga J (2001a) Clinical trials of Herceptin(R) (trastuzumab). Eur J Cancer 37 Suppl 1, 18-24. Baselga J (2001b) Phase I and II clinical trials of trastuzumab. Ann Oncol 12 Suppl 1, S49-S55. Ben-Hur H, Cohen O, Schneider D, Gurevich P, Halperin R, Bala U, Mozes M, Zusman I (2002) The role of lymphocytes and macrophages in human breast tumorigenesis: an immunohistochemical and morphometric study. Anticancer Res 22, 1231-1238. Black CL, Morris DM, Goldman LI, McDonald JC (1983) The significance of lymph node involvement in patients with medullary carcinoma of the breast. Surg Gynecol Obstet 157, 497-499. Bloom HJG, Richardson WW, Field JR (1970) Host resistance and survival in carcinoma of breast: a study of 104 cases of medullary carcinoma in a series of 1411 cases of breast cancer followed for 20 years. Br Med J 3, 181-188. Brezinschek HP, Foster SJ, Brezinschek RI, Dorner T, DomiatiSaad R, Lipsky PE (1997) Analysis of the human VH gene repertoire. Differential effects of selection and somatic hypermutation on human peripheral CD5(+)/IgM+ and CD5(-)/IgM+ B cells. J Clin Invest 99, 2488-2501. Chin Y, Janssens J, Bleus J, Vandepitte J, Vandenbrande J, Raus J (1993) Characterization of tumour infiltrating lymphocytes in human breast cancer. Eur J Cancer Prev 2 Suppl 3, 2731. Coronella JA, Spier C, Welch M, Trevor KT, Stopeck AT, Villar H, Hersh EM (2002) Antigen-driven oligoclonal expansion of tumour-infiltrating B cells in infiltrating ductal carcinoma of the breast. J Immunol 169, 1829-1836. Coronella JA, Telleman P, Kingsbury GA, Truong TD, Hays S, Junghans RP (2001) Evidence for an antigen-driven humoral immune response in medullary ductal breast cancer. Cancer Res 61, 7889-7899.

360

Cancer Therapy Vol 1, page 361 Kotlan B, Gruel N, Zafrani B, Furedi G, Foldi J, Petranyi GG, Fridman WH, Teillaud JL (1999) Immunoglobulin variable regions usage by B-lymphocytes infiltrating a human breast medullary carcinoma. Immunol Lett 65, 143-151. Labrecque S, Naor N, Thomson D, Matlashewski G (1993) Analysis of the anti-p53 antibody response in cancer patients. Cancer Res 53, 3468-3471. Lenner P, Wiklund F, Emdin SO, Arnerlรถv C, Eklund C, Hallmans G, Zentgraf H, Dillner J (1999) Serum antibodies against p53 in relation to cancer risk and prognosis in breast cancer: a population-based epidemiological study. Br J Cancer 79, 927-932. Li L, Zhang X, Kovacic S, Long AJ, Bourque K, Wood CR, Choi YS (2000) Identification of a follicular dendritic cell molecule that stimulates germinal center B cell growth. J Exp Med 191, 1077-1083. Liu YJ, Zhang J, Lane PJ, Chan EY, MacLennan IC (1991) Sites of specific B cell activation in primary and secondary responses to T cell-dependent and T cell-independent antigens. Eur J Immunol 21, 2951-2962. Livingston PO, Zhang S, Lloyd KO (1997) Carbohydrate vaccines that induce antibodies against cancer. 1. Rationale. Cancer Immunol Immunother 45, 1-9. Liyanage UK, Moore TT, Joo HG, Tanaka Y, Herrmann V, Doherty G, Drebin JA, Strasberg SM, Eberlein TJ, Goedegebuure PS, Linehan DC (2002) Prevalence of regulatory T cells is increased in peripheral blood and tumor microenvironment of patients with pancreas or breast adenocarcinoma. J Immunol 169, 2756-2761. MacLean GD, Miles DW, Rubens RD, Reddish MA, Longenecker BM (1996) Enhancing the effect of THERATOPE STn-KLH cancer vaccine in patients with metastatic breast cancer by pretreatment with low-dose intravenous cyclophosphamide. J Immunother Emphasis Tumor Immunol 19, 309-316. Maier WP, Rosemond GP, Goldman LI, Kaplan GF, Tyson RR (1977) A ten year study of medullary carcinoma of the breast. Surg Gynecol Obstet 144, 695-698. Marshall J (2003) Carcinoembryonic antigen-based vaccines. Semin Oncol 30, 30-36. McAneny D, Ryan CA, Beazley RM, Kaufman HL (1996) Results of a phase I trial of a recombinant vaccinia virus that expresses carcinoembryonic antigen in patients with advanced colorectal cancer. Ann Surg Oncol 3, 495-500. Mensdorff-Pouilly S, Verstraeten AA, Kenemans P, Snijdewint FG, Kok A, van Kamp GJ, Paul MA, Van Diest PJ, Meijer S, Hilgers J (2000) Survival in early breast cancer patients is favorably influenced by a natural humoral immune response to polymorphic epithelial mucin. J Clin Oncol 18, 574-583. Moore OS, Foote FW (1949) The relatively favourable prognosis of medullary carcinoma of the breast. Cancer 2, 635-642. Nzula S, Going JJ, Stott DI (2003) Antigen-driven Clonal Proliferation, Somatic Hypermutation, and Selection of B Lymphocytes Infiltrating Human Ductal Breast Carcinomas. Cancer Res 63, 3275-3280. Pascual V, Liu YJ, Magalski A, de Bouteiller O, Banchereau J, Capra JD (1994) Analysis of somatic mutation in five B cell subsets of human tonsil. J Exp Med 180, 329-339. Pedersen L, Zedeler K, Holck S, Schiodt T, Mouridsen HT (1991) Medullary carcinoma of the breast, proposal for a new simplified histopathological definition. Based on prognostic observations and observations on inter- and intraobserver variability of 11 histopathological characteristics in 131 breast carcinomas with medullary features. Br J Cancer 63, 591-595. Pegram MD, Lipton A, Hayes DF, Weber BL, Baselga JM, Tripathy D, Baly D, Baughman SA, Twaddell T, Glaspy JA, Slamon DJ (1998a) Phase II study of receptor-enhanced

chemosensitivity using recombinant humanized antip185HER2/neu monoclonal antibody plus cisplatin in patients with HER2/neu-overexpressing metastatic breast cancer refractory to chemotherapy treatment. J Clin Oncol 16, 2659-2671. Pegram MD, Pauletti G, Slamon DJ (1998b) HER-2/neu as a predictive marker of response to breast cancer therapy. Breast Cancer Res Treat 52, 65-77. Petrarca C, Casalino B, von Mensdorff-Pouilly S, Rughetti A, Rahimi H, Scambia G, Hilgers J, Frati L, Nuti M (1999) Isolation of MUC1-primed B lymphocytes from tumourdraining lymph nodes by immunomagnetic beads. Cancer Immunol Immunother 47: 272-277. Ramachandra S, Machin L, Ashley S, Monaghan P, Gusterson BA (1990) Immunohistochemical distribution of c-erbB-2 in in situ breast carcinoma--a detailed morphological analysis. J Pathol 161, 7-14. Rapin V, Contesso G, Mouriesse H, Bertin F, Lacombe MJ, Piekarski JD, Travagli JP, Gadenne C, Friedman S (1988) Medullary breast carcinoma. A reevaluation of 95 cases of breast cancer with inflammatory stroma. Cancer 61, 25032510. Regele S, Vogl FD, Kohler T, Kreienberg R, Runnebaum IB (2003) p53 autoantibodies can be indicative of the development of breast cancer relapse. Anticancer Res 23, 761-764. Richardson WW (1956) Medullary carcinoma of the breast. A distinctive tumour type with a relatively good prognosis following radical mastectomy. Br J Cancer 10, 415-423. Ridolfi RL, Rosen PP, Port A, Kinne D, Mike V (1977) Medullary carcinoma of the breast: a clinicopathologic study with 10 year follow-up. Cancer 40, 1365-1385. Rohrer JW, Barsoum AL, Dyess DL, Tucker JA, Coggin JH, Jr. (1999) Human breast carcinoma patients develop clonable oncofetal antigen-specific effector and regulatory T lymphocytes. J Immunol 162, 6880-6892. Rosenberg SA (2001) Progress in human tumour immunology and immunotherapy. Nature 411, 380-384. Schlom J, Kantor J, Abrams S, Tsang KY, Panicali D, Hamilton JM (1996) Strategies for the development of recombinant vaccines for the immunotherapy of breast cancer. Breast Cancer Res Treat 38, 27-39. Schmidt M, Bachhuber A, Victor A, Steiner E, Mahlke M, Lehr HA, Pilch H, Weikel W, Knapstein PG (2003) p53 expression and resistance against paclitaxel in patients with metastatic breast cancer. J Cancer Res Clin Oncol 129, 295-302. Schwartz GF (1969) Solid circuscribed carcinoma of the breast. Ann Surg 169, 165-173. Sienski W (1980) Immunohistological patterns of immunoglobulins in dysplasias, benign neoplasms and carcinomas of the breast. Tumori 66, 699-711. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, McGuire WL (1987) Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235, 177-182. Snijdewint FG, Mensdorff-Pouilly S, Karuntu-Wanamarta AH, Verstraeten AA, Livingston PO, Hilgers J, Kenemans P (2001) Antibody-dependent cell-mediated cytotoxicity can be induced by MUC1 peptide vaccination of breast cancer patients. Int J Cancer 93, 97-106. Soussi T (2000) p53 Antibodies in the sera of patients with various types of cancer: a review. Cancer Res 60, 17771788. van Nierop K, de Groot C (2002) Human follicular dendritic cells: function, origin and development. Semin Immunol 14, 251.

361

Nzula et al: The role of B lymphocytes in breast cancer Velders MP, van Rhijn CM, Oskam E, Fleuren GJ, Warnaar SO, Litvinov SV (1998) The impact of antigen density and antibody affinity on antibody-dependent cellular cytotoxicity: relevance for immunotherapy of carcinomas. Br J Cancer 78, 478-483. von Mehren M, Arlen P, Tsang KY, Rogatko A, Meropol N, Cooper HS, Davey M, McLaughlin S, Schlom J, Weiner LM (2000) Pilot study of a dual gene recombinant avipox vaccine containing both carcinoembryonic antigen (CEA) and B7.1 transgenes in patients with recurrent CEA-expressing adenocarcinomas. Clin Cancer Res 6, 2219-2228. Whitford P, Mallon EA, George WD, Campbell AM (1990) Flow cytometric analysis of tumour infiltrating lymphocytes in breast cancer. Br J Cancer 62, 971-975. Wong PY, Staren ED, Tereshkova N, Braun DP (1998) Functional analysis of tumor-infiltrating leukocytes in breast cancer patients. J Surg Res 76, 95-103.

Dr. Sazini Nzula

362

Cancer Therapy Vol 1, page 363 Cancer Therapy Vol 1, 363-371, 2003.

Advances in breast cancer therapy and chemoprevention: current strategies and new approaches Review Article

Brittney-Shea Herbert Department of Medical and Molecular Genetics and The Indiana University Cancer Center, Indiana University School of Medicine, Indianapolis, IN 46202, USA

__________________________________________________________________________________ *Correspondence: Brittney-Shea Herbert, Ph.D., Department of Medical and Molecular Genetics, Indiana University School of Medicine, 975 West Walnut St, IB 130, Indianapolis, IN 46202-5251, USA; Tel: +1-317-278-6147; Fax: +1-317-274-2387; e-mail: brherber@iupui.edu Key Words: breast cancer therapy, chemoprevention, radiation therapy, telomerase, telomerase inhibitors Abbreviations: estrogen receptor, (ER); selective estrogen-receptor modulator, (SERM); double strand breaks, (DSB); Nonsteroidal anti-inflammatory drugs, (NSAIDs); cyclooxygenase, (COX); human telomerase reverse transcriptase catalytic subunit, (hTERT); human telomerase RNA component, (hTR); cyclophosamide-methotrexate-fluorouracil, (CMF) Received: 16 December 2003; Accepted: 28 December 2003; electronically published: December 2003

Summary Breast cancer is the most frequent cancer and the second leading cause of cancer mortality in women, with approximately one in eight being affected over their lifetime. One successful breast cancer therapy is inhibiting the function of the estrogen receptor (ER). In addition, the use of tamoxifen is showing promise as a new chemoprevention strategy. However, not all breast tumors respond to anti-estrogen therapy or even contain ER. Furthermore, current therapies for breast cancer include treatments that exert significant toxicity and often result in drug resistance. Thus, there is a need for new drug developments in breast cancer therapy and chemoprevention. These novel strategies should exploit the hallmarks of breast cancer including self-sufficiency in growth signals, insensitivity to antigrowth signals, evading apoptosis, limitless replicative potential, sustained angiogenesis, tissue invasion and metastasis, and genomic instability (Sledge and Miller, 2003). This review discusses some of the recent general strategies in cancer therapy and chemoprevention with the intention to promote the exploitation of the hallmarks of cancer, such as the limitless replicative potential via telomerase. the patient and doctor hopeless in controlling tumor growth. It is thus time that clinicians and basic researchers come together to take advantage of the growing knowledge of the mechanisms underlying cancer. As Hanahan and Weinberg (2000) discussed in their review, there are seven critical features, or a â&#x20AC;&#x153;tool boxâ&#x20AC;? that give a cancer cell its recognizable phenotype (Figure 1). These hallmarks of cancer include self-sufficiency in growth signals, insensitivity to antigrowth signals, evading apoptosis, limitless replicative potential, sustained angiogenesis, tissue invasion and metastasis, and genomic instability. A recent review by Sledge and Miller (2003) suggests the hallmarks of malignancy as a conceptual framework for understanding novel breast cancer therapies. Herein, some of the current therapies for breast cancer will be discussed, including chemoprevention

I. Introduction Conventional breast cancer therapy, such as cytotoxic chemotherapy and radiation, has relied on the long-standing observation that cancer cells divide more rapidly than normal cells. In addition, the use of antiestrogen therapy has long since been used for the treatment of estrogen receptor positive (ER+) breast tumors. These conventional therapies have shown much success and significant survival advantages in breast cancer patients (Kim, 2003). However, the therapies directed towards rapidly dividing cells will also result in the killing of cells lining the gastrointestinal tract or hemtapoietic cells. The toxicity encountered during treatment can hinder the quality of life in breast cancer patients to a point were the negatives outweigh the benefits. Furthermore, drug resistance can occur leaving

363

Herbert: Advances in breast cancer therapy/prevention strategies, with the proposal to develop novel approaches for the treatment of breast cancer by targeting a hallmark of cancer such as the limitless replicative potenital.

It has been well established that estrogen promotes the growth of some breast cancers, especially those that contain the estrogen receptor. Therefore, one of the most successful modes of therapy is either through ovarian ablation, which is a major source of estrogen, or through the use of antiestrogen drugs such as tamoxifen or related drugs. Hormonal therapy has been effective in both premenopausal and postmenopausal women whose cancers are positive for steroid receptors (Early Breast Cancer Trialistsâ&#x20AC;&#x2122; Collaborative Group, 1998; Coleman, 2003). Tamoxifen is a selective estrogen-receptor modulator (SERM) in that it is an antagonist in the breast but agonist in the uterus. Tamoxifen, typically given as adjuvant treatment for five years, has been show to have a 26% reduction in recurrence and a 14% annual reduction in deaths (Early Breast Cancer Trialistsâ&#x20AC;&#x2122; Collaborative Group, 1998; Coleman, 2003). While the use of tamoxifen has shown success, an undesirable effect is the stimulation of uterine or endometrial carcinomas. Under current evaluation as substitutes to tamoxifen are second generation SERMs, such as raloxifene and aromatase inhibitors, which block the production of estrogen and has been shown to be superior to tamoxifen or even be beneficial for combination treatments (Coleman 2003).

II. Current therapies for breast cancer Adjuvant, systemic therapies have greatly improved the prognosis of patients with breast cancer, especially early breast cancer. Systemic therapies include chemotherapy and hormonal therapy before or after surgery. The classes of chemotherapeutics include alkylators, antimetabolites, and antimicrotubules and use cytotoxicity to attack the proliferation of cancer (Table 1). Treatment strategies have shown that using chemotherapeutics in combination are more effective than just one drug alone (Hortobagyi, 1998). For example, cyclophosamide is typically used in combination with methotrexate and fluorouracil (collectively termed CMF) for the adjuvant treatment of breast cancer. While successful, these therapies have adverse side effects which make the use of targeted therapies in combination with lower nontoxic doses of the standard chemotherapeutic agents more desirable.

Figure 1. The breast cancer therapy toolbox: targeting the hallmarks of cancer. The hallmarks of cancer include self-sufficiency in growth signals, insensitivity to antigrowth signals, evading apoptosis, limitless replicative potential, sustained angiogenesis, tissue invasion and metastasis, and genomic instability (Hanahan and Weinberg, 2000). Using our knowledge about the hallmarks of cancer, clinicians are encouraged to exploit these components in order to improve breast cancer treatment strategies (Sledge and Miller, 2003).

Table 1: Common chemotherapy strategies Drug Class Mechanism Alkylators control proliferation Antimetabolites Antimicrotubules

interfere with cell division disrupt mitotic events

Antitumor antibiotics

DNA damage

364

Examples Cyclophosphamide (Cytoxan) Methotrexate, 5-FU paclitaxel (Taxol) Docetaxal (Taxotere) Vinblastine doxorubicin (Adriamycin)

Cancer Therapy Vol 1, page 365 Raloxifene has shown promise for treating breast cancer since it is antagonistic in breast and uterine, but agonistic in bone. Osteoporosis can develop from estrogen deprivation and the use of raloxifene not only helps treat breast cancer, but also helps prevent bone loss. SERMs have also been tested for their affect to prevent breast cancer, as discussed below. Finally, another current successful therapy is immunotherapy with the use of monoclonal antibodies against the receptor HER2/neu. HER2/neu, an epidermal growth factor receptor family member, is overexpressed in approximately one quarter of breast cancers and is associated with poor prognosis (Slamon et al, 1987). The use of the monoclonal antibody to HER2, known as trastuzumab or herceptin, in combination with conventional chemotherapy resulted in higher response rates and prolonged survival in patients with metastatic breast cancer (Slamon et al, 2001). It is now understood that the HER2 and ER pathways share considerable crosstalk. For instance, HER2 can regulate ER coactivators and result in tamoxifen resistance (Schiff et al, 2003). With the increase of knowledge of the HER2 and ER signaling pathways, the use of inhibitors of HER2 signaling has been shown to reverse tamoxifen resistance (Witters et al, 2002). Therefore, integrating our understanding of the molecular mechanisms of cancer with standard chemotherapy can improve therapeutic outcomes. However, we need to ensure that patient selection is taken into account in order to monitor the success of combination targeted therapy (Kim, 2003; Sledge and Miller, 2003). For instance, use of HER2 targeted therapies in combination with tamoxifen would not be successful in ER- or HER2-negative breast cancer patients. Molecular profiling of breast cancer patients, described below, would thus be of clinical significance.

Even with the effectiveness of tumor cell killing, damage to normal tissues can occur. Indeed, if the local irradiation dose (usually 100-300 cGy) was given to the whole body, it could be lethal (Gudkov and Komarova, 2003). In addition, radiation therapy for breast cancer would be delivered to an area which may include some surrounding normal tissue. The current radiation delivery protocols are most likely optimal even with a typical course of fractionating multiple doses. However, the therapeutic index can be improved by understanding the molecular mechanisms of radiation response and exploiting the hallmarks of cancer in order to sensitize cells to irradiation.

IV. Advances in breast chemopreventive strategies

cancer

Unlike chemotherapy, which focuses on halting or eliminating malignant cell growth, chemoprevention focuses on preventing the process of carcinogenesis by the use of pharmacological agents (Sporn and Newton, 1979). With the development of improved screening methods, increased detection, and incidence of breast cancer the need for prevention has grown. Indeed, the number of chemopreventive trials has increased tremendously over the years and has shown some success, particularly in the case for tamoxifen. Tamoxifen became the first chemopreventive agent to earn FDA approval, based on the positive results of National Surgical Adjuvant Breast and Bowel Project (NSABP) breast cancer prevention trial (Fisher et al, 1998). However, two smaller trials in Europe showed negative results. The main differences between the NSABP and the European trials were that the NSABP had a larger and more diverse population, while the European trials each had their own specialized population of either younger with strong family history and concurrent use of hormone replacement therapy or a low-risk population with poor compliance (Decensi and Costa, 2000). Currently, the NSABP is conducting a Study of Tamoxifen and Raloxifene (STAR), with strong support for the use of raloxifene for similar reasons as mentioned above for the therapy trials. Another chemoprevention agent that is currently in Phase III trials is fenretinide. Fenretinide is a synthetic retinoid that has proven potent chemopreventive activity in breast carcinogenesis models with low toxicity, unlike other natural retinoids tested (Costa et al, 1994). Retinoids bind to specific nuclear receptors that can bind to DNA and influence transcription of proteins involved in proliferation, differentiation, or death via apoptosis (Sporn, 1986). Each retinoid, upon binding to a certain retinoid receptor, can have a different effect on the cell. For example, unlike the differentiating agent retinoic acid, fenretinide induces apoptosis in tumor cells. The agent can act on ER-postive or ER-negative breast cancer cells and remains stable in the body for prolonged administration (Sporn and Newton, 1979). With the onset of chemoprevention trials using this synthetic retinoid, additional agents that do not use an antiestrogen

III. Radiation therapy Radiation therapy is an important and integral part of the management of breast cancer patients. This therapy may be used to destroy any residual breast cancer after surgery or to aid in shrinking the tumor before surgery. Radiation therapy is delivered as ionizing radiation (IR) with high-energy photons and charged particles (Gudkov and Komarova, 2003). The ionizing radiation causes ionization of atoms in the biological target tissue because electrons traveling through the target tissue collide with atoms and release energy. The key to the success of radiation therapy is by IR-induced DNA damage. In general, double strand breaks (DSB) induced by ionizing radiation could lead to genome instability, such as translocated chromosomes, broken chromosomes, end-toend fusions, dicentric chromosomes, inversions, duplications, and deletions. Without the regulatory mechanisms to repair damaged DNA, tumor cells are sensitive to ionizing radiation. Thus, radiotherapy plays a key role in the treatment of many tumors, but the radiosensitivity of different tumors varies considerably. The effectiveness of using radiation therapy in the clinic have been the result of decades of experiences and empirical development (Gudkov and Komarova, 2003).

365

Herbert: Advances in breast cancer therapy/prevention mechanism are being evaluated for chemoprevention potential. Nonsteroidal anti-inflammatory drugs (NSAIDs), such as aspirin, ibuprofen, sulindac, and celecoxib, have recently been studied for their potent chemopreventive effects on a number of solid tumors. NSAIDs block the biosynthesis of prostaglandins by inhibiting the cyclooxygenase (COX) activity of the enzyme prostaglandin G/H-synthase (Thun et al, 2002). COX-1 and COX-2, two cyclooxygenase isoforms, are expressed in a variety of normal tissues, and COX-2 has been implicated as having a role in breast cancer as well as other cancers by stimulating cell growth through prostaglandins, suppressing apoptosis by increasing Bcl-2, and enhancing angiogenesis and cell invasiveness (Singh et al, 2002). The expressions of COX-1 and COX-2 were found to be high in human breast cancer (Hwang et al, 1998). Hwang et al (1998) found that COX-2 expression was particularly high in breast epithelial tumors, while COX-1 was primarily localized to the adjacent stromal cells, which also contained some COX-2. On the other hand, Hwang et al found that normal epithelial tissues do not express COX-2. While most chemopreventive studies have been performed with prostate and colon cancer, there is potential for NSAIDs in breast cancer chemoprevention. For example, celecoxib, NS-398, and sulindac sulfone prevented mammary carcinogenesis in mice and rats (Harris et al, 2000; Rozic et al, 2001; Thompson et al, 1997). It is widely accepted that chemopreventive agents may prevent or hinder the occurrence of cancer (Sporn and Suh, 2002). Unfortunately, this approach may not be truly prevention, but only a delay of an undesirable outcome. It is important to note, however, that a practical goal of chemoprevention should be to decrease the incidence and death from invasive breast cancer. Extending the quality of life and advancing the life expectancy of individuals predisposed to breast cancer is still a highly desirable strategy (Sporn and Suh, 2002). To obtain a goal of being truly prevention, further research is needed looking at other endpoints and targets of carcinogenesis. Combination chemoprevention may be just as useful as combination therapy in that they use standard treatments in conjunction with agents that specifically target a mechanism(s) of cancer.

complex consisting of a human telomerase reverse transcriptase catalytic subunit (hTERT) that uses the human telomerase RNA component (hTR) of the complex as a template for adding TTAGGG repeats to the end of the chromosome (Greider and Blackburn, 1985). Once telomerase is activated, it may preferentially elongate critically short telomeres, stabilize telomere lengths and permit continued cell division. This hypothesis is supported by the observation that ectopically introduced telomerase activity can extend telomeres and indefinitely prolong cellular lifespan (Vaziri and Benchimol, 1998; Bodnar et al, 1998). The activation of telomerase occurs in the vast majority of breast cancers (>90% of breast tumors), but is not detected in normal adjacent tissues (Shay and Bacchetti, 1997; Carey et al. 1998; Yashima et al, 1998, Herbert et al, 2001b for review). Therefore, the inhibition of telomerase is an attractive anticancer therapeutic target because treatment with telomerase inhibitors should potentially have less toxicity than other chemotherapeutic agents due to telomerase being absent in most somatic cells. As telomerase is re-expressed in almost all breast cancer cells, the critically short telomeres may be favored to be elongated by telomerase. The average telomere length in these cells becomes stable at lengths well below normal cells. These shorter lengths are at a critical length for cell survival. The difference in telomere lengths between normal and cancer cells thus provides for a mechanism and a window of opportunity to specifically target telomerase and inhibit the growth of cancer cells. Telomerase inhibitors that actually work through a telomere-based mechanism should (i) reduce telomerase activity, but initially not affect cell growth rates; (ii) lead to progressive shortening of telomeres with each cell division; and (iii) cause cells to die or undergo growth arrest. In addition, the time necessary to observe decreased proliferation should vary depending on initial telomere length, and chemically related molecules that do not inhibit telomerase activity should not cause decreased cell proliferation or telomere shortening (White et al, 2001 for review). Telomerase inhibitors have been previously shown to inhibit growth and induce apoptosis in cancer cells (Gyraznov et al, 2001; Hahn et al, 1999; Herbert et al, 1999; Herbert et al, 2001; Herbert et al, 2002; Zhang et al, 1999). Preparations for Phase I clinical trials are currently in progress. Unfortunately, the shortening of telomeres occurs only during cell division and the time necessary to see cells die due to telomerase inhibition is on the order of weeks and months, depending on the initial telomere lengths. It is thus necessary to develop a regimen that takes advantage of the universal expression of telomerase in breast cancer cells while not compromising the patient with the continued growth of the tumor during the weeks of anti-telomerase treatment. The next approach is to examine whether the combination of telomerase inhibition and low doses of other therapeutic agents, such as cytotoxic chemotherapeutic agents, angiogenesis inhibitors, and radiation therapy, can have a greater effect at inhibiting breast cancer growth than either reagent alone. Data supporting this hypothesis has recently been

V. Novel targets for breast cancer therapy: telomeres and telomerase A. Telomerase and telomerase inhibitors One of the hallmarks of breast cancer is its limitless replicative potential, predominantly achieved by telomerase, a reverse transcriptase/ ribonucleoprotein complex that maintains the ends of chromosome (telomeres). Briefly, almost all normal human cells gradually lose telomeric DNA as cells age. Under rare circumstances, immortalized cells emerge when telomerase or another mechanism to maintain telomere stability is activated (Wright et al. 1989; Bryan et al, 1997; Duncan and Reddel, 1997). Telomerase is a protein 366

Cancer Therapy Vol 1, page 367 shown in cancer cells treated with telomerase inhibitors in combination with various antiproliferative agents such as topoisomerase inhibitors, cisplatin, and doxorubicin, or irradiation (Figure 2; Ludwig et al, 2000; Mo et al, 2003; Chen et al, 2003). Treating the cells for a short time with telomerase inhibitors induced enough telomere dysfunction to render the cells even more sensitive to irradiation (Figure 2). Therefore, new strategies for breast cancer treatment can be designed using telomerase inhibitors. Telomerase inhibitors can be used to prevent residual tumor recurrence, in between rounds of chemotherapy, or in the early stages of tumor growth to

sensitize cells to chemotherapy or radiation therapy (Figure 3).

B. Telomere dysfunction and breast cancer therapy Genomic integrity plays an important role in breast cancer progression and is one of the critical hallmarks in cancer. Telomere dysfunction may also play a role in genomic instability seen during carcinogenesis (Artandi et al, 2000; Wu et al, 2003). The maintenance of functional telomeres (repetitive DNA sequences at the ends of chromosomes, consisting of TTAGGG in humans) protect

Figure 2. Combination of irradiation and telomerase inhibitors decreases colony formation of HeLa cervical and MCF-7 breast cancer cells. HeLa and MCF-7 breast cancer cells were either treated with 4 Gy of gamma irradiation (+IR), telomerase inhibitor alone, combination of 4 Gy irradiation and telomerase inhibitors (IR + telomerase inhibitor), or no treatment (untreated). After four days of telomerase inhibitor treatment or no treatment, cells were irradiated and then stained with Geimsa seven days later. The amounts of stained colony circles on treated dishes were compared to untreated stained dishes.

Figure 3. New strategies for breast cancer treatment using telomerase inhibitors. In order to have maximum potential, telomerase inhibitors need to have a dividing cell population within the tumor. Thus, telomerase inhibitors can be used to prevent residual tumor recurrence, in between rounds of chemotherapy, or in the early stages of tumor growth to sensitize cells to chemotherapy or radiation therapy.

367

Herbert: Advances in breast cancer therapy/prevention chemopreventive agents in vitro. Inhibition and/or reversal of the immortal phenotype and other endpoints such as early genomic instability and telomere stability should provide insights into the earliest stages of cancer development, leading to more effective cancer prevention measures. Spontaneous immortalization of human cells in vitro is an extremely rare event, requiring mutations in several genes and cellular pathways normally involved in cellular senescence (Wright et al, 1989; Hara et al, 1991; Shay et al, 1991). Normal cells have a limited lifespan and undergo replicative senescence, in which cells cease to proliferate (Wright and Shay, 2001; Harley et al, 1990; Harley 1991; Campisi et al, 2001). Because of the end replication problem where lagging strand synthesis cannot copy all the way to the very end, almost all normal human cells gradually lose telomeric DNA as cells age (Blackburn, 1991; Blackburn, 1994; Greider, 1994). Senescence occurs when cells contain at least some critically short telomeres. Cells that lose critical cell-cycle checkpoint functions escape this initial growth arrest and divide until they enter crisis, when telomere lengths become extremely short, and chromosome end fusions and apoptosis occur (Blasco et al, 1997; Hande et al, 1999; Harley, 1991; Sedivy, 1998). During crisis, cells undergo a period of balanced cell growth and cell death usually followed by a decrease in the total number of surviving cells. Under extremely rare circumstances, when telomerase or another mechanism to maintain telomere stability is activated, an immortalized cell emerges (Blasco et al, 1997; Kim et al, 1994; Bryan et al, 1997). Limiting the number of cell divisions because of telomere shortening functions as an antitumor protection mechanism by preventing premalignant cells, which have used up their divisions acquiring a few mutations, from being able to continue to proliferate. While normal human breast epithelial cells in vitro rarely ever spontaneously immortalize, Li-Fraumeni Syndrome (LFS)-derived (p53 +/-, telomerase silent) breast epithelial cells have been shown to spontaneously immortalize at a relatively high and reproducible frequency of approximately five in ten million (Shay et al, 1998; Herbert et al, 2001). The fact that the LFS-derived breast epithelial cells can reproducibly spontaneously immortalize allowed for the investigation of the effects of different agents, such as tamoxifen, retinoids, NSAIDs, and telomerase inhibitors, on the immortalization frequency in vitro (Herbert at al., 2001, 2003). Treatment of LFS-derived breast epithelial cells just prior to crisis with low (nM range), non-toxic dosages of some, but not all chemopreventive agents reduced the frequency of spontaneous immortalization. Examining the ability to prevent spontaneous immortalization offers a new intermediate endpoint for validating novel chemopreventive agents.

the ends of eukaryotic chromosomes from end-to-end fusions and being recognized as DNA strand breaks needing repair (de Lange 2002). Without this protection, chromosomal ends may fuse together or be recognized as broken DNA needing unnecessary repair, leading to the same genomic instability seen during carcinogenesis. Telomeres have a 3â&#x20AC;&#x2122; G-rich single stranded overhang that is approximately 200 nucleotides in mammals (Wright et al, 1997). The overhang can displace one strand of the telomeric repeat and hybridize to its complimentary sequence (Griffith et al, 1999). This structure, containing the folded DNA and associated proteins, is called the tloop and may function to prevent the G-rich overhang from activating DNA damage checkpoint activation and repair (Goytisolo and Blasco, 2002). Loss of the G-rich overhang is thought to induce telomere dysfunction through loss of the t-loop structure. The telomerase complex has also been shown to maintain telomeres and the vast majority of human breast cancers maintain their chromosomal ends by telomerase. Telomeres, telomerase, and proteins that bind to telomeres have recently been implicated in being associated with the same proteins that are involved in the response to repair damaged DNA, thus providing a link between DNA repair mechanisms and telomere biology. For example, the DNA damage repair complex, Rad50/MRE11/NBS1, has been shown to associate with telomere-binding proteins and telomeres (Zhu et al, 2000). Taken together, while telomere dysfunction can cause the genomic instability seen in early breast tumorigenesis, disrupting the maintenance of telomeres in breast cancer cells can be advantageous for therapeutics. Dysfunctional telomeres in cancer cells will lead to a DNA damage response. This DNA damage response can push cancer cells over the edge and lead to apoptosis. Cancer cells with critically short and dysfunctional telomeres could be more susceptible to genomic instability and other insults. Multiple insults inflicting DNA damage and other stresses would trigger cell death to the tumor population. Recent evidence supporting this idea suggests that disrupting a cancer cellâ&#x20AC;&#x2122;s ability to maintain functional telomeres can sensitize cells to death (Gonzalez-Suarez et al, 2003). Thus, targeting the maintenance of telomeres will be important in cancer therapeutic strategies (Shay, 2003).

VI. A different approach for studying chemoprevention in vitro: using immortalization as an endpoint As mentioned above, current chemoprevention trials have been encouraging, especially to those who are at a high risk for breast cancer. Unfortunately, results from clinical trials take many years to generate. It is therefore attractive to design and test agents that act on specific molecular targets and to develop preclinical models with a measurable endpoint to examine the effects of potential chemopreventive agents and their mechanisms of action (Sporn and Suh, 2002). Since cancer is mostly a disease of epithelial cells, a system of normal and spontaneously immortalized human breast epithelial cells can provide a good model system to examine the effects of potential

VII. Molecular profiling of breast cancer Improved technologies in genomic and proteomic techniques have allowed us to unravel the complex 368

Cancer Therapy Vol 1, page 369 heterogeneity of breast cancer. Gene-expression profiling by cDNA microarrays uses nucleic acids, which are immobilized on a solid surface or chip, as probes for gene sequences. Proteomics include 2-dimensional gel analyses, yeast two-hybrid and protein chip microarrays (Lopez and Pluskal, 2003). Indeed, genomic and proteomics arrays are now being used to create a molecular portrait of breast cancers and normal breast epithelia (Perou et al, 2000; Sorlie et al, 2001; vanâ&#x20AC;&#x2122;t Veer et al, 2002; West et al, 2001; Hedenfalk et al, 2001; Gruvberger et al, 2001, Sotiriou et al, 2003). Several of these reports have been shown to predict clinical outcome and recent reports show microarray being able to predict chemotherapy response in vitro or a small sample size from fine needle aspirates (Sotiriou et al, 2002; Kudoh et al, 2000). Only time will tell if molecular portraits can readily predict the outcome and best treatment strategy for breast cancer patients. Unfortunately, specimens collected during routine surgical pathology are usually formalin-fixed or paraffin-embedded to preserve tissue histology. This process makes the recovery of intact RNA for microarray analyses difficult (Chung et al, 2002). The ability to apply microarrays to peripheral blood, fine needle aspirates, and breast core needle biopsy samples will be an important step. Furthermore, microarrays were developed to scan the genome in a large-scale fashion and the results can be daunting. Only when microarrays are analyzed carefully to identify a subset of clinically relevant genes can microarrays be useful for clinical diagnosis (Chung et al, 2002). In the meantime, both microarrays and proteomic arrays will continue to provide insights for the molecular basis of cancer which can be of clinical significance.

References Artandi SE, Chang S, Lee SL, Alson S, Gottlieb GJ, Chin L, and DePinho RA (2000) Telomere dysfunction promotes nonreciprocal translocations and epithelial cancers in mice. Nature 406, 641-645. Blackburn EH (1991) Structure and function of telomeres. Nature 350, 569-573. Blackburn EH (1994) Telomeres: no end in sight. Cell 77, 621623. Blasco MA, Lee HW, Hande MP, Samper E, Lansdorp PM, DePinho RA, and Greider CW (1997) Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 91, 25-34. Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, Harley CB, Shay JW, Lichtsteiner S, and Wright WE (1998) Extension of life-span by introduction of telomerase into normal human cells. Science 279, 349-352. Bryan TM, Englezou A, Dalla-Pozza L, Dunham MA, and Reddel RR (1997) Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumorderived cell lines. Nat Med 3, 1271-1274. Campisi J, Kim SH, Lim CS, and Rubio M (2001) Cellular senescence, cancer and aging: the telomere connection. Exp Gerontol 36, 1619-1637. Carey LA, Hedican CA, Henderson GS, Umbricht CB, Dome JS, Varon D, and Sukumar S (1998) Careful histological confirmation and microdissection reveal telomerase activity in otherwise telomerase-negative breast cancers. Clin Cancer Res 4, 435-440. Chen Z, Koeneman KS, and Corey DR (2003) Consequences of telomerase inhibition and combination treatments for the proliferation of cancer cells. Cancer Res 63, 5917-5925. Chung CH, Bernard PS, and Perou CM (2002) Molecular portraits and the family tree of cancer. Nat Genet 32 Suppl, 533-540. Coleman RE (2003) Current and future status of adjuvant therapy for breast cancer. Cancer 97, 880-886. Costa A, Formelli F, Chiesa F, Decensi A, De Pala G, Veronesi U (1994) Prospects of chemoprevention of human cancers with the synthetic retinoid fenretinide. Cancer Res 54, 2032s-2037s. Decensi A and Costa A (2000) Recent advances in cancer chemoprevention, with emphasis on breast and colorectal cancer. Euro J Cancer 36, 694-709. de Lange T (2002) Protection of mammalian telomeres. Oncogene 21, 532-540. Duncan EL and Reddel RR (1997) Genetic changes associated with immortalization. A review. Biochemistry 62, 12631274. Early Breast Cancer Trialistsâ&#x20AC;&#x2122; Collaborative Group (1998) Tamoxifen for early breast cancer: an overview of randomized trials. Lancet 351, 1451-1467. Fisher B, Costantino JP, Wickerham DL, Redmond CK, Kavanah M, Cronin WM, Vogel V, Robidoux A, Dimitrov N, Atkins J, Daly M, Wieand S, Tan-Chiu E, Ford L, and Wolmark N (1998) Tamoxifen for the prevention of breast cancer: report of the national surgical adjuvant breast and bowel project P-1 study. J Natl Cancer Inst 90, 1371-1388. Gonzalez-Suarez E, Goytisolo FA, Flores JM, and Blasco MA (2003) Telomere dysfunction results in enhanced organismal sensitivity to the alkylating agent N-methyl-N-nitrosourea. Cancer Res 63, 7047-7050. Goytisolo FA and Blasco MA (2002) Many ways to telomere dysfunction: in vivo studies using mouse models. Oncogene 21, 584-591. Greider CW and Blackburn EH (1985) Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 43, 405-413.

VIII. Conclusions This review covered a few of the advances in breast cancer therapies and chemoprevention strategies. Another promising therapy under development not mentioned was the use of angiogenesis inhibitors that can block metastasis of breast cancer. Improved technology allows for a molecular profiling of breast cancer patients or those predisposed to breast cancer so that an optimal treatment strategy can be determined for each individual. While current strategies have shown success, clinicians are encouraged to use new approaches that attack more than one hallmark of breast cancer. Novel strategies include combining telomerase inhibitors with conventional chemotherapy or radiation therapy in order to take advantage of dysfunctional telomeres. With the increase in our understanding of the molecular basis for breast cancer, at experimental stage improved treatment strategies will continue to give hope to breast cancer patients.

Acknowledgements The author would like to thank Jimmy Yang for performing the combination experiments and the Indiana Genomics Initiative (INGEN). INGEN of Indiana University is supported in part by Lilly Endowment Inc.

369

Herbert: Advances in breast cancer therapy/prevention Greider CW (1994) Mammalian telomere dynamics: healing, fragmentation shortening and stabilization. Curr Opin Genet Dev 4, 203-211. Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, and de Lange T (1999) Mammalian telomeres end in a large duplex loop. Cell 97, 503-514. Gruvberger S, Ringner M, Chen Y, Panavally S, Saal LH, Borg A, Ferno M, Peterson C, and Meltzer PS (2001) Estrogen receptor status in breast cancer is associated with remarkably distinct gene expression patterns. Cancer Res 61, 59795984. Gryaznov S, Pongracz K, Matray T, Schultz R, Pruzan R, Aimi J, Chin A, Harley C, Shea-Herbert B, Shay J, Oshima Y, Asai A, and Yamashita Y. (2001) Telomerase inhibitorsOligonucleotide phosphoramidates as potential therapeutic agents. Nucleosides, Nucleotides & Nucleic Acids 20, 401410. Gudkov AV and Komarova E A (2003) The role of p53 in determining sensitivity to radiotherapy. Nat Rev Cancer 3, 117-129. Hahn WC, Stewart SA, Brooks MW, York SG, Eaton E, Kurachi A, Beijersbergen RL, Knoll JH, Meyerson M, and Weinberg RA (1999) Inhibition of telomerase limits the growth of human cancer cells. Nature Med 5, 1164-70. Hande MP, Samper E, Lansdorp P, and Blasco MA (1999) Telomere length dynamics and chromosomal instability in cells derived from telomerase null mice. J Cell Biol 144, 589-601. Harley CB, Futcher AB, and Greider CW (1990) Telomeres shorten during ageing of human fibroblasts. Nature 345, 458-460. Harley CB (1991) Telomere loss: mitotic clock or genetic time bomb? Mutat Res 256, 271-282. Harris RE, Alshafie GA, Abou-Issa H, and Seibert K (2000) Chemoprevention of breast cancer in rats by celecoxib, a cyclooxygenase 2 inhibitor. Cancer Res 60, 2101-2103. Hedenfalk I, Duggan D, Chen Y, Radmacher M, Bittner M, Simon R, Meltzer P, Gusterson B, Esteller M, Kallioniemi OP, Wilfond B, Borg A, and Trent J (2001) Gene-expression profiles in hereditary breast cancer. N Engl J Med 344, 539548. Herbert B-S, Pitts AE, Baker SI, Hamilton SE, Wright WE, Shay JW and Corey DR (1999) Inhibition of human telomerase in immortal human cells leads to progressive telomere shortening and cell death. Proc Natl Acad Sci 96, 1427614281. Herbert B-S, Wright AC, Passons CM, Kopelovich L, Ali I, Wright WE and Shay JW (2001) Effects of chemopreventive and anti-telomerase agents on the spontaneous immortalization of breast epithelial cells. J Natl Cancer Inst 93, 39-45. Herbert B-S, Wright WE and Shay JW (2001b) Telomerase and breast cancer. Breast Cancer Research 3, 146-149. Herbert BS, Pongracz K, Shay JW, and Gryaznov SM (2002) Oligonucleotide N3â&#x20AC;&#x2122;!P5â&#x20AC;&#x2122; phosphoramidates as efficient telomerase inhibitors. Oncogene 21, 638-642. Hortobagyi GN (1998) Treatment of breast cancer. N Engl J Med 339, 974-984. Hwang D, Scollard D, Byrne J, and Levine E (1998) Expression of cyclooxygenase-1 and cyclooxygenase-2 in human breast cancer. J Natl Cancer Inst 90, 455-460. Kim JA (2003) Targeted therapies for the treatment of cancer. Am J Surgery 186, 264-268. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, Coviello GM, Wright WE, Weinrich SL, and Shay JW (1994) Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011-2015.

Kudoh K, Ramanna M, Ravatn R, Elkahloun AG, Bittner ML, Meltzer PS, Trent JM, Dalton WS, and Chin KV (2002) Monitoring the expression profiles of doxorubicin-induced and doxorubicin-resistant cancer cells by cDNA microarray. Cancer Res 60, 4161-4166. Lopez M F and Pluskal M G (2003) Protein micro- and macroarrays: digitizing the proteome. J Chromatogr B Analyt Technol Biomed Life Sci 787, 19-27. Ludwig A, Saretzki G, Holm PS, Tiemann F, Lorenz M, Emrich T, Harley CB, and von Zglinicki T (2001) Ribozyme cleavage of telomerase mRNA sensitizes breast epithelial cells to inhibitors of topoisomerase. Cancer Res 61, 30533061. Mo Y, Gan Y, Song S, Johnston J, Xiao X, Wientnes MG, and Au L-S (2003) Simultaneous targeting of telomeres and telomerase as a cancer therapeutic approach. Cancer Res 63, 579-585. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR, Ross DT, Johnsen H, Akslen LA, Fluge O, Pergamenschikov A, Williams C, Zhu SX, Lonning PE, Borresen-Dale AL, Brown PO, and Botstein D (2000) Molecular portraits of human breast tumours. Nature 406, 747-752. Rozic JG, Chakraborty C, and Lala PK (2001) Cyclooxygenase inhibitors retard murine mammary tumor progression by reducing tumor cell migration, invasiveness and angiogenesis. Int J Cancer 93, 497-506. Schiff R, Massarweh S, Shou J, and Osborne CK (2003) Breast cancer endocrine resistance: how growth factor signaling and estrogen receptor coregulators modulate response. Clin Cancer Res 9, 447S-454S. Sedivy JM (1998) Can ends justify the means?: telomeres and the mechanisms of replicative senescence and immortalization in mammalian cells. Proc Natl Acad Sci U S A 95, 9078-9081. Shay JW (2003) Telomerase therapeutics: telomeres recognized as DNA damage signals Clin Cancer Res 9, 3521-3525. Shay JW and Bacchetti S (1997) A survey of telomerase activity in human cancer. Eur J Cancer 33, 787-791. Shay JW, Tomlinson G, Piatyszek MA, and Gollahon LS (1995) Spontaneous in vitro immortalization of breast epithelial cells from a patient with Li-Fraumeni Syndrome. Mol Cell Biol 15, 425-432. Singh B and Lucci A (2002) Role of cyclooxygenase-2 in breast cancer. J Surg Res 108, 173-179. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, and McGuire WL (1987) Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235, 177-182. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, Fleming T, Eiermann W, Wolter J, Pegram M, Baselga J, and Norton L (2001) Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med 344, 783792. Sledge GW and Miller KD (2003) Exploiting the hallmarks of breast cancer: the future conquest of breast cancer. Euro J Cancer 39, 1668-1675. Sotiriou C, Powles TJ, Dowsett M, Jazaeri AA, Feldman AL, Assersohn L, Gadisetti C, Libutti SK, and Liu ET (2002) Gene expression profiles derived from fine needle aspiration correlate with response to systemic chemotherapy in breast cancer. Breast Cancer Res 4, R3. Sotiriou C, Neo SY, McShane L M, Korn EL, Long PM, Jazaeri A, Martiat P, Fox SB, Harris AL, and Liu ET (2003) Breast cancer classification and prognosis based on gene expression profiles from a population-based study. Proc Natl Acad Sci U S A 100, 10393-10398.

370

Cancer Therapy Vol 1, page 371 Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H, Hastie T, Eisen MB, van de Rijn M, Jeffrey SS, Thorsen T, Quist H, Matese JC, Brown PO, Botstein D, Eystein Lonning P, and Borresen-Dale AL ( 2001) Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A 98, 10869-10874. Sporn MB and Newton DL (1979) Chemoprevention of cancer with retinoids. Fed Procs 38, 2528-2534. Sporn MB, Roberts AB, Roche NS, Kagechika H, and Shudo K (1986) Mechanism of action of retinoids. J Am Acad Dermatol 15, 756-764. Sporn MB and Suh N (2002) Chemoprevention: an essential approach to controlling cancer. Nat Rev Cancer 2, 537-543. Thompson HJ, Jiang C, Lu J, Mehta RG, Piazza GA, Paranka NS, Pamukcu R, and Ahnen DJ (1997) Sulfone metabolite of sulindac inhibits mammary carcinogenesis. Cancer Res 57, 267-271. Thun MJ, Henley SJ, and Patron C (2002) Nonsteroidal antiinflammatory drugs as anticancer agents: mechanistic, pharmacologic, and clinical issues. J Natl Cancer Inst 94, 252-266. van 't Veer LJ, Dai H, van de Vijver MJ, He YD, Hart AA, Mao M, Peterse HL, van der Kooy K, Marton MJ, Witteveen AT, Schreiber GJ, Kerkhoven RM, Roberts C, Linsley PS, Bernards R, and Friend SH (2002) Gene expression profiling predicts clinical outcome of breast cancer. Nature 415, 530536. West M, Blanchette C, Dressman H, Huang E, Ishida S, Spang R, Zuzan H, Olson JA Jr, Marks JR, and Nevins JR (2001) Predicting the clinical status of human breast cancer by using gene expression profiles. Proc Natl Acad Sci U S A 98, 11462-11467. White LK, Wright WE, and Shay JW (2001) Telomerase inhibitors. Trends Biotechnol 19, 114-120. Witters L, Engle L, and Lipton A (2002) Restoration of estrogen responsiveness by blocking the HER-2/neu pathway. Oncol Rep 9, 1163-1166. Wright WE, OM Pereira-Smith, and JW Shay (1989) Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol 9, 30883092.

Wright WE, VM Tesmer, KE Huffman, SD Levene, and JW Shay (1997) Normal human chromosomes have long G-rich telomeric overhangs at one end. Genes Dev 11, 2801-2809. Wright WE and Shay JW (2001) Cellular senescence as a tumorprotection mechanism: the essential role of counting. Curr Opin Genet Dev 11, 98-103. Wu X, Amos CI, Zhu Y, Zhao H, Grossman BH, Shay JW, Luo S, Hong WK, and Spitz MR (2003) Telomere dysfunction: a potential cancer predisposition factor. J Natl Cancer Inst 95, 1211-1218. Vaziri H and Benchimol S (1998) Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Curr Biol 8, 279-282. Yashima K, Milchgrub S, Gollahon LS, Maitra A, Saboorian MH, Shay JW, and Gazdar AF (1998) Telomerase enzyme activity and RNA expression during the multistage pathogenesis of breast carcinoma. Clin Cancer Res 4, 22924. Zhang X, Mar V, Zhou W, Harrington L and Robinson MO (1999) Telomere shortening and apoptosis in telomeraseinhibited human tumor cells. Genes Develop 13, 2388-2399. Zhu XD, Kuster B, Mann M, Petrini JH, and Lange T (2000) Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat Genet 25, 347-352.

Dr. Brittney-Shea Herbert

371

Herbert: Advances in breast cancer therapy/prevention

372

Cancer Therapy Vol 1, page 373 Cancer Therapy Vol 1, 373-391, 2003.

Treatment planning in endometrial cancer Review Article

Angiolo Gadducci*, Stefania Cosio, Andrea Riccardo Genazzani Department of Procreative Medicine and Child Development, Division of Gynecology and Obstetrics, University of Pisa, Italy

__________________________________________________________________________________ *Correspondence: Angiolo Gadducci, Department of Procreative Medicine and Child Development, Division of Gynecology and Obstetrics, University of Pisa, Via Roma 57, 56127 Pisa, Italy; Tel: 39 50 992609; Fax: 39 50 553410; e-mail: a.gadducci@obgyn.med.unipi.it Key Words: Endometrial cancer, Surgery, Radiotherapy, Chemotherapy, Endocrine therapy Abbreviations: Federation of Gynecology and Obstetrics, (FIGO); Gynecologic Oncology Group, (GOG); Doxorubicin, (DOX); cisplatin, (CDDP); Epirubicin, (EPIDOX); carboplatin, (CBDCA); cyclophosphamide, (CTX); paclitaxel, (TAX); European Organization for Research and Treatment of Cancer, (EORTC); relative risk, (RR); Confidence interval, (CI); medroxyprogesterone acetate, (MPA); gonadotrophin-releasing hormone, (GnRH); selective estrogen receptor modulator, (SERM); Post Operative Radiation Therapy in Endometrial Cancer, (PORTEC) Received: 18 December 2003; Accepted: 29 December 2003; electronically published: December 2003

Summary Endometrial cancer is the most common gynecological cancer in the western world. Whenever possible surgery is the initial treatment for both early and advanced disease. Surgery consists of laparotomy, peritoneal washing, total extrafascial hysterectomy, bilateral salpingo-oophorectomy, and pelvic and para-aortic lymph node dissection. Modified radical hysterectomy is performed in cases with macroscopic cervical involvement, vaginal hysterectomy is taken into consideration in specific clinical conditions, and laparoscopic-assisted vaginal hysterectomy is still investigational. Intensive surgical staging, including peritoneal biopsies and omentectomy besides pelvic and paraaortic lymphadenectomy, is warranted in non-endometrioid tumors. In patients with advanced disease at surgical exploration tumor debulking should be attempted whenever possible. Current guidelines of postoperative management are based on surgical stage and prognostic pathological variables assessed on surgical samples. Highrisk , early stages as well as more advanced stages should receive adjuvant treatment including irradiation and /or platinum-based chemotherapy. This latter should consist of the combination of doxorubicin or epirubicin + cisplatin + paclitaxel or single-agent carboplatin according to patient age and performance status. The lack of benefit associated with an intensive follow-up is mainly due to the limited chance of cure of recurrent endometrial cancer patients, with the exception of those with disease limited to the vagina. Interesting fields of research are represented by the assessment of investigational agents able to interfere with the activity of proto-oncogenes, oncosuppressor genes, mismatch repair genes, and molecules involved in tumor invasiveness and angiogenesis. often associated with endometrial atypical hyperplasia, and generally have a good prognosis, whereas type-2 nonendometrioid carcinomas (i.e. serous papillary and clear cell carcinomas) are estrogen- independent, arise in an atrophic endometrium, affect older women, and display a high biological aggressiveness with poor clinical outcome. The recurrence rate of these latter is extremely high and the most frequent extra-pelvic sites of relapse are the upper abdomen, lungs and liver (Trope et al, 2001). Molecular pathogenesis is quite different for the two variants (Sherman et al, 1995; Matias-Guiu et al, 2001; Prat, 2002). Four different genetic abnormalities may occur in endometrioid carcinomas (microsatellite instability and mutations in the PTEN, k-RAS and betacatenin genes), whereas nonendometrioid carcinomas often display p53 gene mutations and loss of heterozygosity on several chromosomes. Occasionally a

I. Introduction Endometrial cancer is the most common gynecological cancer in the western world. In the United States every year 36,100 new cases are diagnosed and approximately 6,500 women die of this malignancy (Greenlee et al, 2000). Of the 6,088 endometrial cancer patients assessed by the International Federation of Gynecology and Obstetrics (FIGO) Annual Report n. 24, 2.8% were younger than 40 years of age, 9.9% were 40-49 years old, 25.6% were 50-59 years old, 33.3% were 60-69 years old, and 28.4% were 70 years or older (Creasman et al, 2001). Two different clinico-pathological and biological types of endometrial cancer can be considered (Sherman et al, 1995; Matias-Guiu et al, 2001; Prat, 2002). Type-1 endometrioid carcinomas are estrogen-dependent, are

373

Gadducci et al: Treatment planning in endometrial cancer nonendometrioid carcinoma may develop as a result of dedifferentiation of a preexisting endometrioid carcinoma; in such a case, the tumor exhibits overlapping clinical, morphologic, immunohistochemical and molecular features of the two types (Matias-Guiu et al, 2001). Endometrial cancer spreads by direct extension (myometrium, cervix, vagina, adnexa, and more rarely, bladder and rectum), lymphatic spread, and hematogeneous spread (Oram, 1990). Lymphatic trunks drain mainly into the pelvic and para-aortic nodes, and less frequently into the groin nodes through vessels lying in the round ligament (Boronow et al, 1984; Oram, 1990; Ayhan et al, 1994; Benedetti Panici et al, 1998). In a prospective trial performed by Ayan et al (1994) on 183 patients with clinical stage I disease submitted to systematic lymphadenectomy, pelvic and para-aortic metastases were found in 15.3% and 9.3% of the cases, respectively. In a study of the Gynecologic Oncology Group (GOG), paraaortic metastases were detected in 2% of patients with negative pelvic nodes compared to 67% of those with positive pelvic nodes (Boronow et al, 1984). In 1988 the FIGO Committee on Gynecologic Oncology changed the staging of endometrial cancer from a clinical to a surgical-pathologic staging that requires an accurate histopathologic examination of the surgical sample aimed to assess the true extension of the disease and to define a series of prognostic variables (Mikuta, 1993) (Table 1). Each case is graded histologically as G1, G2 or G3, according to whether nonsquamous or nonmorular solid growth pattern involves <5%, 6-50%, or >50% of the glandular component (Mikuta, 1993; Creasman et al, 2001). Significant nuclear atypia increases the histologic grade one step. In serous papillary, clear cell and adenosquamous carcinomas, the nuclear grade takes precedence. Adenocarcinoma with squamous differentiation is graded according to the nuclear grade of the glandular component. An accurate surgical staging shows that approximately 15-20 % of patients with tumor apparently confined to the uterine body have a subclinical extension of the disease to the cervix, adnexa, lymph nodes or peritoneum (De Palo et al, 1993). The high operability rate of endometrial cancer makes this staging system a viable one, which provides information about the need for additional treatment. Patients who are treated primarily with radiation therapy should be staged according to the clinical staging system adopted by FIGO in 1971. Table 2 reports the most important surgicalpathological prognostic variables, most of which are included in the 1988 FIGO staging system (Mikuta, 1993). Among the 5,694 surgically staged patients reported in the FIGO Annual Report n. 24, 5-year survival was 88.9% for stage Ia, 90.0% for stage Ib, 80.7% for stage Ic, 79.9% for stage IIa, 72.3% for stage IIb, 63.4% for stage IIIa, 38.8% for stage IIIb, 51.1% for stage IIIc, 19.9% for stage IVa, and 17.2% for stage IVb (Creasman et al, 2001). Survival was related to the degree of differentiation for any stage and to histological type. For instance 5-year survival ranged from 92.0% for grade G1 to 74.0% for grade G3 among stage I patients, from 78.6% for grade G1 to 44.4%

for grade G 3 among stage IIIa patients, and from 61.2% for grade G 1 to 44.0% for grade G 3 among stage IIIc patients. In the same series 5-year survival was 79.7% for endometrioid carcinoma, 79.1% for adenosquamous carcinoma, 72.9% for mucinous carcinoma, 54.3% for serous papillary carcinoma, and 63.2 % for clear cell carcinoma. The aggressive biological behaviour, and in particular the higher frequency to extrauterine spreading, helps to explain the poorer survival of serous papillary and clear cell carcinomas (Cirisano et al, 2000; Trope et al, 2001). Several authors reported that uterine papillary serous carcinoma can relapse also in patients with tumor confined to the endometrium or to an endometrial polyp (Silva and Jenkins, 1990; Lee and Belinson, 1991; Carcangiu and Chambers, 1992; Suzuki et al, 1999). Lymph node involvement is related to several pathological variables such as histological grade, myometrial invasion, histological type, lymph-vascular space involvement, tumor size, cervical extension, peritoneal cytology, and adnexal metastases (Creasman et al, 1987; Feuer and Calanog, 1987; Morrow et al, 1991; Bell et al, 1997). In a GOG study including 621 stage I endometrial cancer patients positive pelvic and para-aortic node rate ranged from 3% and 2% for grade G1 to 18% and 11% respectively for grade G3, and from 1% and 1% for tumors confined to endometrium to 25% and 17% respectively for tumors invading myometrium deeply (Creasman et al, 1987). The prognostic relevance of peritoneal cytology in patients with endometrial cancer apparently confined to the uterine body, but that are classified in stage IIIa only for the presence of neoplastic cells in peritoneal fluid or washing is still debated (Turner et al, 1989; Grimshaw et al, 1990; Grigsby et al, 1992; Kadar et al, 1992; Vecek et al, 1993; Kennedy et al, 1993; Kashimura et al, 1997; Ebina et al, 1997; Obermair et al, 2001; Takeshima et al, 2001; Luo et al, 2001; Kasamatsu et al, 2003) (Table 3). Conversely positive peritoneal cytology is a poor prognostic factor in patients with extrauterine disease (Kadar et al, 1992; Ebina et al, 1997; Takeshima et al, 2001). For instance according to Kadar et al (1992) if the tumor had spread to the adnexa, lymph nodes or peritoneum, positive peritoneal cytology had a detrimental effect on 5-year survival, decreasing it from 73 to 13%. Similarly Ebina et al (1997) reported that in stages IIIc and IV the prognosis was significantly poorer for patients with positive than for those with negative peritoneal cytology. Hirai et al (2001) investigated the malignant potential of endometrial cancer cells in peritoneal washing in 50 patients with clinical stage I窶的I disease in whom positive peritoneal cytology was found at surgery. A tube for cytologic analyses was inserted into the peritoneal cavity when closing the abdomen, and afterwards the peritoneal cavity was irrigated with physiologic saline and washings were obtained through the tube seven and fourteen days after surgery. Persistence of positive peritoneal cytology was observed in 4 out of 7 patients with adnexal metastases, none of the 9 patients with nodal disease, and 1 of 34 patients with disease confined to the uterus, for a total of 10% (5 of 50).

374

Cancer Therapy Vol 1, page 375 Table 1. FIGO surgical staging of endometrial cancer (Rio de Janeiro, 1988) Stage Ia Ib Ic IIa IIb IIIa

Tumor limited to the endometrium (G1, G2, G3) Invasion to < half of myometrium (G1, G2, G3) Invasion to > half of myometrium (G1, G2, G3) Endocervical glandular involvement only (G1, G2, G3) Cervical stromal involvement (G1, G2, G3) Involvement of uterine serosa and/or adnexae and/or positive peritoneal cytology (G1, G2, G3) Vaginal involvement (G1, G2, G3) Metastases to pelvic and/or para-aortic lymph nodes (G1, G2, G3) Involvement of bladder and/or rectal mucosa (G1, G2, G3) Distant metastases (including intra-abdominal and groin lymph node metastases) (G1, G2, G3)

IIIb IIIc IVa IVb G1, grade 1; G2, grade 2; G3, grade 3

Table 2. Surgical-pathological risk factors of endometrial cancer Intra-uterine risk factors 1. Depth of myometrial invasion 2. Histologic grade 3. Histology 4. Cervical extension 5. Lymph vascular space involvement Extra-uterine risk factors 1. Pelvic and para-aortic node metastases 2. Adnexal involvement 3. Penetration of uterine serosa 4. Positive peritoneal cytology Table 3. Independent prognostic significance of positive peritoneal cytology in endometrial cancer confined to the uterine body NO Grimshaw et al, 1990 Lurain et al, 1991 Vecek et al, 1993 Ebina et al, 1997 Takeshima et al, 2001 Kasamatsu et al, 2003

YES Turner et al, 1989 Grigsby et al, 1992 Kennedy et al, 1993 Kashimura et al, 1997 Luo et al, 2001 Obermair et al, 2001

In the other 45 (90%) patients no malignant cells were found in any of the washings. These data seem to suggest that endometrial cancer cells found in the peritoneal cavity usually disappear within a short time and have a low malignant potential. Only malignant cells from particular cases, such as adnexal metastases, appear to be capable of independent growth and could represent a risk factor for recurrence.

et al, 1983; Chen, 1989; Vardi et al, 1992; Lanciano et al, 1993; Gretz et al, 1996; Boronow, 1997). However the lack of resection of the upper vagina does not seem to have a strong impact on survival (la Vecchia et al, 1983). Different surgical procedures can be performed to assess retroperitoneum, ranging from biopsies of enlarged nodes only to selective node sampling from multiple sites to systematic pelvic and para-aortic lymphadenectomy (Chuang et al, 1995; Kilgore et al, 1995; Onda et al, 1997). In the experience of Kilgore et al (1995) the chance to detect microscopic metastases was related to the number of sampled pelvic sites and to the number of removed nodes. Maximal surgical cytoreduction should be recommended for patients with advanced endometrial cancer, since the achievement of a residual disease <1 cm appears to be an independent prognostic variable for survival (Goff et al, 1994; Chi et al, 1997; Bristow et al,

II. Surgery Whenever possible surgery is the initial treatment for both early and advanced endometrial cancer (Bremond et al, 2001). The standard surgical approach consists of laparotomy, peritoneal washing, extrafascial hysterectomy, bilateral salpingo-oophorectomy, partial colpectomy, and pelvic and para-aortic lymph node dissection (Oram, 1990; Boronow et al, 1984; De Palo et al, 1993; la Vecchia

375

Gadducci et al: Treatment planning in endometrial cancer 2000, 2001; Ayhan et al, 2002). For instance in the series of Bristow et al (2000), including 65 patients submitted to primary surgery for stage IVb endometrial cancer, median survival was 34.3 months for patients with residual disease <1 cm compared to 11.0 months (p=0.0001) for those with larger residum). As for the former, the patients with microscopic residual disease had a significant better survival compared to those with macroscopic residuum. Similarly, among the 37 patients with stage IVb endometrial cancer treated by Ayhan et al (2002), median survival was 25 months for the patients with residuum <1cm compared to 10 months (p=0.01) for those with bulkier residual disease. Intensive surgical staging (also including omentectomy and peritoneal biopsies) similar to that required for ovarian cancer is warranted for serous papillary and clear cell carcinoma of the endometrium (Gallion et al, 1989; Bancher-Todesca et al, 1998; Cirisano et al, 2000; Chan et al, 2003). It is uncertain whether lymph node dissection itself gives a clinical benefit (Candiani et al, 1990; Chuang et al, 1995; Kilgore et al, 1995; Fanning et al, 1996; Massi et al, 1996; Onda et al, 1997; Orr et al, 1997; Bar-Am et al, 1998; Larson et al, 1998; Podratz et al, 1998; Mohan et al, 1998; Trimble et al, 1998; Mariani et al, 2000; Seago et al, 2001; Rittenberg et al, 2003). Cumulative data from the literature showed the development of recurrent disease in 20 (6.6%) out of 305 patients who had been submitted to systematic lymphadenectomy for medium risk endometrial cancer, who had negative nodes and who had not undergone postoperative pelvic irradiation (Fanning et al, 1996; Orr et al, 1997; Podratz et al, 1998; Larson et al, 1998; Mohan et al, 1998). Only 5 of these 20 recurrences were loco-regional. Subsequent studies confirmed that whole pelvis irradiation can be safely omitted in patients with FIGO stage Ic or stage I grade G3 endometrial cancer if nodal status is known (Seago et al, 2001; Rittenberg et al, 2003). Therefore systematic lymphadenectomy could avoid adjuvant external irradiation in medium risk patients with histologically proven negative lymph nodes. The therapeutic relevance of lymphadenectomy has been long debated (Candiani et al, 1990; Chuang et al, 1995; Kilgore et al, 1995; Massi et al, 1996; Onda et al, 1997; Larson et al, 1998; Mohan et al, 1998; Podratz et al, 1998; Mariani et al, 2000). For instance, both Candiani et al (1990) and Massi et al (1996) failed to detect a difference in survival between patients who had undergone pelvic lymphadenectomy and those who had not. Conversely, Kilgore et al (1995) showed a survival benefit for patients undergoing multiple site pelvic lymph node sampling compared with those not receiving such procedure. Mariani et al (2000) assessed 137 endometrial cancer patients with an high risk of para-aortic metastases due to deep myometrial invasion or palpable pelvic nodes or adnexal involvement, and 51 patients who had positive pelvic or para-aortic nodes. Among the former 5-year survival was 85% for patients who had undergone paraaortic lymphadenectomy compared to 71% (p=0.06) for those who had not, and among the latter 5-year survival was 77% for patients who had undergone this surgical

procedure compared to 42% (p=0.05) for those who had not. Piver II-III radical hysterectomy is sometimes performed in endometrial cancer patients, and particularly in those with macroscopic involvement of the uterine cervix (Rutledge, 1974; Boothby et al, 1989; Boente et al, 1995, Mariani et al, 2001; Sartori et al, 2001). The rationale for this operation is that the removal of parametria provides more adequate free surgical margins when endometrial cancer has spread to the cervix (Sartori et al, 2001). In 1995 a study performed on specific diagnostic and therapeutic options in endometrial cancer by means of a questionnaire sent to several leading centres for gynecologic oncology in Western Europe, revealed that Piver II-III hysterectomy was routinely performed in 6.2% of 81 institutions, never used in 11.1%, and adopted for specific conditions (such as FIGO stage >I, younger age, poorly differentiated tumor) in 82.7% of the centres (Maggino et al, 1995). As for the elective surgical management in stage II disease, radical hysterectomy was considered to be the treatment of choice in 79.5% of the institutions. Rutledge (1974) reported that 5-year survival was not significantly different between endometrial cancer patients who underwent extended hysterectomy and those treated with simple hysterectomy, even though, among stage I patients, the local recurrence rate was lower in the radical surgery group. In the study of Bonte et al (1995) on patients with stage II disease, pelvic recurrence rate was 6% among the 33 patients submitted to radical hysterectomy and 14% among the 37 submitted to extrafascial hysterectomy. The retrospective analysis of 203 stage II endometrial cancer cases treated in five different Italian gynecologic oncology centres detected that 5-year and 10-year survivals were significantly better in the 68 patients who had undergone radical hysterectomy compared to the 135 who had undergone simple hysterectomy (94% versus 79%, and, respectively, 94% versus 74%, p=0.03) (Sartori et al, 2001). Vaginal hysterectomy may be considered a reasonable alternative to the abdominal approach in specific clinical conditions, such as obesity, old age, uterine prolapse, poor performance status, and high anesthesiological risk (Maggino et al, 1995; Massi et al, 1996; Chan et al, 2001). In the series of Massi et al (1996) including stage I endometrial cancer patients, 5-year and 10-year-survivals were superimposible in the 180 patients who underwent vaginal hysterectomy (90% and 87%, respectively) and in the 147 who underwent abdominal hysterectomy (91% and 90%, respectively). Vaginal operation can be complemented by extraperitoneal pelvic lymphadenectomy according to a modification of Mitraâ&#x20AC;&#x2122;s technique, that is a fast procedure applicable in high-risk surgical patients under spinal anesthesia (Massi et al, 2000), as well as by a laparoscopic staging (Gemignani et al, 1999; Eltabbakh et al, 2001; Malur et al, 2001; Eltabbakh, 2002; Fram, 2002; Holub et al, 2002; Langebrekke et al, 2002; Occelli et al, 2003). In particular laparoscopic assisted vaginal hysterectomy has been recently considered as a technically acceptable and safe surgical procedure for early

376

Cancer Therapy Vol 1, page 377 endometrial cancer in the hands of experienced operators. It is associated with a longer operating time, but with a less blood loss, a shorter hospitalisation and equivalent clinical outcomes when compared to abdominal hysterectomy (Gemignani et al, 1999; Eltabbakh et al, 2001; Malur et al, 2001; Eltabbakh, 2002; Holub et al, 2002; Fram, 2002; Occelli et al, 2003). For instance a retrospective review of Eltabbakh (2002) on women with clinical stage I endometrial cancer showed that the 100 patients who underwent laparoscopy and the 86 who underwent laparotomy had similar 2-year and 5-year recurrence-free survivals (93% versus 94%, and 90% versus 92%, respectively), as well as similar 2-year and 5year overall survivals (98% versus 96% and 92% versus 92%, respectively). Both groups were similar with regard to age, lymphadenectomy, surgical stage, tumor grade, histology, and postoperative radiation therapy, and moreover there was no apparent difference with regard to the sites of recurrence between the two groups. However in low-risk endometrial cancer patients treated by laparoscopic assisted vaginal hysterectomy an higher incidence of vaginal cuff recurrences or positive peritoneal cytology has been sometimes reported, and some cases of port-site recurrences have been described, probably due to the intraoperative dissemination of tumor cells enhanced by the use of intrauterine manipulator (Wang et al, 1997; Zayyan and Kazmi, 1998; Muntz et al, 1999; Sonoda et al, 2001; Vergote et al, 2002; Chu et al, 2003). For instance, in a large series of low risk endometrial cancer patients Sonoda et al (2001) found a positive peritoneal cytology in 10.3% of the 131 patients treated with laparoscopic assisted vaginal hysterectomy compared to 2.8% of the 246 patients who underwent abdominal hysterectomy. Therefore, the routine use of laparoscopic assisted vaginal hysterectomy should be undertaken with caution, as the long-term risks for recurrence and survival have yet to be defined in large, randomised controlled trials (Chu et al, 2003). As for recurrent endometrial cancer, intensive surgery has been sometimes suggested for women with large pelvic or abdominal relapse (Scarabelli et al, 1998). In carefully selected cases of isolated central recurrences pelvic exenteration is the only potential option for cure (Morris et al, 1996; Barakat et al, 1999; Chi and Barakat, 2001). In the series of Morris et al (1996), including 20 patients with recurrent endometrial cancer who underwent exenteration with curative intent, the estimated 5-year disease-free survival was 45%. Twelve (60%) patients experienced major complications, the most common of which was neovaginal flap necrosis, and 1 (5%) patient died of surgical complications. Barakat et al (1999) reassessed 44 patients with central recurrence after surgery with or without radiotherapy who underwent pelvic exenteration. Major postoperative complications occurred in 35 (80%) patients and included urinary/intestinal tract fistulas, pelvic abscess, septicemia, pulmonary embolism, and stroke. Median survival for the entire group of patients was 10.2 months, but 9 (20%) achieved long-term survival (>5 years). Further investigation into the techniques of intraoperative radiotherapy could increase the pool of

patients to whom a salvage surgery may be sometimes offered (Chi and Barakat, 2001).

III. Radiotherapy Exclusive radiotherapy consisting of both external beam irradiation and uterovaginal brachytherapy is undertaken only in selected cases unsuitable for surgical management due to medical contraindications or advanced age (Rose et al, 1993; Rouanet et al, 1993; Fishman et al, 1996; Thomas et al, 2001; Peiffert et al, 2003). In patients with early tumor this treatment modality can obtain a local control rate of about 80-90% (Peiffert et al, 2003). Fishman et al (1996) assessed 54 patients with clinical stage I and II endometrioid carcinoma who were deemed medically inoperable and exclusively received radiation therapy, and a cohort of 108 operable patients adjusted for age, clinical stage, and grade as a control group. The 5year actuarial cancer-specific survivals for patients with stage I inoperable, stage II inoperable, stage I operable, and stage II operable disease were 80, 85, 98, and 100%, respectively. External pelvic irradiation is the most common adjuvant treatment in endometrial cancer, able to reduce loco-regional recurrences without improving overall survival (Aalders et al, 1980; Roberts et al, 1999; Creutzberg et al, 2000; Straugh et al, 2003; Creutzberg et al, 2003). In the randomised study of Aalders et al (1980) enrolling 540 stage I patients, vaginal-pelvic recurrence rate was 1.9% in patients who received adjuvant intravaginal irradiation plus external pelvic irradiation compared to 6.9% (p<0.01) in those who received adjuvant intravaginal irradiation alone, whereas distant metastases developed in 9.9% of the former and in 5.4% of the latter. Thus, the 5-year survival was not improved by external irradiation. A more detailed analysis led to the conclusion that only patients with poorly differentiated tumors which infiltrate more than half of the myometrial thickness, might benefit from additional external radiotherapy. In the GOG 99 trial comparing surgery versus surgery plus external irradiation in patients with intermediate-risk stage endometrial cancer, loco-regional recurrence rate was 1.6% in the patients who had radiotherapy compared to 8.5% in those who had no further treatment, whereas survivals were not significantly different (Roberts et al, 1999). In the multicenter randomised PORTEC [Post Operative Radiation Therapy in Endometrial Cancer] study enrolling 715 patients with intermediate-risk stage I disease, adjuvant external pelvic irradiation reduced loco-regional recurrence rate (4% versus 14%, p<0.001) and increased treatment complication rate (25% versus 6%, p<0.0001) compared to surgery alone, whereas deaths for cancer (9% versus 6%), 5â&#x20AC;&#x201C;year survivals (81% versus 85%), and 8-year actuarial survivals (71% versus 77%) were unchanged (Creutzberg et al, 2000; Creutzberg et al, 2003). As pelvic radiotherapy appears to improve loco-regional control without a survival benefit, its use should be limited to those patients at sufficiently high risk (15% or over) for recurrence in order to maximize local control and relapse-free survival (Creutzberg et al, 2003).

377

Gadducci et al: Treatment planning in endometrial cancer Vaginal vault brachytherapy alone has been used as postoperative treatment in patients with low risk (stage Ib G1, G2) disease (Alektiar et al, 2002) or in patients with medium risk (stage I G3 or stage Ic) disease with histologically proven negative lymph nodes (Seago et al, 2001; Rittenberg et al, 2003), but the clinical benefit of this adjuvant therapy versus surgery alone has not yet been defined. Moreover, there is no definitive suggestion that the addition of a vaginal vault brachytherapy boost to external beam irradiation is beneficial for pelvic control or disease-free survival of stage I or II endometrial cancer patients and prospective randomised trials designed to study external beam irradiation alone versus external beam irradiation plus vaginal brachytherapy are unlike to show a positive result (Greven et al, 1998). Little data are currently available about extendedfield irradiation in patients with positive para-aortic nodes (Feuer and Calanog, 1987; Corn et al, 1992; Rose et al, 1992; De Palo et al, 1993; Hicks et al, 1993; Rotman et al, 1993). In the study of Feuer and Calanog (1987) this treatment obtained a 5-year survival of 66.7% in patients with microscopic aortic metastases compared to 16.7% in those with macroscopic aortic metastases. Rose et al (1992) gave extended field irradiation to 17 out of 26 patients with para-aortic involvement, and found that 9 (53%) of them were alive with no evidence of disease with a median survival of 27 months, whereas 87.5% of the 8 patients treated with chemotherapy or progestins died after a median time of 13 months. By assessing 19 patients with positive para-aortic nodes, Hicks et al (1993) detected a 5year disease-free survival of 27% in patients treated with pelvic plus para-aortic irradiation compared to 0% in those who received pelvic irradiation plus hormonotherapy. Para-aortic irradiation could be effective particularly in the control of microscopic disease even after surgical debulking; however, this procedure is sporadically used in the clinical practice for both the risk of severe bowel complications and the suggestion that para-aortic node involvement is associated with systemic spread of disease (Corn et al, 1992; Rotman et al, 1993). The role of whole abdomen irradiation in selected patients is still debated (Martinez et al, 1988; Small et al, 2000; Smith et al, 2000; Lee et al, 2003; Martinez et al, 2003). Recently Lee et al (2003) reported that whole abdomen irradiation with a cumulative dose of 3000 cGy plus supplementary doses to partial abdominal volumes can eradicate small peritoneal deposits after surgical cytoreduction. This treatment modality has been evaluated also in patients with uterine serous papillary and clear cell carcinoma (Smith et al, 2000; Martinez et al, 2003). Smith et al (2000) assessed 22 patients with FIGO Stage III-IV endometrioid carcinoma and 26 patients with FIGO Stage I-IV serous papillary or clear cell carcinoma treated postoperatively with whole abdomen irradiation (median dose: 3000 cGy to the upper abdomen and 4980 cGy to the pelvis, respectively). Patients with endometrioid carcinoma had 3-year disease-free and 3-year overall survival of 79% and 89%, respectively, compared with 47% and 68% in the group of patients with serous papillary or clear cell carcinoma. Stage I-II patients with serous papillary or clear cell carcinoma had 3-year

disease-free survival and overall survival of 87% compared with 32% and 61% in those with stage III and IV disease. The 3-year actuarial major complication rate was 7%, with no treatment-related deaths. These data appear to suggest that whole abdomen irradiation is a safe, effective treatment for patients with optimally debulked advanced stage endometrioid or early stage serous papillary or clear cell carcinoma. Martinez et al (2003) gave postoperative whole abdomen irradiation with a pelvic/vaginal boost to 132 patients with stage I-III endometrial carcinoma at high risk for abdomen-pelvic recurrence, including serous-papillary and clear cell histology. The 5- and 10-year cause-specific survival was 77% and 72% for the entire group, 75% and 70% for adenocarcinoma, and 80% and 74% for serous papillary and clear cell carcinoma, and the long-term complication rate was acceptable (chronic grade 3/4 gastrointestinal toxicity in 14% and grade 3 renal toxicity in 2% of the cases, respectively). Concurrent chemo-radiation in endometrial cancer is still investigational (Reisinger et al, 1996; Frigerio et al, 2001; Sood et al, 2002). Radiotherapy has been widely used for the management of loco-regional recurrences of surgically treated endometrial cancer patients (Aalders et al, 1980; Ackerman et al, 1996; Pai et al, 1997; Hart et al, 1998; Nag et al, 2000; Wylie et al, 2000; Jhingran et al, 2003). The size of recurrence (<2cm versus >2 cm) is a strong predictor of local control (Wylie et al, 2000). However, the chances of survival are generally poor, with the exception of the patients with recurrent disease limited to the vagina (Hart et al, 1998). Infact external beam irradiation followed by low-or high-dose-rate brachytherapy may be curative for women with isolated vaginal recurrence (Aalders et al, 1980; Pai et al, 1997; Wylie et al, 2000; Jhingran et al, 2003). Intracavitary brachytherapy should be restricted to patients with nonbulky (<0.5 cm thick) disease, whereas patients with bulky recurrences should be treated with interstitial techniques (Nag et al, 2000). In the study of Jhingran et al (2003) including 91 patients treated with radiotherapy for vaginal recurrence after definitive surgery for endometrial cancer, 5-year-local control rate and 5-year overall survival were 75% and 43%, respectively. A total radiotherapy dose >8000 cGy was a significant predictor of local control, whereas the combination of external pelvic irradiation plus brachytherapy versus single modality therapy was a significant predictor of both local control and survival. It is worth noting that a high percentage of patients with radiotherapy-induced local control subsequently died of disease for the development of distant recurrence. According to Corn et al (1997) the women who recur locally have nearly a fourfold risk of failing distantly compared to those who remain locally controlled.

IV. Pharmacological treatment Both chemotherapeutic and hormonal agents have been employed in endometrial cancer (Table 5).

378

Cancer Therapy Vol 1, page 379 1996), and paclitaxel (TAX) (Ball et al, 1996; Lissoni et al, 1996; Lincoln et al, 2003). The majority of responses to single agents are partial and short-lived, with response durations ranging between 3 and 6 months (Muss, 1994) Cumulative data from several clinical studies detected an overall response rate of 34% for the combination of DOX + CTX (Muggia et al, 1977; Seski et al, 1981; Campora et al, 1990; Thigpen et al, 1994). A GOG randomised trial showed that response rates were 30% for DOX + CTX and 22% for single-agent DOX (p=0.06) (Thigpen et al, 1994). Trope et al (1984) found that chemotherapy including DOX 50 mg/m 2 + CDDP 50 mg/m 2 produced an objective response of 60% in 20 patients with recurrent endometrial cancer. Another GOG randomised study on 297 patients revealed that CDDP + DOX compared to single-agent DOX had a higher response rate (45% versus 27%) but a similar survival (with a median of about 9 months) (Thigpen et al, 1993; Muss, 1994). Conversely a similar trial conducted by the European Organization for Research

A. Chemotherapy Doxorubicin (DOX) and cisplatin (CDDP) are the most commonly used chemotherapeutic drugs (Thigpen et al, 1989, 1994; Muss, 1994; Thigpen et al, 1995; Trope and Kristensen, 1997) (Table 4). Data from cumulative series showed an objective response in 26% of 161 patients treated with D0X, and in 24% of 124 patients treated with CDDP (Muss, 1994; Thigpen et al, 1995; Trope and Kristensen, 1997). Epirubicin (EPIDOX) seemed to have the same activity of DOX (Thigpen et al, 1995; Trope and Kristensen, 1997), and carboplatin (CBDCA) produced a response rate of 17-30% (Long et al, 1988; Green et al, 1990; van Wijk et al, 2003). For instance in the study of van Wijk et al (2003) CBDCA achieved an objective response in 17% of 47 evaluable patients, and, in detail, in 24% of the 33 patients who received CBDCA as first-line chemotherapy. Other drugs with an objective response rate higher than 20% are 5fluorouracil (De Vita et al, 1976), cyclophosphamide (CTX) (Horton et al, 1978), ifosfamide (Sutton et al, Table 4. Drugs used in the treatment of endometrial cancer Chemotherapeutic agents Doxorubicin Cisplatin Epirubicin Carboplatin 5-fluorouracil Cyclophosphamide Paclitaxel

Progestins:

Hormonal agents medroxyprogesterone acetate hydroxyprogesterone caproate megestrol acetate Tamoxifen Gn-RH analogues Aromatase inhibitors (anastrozole, letrozole) SERM (arzoxifene)

Table 5. Surgical treatment of endometrial cancer

TAH+ BSO, total abdominal hysterectomy and bilateral salpingo- oophorectomy; G1, grade 1; G2, grade 2; G3, grade 3; M0, tumor limited to the endometrium; M1, invasion to < half of myometrium; M2, invasion to > half of myometrium

379

Gadducci et al: Treatment planning in endometrial cancer and Treatment of Cancer (EORTC) on 154 patients detected an improved median survival for CDDP + DOX arm (13 months versus 8 months, p=0.036) (Aapro et al, 1994). The combination of CDDP +DOX or EPIDOX + CTX, with or without progestins, has been largely employed in advanced or recurrent endometrial cancer, with an objective response rate ranging between 31% and 60%, a median duration of response of 4-10 months, and a median survival of 7-15 months (Lovecchio et al, 1984; Turbow et al, 1985; Hancock et al, 1986; Edmondson et al, 1987; Hoffman et al, 1989; Burke et al, 1991; Dunton et al, 1991; Gadducci et al, 1999). The analysis of the relationship between dose intensity of chemotherapy and response in advanced endometrial cancer showed that CTX is relatively inactive when used in combination regimens (Levin and Hryniuk, 1987). Therefore CTX could be omitted from chemotherapy regimens for endometrial cancer, and the combination of CDDP plus DOX could be considered as the standard of care for patients with advanced or recurrent disease (Thigpen et al, 1995; Trope and Kristensen, 1997). In a recent randomised GOG trial including 342 patients with stage III, IV, or recurrent endometrial cancer, no significant benefit in terms of response rate, progression-free survival, overall survival, or toxicity profile was observed with circadian timed chemotherapy consisting of DOX 60 mg/m2 at 6:00 am + CDDP 60 mg/m2 at 6:00 pm. compared to standard DOX 60 mg/m2+ CDDP 60 mg/m2 (Gallion et al, 2003). As for TAX, in a phase II GOG trial this agent at the dose of 250 mg/m2 (24 hour-infusion) obtained an objective response rate of 36% (with a complete response rate of 14%) in 28 patients with advanced and recurrent endometrial cancer (Ball et al, 1996). TAX 175 mg/m2 (3 hour-infusion) (Lincoln et al, 2003) achieved a complete response in 10.5% and a partial response in 26.3% of 19 patients previously treated with CDDP + DOX + CTX (Lissoni et al, 1996). By giving TAX to patients with persistent or recurrent endometrial cancer who have failed prior chemotherapy, Lincol et al (2003) found that 3 (6.8%) out of the 44 evaluable patients obtained a complete response and 9 (20.5%) had a partial response for an overall response rate of 27.3%. The median overall survival was 10.3 months. The combination of TAX with a platinum compound seems to achieve promising results even in the serous papillary histotype (Resnik and Taxy, 1996; Vasuratna et al, 1998; Eltabbakh et al, 1999; Le et al, 1999; Hoskins et al, 2001; Fleming et al, 2002; Niwa et al, 2002). In a randomised GOG study enrolling 266 patients with advanced or recurrent endometrial cancer, the combination of DOX 45 mg/m2 + CDDP 50 mg/m2 + TAX 160 mg/m2 (3-hour infusion) obtained an improvement in response rates (57% versus 33%, p<0.001), a decrease in recurrence risk (relative risk [RR]= 0.57; Confidence interval [CI 95%]= 0.43-0.75, p<0.001], and a nonsignificant decrease in death risk (RR = 0.79; CI 95%= 0.59-1.07) compared to the combination of DOX 60 mg/m2 + CDDP 50 mg/m2 (Fleming et al, 2002). The topoisomerase I inhibitor, topotecan, is being investigated for the treatment of endometrial cancer

(Miller et al, 2002; Holloway, 2003; Wadler et al, 2003). Single-agent topotecan has been found to achieve an objective response in 9% of 22 previously treated patients (Holloway, 2003) and in 20% of 40 chemotherapy-naive patients (Wadler et al, 2003). This agent is active also against uterine papillary serous carcinoma (Miller et al, 2002). The are no conclusive data about the effectiveness of adjuvant chemotherapy in patients with high-risk endometrial cancer (Morrow et al, 1990; Burke et al, 1994; Onda et al, 1997; Bancher-Todesca et al, 1998; Maggi et al, 1999; Tomioka et al, 1999; Pustilnik and Burke, 2000; Mundt et al, 2001). In a GOG trial including 181 patients, 5-year survival was not significantly different in patients who received adjuvant external beam irradiation alone compared to those who had adjuvant irradiation plus DOX (72% versus 63%) (Morrow et al, 1990). Burke et al (1994) gave 6 cycles of adjuvant therapy consisting of CDDP + DOX + CTX to 62 high risk patients, and reported actuarial 3-year survivals of 46% and 82%, respectively, for patients with and those without extrauterine spread of disease. Onda et al (1997) observed a 5year survival of 75% in 20 patients with histologically proven para-aortic nodes who received 3 cycles of postoperative platinum-based chemotherapy followed by pelvic plus para-aortic irradiation. Tomioka et al (1999) reported a 5-year survival of 83% in a series of 83 high risk patients who underwent adjuvant chemotherapy with CDDP + DOX + CTX, which was similar to the survival of an historical control group including 68 patients who received adjuvant pelvic irradiation. Among 340 patients with high risk endometrial cancer (stage Ic grade G3, stage IIa-b grade G3, stage III) enrolled in a multicenter Italian study there was no difference in recurrence rate between patients who received adjuvant chemotherapy consisting of CDDP + DOX + CTX and those who received external pelvic irradiation (29.1% versus 27.3%) (Maggi et al, 1999). Mundt et al (2001) assessed 43 high risk endometrial cancer patients (most of whom had Stage IIIIV disease or unfavourable histology) who received chemotherapy consisting primarily of CDDP and DOX as sole postoperative treatment. After a median follow-up of 27 months, 29 (67.4%) women relapsed, and in detail, 17 (39.5%) recurred in the pelvis and 23 (55.5%) in extrapelvic sites. Nine (31%) of the 29 relapsed patients developed pelvic recurrence as their only (n.6) or first site (n.3) of recurrence. Since pelvic recurrence is common in high risk stage I-IV endometrial cancer patients after adjuvant chemotherapy alone, the authors suggest the use of adjuvant irradiation after chemotherapy.

B. Endocrine therapy Progestins have been long used in the treatment of advanced or recurrent endometrial cancer. Kauppila (1984) reviewed 1,068 patients treated with medroxyprogesterone acetate (MPA), megestrol acetate, or hydroxyprogesterone caproate in different trials and found an overall response rate of 34%, with an average duration of response ranging from 16 to 28 months and an average survival ranging from 18 to 33 months. However

380

Cancer Therapy Vol 1, page 381 subsequent clinical studies, based on more stringent criteria for response assessment, reported lower response rates ranging from 11.2% to 15.8% with no difference according to the type of progestin (Piver et al, 1980; Podratz et al, 1985). In a randomised GOG trial 299 women with advanced or recurrent endometrial cancer were randomly allocated to receive oral MPA either 200 mg daily or 1000 mg daily (Thigpen et al, 1999). The 145 patients receiving low-dose progestins experienced 25 complete and 11 partial responses, for an overall response rate of 25%. Among the 154 patients treated with highdose progestins, there were 14 complete and 10 partial responses, for an overall response rate of 15%. Median progression- free survival and median survival were 3.2 and 11.1 months, respectively for the low-dose group, and 2.5 and 7 months, respectively for the high-dose group. According to this study oral MPA 200 mg daily is a reasonable initial approach for advanced or recurrent endometrial cancer, particularly for those lesions that are well-differentiated and/or have a high progesterone receptor content (>50 fmol/mg cytosol protein). The majority of progestin-sensitive tumors are represented by well differentiated carcinomas. For instance in the series of Podratz et al (1985), an objective response was obtained by 40% of patients with grade 1 tumors according to Broders, compared to 17.5% of patients with grade 2 tumors, 2.4% of those with grade 3 tumors, and 0% of those with grade 4 tumors. Hormone receptor status (Kauppila, 1984; Thigpen et al, 1999), interval between primary treatment and hormonal therapy and tumor burden (Podratz et al, 1985) are predictors of the response to progestins. The role of progestins as adjuvant treatment in early endometrial cancer has been long debated (Malkasian and Decker, 1978; MacDonald et al, 1988; Vergote et al, 1989; De Palo et al, 1993; Martin-Hirsch et al, 2000). The Cochrane Gynaecological Cancer Group recently performed a cumulative analysis of the 4,351 patients included in six clinical trials assessing the role of adjuvant progestagens following primary surgery for endometrial cancer (Martin-Hirsch et al, 2000). Three studies enrolled only women with stage I disease, whereas three included patients with more advanced disease. The analysis showed that progestin therapy does not significantly reduce the risk of recurrence (RR= 0.81, CI 95%= 0.65-1.01) and of endometrial cancer related death (RR= 0.88, CI 95%= 0.71-1.1) and increases the risk of non-endometrial cancer related death (RR= 1.33, CI 95%= 1.02-1.73). Therefore adjuvant progestin therapy does not improve patient survival (RR= 1.05; CI 95%= 0.88-1.24). As for tamoxifen, in a recent GOG study including 68 patients with advanced or recurrent disease this agent achieved 3 complete and 4 partial responses, with an overall response rate of 10%, a median progression-free survival of 1.9 months and a median overall survival of 8.8 months (Thigpen et al, 2001). Therefore tamoxifen has a modest activity against endometrial cancer and does not warrant further investigation as single agent for this disease. It is well known that tamoxifen can increase progesterone receptor content in endometrial cancer (Nola et al, 1999), and experimental studies on human

endometrial cancer transplanted into nude mice revealed that sequential administration of tamoxifen and MPA induces a greater tumor regression than MPA alone (Zaino et al, 1985). However, clinical studies on alternating treatment with tamoxifen and MPA gave unsatisfactory results in advanced or recurrent endometrial cancer (Kline et al, 1987; Fiorica et al, 2000; Pandya et al, 2001). For instance an Eastern Cooperative Oncology Group study failed to detect any difference in response rate between the 20 patients treated with megestrol acetate and the 42 patients who received sequential therapy with megestrol acetate and tamoxifen (20% versus 19%) (Pandya et al, 2001). After the discovery of gonadotrophin-releasing hormone (GnRH) receptors in endometrial cancer, some authors investigated whether GnRH agonists were able to exert an anticancer activity in patients with this malignancy and found objective response rates ranging from 0% to 28% (Jeyarajah et al, 1996; Covens et al, 1997; Asbury et al, 2002). For instance in a GOG study goserelin acetate obtained 2 complete and 3 partial responses among 40 evaluable patients with recurrent disease, with an overall response rate of 11%, a median progression-free survival of 1.9 months and a median overall survival of 7.3 months (Asbury et al, 2002). The activity of goserelin acetate in endometrial cancer is insufficient to warrant further study of the single agent, but elucidation of the mechanism of action of this drug may allow more effective use in conjunction with other agents in the future. Little data are currently available about aromatase inhibitors and selective estrogen receptor modulators (SERM)s in endometrial cancer (Rose et al, 2000; Berstein et al, 2002; Chan, 2002; Elit and Hirte, 2002; Burke and Walker, 2003; McMeekin et al, 2003). In the study of Rose et al (2000) anastrozole achieved an objective response in 9% of 23 patients with advanced or recurrent disease who had received no more than one prior hormone therapy regimen. Median progression-free survival and overall survival were 1 month and 6 months, respectively. Letrozole is currently under evaluation (Elit and Hirte, 2002; Berstein et al, 2002). The third-generation SERM arzoxifene, that opposes the action of estrogen on the breast and endometrium but exerts an estrogen-agonist effect on bone and lipid profile, obtained one complete response and 8 partial responses among 29 evaluable patients, with an overall response rate of 31% and a median duration of response of 13.9 months (Burke and Walker, 2003; McMeekin et al, 2003). All 9 responses occurred in progestagen-sensitive patients. Toxicity was minimal, with no grade 3-4 toxic effects. The high response rate and the extremely favourable toxicity profile make this agent warranting further evaluation.

V. Guidelines for management A. Patients suitable for primary surgery 1. Surgery Whenever possible surgery is the initial treatment both for early and advanced endometrial cancer. Surgery for patients with clinically early disease consists of 381

Gadducci et al: Treatment planning in endometrial cancer laparotomy, peritoneal washing, total extrafascial hysterectomy and bilateral salpingo-oophorectomy (Table 5). Pelvic and para-aortic lymphadenectomy is required for patients with suspicious nodes at surgical exploration and is recommended for patients with higher risk of nodal metastases, such as those with macroscopic extrauterine disease or those with disease apparently confined to the uterine body but with grade G3 tumor (assessed on preoperative biopsy) or with deep myometrial invasion (assessed on preoperative trans-vaginal ultrasound and/or magnetic resonance or on intra-operative frozen sections). Modified radical hysterectomy is performed in cases with macroscopic cervical involvement, vaginal hysterectomy is taken into consideration in specific clinical conditions (i.e obesity, old age, significant uterine prolapse, poor performance status, and high anesthesiological risk), and laparoscopic-assisted vaginal hysterectomy is still investigational. Intensive surgical staging, including peritoneal biopsies and omentectomy besides pelvic and para-aortic lymphadenectomy, is warranted in patients with non-endometrioid tumors. In patients with advanced disease at surgical exploration tumor debulking should be attempted whenever possible. The planning of postoperative treatment should be different in patients with endometrioid and with nonendometrioid tumors.

No well defined postoperative therapy can be suggested for patients assigned to stage IIIa only for positive peritoneal cytology. The need for an adjuvant treatment should be based on pathological findings on uterine sample (tumor grade, myometrial invasion, cervical involvement) as well as on patient age and performance status. If an adjuvant treatment is taken into consideration, it should consist of platinum-based chemotherapy aimed to reduce the risk of peritoneal and distant recurrences. Patients with stage IVb disease for intra-abdominal or groin metastases should undergo platinum-based chemotherapy. Platinum-based chemotherapy should consist of the combination of DOX (or EPIDOX) + CDDP Âą TAX (3hour infusion) or single-agent CBDCA according to patient age and performance status.

3. Postoperative endometrioid tumors

treatment

non-

Whereas patients with stage Ia tumors need no further treatment, patients with stage Ib-IIb disease as well as those with stage IIIa disease for positive peritoneal cytology should receive platinum-based regimens (Table 8). The use of TAX in combination with platinum-based chemotherapy is particularly recommended in these tumors that often display p53 mutations. Patients with stage IIIa disease for invasion of the serosa of the uterine body or adnexal involvement and those with stage IIIb disease should undergo platinumbased chemotherapy followed by external pelvic irradiation. Patients with stage IIIc disease should receive platinum-based chemotherapy followed by pelvic + paraaortic irradiation. Stage IVb patients should be treated with platinumbased chemotherapy.

2. Postoperative treatment of endometrioid tumors No further treatment is required for patients with stage Ia any grade disease, for patients with stage Ib grade G 1-2 disease, for patients with stage IIa grade G1-2 disease with no or superficial myometrial invasion, and for patients with stage Ib grade G3 disease or stage Ic any grade disease or stage IIa disease with grade G3 differentiation or with deep myometrial invasion who had histologically proven negative nodes after pelvic and paraaortic lymphadenectomy (Table 6). Conversely adjuvant external pelvic irradiation is warranted for patients with stage Ib grade G3 disease or stage Ic any grade disease or stage IIa disease with grade G3 differentiation or deep myometrial invasion not submitted to adequate lymphadenectomy, as well as for patients with stage IIb disease. Stage III include patients with very different clinical conditions (Table 7). Patients with stage IIIa disease for invasion of the serosa of the uterine body or adnexal involvement could be treated with external pelvic irradiation or platinum-based chemotherapy followed by external pelvic irradiation. Patients with stage IIIc disease should receive pelvic + para-aortic irradiation according to the site of positive nodes or platinum-based chemotherapy followed by external beam irradiation. Controlled clinical trials are warranted to test the clinical benefit of the addition of chemotherapy to radiotherapy in these subsets of patients. Adjuvant external pelvic irradiation followed by vaginal brachytherapy should be given to patients with stage IIIb disease.

B. Patients surgery

unsuitable

for

primary

No stardard therapeutic approach has been defined for patients with clinically advanced endometrial cancer at presentation not manageable with primary surgery. Patients with clinical stage IIIb disease with extensive spread to vaginal walls should be treated with external pelvic irradiation plus brachytherapy or, alternatively, with neoadjuvant platinum-based chemotherapy followed by individualized surgery or external pelvic irradiation plus brachytherapy Patients with clinical stage IVa disease should undergo neoadjuvant platinum-based chemotherapy followed by pelvic exenteration or external pelvic irradiation. Patients with clinical stage IVb disease should be treated with platinumâ&#x20AC;&#x201C;based chemotherapy, followed, in responsive cases, by individualized surgery or irradiation on primary tumor.

382

Cancer Therapy Vol 1, page 383

VI. Follow-up recurrence

and

pattern

papers have recently assessed in detail a large amount of information about the follow-up and the detection of recurrence in patients with clinically early disease (Lurain et al, 1991; Podczaski et al, 1992; Shumsky et al, 1997, 1994, Berchuck et al, 1995, Reddoch et al, 1995; Agboola et al, 1997; Gadducci et al, 2000; Morice et al, 2003).

There is no agreement in the literature about the examinations to carry out in the post-treatment surveillance of patients with endometrial cancer. Some

Table 6. Postoperative treatment of endometrioid endometrial cancer (surgical stage I-II)

G1, grade 1; G2, grade 2; G3, grade 3; M0, tumor limited to the endometrium; M1, invasion to < half of myometrium; M2, invasion to > half of myometrium; N, lymph nodes Table 7. Postoperative treatment of endometrioid endometrial cancer (surgical stage III-IV)

383

Gadducci et al: Treatment planning in endometrial cancer Table 8. Postoperative treatment of non-endometrioid endometrial cancer Stage Ia Stage Ib-IIb Stage IIIa positive peritoneal cytology Stage IIIa Uterine serosa or adnexal involvement Stage IIIb

no further treatment chemotherapy Chemotherapy Chemotherapy followed by external pelvic irradiation Chemotherapy followed by external pelvic irradiation Chemotherapy followed by external pelvic +/-aortic irradiation Chemotherapy

Stage IIIc

Stage IVb

highly selected cases (isolated lung or abdominal or lymph node metastases). External beam irradiation may be used with the aim of palliation in patients with bone or lymph node metastases.

Recurrence rates ranged from 11 to 19% approximately, and the majority of relapses involved distant sites and generally developed within 2-3 years of primary treatment (Table 9). Table 10 reported the examinations that revealed the recurrent disease in asymptomatic patients.

Conclusions

Current data from the literature failed to show that routine surveillance could give a survival benefit for endometrial cancer patients (Podczaski et al, 1992; Shumsky et al, 1994; Berchuck et al, 1995; Reddoch et al, 1995; Agboola et al, 1997; Gadducci et al, 2000). For instance Shumsky et al (1994) found 1 case of recurrence every 206 routine examinations, and observed no survival difference between the relapsed patients detected on follow-up examinations and those who were symptomatic. In the series of Podczaski et al (1992) survival after recurrence was related to the site of the recurrence, the time interval from initial surgery to recurrence, and whether postoperative pelvic irradiation was used but not to the presence or absence of symptoms. Similarly in our series (Gadducci et al, 2000) survival was similar in asymptomatic women in whom the relapse was occasionally detected by follow-up examinations, and in symptomatic ones.

The cornerstone of treatment of endometrial cancer is represented by extrafascial abdominal hysterectomy with bilateral salpingo-oophorectomy. Pelvic and paraaortic lymphadenectomy may provide additional prognostic information, but its therapeutic relevance is still under debate. However, the surgical assessment of the retroperitoneum may avoid adjuvant pelvic irradiation in early stage, medium risk patients with histologically proven negative nodes. An intensive surgical staging similar to that performed in ovarian cancer is warranted for non-endometrioid tumors. Optimal surgical cytoreduction may offer a survival benefit in patients with stage IV disease. Current guidelines of postoperative management are based on surgical stage and prognostic pathological variables assessed on surgical samples. Highrisk early stages as well as more advanced stages should receive adjuvant treatment consisting of irradiation and /or platinum-based chemotherapy. In patients that cannot undergo surgery, exclusive radiotherapy should be performed. The lack of benefit associated with an intensive follow-up is mainly due to the limited chance of cure of recurrent endometrial cancer patients, with the exception of those with disease limited to the vagina (Berchuck et al, 1995; Ackerman et al, 1996; Pai et al, 1997; Hart et al, 1998; Gadducci et al, 2000; Wylie et al, 2000; Creutzberg et al, 2003; Jhingran et al, 2003; Sartori et al, 2003). For instance, in the series of Berchuck et al (1995) 50% of the 12 women with isolated vaginal recurrence were salvaged compared to 6% of the 34 patients with other patterns of failure. In the PORTEC study Creutzberg et al (2003) reported a 3-year survival of 73% for patients with vaginal relapse, 8% for those with pelvic relapse, and 14% for those with distant failure. Since most relapses involve distant sites and no effective therapy is usually available for these cases, the earlier detection of recurrent disease allowed by an intensive follow-up program has a limited chance to

VII. Treatment of recurrent disease In patients not previously submitted to adjuvant radiotherapy, isolated vaginal recurrence can be managed with satisfactory cure rates with external beam irradiation followed by high-dose-rate brachytherapy, and central or lateral pelvic recurrence may be treated with limited chance of cure with external pelvic irradiation or with platinum-based chemotherapy followed by external pelvic irradiation. Pelvic exenteration may represent the only potential option for cure for carefully selected patients with isolated central pelvic failures who have exhausted other treatment modalities. However this ultraradical surgery can be seldom taken into consideration for patient age, habitus and performance status. Patients with distant recurrences should receive platinum-based chemotherapy. Progestins may represent an alternative therapeutic option for patients with welldifferentiated tumours, high progesterone receptor content, and long disease-free interval. Cytoreductive surgery before or after systemic treatment can be performed in

384

Cancer Therapy Vol 1, page 385 Table 9. Rates and sites of recurrence in patients with early stage endometrial cancer Reference

patients

Patients with recurrence

Sites of recurrences Distant Local Dostant 264 33 (12.5%) 3 27 3 300 47 (15.6%) 16 29 2 317 53 (16.7%) 25 28 398 44** (11.1%) 15 16 8 133 24 (18.0%) 6 17 1 recurrent disease but complete follow-up data were available only for 39 of them Local

Lurain et al, 1991 Podczaski et al, 1992 Shumsky et al, 1994 Reddoch et al, 1995 Gadducci et al, 2000 ** 44 patients developed

Table 10. Examinations that detected recurrent disease in asymptomatic patients with relapsed endometrial cancer Reference

Patients

Recurred patients

Asymptomatic Physical Chest PAP US CT other Recurred exam x-ray test patients Podczaski et al, 1992 300 47 24 14* 10* 1 Shumsky et al, 1994 317 53 13 5 6 2 Reddoch et al, 1995 398 44** 23 13 1 1 2 6 Gadducci et al, 2000 133 24 13 3 1 1 3 5 * one patient with concomitant local and distant failure had both an abnormal physical examination and an abnormal chest X-ray ** 44 patients developed recurrent disease but complete follow-up data were available only for 39 of them US: ultrasound; CT: computed tomography Alektiar KM, McKee A, Venkatraman E, McKee B, Zelefsky MJ, Mychalczak BR, Hoskins WJ, Barakat RR. (2002) Intravaginal high-dose-rate brachytherapy for Stage IB (FIGO Grade 1, 2) endometrial cancer. Int J Radiat Oncol Biol Phys 53, 707-713. Asbury RF, Brunetto VL, Lee RB, Reid G, Rocereto TF. Gynecologic Oncology Group (2002). Goserelin acetate as treatment for recurrent endometrial carcinoma: a Gynecologic Oncology Group study. Am J Clin Oncol 25, 557-560. Ayhan A, Taskiran C, Celik C, Yuce K, Kucukali T. (2002) The influence of cytoreductive surgery on survival and morbidity in stage IVB endometrial cancer. Int J Gynecol Cancer 12, 448-453. Ayhan A, Tuncer R, Tuncer ZS, Yuce K, Kucukali T. (1994) Correlation between clinical and histopathologic risk factors and lymph node metastases in early endometrial cancer (a multivariate analysis of 183 cases). Int J Gynecol Cancer 4, 306-309. Ball HG, Blessing JA, Lentz SS, Mutch DG. (1996) A phase II trial of taxol in advanced and recurrent adenocarcinoma of the endometrium. Gynecol Oncol 62, 278-281. Bancher-Todesca D, Neunteufel W, Williams KE, Prainsack D, Breitenecker G, Friedlander ML, Hacker NF. (1998) Influence of postoperative treatment on survival in patients with uterine papillary serous carcinoma. Gynecol Oncol 71, 344-347. Barakat RR, Goldman NA, Patel DA, Venkatraman ES, Curtin JP. (1999) Pelvic exenteration for recurrent endometrial cancer. Gynecol Oncol 75, 99-102. Bar-Am A, Ron IG, Kuperminc M, Gal I, Jaffa A, Kovner F, Wigler N, Inbar M, Lessing J. (1998) The role of routine pelvic lymph node sampling in patients with stage I endometrial carcinoma: Second thoughts. Acta Obstet Gynecol Scand. 77, 347-350. Bell JG, Minnick A, Reid GC, Judis J, Brownell M. (1997) Relationship of nonstaging pathological risk factors to lymph

improve patient survival. Interesting fields of research are represented by the assessment of new hormonal drugs, such as SERMs (Chan, 2002; Burke and Walker, 2003; McMeekin et al, 2003) and antisense estrogen receptor oligodeoxyribonucleotides (Taylor et al, 2002), and of investigational agents able to interfere with the activity of protooncogenes, onco-suppressor genes, mismatch repair genes, and molecules involved in tumor invasiveness and angiogenesis (Elit and Hirte, 2002; Fujiwaki et al, 2002; Santin et al, 2002). For instance Santin et al (2002) suggested the administration of trastuzumab to patients with uterine serous papillary l cancer that often shows HER-2/neu overexpression. Further developments in understanding the molecules involved in tumor growth and spreading will allow the synthesis of specific and selective inhibitors (Fujiwaki et al, 2002).

References Aalders J, Abeler V, Kolstad P, Onsrud M. (1980) Postoperative external irradiation and prognostic parameters in stage I endometrial carcinoma: clinical and histopathologic study of 540 patients. Obstet Gynecol 56, 419-427. Aapro M, Bolis G, Chevallier B, van der Burg MEL, Poveda A, de Oliveira C, Pawinski A, Sahmoud T, Pecorelli S. (1994) An EORTC-GCCG randomized phase II trial of doxorubicin (DOX) versus DOX-cisplatin (CDDP) in endometrial carcinoma. Proc Am Soc Clin Oncol 13, 275 (abstract 885). Ackerman I, Malone S, Thomas G, Franssen E, Balogh J, Dembo A. (1996) Endometrial carcinoma--relative effectiveness of adjuvant irradiation vs therapy reserved for relapse. Gynecol Oncol 60, 177-183 Agboola OO, Grunfeld E, Coyle D, Perry GA. (1997) Costs and benefits of routine follow-up after curative treatment for endometrial cancer. CMAJ 157, 879-886.

385

Gadducci et al: Treatment planning in endometrial cancer node metastasis and recurrence in clinical stage I endometrial carcinoma. Gynecol Oncol 66, 388-392. Benedetti Panici P, Maneschi F, Cutillo G, Dâ&#x20AC;&#x2122; Andrea G, Manci N, Rabitti C. (1998) Anatomical and pathological study of retroperitoneal nodes in endometrial cancer. Int J Gynecol Cancer 8, 322-327. Berchuck A, Anspach C, Evans AC, Soper JT, Rodriguez GC, Dodge R, Robboy S, Clarke-Pearson DL. (1995) Postsurgical surveillance of patients with FIGO stage I/II endometrial adenocarcinoma. Gynecol Oncol 59, 20-24. Berstein L, Maximov S, Gershfeld E, Meshkova I, Gamajunova V, Tsyrlina E, Larionov A, Kovalevskij A, Vasilyev D. (2002) Neoadjuvant therapy of endometrial cancer with the aromatase inhibitor letrozole: endocrine and clinical effects. Eur J Obstet Gynecol Reprod Biol 105, 161-165. Boente MP, Orandi YA, Yordan EL, Miller A, Graham JE, Kirshner C, Wilbanks GD. (1995) Recurrence patterns and complications in endometrial adenocarcinoma with cervical involvement. Ann Surg Oncol 2, 138-144. Boothby RA, Carlson JA, Neiman W, Rubin MM, Morgan MA, Schultz D, Mikuta JJ, (1989) Treatment of stage II endometrial cancer. Gynecol Oncol 33, 204-208. Boronow RC, Morrow CP, Creasman WT, Disaia PJ, Silverberg SG, Miller A, Blessing JA. (1984) Surgical staging in endometrial cancer: clinical-pathologic findings of a prospective study. Obstet Gynecol 63, 825-832. Boronow RC. (1997) Surgical staging of endometrial cancer: evolution, evaluation, and responsible challenge--a personal perspective. Gynecol Oncol 66, 179-189. Bremond A, Bataillard A, Thomas L, Achard JL, Fervers B, Fondrinier E, Lansac J, Bailly C, Hoffstetter S, Basuyau JP, d'Anjou J, Descamps P, Farsi F, Guastalla JP, Laffargue F, Rodier JF, Vincent P, Pigneux J (2001) Federation Nationale des Centres de Lutte Contre le Cancer. Standards, Options and Recommendations for the surgical management of carcinoma of the endometrium. Bull. Cancer. 88, 181-198. Bristow RE, Duska LR, Montz FJ. (2001) The role of cytoreductive surgery in the management of stage IV uterine papillary serous carcinoma. Gynecol Oncol 81, 92-99. Bristow RE, Zerbe MJ, Rosenshein NB, Grumbine FC, Montz FJ. (2000) Stage IVB endometrial carcinoma: the role of cytoreductive surgery and determinants of survival. Gynecol Oncol 78, 85-91. Burke TW, Gershenson DM, Morris M, Stringer CA, Levenback C, Tortolero-Luna G, Baker VV. (1994) Postoperative adjuvant cisplatin, doxorubicin, and cyclophosphamide (PAC) chemotherapy in women with high-risk endometrial carcinoma. Gynecol Oncol 55, 47-50. Burke TW, Stringer CA, Morris M, Freedman RS, Gershenson DM, Kavanagh JJ, Edwards CL. (1991) Prospective treatment of advanced or recurrent endometrial carcinoma with cisplatin, doxorubicin, and cyclophosphamide. Gynecol Oncol 40, 264-267. Burke TW, Walker CL. (2003) Arzoxifene as therapy for endometrial cancer. Gynecol Oncol 90, S40-46. Campora E, Vidali A, Mammoliti S, Ragni N, Conte PF. (1990) Treatment of advanced or recurrent adenocarcinoma of endometrium with doxorubicin and cyclophosphamide. Eur J Gynaecol Oncol 11, 181-183 . Candiani GB, Belloni C, Maggi R, Colombo G, Frigoli A, Carinelli SG. (1990) Evaluation of different surgical approaches in the treatment of endometrial cancer at FIGO stage I. Gynecol Oncol 37, 6-8. Carcangiu ML, Chambers JT. (1992) Uterine papillary serous carcinoma: A study on 108 cases with emphasis on the prognostic significance of associated endometrioid carcinoma, absence of invasion, and concomitant ovarian carcinoma. Gynecol Oncol 47, 298-305.

Chan JK, Lin YG, Monk BJ, Tewari K, Bloss JD, Berman ML. (2001) Vaginal hysterectomy as primary treatment of endometrial cancer in medically compromised women. Obstet Gynecol 97, 707-711. Chan JK, Loizzi V, Youssef M, Osann K, Rutgers J, Vasilev SA, Berman ML. (2003) Significance of comprehensive surgical staging in noninvasive papillary serous carcinoma of the endometrium. Gynecol Oncol 90, 181-185. Chan S. (2002) A review of selective estrogen receptor modulators in the treatment of breast and endometrial cancer. Semin Oncol 29, 129-133. Chen SS. (1989) Operative treatment in stage I endometrial carcinoma with deep myometrial invasion and/or grade 3 tumor surgically limited to the corpus uteri. No recurrence with only primary surgery. Cancer 63, 1843-1845. Chi DS, Barakat RR. (2001) Surgical management of advanced or recurrent endometrial cancer. Surg Clin North. Am 81, 885-896. Chi DS, Welshinger M, Venkatraman ES, Barakat RR. (1997) The role of surgical cytoreduction in Stage IV endometrial carcinoma. Gynecol Oncol 67, 56-60. Chu CS, Randall TC, Bandera CA, Rubin SC. (2003) Vaginal cuff recurrence of endometrial cancer treated by laparoscopic-assisted vaginal hysterectomy. Gynecol Oncol 88, 62-65. Chuang L, Burke TW, Tornos C, Marino BD, Mitchell MF, Tortolero-Luna G, Levenback C, Morris M, Gershenson DM. (1995) Staging laparotomy for endometrial carcinoma: assessment of retroperitoneal lymph nodes. Gynecol Oncol 58, 189-193. Cirisano FD Jr, Robboy SJ, Dodge RK, Bentley RC, Krigman HR, Synan IS, Soper JT, Clarke-Pearson DL. (2000) The outcome of stage I-II clinically and surgically staged papillary serous and clear cell endometrial cancers when compared with endometrioid carcinoma. Gynecol Oncol 77, 55-65. Corn BW, Lanciano RM, D'agostino R Jr, Kiggundu E, Dunton CJ, Pursen P, Greven KM. (1997) The relationship of local and distant failure from endometrial cancer: Defining a clinical paradigm. Gynecol Oncol 66, 411-416. Corn BW, Lanciano RM, Greven KM, Schultz DJ, Reisinger SA, Stafford PM, Hanks GE. (1992) Endometrial cancer with para-aortic adenopathy: patterns of failure and opportunities for cure. Int J Radiat Oncol Biol Phys 24, 223-227. Covens A, Thomas G, Shaw P, Ackerman I, Osborne R, Lukka H, Carey M, Franssen E, Roche K. (1997) A phase II study of leuprolide in advanced/ recurrent endometrial cancer. Gynecol Oncol 64, 126-129. Creasman WT, Morrow CP, Bundy BN, Homesley HD, Graham JE, Heller PB. (1987) Surgical pathologic spread patterns of endometrial cancer. A Gynecologic Oncology Group study. Cancer 60, 2035-2041. Creasman WT, Odicino F, Massoineuve Beller U, Benedet JL, Heintz APM, HYS NGAN, Sideri M, Pecorelli S. (2001) Carcinoma of the corpus uteri. J Epidemiol Biostat 6, 45-86. Creutzberg CL, van Putten WL, Koper PC, Lybeert ML, Jobsen JJ, Warlam-Rodenhuis CC, De Winter KA, Lutgens LC, van den Bergh AC, van de Steen-Banasik E, Beerman H, van Lent M. (2000) Surgery and postoperative radiotherapy versus surgery alone for patients with stage-1 endometrial carcinoma: multicentre randomised trial. PORTEC Study Group. Post Operative Radiation Therapy in Endometrial Carcinoma. Lancet. 355, 1404-1411. Creutzberg CL, van Putten WL, Koper PC, Lybeert ML, Jobsen JJ, Warlam-Rodenhuis CC, De Winter KA, Lutgens LC, van den Bergh AC, van der Steen-Banasik E, Beerman H, van Lent M. PORTEC Study Group. (2003) Survival after

386

Cancer Therapy Vol 1, page 387 relapse in patients with endometrial cancer, results from a randomized trial. Gynecol Oncol 89, 201-209. De Palo G, Mangioni C, Periti P, Del Vecchio M, Marubini E. (1993) Treatment of FIGO (1971) stage I endometrial carcinoma with intensive surgery, radiotherapy and hormonotherapy according to pathological prognostic groups. Long-term results of a randomised multicentre study. Eur J Cancer 29A, 1133-1140. De Vita VT jr, Wasserman TH, Young RC, Carter SK. (1976) Perspective on research in gynecologic oncology. Cancer 38, 509-525. Dunton CJ, Pfeifer SM, Braitman LE, Morgan MA, Carlson JA, Mikuta JJ. (1991) Treatment of advanced and recurrent endometrial cancer with cisplatin, doxorubicin and cyclophosphamide. Gynecol Oncol 41 113-116. Ebina Y, Hareyama H, Sakuragh N, Yamamoto R, Furuya M, Sogame M, Fujino T, Makinoda S, Fujimoto S. (1997) Peritoneal cytology and its prognostic value in endometrial carcinoma. Int Surg 82, 244-248. Edmondson JH, Krook JE, Hilton JF, Malkasian GD, Everson LK, Jefferies JA, Mailliard JA. (1987) Randomized phase II studies of cisplatin and a combination of cyclophosphamidedoxorubicin-cisplatin (CAP) in patients with progestinrefractory advanced endometrial carcinoma. Gynecol Oncol 28, 20-24. Elit L, Hirte H. (2002) Current status and future innovations of hormonal agents, chemotherapy and investigational agents in endometrial cancer. Curr Opin Obstet Gynecol 14, 67-73 Eltabbakh GH, Moody J, Garafano LL, Hammond JM. (1999) The combination paclitaxel, carboplatin and megestrol acetate is effective in women with recurrent uterine papillary serous adenocarcinoma. Eur J Gynaecol Oncol 20, 18-19. Eltabbakh GH, Shamonki MI, Moody JM, Garafano LL. (2001) Laparoscopy as the primary modality for the treatment of women with endometrial carcinoma. Cancer 91, 378-387. Eltabbakh GH. (2002) Analysis of survival after laparoscopy in women with endometrial carcinoma. Cancer 95, 1894-1901. Fanning J, Nanavati PJ, Hilgers RD. (1996) Surgical staging and high dose rate brachytherapy for endometrial cancer: Limiting external radiotherapy to node-positive tumor. Obstet Gynecol 87, 1041-1044. Feuer GA, Calanog A. (1987) Endometrial carcinoma: Treatment of positive paraaortic nodes. Gynecol Oncol 27, 104-109. Fiorica J, Brunetto V, Hanjani P, Lentz S, Mannel R, Anderson W. (2000) A phase II study (GOG 153) of recurrent and advanced endometrial carcinoma treated with alternating courses of megestrol acetate and tamoxifen citrate. Proc Am Soc Clin Oncol 19, 379 (abstract 1499). Fishman DA, Roberts KB, Chambers JT, Kohorn EI, Schwartz PE, Chambers SK. (1996) Radiation therapy as exclusive treatment for medically inoperable patients with stage I and II endometrioid carcinoma with endometrium. Gynecol Oncol 61, 189-196. Fleming GF, Brunetto BL, Mundt AJ, Burks RT, Look KY, Reid G. (2002) Randomized trial of doxorubicin (DOX) plus cisplatin (CIS) versus DOX plus CIS plus paclitaxel (TAX) in patients with advanced or recurrent endometrial carcinoma: a Gynecologic Oncology Group (GOG) study. Proc Am Soc Clin Oncol 21, 202 (abstract 807). Fram KM. (2002) Laparoscopically assisted vaginal hysterectomy versus abdominal hysterectomy in stage I endometrial cancer. Int J Gynecol Cancer. 12, 57-61. Frigerio L, Mangili G, Aletti G, Carnelli M, Garavaglia E, Beatrice S, Ferrari A. (2001) Concomitant radiotherapy and paclitaxel for high-risk endometrial cancer: first feasibility study. Gynecol Oncol 81, 53-57. Fujiwaki R, Iida K, Kanasaki H, Ozaki T, Hata K, Miyazaki K. (2002) Cyclooxygenase-2 expression in endometrial cancer:

correlation with microvessel count and expression of vascular endothelial growth factor and thymidine phosphorylase. Hum Pathol 33, 213-219. Gadducci A, Cosio S, Fanucchi A, Cristofani R, Genazzani AR. (2000) An intensive follow-up does not change survival of patients with clinical stage I endometrial cancer. Anticancer Res 20, 1977-1984. Gadducci A, Romanini A, Cosio S, Fanucchi A, Tanganelli L, Ciampi B, Genazzani AR. (1999) Combination of cisplatin, epirubicin, and cyclophoshamide (PEC regimen) in advanced or recurrent endometrial cancer: a retrospective clinical study. Anticancer Res 19, 2253-2256. Gallion HH, Brunetto VL, Cibull M, Lentz SS, Reid G, Soper JT, Burger RA, Andersen W Gynecologic Oncology Group Study. (2003) Randomized phase III trial of standard timed doxorubicin plus cisplatin versus circadian timed doxorubicin plus cisplatin in stage III and IV or recurrent endometrial carcinoma: a Gynecologic Oncology Group Study. J Clin Oncol 21, 3808-3813. Gallion HH, van Nagell JR Jr, Powell DF, Donaldson ES, Higgins RV, Kryscio RJ, Pavlik EJ, Nelson K. (1989) Stage I serous papillary carcinoma of the endometrium. Cancer 63, 2224-2228. Gemignani ML, Curtin JP, Zelmanovich J, Patel DA, Venkatraman E, Barakat RR. (1999) Laparoscopic-assisted vaginal hysterectomy for endometrial cancer: clinical outcomes and hospital charges. Gynecol Oncol 73, 5-11. Goff BA, Goodman A, Muntz HG, Fuller AF Jr, Nikrui N, Rice LW. (1994) Surgical stage IV endometrial carcinoma: a study of 47 cases. Gynecol Oncol 52, 237-240. Green JB, Green S, Albert DS, O'Toole R, Surwit EA, Noltimier JW. (1990) Carboplatin therapy in advanced endometrial cancer. Obstet Gynecol 75, 696-700. Greenlee RT, Murray T, Bolden S, Wingo PA. (2000) Cancer statistics. CA Cancer J Clin 50, 7-33.c Gretz HF3rd, Economos K, Husain A, Lesser M, Kaplan E, Caputo TA, Reynolds RK, Johnston CM, Pearl ML, Roberts JA. (1996) The practice of surgical staging and its impact on adjuvant treatment recommendations in patients with stage I endometrial carcinoma. Gynecol Oncol 61, 409-415. Greven KM, D'Agostino RB Jr, Lanciano RM, Corn BW. (1998) Is there a role for a brachytherapy vaginal cuff boost in the adjuvant management of patients with uterine-confined endometrial cancer? Int J Radiat Oncol Biol Phys 42, 101104. Grigsby PW, Perez CA, Kuten A, Simpson JR, Garcia DM, Camel HM, Kao MS, Galakatos AE. (1992) Clinical stage I endometrial cancer: prognostic factors for local control and distant metastasis and implications of the new FIGO surgical staging system. Int J Radiat Oncol Biol Phys 22, 905-911. Grimshaw RN, Tupper WC, Fraser RC, Tompkins MG, Jeffrey JF. (1990) Prognostic value of peritoneal cytology in endometrial carcinoma. Gynecol Oncol 36, 97-100. Hancock KC, Freedman RS, Edwards CL, Rutledge FN. (1986) Use of cisplatin, doxorubicin, and cyclophosphamide to treat advanced and recurrent adenocarcinoma of the endometrium. Cancer Treat Rep. 70, 789-791. Hart KB, Han I, Shamsa F, Court WS, Chuba P, Deppe G, Malone J, Christensen C, Porter AT. (1998) Radiation therapy for endometrial cancer in patients treated for postoperative recurrence. Int J Radiat Oncol Biol Phys 41, 7-11 Hicks ML, Piver MS, Puretz JL, Hempling RE, Baker TR, Mcauley M, Walsh DL. (1993) Survival in patients with paraaortic lymph node metastases from endometrial adenocarcinoma clinically limited to the uterus. Int J Radiat Oncol Biol Phys 26, 607-711.

387

Gadducci et al: Treatment planning in endometrial cancer Hirai Y, Takeshima N, Kato T, Hasumi K. (2001) Malignant potential of positive peritoneal cytology in endometrial cancer. Obstet Gynecol 97, 725-728. Hoffman MS, Roberts WS, Cavanagh D, Praphat H, Solomon P, Lyman GH. (1989) Treatment of recurrent and metastatic endometrial cancer with cisplatin, doxorubicin, cyclophosphamide, and megestrol acetate. Gynecol Oncol 35, 75-77. Holloway RW. (2003) Treatment options for endometrial cancer: experience with topotecan. Gynecol Oncol 90, S28-33. Holub Z, Jabor A, Bartos P, Eim J, Urbanek S, Pivovarnikova R. (2002) Laparoscopic surgery for endometrial cancer: longterm results of a multicentric study. Eur J Gynaecol Oncol 23, 305-310. Horton J, Begg CB, Arseneault J, Bruckner H, Creech R, Hahn RG. (1978) Comparison of adriamycin with cyclophosphamide in patients with advanced endometrial cancer. Cancer Treat Rep. 62, 159-161. Hoskins PJ, Swenerton KD, Pike JA, Wong F, Lim P, AcquinoParsons C, Lee N. (2001) Paclitaxel and carboplatin, alone or with irradiation, in advanced or recurrent endometrial cancer: a phase II study. J Clin Oncol 19, 4048-4053. Jeyarajah AR, Gallagher CJ, Blake PR, Oram DH, Dowsett M, Fisher C, Oliver RT. (1996) Long-term follow-up of gonadotrophin-releasing hormone analog treatment for recurrent endometrial cancer . Gynecol Oncol 63, 47-52. Jhingran A, Burke TW, Eifel PJ. (2003) Definitive radiotherapy for patients with isolated vaginal recurrence of endometrial carcinoma after hysterectomy. Int J Radiat Oncol Biol Phys 56, 1366-1372. Kadar N, Homesley HD, Malfetano JH. (1992) Positive peritoneal cytology is an adverse factor in endometrial carcinoma only if there is other evidence of extrauterine disease. Gynecol Oncol 46, 145-149. Kasamatsu T, Onda T, Katsumata N, Sawada M, Yamada T, Tsunematsu R, Ohmi K, Sasajima Y, Matsuno Y. (2003) Prognostic significance of positive peritoneal cytology in endometrial carcinoma confined to the uterus. Br J Cancer 88, 245-250. Kashimura M, Sugihara K, Toki N, Matsuura Y, Kawagoe T, Kamura T, Kaku T, Tsuruchi N, Nakashima H, Sakai H. (1997) The significance of peritoneal cytology in uterine cervix and endometrial cancer. Gynecol Oncol 67, 285-290. Kauppila A. (1984) Progestin therapy of endometrial, breast and ovarian carcinoma. A review of clinical observations. Acta Obstet Gynecol Scand 63, 441-450. Kennedy AW, Webster KD, Nunez C, Bauer LJ. (1993) Pelvic washings for cytologic analysis in endometrial adenocarcinoma. J Reprod Med 38, 637-642. Kilgore LC, Partridge EE, Alvarez RD, Austin JM, Shingleton HM, Noojin F 3rd, Conner W. (1995) Adenocarcinoma of the endometrium, survival comparisons of patients with and without pelvic node sampling. Gynecol Oncol 56, 29-33. Kline RC, Freedman RS, Jones LA, Atkinson EN. (1987) Treatment of recurrent or metastatic poorly differentiated adenocarcinoma of the endometrium with tamoxifen and medroxyprogesterone acetate. Cancer Treat Rep 71, 327328. la Vecchia C, Franceschi S, Parazzini F, Colombo E, Colombo F, Liberati A, Mangioni C. (1983) Ten-year survival in 290 patients with endometrial cancer, prognostic factors and therapeutic approach. Br. J Obstet Gynaecol. 90, 654-661. Lanciano RM, Corn BW, Schultz DJ, Kramer CA, Rosenblum N, Hogan WM. (1993) The justification for a surgical staging system in endometrial carcinoma. Radiother. Oncol 28, 189-196. Langebrekke A, Istre O, Hallqvist AC, Hartgill TW, Onsrud M. (2002) Comparison of laparoscopy and laparotomy in

patients with endometrial cancer. J Am Assoc Gynecol Laparosc 9, 152-157. Larson DM, Broste SK, Krawisz BR. (1998) Surgery without radiotherapy for primary treatment of endometrial cancer. Obstet Gynecol 91, 355-359. Le TD, Yamada SD, Rutgers JL, DiSaia PJ. (1999) Complete response of a stage IV uterine papillary serous carcinoma to neoadjuvant chemotherapy with taxol and carboplatin. Gynecol Oncol 73, 461-463. Lee KR, Belinson JL. (1991) Recurrence in noninvasive endometrial carcinoma. Relationship with uterine papillary serous carcinoma. Am J Surg Pathol 15, 965-973. Lee SW, Russell AH, Kinney WK. (2003) Whole abdomen radiotherapy for patients with peritoneal dissemination of endometrial adenocarcinoma. Int J Radiat Oncol Biol Phys 56, 788-792. Levin L, Hryniuk W. (1987) The application of dose intensity to problems in chemotherapy of ovarian and endometrial cancer. Semin Oncol 14 (Suppl 4), 12-19. Lincoln S, Blessing JA, Lee RB, Rocereto TF. (2003) Activity of paclitaxel as second-line chemotherapy in endometrial carcinoma: a Gynecologic Oncology Group study. Gynecol Oncol 88, 277-281. Lissoni A, Zanetta G, Losa G, Gabriele A, Parma G, Mangioni C. (1996) Phase II study of paclitaxel as salvage treatment in advanced endometrial cancer. Ann. Oncol 7, 861-863. Long HJ, Pfeifle DM, Wieand HS, Krook JE, Edmonson JH, Buckner JC. (1988) Phase II evaluation of carboplatin in advanced endometrial carcinoma. J Natl. Cancer Inst. 80, 276-278. Lovecchio JL, Averette HE, Lichtinger M, Townsend PA, Girtanner RW, Fenton AN. (1984) Treatment of advanced or recurrent endometrial adenocarcinoma with cyclophosphamide, doxorubicin, cis-platinum, and megestrol acetate. Obstet Gynecol 63, 557-560. Luo ML, Sakuragi N, Shimizu M, Seino K, Okamoto K, Kaneuchi M, Ebina Y, Okuyama K, Fujino T, Sagawa T, Fujimoto S. (2001) Prognostic significance of combined conventional and immunocytochemical cytology for peritoneal washings in endometrial carcinoma. Cancer 93, 115-123. Lurain JR, Rice BL, Rademaker AW, Poggensee LE, Schink JC, Miller DS. (1991) Prognostic factors associated with recurrence in clinical stage I adenocarcinoma of the endometrium. Obstet Gynecol 78, 63-69. MacDonald RR, Thorogood J, Mason MK. (1988) A randomized trial of progestogens in the primary treatment of endometrial carcinoma. Br J Obstet Gynaecol. 95, 166-174. Maggi R, Cagnazzo G, Atlante G, Marinaccio M. (1999) Risk groups and adjuvant therapy in surgical staged endometrial cancer patients. A randomized multicentre study comparing chemotherapy with radiation therapy. In: "7th Biennial Meeting of the International Gynecologic Cancer Society" Rome (Italy), September 26-30, 1999 (Pecorelli S, Atlante G, Benedetti Panici P, Mancuso S Eds) Monduzzi Editore, International Proceedings Division, 97-101. Maggino T, Romagnolo C, Zola P, Sartori E, Landoni F, Gadducci A. (1995) An analysis of approaches to the treatment of endometrial cancer in western Europe: a CTF study. Eur J Cancer. 31A, 1993-1997. Malkasian GD jr, Decker DG. (1978) Adjuvant progesterone therapy for stage I endometrial carcinoma. Int J Gynaecol Obstet 16, 48-49. Malur S, Possover M, Michels W, Schneider A. (2001) Laparoscopic-assisted vaginal versus abdominal surgery in patients with endometrial cancer--a prospective randomized trial. Gynecol Oncol 80, 239-244.

388

Cancer Therapy Vol 1, page 389 Mariani A, Webb MJ, Galli L, Podratz KC. (2000) Potential therapeutic role of para-aortic lymphadenectomy in nodepositive endometrial cancer. Gynecol Oncol 76, 348-356. Mariani A, Webb MJ, Keeney GL, Calori G, Podratz KC. (2001) Role of wide/radical hysterectomy and pelvic lymph node dissection in endometrial cancer with cervical involvement. Gynecol Oncol 83, 72-80. Martinez A, Podratz K, Schray M, Malkasian G. (1988) Results of whole abdominopelvic irradiation with nodal boost for patients with endometrial cancer at high risk of failure in the peritoneal cavity. A prospective clinical trial at the Mayo Clinic. Hematol Oncol Clin North Am 2, 431-446. Martinez AA, Weiner S, Podratz K, Armin AR, Stromberg JS, Stanhope R, Sherman A, Schray M, Brabbins DA. (2003) Improved outcome at 10 years for serous-papillary/clear cell or high-risk endometrial cancer patients treated by adjuvant high-dose whole abdomino-pelvic irradiation. Gynecol Oncol 90, 537-546. Martin-Hirsch PL, Jarvis G, Kitchener H, Lilford R. (2000) Progestagens for endometrial cancer. Cochrane Database Syst Rev 2, CD001040 Massi G, Savino L, Susini T. (1996) Vaginal hysterectomy versus abdominal hysterectomy for the treatment of stage I endometrial adenocarcinoma. Am J Obstet Gynecol 174, 1320-1326. Massi G, Susini T, Amunni G. (2000) Extraperitoneal pelvic lymphadenectomy to complement vaginal operations for cervical and endometrial cancer. Int J Gynaecol Obstet 69, 27-35. Matias-Guiu X, Catasus L, Bussaglia E, Lagarda H, Garcia A, Pons C, Munoz J, Arguelles R, Machin P, Prat J. (2001) Molecular pathology of endometrial hyperplasia and carcinoma. Hum Pathol 32, 569-577. McMeekin DS, Gordon A, Fowler J, Melemed A, Buller R, Burke T, Bloss J, Sabbatini P. (2003) A phase II trial of arzoxifene, a selective estrogen response modulator, in patients with recurrent or advanced endometrial cancer. Gynecol Oncol 90, 64-69. Mikuta JJ. (1993) International Federation of Gynecology and Obstetrics staging of endometrial cancer 1988. Cancer 71 (Suppl), 1460-1463. Miller DS, Blessing JA, Lentz SS, Waggoner SE. (2002) A phase II trial of topotecan in patients with advanced, persistent, or recurrent endometrial carcinoma: a gynecologic oncology group study. Gynecol Oncol 87, 247-251. Mohan DS, Samuels MA, Selim MA, Shalodi AD, Ellis RJ, Samuels JR, Yun HJ. (1998) Long-term outcomes of therapeutic pelvic lymphadenectomy for stage I endometrial adenocarcinoma. Gynecol Oncol 70, 165-171. Morice P, Levy-Piedbois C, Ajaj S, Pautier P, Haie-Meder C, Lhomme C, Duvillard P, Castaigne D. (2003) Value and cost evaluation of routine follow-up for patients with clinical stage I/II endometrial cancer. Eur J Cancer 7, 985-990. Morris M, Alvarez RD, Kinney WK, Wilson TO. (1996) Treatment of recurrent adenocarcinoma of the endometrium with pelvic exenteration. Gynecol Oncol 60, 288-291. Morrow CP, Bundy BN, Homesley HD, Creasman WT, Hornback NB, Kurman R, Thigpen JT. (1990) Doxorubicin as an adjuvant following surgery and radiation therapy in patients with high-risk endometrial carcinoma, stage I and occult stage II: a Gynecologic Oncology Group Study. Gynecol Oncol 36, 166-171. Morrow CP, Bundy BN, Kurman RJ, Creasman WT, Heller P, Homesley HD, Graham JE. (1991) Relationship between surgical-pathological risk factors and outcome in clinical stage I and II carcinoma of the endometrium: a Gynecologic Oncology Group study. Gynecol Oncol 40, 55-65.

Muggia FM, Chia G, Reed LJ, Romney SL. (1977) Doxorubicincyclophosphamide: effective chemotherapy for advanced endometrial adenocarcinoma. Am J Obstet Gynecol 128, 314-319. Mundt AJ, McBride R, Rotmensch J, Waggoner SE, Yamada SD, Connell PP. (2001) Significant pelvic recurrence in highrisk pathologic stage I--IV endometrial carcinoma patients after adjuvant chemotherapy alone: implications for adjuvant radiation therapy. Int J Radiat Oncol Biol Phys 50, 1145-1153. Muntz HG, Goff BA, Madsen BL, Yon JL. (1999) Port-site recurrence after laparoscopic surgery for endometrial carcinoma. Obstet Gynecol 93, 807-809. Muss HB. (1994) Chemotherapy of metastatic endometrial cancer. Semin Oncol 21, 107-113. Nag S, Erickson B, Parikh S, Gupta N, Varia M, Glasgow G. (2000) The American Brachytherapy Society recommendations for high-dose-rate brachytherapy for carcinoma of the endometrium. Int J Radiat Oncol Biol Phys 48, 779-790. Niwa K, Kometani K, Sekiya T, Nakazawa K, Kanakura Y. (2002) Complete remission of uterine endometrial cancer with multiple lung metastases treated by paclitaxel and carboplatin. Int J Clin Oncol 7, 197-200. Nola M, Jukic S, Ilic-Forko J, Babic D, Uzarevic B, Petrovecki M, Suchanek E, Skrablin S, Dotlic S, Marusic M. (1999) Effects of tamoxifen on steroid hormone receptors and hormone concentration and the results of DNA analysis by flow cytometry in endometrial carcinoma. Gynecol Oncol 72, 331-336. Obermair A, Geramou M, Tripcony L, Nicklin JL, Perrin L, Crandon AJ. (2001) Peritoneal cytology: impact on diseasefree survival in clinical stage I endometrioid adenocarcinoma of the uterus. Cancer Lett 164, 105-110. Occelli B, Samouelian V, Narducci F, Leblanc E, Querleu D. (2003) The choice of approach in the surgical management of endometrial carcinoma: a retrospective series of 155 cases. Bull. Cancer 90, 347-355. Onda T, Yoshikawa H, Mizutani K, Mishima M, Yokota H, Nagano H, Ozaki Y, Murakami A, Ueda K, Taketani Y. (1997) Treatment of node-positive endometrial cancer with complete node dissection, chemotherapy and radiation therapy. Br. J Cancer 75, 1836-1841. Oram D. (1990) The management of cancer of the uterine corpus. In: â&#x20AC;&#x153;Clinical Gynecological Oncologyâ&#x20AC;&#x153; (Sheperd JH, Monaghan JM, Eds), Second Edition. Oxford, Blackwell Scientific Publications 115-139. Orr JW, Holimon JL, Orr PF. (1997) Stage I corpus cancer: Is teletherapy necessary? Am J Obstet Gynecol 176, 777-789. Pai HH, Souhami L, Clark BG, Roman T. (1997) Isolated vaginal recurrences in endometrial carcinoma, treatment results using high-dose-rate intracavitary brachytherapy and external beam radiotherapy. Gynecol Oncol 66, 300-307. Pandya KJ, Yeap BY, Weiner LM, Krook JE, Erban JK, Schinella RA, Davis TE. (2001) Megestrol and tamoxifen in patients with advanced endometrial cancer: an Eastern Cooperative Oncology Group Study (E4882). Am J Clin Oncol 24, 43-46. Peiffert D, Hoffstetter S, Charra-Brunaud C. (2003) Brachytherapy of endometrial cancers Cancer Radiother 7, 121-131. Piver MS, Barlow JJ, Lurain JR, Blumenson LE. (1980) Medroxyprogesterone acetate (Depo-Provera) vs. hydroxyprogesterone caproate (Delalutin) in women with metastatic endometrial adenocarcinoma. Cancer 45, 268272. Podczaski E, Kaminski P, Gurski K, MacNeill C, Stryker JA, Singapuri K, Hackett TE, Sorosky J, Zaino R. (1992)

389

Gadducci et al: Treatment planning in endometrial cancer Detection and patterns of treament failure in 300 consecutive cases of "early" endometrial cancer after primary surgery. Gynecol Oncol 47, 323-327. Podratz KC, Mariani A, Webb MJ. (1998) Staging and therapeutic value of lymphadenectomy in endometrial cancer. Gynecol Oncol 70, 163-164. Podratz KC, O'Brien PC, Malkasian GD Jr, Decker DG, Jefferies JA, Edmonson JH. (1985) Effects of progestational agents in treatment of endometrial carcinoma. Obstet Gynecol 66, 106-110. Prat J (2002) Endometrial cancer: epidemiology, pathology, and natural history. In: "Hormone replacement therapy and cancer. The current status of research and practice" (Genazzani AR Editor), The Parthenon Publishing Group: Boca Raton, London, New York, Washington DC, 105-114. Pustilnik T, Burke TW. (2000) Adjuvant chemotherapy for highrisk endometrial cancer. Semin Radiat Oncol 10, 23-28. Reddoch JM, Burke TW, Morris M, Tornos C, Levenback C, Gershenson DM. (1995) Surveillance for recurrent endometrial carcinoma: development of a follow-up scheme. Gynecol Oncol 59, 221-225. Reisinger SA, Asbury R, Liao SY, Homesley HD. (1996) A phase I study of weekly cisplatin and whole abdominal radiation for the treatment of stage III and IV endometrial carcinoma: a Gynecologic Oncology Group pilot study. Gynecol Oncol 63, 299-303. Resnik E, Taxy JB. (1996) Neoadjuvant chemotherapy in uterine papillary serous carcinoma. Gynecol Oncol 62, 123-127. Rittenberg PV, Lotocki RJ, Heywood MS, Jones KD, Krepart GV. (2003) High-risk surgical stage 1 endometrial cancer: outcomes with vault brachytherapy alone. Gynecol Oncol 89, 288-294. Roberts JA, Zaino R, Keys H. (1999) A phase III randomized study of surgery vs surgery plus adjunctive radiation therapy in intermediate risk endometrial adenocarcinoma. Protocol GOG99. Gynecol Oncol 68, 135 (abstract 258). Rose PG, Baker S, Kern M, Fitzgerald TJ, Tak WK, Reale FR, Nelson BE, Hunter RE. (1993) Primary radiation therapy for endometrial carcinoma: a case controlled study. Int J Radiat Oncol Biol Phys 27, 585-590. Rose PG, Brunetto VL, VanLe L, Bell J, Walker JL, Lee RB. (2000) A phase II trial of anastrozole in advanced recurrent or persistent endometrial carcinoma: a Gynecologic Oncology Group study. Gynecol Oncol 78, 212-216. Rose PG, Cha SD, Tak WK, Fitzgerald T, Reale F, Hunter RE. (1992) Radiation therapy for surgically proven para-aortic node metastasis in endometrial carcinoma. Int J Radiat Oncol Biol Phys 24, 229-233. Rotman M, Aziz H, Boronow R. (1993) Insights in para-aortic radiation therapy for endometrial carcinoma. Int J Radiat Oncol Biol Phys 26, 711-712. Rouanet P, Dubois JB, Gely S, Pourquier H. (1993) Exclusive radiation therapy in endometrial carcinoma. Int J Radiat Oncol Biol Phys 26, 223-228. Rutledge FN. (1974) The role of radical hysterectomy in adenocarcinoma of the endometrium. Gynecol Oncol 2, 331347. Santin AD, Bellone S, Gokden M, Palmieri M, Dunn D, Agha J, Roman JJ, Hutchins L, Pecorelli S, O'Brien T, Cannon MJ, Parham GP. (2002) Overexpression of HER-2/neu in uterine serous papillary cancer. Clin Cancer Res 8, 1271-1279. Sartori E, Gadducci A, Landoni F, Lissoni A, Maggino T, Zola P, Zanagnolo V. (2001) Clinical behavior of 203 stage II endometrial cancer cases: the impact of primary surgical approach and of adjuvant radiation therapy. Int J Gynecol Cancer. 11, 430-437. Sartori E, Laface B, Gadducci A, Maggino T, Zola P, Landoni F, Zanagnolo V. (2003) Factors influencing survival in

endometrial cancer relapsing patients: a Cooperation Task Force (CTF) study. Int J Gynecol Cancer 13, 458-465. Scarabelli C, Campagnutta E, Giorda G, DePiero G, Sopracordevole F, Quaranta M, DeMarco L. (1998) Maximal cytoreductive surgery as a reasonable therapeutic alternative for recurrent endometrial carcinoma. Gynecol Oncol 70, 9093. Seago DP, Raman A, Lele S. (2001) Potential benefit of lymphadenectomy for the treatment of node-negative locally advanced uterine cancers. Gynecol Oncol 83, 282-285. Seski JC, Edwards CL, Gershenson DM, Copeland LJ (1981) Doxorubicin and cyclophosphamide chemotherapy for disseminated endometrial cancer. Obstet Gynecol 58, 88-91. Sherman ME, Bur ME, Kurman RJ. (1995) p53 in endometrial cancer and its putative precursors: evidence for diverse pathways of tumorigenesis. Hum Pathol 26, 1268-1274. Shumsky AG, Brasher PMA, Stuart GCE, Nation JG. (1997) Risk-specific follow-up for endometrial carcinoma patients. Gynecol Oncol 65, 379-382. Shumsky AG, Stuart GCE, Brasher P, Nation JG, Robertson DI, Sangkarat S. (1994) An evaluation of routine follow-up of patients treated for endometrial carcinoma. Gynecol Oncol 55, 229-233. Silva EG, Jenkins R. (1990) Serous carcinoma in endometrial polyps. Mod. Pathol 13, 120-128. Small W Jr, Mahadevan A, Roland P, Vallow L, Zusag T, Fishman D, Massad S, Rademaker A, Kalapurakal JA, Chang S, Lurain J. (2000) Whole-abdominal radiation in endometrial carcinoma: an analysis of toxicity, patterns of recurrence, and survival. Cancer J 6, 394-400. Smith RS, Kapp DS, Chen Q, Teng NN. (2000) Treatment of high-risk uterine cancer with whole abdominopelvic radiation therapy. Int J Radiat Oncol Biol Phys 48, 767778. Sonoda Y, Zerbe M, Smith A, Lin O, Barakat RR, Hoskins WJ. (2001) High incidence of positive peritoneal cytology in lowrisk endometrial cancer treated by laparoscopically assisted vaginal hysterectomy. Gynecol Oncol 80, 378-382. Sood BM, Timmins PF, Gorla GR, Garg M, Anderson PS, Vikram B, Goldberg GL. (2002) Concomitant cisplatin and extended field radiation therapy in patients with cervical and endometrial cancer. Int J Gynecol Cancer. 12, 459-464. Straughn JM, Huh WK, Orr JW Jr, Kelly FJ, Roland PY, Gold MA, Powell M, Mutch DG, Partridge EE, Kilgore LC, Barnes MN, Austin JM Jr, Alvarez RD. (2003) Stage IC adenocarcinoma of the endometrium: survival comparisons of surgically staged patients with and without adjuvant radiation therapy. Gynecol Oncol 89, 295-300. Sutton GP, Blessing JA, DeMars LR, Moore D, Burke TW, Grendys EC. (1996) A phase II Gynecologic Oncology Group Trial of ifosfamide and MESNA in advanced or recurrent adenocarcinoma of the endometrium. Gynecol Oncol 63, 25-27. Suzuki M, Ohwada M, Kanai N, Sato I. (1999) Rapid death following papillary serous carcinoma of the endometrium without myometrial invasion. Oncol Rep. 6, 1009-1012. Takeshima N, Nishida H, Tabata T, Hirai Y, Hasumi K. (2001) Positive peritoneal cytology in endometrial cancer: enhancement of other prognostic indicators. Gynecol Oncol 82, 470-473. Taylor AH, al-Azzawi F, Pringle JH, Bell SC. (2002) Inhibition of endometrial carcinoma cell growth using antisense estrogen receptor oligodeoxyribonucleotides. Anticancer Res 22, 3993-4003. Thigpen JT, Blessing JA, DiSaia PJ, Yordan E, Carson LF, Evers C. (1994) A randomized comparison of doxorubicin alone versus doxorubicin plus cyclophosphamide in the management of advanced or recurrent endometrial

390

Cancer Therapy Vol 1, page 391 carcinoma: a Gynecologic Oncology Group study. J Clin Oncol 12, 1408-1414. Thigpen JT, Blessing JA, Homesley H, Creasman WT, Sutton G. (1989) Phase II trial of cisplatin as first-line chemotherapy in patients with advanced or recurrent endometrial carcinoma: a Gynecologic Oncology Group study. Gynecol Oncol 33, 6870. Thigpen JT, Brady MF, Alvarez RD, Adelson MD, Homesley HD, Manetta A, Soper JT, Given FT. (1999) Oral medroxyprogesterone acetate in the treatment of advanced or recurrent endometrial carcinoma: a dose-response study by the Gynecologic Oncology Group. J Clin Oncol 17, 17361744. Thigpen T, Blessing J, Homesley H, Malfetano J, DiSaia P, Yordan E. (1993) Phase III trial of doxorubicin +/- cisplatin in advanced or recurrent endometrial carcinoma: a Gynecologic Oncology Group (GOG) study. Proc Am Soc Clin Oncol 12, 261 (abstract 830). Thigpen T, Brady MF, Homesley HD, Soper JT, Bell J (2001) Tamoxifen in the treatment of advanced or recurrent endometrial carcinoma: a Gynecologic Oncology Group study. J Clin Oncol 15, 364-367. Thigpen T, Vance RB, Khansur Y. (1995) The platinum compounds in the management of carcinomas of the endometrium and uterine cervix. Semin Oncol, 22 (Supp.12), 67-75. Thomas L, Bataillard A, Bremond A, Fondrinier E, Fervers B, Achard JL, Lansac J, Bailly C, Hoffstetter S, Basuyau JP, d'Anjou J, Descamps P, Farsi F, Guastalla JP, Laffargue F, Rodier JF, Vincent P, Pigneux J. (2001) Standards, options, and recommendations for the radiotherapy of patients with endometrial cancer. FNCLCC (National Federation of Cancer Campaign Centers) and CRLCC (Regional Cancer Campaign Centers). Cancer Radiother 5, 163-192. Tomioka Y, Kumagai S, Fujiyoshi K, Hirai N, Sugiyama T, Nishida T, Kamura T. (1999) Adjuvant CAP in endometrial cancer. Adjuvant chemotherapy with cisplatin, adriamycin, and cyclophosphamide following in patients with high-risk endometrial cancer. In: "7th Biennial Meeting of the International Gynecologic Cancer Society" Rome (Italy), September 26-30, 1999 (Pecorelli S, Atlante G, Benedetti Panici P, Mancuso S Eds) Monduzzi Editore, International Proceedings Division, 157-161. Trimble EL, Kosary C, Park RC. (1998) Lymph node sampling and survival in endometrial cancer. Gynecol Oncol 71, 340343. Trope C, Johnsson JE, Simonsen E, Christiansen H, CavallinStahl E, Horvath G. (1984) Treatment of recurrent endometrial adenocarcinoma with a combination of doxorubicin and cisplatin. Am J Obstet Gynecol 149, 379381. Trope C, Kristensen G. (1997) Current status of chemotherapy in gynecologic cancer. Semin Oncol 24, S15-S22. Trope C, Kristensen GB, Abeler VM. (2001) Clear-cell and papillary serous cancer: treatment options. Best Pract Res Clin Obstet Gynaecol 15, 433-446.

Turbow MM, Ballon SC, Sikic BI, Koretz MM. (1985) Cisplatin, doxorubicin, and cyclophosphamide chemotherapy for advanced endometrial carcinoma. Cancer Treat Rep 69, 465-467. Turner DA, Gershenson DM, Atkinson N, Sneige N, Wharton AT. (1989) The prognostic significance of peritoneal cytology for stage I endometrial cancer. Obstet Gynecol 74, 775-780. van Wijk FH, Lhomme C, Bolis G, Scotto di Palumbo V, Tumolo S, Nooij M, de Oliveira CF, Vermorken JB; European Organization for Research and Treatment of Cancer. Gynaecological Cancer Group. (2003) Phase II study of carboplatin in patients with advanced or recurrent endometrial carcinoma. A trial of the EORTC Gynaecological Cancer Group. Eur J Cancer 39, 78-85. Vardi JR, Tadros GH, Anselmo MT, Rafla SD. (1992) The value of exploratory laparotomy in patients with endometrial carcinoma according to the new International Federation of Gynecology and Obstetrics staging. Obstet Gynecol 80, 204-208. Vasuratna A, Kudelka AP, Edwards CL, Wootipoom V, Verschraegen CF, Charnsangavej C, Kavanagh JJ. (1998) Prolonged remission of endometrial cancer with paclitaxel and carboplatin. Anticancer Drugs 9, 283-285. Vecek N, Marinovic T, Ivic J, Jukic S, Nola M, DzanicCemalovic N, Vecek N Jr. (1993) Prognostic impact of peritoneal cytology in patients with endometrial carcinoma. Eur J Gynaecol Oncol 14, 380-385. Vergote I, De Smet I, Amant F. (2002) Incidence of positive peritoneal cytology in low-risk endometrial cancer treated by laparoscopically assisted vaginal hysterectomy. Gynecol Oncol 84, 537-538. Vergote I, Kjorstad K, Abeler V, Kolstad P. (1989) A randomized trial of adjuvant progestagen in early endometrial cancer. Cancer 64, 1011-1016. Wadler S, Levy DE, Lincoln ST, Soori GS, Schink JC, Goldberg G. (2003) Topotecan is an active agent in the first-line treatment of metastatic or recurrent endometrial carcinoma: Eastern Cooperative Oncology Group Study E3E93. J Clin Oncol 21, 2110-2114. Wang PH, Yen MS, Yuan CC, Chao KC, Ng HT, Lee WL, Chao HT. (1997) Port site metastasis after laparoscopic-assisted vaginal hysterectomy for endometrial cancer: possible mechanisms and prevention. Gynecol Oncol 66, 151-155. Wylie J, Irwin C, Pintilie M, Levin W, Manchul L, Milosevic M, Fyles A. (2000) Results of radical radiotherapy for recurrent endometrial cancer. Gynecol Oncol 77, 66-72. Zaino RJ, Satyaswaroop PG, Mortel R. ( 1985) Hormonal therapy of human endometrial adenocarcinoma in a nude mouse model. Cancer Res 45, 539-541. Zayyan KS, Kazmi NT. (1998) Port site metastasis after laparoscopic-assisted vaginal hysterectomy for endometrial cancer: possible mechanisms and prevention. Gynecol Oncol 70, 154-155.

391

Gadducci et al: Treatment planning in endometrial cancer

392

Cancer Therapy Vol 1, page 393 Cancer Therapy Vol 1, 393-405, 2003.

Dendritic cell-mediated immunosuppression in malignant melanoma Review Article

Marta E Polak1, Nicola J Borthwick2, Martine J Jager3, Ian A Cree1 1

Translational Oncology Research Centre, Department of Histopathology, Queen Alexandra Hospital, Portsmouth PO6 3LY, UK; 2Department of Pathology, Institute of Ophtalmology, Bath Street, London EC1V 9EL; 3Department of Ophthalmology, Leiden University Medical Center, University of Leiden, Leiden, The Netherlands

__________________________________________________________________________________ *Correspondence: Marta E Polak, Translational Oncology Research Centre, Department of Histopathology, Queen Alexandra Hospital, Portsmouth PO6 3LY, UK; Tel: 0044 2392 286 000 x 5381; Fax: 0044 2392 286 27; e-mail: marta.polak@porthosp.nhs.uk Key Words: Melanoma, dendritic cell, immunosuppression, vaccine, adjuvant Abbreviations: Antigen Presenting Cell, (APC); Cluster of Differentiation, (CD); Cytotoxic T Lymphocytes, (CTL); Dendritic cells, (DC); Dinitrophenyl, (DNP); Delayed Type Hypersensitivity, (DTH); Fas Ligand, (FasL); Granulocyte-Macrophage Colony Stimulating Factor, (GMCSF); Human Leukocyte Antigen, (HLA); Heat Shock Protein, (HSP); Interferon, (IFN); Interleukin, (IL); Keyhole Limpet Hemocyanin, (KLH); Langerhance Cells, (LC); Natural Killer Cells, (NK); Peripheral Blood Lymphocytes, (PBL); Tumor Associated Antigen, (TAA); T cell receptor, (TCR); Tumor Growth factor, (TGF); Tumor Necrosis Factor, (TNF); World Health Organisation, (WHO) Received: 22 December 2003; Accepted: 31 December 2003; electronically published: December 2003

Summary Melanomas are immunogenic tumors, presenting a range of tumor-associated antigens (TAA), and cases of spontaneous tumor regression indicate that immune control over melanoma growth can be achieved. Evasion of the immune response is a critical part of tumor development and melanomas can avoid recognition by a variety of mechanisms such as impaired expression of HLA molecules, shedding TAA or secretion of immunosuppressive factors. To enhance antigen presentation and prime effector T lymphocytes, a range of dendritic cell (DC) based melanoma vaccines have been developed. A variety of strategies have been employed using autologous DC to stimulate tumor specific immune responses. Although all of these were apparently successful in vitro, when used in patients the responses were disappointing and they ultimately failed to destroy the tumor in the majority of patients. This may reflect observations that melanoma cells suppress immune responses in vitro, and may prevent the generation of effector cells following DC vaccination. Mature DC are normally potent activators of immune responses. However, when immature, they are often immunosuppressive. The DC found in melanoma and in the sentinel lymph nodes invaded by tumor are of an immature phenotype and therefore may suppress the anti-tumor immune response. We suggest, that a successful vaccine for melanoma must include either mechanisms to reverse in situ DC suppression or increase immune stimulation. immunotherapy. Despite the presence of potent anti-tumor immune cells in their blood, more than 95% of patients gain no benefit from anti-tumor immune therapy. The coexistence of anti-tumor immunity and tumor progression in the same individual remains one of the major paradoxes of melanoma immunology.

I. Introduction A great deal of effort has been put into developing a vaccine for the treatment of melanoma. However none of the current approaches have addressed immune suppression at the tumor site. It is possible that unless this melanoma-derived immune suppression is reversed immunotherapy will be unsuccessful. Melanomas, unlike most other tumors, can be immunogenic, and can present a range of tumor-associated antigens (TAA). Cases of spontaneous tumor regression have been reported even in very advanced disease (Szekeres and Daroczy, 1981; Ralfkiaer et al, 1987; Tefany et al, 1991), and these reports have encouraged efforts towards anti-tumor

II. Escaping immune surveillance It has been recognised for some time that the immune system plays a crucial role in the removal of malignancies arising through somatic mutation. Successful malignancies must survive this surveillance and are therefore subject to selection pressure resulting in 393

Polak et al: Dendritic cell-mediated immunosuppression in malignant melanoma the evolution of escape variants, that can no longer be recognised by either T lymphocytes or NK cells (Burnet, 1970; Festenstein and Garrido, 1986). Since the recognition is based on antigen presentation, the loss of HLA molecules and impaired antigen presentation are the most obvious mechanisms of escape from destruction by cytotoxic T lymphocytes (CTL). Alterations in HLA expression are ubiquitous among tumors, but are also highly variable. So far seven different major modifications of HLA class I phenotypes have been described in different tumor types. These include complete loss of any HLA allele, significant down-regulation of one or more alleles, expression of altered HLA alleles or immunosuppressive HLA alleles, and altered responsiveness to activation signals such as type I interferons (Adrian Cabestre et al, 1999). Loss of HLA class I is often attributable to structural alterations in the proteins involved in antigen processing leading to impaired HLA loading, and therefore surface antigen presentation (Seliger et al, 2001). Melanomas can also express HLA class II proteins, whose expression is generally restricted to APC and activated T cells. This ability does not enhance tumor immune sensitivity, but on the contrary interferes with normal T helper function due to the absence of co-stimulatory molecules such as B7 on the tumor (Becker et al, 1991; Hersey et al, 1994; Becker and Brocker, 1995; Denfeld et al, 1995). Antigen recognition and a successful immune reaction is additionally impeded by heterogeneity in surface protein expression, even within the same tumor (Dalerba et al, 1998). Moreover melanoma cells can shed antigens, which may abrogate anti-tumor cytotoxic cell function or express and release FasL, which causes apoptosis of T lymphocytes and secrete immunosuppressive cytokines (Becker et al, 1991; Ekmekcioglu et al, 1999; Gray et al, 2002; Redondo et al, 2002, 2003; Sombroek et al, 2002; Wolfl et al, 2002; Peguet-Navarro et al, 2003).

either utilised DC directly or used a variety of mechanisms to stimulate them. To find suitable antigens for vaccine purposes, melanoma proteins have been screened in search of peptides with potent immunostimulatory characteristics, presented by both HLA class I and II, to activate both cytotoxic and helper T lymphocytes. Studies have identified HLA class I binding peptides, and several peptides presented in the context of multiple HLA-DR alleles and recognisable by CD4+ T cells (Table 1). Peptides derived from known melanoma associated antigens have been used to load DC generated in vitro from blood or bone marrow precursors or monocytes from both melanoma patients and healthy donors. In order to enhance antigen presentation several peptide modifications have been tested. For example, the proteins were fused with TAP targeting sequence to facilitate antigen processing (Minev et al, 2000) or with heat shock protein to assist antigen delivery into dendritic cells. (Noessner et al, 2002). In one particularly successful approach, fusion of melanoma derived antigen with recombinant HIV transactivating fusion proteins allowed enhancement of the protein incorporation rate to 95% (Table 2). One of the most important disadvantages of peptidebased vaccines is the lack of non-self antigens shared by all melanoma cells. A single epitope is seldom sufficient for the induction of a potent immune response, therefore an ideal vaccine should contain a variety of epitopes and proteins. One way of avoiding these difficulties is to use whole tumor cells, or vesicles secreted by them, as a source of antigen. It has been shown that dendritic cells can phagocytose necrotic (Abdel-Wahab et al, 1998) and apoptotic (Soruri et al, 2001) tumor cells, however in the latter case DC maturation strongly depends on the presence of pro-inflammatory cytokines in the environment (Jenne et al, 2000; Labarriere et al, 2002). One approach to increase vaccine immunogenity exploits the technique of cell fusion. Hybridomas of melanoma cells and dendritic cells have been shown to preserve the features of dendritic cells vital for their function (expression of HLA-A, B, C; HLA-DR; CD40, CD54, CD80, CD83, CD86, and the pro-inflammatory cytokine interleukin-12) and expression of melanoma-associated antigens (Holmes et al, 2001; Soruri et al, 2001; Jantscheff et al, 2002). Endogenous expression of antigen by DC offers the potential advantage of prolonged presentation of antigens in the context of both HLA classes, and potentially extends the repertoire of immune stimulation. Nucleic acid-based immunization provides an attractive method for the delivery of protein antigens and adjuvants, without the need to know the sequence of immunogenic epitopes in advance. Additionally it allows the function of multiple restriction elements for the presentation of the same antigen Kim et al, 1997 and the generation of CD8(+) T cells against multiple class I-restricted epitopes within the antigen (Alijagic et al, 1995; Lapointe et al, 2001; Larregina et al, 2001).

III. Dendritic cell based immune vaccines As the generation of successful anti-tumor immune responses would greatly benefit patients with this aggressive tumor, a number of approaches have been taken to initiate protective immunity. Many of these exploit function of dendritic cells, which act as potent immune response stimulators. Dendritic cells migrate from blood to nearly every tissue in the body, take up antigens and process them. They then migrate to spleen and lymph nodes and deliver the antigens for presentation to lymphocytes. As professional APC they express both HLA class I and II, and can additionally therefore activate both helper and cytotoxic T lymphocytes. They can crossprocess antigens between these two pathways and in this way switch the immune response type and evoke cytotoxic reactions against endogenous tumor antigens (Albert et al, 1998a, 1998b; Banchereau and Steinman, 1998; Inaba et al, 1998) (Figure 1). Numerous vaccine strategies have

394

Cancer Therapy Vol 1, page 395

Figure 1 Role of dendritic cells in immune system activation. Dendritic cells reside in the majority of tissues, and continuously acquire and process the antigens form the environment (1). The antigen uptake gives them a primary signal for maturation. They start production of proteins necessary for antigen presentation and they migrate via blood to deliver the antigens to spleen and lymph nodes (2). Being antigen-presenting cells, they express both HLA class I and II, and can therefore activate both helper and cytotoxic T lymphocytes. Furthermore, they can cross-process antigens between these two pathways and thus switch the immune response type and evoke cytotoxic reactions against endogenous tumour antigens presented in their HLA proteins. Providing the secondary activation signal (accessory molecules and cytokines), they prevent lymphocyte anergy, resulting in the generation of an army of sensitised cytotoxic and helper, effector and memory lymphocytes (3).

Table 1. Examples of defined epitopes suitable for anti-melanoma immune vaccine therapy. Protein NY-ESO-1

MAGE-3

gp-100

MelanA/MART-1

HER2/neu

HLA-I binding peptides HLA-II binding peptides Cancer-testis antigens + 119-143 119-143 TQHFVQENYLEY EVDPIGHLY Melanocyte differentiation antigens gp100[9(87)] gp100[10(86)

GILTVILGV ALMDKSLHV 51-73 Widely expressed antigens 776-788

395

Authors Jager et al, 2000; Zarour et al, 2002, 2000b Schultz et al, 2000, Schultz et al, 2001 Kawashima et al, 1998 Cochlovius et al, 1999 Cochlovius et al, 2000 Kierstead et al, 2001 van Elsas et al, 1996 Zarour et al, 2000a Sotiriadou et al, 2001

Polak et al: Dendritic cell-mediated immunosuppression in malignant melanoma Table 2. In vitro immune response mediated by melanoma antigens loaded dendritic cells. Antigen source Defined peptide (MAA)

Antigen presentation +++

Melanoma cell lysates

+++ crosspresentation

+++

Inducted cells CTL, NK, Th lymphocytes

Cytotoxic reactivity anti:

References

Bakker et al., 1995; Saeterdal et al., 1998 Tjandrawan et al., 1998 AbdelWahab et al., 1998 Dhodapkar et al., 2000; Kikuchi et al., 2001; Minev et al., 2000; Yang et al., 2002 Noessner et al., 2002 Tanaka et al., 2003 Abdel-Wahab et al., 1998 Soruri et al., 1998 Imro et al., 1999 Berard et al., 2000 Nouri-Shirazi et al., 2000 Jenne et al., 2000; Labarriere et al., 2002 Whiteside et al., 2002 Bateman et al., 2002 Russo et al., 2000 Andre et al., 2002 Holmes et al., 2001 Soruri et al., 2001 Jantscheff et al., 2002 Reeves et al., 1996 Bettinotti et al., 1998; Tuting et al., 1998 Chinnasamy et al., 2000 Yang et al., 2000 Kim et al., 1998 Drexler et al., 1999 Linette et al., 2000 Motta et al., 2001; Philip et al., 2000 Lapointe et al., 2001 Larregina et al., 2001; Smith et al., 2001 Firat et al., 2002 Prabakaran et al., 2002 Temme et al., 2002 Sumimoto et al., 2002

Peptide loaded target cells Tumor cell lines Normal melanocytes Autologous tumor cells

CTL, Th lymphocytes

Autologous tumor cells

CTL, Th lymphocytes (1 study)

Cells presenting MAA antigens Autologous tumor cells

Hybridomas Genetically modified cells

activity are potentially of great clinical significance as they provide a mechanism for lysis of tumor cells that have lost HLA expression (Saeterdal et al, 1998) It is the ability of in vitro expanded lymphocytes to recognize naturally processed and presented epitopes that illustrates the potential use of dendritic cells for vaccination in human cancer. Unfortunate therefore that, despite these encouraging results, so far none of these strategies has found direct effective translation to patient care.

IV. In vitro efficacy of dendritic cells vaccines Overall, the majority of the in vitro approaches described have been successful, with regards to antigen incorporation/transfection rate, protein production and presentation, and T-lymphocyte activation. Experiments in vitro have proved that dendritic cells are able to process and present melanoma-specific antigens derived from whole melanoma cells, synthesised or purified peptides or when they are genetically modified to produce tumor antigens (Table 2). Moreover, synergistic effects of viral transfection and DC maturation have been observed (Rea et al, 2001; Temme et al, 2002). Transfected DC synthesised the desired product, and the antigen expression remained detectable for at least 7 days. Also DC loaded with killed tumor cells can induce HLA class Iand class II-restricted proliferation of autologous CD8+ and CD4+ T cells, and are therefore able to cross-present tumor cell-derived antigens. In all cases they presented a broad range of tumor antigen epitopes in the context of multiple HLA alleles and stimulated several types of lymphocytes reactive against multiple melanoma antigens. In the vast majority of studies both proliferative and cytotoxic responses were reported. Lymphocytes cocultured with genetically modified DC produced Th1 type cytokines and showed multiple antigen specific cytotoxic responses, against melanoma cell lines, HLA-matched B cell lines pulsed with peptide and, most importantly, autologous tumor (Table 2). Induction of not only cytotoxic and helper lymphocytes, but also clones of NK cells have been reported. Tumor-specific T cells with NK

V. Response vaccination

patients

Despite dendritic cells being increasingly used for the immunotherapy of melanoma only a few tumor remissions due to vaccination have been reported (Table 3). Several phase I/II clinical studies have shown that DC vaccines are non-toxic (no grade 3 or 4 WHO scale toxicities), that vaccine injections are well tolerated, and that DC derived in vitro are viable after injection and can mediate biologic activity in situ (Table 3 ). Both adjuvant therapies and dendritic cell based vaccines caused infiltration of immune cells (both dendritic cells and lymphocytes as well as numerous other types) into the site of vaccination, and the cytotoxic tests on patients immune cells obtained after one or several courses of vaccine administration have given encouraging results. Peripheral blood lymphocytes from patients recognised melanoma cells in vitro, produced pro-inflammatory cytokines and

396

Cancer Therapy Vol 1, page 397 Table 3. Clinical outcome of DC based vaccines No Patients

DC targeted adjuvants GM-CSF 72

DC infiltration

5/5 studies

GM-CSF + 51 1/2 studies Other adjuvants Antigen modified dendritic cells Autologous 7 1/1 studies DC injected into tumor site Peptide loaded 172 3/13 studies

Melanoma lysates loaded

Genetically modified

1/3 studies

T lymphocytes infiltration

Objective response rate â&#x20AC;&#x201C; overall percentage Complete response

Partial response

16.7%

22,5%

27%

1/1 studies

57%

4/13 studies

12%

2/4 studies

12%

13.6%

1.5%

1/3 studies

4/5 studies

References

Disease stabilisation Nasi et al., 1999 Kusumoto et al., 2001 Zehntner et al., 1999 Chang et al., 2000; Soiffer et al., 1998 Janik et al., 1999; Schachter et al., 1998

Triozzi et al., 2000

Lotze et al., 1997; Thurner et al., 1999 Lotze et al., 2000 Mackensen et al., 2000 Panelli et al., 2000 Schuler-Thurner et al., 2000 Andersen et al., 2001 Banchereau et al., 2001 Lau et al., 2001 Thomas et al., 2001 Toungouz et al., 2001 Schuler-Thurner et al., 2002 Smithers et al., 2003 Nestle, 2000 Chang et al., 2002 Krause et al., 2002 O'Rourke et al., 2003 Housseau et al., 2002 Nair et al., 2002 Tsao et al., 2002

intra-cutaneous injections (Schachter et al, 1998; Janik et al, 1999; Nasi et al, 1999) and the use of genetically modified melanoma cells (Soiffer et al, 1998; Zehntner et al, 1999; Chang et al, 2000; Kusumoto et al, 2001) have been used for vaccine administration either alone or in combination with other cytokines (Janik et al, 1999) and cytotoxic agents (Schachter et al, 1998). Vaccine evaluation was based on immunohistochemical staining of vaccine site biopsies, peripheral blood analysis and functional tests in vitro, as well as clinical outcome. In most cases, despite DC and lymphocyte influx into metastatic tumor sites and the successful specific activation of anti-tumor T lymphocytes, the clinical outcome was far from satisfactory. In two studies achieved remission in only one patient (Chang et al, 2000; Kusumoto et al, 2001), and in three, no anti-tumor effects were observed. In the study performed by Soiffer and colleagues, extensive tumor destruction was observed, but no durable complete remission was reported. (Soiffer et al, 1998). The adjuvant vaccine worked well however when combined with chemotherapy, giving a response rate over 50%. Nevertheless the drug regimen, including cytokines,

even killed melanoma cells from cell lines or autologous tumors. Nevertheless, the vaccination was ultimately unsuccessful in most cases, since the melanoma survived and the patient died (Table 3).

A. Adjuvants Adjuvants stimulate DC and in this way enhance immune response. An early attempt to induce clinical inflammatory response in vivo using the dinitrophenyl (DNP) -conjugated melanoma cell immunization of DNPpre-sensitised patients resulted in cutaneous DTH. In half of the patients the inflammatory reaction was confirmed and caused regression of metastases within 2-4 months. The inflammatory response was associated with the infiltration of CD8+ T cells, enhanced expression of ICAM-1 and HLA-DR by melanoma cells and the presence of numerous HLA-DR+, CD4+, CD1-, Leu-1dendritic cells (Murphy et al, 1993). The cytokine GM-CSF stimulates DC maturation in vitro and has been used to stimulate DC activation in vivo. (Mortarini et al, 1997; Chen et al, 2001). Direct sub- or 397

Polak et al: Dendritic cell-mediated immunosuppression in malignant melanoma was very toxic, and this strategy has not been explored further (Schachter et al, 1998). These results are consistent with adjuvant clinical trial studies, where IL2, IFN g, and GM-CSF did not result in an improved clinical outcome (McClay, 2002).

and therefore unable to perform any anti-tumor activity. It is well known that tumors are immune privileged sites and that they create an immunosuppressive environment around themselves, preventing inflammatory responses. This is thought to be achieved by the secretion of a range of immunosuppressive cytokines, such as IL-10, IL-19, IL-6, TGF b1 and 2, macrophage migration-inhibitory factor, gangliosides, heavy chain ferritin, ICAM-1 and prostaglanoids. In addition tumors are not only resistant to TNF receptor pathway mediated apoptosis, but can also express and secrete FasL, which causes apoptosis of activated lymphocytes (Ekmekcioglu et al, 1999; Gray et al, 2002; Redondo et al, 2002; Sombroek et al, 2002; Peguet-Navarro et al, 2003; Redondo et al, 2003; Wolfl et al, 2002).

B. DC vaccines Several clinical trials of DC-based anti-melanoma vaccines have been performed (Table 3). In a study by Triozzi and colleagues the biologic activity of dendritic cells injected directly into tumors was examined. This pilot study demonstrated that DC derived in vitro were viable after intratumoral injection and could mediate biologic activity in situ. (Triozzi et al, 2000) Whether applied intravenously or intradermally, DC can easily migrate to lymphoid organs and tumor sites (Mackensen et al, 1999; Thomas et al, 1999). Many T cell anti-tumor responses were measured, and in 7 out of 9 trials at least transient tumor-specific PBL activity was observed. (Table 3). When keyhole limpet hemocyanin (KLH) was administered, activation of helper T lymphocytes was reported; with DTH directed both against KHL and tumor cells (Nestle et al, 1998; Toungouz et al, 2001; Chang et al, 2002). Unfortunately, despite the high in vitro anti-tumor activity of patients’ PBL, the clinical outcome was not very successful. A maximum overall response rate of 25.6% has been reported with a12% complete response rate (Table 3). Interestingly, the most potent immune response was induced when autologous tumor material was used (Andersen et al, 2001; Thomas et al, 2001; Krause et al, 2002; O'Rourke et al, 2003; Smithers et al, 2003)

VII. Modulation of immune responses by dendritic cells Since inappropriate immune responses can be dangerous (if e.g. induced against healthy tissue), they must be carefully regulated. DC subsets play crucial roles in the selection process in the thymus as well as regulatory roles in lymph nodes and the periphery. One of the most characteristic features of dendritic cells is the transformation of their phenotype during maturation. DC function is highly dependent on their level of maturation, and cells in various stages of development differ not only in their morphology but also completely alter their surface antigen expression. In humans, the presence of immature DC has been reported in most organs, including liver, kidney and heart, where they tend to be associated with vascular structures (Hart, 1997; Banchereau and Steinman, 1998). An interdigitating sentinel epithelial network of DC has been described in the mucosa of the oral cavity, intestinal tract and the respiratory tract (Hart, 1997). It is increasingly believed that tissue-residing immature dendritic cells constantly incorporate and process various proteins from their environment. Under physiological conditions, they express few self-antigens on their surface for presentation to T lymphocytes. However, since the dendritic cells are immature, they do not express co-stimulatory molecules, and what results is impaired lymphocyte activation, and anergy. This simple mechanism eliminates self-reactive lymphocytes, and prevents autoimmunity (Hart, 1997; Banchereau and Steinman, 1998; Lutz and Schuler, 2002). Tissue resident immature dendritic cells can also phagocytose apoptotic bodies formed when neighbouring cells die by apoptosis. Normally this will not result in an immune response, however, if apoptosis was the result of a viral infection then additional signals at the site of infection (e.g. IFNa, HSP) induce dual activation and maturation of dendritic cells, and launch an immune reaction (Hart 1997; Banchereau and Steinman, 1998; Lutz and Schuler, 2002). It is not only immature tissue-resident dendritic cells that anergise T lymphocytes. The presence of “semimatured” dendritic cells circulating in the blood of healthy donors was described by Lutz and Schuler (2002). These

VI. Reasons for the failure of DC vaccination Given that all of the strategies tested are equally successful in vitro, that their application routes in general do not differ, and that they are all based on autologous dendritic cells obtained either from patients blood, generated from CD34+ precursors ex vivo, or monocytes, the reason for the failure to eradicate the tumor is probably independent of the methods of vaccination. Since antitumor PBL activity has been shown, this suggests patients’ immune systems are capable of producing a wide range of cytotoxic cells, potentially able to recognise tumor antigens. It appears, that although the immune response against melanoma tumors has been induced, in patients its effector phase is not carried through to completion. There are several possible explanations for the failure of DC vaccinations to eliminate tumor. The simplest explanation would be that the modified cells or presensitised CTL might have been unable to penetrate the tumor or that the antigen specificity of the CTL may have been too narrow. Studies have however confirmed the generation of potent anti-tumor CTL and their successful migration into the tumor site (Table 3). Alternatively, the CTL may be suppressed or killed at the site of the tumor

398

Cancer Therapy Vol 1, page 399 cells are loaded with self-antigen, and express antigens associated with a mature phenotype, but do not release cytokines, and therefore do not provide sufficient activation signals for lymphocytes. They react with CD4+ lymphocytes, inducing a subset of regulatory helper lymphocytes, which remain in the organism as memory cells, providing a mechanism that supports peripheral tolerance.

VIII. Melanoma derived, mediated immune control

In the presence of melanoma cells or tumor conditioned media, CD 80, 86 and HLA class I and II are up-regulated on the DC surface, even though expression of immature DC-related antigens like E-cadherin is retained, and the DC maturity factor, CD 83, is not expressed (Remmel et al, 2001; Padovan et al, 2002). These cells therefore have a phenotype allowing antigen presentation by immature cells, leading to the suppression of antigen-specific immune responses. It may be worth considering whether the characteristic dissemination of melanoma via the lymphatics and primary metastatic spread into the lymph nodes is coincidental.

A. Altered phenotype of lymph nodes invaded by melanoma The induction of T lymphocyte anergy in tissues and the creation of a population of regulatory cells are two distinct pathways leading to tolerance to self-antigens. Thanks to these control mechanisms, severe autoimmune reactions can be avoided. If however dendritic cells are kept artificially immature, it creates a potential hazard for the function of immune system. Many groups have reported alterations in cell ratio and function in lymph nodes invaded by melanoma. Several authors observed the recruitment of immature plasmacytoid dendritic cells, and T lymphocytes with a suppressive phenotype. (Fernandez-Bussy et al, 1983; Lana et al, 2001; Salio et al, 2003; Vermi et al, 2003). A comparison between sentinel and non-sentinel lymph nodes showed a quantitative reduction in dendritic cell markers, in the sentinel lymph node. This suggests a loss of mature DC and a concomitant decrease in total DC content (Essner and Kojima, 2002) Histological studies show a profound decrease in the number of antigen-presenting cells expressing HLA class II in the epidermis above the melanoma, with zonal immune suppression in involved lymph nodes. There are decreased numbers of DC in the paracortex of the lymph node, and the majority of remaining LC and DC are phenotypically immature (Fernandez-Bussy et al, 1983; Cochran et al, 1987; Toriyama et al, 1993; Garcia-Plata et al, 1995; Barbour and Coventry, 2003) (Figure 2). In vitro assays confirmed the suppressed functional characteristics of cells derived from melanoma-invaded sentinel lymph nodes or exposed to conditioned supernatants from melanoma cell cultures (Hoon et al, 1987a, 1987b; Farzad et al, 1997; Chang et al, 1999). Several studies have examined the tolerizing influence of melanoma cells on the maturation and function of DC and show that under the influence of melanoma, DC acquire an immunosuppressive phenotype and cause the generation of anergic T lymphocytes. The immunostimulatory function of DC obtained from progressing and regressing melanoma metastases show a significant difference in the abilities of each population. In addition, monocyte-derived DC exposed to tumor supernatant failed to acquire full allo-stimulatory activity and rapidly underwent apoptosis (Enk et al, 1997; Steinbrink et al, 1999; Kiertscher et al, 2000; Steinbrink et al, 2002).

B Dendritic cells as a key to immune escape Melanoma is a tumor recognisable to the immune system and cannot grow and develop in the presence of a competent immune system. In the early stages of tumor development melanoma acquire an â&#x20AC;&#x153;invisibleâ&#x20AC;? phenotype following the selection pressure of the immune system. This however might be not enough to ensure further tumor cell survival. The tumor needs a more secure and permanent strategy. Lymph nodes are the nerve centres of the immune response, places where antigens are presented to lymphocytes and where decisions about immune responses are made. By invading these, melanoma creates an immune-privileged site in the centre of immune reaction. What can be harmful to infiltrating cytotoxic cells must also influence to at least the same degree any regulatory cells residing in vicinity. Dendritic cells act as the key component in immune reaction regulation. Under normal circumstances they are able to stimulate populations of lymphocytes against danger (e.g. tumor cells), however if their maturation is halted and their phenotype switched into modulatory mode, instead of immune stimulation, they will induce immune tolerance. Melanoma cells have the potential to keep dendritic cells in an immature state (Figure 2), impaired and suppressed, yet able to control and suppress other components of the immune response. By invading lymph nodes, melanoma acquire a potent strategy of immune evasion. The hunted transforms into the hunter â&#x20AC;&#x201C; instead of escaping the immune system, in effect the melanoma takes control and deletes the tumor sensitive lymphocytes at the command centre of immune reactivity (Figure 3). Functional alterations in lymph nodes invaded by melanoma should be considered when attempting immune therapy. If our hypothesis is correct, any external immune intervention is unlikely to result in tumor destruction, despite the induction of immunocompetent cells. Tumor specific cytotoxic cells will migrate into the lymph nodes and instead of being activated they will be anergized and may undergo apoptosis due to the interaction with dendritic cells modulated by the melanoma. To obtain a successful anti-melanoma vaccination, the immune suppression in draining lymph nodes must be overcome.

399

Polak et al: Dendritic cell-mediated immunosuppression in malignant melanoma

Figure 2. Presence of immature DC within the lymphoid tissue (Immunohistochemistry): FXIIIa staining of cells without protrusions.

Figure 3. Suppression of immune system managed by melanoma-derived altered maturation of dendritic cells. Antigen presentation by immature dendritic cells is one of the immune control mechanisms. Dendritic cells kept in the immature state by cytokines released by melanoma are capable to modulate immune response and anergise antigen specific T lymphocytes. This mechanism can be potentially used by melanoma to avoid immune recognition and to suppress the immune reaction. Albert ML, Sauter B, Bhardwaj N (1998b) Dendritic cells acquire antigen from apoptotic cells and induce class Irestricted CTLs. Nature, 392, 86-89. Alijagic S, Moller P, Artuc M, Jurgovsky K, Czarnetzki BM, Schadendorf D (1995) Dendritic cells generated from peripheral blood transfected with human tyrosinase induce specific T cell activation. Eur J Immunol 25, 3100-3107. Andersen MH, Keikavoussi P, Brocker EB, Schuler-Thurner B, Jonassen M, Sondergaard, I, Straten, PT, Becker, JC, Kampgen E (2001) Induction of systemic CTL responses in melanoma patients by dendritic cell vaccination, cessation of CTL responses is associated with disease progression. Int J Cancer 94, 820-824. Andre F, Schartz NE, Movassagh M, Flament C, Pautier P, Morice P, Pomel C, Lhomme C, Escudier B, Le Chevalier T, Tursz T, Amigorena S, Raposo G, Angevin E, Zitvogel L (2002) Malignant effusions and immunogenic tumourderived exosomes. Lancet 360, 295-305. Bakker AB, Marland G, de Boer AJ, Huijbens RJ, Danen EH, Adema GJ, Figdor CG (1995) Generation of antimelanoma cytotoxic T lymphocytes from healthy donors after presentation of melanoma-associated antigen-derived epitopes by dendritic cells in vitro. Cancer Res 55, 53305334.

Acknowledgements We are grateful to Ms Penny Johnson for expert technical assistance. The study was funded by Wessex Cancer Trust UK.

References Abdel-Wahab Z, DeMatos P, Hester D, Dong XD, Seigler HF (1998) Human dendritic cells, pulsed with either melanoma tumor cell lysates or the gp100 peptide (280-288, induce pairs of T-cell cultures with similar phenotype and lytic activity. Cell Immunol 186, 63-74. Adrian Cabestre F, Moreau P, Riteau B, Ibrahim EC, Le Danff C, Dausset, J, Rouas-Freiss N, Carosella ED, Paul P (1999) HLA-G expression in human melanoma cells, protection from NK cytolysis. J Reprod Immunol 43, 183-193. Albert ML, Pearce SF, Francisco LM, Sauter B, Roy P, Silverstein RL, Bhardwaj N (1998a) Immature dendritic cells phagocytose apoptotic cells via alphavbeta5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J Exp Med 188, 1359-1368.

400

Cancer Therapy Vol 1, page 401 Banchereau J, Palucka AK, Dhodapkar M, Burkeholder S, Taque N, Rolland A, Taquet S, Coquery S, Wittkowski KM, Bhardwaj N, Pineiro L, Steinman R, Fay J (2001) Immune and clinical responses in patients with metastatic melanoma to CD34 (+) progenitor-derived dendritic cell vaccine. Cancer Res 61, 6451-6458. Banchereau J, Steinman RM (1998) Dendritic cells and the control of immunity. Nature 392, 245-252. Barbour AH, Coventry, BJ (2003) Dendritic cell density and activation status of tumour-infiltrating lymphocytes in metastatic human melanoma, possible implications for sentinel node metastases. Melanoma Res 13, 263-269. Bateman AR, Harrington KJ, Kottke T, AhMed A, Melcher AA, Gough MJ, Linardakis E, Riddle D, Dietz A, Lohse CM, Strome S, Peterson T, Simari R, Vile RG (2002) Viral fusogenic membrane glycoproteins kill solid tumor cells by nonapoptotic mechanisms that promote cross presentation of tumor antigens by dendritic cells. Cancer Res 62, 65666578. Becker JC, Brocker, EB (1995) Lymphocyte-melanoma interaction, role of surface molecules. Recent Results Cancer Res 139, 205-214. Becker JC, Dummer R, Hartmann AA, Burg G, Schmidt RE (1991) Shedding of ICAM-1 from human melanoma cell lines induced by IFN-gamma and tumor necrosis factoralpha. Functional consequences on cell-mediated cytotoxicity. J Immunol 147, 4398-4401. Berard F, Blanco P, Davoust J, Neidhart-Berard EM, NouriShirazi M, Taquet N, Rimoldi D, Cerottini JC, Banchereau J, Palucka AK (2000) Cross-priming of naive CD8 T cells against melanoma antigens using dendritic cells loaded with killed allogeneic melanoma cells. J Exp Med 192, 15351544. Bettinotti MP, Kim CJ, Lee KH, Roden M, Cormier JN, Panelli M, Parker KK, Marincola FM (1998) Stringent allele/epitope requirements for MART-1/Melan A immunodominance, implications for peptide-based immunotherapy. J Immunol 161, 877-889. Burnet FM (1970) The concept of immunological surveillance. Prog Exp Tumor Res 13, 1-27. Chang AE, Li Q, Bishop DK, Normolle DP, Redman BD, Nickoloff BJ (2000) Immunogenetic therapy of human melanoma utilizing autologous tumor cells transduced to secrete granulocyte-macrophage colony-stimulating factor. Hum Gene Ther 11, 839-850. Chang AE, Redman BG, Whitfield JR, Nickoloff BJ, Braun TM, Lee PP, Geiger JD, Mule JJ (2002) A phase I trial of tumor lysate-pulsed dendritic cells in the treatment of advanced cancer. Clin Cancer Res 8, 1021-1032. Chang JW, Vaquerano JE, Zhou YM, Peng M, Leong SP (1999) Characterization of dendritic cells generated from peripheral blood of patients with malignant melanoma. Anticancer Res 19, 1815-1820. Chen B, Stiff P, Sloan G, Kash J, Manjunath R, Pathasarathy M, Oldenburg D, Foreman KE, Nickoloff BJ (2001) Replicative response, immunophenotype, and functional activity of monocyte-derived versus CD34 (+)-derived dendritic cells following exposure to various expansion and maturational stimuli. Clin Immunol 98, 280-292. Chinnasamy N, Chinnasamy D, Toso JF, Lapointe R, Candotti F, Morgan RA, Hwu P (2000) Efficient gene transfer to human peripheral blood monocyte-derived dendritic cells using human immunodeficiency virus type 1-based lentiviral vectors. Hum Gene Ther 11, 1901-1909. Cochlovius B, Linnebacher M, Zewe-Welschof M, Zoller M (1999) Recombinant gp100 protein presented by dendritic cells elicits a T-helper-cell response in vitro and in vivo. Int J Cancer 83, 547-554.

Cochlovius B, Stassar M, Christ O, Raddrizzani L, Hammer J, Mytilineos I, Zoller M (2000) In vitro and in vivo induction of a Th cell response toward peptides of the melanomaassociated glycoprotein 100 protein selected by the TEPITOPE program. J Immunol 165, 4731-4741. Cochran AJ, Pihl E, Wen DR, Hoon DS, Korn EL (1987) Zoned immune suppression of lymph nodes draining malignant melanoma, histologic and immunohistologic studies. J Natl Cancer Inst 78, 399-405. Dalerba P, Ricci A, Russo V, Rigatti D, Nicotra MR, Mottolese M, Bordignon C, Natali PG, Traversari C (1998) High homogeneity of MAGE, BAGE, GAGE, tyrosinase and Melan-A/MART-1 gene expression in clusters of multiple simultaneous metastases of human melanoma, implications for protocol design of therapeutic antigen-specific vaccination strategies. Int J Cancer 77, 200-204. Denfeld RW, Dietrich A, Wuttig C, Tanczos E, Weiss JM, Vanscheidt W, Schopf E, Simon JC (1995) In situ expression of B7 and CD28 receptor families in human malignant melanoma, relevance for T-cell-mediated anti-tumor immunity. Int J Cancer, 62, 259-265. Dhodapkar MV, Young JW, Chapman PB, Cox WI, Fonteneau JF, Amigorena S, Houghton AN, Steinman RM, Bhardwaj N (2000) Paucity of functional T-cell memory to melanoma antigens in healthy donors and melanoma patients. Clin Cancer Res 6, 4831-4838. Drexler I, Antunes E, Schmitz M, Wolfel T, Huber C, Erfle V, Rieber P, Theobald M, Sutter G (1999) Modified vaccinia virus Ankara for delivery of human tyrosinase as melanomaassociated antigen, induction of tyrosinase- and melanomaspecific human leukocyte antigen A*0201-restricted cytotoxic T cells in vitro and in vivo. Cancer Res 59, 49554963. Ekmekcioglu S, Okcu MF, Colome-Grimmer MI, Owen-Schaub L, Buzaid AC, Grimm EA (1999) Differential increase of Fas ligand expression on metastatic and thin or thick primary melanoma cells compared with interleukin-10. Melanoma Res 9, 261-272. Enk AH, Jonuleit H, Saloga J, Knop J (1997) Dendritic cells as mediators of tumor-induced tolerance in metastatic melanoma. Int J Cancer 73, 309-316. Essner R, Kojima M (2002) Dendritic cell function in sentinel nodes. Oncology (Huntingt, 16 (1 Suppl 1, 27-31. Farzad Z, McBride WH, Ogbechi H, Asnong-Holthoff C, Morton DL, Cochran AJ (1997) Lymphocytes from lymph nodes at different distances from human melanoma vary in their capacity to inhibit/enhance tumor cell growth in vitro. Melanoma Res 7 Suppl 2, S59-65. Fernandez-Bussy R, Cambazard F, Mauduit G, Schmitt D, Thivolet J (1983) T cell subsets and Langerhans cells in skin tumours. Eur J Cancer Clin Oncol, 19, 907-913. Festenstein H, Garrido F (1986) MHC antigens and malignancy. Nature, 322, 502-503. Firat H, Zennou V, Garcia-Pons F, Ginhoux F, Cochet M, Danos O, Lemonnier FA, Langlade-Demoyen P, Charneau P (2002) Use of a lentiviral flap vector for induction of CTL immunity against melanomaPerspectives for immunotherapy. J Gene Med 4, 38-45. Garcia-Plata D, Lessana-Leibowitch M, Palangie A, Gulliemette J, Sedel D, Mendez L, Mozos E (1995) Immunophenotype analysis of dendritic cells and lymphocytes associated with cutaneous malignant melanomas. Invasion Metastasis, 15, 125-134. Gray CP, Arosio P, Hersey P (2002) Heavy chain ferritin activates regulatory T cells by induction of changes in dendritic cells. Blood, 99, 3326-3334.

401

Polak et al: Dendritic cell-mediated immunosuppression in malignant melanoma Hart DN (1997) Dendritic cells, unique leukocyte populations which control the primary immune response. Blood, 90, 3245-3287. Hersey P, Si Z, Smith MJ, ThomasWD (1994) Expression of the co-stimulatory molecule B7 on melanoma cells. Int J Cancer, 58, 527-532. Holmes LM, Li J, Sticca RP, Wagner TE, Wei Y (2001) A rapid, novel strategy to induce tumor cell-specific cytotoxic T lymphoctye responses using instant dentritomas. J Immunother, 24, 122-129. Hoon DS, Bowker RJ, Cochran AJ (1987a) Suppressor cell activity in melanoma-draining lymph nodes. Cancer Res 47, 1529-1533. Hoon DS, Korn EL, Cochran AJ (1987b) Variations in functional immunocompetence of individual tumor-draining lymph nodes in humans. Cancer Res 47, 1740-1744. Housseau F, Lindsey KR, Oberholtzer SD, Gonzales MI, Boutin P, Moorthy AK, Shankara S, Roberts BL, Topalian SL (2002) Quantitative real-time RT-PCR as a method for monitoring T lymphocyte reactivity to full-length tyrosinase protein in vaccinated melanoma patients. J Immunol Methods 266, 87-103. Imro MA, Manici S, Russo V, Consogno G, Bellone M, Rugarli C, Traversari C, Protti MP (1999) Major histocompatibility complex class I restricted cytotoxic T cells specific for natural melanoma peptides recognize unidentified shared melanoma antigen (s). Cancer Res 59, 2287-2291. Inaba K, Turley S, Yamaide F, Iyoda T, Mahnke K, Inaba M, Pack M, Subklewe M, Sauter B, Sheff D, Albert M, Bhardwaj N, Mellman I, Steinman RM (1998) Efficient presentation of phagocytosed cellular fragments on the major histocompatibility complex class II products of dendritic cells. J Exp Med 188, 2163-2173. Jager E, Jager D, Karbach J, Chen YT, Ritter G, Nagata Y, Gnjatic S, Stockert E, Arand M, Old LJ, Knuth A (2000) Identification of NY-ESO-1 epitopes presented by human histocompatibility antigen (HLA)-DRB4*0101-0103 and recognized by CD4 (+) T lymphocytes of patients with NYESO-1-expressing melanoma. J Exp Med 191, 625-630. Janik JE, Miller LL, Kopp WC, Taub DD, Dawson H, Stevens D, Kostboth P, Curti BD, Conlon KC, Dunn BK, Donegan SE, Ullrich R, Alvord WG, Gause BL, Longo DL (1999) Treatment with tumor necrosis factor-alpha and granulocytemacrophage colony-stimulating factor increases epidermal Langerhans' cell numbers in cancer patients. Clin Immunol 93, 209-221. Jantscheff P, Spagnoli G, Zajac P, Rochlitz CF (2002) Cell fusion, an approach to generating constitutively proliferating human tumor antigen-presenting cells. Cancer Immunol Immunother 51, 367-375. Jenne L, Arrighi JF, Jonuleit H, Saurat JH, Hauser C (2000) Dendritic cells containing apoptotic melanoma cells prime human CD8+ T cells for efficient tumor cell lysis. Cancer Res 60, 4446-4452. Kawashima I, Tsai V, Southwood S, Takesako K, Celis E, Sette A (1998) Identification of gp100-derived, melanoma-specific cytotoxic T-lymphocyte epitopes restricted by HLA-A3 supertype molecules by primary in vitro immunization with peptide-pulsed dendritic cells. Int J Cancer, 78, 518-524. Kierstead LS, Ranieri E, Olson W, Brusic V, Sidney J, Sette A, Kasamon YL, Slingluff CL, Jr, Kirkwood JM, Storkus WJ (2001) gp100/pmel17 and tyrosinase encode multiple epitopes recognized by Th1-type CD4+T cells. Br J Cancer 85, 1738-1745. Kiertscher SM, Luo J, Dubinett SM, Roth MD (2000) Tumors promote altered maturation and early apoptosis of monocytederived dendritic cells. J Immunol 164, 1269-1276.

Kikuchi A, Nieda M, Schmidt C, Koezuka Y, Ishihara S, Ishikawa Y, Tadokoro K, Durrant S, Boyd A, Juji T, Nicol A (2001) In vitro anti-tumour activity of alphagalactosylceramide-stimulated human invariant Valpha24+NKT cells against melanoma. Br J Cancer 85, 741-746. Kim CJ, Cormier J, Roden M, Gritz L, Mazzara GP, Fetsch P, Hijazi Y, Lee KH, Rosenberg SA, Marincola FM (1998) Use of recombinant poxviruses to stimulate anti-melanoma T cell reactivity. Ann Surg Oncol 5, 64-76. Kim CJ, Prevette T, Cormier J, Overwijk W, Roden M, Restifo NP, Rosenberg SA, Marincola FM (1997) Dendritic cells infected with poxviruses encoding MART-1/Melan A sensitize T lymphocytes in vitro. J Immunother 20, 276286. Krause SW, Neumann C, Soruri A, Mayer S, Peters JH, Andreesen R (2002) The treatment of patients with disseminated malignant melanoma by vaccination with autologous cell hybrids of tumor cells and dendritic cells. J Immunother 25, 421-428. Kusumoto M, Umeda S, Ikubo A, Aoki Y, Tawfik O, Oben R, Williamson S, Jewell W, Suzuki T (2001) Phase 1 clinical trial of irradiated autologous melanoma cells adenovirally transduced with human GM-CSF gene. Cancer Immunol Immunother 50, 373-381. Labarriere N, Bretaudeau L, Gervois N, Bodinier M, Bougras G, Diez E, Lang F, Gregoire M, Jotereau F (2002) Apoptotic body-loaded dendritic cells efficiently cross-prime cytotoxic T lymphocytes specific for NA17-A antigen but not for Melan-A/MART-1 antigen. Int J Cancer 101, 280-286. Lana AM, Wen DR, Cochran AJ (2001) The morphology, immunophenotype and distribution of paracortical dendritic leucocytes in lymph nodes regional to cutaneous melanoma. Melanoma Res 11, 401-410. Lapointe R, Royal RE, Reeves ME, Altomare I, Robbins PF, Hwu P (2001) Retrovirally transduced human dendritic cells can generate T cells recognizing multiple MHC class I and class II epitopes from the melanoma antigen glycoprotein 100. J Immunol 167, 4758-4764. Larregina AT, Watkins SC, Erdos G, Spencer LA, Storkus WJ, Beer Stolz D, Falo LD, Jr (2001) Direct transfection and activation of human cutaneous dendritic cells. Gene Ther 8, 608-617. Lau R, Wang F, Jeffery G, Marty V, Kuniyoshi J, Bade E, Ryback ME, Weber J (2001) Phase I trial of intravenous peptide-pulsed dendritic cells in patients with metastatic melanoma. J Immunother 24 (, 66-78. Linette GP, Shankara S, Longerich S, Yang S, Doll R, Nicolette C, Preffer FI, Roberts BL, Haluska FG (2000) In vitro priming with adenovirus/gp100 antigen-transduced dendritic cells reveals the epitope specificity of HLA-A*0201restricted CD8+ T cells in patients with melanoma. J Immunol 164, 3402-3412. Lotze MT, Hellerstedt B, Stolinski L, Tueting T, Wilson C, Kinzler D, Vu H, Rubin JT, Storkus W, Tahara H, Elder E, Whiteside T (1997) The role of interleukin-2, interleukin-12, and dendritic cells in cancer therapy. Cancer J Sci Am 3 Suppl 1, S109-114. Lotze MT, Shurin M, Esche C, Tahara H, Storkus W, Kirkwood JM, Whiteside TL, Elder EM, Okada H, Robbins P (2000) Interleukin-2, developing additional cytokine gene therapies using fibroblasts or dendritic cells to enhance tumor immunity. Cancer J Sci Am 6 Suppl 1, S61-66. Lutz MB, Schuler G (2002) Immature, semi-mature and fully mature dendritic cells, which signals induce tolerance or immunity? Trends Immunol 23, 445-449. Mackensen A, Herbst B, Chen JL, Kohler G, Noppen C, Herr W, Spagnoli GC, Cerundolo V, Lindemann A (2000) Phase I

402

Cancer Therapy Vol 1, page 403 study in melanoma patients of a vaccine with peptide-pulsed dendritic cells generated in vitro from CD34 (+) hematopoietic progenitor cells. Int J Cancer 86, 385-392. Mackensen A, Krause T, Blum U, Uhrmeister P, Mertelsmann R, Lindemann A (1999) Homing of intravenously and intralymphatically injected human dendritic cells generated in vitro from CD34+ hematopoietic progenitor cells. Cancer Immunol Immunother 48 (2-3, 118-122. McClay EF (2002) Adjuvant therapy for patients with high-risk malignant melanoma. Semin Oncol 29, 389-399. Minev BR, Chavez FL, Dudouet BM, Mitchell MS (2000) Synthetic insertion signal sequences enhance MHC class I presentation of a peptide from the melanoma antigen MART1. Eur J Immunol 30, 2115-2124. Mortarini R, Anichini A, Di Nicola M, Siena S, Bregni M, Belli F, Molla A, Gianni AM, Parmiani G (1997) Autologous dendritic cells derived from CD34+ progenitors and from monocytes are not functionally equivalent antigen-presenting cells in the induction of melan-A/Mart-1 (27-35)-specific CTLs from peripheral blood lymphocytes of melanoma patients with low frequency of CTL precursors. Cancer Res 57, 5534-5541. Motta I, Andre F, Lim A, Tartaglia J, Cox WI, Zitvogel L, Angevin E, Kourilsky P (2001) Cross-presentation by dendritic cells of tumor antigen expressed in apoptotic recombinant canarypox virus-infected dendritic cells. J Immunol 167, 1795-1802. Murphy GF, Radu A, Kaminer M, Berd D (1993) Autologous melanoma vaccine induces inflammatory responses in melanoma metastases, relevance to immunologic regression and immunotherapy. J Invest Dermatol 100, 335S-341S. Nair SK, Morse M, Boczkowski D, Cumming RI, Vasovic L, Gilboa E, Lyerly HK (2002) Induction of tumor-specific cytotoxic T lymphocytes in cancer patients by autologous tumor RNA-transfected dendritic cells. Ann Surg 235, 540549. Nasi ML, Lieberman P, Busam KJ, Prieto V, Panageas KS, Lewis JJ, Houghton AN, Chapman PB (1999) Intradermal injection of granulocyte-macrophage colony-stimulating factor (GM-CSF) in patients with metastatic melanoma recruits dendritic cells. Cytokines Cell Mol Ther 5, 139144. Nestle FO (2000) Dendritic cell vaccination for cancer therapy. Oncogene 19, 6673-6679. Nestle FO, Alijagic S, Gilliet M, Sun Y, Grabbe S, Dummer R, Burg G, Schadendorf D (1998) Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat Med 4, 328-332. Noessner E, Gastpar R, Milani V, Brandl A, Hutzler PJ, Kuppner MC, Roos M, Kremmer E, Asea A, Calderwood SK, Issels RD (2002) Tumor-derived heat shock protein 70 peptide complexes are cross-presented by human dendritic cells. J Immunol 169, 5424-5432. Nouri-Shirazi M, Banchereau J, Bell D, Burkeholder S, Kraus ET, Davoust J, Palucka KA (2000) Dendritic cells capture killed tumor cells and present their antigens to elicit tumorspecific immune responses. J Immunol 165, 3797-3803. O'Rourke MG, Johnson M, Lanagan C, See J, Yang J, Bell JR, Slater GJ, Kerr BM, Crowe B, Purdie DM, Elliott SL, Ellem KA, Schmidt CW (2003) Durable complete clinical responses in a phase I/II trial using an autologous melanoma cell/dendritic cell vaccine. Cancer Immunol Immunother 52, 387-395. Padovan E, Terracciano L, Certa U, Jacobs B, Reschner A, Bolli M, Spagnoli GC, Borden EC, Heberer M (2002) Interferon stimulated gene 15 constitutively produced by melanoma cells induces e-cadherin expression on human dendritic cells. Cancer Res 62, 3453-3458.

Panelli MC, Wunderlich J, Jeffries J, Wang E, Mixon A, Rosenberg SA, Marincola FM (2000) Phase 1 study in patients with metastatic melanoma of immunization with dendritic cells presenting epitopes derived from the melanoma-associated antigens MART-1 and gp100. J Immunother 23, 487-498. Peguet-Navarro J, Sportouch M, Popa I, Berthier O, Schmitt D, Portoukalian J (2003) Gangliosides from human melanoma tumors impair dendritic cell differentiation from monocytes and induce their apoptosis. J Immunol 170, 3488-3494. Philip R, Alters SE, Brunette E, Ashton J, Gadea J, Yau J, Lebkowski J, Philip M (2000) Dendritic cells loaded with MART-1 peptide or infected with adenoviral construct are functionally equivalent in the induction of tumor-specific cytotoxic T lymphocyte responses in patients with melanoma. J Immunother 23, 168-176. Prabakaran I, Menon C, Xu S, Gomez-Yafal A, Czerniecki BJ, Fraker DL (2002) Mature CD83 (+) dendritic cells infected with recombinant gp100 vaccinia virus stimulate potent antimelanoma T cells. Ann Surg Oncol 9, 411-418. Ralfkiaer E, Hou-Jensen K, Gatter KC, Drzewiecki KT, Mason DY (1987) Immunohistological analysis of the lymphoid infiltrate in cutaneous malignant melanomas. Virchows Arch A Pathol Anat Histopathol, 410, 355-361. Rea D, Havenga MJ, van Den Assem M, Sutmuller RP, Lemckert A, Hoeben RC, BoutA, Melief CJ, Offringa R (2001) Highly efficient transduction of human monocytederived dendritic cells with subgroup B fiber-modified adenovirus vectors enhances transgene-encoded antigen presentation to cytotoxic T cells. J Immunol 166, 52365244. Redondo P, Sanchez-Carpintero I, Bauza A, Idoate M, Solano T, Mihm MC, Jr (2003) Immunologic escape and angiogenesis in human malignant melanoma. J Am Acad Dermatol 49, 255-263. Redondo P, Solano T, B VA, Bauza A, Idoate M (2002) Fas and Fas ligand, expression and soluble circulating levels in cutaneous malignant melanoma. Br J Dermatol 147, 80-86. Reeves ME, Royal RE, Lam JS, Rosenberg SA, Hwu P (1996) Retroviral transduction of human dendritic cells with a tumor-associated antigen gene. Cancer Res 56, 5672-5677. Remmel E, Terracciano L, Noppen C, Zajac P, Heberer M, Spagnoli GC, Padovan E (2001) Modulation of dendritic cell phenotype and mobility by tumor cells in vitro. Hum Immunol 62, 39-49. Russo V, Tanzarella S, Dalerba P, Rigatti D, Rovere P, Villa A, Bordignon C, Traversari C (2000) Dendritic cells acquire the MAGE-3 human tumor antigen from apoptotic cells and induce a class I-restricted T cell response. Proc Natl Acad Sci U S A, 97, 2185-2190. Saeterdal I, thor Straten P, Myklebust JH, Kirkin AF, Gjertsen MK, Gaudernack G (1998) Generation and characterization of gp100 peptide-specific NK-T cell clones. Int J Cancer 75, 794-803. Salio M, Cella M, Vermi W, Facchetti F, Palmowski MJ, Smith CL, Shepherd D, Colonna M, Cerundolo V (2003) Plasmacytoid dendritic cells prime IFN-gamma-secreting melanoma-specific CD8 lymphocytes and are found in primary melanoma lesions. Eur J Immunol 33, 1052-1062. Schachter J, Rakowsky E, Sulkes A, Adler A (1998) A sequential four-drug chemotherapy and biotherapy with interferon alpha and GM-CSF--an innovative protocol for the treatment of metastatic melanoma. Cancer Biother Radiopharm 13, 155-164. Schuler-Thurner B, Dieckmann D, Keikavoussi P, Bender A, Maczek C, Jonuleit H, Roder C, Haendle I, Leisgang W, Dunbar R, Cerundolo V, von Den Driesch P, Knop J, Brocker EB, Enk A, Kampgen E, Schuler G (2000) Mage-3

403

Polak et al: Dendritic cell-mediated immunosuppression in malignant melanoma and influenza-matrix peptide-specific cytotoxic T cells are inducible in terminal stage HLA-A2.1+ melanoma patients by mature monocyte-derived dendritic cells. J Immunol 165, 3492-3496. Schuler-Thurner B, Schultz ES, Berger TG, Weinlich G, Ebner S, Woerl P, Bender A, Feuerstein B, Fritsch PO, Romani N, Schuler G (2002) Rapid induction of tumor-specific type 1 T helper cells in metastatic melanoma patients by vaccination with mature, cryopreserved, peptide-loaded monocytederived dendritic cells. J Exp Med 195, 1279-1288. Schultz ES, Lethe B, Cambiaso CL, Van Snick J, Chaux P, Corthals J, Heirman C, Thielemans K, Boon T, van der Bruggen P (2000) A MAGE-A3 peptide presented by HLADP4 is recognized on tumor cells by CD4+ cytolytic T lymphocytes. Cancer Res 60, 6272-6275. Schultz ES, Zhang Y, Knowles R, Tine J, Traversari C, Boon T, van der Bruggen P (2001) A MAGE-3 peptide recognized on HLA-B35 and HLA-A1 by cytolytic T lymphocytes. Tissue Antigens 57, 103-109. Seliger B, Ritz U, Abele R, Bock M, Tampe R, Sutter G, Drexler I, Huber C, Ferrone S (2001) Immune escape of melanoma, first evidence of structural alterations in two distinct components of the MHC class I antigen processing pathway. Cancer Res 61, 8647-8650. Smith SG, Patel PM, Porte J, Selby PJ, Jackson AM (2001) Human dendritic cells genetically engineered to express a melanoma polyepitope DNA vaccine induce multiple cytotoxic T-cell responses. Clin Cancer Res 7, 4253-4261. Smithers M, O'Connell K, MacFadyen S, Chambers M, Greenwood K, Boyce A, Abdul-Jabbar I, Barker K, Grimmett K, Walpole E, Thomas R (2003) Clinical response after intradermal immature dendritic cell vaccination in metastatic melanoma is associated with immune response to particulate antigen. Cancer Immunol Immunother 52, 4152. Soiffer R, Lynch T, Mihm M, Jung K, Rhuda C, Schmollinger JC, Hodi FS, Liebster L, Lam, P, Mentzer S, Singer S, Tanabe KK, Cosimi AB, Duda R, Sober A, Bhan A, Daley J, Neuberg D, Parry G, Rokovich J, Richards L, Drayer J, Berns A, Clift S, Dranoff G, et al (1998) Vaccination with irradiated autologous melanoma cells engineered to secrete human granulocyte-macrophage colony-stimulating factor generates potent antitumor immunity in patients with metastatic melanoma. Proc Natl Acad Sci U S A, 95, 1314113146. Sombroek, CC, Stam AG, Masterson AJ, Lougheed SM, Schakel MJ, Meijer CJ, Pinedo HM, van den Eertwegh AJ, Scheper RJ, de Gruijl TD (2002) Prostanoids play a major role in the primary tumor-induced inhibition of dendritic cell differentiation. J Immunol 168 4333-4343. Soruri A, Fayyazi A, Gieseler R, Schlott T, Runger TM, Neumann C, Peters JH (1998) Specific autologous antimelanoma T cell response in vitro using monocyte-derived dendritic cells. Immunobiology 198, 527-538. Soruri A, Fayyazi A, Neumann C, Schlott T, Jung T, Matthes C, Zwirner J, Riggert J, Peters JH (2001) Ex vivo generation of human anti-melanoma autologous cytolytic T cells by dentritic cell/melanoma cell hybridomas. Cancer Immunol Immunother 50, 307-314. Sotiriadou R, Perez SA, Gritzapis AD, Sotiropoulou PA, Echner H, Heinzel S, Mamalaki, A, Pawelec G, Voelter W, Baxevanis CN, Papamichail M (2001) Peptide HER2 (776788) represents a naturally processed broad MHC class IIrestricted T cell epitope. Br J Cancer 85, 1527-1534. Steinbrink K, Graulich E, Kubsch S, Knop J, Enk AH (2002) CD4 (+) and CD8 (+) anergic T cells induced by interleukin10-treated human dendritic cells display antigen-specific suppressor activity. Blood 99, 2468-2476.

Steinbrink K, Jonuleit,H, Muller G, Schuler G, Knop J, Enk AH (1999) Interleukin-10-treated human dendritic cells induce a melanoma-antigen-specific anergy in CD8 (+) T cells resulting in a failure to lyse tumor cells. Blood 93, 16341642. Sumimoto H, Tsuji T, Miyoshi H, Hagihara M, TakadaYamazaki R, Okamoto S, Ikeda Y, Takahashi T, Kawakami Y (2002) Rapid and efficient generation of lentivirally genemodified dendritic cells from DC progenitors with bone marrow stromal cells. J Immunol Methods 271, 153-165. SzekeRes L, Daroczy J (1981) Electron microscopic investigation on the local cellular reaction to primary malignant melanoma. Dermatologica 163, 137-144. Tanaka Y, Dowdy SF, Linehan DC, Eberlein TJ, Goedegebuure PS (2003) Induction of antigen-specific CTL by recombinant HIV trans-activating fusion protein-pulsed human monocytederived dendritic cells. J Immunol 170, 1291-1298. Tefany FJ, Barnetson RS, Halliday GM, McCarthy SW, McCarthy WH (1991) Immunocytochemical analysis of the cellular infiltrate in primary regressing and non-regressing malignant melanoma. J Invest Dermatol 97, 197-202. Temme A, Morgenroth A, Schmitz M, Weigle B, Rohayem J, Lindemann D, Fussel M, Ehninger G, Rieber EP (2002) Efficient transduction and long-term retroviral expression of the melanoma-associated tumor antigen tyrosinase in CD34 (+) cord blood-derived dendritic cells. Gene Ther 9, 15511560. Thomas R, Chambers M, Boytar R, Barker K, Cavanagh LL, MacFadyen S, Smithers M, Jenkins M, Andersen J (1999) Immature human monocyte-derived dendritic cells migrate rapidly to draining lymph nodes after intradermal injection for melanoma immunotherapy. Melanoma Res 9 5, 474-481. Thomas R, Padmanabha J, Chambers M, McFadyen S, Walpole E, Nielssen G, Smithers M (2001) Metastatic lesions in the joint associated with acute inflammatory arthritis after dendritic cell immunotherapy for metastatic melanoma. Melanoma Res 11, 167-173. Thurner B, Haendle I, Roder C, Dieckmann D, Keikavoussi P, Jonuleit H, Bender A, Maczek C, Schreiner D, von den Driesch P, Brocker EB, Steinman RM, Enk A, Kampgen E, Schuler G (1999) Vaccination with mage-3A1 peptide-pulsed mature, monocyte-derived dendritic cells expands specific cytotoxic T cells and induces regression of some metastases in advanced stage IV melanoma. J Exp Med 190, 16691678. Tjandrawan T, Martin DM, Maeurer MJ, Castelli C, Lotze MT, Storkus, WJ (1998) Autologous human dendriphages pulsed with synthetic or natural tumor peptides elicit tumor-specific CTLs in vitro. J Immunother 21, 149-157. Toriyama K, Wen DR, Paul E, Cochran AJ (1993) Variations in the distribution, frequency, and phenotype of Langerhans cells during the evolution of malignant melanoma of the skin. J Invest Dermatol 100, 269S-273S. Toungouz M, Libin M, Bulte F, Faid, L, Lehmann, F, Duriau, D, Laporte, M, Gangji, D, Bruyns C, Lambermont M, Goldman M, Velu T (2001) Transient expansion of peptide-specific lymphocytes producing IFN-gamma after vaccination with dendritic cells pulsed with MAGE peptides in patients with mage-A1/A3-positive tumors. J Leukoc Biol 69, 937-943. Triozzi PL, Khurram R, Aldrich WA, Walker MJ, Kim JA, Jaynes S (2000) Intratumoral injection of dendritic cells derived in vitro in patients with metastatic cancer. Cancer 89, 2646-2654. Tsao H, Millman P, Linette GP, Hodi FS, Sober AJ, Goldberg MA, Haluska FG (2002) Hypopigmentation associated with an adenovirus-mediated gp100/MART-1-transduced dendritic cell vaccine for metastatic melanoma. Arch Dermatol 138, 799-802.

404

Cancer Therapy Vol 1, page 405 Tuting T, Wilson CC, Martin DM, Kasamon YL, Rowles J, Ma DI, Slingluff CL, Jr, Wagner SN, van der Bruggen P, Baar J, Lotze MT, Storkus WJ (1998) Autologous human monocytederived dendritic cells genetically modified to express melanoma antigens elicit primary cytotoxic T cell responses in vitro, enhancement by cotransfection of genes encoding the Th1-biasing cytokines IL-12 and IFN-alpha. J Immunol 160, 1139-1147. van Elsas A, van der Burg SH, van der Minne CE, Borghi M, Mourer JS, Melief CJ, Schrier PI (1996) Peptide-pulsed dendritic cells induce tumoricidal cytotoxic T lymphocytes from healthy donors against stably HLA-A*0201-binding peptides from the Melan-A/MART-1 self antigen. Eur J Immunol 26, 1683-1689. Vermi W, Bonecchi R, Facchetti F, Bianchi D, Sozzani S, Festa S, Berenzi A, Cella M, Colonna, M (2003) Recruitment of immature plasmacytoid dendritic cells (plasmacytoid monocytes) and myeloid dendritic cells in primary cutaneous melanomas. J Pathol, 200, 255-268. Whiteside TL, Gambotto A, Albers A, Stanson J, Cohen EP (2002) Human tumor-derived genomic DNA transduced into a recipient cell induces tumor-specific immune responses ex vivo. Proc Natl Acad Sci U S A 99, 9415-9420. Wolfl M, Batten WY, Posovszky C, Bernhard H, Berthold F (2002) Gangliosides inhibit the development from monocytes to dendritic cells. Clin Exp Immunol 130, 441-448. Yang S, Kittlesen D, Slingluff CL, Jr, Vervaert CE, Seigler HF, Darrow TL (2000) Dendritic cells infected with a vaccinia vector carrying the human gp100 gene simultaneously present multiple specificities and elicit high-affinity T cells reactive to multiple epitopes and restricted by HLA-A2 and A3. J Immunol 164, 4204-4211. Yang S, Linette GP, Longerich S, Haluska FG (2002) Antimelanoma activity of CTL generated from peripheral blood mononuclear cells after stimulation with autologous dendritic cells pulsed with melanoma gp100 peptide G2092M is correlated to TCR avidity. J Immunol 169, 531-539.

Zarour HM, Kirkwood JM, Kierstead LS, Herr W, Brusic V, Slingluff CL, Jr, Sidney J, Sette A, Storkus WJ (2000a) Melan-A/MART-1 (51-73) represents an immunogenic HLA-DR4-restricted epitope recognized by melanomareactive CD4 (+) T cells. Proc Natl Acad Sci U S A 97, 400405. Zarour HM, Maillere B, Brusic V, Coval K, Williams E, Pouvelle-Moratille S, Castelli F, Land S, Bennouna J, Logan T, Kirkwood JM (2002) NY-ESO-1 119-143 is a promiscuous major histocompatibility complex class II Thelper epitope recognized by Th1- and Th2-type tumorreactive CD4+ T cells. Cancer Res 62, 213-218. Zarour HM, Storkus WJ, Brusic V, Williams E, Kirkwood JM (2000b) NY-ESO-1 encodes DRB1*0401-restricted epitopes recognized by melanoma-reactive CD4+ T cells. Cancer Res 60, 4946-4952. Zehntner S, Townsend W, Parkes J, Schmidt C, Down M, Bell J, Mulligan R, O'Rourke M, Ellem K, Thomas R (1999) Tumor metastasis biopsy as a surrogate marker of response to melanoma immunotherapy. Pathology 31, 116-122.

Dr. Marta E Polak

405

Polak et al: Dendritic cell-mediated immunosuppression in malignant melanoma

406